Lobanov, Alexey V.; Delgado, Cesar; Rahlfs, Stefan; Novoselov, Sergey V.; Kryukov, Gregory V.; Gromer, Stephan; Hatfield, Dolph L.; Becker, Katja; Gladyshev, Vadim N.
2006-01-01
The use of selenocysteine (Sec) as the 21st amino acid in the genetic code has been described in all three major domains of life. However, within eukaryotes, selenoproteins are only known in animals and algae. In this study, we characterized selenoproteomes and Sec insertion systems in protozoan Apicomplexa parasites. We found that among these organisms, Plasmodium and Toxoplasma utilized Sec, whereas Cryptosporidium did not. However, Plasmodium had no homologs of known selenoproteins. By searching computationally for evolutionarily conserved selenocysteine insertion sequence (SECIS) elements, which are RNA structures involved in Sec insertion, we identified four unique Plasmodium falciparum selenoprotein genes. These selenoproteins were incorrectly annotated in PlasmoDB, were conserved in other Plasmodia and had no detectable homologs in other species. We provide evidence that two Plasmodium SECIS elements supported Sec insertion into parasite and endogenous selenoproteins when they were expressed in mammalian cells, demonstrating that the Plasmodium SECIS elements are functional and indicating conservation of Sec insertion between Apicomplexa and animals. Dependence of the plasmodial parasites on selenium suggests possible strategies for antimalarial drug development. PMID:16428245
MINS2: revisiting the molecular code for transmembrane-helix recognition by the Sec61 translocon.
Park, Yungki; Helms, Volkhard
2008-08-15
To be fully functional, membrane proteins should not only fold, but also get inserted into the membrane, which is mediated by the Sec61 translocon. Recent experimental studies have attempted to elucidate how the Sec61 translocon accomplishes this delicate task by measuring the translocon-mediated membrane insertion free energies of 357 systematically designed peptides. On the basis of this data set, we have developed MINS2, a novel sequence-based computational method for predicting the membrane insertion free energies of protein sequences. A benchmark analysis of MINS2 shows that MINS2 signi.cantly outperforms previously proposed methods. Importantly, the application of MINS2 to known membrane protein structures shows that a better prediction of membrane insertion free energies does not lead to a better prediction of transmembrane segments of polytopic membrane proteins. A web server for MINS2 is publicly available at http://service.bioinformatik.uni-saarland.de/mins. Supplementary data are available at Bioinformatics online.
Dubey, Aditi; Copeland, Paul R
2016-01-01
Selenocysteine (Sec) is a critical residue in at least 25 human proteins that are essential for antioxidant defense and redox signaling in cells. Sec is inserted into proteins cotranslationally by the recoding of an in-frame UGA termination codon to a Sec codon. In eukaryotes, this recoding event requires several specialized factors, including a dedicated, Sec-specific elongation factor called eEFSec, which binds Sec-tRNASec with high specificity and delivers it to the ribosome for selenoprotein production. Unlike most translation factors, including the canonical elongation factor eEF1A, eEFSec readily localizes to the nucleus of mammalian cells and shuttles between the cytoplasmic and nuclear compartments. The functional significance of eEFSec's nuclear localization has remained unclear. In this study, we have examined the subcellular localization of eEFSec in the context of altered Sec incorporation to demonstrate that reduced selenoprotein production does not correlate with changes in the nuclear localization of eEFSec. In addition, we identify several novel sequences of the protein that are essential for localization as well as Sec insertion activity, and show that eEFSec utilizes CRM1-mediated nuclear export pathway. Our findings argue for two distinct pools of eEFSec in the cell, where the cytoplasmic pool participates in Sec incorporation and the nuclear pool may be involved in an as yet unknown function.
Shchedrina, Valentina A.; Novoselov, Sergey V.; Malinouski, Mikalai Yu.; Gladyshev, Vadim N.
2007-01-01
Selenocysteine (Sec, U) insertion into proteins is directed by translational recoding of specific UGA codons located upstream of a stem-loop structure known as Sec insertion sequence (SECIS) element. Selenoproteins with known functions are oxidoreductases containing a single redox-active Sec in their active sites. In this work, we identified a family of selenoproteins, designated SelL, containing two Sec separated by two other residues to form a UxxU motif. SelL proteins show an unusual occurrence, being present in diverse aquatic organisms, including fish, invertebrates, and marine bacteria. Both eukaryotic and bacterial SelL genes use single SECIS elements for insertion of two Sec. In eukaryotes, the SECIS is located in the 3′ UTR, whereas the bacterial SelL SECIS is within a coding region and positioned at a distance that supports the insertion of either of the two Sec or both of these residues. SelL proteins possess a thioredoxin-like fold wherein the UxxU motif corresponds to the catalytic CxxC motif in thioredoxins, suggesting a redox function of SelL proteins. Distantly related SelL-like proteins were also identified in a variety of organisms that had either one or both Sec replaced with Cys. Danio rerio SelL, transiently expressed in mammalian cells, incorporated two Sec and localized to the cytosol. In these cells, it occurred in an oxidized form and was not reducible by DTT. In a bacterial expression system, we directly demonstrated the formation of a diselenide bond between the two Sec, establishing it as the first diselenide bond found in a natural protein. PMID:17715293
Fajardo, Diego; Schlautman, Brandon; Steffan, Shawn; Polashock, James; Vorsa, Nicholi; Zalapa, Juan
2014-02-25
This is the first de novo assembly and annotation of a complete mitochondrial genome in the Ericales order from the American cranberry (Vaccinium macrocarpon Ait.). Moreover, only four complete Asterid mitochondrial genomes have been made publicly available. The cranberry mitochondrial genome was assembled and reconstructed from whole genome 454 Roche GS-FLX and Illumina shotgun sequences. Compared with other Asterids, the reconstruction of the genome revealed an average size mitochondrion (459,678 nt) with relatively little repetitive sequences and DNA of plastid origin. The complete mitochondrial genome of cranberry was annotated obtaining a total of 34 genes classified based on their putative function, plus three ribosomal RNAs, and 17 transfer RNAs. Maternal organellar cranberry inheritance was inferred by analyzing gene variation in the cranberry mitochondria and plastid genomes. The annotation of cranberry mitochondrial genome revealed the presence of two copies of tRNA-Sec and a selenocysteine insertion sequence (SECIS) element which were lost in plants during evolution. This is the first report of a land plant possessing selenocysteine insertion machinery at the sequence level. Published by Elsevier B.V.
Mix, Heiko; Lobanov, Alexey V.; Gladyshev, Vadim N.
2007-01-01
Expression of selenocysteine (Sec)-containing proteins requires the presence of a cis-acting mRNA structure, called selenocysteine insertion sequence (SECIS) element. In bacteria, this structure is located in the coding region immediately downstream of the Sec-encoding UGA codon, whereas in eukaryotes a completely different SECIS element has evolved in the 3′-untranslated region. Here, we report that SECIS elements in the coding regions of selenoprotein mRNAs support Sec insertion in higher eukaryotes. Comprehensive computational analysis of all available viral genomes revealed a SECIS element within the ORF of a naturally occurring selenoprotein homolog of glutathione peroxidase 4 in fowlpox virus. The fowlpox SECIS element supported Sec insertion when expressed in mammalian cells as part of the coding region of viral or mammalian selenoproteins. In addition, readthrough at UGA was observed when the viral SECIS element was located upstream of the Sec codon. We also demonstrate successful de novo design of a functional SECIS element in the coding region of a mammalian selenoprotein. Our data provide evidence that the location of the SECIS element in the untranslated region is not a functional necessity but rather is an evolutionary adaptation to enable a more efficient synthesis of selenoproteins. PMID:17169995
Soman, Raunak; Yuan, Jijun; Kuhn, Andreas; Dalbey, Ross E
2014-01-10
During membrane biogenesis, the M13 procoat protein is inserted into the lipid bilayer in a strictly YidC-dependent manner with both the hydrophobic signal sequence and the membrane anchor sequence promoting translocation of the periplasmic loop via a hairpin mechanism. Here, we find that the translocase requirements can be altered for PClep in a predictable manner by changing the polarity and charge of the peptide region that is translocated across the membrane. When the polarity of the translocated peptide region is lowered and the charged residues in this region are removed, translocation of this loop region occurs largely by a YidC- and Sec-independent mechanism. When the polarity is increased to that of the wild-type procoat protein, the YidC insertase is essential for translocation. Further increasing the polarity, by adding charged residues, switches the insertion pathway to a YidC/Sec mechanism. Conversely, we find that increasing the hydrophobicity of the transmembrane segments of PClep can decrease the translocase requirement for translocation of the peptide chain. This study provides a framework to understand why the YidC and Sec machineries exist in parallel and demonstrates that the YidC insertase has a limited capacity to translocate a peptide chain on its own.
1985-01-01
SEC53, a gene that is required for completion of assembly of proteins in the endoplasmic reticulum in yeast, has been cloned, sequenced, and the product localized by cell fractionation. Complementation of a sec53 mutation is achieved with unique plasmids from genomic or cDNA expression banks. These inserts contain the authentic gene, a cloned copy of which integrates at the sec53 locus. An open reading frame in the insert predicts a 29-kD protein with no significant hydrophobic character. This prediction is confirmed by detection of a 28-kD protein overproduced in cells that carry SEC53 on a multicopy plasmid. To follow Sec53p more directly, a LacZ-SEC53 gene fusion has been constructed which allows the isolation of a hybrid protein for use in production of antibody. With such an antibody, quantitative immune decoration has shown that the sec53-6 mutation decreases the level of Sec53p at 37 degrees C, while levels comparable to wild-type are seen at 24 degrees C. An eightfold overproduction of Sec53p accompanies transformation of cells with a multicopy plasmid containing SEC53. Cell fractionation, performed with conditions that preserve the lumenal content of the endoplasmic reticulum (ER), shows Sec53p highly enriched in the cytosol fraction. We suggest that Sec53p acts indirectly to facilitate assembly in the ER, possibly by interacting with a stable ER component, or by providing a small molecule, other than an oligosaccharide precursor, necessary for the assembly event. PMID:3905826
Miller, Thomas F.
2017-01-01
We present a coarse-grained simulation model that is capable of simulating the minute-timescale dynamics of protein translocation and membrane integration via the Sec translocon, while retaining sufficient chemical and structural detail to capture many of the sequence-specific interactions that drive these processes. The model includes accurate geometric representations of the ribosome and Sec translocon, obtained directly from experimental structures, and interactions parameterized from nearly 200 μs of residue-based coarse-grained molecular dynamics simulations. A protocol for mapping amino-acid sequences to coarse-grained beads enables the direct simulation of trajectories for the co-translational insertion of arbitrary polypeptide sequences into the Sec translocon. The model reproduces experimentally observed features of membrane protein integration, including the efficiency with which polypeptide domains integrate into the membrane, the variation in integration efficiency upon single amino-acid mutations, and the orientation of transmembrane domains. The central advantage of the model is that it connects sequence-level protein features to biological observables and timescales, enabling direct simulation for the mechanistic analysis of co-translational integration and for the engineering of membrane proteins with enhanced membrane integration efficiency. PMID:28328943
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kim, Moon-Jung; Lee, Byung Cheon; Division of Biotechnology, College of Life Sciences & Biotechnology, Korea University, Seoul 136-701
Thioredoxin (Trx) is a major thiol-disulfide reductase that plays a role in many biological processes, including DNA replication and redox signaling. Although selenocysteine (Sec)-containing Trxs have been identified in certain bacteria, their enzymatic properties have not been characterized. In this study, we expressed a selenoprotein Trx from Treponema denticola, an oral spirochete, in Escherichia coli and characterized this selenoenzyme and its natural cysteine (Cys) homologue using E. coli Trx1 as a positive control. {sup 75}Se metabolic labeling and mutation analyses showed that the SECIS (Sec insertion sequence) of T. denticola selenoprotein Trx is functional in the E. coli Sec insertion system with specificmore » selenium incorporation into the Sec residue. The selenoprotein Trx exhibited approximately 10-fold higher catalytic activity than the Sec-to-Cys version and natural Cys homologue and E. coli Trx1, suggesting that Sec confers higher catalytic activity on this thiol-disulfide reductase. Kinetic analysis also showed that the selenoprotein Trx had a 30-fold higher K{sub m} than Cys-containing homologues, suggesting that this selenoenzyme is adapted to work efficiently with high concentrations of substrate. Collectively, the results of this study support the hypothesis that selenium utilization in oxidoreductase systems is primarily due to the catalytic advantage provided by the rare amino acid, Sec. - Highlights: • The first characterization of a selenoprotein Trx is presented. • The selenoenzyme Trx exhibits 10-fold higher catalytic activity than Cys homologues. • Se utilization in Trx is primarily due to the catalytic advantage provided by Sec residue.« less
USDA-ARS?s Scientific Manuscript database
The American cranberry (Vaccinium macrocarpon Ait.) mitochondrial genome was assembled and reconstructed from whole genome 454 Roche GS-FLX and Illumina shotgun sequences. Compared with other Asterids, the reconstruction of the genome revealed an average size mitochondrion (459,678 nt) with comparat...
Selenium. Role of the Essential Metalloid in Health
Kurokawa, Suguru; Berry, Marla J.
2015-01-01
Selenium is an essential micronutrient in mammals, but is also recognized as toxic in excess. It is a non-metal with properties that are intermediate between the chalcogen elements sulfur and tellurium. Selenium exerts its biological functions through selenoproteins. Selenoproteins contain selenium in the form of the 21st amino acid, selenocysteine (Sec), which is an analog of cysteine with the sulfur-containing side chain replaced by a Se-containing side chain. Sec is encoded by the codon UGA, which is one of three termination codons for mRNA translation in non-selenoprotein genes. Recognition of the UGA codon as a Sec insertion site instead of stop requires a Sec insertion sequence (SECIS) element in selenoprotein mRNAs and a unique selenocysteyl-tRNA, both of which are recognized by specialized protein factors. Unlike the 20 standard amino acids, Sec is biosynthesized from serine on its tRNA. Twenty-five selenoproteins are encoded in the human genome. Most of the selenoprotein genes were discovered by bioinformatics approaches, searching for SECIS elements downstream of in-frame UGA codons. Sec has been described as having stronger nucleophilic and electrophilic properties than cysteine, and Sec is present in the catalytic site of all selenoenzymes. Most selenoproteins, whose functions are known, are involved in redox systems and signaling pathways. However, several selenoproteins are not well characterized in terms of their function. The selenium field has grown dramatically in the last few decades, and research on selenium biology is providing extensive new information regarding its importance for human health. PMID:24470102
1992-01-01
We have isolated mutants that inhibit membrane protein insertion into the ER membrane of Saccharomyces cerevisiae. The mutants were contained in three complementation groups, which we have named SEC70, SEC71, and SEC72. The mutants also inhibited the translocation of soluble proteins into the lumen of the ER, indicating that they pleiotropically affect protein transport across and insertion into the ER membrane. Surprisingly, the mutants inhibited the translocation and insertion of different proteins to drastically different degrees. We have also shown that mutations in SEC61 and SEC63, which were previously isolated as mutants inhibiting the translocation of soluble proteins, also affect the insertion of membrane proteins into the ER. Taken together our data indicate that the process of protein translocation across the ER membrane involves a much larger number of gene products than previously appreciated. Moreover, different translocation substrates appear to have different requirements for components of the cellular targeting and translocation apparatus. PMID:1730771
Characterization of the UGA-recoding and SECIS-binding activities of SECIS-binding protein 2.
Bubenik, Jodi L; Miniard, Angela C; Driscoll, Donna M
2014-01-01
Selenium, a micronutrient, is primarily incorporated into human physiology as selenocysteine (Sec). The 25 Sec-containing proteins in humans are known as selenoproteins. Their synthesis depends on the translational recoding of the UGA stop codon to allow Sec insertion. This requires a stem-loop structure in the 3' untranslated region of eukaryotic mRNAs known as the Selenocysteine Insertion Sequence (SECIS). The SECIS is recognized by SECIS-binding protein 2 (SBP2) and this RNA:protein interaction is essential for UGA recoding to occur. Genetic mutations cause SBP2 deficiency in humans, resulting in a broad set of symptoms due to differential effects on individual selenoproteins. Progress on understanding the different phenotypes requires developing robust tools to investigate SBP2 structure and function. In this study we demonstrate that SBP2 protein produced by in vitro translation discriminates among SECIS elements in a competitive UGA recoding assay and has a much higher specific activity than bacterially expressed protein. We also show that a purified recombinant protein encompassing amino acids 517-777 of SBP2 binds to SECIS elements with high affinity and selectivity. The affinity of the SBP2:SECIS interaction correlated with the ability of a SECIS to compete for UGA recoding activity in vitro. The identification of a 250 amino acid sequence that mediates specific, selective SECIS-binding will facilitate future structural studies of the SBP2:SECIS complex. Finally, we identify an evolutionarily conserved core cysteine signature in SBP2 sequences from the vertebrate lineage. Mutation of multiple, but not single, cysteines impaired SECIS-binding but did not affect protein localization in cells.
M13 procoat protein insertion into YidC and SecYEG proteoliposomes and liposomes.
Stiegler, Natalie; Dalbey, Ross E; Kuhn, Andreas
2011-02-25
M13 procoat protein was one of the first model proteins used to study bacterial membrane protein insertion. It contains a signal peptide of 23 amino acid residues and is not membrane targeted by the signal recognition particle. The translocation of its periplasmic domain is independent of the preprotein translocase (SecAYEG) but requires electrochemical membrane potential and the membrane insertase YidC of Escherichia coli. We show here that YidC is sufficient for efficient membrane insertion of the purified M13 procoat protein into energized YidC proteoliposomes. When no membrane potential is applied, the insertion is substantially reduced. Only in the presence of YidC, membrane insertion occurs if bilayer integrity is preserved and membrane potential is stable for more than 20 min. A mutant of the M13 procoat protein, H5EE, with two additional negatively charged residues in the periplasmic domain inserted into YidC proteoliposomes and SecYEG proteoliposomes with equal efficiencies. We conclude that the protein can use both the YidC-only pathway and the Sec pathway. This poses the questions of how procoat H5EE is inserted in vivo and how insertion pathways are selected in the cell. Copyright © 2011 Elsevier Ltd. All rights reserved.
Sec66-Dependent Regulation of Yeast Spindle-Pole Body Duplication Through Pom152
Katta, Santharam S.; Chen, Jingjing; Gardner, Jennifer M.; Friederichs, Jennifer M.; Smith, Sarah E.; Gogol, Madelaine; Unruh, Jay R.; Slaughter, Brian D.; Jaspersen, Sue L.
2015-01-01
In closed mitotic systems such as Saccharomyces cerevisiae, the nuclear envelope (NE) does not break down during mitosis, so microtubule-organizing centers such as the spindle-pole body (SPB) must be inserted into the NE to facilitate bipolar spindle formation and chromosome segregation. The mechanism of SPB insertion has been linked to NE insertion of nuclear pore complexes (NPCs) through a series of genetic and physical interactions between NPCs and SPB components. To identify new genes involved in SPB duplication and NE insertion, we carried out genome-wide screens for suppressors of deletion alleles of SPB components, including Mps3 and Mps2. In addition to the nucleoporins POM152 and POM34, we found that elimination of SEC66/SEC71/KAR7 suppressed lethality of cells lacking MPS2 or MPS3. Sec66 is a nonessential subunit of the Sec63 complex that functions together with the Sec61 complex in import of proteins into the endoplasmic reticulum (ER). Cells lacking Sec66 have reduced levels of Pom152 protein but not Pom34 or Ndc1, a shared component of the NPC and SPB. The fact that Sec66 but not other subunits of the ER translocon bypass deletion mutants in SPB genes suggests a specific role for Sec66 in the control of Pom152 levels. Based on the observation that sec66∆ does not affect the distribution of Ndc1 on the NE or Ndc1 binding to the SPB, we propose that Sec66-mediated regulation of Pom152 plays an NPC-independent role in the control of SPB duplication. PMID:26510791
Voelker, R; Mendel-Hartvig, J; Barkan, A
1997-02-01
A nuclear mutant of maize, tha1, which exhibited defects in the translocation of proteins across the thylakoid membrane, was described previously. A transposon insertion at the tha1 locus facilitated the cloning of portions of the tha1 gene. Strong sequence similarity with secA genes from bacteria, pea and spinach indicates that tha1 encodes a SecA homologue (cp-SecA). The tha1-ref allele is either null or nearly so, in that tha1 mRNA is undetectable in mutant leaves and cp-SecA accumulation is reduced > or = 40-fold. These results, in conjunction with the mutant phenotype described previously, demonstrate that cp-SecA functions in vivo to facilitate the translocation of OEC33, PSI-F and plastocyanin but does not function in the translocation of OEC23 and OEC16. Our results confirm predictions for cp-SecA function made from the results of in vitro experiments and establish several new functions for cp-SecA, including roles in the targeting of a chloroplast-encoded protein, cytochrome f, and in protein targeting in the etioplast, a nonphotosynthetic plastid type. Our finding that the accumulation of properly targeted plastocyanin and cytochrome f in tha1-ref thylakoid membranes is reduced only a few-fold despite the near or complete absence of cp-SecA suggests that cp-SecA facilitates but is not essential in vivo for their translocation across the membrane.
NASA Technical Reports Server (NTRS)
Peoples, J. A., Jr.; Puthoff, R. L.
1973-01-01
Application of nuclear reactors in space will present operational problems. One such problem is the possibility of an earth impact at velocities in excess of 305 m/sec (1000 ft/sec). This report shows the results of an impact against concrete at 328 m/sec (1075 ft/sec) and examines the deformed core to estimate the range of activity inserted as a result of the impact. The results of this examination are that the deformation of the reactor core within the containment vessel left only an estimated 2.7 percent void in the core and that the reactivity inserted due to this impact deformation could be from 4.0 to 10.25 dollars.
A quantitative study of copulatory behaviour of large Felidae.
Lanier, D L; Dewsbury, D A
1976-12-01
A total of 109 copulations was observed in six male-female pairs from four species of large Felidae. The mean intromission durations were 3.0 sec for Asian leopards (Panthera pardus), 3.3 sec for African leopards (Panthera pardus), 12.9 sec for snow leopards (Uncia uncia), 2.3 sec for spotted jaguars (Panthera onca), 3.3 sec for black jaguars (Panthera onca), and 12.4 sec for Siberian tigers (Panthera tigris). Behavioural patterns were qualitatively similar across species; all displayed a copulatory pattern with no lock, no intra-vaginal thrusting, ejaculation on a single insertion, and multiple ejaculations. Whereas domestic cats are reported to assume a neck grip and to tread prior to insertion, these larger Felidae generally did so after intromission had been achieved. After copulation, females of some pairs swiped at the male and displayed a rolling after-reaction. Copyright © 1976. Published by Elsevier B.V.
Ben-Abraham, Ron; Flaishon, Ron; Sotman, Alexander; Ekstein, Perla; Ezri, Tiberiu; Ogorek, Daniel; Weinbroum, Avi A
2008-07-01
The threat of a mass casualty unconventional attack has challenged the medical community to devise means for providing rapid and reliable emergent airway control under chaotic conditions by inexperienced medical personnel dressed in self protective gear. Since endotracheal intubation may not be feasible under those conditions, other extraglottic devices should be considered. We assessed the performance of anesthesia and non-anesthesia residents in inserting the CobraPLA, a supraglottic airway device, on consecutive anesthetized patients, to assess its potential use under simulated conditions. Anesthesia and non-anesthesia residents wearing either surgical scrubs or complete anti-chemical gear inserted the CobraPLA in anesthetized patients. If post-trial positive pressure ventilation via the CobraPLA was unsuccessful, an LMA or endotracheal tube was inserted in its stead. It took anesthesia residents 57+/-23 sec and 43+/-13 sec (P<0.05) to place the CobraPLA while wearing anti-chemical gear and surgical scrubs, respectively. Non-anesthesia residents wearing anti-chemical gear performed worse than anesthetists in their first insertion (73+/-9 sec, P<0.05), but after the brief training period they performed as well as their colleagues anesthetists (58+/-10 sec, P=NS). Post-trial, twenty-one CobraPLA (42%) leaked, preventing adequate positive-pressure ventilation: 13 devices (26% of the total) required replacements. Anti-chemical protective gear slowed the insertion of the CobraPLA by anesthetists, and more so by other residents inexperienced in airway management. In 26% of the cases CobraPLA was inadequate for positive pressure ventilation.
46 CFR Sec. 7 - Job order numbering.
Code of Federal Regulations, 2011 CFR
2011-10-01
... 46 Shipping 8 2011-10-01 2011-10-01 false Job order numbering. Sec. 7 Section 7 Shipping MARITIME... REPAIRS UNDER NATIONAL SHIPPING AUTHORITY MASTER LUMP SUM REPAIR CONTRACT-NSA-LUMPSUMREP Sec. 7 Job order numbering. (a) The NSA-LUMPSUMREP Contract number shall be inserted in every job order and supplemental job...
46 CFR Sec. 7 - Job order numbering.
Code of Federal Regulations, 2010 CFR
2010-10-01
... 46 Shipping 8 2010-10-01 2010-10-01 false Job order numbering. Sec. 7 Section 7 Shipping MARITIME... REPAIRS UNDER NATIONAL SHIPPING AUTHORITY MASTER LUMP SUM REPAIR CONTRACT-NSA-LUMPSUMREP Sec. 7 Job order numbering. (a) The NSA-LUMPSUMREP Contract number shall be inserted in every job order and supplemental job...
46 CFR Sec. 7 - Job order numbering.
Code of Federal Regulations, 2013 CFR
2013-10-01
... 46 Shipping 8 2013-10-01 2013-10-01 false Job order numbering. Sec. 7 Section 7 Shipping MARITIME... REPAIRS UNDER NATIONAL SHIPPING AUTHORITY MASTER LUMP SUM REPAIR CONTRACT-NSA-LUMPSUMREP Sec. 7 Job order numbering. (a) The NSA-LUMPSUMREP Contract number shall be inserted in every job order and supplemental job...
46 CFR Sec. 7 - Job order numbering.
Code of Federal Regulations, 2014 CFR
2014-10-01
... 46 Shipping 8 2014-10-01 2014-10-01 false Job order numbering. Sec. 7 Section 7 Shipping MARITIME... REPAIRS UNDER NATIONAL SHIPPING AUTHORITY MASTER LUMP SUM REPAIR CONTRACT-NSA-LUMPSUMREP Sec. 7 Job order numbering. (a) The NSA-LUMPSUMREP Contract number shall be inserted in every job order and supplemental job...
46 CFR Sec. 7 - Job order numbering.
Code of Federal Regulations, 2012 CFR
2012-10-01
... 46 Shipping 8 2012-10-01 2012-10-01 false Job order numbering. Sec. 7 Section 7 Shipping MARITIME... REPAIRS UNDER NATIONAL SHIPPING AUTHORITY MASTER LUMP SUM REPAIR CONTRACT-NSA-LUMPSUMREP Sec. 7 Job order numbering. (a) The NSA-LUMPSUMREP Contract number shall be inserted in every job order and supplemental job...
Gobler, Christopher J; Lobanov, Alexei V; Tang, Ying-Zhong; Turanov, Anton A; Zhang, Yan; Doblin, Martina; Taylor, Gordon T; Sañudo-Wilhelmy, Sergio A; Grigoriev, Igor V; Gladyshev, Vadim N
2013-07-01
The trace element selenium (Se) is required for the biosynthesis of selenocysteine (Sec), the 21st amino acid in the genetic code, but its role in the ecology of harmful algal blooms (HABs) is unknown. Here, we examined the role of Se in the biology and ecology of the harmful pelagophyte, Aureococcus anophagefferens, through cell culture, genomic analyses, and ecosystem studies. This organism has the largest and the most diverse selenoproteome identified to date that consists of at least 59 selenoproteins, including known eukaryotic selenoproteins, selenoproteins previously only detected in bacteria, and novel selenoproteins. The A. anophagefferens selenoproteome was dominated by the thioredoxin fold proteins and oxidoreductase functions were assigned to the majority of detected selenoproteins. Insertion of Sec in these proteins was supported by a unique Sec insertion sequence. Se was required for the growth of A. anophagefferens as cultures grew maximally at nanomolar Se concentrations. In a coastal ecosystem, dissolved Se concentrations were elevated before and after A. anophagefferens blooms, but were reduced by >95% during the peak of blooms to 0.05 nM. Consistent with this pattern, enrichment of seawater with selenite before and after a bloom did not affect the growth of A. anophagefferens, but enrichment during the peak of the bloom significantly increased population growth rates. These findings demonstrate that Se inventories, which can be anthropogenically enriched, can support proliferation of HABs, such as A. anophagefferens through its synthesis of a large arsenal of Se-dependent oxidoreductases that fine-tune cellular redox homeostasis.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gobler, Christopher J.; Lobanov, Alexei V.; Tang, Ying-Zhong
The trace element selenium (Se) is required for the biosynthesis of selenocysteine (Sec), the 21st amino acid in the genetic code, but its role in the ecology of harmful algal blooms (HABs) is unknown. Here, we examined the role of Se in the biology and ecology of the harmful pelagophyte, Aureococcus anophagefferens, through cell culture, genomic analyses, and ecosystem studies. This organism has the largest and the most diverse selenoproteome identified to date that consists of at least 59 selenoproteins, including known eukaryotic selenoproteins, selenoproteins previously only detected in bacteria, and novel selenoproteins. The A. anophagefferens selenoproteome was dominated bymore » the thioredoxin fold proteins and oxidoreductase functions were assigned to the majority of detected selenoproteins. Insertion of Sec in these proteins was supported by a unique Sec insertion sequence. Se was required for the growth of A. anophagefferens as cultures grew maximally at nanomolar Se concentrations. In a coastal ecosystem, dissolved Se concentrations were elevated before and after A. anophagefferens blooms, but were reduced by >95percent during the peak of blooms to 0.05 nM. Consistent with this pattern, enrichment of seawater with selenite before and after a bloom did not affect the growth of A. anophagefferens, but enrichment during the peak of the bloom significantly increased population growth rates. These findings demonstrate that Se inventories, which can be anthropogenically enriched, can support proliferation of HABs, such as A. anophagefferens through its synthesis of a large arsenal of Se-dependent oxidoreductases that fine-tune cellular redox homeostasis.« less
Transmembrane helices containing a charged arginine are thermodynamically stable.
Ulmschneider, Martin B; Ulmschneider, Jakob P; Freites, J Alfredo; von Heijne, Gunnar; Tobias, Douglas J; White, Stephen H
2017-10-01
Hydrophobic amino acids are abundant in transmembrane (TM) helices of membrane proteins. Charged residues are sparse, apparently due to the unfavorable energetic cost of partitioning charges into nonpolar phases. Nevertheless, conserved arginine residues within TM helices regulate vital functions, such as ion channel voltage gating and integrin receptor inactivation. The energetic cost of arginine in various positions along hydrophobic helices has been controversial. Potential of mean force (PMF) calculations from atomistic molecular dynamics simulations predict very large energetic penalties, while in vitro experiments with Sec61 translocons indicate much smaller penalties, even for arginine in the center of hydrophobic TM helices. Resolution of this conflict has proved difficult, because the in vitro assay utilizes the complex Sec61 translocon, while the PMF calculations rely on the choice of simulation system and reaction coordinate. Here we present the results of computational and experimental studies that permit direct comparison with the Sec61 translocon results. We find that the Sec61 translocon mediates less efficient membrane insertion of Arg-containing TM helices compared with our computational and experimental bilayer-insertion results. In the simulations, a combination of arginine snorkeling, bilayer deformation, and peptide tilting is sufficient to lower the penalty of Arg insertion to an extent such that a hydrophobic TM helix with a central Arg residue readily inserts into a model membrane. Less favorable insertion by the translocon may be due to the decreased fluidity of the endoplasmic reticulum (ER) membrane compared with pure palmitoyloleoyl-phosphocholine (POPC). Nevertheless, our results provide an explanation for the differences between PMF- and experiment-based penalties for Arg burial.
The bacterial Sec system is required for the organization and function of the MreB cytoskeleton
2017-01-01
The Sec system is responsible for protein insertion, translocation and secretion across membranes in all cells. The bacterial actin homolog MreB controls various processes, including cell wall synthesis, membrane organization and polarity establishment. Here we show that the two systems genetically interact and that components of the Sec system, especially the SecA motor protein, are essential for spatiotemporal organization of MreB in E. coli, as evidenced by the accumulation of MreB at irregular sites in Sec-impaired cells. MreB mislocalization in SecA-defective cells significantly affects MreB-coordinated processes, such as cell wall synthesis, and induce formation of membrane invaginations enriched in high fluidity domains. Additionally, MreB is not recruited to the FtsZ ring in secA mutant cells, contributing to division arrest and cell filamentation. Our results show that all these faults are due to improper targeting of MreB to the membrane in the absence of SecA. Thus, when we reroute RodZ, MreB membrane-anchor, by fusing it to a SecA-independent integral membrane protein and overproducing it, MreB localization is restored and the defect in cell division is corrected. Notably, the RodZ moiety is not properly inserted into the membrane, strongly suggesting that it only serves as a bait for placing MreB around the cell circumference. Finally, we show that MreB localization depends on SecA also in C. crescentus, suggesting that regulation of MreB by the Sec system is conserved in bacteria. Taken together, our data reveal that the secretion system plays an important role in determining the organization and functioning of the cytoskeletal system in bacteria. PMID:28945742
The bacterial Sec system is required for the organization and function of the MreB cytoskeleton.
Govindarajan, Sutharsan; Amster-Choder, Orna
2017-09-01
The Sec system is responsible for protein insertion, translocation and secretion across membranes in all cells. The bacterial actin homolog MreB controls various processes, including cell wall synthesis, membrane organization and polarity establishment. Here we show that the two systems genetically interact and that components of the Sec system, especially the SecA motor protein, are essential for spatiotemporal organization of MreB in E. coli, as evidenced by the accumulation of MreB at irregular sites in Sec-impaired cells. MreB mislocalization in SecA-defective cells significantly affects MreB-coordinated processes, such as cell wall synthesis, and induce formation of membrane invaginations enriched in high fluidity domains. Additionally, MreB is not recruited to the FtsZ ring in secA mutant cells, contributing to division arrest and cell filamentation. Our results show that all these faults are due to improper targeting of MreB to the membrane in the absence of SecA. Thus, when we reroute RodZ, MreB membrane-anchor, by fusing it to a SecA-independent integral membrane protein and overproducing it, MreB localization is restored and the defect in cell division is corrected. Notably, the RodZ moiety is not properly inserted into the membrane, strongly suggesting that it only serves as a bait for placing MreB around the cell circumference. Finally, we show that MreB localization depends on SecA also in C. crescentus, suggesting that regulation of MreB by the Sec system is conserved in bacteria. Taken together, our data reveal that the secretion system plays an important role in determining the organization and functioning of the cytoskeletal system in bacteria.
Secretome Analysis Defines the Major Role of SecDF in Staphylococcus aureus Virulence
Quiblier, Chantal; Seidl, Kati; Roschitzki, Bernd; Zinkernagel, Annelies S.; Berger-Bächi, Brigitte; Senn, Maria M.
2013-01-01
The Sec pathway plays a prominent role in protein export and membrane insertion, including the secretion of major bacterial virulence determinants. The accessory Sec constituent SecDF has been proposed to contribute to protein export. Deletion of Staphylococcus aureus secDF has previously been shown to reduce resistance, to alter cell separation, and to change the expression of certain virulence factors. To analyse the impact of the secDF deletion in S. aureus on protein secretion, a quantitative secretome analysis was performed. Numerous Sec signal containing proteins involved in virulence were found to be decreased in the supernatant of the secDF mutant. However, two Sec-dependent hydrolases were increased in comparison to the wild type, suggesting additional indirect, regulatory effects to occur upon deletion of secDF. Adhesion, invasion, and cytotoxicity of the secDF mutant were reduced in human umbilical vein endothelial cells. Virulence was significantly reduced using a Galleria mellonella insect model. Altogether, SecDF is a promising therapeutic target for controlling S. aureus infections. PMID:23658837
Biosynthesis of Selenocysteine on Its tRNA in Eukaryotes
Mix, Heiko; Zhang, Yan; Saira, Kazima; Glass, Richard S; Berry, Marla J; Gladyshev, Vadim N; Hatfield, Dolph L
2007-01-01
Selenocysteine (Sec) is cotranslationally inserted into protein in response to UGA codons and is the 21st amino acid in the genetic code. However, the means by which Sec is synthesized in eukaryotes is not known. Herein, comparative genomics and experimental analyses revealed that the mammalian Sec synthase (SecS) is the previously identified pyridoxal phosphate-containing protein known as the soluble liver antigen. SecS required selenophosphate and O-phosphoseryl-tRNA[Ser]Sec as substrates to generate selenocysteyl-tRNA[Ser]Sec. Moreover, it was found that Sec was synthesized on the tRNA scaffold from selenide, ATP, and serine using tRNA[Ser]Sec, seryl-tRNA synthetase, O-phosphoseryl-tRNA[Ser]Sec kinase, selenophosphate synthetase, and SecS. By identifying the pathway of Sec biosynthesis in mammals, this study not only functionally characterized SecS but also assigned the function of the O-phosphoseryl-tRNA[Ser]Sec kinase. In addition, we found that selenophosphate synthetase 2 could synthesize monoselenophosphate in vitro but selenophosphate synthetase 1 could not. Conservation of the overall pathway of Sec biosynthesis suggests that this pathway is also active in other eukaryotes and archaea that synthesize selenoproteins. PMID:17194211
Calléja, F; Tandeau de Marsac, N; Coursin, T; van Ormondt, H; de Waard, A
1985-09-25
A new sequence-specific endonuclease from the cyanobacterium Synechocystis species PCC 6701 has been purified and characterized. This enzyme, SecI, is unique in recognizing the nucleotide sequence: 5' -CCNNGG-3' 3' -GGNNCC-5' and cleaves it at the position indicated by the symbol. Two other restriction endonucleases, SecII and SecIII, found in this organism are isoschizomers of MspI and MstII, respectively.
Fiester, Steven E.; Nwugo, Chika C.; Penwell, William F.; Neary, John M.; Beckett, Amber C.; Arivett, Brock A.; Schmidt, Robert E.; Geiger, Sarah C.; Connerly, Pamela L.; Menke, Sharon M.; Tomaras, Andrew P.
2015-01-01
Acinetobacter baumannii is a Gram-negative opportunistic nosocomial pathogen that causes pneumonia and soft tissue and systemic infections. Screening of a transposon insertion library of A. baumannii ATCC 19606T resulted in the identification of the 2010 derivative, which, although capable of growing well in iron-rich media, failed to prosper under iron chelation. Genetic, molecular, and functional assays showed that 2010's iron utilization-deficient phenotype is due to an insertion within the 3′ end of secA, which results in the production of a C-terminally truncated derivative of SecA. SecA plays a critical role in protein translocation through the SecYEG membrane channel. Accordingly, the secA mutation resulted in undetectable amounts of the ferric acinetobactin outer membrane receptor protein BauA while not affecting the production of other acinetobactin membrane protein transport components, such as BauB and BauE, or the secretion of acinetobactin by 2010 cells cultured in the presence of subinhibitory concentrations of the synthetic iron chelator 2,2′-dipyridyl. Outer membrane proteins involved in nutrient transport, adherence, and biofilm formation were also reduced in 2010. The SecA truncation also increased production of 30 different proteins, including proteins involved in adaptation/tolerance responses. Although some of these protein changes could negatively affect the pathobiology of the 2010 derivative, its virulence defect is mainly due to its inability to acquire iron via the acinetobactin-mediated system. These results together indicate that although the C terminus of the A. baumannii ATCC 19606T SecA is not essential for viability, it plays a critical role in the production and translocation of different proteins and virulence. PMID:25605767
Calléja, F; Tandeau de Marsac, N; Coursin, T; van Ormondt, H; de Waard, A
1985-01-01
A new sequence-specific endonuclease from the cyanobacterium Synechocystis species PCC 6701 has been purified and characterized. This enzyme, SecI, is unique in recognizing the nucleotide sequence: 5' -CCNNGG-3' 3' -GGNNCC-5' and cleaves it at the position indicated by the symbol. Two other restriction endonucleases, SecII and SecIII, found in this organism are isoschizomers of MspI and MstII, respectively. Images PMID:2997722
78 FR 76074 - Department of State Acquisition Regulation
Federal Register 2010, 2011, 2012, 2013, 2014
2013-12-16
... DOSAR Sec. Sec. 652.245-70(a)(3) and 652.245-71, on the theory that Part 45 governs the management and... expectancy to exceed two years. (b) The contracting officer shall insert the clause at 652.245-71, Special... property when put into use; and is of a durable nature with an estimated useful life expectancy to exceed...
76 FR 56099 - Amendment of Class E Airspace; Orangeburg, SC
Federal Register 2010, 2011, 2012, 2013, 2014
2011-09-12
... Group, Eastern Service Center, Federal Aviation Administration, P.O. Box 20636, Atlanta, Georgia 30320... the airspace descriptor from ``ASO GA E5 Orangeburg, SC [Amended]'' to ``ASO SC E5 Orangeburg, SC... Airport, SC, remove ``lat. 33[deg]27[min]39[sec] N., long. 80[deg]51[min]32[sec] W.'' and insert ``lat. 33...
Sauvageau, Anny
2009-01-01
The human pathophysiology of asphyxia by hanging is still poorly understood, despite great advances in forensic science. In that context, filmed hangings may hold the key to answer questions regarding the sequence of events leading to death in human asphyxia. Four filmed hangings were analyzed. Rapid loss of consciousness was observed between 13 sec and 18 sec after onset of hanging, closely followed by convulsions (at 14-19 sec). A complex pattern of decerebration rigidity (19-21 sec in most cases), followed by a quick phase of decortication rigidity (1 min 00 sec-1 min 08 sec in most cases), an extended phase of decortication rigidity (1 min 04 sec-1 min 32 sec) and loss of muscle tone (1 min 38 sec-2 min 47 sec) was revealed. Very deep respiratory attempts started between 20 and 22 sec, the last respiratory attempt being detected between 2 min 00 sec and 2 min 04 sec. Despite differences in the types of hanging, this unique study reveals similarities that are further discussed.
Secisbp2 Is Essential for Embryonic Development and Enhances Selenoprotein Expression
Seeher, Sandra; Atassi, Tarik; Mahdi, Yassin; Carlson, Bradley A.; Braun, Doreen; Wirth, Eva K.; Klein, Marc O.; Reix, Nathalie; Miniard, Angela C.; Schomburg, Lutz; Hatfield, Dolph L.; Driscoll, Donna M.
2014-01-01
Abstract Aims: The selenocysteine insertion sequence (SECIS)-binding protein 2 (Secisbp2) binds to SECIS elements located in the 3′-untranslated region of eukaryotic selenoprotein mRNAs. Selenoproteins contain the rare amino acid selenocysteine (Sec). Mutations in SECISBP2 in humans lead to reduced selenoprotein expression thereby affecting thyroid hormone-dependent growth and differentiation processes. The most severe cases also display myopathy, hearing impairment, male infertility, increased photosensitivity, mental retardation, and ataxia. Mouse models are needed to understand selenoprotein-dependent processes underlying the patients' pleiotropic phenotypes. Results: Unlike tRNA[Ser]Sec-deficient embryos, homozygous Secisbp2-deleted embryos implant, but fail before gastrulation. Heterozygous inactivation of Secisbp2 reduced the amount of selenoprotein expressed, but did not affect the thyroid hormone axis or growth. Conditional deletion of Secisbp2 in hepatocytes significantly decreased selenoprotein expression. Unexpectedly, the loss of Secisbp2 reduced the abundance of many, but not all, selenoprotein mRNAs. Transcript-specific and gender-selective effects on selenoprotein mRNA abundance were greater in Secisbp2-deficient hepatocytes than in tRNA[Ser]Sec-deficient cells. Despite the massive reduction of Dio1 and Sepp1 mRNAs, significantly more corresponding protein was detected in primary hepatocytes lacking Secisbp2 than in cells lacking tRNA[Ser]Sec. Regarding selenoprotein expression, compensatory nuclear factor, erythroid-derived, like 2 (Nrf2)-dependent gene expression, or embryonic development, phenotypes were always milder in Secisbp2-deficient than in tRNA[Ser]Sec-deficient mice. Innovation: We report the first Secisbp2 mutant mouse models. The conditional mutants provide a model for analyzing Secisbp2 function in organs not accessible in patients. Conclusion: In hepatocyte-specific conditional mouse models, Secisbp2 gene inactivation is less detrimental than tRNA[Ser]Sec inactivation. A role of Secisbp2 in stabilizing selenoprotein mRNAs in vivo was uncovered. Antioxid. Redox Signal. 21, 835–849. PMID:24274065
Ha, Sang Hee; Kim, Min-Soo; Suh, Jiwoo; Lee, Jong Seok
2018-05-01
The self-pressurized air-Q® (air-Q SP) intubating laryngeal airway is a relatively new supraglottic airway (SGA) device. The intracuff pressure of air-Q dynamically equilibrates with the airway pressure and adjusts to the patient's pharyngeal and periglottic anatomy, potentially providing improved airway fit and seal. The aim of this prospective randomized study was to compare the clinical performance of air-Q to the LMA® Classic™ SGA. Adult patients requiring general anesthesia for elective surgery were prospectively enrolled and randomly assigned to either air-Q SP or the LMA Classic SGA. Oropharyngeal leak pressure (primary endpoint), success rate, insertion features (insertion time, ease of insertion, requirement for device manipulation), sealing function, gastric insufflation, bronchoscopic view, and oropharyngeal complications at device insertion and following its removal (sore throat, dysphagia, dysphonia) were compared. The mean (standard deviation [SD]) oropharyngeal leak pressure just after insertion was similar in the air-Q SP and LMA [16.8 (4.9) vs 18.6 (5.5) cm H 2 O, respectively; mean difference, 1.8 cm H 2 O; 95% CI, -0.5 to 4.2; P = 0.13] and did not differ at ten minutes following device insertion. Median [interquartile range (IQR)] peak inspiratory pressure just after insertion was lower in the air-Q SP (11.0 [10.0-13.0] vs 13.0 [11.0-14.0] cmH 2 O, median difference, 1.0 cm H 2 O; 95% CI, 0.0 to 2.0; P = 0.03) but no difference was observed at ten minutes. The median [IQR] insertion time was faster with the air-Q SP (15.9 [13.6-20.3] sec vs 24 [21.2-27.1] sec; median difference, 8.1 sec; 95% CI, 5.6 to 9.9; P < 0.001) and improved bronchoscopic viewing grade were seen with the air-Q SP immediately after insertion (P < 0.001). No differences between the groups were observed with respect to the rate of successful insertion at first attempt, overall insertion success rate, ease of insertion, and complications. The air-Q SP had similar leak pressures but a faster insertion time and superior bronchoscopic viewing grade when compared with the LMA Classic. The air-Q SP is a suitable alternative to the LMA Classic in adult patients and may be a superior conduit for tracheal intubation. www.clinicaltrials.gov (NCT02206438). Registered 1 August 2014.
Sauvageau, Anny; Racette, Stéphanie
2007-07-01
The forensic literature on the pathophysiology of human hanging is still limited. Therefore, forensic pathologists often feel uncomfortable when confronted with related questions. Here presented is the filmed suicidal hanging of a 37-year-old man. This recording allows a unique analysis of agonal movement sequences: loss of consciousness (13 sec), convulsions (15 sec), decortication rigidity (21 sec), decerebration rigidity (46 sec), second decortication rigidity (1 min 11 sec), loss of muscle tone, (1 min 38 sec) and last isolated muscle movement (4 min 10 sec). As for respiratory responses, very deep respiratory attempts started at 20 sec. Respiratory movements progressively decreased and completely stopped at 2 min. Despite the fact that extending the presented data on all cases of hanging asphyxia would be a mistake, this case gives a very interesting insight into movement and respiratory response to asphyxia by hanging.
Hodgetts, Jennifer; Boonham, Neil; Mumford, Rick; Harrison, Nigel; Dickinson, Matthew
2008-08-01
Phytoplasma phylogenetics has focused primarily on sequences of the non-coding 16S rRNA gene and the 16S-23S rRNA intergenic spacer region (16-23S ISR), and primers that enable amplification of these regions from all phytoplasmas by PCR are well established. In this study, primers based on the secA gene have been developed into a semi-nested PCR assay that results in a sequence of the expected size (about 480 bp) from all 34 phytoplasmas examined, including strains representative of 12 16Sr groups. Phylogenetic analysis of secA gene sequences showed similar clustering of phytoplasmas when compared with clusters resolved by similar sequence analyses of a 16-23S ISR-23S rRNA gene contig or of the 16S rRNA gene alone. The main differences between trees were in the branch lengths, which were elongated in the 16-23S ISR-23S rRNA gene tree when compared with the 16S rRNA gene tree and elongated still further in the secA gene tree, despite this being a shorter sequence. The improved resolution in the secA gene-derived phylogenetic tree resulted in the 16SrII group splitting into two distinct clusters, while phytoplasmas associated with coconut lethal yellowing-type diseases split into three distinct groups, thereby supporting past proposals that they represent different candidate species within 'Candidatus Phytoplasma'. The ability to differentiate 16Sr groups and subgroups by virtual RFLP analysis of secA gene sequences suggests that this gene may provide an informative alternative molecular marker for pathogen identification and diagnosis of phytoplasma diseases.
Dinesh Kumar, K. K.; Bhardwaj, Neerja; Yaddanapudi, Sandhya
2017-01-01
Background and Aims: It is not known whether trapezius squeeze test (TPZ) is a better clinical test than jaw thrust (JT) to assess laryngeal mask airway (LMA) insertion conditions in children under sevoflurane anesthesia. Material and Methods: After the Institutional Ethics Committee approval and written informed parental consent, 124 American Society of Anesthesiologists I and II children of 2–8 years of age undergoing minor surgical procedures were randomized into TPZ and JT groups. The children were induced with 8% sevoflurane in oxygen at a fresh gas flow of 4 L/min. TPZ or JT was performed after 1 min of start of sevoflurane and then every 20 s till the test was negative, when end-tidal (ET) sevoflurane concentration was noted. Classic LMA of requisite size was inserted by a blinded anesthetist and conditions at the insertion of LMA, insertion time, and the number of attempts of LMA insertion were recorded. Results: The mean LMA insertion time was significantly longer (P < 0.001) for TPZ (145 ± 28.7 sec) compared to JT group (111.8 ± 31.0 sec). ET sevoflurane concentration at the time of LMA insertion was comparable in the two groups. LMA insertion conditions were similar in the two groups. There was no difference between the two groups regarding total number of attempts of LMA insertion. Heart rate (HR) decreased in both groups after LMA insertion (P < 0.001) but TPZ group had significantly lower HR compared with the JT group up to 5 min after LMA insertion (P = 0.03). Conclusion: Both JT and TPZ are equivalent clinical indicators in predicting the optimal conditions of LMA insertion in spontaneously breathing children; however, it takes a longer time to achieve a negative TPZ squeeze test. PMID:28413275
Protein Export by the Mycobacterial SecA2 System Is Determined by the Preprotein Mature Domain
Feltcher, Meghan E.; Gibbons, Henry S.; Ligon, Lauren S.
2013-01-01
At the core of the bacterial general secretion (Sec) pathway is the SecA ATPase, which powers translocation of unfolded preproteins containing Sec signal sequences through the SecYEG membrane channel. Mycobacteria have two nonredundant SecA homologs: SecA1 and SecA2. While the essential SecA1 handles “housekeeping” export, the nonessential SecA2 exports a subset of proteins and is required for Mycobacterium tuberculosis virulence. Currently, it is not understood how SecA2 contributes to Sec export in mycobacteria. In this study, we focused on identifying the features of two SecA2 substrates that target them to SecA2 for export, the Ms1704 and Ms1712 lipoproteins of the model organism Mycobacterium smegmatis. We found that the mature domains of Ms1704 and Ms1712, not the N-terminal signal sequences, confer SecA2-dependent export. We also demonstrated that the lipid modification and the extreme N terminus of the mature protein do not impart the requirement for SecA2 in export. We further showed that the Ms1704 mature domain can be efficiently exported by the twin-arginine translocation (Tat) pathway. Because the Tat system exports only folded proteins, this result implies that SecA2 substrates can fold in the cytoplasm and suggests a putative role of SecA2 in enabling export of such proteins. Thus, the mycobacterial SecA2 system may represent another way that bacteria solve the problem of exporting proteins that can fold in the cytoplasm. PMID:23204463
Federal Register 2010, 2011, 2012, 2013, 2014
2011-12-16
... DEPARTMENT OF HOMELAND SECURITY Coast Guard 33 CFR Part 165 [Docket No. USCG-2011-1091] RIN 1625...-2011-1091 and are available online by going to http://www.regulations.gov , inserting USCG-2011-1091 in.... 0 2. Add a temporary Sec. 165.T07-1091 to read as follows: Sec. 165.T07-1091 Safety Zones; New Year...
NASA Technical Reports Server (NTRS)
Yariv, A.
1972-01-01
A theoretical investigation revealed that a steady state mode-locked solution appropriate to ultrashort pulses is induced by Kerr liquids. An experimental investigation using a Q-switched ruby laser passively mode-locked by the insertion of a Kerr liquid verified the theory. Pulses of about 10 to the -11th power sec were generated when the relaxation time of the liquid was temperature tuned to approximately 10 to the -11th power sec.
Gupta, Anjali Bansal; Wee, Liang En; Zhou, Yi Ting; Hortsch, Michael; Low, Boon Chuan
2012-01-01
The CRAL_TRIO protein domain, which is unique to the Sec14 protein superfamily, binds to a diverse set of small lipophilic ligands. Similar domains are found in a range of different proteins including neurofibromatosis type-1, a Ras GTPase-activating Protein (RasGAP) and Rho guanine nucleotide exchange factors (RhoGEFs). Proteins containing this structural protein domain exhibit a low sequence similarity and ligand specificity while maintaining an overall characteristic three-dimensional structure. We have previously demonstrated that the BNIP-2 and Cdc42GAP Homology (BCH) protein domain, which shares a low sequence homology with the CRAL_TRIO domain, can serve as a regulatory scaffold that binds to Rho, RhoGEFs and RhoGAPs to control various cell signalling processes. In this work, we investigate 175 BCH domain-containing proteins from a wide range of different organisms. A phylogenetic analysis with ∼100 CRAL_TRIO and similar domains from eight representative species indicates a clear distinction of BCH-containing proteins as a novel subclass within the CRAL_TRIO/Sec14 superfamily. BCH-containing proteins contain a hallmark sequence motif R(R/K)h(R/K)(R/K)NL(R/K)xhhhhHPs (‘h’ is large and hydrophobic residue and ‘s’ is small and weekly polar residue) and can be further subdivided into three unique subtypes associated with BNIP-2-N, macro- and RhoGAP-type protein domains. A previously unknown group of genes encoding ‘BCH-only’ domains is also identified in plants and arthropod species. Based on an analysis of their gene-structure and their protein domain context we hypothesize that BCH domain-containing genes evolved through gene duplication, intron insertions and domain swapping events. Furthermore, we explore the point of divergence between BCH and CRAL-TRIO proteins in relation to their ability to bind small GTPases, GAPs and GEFs and lipid ligands. Our study suggests a need for a more extensive analysis of previously uncharacterized BCH, ‘BCH-like’ and CRAL_TRIO-containing proteins and their significance in regulating signaling events involving small GTPases. PMID:22479462
Design of a Ram Accelerator mass launch system
NASA Technical Reports Server (NTRS)
1988-01-01
The Ram Accelerator, a chemically propelled, impulsive mass launch system, is presented as a viable concept for directly launching acceleration-insensitive payloads into low Earth orbit. The principles of propulsion are based on those of an airbreathing supersonic ramjet. The payload vehicle acts as the ramjet centerbody and travels through a fixed launch tube that acts as the ramjet outer cowling. The launch tube is filled with premixed gaseous fuel and oxidizer mixtures that combust at the base of the vehicle and produce thrust. Two modes of in-tube propulsion involving ramjet cycles are used in sequence to accelerate the vehicle from 0.7 km/sec to 9 km/sec. Requirements for placing a 2000 kg vehicle into a 500-km circular orbit, with a minimum amount of onboard rocket propellant for orbital maneuvers, are examined. It is shown that in-tube propulsion requirements dictate a launch tube length of 5.1 km to achieve an exit velocity of 9 km/sec, with peak accelerations not to exceed 1000 g's. Aerodynamic heating due to atmospheric transit requires minimal ablative protection and the vehicle retains a large percentage of its exit velocity. An indirect orbital insertion maneuver with aerobraking and two apogee burns is examined to minimize the required onboard propellant mass. An appropriate onboard propulsion system design to perform the required orbital maneuvers with minimum mass requirements is also determined. The structural designs of both the launch tube and the payload vehicle are examined using simple structural and finite element analysis for various materials.
Komatsu, R.; Nagata, O.; Kamata, K.; Yamagata, K.; Sessler, D.I.; Ozaki, M.
2005-01-01
Summary We compared the usefulness of the laryngeal tube (LT) with the intubating laryngeal mask airway (ILMA) in 51 patients whose necks were stabilised by manual in-line traction. After induction of anaesthesia and neuromuscular block, the LT and ILMA were inserted consecutively in a randomised, crossover design. During pressure-controlled ventilation (20 cmH2O inspiratory pressure), we measured insertion attempts, time to establish positive-pressure ventilation, tidal volume, gastric insufflation, and minimum airway pressure at which gas leaked around the cuff. Data were compared using Wilcoxon signed-rank tests; P<0.05 was considered significant. Insertion was more difficult with the LT (successful at first attempt in 16 patients) than with the ILMA (successful at first attempt in 42 patients, P<0.0001). Time required for insertion was longer for the LT (28 [23–35] sec, median [interquartile range]) than the ILMA (20 [15–25] sec, P=0.0009). Tidal volume was less for the LT (440 [290–670] ml) than the ILMA. (630 [440–750] ml, P=0.013). Minimum airway pressure at which gas leak occurred and incidence of gastric insufflation were similar with two devices. In patients whose necks were stabilised with manual in-line traction, insertion of the ILMA was easier and quicker than insertion of the LT and tidal volume was greater with the ILMA than the LT. PMID:15644005
Hartweck, Lynn M; Scott, Cheryl L; Olszewski, Neil E
2002-01-01
The Arabidopsis SECRET AGENT (SEC) and SPINDLY (SPY) proteins are similar to animal O-linked N-acetylglucosamine transferases (OGTs). OGTs catalyze the transfer of N-acetylglucosamine (GlcNAc) from UDP-GlcNAc to Ser/Thr residues of proteins. In animals, O-GlcNAcylation has been shown to affect protein activity, stability, and/or localization. SEC protein expressed in Escherichia coli had autocatalytic OGT activity. To determine the function of SEC in plants, two tDNA insertional mutants were identified and analyzed. Although sec mutant plants did not exhibit obvious phenotypes, sec and spy mutations had a synthetic lethal interaction. This lethality was incompletely penetrant in gametes and completely penetrant postfertilization. The rate of both female and male sec spy gamete transmission was higher in plants heterozygous for both mutations than in plants heterozygous for sec and homozygous for spy. Double-mutant embryos aborted at various stages of development and no double-mutant seedlings were obtained. These results indicate that OGT activity is required during gametogenesis and embryogenesis with lethality occurring when parentally derived SEC, SPY, and/or O-GlcNAcylated proteins become limiting. PMID:12136030
Mitchell, Michael S; Lee White, Marjorie; King, William D; Wang, Henry E
2012-01-01
Pediatric endotracheal intubation (ETI) is difficult and can have serious adverse events when performed by paramedics in the prehospital setting. Paramedics may use the King Laryngeal Tube airway (KLT) in difficult adult airways, but only limited data describe their application in pediatric patients. To compare paramedic airway insertion speed and complications between KLT and ETI in a simulated model of pediatric respiratory arrest. This prospective, randomized trial included paramedics and senior paramedic students with limited prior KLT experience. We provided brief training on pediatric KLT insertion. Using a random allocation protocol, participants performed both ETI and KLT on a pediatric mannequin (6-month old size) in simulated respiratory arrest. The primary outcomes were 1) elapsed time to successful airway placement (seconds), and 2) proper airway positioning. We compared airway insertion performance between KLT and ETI using the Wilcoxon signed-ranks test. Subjects also indicated their preferred airway device. The 25 subjects included 19 paramedics and 6 senior paramedic students. Two subjects had prior adult KLT experience. Airway insertion time was not statistically different between the KLT (median 27 secs) and ETI (median 31 secs) (p = 0.08). Esophageal intubation occurred in 2 of 25 (8%) ETI. Airway leak occurred in 3 of 25 (12%) KLT, but ventilation remained satisfactory. Eighty-four percent of the subjects preferred the KLT over ETI. Paramedics and paramedic students demonstrated similar airway insertion performance between KLT and ETI in simulated, pediatric respiratory arrest. Most subjects preferred KLT. KLT may provide a viable alternative to ETI in prehospital pediatric airway management.
46 CFR Sec. 18 - Group classification.
Code of Federal Regulations, 2013 CFR
2013-10-01
... MARITIME ADMINISTRATION, DEPARTMENT OF TRANSPORTATION A-NATIONAL SHIPPING AUTHORITY PROCEDURE FOR ACCOMPLISHMENT OF VESSEL REPAIRS UNDER NATIONAL SHIPPING AUTHORITY MASTER LUMP SUM REPAIR CONTRACT-NSA-LUMPSUMREP... inserted thereon: Number Classification 41 Maintenance Repairs (deck, engine and stewards department...
46 CFR Sec. 18 - Group classification.
Code of Federal Regulations, 2010 CFR
2010-10-01
... MARITIME ADMINISTRATION, DEPARTMENT OF TRANSPORTATION A-NATIONAL SHIPPING AUTHORITY PROCEDURE FOR ACCOMPLISHMENT OF VESSEL REPAIRS UNDER NATIONAL SHIPPING AUTHORITY MASTER LUMP SUM REPAIR CONTRACT-NSA-LUMPSUMREP... inserted thereon: Number Classification 41 Maintenance Repairs (deck, engine and stewards department...
46 CFR Sec. 18 - Group classification.
Code of Federal Regulations, 2014 CFR
2014-10-01
... MARITIME ADMINISTRATION, DEPARTMENT OF TRANSPORTATION A-NATIONAL SHIPPING AUTHORITY PROCEDURE FOR ACCOMPLISHMENT OF VESSEL REPAIRS UNDER NATIONAL SHIPPING AUTHORITY MASTER LUMP SUM REPAIR CONTRACT-NSA-LUMPSUMREP... inserted thereon: Number Classification 41 Maintenance Repairs (deck, engine and stewards department...
46 CFR Sec. 18 - Group classification.
Code of Federal Regulations, 2012 CFR
2012-10-01
... MARITIME ADMINISTRATION, DEPARTMENT OF TRANSPORTATION A-NATIONAL SHIPPING AUTHORITY PROCEDURE FOR ACCOMPLISHMENT OF VESSEL REPAIRS UNDER NATIONAL SHIPPING AUTHORITY MASTER LUMP SUM REPAIR CONTRACT-NSA-LUMPSUMREP... inserted thereon: Number Classification 41 Maintenance Repairs (deck, engine and stewards department...
46 CFR Sec. 18 - Group classification.
Code of Federal Regulations, 2011 CFR
2011-10-01
... MARITIME ADMINISTRATION, DEPARTMENT OF TRANSPORTATION A-NATIONAL SHIPPING AUTHORITY PROCEDURE FOR ACCOMPLISHMENT OF VESSEL REPAIRS UNDER NATIONAL SHIPPING AUTHORITY MASTER LUMP SUM REPAIR CONTRACT-NSA-LUMPSUMREP... inserted thereon: Number Classification 41 Maintenance Repairs (deck, engine and stewards department...
Lakkaraju, Asvin K. K.; Thankappan, Ratheeshkumar; Mary, Camille; Garrison, Jennifer L.; Taunton, Jack; Strub, Katharina
2012-01-01
Mammalian cells secrete a large number of small proteins, but their mode of translocation into the endoplasmic reticulum is not fully understood. Cotranslational translocation was expected to be inefficient due to the small time window for signal sequence recognition by the signal recognition particle (SRP). Impairing the SRP pathway and reducing cellular levels of the translocon component Sec62 by RNA interference, we found an alternate, Sec62-dependent translocation path in mammalian cells required for the efficient translocation of small proteins with N-terminal signal sequences. The Sec62-dependent translocation occurs posttranslationally via the Sec61 translocon and requires ATP. We classified preproteins into three groups: 1) those that comprise ≤100 amino acids are strongly dependent on Sec62 for efficient translocation; 2) those in the size range of 120–160 amino acids use the SRP pathway, albeit inefficiently, and therefore rely on Sec62 for efficient translocation; and 3) those larger than 160 amino acids depend on the SRP pathway to preserve a transient translocation competence independent of Sec62. Thus, unlike in yeast, the Sec62-dependent translocation pathway in mammalian cells serves mainly as a fail-safe mechanism to ensure efficient secretion of small proteins and provides cells with an opportunity to regulate secretion of small proteins independent of the SRP pathway. PMID:22648169
Control of total GFP expression by alterations to the 3′ region nucleotide sequence
2013-01-01
Background Previously, we distinguished the Escherichia coli type II cytoplasmic membrane translocation pathways of Tat, Yid, and Sec for unfolded and folded soluble target proteins. The translocation of folded protein to the periplasm for soluble expression via the Tat pathway was controlled by an N-terminal hydrophilic leader sequence. In this study, we investigated the effect of the hydrophilic C-terminal end and its nucleotide sequence on total and soluble protein expression. Results The native hydrophilic C-terminal end of GFP was obtained by deleting the C-terminal peptide LeuGlu-6×His, derived from pET22b(+). The corresponding clones induced total and soluble GFP expression that was either slightly increased or dramatically reduced, apparently through reconstruction of the nucleotide sequence around the stop codon in the 3′ region. In the expression-induced clones, the hydrophilic C-terminus showed increased Tat pathway specificity for soluble expression. However, in the expression-reduced clone, after analyzing the role of the 5′ poly(A) coding sequence with a substituted synonymous codon, we proved that the longer 5′ poly(A) coding sequence interacted with the reconstructed 3′ region nucleotide sequence to create a new mRNA tertiary structure between the 5′ and 3′ regions, which resulted in reduced total GFP expression. Further, to recover the reduced expression by changing the 3′ nucleotide sequence, after replacing selected C-terminal 5′ codons and the stop codon in the ORF with synonymous codons, total GFP expression in most of the clones was recovered to the undeleted control level. The insertion of trinucleotides after the stop codon in the 3′-UTR recovered or reduced total GFP expression. RT-PCR revealed that the level of total protein expression was controlled by changes in translational or transcriptional regulation, which were induced or reduced by the substitution or insertion of 3′ region nucleotides. Conclusions We found that the hydrophilic C-terminal end of GFP increased Tat pathway specificity and that the 3′ nucleotide sequence played an important role in total protein expression through translational and transcriptional regulation. These findings may be useful for efficiently producing recombinant proteins as well as for potentially controlling the expression level of specific genes in the body for therapeutic purposes. PMID:23834827
Summers, R.; Byerlee, J.
1977-01-01
This report is a collection of stress-strain charts which were produced by deforming selected simuiated fault gouge materials. Several sets of samples consisted of intact cylinders, 1.000 inch in diameter and 2.500 inches long. The majority of the samples consisted of thin layers of the selected sample material, inserted within a diagonal sawcut in a 1.000-inch by 2.500-inch Westerly Granite cylinder. Two sorts of inserts were used. The first consisted of thin wafers cut from 1.000-inch-diameter cores of the rock being tested. The other consisted of thin layers of crushed material packed onto the sawcut surface. In several groups of tests using various thicknesses (0.010 inch to 0.160 inch) of a given type material there were variations in the stress level and/or stability of sliding as a function of the fault zone width. Because of this we elected to use a standard 0.025-inch width fault zone to compare the frictional properties of many of the different types of rock materials. This 0.025-inch thickness was chosen partially because this thickness of crushed granite behaves approximately the same as a fractured sample of initially intact granite, and also because this is near the lower limit at which we could cut intact wafers for those samples that were prepared from thin slices of rock. One series of tests was done with saw cut granite cylinders without fault gouge inserts. All of these tests were done in a hydraulically operated triaxial testing machine. The confining pressure (δ1, least principal stress) was applied by pumping petroleum ether into a pressure vessel. The differential stress (δ3-δ1) was applied by a hydraulically operated ram that could be advanced into the pressure vessel at any of several strain rates (10-4sec-1, 10-5sec-1, 10-6sec-1, 10-7sec-1, or 10-8sec-1). All samples were jacketed in polyurethane tubing to exclude the confining pressure medium from the samples. The majority of the samples, with the exception of some of the initially intact rocks, also had thin copper jackets. These served to hold the saw cut parts of the granite sample holders in alignment while the samples were handled and pushed into the polyurethane jackets.
Guo, Bingfu; Guo, Yong; Hong, Huilong; Qiu, Li-Juan
2016-01-01
Molecular characterization of sequence flanking exogenous fragment insertion is essential for safety assessment and labeling of genetically modified organism (GMO). In this study, the T-DNA insertion sites and flanking sequences were identified in two newly developed transgenic glyphosate-tolerant soybeans GE-J16 and ZH10-6 based on whole genome sequencing (WGS) method. More than 22.4 Gb sequence data (∼21 × coverage) for each line was generated on Illumina HiSeq 2500 platform. The junction reads mapped to boundaries of T-DNA and flanking sequences in these two events were identified by comparing all sequencing reads with soybean reference genome and sequence of transgenic vector. The putative insertion loci and flanking sequences were further confirmed by PCR amplification, Sanger sequencing, and co-segregation analysis. All these analyses supported that exogenous T-DNA fragments were integrated in positions of Chr19: 50543767-50543792 and Chr17: 7980527-7980541 in these two transgenic lines. Identification of genomic insertion sites of G2-EPSPS and GAT transgenes will facilitate the utilization of their glyphosate-tolerant traits in soybean breeding program. These results also demonstrated that WGS was a cost-effective and rapid method for identifying sites of T-DNA insertions and flanking sequences in soybean.
Aalto, M K; Ronne, H; Keränen, S
1993-01-01
The yeast SEC1 gene encodes a hydrophilic protein that functions at the terminal stage in secretion. We have cloned two yeast genes, SSO1 and SSO2, which in high copy number can suppress sec1 mutations and also mutations in several other late acting SEC genes, such as SEC3, SEC5, SEC9 and SEC15. SSO1 and SSO2 encode small proteins with N-terminal hydrophilic domains and C-terminal hydrophobic tails. The two proteins are 72% identical in sequence and together perform an essential function late in secretion. Sso1p and Sso2p show significant sequence similarity to six other proteins. Two of these, Sed5p and Pep12p, are yeast proteins that function in transport from ER to Golgi and from Golgi to the vacuole, respectively. Also related to Sso1p and Sso2p are three mammalian proteins: epimorphin, syntaxin A/HPC-1 and syntaxin B. A nematode cDNA product also belongs to the new protein family. The new protein family is thus present in a wide variety of eukaryotic cells, where its members function at different stages in vesicular transport. Images PMID:8223426
Lee, I-M; Bottner-Parker, K D; Zhao, Y; Bertaccini, A; Davis, R E
2012-09-01
The pigeon pea witches'-broom phytoplasma group (16SrIX) comprises diverse strains that cause numerous diseases in leguminous trees and herbaceous crops, vegetables, a fruit, a nut tree and a forest tree. At least 14 strains have been reported worldwide. Comparative phylogenetic analyses of the highly conserved 16S rRNA gene and the moderately conserved rplV (rpl22)-rpsC (rps3) and secY genes indicated that the 16SrIX group consists of at least six distinct genetic lineages. Some of these lineages cannot be readily differentiated based on analysis of 16S rRNA gene sequences alone. The relative genetic distances among these closely related lineages were better assessed by including more variable genes [e.g. ribosomal protein (rp) and secY genes]. The present study demonstrated that virtual RFLP analyses using rp and secY gene sequences allowed unambiguous identification of such lineages. A coding system is proposed to designate each distinct rp and secY subgroup in the 16SrIX group.
The complete general secretory pathway in gram-negative bacteria.
Pugsley, A P
1993-01-01
The unifying feature of all proteins that are transported out of the cytoplasm of gram-negative bacteria by the general secretory pathway (GSP) is the presence of a long stretch of predominantly hydrophobic amino acids, the signal sequence. The interaction between signal sequence-bearing proteins and the cytoplasmic membrane may be a spontaneous event driven by the electrochemical energy potential across the cytoplasmic membrane, leading to membrane integration. The translocation of large, hydrophilic polypeptide segments to the periplasmic side of this membrane almost always requires at least six different proteins encoded by the sec genes and is dependent on both ATP hydrolysis and the electrochemical energy potential. Signal peptidases process precursors with a single, amino-terminal signal sequence, allowing them to be released into the periplasm, where they may remain or whence they may be inserted into the outer membrane. Selected proteins may also be transported across this membrane for assembly into cell surface appendages or for release into the extracellular medium. Many bacteria secrete a variety of structurally different proteins by a common pathway, referred to here as the main terminal branch of the GSP. This recently discovered branch pathway comprises at least 14 gene products. Other, simpler terminal branches of the GSP are also used by gram-negative bacteria to secrete a more limited range of extracellular proteins. PMID:8096622
Filtration coefficient of the axon membrane as measured with hydrostatic and osmotic methods.
Vargas, F F
1968-01-01
The hydraulic conductivity of the membranes surrounding the giant axon of the squid, Dosidicus gigas, was measured. In some axons the axoplasm was partially removed by suction. Perfusion was then established by insertion of a second pipette. In other axons the axoplasm was left intact and only one pipette was inserted. In both groups hydrostatic pressure was applied by means of a water column in a capillary manometer. Displacement of the meniscus in time gave the rate of fluid flowing across the axon sheath. In both groups osmotic differences across the membrane were established by the addition of a test molecule to the external medium which was seawater. The hydraulic conductivity determined by application of hydrostatic pressure was 10.6 +/- 0.8.10(-8) cm/sec cm H(2)O in perfused axons and 3.2 +/- 0.6.10(-8) cm/sec cm H(2)O in intact axons. When the driving force was an osmotic pressure gradient the conductivity was 4.5 +/- 0.6 x 10(-10) cm/sec cm H(2)O and 4.8 +/- 0.9 x 10(-10) cm/sec cm H(2)O in perfused and intact axons, respectively. A comparable result was found when the internal solution was made hyperosmotic. The fluid flow was a linear function of the hydrostatic pressure up to 70 cm of water. Glycerol outflux and membrane conductance were increased 1.6 and 1.1 times by the application of hydrostatic pressure. These increments do not give an explanation of the difference between the filtration coefficients. Other possible explanations are suggested and discussed.
Guimarães, M. Jorge; Peterson, David; Vicari, Alain; Cocks, Benjamin G.; Copeland, Neal G.; Gilbert, Debra J.; Jenkins, Nancy A.; Ferrick, David A.; Kastelein, Robert A.; Bazan, J. Fernando; Zlotnik, Albert
1996-01-01
Escherichia coli selenophosphate synthetase (SPS, the selD gene product) catalyzes the production of monoselenophosphate, the selenium donor compound required for synthesis of selenocysteine (Sec) and seleno-tRNAs. We report the molecular cloning of human and mouse homologs of the selD gene, designated Sps2, which contains an in-frame TGA codon at a site corresponding to the enzyme’s putative active site. These sequences allow the identification of selD gene homologs in the genomes of the bacterium Haemophilus influenzae and the archaeon Methanococcus jannaschii, which had been previously misinterpreted due to their in-frame TGA codon. Sps2 mRNA levels are elevated in organs previously implicated in the synthesis of selenoproteins and in active sites of blood cell development. In addition, we show that Sps2 mRNA is up-regulated upon activation of T lymphocytes and have mapped the Sps2 gene to mouse chromosome 7. Using the mouse gene isolated from the hematopoietic cell line FDCPmixA4, we devised a construct for protein expression that results in the insertion of a FLAG tag sequence at the N terminus of the SPS2 protein. This strategy allowed us to document the readthrough of the in-frame TGA codon and the incorporation of 75Se into SPS2. These results suggest the existence of an autoregulatory mechanism involving the incorporation of Sec into SPS2 that might be relevant to blood cell biology. This mechanism is likely to have been present in ancient life forms and conserved in a variety of living organisms from all domains of life. PMID:8986768
Niu, Li-na; Luo, Xiao-juan; Li, Guo-hua; Bortoluzzi, Eduardo A.; Mao, Jing; Chen, Ji-hua; Gutmann, James L.; Pashley, David H.; Tay, Franklin R.
2014-01-01
Objectives The effects of different EndoActivator® (EA) sonic activation protocols on root canal debridement efficacy were examined. Methods Root canals in 48 single-rooted teeth were instrumented, irrigated initially with NaOCl and divided into 6 groups (N=8) based on the application time of QMix (antimicrobial calcium-chelating irrigant), and the time and sequence of EA irrigant activation - Positive Control: 90 sec QMix; Negative Control: 90 sec saline; Group 1A: 15 sec QMix + 15 sec QMix with EA-activation; Group 1B: 30 sec QMix + 30 sec of QMix with EA-activation; Group 2A: 15 sec QMix with EA-activation + 15 sec QMix; Group 2B: 30 sec QMix with EA-activation + 30 sec QMix. Split roots were examined with scanning electron microscopy for assignment of smear and debris scores in locations along the coronal, middle and apical thirds of the canals. The overall cleanliness of pooled canal locations in the Positive Control and the 4 experimental groups were compared with chi-square tests. Results Significant differences were detected among the 5 groups (p<0.001). Post-hoc pairwise comparisons indicated that the overall canal cleanliness was in the order (from best to worst): 1B = 2B > 2A > 1A > Positive Control. Completely clean canals could not be achieved due to the absence of continuous irrigant flow for EA to clear intraradicular debris. Conclusions Irrespective of the sonic activation sequence, irrigant activation for 30 seconds during a 60-second period of QMix application appears to maximize the smear layer and debris removal potential of the EndoActivator® system. PMID:24878251
Bauer, Benedikt W; Shemesh, Tom; Chen, Yu; Rapoport, Tom A
2014-06-05
In bacteria, most secretory proteins are translocated across the plasma membrane by the interplay of the SecA ATPase and the SecY channel. How SecA moves a broad range of polypeptide substrates is only poorly understood. Here we show that SecA moves polypeptides through the SecY channel by a "push and slide" mechanism. In its ATP-bound state, SecA interacts through a two-helix finger with a subset of amino acids in a substrate, pushing them into the channel. A polypeptide can also passively slide back and forth when SecA is in the predominant ADP-bound state or when SecA encounters a poorly interacting amino acid in its ATP-bound state. SecA performs multiple rounds of ATP hydrolysis before dissociating from SecY. The proposed push and slide mechanism is supported by a mathematical model and explains how SecA allows translocation of a wide range of polypeptides. This mechanism may also apply to hexameric polypeptide-translocating ATPases. Copyright © 2014 Elsevier Inc. All rights reserved.
Translation regulation of mammalian selenoproteins.
Vindry, Caroline; Ohlmann, Théophile; Chavatte, Laurent
2018-05-09
Interest in selenium research has considerably grown over the last decades owing to the association of selenium deficiencies with an increased risk of several human diseases, including cancers, cardiovascular disorders and infectious diseases. The discovery of a genetically encoded 21 st amino acid, selenocysteine, is a fascinating breakthrough in molecular biology as it is the first addition to the genetic code deciphered in the 1960s. Selenocysteine is a structural and functional analog of cysteine, where selenium replaces sulfur, and its presence is critical for the catalytic activity of selenoproteins. The insertion of selenocysteine is a non-canonical translational event, based on the recoding of a UGA codon in selenoprotein mRNAs, normally used as a stop codon in other cellular mRNAs. Two RNA molecules and associated partners are crucial components of the selenocysteine insertion machinery, the Sec-tRNA [Ser]Sec devoted to UGA codon recognition and the SECIS elements located in the 3'UTR of selenoprotein mRNAs. The translational UGA recoding event is a limiting stage of selenoprotein expression and its efficiency is regulated by several factors. The control of selenoproteome expression is crucial for redox homeostasis and antioxidant defense of mammalian organisms. In this review, we summarize current knowledge on the co-translational insertion of selenocysteine into selenoproteins, and its layers of regulation. Copyright © 2018. Published by Elsevier B.V.
Chao, Michael C.; Pritchard, Justin R.; Zhang, Yanjia J.; Rubin, Eric J.; Livny, Jonathan; Davis, Brigid M.; Waldor, Matthew K.
2013-01-01
The coupling of high-density transposon mutagenesis to high-throughput DNA sequencing (transposon-insertion sequencing) enables simultaneous and genome-wide assessment of the contributions of individual loci to bacterial growth and survival. We have refined analysis of transposon-insertion sequencing data by normalizing for the effect of DNA replication on sequencing output and using a hidden Markov model (HMM)-based filter to exploit heretofore unappreciated information inherent in all transposon-insertion sequencing data sets. The HMM can smooth variations in read abundance and thereby reduce the effects of read noise, as well as permit fine scale mapping that is independent of genomic annotation and enable classification of loci into several functional categories (e.g. essential, domain essential or ‘sick’). We generated a high-resolution map of genomic loci (encompassing both intra- and intergenic sequences) that are required or beneficial for in vitro growth of the cholera pathogen, Vibrio cholerae. This work uncovered new metabolic and physiologic requirements for V. cholerae survival, and by combining transposon-insertion sequencing and transcriptomic data sets, we also identified several novel noncoding RNA species that contribute to V. cholerae growth. Our findings suggest that HMM-based approaches will enhance extraction of biological meaning from transposon-insertion sequencing genomic data. PMID:23901011
You, Lu; Liu, Ci; Yang, Zi-Jiang; Li, Ming; Li, Shu
2014-08-01
Selenoprotein T (SelT) is associated with the regulation of calcium homeostasis and neuroendocrine secretion. SelT can also change cell adhesion and is involved in redox regulation and cell fixation. However, the structure and function of chicken SelT and its response to selenium (Se) remains unclear. In the present study, 150 1-day-old chickens were randomly divided into a low Se group (L group, fed a Se-deficient diet containing 0.020 mg/kg Se) and a control group (C group, fed a diet containing sodium selenite at 0.2 mg/kg Se). The immune organs (spleen, thymus, and bursa of Fabricius) were collected at 15, 25, 35, 45, and 55 days of age. We performed a sequence analysis and predicted the structure and function of SelT. We also investigated the effects of Se deficiency on the expression of SelT, selenophosphate synthetase-1 (SPS1), and selenocysteine synthase (SecS) using RT-PCR and the oxidative stress in the chicken immune organs. The data showed that the coding sequence (CDS) and deduced amino acid sequence of SelT were highly similar to those of 17 other animals. Se deficiency induced lower (P < 0.05) levels of SelT, SPS1, and SecS, reduced the catalase (CAT) activity, and increased the levels of hydrogen peroxide (H2O2) and hydroxyl radical (-OH) in immune organs. In conclusion, the CDS and deduced amino acid sequence of chicken SelT are highly homologous to those of various mammals. The redox function and response to the Se deficiency of chicken SelT may be conserved. A Se-deficient diet led to a decrease in SelT, SecS, and SPS1 and induced oxidative stress in the chicken immune organs. To our knowledge, this is the first report of predictions of chicken SelT structure and function. The present study demonstrated the relationship between the selenoprotein synthases (SPS1, SecS) and SelT expression in the chicken immune organs and further confirmed oxidative stress caused by Se deficiency. Thus, the information presented in this study is helpful to understand chicken SelT structure and function. Meanwhile, the present research also confirmed the negative effects of Se deficiency on chicken immune organs.
Decrypting protein insertion through the translocon with free-energy calculations.
Gumbart, James C; Chipot, Christophe
2016-07-01
Protein insertion into a membrane is a complex process involving numerous players. The most prominent of these players is the Sec translocon complex, a conserved protein-conducting channel present in the cytoplasmic membrane of bacteria and the membrane of the endoplasmic reticulum in eukaryotes. The last decade has seen tremendous leaps forward in our understanding of how insertion is managed by the translocon and its partners, coming from atomic-detailed structures, innovative experiments, and well-designed simulations. In this review, we discuss how experiments and simulations, hand-in-hand, teased out the secrets of the translocon-facilitated membrane insertion process. In particular, we focus on the role of free-energy calculations in elucidating membrane insertion. Amazingly, despite all its apparent complexity, protein insertion into membranes is primarily driven by simple thermodynamic and kinetic principles. This article is part of a Special Issue entitled: Membrane proteins edited by J.C. Gumbart and Sergei Noskov. Copyright © 2016 Elsevier B.V. All rights reserved.
Super elongation complex contains a TFIIF-related subcomplex
Knutson, Bruce A.; Smith, Marissa L.; Walker-Kopp, Nancy; Xu, Xia
2016-01-01
ABSTRACT Super elongation complex (SEC) belongs to a family of RNA polymerase II (Pol II) elongation factors that has similar properties as TFIIF, a general transcription factor that increases the transcription elongation rate by reducing pausing. Although SEC has TFIIF-like functional properties, it apparently lacks sequence and structural homology. Using HHpred, we find that SEC contains an evolutionarily related TFIIF-like subcomplex. We show that the SEC subunit ELL interacts with the Pol II Rbp2 subunit, as expected for a TFIIF-like factor. These findings suggest a new model for how SEC functions as a Pol II elongation factor and how it suppresses Pol II pausing. PMID:27223670
Templated sequence insertion polymorphisms in the human genome
NASA Astrophysics Data System (ADS)
Onozawa, Masahiro; Aplan, Peter
2016-11-01
Templated Sequence Insertion Polymorphism (TSIP) is a recently described form of polymorphism recognized in the human genome, in which a sequence that is templated from a distant genomic region is inserted into the genome, seemingly at random. TSIPs can be grouped into two classes based on nucleotide sequence features at the insertion junctions; Class 1 TSIPs show features of insertions that are mediated via the LINE-1 ORF2 protein, including 1) target-site duplication (TSD), 2) polyadenylation 10-30 nucleotides downstream of a “cryptic” polyadenylation signal, and 3) preference for insertion at a 5’-TTTT/A-3’ sequence. In contrast, class 2 TSIPs show features consistent with repair of a DNA double-strand break via insertion of a DNA “patch” that is derived from a distant genomic region. Survey of a large number of normal human volunteers demonstrates that most individuals have 25-30 TSIPs, and that these TSIPs track with specific geographic regions. Similar to other forms of human polymorphism, we suspect that these TSIPs may be important for the generation of human diversity and genetic diseases.
Landscape of Insertion Polymorphisms in the Human Genome
Onozawa, Masahiro; Goldberg, Liat; Aplan, Peter D.
2015-01-01
Nucleotide substitutions, small (<50 bp) insertions or deletions (indels), and large (>50 bp) deletions are well-known causes of genetic variation within the human genome. We recently reported a previously unrecognized form of polymorphic insertions, termed templated sequence insertion polymorphism (TSIP), in which the inserted sequence was templated from a distant genomic region, and was inserted in the genome through reverse transcription of an RNA intermediate. TSIPs can be grouped into two classes based on nucleotide sequence features at the insertion junctions; class 1 TSIPs show target site duplication, polyadenylation, and preference for insertion at a 5′-TTTT/A-3′ sequence, suggesting a LINE-1 based insertion mechanism, whereas class 2 TSIPs show features consistent with repair of a DNA double strand break by nonhomologous end joining. To gain a more complete picture of TSIPs throughout the human population, we evaluated whole-genome sequence from 52 individuals, and identified 171 TSIPs. Most individuals had 25–30 TSIPs, and common (present in >20% of individuals) TSIPs were found in individuals throughout the world, whereas rare TSIPs tended to cluster in specific geographic regions. The number of rare TSIPs was greater than the number of common TSIPs, suggesting that TSIP generation is an ongoing process. Intriguingly, mitochondrial sequences were a frequent template for class 2 insertions, used more commonly than any nuclear chromosome. Similar to single nucleotide polymorphisms and indels, we suspect that these TSIPs may be important for the generation of human diversity and genetic diseases, and can be useful in tracking historical migration of populations. PMID:25745018
Filtration Coefficient of the Axon Membrane As Measured with Hydrostatic and Osmotic Methods
Vargas, Fernando F.
1968-01-01
The hydraulic conductivity of the membranes surrounding the giant axon of the squid, Dosidicus gigas, was measured. In some axons the axoplasm was partially removed by suction. Perfusion was then established by insertion of a second pipette. In other axons the axoplasm was left intact and only one pipette was inserted. In both groups hydrostatic pressure was applied by means of a water column in a capillary manometer. Displacement of the meniscus in time gave the rate of fluid flowing across the axon sheath. In both groups osmotic differences across the membrane were established by the addition of a test molecule to the external medium which was seawater. The hydraulic conductivity determined by application of hydrostatic pressure was 10.6 ± 0.8.10-8 cm/sec cm H2O in perfused axons and 3.2 ± 0.6.10-8 cm/sec cm H2O in intact axons. When the driving force was an osmotic pressure gradient the conductivity was 4.5 ± 0.6 x 10-10 cm/sec cm H2O and 4.8 ± 0.9 x 10-10 cm/sec cm H2O in perfused and intact axons, respectively. A comparable result was found when the internal solution was made hyperosmotic. The fluid flow was a linear function of the hydrostatic pressure up to 70 cm of water. Glycerol outflux and membrane conductance were increased 1.6 and 1.1 times by the application of hydrostatic pressure. These increments do not give an explanation of the difference between the filtration coefficients. Other possible explanations are suggested and discussed. PMID:5642470
Otsuka, Sachio; Saiki, Jun
2016-02-01
Prior studies have shown that visual statistical learning (VSL) enhances familiarity (a type of memory) of sequences. How do statistical regularities influence the processing of each triplet element and inserted distractors that disrupt the regularity? Given that increased attention to triplets induced by VSL and inhibition of unattended triplets, we predicted that VSL would promote memory for each triplet constituent, and degrade memory for inserted stimuli. Across the first two experiments, we found that objects from structured sequences were more likely to be remembered than objects from random sequences, and that letters (Experiment 1) or objects (Experiment 2) inserted into structured sequences were less likely to be remembered than those inserted into random sequences. In the subsequent two experiments, we examined an alternative account for our results, whereby the difference in memory for inserted items between structured and random conditions is due to individuation of items within random sequences. Our findings replicated even when control letters (Experiment 3A) or objects (Experiment 3B) were presented before or after, rather than inserted into, random sequences. Our findings suggest that statistical learning enhances memory for each item in a regular set and impairs memory for items that disrupt the regularity. Copyright © 2015 Elsevier B.V. All rights reserved.
Characterization of GM events by insert knowledge adapted re-sequencing approaches
Yang, Litao; Wang, Congmao; Holst-Jensen, Arne; Morisset, Dany; Lin, Yongjun; Zhang, Dabing
2013-01-01
Detection methods and data from molecular characterization of genetically modified (GM) events are needed by stakeholders of public risk assessors and regulators. Generally, the molecular characteristics of GM events are incomprehensively revealed by current approaches and biased towards detecting transformation vector derived sequences. GM events are classified based on available knowledge of the sequences of vectors and inserts (insert knowledge). Herein we present three insert knowledge-adapted approaches for characterization GM events (TT51-1 and T1c-19 rice as examples) based on paired-end re-sequencing with the advantages of comprehensiveness, accuracy, and automation. The comprehensive molecular characteristics of two rice events were revealed with additional unintended insertions comparing with the results from PCR and Southern blotting. Comprehensive transgene characterization of TT51-1 and T1c-19 is shown to be independent of a priori knowledge of the insert and vector sequences employing the developed approaches. This provides an opportunity to identify and characterize also unknown GM events. PMID:24088728
Characterization of GM events by insert knowledge adapted re-sequencing approaches.
Yang, Litao; Wang, Congmao; Holst-Jensen, Arne; Morisset, Dany; Lin, Yongjun; Zhang, Dabing
2013-10-03
Detection methods and data from molecular characterization of genetically modified (GM) events are needed by stakeholders of public risk assessors and regulators. Generally, the molecular characteristics of GM events are incomprehensively revealed by current approaches and biased towards detecting transformation vector derived sequences. GM events are classified based on available knowledge of the sequences of vectors and inserts (insert knowledge). Herein we present three insert knowledge-adapted approaches for characterization GM events (TT51-1 and T1c-19 rice as examples) based on paired-end re-sequencing with the advantages of comprehensiveness, accuracy, and automation. The comprehensive molecular characteristics of two rice events were revealed with additional unintended insertions comparing with the results from PCR and Southern blotting. Comprehensive transgene characterization of TT51-1 and T1c-19 is shown to be independent of a priori knowledge of the insert and vector sequences employing the developed approaches. This provides an opportunity to identify and characterize also unknown GM events.
The evolution processes of DNA sequences, languages and carols
NASA Astrophysics Data System (ADS)
Hauck, Jürgen; Henkel, Dorothea; Mika, Klaus
2001-04-01
The sequences of bases A, T, C and G of about 100 enolase, secA and cytochrome DNA were analyzed for attractive or repulsive interactions by the numbers T 1,T 2,T 3; r of nearest, next-nearest and third neighbor bases of the same kind and the concentration r=other bases/analyzed base. The area of possible T1, T2 values is limited by the linear borders T 2=2T 1-2, T 2=0 or T1=0 for clustering, attractive or repulsive interactions and the border T2=-2 T1+2(2- r) for a variation from repulsive to attractive interactions at r⩽2. Clustering is preferred by most bases in sequences of enolases and secA’ s. Major deviations with repulsive interactions of some bases are observed for archaea bacteria in secA and for highly developed animals and the human species in enolase sequences. The borders of the structure map for enthalpy stabilized structures with maximum interactions are approached in few cases. Most letters of the natural languages and some music notes are at the borders of the structure map.
Onozawa, Masahiro; Zhang, Zhenhua; Kim, Yoo Jung; Goldberg, Liat; Varga, Tamas; Bergsagel, P Leif; Kuehl, W Michael; Aplan, Peter D
2014-05-27
We used the I-SceI endonuclease to produce DNA double-strand breaks (DSBs) and observed that a fraction of these DSBs were repaired by insertion of sequences, which we termed "templated sequence insertions" (TSIs), derived from distant regions of the genome. These TSIs were derived from genic, retrotransposon, or telomere sequences and were not deleted from the donor site in the genome, leading to the hypothesis that they were derived from reverse-transcribed RNA. Cotransfection of RNA and an I-SceI expression vector demonstrated insertion of RNA-derived sequences at the DNA-DSB site, and TSIs were suppressed by reverse-transcriptase inhibitors. Both observations support the hypothesis that TSIs were derived from RNA templates. In addition, similar insertions were detected at sites of DNA DSBs induced by transcription activator-like effector nuclease proteins. Whole-genome sequencing of myeloma cell lines revealed additional TSIs, demonstrating that repair of DNA DSBs via insertion was not restricted to experimentally produced DNA DSBs. Analysis of publicly available databases revealed that many of these TSIs are polymorphic in the human genome. Taken together, these results indicate that insertional events should be considered as alternatives to gross chromosomal rearrangements in the interpretation of whole-genome sequence data and that this mutagenic form of DNA repair may play a role in genetic disease, exon shuffling, and mammalian evolution.
Fang, H; Green, N
1994-01-01
The sec71-1 and sec72-1 mutations were identified by a genetic assay that monitored membrane protein integration into the endoplasmic reticulum (ER) membrane of the yeast Saccharomyces cerevisiae. The mutations inhibited integration of various chimeric membrane proteins and translocation of a subset of water soluble proteins. In this paper we show that SEC71 encodes the 31.5-kDa transmembrane glycoprotein (p31.5) and SEC72 encodes the 23-kDa protein (p23) of the Sec63p-BiP complex. SEC71 is therefore identical to SEC66 (HSS1), which was previously shown to encode p31.5. DNA sequence analyses reveal that sec71-1 cells contain a nonsense mutation that removes approximately two-thirds of the cytoplasmic C-terminal domain of p31.5. The sec72-1 mutation shifts the reading frame of the gene encoding p23. Unexpectedly, the sec71-1 mutant lacks p31.5 and p23. Neither mutation is lethal, although sec71-1 cells exhibit a growth defect at 37 degrees C. These results show that p31.5 and p23 are important for the trafficking of a subset of proteins to the ER membrane. Images PMID:7841522
Prediction of the translocon-mediated membrane insertion free energies of protein sequences.
Park, Yungki; Helms, Volkhard
2008-05-15
Helical membrane proteins (HMPs) play crucial roles in a variety of cellular processes. Unlike water-soluble proteins, HMPs need not only to fold but also get inserted into the membrane to be fully functional. This process of membrane insertion is mediated by the translocon complex. Thus, it is of great interest to develop computational methods for predicting the translocon-mediated membrane insertion free energies of protein sequences. We have developed Membrane Insertion (MINS), a novel sequence-based computational method for predicting the membrane insertion free energies of protein sequences. A benchmark test gives a correlation coefficient of 0.74 between predicted and observed free energies for 357 known cases, which corresponds to a mean unsigned error of 0.41 kcal/mol. These results are significantly better than those obtained by traditional hydropathy analysis. Moreover, the ability of MINS to reasonably predict membrane insertion free energies of protein sequences allows for effective identification of transmembrane (TM) segments. Subsequently, MINS was applied to predict the membrane insertion free energies of 316 TM segments found in known structures. An in-depth analysis of the predicted free energies reveals a number of interesting findings about the biogenesis and structural stability of HMPs. A web server for MINS is available at http://service.bioinformatik.uni-saarland.de/mins
Rajapandi, T.; Oliver, D.
1994-01-01
Complementation analysis of the ssaD1 mutation, isolated as a suppressor of the secA51(Ts) mutation that renders growth of Escherichia coli cold sensitive, was used to show that ssaD corresponds to nusB, a gene known to be important in transcription antitermination. DNA sequence analysis of the ssaD1 allele showed that it creates an amber mutation in the 15th codon of nusB. Analysis of the effect of different levels of NusB protein on secA transcription and translation suggested that NusB plays little or no role in the control of secA expression. Accordingly, mechanisms by which nusB inactivation can lead to suppression of secA51(Ts) and secY24(Ts) mutations without affecting secA expression need to be considered. PMID:8021230
Khoriaty, Rami; Everett, Lesley; Chase, Jennifer; Zhu, Guojing; Hoenerhoff, Mark; McKnight, Brooke; Vasievich, Matthew P.; Zhang, Bin; Tomberg, Kärt; Williams, John; Maillard, Ivan; Ginsburg, David
2016-01-01
In humans, loss of function mutations in SEC23B result in Congenital Dyserythropoietic Anemia type II (CDAII), a disease limited to defective erythroid development. Patients with two nonsense SEC23B mutations have not been reported, suggesting that complete SEC23B deficiency might be lethal. We previously reported that SEC23B-deficient mice die perinatally, exhibiting massive pancreatic degeneration and that mice with hematopoietic SEC23B deficiency do not exhibit CDAII. We now show that SEC23B deficiency restricted to the pancreas is sufficient to explain the lethality observed in mice with global SEC23B-deficiency. Immunohistochemical stains demonstrate an acinar cell defect but normal islet cells. Mammalian genomes contain two Sec23 paralogs, Sec23A and Sec23B. The encoded proteins share ~85% amino acid sequence identity. We generate mice with pancreatic SEC23A deficiency and demonstrate that these mice survive normally, exhibiting normal pancreatic weights and histology. Taken together, these data demonstrate that SEC23B but not SEC23A is essential for murine pancreatic development. We also demonstrate that two BAC transgenes spanning Sec23b rescue the lethality of mice homozygous for a Sec23b gene trap allele, excluding a passenger gene mutation as the cause of the pancreatic lethality, and indicating that the regulatory elements critical for Sec23b pancreatic function reside within the BAC transgenes. PMID:27297878
Sauvageau, Anny; LaHarpe, Romano; Geberth, Vernon J
2010-09-01
It has been proposed that filmed hangings may hold the key to a better understanding of human asphyxia, and The Working Group on Human Asphyxia was formed to systematically review and compare these video recordings. This study analyzed eight filmed hangings. Considering time 0 to represent the onset of the final hanging, rapid loss of consciousness was observed (at 8-18 sec), closely followed by convulsions (at 10-19 sec). A complex pattern of decerebrate rigidity and decorticate rigidity then followed. Between 1 min 38 sec and 2 min 15 sec, muscle tone seemed to be lost, the body becoming progressively flaccid. From then on, isolated body movements were observed from time to time, the last one occurring between 1 min 2 sec and 7 min 31 sec. As for the respiratory responses, all cases presented deep rhythmic abdominal respiratory movements (last one between 1 min 2 sec and 2 min 5 sec). © 2010 American Academy of Forensic Sciences.
Zhu, Meiqin; Yu, Jian; Zhou, Changlin; Fang, Hongqing
2016-01-01
Red-based recombineering has been widely used in Escherichia coli genome modification through electroporating PCR fragments into electrocompetent cells to replace target sequences. Some mutations in the PCR fragments may be brought into the homologous regions near the target. To solve this problem in markeless gene deletion we developed a novel method characterized with two-step recombination and a donor plasmid. First, generated by PCR a linear DNA cassette which comprises a I-Sec I site-containing marker gene and homologous arms was electroporated into cells for marker-substitution deletion of the target sequence. Second, after a donor plasmid carrying the I-Sec I site-containing fusion homologous arm was chemically transformed into the marker-containing cells, the fusion arms and the marker was simultaneously cleaved by I-Sec I endonuclease and the marker-free deletion was stimulated by double-strand break-mediated intermolecular recombination. Eleven nonessential regions in E. coli DH1 genome were sequentially deleted by our method, resulting in a 10.59% reduced genome size. These precise deletions were also verified by PCR sequencing and genome resequencing. Though no change in the growth rate on the minimal medium, we found the genome-reduced strains have some alteration in the acid resistance and for the synthesis of lycopene.
75 FR 40763 - Federal Management Regulation; Sale of Personal Property
Federal Register 2010, 2011, 2012, 2013, 2014
2010-07-14
... Sec. Sec. 102- 38.365 and 102-38.370 must report quarterly sales performance measures to the GSA...; Sequence 1] RIN 3090-AJ04 Federal Management Regulation; Sale of Personal Property AGENCY: Office of... the sale of personal property through Federal Asset Sales (FAS) Sales Centers. DATES: Interested...
Sanchez-Luque, Francisco J; Richardson, Sandra R; Faulkner, Geoffrey J
2016-01-01
Mobile genetic elements (MGEs) are of critical importance in genomics and developmental biology. Polymorphic and somatic MGE insertions have the potential to impact the phenotype of an individual, depending on their genomic locations and functional consequences. However, the identification of polymorphic and somatic insertions among the plethora of copies residing in the genome presents a formidable technical challenge. Whole genome sequencing has the potential to address this problem; however, its efficacy depends on the abundance of cells carrying the new insertion. Robust detection of somatic insertions present in only a subset of cells within a given sample can also be prohibitively expensive due to a requirement for high sequencing depth. Here, we describe retrotransposon capture sequencing (RC-seq), a sequence capture approach in which Illumina libraries are enriched for fragments containing the 5' and 3' termini of specific MGEs. RC-seq allows the detection of known polymorphic insertions present in an individual, as well as the identification of rare or private germline insertions not previously described. Furthermore, RC-seq can be used to detect and characterize somatic insertions, providing a valuable tool to elucidate the extent and characteristics of MGE activity in healthy tissues and in various disease states.
Analysis of the Isolated SecA DEAD Motor Suggests a Mechanism for Chemical-Mechanical Coupling
DOE Office of Scientific and Technical Information (OSTI.GOV)
Nithianantham, Stanley; Shilton, Brian H
The preprotein cross-linking domain and C-terminal domains of Escherichia coli SecA were removed to create a minimal DEAD motor, SecA-DM. SecA-DM hydrolyzes ATP and has the same affinity for ADP as full-length SecA. The crystal structure of SecA-DM in complex with ADP was solved and shows the DEAD motor in a closed conformation. Comparison with the structure of the E. coli DEAD motor in an open conformation (Protein Data Bank ID 2FSI) indicates main-chain conformational changes in two critical sequences corresponding to Motif III and Motif V of the DEAD helicase family. The structures that the Motif III and Motifmore » V sequences adopt in the DEAD motor open conformation are incompatible with the closed conformation. Therefore, when the DEAD motor makes the transition from open to closed, Motif III and Motif V are forced to change their conformations, which likely functions to regulate passage through the transition state for ATP hydrolysis. The transition state for ATP hydrolysis for the SecA DEAD motor was modeled based on the conformation of the Vasa helicase in complex with adenylyl imidodiphosphate and RNA (Protein Data Bank ID 2DB3). A mechanism for chemical-mechanical coupling emerges, where passage through the transition state for ATP hydrolysis is hindered by the conformational changes required in Motif III and Motif V, and may be promoted by binding interactions with the preprotein substrate and/or other translocase domains and subunits.« less
Analysis of the Isolated SecA DEAD Motor Suggests a Mechanism for Chemical-Mechanical Coupling
DOE Office of Scientific and Technical Information (OSTI.GOV)
Nithianantham, Stanley; Shilton, Brian H
2011-09-28
The preprotein cross-linking domain and C-terminal domains of Escherichia coli SecA were removed to create a minimal DEAD motor, SecA-DM. SecA-DM hydrolyzes ATP and has the same affinity for ADP as full-length SecA. The crystal structure of SecA-DM in complex with ADP was solved and shows the DEAD motor in a closed conformation. Comparison with the structure of the E. coli DEAD motor in an open conformation (Protein Data Bank ID 2FSI) indicates main-chain conformational changes in two critical sequences corresponding to Motif III and Motif V of the DEAD helicase family. The structures that the Motif III and Motifmore » V sequences adopt in the DEAD motor open conformation are incompatible with the closed conformation. Therefore, when the DEAD motor makes the transition from open to closed, Motif III and Motif V are forced to change their conformations, which likely functions to regulate passage through the transition state for ATP hydrolysis. The transition state for ATP hydrolysis for the SecA DEAD motor was modeled based on the conformation of the Vasa helicase in complex with adenylyl imidodiphosphate and RNA (Protein Data Bank ID 2DB3). A mechanism for chemical-mechanical coupling emerges, where passage through the transition state for ATP hydrolysis is hindered by the conformational changes required in Motif III and Motif V, and may be promoted by binding interactions with the preprotein substrate and/or other translocase domains and subunits.« less
Schouten, Henk J; Vande Geest, Henri; Papadimitriou, Sofia; Bemer, Marian; Schaart, Jan G; Smulders, Marinus J M; Perez, Gabino Sanchez; Schijlen, Elio
2017-03-01
Transformation resulted in deletions and translocations at T-DNA inserts, but not in genome-wide small mutations. A tiny T-DNA splinter was detected that probably would remain undetected by conventional techniques. We investigated to which extent Agrobacterium tumefaciens-mediated transformation is mutagenic, on top of inserting T-DNA. To prevent mutations due to in vitro propagation, we applied floral dip transformation of Arabidopsis thaliana. We re-sequenced the genomes of five primary transformants, and compared these to genomic sequences derived from a pool of four wild-type plants. By genome-wide comparisons, we identified ten small mutations in the genomes of the five transgenic plants, not correlated to the positions or number of T-DNA inserts. This mutation frequency is within the range of spontaneous mutations occurring during seed propagation in A. thaliana, as determined earlier. In addition, we detected small as well as large deletions specifically at the T-DNA insert sites. Furthermore, we detected partial T-DNA inserts, one of these a tiny 50-bp fragment originating from a central part of the T-DNA construct used, inserted into the plant genome without flanking other T-DNA. Because of its small size, we named this fragment a T-DNA splinter. As far as we know this is the first report of such a small T-DNA fragment insert in absence of any T-DNA border sequence. Finally, we found evidence for translocations from other chromosomes, flanking T-DNA inserts. In this study, we showed that next-generation sequencing (NGS) is a highly sensitive approach to detect T-DNA inserts in transgenic plants.
Using PATIMDB to Create Bacterial Transposon Insertion Mutant Libraries
Urbach, Jonathan M.; Wei, Tao; Liberati, Nicole; Grenfell-Lee, Daniel; Villanueva, Jacinto; Wu, Gang; Ausubel, Frederick M.
2015-01-01
PATIMDB is a software package for facilitating the generation of transposon mutant insertion libraries. The software has two main functions: process tracking and automated sequence analysis. The process tracking function specifically includes recording the status and fates of multiwell plates and samples in various stages of library construction. Automated sequence analysis refers specifically to the pipeline of sequence analysis starting with ABI files from a sequencing facility and ending with insertion location identifications. The protocols in this unit describe installation and use of PATIMDB software. PMID:19343706
Fabry-Perot Observations of Comet Hale-Bopp H_2O(+) Velocity Fields
NASA Astrophysics Data System (ADS)
Roesler, F. L.; Klinglesmith, D. A., III; Scherb, F.; Mierkiewicz, E. J.; Oliversen, R. J.
1997-07-01
We have obtained Doppler-sliced images of H_2O(+) emission from Comet Hale-Bopp, using a 15-cm, dual-etalon, Fabry-Perot/CCD imaging spectrometer at the McMath-Pierce 0.8-meter west auxiliary telescope of the National Solar Observatory on Kitt Peak. The 6-arcmin field of view was centered on the comet nucleus, and the spectral resolution was 0.4 Angstroms (20km/sec). The observations consisted of ``data cubes,'' i.e., a sequence of images of the 6158 Angstroms emission doublet at velocity steps of 12.5 or 25km/sec, covering a range from -75km/sec to +75km/sec in the comet reference frame. We were able to follow the comet for 1 to 1(1/_2) hours each clear night. We obtained useable data cubes on at least ten nights between February 25 and April 16. These data are being examined to investigate the comet-solar wind interaction. We will present both still images and time-lapse movies showing sequences of ion velocities and accelerations on the plane of the sky.
Kleinboelting, Nils; Huep, Gunnar; Weisshaar, Bernd
2017-01-01
SimpleSearch provides access to a database containing information about T-DNA insertion lines of the GABI-Kat collection of Arabidopsis thaliana mutants. These mutants are an important tool for reverse genetics, and GABI-Kat is the second largest collection of such T-DNA insertion mutants. Insertion sites were deduced from flanking sequence tags (FSTs), and the database contains information about mutant plant lines as well as insertion alleles. Here, we describe improvements within the interface (available at http://www.gabi-kat.de/db/genehits.php) and with regard to the database content that have been realized in the last five years. These improvements include the integration of the Araport11 genome sequence annotation data containing the recently updated A. thaliana structural gene descriptions, an updated visualization component that displays groups of insertions with very similar insertion positions, mapped confirmation sequences, and primers. The visualization component provides a quick way to identify insertions of interest, and access to improved data about the exact structure of confirmed insertion alleles. In addition, the database content has been extended by incorporating additional insertion alleles that were detected during the confirmation process, as well as by adding new FSTs that have been produced during continued efforts to complement gaps in FST availability. Finally, the current database content regarding predicted and confirmed insertion alleles as well as primer sequences has been made available as downloadable flat files. © The Author 2016. Published by Oxford University Press on behalf of Japanese Society of Plant Physiologists.
“Agrolistic” transformation of plant cells: Integration of T-strands generated in planta
Hansen, Geneviève; Chilton, Mary-Dell
1996-01-01
We describe a novel plant transformation technique, termed “agrolistic,” that combines the advantages of the Agrobacterium transformation system with the high efficiency of biolistic DNA delivery. Agrolistic transformation allows integration of the gene of interest without undesired vector sequence. The virulence genes virD1 and virD2 from Agrobacterium tumefaciens that are required in bacteria for excision of T-strands from the tumor-inducing plasmid were placed under the control of the CaMV35S promoter and codelivered with a target plasmid containing border sequences flanking the gene of interest. Transient expression assays in tobacco and in maize cells indicated that vir gene products caused strand-specific nicking in planta at the right border sequence, similar to VirD1/VirD2-catalyzed T-strand excision observed in Agrobacterium. Agrolistically transformed tobacco calli were obtained after codelivery of virD1 and virD2 genes together with a selectable marker flanked by border sequences. Some inserts exhibited right junctions with plant DNA that corresponded precisely to the sequence expected for T-DNA (portion of the tumor-inducing plasmid that is transferred to plant cells) insertion events. We designate these as “agrolistic” inserts, as distinguished from “biolistic” inserts. Both types of inserts were found in some transformed lines. The frequency of agrolistic inserts was 20% that of biolistic inserts. PMID:8962167
Nascent chain-monitored remodeling of the Sec machinery for salinity adaptation of marine bacteria
Ishii, Eiji; Chiba, Shinobu; Hashimoto, Narimasa; Kojima, Seiji; Homma, Michio; Ito, Koreaki; Akiyama, Yoshinori; Mori, Hiroyuki
2015-01-01
SecDF interacts with the SecYEG translocon in bacteria and enhances protein export in a proton-motive-force-dependent manner. Vibrio alginolyticus, a marine-estuarine bacterium, contains two SecDF paralogs, V.SecDF1 and V.SecDF2. Here, we show that the export-enhancing function of V.SecDF1 requires Na+ instead of H+, whereas V.SecDF2 is Na+-independent, presumably requiring H+. In accord with the cation-preference difference, V.SecDF2 was only expressed under limited Na+ concentrations whereas V.SecDF1 was constitutive. However, it is not the decreased concentration of Na+ per se that the bacterium senses to up-regulate the V.SecDF2 expression, because marked up-regulation of the V.SecDF2 synthesis was observed irrespective of Na+ concentrations under certain genetic/physiological conditions: (i) when the secDF1VA gene was deleted and (ii) whenever the Sec export machinery was inhibited. VemP (Vibrio export monitoring polypeptide), a secretory polypeptide encoded by the upstream ORF of secDF2VA, plays the primary role in this regulation by undergoing regulated translational elongation arrest, which leads to unfolding of the Shine–Dalgarno sequence for translation of secDF2VA. Genetic analysis of V. alginolyticus established that the VemP-mediated regulation of SecDF2 is essential for the survival of this marine bacterium in low-salinity environments. These results reveal that a class of marine bacteria exploits nascent-chain ribosome interactions to optimize their protein export pathways to propagate efficiently under different ionic environments that they face in their life cycles. PMID:26392525
In vitro membrane protein synthesis inside Sec translocon-reconstituted cell-sized liposomes
Ohta, Naoki; Kato, Yasuhiko; Watanabe, Hajime; Mori, Hirotada; Matsuura, Tomoaki
2016-01-01
Protein synthesis using an in vitro transcription-translation system (IVTT) inside cell-sized liposomes has become a valuable tool to study the properties of biological systems under cell-mimicking conditions. However, previous liposome systems lacked the machinery for membrane protein translocation. Here, we reconstituted the translocon consisting of SecYEG from Escherichia coli inside cell-sized liposomes. The cell-sized liposomes also carry the reconstituted IVTT, thereby providing a cell-mimicking environment for membrane protein synthesis. By using EmrE, a multidrug transporter from E. coli, as a model membrane protein, we found that both the amount and activity of EmrE synthesized inside the liposome is increased approximately three-fold by incorporating the Sec translocon. The topological change of EmrE induced by the translocon was also identified. The membrane integration of 6 out of 9 E. coli inner membrane proteins that was tested was increased by incorporation of the translocon. By introducing the Sec translocon, the membrane integration efficiency of the membrane protein of interest was increased, and enabled the integration of membrane proteins that otherwise cannot be inserted. In addition, this work represents an essential step toward the construction of an artificial cell through a bottom-up approach. PMID:27808179
NASA Astrophysics Data System (ADS)
Borot de Battisti, M.; de Senneville, B. Denis; Hautvast, G.; Binnekamp, D.; Lagendijk, J. J. W.; Maenhout, M.; Moerland, M. A.
2017-05-01
MR-guided high-dose-rate (HDR) brachytherapy has gained increasing interest as a treatment for patients with localized prostate cancer because of the superior value of MRI for tumor and surrounding tissues localization. To enable needle insertion into the prostate with the patient in the MR bore, a single needle MR-compatible robotic system involving needle-by-needle dose delivery has been developed at our institution. Throughout the intervention, dose delivery may be impaired by: (1) sub-optimal needle positioning caused by e.g. needle bending, (2) intra-operative internal organ motion such as prostate rotations or swelling, or intra-procedural rectum or bladder filling. This may result in failure to reach clinical constraints. To assess the first aforementioned challenge, a recent study from our research group demonstrated that the deposited dose may be greatly improved by real-time adaptive planning with feedback on the actual needle positioning. However, the needle insertion sequence is left to the doctor and therefore, this may result in sub-optimal dose delivery. In this manuscript, a new method is proposed to determine and update automatically the needle insertion sequence. This strategy is based on the determination of the most sensitive needle track. The sensitivity of a needle track is defined as its impact on the dose distribution in case of sub-optimal positioning. A stochastic criterion is thus presented to determine each needle track sensitivity based on needle insertion simulations. To assess the proposed sequencing strategy, HDR prostate brachytherapy was simulated on 11 patients with varying number of needle insertions. Sub-optimal needle positioning was simulated at each insertion (modeled by typical random angulation errors). In 91% of the scenarios, the dose distribution improved when the needle was inserted into the most compared to the least sensitive needle track. The computation time for sequencing was less than 6 s per needle track. The proposed needle insertion sequencing can therefore assist in delivering an optimal dose in HDR prostate brachytherapy.
Aschard, Hugues; Cattoir, Vincent; Yoder-Himes, Deborah; Lory, Stephen; Pier, Gerald B.
2013-01-01
High-throughput sequencing of transposon (Tn) libraries created within entire genomes identifies and quantifies the contribution of individual genes and operons to the fitness of organisms in different environments. We used insertion-sequencing (INSeq) to analyze the contribution to fitness of all non-essential genes in the chromosome of Pseudomonas aeruginosa strain PA14 based on a library of ∼300,000 individual Tn insertions. In vitro growth in LB provided a baseline for comparison with the survival of the Tn insertion strains following 6 days of colonization of the murine gastrointestinal tract as well as a comparison with Tn-inserts subsequently able to systemically disseminate to the spleen following induction of neutropenia. Sequencing was performed following DNA extraction from the recovered bacteria, digestion with the MmeI restriction enzyme that hydrolyzes DNA 16 bp away from the end of the Tn insert, and fractionation into oligonucleotides of 1,200–1,500 bp that were prepared for high-throughput sequencing. Changes in frequency of Tn inserts into the P. aeruginosa genome were used to quantify in vivo fitness resulting from loss of a gene. 636 genes had <10 sequencing reads in LB, thus defined as unable to grow in this medium. During in vivo infection there were major losses of strains with Tn inserts in almost all known virulence factors, as well as respiration, energy utilization, ion pumps, nutritional genes and prophages. Many new candidates for virulence factors were also identified. There were consistent changes in the recovery of Tn inserts in genes within most operons and Tn insertions into some genes enhanced in vivo fitness. Strikingly, 90% of the non-essential genes were required for in vivo survival following systemic dissemination during neutropenia. These experiments resulted in the identification of the P. aeruginosa strain PA14 genes necessary for optimal survival in the mucosal and systemic environments of a mammalian host. PMID:24039572
Ulrich, Alexander; Andersen, Kasper R.; Schwartz, Thomas U.
2012-01-01
We present a fast, reliable and inexpensive restriction-free cloning method for seamless DNA insertion into any plasmid without sequence limitation. Exponential megapriming PCR (EMP) cloning requires two consecutive PCR steps and can be carried out in one day. We show that EMP cloning has a higher efficiency than restriction-free (RF) cloning, especially for long inserts above 2.5 kb. EMP further enables simultaneous cloning of multiple inserts. PMID:23300917
Ulrich, Alexander; Andersen, Kasper R; Schwartz, Thomas U
2012-01-01
We present a fast, reliable and inexpensive restriction-free cloning method for seamless DNA insertion into any plasmid without sequence limitation. Exponential megapriming PCR (EMP) cloning requires two consecutive PCR steps and can be carried out in one day. We show that EMP cloning has a higher efficiency than restriction-free (RF) cloning, especially for long inserts above 2.5 kb. EMP further enables simultaneous cloning of multiple inserts.
Dunn, R. C.; Laurie, C. C.
1995-01-01
Variation in the DNA sequence and level of alcohol dehydrogenase (Adh) gene expression in Drosophila melanogaster have been studied to determine what types of DNA polymorphisms contribute to phenotypic variation in natural populations. The Adh gene, like many others, shows a high level of variability in both DNA sequence and quantitative level of expression. A number of transposable element insertions occur in the Adh region and one of these, a copia insertion in the 5' flanking region, is associated with unusually low Adh expression. To determine whether this insertion (called RI42) causes the low expression level, the insertion was excised from the cloned RI42 Adh gene and the effect was assessed by P-element transformation. Removal of this insertion causes a threefold increase in the level of ADH, clearly showing that it contributes to the naturally occurring variation in expression at this locus. Removal of all but one LTR also causes a threefold increase, indicating that the mechanism is not a simple sequence disruption. Furthermore, this copia insertion, which is located between the two Adh promoters and their upstream enhancer sequences, has differential effects on the levels of proximal and distal transcripts. Finally, a test for the possible modifying effects of two suppressor loci, su(w(a)) and su(f), on this insertional mutation was negative, in contrast to a previous report in the literature. PMID:7498745
Identifying transposon insertions and their effects from RNA-sequencing data.
de Ruiter, Julian R; Kas, Sjors M; Schut, Eva; Adams, David J; Koudijs, Marco J; Wessels, Lodewyk F A; Jonkers, Jos
2017-07-07
Insertional mutagenesis using engineered transposons is a potent forward genetic screening technique used to identify cancer genes in mouse model systems. In the analysis of these screens, transposon insertion sites are typically identified by targeted DNA-sequencing and subsequently assigned to predicted target genes using heuristics. As such, these approaches provide no direct evidence that insertions actually affect their predicted targets or how transcripts of these genes are affected. To address this, we developed IM-Fusion, an approach that identifies insertion sites from gene-transposon fusions in standard single- and paired-end RNA-sequencing data. We demonstrate IM-Fusion on two separate transposon screens of 123 mammary tumors and 20 B-cell acute lymphoblastic leukemias, respectively. We show that IM-Fusion accurately identifies transposon insertions and their true target genes. Furthermore, by combining the identified insertion sites with expression quantification, we show that we can determine the effect of a transposon insertion on its target gene(s) and prioritize insertions that have a significant effect on expression. We expect that IM-Fusion will significantly enhance the accuracy of cancer gene discovery in forward genetic screens and provide initial insight into the biological effects of insertions on candidate cancer genes. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.
Liu, Ruifang; Koyanagi, Kanako O; Chen, Sunlu; Kishima, Yuji
2012-12-01
In plant genomes, the incorporation of DNA segments is not a common method of artificial gene transfer. Nevertheless, various segments of pararetroviruses have been found in plant genomes in recent decades. The rice genome contains a number of segments of endogenous rice tungro bacilliform virus-like sequences (ERTBVs), many of which are present between AT dinucleotide repeats (ATrs). Comparison of genomic sequences between two closely related rice subspecies, japonica and indica, allowed us to verify the preferential insertion of ERTBVs into ATrs. In addition to ERTBVs, the comparative analyses showed that ATrs occasionally incorporate repeat sequences including transposable elements, and a wide range of other sequences. Besides the known genomic sequences, the insertion sequences also represented DNAs of unclear origins together with ERTBVs, suggesting that ATrs have integrated episomal DNAs that would have been suspended in the nucleus. Such insertion DNAs might be trapped by ATrs in the genome in a host-dependent manner. Conversely, other simple mono- and dinucleotide sequence repeats (SSR) were less frequently involved in insertion events relative to ATrs. Therefore, ATrs could be regarded as hot spots of double-strand breaks that induce non-homologous end joining. The insertions within ATrs occasionally generated new gene-related sequences or involved structural modifications of existing genes. Likewise, in a comparison between Arabidopsis thaliana and Arabidopsis lyrata, the insertions preferred ATrs to other SSRs. Therefore ATrs in plant genomes could be considered as genomic dumping sites that have trapped various DNA molecules and may have exerted a powerful evolutionary force. © 2012 The Authors. The Plant Journal © 2012 Blackwell Publishing Ltd.
Pick, Joseph E; Khatri, Latika; Sathler, Matheus F; Ziff, Edward B
2017-01-17
mGluR long-term depression (mGluR-LTD) is a form of synaptic plasticity induced at excitatory synapses by metabotropic glutamate receptors (mGluRs). mGluR-LTD reduces synaptic strength and is relevant to learning and memory, autism, and sensitization to cocaine; however, the mechanism is not known. Here we show that activation of Group I mGluRs in medium spiny neurons induces trafficking of GluA2 from the endoplasmic reticulum (ER) to the synapse by enhancing GluA2 binding to essential COPII vesicle proteins, Sec23 and Sec13. GluA2 exit from the ER further depends on IP3 and Ryanodine receptor-controlled Ca 2+ release as well as active translation. Synaptic insertion of GluA2 is coupled to removal of high-conducting Ca 2+ -permeable AMPA receptors from synapses, resulting in synaptic depression. This work demonstrates a novel mechanism in which mGluR signals release AMPA receptors rapidly from the ER and couple ER release to GluA2 synaptic insertion and GluA1 removal. © 2016 The Authors.
Horta-Valerdi, Guillermo; Sanchez-Alonso, Maria Patricia; Perez-Marquez, Victor M; Negrete-Abascal, Erasmo; Vaca-Pacheco, Sergio; Hernandez-Gonzalez, Ismael; Gomez-Lunar, Zulema; Olmedo-Álvarez, Gabriela; Vázquez-Cruz, Candelario
2017-04-13
The draft genome sequence of Avibacterium paragallinarum strain CL serovar C is reported here. The genome comprises 154 contigs corresponding to 2.4 Mb with 41% G+C content and many insertion sequence (IS) elements, a characteristic not previously reported in A. paragallinarum . Copyright © 2017 Horta-Valerdi et al.
Morozumi, Takeya; Toki, Daisuke; Eguchi-Ogawa, Tomoko; Uenishi, Hirohide
2011-09-01
Large-scale cDNA-sequencing projects require an efficient strategy for mass sequencing. Here we describe a method for sequencing pooled cDNA clones using a combination of transposon insertion and Gateway technology. Our method reduces the number of shotgun clones that are unsuitable for reconstruction of cDNA sequences, and has the advantage of reducing the total costs of the sequencing project.
High-Throughput Analysis of T-DNA Location and Structure Using Sequence Capture.
Inagaki, Soichi; Henry, Isabelle M; Lieberman, Meric C; Comai, Luca
2015-01-01
Agrobacterium-mediated transformation of plants with T-DNA is used both to introduce transgenes and for mutagenesis. Conventional approaches used to identify the genomic location and the structure of the inserted T-DNA are laborious and high-throughput methods using next-generation sequencing are being developed to address these problems. Here, we present a cost-effective approach that uses sequence capture targeted to the T-DNA borders to select genomic DNA fragments containing T-DNA-genome junctions, followed by Illumina sequencing to determine the location and junction structure of T-DNA insertions. Multiple probes can be mixed so that transgenic lines transformed with different T-DNA types can be processed simultaneously, using a simple, index-based pooling approach. We also developed a simple bioinformatic tool to find sequence read pairs that span the junction between the genome and T-DNA or any foreign DNA. We analyzed 29 transgenic lines of Arabidopsis thaliana, each containing inserts from 4 different T-DNA vectors. We determined the location of T-DNA insertions in 22 lines, 4 of which carried multiple insertion sites. Additionally, our analysis uncovered a high frequency of unconventional and complex T-DNA insertions, highlighting the needs for high-throughput methods for T-DNA localization and structural characterization. Transgene insertion events have to be fully characterized prior to use as commercial products. Our method greatly facilitates the first step of this characterization of transgenic plants by providing an efficient screen for the selection of promising lines.
Itskov, Vladimir; Curto, Carina; Pastalkova, Eva; Buzsáki, György
2011-01-01
Hippocampal neurons can display reliable and long-lasting sequences of transient firing patterns, even in the absence of changing external stimuli. We suggest that time-keeping is an important function of these sequences, and propose a network mechanism for their generation. We show that sequences of neuronal assemblies recorded from rat hippocampal CA1 pyramidal cells can reliably predict elapsed time (15-20 sec) during wheel running with a precision of 0.5sec. In addition, we demonstrate the generation of multiple reliable, long-lasting sequences in a recurrent network model. These sequences are generated in the presence of noisy, unstructured inputs to the network, mimicking stationary sensory input. Identical initial conditions generate similar sequences, whereas different initial conditions give rise to distinct sequences. The key ingredients responsible for sequence generation in the model are threshold-adaptation and a Mexican-hat-like pattern of connectivity among pyramidal cells. This pattern may arise from recurrent systems such as the hippocampal CA3 region or the entorhinal cortex. We hypothesize that mechanisms that evolved for spatial navigation also support tracking of elapsed time in behaviorally relevant contexts. PMID:21414904
Argemi, Xavier; Nanoukon, Chimène; Affolabi, Dissou; Keller, Daniel; Hansmann, Yves; Riegel, Philippe; Baba-Moussa, Lamine; Prévost, Gilles
2018-02-25
Staphylococcus epidermidis is a leading cause of nosocomial infections, majorly resistant to beta-lactam antibiotics, and may transfer several mobile genetic elements among the members of its own species, as well as to Staphylococcus aureus ; however, a genetic exchange from S. aureus to S. epidermidis remains controversial. We recently identified two pathogenic clinical strains of S. epidermidis that produce a staphylococcal enterotoxin C3-like (SEC) similar to that by S. aureus pathogenicity islands. This study aimed to determine the genetic environment of the SEC-coding sequence and to identify the mobile genetic elements. Whole-genome sequencing and annotation of the S. epidermidis strains were performed using Illumina technology and a bioinformatics pipeline for assembly, which provided evidence that the SEC-coding sequences were located in a composite pathogenicity island that was previously described in the S. epidermidis strain FRI909, called SePI-1/SeCI-1, with 83.8-89.7% nucleotide similarity. Various other plasmids were identified, particularly p_3_95 and p_4_95, which carry antibiotic resistance genes ( hsrA and dfrG , respectively), and share homologies with SAP085A and pUSA04-2-SUR11, two plasmids described in S. aureus . Eventually, one complete prophage was identified, ΦSE90, sharing 30 out of 52 coding sequences with the Acinetobacter phage vB_AbaM_IME200. Thus, the SePI-1/SeCI-1 pathogenicity island was identified in two pathogenic strains of S. epidermidis that produced a SEC enterotoxin causing septic shock. These findings suggest the existence of in vivo genetic exchange from S. aureus to S. epidermidis .
Nanoukon, Chimène; Affolabi, Dissou; Keller, Daniel; Hansmann, Yves; Riegel, Philippe; Baba-Moussa, Lamine; Prévost, Gilles
2018-01-01
Staphylococcus epidermidis is a leading cause of nosocomial infections, majorly resistant to beta-lactam antibiotics, and may transfer several mobile genetic elements among the members of its own species, as well as to Staphylococcus aureus; however, a genetic exchange from S. aureus to S. epidermidis remains controversial. We recently identified two pathogenic clinical strains of S. epidermidis that produce a staphylococcal enterotoxin C3-like (SEC) similar to that by S. aureus pathogenicity islands. This study aimed to determine the genetic environment of the SEC-coding sequence and to identify the mobile genetic elements. Whole-genome sequencing and annotation of the S. epidermidis strains were performed using Illumina technology and a bioinformatics pipeline for assembly, which provided evidence that the SEC-coding sequences were located in a composite pathogenicity island that was previously described in the S. epidermidis strain FRI909, called SePI-1/SeCI-1, with 83.8–89.7% nucleotide similarity. Various other plasmids were identified, particularly p_3_95 and p_4_95, which carry antibiotic resistance genes (hsrA and dfrG, respectively), and share homologies with SAP085A and pUSA04-2-SUR11, two plasmids described in S. aureus. Eventually, one complete prophage was identified, ΦSE90, sharing 30 out of 52 coding sequences with the Acinetobacter phage vB_AbaM_IME200. Thus, the SePI-1/SeCI-1 pathogenicity island was identified in two pathogenic strains of S. epidermidis that produced a SEC enterotoxin causing septic shock. These findings suggest the existence of in vivo genetic exchange from S. aureus to S. epidermidis. PMID:29495323
Traffic routing in a switched regenerative satellite. Volume 2, task 4: Review (executive summary)
NASA Astrophysics Data System (ADS)
Barberis, G.
1982-12-01
A communications satellite design for 1990's European use is proposed. Time plan assignment is discussed. The satellite system should be interfaced with the terrestrial telephone network at several nodes per nation (rather than at one node per nation as for ECS). A 64 Kbit/sec ISDN service and a specialized 2.048 Mbit/sec service on reservation basis are suggested. Wide use of the 12/14 and 20/30 GHz bands is advocated. A procedure to achieve a switching plan with high efficiency, taking into account all system constraints such as no bursts breaking and two transmission rates harmonization is proposed. Algorithms to be implemented are: the Hungarian method; branch and bound; the INSERT heuristic; and the HOLE heuristic.
A new molecular evolution model for limited insertion independent of substitution.
Lèbre, Sophie; Michel, Christian J
2013-10-01
We recently introduced a new molecular evolution model called the IDIS model for Insertion Deletion Independent of Substitution [13,14]. In the IDIS model, the three independent processes of substitution, insertion and deletion of residues have constant rates. In order to control the genome expansion during evolution, we generalize here the IDIS model by introducing an insertion rate which decreases when the sequence grows and tends to 0 for a maximum sequence length nmax. This new model, called LIIS for Limited Insertion Independent of Substitution, defines a matrix differential equation satisfied by a vector P(t) describing the sequence content in each residue at evolution time t. An analytical solution is obtained for any diagonalizable substitution matrix M. Thus, the LIIS model gives an expression of the sequence content vector P(t) in each residue under evolution time t as a function of the eigenvalues and the eigenvectors of matrix M, the residue insertion rate vector R, the total insertion rate r, the initial and maximum sequence lengths n0 and nmax, respectively, and the sequence content vector P(t0) at initial time t0. The derivation of the analytical solution is much more technical, compared to the IDIS model, as it involves Gauss hypergeometric functions. Several propositions of the LIIS model are derived: proof that the IDIS model is a particular case of the LIIS model when the maximum sequence length nmax tends to infinity, fixed point, time scale, time step and time inversion. Using a relation between the sequence length l and the evolution time t, an expression of the LIIS model as a function of the sequence length l=n(t) is obtained. Formulas for 'insertion only', i.e. when the substitution rates are all equal to 0, are derived at evolution time t and sequence length l. Analytical solutions of the LIIS model are explicitly derived, as a function of either evolution time t or sequence length l, for two classical substitution matrices: the 3-parameter symmetric substitution matrix [12] (LIIS-SYM3) and the HKY asymmetric substitution matrix[9] (LIIS-HKY). An evaluation of the LIIS model (precisely, LIIS-HKY) based on four statistical analyses of the GC content in complete genomes of four prokaryotic taxonomic groups, namely Chlamydiae, Crenarchaeota, Spirochaetes and Thermotogae, shows the expected improvement from the theory of the LIIS model compared to the IDIS model. Copyright © 2013 Elsevier Inc. All rights reserved.
Kontinen, V P; Yamanaka, M; Nishiyama, K; Tokuda, H
1996-06-01
SecE, an essential membrane component of the Escherichia coli protein translocase, consists of 127 amino acid residues. Only a part of the second putative cytoplasmic region comprising some 13 residues is essential for the SecE function as long as the proper topological arrangement is retained. The Trp84 and Pro85 residues of this region are conserved in all eubacterial SecE homologues. The conservation of positively charged residues corresponding to Arg80 and Lys81 is also substantial. We deleted or replaced these residues to assess their roles in the SecE function. Deletion of the Arg80-Lys81 dipeptide did not abolish the SecE function whereas that of Trp84 or Pro85 caused a loss of the function. Strikingly, however, replacement of Pro85 with either Gly, Ser, or Ala, and that of Trp84 with Lys did not abolish the SecE function. These results indicate that the strong conservation of these residues does not reflect their obligatory requirement for the SecE function. A chimeric SecE possessing the cytoplasmic region of the E. coli SecE and the following region of the Bacillus subtilis SecE was able to form the translocation machinery together with SecA, SecY, and SecG. Although a Leu to Arg mutation at position 108 has been thought to cause a loss of signal recognition fidelity and thereby suppress a signal sequence defect, the same mutation at position 111 caused a complete loss of the function. The levels of SecY and SecG in the secEcsE501 mutant, which expresses SecE at a decreased level and is sensitive to low temperature, increased upon the expression of functional SecE derivatives, irrespective of the site of mutation, suggesting that the levels of SecY and SecG are co-operatively determined by the level of functional, but not non-functional, SecE. Based on these results, the SecE function in the translocase is discussed.
Hamond, C; Pestana, C P; Medeiros, M A; Lilenbaum, W
2016-01-01
The aim of this study was to identify Leptospira in urine samples of cattle by direct sequencing of the secY gene. The validity of this approach was assessed using ten Leptospira strains obtained from cattle in Brazil and 77 DNA samples previously extracted from cattle urine, that were positive by PCR for the genus-specific lipL32 gene of Leptospira. Direct sequencing identified 24 (31·1%) interpretable secY sequences and these were identical to those obtained from direct DNA sequencing of the urine samples from which they were recovered. Phylogenetic analyses identified four species: L. interrogans, L. borgpetersenii, L. noguchii, and L. santarosai with the most prevalent genotypes being associated with L. borgpetersenii. While direct sequencing cannot, as yet, replace culturing of leptospires, it is a valid additional tool for epidemiological studies. An unexpected finding from this study was the genetic diversity of Leptospira infecting Brazilian cattle.
Martin, Sophie G.
2012-01-01
The exocyst complex is essential for many exocytic events, by tethering vesicles at the plasma membrane for fusion. In fission yeast, polarized exocytosis for growth relies on the combined action of the exocyst at cell poles and myosin-driven transport along actin cables. We report here the identification of fission yeast Schizosaccharomyces pombe Sec3 protein, which we identified through sequence homology of its PH-like domain. Like other exocyst subunits, sec3 is required for secretion and cell division. Cells deleted for sec3 are only conditionally lethal and can proliferate when osmotically stabilized. Sec3 is redundant with Exo70 for viability and for the localization of other exocyst subunits, suggesting these components act as exocyst tethers at the plasma membrane. Consistently, Sec3 localizes to zones of growth independently of other exocyst subunits but depends on PIP2 and functional Cdc42. FRAP analysis shows that Sec3, like all other exocyst subunits, localizes to cell poles largely independently of the actin cytoskeleton. However, we show that Sec3, Exo70 and Sec5 are transported by the myosin V Myo52 along actin cables. These data suggest that the exocyst holocomplex, including Sec3 and Exo70, is present on exocytic vesicles, which can reach cell poles by either myosin-driven transport or random walk. PMID:22768263
NASA Astrophysics Data System (ADS)
Khosla, Deepak; Huber, David J.; Martin, Kevin
2017-05-01
This paper† describes a technique in which we improve upon the prior performance of the Rapid Serial Visual Presentation (RSVP) EEG paradigm for image classification though the insertion of visual attention distracters and overall sequence reordering based upon the expected ratio of rare to common "events" in the environment and operational context. Inserting distracter images maintains the ratio of common events to rare events at an ideal level, maximizing the rare event detection via P300 EEG response to the RSVP stimuli. The method has two steps: first, we compute the optimal number of distracters needed for an RSVP stimuli based on the desired sequence length and expected number of targets and insert the distracters into the RSVP sequence, and then we reorder the RSVP sequence to maximize P300 detection. We show that by reducing the ratio of target events to nontarget events using this method, we can allow RSVP sequences with more targets without sacrificing area under the ROC curve (azimuth).
Bashir, Ali; Bansal, Vikas; Bafna, Vineet
2010-06-18
Massively parallel DNA sequencing technologies have enabled the sequencing of several individual human genomes. These technologies are also being used in novel ways for mRNA expression profiling, genome-wide discovery of transcription-factor binding sites, small RNA discovery, etc. The multitude of sequencing platforms, each with their unique characteristics, pose a number of design challenges, regarding the technology to be used and the depth of sequencing required for a particular sequencing application. Here we describe a number of analytical and empirical results to address design questions for two applications: detection of structural variations from paired-end sequencing and estimating mRNA transcript abundance. For structural variation, our results provide explicit trade-offs between the detection and resolution of rearrangement breakpoints, and the optimal mix of paired-read insert lengths. Specifically, we prove that optimal detection and resolution of breakpoints is achieved using a mix of exactly two insert library lengths. Furthermore, we derive explicit formulae to determine these insert length combinations, enabling a 15% improvement in breakpoint detection at the same experimental cost. On empirical short read data, these predictions show good concordance with Illumina 200 bp and 2 Kbp insert length libraries. For transcriptome sequencing, we determine the sequencing depth needed to detect rare transcripts from a small pilot study. With only 1 Million reads, we derive corrections that enable almost perfect prediction of the underlying expression probability distribution, and use this to predict the sequencing depth required to detect low expressed genes with greater than 95% probability. Together, our results form a generic framework for many design considerations related to high-throughput sequencing. We provide software tools http://bix.ucsd.edu/projects/NGS-DesignTools to derive platform independent guidelines for designing sequencing experiments (amount of sequencing, choice of insert length, mix of libraries) for novel applications of next generation sequencing.
Willett-Brozick, J E; Savul, S A; Richey, L E; Baysal, B E
2001-08-01
Constitutional chromosomal translocations are relatively common causes of human morbidity, yet the DNA double-strand break (DSB) repair mechanisms that generate them are incompletely understood. We cloned, sequenced and analyzed the breakpoint junctions of a familial constitutional reciprocal translocation t(9;11)(p24;q23). Within the 10-kb region flanking the breakpoints, chromosome 11 had 25% repeat elements, whereas chromosome 9 had 98% repeats, 95% of which were L1-type LINE elements. The breakpoints occurred within an L1-type repeat element at 9p24 and at the 3'-end of an Alu sequence at 11q23. At the breakpoint junction of derivative chromosome 9, we discovered an unusually large 41-bp insertion, which showed 100% identity to 12S mitochondrial DNA (mtDNA) between nucleotides 896 and 936 of the mtDNA sequence. Analysis of the human genome failed to show the preexistence of the inserted sequence at normal chromosomes 9 and 11 breakpoint junctions or elsewhere in the genome, strongly suggesting that the insertion was derived from human mtDNA and captured into the junction during the DSB repair process. To our knowledge, these findings represent the first observation of spontaneous germ line insertion of modern human mtDNA sequences and suggest that DSB repair may play a role in inter-organellar gene transfer in vivo. Our findings also provide evidence for a previously unrecognized insertional mechanism in human, by which non-mobile extra-chromosomal fragments can be inserted into the genome at DSB repair junctions.
High-throughput analysis of T-DNA location and structure using sequence capture
DOE Office of Scientific and Technical Information (OSTI.GOV)
Inagaki, Soichi; Henry, Isabelle M.; Lieberman, Meric C.
Agrobacterium-mediated transformation of plants with T-DNA is used both to introduce transgenes and for mutagenesis. Conventional approaches used to identify the genomic location and the structure of the inserted T-DNA are laborious and high-throughput methods using next-generation sequencing are being developed to address these problems. Here, we present a cost-effective approach that uses sequence capture targeted to the T-DNA borders to select genomic DNA fragments containing T-DNA—genome junctions, followed by Illumina sequencing to determine the location and junction structure of T-DNA insertions. Multiple probes can be mixed so that transgenic lines transformed with different T-DNA types can be processed simultaneously,more » using a simple, index-based pooling approach. We also developed a simple bioinformatic tool to find sequence read pairs that span the junction between the genome and T-DNA or any foreign DNA. We analyzed 29 transgenic lines of Arabidopsis thaliana, each containing inserts from 4 different T-DNA vectors. We determined the location of T-DNA insertions in 22 lines, 4 of which carried multiple insertion sites. Additionally, our analysis uncovered a high frequency of unconventional and complex T-DNA insertions, highlighting the needs for high-throughput methods for T-DNA localization and structural characterization. Transgene insertion events have to be fully characterized prior to use as commercial products. As a result, our method greatly facilitates the first step of this characterization of transgenic plants by providing an efficient screen for the selection of promising lines.« less
High-throughput analysis of T-DNA location and structure using sequence capture
Inagaki, Soichi; Henry, Isabelle M.; Lieberman, Meric C.; ...
2015-10-07
Agrobacterium-mediated transformation of plants with T-DNA is used both to introduce transgenes and for mutagenesis. Conventional approaches used to identify the genomic location and the structure of the inserted T-DNA are laborious and high-throughput methods using next-generation sequencing are being developed to address these problems. Here, we present a cost-effective approach that uses sequence capture targeted to the T-DNA borders to select genomic DNA fragments containing T-DNA—genome junctions, followed by Illumina sequencing to determine the location and junction structure of T-DNA insertions. Multiple probes can be mixed so that transgenic lines transformed with different T-DNA types can be processed simultaneously,more » using a simple, index-based pooling approach. We also developed a simple bioinformatic tool to find sequence read pairs that span the junction between the genome and T-DNA or any foreign DNA. We analyzed 29 transgenic lines of Arabidopsis thaliana, each containing inserts from 4 different T-DNA vectors. We determined the location of T-DNA insertions in 22 lines, 4 of which carried multiple insertion sites. Additionally, our analysis uncovered a high frequency of unconventional and complex T-DNA insertions, highlighting the needs for high-throughput methods for T-DNA localization and structural characterization. Transgene insertion events have to be fully characterized prior to use as commercial products. As a result, our method greatly facilitates the first step of this characterization of transgenic plants by providing an efficient screen for the selection of promising lines.« less
ERIC Educational Resources Information Center
Duncko, Roman; Cornwell, Brian; Cui, Lihong; Merikangas, Kathleen R.; Grillon, Christian
2007-01-01
The present study investigated the effects of acute stress exposure on learning performance in humans using analogs of two paradigms frequently used in animals. Healthy male participants were exposed to the cold pressor test (CPT) procedure, i.e., insertion of the dominant hand into ice water for 60 sec. Following the CPT or the control procedure,…
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wang, A; Stayman, J; Otake, Y
Purpose: To address the challenges of image quality, radiation dose, and reconstruction speed in intraoperative cone-beam CT (CBCT) for neurosurgery by combining model-based image reconstruction (MBIR) with accelerated algorithmic and computational methods. Methods: Preclinical studies involved a mobile C-arm for CBCT imaging of two anthropomorphic head phantoms that included simulated imaging targets (ventricles, soft-tissue structures/bleeds) and neurosurgical procedures (deep brain stimulation (DBS) electrode insertion) for assessment of image quality. The penalized likelihood (PL) framework was used for MBIR, incorporating a statistical model with image regularization via an edgepreserving penalty. To accelerate PL reconstruction, the ordered-subset, separable quadratic surrogates (OS-SQS) algorithmmore » was modified to incorporate Nesterov's method and implemented on a multi-GPU system. A fair comparison of image quality between PL and conventional filtered backprojection (FBP) was performed by selecting reconstruction parameters that provided matched low-contrast spatial resolution. Results: CBCT images of the head phantoms demonstrated that PL reconstruction improved image quality (∼28% higher CNR) even at half the radiation dose (3.3 mGy) compared to FBP. A combination of Nesterov's method and fast projectors yielded a PL reconstruction run-time of 251 sec (cf., 5729 sec for OS-SQS, 13 sec for FBP). Insertion of a DBS electrode resulted in severe metal artifact streaks in FBP reconstructions, whereas PL was intrinsically robust against metal artifact. The combination of noise and artifact was reduced from 32.2 HU in FBP to 9.5 HU in PL, thereby providing better assessment of device placement and potential complications. Conclusion: The methods can be applied to intraoperative CBCT for guidance and verification of neurosurgical procedures (DBS electrode insertion, biopsy, tumor resection) and detection of complications (intracranial hemorrhage). Significant improvement in image quality, dose reduction, and reconstruction time of ∼4 min will enable practical deployment of low-dose C-arm CBCT within the operating room. AAPM Research Seed Funding (2013-2014); NIH Fellowship F32EB017571; Siemens Healthcare (XP Division)« less
Park, Doori; Park, Su-Hyun; Ban, Yong Wook; Kim, Youn Shic; Park, Kyoung-Cheul; Kim, Nam-Soo; Kim, Ju-Kon; Choi, Ik-Young
2017-08-15
Genetically modified crops (GM crops) have been developed to improve the agricultural traits of modern crop cultivars. Safety assessments of GM crops are of paramount importance in research at developmental stages and before releasing transgenic plants into the marketplace. Sequencing technology is developing rapidly, with higher output and labor efficiencies, and will eventually replace existing methods for the molecular characterization of genetically modified organisms. To detect the transgenic insertion locations in the three GM rice gnomes, Illumina sequencing reads are mapped and classified to the rice genome and plasmid sequence. The both mapped reads are classified to characterize the junction site between plant and transgene sequence by sequence alignment. Herein, we present a next generation sequencing (NGS)-based molecular characterization method, using transgenic rice plants SNU-Bt9-5, SNU-Bt9-30, and SNU-Bt9-109. Specifically, using bioinformatics tools, we detected the precise insertion locations and copy numbers of transfer DNA, genetic rearrangements, and the absence of backbone sequences, which were equivalent to results obtained from Southern blot analyses. NGS methods have been suggested as an effective means of characterizing and detecting transgenic insertion locations in genomes. Our results demonstrate the use of a combination of NGS technology and bioinformatics approaches that offers cost- and time-effective methods for assessing the safety of transgenic plants.
Amirhaeri, S; Wohlrab, F; Wells, R D
1995-02-17
The influence of simple repeat sequences, cloned into different positions relative to the SV40 early promoter/enhancer, on the transient expression of the chloramphenicol acetyltransferase (CAT) gene was investigated. Insertion of (G)29.(C)29 in either orientation into the 5'-untranslated region of the CAT gene reduced expression in CV-1 cells 50-100 fold when compared with controls with random sequence inserts. Analysis of CAT-specific mRNA levels demonstrated that the effect was due to a reduction of CAT mRNA production rather than to posttranscriptional events. In contrast, insertion of the same insert in either orientation upstream of the promoter-enhancer or downstream of the gene stimulated gene expression 2-3-fold. These effects could be reversed by cotransfection of a competitor plasmid carrying (G)25.(C)25 sequences. The results suggest that a G.C-binding transcription factor modulates gene expression in this system and that promoter strength can be regulated by providing protein-binding sites in trans. Although constructs containing longer tracts of alternating (C-G), (T-G), or (A-T) sequences inhibited CAT expression when inserted in the 5'-untranslated region of the CAT gene, the amount of CAT mRNA was unaffected. Hence, these inhibitions must be due to posttranscriptional events, presumably at the level of translation. These effects of microsatellite sequences on gene expression are discussed with respect to recent data on related simple repeat sequences which cause several human genetic diseases.
Artificial MicroRNAs as Novel Secreted Reporters for Cell Monitoring in Living Subjects.
Ronald, John A; D'Souza, Aloma L; Chuang, Hui-Yen; Gambhir, Sanjiv Sam
2016-01-01
Reporter genes are powerful technologies that can be used to directly inform on the fate of transplanted cells in living subjects. Imaging reporter genes are often employed to quantify cell number, location(s), and viability with various imaging modalities. To complement this, reporters that are secreted from cells can provide a low-cost, in vitro diagnostic test to monitor overall cell viability at relatively high frequency without knowing the locations of all cells. Whereas protein-based secretable reporters have been developed, an RNA-based reporter detectable with amplification inherent PCR-based assays has not been previously described. MicroRNAs (miRNAs) are short non-coding RNAs (18-22 nt) that regulate mRNA translation and are being explored as relatively stable blood-based disease biomarkers. We developed an artificial miRNA-based secreted reporter, called Sec-miR, utilizing a coding sequence that is not expressed endogenously and does not have any known vertebrate target. Sec-miR was detectable in both the cells and culture media of transiently transfected cells. Cells stably expressing Sec-miR also reliably secreted it into the culture media. Mice implanted with parental HeLa cells or HeLa cells expressing both Sec-miR and the bioluminescence imaging (BLI) reporter gene Firefly luciferase (FLuc) were monitored over time for tumor volume, FLuc signal via BLI, and blood levels of Sec-miR. Significantly (p<0.05) higher Sec-miR was found in the blood of mice bearing Sec-miR-expressing tumors compared to parental cell tumors at 21 and 28 days after implantation. Importantly, blood Sec-miR reporter levels after day 21 showed a trend towards correlation with tumor volume (R2 = 0.6090; p = 0.0671) and significantly correlated with FLuc signal (R2 = 0.7067; p<0.05). Finally, we could significantly (p<0.01) amplify Sec-miR secretion into the cell media by chaining together multiple Sec-miR copies (4 instead of 1 or 2) within an expression cassette. Overall, we show that a novel complement of BLI together with a unique Sec-miR reporter adds an in vitro RNA-based diagnostic to enhance the monitoring of transplanted cells. While Sec-miR was not as sensitive as BLI for monitoring cell number, it may be more sensitive than clinically-relevant positron emission tomography (PET) reporter assays. Future work will focus on improving cell detectability via improved secretion of Sec-miR reporters from cells and more sensitive detection platforms, as well as, exploring other miRNA sequences to allow multiplexed monitoring of more than one cell population at a time. Continued development may lead to more refined and precise monitoring of cell-based therapies.
Rueda, P; Morón, G; Sarraseca, J; Leclerc, C; Casal, J I
2004-03-01
We have previously developed an antigen-delivery system based on hybrid recombinant porcine parvovirus-like particles (PPV-VLPs) formed by the self-assembly of the VP2 protein of PPV carrying a foreign epitope at its N terminus. In this study, different constructs were made containing a CD8(+) T-cell epitope of chicken ovalbumin (OVA) to analyse the influence of the sequence inserted into VP2 on the correct processing of VLPs by antigen-presenting cells. We analysed the presentation of the OVA epitope inserted without flanking sequences or with either different natural flanking sequences or with the natural flanking sequences of a CD8(+) T-cell epitope from the lymphocytic choriomeningitis virus nucleoprotein, and as a dimer with or without linker sequences. All constructs were studied in terms of level of expression, assembly of VLPs and ability to deliver the inserted epitope into the MHC I pathway. The presentation of the OVA epitope was considerably improved by insertion of short natural flanking sequences, which indicated the relevance of the flanking sequences on the processing of PPV-VLPs. Only PPV-VLPs carrying two copies of the OVA epitope linked by two glycines were able to be properly processed, suggesting that the introduction of flexible residues between the two consecutive OVA epitopes may be necessary for the correct presentation of these dimers by PPV-VLPs. These results provide information to improve the insertion of epitopes into PPV-VLPs to facilitate their processing and presentation by MHC class I molecules.
Schiavo, Giuseppina; Hoffmann, Orsolya Ivett; Ribani, Anisa; Utzeri, Valerio Joe; Ghionda, Marco Ciro; Bertolini, Francesca; Geraci, Claudia; Bovo, Samuele; Fontanesi, Luca
2017-10-01
Nuclear DNA sequences of mitochondrial origin (numts) are derived by insertion of mitochondrial DNA (mtDNA), into the nuclear genome. In this study, we provide, for the first time, a genome picture of numts inserted in the pig nuclear genome. The Sus scrofa reference nuclear genome (Sscrofa10.2) was aligned with circularized and consensus mtDNA sequences using LAST software. A total of 430 numt sequences that may represent 246 different numt integration events (57 numt regions determined by at least two numt sequences and 189 singletons) were identified, covering about 0.0078% of the nuclear genome. Numt integration events were correlated (0.99) to the chromosome length. The longest numt sequence (about 11 kbp) was located on SSC2. Six numts were sequenced and PCR amplified in pigs of European commercial and local pig breeds, of the Chinese Meishan breed and in European wild boars. Three of them were polymorphic for the presence or absence of the insertion. Surprisingly, the estimated age of insertion of two of the three polymorphic numts was more ancient than that of the speciation time of the Sus scrofa, supporting that these polymorphic sites were originated from interspecies admixture that contributed to shape the pig genome. © The Author 2017. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.
Berthier, Y; Thierry, D; Lemattre, M; Guesdon, J L
1994-01-01
A new insertion sequence was isolated from Xanthomonas campestris pv. dieffenbachiae. Sequence analysis showed that this element is 1,158 bp long and has 15-bp inverted repeat ends containing two mismatches. Comparison of this sequence with sequences in data bases revealed significant homology with Escherichia coli IS5. IS1051, which detected multiple restriction fragment length polymorphisms, was used as a probe to characterize strains from the pathovar dieffenbachiae. Images PMID:7906933
Onel, Buket; Carver, Megan; Agrawal, Prashansa; Hurley, Laurence H; Yang, Danzhou
2018-04-01
While the most stable G-quadruplex formed in the human PDGFR-β promoter nuclease hypersensitive element (NHE) is the 5'-mid G-quadruplex, the 3'-end sequence that contains a 3'-GGA run forms a less stable G-quadruplex. Recently, the 3'-end G-quadruplex was found to be a transcriptional repressor and can be selectively targeted by a small molecule for PDGFR-β downregulation. We use 1D and 2D high-field NMR, in combination with Dimethylsulfate Footprinting, Circular Dichroism Spectroscopy, and Electrophoretic Mobility Shift Assay. We determine that the PDGFR-β extended 3'-end NHE sequence forms two novel end-insertion intramolecular G-quadruplexes that co-exist in equilibrium under physiological salt conditions. One G-quadruplex has a 3'-non-adjacent flanking guanine inserted into the 3'-external tetrad (3'-insertion-G4), and another has a 5'-non-adjacent flanking guanine inserted into the 5'-external tetrad (5'-insertion-G4). The two guanines in the GGA-run move up or down within the G-quadruplex to accommodate the inserted guanine. Each end-insertion G-quadruplex has a low thermal stability as compared to the 5'-mid G-quadruplex, but the selective stabilization of GSA1129 shifts the equilibrium toward the 3'-end G-quadruplex in the PDGFR-β NHE. An equilibrium mixture of two unique end-insertion intramolecular G-quadruplexes forms in the PDGFR-β NHE 3'-end sequence that contains a GGA-run and non-adjacent guanines in both the 3'- and 5'- flanking segments; the novel end-insertion structures of the 3'-end G-quadruplex are selectively stabilized by GSA1129. We show for the first time that an equilibrium mixture of two unusual end-insertion G-quadruplexes forms in a native promoter sequence and appears to be the molecular recognition for PDGFR-β downregulation. Copyright © 2017 Elsevier B.V. All rights reserved.
2010-10-14
High-Resolution Functional Mapping of the Venezuelan Equine Encephalitis Virus Genome by Insertional Mutagenesis and Massively Parallel Sequencing...Venezuelan equine encephalitis virus (VEEV) genome. We initially used a capillary electrophoresis method to gain insight into the role of the VEEV...Smith JM, Schmaljohn CS (2010) High-Resolution Functional Mapping of the Venezuelan Equine Encephalitis Virus Genome by Insertional Mutagenesis and
GABI-Kat SimpleSearch: new features of the Arabidopsis thaliana T-DNA mutant database.
Kleinboelting, Nils; Huep, Gunnar; Kloetgen, Andreas; Viehoever, Prisca; Weisshaar, Bernd
2012-01-01
T-DNA insertion mutants are very valuable for reverse genetics in Arabidopsis thaliana. Several projects have generated large sequence-indexed collections of T-DNA insertion lines, of which GABI-Kat is the second largest resource worldwide. User access to the collection and its Flanking Sequence Tags (FSTs) is provided by the front end SimpleSearch (http://www.GABI-Kat.de). Several significant improvements have been implemented recently. The database now relies on the TAIRv10 genome sequence and annotation dataset. All FSTs have been newly mapped using an optimized procedure that leads to improved accuracy of insertion site predictions. A fraction of the collection with weak FST yield was re-analysed by generating new FSTs. Along with newly found predictions for older sequences about 20,000 new FSTs were included in the database. Information about groups of FSTs pointing to the same insertion site that is found in several lines but is real only in a single line are included, and many problematic FST-to-line links have been corrected using new wet-lab data. SimpleSearch currently contains data from ~71,000 lines with predicted insertions covering 62.5% of the 27,206 nuclear protein coding genes, and offers insertion allele-specific data from 9545 confirmed lines that are available from the Nottingham Arabidopsis Stock Centre.
Novel insertion mutation of ABCB1 gene in an ivermectin-sensitive Border Collie.
Han, Jae-Ik; Son, Hyoung-Won; Park, Seung-Cheol; Na, Ki-Jeong
2010-12-01
P-glycoprotein (P-gp) is encoded by the ABCB1 gene and acts as an efflux pump for xenobiotics. In the Border Collie, a nonsense mutation caused by a 4-base pair deletion in the ABCB1 gene is associated with a premature stop to P-gp synthesis. In this study, we examined the full-length coding sequence of the ABCB1 gene in an ivermectin-sensitive Border Collie that lacked the aforementioned deletion mutation. The sequence was compared to the corresponding sequences of a wild-type Beagle and seven ivermectin-tolerant family members of the Border Collie. When compared to the wild-type Beagle sequence, that of the ivermectin-sensitive Border Collie was found to have one insertion mutation and eight single nucleotide polymorphisms (SNPs) in the coding sequence of the ABCB1 gene. While the eight SNPs were also found in the family members' sequences, the insertion mutation was found only in the ivermectin-sensitive dog. These results suggest the possibility that the SNPs are species-specific features of the ABCB1 gene in Border Collies, and that the insertion mutation may be related to ivermectin intolerance.
Novel insertion mutation of ABCB1 gene in an ivermectin-sensitive Border Collie
Han, Jae-Ik; Son, Hyoung-Won; Park, Seung-Cheol
2010-01-01
P-glycoprotein (P-gp) is encoded by the ABCB1 gene and acts as an efflux pump for xenobiotics. In the Border Collie, a nonsense mutation caused by a 4-base pair deletion in the ABCB1 gene is associated with a premature stop to P-gp synthesis. In this study, we examined the full-length coding sequence of the ABCB1 gene in an ivermectin-sensitive Border Collie that lacked the aforementioned deletion mutation. The sequence was compared to the corresponding sequences of a wild-type Beagle and seven ivermectin-tolerant family members of the Border Collie. When compared to the wild-type Beagle sequence, that of the ivermectin-sensitive Border Collie was found to have one insertion mutation and eight single nucleotide polymorphisms (SNPs) in the coding sequence of the ABCB1 gene. While the eight SNPs were also found in the family members' sequences, the insertion mutation was found only in the ivermectin-sensitive dog. These results suggest the possibility that the SNPs are species-specific features of the ABCB1 gene in Border Collies, and that the insertion mutation may be related to ivermectin intolerance. PMID:21113104
Brewer, Megan H.; Chaudhry, Rabia; Qi, Jessica; Kidambi, Aditi; Drew, Alexander P.; Ryan, Monique M.; Subramanian, Gopinath M.; Young, Helen K.; Zuchner, Stephan; Reddel, Stephen W.; Nicholson, Garth A.; Kennerson, Marina L.
2016-01-01
With the advent of whole exome sequencing, cases where no pathogenic coding mutations can be found are increasingly being observed in many diseases. In two large, distantly-related families that mapped to the Charcot-Marie-Tooth neuropathy CMTX3 locus at chromosome Xq26.3-q27.3, all coding mutations were excluded. Using whole genome sequencing we found a large DNA interchromosomal insertion within the CMTX3 locus. The 78 kb insertion originates from chromosome 8q24.3, segregates fully with the disease in the two families, and is absent from the general population as well as 627 neurologically normal chromosomes from in-house controls. Large insertions into chromosome Xq27.1 are known to cause a range of diseases and this is the first neuropathy phenotype caused by an interchromosomal insertion at this locus. The CMTX3 insertion represents an understudied pathogenic structural variation mechanism for inherited peripheral neuropathies. Our finding highlights the importance of considering all structural variation types when studying unsolved inherited peripheral neuropathy cases with no pathogenic coding mutations. PMID:27438001
Martínez, Lidia Mayorga; Orozco, Aurea; Villalobos, Patricia; Valverde-R, Carlos
2008-05-01
Thyroid hormone bioactivity is finely regulated at the cellular level by the peripheral iodothyronine deiodinases (D). The study of thyroid function in fish has been restricted mainly to teleosts, whereas the study and characterization of Ds have been overlooked in chondrichthyes. Here we report the cloning and operational characterization of both the native and the recombinant hepatic type 3 iodothyronine deiodinase in the tropical shark Chiloscyllium punctatum. Native and recombinant sD3 show identical catalytic activities: a strong preference for T3-inner-ring deiodination, a requirement for a high concentration of DTT, a sequential reaction mechanism, and resistance to PTU inhibition. The cloned cDNA contains 1298 nucleotides [excluding the poly(A) tail] and encodes a predicted protein of 259 amino acids. The triplet TGA coding for selenocysteine (Sec) is at position 123. The consensus selenocysteine insertion sequence (SECIS) was identified 228 bp upstream of the poly(A) tail and corresponds to form 2. The deduced amino acid sequence was 77% and 72% identical to other D3 cDNAs in fishes and other vertebrates, respectively. As in the case of other piscivore teleost species, shark expresses hepatic D3 through adulthood. This characteristic may be associated with the alimentary strategy in which the protection from an exogenous overload of thyroid hormones could be of physiological importance for thyroidal homeostasis.
NASA Technical Reports Server (NTRS)
1972-01-01
This report contains the results of additional studies which were conducted to confirm the conclusions of the MSC Mission Report and contains analyses which were not completed in time to meet the mission report deadline. The LM IMU data were examined during the lunar descent and ascent phases. Most of the PGNCS descent absolute velocity error was caused by platform misalignments. PGNCS radial velocity divergence from AGS during the early part of descent was partially caused by PGNCS gravity computation differences from AGS. The remainder of the differences between PGNCS and AGS velocity were easily attributable to attitude reference alignment differences and tolerable instrument errors. For ascent the PGNCS radial velocity error at insertion was examined. The total error of 10.8 ft/sec was well within mission constraints but larger than expected. Of the total error, 2.30 ft/sec was PIPA bias error, which was suspected to exist pre-lunar liftoff. The remaining 8.5 ft/sec is most probably satisified with a large pre-liftoff planform misalignment.
Quantifying the Number of Independent Organelle DNA Insertions in Genome Evolution and Human Health
Martin, William F.
2017-01-01
Fragments of organelle genomes are often found as insertions in nuclear DNA. These fragments of mitochondrial DNA (numts) and plastid DNA (nupts) are ubiquitous components of eukaryotic genomes. They are, however, often edited out during the genome assembly process, leading to systematic underestimation of their frequency. Numts and nupts, once inserted, can become further fragmented through subsequent insertion of mobile elements or other recombinational events that disrupt the continuity of the inserted sequence relative to the genuine organelle DNA copy. Because numts and nupts are typically identified through sequence comparison tools such as BLAST, disruption of insertions into smaller fragments can lead to systematic overestimation of numt and nupt frequencies. Accurate identification of numts and nupts is important, however, both for better understanding of their role during evolution, and for monitoring their increasingly evident role in human disease. Human populations are polymorphic for 141 numt loci, five numts are causal to genetic disease, and cancer genomic studies are revealing an abundance of numts associated with tumor progression. Here, we report investigation of salient parameters involved in obtaining accurate estimates of numt and nupt numbers in genome sequence data. Numts and nupts from 44 sequenced eukaryotic genomes reveal lineage-specific differences in the number, relative age and frequency of insertional events as well as lineage-specific dynamics of their postinsertional fragmentation. Our findings outline the main technical parameters influencing accurate identification and frequency estimation of numts in genomic studies pertinent to both evolution and human health. PMID:28444372
Loureiro, A P; Hamond, C; Pinto, P; Bremont, S; Bourhy, P; Lilenbaum, W
2016-04-01
Bovine leptospirosis causes substantial reproductive failure in cattle, mainly due to infections with serovar (sv) Hardjo infection. Notwithstanding, other serovars from the serogroup (sg) Sejroe could also have important roles in bovine leptospirosis. The objective was to investigate genetic diversity of serogroup Sejroe isolates obtained from asymptomatic cattle in the state of Rio de Janeiro, Brazil. Urine and vaginal fluid (VF) were collected from clinically healthy cattle immediately after slaughter. Five isolates were recovered and characterized (serogrouping) as belonging to sg Sejroe. Sequencing of rrs and secY genes further identified them as Leptospira santarosai. Analysis of secY sequences indicated a high level of sequence homology to sv Guaricura strains. Based on culture and sequence data, we inferred that other members of sg Sejroe may be important in bovine leptospiral infection, particularly genotypes of L. santarosai serovar Guaricura. Copyright © 2016 Elsevier Ltd. All rights reserved.
Kong, V Y; Oosthuizen, G V; Sartorius, B; Keene, C; Clarke, D L
2014-11-01
Intercostal chest drain (ICD) insertion is a commonly performed procedure in trauma and may be associated with significant morbidity. This was a retrospective review of ICD complications in a major trauma service in South Africa over a four-year period from January 2010 to December 2013. A total of 1,050 ICDs were inserted in 1,006 patients, of which 91% were male. The median patient age was 24 years (interquartile range [IQR]: 20-29 years). There were 962 patients with unilateral ICDs and 44 with bilateral ICDs. Seventy-five per cent (758/1,006) sustained penetrating trauma and the remaining 25% (248/1006) sustained blunt trauma. Indications for ICD insertion were: haemopneumothorax (n=338), haemothorax (n=314), simple pneumothorax (n=265), tension pneumothorax (n=79) and open pneumothorax (n=54). Overall, 203 ICDs (19%) were associated with complications: 18% (36/203) were kinked, 18% (36/203) were inserted subcutaneously, 13% (27/203) were too shallow and in 7% (14/203) there was inadequate fixation resulting in dislodgement. Four patients (2%) sustained visceral injuries and two sustained vascular injuries. Forty-one per cent (83/203) were inserted outside the 'triangle of safety' but without visceral or vascular injuries. One patient had the ICD inserted on the wrong side. Junior doctors inserted 798 ICDs (76%) while senior doctors inserted 252 (24%). Junior doctors had a significantly higher complication rate (24%) compared with senior doctors (5%) (p<0.001). There was no mortality as a direct result of ICD insertion. Conclusions ICD insertion is associated with a high rate of complications. These complications are significantly higher when junior doctors perform the procedure. A multifaceted quality improvement programme is needed to improve the situation.
An Enterotoxin-Bearing Pathogenicity Island in Staphylococcus epidermidis▿†
Madhusoodanan, Jyoti; Seo, Keun Seok; Remortel, Brian; Park, Joo Youn; Hwang, Sun Young; Fox, Lawrence K.; Park, Yong Ho; Deobald, Claudia F.; Wang, Dan; Liu, Song; Daugherty, Sean C.; Gill, Ann Lindley; Bohach, Gregory A.; Gill, Steven R.
2011-01-01
Cocolonization of human mucosal surfaces causes frequent encounters between various staphylococcal species, creating opportunities for the horizontal acquisition of mobile genetic elements. The majority of Staphylococcus aureus toxins and virulence factors are encoded on S. aureus pathogenicity islands (SaPIs). Horizontal movement of SaPIs between S. aureus strains plays a role in the evolution of virulent clinical isolates. Although there have been reports of the production of toxic shock syndrome toxin 1 (TSST-1), enterotoxin, and other superantigens by coagulase-negative staphylococci, no associated pathogenicity islands have been found in the genome of Staphylococcus epidermidis, a generally less virulent relative of S. aureus. We show here the first evidence of a composite S. epidermidis pathogenicity island (SePI), the product of multiple insertions in the genome of a clinical isolate. The taxonomic placement of S. epidermidis strain FRI909 was confirmed by a number of biochemical tests and multilocus sequence typing. The genome sequence of this strain was analyzed for other unique gene clusters and their locations. This pathogenicity island encodes and expresses staphylococcal enterotoxin C3 (SEC3) and staphylococcal enterotoxin-like toxin L (SElL), as confirmed by quantitative reverse transcription-PCR (qRT-PCR) and immunoblotting. We present here an initial characterization of this novel pathogenicity island, and we establish that it is stable, expresses enterotoxins, and is not obviously transmissible by phage transduction. We also describe the genome sequence, excision, replication, and packaging of a novel bacteriophage in S. epidermidis FRI909, as well as attempts to mobilize the SePI element by this phage. PMID:21317317
Ribosome binding induces repositioning of the signal recognition particle receptor on the translocon
Kuhn, Patrick; Draycheva, Albena; Vogt, Andreas; Petriman, Narcis-Adrian; Sturm, Lukas; Drepper, Friedel; Warscheid, Bettina; Wintermeyer, Wolfgang
2015-01-01
Cotranslational protein targeting delivers proteins to the bacterial cytoplasmic membrane or to the eukaryotic endoplasmic reticulum membrane. The signal recognition particle (SRP) binds to signal sequences emerging from the ribosomal tunnel and targets the ribosome-nascent-chain complex (RNC) to the SRP receptor, termed FtsY in bacteria. FtsY interacts with the fifth cytosolic loop of SecY in the SecYEG translocon, but the functional role of the interaction is unclear. By using photo-cross-linking and fluorescence resonance energy transfer measurements, we show that FtsY–SecY complex formation is guanosine triphosphate independent but requires a phospholipid environment. Binding of an SRP–RNC complex exposing a hydrophobic transmembrane segment induces a rearrangement of the SecY–FtsY complex, which allows the subsequent contact between SecY and ribosomal protein uL23. These results suggest that direct RNC transfer to the translocon is guided by the interaction between SRP and translocon-bound FtsY in a quaternary targeting complex. PMID:26459600
DOE Office of Scientific and Technical Information (OSTI.GOV)
Borot de Battisti, M; Maenhout, M; Lagendijk, J J W
Purpose: To develop a new method which adaptively determines the optimal needle insertion sequence for HDR prostate brachytherapy involving divergent needle-by-needle dose delivery by e.g. a robotic device. A needle insertion sequence is calculated at the beginning of the intervention and updated after each needle insertion with feedback on needle positioning errors. Methods: Needle positioning errors and anatomy changes may occur during HDR brachytherapy which can lead to errors in the delivered dose. A novel strategy was developed to calculate and update the needle sequence and the dose plan after each needle insertion with feedback on needle positioning errors. Themore » dose plan optimization was performed by numerical simulations. The proposed needle sequence determination optimizes the final dose distribution based on the dose coverage impact of each needle. This impact is predicted stochastically by needle insertion simulations. HDR procedures were simulated with varying number of needle insertions (4 to 12) using 11 patient MR data-sets with PTV, prostate, urethra, bladder and rectum delineated. Needle positioning errors were modeled by random normally distributed angulation errors (standard deviation of 3 mm at the needle’s tip). The final dose parameters were compared in the situations where the needle with the largest vs. the smallest dose coverage impact was selected at each insertion. Results: Over all scenarios, the percentage of clinically acceptable final dose distribution improved when the needle selected had the largest dose coverage impact (91%) compared to the smallest (88%). The differences were larger for few (4 to 6) needle insertions (maximum difference scenario: 79% vs. 60%). The computation time of the needle sequence optimization was below 60s. Conclusion: A new adaptive needle sequence determination for HDR prostate brachytherapy was developed. Coupled to adaptive planning, the selection of the needle with the largest dose coverage impact increases chances of reaching the clinical constraints. M. Borot de Battisti is funded by Philips Medical Systems Nederland B.V.; M. Moerland is principal investigator on a contract funded by Philips Medical Systems Nederland B.V.; G. Hautvast and D. Binnekamp are fulltime employees of Philips Medical Systems Nederland B.V.« less
Ma, Ran Jing; Wang, Yan Hong; Liu, Lu; Bai, Lei Lei; Ban, Rui
2018-02-01
Lipases are among the most versatile biocatalysts, and are used in a range of industrially relevant bioconversion reactions. However, the production of LipA in recombinant Bacillus subtilis is still limited, due to unresolved issues surrounding the regulation of the expression and secretion systems. In this study, the gene encoding LipA from B. subtilis 168 was expressed in BNA under the control of the P 43 and the P AE promoter. The extracellular lipase activity of the resulting strains BNACL and BNAAL was 7.8 U ml -1 and 12.6 U ml -1 , respectively. To further enhance the expression of LipA, pHP13L was constructed by inserting the P AE -lip into the shuttle vector pHP13, which produced an extracellular lipase activity of 180.5 U ml -1 of BNA/pHP13L. The strain BNAY8 described in Supplement data which lacks eight extracellular proteins was constructed and the deletion a few of the much weaker secreting proteins had no significant effect on the secretion of LipA. Moreover, the four Sec pathway components, secA-prfB, secDF, secYEG, prsA, were individually overexpressed in BNA. The overexpression of secDF and prsA enhanced the production of LipA by 28% and 49%, respectively. Furthermore, the co-overexpression of secDF with prsA improved the extracellular amount of LipA by 59% over that of BNA/pHP13L, reaching 287.8 U ml -1 . It can therefore be said that both regulatory elements and secretion pathway had an impact on the production of secreted LipA. Their optimization and modification is a useful strategy to improve the homologous overproduction of other extracellular proteins in B. subtilis. Copyright © 2017. Published by Elsevier Inc.
In vivo insertion pool sequencing identifies virulence factors in a complex fungal–host interaction
Uhse, Simon; Pflug, Florian G.; Stirnberg, Alexandra; Ehrlinger, Klaus; von Haeseler, Arndt
2018-01-01
Large-scale insertional mutagenesis screens can be powerful genome-wide tools if they are streamlined with efficient downstream analysis, which is a serious bottleneck in complex biological systems. A major impediment to the success of next-generation sequencing (NGS)-based screens for virulence factors is that the genetic material of pathogens is often underrepresented within the eukaryotic host, making detection extremely challenging. We therefore established insertion Pool-Sequencing (iPool-Seq) on maize infected with the biotrophic fungus U. maydis. iPool-Seq features tagmentation, unique molecular barcodes, and affinity purification of pathogen insertion mutant DNA from in vivo-infected tissues. In a proof of concept using iPool-Seq, we identified 28 virulence factors, including 23 that were previously uncharacterized, from an initial pool of 195 candidate effector mutants. Because of its sensitivity and quantitative nature, iPool-Seq can be applied to any insertional mutagenesis library and is especially suitable for genetically complex setups like pooled infections of eukaryotic hosts. PMID:29684023
Motorized fusion guided prostate biopsy: phantom study
NASA Astrophysics Data System (ADS)
Seifabadi, Reza; Xu, Sheng; Aalamifar, Fereshteh; Pinto, Peter; Wood, Bradford J.
2017-03-01
Purpose: Fusion of Magnetic Resonance Imaging (MRI) with intraoperative real-time Ultrasound (US) during prostate biopsy has significantly improved the sensitivity of transrectal ultrasound (TRUS) guided cancer detection. Currently, sweeping of the TRUS probe to build a 3D volume as part of the fusion process and the TRUS probe manipulation for needle guidance are both done manually. A motorized, joystick controlled, probe holder was custom fabricated that can potentially reduce inter-operator variability, provide standardization of needle placement, improve repeatability and uniformity of needle placement, which may have impacts upon the learning curve after clinical deployment of this emerging approach. Method: a 2DOF motorized probe holder was designed to provide translation and rotation of a triplane TRUS end firing probe for prostate biopsy. The probe holder was joystick controlled and can assist manipulation of the probe during needle insertion as well as in acquiring a smoother US 2D to 3D sweep in which the 3D US volume for fusion is built. A commercial MRI-US fusion platform was used. Three targets were specified on MR image of a commercial prostate phantom. After performing the registration, two operators performed targeting, once manually and once with the assistance of the motorized probe holder. They repeated these tasks 5 times resulting in a total of 30 targeting events. Time of completion and mechanical error i.e. distance of the target from the needle trajectory in the software user interface were measured. Repeatability in reaching a given target in a systematic and consistent way was measured using a scatter plot showing all targets in the US coordinate system. Pearson product-moment correlation coefficient (PPMCC) was used to demonstrate the probe steadiness during targeting. Results: the completion time was 25+/-17 sec, 25+/-24 sec, and 27+/-15 sec for free hand and 24+/-10 sec, 22.5+/-10 sec, and 37+/-10 sec for motorized insertion, for target 1, 2, and 3, respectively. The mechanical error was 0.75+/-0.4 mm, 0.45+/-0.4 mm, and 0.55+/-0.4 mm, for free hand approach while it was 1.0+/-0.57 mm, 0.45+/-0.4 mm, and 0.35+/-0.25 mm, for motorized approach, for target 1, 2, and 3, respectively. PPMCC remained almost at 1.0 for the motorized approach while having a variation between 0.9 and 1.0 for the free hand approach. Conclusions: motorized fusion guided prostate biopsy in a phantom study was feasible and non-inferior or comparable to the free hand manual approach in terms of accuracy and speed of targeting, while being superior in terms of repeatability and steadiness.
[Patients' rights--doctors' duties].
Jaeger, L; Bertram, E; Grate, S; Mischkowsky, T; Paul, D; Probst, J; Scala, E; Wbllenweber, H D
2015-06-01
On 26 February 2013 the new "Law on Patients' Rights" (hereinafter also the "Law") became effective. This Law strengthens patients' rights vis-à-vis the insurdnce company and also regulates patients' rights regarding their relation to the doctor. This has consequences for the laws on medical liability all doctors must consider. The doctor's performance is and remains a service and such service does not hold any guarantee of success. Nevertheless, this Law primarily reads as a "law on the duties of physicians". To duly take into account these duties and to avoid mistakes and misinterpretation of the Law, the Ethics Committee of the Consortium of Osteosynthesis Trauma Germany (AOTRAUMA-D) has drafted comments on the Law. Brief summaries of its effects are to be found at the end of the respective comment under the heading "Consequences for Practice". The text of the law was influenced particularly by case law, as continuously developed by the German Federal Court of Justice ("BGH"). The implementation of the Law on Patients' Rights was effected by the newly inserted sections 630a to 630h of the German Civil Code (the "BGB"), which are analysed below. The following comments are addressed to physicians only and do not deal with the specific requirements and particularities of the other medical professions such as physiotherapy, midwifery and others so on. Special attention should be paid to the comments on the newly inserted Duty to inform, which has to be fullfilled prior to any diagnostic or therapeutic procedure (sec. 630c para 2 sentence 1 BGB). Under certain conditions the doctor also has to inform the patient about the circumstances that lead to the presumed occurance of a therapeutic or diagnostic malpractice (sec. 630c para. 2 sentence 2 BGB), based on the manifestation of an undesired event or an undesired outcome. As before, the patient's valid consent to any procedure (sec. 630d BGB) is directly linked to the comprehensive and timely provision of information (sec. 630e BGB). Comprehensive documentation obligations regarding all procedures are stipulated in sec. 630f BGB. As before, the burden of proof still rests with the patient, unless a severe malpractice has been established (sec. 630h BGB). The definition of "severe malpractice" remains unchanged and is based on the case law of the Federal Court of Justice (BGH). The patient's obligations to preserve his or her health and to actively support the process of recovery and securing a positive outcome of the treatment are not explicitly mentioned in the Law. Nevertheless, the patient and the physician need to work closely together to achieve a successful result of the treatment. In case the patient does not give his or her cooperation, the physician should consider terminating the treatment relationship.
Time- and Cost-Efficient Identification of T-DNA Insertion Sites through Targeted Genomic Sequencing
Lepage, Étienne; Zampini, Éric; Boyle, Brian; Brisson, Normand
2013-01-01
Forward genetic screens enable the unbiased identification of genes involved in biological processes. In Arabidopsis, several mutant collections are publicly available, which greatly facilitates such practice. Most of these collections were generated by agrotransformation of a T-DNA at random sites in the plant genome. However, precise mapping of T-DNA insertion sites in mutants isolated from such screens is a laborious and time-consuming task. Here we report a simple, low-cost and time efficient approach to precisely map T-DNA insertions simultaneously in many different mutants. By combining sequence capture, next-generation sequencing and 2D-PCR pooling, we developed a new method that allowed the rapid localization of T-DNA insertion sites in 55 out of 64 mutant plants isolated in a screen for gyrase inhibition hypersensitivity. PMID:23951038
Sorting genomes by reciprocal translocations, insertions, and deletions.
Qi, Xingqin; Li, Guojun; Li, Shuguang; Xu, Ying
2010-01-01
The problem of sorting by reciprocal translocations (abbreviated as SBT) arises from the field of comparative genomics, which is to find a shortest sequence of reciprocal translocations that transforms one genome Pi into another genome Gamma, with the restriction that Pi and Gamma contain the same genes. SBT has been proved to be polynomial-time solvable, and several polynomial algorithms have been developed. In this paper, we show how to extend Bergeron's SBT algorithm to include insertions and deletions, allowing to compare genomes containing different genes. In particular, if the gene set of Pi is a subset (or superset, respectively) of the gene set of Gamma, we present an approximation algorithm for transforming Pi into Gamma by reciprocal translocations and deletions (insertions, respectively), providing a sorting sequence with length at most OPT + 2, where OPT is the minimum number of translocations and deletions (insertions, respectively) needed to transform Pi into Gamma; if Pi and Gamma have different genes but not containing each other, we give a heuristic to transform Pi into Gamma by a shortest sequence of reciprocal translocations, insertions, and deletions, with bounds for the length of the sorting sequence it outputs. At a conceptual level, there is some similarity between our algorithm and the algorithm developed by El Mabrouk which is used to sort two chromosomes with different gene contents by reversals, insertions, and deletions.
Neuhof, Andrea; Rolls, Melissa M.; Jungnickel, Berit; Kalies, Kai-Uwe; Rapoport, Tom A.
1998-01-01
Most secretory and membrane proteins are sorted by signal sequences to the endoplasmic reticulum (ER) membrane early during their synthesis. Targeting of the ribosome-nascent chain complex (RNC) involves the binding of the signal sequence to the signal recognition particle (SRP), followed by an interaction of ribosome-bound SRP with the SRP receptor. However, ribosomes can also independently bind to the ER translocation channel formed by the Sec61p complex. To explain the specificity of membrane targeting, it has therefore been proposed that nascent polypeptide-associated complex functions as a cytosolic inhibitor of signal sequence- and SRP-independent ribosome binding to the ER membrane. We report here that SRP-independent binding of RNCs to the ER membrane can occur in the presence of all cytosolic factors, including nascent polypeptide-associated complex. Nontranslating ribosomes competitively inhibit SRP-independent membrane binding of RNCs but have no effect when SRP is bound to the RNCs. The protective effect of SRP against ribosome competition depends on a functional signal sequence in the nascent chain and is also observed with reconstituted proteoliposomes containing only the Sec61p complex and the SRP receptor. We conclude that cytosolic factors do not prevent the membrane binding of ribosomes. Instead, specific ribosome targeting to the Sec61p complex is provided by the binding of SRP to RNCs, followed by an interaction with the SRP receptor, which gives RNC–SRP complexes a selective advantage in membrane targeting over nontranslating ribosomes. PMID:9436994
One-milliarsecond precision parallax studies in the regions of Delta Cephei and EV Lacertae
NASA Technical Reports Server (NTRS)
Gatewood, George; De Jonge, Kiewiet Joost; Stephenson, Bruce
1993-01-01
Trigonometric parallaxes for stars in the regions of the variable stars delta Cephei and EV Lacertae are derived from data collected with the Multichannel Astrometric Photometer (MAP) and the Thaw Refractor of the University of Pittsburgh's Allegheny Observatory. The weighted mean parallax of all trigonometric studies of delta Cephei is now + 0.0030 sec + or - 0.00093 sec, corresponding to a distance modulus of 7.61 + or - 0.67 mag. This indicates that this luminosity standard star is approximately one standard deviation more distance than has been generally accepted. The weighted mean trigonometric parallax of all studies of the variable star EV Lacertae (BD + 43 deg 4305) is + 0.1993 sec + or - 0.00093 sec, implying a distance modulus of - 1.498 + or - 0.0010 mag. The calculated absolute magnitude of this star is almost exactly that predicted by its (R-I)(sub Kron) magnitude and by the Gliese (R-I) main-sequence value for stars in the solar neighborhood. We also find a parallax of 0.0189 sec + or - 0.0008 sec for the FO IVn star, HR 8666 (BD + 43 sec 4300). The derived luminosity of this star is midway between that expected for luminosity class IV and V stars at the indicated temperature.
Quantifying the Number of Independent Organelle DNA Insertions in Genome Evolution and Human Health.
Hazkani-Covo, Einat; Martin, William F
2017-05-01
Fragments of organelle genomes are often found as insertions in nuclear DNA. These fragments of mitochondrial DNA (numts) and plastid DNA (nupts) are ubiquitous components of eukaryotic genomes. They are, however, often edited out during the genome assembly process, leading to systematic underestimation of their frequency. Numts and nupts, once inserted, can become further fragmented through subsequent insertion of mobile elements or other recombinational events that disrupt the continuity of the inserted sequence relative to the genuine organelle DNA copy. Because numts and nupts are typically identified through sequence comparison tools such as BLAST, disruption of insertions into smaller fragments can lead to systematic overestimation of numt and nupt frequencies. Accurate identification of numts and nupts is important, however, both for better understanding of their role during evolution, and for monitoring their increasingly evident role in human disease. Human populations are polymorphic for 141 numt loci, five numts are causal to genetic disease, and cancer genomic studies are revealing an abundance of numts associated with tumor progression. Here, we report investigation of salient parameters involved in obtaining accurate estimates of numt and nupt numbers in genome sequence data. Numts and nupts from 44 sequenced eukaryotic genomes reveal lineage-specific differences in the number, relative age and frequency of insertional events as well as lineage-specific dynamics of their postinsertional fragmentation. Our findings outline the main technical parameters influencing accurate identification and frequency estimation of numts in genomic studies pertinent to both evolution and human health. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.
Kalscheuer, Vera M.; James, Victoria M.; Himelright, Miranda L.; Long, Philip; Oegema, Renske; Jensen, Corinna; Bienek, Melanie; Hu, Hao; Haas, Stefan A.; Topf, Maya; Hoogeboom, A. Jeannette M.; Harvey, Kirsten; Walikonis, Randall; Harvey, Robert J.
2016-01-01
Disease gene discovery in neurodevelopmental disorders, including X-linked intellectual disability (XLID) has recently been accelerated by next-generation DNA sequencing approaches. To date, more than 100 human X chromosome genes involved in neuronal signaling pathways and networks implicated in cognitive function have been identified. Despite these advances, the mutations underlying disease in a large number of XLID families remained unresolved. We report the resolution of MRX78, a large family with six affected males and seven affected females, showing X-linked inheritance. Although a previous linkage study had mapped the locus to the short arm of chromosome X (Xp11.4-p11.23), this region contained too many candidate genes to be analyzed using conventional approaches. However, our X-chromosome exome resequencing, bioinformatics analysis and inheritance testing revealed a missense mutation (c.C2366T, p.A789V) in IQSEC2, encoding a neuronal GDP-GTP exchange factor for Arf family GTPases (ArfGEF) previously implicated in XLID. Molecular modeling of IQSEC2 revealed that the A789V substitution results in the insertion of a larger side-chain into a hydrophobic pocket in the catalytic Sec7 domain of IQSEC2. The A789V change is predicted to result in numerous clashes with adjacent amino acids and disruption of local folding of the Sec7 domain. Consistent with this finding, functional assays revealed that recombinant IQSEC2A789V was not able to catalyze GDP-GTP exchange on Arf6 as efficiently as wild-type IQSEC2. Taken together, these results strongly suggest that the A789V mutation in IQSEC2 is the underlying cause of XLID in the MRX78 family. PMID:26793055
Michalovova, M; Vyskot, B; Kejnovsky, E
2013-10-01
We analysed the size, relative age and chromosomal localization of nuclear sequences of plastid and mitochondrial origin (NUPTs-nuclear plastid DNA and NUMTs-nuclear mitochondrial DNA) in six completely sequenced plant species. We found that the largest insertions showed lower divergence from organelle DNA than shorter insertions in all species, indicating their recent origin. The largest NUPT and NUMT insertions were localized in the vicinity of the centromeres in the small genomes of Arabidopsis and rice. They were also present in other chromosomal regions in the large genomes of soybean and maize. Localization of NUPTs and NUMTs correlated positively with distribution of transposable elements (TEs) in Arabidopsis and sorghum, negatively in grapevine and soybean, and did not correlate in rice or maize. We propose a model where new plastid and mitochondrial DNA sequences are inserted close to centromeres and are later fragmented by TE insertions and reshuffled away from the centromere or removed by ectopic recombination. The mode and tempo of TE dynamism determines the turnover of NUPTs and NUMTs resulting in their species-specific chromosomal distributions.
2012-01-01
Background The ovine Major Histocompatibility Complex (MHC) harbors genes involved in overall resistance/susceptibility of the host to infectious diseases. Compared to human and mouse, the ovine MHC is interrupted by a large piece of autosome insertion via a hypothetical chromosome inversion that constitutes ~25% of ovine chromosome 20. The evolutionary consequence of such an inversion and an insertion (inversion/insertion) in relation to MHC function remains unknown. We previously constructed a BAC clone physical map for the ovine MHC exclusive of the insertion region. Here we report the construction of a high-density physical map covering the autosome insertion in order to address the question of what the inversion/insertion had to do with ruminants during the MHC evolution. Results A total of 119 pairs of comparative bovine oligo primers were utilized to screen an ovine BAC library for positive clones and the orders and overlapping relationships of the identified clones were determined by DNA fingerprinting, BAC-end sequencing, and sequence-specific PCR. A total of 368 positive BAC clones were identified and 108 of the effective clones were ordered into an overlapping BAC contig to cover the consensus region between ovine MHC class IIa and IIb. Therefore, a continuous physical map covering the entire ovine autosome inversion/insertion region was successfully constructed. The map confirmed the bovine sequence assembly for the same homologous region. The DNA sequences of 185 BAC-ends have been deposited into NCBI database with the access numbers HR309252 through HR309068, corresponding to dbGSS ID 30164010 through 30163826. Conclusions We have constructed a high-density BAC clone physical map for the ovine autosome inversion/insertion between the MHC class IIa and IIb. The entire ovine MHC region is now fully covered by a continuous BAC clone contig. The physical map we generated will facilitate MHC functional studies in the ovine, as well as the comparative MHC evolution in ruminants. PMID:22897909
Alu repeat discovery and characterization within human genomes
Hormozdiari, Fereydoun; Alkan, Can; Ventura, Mario; Hajirasouliha, Iman; Malig, Maika; Hach, Faraz; Yorukoglu, Deniz; Dao, Phuong; Bakhshi, Marzieh; Sahinalp, S. Cenk; Eichler, Evan E.
2011-01-01
Human genomes are now being rapidly sequenced, but not all forms of genetic variation are routinely characterized. In this study, we focus on Alu retrotransposition events and seek to characterize differences in the pattern of mobile insertion between individuals based on the analysis of eight human genomes sequenced using next-generation sequencing. Applying a rapid read-pair analysis algorithm, we discover 4342 Alu insertions not found in the human reference genome and show that 98% of a selected subset (63/64) experimentally validate. Of these new insertions, 89% correspond to AluY elements, suggesting that they arose by retrotransposition. Eighty percent of the Alu insertions have not been previously reported and more novel events were detected in Africans when compared with non-African samples (76% vs. 69%). Using these data, we develop an experimental and computational screen to identify ancestry informative Alu retrotransposition events among different human populations. PMID:21131385
Proels, Reinhard K; Roitsch, Thomas
2006-03-01
Very few CACTA transposon-like sequences have been described in Solanaceae species. Sequence information has been restricted to partial transposase (TPase)-like fragments, and no target gene of CACTA-like transposon insertion has been described in tomato to date. In this manuscript, we report on a CACTA transposon-like insertion in intron I of tomato (Lycopersicon esculentum) invertase gene Lin5 and TPase-like sequences of several Solanaceae species. Consensus primers deduced from the TPase region of the tomato CACTA transposon-like element allowed the amplification of similar sequences from various Solanaceae species of different subfamilies including Solaneae (Solanum tuberosum), Cestreae (Nicotiana tabacum) and Datureae (Datura stramonium). This demonstrates the ubiquitous presence of CACTA-like elements in Solanaceae genomes. The obtained partial sequences are highly conserved, and allow further detection and detailed analysis of CACTA-like transposons throughout Solanaceae species. CACTA-like transposon sequences make possible the evaluation of their use for genome analysis, functional studies of genes and the evolutionary relationships between plant species.
Izumi, Kosuke; Nakato, Ryuichiro; Zhang, Zhe; Edmondson, Andrew C.; Noon, Sarah; Dulik, Matthew C.; Rajagopalan, Ramkakrishnan; Venditti, Charles P.; Gripp, Karen; Samanich, Joy; Zackai, Elaine H.; Deardorff, Matthew A.; Clark, Dinah; Allen, Julian L.; Dorsett, Dale; Misulovin, Ziva; Komata, Makiko; Bando, Masashige; Kaur, Maninder; Katou, Yuki; Shirahige, Katsuhiko; Krantz, Ian D.
2015-01-01
Transcriptional elongation is critical for gene expression regulation during embryogenesis. The super elongation complex (SEC) governs this process by mobilizing paused RNA polymerase II (RNAP2). Using exome sequencing, we discovered missense mutations in AFF4, a core component of the SEC in three unrelated probands with a novel syndrome that phenotypically overlaps Cornelia de Lange syndrome (CdLS), that we have named CHOPS syndrome (C for Cognitive impairment and Coarse facies, H for Heart defects, O for Obesity, P for Pulmonary involvement and S for Short stature and Skeletal dysplasia). Transcriptome and chromatin immunoprecipitation sequencing (ChIP-seq) analyses demonstrated similar alterations of genome-wide binding of AFF4, cohesin and RNAP2 between CdLS and CHOPS syndrome. Direct molecular interaction between SEC, cohesin and RNAP2 was demonstrated. This data supports a common molecular pathogenesis for CHOPS syndrome and CdLS caused by disturbance of transcriptional elongation due to alterations in genome-wide binding of AFF4 and cohesin. PMID:25730767
Method for introducing unidirectional nested deletions
Dunn, John J.; Quesada, Mark A.; Randesi, Matthew
2001-01-01
Disclosed is a method for the introduction of unidirectional deletions in a cloned DNA segment in the context of a cloning vector which contains an f1 endonuclease recognition sequence adjacent to the insertion site of the DNA segment. Also disclosed is a method for producing single-stranded DNA probes utilizing the same cloning vector. An optimal vector, PZIP is described. Methods for introducing unidirectional deletions into a terminal location of a cloned DNA sequence which is inserted into the vector of the present invention are also disclosed. These methods are useful for introducing deletions into either or both ends of a cloned DNA insert, for high throughput sequencing of any DNA of interest.
Triple helix purification and sequencing
Wang, Renfeng; Smith, Lloyd M.; Tong, Xinchun E.
1995-01-01
Disclosed herein are methods, kits, and equipment for purifying single stranded circular DNA and then using the DNA for DNA sequencing purposes. Templates are provided with an insert having a hybridization region. An elongated oligonucleotide has two regions that are complementary to the insert and the oligo is bound to a magnetic anchor. The oligo hybridizes to the insert on two sides to form a stable triple helix complex. The anchor can then be used to drag the template out of solution using a magnet. The system can purify sequencing templates, and if desired the triple helix complex can be opened up to a double helix so that the oligonucleotide will act as a primer for further DNA synthesis.
Triple helix purification and sequencing
Wang, R.; Smith, L.M.; Tong, X.E.
1995-03-28
Disclosed herein are methods, kits, and equipment for purifying single stranded circular DNA and then using the DNA for DNA sequencing purposes. Templates are provided with an insert having a hybridization region. An elongated oligonucleotide has two regions that are complementary to the insert and the oligo is bound to a magnetic anchor. The oligo hybridizes to the insert on two sides to form a stable triple helix complex. The anchor can then be used to drag the template out of solution using a magnet. The system can purify sequencing templates, and if desired the triple helix complex can be opened up to a double helix so that the oligonucleotide will act as a primer for further DNA synthesis. 4 figures.
[Isolation and function of genes regulating aphB expression in Vibrio cholerae].
Chen, Haili; Zhu, Zhaoqin; Zhong, Zengtao; Zhu, Jun; Kan, Biao
2012-02-04
We identified genes that regulate the expression of aphB, the gene encoding a key virulence regulator in Vibrio cholerae O1 E1 Tor C6706(-). We constructed a transposon library in V. cholerae C6706 strain containing a P(aphB)-luxCDABE and P(aphB)-lacZ transcriptional reporter plasmids. Using a chemiluminescence imager system, we rapidly detected aphB promoter expression level at a large scale. We then sequenced the transposon insertion sites by arbitrary PCR and sequencing analysis. We obtained two candidate mutants T1 and T2 which displayed reduced aphB expression from approximately 40,000 transposon insertion mutants. Sequencing analysis shows that Tn inserted in vc1585 reading frame in the T1 mutant and Tn inserted in the end of coding sequence of vc1602 in the T2 mutant. By using a genetic screen, we identified two potential genes that may involve in regulation of the expression of the key virulence regulator AphB. This study sheds light on our further investigation to fully understand V. cholerae virulence gene regulatory cascades.
Rodríguez-Martín, Carlos; Cidre, Florencia; Fernández-Teijeiro, Ana; Gómez-Mariano, Gema; de la Vega, Leticia; Ramos, Patricia; Zaballos, Ángel; Monzón, Sara; Alonso, Javier
2016-05-01
Retinoblastoma (RB, MIM 180200) is the paradigm of hereditary cancer. Individuals harboring a constitutional mutation in one allele of the RB1 gene have a high predisposition to develop RB. Here, we present the first case of familial RB caused by a de novo insertion of a full-length long interspersed element-1 (LINE-1) into intron 14 of the RB1 gene that caused a highly heterogeneous splicing pattern of RB1 mRNA. LINE-1 insertion was inferred by mRNA studies and full-length sequenced by massive parallel sequencing. Some of the aberrant mRNAs were produced by noncanonical acceptor splice sites, a new finding that up to date has not been described to occur upon LINE-1 retrotransposition. Our results clearly show that RNA-based strategies have the potential to detect disease-causing transposon insertions. It also confirms that the incorporation of new genetic approaches, such as massive parallel sequencing, contributes to characterize at the sequence level these unique and exceptional genetic alterations.
Lemos, Brenda R; Kaplan, Adam C; Bae, Ji Eun; Ferrazzoli, Alexander E; Kuo, James; Anand, Ranjith P; Waterman, David P; Haber, James E
2018-02-27
Harnessing CRISPR-Cas9 technology provides an unprecedented ability to modify genomic loci via DNA double-strand break (DSB) induction and repair. We analyzed nonhomologous end-joining (NHEJ) repair induced by Cas9 in budding yeast and found that the orientation of binding of Cas9 and its guide RNA (gRNA) profoundly influences the pattern of insertion/deletions (indels) at the site of cleavage. A common indel created by Cas9 is a 1-bp (+1) insertion that appears to result from Cas9 creating a 1-nt 5' overhang that is filled in by a DNA polymerase and ligated. The origin of +1 insertions was investigated by using two gRNAs with PAM sequences located on opposite DNA strands but designed to cleave the same sequence. These templated +1 insertions are dependent on the X-family DNA polymerase, Pol4. Deleting Pol4 also eliminated +2 and +3 insertions, which are biased toward homonucleotide insertions. Using inverted PAM sequences, we also found significant differences in overall NHEJ efficiency and repair profiles, suggesting that the binding of the Cas9:gRNA complex influences subsequent NHEJ processing. As with events induced by the site-specific HO endonuclease, CRISPR-Cas9-mediated NHEJ repair depends on the Ku heterodimer and DNA ligase 4. Cas9 events are highly dependent on the Mre11-Rad50-Xrs2 complex, independent of Mre11's nuclease activity. Inspection of the outcomes of a large number of Cas9 cleavage events in mammalian cells reveals a similar templated origin of +1 insertions in human cells, but also a significant frequency of similarly templated +2 insertions.
Ebbie: automated analysis and storage of small RNA cloning data using a dynamic web server
Ebhardt, H Alexander; Wiese, Kay C; Unrau, Peter J
2006-01-01
Background DNA sequencing is used ubiquitously: from deciphering genomes[1] to determining the primary sequence of small RNAs (smRNAs) [2-5]. The cloning of smRNAs is currently the most conventional method to determine the actual sequence of these important regulators of gene expression. Typical smRNA cloning projects involve the sequencing of hundreds to thousands of smRNA clones that are delimited at their 5' and 3' ends by fixed sequence regions. These primers result from the biochemical protocol used to isolate and convert the smRNA into clonable PCR products. Recently we completed a smRNA cloning project involving tobacco plants, where analysis was required for ~700 smRNA sequences[6]. Finding no easily accessible research tool to enter and analyze smRNA sequences we developed Ebbie to assist us with our study. Results Ebbie is a semi-automated smRNA cloning data processing algorithm, which initially searches for any substring within a DNA sequencing text file, which is flanked by two constant strings. The substring, also termed smRNA or insert, is stored in a MySQL and BlastN database. These inserts are then compared using BlastN to locally installed databases allowing the rapid comparison of the insert to both the growing smRNA database and to other static sequence databases. Our laboratory used Ebbie to analyze scores of DNA sequencing data originating from an smRNA cloning project[6]. Through its built-in instant analysis of all inserts using BlastN, we were able to quickly identify 33 groups of smRNAs from ~700 database entries. This clustering allowed the easy identification of novel and highly expressed clusters of smRNAs. Ebbie is available under GNU GPL and currently implemented on Conclusion Ebbie was designed for medium sized smRNA cloning projects with about 1,000 database entries [6-8].Ebbie can be used for any type of sequence analysis where two constant primer regions flank a sequence of interest. The reliable storage of inserts, and their annotation in a MySQL database, BlastN[9] comparison of new inserts to dynamic and static databases make it a powerful new tool in any laboratory using DNA sequencing. Ebbie also prevents manual mistakes during the excision process and speeds up annotation and data-entry. Once the server is installed locally, its access can be restricted to protect sensitive new DNA sequencing data. Ebbie was primarily designed for smRNA cloning projects, but can be applied to a variety of RNA and DNA cloning projects[2,3,10,11]. PMID:16584563
USDA-ARS?s Scientific Manuscript database
Transformation plasmid-derived insert number and insert site sequence in 55-1 line papaya derivatives Rainbow and SunUp was determined as part of a larger petition to allow its import into Japan (Suzuki, et al., 2007, 2008). Three insertions were detected by Southern analysis and their correspondin...
Arnaiz, Olivier; Mathy, Nathalie; Baudry, Céline; Malinsky, Sophie; Aury, Jean-Marc; Denby Wilkes, Cyril; Garnier, Olivier; Labadie, Karine; Lauderdale, Benjamin E; Le Mouël, Anne; Marmignon, Antoine; Nowacki, Mariusz; Poulain, Julie; Prajer, Malgorzata; Wincker, Patrick; Meyer, Eric; Duharcourt, Sandra; Duret, Laurent; Bétermier, Mireille; Sperling, Linda
2012-01-01
Insertions of parasitic DNA within coding sequences are usually deleterious and are generally counter-selected during evolution. Thanks to nuclear dimorphism, ciliates provide unique models to study the fate of such insertions. Their germline genome undergoes extensive rearrangements during development of a new somatic macronucleus from the germline micronucleus following sexual events. In Paramecium, these rearrangements include precise excision of unique-copy Internal Eliminated Sequences (IES) from the somatic DNA, requiring the activity of a domesticated piggyBac transposase, PiggyMac. We have sequenced Paramecium tetraurelia germline DNA, establishing a genome-wide catalogue of -45,000 IESs, in order to gain insight into their evolutionary origin and excision mechanism. We obtained direct evidence that PiggyMac is required for excision of all IESs. Homology with known P. tetraurelia Tc1/mariner transposons, described here, indicates that at least a fraction of IESs derive from these elements. Most IES insertions occurred before a recent whole-genome duplication that preceded diversification of the P. aurelia species complex, but IES invasion of the Paramecium genome appears to be an ongoing process. Once inserted, IESs decay rapidly by accumulation of deletions and point substitutions. Over 90% of the IESs are shorter than 150 bp and present a remarkable size distribution with a -10 bp periodicity, corresponding to the helical repeat of double-stranded DNA and suggesting DNA loop formation during assembly of a transpososome-like excision complex. IESs are equally frequent within and between coding sequences; however, excision is not 100% efficient and there is selective pressure against IES insertions, in particular within highly expressed genes. We discuss the possibility that ancient domestication of a piggyBac transposase favored subsequent propagation of transposons throughout the germline by allowing insertions in coding sequences, a fraction of the genome in which parasitic DNA is not usually tolerated.
Arnaiz, Olivier; Mathy, Nathalie; Baudry, Céline; Malinsky, Sophie; Aury, Jean-Marc; Denby Wilkes, Cyril; Garnier, Olivier; Labadie, Karine; Lauderdale, Benjamin E.; Le Mouël, Anne; Marmignon, Antoine; Nowacki, Mariusz; Poulain, Julie; Prajer, Malgorzata; Wincker, Patrick; Meyer, Eric; Duharcourt, Sandra; Duret, Laurent; Bétermier, Mireille; Sperling, Linda
2012-01-01
Insertions of parasitic DNA within coding sequences are usually deleterious and are generally counter-selected during evolution. Thanks to nuclear dimorphism, ciliates provide unique models to study the fate of such insertions. Their germline genome undergoes extensive rearrangements during development of a new somatic macronucleus from the germline micronucleus following sexual events. In Paramecium, these rearrangements include precise excision of unique-copy Internal Eliminated Sequences (IES) from the somatic DNA, requiring the activity of a domesticated piggyBac transposase, PiggyMac. We have sequenced Paramecium tetraurelia germline DNA, establishing a genome-wide catalogue of ∼45,000 IESs, in order to gain insight into their evolutionary origin and excision mechanism. We obtained direct evidence that PiggyMac is required for excision of all IESs. Homology with known P. tetraurelia Tc1/mariner transposons, described here, indicates that at least a fraction of IESs derive from these elements. Most IES insertions occurred before a recent whole-genome duplication that preceded diversification of the P. aurelia species complex, but IES invasion of the Paramecium genome appears to be an ongoing process. Once inserted, IESs decay rapidly by accumulation of deletions and point substitutions. Over 90% of the IESs are shorter than 150 bp and present a remarkable size distribution with a ∼10 bp periodicity, corresponding to the helical repeat of double-stranded DNA and suggesting DNA loop formation during assembly of a transpososome-like excision complex. IESs are equally frequent within and between coding sequences; however, excision is not 100% efficient and there is selective pressure against IES insertions, in particular within highly expressed genes. We discuss the possibility that ancient domestication of a piggyBac transposase favored subsequent propagation of transposons throughout the germline by allowing insertions in coding sequences, a fraction of the genome in which parasitic DNA is not usually tolerated. PMID:23071448
The super elongation complex (SEC) and MLL in development and disease
Smith, Edwin; Lin, Chengqi; Shilatifard, Ali
2011-01-01
Transcriptional regulation at the level of elongation is vital for the control of gene expression and metazoan development. The mixed lineage leukemia (MLL) protein and its Drosophila homolog, Trithorax, which exist within COMPASS (complex of proteins associated with Set1)-like complexes, are master regulators of development. They are required for proper homeotic gene expression, in part through methylation of histone H3 on Lys 4. In humans, the MLL gene is involved in a large number of chromosomal translocations that create chimeric proteins, fusing the N terminus of MLL to several proteins that share little sequence similarity. Several frequent translocation partners of MLL were found recently to coexist in a super elongation complex (SEC) that includes known transcription elongation factors such as eleven-nineteen lysine-rich leukemia (ELL) and P-TEFb. Importantly, the SEC is required for HOX gene expression in leukemic cells, suggesting that chromosomal translocations involving MLL could lead to the overexpression of HOX and other genes through the involvement of the SEC. Here, we review the normal developmental roles of MLL and the SEC, and how MLL fusion proteins can mediate leukemogenesis. PMID:21460034
Mechanisms of ribosome stalling by SecM at multiple elongation steps
Zhang, Jun; Pan, Xijiang; Yan, Kaige; Sun, Shan; Gao, Ning; Sui, Sen-Fang
2015-01-01
Regulation of translating ribosomes is a major component of gene expression control network. In Escherichia coli, ribosome stalling by the C-terminal arrest sequence of SecM regulates the SecA-dependent secretion pathway. Previous studies reported many residues of SecM peptide and ribosome exit tunnel are critical for stalling. However, the underlying molecular mechanism is still not clear at the atomic level. Here, we present two cryo-EM structures of the SecM-stalled ribosomes at 3.3–3.7 Å resolution, which reveal two different stalling mechanisms at distinct elongation steps of the translation cycle: one is due to the inactivation of ribosomal peptidyl-transferase center which inhibits peptide bond formation with the incoming prolyl-tRNA; the other is the prolonged residence of the peptidyl-RNA at the hybrid A/P site which inhibits the full-scale tRNA translocation. These results demonstrate an elegant control of translation cycle by regulatory peptides through a continuous, dynamic reshaping of the functional center of the ribosome. DOI: http://dx.doi.org/10.7554/eLife.09684.001 PMID:26670735
Hsing, Michael; Cherkasov, Artem
2008-06-25
Insertions and deletions (indels) represent a common type of sequence variations, which are less studied and pose many important biological questions. Recent research has shown that the presence of sizable indels in protein sequences may be indicative of protein essentiality and their role in protein interaction networks. Examples of utilization of indels for structure-based drug design have also been recently demonstrated. Nonetheless many structural and functional characteristics of indels remain less researched or unknown. We have created a web-based resource, Indel PDB, representing a structural database of insertions/deletions identified from the sequence alignments of highly similar proteins found in the Protein Data Bank (PDB). Indel PDB utilized large amounts of available structural information to characterize 1-, 2- and 3-dimensional features of indel sites. Indel PDB contains 117,266 non-redundant indel sites extracted from 11,294 indel-containing proteins. Unlike loop databases, Indel PDB features more indel sequences with secondary structures including alpha-helices and beta-sheets in addition to loops. The insertion fragments have been characterized by their sequences, lengths, locations, secondary structure composition, solvent accessibility, protein domain association and three dimensional structures. By utilizing the data available in Indel PDB, we have studied and presented here several sequence and structural features of indels. We anticipate that Indel PDB will not only enable future functional studies of indels, but will also assist protein modeling efforts and identification of indel-directed drug binding sites.
Garnier, Fabien; Janapatla, Rajendra Prasad; Charpentier, Emmanuelle; Masson, Geoffrey; Grélaud, Carole; Stach, Jean François; Denis, François; Ploy, Marie-Cécile
2007-07-01
A serotype 1 Streptococcus pneumoniae strain isolated by blood culture from a woman with pneumonia was found to harbor insertion sequence (IS) 1515 in the pneumolysin gene, abolishing pneumolysin expression. To our knowledge, this is the first report of an IS in the pneumolysin gene of S. pneumoniae.
Methods and compositions for controlling gene expression by RNA processing
Doudna, Jennifer A.; Qi, Lei S.; Haurwitz, Rachel E.; Arkin, Adam P.
2017-08-29
The present disclosure provides nucleic acids encoding an RNA recognition sequence positioned proximal to an insertion site for the insertion of a sequence of interest; and host cells genetically modified with the nucleic acids. The present disclosure also provides methods of modifying the activity of a target RNA, and kits and compositions for carrying out the methods.
Slowly moving disturbances in the X-ray corona
NASA Technical Reports Server (NTRS)
Rust, D. M.; Svestka, Z.
1979-01-01
Sequences of soft X-ray pictures, taken aboard Skylab between May and November, 1973, have made it possible to detect slowly moving disturbances originating in disrupted filaments and causing subsequent brightenings of distant coronal structures. With speeds decreasing from approximately 400 km/sec shortly after the filament disruption to approximately 10 km/sec four or five hours later, these disturbances appear to be identical with slow waves earlier inferred by Bruzel (1952, 1969), Oehman (1953), and Yajima (1971) from chromospheric observations.
Sequential Events Control System (SECS) Overview
NASA Technical Reports Server (NTRS)
Interbartolo, Michael
2009-01-01
This slide presentation will cover the Sequential Events Control System (SECS), which is the Apollo spacecraft subsystem that controls the automatically sequenced functions during the mission and during any a borts that could be performed. Included in this presentation are its general architecture, its integration into and use of the spacecraft' s other systems, and details on the functions it is responsible for c ontrolling during the mission. The objectives are to describe the system's architecture, the major components in the system, and the major system functions.
Jia, Xianbo; Lin, Xinjian; Chen, Jichen
2017-11-02
Current genome walking methods are very time consuming, and many produce non-specific amplification products. To amplify the flanking sequences that are adjacent to Tn5 transposon insertion sites in Serratia marcescens FZSF02, we developed a genome walking method based on TAIL-PCR. This PCR method added a 20-cycle linear amplification step before the exponential amplification step to increase the concentration of the target sequences. Products of the linear amplification and the exponential amplification were diluted 100-fold to decrease the concentration of the templates that cause non-specific amplification. Fast DNA polymerase with a high extension speed was used in this method, and an amplification program was used to rapidly amplify long specific sequences. With this linear and exponential TAIL-PCR (LETAIL-PCR), we successfully obtained products larger than 2 kb from Tn5 transposon insertion mutant strains within 3 h. This method can be widely used in genome walking studies to amplify unknown sequences that are adjacent to known sequences.
Bonen, Linda; Boer, Poppo H.; Gray, Michael W.
1984-01-01
We have determined the sequence of the wheat mitochondrial gene for cytochrome oxidase subunit II (COII) and find that its derived protein sequence differs from that of maize at only three amino acid positions. Unexpectedly, all three replacements are non-conservative ones. The wheat COII gene has a highly-conserved intron at the same position as in maize, but the wheat intron is 1.5 times longer because of an insert relative to its maize counterpart. Hybridization analysis of mitochondrial DNA from rye, pea, broad bean and cucumber indicates strong sequence conservation of COII coding sequences among all these higher plants. However, only rye and maize mitochondrial DNA show homology with wheat COII intron sequences and rye alone with intron-insert sequences. We find that a sequence identical to the region of the 5' exon corresponding to the transmembrane domain of the COII protein is present at a second genomic location in wheat mitochondria. These variations in COII gene structure and size, as well as the presence of repeated COII sequences, illustrate at the DNA sequence level, factors which contribute to higher plant mitochondrial DNA diversity and complexity. ImagesFig. 3.Fig. 4.Fig. 5. PMID:16453565
Fast and efficient three-step target-specific curing of a virulence plasmid in Salmonella enterica.
de Moraes, Marcos H; Teplitski, Max
2015-12-01
Virulence plasmids borne by serovars of Salmonella enterica carry genes involved in its pathogenicity, as well as other functions. Characterization of phenotypes associated with virulence plasmids requires a system for efficiently curing strains of their virulence plasmids. Here, we developed a 3-step protocol for targeted curing of virulence plasmids. The protocol involves insertion of an I-SecI restriction site linked to an antibiotic resistance gene into the target plasmid using λ-Red mutagenesis, followed by the transformation with a temperature-sensitive auxiliary plasmid which carries I-SecI nuclease expressed from a tetracycline-inducible promoter. Finally, the auxiliary plasmid is removed by incubation at 42 °C and the plasmid-less strains are verified on antibiotic-containing media. This method is fast and very efficient: over 90 % of recovered colonies lacked their virulence plasmid.
Lower power dc arcjet operations with hydrogen hydrogen/nitrogen propellant mixtures
NASA Technical Reports Server (NTRS)
Curran, F. M.; Nakanishi, S.
1986-01-01
The arcjet assembly from a flight model system was modified with a new thoriated tungsten nozzle insert and has been tested with hydrogen-nitrogen mixtures simulating the decomposition products of ammonia and hydrazine. Arcjet power consumption ranged from 0.7 to 1.15 kW depending on low rate, input current, and mixture composition. At a nominal 1 kW power level the ammonia mixtures thrust efficiency was about 0.31 at specific impulse values ranging between 460 and 500 sec. Hydrazine mixtures gave similar thrust efficiencies at the same power level with specific impulse values between 395 and 430 sec. Large, spontaneous voltage mode changes were not observed once the thruster had passed a period of instability immediately following start up. This period of instability, and the startup at low pressure, were seen as major causes of constrictor damage during the tests.
Omidvari, Negar; Topping, Geoffrey; Cabello, Jorge; Paul, Stephan; Schwaiger, Markus; Ziegler, Sibylle I
2018-05-01
Compromises in the design of a positron emission tomography (PET) insert for a magnetic resonance imaging (MRI) system should minimize the deterioration of image quality in both modalities, particularly when simultaneous demanding acquisitions are performed. In this work, the advantages of using individually read-out crystals with high-gain silicon photomultipliers (SiPMs) were studied with a small animal PET insert for a 7 T MRI system, in which the SiPM charge was transferred to outside the MRI scanner using coaxial cables. The interferences between the two systems were studied with three radio-frequency (RF) coil configurations. The effects of PET on the static magnetic field, flip angle distribution, RF noise, and image quality of various MRI sequences (gradient echo, spin echo, and echo planar imaging (EPI) at 1 H frequency, and chemical shift imaging at 13 C frequency) were investigated. The effects of fast-switching gradient fields and RF pulses on PET count rate were studied, while the PET insert and the readout electronics were not shielded. Operating the insert inside a 1 H volume coil, used for RF transmission and reception, limited the MRI to T1-weighted imaging, due to coil detuning and RF attenuation, and resulted in significant PET count loss. Using a surface receive coil allowed all tested MR sequences to be used with the insert, with 45-59% signal-to-noise ratio (SNR) degradation, compared to without PET. With a 1 H/ 13 C volume coil inside the insert and shielded by a copper tube, the SNR degradation was limited to 23-30% with all tested sequences. The insert did not introduce any discernible distortions into images of two tested EPI sequences. Use of truncated sinc shaped RF excitation pulses and gradient field switching had negligible effects on PET count rate. However, PET count rate was substantially affected by high-power RF block pulses and temperature variations due to high gradient duty cycles.
Liu, Youzhou; Baird, Sonya M; Qiao, Junqing; Du, Yan; Lu, Shi-En
2015-05-01
Strain YL23 was isolated from soybean root tips and identified to be Pseudomonas sp. This strain showed broad-spectrum antibacterial activity against bacterial pathogens that are economically important in agriculture. To characterize the genes dedicated to antibacterial activities against microbial phytopathogens, a Tn5-mutation library of YL23 was constructed. Plate bioassays revealed that the mutant YL23-93 lost its antibacterial activities against Erwinia amylovora and Dickeya chrysanthemi as compared with its wild type strain. Genetic and sequencing analyses localized the transposon in a homolog of the secG gene in the mutant YL23-93. Constitutive expression plasmid pUCP26-secG was constructed and electroporated into the mutant YL23-93. Introduction of the plasmid pUCP26-secG restored antibacterial activities of the mutant YL23-93 to E. amylovora and D. chrysanthemi. As expected, empty plasmid pUCP26 could not complement the phenotype of the antibacterial activity in the mutant. Thus the secG gene, belonging to the Sec protein translocation system, is required for antibacterial activity of strain YL23 against E. amylovora and D. chrysanthemi. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Compositions and methods for the expression of selenoproteins in eukaryotic cells
Gladyshev, Vadim [Lincoln, NE; Novoselov, Sergey [Puschino, RU
2012-09-25
Recombinant nucleic acid constructs for the efficient expression of eukaryotic selenoproteins and related methods for production of recombinant selenoproteins are provided. The nucleic acid constructs comprise novel selenocysteine insertion sequence (SECIS) elements. Certain novel SECIS elements of the invention contain non-canonical quartet sequences. Other novel SECIS elements provided by the invention are chimeric SECIS elements comprising a canonical SECIS element that contains a non-canonical quartet sequence and chimeric SECIS elements comprising a non-canonical SECIS element that contains a canonical quartet sequence. The novel SECIS elements of the invention facilitate the insertion of selenocysteine residues into recombinant polypeptides.
Hogg, Matthew; Seki, Mineaki; Wood, Richard D; Doublié, Sylvie; Wallace, Susan S
2011-01-21
DNA polymerase θ (POLQ, polθ) is a large, multidomain DNA polymerase encoded in higher eukaryotic genomes. It is important for maintaining genetic stability in cells and helping protect cells from DNA damage caused by ionizing radiation. POLQ contains an N-terminal helicase-like domain, a large central domain of indeterminate function, and a C-terminal polymerase domain with sequence similarity to the A-family of DNA polymerases. The enzyme has several unique properties, including low fidelity and the ability to insert and extend past abasic sites and thymine glycol lesions. It is not known whether the abasic site bypass activity is an intrinsic property of the polymerase domain or whether helicase activity is also required. Three "insertion" sequence elements present in POLQ are not found in any other A-family DNA polymerase, and it has been proposed that they may lend some unique properties to POLQ. Here, we analyzed the activity of the DNA polymerase in the absence of each sequence insertion. We found that the pol domain is capable of highly efficient bypass of abasic sites in the absence of the helicase-like or central domains. Insertion 1 increases the processivity of the polymerase but has little, if any, bearing on the translesion synthesis properties of the enzyme. However, removal of insertions 2 and 3 reduces activity on undamaged DNA and completely abrogates the ability of the enzyme to bypass abasic sites or thymine glycol lesions. Copyright © 2010 Elsevier Ltd. All rights reserved.
One year quality of life measured with SEC-QoL in levonorgestrel 52 mg IUS users.
Cristobal, Ignacio; Lete, Luis Ignacio; Viuda, Esther de la; Perulero, Nuria; Arbat, Agnes; Canals, Ignasi
2016-04-01
The present study aims to prospectively evaluate quality of life (QoL) of women using 52-mg levonorgestrel intrauterine system (LNG-IUS) for contraception determined through the Sociedad Española de Contracepción (Spanish contraception Society) (SEC)-QoL, a questionnaire specifically designed to assess the impact of contraceptive methods on QoL of fertile women. We conducted a prospective observational multicenter study of 201 reproductive age women who initiated the LNG-IUS for contraception. Sociodemographic and clinical data were collected at baseline and 12 months afterwards. Participants filled in the SEC-QoL questionnaire at both visits. SEQ-QoL scores range from 0 (worst QoL) to 100 (best QoL). Participants claimed an increased QoL 12 months after insertion in all five dimensions of SEC-QoL due to its high contraceptive efficacy and its capability to reduce other menstrual symptoms (e.g., heavy menstrual bleeding or dysmenorrhoea), overall exerting a positive impact on user's satisfaction. SEC-QoL general overall score went from a mean (S.D.) score of 46.3 (17.3) at baseline to 72.2 (14.8) 12 months afterwards (p<.001). Overall, 94.6% of women claimed having found additional benefits other than contraception. No pregnancies were reported during the 12 months of study duration, and only 14 women discontinued use of LNG-IUS (only two of them due to an adverse event), representing a continuation rate of 93%. Women using LNG-IUS for contraception have an increased QoL after 12 months of use, demonstrated by the increased score in all dimensions of the SEC-QoL questionnaire. The present study prospectively evaluated QoL of women using LNG-IUS for contraception through the SEC-QoL questionnaire. Participants claimed increased QoL 12 months afterwards, implying that women using LNG-IUS for contraception in usual clinical practise also benefit from the reduction of period-related symptoms, overall leading to very low discontinuation rates. Copyright © 2016 Elsevier Inc. All rights reserved.
The ATRX cDNA is prone to bacterial IS10 element insertions that alter its structure.
Valle-García, David; Griffiths, Lyra M; Dyer, Michael A; Bernstein, Emily; Recillas-Targa, Félix
2014-01-01
The SWI/SNF-like chromatin-remodeling protein ATRX has emerged as a key factor in the regulation of α-globin gene expression, incorporation of histone variants into the chromatin template and, more recently, as a frequently mutated gene across a wide spectrum of cancers. Therefore, the availability of a functional ATRX cDNA for expression studies is a valuable tool for the scientific community. We have identified two independent transposon insertions of a bacterial IS10 element into exon 8 of ATRX isoform 2 coding sequence in two different plasmids derived from a single source. We demonstrate that these insertion events are common and there is an insertion hotspot within the ATRX cDNA. Such IS10 insertions produce a truncated form of ATRX, which significantly compromises its nuclear localization. In turn, we describe ways to prevent IS10 insertion during propagation and cloning of ATRX-containing vectors, including optimal growth conditions, bacterial strains, and suggested sequencing strategies. Finally, we have generated an insertion-free plasmid that is available to the community for expression studies of ATRX.
A High-Throughput Arabidopsis Reverse Genetics System
Sessions, Allen; Burke, Ellen; Presting, Gernot; Aux, George; McElver, John; Patton, David; Dietrich, Bob; Ho, Patrick; Bacwaden, Johana; Ko, Cynthia; Clarke, Joseph D.; Cotton, David; Bullis, David; Snell, Jennifer; Miguel, Trini; Hutchison, Don; Kimmerly, Bill; Mitzel, Theresa; Katagiri, Fumiaki; Glazebrook, Jane; Law, Marc; Goff, Stephen A.
2002-01-01
A collection of Arabidopsis lines with T-DNA insertions in known sites was generated to increase the efficiency of functional genomics. A high-throughput modified thermal asymetric interlaced (TAIL)-PCR protocol was developed and used to amplify DNA fragments flanking the T-DNA left borders from ∼100,000 transformed lines. A total of 85,108 TAIL-PCR products from 52,964 T-DNA lines were sequenced and compared with the Arabidopsis genome to determine the positions of T-DNAs in each line. Predicted T-DNA insertion sites, when mapped, showed a bias against predicted coding sequences. Predicted insertion mutations in genes of interest can be identified using Arabidopsis Gene Index name searches or by BLAST (Basic Local Alignment Search Tool) search. Insertions can be confirmed by simple PCR assays on individual lines. Predicted insertions were confirmed in 257 of 340 lines tested (76%). This resource has been named SAIL (Syngenta Arabidopsis Insertion Library) and is available to the scientific community at www.tmri.org. PMID:12468722
Nakagome, Mariko; Solovieva, Elena; Takahashi, Akira; Yasue, Hiroshi; Hirochika, Hirohiko; Miyao, Akio
2014-03-14
Transposition event detection of transposable element (TE) in the genome using short reads from the next-generation sequence (NGS) was difficult, because the nucleotide sequence of TE itself is repetitive, making it difficult to identify locations of its insertions by alignment programs for NGS. We have developed a program with a new algorithm to detect the transpositions from NGS data. In the process of tool development, we used next-generation sequence (NGS) data of derivative lines (ttm2 and ttm5) of japonica rice cv. Nipponbare, regenerated through cell culture. The new program, called a transposon insertion finder (TIF), was applied to detect the de novo transpositions of Tos17 in the regenerated lines. TIF searched 300 million reads of a line within 20 min, identifying 4 and 12 de novo transposition in ttm2 and ttm5 lines, respectively. All of the transpositions were confirmed by PCR/electrophoresis and sequencing. Using the program, we also detected new transposon insertions of P-element from NGS data of Drosophila melanogaster. TIF operates to find the transposition of any elements provided that target site duplications (TSDs) are generated by their transpositions.
Fomukong, N G; Tang, T H; al-Maamary, S; Ibrahim, W A; Ramayah, S; Yates, M; Zainuddin, Z F; Dale, J W
1994-12-01
DNA fingerprinting with the insertion sequence IS6110 (also known as IS986) has become established as a major tool for investigating the spread of tuberculosis. Most strains of Mycobacterium tuberculosis have multiple copies of IS6110, but a small minority carry a single copy only. We have examined selected strains from Malaysia, Tanzania and Oman, in comparison with M. bovis isolates and BCG strains carrying one or two copies of IS6110. The insertion sequence appears to be present in the same position in all these strains, which suggests that in these organisms the element is defective in transposition and that the loss of transposability may have occurred at an early stage in the evolution of the M. tuberculosis complex.
Sequence search on a supercomputer.
Gotoh, O; Tagashira, Y
1986-01-10
A set of programs was developed for searching nucleic acid and protein sequence data bases for sequences similar to a given sequence. The programs, written in FORTRAN 77, were optimized for vector processing on a Hitachi S810-20 supercomputer. A search of a 500-residue protein sequence against the entire PIR data base Ver. 1.0 (1) (0.5 M residues) is carried out in a CPU time of 45 sec. About 4 min is required for an exhaustive search of a 1500-base nucleotide sequence against all mammalian sequences (1.2M bases) in Genbank Ver. 29.0. The CPU time is reduced to about a quarter with a faster version.
Yoshida, Naohisa; Toyonaga, Takashi; Murakami, Takaaki; Hirose, Ryohei; Ogiso, Kiyoshi; Inada, Yutaka; Rani, Rafiz Abdul; Naito, Yuji; Kishimoto, Mitsuo; Ohara, Yoshiko; Azuma, Takeshi; Itoh, Yoshito
2017-01-01
With respect to the knife's design in colorectal endoscopic submucosal dissection (ESD), diameter, water jet function, and electric power are important because these relate to efficient dissection. In this study, we analyzed a novel, narrow ball tip-typed ESD knife with water jet function (Flush knife BT-S, diameter: 2.2 mm, length: 2000 mm, Fujifilm Co., Tokyo, Japan) compared to a regular diameter knife (Flush knife BT, diameter: 2.6 mm, length: 1800 mm). In laboratory and clinical research, electric power, knife insertion time, vacuum/suction amount with knife in the endoscopic channel, and water jet function were analyzed. We used a knife 2.0 mm long for BT-S and BT knives. The BT-S showed faster mean knife insertion time (sec) and better vacuum amount (ml/min) compared to the BT (insertion time: 16.7 versus 21.6, p < 0.001, vacuum amount: 38.0 versus 14.0, p < 0.01). Additionally, the water jet function of the BT-S was not inferior. In 39 colorectal ESD cases in two institutions, there were mean 4.7 times (range: 1-28) of knife insertion. Suction under knife happened 59% (23/39) and suction of fluid could be done in 100%. Our study showed that the narrow knife allows significantly faster knife insertion, better vacuum function, and effective clinical results.
Kumar, Rajesh; Grover, Sunita; Kaushik, Jai K; Batish, Virender Kumar
2014-01-01
Lactobacillus plantarum is a flexible and versatile microorganism that inhabits a variety of niches, and its genome may express up to four bsh genes to maximize its survival in the mammalian gut. However, the ecological significance of multiple bsh genes in L. plantarum is still not clearly understood. Hence, this study demonstrated the disruption of bile salt hydrolase (bsh1) gene due to the insertion of a transposable element in L. plantarum Lp20 - a wild strain of human fecal origin. Surprisingly, L. plantarum strain Lp20 produced a ∼2.0 kb bsh1 amplicon against the normal size (∼1.0 kb) bsh1 amplicon of Bsh(+)L. plantarum Lp21. Strain Lp20 exhibited minimal Bsh activity in spite of having intact bsh2, bsh3 and bsh4 genes in its genome and hence had a Bsh(-) phenotype. Cloning and sequence characterization of Lp20 bsh1 gene predicted four individual open reading frames (ORFs) within this region. BLAST analysis of ORF1 and ORF2 revealed significant sequence similarity to the L. plantarum bsh1 gene while ORF3 and ORF4 showed high sequence homology to IS30-family transposases. Since, IS30-related transposon element was inserted within Lp20 bsh1 gene in reverse orientation (3'-5'), it introduced several stop codons and disrupted the protein reading frames of both Bsh1 and transposase. Inverted terminal repeats (GGCAGATTG) of transposon, mediated its insertion at 255-263 nt and 1301-1309 nt positions of Lp20 bsh1 gene. In conclusion, insertion of IS30 related-transposon within the bsh1 gene sequence of L. plantarum strain Lp20 demolished the integrity and functionality of Bsh1 enzyme. Additionally, this transposon DNA sequence remains active among various Lactobacillus spp. and hence harbors the potential to be explored in the development of efficient insertion mutagenesis system. Copyright © 2013 Elsevier GmbH. All rights reserved.
Utilization of next generation sequencing for analyzing transgenic insertions in plum
USDA-ARS?s Scientific Manuscript database
When utilizing transgenic plants, it is useful to know how many copies of the genes were inserted and the locations of these insertions in the genome. This information can provide important insights for the interpretation of transgene expression and the resulting phenotype. Traditionally, these qu...
Aging jets from low-mass stars
NASA Technical Reports Server (NTRS)
Graham, J. A.; Chen, W. P.
1994-01-01
An extended faint optical jet is associated with the compact emission region plus faint star known as HH 55. HH 55 is located in the Lupus 2 cloud 2 min SW of the well studied T Tauri star RU Lupi. The HH 55 jet extends 55 sec N and 35 sec S in PA 160 deg. The HH 55 star is an emission line star of spectral type M3.5. Its image in the emission lines of H-alpha and (S II) is slightly elongated by 2 sec - 3 sec to the S but in continuum light is symmetrical and pointlike ((full width at half maximum) (FWHM) = 1.7 sec). The star and jet have several features in common with the star and jet known as Sz 102 = Th 28 in the nearby Lupus 3 cloud. We suggest that these objects are representative of the late evolutionary stage of the HH jet-outflow phenomenon and point out that such objects may be quite common although difficult to detect. With L(sub bol) approximately = 0.005 solar luminosity, and log T(sub e) approximately = 3.5, the HH 55 star is close to the main sequence and evolutionary tracks suggest an age of 3 x 10(exp 7) yr.
Characterization of (CA)n microsatellite repeats from large-insert clones.
Litt, M; Browne, D
2001-05-01
The most laborious part of developing (CA)n microsatellite repeats as genetic markers is constructing DNA clones to permit determination of sequences flanking the microsatellites. When cosmids or large-insert phage clones are used as primary sources of (CA)n repeat markers, they have traditionally been subcloned into plasmid vectors such as pUC18 or M13 mp 18/19 cloning vectors to obtain fragments of suitable size for DNA sequencing. This unit presents an alternative approach whereby a set of degenerate sequencing primers that anneal directly to (CA)n microsatellites can be used to determine sequences that are inaccessible with vector-derived primers. Because the primers anneal to the repeat and not to the vector, they can be used with subclones containing inserts of several kilobases and should, in theory, always give sequence in the regions directly flanking the repeat. Degeneracy at the 3 end of each of these primers prevents elongation of primers that have annealed out-of-register. The most laborious part of developing (CA)n microsatellite repeats as genetic markers is constructing DNA clones to permit.
Yoshida, Naoto; Shimura, Hanako; Masuta, Chikara
2018-06-01
Allexiviruses are economically important garlic viruses that are involved in garlic mosaic diseases. In this study, we characterized the allexivirus cysteine-rich protein (CRP) gene located just downstream of the coat protein (CP) gene in the viral genome. We determined the nucleotide sequences of the CP and CRP genes from numerous allexivirus isolates and performed a phylogenetic analysis. According to the resulting phylogenetic tree, we found that allexiviruses were clearly divided into two major groups (group I and group II) based on the sequences of the CP and CRP genes. In addition, the allexiviruses in group II had distinct sequences just before the CRP gene, while group I isolates did not. The inserted sequence between the CP and CRP genes was partially complementary to garlic 18S rRNA. Using a potato virus X vector, we showed that the CRPs affected viral accumulation and symptom induction in Nicotiana benthamiana, suggesting that the allexivirus CRP is a pathogenicity determinant. We assume that the inserted sequences before the CRP gene may have been generated during viral evolution to alter the termination-reinitiation mechanism for coupled translation of CP and CRP.
Chen, Bo-Ruei; Hale, Devin C; Ciolek, Peter J; Runge, Kurt W
2012-05-03
Barcodes are unique DNA sequence tags that can be used to specifically label individual mutants. The barcode-tagged open reading frame (ORF) haploid deletion mutant collections in the budding yeast Saccharomyces cerevisiae and the fission yeast Schizosaccharomyces pombe allow for high-throughput mutant phenotyping because the relative growth of mutants in a population can be determined by monitoring the proportions of their associated barcodes. While these mutant collections have greatly facilitated genome-wide studies, mutations in essential genes are not present, and the roles of these genes are not as easily studied. To further support genome-scale research in S. pombe, we generated a barcode-tagged fission yeast insertion mutant library that has the potential of generating viable mutations in both essential and non-essential genes and can be easily analyzed using standard molecular biological techniques. An insertion vector containing a selectable ura4+ marker and a random barcode was used to generate a collection of 10,000 fission yeast insertion mutants stored individually in 384-well plates and as six pools of mixed mutants. Individual barcodes are flanked by Sfi I recognition sites and can be oligomerized in a unique orientation to facilitate barcode sequencing. Independent genetic screens on a subset of mutants suggest that this library contains a diverse collection of single insertion mutations. We present several approaches to determine insertion sites. This collection of S. pombe barcode-tagged insertion mutants is well-suited for genome-wide studies. Because insertion mutations may eliminate, reduce or alter the function of essential and non-essential genes, this library will contain strains with a wide range of phenotypes that can be assayed by their associated barcodes. The design of the barcodes in this library allows for barcode sequencing using next generation or standard benchtop cloning approaches.
Birchler, James A; Presting, Gernot G
2012-04-01
The centromeres of most eukaryotic organisms consist of highly repetitive arrays that are similar across nonhomologous chromosomes. These sequences evolve rapidly, thus posing a mystery as to how such arrays can be homogenized. Recent work in species in which centromere-enriched retrotransposons occur indicates that these elements preferentially insert into the centromeric regions. In two different Arabidopsis species, a related element was recognized in which the specificity for such targeting was altered. These observations provide a partial explanation for how homogenization of centromere DNA sequences occurs.
Characterization of IS1515, a Functional Insertion Sequence in Streptococcus pneumoniae
Muñoz, Rosario; López, Rubens; García, Ernesto
1998-01-01
We describe the characterization of a new insertion sequence, IS1515, identified in the genome of Streptococcus pneumoniae I41R, an unencapsulated mutant isolated many years ago (R. Austrian, H. P. Bernheimer, E. E. B. Smith, and G. T. Mills, J. Exp. Med. 110:585–602, 1959). A copy of this element located in the cap1EI41R gene was sequenced. The 871-bp-long IS1515 element possesses 12-bp perfect inverted repeats and generates a 3-bp target duplication upon insertion. The IS encodes a protein of 271 amino acid residues similar to the putative transposases of other insertion sequences, namely IS1381 from S. pneumoniae, ISL2 from Lactobacillus helveticus, IS702 from the cyanobacterium Calothrix sp. strain PCC 7601, and IS112 from Streptomyces albus G. IS1515 appears to be present in the genome of most type 1 pneumococci in a maximum of 13 copies, although it has also been found in the chromosome of pneumococcal isolates belonging to other serotypes. We have found that the unencapsulated phenotype of strain I41R is the result of both the presence of an IS1515 copy and a frameshift mutation in the cap1EI41R gene. Precise excision of the IS was observed in the type 1 encapsulated transformants isolated in experiments designed to repair the frameshift. These results reveal that IS1515 behaves quite differently from other previously described pneumococcal insertion sequences. Several copies of IS1515 were also able to excise and move to another locations in the chromosome of S. pneumoniae. To our knowledge, this is the first report of a functional IS in pneumococcus. PMID:9580131
Trinh, T. Q.; Sinden, R. R.
1993-01-01
We describe a system to measure the frequency of both deletions and duplications between direct repeats. Short 17- and 18-bp palindromic and nonpalindromic DNA sequences were cloned into the EcoRI site within the chloramphenicol acetyltransferase gene of plasmids pBR325 and pJT7. This creates an insert between direct repeated EcoRI sites and results in a chloramphenicol-sensitive phenotype. Selection for chloramphenicol resistance was utilized to select chloramphenicol resistant revertants that included those with precise deletion of the insert from plasmid pBR325 and duplication of the insert in plasmid pJT7. The frequency of deletion or duplication varied more than 500-fold depending on the sequence of the short sequence inserted into the EcoRI site. For the nonpalindromic inserts, multiple internal direct repeats and the length of the direct repeats appear to influence the frequency of deletion. Certain palindromic DNA sequences with the potential to form DNA hairpin structures that might stabilize the misalignment of direct repeats had a high frequency of deletion. Other DNA sequences with the potential to form structures that might destabilize misalignment of direct repeats had a very low frequency of deletion. Duplication mutations occurred at the highest frequency when the DNA between the direct repeats contained no direct or inverted repeats. The presence of inverted repeats dramatically reduced the frequency of duplications. The results support the slippage-misalignment model, suggesting that misalignment occurring during DNA replication leads to deletion and duplication mutations. The results also support the idea that the formation of DNA secondary structures during DNA replication can facilitate and direct specific mutagenic events. PMID:8325478
Protein secretion and membrane insertion systems in gram-negative bacteria.
Saier, Milton H
2006-01-01
In contrast to other organisms, gram-negative bacteria have evolved numerous systems for protein export. Eight types are known that mediate export across or insertion into the cytoplasmic membrane, while eight specifically mediate export across or insertion into the outer membrane. Three of the former secretory pathway (SP) systems, type I SP (ISP, ABC), IIISP (Fla/Path) and IVSP (Conj/Vir), can export proteins across both membranes in a single energy-coupled step. A fourth generalized mechanism for exporting proteins across the two-membrane envelope in two distinct steps (which we here refer to as type II secretory pathways [IISP]) utilizes either the general secretory pathway (GSP or Sec) or the twin-arginine targeting translocase for translocation across the inner membrane, and either the main terminal branch or one of several protein-specific export systems for translocation across the outer membrane. We here survey the various well-characterized protein translocation systems found in living organisms and then focus on the systems present in gram-negative bacteria. Comparisons between these systems suggest specific biogenic, mechanistic and evolutionary similarities as well as major differences.
Nuclear Mitochondrial DNA Activates Replication in Saccharomyces cerevisiae
Chatre, Laurent; Ricchetti, Miria
2011-01-01
The nuclear genome of eukaryotes is colonized by DNA fragments of mitochondrial origin, called NUMTs. These insertions have been associated with a variety of germ-line diseases in humans. The significance of this uptake of potentially dangerous sequences into the nuclear genome is unclear. Here we provide functional evidence that sequences of mitochondrial origin promote nuclear DNA replication in Saccharomyces cerevisiae. We show that NUMTs are rich in key autonomously replicating sequence (ARS) consensus motifs, whose mutation results in the reduction or loss of DNA replication activity. Furthermore, 2D-gel analysis of the mrc1 mutant exposed to hydroxyurea shows that several NUMTs function as late chromosomal origins. We also show that NUMTs located close to or within ARS provide key sequence elements for replication. Thus NUMTs can act as independent origins, when inserted in an appropriate genomic context or affect the efficiency of pre-existing origins. These findings show that migratory mitochondrial DNAs can impact on the replication of the nuclear region they are inserted in. PMID:21408151
Nuclear mitochondrial DNA activates replication in Saccharomyces cerevisiae.
Chatre, Laurent; Ricchetti, Miria
2011-03-08
The nuclear genome of eukaryotes is colonized by DNA fragments of mitochondrial origin, called NUMTs. These insertions have been associated with a variety of germ-line diseases in humans. The significance of this uptake of potentially dangerous sequences into the nuclear genome is unclear. Here we provide functional evidence that sequences of mitochondrial origin promote nuclear DNA replication in Saccharomyces cerevisiae. We show that NUMTs are rich in key autonomously replicating sequence (ARS) consensus motifs, whose mutation results in the reduction or loss of DNA replication activity. Furthermore, 2D-gel analysis of the mrc1 mutant exposed to hydroxyurea shows that several NUMTs function as late chromosomal origins. We also show that NUMTs located close to or within ARS provide key sequence elements for replication. Thus NUMTs can act as independent origins, when inserted in an appropriate genomic context or affect the efficiency of pre-existing origins. These findings show that migratory mitochondrial DNAs can impact on the replication of the nuclear region they are inserted in.
Hamilton, P T; Reeve, J N
1985-01-01
DNA fragments cloned from the methanogenic archaebacterium Methanobrevibacter smithii which complement mutations in the purE and proC genes of E. coli have been sequenced. Sequence analyses, transposon mutagenesis and expression in E. coli minicells indicate that purE and proC complementations result from the synthesis of M. smithii polypeptides with molecular weights of 36,697 and 27,836 respectively. The encoding genes appear to be located in operons. The M. smithii genome contains 69% A/T basepairs (bp) which is reflected in unusual codon usages and intergenic regions containing approximately 85% A/T bp. An insertion element, designated ISM1, was found within the cloned M. smithii DNA located adjacent to the proC complementing region. ISM1 is 1381 bp in length, has 29 bp terminal inverted repeat sequences and contains one major ORF encoded in 87% of the ISM1 sequence. ISM1 is mobile, present in approximately 10 copies per genome and integration duplicates 8 bp at the site of insertion. The duplicated sequences show homology with sequences within the 29 bp terminal repeat sequence of ISM1. Comparison of our data with sequences from halophilic archaebacteria suggests that 5'GAANTTTCA and 5'TTTTAATATAAA may be consensus promoter sequences for archaebacteria. These sequences closely resemble the consensus sequences which precede Drosophila heat-shock genes (Pelham 1982; Davidson et al. 1983). Methanogens appear to employ the eubacterial system of mRNA: 16SrRNA hybridization to ensure initiation of translation; the consensus ribosome binding sequence is 5'AGGTGA.
NASA Astrophysics Data System (ADS)
Omidvari, Negar; Topping, Geoffrey; Cabello, Jorge; Paul, Stephan; Schwaiger, Markus; Ziegler, Sibylle I.
2018-05-01
Compromises in the design of a positron emission tomography (PET) insert for a magnetic resonance imaging (MRI) system should minimize the deterioration of image quality in both modalities, particularly when simultaneous demanding acquisitions are performed. In this work, the advantages of using individually read-out crystals with high-gain silicon photomultipliers (SiPMs) were studied with a small animal PET insert for a 7 T MRI system, in which the SiPM charge was transferred to outside the MRI scanner using coaxial cables. The interferences between the two systems were studied with three radio-frequency (RF) coil configurations. The effects of PET on the static magnetic field, flip angle distribution, RF noise, and image quality of various MRI sequences (gradient echo, spin echo, and echo planar imaging (EPI) at 1H frequency, and chemical shift imaging at 13C frequency) were investigated. The effects of fast-switching gradient fields and RF pulses on PET count rate were studied, while the PET insert and the readout electronics were not shielded. Operating the insert inside a 1H volume coil, used for RF transmission and reception, limited the MRI to T1-weighted imaging, due to coil detuning and RF attenuation, and resulted in significant PET count loss. Using a surface receive coil allowed all tested MR sequences to be used with the insert, with 45–59% signal-to-noise ratio (SNR) degradation, compared to without PET. With a 1H/13C volume coil inside the insert and shielded by a copper tube, the SNR degradation was limited to 23–30% with all tested sequences. The insert did not introduce any discernible distortions into images of two tested EPI sequences. Use of truncated sinc shaped RF excitation pulses and gradient field switching had negligible effects on PET count rate. However, PET count rate was substantially affected by high-power RF block pulses and temperature variations due to high gradient duty cycles.
Bakker, Theo C M; Giger, Thomas; Frommen, Joachim G; Largiadèr, Carlo R
2017-08-01
There is a need for rapid and reliable molecular sexing of three-spined sticklebacks, Gasterosteus aculeatus, the supermodel species for evolutionary biology. A DNA region at the 5' end of the sex-linked microsatellite Gac4202 was sequenced for the X chromosome of six females and the Y chromosome of five males from three populations. The Y chromosome contained two large insertions, which did not recombine with the phenotype of sex in a cross of 322 individuals. Genetic variation (SNPs and indels) within the insertions was smaller than on flanking DNA sequences. Three molecular PCR-based sex tests were developed, in which the first, the second or both insertions were covered. In five European populations (from DE, CH, NL, GB) of three-spined sticklebacks, tests with both insertions combined showed two clearly separated bands on agarose minigels in males and one band in females. The tests with the separate insertions gave similar results. Thus, the new molecular sexing method gave rapid and reliable results for sexing three-spined sticklebacks and is an improvement and/or alternative to existing methods.
Pseudomonas cepacia strain AC1100, capable of growth on 2,4,5-trichlorophenoxyacetic acid (2,4,5-T), was mutated to the 2,4,5-T− strain PT88 by a ColE1 :: Tn5 chromosomal insertion. Using cloned DNA from the region flanking the insertion, a 1477-bp sequence (designated RS1100) wa...
Müller, G; Zimmermann, R
1987-01-01
Honeybee prepromelittin is correctly processed and imported by dog pancreas microsomes. Insertion of prepromelittin into microsomal membranes, as assayed by signal sequence removal, does not depend on signal recognition particle (SRP) and docking protein. We addressed the question as to how prepromelittin bypasses the SRP/docking protein system. Hybrid proteins between prepromelittin, or carboxy-terminally truncated derivatives, and the cytoplasmic protein dihydrofolate reductase from mouse were constructed. These hybrid proteins were analysed for membrane insertion and sequestration into microsomes. The results suggest the following: (i) The signal sequence of prepromelittin is capable of interacting with the SRP/docking protein system, but this interaction is not mandatory for membrane insertion; this is related to the small size of prepromelittin. (ii) In prepromelittin a cluster of negatively charged amino acids must be balanced by a cluster of positively charged amino acids in order to allow membrane insertion. (iii) In general, a signal sequence can be sufficient to mediate membrane insertion independently of SRP and docking protein in the case of short precursor proteins; however, the presence and distribution of charged amino acids within the mature part of these precursors can play distinct roles. Images Fig. 3. Fig. 4. Fig. 5. Fig. 6. Fig. 7. Fig. 8. Fig. 9. PMID:2820722
Guérillot, Romain; Siguier, Patricia; Gourbeyre, Edith; Chandler, Michael; Glaser, Philippe
2014-01-01
Transposable elements (TEs) are major components of both prokaryotic and eukaryotic genomes and play a significant role in their evolution. In this study, we have identified new prokaryotic DDE transposase families related to the eukaryotic Mutator-like transposases. These genes were retrieved by cascade PSI-Blast using as initial query the transposase of the streptococcal integrative and conjugative element (ICE) TnGBS2. By combining secondary structure predictions and protein sequence alignments, we predicted the DDE catalytic triad and the DNA-binding domain recognizing the terminal inverted repeats. Furthermore, we systematically characterized the organization and the insertion specificity of the TEs relying on these prokaryotic Mutator-like transposases (p-MULT) for their mobility. Strikingly, two distant TE families target their integration upstream σA dependent promoters. This allowed us to identify a transposase sequence signature associated with this unique insertion specificity and to show that the dissymmetry between the two inverted repeats is responsible for the orientation of the insertion. Surprisingly, while DDE transposases are generally associated with small and simple transposons such as insertion sequences (ISs), p-MULT encoding TEs show an unprecedented diversity with several families of IS, transposons, and ICEs ranging in size from 1.1 to 52 kb. PMID:24418649
Venken, Koen J. T.; Schulze, Karen L.; Haelterman, Nele A.; Pan, Hongling; He, Yuchun; Evans-Holm, Martha; Carlson, Joseph W.; Levis, Robert W.; Spradling, Allan C.; Hoskins, Roger A.; Bellen, Hugo J.
2011-01-01
We demonstrate the versatility of a collection of insertions of the transposon Minos mediated integration cassette (MiMIC), in Drosophila melanogaster. MiMIC contains a gene-trap cassette and the yellow+ marker flanked by two inverted bacteriophage ΦC31 attP sites. MiMIC integrates almost at random in the genome to create sites for DNA manipulation. The attP sites allow the replacement of the intervening sequence of the transposon with any other sequence through recombinase mediated cassette exchange (RMCE). We can revert insertions that function as gene traps and cause mutant phenotypes to wild type by RMCE and modify insertions to control GAL4 or QF overexpression systems or perform lineage analysis using the Flp system. Insertions within coding introns can be exchanged with protein-tag cassettes to create fusion proteins to follow protein expression and perform biochemical experiments. The applications of MiMIC vastly extend the Drosophila melanogaster toolkit. PMID:21985007
Active role of a human genomic insert in replication of a yeast artificial chromosome.
van Brabant, A J; Fangman, W L; Brewer, B J
1999-06-01
Yeast artificial chromosomes (YACs) are a common tool for cloning eukaryotic DNA. The manner by which large pieces of foreign DNA are assimilated by yeast cells into a functional chromosome is poorly understood, as is the reason why some of them are stably maintained and some are not. We examined the replication of a stable YAC containing a 240-kb insert of DNA from the human T-cell receptor beta locus. The human insert contains multiple sites that serve as origins of replication. The activity of these origins appears to require the yeast ARS consensus sequence and, as with yeast origins, additional flanking sequences. In addition, the origins in the human insert exhibit a spacing, a range of activation efficiencies, and a variation in times of activation during S phase similar to those found for normal yeast chromosomes. We propose that an appropriate combination of replication origin density, activation times, and initiation efficiencies is necessary for the successful maintenance of YAC inserts.
Lesmana, Harry; Dyer, Lisa; Li, Xia; Denton, James; Griffiths, Jenna; Chonat, Satheesh; Seu, Katie G; Heeney, Matthew M; Zhang, Kejian; Hopkin, Robert J; Kalfa, Theodosia A
2018-03-01
Pyruvate kinase deficiency (PKD) is the most frequent red blood cell enzyme abnormality of the glycolytic pathway and the most common cause of hereditary nonspherocytic hemolytic anemia. Over 250 PKLR-gene mutations have been described, including missense/nonsense, splicing and regulatory mutations, small insertions, small and gross deletions, causing PKD and hemolytic anemia of variable severity. Alu retrotransposons are the most abundant mobile DNA sequences in the human genome, contributing to almost 11% of its mass. Alu insertions have been associated with a number of human diseases either by disrupting a coding region or a splice signal. Here, we report on two unrelated Middle Eastern patients, both born from consanguineous parents, with transfusion-dependent hemolytic anemia, where sequence analysis revealed a homozygous insertion of AluYb9 within exon 6 of the PKLR gene, causing precipitous decrease of PKLR RNA levels. This Alu element insertion consists a previously unrecognized mechanism underlying pathogenesis of PKD. © 2017 Wiley Periodicals, Inc.
Mechanism for DNA transposons to generate introns on genomic scales
Huff, Jason T.; Zilberman, Daniel; Roy, Scott W.
2017-01-01
Discovered four decades ago, the existence of introns was one of the most unexpected findings in molecular biology1. Introns are sequences interrupting genes that must be removed as part of mRNA production. Genome sequencing projects have documented that most eukaryotic genes contain at least one and frequently many introns2,3. Comparison of these genomes reveals a history of long evolutionary periods with little intron gain punctuated by episodes of rapid, extensive gain2,3. However, no detailed mechanism for such episodic intron generation has been empirically supported on a sufficient scale, despite several proposals4–8. Here we show how short non-autonomous DNA transposons independently generated hundreds to thousands of introns in the prasinophyte Micromonas pusilla and the pelagophyte Aureococcus anophagefferens. Each transposon carries one splice site. The other splice site is co-opted from gene sequence duplicated upon transposon insertion, allowing perfect splicing out of RNA. The distributions of sequences that can be co-opted are biased with respect to codons, and phasing of transposon-generated introns is similarly biased. These transposons insert between preexisting nucleosomes, so that multiple nearby insertions generate nucleosome-sized intervening segments. Thus, transposon insertion and sequence co-option may explain the intron phase biases2 and prevalence of nucleosome-sized exons9 observed in eukaryotes. Overall, the two independent examples of proliferating elements illustrate a general DNA transposon mechanism plausibly accounting for episodes of rapid, extensive intron gain during eukaryotic evolution2,3. PMID:27760113
Zhang, Xiaobing; Tang, Qiaoling; Wang, Xujing; Wang, Zhixing
2016-01-01
In this study, the flanking sequence of an inserted fragment conferring glyphosate tolerance on transgenic cotton line BG2-7 was analyzed by thermal asymmetric interlaced polymerase chain reaction (TAIL-PCR) and standard PCR. The results showed apparent insertion of the exogenous gene into chromosome D10 of the Gossypium hirsutum L. genome, as the left and right borders of the inserted fragment are nucleotides 61,962,952 and 61,962,921 of chromosome D10, respectively. In addition, a 31-bp cotton microsatellite sequence was noted between the genome sequence and the 5' end of the exogenous gene. In total, 84 and 298 bp were deleted from the left and right borders of the exogenous gene, respectively, with 30 bp deleted from the cotton chromosome at the insertion site. According to the flanking sequence obtained, several pairs of event-specific detection primers were designed to amplify sequence between the 5' end of the exogenous gene and the cotton genome junction region as well as between the 3' end and the cotton genome junction region. Based on screening tests, the 5'-end primers GTCATAACGTGACTCCCTTAATTCTCC/CCTATTACACGGCTATGC and 3'-end primers TCCTTTCGCTTTCTTCCCTT/ACACTTACATGGCGTCTTCT were used to detect the respective BG2-7 event-specific primers. The limit of detection of the former primers reached 44 copies, and that of the latter primers reached 88 copies. The results of this study provide useful data for assessment of BG2-7 safety and for accelerating its industrialization.
A Predictive Model of Intein Insertion Site for Use in the Engineering of Molecular Switches
Apgar, James; Ross, Mary; Zuo, Xiao; Dohle, Sarah; Sturtevant, Derek; Shen, Binzhang; de la Vega, Humberto; Lessard, Philip; Lazar, Gabor; Raab, R. Michael
2012-01-01
Inteins are intervening protein domains with self-splicing ability that can be used as molecular switches to control activity of their host protein. Successfully engineering an intein into a host protein requires identifying an insertion site that permits intein insertion and splicing while allowing for proper folding of the mature protein post-splicing. By analyzing sequence and structure based properties of native intein insertion sites we have identified four features that showed significant correlation with the location of the intein insertion sites, and therefore may be useful in predicting insertion sites in other proteins that provide native-like intein function. Three of these properties, the distance to the active site and dimer interface site, the SVM score of the splice site cassette, and the sequence conservation of the site showed statistically significant correlation and strong predictive power, with area under the curve (AUC) values of 0.79, 0.76, and 0.73 respectively, while the distance to secondary structure/loop junction showed significance but with less predictive power (AUC of 0.54). In a case study of 20 insertion sites in the XynB xylanase, two features of native insertion sites showed correlation with the splice sites and demonstrated predictive value in selecting non-native splice sites. Structural modeling of intein insertions at two sites highlighted the role that the insertion site location could play on the ability of the intein to modulate activity of the host protein. These findings can be used to enrich the selection of insertion sites capable of supporting intein splicing and hosting an intein switch. PMID:22649521
Insertion sequences enrichment in extreme Red sea brine pool vent.
Elbehery, Ali H A; Aziz, Ramy K; Siam, Rania
2017-03-01
Mobile genetic elements are major agents of genome diversification and evolution. Limited studies addressed their characteristics, including abundance, and role in extreme habitats. One of the rare natural habitats exposed to multiple-extreme conditions, including high temperature, salinity and concentration of heavy metals, are the Red Sea brine pools. We assessed the abundance and distribution of different mobile genetic elements in four Red Sea brine pools including the world's largest known multiple-extreme deep-sea environment, the Red Sea Atlantis II Deep. We report a gradient in the abundance of mobile genetic elements, dramatically increasing in the harshest environment of the pool. Additionally, we identified a strong association between the abundance of insertion sequences and extreme conditions, being highest in the harshest and deepest layer of the Red Sea Atlantis II Deep. Our comparative analyses of mobile genetic elements in secluded, extreme and relatively non-extreme environments, suggest that insertion sequences predominantly contribute to polyextremophiles genome plasticity.
Kim, Shin-Hee; Nayak, Subhashree; Paldurai, Anandan; Nayak, Baibaswata; Samuel, Arthur; Aplogan, Gilbert L.; Awoume, Kodzo A.; Webby, Richard J.; Ducatez, Mariette F.; Collins, Peter L.
2012-01-01
The complete genome sequence of an African Newcastle disease virus (NDV) strain isolated from a chicken in Togo in 2009 was determined. The genome is 15,198 nucleotides (nt) in length and is classified in genotype VII in the class II cluster. Compared to common vaccine strains, the African strain contains a previously described 6-nt insert in the downstream untranslated region of the N gene and a novel 6-nt insert in the HN-L intergenic region. Genome length differences are a marker of the natural history of NDV. This is the first description of a class II NDV strain with a genome of 15,198 nt and a 6-nt insert in the HN-L intergenic region. Sequence divergence relative to vaccine strains was substantial, likely contributes to outbreaks, and illustrates the continued evolution of new NDV strains in West Africa. PMID:22997417
Phumthanakorn, Nathita; Fungwithaya, Punpichaya; Chanchaithong, Pattrarat; Prapasarakul, Nuvee
2018-06-01
This study aimed to detect and identify staphylococcal enterotoxin (SE) genes in methicillin-resistant Staphylococcus pseudintermedius (MRSP) strains from different sources, and to investigate the relationship between their sequence types (STs) and SE gene patterns. The profiles of 17 SE genes in 93 MRSP strains isolated from dogs (n=43), humans (n=18) and the environment (n=32) were detected by PCR. Multilocus sequence typing (MLST), SCCmec typing and pulsed-field gel electrophoresis (PFGE) were used to analyse the clonal relatedness between the molecular type and SE gene profiles.Results/Key findings. The human MRSP strains harboured the greatest number of SE genes (12/17; sea, sec, seg, sei, sek, sel, sem, sen, seo, sep, seq and tst-1) compared to those from dogs (5/17; sec, sel, sem, seq and tst-1) and environmental sources (3/17; sec, seq and tst-1). Using MLST and PFGE, different SE gene profiles were found within the same clonal type. We show that isolates of MRSP vary in their virulence gene profiles, depending on the source from which they have been isolated. This insight should encourage the development of appropriate monitoring and mitigation strategies to reduce the transmission of MRSP in veterinary hospitals and households.
Peck, Kyong Ran; Baek, Jin Yang; Song, Jae-Hoon
2009-01-01
In this study, we investigated the genetic background of 70 Staphylococcus aureus isolates (36 methicillin-resistant S. aureus [MRSA] and 34 methicillin-susceptible S. aureus [MSSA]) obtained from blood at a Korean tertiary-care hospital, using spa typing, multilocus sequence typing, and SCCmec typing. In addition, the prevalence of enterotoxin (sea, seb, sec, sed, see, seg, seh, sei, and sek), tst, and pvl genes among the samples was assessed via polymerase chain reaction, and the results were compared with those of 95 isolates of S. aureus obtained from nasal swabs. All MRSA isolates from blood, except one, belonged to three major clones: sequence type (ST)5-MRSA-II, ST72-MRSA-II (or IVA), and ST239-MRSA-III, among which ST5-MRSA-II was the predominant clone. The prevalence of enterotoxin genes in the S. aureus isolates obtained from blood differed significantly from those from the nasal swabs for the sea, seb, sec, and seh gene. In particular, the seb and sec genes were detected exclusively in the MRSA isolates of ST5 or spa-CC002, thereby suggesting the co-adaptation of virulence genes with the genetic background and their contribution to biological fitness. PMID:19654937
Blanchard, Adam M.; Egan, Sharon A.; Emes, Richard D.; Warry, Andrew; Leigh, James A.
2016-01-01
The Pragmatic Insertional Mutation Mapping (PIMMS) laboratory protocol was developed alongside various bioinformatics packages (Blanchard et al., 2015) to enable detection of essential and conditionally essential genes in Streptococcus and related bacteria. This extended the methodology commonly used to locate insertional mutations in individual mutants to the analysis of mutations in populations of bacteria. In Streptococcus uberis, a pyogenic Streptococcus associated with intramammary infection and mastitis in ruminants, the mutagen pGhost9:ISS1 was shown to integrate across the entire genome. Analysis of >80,000 mutations revealed 196 coding sequences, which were not be mutated and a further 67 where mutation only occurred beyond the 90th percentile of the coding sequence. These sequences showed good concordance with sequences within the database of essential genes and typically matched sequences known to be associated with basic cellular functions. Due to the broad utility of this mutagen and the simplicity of the methodology it is anticipated that PIMMS will be of value to a wide range of laboratories in functional genomic analysis of a wide range of Gram positive bacteria (Streptococcus, Enterococcus, and Lactococcus) of medical, veterinary, and industrial significance. PMID:27826289
A Sequence of Sorting Strategies.
ERIC Educational Resources Information Center
Duncan, David R.; Litwiller, Bonnie H.
1984-01-01
Describes eight increasingly sophisticated and efficient sorting algorithms including linear insertion, binary insertion, shellsort, bubble exchange, shakersort, quick sort, straight selection, and tree selection. Provides challenges for the reader and the student to program these efficiently. (JM)
Inada, Yutaka; Rani, Rafiz Abdul; Naito, Yuji; Azuma, Takeshi; Itoh, Yoshito
2017-01-01
Backgrounds With respect to the knife's design in colorectal endoscopic submucosal dissection (ESD), diameter, water jet function, and electric power are important because these relate to efficient dissection. In this study, we analyzed a novel, narrow ball tip-typed ESD knife with water jet function (Flush knife BT-S, diameter: 2.2 mm, length: 2000 mm, Fujifilm Co., Tokyo, Japan) compared to a regular diameter knife (Flush knife BT, diameter: 2.6 mm, length: 1800 mm). Methods In laboratory and clinical research, electric power, knife insertion time, vacuum/suction amount with knife in the endoscopic channel, and water jet function were analyzed. We used a knife 2.0 mm long for BT-S and BT knives. Results The BT-S showed faster mean knife insertion time (sec) and better vacuum amount (ml/min) compared to the BT (insertion time: 16.7 versus 21.6, p < 0.001, vacuum amount: 38.0 versus 14.0, p < 0.01). Additionally, the water jet function of the BT-S was not inferior. In 39 colorectal ESD cases in two institutions, there were mean 4.7 times (range: 1–28) of knife insertion. Suction under knife happened 59% (23/39) and suction of fluid could be done in 100%. Conclusions Our study showed that the narrow knife allows significantly faster knife insertion, better vacuum function, and effective clinical results. PMID:29081793
Weiser, Keith C.; Liu, Bin; Hansen, Gwenn M.; Skapura, Darlene; Hentges, Kathryn E.; Yarlagadda, Sujatha; Morse III, Herbert C.
2007-01-01
AKXD recombinant inbred (RI) strains develop a variety of leukemias and lymphomas due to somatically acquired insertions of retroviral DNA into the genome of hematopoetic cells that can mutate cellular proto-oncogenes and tumor suppressor genes. We generated a new set of tumors from nine AKXD RI strains selected for their propensity to develop B-cell tumors, the most common type of human hematopoietic cancers. We employed a PCR technique called viral insertion site amplification (VISA) to rapidly isolate genomic sequence at the site of provirus insertion. Here we describe 550 VISA sequence tags (VSTs) that identify 74 common insertion sites (CISs), of which 21 have not been identified previously. Several suspected proto-oncogenes and tumor suppressor genes lie near CISs, providing supportive evidence for their roles in cancer. Furthermore, numerous previously uncharacterized genes lie near CISs, providing a pool of candidate disease genes for future research. Pathway analysis of candidate genes identified several signaling pathways as common and powerful routes to blood cancer, including Notch, E-protein, NFκB, and Ras signaling. Misregulation of several Notch signaling genes was confirmed by quantitative RT-PCR. Our data suggest that analyses of insertional mutagenesis on a single genetic background are biased toward the identification of cooperating mutations. This tumor collection represents the most comprehensive study of the genetics of B-cell leukemia and lymphoma development in mice. We have deposited the VST sequences, CISs in a genome viewer, histopathology, and molecular tumor typing data in a public web database called VISION (Viral Insertion Sites Identifying Oncogenes), which is located at http://www.mouse-genome.bcm.tmc.edu/vision. PMID:17926094
Weiser, Keith C; Liu, Bin; Hansen, Gwenn M; Skapura, Darlene; Hentges, Kathryn E; Yarlagadda, Sujatha; Morse Iii, Herbert C; Justice, Monica J
2007-10-01
AKXD recombinant inbred (RI) strains develop a variety of leukemias and lymphomas due to somatically acquired insertions of retroviral DNA into the genome of hematopoetic cells that can mutate cellular proto-oncogenes and tumor suppressor genes. We generated a new set of tumors from nine AKXD RI strains selected for their propensity to develop B-cell tumors, the most common type of human hematopoietic cancers. We employed a PCR technique called viral insertion site amplification (VISA) to rapidly isolate genomic sequence at the site of provirus insertion. Here we describe 550 VISA sequence tags (VSTs) that identify 74 common insertion sites (CISs), of which 21 have not been identified previously. Several suspected proto-oncogenes and tumor suppressor genes lie near CISs, providing supportive evidence for their roles in cancer. Furthermore, numerous previously uncharacterized genes lie near CISs, providing a pool of candidate disease genes for future research. Pathway analysis of candidate genes identified several signaling pathways as common and powerful routes to blood cancer, including Notch, E-protein, NFkappaB, and Ras signaling. Misregulation of several Notch signaling genes was confirmed by quantitative RT-PCR. Our data suggest that analyses of insertional mutagenesis on a single genetic background are biased toward the identification of cooperating mutations. This tumor collection represents the most comprehensive study of the genetics of B-cell leukemia and lymphoma development in mice. We have deposited the VST sequences, CISs in a genome viewer, histopathology, and molecular tumor typing data in a public web database called VISION (Viral Insertion Sites Identifying Oncogenes), which is located at http://www.mouse-genome.bcm.tmc.edu/vision .
Analysis of seismic body waves excited by the Mount Saint Helens eruption of May 18, 1980
NASA Technical Reports Server (NTRS)
Kanamori, H.; Given, J. W.; Lay, T.
1982-01-01
Seismic body waves which were excited by eruption of Mt. St. Helens, and recorded by the Global Digital Seismographic Network (GDSN) stations are analyzed to determine the nature and the time sequence of the events associated with the eruption. The polarity of teleseismic P waves (period 20 sec) is identical at six stations which are distributed over a wide azimuthal range. This observation, together with a very small S to P amplitude ratio (at 20 sec), suggests that the source is a nearly vertical single force that represents the counter force of the eruption. The time history of the vertical force suggests two distinct groups of events, about two minutes apart, each consisting of several subevents with a duration of about 25 sec. The magnitude of the force is approximately 2.6 to the 17th power dyne. this vertical force is in contrast with the long period (approximately 150 sec) southward horizontal single force which was determined by a previous study and interpreted to be due to the massive landslide.
First results on quiet and magnetic granulation from SOUP
NASA Technical Reports Server (NTRS)
Title, A. M.; Tarbell, T. D.; Acton, L.; Duncan, D.; Ferguson, S. H.; Finch, M.; Frank, Z.; Kelly, G.; Lindgren, R.; Morrill, M.
1987-01-01
The flight of Solar Optical Universal Polarimeter (SOUP) on Spacelab 2 allowed the collection of time sequences of diffraction limited (0.5 arc sec) granulation images with excellent pointing (0.003 arc sec) and completely free of the distortion that plagues groundbased images. The p-mode oscillations are clearly seen in the data. Using Fourier transforms in the temporal and spatial domain, it was shown that the p-modes dominate the autocorrelation lifetime in magnetic regions. When these oscillations are removed the autocorrelation lifetime is found to be 500 sec in quiet and 950 sec in magnetic regions. In quiet areas exploding granules are seen to be common. It is speculated that a significant fraction of granule lifetimes are terminated by nearby explosions. Using local correlation tracking techniques it was able to measure horizontal displacements, and thus transverse velocities, in the magnetic field. In quiet sun it is possible to detect both super and mesogranulation. Horizontal velocities are as great as 1000 m/s and the average velocity is 400 m/s. In magnetic regions horizontal velocities are much less, about 100 m/s.
First results on quiet and magnetic granulation from SOUP
NASA Astrophysics Data System (ADS)
Title, A. M.; Tarbell, T. D.; Acton, L.; Duncan, D.; Ferguson, S. H.; Finch, M.; Frank, Z.; Kelly, G.; Lindgren, R.; Morrill, M.
1987-09-01
The flight of Solar Optical Universal Polarimeter (SOUP) on Spacelab 2 allowed the collection of time sequences of diffraction limited (0.5 arc sec) granulation images with excellent pointing (0.003 arc sec) and completely free of the distortion that plagues groundbased images. The p-mode oscillations are clearly seen in the data. Using Fourier transforms in the temporal and spatial domain, it was shown that the p-modes dominate the autocorrelation lifetime in magnetic regions. When these oscillations are removed the autocorrelation lifetime is found to be 500 sec in quiet and 950 sec in magnetic regions. In quiet areas exploding granules are seen to be common. It is speculated that a significant fraction of granule lifetimes are terminated by nearby explosions. Using local correlation tracking techniques it was able to measure horizontal displacements, and thus transverse velocities, in the magnetic field. In quiet sun it is possible to detect both super and mesogranulation. Horizontal velocities are as great as 1000 m/s and the average velocity is 400 m/s. In magnetic regions horizontal velocities are much less, about 100 m/s.
Phylogenetic Placement of Exact Amplicon Sequences Improves Associations with Clinical Information
McDonald, Daniel; Gonzalez, Antonio; Navas-Molina, Jose A.; Jiang, Lingjing; Xu, Zhenjiang Zech; Winker, Kevin; Kado, Deborah M.; Orwoll, Eric; Manary, Mark; Mirarab, Siavash
2018-01-01
ABSTRACT Recent algorithmic advances in amplicon-based microbiome studies enable the inference of exact amplicon sequence fragments. These new methods enable the investigation of sub-operational taxonomic units (sOTU) by removing erroneous sequences. However, short (e.g., 150-nucleotide [nt]) DNA sequence fragments do not contain sufficient phylogenetic signal to reproduce a reasonable tree, introducing a barrier in the utilization of critical phylogenetically aware metrics such as Faith’s PD or UniFrac. Although fragment insertion methods do exist, those methods have not been tested for sOTUs from high-throughput amplicon studies in insertions against a broad reference phylogeny. We benchmarked the SATé-enabled phylogenetic placement (SEPP) technique explicitly against 16S V4 sequence fragments and showed that it outperforms the conceptually problematic but often-used practice of reconstructing de novo phylogenies. In addition, we provide a BSD-licensed QIIME2 plugin (https://github.com/biocore/q2-fragment-insertion) for SEPP and integration into the microbial study management platform QIITA. IMPORTANCE The move from OTU-based to sOTU-based analysis, while providing additional resolution, also introduces computational challenges. We demonstrate that one popular method of dealing with sOTUs (building a de novo tree from the short sequences) can provide incorrect results in human gut metagenomic studies and show that phylogenetic placement of the new sequences with SEPP resolves this problem while also yielding other benefits over existing methods. PMID:29719869
Further exploration of MRI techniques for liver T1rho quantification.
Zhao, Feng; Yuan, Jing; Deng, Min; Lu, Pu-Xuan; Ahuja, Anil T; Wang, Yi-Xiang J
2013-12-01
With biliary duct ligation and CCl4 induced rat liver fibrosis models, recent studies showed that MR T1rho imaging is able to detect liver fibrosis, and the degree of fibrosis is correlated with the degree of elevation of the T1rho measurements, suggesting liver T1rho quantification may play an important role for liver fibrosis early detection and grading. It has also been reported it is feasible to obtain consistent liver T1rho measurement for human subjects at 3 Tesla (3 T), and preliminary clinical data suggest liver T1rho is increased in patients with cirrhosis. In these previous studies, T1rho imaging was used with the rotary-echo spin-lock pulse for T1rho preparation, and number of signal averaging (NSA) was 2. Due to the presence of inhomogeneous B0 field, artifacts may occur in the acquired T1rho-weighted images. The method described by Dixon et al. (Magn Reson Med 1996;36:90-4), which is a hard RF pulse with 135° flip angle and same RF phase as the spin-locking RF pulse is inserted right before and after the spin-locking RF pulse, has been proposed to reduce sensitivity to B0 field inhomogeneity in T1rho imaging. In this study, we compared the images scanned by rotary-echo spin-lock pulse method (sequence 1) and the pulse modified according to Dixon method (sequence 2). When the artifacts occurred in T1rho images, we repeated the same scan until satisfactory. We accepted images if artifact in liver was less than 10% of liver area by visual estimation. When NSA =2, the breath-holding duration for data acquisition of one slice scanning was 8 sec due to a delay time of 6,000 ms for magnetization restoration. If NSA =1, the duration was shortened to be 2 sec. In previous studies, manual region of interest (ROI) analysis of T1rho map was used. In this current study, histogram analysis was also applied to evaluate liver T1rho value on T1rho maps. MRI data acquisition was performed on a 3 T clinical scanner. There were 29 subjects with 61 examinations obtained. Liver T1rho values obtained by sequence 1 (NSA =2) and sequence 2 (NSA =2) showed similar values, i.e., 43.1±2.1 ms (range: 38.6-48.0 ms, n=40 scans) vs. 43.5±2.5 ms (range: 39.0-47.7 ms, n=12 scans, P=0.74) respectively. For the six volunteers scanned with both sequences in one session, the intraclass correlation coefficient (ICC) was 0.939. Overall, the success rate of obtaining satisfactory images per acquisition was slightly over 50% for both sequence 1 and sequence 2. Satisfactory images can usually be obtained by asking the volunteer subjects to better hold their breath. However, sequence 2 did not increase the scan success rate. For the nine subjects scanned by sequence 2 with both NSA =2 and NSA =1 during one session, the ICC was 0.274, demonstrated poor agreement. T1rho measurement by ROI method and histogram had an ICC of 0.901 (P>0.05), demonstrated very good agreement. We conclude that by including 135° flip angle before and after the spin-locking RF pulse, the rate of artifacts occurring did not decrease. On the other hand, sequence 1 and sequence 2 measured similar T1rho value in healthy liver. While reducing the breath-holding duration significantly, NSA =1 did not offer satisfactory signal-to-noise ratio. Histogram measurement can be adopted for future studies.
An, Z; Tang, Z; Ma, B; Mason, A S; Guo, Y; Yin, J; Gao, C; Wei, L; Li, J; Fu, D
2014-07-01
Although many studies have shown that transposable element (TE) activation is induced by hybridisation and polyploidisation in plants, much less is known on how different types of TE respond to hybridisation, and the impact of TE-associated sequences on gene function. We investigated the frequency and regularity of putative transposon activation for different types of TE, and determined the impact of TE-associated sequence variation on the genome during allopolyploidisation. We designed different types of TE primers and adopted the Inter-Retrotransposon Amplified Polymorphism (IRAP) method to detect variation in TE-associated sequences during the process of allopolyploidisation between Brassica rapa (AA) and Brassica oleracea (CC), and in successive generations of self-pollinated progeny. In addition, fragments with TE insertions were used to perform Blast2GO analysis to characterise the putative functions of the fragments with TE insertions. Ninety-two primers amplifying 548 loci were used to detect variation in sequences associated with four different orders of TE sequences. TEs could be classed in ascending frequency into LTR-REs, TIRs, LINEs, SINEs and unknown TEs. The frequency of novel variation (putative activation) detected for the four orders of TEs was highest from the F1 to F2 generations, and lowest from the F2 to F3 generations. Functional annotation of sequences with TE insertions showed that genes with TE insertions were mainly involved in metabolic processes and binding, and preferentially functioned in organelles. TE variation in our study severely disturbed the genetic compositions of the different generations, resulting in inconsistencies in genetic clustering. Different types of TE showed different patterns of variation during the process of allopolyploidisation. © 2013 German Botanical Society and The Royal Botanical Society of the Netherlands.
Evolutionary genomics of miniature inverted-repeat transposable elements (MITEs) in Brassica.
Nouroz, Faisal; Noreen, Shumaila; Heslop-Harrison, J S
2015-12-01
Miniature inverted-repeat transposable elements (MITEs) are truncated derivatives of autonomous DNA transposons, and are dispersed abundantly in most eukaryotic genomes. We aimed to characterize various MITEs families in Brassica in terms of their presence, sequence characteristics and evolutionary activity. Dot plot analyses involving comparison of homoeologous bacterial artificial chromosome (BAC) sequences allowed identification of 15 novel families of mobile MITEs. Of which, 5 were Stowaway-like with TA Target Site Duplications (TSDs), 4 Tourist-like with TAA/TTA TSDs, 5 Mutator-like with 9-10 bp TSDs and 1 novel MITE (BoXMITE1) flanked by 3 bp TSDs. Our data suggested that there are about 30,000 MITE-related sequences in Brassica rapa and B. oleracea genomes. In situ hybridization showed one abundant family was dispersed in the A-genome, while another was located near 45S rDNA sites. PCR analysis using primers flanking sequences of MITE elements detected MITE insertion polymorphisms between and within the three Brassica (AA, BB, CC) genomes, with many insertions being specific to single genomes and others showing evidence of more recent evolutionary insertions. Our BAC sequence comparison strategy enables identification of evolutionarily active MITEs with no prior knowledge of MITE sequences. The details of MITE families reported in Brassica enable their identification, characterization and annotation. Insertion polymorphisms of MITEs and their transposition activity indicated important mechanism of genome evolution and diversification. MITE families derived from known Mariner, Harbinger and Mutator DNA transposons were discovered, as well as some novel structures. The identification of Brassica MITEs will have broad applications in Brassica genomics, breeding, hybridization and phylogeny through their use as DNA markers.
Zillmann, M; Limauro, S E; Goodchild, J
1997-01-01
By truncating helix II to two base pairs in a hammerhead ribozyme having long flanking sequences (greater than 30 bases), the rate of cleavage in 1 mM magnesium can be increased roughly 100-fold. Replacing most of the nucleotides in a typical stem-loop II with 1-4 randomized nucleotides gave an RNA library that, even before selection, was more active in 1 mM magnesium than the parent ribozyme, but considerably less active than the truncated stem-loop II ribozyme. A novel, multiround selection for intermolecular cleavage was exploited to optimize this library for cleavage in low concentrations of magnesium. After three rounds of selection at sequentially lower concentrations of magnesium, the library cleaved substrate RNA 20-fold faster than the initial pool and was cloned. This pool was heavily enriched for one particular sequence (5'-CGUG-3') that represented 16 of 52 isolates (the next most common sequence was represented only six times). This sequence also represented the most active sequence, exceeding the activity of the short helix II variant under the conditions of the selection, thereby demonstrating the effectiveness of the selection technique. Analysis of the cleavage rates of RNAs made from eight isolates having different four-base insert sequences allowed assignment of highly preferred bases at each position in the insert. Analysis of pool clones having insert of differing lengths showed that, in general, activity decreased as the length of the insert decreased from 4 to 1. This supports the suggested role of stem-loop II in stabilizing the non-Watson-Crick interactions between the conserved bases of the catalytic core. PMID:9214657
Spooner, David M; Ruess, Holly; Iorizzo, Massimo; Senalik, Douglas; Simon, Philipp
2017-02-01
We explored the phylogenetic utility of entire plastid DNA sequences in Daucus and compared the results with prior phylogenetic results using plastid and nuclear DNA sequences. We used Illumina sequencing to obtain full plastid sequences of 37 accessions of 20 Daucus taxa and outgroups, analyzed the data with phylogenetic methods, and examined evidence for mitochondrial DNA transfer to the plastid ( Dc MP). Our phylogenetic trees of the entire data set were highly resolved, with 100% bootstrap support for most of the external and many of the internal clades, except for the clade of D. carota and its most closely related species D. syrticus . Subsets of the data, including regions traditionally used as phylogenetically informative regions, provide various degrees of soft congruence with the entire data set. There are areas of hard incongruence, however, with phylogenies using nuclear data. We extended knowledge of a mitochondrial to plastid DNA insertion sequence previously named Dc MP and identified the first instance in flowering plants of a sequence of potential nuclear genome origin inserted into the plastid genome. There is a relationship of inverted repeat junction classes and repeat DNA to phylogeny, but no such relationship with nonsynonymous mutations. Our data have allowed us to (1) produce a well-resolved plastid phylogeny of Daucus , (2) evaluate subsets of the entire plastid data for phylogeny, (3) examine evidence for plastid and nuclear DNA phylogenetic incongruence, and (4) examine mitochondrial and nuclear DNA insertion into the plastid. © 2017 Spooner et al. Published by the Botanical Society of America. This work is licensed under a Creative Commons public domain license (CC0 1.0).
Schiavo, G; Strillacci, M G; Ribani, A; Bovo, S; Roman-Ponce, S I; Cerolini, S; Bertolini, F; Bagnato, A; Fontanesi, L
2018-06-01
Mitochondrial DNA (mtDNA) insertions have been detected in the nuclear genome of many eukaryotes. These sequences are pseudogenes originated by horizontal transfer of mtDNA fragments into the nuclear genome, producing nuclear DNA sequences of mitochondrial origin (numt). In this study we determined the frequency and distribution of mtDNA-originated pseudogenes in the turkey (Meleagris gallopavo) nuclear genome. The turkey reference genome (Turkey_2.01) was aligned with the reference linearized mtDNA sequence using last. A total of 32 numt sequences (corresponding to 18 numt regions derived by unique insertional events) were identified in the turkey nuclear genome (size ranging from 66 to 1415 bp; identity against the modern turkey mtDNA corresponding region ranging from 62% to 100%). Numts were distributed in nine chromosomes and in one scaffold. They derived from parts of 10 mtDNA protein-coding genes, ribosomal genes, the control region and 10 tRNA genes. Seven numt regions reported in the turkey genome were identified in orthologues positions in the Gallus gallus genome and therefore were present in the ancestral genome that in the Cretaceous originated the lineages of the modern crown Galliformes. Five recently integrated turkey numts were validated by PCR in 168 turkeys of six different domestic populations. None of the analysed numts were polymorphic (i.e. absence of the inserted sequence, as reported in numts of recent integration in other species), suggesting that the reticulate speciation model is not useful for explaining the origin of the domesticated turkey lineage. © 2018 Stichting International Foundation for Animal Genetics.
Janes, Holly; Frahm, Nicole; DeCamp, Allan; Rolland, Morgane; Gabriel, Erin; Wolfson, Julian; Hertz, Tomer; Kallas, Esper; Goepfert, Paul; Friedrich, David P.; Corey, Lawrence; Mullins, James I.; McElrath, M. Juliana; Gilbert, Peter
2012-01-01
Background The sieve analysis for the Step trial found evidence that breakthrough HIV-1 sequences for MRKAd5/HIV-1 Gag/Pol/Nef vaccine recipients were more divergent from the vaccine insert than placebo sequences in regions with predicted epitopes. We linked the viral sequence data with immune response and acute viral load data to explore mechanisms for and consequences of the observed sieve effect. Methods Ninety-one male participants (37 placebo and 54 vaccine recipients) were included; viral sequences were obtained at the time of HIV-1 diagnosis. T-cell responses were measured 4 weeks post-second vaccination and at the first or second week post-diagnosis. Acute viral load was obtained at RNA-positive and antibody-negative visits. Findings Vaccine recipients had a greater magnitude of post-infection CD8+ T cell response than placebo recipients (median 1.68% vs 1.18%; p = 0·04) and greater breadth of post-infection response (median 4.5 vs 2; p = 0·06). Viral sequences for vaccine recipients were marginally more divergent from the insert than placebo sequences in regions of Nef targeted by pre-infection immune responses (p = 0·04; Pol p = 0·13; Gag p = 0·89). Magnitude and breadth of pre-infection responses did not correlate with distance of the viral sequence to the insert (p>0·50). Acute log viral load trended lower in vaccine versus placebo recipients (estimated mean 4·7 vs 5·1) but the difference was not significant (p = 0·27). Neither was acute viral load associated with distance of the viral sequence to the insert (p>0·30). Interpretation Despite evidence of anamnestic responses, the sieve effect was not well explained by available measures of T-cell immunogenicity. Sequence divergence from the vaccine was not significantly associated with acute viral load. While point estimates suggested weak vaccine suppression of viral load, the result was not significant and more viral load data would be needed to detect suppression. PMID:22952672
Characterization of full-length sequenced cDNA inserts (FLIcs) from Atlantic salmon (Salmo salar)
Andreassen, Rune; Lunner, Sigbjørn; Høyheim, Bjørn
2009-01-01
Background Sequencing of the Atlantic salmon genome is now being planned by an international research consortium. Full-length sequenced inserts from cDNAs (FLIcs) are an important tool for correct annotation and clustering of the genomic sequence in any species. The large amount of highly similar duplicate sequences caused by the relatively recent genome duplication in the salmonid ancestor represents a particular challenge for the genome project. FLIcs will therefore be an extremely useful resource for the Atlantic salmon sequencing project. In addition to be helpful in order to distinguish between duplicate genome regions and in determining correct gene structures, FLIcs are an important resource for functional genomic studies and for investigation of regulatory elements controlling gene expression. In contrast to the large number of ESTs available, including the ESTs from 23 developmental and tissue specific cDNA libraries contributed by the Salmon Genome Project (SGP), the number of sequences where the full-length of the cDNA insert has been determined has been small. Results High quality full-length insert sequences from 560 pre-smolt white muscle tissue specific cDNAs were generated, accession numbers [GenBank: BT043497 - BT044056]. Five hundred and ten (91%) of the transcripts were annotated using Gene Ontology (GO) terms and 440 of the FLIcs are likely to contain a complete coding sequence (cCDS). The sequence information was used to identify putative paralogs, characterize salmon Kozak motifs, polyadenylation signal variation and to identify motifs likely to be involved in the regulation of particular genes. Finally, conserved 7-mers in the 3'UTRs were identified, of which some were identical to miRNA target sequences. Conclusion This paper describes the first Atlantic salmon FLIcs from a tissue and developmental stage specific cDNA library. We have demonstrated that many FLIcs contained a complete coding sequence (cCDS). This suggests that the remaining cDNA libraries generated by SGP represent a valuable cCDS FLIc source. The conservation of 7-mers in 3'UTRs indicates that these motifs are functionally important. Identity between some of these 7-mers and miRNA target sequences suggests that they are miRNA targets in Salmo salar transcripts as well. PMID:19878547
Del Grande, Filippo; Subhawong, Ty; Weber, Kristy; Aro, Michael; Mugera, Charles; Fayad, Laura M
2014-05-01
To determine the added value of functional magnetic resonance (MR) sequences (dynamic contrast material-enhanced [DCE] and quantitative diffusion-weighted [DW] imaging with apparent diffusion coefficient [ADC] mapping) for the detection of recurrent soft-tissue sarcomas following surgical resection. This retrospective study was approved by the institutional review board. The requirement to obtain informed consent was waived. Thirty-seven patients referred for postoperative surveillance after resection of soft-tissue sarcoma (35 with high-grade sarcoma) were studied. Imaging at 3.0 T included conventional (T1-weighted, fluid-sensitive, and contrast-enhanced T1-weighted imaging) and functional (DCE MR imaging, DW imaging with ADC mapping) sequences. Recurrences were confirmed with biopsy or resection. A disease-free state was determined with at least 6 months of follow-up. Two readers independently recorded the signal and morphologic characteristics with conventional sequences, the presence or absence of arterial enhancement at DCE MR imaging, and ADCs of the surgical bed. The accuracy of conventional MR imaging in the detection of recurrence was compared with that with the addition of functional sequences. The Fisher exact and Wilcoxon rank sum tests were used to define the accuracy of imaging features, the Cohen κ and Lin interclass correlation were used to define interobserver variability, and receiver operating characteristic analysis was used to define a threshold to detect recurrence and assess reader confidence after the addition of functional imaging to conventional sequences. There were six histologically proved recurrences in 37 patients. Sensitivity and specificity of MR imaging in the detection of tumor recurrence were 100% (six of six patients) and 52% (16 of 31 patients), respectively, with conventional sequences, 100% (six of six patients) and 97% (30 of 31 patients) with the addition of DCE MR imaging, and 60% (three of five patients) and 97% (30 of 31 patients) with the addition of DW imaging and ADC mapping. The average ADC of recurrence (1.08 mm(2)/sec ± 0.19) was significantly different from those of postoperative scarring (0.9 mm(2)/sec ± 0.00) and hematomas (2.34 mm(2)/sec ± 0.72) (P = .03 for both). The addition of functional MR sequences to a routine MR protocol, in particular DCE MR imaging, offers a specificity of more than 95% for distinguishing recurrent sarcoma from postsurgical scarring.
Ma, Zhengqiang
2013-01-01
Rht-B1c, allelic to the DELLA protein-encoding gene Rht-B1a, is a natural mutation documented in common wheat (Triticum aestivum). It confers variation to a number of traits related to cell and plant morphology, seed dormancy, and photosynthesis. The present study was conducted to examine the sequence variations of Rht-B1c and their functional impacts. The results showed that Rht-B1c was partially dominant or co-dominant for plant height, and exhibited an increased dwarfing effect. At the sequence level, Rht-B1c differed from Rht-B1a by one 2kb Veju retrotransposon insertion, three coding region single nucleotide polymorphisms (SNPs), one 197bp insertion, and four SNPs in the 1kb upstream sequence. Haplotype investigations, association analyses, transient expression assays, and expression profiling showed that the Veju insertion was primarily responsible for the extreme dwarfing effect. It was found that the Veju insertion changed processing of the Rht-B1c transcripts and resulted in DELLA motif primary structure disruption. Expression assays showed that Rht-B1c caused reduction of total Rht-1 transcript levels, and up-regulation of GATA-like transcription factors and genes positively regulated by these factors, suggesting that one way in which Rht-1 proteins affect plant growth and development is through GATA-like transcription factor regulation. PMID:23918966
Insertion and deletion mutagenesis of the human cytomegalovirus genome
DOE Office of Scientific and Technical Information (OSTI.GOV)
Spaete, R.R.; Mocarski, E.S.
1987-10-01
Studies on human cytomegalovirus (CMV) have been limited by a paucity of molecular genetic techniques available for manipulating the viral genome. The authors have developed methods for site-specific insertion and deletion mutagenesis of CMV utilizing a modified Escherichia coli lacZ gene as a genetic marker. The lacZ gene was placed under the control of the major ..beta.. gene regulatory signals and inserted into the viral genome by homologous recombination, disrupting one of two copies of this ..beta.. gene within the L-component repeats of CMV DNA. They observed high-level expression of ..beta..-galactosidase by the recombinant in a temporally authentic manner, withmore » levels of this enzyme approaching 1% of total protein in infected cells. Thus, CMV is an efficient vector for high-level expression of foreign gene products in human cells. Using back selection of lacZ-deficient virus in the presence of the chromogenic substrate 5-bromo-4-chloro-3-indolyl ..beta..-D-galactoside, they generated random endpoint deletion mutants. Analysis of these mutant revealed that CMV DNA sequences flanking the insert had been removed, thereby establishing this approach as a means of determining whether sequences flanking a lacZ insertion are dispensable for viral growth. In an initial test of the methods, they have shown that 7800 base pairs of one copy of L-component repeat sequences can be deleted without affecting viral growth in human fibroblasts.« less
Selenoproteins-What unique properties can arise with selenocysteine in place of cysteine?
Arnér, Elias S J
2010-05-01
The defining entity of a selenoprotein is the inclusion of at least one selenocysteine (Sec) residue in its sequence. Sec, the 21st naturally occurring genetically encoded amino acid, differs from its significantly more common structural analog cysteine (Cys) by the identity of a single atom: Sec contains selenium instead of the sulfur found in Cys. Selenium clearly has unique chemical properties that differ from sulfur, but more striking are perhaps the similarities between the two elements. Selenium was discovered by Jöns Jacob Berzelius, a renowned Swedish scientist instrumental in establishing the institution that would become Karolinska Institutet. Written at the occasion of the bicentennial anniversary of Karolinska Institutet, this mini review focuses on the unique selenium-derived properties that may potentially arise in a protein upon the inclusion of Sec in place of Cys. With 25 human genes encoding selenoproteins and in total several thousand selenoproteins yet described in nature, it seems likely that the presence of that single selenium atom of Sec should convey some specific feature, thereby explaining the existence of selenoproteins in spite of demanding and energetically costly Sec-specific synthesis machineries. Nonetheless, most, if not all, of the currently known selenoproteins are also found as Cys-containing non-selenoprotein orthologues in other organisms, wherefore any potentially unique properties of selenoproteins are yet a matter of debate. The pK(a) of free Sec (approximately 5.2) being significantly lower than that of free Cys (approximately 8.5) has often been proposed as one of the unique features of Sec. However, as discussed herein, this pK(a) difference between Sec and Cys can hardly provide an evolutionary pressure for maintenance of selenoproteins. Moreover, the typically 10- to 100-fold lower enzymatic efficiencies of Sec-to-Cys mutants of selenoprotein oxidoreductases, are also weak arguments for the overall existence of selenoproteins. Here, it is however emphasized that the inherent high nucleophilicity of Sec and thereby its higher chemical reaction rate with electrophiles, as compared to Cys, seems to be a truly unique property of Sec that cannot easily be mimicked by the basicity of Cys, even within the microenvironment of a protein. The chemical rate enhancement obtained with Sec can have other consequences than those arising from a low redox potential of some Cys-dependent proteins, typically aiming at maintaining redox equilibria. Another unique aspect of Sec compared to Cys seems to be its efficient potency to support one-electron transfer reactions, which, however, has not yet been unequivocally shown as a Sec-dependent step during the natural catalysis of any known selenoprotein enzyme. Copyright 2010 Elsevier Inc. All rights reserved.
2012-01-01
Background Barcodes are unique DNA sequence tags that can be used to specifically label individual mutants. The barcode-tagged open reading frame (ORF) haploid deletion mutant collections in the budding yeast Saccharomyces cerevisiae and the fission yeast Schizosaccharomyces pombe allow for high-throughput mutant phenotyping because the relative growth of mutants in a population can be determined by monitoring the proportions of their associated barcodes. While these mutant collections have greatly facilitated genome-wide studies, mutations in essential genes are not present, and the roles of these genes are not as easily studied. To further support genome-scale research in S. pombe, we generated a barcode-tagged fission yeast insertion mutant library that has the potential of generating viable mutations in both essential and non-essential genes and can be easily analyzed using standard molecular biological techniques. Results An insertion vector containing a selectable ura4+ marker and a random barcode was used to generate a collection of 10,000 fission yeast insertion mutants stored individually in 384-well plates and as six pools of mixed mutants. Individual barcodes are flanked by Sfi I recognition sites and can be oligomerized in a unique orientation to facilitate barcode sequencing. Independent genetic screens on a subset of mutants suggest that this library contains a diverse collection of single insertion mutations. We present several approaches to determine insertion sites. Conclusions This collection of S. pombe barcode-tagged insertion mutants is well-suited for genome-wide studies. Because insertion mutations may eliminate, reduce or alter the function of essential and non-essential genes, this library will contain strains with a wide range of phenotypes that can be assayed by their associated barcodes. The design of the barcodes in this library allows for barcode sequencing using next generation or standard benchtop cloning approaches. PMID:22554201
Stable zymomonas mobilis xylose and arabinose fermenting strains
Zhang, Min [Lakewood, CO; Chou, Yat-Chen [Taipei, TW
2008-04-08
The present invention briefly includes a transposon for stable insertion of foreign genes into a bacterial genome, comprising at least one operon having structural genes encoding enzymes selected from the group consisting of xylAxylB, araBAD and tal/tkt, and at least one promoter for expression of the structural genes in the bacterium, a pair of inverted insertion sequences, the operons contained inside the insertion sequences, and a transposase gene located outside of the insertion sequences. A plasmid shuttle vector for transformation of foreign genes into a bacterial genome, comprising at least one operon having structural genes encoding enzymes selected from the group consisting of xylAxylB, araBAD and tal/tkt, at least one promoter for expression of the structural genes in the bacterium, and at least two DNA fragments having homology with a gene in the bacterial genome to be transformed, is also provided.The transposon and shuttle vectors are useful in constructing significantly different Zymomonas mobilis strains, according to the present invention, which are useful in the conversion of the cellulose derived pentose sugars into fuels and chemicals, using traditional fermentation technology, because they are stable for expression in a non-selection medium.
Traverse, Charles C.
2017-01-01
ABSTRACT Advances in sequencing technologies have enabled direct quantification of genome-wide errors that occur during RNA transcription. These errors occur at rates that are orders of magnitude higher than rates during DNA replication, but due to technical difficulties such measurements have been limited to single-base substitutions and have not yet quantified the scope of transcription insertions and deletions. Previous reporter gene assay findings suggested that transcription indels are produced exclusively by elongation complex slippage at homopolymeric runs, so we enumerated indels across the protein-coding transcriptomes of Escherichia coli and Buchnera aphidicola, which differ widely in their genomic base compositions and incidence of repeat regions. As anticipated from prior assays, transcription insertions prevailed in homopolymeric runs of A and T; however, transcription deletions arose in much more complex sequences and were rarely associated with homopolymeric runs. By reconstructing the relocated positions of the elongation complex as inferred from the sequences inserted or deleted during transcription, we show that continuation of transcription after slippage hinges on the degree of nucleotide complementarity within the RNA:DNA hybrid at the new DNA template location. PMID:28851848
Nie, Xiao-wei; Sun, Li-jun; Hao, Yue-wen; Yang, Guang-xiao; Wang, Quan-ying
2011-03-01
To synthesize the minimal and artificial HRE, and to insert it into the anterior extremity of CMV promoter of a AAV plasmid, and then to construct the AAV regulated by hypoxic-responsive element which was introduced into 293 cell by method of Ca3(PO4)2 using three plasmids. Thus obtaining the adenoassociated virus vector regulated by hypoxic-responsive element was possibly used for gene therapy in ischemia angiocardiopathy and cerebrovascular disease. Artificially synthesize the 36 bp nucleotide sequences of four connection in series HIF-binding sites A/GCGTG(4×HBS)and a 35 bp nucleotide sequences spacing inserted into anterior extremity of CMV promoter TATA Box, then amplified by PCR. The cDNA fragment was confirmed to be right by DNA sequencing. Molecular biology routine method was used to construct a AAV vector regulated by minimal hypoxic-responsive element after the normal CMV promoter in AAV vector was replaced by the CMV promoter included minimal hypoxic-responsive element. Then, NT4-6His-PR39 fusogenic peptide was inserted into MCS of the plasmid, the recombinant AAV vector was obtained by three plasmid co-transfection in 293 cells, in which we can also investigate the expression of 6×His using immunochemistry in hypoxia environment. Artificial HRE was inserted into anterior extremity of CMV promoter and there was a correct spacing between the HRE and the TATA-box. The DNA sequencing and restriction enzyme digestion results indicated that the AAV regulated by hypoxic-responsive element was successfully constructed. Compared to the control group, the expressions of 6×His was significantly increased in the experimental groups in hypoxia environment, which confirmed that the AAV effectually regulated by the minimal HRE was inserted into anterior extremity of CMV promoter. The HRE is inserted into anterior extremity of CMV promoter to lack incision enzyme recognition site by PCR. And eukaryotic expression vector regulated by hypoxic-responsive is constructed. The AAV effectually regulated by the minimal HRE inserted into anterior extremity of CMV promoter. The vector is successfully constructed and it has important theoretical and practical value in the synteresis and therapy of ischemia angiocardiopathy and cerebrovascular disease.
Equivalent Indels – Ambiguous Functional Classes and Redundancy in Databases
Assmus, Jens; Kleffe, Jürgen; Schmitt, Armin O.; Brockmann, Gudrun A.
2013-01-01
There is considerable interest in studying sequenced variations. However, while the positions of substitutions are uniquely identifiable by sequence alignment, the location of insertions and deletions still poses problems. Each insertion and deletion causes a change of sequence. Yet, due to low complexity or repetitive sequence structures, the same indel can sometimes be annotated in different ways. Two indels which differ in allele sequence and position can be one and the same, i.e. the alternative sequence of the whole chromosome is identical in both cases and, therefore, the two deletions are biologically equivalent. In such a case, it is impossible to identify the exact position of an indel merely based on sequence alignment. Thus, variation entries in a mutation database are not necessarily uniquely defined. We prove the existence of a contiguous region around an indel in which all deletions of the same length are biologically identical. Databases often show only one of several possible locations for a given variation. Furthermore, different data base entries can represent equivalent variation events. We identified 1,045,590 such problematic entries of insertions and deletions out of 5,860,408 indel entries in the current human database of Ensembl. Equivalent indels are found in sequence regions of different functions like exons, introns or 5' and 3' UTRs. One and the same variation can be assigned to several different functional classifications of which only one is correct. We implemented an algorithm that determines for each indel database entry its complete set of equivalent indels which is uniquely characterized by the indel itself and a given interval of the reference sequence. PMID:23658777
Model-based quality assessment and base-calling for second-generation sequencing data.
Bravo, Héctor Corrada; Irizarry, Rafael A
2010-09-01
Second-generation sequencing (sec-gen) technology can sequence millions of short fragments of DNA in parallel, making it capable of assembling complex genomes for a small fraction of the price and time of previous technologies. In fact, a recently formed international consortium, the 1000 Genomes Project, plans to fully sequence the genomes of approximately 1200 people. The prospect of comparative analysis at the sequence level of a large number of samples across multiple populations may be achieved within the next five years. These data present unprecedented challenges in statistical analysis. For instance, analysis operates on millions of short nucleotide sequences, or reads-strings of A,C,G, or T's, between 30 and 100 characters long-which are the result of complex processing of noisy continuous fluorescence intensity measurements known as base-calling. The complexity of the base-calling discretization process results in reads of widely varying quality within and across sequence samples. This variation in processing quality results in infrequent but systematic errors that we have found to mislead downstream analysis of the discretized sequence read data. For instance, a central goal of the 1000 Genomes Project is to quantify across-sample variation at the single nucleotide level. At this resolution, small error rates in sequencing prove significant, especially for rare variants. Sec-gen sequencing is a relatively new technology for which potential biases and sources of obscuring variation are not yet fully understood. Therefore, modeling and quantifying the uncertainty inherent in the generation of sequence reads is of utmost importance. In this article, we present a simple model to capture uncertainty arising in the base-calling procedure of the Illumina/Solexa GA platform. Model parameters have a straightforward interpretation in terms of the chemistry of base-calling allowing for informative and easily interpretable metrics that capture the variability in sequencing quality. Our model provides these informative estimates readily usable in quality assessment tools while significantly improving base-calling performance. © 2009, The International Biometric Society.
Christensen, Shawn M; Ye, Junqiang; Eickbush, Thomas H
2006-11-21
Non-LTR retrotransposons insert into eukaryotic genomes by target-primed reverse transcription (TPRT), a process in which cleaved DNA targets are used to prime reverse transcription of the element's RNA transcript. Many of the steps in the integration pathway of these elements can be characterized in vitro for the R2 element because of the rigid sequence specificity of R2 for both its DNA target and its RNA template. R2 retrotransposition involves identical subunits of the R2 protein bound to different DNA sequences upstream and downstream of the insertion site. The key determinant regulating which DNA-binding conformation the protein adopts was found to be a 320-nt RNA sequence from near the 5' end of the R2 element. In the absence of this 5' RNA the R2 protein binds DNA sequences upstream of the insertion site, cleaves the first DNA strand, and conducts TPRT when RNA containing the 3' untranslated region of the R2 transcript is present. In the presence of the 320-nt 5' RNA, the R2 protein binds DNA sequences downstream of the insertion site. Cleavage of the second DNA strand by the downstream subunit does not appear to occur until after the 5' RNA is removed from this subunit. We postulate that the removal of the 5' RNA normally occurs during reverse transcription, and thus provides a critical temporal link to first- and second-strand DNA cleavage in the R2 retrotransposition reaction.
Rabah, Samar O; Lee, Chaehee; Hajrah, Nahid H; Makki, Rania M; Alharby, Hesham F; Alhebshi, Alawiah M; Sabir, Jamal S M; Jansen, Robert K; Ruhlman, Tracey A
2017-11-01
In plant evolution, intracellular gene transfer (IGT) is a prevalent, ongoing process. While nuclear and mitochondrial genomes are known to integrate foreign DNA via IGT and horizontal gene transfer (HGT), plastid genomes (plastomes) have resisted foreign DNA incorporation and only recently has IGT been uncovered in the plastomes of a few land plants. In this study, we completed plastome sequences for l0 crop species and describe a number of structural features including variation in gene and intron content, inversions, and expansion and contraction of the inverted repeat (IR). We identified a putative in cinnamon ( J. Presl) and other sequenced Lauraceae and an apparent functional transfer of to the nucleus of quinoa ( Willd.). In the orchard tree cashew ( L.), we report the insertion of an ∼6.7-kb fragment of mitochondrial DNA into the plastome IR. BLASTn analyses returned high identity hits to mitogenome sequences including an intact open reading frame. Using three plastome markers for five species of , we generated a phylogeny to investigate the distribution and timing of the insertion. Four species share the insertion, suggesting that this event occurred <20 million yr ago in a single clade in the genus. Our study extends the observation of mitochondrial to plastome IGT to include long-lived tree species. While previous studies have suggested possible mechanisms facilitating IGT to the plastome, more examples of this phenomenon, along with more complete mitogenome sequences, will be required before a common, or variable, mechanism can be elucidated. Copyright © 2017 Crop Science Society of America.
Boonmak, S; Boonmak, P; Bunsaengjaroen, P; Srichaipanha, S
2006-05-01
To evaluate disposable LMA for endotracheal intubation using the FOB guidance and blind techniques. The authors included ASA class I-II patients between 15 and 60 years of age, with mouth opening more than 3 cm, scheduled for elective surgery. The authors excluded patients with any history of gastro-esophageal reflux, full stomach or a body weight < 30 kg. All of the patients received standard general anesthesia. After inducing anesthesia, a disposable LMA No. 3 or No. 4 (Soft Seal, Smiths Medical, Portex Inc, USA) was inserted while the patient was in the sniff position. The authors recorded the insertion time, the ease of insertion, the anatomic placement and position. The authors then inserted a flexible endotracheal tube (No. 6.5 for LMA No. 4 and No. 6 for LMA No. 3) and recorded the success rate and the ease of insertion. After three failures, the authors used FOB guidance. Sixty patients were enrolled (32 males). The mean +/- SD age and BMI was 43.2 +/- 13.4 years and 22.6 +/- 3.9, respectively. Most of the patients had a Mallampati of grade I. The mean +/- SD insertion time was 24.6 +/- 16.1 sec. After the FOB evaluation, only 27 patients had an anatomic placement in full view of the glottis. Eighteen patients had vocal cords in the middle part of the opening. The success rate of blind endotracheal intubation was 5 percent (95%CI 1.0-13.9) (3/60); while the success rate with FOB guidance was 85 percent (95%CI 73.4-92.9). A disposable laryngeal mask airway (Soft Seal) for blind endotracheal intubation had a low success rate, but it could be used more successfully with FOB guidance.
Determination of Membrane-Insertion Free Energies by Molecular Dynamics Simulations
Gumbart, James; Roux, Benoît
2012-01-01
The accurate prediction of membrane-insertion probability for arbitrary protein sequences is a critical challenge to identifying membrane proteins and determining their folded structures. Although algorithms based on sequence statistics have had moderate success, a complete understanding of the energetic factors that drive the insertion of membrane proteins is essential to thoroughly meeting this challenge. In the last few years, numerous attempts to define a free-energy scale for amino-acid insertion have been made, yet disagreement between most experimental and theoretical scales persists. However, for a recently resolved water-to-bilayer scale, it is found that molecular dynamics simulations that carefully mimic the conditions of the experiment can reproduce experimental free energies, even when using the same force field as previous computational studies that were cited as evidence of this disagreement. Therefore, it is suggested that experimental and simulation-based scales can both be accurate and that discrepancies stem from disparities in the microscopic processes being considered rather than methodological errors. Furthermore, these disparities make the development of a single universally applicable membrane-insertion free energy scale difficult. PMID:22385850
The Design and Analysis of Transposon-Insertion Sequencing Experiments
Chao, Michael C.; Abel, Sören; Davis, Brigid M.; Waldor, Matthew K.
2016-01-01
Preface Transposon-insertion sequencing (TIS) is a powerful approach that can be widely applied to genome-wide definition of loci that are required for growth in diverse conditions. However, experimental design choices and stochastic biological processes can heavily influence the results of TIS experiments and affect downstream statistical analysis. Here, we discuss TIS experimental parameters and how these factors relate to the benefits and limitations of the various statistical frameworks that can be applied to computational analysis of TIS data. PMID:26775926
Word and frame synchronization with verification for PPM optical communications
NASA Technical Reports Server (NTRS)
Marshall, William K.
1986-01-01
A method for obtaining word and frame synchronization in pulse position modulated optical communication systems is described. The method uses a short sync sequence inserted at the beginning of each data frame and a verification procedure to distinguish between inserted and randomly occurring sequences at the receiver. This results in an easy to implement sync system which provides reliable synchronization even at high symbol error rates. Results are given for the application of this approach to a highly energy efficient 256-ary PPM test system.
Wang, Yan; Wang, Rui; Jin, Feng; Liu, Yang; Yu, Jiayu; Fu, Xinmiao; Chang, Zengyi
2016-08-05
β-barrel outer membrane proteins (OMPs) are ubiquitously present in Gram-negative bacteria, mitochondria and chloroplasts, and function in a variety of biological processes. The mechanism by which the hydrophobic nascent β-barrel OMPs are transported through the hydrophilic periplasmic space in bacterial cells remains elusive. Here, mainly via unnatural amino acid-mediated in vivo photo-crosslinking studies, we revealed that the primary periplasmic chaperone SurA interacts with nascent β-barrel OMPs largely via its N-domain but with β-barrel assembly machine protein BamA mainly via its satellite P2 domain, and that the nascent β-barrel OMPs interact with SurA via their N- and C-terminal regions. Additionally, via dual in vivo photo-crosslinking, we demonstrated the formation of a ternary complex involving β-barrel OMP, SurA, and BamA in cells. More importantly, we found that a supercomplex spanning the inner and outer membranes and involving the BamA, BamB, SurA, PpiD, SecY, SecE, and SecA proteins appears to exist in living cells, as revealed by a combined analyses of sucrose-gradient ultra-centrifugation, Blue native PAGE and mass spectrometry. We propose that this supercomplex integrates the translocation, transportation, and membrane insertion events for β-barrel OMP biogenesis. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.
Wang, Yan; Wang, Rui; Jin, Feng; Liu, Yang; Yu, Jiayu; Fu, Xinmiao; Chang, Zengyi
2016-01-01
β-barrel outer membrane proteins (OMPs) are ubiquitously present in Gram-negative bacteria, mitochondria and chloroplasts, and function in a variety of biological processes. The mechanism by which the hydrophobic nascent β-barrel OMPs are transported through the hydrophilic periplasmic space in bacterial cells remains elusive. Here, mainly via unnatural amino acid-mediated in vivo photo-crosslinking studies, we revealed that the primary periplasmic chaperone SurA interacts with nascent β-barrel OMPs largely via its N-domain but with β-barrel assembly machine protein BamA mainly via its satellite P2 domain, and that the nascent β-barrel OMPs interact with SurA via their N- and C-terminal regions. Additionally, via dual in vivo photo-crosslinking, we demonstrated the formation of a ternary complex involving β-barrel OMP, SurA, and BamA in cells. More importantly, we found that a supercomplex spanning the inner and outer membranes and involving the BamA, BamB, SurA, PpiD, SecY, SecE, and SecA proteins appears to exist in living cells, as revealed by a combined analyses of sucrose-gradient ultra-centrifugation, Blue native PAGE and mass spectrometry. We propose that this supercomplex integrates the translocation, transportation, and membrane insertion events for β-barrel OMP biogenesis. PMID:27298319
Somatic overgrowth associated with homozygous mutations in both MAN1B1 and SEC23A
Gupta, Swati; Fahiminiya, Somayyeh; Wang, Tracy; Dempsey Nunez, Laura; Rosenblatt, David S.; Gibson, William T.; Gilfix, Brian; Bergeron, John J. M.; Jerome-Majewska, Loydie A.
2016-01-01
Using whole-exome sequencing, we identified homozygous mutations in two unlinked genes, SEC23A c.1200G>C (p.M400I) and MAN1B1 c.1000C>T (p.R334C), associated with congenital birth defects in two patients from a consanguineous family. Patients presented with carbohydrate-deficient transferrin, tall stature, obesity, macrocephaly, and maloccluded teeth. The parents were healthy heterozygous carriers for both mutations and an unaffected sibling with tall stature carried the heterozygous mutation in SEC23A only. Mutations in SEC23A are responsible for craniolenticosultura dysplasia (CLSD). CLSD patients are short, have late-closing fontanels, and have reduced procollagen (pro-COL1A1) secretion because of abnormal pro-COL1A1 retention in the endoplasmic reticulum (ER). The mutation we identified in MAN1B1 was previously associated with reduced MAN1B1 protein and congenital disorders of glycosylation (CDG). CDG patients are also short, are obese, and have abnormal glycan remodeling. Molecular analysis of fibroblasts from the family revealed normal levels of SEC23A in all cells and reduced levels of MAN1B1 in cells with heterozygous or homozygous mutations in SEC23A and MAN1B1. Secretion of pro-COL1A1 was increased in fibroblasts from the siblings and patients, and pro-COL1A1 was retained in Golgi of heterozygous and homozygous mutant cells, although intracellular pro-COL1A1 was increased in patient fibroblasts only. We postulate that increased pro-COL1A1 secretion is responsible for tall stature in these patients and an unaffected sibling, and not previously discovered in patients with mutations in either SEC23A or MAN1B1. The patients in this study share biochemical and cellular characteristics consistent with mutations in MAN1B1 and SEC23A, indicating a digenic disease. PMID:27148587
Dyvorne, Hadrien A; Galea, Nicola; Nevers, Thomas; Fiel, M Isabel; Carpenter, David; Wong, Edmund; Orton, Matthew; de Oliveira, Andre; Feiweier, Thorsten; Vachon, Marie-Louise; Babb, James S; Taouli, Bachir
2013-03-01
To optimize intravoxel incoherent motion (IVIM) diffusion-weighted (DW) imaging by estimating the effects of diffusion gradient polarity and breathing acquisition scheme on image quality, signal-to-noise ratio (SNR), IVIM parameters, and parameter reproducibility, as well as to investigate the potential of IVIM in the detection of hepatic fibrosis. In this institutional review board-approved prospective study, 20 subjects (seven healthy volunteers, 13 patients with hepatitis C virus infection; 14 men, six women; mean age, 46 years) underwent IVIM DW imaging with four sequences: (a) respiratory-triggered (RT) bipolar (BP) sequence, (b) RT monopolar (MP) sequence, (c) free-breathing (FB) BP sequence, and (d) FB MP sequence. Image quality scores were assessed for all sequences. A biexponential analysis with the Bayesian method yielded true diffusion coefficient (D), pseudodiffusion coefficient (D*), and perfusion fraction (PF) in liver parenchyma. Mixed-model analysis of variance was used to compare image quality, SNR, IVIM parameters, and interexamination variability between the four sequences, as well as the ability to differentiate areas of liver fibrosis from normal liver tissue. Image quality with RT sequences was superior to that with FB acquisitions (P = .02) and was not affected by gradient polarity. SNR did not vary significantly between sequences. IVIM parameter reproducibility was moderate to excellent for PF and D, while it was less reproducible for D*. PF and D were both significantly lower in patients with hepatitis C virus than in healthy volunteers with the RT BP sequence (PF = 13.5% ± 5.3 [standard deviation] vs 9.2% ± 2.5, P = .038; D = [1.16 ± 0.07] × 10(-3) mm(2)/sec vs [1.03 ± 0.1] × 10(-3) mm(2)/sec, P = .006). The RT BP DW imaging sequence had the best results in terms of image quality, reproducibility, and ability to discriminate between healthy and fibrotic liver with biexponential fitting.
QuickMap: a public tool for large-scale gene therapy vector insertion site mapping and analysis.
Appelt, J-U; Giordano, F A; Ecker, M; Roeder, I; Grund, N; Hotz-Wagenblatt, A; Opelz, G; Zeller, W J; Allgayer, H; Fruehauf, S; Laufs, S
2009-07-01
Several events of insertional mutagenesis in pre-clinical and clinical gene therapy studies have created intense interest in assessing the genomic insertion profiles of gene therapy vectors. For the construction of such profiles, vector-flanking sequences detected by inverse PCR, linear amplification-mediated-PCR or ligation-mediated-PCR need to be mapped to the host cell's genome and compared to a reference set. Although remarkable progress has been achieved in mapping gene therapy vector insertion sites, public reference sets are lacking, as are the possibilities to quickly detect non-random patterns in experimental data. We developed a tool termed QuickMap, which uniformly maps and analyzes human and murine vector-flanking sequences within seconds (available at www.gtsg.org). Besides information about hits in chromosomes and fragile sites, QuickMap automatically determines insertion frequencies in +/- 250 kb adjacency to genes, cancer genes, pseudogenes, transcription factor and (post-transcriptional) miRNA binding sites, CpG islands and repetitive elements (short interspersed nuclear elements (SINE), long interspersed nuclear elements (LINE), Type II elements and LTR elements). Additionally, all experimental frequencies are compared with the data obtained from a reference set, containing 1 000 000 random integrations ('random set'). Thus, for the first time a tool allowing high-throughput profiling of gene therapy vector insertion sites is available. It provides a basis for large-scale insertion site analyses, which is now urgently needed to discover novel gene therapy vectors with 'safe' insertion profiles.
Wu, Chengcang; Proestou, Dina; Carter, Dorothy; Nicholson, Erica; Santos, Filippe; Zhao, Shaying; Zhang, Hong-Bin; Goldsmith, Marian R
2009-01-01
Background Manduca sexta, Heliothis virescens, and Heliconius erato represent three widely-used insect model species for genomic and fundamental studies in Lepidoptera. Large-insert BAC libraries of these insects are critical resources for many molecular studies, including physical mapping and genome sequencing, but not available to date. Results We report the construction and characterization of six large-insert BAC libraries for the three species and sampling sequence analysis of the genomes. The six BAC libraries were constructed with two restriction enzymes, two libraries for each species, and each has an average clone insert size ranging from 152–175 kb. We estimated that the genome coverage of each library ranged from 6–9 ×, with the two combined libraries of each species being equivalent to 13.0–16.3 × haploid genomes. The genome coverage, quality and utility of the libraries were further confirmed by library screening using 6~8 putative single-copy probes. To provide a first glimpse into these genomes, we sequenced and analyzed the BAC ends of ~200 clones randomly selected from the libraries of each species. The data revealed that the genomes are AT-rich, contain relatively small fractions of repeat elements with a majority belonging to the category of low complexity repeats, and are more abundant in retro-elements than DNA transposons. Among the species, the H. erato genome is somewhat more abundant in repeat elements and simple repeats than those of M. sexta and H. virescens. The BLAST analysis of the BAC end sequences suggested that the evolution of the three genomes is widely varied, with the genome of H. virescens being the most conserved as a typical lepidopteran, whereas both genomes of H. erato and M. sexta appear to have evolved significantly, resulting in a higher level of species- or evolutionary lineage-specific sequences. Conclusion The high-quality and large-insert BAC libraries of the insects, together with the identified BACs containing genes of interest, provide valuable information, resources and tools for comprehensive understanding and studies of the insect genomes and for addressing many fundamental questions in Lepidoptera. The sample of the genomic sequences provides the first insight into the constitution and evolution of the insect genomes. PMID:19558662
Orangutan Alu quiescence reveals possible source element: support for ancient backseat drivers
2012-01-01
Background Sequence analysis of the orangutan genome revealed that recent proliferative activity of Alu elements has been uncharacteristically quiescent in the Pongo (orangutan) lineage, compared with all previously studied primate genomes. With relatively few young polymorphic insertions, the genomic landscape of the orangutan seemed like the ideal place to search for a driver, or source element, of Alu retrotransposition. Results Here we report the identification of a nearly pristine insertion possessing all the known putative hallmarks of a retrotranspositionally competent Alu element. It is located in an intronic sequence of the DGKB gene on chromosome 7 and is highly conserved in Hominidae (the great apes), but absent from Hylobatidae (gibbon and siamang). We provide evidence for the evolution of a lineage-specific subfamily of this shared Alu insertion in orangutans and possibly the lineage leading to humans. In the orangutan genome, this insertion contains three orangutan-specific diagnostic mutations which are characteristic of the youngest polymorphic Alu subfamily, AluYe5b5_Pongo. In the Homininae lineage (human, chimpanzee and gorilla), this insertion has acquired three different mutations which are also found in a single human-specific Alu insertion. Conclusions This seemingly stealth-like amplification, ongoing at a very low rate over millions of years of evolution, suggests that this shared insertion may represent an ancient backseat driver of Alu element expansion. PMID:22541534
Orangutan Alu quiescence reveals possible source element: support for ancient backseat drivers.
Walker, Jerilyn A; Konkel, Miriam K; Ullmer, Brygg; Monceaux, Christopher P; Ryder, Oliver A; Hubley, Robert; Smit, Arian Fa; Batzer, Mark A
2012-04-30
Sequence analysis of the orangutan genome revealed that recent proliferative activity of Alu elements has been uncharacteristically quiescent in the Pongo (orangutan) lineage, compared with all previously studied primate genomes. With relatively few young polymorphic insertions, the genomic landscape of the orangutan seemed like the ideal place to search for a driver, or source element, of Alu retrotransposition. Here we report the identification of a nearly pristine insertion possessing all the known putative hallmarks of a retrotranspositionally competent Alu element. It is located in an intronic sequence of the DGKB gene on chromosome 7 and is highly conserved in Hominidae (the great apes), but absent from Hylobatidae (gibbon and siamang). We provide evidence for the evolution of a lineage-specific subfamily of this shared Alu insertion in orangutans and possibly the lineage leading to humans. In the orangutan genome, this insertion contains three orangutan-specific diagnostic mutations which are characteristic of the youngest polymorphic Alu subfamily, AluYe5b5_Pongo. In the Homininae lineage (human, chimpanzee and gorilla), this insertion has acquired three different mutations which are also found in a single human-specific Alu insertion. This seemingly stealth-like amplification, ongoing at a very low rate over millions of years of evolution, suggests that this shared insertion may represent an ancient backseat driver of Alu element expansion.
White, K Makay; Matthews, Melinda K; Hughes, Rachel C; Sommer, Andrew J; Griffitts, Joel S; Newell, Peter D; Chaston, John M
2018-03-28
A metagenome wide association (MGWA) study of bacterial host association determinants in Drosophila predicted that LPS biosynthesis genes are significantly associated with host colonization. We were unable to create site-directed mutants for each of the predicted genes in Acetobacter , so we created an arrayed transposon insertion library using Acetobacter fabarum DsW_054 isolated from Drosophila Creation of the A. fabarum DsW_054 gene knock-out library was performed by combinatorial mapping and Illumina sequencing of random transposon insertion mutants. Transposon insertion locations for 6,418 mutants were successfully mapped, including hits within 63% of annotated genes in the A. fabarum DsW_054 genome. For 45/45 members of the library, insertion sites were verified by arbitrary PCR and Sanger sequencing. Mutants with insertions in four different LPS biosynthesis genes were selected from the library to validate the MGWA predictions. Insertion mutations in two genes biosynthetically upstream of Lipid-A formation, lpxC and lpxB , show significant differences in host association, whereas mutations in two genes encoding LPS biosynthesis functions downstream of Lipid-A biosynthesis had no effect. These results suggest an impact of bacterial cell surface molecules on the bacterial capacity for host association. Also, the transposon insertion mutant library will be a useful resource for ongoing research on the genetic basis for Acetobacter traits. Copyright © 2018 White et al.
Hernández-Martínez, Miguel Ángel; Escalante, Ananías A.; Arévalo-Herrera, Myriam; Herrera, Sócrates
2011-01-01
Circumsporozoite (CS) protein is a malaria antigen involved in sporozoite invasion of hepatocytes, and thus considered to have good vaccine potential. We evaluated the polymorphism of the Plasmodium vivax CS gene in 24 parasite isolates collected from malaria-endemic areas of Colombia. We sequenced 27 alleles, most of which (25/27) corresponded to the VK247 genotype and the remainder to the VK210 type. All VK247 alleles presented a mutation (Gly → Asn) at position 28 in the N-terminal region, whereas the C-terminal presented three insertions: the ANKKAGDAG, which is common in all VK247 isolates; 12 alleles presented the insertion GAGGQAAGGNAANKKAGDAG; and 5 alleles presented the insertion GGNAGGNA. Both repeat regions were polymorphic in gene sequence and size. Sequences coding for B-, T-CD4+, and T-CD8+ cell epitopes were found to be conserved. This study confirms the high polymorphism of the repeat domain and the highly conserved nature of the flanking regions. PMID:21292878
Cianciulli, Antonia; Calvello, Rosa; Panaro, Maria A
2015-04-01
In the homologous genes studied, the exons and introns alternated in the same order in mouse and human. We studied, in both species: corresponding short segments of introns, whole corresponding introns and complete homologous genes. We considered the total number of nucleotides and the number and orientation of the SINE inserts. Comparisons of mouse and human data series showed that at the level of individual relatively short segments of intronic sequences the stochastic variability prevails in the local structuring, but at higher levels of organization a deterministic component emerges, conserved in mouse and human during the divergent evolution, despite the ample re-editing of the intronic sequences and the fact that processes such as SINE spread had taken place in an independent way in the two species. Intron conservation is negatively correlated with the SINE occupancy, suggesting that virus inserts interfere with the conservation of the sequences inherited from the common ancestor. Copyright © 2015 Elsevier Ltd. All rights reserved.
Cook, Jeffrey R; Mhatre, Ajay; Wang, Fen Wei; Uretsky, Barry F
2014-03-01
Optimizing stent deployment is important for both acute- and long-term outcomes. High-pressure balloon inflation is the standard for coronary stent implantation. However, there is no standardized inflation protocol. We hypothesized that prolonged high-pressure balloon inflation until stabilization of inflation pressure is superior to a rapid inflation/deflation sequence for both stent expansion and strut apposition. A high-pressure rapid inflation/deflation sequence was deployed followed by angiography to assure no residual stenosis. Optical coherence tomography (OCT) was then performed followed by prolonged inflation until balloon pressure was stabilized for 30 sec using the same balloon at the same pressure as the rapid sequence. A second OCT run was then done. Thirteen thousand nine hundred thirteen stent struts were evaluated by OCT in 12 patients undergoing successful stenting. Stent expansion improved with prolonged (206 ± 115 sec) vs. rapid (28 ± 17 sec) inflation for both minimal stent diameter (3.0 ± 0.5 vs. 2.75 ± 0.44 mm, P < 0.0001) and area (7.83 ± 2.45 vs. 6.63 ± 1.85 mm(2) , P = 0.0003). The number of malapposed struts decreased (45 ± 41 vs. 88 ± 75, P = 0.005) as did the maximal malapposed strut distance (0.31 ± 0.2 vs. 0.43 ± 0.2 mm, P = 0.0001). Factors related to strut malapposition after rapid inflation included localized asymmetry in 67%, stent underexpansion in 75%, and stent undersizing in 67%. These data demonstrate that prolonged inflation is superior to a rapid inflation/deflation technique for both stent expansion and strut apposition. We recommend for routine stent deployment a prolonged inflation protocol as described above to optimize stent deployment. Copyright © 2012 Wiley Periodicals, Inc.
Megabase sequencing of human genome by ordered-shotgun-sequencing (OSS) strategy
NASA Astrophysics Data System (ADS)
Chen, Ellson Y.
1997-05-01
So far we have used OSS strategy to sequence over 2 megabases DNA in large-insert clones from regions of human X chromosomes with different characteristic levels of GC content. The method starts by randomly fragmenting a BAC, YAC or PAC to 8-12 kb pieces and subcloning those into lambda phage. Insert-ends of these clones are sequenced and overlapped to create a partial map. Complete sequencing is then done on a minimal tiling path of selected subclones, recursively focusing on those at the edges of contigs to facilitate mergers of clones across the entire target. To reduce manual labor, PCR processes have been adapted to prepare sequencing templates throughout the entire operation. The streamlined process can thus lend itself to further automation. The OSS approach is suitable for large- scale genomic sequencing, providing considerable flexibility in the choice of subclones or regions for more or less intensive sequencing. For example, subclones containing contaminating host cell DNA or cloning vector can be recognized and ignored with minimal sequencing effort; regions overlapping a neighboring clone already sequenced need not be redone; and segments containing tandem repeats or long repetitive sequences can be spotted early on and targeted for additional attention.
Dröge, Melloney J; Boersma, Ykelien L; Braun, Peter G; Buining, Robbert Jan; Julsing, Mattijs K; Selles, Karin G A; van Dijl, Jan Maarten; Quax, Wim J
2006-07-01
Using the phage display technology, a protein can be displayed at the surface of bacteriophages as a fusion to one of the phage coat proteins. Here we describe development of this method for fusion of an intracellular carboxylesterase of Bacillus subtilis to the phage minor coat protein g3p. The carboxylesterase gene was cloned in the g3p-based phagemid pCANTAB 5E upstream of the sequence encoding phage g3p and downstream of a signal peptide-encoding sequence. The phage-bound carboxylesterase was correctly folded and fully enzymatically active, as determined from hydrolysis of the naproxen methyl ester with Km values of 0.15 mM and 0.22 mM for the soluble and phage-displayed carboxylesterases, respectively. The signal peptide directs the encoded fusion protein to the cell membrane of Escherichia coli, where phage particles are assembled. In this study, we assessed the effects of several signal peptides, both Sec dependent and Tat dependent, on the translocation of the carboxylesterase in order to optimize the phage display of this enzyme normally restricted to the cytoplasm. Functional display of Bacillus carboxylesterase NA could be achieved when Sec-dependent signal peptides were used. Although a Tat-dependent signal peptide could direct carboxylesterase translocation across the inner membrane of E. coli, proper assembly into phage particles did not seem to occur.
Thieme, Frank; Marillonnet, Sylvestre
2014-01-01
Identification of unknown sequences that flank known sequences of interest requires PCR amplification of DNA fragments that contain the junction between the known and unknown flanking sequences. Since amplified products often contain a mixture of specific and nonspecific products, the quick and clean (QC) cloning procedure was developed to clone specific products only. QC cloning is a ligation-independent cloning procedure that relies on the exonuclease activity of T4 DNA polymerase to generate single-stranded extensions at the ends of the vector and insert. A specific feature of QC cloning is the use of vectors that contain a sequence called catching sequence that allows cloning specific products only. QC cloning is performed by a one-pot incubation of insert and vector in the presence of T4 DNA polymerase at room temperature for 10 min followed by direct transformation of the incubation mix in chemo-competent Escherichia coli cells.
Sun, Qinghui; Ba, Zhaofen; Wu, Guoying; Wang, Wei; Lin, Shuxiang; Yang, Hongjiang
2016-05-01
Carbapenem resistance mechanisms were investigated in 32 imipenem-resistant Pseudomonas aeruginosa clinical isolates recovered from hospitalised children. Sequence analysis revealed that 31 of the isolates had an insertion sequence element ISRP10 disrupting the porin gene oprD, demonstrating that ISRP10 inactivation of oprD conferred imipenem resistance in the majority of the isolates. Multilocus sequence typing (MLST) was used to discriminate the isolates. In total, 11 sequence types (STs) were identified including 3 novel STs, and 68.3% (28/41) of the tested strains were characterised as clone ST253. In combination with random amplified polymorphic DNA (RAPD) analysis, the imipenem-resistant isolates displayed a relatively high degree of genetic variability and were unlikely associated with nosocomial infections. Copyright © 2016 Elsevier B.V. and the International Society of Chemotherapy. All rights reserved.
Schröder, Christiane; Bleidorn, Christoph; Hartmann, Stefanie; Tiedemann, Ralph
2009-12-15
Investigating the dog genome we found 178965 introns with a moderate length of 200-1000 bp. A screening of these sequences against 23 different repeat libraries to find insertions of short interspersed elements (SINEs) detected 45276 SINEs. Virtually all of these SINEs (98%) belong to the tRNA-derived Can-SINE family. Can-SINEs arose about 55 million years ago before Carnivora split into two basal groups, the Caniformia (dog-like carnivores) and the Feliformia (cat-like carnivores). Genome comparisons of dog and cat recovered 506 putatively informative SINE loci for caniformian phylogeny. In this study we show how to use such genome information of model organisms to research the phylogeny of related non-model species of interest. Investigating a dataset including representatives of all major caniformian lineages, we analysed 24 randomly chosen loci for 22 taxa. All loci were amplifiable and revealed 17 parsimony-informative SINE insertions. The screening for informative SINE insertions yields a large amount of sequence information, in particular of introns, which contain reliable phylogenetic information as well. A phylogenetic analysis of intron- and SINE sequence data provided a statistically robust phylogeny which is congruent with the absence/presence pattern of our SINE markers. This phylogeny strongly supports a sistergroup relationship of Musteloidea and Pinnipedia. Within Pinnipedia, we see strong support from bootstrapping and the presence of a SINE insertion for a sistergroup relationship of the walrus with the Otariidae.
Zhang, Chun; Feng, Li; Tian, Xing-Shan
2018-04-26
The herbicide glyphosate inhibits the enzyme 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS). Overexpression of the EPSPS gene is one of the molecular mechanisms conferring glyphosate resistance in weeds, but the transcriptional regulation of this gene is poorly understood. The EPSPS gene was found to be significantly up-regulated following glyphosate treatment in a glyphosate- resistant Eleusine indica population from South China. To further investigate the regulation of EPSPS overexpression, the promoter of the EPSPS gene from this E. indica population was cloned and analyzed. Two upstream regulatory sequences, Epro-S (862 bp) and Epro-R (877 bp) of EPSPS were obtained from glyphosate-susceptible (S) and -resistant (R) E. indica plants respectively by HiTAIL-PCR. The Epro-S and Epro-R sequences were 99% homologous, except for the two insertions (3 bp and12 bp) in the R sequence. The 12-base insertion of the Epro-R sequence was located in the 5'-UTR-Py-rich stretch element. The promoter activity tests showed that the 12-base insertion resulted in significant enhancement of the Epro-R promoter activity, whereas the 3-base insertion had little effect on Epro-R promoter activity. Alterations in the 5'-UTR-Py-rich stretch element of EPSPS are responsible for glyphosate induced EPSPS overexpression. Therefore, EPSPS transcriptional regulation confers glyphosate resistance in this E. indica population. This article is protected by copyright. All rights reserved.
Mesarich, Carl H.; Rees-George, Jonathan; Gardner, Paul P.; Ghomi, Fatemeh Ashari; Gerth, Monica L.; Andersen, Mark T.; Rikkerink, Erik H. A.; Fineran, Peter C.
2017-01-01
Pseudomonas syringae pv. actinidiae (Psa), the causal agent of kiwifruit canker, is one of the most devastating plant diseases of recent times. We have generated two mini-Tn5-based random insertion libraries of Psa ICMP 18884. The first, a ‘phenotype of interest’ (POI) library, consists of 10,368 independent mutants gridded into 96-well plates. By replica plating onto selective media, the POI library was successfully screened for auxotrophic and motility mutants. Lipopolysaccharide (LPS) biosynthesis mutants with ‘Fuzzy-Spreader’-like morphologies were also identified through a visual screen. The second, a ‘mutant of interest’ (MOI) library, comprises around 96,000 independent mutants, also stored in 96-well plates, with approximately 200 individuals per well. The MOI library was sequenced on the Illumina MiSeq platform using Transposon-Directed Insertion site Sequencing (TraDIS) to map insertion sites onto the Psa genome. A grid-based PCR method was developed to recover individual mutants, and using this strategy, the MOI library was successfully screened for a putative LPS mutant not identified in the visual screen. The Psa chromosome and plasmid had 24,031 and 1,236 independent insertion events respectively, giving insertion frequencies of 3.65 and 16.6 per kb respectively. These data suggest that the MOI library is near saturation, with the theoretical probability of finding an insert in any one chromosomal gene estimated to be 97.5%. However, only 47% of chromosomal genes had insertions. This surprisingly low rate cannot be solely explained by the lack of insertions in essential genes, which would be expected to be around 5%. Strikingly, many accessory genes, including most of those encoding type III effectors, lacked insertions. In contrast, 94% of genes on the Psa plasmid had insertions, including for example, the type III effector HopAU1. These results suggest that some chromosomal sites are rendered inaccessible to transposon insertion, either by DNA-binding proteins or by the architecture of the nucleoid. PMID:28249011
Guimond, A; Moss, T
1999-02-01
We have used a differential cloning approach to isolate ribosomal/non-ribosomal frontier sequences from Xenopus laevis. A ribosomal intergenic spacer sequence (IGS) was cloned and shown not to be physically linked with the ribosomal locus. This ribosomal orphon contained the IGS sequences found immediately downstream of the 28S gene and included an array of enhancer repetitions and a non-functional spacer promoter. The orphon sequence was flanked by a member of the novel 'Frt' low copy repetitive element family. Three individual Frt repeats were sequenced and all members of this family were shown to lie clustered at two chromosomal sites, one of which contained the ribosomal orphon. One of the Frt elements contained an insertion of 297 bp that showed extensive homology to sequences within at least three other Xenopus genes. Each homology region was flanked by members of the T2 family of short interspersed repetitive elements, (SINEs), and by its target insertion sequence, suggesting multiple translocation events. The data are discussed in terms of the evolution of the ribosomal gene locus.
Takenouchi, Toshiki; Kuchikata, Tomu; Yoshihashi, Hiroshi; Fujiwara, Mineko; Uehara, Tomoko; Miyama, Sahoko; Yamada, Shiro; Kosaki, Kenjiro
2017-05-01
Among more than 5,000 human monogenic disorders with known causative genes, transposable element insertion of a Long Interspersed Nuclear Element 1 (LINE1, L1) is known as the mechanistic basis in only 13 genetic conditions. Meckel-Gruber syndrome is a rare ciliopathy characterized by occipital encephalocele and cystic kidney disease. Here, we document a boy with occipital encephalocele, post-axial polydactyly, and multicystic renal disease. A medical exome analysis detected a heterozygous frameshift mutation, c.4582_4583delCG p.(Arg1528Serfs*17) in CC2D2A in the maternally derived allele. The further use of a dedicated bioinformatics algorithm for detecting retrotransposon insertions led to the detection of an L1 insertion affecting exon 7 in the paternally derived allele. The complete sequencing and sequence homology analysis of the inserted L1 element showed that the L1 element was classified as L1HS (L1 human specific) and that the element had intact open reading frames in the two L1-encoded proteins. This observation ranks Meckel-Gruber syndrome as only the 14th disorder to be caused by an L1 insertion among more than 5,000 known human genetic disorders. Although a transposable element detection algorithm is not included in the current best-practice next-generation sequencing analysis, the present observation illustrates the utility of such an algorithm, which would require modest computational time and resources. Whether the seemingly infrequent recognition of L1 insertion in the pathogenesis of human genetic diseases might simply reflect a lack of appropriate detection methods remains to be seen. © 2017 Wiley Periodicals, Inc.
Gene replacements and insertions in rice by intron targeting using CRISPR-Cas9.
Li, Jun; Meng, Xiangbing; Zong, Yuan; Chen, Kunling; Zhang, Huawei; Liu, Jinxing; Li, Jiayang; Gao, Caixia
2016-09-12
Sequence-specific nucleases have been exploited to create targeted gene knockouts in various plants(1), but replacing a fragment and even obtaining gene insertions at specific loci in plant genomes remain a serious challenge. Here, we report efficient intron-mediated site-specific gene replacement and insertion approaches that generate mutations using the non-homologous end joining (NHEJ) pathway using the clustered regularly interspaced short palindromic repeats (CRISPR)-CRISPR-associated protein 9 (Cas9) system. Using a pair of single guide RNAs (sgRNAs) targeting adjacent introns and a donor DNA template including the same pair of sgRNA sites, we achieved gene replacements in the rice endogenous gene 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) at a frequency of 2.0%. We also obtained targeted gene insertions at a frequency of 2.2% using a sgRNA targeting one intron and a donor DNA template including the same sgRNA site. Rice plants harbouring the OsEPSPS gene with the intended substitutions were glyphosate-resistant. Furthermore, the site-specific gene replacements and insertions were faithfully transmitted to the next generation. These newly developed approaches can be generally used to replace targeted gene fragments and to insert exogenous DNA sequences into specific genomic sites in rice and other plants.
The genome sequence of the facultative intracellular pathogen Brucella melitensis.
DelVecchio, Vito G; Kapatral, Vinayak; Redkar, Rajendra J; Patra, Guy; Mujer, Cesar; Los, Tamara; Ivanova, Natalia; Anderson, Iain; Bhattacharyya, Anamitra; Lykidis, Athanasios; Reznik, Gary; Jablonski, Lynn; Larsen, Niels; D'Souza, Mark; Bernal, Axel; Mazur, Mikhail; Goltsman, Eugene; Selkov, Eugene; Elzer, Philip H; Hagius, Sue; O'Callaghan, David; Letesson, Jean-Jacques; Haselkorn, Robert; Kyrpides, Nikos; Overbeek, Ross
2002-01-08
Brucella melitensis is a facultative intracellular bacterial pathogen that causes abortion in goats and sheep and Malta fever in humans. The genome of B. melitensis strain 16M was sequenced and found to contain 3,294,935 bp distributed over two circular chromosomes of 2,117,144 bp and 1,177,787 bp encoding 3,197 ORFs. By using the bioinformatics suite ERGO, 2,487 (78%) ORFs were assigned functions. The origins of replication of the two chromosomes are similar to those of other alpha-proteobacteria. Housekeeping genes, including those involved in DNA replication, transcription, translation, core metabolism, and cell wall biosynthesis, are distributed on both chromosomes. Type I, II, and III secretion systems are absent, but genes encoding sec-dependent, sec-independent, and flagella-specific type III, type IV, and type V secretion systems as well as adhesins, invasins, and hemolysins were identified. Several features of the B. melitensis genome are similar to those of the symbiotic Sinorhizobium meliloti.
The genome sequence of the facultative intracellular pathogen Brucella melitensis
DelVecchio, Vito G.; Kapatral, Vinayak; Redkar, Rajendra J.; Patra, Guy; Mujer, Cesar; Los, Tamara; Ivanova, Natalia; Anderson, Iain; Bhattacharyya, Anamitra; Lykidis, Athanasios; Reznik, Gary; Jablonski, Lynn; Larsen, Niels; D'Souza, Mark; Bernal, Axel; Mazur, Mikhail; Goltsman, Eugene; Selkov, Eugene; Elzer, Philip H.; Hagius, Sue; O'Callaghan, David; Letesson, Jean-Jacques; Haselkorn, Robert; Kyrpides, Nikos; Overbeek, Ross
2002-01-01
Brucella melitensis is a facultative intracellular bacterial pathogen that causes abortion in goats and sheep and Malta fever in humans. The genome of B. melitensis strain 16M was sequenced and found to contain 3,294,935 bp distributed over two circular chromosomes of 2,117,144 bp and 1,177,787 bp encoding 3,197 ORFs. By using the bioinformatics suite ERGO, 2,487 (78%) ORFs were assigned functions. The origins of replication of the two chromosomes are similar to those of other α-proteobacteria. Housekeeping genes, including those involved in DNA replication, transcription, translation, core metabolism, and cell wall biosynthesis, are distributed on both chromosomes. Type I, II, and III secretion systems are absent, but genes encoding sec-dependent, sec-independent, and flagella-specific type III, type IV, and type V secretion systems as well as adhesins, invasins, and hemolysins were identified. Several features of the B. melitensis genome are similar to those of the symbiotic Sinorhizobium meliloti. PMID:11756688
Bintz, Brittania J; Dixon, Groves B; Wilson, Mark R
2014-07-01
Next-generation sequencing technologies enable the identification of minor mitochondrial DNA variants with higher sensitivity than Sanger methods, allowing for enhanced identification of minor variants. In this study, mixtures of human mtDNA control region amplicons were subjected to pyrosequencing to determine the detection threshold of the Roche GS Junior(®) instrument (Roche Applied Science, Indianapolis, IN). In addition to expected variants, a set of reproducible variants was consistently found in reads from one particular amplicon. A BLASTn search of the variant sequence revealed identity to a segment of a 611-bp nuclear insertion of the mitochondrial control region (NumtS) spanning the primer-binding sites of this amplicon (Nature 1995;378:489). Primers (Hum Genet 2012;131:757; Hum Biol 1996;68:847) flanking the insertion were used to confirm the presence or absence of the NumtS in buccal DNA extracts from twenty donors. These results further our understanding of human mtDNA variation and are expected to have a positive impact on the interpretation of mtDNA profiles using deep-sequencing methods in casework. © 2014 American Academy of Forensic Sciences.
Long interspersed element-1 (LINE-1): passenger or driver in human neoplasms?
Rodić, Nemanja; Burns, Kathleen H
2013-03-01
LINE-1 (L1) retrotransposons make up a significant portion of human genomes, with an estimated 500,000 copies per genome. Like other retrotransposons, L1 retrotransposons propagate through RNA sequences that are reverse transcribed into DNA sequences, which are integrated into new genomic loci. L1 somatic insertions have the potential to disrupt the transcriptome by inserting into or nearby genes. By mutating genes and playing a role in epigenetic dysregulation, L1 transposons may contribute to tumorigenesis. Studies of the "mobilome" have lagged behind other tumor characterizations at the sequence, transcript, and epigenetic levels. Here, we consider evidence that L1 retrotransposons may sometimes drive human tumorigenesis.
Timmis, K N; Cabello, F; Andrés, I; Nordheim, A; Burkhardt, H J; Cohen, S N
1978-11-16
Detailed examination of the structure of cloned DNA fragments of the R6-5 antibiotic resistance plasmid has revealed a substantial degree of polynucleotide sequence heterogeneity and indicates that sequence rearrangements in plasmids and possible other replicons occur more frequently than has hitherto been appreciated. The sequences changes in cloned R6-5 fragments were shown in some instances to have occurred prior to cloning, i.e. existing in the original population of R6-5 molecules that was obtained from a single bacterial clone and by several different criteria judged to be homogeneous, and in others to have occurred either during the cloning procedure or during subsequent propagation of hybrid molecules. The molecular changes that are described involved insertion/deletion of the previously characterized IS2 insertion element, formation of a new inverted repeat structure probably by duplication of a preexisting R6-5 DNA sequence, sequence inversion, and loss and gain of restriction endonuclease cleavage sites.
Unique transposon landscapes are pervasive across Drosophila melanogaster genomes
Rahman, Reazur; Chirn, Gung-wei; Kanodia, Abhay; Sytnikova, Yuliya A.; Brembs, Björn; Bergman, Casey M.; Lau, Nelson C.
2015-01-01
To understand how transposon landscapes (TLs) vary across animal genomes, we describe a new method called the Transposon Insertion and Depletion AnaLyzer (TIDAL) and a database of >300 TLs in Drosophila melanogaster (TIDAL-Fly). Our analysis reveals pervasive TL diversity across cell lines and fly strains, even for identically named sub-strains from different laboratories such as the ISO1 strain used for the reference genome sequence. On average, >500 novel insertions exist in every lab strain, inbred strains of the Drosophila Genetic Reference Panel (DGRP), and fly isolates in the Drosophila Genome Nexus (DGN). A minority (<25%) of transposon families comprise the majority (>70%) of TL diversity across fly strains. A sharp contrast between insertion and depletion patterns indicates that many transposons are unique to the ISO1 reference genome sequence. Although TL diversity from fly strains reaches asymptotic limits with increasing sequencing depth, rampant TL diversity causes unsaturated detection of TLs in pools of flies. Finally, we show novel transposon insertions negatively correlate with Piwi-interacting RNA (piRNA) levels for most transposon families, except for the highly-abundant roo retrotransposon. Our study provides a useful resource for Drosophila geneticists to understand how transposons create extensive genomic diversity in fly cell lines and strains. PMID:26578579
Angsuthanasombat, C; Chungjatupornchai, W; Kertbundit, S; Luxananil, P; Settasatian, C; Wilairat, P; Panyim, S
1987-07-01
Five recombinant E. coli clones exhibiting toxicity to Aedes aegypti larvae were obtained from a library of 800 clones containing XbaI DNA fragments of 110 kb plasmid from B. thuringiensis var. israelensis. All the five clones (pMU 14/258/303/388/679) had the same 3.8-kb insert and encoded a major protein of 130 kDa which was highly toxic to A. aegypti larvae. Three clones (pMU 258/303/388) transcribed the 130 kD a gene in the same direction as that of lac Z promoter of pUC12 vector whereas the transcription of the other two (pMU 14/679) was in the opposite direction. A 1.9-kb fragment of the 3.8 kb insert coded for a protein of 65 kDa. Partial DNA sequence of the 3.8 kb insert, corresponding to the 5'-terminal of the 130 kDa gene, revealed a continuous reading frame, a Shine-Dalgarno sequence and a tentative 5'-regulatory region. These results demonstrated that the 3.8 kb insert is a minimal DNA fragment containing a regulatory region plus the coding sequence of the 130 kDa protein that is highly toxic to mosquito larvae.
Structure of yeast Argonaute with guide RNA
Nakanishi, Kotaro; Weinberg, David E.; Bartel, David P.; Patel, Dinshaw J.
2012-01-01
The RNA-induced silencing complex, comprising Argonaute and guide RNA, mediates RNA interference. Here we report the 3.2 Å crystal structure of Kluyveromyces Argonaute (KpAGO) fortuitously complexed with guide RNA originating from small-RNA duplexes autonomously loaded and processed by recombinant KpAGO. Despite their diverse sequences, guide-RNA nucleotides 1–8 are positioned similarly, with sequence-independent contacts to bases, phosphates and 2′-hydroxyl groups pre-organizing the backbone of nucleotides 2–8 in a near–A-form conformation. Compared with prokaryotic Argonautes, KpAGO has numerous surface-exposed insertion segments, with a cluster of conserved insertions repositioning the N domain to enable full propagation of guide–target pairing. Compared with Argonautes in inactive conformations, KpAGO has a hydrogen-bond network that stabilizes an expanded and repositioned loop, which inserts an invariant glutamate into the catalytic pocket. Mutation analyses and analogies to Ribonuclease H indicate that insertion of this glutamate finger completes a universally conserved catalytic tetrad, thereby activating Argonaute for RNA cleavage. PMID:22722195
1996-05-01
see figure appendix; B. abortus sequence in similarity arrangement with secD of E.coli, H. influenzae, M. leprae and S. coelicalor). Highly related...low similarity (E. coil and M. leprae approx 13.5% similarity). The Brucella and E. coil sequences were 25% similar (see figures appendix). In E...1987. Micobacterial growth inhibition by interferon-g activated bone marrow macrophages and differential susceptibility among strains of Mycobacterium
Sabri, Suriana; Steen, Jennifer A; Bongers, Mareike; Nielsen, Lars K; Vickers, Claudia E
2013-06-24
Metabolic engineering projects often require integration of multiple genes in order to control the desired phenotype. However, this often requires iterative rounds of engineering because many current insertion approaches are limited by the size of the DNA that can be transferred onto the chromosome. Consequently, construction of highly engineered strains is very time-consuming. A lack of well-characterised insertion loci is also problematic. A series of knock-in/knock-out (KIKO) vectors was constructed for integration of large DNA sequences onto the E. coli chromosome at well-defined loci. The KIKO plasmids target three nonessential genes/operons as insertion sites: arsB (an arsenite transporter); lacZ (β-galactosidase); and rbsA-rbsR (a ribose metabolism operon). Two homologous 'arms' target each insertion locus; insertion is mediated by λ Red recombinase through these arms. Between the arms is a multiple cloning site for the introduction of exogenous sequences and an antibiotic resistance marker (either chloramphenicol or kanamycin) for selection of positive recombinants. The resistance marker can subsequently be removed by flippase-mediated recombination. The insertion cassette is flanked by hairpin loops to isolate it from the effects of external transcription at the integration locus. To characterize each target locus, a xylanase reporter gene (xynA) was integrated onto the chromosomes of E. coli strains W and K-12 using the KIKO vectors. Expression levels varied between loci, with the arsB locus consistently showing the highest level of expression. To demonstrate the simultaneous use of all three loci in one strain, xynA, green fluorescent protein (gfp) and a sucrose catabolic operon (cscAKB) were introduced into lacZ, arsB and rbsAR respectively, and shown to be functional. The KIKO plasmids are a useful tool for efficient integration of large DNA fragments (including multiple genes and pathways) into E. coli. Chromosomal insertion provides stable expression without the need for continuous antibiotic selection. Three non-essential loci have been characterised as insertion loci; combinatorial insertion at all three loci can be performed in one strain. The largest insertion at a single site described here was 5.4 kb; we have used this method in other studies to insert a total of 7.3 kb at one locus and 11.3 kb across two loci. These vectors are particularly useful for integration of multigene cassettes for metabolic engineering applications.
Identification of genomic indels and structural variations using split reads
2011-01-01
Background Recent studies have demonstrated the genetic significance of insertions, deletions, and other more complex structural variants (SVs) in the human population. With the development of the next-generation sequencing technologies, high-throughput surveys of SVs on the whole-genome level have become possible. Here we present split-read identification, calibrated (SRiC), a sequence-based method for SV detection. Results We start by mapping each read to the reference genome in standard fashion using gapped alignment. Then to identify SVs, we score each of the many initial mappings with an assessment strategy designed to take into account both sequencing and alignment errors (e.g. scoring more highly events gapped in the center of a read). All current SV calling methods have multilevel biases in their identifications due to both experimental and computational limitations (e.g. calling more deletions than insertions). A key aspect of our approach is that we calibrate all our calls against synthetic data sets generated from simulations of high-throughput sequencing (with realistic error models). This allows us to calculate sensitivity and the positive predictive value under different parameter-value scenarios and for different classes of events (e.g. long deletions vs. short insertions). We run our calculations on representative data from the 1000 Genomes Project. Coupling the observed numbers of events on chromosome 1 with the calibrations gleaned from the simulations (for different length events) allows us to construct a relatively unbiased estimate for the total number of SVs in the human genome across a wide range of length scales. We estimate in particular that an individual genome contains ~670,000 indels/SVs. Conclusions Compared with the existing read-depth and read-pair approaches for SV identification, our method can pinpoint the exact breakpoints of SV events, reveal the actual sequence content of insertions, and cover the whole size spectrum for deletions. Moreover, with the advent of the third-generation sequencing technologies that produce longer reads, we expect our method to be even more useful. PMID:21787423
Bacterial Artificial Chromosome Libraries for Mouse Sequencing and Functional Analysis
Osoegawa, Kazutoyo; Tateno, Minako; Woon, Peng Yeong; Frengen, Eirik; Mammoser, Aaron G.; Catanese, Joseph J.; Hayashizaki, Yoshihide; de Jong, Pieter J.
2000-01-01
Bacterial artificial chromosome (BAC) and P1-derived artificial chromosome (PAC) libraries providing a combined 33-fold representation of the murine genome have been constructed using two different restriction enzymes for genomic digestion. A large-insert PAC library was prepared from the 129S6/SvEvTac strain in a bacterial/mammalian shuttle vector to facilitate functional gene studies. For genome mapping and sequencing, we prepared BAC libraries from the 129S6/SvEvTac and the C57BL/6J strains. The average insert sizes for the three libraries range between 130 kb and 200 kb. Based on the numbers of clones and the observed average insert sizes, we estimate each library to have slightly in excess of 10-fold genome representation. The average number of clones found after hybridization screening with 28 probes was in the range of 9–14 clones per marker. To explore the fidelity of the genomic representation in the three libraries, we analyzed three contigs, each established after screening with a single unique marker. New markers were established from the end sequences and screened against all the contig members to determine if any of the BACs and PACs are chimeric or rearranged. Only one chimeric clone and six potential deletions have been observed after extensive analysis of 113 PAC and BAC clones. Seventy-one of the 113 clones were conclusively nonchimeric because both end markers or sequences were mapped to the other confirmed contig members. We could not exclude chimerism for the remaining 41 clones because one or both of the insert termini did not contain unique sequence to design markers. The low rate of chimerism, ∼1%, and the low level of detected rearrangements support the anticipated usefulness of the BAC libraries for genome research. [The sequence data described in this paper have been submitted to the GenBank data library under accession numbers AQ797173–AQ797398.] PMID:10645956
Fingerprints of Modified RNA Bases from Deep Sequencing Profiles.
Kietrys, Anna M; Velema, Willem A; Kool, Eric T
2017-11-29
Posttranscriptional modifications of RNA bases are not only found in many noncoding RNAs but have also recently been identified in coding (messenger) RNAs as well. They require complex and laborious methods to locate, and many still lack methods for localized detection. Here we test the ability of next-generation sequencing (NGS) to detect and distinguish between ten modified bases in synthetic RNAs. We compare ultradeep sequencing patterns of modified bases, including miscoding, insertions and deletions (indels), and truncations, to unmodified bases in the same contexts. The data show widely varied responses to modification, ranging from no response, to high levels of mutations, insertions, deletions, and truncations. The patterns are distinct for several of the modifications, and suggest the future use of ultradeep sequencing as a fingerprinting strategy for locating and identifying modifications in cellular RNAs.
Draft genome sequences of Actinomyces timonensis strain 7400942T and its prophage.
Gorlas, Aurore; Gimenez, Grégory; Raoult, Didier; Roux, Véronique
2012-12-01
A draft genome sequence of Actinomyces timonensis, an anaerobic bacterium isolated from a human clinical osteoarticular sample, is described here. CRISPR-associated proteins, insertion sequence, and toxin-antitoxin loci were found on the genome. A new virus or provirus, AT-1, was characterized.
Ehrmann, M A; Vogel, R E
2001-11-01
An insertion sequence has been identified in the genome of Lactobacillus sanfranciscensis DSM 20451T as segment of 1351 nucleotides containing 37-bp imperfect terminal inverted repeats. The sequence of this element encodes two out of phase, overlapping open reading frames, orfA and orfB, from which three putative proteins are produced. OrfAB is a transframe protein produced by -1 translational frame shifting between orf A and orf B that is presumed to be the transposase. The large orfAB of this element encodes a 342 amino acid protein that displays similarities with transposases encoded by bacterial insertion sequences belonging to the IS3 family. In L. sanfranciscensis type strain DSM 20451T multiple truncated IS elements were identified. Inverse PCR was used to analyze target sites of four of these elements, but except of their highly AT rich character not any sequence specificity was identified so far. Moreover, no flanking direct repeats were identified. Multiple copies of IS153 were detected by hybridization in other strains of L. sanfranciscensis. Resulting hybridization patterns were shown to differentiate between organisms at strain level rather than a probe targeted against the 16S rDNA. With a PCR based approach IS153 or highly similar sequences were detected in L. acidophilus, L. casei, L. malefermentans, L. plantarum, L. hilgardii, L. collinoides L. farciminis L. sakei and L. salivarius, L. reuteri as well as in Enterococcus faecium, Pediococcus acidilactici and P. pentosaceus.
The novel fusion transcript NR5A2-KLHL29FT is generated by an insertion at the KLHL29 locus.
Sun, Zhenguo; Ke, Xiquan; Salzberg, Steven L; Kim, Daehwan; Antonescu, Valentin; Cheng, Yulan; Huang, Binbin; Song, Jee Hoon; Abraham, John M; Ibrahim, Sariat; Tian, Hui; Meltzer, Stephen J
2017-05-01
Novel fusion transcripts (FTs) caused by chromosomal rearrangement are common factors in the development of cancers. In the current study, the authors used massively parallel RNA sequencing to identify new FTs in colon cancers. RNA sequencing (RNA-Seq) and TopHat-Fusion were used to identify new FTs in colon cancers. The authors then investigated whether the novel FT nuclear receptor subfamily 5, group A, member 2 (NR5A2)-Kelch-like family member 29 FT (KLHL29FT) was transcribed from a genomic chromosomal rearrangement. Next, the expression of NR5A2-KLHL29FT was measured by quantitative real-time polymerase chain reaction in colon cancers and matched corresponding normal epithelia. The authors identified the FT NR5A2-KLHL29FT in normal and cancerous epithelia. While investigating this transcript, it was unexpectedly found that it was due to an uncharacterized polymorphic germline insertion of the NR5A2 sequence from chromosome 1 into the KLHL29 locus at chromosome 2, rather than a chromosomal rearrangement. This germline insertion, which occurred at a population frequency of 0.40, appeared to bear no relationship to cancer development. Moreover, expression of NR5A2-KLHL29FT was validated in RNA specimens from samples with insertions of NR5A2 at the KLHL29 gene locus, but not from samples without this insertion. It is interesting to note that NR5A2-KLH29FT expression levels were significantly lower in colon cancers than in matched normal colonic epithelia (P =.029), suggesting the potential participation of NR5A2-KLHL29FT in the origin or progression of this tumor type. NR5A2-KLHL29FT was generated from a polymorphism insertion of the NR5A2 sequence into the KLHL29 locus. NR5A2-KLHL29FT may influence the origin or progression of colon cancer. Moreover, researchers should be aware that similar FTs may occur due to transchromosomal insertions that are not correctly annotated in genome databases, especially with current assembly algorithms. Cancer 2017;123:1507-1515. © 2017 American Cancer Society. © 2016 American Cancer Society.
USDA-ARS?s Scientific Manuscript database
We explored the phylogenetic utility of entire plastid DNA sequences in Daucus and compared the results to prior phylogenetic results using plastid, nuclear, and mitochondrial DNA sequences. We obtained, using Illumina sequencing, full plastid sequences of 37 accessions of 20 Daucus taxa and outgrou...
Truszewski, Zenon; Krajewski, Paweł; Fudalej, Marcin; Smereka, Jacek; Frass, Michael; Robak, Oliver; Nguyen, Bianka; Ruetzler, Kurt; Szarpak, Lukasz
2016-01-01
Abstract Background: Airway management is a crucial skill essential to paramedics and personnel working in Emergency Medical Services and Emergency Departments: Lack of practice, a difficult airway, or a trauma situation may limit the ability of paramedics to perform direct laryngoscopy during cardiopulmonary resuscitation. Videoscope devices are alternatives for airway management in these situations. The ETView VivaSight SL (ETView; ETView Ltd., Misgav, Israel) is a new, single-lumen airway tube with an integrated high-resolution imaging camera. To assess if the ETView VivaSight SL can be a superior alternative to a standard endotracheal tube for intubation in an adult cadaver model, both during and without simulated CPR. Methods: ETView VivaSight SL tube was investigated via an interventional, randomized, crossover, cadaver study. A total of 52 paramedics participated in the intubation of human cadavers in three different scenarios: a normal airway at rest without concomitant chest compression (CC) (scenario A), a normal airway with uninterrupted CC (scenario B) and manual in-line stabilization (scenario C). Time and rate of success for intubation, the glottic view scale, and ease-of-use of ETView vs. sETT intubation were assessed for each emergency scenario. Results: The median time to intubation using ETView vs. sETT was compared for each of the aforementioned scenarios. For scenario A, time to first ventilation was achieved fastest for ETView, 19.5 [IQR, 16.5–22] sec, when compared to that of sETT at 21.5 [IQR, 20–25] sec (p = .013). In scenario B, the time for intubation using ETView was 21 [IQR, 18.5–24.5] sec (p < .001) and sETT was 27 [IQR, 24.5–31.5] sec. Time to first ventilation for scenario C was 23.5 [IQR, 19–25.5] sec for the ETView and 42.5 [IQR, 35–49.5] sec for sETT. Conclusions: In normal airways and situations with continuous chest compressions, the success rate for intubation of cadavers and the time to ventilation were improved with the ETView. The time to glottis view, tube insertion, and cuff block were all found to be shorter with the ETView. Trial Registration: clinicaltrials.gov Identifier: NCT02733536. PMID:27858851
Truszewski, Zenon; Krajewski, Paweł; Fudalej, Marcin; Smereka, Jacek; Frass, Michael; Robak, Oliver; Nguyen, Bianka; Ruetzler, Kurt; Szarpak, Lukasz
2016-11-01
Airway management is a crucial skill essential to paramedics and personnel working in Emergency Medical Services and Emergency Departments: Lack of practice, a difficult airway, or a trauma situation may limit the ability of paramedics to perform direct laryngoscopy during cardiopulmonary resuscitation. Videoscope devices are alternatives for airway management in these situations. The ETView VivaSight SL (ETView; ETView Ltd., Misgav, Israel) is a new, single-lumen airway tube with an integrated high-resolution imaging camera. To assess if the ETView VivaSight SL can be a superior alternative to a standard endotracheal tube for intubation in an adult cadaver model, both during and without simulated CPR. ETView VivaSight SL tube was investigated via an interventional, randomized, crossover, cadaver study. A total of 52 paramedics participated in the intubation of human cadavers in three different scenarios: a normal airway at rest without concomitant chest compression (CC) (scenario A), a normal airway with uninterrupted CC (scenario B) and manual in-line stabilization (scenario C). Time and rate of success for intubation, the glottic view scale, and ease-of-use of ETView vs. sETT intubation were assessed for each emergency scenario. The median time to intubation using ETView vs. sETT was compared for each of the aforementioned scenarios. For scenario A, time to first ventilation was achieved fastest for ETView, 19.5 [IQR, 16.5-22] sec, when compared to that of sETT at 21.5 [IQR, 20-25] sec (p = .013). In scenario B, the time for intubation using ETView was 21 [IQR, 18.5-24.5] sec (p < .001) and sETT was 27 [IQR, 24.5-31.5] sec. Time to first ventilation for scenario C was 23.5 [IQR, 19-25.5] sec for the ETView and 42.5 [IQR, 35-49.5] sec for sETT. In normal airways and situations with continuous chest compressions, the success rate for intubation of cadavers and the time to ventilation were improved with the ETView. The time to glottis view, tube insertion, and cuff block were all found to be shorter with the ETView. clinicaltrials.gov Identifier: NCT02733536.
Burstyn, J N; Heiger-Bernays, W J; Cohen, S M; Lippard, S J
2000-11-01
Mapping of cis-diamminedichloroplatinum(II) (cis-DDP, cisplatin) DNA adducts over >3000 nucleotides was carried out using a replication blockage assay. The sites of inhibition of modified T4 DNA polymerase, also referred to as stop sites, were analyzed to determine the effects of local sequence context on the distribution of intrastrand cisplatin cross-links. In a 3120 base fragment from replicative form M13mp18 DNA containing 24.6% guanine, 25.5% thymine, 26.9% adenine and 23.0% cytosine, 166 individual stop sites were observed at a bound platinum/nucleotide ratio of 1-2 per thousand. The majority of stop sites (90%) occurred at G(n>2) sequences and the remainder were located at sites containing an AG dinucleotide. For all of the GG sites present in the mapped sequences, including those with Gn(>)2, 89% blocked replication, whereas for the AG sites only 17% blocked replication. These blockage sites were independent of flanking nucleotides in a sequence of N(1)G*G*N(2) where N(1), N(2) = A, C, G, T and G*G* indicates a 1,2-intrastrand platinum cross-link. The absence of long-range sequence dependence was confirmed by monitoring the reaction of cisplatin with a plasmid containing an 800 bp insert of the human telomere repeat sequence (TTAGGG)(n). Platination reactions monitored at several formal platinum/nucleotide ratios or as a function of time reveal that the telomere insert was not preferentially damaged by cisplatin. Both replication blockage and telomere-insert plasmid platination experiments indicate that cisplatin 1,2-intrastrand adducts do not form preferentially at G-rich sequences in vitro.
Traverse, Charles C; Ochman, Howard
2017-08-29
Advances in sequencing technologies have enabled direct quantification of genome-wide errors that occur during RNA transcription. These errors occur at rates that are orders of magnitude higher than rates during DNA replication, but due to technical difficulties such measurements have been limited to single-base substitutions and have not yet quantified the scope of transcription insertions and deletions. Previous reporter gene assay findings suggested that transcription indels are produced exclusively by elongation complex slippage at homopolymeric runs, so we enumerated indels across the protein-coding transcriptomes of Escherichia coli and Buchnera aphidicola , which differ widely in their genomic base compositions and incidence of repeat regions. As anticipated from prior assays, transcription insertions prevailed in homopolymeric runs of A and T; however, transcription deletions arose in much more complex sequences and were rarely associated with homopolymeric runs. By reconstructing the relocated positions of the elongation complex as inferred from the sequences inserted or deleted during transcription, we show that continuation of transcription after slippage hinges on the degree of nucleotide complementarity within the RNA:DNA hybrid at the new DNA template location. IMPORTANCE The high level of mistakes generated during transcription can result in the accumulation of malfunctioning and misfolded proteins which can alter global gene regulation and in the expenditure of energy to degrade these nonfunctional proteins. The transcriptome-wide occurrence of base substitutions has been elucidated in bacteria, but information on transcription insertions and deletions-errors that potentially have more dire effects on protein function-is limited to reporter gene constructs. Here, we capture the transcriptome-wide spectrum of insertions and deletions in Escherichia coli and Buchnera aphidicola and show that they occur at rates approaching those of base substitutions. Knowledge of the full extent of sequences subject to transcription indels supports a new model of bacterial transcription slippage, one that relies on the number of complementary bases between the transcript and the DNA template to which it slipped. Copyright © 2017 Traverse and Ochman.
Tatonova, Yulia V; Chelomina, Galina N; Nguyen, Hung Manh
2017-11-01
Here we examined the intraspecific genetic variability of Clonorchis sinensis from Russia and Vietnam using nuclear DNA sequences (the 5.8S gene and two internal transcribed spacers of the ribosomal cluster). Despite the low level of variability in the ITS1 region, this marker has revealed some features of C. sinensis across multiple geographic regions. The genetic diversity levels for the Russian and Vietnamese populations were similar (0.1 and 0.09%, respectively) but were significantly lower than the C. sinensis from China (0.31%). About half of the sequences of the Chinese (53%) and Korean (47%) populations and about a tenth of the Vietnamese (12%) and Russian (8%) sequences included a 5bp insertion. No sequences with nucleotide substitutions both upstream and downstream of the 5bp insertion were found within the whole data set. The population of northern China had both sequence variants (with substitutions either upstream or downstream of the insertion), while only one of these variants was presented at the other localities. The Vietnamese population had a higher frequency of intragenomic polymorphism than the Russian population (69% vs. 46% and 23% vs. 3% at the 114bp and 339bp positions, respectively). These data are discussed in connection with parasite origin and adaptation, and also its invasive capacity and drug-resistance. Copyright © 2017 Elsevier B.V. All rights reserved.
Genetic and DNA sequence analysis of the kanamycin resistance transposon Tn903.
Grindley, N D; Joyce, C M
1980-01-01
The kanamycin resistance transposon Tn903 consists of a unique region of about 1000 base pairs bounded by a pair of 1050-base-pair inverted repeat sequences. Each repeat contains two Pvu II endonuclease cleavage sites separated by 520 base pairs. We have constructed derivatives of Tn903 in which this 520-base-pair fragment is deleted from one or both repeats. Those derivatives that lack both 520-base-pair fragments cannot transpose, whereas those that lack just one remain transposition proficient. One such transposable derivative, Tn903 delta I, has been selected for further study. We have determined the sequence of the intact inverted repeat. The 18 base pairs at each end are identical and inverted relative to one another, a structure characteristic of insertion sequences. Additional experiments indicate that a single inverted repeat from Tn903 can, in fact, transpose; we propose that this element be called IS903. To correlate the DNA sequence with genetic activities, we have created mutations by inserting a 10-base-pair DNA fragment at several sites within the intact repeat of Tn903 delta 1, and we have examined the effect of such insertions on transposability. The results suggest that IS903 encodes a 307-amino-acid polypeptide (a "transposase") that is absolutely required for transposition of IS903 or Tn903. Images PMID:6261245
The PNC-CAT insertion device beamline at the Advanced Photon Source
NASA Astrophysics Data System (ADS)
Heald, S. M.; Stern, E. A.; Brown, F. C.; Kim, K. H.; Barg, B.; Crozier, E. D.
1996-09-01
The PNC-CAT is a consortium of Pacific Northwest institutions formed to instrument a sector (number 20) at the Advanced Photon Source (APS). Research is planned in a variety of areas, with an emphasis on environmentally based problems. The insertion device beamline is based on the APS undulator A and will be optimized for producing microbeams as well as for applications requiring energy scanning capabilities. This paper describes the basic layout and some special features of the beamline. Two experimental stations are planned: one general purpose and one dedicated to MBE and surface science problems. Both tapered capillaries and Kirkpatrick-Baez optics will be used for producing microbeams, and a large optical bench is planned for the main station to allow for easy accommodation of new optics developments. Design calculations and initial capillary tests indicate that flux densities exceeding 1011 photons/sec/mm2 should be achievable. All major components are under construction or in procurement, and initial testing is planned for late 1996.
Size-Dependency of the Surface Ligand Density of Liposomes Prepared by Post-insertion.
Lee, Shang-Hsuan; Sato, Yusuke; Hyodo, Mamoru; Harashima, Hideyoshi
2017-01-01
In the active targeting of a drug delivery system (DDS), the density of the ligand on the functionalized liposome determines its affinity for binding to the target. To evaluate these densities on the surface of different sized liposomes, 4 liposomes with various diameters (188, 137, 70, 40 nm) were prepared and their surfaces were modified with fluorescently labeled ligand-lipid conjugates by the post-insertion method. Each liposomal mixture was fractionated into a series of fractions using size exclusion chromatography (SEC), and the resulting liposome fractions were precisely analyzed and the surface ligand densities calculated. The data collected using this methodology indicate that the density of the ligand on a particle is greatly dependent on the size of the liposome. This, in turn, indicates that smaller liposomes (75-40 nm) tend to possess higher densities. For developing active targeting systems, size and the density of the ligands are two important and independent factors that can affect the efficiency of a system as it relates to medical use.
Bardaji, Leire; Añorga, Maite; Jackson, Robert W.; Martínez-Bilbao, Alejandro; Yanguas-Casás, Natalia; Murillo, Jesús
2011-01-01
Mobile genetic elements are widespread in Pseudomonas syringae, and often associate with virulence genes. Genome reannotation of the model bean pathogen P. syringae pv. phaseolicola 1448A identified seventeen types of insertion sequences and two miniature inverted-repeat transposable elements (MITEs) with a biased distribution, representing 2.8% of the chromosome, 25.8% of the 132-kb virulence plasmid and 2.7% of the 52-kb plasmid. Employing an entrapment vector containing sacB, we estimated that transposition frequency oscillated between 2.6×10−5 and 1.1×10−6, depending on the clone, although it was stable for each clone after consecutive transfers in culture media. Transposition frequency was similar for bacteria grown in rich or minimal media, and from cells recovered from compatible and incompatible plant hosts, indicating that growth conditions do not influence transposition in strain 1448A. Most of the entrapped insertions contained a full-length IS801 element, with the remaining insertions corresponding to sequences smaller than any transposable element identified in strain 1448A, and collectively identified as miniature sequences. From these, fragments of 229, 360 and 679-nt of the right end of IS801 ended in a consensus tetranucleotide and likely resulted from one-ended transposition of IS801. An average 0.7% of the insertions analyzed consisted of IS801 carrying a fragment of variable size from gene PSPPH_0008/PSPPH_0017, showing that IS801 can mobilize DNA in vivo. Retrospective analysis of complete plasmids and genomes of P. syringae suggests, however, that most fragments of IS801 are likely the result of reorganizations rather than one-ended transpositions, and that this element might preferentially contribute to genome flexibility by generating homologous regions of recombination. A further miniature sequence previously found to affect host range specificity and virulence, designated MITEPsy1 (100-nt), represented an average 2.4% of the total number of insertions entrapped in sacB, demonstrating for the first time the mobilization of a MITE in bacteria. PMID:22016774
Bardaji, Leire; Añorga, Maite; Jackson, Robert W; Martínez-Bilbao, Alejandro; Yanguas-Casás, Natalia; Murillo, Jesús
2011-01-01
Mobile genetic elements are widespread in Pseudomonas syringae, and often associate with virulence genes. Genome reannotation of the model bean pathogen P. syringae pv. phaseolicola 1448A identified seventeen types of insertion sequences and two miniature inverted-repeat transposable elements (MITEs) with a biased distribution, representing 2.8% of the chromosome, 25.8% of the 132-kb virulence plasmid and 2.7% of the 52-kb plasmid. Employing an entrapment vector containing sacB, we estimated that transposition frequency oscillated between 2.6×10(-5) and 1.1×10(-6), depending on the clone, although it was stable for each clone after consecutive transfers in culture media. Transposition frequency was similar for bacteria grown in rich or minimal media, and from cells recovered from compatible and incompatible plant hosts, indicating that growth conditions do not influence transposition in strain 1448A. Most of the entrapped insertions contained a full-length IS801 element, with the remaining insertions corresponding to sequences smaller than any transposable element identified in strain 1448A, and collectively identified as miniature sequences. From these, fragments of 229, 360 and 679-nt of the right end of IS801 ended in a consensus tetranucleotide and likely resulted from one-ended transposition of IS801. An average 0.7% of the insertions analyzed consisted of IS801 carrying a fragment of variable size from gene PSPPH_0008/PSPPH_0017, showing that IS801 can mobilize DNA in vivo. Retrospective analysis of complete plasmids and genomes of P. syringae suggests, however, that most fragments of IS801 are likely the result of reorganizations rather than one-ended transpositions, and that this element might preferentially contribute to genome flexibility by generating homologous regions of recombination. A further miniature sequence previously found to affect host range specificity and virulence, designated MITEPsy1 (100-nt), represented an average 2.4% of the total number of insertions entrapped in sacB, demonstrating for the first time the mobilization of a MITE in bacteria.
TEs or not TEs? That is the evolutionary question.
Vaknin, Keren; Goren, Amir; Ast, Gil
2009-10-23
Transposable elements (TEs) have contributed a wide range of functional sequences to their host genomes. A recent paper in BMC Molecular Biology discusses the creation of new transcripts by transposable element insertion upstream of retrocopies and the involvement of such insertions in tissue-specific post-transcriptional regulation.
Kim, Junho; Maeng, Ju Heon; Lim, Jae Seok; Son, Hyeonju; Lee, Junehawk; Lee, Jeong Ho; Kim, Sangwoo
2016-10-15
Advances in sequencing technologies have remarkably lowered the detection limit of somatic variants to a low frequency. However, calling mutations at this range is still confounded by many factors including environmental contamination. Vector contamination is a continuously occurring issue and is especially problematic since vector inserts are hardly distinguishable from the sample sequences. Such inserts, which may harbor polymorphisms and engineered functional mutations, can result in calling false variants at corresponding sites. Numerous vector-screening methods have been developed, but none could handle contamination from inserts because they are focusing on vector backbone sequences alone. We developed a novel method-Vecuum-that identifies vector-originated reads and resultant false variants. Since vector inserts are generally constructed from intron-less cDNAs, Vecuum identifies vector-originated reads by inspecting the clipping patterns at exon junctions. False variant calls are further detected based on the biased distribution of mutant alleles to vector-originated reads. Tests on simulated and spike-in experimental data validated that Vecuum could detect 93% of vector contaminants and could remove up to 87% of variant-like false calls with 100% precision. Application to public sequence datasets demonstrated the utility of Vecuum in detecting false variants resulting from various types of external contamination. Java-based implementation of the method is available at http://vecuum.sourceforge.net/ CONTACT: swkim@yuhs.acSupplementary information: Supplementary data are available at Bioinformatics online. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.
Gniadkowski, M; Hemmings-Mieszczak, M; Klahre, U; Liu, H X; Filipowicz, W
1996-02-15
Introns of nuclear pre-mRNAs in dicotyledonous plants, unlike introns in vertebrates or yeast, are distinctly rich in A+U nucleotides and this feature is essential for their processing. In order to define more precisely sequence elements important for intron recognition in plants, we investigated the effects of short insertions, either U-rich or A-rich, on splicing of synthetic introns in transfected protoplast of Nicotiana plumbaginifolia. It was found that insertions of U-rich (sequence UUUUUAU) but not A-rich (AUAAAAA) segments can activate splicing of a GC-rich synthetic infron, and that U-rich segments, or multimers thereof, can function irrespective of the site of insertion within the intron. Insertions of multiple U-rich segments, either at the same or different locations, generally had an additive, stimulatory effect on splicing. Mutational analysis showed that replacement of one or two U residues in the UUUUUAU sequence with A or C residues had only a small effect on splicing, but replacement with G residues was strongly inhibitory. Proteins that interact with fragments of natural and synthetic pre-mRNAs in vitro were identified in nuclear extracts of N.plumbaginifolia by UV cross- linking. The profile of cross-linked plant proteins was considerably less complex than that obtained with a HeLa cell nuclear extract. Two major cross-linkable plant proteins had apparent molecular mass of 50 and 54 kDa and showed affinity for oligouridilates present in synGC introns or for poly(U).
Gniadkowski, M; Hemmings-Mieszczak, M; Klahre, U; Liu, H X; Filipowicz, W
1996-01-01
Introns of nuclear pre-mRNAs in dicotyledonous plants, unlike introns in vertebrates or yeast, are distinctly rich in A+U nucleotides and this feature is essential for their processing. In order to define more precisely sequence elements important for intron recognition in plants, we investigated the effects of short insertions, either U-rich or A-rich, on splicing of synthetic introns in transfected protoplast of Nicotiana plumbaginifolia. It was found that insertions of U-rich (sequence UUUUUAU) but not A-rich (AUAAAAA) segments can activate splicing of a GC-rich synthetic infron, and that U-rich segments, or multimers thereof, can function irrespective of the site of insertion within the intron. Insertions of multiple U-rich segments, either at the same or different locations, generally had an additive, stimulatory effect on splicing. Mutational analysis showed that replacement of one or two U residues in the UUUUUAU sequence with A or C residues had only a small effect on splicing, but replacement with G residues was strongly inhibitory. Proteins that interact with fragments of natural and synthetic pre-mRNAs in vitro were identified in nuclear extracts of N.plumbaginifolia by UV cross- linking. The profile of cross-linked plant proteins was considerably less complex than that obtained with a HeLa cell nuclear extract. Two major cross-linkable plant proteins had apparent molecular mass of 50 and 54 kDa and showed affinity for oligouridilates present in synGC introns or for poly(U). PMID:8604302
Xiong, Y; Eickbush, T H
1988-01-01
Two types of insertion elements, R1 and R2 (previously called type I and type II), are known to interrupt the 28S ribosomal genes of several insect species. In the silkmoth, Bombyx mori, each element occupies approximately 10% of the estimated 240 ribosomal DNA units, while at most only a few copies are located outside the ribosomal DNA units. We present here the complete nucleotide sequence of an R1 insertion from B. mori (R1Bm). This 5.1-kilobase element contains two overlapping open reading frames (ORFs) which together occupy 88% of its length. ORF1 is 461 amino acids in length and exhibits characteristics of retroviral gag genes. ORF2 is 1,051 amino acids in length and contains homology to reverse transcriptase-like enzymes. The analysis of 3' and 5' ends of independent isolates from the ribosomal locus supports the suggestion that R1 is still functioning as a transposable element. The precise location of the element within the genome implies that its transposition must occur with remarkable insertion sequence specificity. Comparison of the deduced amino acid sequences from six retrotransposons, R1 and R2 of B. mori, I factor and F element of Drosophila melanogaster, L1 of Mus domesticus, and Ingi of Trypanosoma brucei, reveals a relatively high level of sequence homology in the reverse transcriptase region. Like R1, these elements lack long terminal repeats. We have therefore named this class of related elements the non-long-terminal-repeat (non-LTR) retrotransposons. Images PMID:2447482
Pandey, R; Ashraf, H; Bhalla, A P; Garg, R
2012-01-01
Optimal wrist position is essential for successful catheterization of the radial artery. We planned to study the success rate of radial artery catheterization at various degrees of wrist extension angulations. This prospective, randomized study was performed in 60 consenting patients aged between 18-65 years and undergoing variable surgeries where the anesthetic management required an arterial catheterization. All patients were randomized into three groups of 20 patients each, according to wrist angulation during radial artery catheterization : either 30 degrees (Group 30), 45 degrees (Group 45), or 60 degrees (Group 60). Three metallic angulated wrist boards with angles of 30 degrees, 45 degrees, and 60 degrees (angle measured with calipers) were prepared, on which patient's wrist was kept at the above-mentioned angles of extension. Radial artery catheterization success rate, catheterization time, and numbers of attempts were recorded. The catheterization time was minimal in group 45 (30.50 +/- 16.82 sec) as compared to 36.00 +/- 14.19 sec and 43.50 +/- 13.80 sec in group 30 and 60, respectively. Radial artery was catheterized at first attempt in 60% of Group 45 and Group 60 patients, and in 50% of Group 30 patients. The arterial catheterization was successful in 14/20 patients in Group 30, 19/20 patients in group 45, and 16/20 patients in group 60. We conclude that a wrist extension of 450 appears to be the optimal wrist joint extension for a successful radial artery cannula insertion.
Szeverényi, I; Hodel, A; Arber, W; Olasz, F
1996-09-26
We constructed and characterized a novel trap vector for rapid isolation of insertion sequences. The strategy used for the isolation of IS elements is based on the ability of many IS elements to turn on the expression of otherwise silent genes distal to some sites of insertion. The simple transposition of an IS element can sometimes cause the constitutive expression of promoterless antibiotic resistance genes resulting in selectable phenotypes. The trap vector pAW1326 is based on a pBR322 replicon, it carries ampicillin and streptomycin resistance genes, and also silenced genes that confer chloramphenicol and kanamycin resistance once activated. The trap vector pAW1326 proved to be efficient and 85 percent of all isolated mutations were insertions. The majority of IS elements resident in the studied Escherichia coli strains tested became trapped, namely IS2, IS3, IS5, IS150, IS186 and Tn1000. We also encountered an insertion sequence, called IS10L/R-2, which is a hybrid of the two IS variants IS10L and IS10R. IS10L/R-2 is absent from most E. coli strains, but it is detectable in some strains such as JM109 which had been submitted to Tn10 mutagenesis. The distribution of the insertion sequences within the trap region was not random. Rather, the integration of chromosomal mobile genetic elements into the offered target sequence occurred in element-specific clusters. This is explained both by the target specificity and by the specific requirements for the activation of gene transcription by the DNA rearrangement. The employed trap vector pAW1326 proved to be useful for the isolation of mobile genetic elements, for a demonstration of their transposition activity as well as for the further characterization of some of the functional parameters of transposition.
Targeted gene insertion for molecular medicine.
Voigt, Katrin; Izsvák, Zsuzsanna; Ivics, Zoltán
2008-11-01
Genomic insertion of a functional gene together with suitable transcriptional regulatory elements is often required for long-term therapeutical benefit in gene therapy for several genetic diseases. A variety of integrating vectors for gene delivery exist. Some of them exhibit random genomic integration, whereas others have integration preferences based on attributes of the targeted site, such as primary DNA sequence and physical structure of the DNA, or through tethering to certain DNA sequences by host-encoded cellular factors. Uncontrolled genomic insertion bears the risk of the transgene being silenced due to chromosomal position effects, and can lead to genotoxic effects due to mutagenesis of cellular genes. None of the vector systems currently used in either preclinical experiments or clinical trials displays sufficient preferences for target DNA sequences that would ensure appropriate and reliable expression of the transgene and simultaneously prevent hazardous side effects. We review in this paper the advantages and disadvantages of both viral and non-viral gene delivery technologies, discuss mechanisms of target site selection of integrating genetic elements (viruses and transposons), and suggest distinct molecular strategies for targeted gene delivery.
[cDNA library construction from panicle meristem of finger millet].
Radchuk, V; Pirko, Ia V; Isaenkov, S V; Emets, A I; Blium, Ia B
2014-01-01
The protocol for production of full-size cDNA using SuperScript Full-Length cDNA Library Construction Kit II (Invitrogen) was tested and high quality cDNA library from meristematic tissue of finger millet panicle (Eleusine coracana (L.) Gaertn) was created. The titer of obtained cDNA library comprised 3.01 x 10(5) CFU/ml in avarage. In average the length of cDNA insertion consisted about 1070 base pairs, the effectivity of cDNA fragment insertions--99.5%. The selective sequencing of cDNA clones from created library was performed. The sequences of cDNA clones were identified with usage of BLAST-search. The results of cDNA library analysis and selective sequencing represents prove good functionality and full length character of inserted cDNA clones. Obtained cDNA library from meristematic tissue of finger millet panicle represents good and valuable source for isolation and identification of key genes regulating metabolism and meristematic development and for mining of new molecular markers to conduct out high quality genetic investigations and molecular breeding as well.
[Determination of genetic bases of auxotrophy in Yersinia pestis ssp. caucasica strains].
Odinokov, G N; Eroshenko, G A; Kukleva, L M; Shavina, N Iu; Krasnov, Ia M; Kutyrev, V V
2012-04-01
Based on the results of computer analysis of nucleotide sequences in strains Yersinia pestis and Y. pseudotuberculosis recorded in the files of NCBI GenBank database, differences between genes argA, aroG, aroF, thiH, and thiG of strain Pestoides F (subspecies caucasica) were found, compared to other strains of plaque agent and pseudotuberculosis microbe. Using PCR with calculated primers and the method of sequence analysis, the structure of variable regions of these genes was studied in 96 natural Y. pestis and Y. pseudotuberculosis strains. It was shown that all examined strains of subspecies caucasica, unlike strains of plague-causing agent of other subspecies and pseudotubercolosis microbe, had identical mutations in genes argA (integration of the insertion sequence IS100), aroG (insertion of ten nucleotides), aroF (inserion of IS100), thiH (insertion of nucleotide T), and thiG (deletion of 13 nucleotides). These mutations are the reason for the absence in strains belonging to this subspecies of the ability to synthesize arginine, phenylalanine, tyrosine, and vitamin B1 (thiamine), and cause their auxotrophy for these growth factors.
2011-01-01
Background One of the key goals of oak genomics research is to identify genes of adaptive significance. This information may help to improve the conservation of adaptive genetic variation and the management of forests to increase their health and productivity. Deep-coverage large-insert genomic libraries are a crucial tool for attaining this objective. We report herein the construction of a BAC library for Quercus robur, its characterization and an analysis of BAC end sequences. Results The EcoRI library generated consisted of 92,160 clones, 7% of which had no insert. Levels of chloroplast and mitochondrial contamination were below 3% and 1%, respectively. Mean clone insert size was estimated at 135 kb. The library represents 12 haploid genome equivalents and, the likelihood of finding a particular oak sequence of interest is greater than 99%. Genome coverage was confirmed by PCR screening of the library with 60 unique genetic loci sampled from the genetic linkage map. In total, about 20,000 high-quality BAC end sequences (BESs) were generated by sequencing 15,000 clones. Roughly 5.88% of the combined BAC end sequence length corresponded to known retroelements while ab initio repeat detection methods identified 41 additional repeats. Collectively, characterized and novel repeats account for roughly 8.94% of the genome. Further analysis of the BESs revealed 1,823 putative genes suggesting at least 29,340 genes in the oak genome. BESs were aligned with the genome sequences of Arabidopsis thaliana, Vitis vinifera and Populus trichocarpa. One putative collinear microsyntenic region encoding an alcohol acyl transferase protein was observed between oak and chromosome 2 of V. vinifera. Conclusions This BAC library provides a new resource for genomic studies, including SSR marker development, physical mapping, comparative genomics and genome sequencing. BES analysis provided insight into the structure of the oak genome. These sequences will be used in the assembly of a future genome sequence for oak. PMID:21645357
Structural features of the rice chromosome 4 centromere.
Zhang, Yu; Huang, Yuchen; Zhang, Lei; Li, Ying; Lu, Tingting; Lu, Yiqi; Feng, Qi; Zhao, Qiang; Cheng, Zhukuan; Xue, Yongbiao; Wing, Rod A; Han, Bin
2004-01-01
A complete sequence of a chromosome centromere is necessary for fully understanding centromere function. We reported the sequence structures of the first complete rice chromosome centromere through sequencing a large insert bacterial artificial chromosome clone-based contig, which covered the rice chromosome 4 centromere. Complete sequencing of the 124-kb rice chromosome 4 centromere revealed that it consisted of 18 tracts of 379 tandemly arrayed repeats known as CentO and a total of 19 centromeric retroelements (CRs) but no unique sequences were detected. Four tracts, composed of 65 CentO repeats, were located in the opposite orientation, and 18 CentO tracts were flanked by 19 retroelements. The CRs were classified into four types, and the type I retroelements appeared to be more specific to rice centromeres. The preferential insert of the CRs among CentO repeats indicated that the centromere-specific retroelements may contribute to centromere expansion during evolution. The presence of three intact retrotransposons in the centromere suggests that they may be responsible for functional centromere initiation through a transcription-mediated mechanism.
Verma, Alok Kumar; Misra, Amita; Subash, Swarna; Das, Mukul; Dwivedi, Premendra D
2011-09-01
Development of genetically modified (GM) crops is on increase to improve food quality, increase harvest yields, and reduce the dependency on chemical pesticides. Before their release in marketplace, they should be scrutinized for their safety. Several guidelines of different regulatory agencies like ILSI, WHO Codex, OECD, and so on for allergenicity evaluation of transgenics are available and sequence homology analysis is the first test to determine the allergenic potential of inserted proteins. Therefore, to test and validate, 312 allergenic, 100 non-allergenic, and 48 inserted proteins were assessed for sequence similarity using 8-mer, 80-mer, and full FASTA search. On performing sequence homology studies, ~94% the allergenic proteins gave exact matches for 8-mer and 80-mer homology. However, 20 allergenic proteins showed non-allergenic behavior. Out of 100 non-allergenic proteins, seven qualified as allergens. None of the inserted proteins demonstrated allergenic behavior. In order to improve the predictability, proteins showing anomalous behavior were tested by Algpred and ADFS separately. Use of Algpred and ADFS softwares reduced the tendency of false prediction to a great extent (74-78%). In conclusion, routine sequence homology needs to be coupled with some other bioinformatic method like ADFS/Algpred to reduce false allergenicity prediction of novel proteins.
MSeq-CNV: accurate detection of Copy Number Variation from Sequencing of Multiple samples.
Malekpour, Seyed Amir; Pezeshk, Hamid; Sadeghi, Mehdi
2018-03-05
Currently a few tools are capable of detecting genome-wide Copy Number Variations (CNVs) based on sequencing of multiple samples. Although aberrations in mate pair insertion sizes provide additional hints for the CNV detection based on multiple samples, the majority of the current tools rely only on the depth of coverage. Here, we propose a new algorithm (MSeq-CNV) which allows detecting common CNVs across multiple samples. MSeq-CNV applies a mixture density for modeling aberrations in depth of coverage and abnormalities in the mate pair insertion sizes. Each component in this mixture density applies a Binomial distribution for modeling the number of mate pairs with aberration in the insertion size and also a Poisson distribution for emitting the read counts, in each genomic position. MSeq-CNV is applied on simulated data and also on real data of six HapMap individuals with high-coverage sequencing, in 1000 Genomes Project. These individuals include a CEU trio of European ancestry and a YRI trio of Nigerian ethnicity. Ancestry of these individuals is studied by clustering the identified CNVs. MSeq-CNV is also applied for detecting CNVs in two samples with low-coverage sequencing in 1000 Genomes Project and six samples form the Simons Genome Diversity Project.
SvABA: genome-wide detection of structural variants and indels by local assembly.
Wala, Jeremiah A; Bandopadhayay, Pratiti; Greenwald, Noah F; O'Rourke, Ryan; Sharpe, Ted; Stewart, Chip; Schumacher, Steve; Li, Yilong; Weischenfeldt, Joachim; Yao, Xiaotong; Nusbaum, Chad; Campbell, Peter; Getz, Gad; Meyerson, Matthew; Zhang, Cheng-Zhong; Imielinski, Marcin; Beroukhim, Rameen
2018-04-01
Structural variants (SVs), including small insertion and deletion variants (indels), are challenging to detect through standard alignment-based variant calling methods. Sequence assembly offers a powerful approach to identifying SVs, but is difficult to apply at scale genome-wide for SV detection due to its computational complexity and the difficulty of extracting SVs from assembly contigs. We describe SvABA, an efficient and accurate method for detecting SVs from short-read sequencing data using genome-wide local assembly with low memory and computing requirements. We evaluated SvABA's performance on the NA12878 human genome and in simulated and real cancer genomes. SvABA demonstrates superior sensitivity and specificity across a large spectrum of SVs and substantially improves detection performance for variants in the 20-300 bp range, compared with existing methods. SvABA also identifies complex somatic rearrangements with chains of short (<1000 bp) templated-sequence insertions copied from distant genomic regions. We applied SvABA to 344 cancer genomes from 11 cancer types and found that short templated-sequence insertions occur in ∼4% of all somatic rearrangements. Finally, we demonstrate that SvABA can identify sites of viral integration and cancer driver alterations containing medium-sized (50-300 bp) SVs. © 2018 Wala et al.; Published by Cold Spring Harbor Laboratory Press.
Optical mapping and its potential for large-scale sequencing projects.
Aston, C; Mishra, B; Schwartz, D C
1999-07-01
Physical mapping has been rediscovered as an important component of large-scale sequencing projects. Restriction maps provide landmark sequences at defined intervals, and high-resolution restriction maps can be assembled from ensembles of single molecules by optical means. Such optical maps can be constructed from both large-insert clones and genomic DNA, and are used as a scaffold for accurately aligning sequence contigs generated by shotgun sequencing.
Sakai, Hiroaki; Kanamori, Hiroyuki; Arai-Kichise, Yuko; Shibata-Hatta, Mari; Ebana, Kaworu; Oono, Youko; Kurita, Kanako; Fujisawa, Hiroko; Katagiri, Satoshi; Mukai, Yoshiyuki; Hamada, Masao; Itoh, Takeshi; Matsumoto, Takashi; Katayose, Yuichi; Wakasa, Kyo; Yano, Masahiro; Wu, Jianzhong
2014-01-01
Having a deep genetic structure evolved during its domestication and adaptation, the Asian cultivated rice (Oryza sativa) displays considerable physiological and morphological variations. Here, we describe deep whole-genome sequencing of the aus rice cultivar Kasalath by using the advanced next-generation sequencing (NGS) technologies to gain a better understanding of the sequence and structural changes among highly differentiated cultivars. The de novo assembled Kasalath sequences represented 91.1% (330.55 Mb) of the genome and contained 35 139 expressed loci annotated by RNA-Seq analysis. We detected 2 787 250 single-nucleotide polymorphisms (SNPs) and 7393 large insertion/deletion (indel) sites (>100 bp) between Kasalath and Nipponbare, and 2 216 251 SNPs and 3780 large indels between Kasalath and 93-11. Extensive comparison of the gene contents among these cultivars revealed similar rates of gene gain and loss. We detected at least 7.39 Mb of inserted sequences and 40.75 Mb of unmapped sequences in the Kasalath genome in comparison with the Nipponbare reference genome. Mapping of the publicly available NGS short reads from 50 rice accessions proved the necessity and the value of using the Kasalath whole-genome sequence as an additional reference to capture the sequence polymorphisms that cannot be discovered by using the Nipponbare sequence alone. PMID:24578372
Bartels, Daniela; Kespohl, Sebastian; Albaum, Stefan; Drüke, Tanja; Goesmann, Alexander; Herold, Julia; Kaiser, Olaf; Pühler, Alfred; Pfeiffer, Friedhelm; Raddatz, Günter; Stoye, Jens; Meyer, Folker; Schuster, Stephan C
2005-04-01
We provide the graphical tool BACCardI for the construction of virtual clone maps from standard assembler output files or BLAST based sequence comparisons. This new tool has been applied to numerous genome projects to solve various problems including (a) validation of whole genome shotgun assemblies, (b) support for contig ordering in the finishing phase of a genome project, and (c) intergenome comparison between related strains when only one of the strains has been sequenced and a large insert library is available for the other. The BACCardI software can seamlessly interact with various sequence assembly packages. Genomic assemblies generated from sequence information need to be validated by independent methods such as physical maps. The time-consuming task of building physical maps can be circumvented by virtual clone maps derived from read pair information of large insert libraries.
Characterization of the Fb-Nof Transposable Element of Drosophila Melanogaster
Harden, N.; Ashburner, M.
1990-01-01
FB-NOF is a composite transposable element of Drosophila melanogaster. It is composed of foldback sequences, of variable length, which flank a 4-kb NOF sequence with 308-bp inverted repeat termini. The NOF sequence could potentially code for a 120-kD polypeptide. The FB-NOF element is responsible for unstable mutations of the white gene (w(c) and w(DZL)) and is associated with the large TEs of G. Ising. Although most strains of D. melanogaster have 20-30 sites of FB insertion, FB-NOF elements are usually rare, many strains lack this composite element or have only one copy of it. A few strains, including w(DZL) and Basc have many (8-21) copies of FB-NOF, and these show a tendency to insert at ``hot-spots.'' These strains also have an increased number of FB elements. The DNA sequence of the NOF region associated with TE146(Z) has been determined. PMID:2174013
A periplasmic, pyridoxal-5'-phosphate-dependent amino acid racemase in Pseudomonas taetrolens.
Matsui, Daisuke; Oikawa, Tadao; Arakawa, Noriaki; Osumi, Shintaro; Lausberg, Frank; Stäbler, Norma; Freudl, Roland; Eggeling, Lothar
2009-07-01
The pyridoxal-5'-phosphate (PLP)-dependent amino acid racemases occur in almost every bacterium but may differ considerably with respect to substrate specificity. We here isolated the cloned broad substrate specificity racemase ArgR of Pseudomonas taetrolens from Escherichia coli by classical procedures. The racemase was biochemically characterized and amongst other aspects it was confirmed that it is mostly active with lysine, arginine and ornithine, but merely weakly active with alanine, whereas the alanine racemase of the same organism studied in comparison acts on alanine only. Unexpectedly, sequencing the amino-terminal end of ArgR revealed processing of the protein, with a signal peptide cleaved off. Subsequent localization studies demonstrated that in both P. taetrolens and E. coli ArgR activity was almost exclusively present in the periplasm, a feature so far unknown for any amino acid racemase. An ArgR-derivative carrying a carboxy-terminal His-tag was made and this was demonstrated to localize even in an E. coli mutant devoid of the twin-arginine translocation (Tat) pathway in the periplasm. These data indicate that ArgR is synthesized as a prepeptide and translocated in a Tat-independent manner. We therefore propose that ArgR translocation depends on the Sec system and a post-translocational insertion of PLP occurs. As further experiments showed, ArgR is necessary for the catabolism of D: -arginine and D: -lysine by P. taetrolens.
The ram accelerator - A chemically driven mass launcher
NASA Technical Reports Server (NTRS)
Kaloupis, P.; Bruckner, A. P.
1988-01-01
The ram accelerator, a chemically propelled mass driver, is presented as a viable new approach for directly launching acceleration-insensitive payloads into low earth orbit. The propulsion principle is similar to that of a conventional air-breathing ramjet. The cargo vehicle resembles the center-body of a ramjet and travels through a tube filled with a pre-mixed fuel and oxidizer mixture. The launch tube acts as the outer cowling of the ramjet and the combustion process travels with the vehicle. Two drive modes of the ram accelerator propulsion system are described, which when used in sequence are capable of accelerating the vehicle to as high as 10 km/sec. The requirements are examined for placing a 2000 kg vehicle into a 500 km orbit with a minimum of on-board rocket propellant for circularization maneuvers. It is shown that aerodynamic heating during atmospheric transit results in very little ablation of the nose. An indirect orbital insertion scenario is selected, utilizing a three step maneuver consisting of two burns and aerobraking. An on-board propulsion system using storable liquid propellants is chosen in order to minimize propellant mass requirements, and the use of a parking orbit below the desired final orbit is suggested as a means to increase the flexibility of the mass launch concept. A vehicle design using composite materials is proposed that will best meet the structural requirements, and a preliminary launch tube design is presented.
Genome-wide analysis of Tol2 transposon reintegration in zebrafish.
Kondrychyn, Igor; Garcia-Lecea, Marta; Emelyanov, Alexander; Parinov, Sergey; Korzh, Vladimir
2009-09-08
Tol2, a member of the hAT family of transposons, has become a useful tool for genetic manipulation of model animals, but information about its interactions with vertebrate genomes is still limited. Furthermore, published reports on Tol2 have mainly been based on random integration of the transposon system after co-injection of a plasmid DNA harboring the transposon and a transposase mRNA. It is important to understand how Tol2 would behave upon activation after integration into the genome. We performed a large-scale enhancer trap (ET) screen and generated 338 insertions of the Tol2 transposon-based ET cassette into the zebrafish genome. These insertions were generated by remobilizing the transposon from two different donor sites in two transgenic lines. We found that 39% of Tol2 insertions occurred in transcription units, mostly into introns. Analysis of the transposon target sites revealed no strict specificity at the DNA sequence level. However, Tol2 was prone to target AT-rich regions with weak palindromic consensus sequences centered at the insertion site. Our systematic analysis of sequential remobilizations of the Tol2 transposon from two independent sites within a vertebrate genome has revealed properties such as a tendency to integrate into transcription units and into AT-rich palindrome-like sequences. This information will influence the development of various applications involving DNA transposons and Tol2 in particular.
Galindo-González, Leonardo; Mhiri, Corinne; Grandbastien, Marie-Angèle; Deyholos, Michael K
2016-12-07
Initial characterization of the flax genome showed that Ty1-copia retrotransposons are abundant, with several members being recently inserted, and in close association with genes. Recent insertions indicate a potential for ongoing transpositional activity that can create genomic diversity among accessions, cultivars or varieties. The polymorphisms generated constitute a good source of molecular markers that may be associated with phenotype if the insertions alter gene activity. Flax, where accessions are bred mainly for seed nutritional properties or for fibers, constitutes a good model for studying the relationship of transpositional activity with diversification and breeding. In this study, we estimated copy number and used a type of transposon display known as Sequence-Specific Amplification Polymorphisms (SSAPs), to characterize six families of Ty1-copia elements across 14 flax accessions. Polymorphic insertion sites were sequenced to find insertions that could potentially alter gene expression, and a preliminary test was performed with selected genes bearing transposable element (TE) insertions. Quantification of six families of Ty1-copia elements indicated different abundances among TE families and between flax accessions, which suggested diverse transpositional histories. SSAPs showed a high level of polymorphism in most of the evaluated retrotransposon families, with a trend towards higher levels of polymorphism in low-copy number families. Ty1-copia insertion polymorphisms among cultivars allowed a general distinction between oil and fiber types, and between spring and winter types, demonstrating their utility in diversity studies. Characterization of polymorphic insertions revealed an overwhelming association with genes, with insertions disrupting exons, introns or within 1 kb of coding regions. A preliminary test on the potential transcriptional disruption by TEs of four selected genes evaluated in three different tissues, showed one case of significant impact of the insertion on gene expression. We demonstrated that specific Ty1-copia families have been active since breeding commenced in flax. The retrotransposon-derived polymorphism can be used to separate flax types, and the close association of many insertions with genes defines a good source of potential mutations that could be associated with phenotypic changes, resulting in diversification processes.
Selfish DNA in protein-coding genes of Rickettsia.
Ogata, H; Audic, S; Barbe, V; Artiguenave, F; Fournier, P E; Raoult, D; Claverie, J M
2000-10-13
Rickettsia conorii, the aetiological agent of Mediterranean spotted fever, is an intracellular bacterium transmitted by ticks. Preliminary analyses of the nearly complete genome sequence of R. conorii have revealed 44 occurrences of a previously undescribed palindromic repeat (150 base pairs long) throughout the genome. Unexpectedly, this repeat was found inserted in-frame within 19 different R. conorii open reading frames likely to encode functional proteins. We found the same repeat in proteins of other Rickettsia species. The finding of a mobile element inserted in many unrelated genes suggests the potential role of selfish DNA in the creation of new protein sequences.
Clostridium perfringens type A–E toxin plasmids
Freedman, John C.; Theoret, James R.; Wisniewski, Jessica A.; Uzal, Francisco A.; Rood, Julian I.; McClane, Bruce A.
2014-01-01
Clostridium perfringens relies upon plasmid-encoded toxin genes to cause intestinal infections. These toxin genes are associated with insertion sequences that may facilitate their mobilization and transfer, giving rise to new toxin plasmids with common backbones. Most toxin plasmids carry a transfer of clostridial plasmids locus mediating conjugation, which likely explains the presence of similar toxin plasmids in otherwise unrelated C. perfringens strains. The association of many toxin genes with insertion sequences and conjugative plasmids provides virulence flexibility when causing intestinal infections. However, incompatibility issues apparently limit the number of toxin plasmids maintained by a single cell. PMID:25283728
Hara, Yuichiro; Tatsumi, Kaori; Yoshida, Michio; Kajikawa, Eriko; Kiyonari, Hiroshi; Kuraku, Shigehiro
2015-11-18
RNA-seq enables gene expression profiling in selected spatiotemporal windows and yields massive sequence information with relatively low cost and time investment, even for non-model species. However, there remains a large room for optimizing its workflow, in order to take full advantage of continuously developing sequencing capacity. Transcriptome sequencing for three embryonic stages of Madagascar ground gecko (Paroedura picta) was performed with the Illumina platform. The output reads were assembled de novo for reconstructing transcript sequences. In order to evaluate the completeness of transcriptome assemblies, we prepared a reference gene set consisting of vertebrate one-to-one orthologs. To take advantage of increased read length of >150 nt, we demonstrated shortened RNA fragmentation time, which resulted in a dramatic shift of insert size distribution. To evaluate products of multiple de novo assembly runs incorporating reads with different RNA sources, read lengths, and insert sizes, we introduce a new reference gene set, core vertebrate genes (CVG), consisting of 233 genes that are shared as one-to-one orthologs by all vertebrate genomes examined (29 species)., The completeness assessment performed by the computational pipelines CEGMA and BUSCO referring to CVG, demonstrated higher accuracy and resolution than with the gene set previously established for this purpose. As a result of the assessment with CVG, we have derived the most comprehensive transcript sequence set of the Madagascar ground gecko by means of assembling individual libraries followed by clustering the assembled sequences based on their overall similarities. Our results provide several insights into optimizing de novo RNA-seq workflow, including the coordination between library insert size and read length, which manifested in improved connectivity of assemblies. The approach and assembly assessment with CVG demonstrated here would be applicable to transcriptome analysis of other species as well as whole genome analyses.
Gallei, Andreas; Orlich, Michaela; Thiel, Heinz-Juergen; Becher, Paul
2005-01-01
Several studies have demonstrated that cytopathogenic (cp) pestivirus strains evolve from noncytopathogenic (noncp) viruses by nonhomologous RNA recombination. In addition, two recent reports showed the rapid emergence of noncp Bovine viral diarrhea virus (BVDV) after a few cell culture passages of cp BVDV strains by homologous recombination between identical duplicated viral sequences. To allow the identification of recombination sites from noncp BVDV strains that evolve from cp viruses, we constructed the cp BVDV strains CP442 and CP552. Both harbor duplicated viral sequences of different origin flanking the cellular insertion Nedd8*; the latter is a prerequisite for their cytopathogenicity. In contrast to the previous studies, isolation of noncp strains was possible only after extensive cell culture passages of CP442 and CP552. Sequence analysis of 15 isolated noncp BVDVs confirmed that all recombinant strains lack at least most of Nedd8*. Interestingly, only one strain resulted from homologous recombination while the other 14 strains were generated by nonhomologous recombination. Accordingly, our data suggest that the extent of sequence identity between participating sequences influences both frequency and mode (homologous versus nonhomologous) of RNA recombination in pestiviruses. Further analyses of the noncp recombinant strains revealed that a duplication of 14 codons in the BVDV nonstructural protein 4B (NS4B) gene does not interfere with efficient viral replication. Moreover, an insertion of viral sequences between the NS4A and NS4B genes was well tolerated. These findings thus led to the identification of two genomic loci which appear to be suited for the insertion of heterologous sequences into the genomes of pestiviruses and related viruses. PMID:16254361
Dyvorne, Hadrien A.; Galea, Nicola; Nevers, Thomas; Fiel, M. Isabel; Carpenter, David; Wong, Edmund; Orton, Matthew; de Oliveira, Andre; Feiweier, Thorsten; Vachon, Marie-Louise; Babb, James S.
2013-01-01
Purpose: To optimize intravoxel incoherent motion (IVIM) diffusion-weighted (DW) imaging by estimating the effects of diffusion gradient polarity and breathing acquisition scheme on image quality, signal-to-noise ratio (SNR), IVIM parameters, and parameter reproducibility, as well as to investigate the potential of IVIM in the detection of hepatic fibrosis. Materials and Methods: In this institutional review board–approved prospective study, 20 subjects (seven healthy volunteers, 13 patients with hepatitis C virus infection; 14 men, six women; mean age, 46 years) underwent IVIM DW imaging with four sequences: (a) respiratory-triggered (RT) bipolar (BP) sequence, (b) RT monopolar (MP) sequence, (c) free-breathing (FB) BP sequence, and (d) FB MP sequence. Image quality scores were assessed for all sequences. A biexponential analysis with the Bayesian method yielded true diffusion coefficient (D), pseudodiffusion coefficient (D*), and perfusion fraction (PF) in liver parenchyma. Mixed-model analysis of variance was used to compare image quality, SNR, IVIM parameters, and interexamination variability between the four sequences, as well as the ability to differentiate areas of liver fibrosis from normal liver tissue. Results: Image quality with RT sequences was superior to that with FB acquisitions (P = .02) and was not affected by gradient polarity. SNR did not vary significantly between sequences. IVIM parameter reproducibility was moderate to excellent for PF and D, while it was less reproducible for D*. PF and D were both significantly lower in patients with hepatitis C virus than in healthy volunteers with the RT BP sequence (PF = 13.5% ± 5.3 [standard deviation] vs 9.2% ± 2.5, P = .038; D = [1.16 ± 0.07] × 10−3 mm2/sec vs [1.03 ± 0.1] × 10−3 mm2/sec, P = .006). Conclusion: The RT BP DW imaging sequence had the best results in terms of image quality, reproducibility, and ability to discriminate between healthy and fibrotic liver with biexponential fitting. © RSNA, 2012 PMID:23220895
USDA-ARS?s Scientific Manuscript database
Simple sequence repeats (SSR) markers were developed from a small insert genomic library for Bipolaris sorokiniana, a mitosporic fungal pathogen that causes spot blotch and root rot in switchgrass. About 59% of sequenced clones (n=384) harbored various SSR motifs. After eliminating the redundant seq...
Vincent, Antony T; Trudel, Mélanie V; Freschi, Luca; Nagar, Vandan; Gagné-Thivierge, Cynthia; Levesque, Roger C; Charette, Steve J
2016-01-12
Aeromonads make up a group of Gram-negative bacteria that includes human and fish pathogens. The Aeromonas salmonicida species has the peculiarity of including five known subspecies. However, few studies of the genomes of A. salmonicida subspecies have been reported to date. We sequenced the genomes of additional A. salmonicida isolates, including three from India, using next-generation sequencing in order to gain a better understanding of the genomic and phylogenetic links between A. salmonicida subspecies. Their relative phylogenetic positions were confirmed by a core genome phylogeny based on 1645 gene sequences. The Indian isolates, which formed a sub-group together with A. salmonicida subsp. pectinolytica, were able to grow at either at 18 °C and 37 °C, unlike the A. salmonicida psychrophilic isolates that did not grow at 37 °C. Amino acid frequencies, GC content, tRNA composition, loss and gain of genes during evolution, pseudogenes as well as genes under positive selection and the mobilome were studied to explain this intraspecies dichotomy. Insertion sequences appeared to be an important driving force that locked the psychrophilic strains into their particular lifestyle in order to conserve their genomic integrity. This observation, based on comparative genomics, is in agreement with previous results showing that insertion sequence mobility induced by heat in A. salmonicida subspecies causes genomic plasticity, resulting in a deleterious effect on the virulence of the bacterium. We provide a proof-of-concept that selfish DNAs play a major role in the evolution of bacterial species by modeling genomes.
Rapid discrimination of sequences flanking and within T-DNA insertions in the Arabidopsis genome.
Ponce, M R; Quesada, V; Micol, J L
1998-05-01
An improvement to previous methods for recovering Arabidopsis thaliana genomic DNA flanking T-DNA insertions is presented that allows for the avoidance of some of the cloning difficulties caused by the concatameric nature of T-DNA inserts. The principle of the procedure is to categorize by size restriction fragments of mutant DNA, produced in separate digestions with NdeI and Bst1107I. Given that the sites for these two enzymes are contiguous within the pGV3850:1003 T-DNA construct, the restriction fragments obtained fall into two categories: those showing identical size in both digestions, which correspond to sequences internal to T-DNA concatamers; and those of different sizes, that contain the junctions between plant DNA and the T-DNA insert. Such a criterion makes it possible to easily distinguish the digestion products corresponding to internal T-DNA parts, which do not deserve further attention, and those which presumably include a segment of the locus of interest. Discrimination between restriction fragments of genomic mutant DNA can be made on rescued plasmids, inverse PCR amplification products or bands in a genomic blot.
Continuous Influx of Genetic Material from Host to Virus Populations
Gilbert, Clément; Peccoud, Jean; Chateigner, Aurélien; Moumen, Bouziane
2016-01-01
Many genes of large double-stranded DNA viruses have a cellular origin, suggesting that host-to-virus horizontal transfer (HT) of DNA is recurrent. Yet, the frequency of these transfers has never been assessed in viral populations. Here we used ultra-deep DNA sequencing of 21 baculovirus populations extracted from two moth species to show that a large diversity of moth DNA sequences (n = 86) can integrate into viral genomes during the course of a viral infection. The majority of the 86 different moth DNA sequences are transposable elements (TEs, n = 69) belonging to 10 superfamilies of DNA transposons and three superfamilies of retrotransposons. The remaining 17 sequences are moth sequences of unknown nature. In addition to bona fide DNA transposition, we uncover microhomology-mediated recombination as a mechanism explaining integration of moth sequences into viral genomes. Many sequences integrated multiple times at multiple positions along the viral genome. We detected a total of 27,504 insertions of moth sequences in the 21 viral populations and we calculate that on average, 4.8% of viruses harbor at least one moth sequence in these populations. Despite this substantial proportion, no insertion of moth DNA was maintained in any viral population after 10 successive infection cycles. Hence, there is a constant turnover of host DNA inserted into viral genomes each time the virus infects a moth. Finally, we found that at least 21 of the moth TEs integrated into viral genomes underwent repeated horizontal transfers between various insect species, including some lepidopterans susceptible to baculoviruses. Our results identify host DNA influx as a potent source of genetic diversity in viral populations. They also support a role for baculoviruses as vectors of DNA HT between insects, and call for an evaluation of possible gene or TE spread when using viruses as biopesticides or gene delivery vectors. PMID:26829124
Continuous Influx of Genetic Material from Host to Virus Populations.
Gilbert, Clément; Peccoud, Jean; Chateigner, Aurélien; Moumen, Bouziane; Cordaux, Richard; Herniou, Elisabeth A
2016-02-01
Many genes of large double-stranded DNA viruses have a cellular origin, suggesting that host-to-virus horizontal transfer (HT) of DNA is recurrent. Yet, the frequency of these transfers has never been assessed in viral populations. Here we used ultra-deep DNA sequencing of 21 baculovirus populations extracted from two moth species to show that a large diversity of moth DNA sequences (n = 86) can integrate into viral genomes during the course of a viral infection. The majority of the 86 different moth DNA sequences are transposable elements (TEs, n = 69) belonging to 10 superfamilies of DNA transposons and three superfamilies of retrotransposons. The remaining 17 sequences are moth sequences of unknown nature. In addition to bona fide DNA transposition, we uncover microhomology-mediated recombination as a mechanism explaining integration of moth sequences into viral genomes. Many sequences integrated multiple times at multiple positions along the viral genome. We detected a total of 27,504 insertions of moth sequences in the 21 viral populations and we calculate that on average, 4.8% of viruses harbor at least one moth sequence in these populations. Despite this substantial proportion, no insertion of moth DNA was maintained in any viral population after 10 successive infection cycles. Hence, there is a constant turnover of host DNA inserted into viral genomes each time the virus infects a moth. Finally, we found that at least 21 of the moth TEs integrated into viral genomes underwent repeated horizontal transfers between various insect species, including some lepidopterans susceptible to baculoviruses. Our results identify host DNA influx as a potent source of genetic diversity in viral populations. They also support a role for baculoviruses as vectors of DNA HT between insects, and call for an evaluation of possible gene or TE spread when using viruses as biopesticides or gene delivery vectors.
Transposon Insertions of magellan-4 That Impair Social Gliding Motility in Myxococcus xanthus
Youderian, Philip; Hartzell, Patricia L.
2006-01-01
Myxococcus xanthus has two different mechanisms of motility, adventurous (A) motility, which permits individual cells to glide over solid surfaces, and social (S) motility, which permits groups of cells to glide. To identify the genes involved in S-gliding motility, we mutagenized a ΔaglU (A−) strain with the defective transposon, magellan-4, and screened for S− mutants that form nonmotile colonies. Sequence analysis of the sites of the magellan-4 insertions in these mutants and the alignment of these sites with the M. xanthus genome sequence show that two-thirds of these insertions lie within 27 of the 37 nonessential genes known to be required for social motility, including those necessary for the biogenesis of type IV pili, exopolysaccharide, and lipopolysaccharide. The remaining insertions also identify 31 new, nonessential genes predicted to encode both structural and regulatory determinants of S motility. These include three tetratricopeptide repeat proteins, several regulators of transcription that may control the expression of genes involved in pilus extension and retraction, and additional enzymes involved in polysaccharide metabolism. Three insertions that abolish S motility lie within genes predicted to encode glycolytic enzymes, suggesting that the signal for pilus retraction may be a simple product of exopolysaccharide catabolism. PMID:16299386
vonHoldt, Bridgett M; Ji, Sarah S; Aardema, Matthew L; Stahler, Daniel; Udell, Monique A R; Sinsheimer, Janet S
2018-06-01
In canines, transposon dynamics have been associated with a hyper-social behavioral syndrome, although the functional mechanism has yet to be described. We investigate the epigenetic and transcriptional consequences of these behavior-associated mobile element insertions in dogs and Yellowstone wolves. We posit that the transposons themselves may not be the causative feature; rather, their transcriptional regulation may exert the functional impact. We survey four outlier transposons associated with hyper-sociability, with the expectation that they are targeted for epigenetic silencing. We predict hyper-methylation of mobile element insertions (MEIs), suggestive that the epigenetic silencing of and not the MEIs themselves may be driving dysregulation of nearby genes. We found that transposon-derived sequences are significantly hyper-methylated, regardless of their copy number or species. Further, we have assessed transcriptome sequence data and found evidence that mobile element insertions impact the expression levels of six genes (WBSCR17, LIMK1, GTF2I, WBSCR27, BAZ1B, and BCL7B), all of which have known roles in human Williams-Beuren syndrome due to changes in copy number, typically hemizygosity. Although further evidence is needed, our results suggest that a few insertions alter local expression at multiple genes, likely through a cis-regulatory mechanism that excludes proximal methylation.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Solera, J.; Magallon, M.; Martin-Villar, J.
1992-02-01
DNA from a patient with severe hemophilia B was evaluated by RFLP analysis, producing results which suggested the existence of a partial deletion within the factor IX gene. The deletion was further localized and characterized by PCR amplification and sequencing. The altered allele has a 4,442-bp deletion which removes both the donor splice site located at the 5[prime] end of intron d and the two last coding nucleotides located at the 3[prime] end of exon IV in the normal factor IX gene; this fragment has been inserted in inverted orientation. Two homologous sequences have been discovered at the ends ofmore » the deleted DNA fragment.« less
Sahar-Helft, Sharonit; Sarp, Ayşe Sena Kabaş; Stabholtz, Adam; Gutkin, Vitaly; Redenski, Idan; Steinberg, Doron
2015-03-01
The purpose of this study was to compare the efficacy of three irrigation techniques for smear-layer removal with 17% EDTA. Cleaning and shaping the root canal system during endodontic treatment produces a smear layer and hard tissue debris. Three irrigation techniques were tested for solution infiltration of this layer: positive-pressure irrigation, passive ultrasonic irrigation, and laser-activated irrigation. Sixty extracted teeth were divided into six equal groups; 17% EDTA was used for 60 sec irrigation of five of the groups. The groups were as follows: Group 1, treated only with ProTaper™ F3 Ni-Ti files; Group 2, positive-pressure irrigation, with a syringe; Group 3, passive ultrasonic irrigation, inserted 1 mm short of the working length; Group 4, passive ultrasonic irrigation, inserted in the upper coronal third of the root; Group 5, Er:YAG laser-activated irrigation, inserted 1 mm short of the working length; and Group 6, Er:YAG laser-activated irrigation, inserted in the upper coronal third of the root. Scanning electron microscopy showed that the smear layer is removed most efficiently using laser-activated irrigation at low energy with 17% EDTA, inserted either at the working length or only in the coronal upper third of the root. Amounts of Ca, P, and O were not significantly different on all treated dentin surfaces. Smear-layer removal was most effective when the root canals were irrigated using Er:YAG laser at low energy with 17% EDTA solution. Interestingly, removal of the smear layer along the entire canal was similar when the laser was inserted in the upper coronal third and at 1 mm short of the working length of the root canal. This effect was not observed with the ultrasonic and positive-pressure techniques.
Wang, Lingfang; Kefalidis, Christos E; Sinbandhit, Sourisak; Dorcet, Vincent; Carpentier, Jean-François; Maron, Laurent; Sarazin, Yann
2013-09-27
The tin(II) complexes {LO(x)}Sn(X) ({LO(x)}(-) =aminophenolate ancillary) containing amido (1-4), chloro (5), or lactyl (6) coligands (X) promote the ring-opening polymerization (ROP) of cyclic esters. Complex 6, which models the first insertion of L-lactide, initiates the living ROP of L-LA on its own, but the amido derivatives 1-4 require the addition of alcohol to do so. Upon addition of one to ten equivalents of iPrOH, precatalysts 1-4 promote the ROP of trimethylene carbonate (TMC); yet, hardly any activity is observed if tert-butyl (R)-lactate is used instead of iPrOH. Strong inhibition of the reactivity of TMC is also detected for the simultaneous copolymerization of L-LA and TMC, or for the block copolymerization of TMC after that of L-LA. Experimental and computational data for the {LO(x)}Sn(OR)complexes (OR=lactyl or lactidyl) replicating the active species during the tin(II)-mediated ROP of L-LA demonstrate that the formation of a five-membered chelate is largely favored over that of an eight-membered one, and that it constitutes the resting state of the catalyst during this (co)polymerization. Comprehensive DFT calculations show that, out of the four possible monomer insertion sequences during simultaneous copolymerization of L-LA and TMC: 1) TMC then TMC, 2) TMC then L-LA, 3) L-LA then L-LA, and 4) L-LA then TMC, the first three are possible. By contrast, insertion of L-LA followed by that of TMC (i.e., insertion sequence 4) is endothermic by +1.1 kcal mol(-1), which compares unfavorably with consecutive insertions of two L-LA units (i.e., insertion sequence 3) (-10.2 kcal mol(-1)). The copolymerization of L-LA and TMC thus proceeds under thermodynamic control. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Saranathan, Rajagopalan; Pagal, Sudhakar; Sawant, Ajit R; Tomar, Archana; Madhangi, M; Sah, Suresh; Satti, Annapurna; Arunkumar, K P; Prashanth, K
2017-10-03
Acinetobacter baumannii is an important human pathogen and considered as a major threat due to its extreme drug resistance. In this study, the genome of a hyper-virulent MDR strain PKAB07 of A. baumannii isolated from an Indian patient was sequenced and analyzed to understand its mechanisms of virulence, resistance and evolution. Comparative genome analysis of PKAB07 revealed virulence and resistance related genes scattered throughout the genome, instead of being organized as an island, indicating the highly mosaic nature of the genome. Many intermittent horizontal gene transfer events, insertion sequence (IS) element insertions identified were augmenting resistance machinery and elevating the SNP densities in A. baumannii eventually aiding in their swift evolution. ISAba1, the most widely distributed insertion sequence in A. baumannii was found in multiple sites in PKAB07. Out of many ISAba1 insertions, we identified novel insertions in 9 different genes wherein insertional inactivation of adeN (tetR type regulator) was significant. To assess the significance of this disruption in A. baumannii, adeN mutant and complement strains were constructed in A. baumannii ATCC 17978 strain and studied. Biofilm levels were abrogated in the adeN knockout when compared with the wild type and complemented strain of adeN knockout. Virulence of the adeN knockout mutant strain was observed to be high, which was validated by in vitro experiments and Galleria mellonella infection model. The overexpression of adeJ, a major component of AdeIJK efflux pump observed in adeN knockout strain could be the possible reason for the elevated virulence in adeN mutant and PKB07 strain. Knocking out of adeN in ATCC strain led to increased resistance and virulence at par with the PKAB07. Disruption of tetR type regulator adeN by ISAba1 consequently has led to elevated virulence in this pathogen.
Watson, Christopher M; Camm, Nick; Crinnion, Laura A; Clokie, Samuel; Robinson, Rachel L; Adlard, Julian; Charlton, Ruth; Markham, Alexander F; Carr, Ian M; Bonthron, David T
2017-12-01
Diagnostic genetic testing programmes based on next-generation DNA sequencing have resulted in the accrual of large datasets of targeted raw sequence data. Most diagnostic laboratories process these data through an automated variant-calling pipeline. Validation of the chosen analytical methods typically depends on confirming the detection of known sequence variants. Despite improvements in short-read alignment methods, current pipelines are known to be comparatively poor at detecting large insertion/deletion mutations. We performed clinical validation of a local reassembly tool, ABRA (assembly-based realigner), through retrospective reanalysis of a cohort of more than 2000 hereditary cancer cases. ABRA enabled detection of a 96-bp deletion, 4-bp insertion mutation in PMS2 that had been initially identified using a comparative read-depth approach. We applied an updated pipeline incorporating ABRA to the entire cohort of 2000 cases and identified one previously undetected pathogenic variant, a 23-bp duplication in PTEN. We demonstrate the effect of read length on the ability to detect insertion/deletion variants by comparing HiSeq2500 (2 × 101-bp) and NextSeq500 (2 × 151-bp) sequence data for a range of variants and thereby show that the limitations of shorter read lengths can be mitigated using appropriate informatics tools. This work highlights the need for ongoing development of diagnostic pipelines to maximize test sensitivity. We also draw attention to the large differences in computational infrastructure required to perform day-to-day versus large-scale reprocessing tasks.
Mahillon, Jacques; Chandler, Michael
1998-01-01
Insertion sequences (ISs) constitute an important component of most bacterial genomes. Over 500 individual ISs have been described in the literature to date, and many more are being discovered in the ongoing prokaryotic and eukaryotic genome-sequencing projects. The last 10 years have also seen some striking advances in our understanding of the transposition process itself. Not least of these has been the development of various in vitro transposition systems for both prokaryotic and eukaryotic elements and, for several of these, a detailed understanding of the transposition process at the chemical level. This review presents a general overview of the organization and function of insertion sequences of eubacterial, archaebacterial, and eukaryotic origins with particular emphasis on bacterial elements and on different aspects of the transposition mechanism. It also attempts to provide a framework for classification of these elements by assigning them to various families or groups. A total of 443 members of the collection have been grouped in 17 families based on combinations of the following criteria: (i) similarities in genetic organization (arrangement of open reading frames); (ii) marked identities or similarities in the enzymes which mediate the transposition reactions, the recombinases/transposases (Tpases); (iii) similar features of their ends (terminal IRs); and (iv) fate of the nucleotide sequence of their target sites (generation of a direct target duplication of determined length). A brief description of the mechanism(s) involved in the mobility of individual ISs in each family and of the structure-function relationships of the individual Tpases is included where available. PMID:9729608
Sliding over the Blocks in Enzyme-Free RNA Copying – One-Pot Primer Extension in Ice
Löffler, Philipp M. G.; Groen, Joost; Dörr, Mark; Monnard, Pierre-Alain
2013-01-01
Template-directed polymerization of RNA in the absence of enzymes is the basis for an information transfer in the ‘RNA-world’ hypothesis and in novel nucleic acid based technology. Previous investigations established that only cytidine rich strands are efficient templates in bulk aqueous solutions while a few specific sequences completely block the extension of hybridized primers. We show that a eutectic water/ice system can support Pb2+/Mg2+-ion catalyzed extension of a primer across such sequences, i.e. AA, AU and AG, in a one-pot synthesis. Using mixtures of imidazole activated nucleotide 5′-monophosphates, the two first “blocking” residues could be passed during template-directed polymerization, i.e., formation of triply extended products containing a high fraction of faithful copies was demonstrated. Across the AG sequence, a mismatch sequence was formed in similar amounts to the correct product due to U·G wobble pairing. Thus, the template-directed extension occurs both across pyrimidine and purine rich sequences and insertions of pyrimidines did not inhibit the subsequent insertions. Products were mainly formed with 2′-5′-phosphodiester linkages, however, the abundance of 3′–5′-linkages was higher than previously reported for pyrimidine insertions. When enzyme-free, template-directed RNA polymerization is performed in a eutectic water ice environment, various intrinsic reaction limitations observed in bulk solution can then be overcome. PMID:24058695
Meyer, C; Pouteau, S; Rouzé, P; Caboche, M
1994-01-01
By Northern blot analysis of nitrate reductase-deficient mutants of Nicotiana plumbaginifolia, we identified a mutant (mutant D65), obtained after gamma-ray irradiation of protoplasts, which contained an insertion sequence in the nitrate reductase (NR) mRNA. This insertion sequence was localized by polymerase chain reaction (PCR) in the first exon of NR and was also shown to be present in the NR gene. The mutant gene contained a 565 bp insertion sequence that exhibits the sequence characteristics of a transposable element, which was thus named dTnp1. The dTnp1 element has 14 bp terminal inverted repeats and is flanked by an 8-bp target site duplication generated upon transposition. These inverted repeats have significant sequence homology with those of other transposable elements. Judging by its size and the absence of a long open reading frame, dTnp1 appears to represent a defective, although mobile, transposable element. The octamer motif TTTAGGCC was found several times in direct orientation near the 5' and 3' ends of dTnp1 together with a perfect palindrome located after the 5' inverted repeat. Southern blot analysis using an internal probe of dTnp1 suggested that this element occurs as a single copy in the genome of N. plumbaginifolia. It is also present in N. tabacum, but absent in tomato or petunia. The dTnp1 element is therefore of potential use for gene tagging in Nicotiana species.
Hamada, Motoharu; Doisaki, Sayoko; Okuno, Yusuke; Muramatsu, Hideki; Hama, Asahito; Kawashima, Nozomu; Narita, Atsushi; Nishio, Nobuhiro; Yoshida, Kenichi; Kanno, Hitoshi; Manabe, Atsushi; Taga, Takashi; Takahashi, Yoshiyuki; Miyano, Satoru; Ogawa, Seishi; Kojima, Seiji
2018-06-23
Congenital dyserythropoietic anemia (CDA) is a heterogeneous group of rare congenital disorders characterized by ineffective erythropoiesis and dysplastic changes in erythroblasts. Diagnosis of CDA is based primarily on the morphology of bone marrow erythroblasts; however, genetic tests have recently become more important. Here, we performed genetic analysis of 10 Japanese patients who had been diagnosed with CDA based on laboratory findings and morphological characteristics. We examined 10 CDA patients via central review of bone marrow morphology and genetic analysis for congenital bone marrow failure syndromes. Sanger sequencing for CDAN1, SEC23B, and KLF1 was performed for all patients. We performed whole-exome sequencing in patients without mutation in these genes. Three patients carried pathogenic CDAN1 mutations, whereas no SEC23B mutations were identified in our cohort. WES unexpectedly identified gene mutations known to cause congenital hemolytic anemia in two patients: canonical G6PD p.Val394Leu mutation and SPTA1 p.Arg28His mutation. Comprehensive genetic analysis is warranted for more effective diagnosis of patients with suspected CDA.
Kuhn, Alexandre; Ong, Yao Min; Quake, Stephen R; Burkholder, William F
2015-07-08
Like other structural variants, transposable element insertions can be highly polymorphic across individuals. Their functional impact, however, remains poorly understood. Current genome-wide approaches for genotyping insertion-site polymorphisms based on targeted or whole-genome sequencing remain very expensive and can lack accuracy, hence new large-scale genotyping methods are needed. We describe a high-throughput method for genotyping transposable element insertions and other types of structural variants that can be assayed by breakpoint PCR. The method relies on next-generation sequencing of multiplex, site-specific PCR amplification products and read count-based genotype calls. We show that this method is flexible, efficient (it does not require rounds of optimization), cost-effective and highly accurate. This method can benefit a wide range of applications from the routine genotyping of animal and plant populations to the functional study of structural variants in humans.
Investigating Delamination Migration in Composite Tape Laminates
NASA Technical Reports Server (NTRS)
Ratcliffe, James G.; DeCarvalho, Nelson V.
2014-01-01
A modification to a recently developed test specimen designed to investigate migration of a delamination between neighboring ply interfaces in tape laminates is presented. The specimen is a cross-ply laminated beam consisting of 40 plies with a polytetrafluoroethylene insert spanning part way along its length. The insert is located between a lower 0-degree ply (specimen length direction) and a stack of four 90-degree plies (specimen width direction). The modification involved a stacking sequence that promotes stable delamination growth prior to migration, and included a relocation of the insert from the specimen midplane to the interface between plies 14 and 15. Specimens were clamped at both ends onto a rigid baseplate and loaded on their upper surface via a piano hinge assembly, resulting in a predominantly flexural loading condition. Tests were conducted with the load-application point positioned at various locations along a specimen's span. This position affected the sequence of damage events during a test.
In and out of the rRNA genes: characterization of Pokey elements in the sequenced Daphnia genome
2013-01-01
Background Only a few transposable elements are known to exhibit site-specific insertion patterns, including the well-studied R-element retrotransposons that insert into specific sites within the multigene rDNA. The only known rDNA-specific DNA transposon, Pokey (superfamily: piggyBac) is found in the freshwater microcrustacean, Daphnia pulex. Here, we present a genome-wide analysis of Pokey based on the recently completed whole genome sequencing project for D. pulex. Results Phylogenetic analysis of Pokey elements recovered from the genome sequence revealed the presence of four lineages corresponding to two divergent autonomous families and two related lineages of non-autonomous miniature inverted repeat transposable elements (MITEs). The MITEs are also found at the same 28S rRNA gene insertion site as the Pokey elements, and appear to have arisen as deletion derivatives of autonomous elements. Several copies of the full-length Pokey elements may be capable of producing an active transposase. Surprisingly, both families of Pokey possess a series of 200 bp repeats upstream of the transposase that is derived from the rDNA intergenic spacer (IGS). The IGS sequences within the Pokey elements appear to be evolving in concert with the rDNA units. Finally, analysis of the insertion sites of Pokey elements outside of rDNA showed a target preference for sites similar to the specific sequence that is targeted within rDNA. Conclusions Based on the target site preference of Pokey elements and the concerted evolution of a segment of the element with the rDNA unit, we propose an evolutionary path by which the ancestors of Pokey elements have invaded the rDNA niche. We discuss how specificity for the rDNA unit may have evolved and how this specificity has played a role in the long-term survival of these elements in the subgenus Daphnia. PMID:24059783
Wolf, Zena T.; Leslie, Elizabeth J.; Arzi, Boaz; Jayashankar, Kartika; Karmi, Nili; Jia, Zhonglin; Rowland, Douglas J.; Young, Amy; Safra, Noa; Sliskovic, Saundra; Murray, Jeffrey C.; Wade, Claire M.; Bannasch, Danika L.
2014-01-01
Cleft palate (CP) is one of the most commonly occurring craniofacial birth defects in humans. In order to study cleft palate in a naturally occurring model system, we utilized the Nova Scotia Duck Tolling Retriever (NSDTR) dog breed. Micro-computed tomography analysis of CP NSDTR craniofacial structures revealed that these dogs exhibit defects similar to those observed in a recognizable subgroup of humans with CP: Pierre Robin Sequence (PRS). We refer to this phenotype in NSDTRs as CP1. Individuals with PRS have a triad of birth defects: shortened mandible, posteriorly placed tongue, and cleft palate. A genome-wide association study in 14 CP NSDTRs and 72 unaffected NSDTRs identified a significantly associated region on canine chromosome 14 (24.2 Mb–29.3 Mb; praw = 4.64×10−15). Sequencing of two regional candidate homeobox genes in NSDTRs, distal-less homeobox 5 (DLX5) and distal-less homeobox 6 (DLX6), identified a 2.1 kb LINE-1 insertion within DLX6 in CP1 NSDTRs. The LINE-1 insertion is predicted to insert a premature stop codon within the homeodomain of DLX6. This prompted the sequencing of DLX5 and DLX6 in a human cohort with CP, where a missense mutation within the highly conserved DLX5 homeobox of a patient with PRS was identified. This suggests the involvement of DLX5 in the development of PRS. These results demonstrate the power of the canine animal model as a genetically tractable approach to understanding naturally occurring craniofacial birth defects in humans. PMID:24699068
Boakes, E.; Kearns, A. M.; Ganner, M.; Perry, C.; Hill, R. L.; Ellington, M. J.
2011-01-01
Genetically diverse community-associated methicillin resistant Staphylococcus aureus (CA-MRSA) can harbor a bacteriophage encoding Panton-Valentine leukocidin (PVL) lysogenized into its chromosome (prophage). Six PVL phages (ΦPVL, Φ108PVL, ΦSLT, ΦSa2MW, ΦSa2USA, and ΦSa2958) are known, and single-nucleotide polymorphisms (SNPs) in the PVL genes have been reported. We sought to determine the distribution of lysogenized PVL phages among MRSA strains with PVL (PVL-MRSA strains), the PVL gene sequences, and the chromosomal phage insertion sites in 114 isolates comprising nine clones of PVL-MRSA that were selected for maximal underlying genetic diversity. The six PVL phages were identified by PCR; ΦSa2USA was present in the highest number of different lineages (multilocus sequence type clonal complex 1 [CC1], CC5, CC8, and sequence type 93 [ST93]) (n = 37 isolates). Analysis of 92 isolates confirmed that PVL phages inserted into the same chromosomal insertion locus in CC22, -30, and -80 but in a different locus in isolates of CC1, -5, -8, -59, and -88 and ST93 (and CC22 in two isolates). Within the two different loci, specific attachment motifs were found in all cases, although some limited inter- and intralineage sequence variation occurred. Overall, lineage-specific relationships between the PVL phage, the genes that encode the toxin, and the position at which the phage inserts into the host chromosome were identified. These analyses provide important insights into the microepidemiology of PVL-MRSA, will prove a valuable adjunct in outbreak investigation, and may help predict the emergence of new strains. PMID:21106787
Structural diversity of domain superfamilies in the CATH database.
Reeves, Gabrielle A; Dallman, Timothy J; Redfern, Oliver C; Akpor, Adrian; Orengo, Christine A
2006-07-14
The CATH database of domain structures has been used to explore the structural variation of homologous domains in 294 well populated domain structure superfamilies, each containing at least three sequence diverse relatives. Our analyses confirm some previously detected trends relating sequence divergence to structural variation but for a much larger dataset and in some superfamilies the new data reveal exceptional structural variation. Use of a new algorithm (2DSEC) to analyse variability in secondary structure compositions across a superfamily sheds new light on how structures evolve. 2DSEC detects inserted secondary structures that embellish the core of conserved secondary structures found throughout the superfamily. Analysis showed that for 56% of highly populated superfamilies (>9 sequence diverse relatives), there are twofold or more increases in the numbers of secondary structures in some relatives. In some families fivefold increases occur, sometimes modifying the fold of the domain. Manual inspection of secondary structure insertions or embellishments in 48 particularly variable superfamilies revealed that although these insertions were usually discontiguous in the sequence they were often co-located in 3D resulting in a larger structural motif that often modified the geometry of the active site or the surface conformation promoting diverse domain partnerships and protein interactions. These observations, supported by automatic analysis of all well populated CATH families, suggest that accretion of small secondary structure insertions may provide a simple mechanism for evolving new functions in diverse relatives. Some layered domain architectures (e.g. mainly-beta and alpha-beta sandwiches) that recur highly in the genomes more frequently exploit these types of embellishments to modify function. In these architectures, aggregation occurs most often at the edges, top or bottom of the beta-sheets. Information on structural variability across domain superfamilies has been made available through the CATH Dictionary of Homologous Structures (DHS).
Genetic Control of Plant Root Colonization by the Biocontrol agent, Pseudomonas fluorescens
DOE Office of Scientific and Technical Information (OSTI.GOV)
Cole, Benjamin J.; Fletcher, Meghan; Waters, Jordan
Plant growth promoting rhizobacteria (PGPR) are a critical component of plant root ecosystems. PGPR promote plant growth by solubilizing inaccessible minerals, suppressing pathogenic microorganisms in the soil, and directly stimulating growth through hormone synthesis. Pseudomonas fluorescens is a well-established PGPR isolated from wheat roots that can also colonize the root system of the model plant, Arabidopsis thaliana. We have created barcoded transposon insertion mutant libraries suitable for genome-wide transposon-mediated mutagenesis followed by sequencing (TnSeq). These libraries consist of over 105 independent insertions, collectively providing loss-of-function mutants for nearly all genes in the P.fluorescens genome. Each insertion mutant can be unambiguouslymore » identified by a randomized 20 nucleotide sequence (barcode) engineered into the transposon sequence. We used these libraries in a gnotobiotic assay to examine the colonization ability of P.fluorescens on A.thaliana roots. Taking advantage of the ability to distinguish individual colonization events using barcode sequences, we assessed the timing and microbial concentration dependence of colonization of the rhizoplane niche. These data provide direct insight into the dynamics of plant root colonization in an in vivo system and define baseline parameters for the systematic identification of the bacterial genes and molecular pathways using TnSeq assays. Having determined parameters that facilitate potential colonization of roots by thousands of independent insertion mutants in a single assay, we are currently establishing a genome-wide functional map of genes required for root colonization in P.fluorescens. Importantly, the approach developed and optimized here for P.fluorescens>A.thaliana colonization will be applicable to a wide range of plant-microbe interactions, including biofuel feedstock plants and microbes known or hypothesized to impact on biofuel-relevant traits including biomass productivity and pathogen resistance.« less
Aboklaish, Ali F.; Dordet-Frisoni, Emilie; Citti, Christine; Toleman, Mark A; Glass, John I.; Spiller, O. Brad
2015-01-01
While transposon mutagenesis has been successfully used for Mycoplasma spp. to disrupt and determine non-essential genes, previous attempts with Ureaplasma spp. have been unsuccessful. Using a polyethylene glycol-transformation enhancing protocol, we were able to transform three separate serovars of Ureaplasma parvum with a Tn4001-based mini-transposon plasmid containing a gentamicin resistance selection marker. Despite the large degree of homology between Ureaplasma parvum and Ureaplasma urealyticum, all attempts to transform the latter in parallel failed, with the exception of a single clinical U. urealyticum isolate. PCR probing and sequencing were used to confirm transposon insertion into the bacterial genome and identify disrupted genes. Transformation of prototype serovar 3 consistently resulted in transfer only of sequence between the mini-transposon inverted repeats, but some strains showed additional sequence transfer. Transposon insertion occurred randomly in the genome resulting in unique disruption of genes UU047, UU390, UU440, UU450, UU520, UU526, UU582 for single clones from a panel of screened clones. An intergenic insertion between genes UU187 and UU188 was also characterised. Two phenotypic alterations were observed in the mutated strains: Disruption of a DEAD-box RNA helicase (UU582) altered growth kinetics, while the U. urealyticum strain lost resistance to serum attack coincident with disruption of gene UUR10_137 and loss of expression of a 41 kDa protein. Transposon mutagenesis was used successfully to insert single copies of a mini-transposon into the genome and disrupt genes leading to phenotypic changes in Ureaplasma parvum strains. This method can now be used to deliver exogenous genes for expression and determine essential genes for Ureaplasma parvum replication in culture and experimental models. PMID:25444567
Aboklaish, Ali F; Dordet-Frisoni, Emilie; Citti, Christine; Toleman, Mark A; Glass, John I; Spiller, O Brad
2014-11-01
While transposon mutagenesis has been successfully used for Mycoplasma spp. to disrupt and determine non-essential genes, previous attempts with Ureaplasma spp. have been unsuccessful. Using a polyethylene glycol-transformation enhancing protocol, we were able to transform three separate serovars of Ureaplasma parvum with a Tn4001-based mini-transposon plasmid containing a gentamicin resistance selection marker. Despite the large degree of homology between Ureaplasma parvum and Ureaplasma urealyticum, all attempts to transform the latter in parallel failed, with the exception of a single clinical U. urealyticum isolate. PCR probing and sequencing were used to confirm transposon insertion into the bacterial genome and identify disrupted genes. Transformation of prototype serovar 3 consistently resulted in transfer only of sequence between the mini-transposon inverted repeats, but some strains showed additional sequence transfer. Transposon insertion occurred randomly in the genome resulting in unique disruption of genes UU047, UU390, UU440, UU450, UU520, UU526, UU582 for single clones from a panel of screened clones. An intergenic insertion between genes UU187 and UU188 was also characterised. Two phenotypic alterations were observed in the mutated strains: Disruption of a DEAD-box RNA helicase (UU582) altered growth kinetics, while the U. urealyticum strain lost resistance to serum attack coincident with disruption of gene UUR10_137 and loss of expression of a 41 kDa protein. Transposon mutagenesis was used successfully to insert single copies of a mini-transposon into the genome and disrupt genes leading to phenotypic changes in Ureaplasma parvum strains. This method can now be used to deliver exogenous genes for expression and determine essential genes for Ureaplasma parvum replication in culture and experimental models. Copyright © 2014 Elsevier GmbH. All rights reserved.
Sequence quality analysis tool for HIV type 1 protease and reverse transcriptase.
Delong, Allison K; Wu, Mingham; Bennett, Diane; Parkin, Neil; Wu, Zhijin; Hogan, Joseph W; Kantor, Rami
2012-08-01
Access to antiretroviral therapy is increasing globally and drug resistance evolution is anticipated. Currently, protease (PR) and reverse transcriptase (RT) sequence generation is increasing, including the use of in-house sequencing assays, and quality assessment prior to sequence analysis is essential. We created a computational HIV PR/RT Sequence Quality Analysis Tool (SQUAT) that runs in the R statistical environment. Sequence quality thresholds are calculated from a large dataset (46,802 PR and 44,432 RT sequences) from the published literature ( http://hivdb.Stanford.edu ). Nucleic acid sequences are read into SQUAT, identified, aligned, and translated. Nucleic acid sequences are flagged if with >five 1-2-base insertions; >one 3-base insertion; >one deletion; >six PR or >18 RT ambiguous bases; >three consecutive PR or >four RT nucleic acid mutations; >zero stop codons; >three PR or >six RT ambiguous amino acids; >three consecutive PR or >four RT amino acid mutations; >zero unique amino acids; or <0.5% or >15% genetic distance from another submitted sequence. Thresholds are user modifiable. SQUAT output includes a summary report with detailed comments for troubleshooting of flagged sequences, histograms of pairwise genetic distances, neighbor joining phylogenetic trees, and aligned nucleic and amino acid sequences. SQUAT is a stand-alone, free, web-independent tool to ensure use of high-quality HIV PR/RT sequences in interpretation and reporting of drug resistance, while increasing awareness and expertise and facilitating troubleshooting of potentially problematic sequences.
Public antibodies to malaria antigens generated by two LAIR1 insertion modalities.
Pieper, Kathrin; Tan, Joshua; Piccoli, Luca; Foglierini, Mathilde; Barbieri, Sonia; Chen, Yiwei; Silacci-Fregni, Chiara; Wolf, Tobias; Jarrossay, David; Anderle, Marica; Abdi, Abdirahman; Ndungu, Francis M; Doumbo, Ogobara K; Traore, Boubacar; Tran, Tuan M; Jongo, Said; Zenklusen, Isabelle; Crompton, Peter D; Daubenberger, Claudia; Bull, Peter C; Sallusto, Federica; Lanzavecchia, Antonio
2017-08-31
In two previously described donors, the extracellular domain of LAIR1, a collagen-binding inhibitory receptor encoded on chromosome 19 (ref. 1), was inserted between the V and DJ segments of an antibody. This insertion generated, through somatic mutations, broadly reactive antibodies against RIFINs, a type of variant antigen expressed on the surface of Plasmodium falciparum-infected erythrocytes. To investigate how frequently such antibodies are produced in response to malaria infection, we screened plasma from two large cohorts of individuals living in malaria-endemic regions. Here we report that 5-10% of malaria-exposed individuals, but none of the European blood donors tested, have high levels of LAIR1-containing antibodies that dominate the response to infected erythrocytes without conferring enhanced protection against febrile malaria. By analysing the antibody-producing B cell clones at the protein, cDNA and gDNA levels, we characterized additional LAIR1 insertions between the V and DJ segments and discovered a second insertion modality whereby the LAIR1 exon encoding the extracellular domain and flanking intronic sequences are inserted into the switch region. By exon shuffling, this mechanism leads to the production of bispecific antibodies in which the LAIR1 domain is precisely positioned at the elbow between the VH and CH1 domains. Additionally, in one donor the genomic DNA encoding the VH and CH1 domains was deleted, leading to the production of a camel-like LAIR1-containing antibody. Sequencing of the switch regions of memory B cells from European blood donors revealed frequent templated inserts originating from transcribed genes that, in rare cases, comprised exons with orientations and frames compatible with expression. These results reveal different modalities of LAIR1 insertion that lead to public and dominant antibodies against infected erythrocytes and suggest that insertion of templated DNA represents an additional mechanism of antibody diversification that can be selected in the immune response against pathogens and exploited for B cell engineering.
NASA Astrophysics Data System (ADS)
Khalighi, Mohammad Mehdi; Delso, Gaspar; Maramraju, Sri Harsha; Deller, Timothy W.; Levin, Craig S.; Glover, Gary H.
2016-10-01
A silicon photomultiplier (SiPM)-based time-of-flight capable PET detector has been integrated with a 70 cm wide-bore 3T MR scanner for simultaneous whole-body imaging (MR750w, GE Healthcare, Waukesha, WI). After insertion of the PET detector, the final PET/MR bore is 60 cm wide (SIGNA PET/MR, GE Healthcare, Waukesha, WI). The MR performance was compared before and after the PET ring insertion. B0 homogeneity, B1+ uniformity of the body coil along with peak B1+, coherent noise, and FBIRN (Function Biomedical Informatics Research Network) tests are used to compare the MR performance. It is shown that B0 homogeneity and coherent noise have not changed according to the system specifications. Peak B1+ is increased by 33% and B1+ inhomogeneity is increased by 4% after PET ring insertion due to a smaller diameter body coil design. The FBIRN test shows similar temporal stability before and after PET ring insertion. Due to a smaller body coil on the PET/MR system, the signal fluctuation to noise ratio (SFNR) and SNR for body receive coil, are improved by 40% and 160% for Echo Planar Imaging (EPI) and spiral sequences respectively. Comparison using RF- and gradient-intensive clinical sequences shows inserting the PET detectors into the wide-bore MRI has not compromised the MR image quality according to these tests.
Diaz, M; Greenberg, A S; Flajnik, M F
1998-11-24
The new antigen receptor (NAR) gene in the nurse shark diversifies extensively by somatic hypermutation. It is not known, however, whether NAR somatic hypermutation generates the primary repertoire (like in the sheep) or rather is used in antigen-driven immune responses. To address this issue, the sequences of NAR transmembrane (Tm) and secretory (Sec) forms, presumed to represent the primary and secondary repertoires, respectively, were examined from the peripheral blood lymphocytes of three adult nurse sharks. More than 40% of the Sec clones but fewer than 11% of Tm clones contained five mutations or more. Furthermore, more than 75% of the Tm clones had few or no mutations. Mutations in the Sec clones occurred mostly in the complementarity-determining regions (CDR) with a significant bias toward replacement substitutions in CDR1; in Tm clones there was no significant bias toward replacements and only a low level of targeting to the CDRs. Unlike the Tm clones where the replacement mutational pattern was similar to that seen for synonymous changes, Sec replacements displayed a distinct pattern of mutations. The types of mutations in NAR were similar to those found in mouse Ig genes rather than to the unusual pattern reported for shark and Xenopus Ig. Finally, an oligoclonal family of Sec clones revealed a striking trend toward acquisition of glutamic/aspartic acid, suggesting some degree of selection. These data strongly suggest that hypermutation of NAR does not generate the repertoire, but instead is involved in antigen-driven immune responses.
NASA Technical Reports Server (NTRS)
Boyd, Mark R.; Winters, Jennifer G.; Henry, Todd J.; Jao, Wei-Chun; Finch, Charlie T.; Subasavage, John P.; Hambly, Nigel C.
2011-01-01
We present 2817 new southern proper motion systems with 0.40 sec/yr > mu > or = 0.18 sec/yr and declination between 47 deg and 00 deg. This is a continuation of the SuperCOSMOS-RECONS (SCR) proper motion searches of the southern sky. We use the same photometric relations as previous searches to provide distance estimates based on the assumption that the objects are single main-sequence stars. We find 79 new red dwarf systems predicted to be within 25 pc, including a few new components of previously known systems. Two systems--SCR 1731-2452 at 9.5 pc and SCR 1746-3214 at 9.9 pc--are anticipated to be within 10 pc. We also find 23 new white dwarf (WD) candidates with distance estimates of 15-66 pc, as well as 360 new red subdwarf candidates. With this search, we complete the SCR sweep of the southern sky for stars with mu > or = 0.18 sec/yr and R(sub 59F) < or = 16.5, resulting in a total of 5042 objects in 4724 previously unreported proper motion systems. Here we provide selected comprehensive lists from our SCR proper motion search to date, including 152 red dwarf systems estimated to be within 25 pc (9 within 10 pc), 46 WDs (10 within 25 pc), and 598 subdwarf candidates. The results of this search suggest that there are more nearby systems to be found at fainter magnitudes and lower proper motion limits than those probed so far.
Kirkwood, Kathryn J.; Ahmad, Yasmeen; Larance, Mark; Lamond, Angus I.
2013-01-01
Proteins form a diverse array of complexes that mediate cellular function and regulation. A largely unexplored feature of such protein complexes is the selective participation of specific protein isoforms and/or post-translationally modified forms. In this study, we combined native size-exclusion chromatography (SEC) with high-throughput proteomic analysis to characterize soluble protein complexes isolated from human osteosarcoma (U2OS) cells. Using this approach, we have identified over 71,500 peptides and 1,600 phosphosites, corresponding to over 8,000 proteins, distributed across 40 SEC fractions. This represents >50% of the predicted U2OS cell proteome, identified with a mean peptide sequence coverage of 27% per protein. Three biological replicates were performed, allowing statistical evaluation of the data and demonstrating a high degree of reproducibility in the SEC fractionation procedure. Specific proteins were detected interacting with multiple independent complexes, as typified by the separation of distinct complexes for the MRFAP1-MORF4L1-MRGBP interaction network. The data also revealed protein isoforms and post-translational modifications that selectively associated with distinct subsets of protein complexes. Surprisingly, there was clear enrichment for specific Gene Ontology terms associated with differential size classes of protein complexes. This study demonstrates that combined SEC/MS analysis can be used for the system-wide annotation of protein complexes and to predict potential isoform-specific interactions. All of these SEC data on the native separation of protein complexes have been integrated within the Encyclopedia of Proteome Dynamics, an online, multidimensional data-sharing resource available to the community. PMID:24043423
Kirkwood, Kathryn J; Ahmad, Yasmeen; Larance, Mark; Lamond, Angus I
2013-12-01
Proteins form a diverse array of complexes that mediate cellular function and regulation. A largely unexplored feature of such protein complexes is the selective participation of specific protein isoforms and/or post-translationally modified forms. In this study, we combined native size-exclusion chromatography (SEC) with high-throughput proteomic analysis to characterize soluble protein complexes isolated from human osteosarcoma (U2OS) cells. Using this approach, we have identified over 71,500 peptides and 1,600 phosphosites, corresponding to over 8,000 proteins, distributed across 40 SEC fractions. This represents >50% of the predicted U2OS cell proteome, identified with a mean peptide sequence coverage of 27% per protein. Three biological replicates were performed, allowing statistical evaluation of the data and demonstrating a high degree of reproducibility in the SEC fractionation procedure. Specific proteins were detected interacting with multiple independent complexes, as typified by the separation of distinct complexes for the MRFAP1-MORF4L1-MRGBP interaction network. The data also revealed protein isoforms and post-translational modifications that selectively associated with distinct subsets of protein complexes. Surprisingly, there was clear enrichment for specific Gene Ontology terms associated with differential size classes of protein complexes. This study demonstrates that combined SEC/MS analysis can be used for the system-wide annotation of protein complexes and to predict potential isoform-specific interactions. All of these SEC data on the native separation of protein complexes have been integrated within the Encyclopedia of Proteome Dynamics, an online, multidimensional data-sharing resource available to the community.
Johnson, Richard J; Smith, Ben E; Sutton, Paul A; McGenity, Terry J; Rowland, Steven J; Whitby, Corinne
2011-01-01
Naphthenic acids (NAs) occur naturally in oil sands and enter the environment through natural and anthropogenic processes. NAs comprise toxic carboxylic acids that are difficult to degrade. Information on NA biodegradation mechanisms is limited, and there are no studies on alkyl branched aromatic alkanoic acid biodegradation, despite their contribution to NA toxicity and recalcitrance. Increased alkyl side chain branching has been proposed to explain NA recalcitrance. Using soil enrichments, we examined the biodegradation of four aromatic alkanoic acid isomers that differed in alkyl side chain branching: (4′-n-butylphenyl)-4-butanoic acid (n-BPBA, least branched); (4′-iso-butylphenyl)-4-butanoic acid (iso-BPBA); (4′-sec-butylphenyl)-4-butanoic acid (sec-BPBA) and (4′-tert-butylphenyl)-4-butanoic acid (tert-BPBA, most branched). n-BPBA was completely metabolized within 49 days. Mass spectral analysis confirmed that the more branched isomers iso-, sec- and tert-BPBA were transformed to their butylphenylethanoic acid (BPEA) counterparts at 14 days. The BPEA metabolites were generally less toxic than BPBAs as determined by Microtox assay. n-BPEA was further transformed to a diacid, showing that carboxylation of the alkyl side chain occurred. In each case, biodegradation of the carboxyl side chain proceeded through beta-oxidation, which depended on the degree of alkyl side chain branching, and a BPBA degradation pathway is proposed. Comparison of 16S rRNA gene sequences at days 0 and 49 showed an increase and high abundance at day 49 of Pseudomonas (sec-BPBA), Burkholderia (n-, iso-, tert-BPBA) and Sphingomonas (n-, sec-BPBA). PMID:20962873
Evaluating Documents: The Case of Patient Package Inserts. Technical Report No. 2.
ERIC Educational Resources Information Center
Krug, Robert E.
To illustrate the types of factors that must be considered in evaluating public documents, this paper analyzes a number of possible outcomes resulting from one type of document, the patient package insert (PPI) designed to provide consumers of prescription drugs with information about the drugs. It first outlines the intended sequence for a PPI:…
USDA-ARS?s Scientific Manuscript database
We recently described the complete genome of enterohemorrhagic Escherichia coli (EHEC) O157:H7 strain NADC 6564, an isolate of strain 86-24 linked to the 1986 disease outbreak. In the current study, we compared the chromosomal sequence of NADC 6564 to the well-characterized chromosomal sequences of ...
Unlocking Short Read Sequencing for Metagenomics
Rodrigue, Sébastien; Materna, Arne C.; Timberlake, Sonia C.; ...
2010-07-28
We describe an experimental and computational pipeline yielding millions of reads that can exceed 200 bp with quality scores approaching that of traditional Sanger sequencing. The method combines an automatable gel-less library construction step with paired-end sequencing on a short-read instrument. With appropriately sized library inserts, mate-pair sequences can overlap, and we describe the SHERA software package that joins them to form a longer composite read.
Anton, Brian P; Mongodin, Emmanuel F; Agrawal, Sonia; Fomenkov, Alexey; Byrd, Devon R; Roberts, Richard J; Raleigh, Elisabeth A
2015-01-01
We report the complete sequence of ER2796, a laboratory strain of Escherichia coli K-12 that is completely defective in DNA methylation. Because of its lack of any native methylation, it is extremely useful as a host into which heterologous DNA methyltransferase genes can be cloned and the recognition sequences of their products deduced by Pacific Biosciences Single-Molecule Real Time (SMRT) sequencing. The genome was itself sequenced from a long-insert library using the SMRT platform, resulting in a single closed contig devoid of methylated bases. Comparison with K-12 MG1655, the first E. coli K-12 strain to be sequenced, shows an essentially co-linear relationship with no major rearrangements despite many generations of laboratory manipulation. The comparison revealed a total of 41 insertions and deletions, and 228 single base pair substitutions. In addition, the long-read approach facilitated the surprising discovery of four gene conversion events, three involving rRNA operons and one between two cryptic prophages. Such events thus contribute both to genomic homogenization and to bacteriophage diversification. As one of relatively few laboratory strains of E. coli to be sequenced, the genome also reveals the sequence changes underlying a number of classical mutant alleles including those affecting the various native DNA methylation systems.
Anton, Brian P.; Mongodin, Emmanuel F.; Agrawal, Sonia; Fomenkov, Alexey; Byrd, Devon R.; Roberts, Richard J.; Raleigh, Elisabeth A.
2015-01-01
We report the complete sequence of ER2796, a laboratory strain of Escherichia coli K-12 that is completely defective in DNA methylation. Because of its lack of any native methylation, it is extremely useful as a host into which heterologous DNA methyltransferase genes can be cloned and the recognition sequences of their products deduced by Pacific Biosciences Single-Molecule Real Time (SMRT) sequencing. The genome was itself sequenced from a long-insert library using the SMRT platform, resulting in a single closed contig devoid of methylated bases. Comparison with K-12 MG1655, the first E. coli K-12 strain to be sequenced, shows an essentially co-linear relationship with no major rearrangements despite many generations of laboratory manipulation. The comparison revealed a total of 41 insertions and deletions, and 228 single base pair substitutions. In addition, the long-read approach facilitated the surprising discovery of four gene conversion events, three involving rRNA operons and one between two cryptic prophages. Such events thus contribute both to genomic homogenization and to bacteriophage diversification. As one of relatively few laboratory strains of E. coli to be sequenced, the genome also reveals the sequence changes underlying a number of classical mutant alleles including those affecting the various native DNA methylation systems. PMID:26010885
Simultaneous message framing and error detection
NASA Technical Reports Server (NTRS)
Frey, A. H., Jr.
1968-01-01
Circuitry simultaneously inserts message framing information and detects noise errors in binary code data transmissions. Separate message groups are framed without requiring both framing bits and error-checking bits, and predetermined message sequence are separated from other message sequences without being hampered by intervening noise.
Mobile element biology – new possibilities with high-throughput sequencing
Xing, Jinchuan; Witherspoon, David J.; Jorde, Lynn B.
2014-01-01
Mobile elements compose more than half of the human genome, but until recently their large-scale detection was time-consuming and challenging. With the development of new high-throughput sequencing technologies, the complete spectrum of mobile element variation in humans can now be identified and analyzed. Thousands of new mobile element insertions have been discovered, yielding new insights into mobile element biology, evolution, and genomic variation. We review several high-throughput methods, with an emphasis on techniques that specifically target mobile element insertions in humans, and we highlight recent applications of these methods in evolutionary studies and in the analysis of somatic alterations in human cancers. PMID:23312846
Characterization of ROP18 alleles in human toxoplasmosis.
Sánchez, Víctor; de-la-Torre, Alejandra; Gómez-Marín, Jorge Enrique
2014-04-01
The role of the virulent gene ROP18 polymorphisms is not known in human toxoplasmosis. A total of 320 clinical samples were analyzed. In samples positive for ROP18 gene, we determined by an allele specific PCR, if patients got the upstream insertion positive ROP18 sequence Toxoplasma strain (mouse avirulent strain) or the upstream insertion negative ROP18 sequence Toxoplasma strain (mouse virulent strain). We designed an ELISA assay for antibodies against ROP18 derived peptides from the three major clonal lineages of Toxoplasma. 20 clinical samples were of quality for ROP18 allele analysis. In patients with ocular toxoplasmosis, a higher inflammatory reaction on eye was associated to a PCR negative result for the upstream region of ROP18. 23.3%, 33% and 16.6% of serums from individuals with ocular toxoplasmosis were positive for type I, type II and type III ROP18 derived peptides, respectively but this assay was affected by cross reaction. The absence of Toxoplasma ROP18 promoter insertion sequence in ocular toxoplasmosis was correlated with severe ocular inflammatory response. Determination of antibodies against ROP18 protein was not useful for serotyping in human toxoplasmosis. © 2013.
2011-01-01
Background The advent of genomics-based technologies has revolutionized many fields of biological enquiry. However, chromosome walking or flanking sequence cloning is still a necessary and important procedure to determining gene structure. Such methods are used to identify T-DNA insertion sites and so are especially relevant for organisms where large T-DNA insertion libraries have been created, such as rice and Arabidopsis. The currently available methods for flanking sequence cloning, including the popular TAIL-PCR technique, are relatively laborious and slow. Results Here, we report a simple and effective fusion primer and nested integrated PCR method (FPNI-PCR) for the identification and cloning of unknown genomic regions flanked known sequences. In brief, a set of universal primers was designed that consisted of various 15-16 base arbitrary degenerate oligonucleotides. These arbitrary degenerate primers were fused to the 3' end of an adaptor oligonucleotide which provided a known sequence without degenerate nucleotides, thereby forming the fusion primers (FPs). These fusion primers are employed in the first step of an integrated nested PCR strategy which defines the overall FPNI-PCR protocol. In order to demonstrate the efficacy of this novel strategy, we have successfully used it to isolate multiple genomic sequences namely, 21 orthologs of genes in various species of Rosaceace, 4 MYB genes of Rosa rugosa, 3 promoters of transcription factors of Petunia hybrida, and 4 flanking sequences of T-DNA insertion sites in transgenic tobacco lines and 6 specific genes from sequenced genome of rice and Arabidopsis. Conclusions The successful amplification of target products through FPNI-PCR verified that this novel strategy is an effective, low cost and simple procedure. Furthermore, FPNI-PCR represents a more sensitive, rapid and accurate technique than the established TAIL-PCR and hiTAIL-PCR procedures. PMID:22093809
Ishiguro, Naotaka; Inoshima, Yasuo; Yanai, Tokuma; Sasaki, Motoki; Matsui, Akira; Kikuchi, Hiroki; Maruyama, Masashi; Hongo, Hitomi; Vostretsov, Yuri E; Gasilin, Viatcheslav; Kosintsev, Pavel A; Quanjia, Chen; Chunxue, Wang
2016-02-01
The mitochondrial DNA (mtDNA) control region (198- to 598-bp) of four ancient Canis specimens (two Canis mandibles, a cranium, and a first phalanx) was examined, and each specimen was genetically identified as Japanese wolf. Two unique nucleotide substitutions, the 78-C insertion and the 482-G deletion, both of which are specific for Japanese wolf, were observed in each sample. Based on the mtDNA sequences analyzed, these four specimens and 10 additional Japanese wolf samples could be classified into two groups- Group A (10 samples) and Group B (4 samples)-which contain or lack an 8-bp insertion/deletion (indel), respectively. Interestingly, three dogs (Akita-b, Kishu 25, and S-husky 102) that each contained Japanese wolf-specific features were also classified into Group A or B based on the 8-bp indel. To determine the origin or ancestor of the Japanese wolf, mtDNA control regions of ancient continental Canis specimens were examined; 84 specimens were from Russia, and 29 were from China. However, none of these 113 specimens contained Japanese wolf-specific sequences. Moreover, none of 426 Japanese modern hunting dogs examined contained these Japanese wolf-specific mtDNA sequences. The mtDNA control region sequences of Groups A and B appeared to be unique to grey wolf and dog populations.
Molecular Population Genetics of the Alcohol Dehydrogenase Gene Region of DROSOPHILA MELANOGASTER
Aquadro, Charles F.; Desse, Susan F.; Bland, Molly M.; Langley, Charles H.; Laurie-Ahlberg, Cathy C.
1986-01-01
Variation in the DNA restriction map of a 13-kb region of chromosome II including the alcohol dehydrogenase structural gene (Adh) was examined in Drosophila melanogaster from natural populations. Detailed analysis of 48 D. melanogaster lines representing four eastern United States populations revealed extensive DNA sequence variation due to base substitutions, insertions and deletions. Cloning of this region from several lines allowed characterization of length variation as due to unique sequence insertions or deletions [nine sizes; 21–200 base pairs (bp)] or transposable element insertions (several sizes, 340 bp to 10.2 kb, representing four different elements). Despite this extensive variation in sequences flanking the Adh gene, only one length polymorphism is clearly associated with altered Adh expression (a copia element approximately 250 bp 5' to the distal transcript start site). Nonetheless, the frequency spectra of transposable elements within and between Drosophila species suggests they are slightly deleterious. Strong nonrandom associations are observed among Adh region sequence variants, ADH allozyme (Fast vs. Slow), ADH enzyme activity and the chromosome inversion ln(2L) t. Phylogenetic analysis of restriction map haplotypes suggest that the major twofold component of ADH activity variation (high vs. low, typical of Fast and Slow allozymes, respectively) is due to sequence variation tightly linked to and possibly distinct from that underlying the allozyme difference. The patterns of nucleotide and haplotype variation for Fast and Slow allozyme lines are consistent with the recent increase in frequency and spread of the Fast haplotype associated with high ADH activity. These data emphasize the important role of evolutionary history and strong nonrandom associations among tightly linked sequence variation as determinants of the patterns of variation observed in natural populations. PMID:3026893
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wang, O.; Masters, C.; Lewis, M.B.
1994-09-01
In an 8-year-old girl and her father, both of whom have severe type III OI, we have previously used RNA/RNA hybrid analysis to demonstrate a mismatch in the region of {alpha}1(I) mRNA coding for aa 558-861. We used SSCP to further localize the abnormality to a subregion coding for aa 579-679. This region was subcloned and sequenced. Each patient`s cDNA has a deletion of the sequences coding for the last residue of exon 34, and all of exons 35 and 36 (aa 604-639), followed by an insertion of 156 nt from the 3{prime}-end of intron 36. PCR amplification of leukocytemore » DNA from the patients and the clinically normal paternal grandmother yielded two fragments: a 1007 bp fragment predicted from normal genomic sequences and a 445 bp fragment. Subcloning and sequencing of the shorter genomic PCR product confirmed the presence of a 565 bp genomic deletion from the end of exon 34 to the middle of intron 36. The abnormal protein is apparently synthesized and incorporated into helix. The inserted nucleotides are in frame with the collagenous sequence and contain no stop codons. They encode a 52 aa non-collagenous region. The fibroblast procollagen of the patients has both normal and electrophoretically delayed pro{alpha}(I) bands. The electrophoretically delayed procollagen is very sensitive to pepsin or trypsin digestion, as predicted by its non-collagenous sequence, and cannot be visualized as collagen. This unique OI collagen mutation is an excellent candidate for molecular targeting to {open_quotes}turn off{close_quotes} a dominant mutant allele.« less
Abergel, Chantal; Blanc, Guillaume; Monchois, Vincent; Renesto, Patricia; Sigoillot, Cécile; Ogata, Hiroyuki; Raoult, Didier; Claverie, Jean-Michel
2006-11-01
The genomic sequencing of Rickettsia conorii revealed a new family of Rickettsia-specific palindromic elements (RPEs) capable of in-frame insertion in preexisting open reading frames (ORFs). Many of these altered ORFs correspond to proteins with well-characterized or essential functions in other microorganisms. Previous experiments indicated that RPE-containing genes are normally transcribed and that no excision of the repeat occurs at the mRNA level. Using mass spectrometry, we now confirmed the retention of the RPE-derived amino acid residues in 4 proteins successfully expressed in Escherichia coli, raising the general question of the consequences of this common insertion event on the fitness of Rickettsia enzymes. The predicted guanylate kinase activity of the R. conorii gmk gene product was measured both on the RPE-containing and RPE-excised recombinant proteins. We show that the 2 proteins are active but exhibit substantial differences in their affinity for adenosine triphosphate, guanosine monophosphate, and catalytic constants. The distribution of the RPEgmk insert among Rickettsia species indicates that the insertion event is ancient and occurred after the divergence of Rickettsia felis and R. conorii but before that of Rickettsia helvetica and R. conorii. We found no evidence that the gmk gene fixed adaptive changes to compensate the RPE peptide insertion. Furthermore, the analysis of the rates of divergence in 23 RPE-containing genes indicates that coding RPE repeats tend to evolve under weak selective constraint, at a rate similar to intergenic noncoding RPE sequences. Altogether, these results suggest that the insertion of RPE-encoded "selfish peptides," although respecting the original fold and activity of the host proteins, might be slightly detrimental to the enzyme efficiency within limits tolerable for slow-growing intracellular parasites such as Rickettsia.
Transmembrane insertion of twin-arginine signal peptides is driven by TatC and regulated by TatB
Fröbel, Julia; Rose, Patrick; Lausberg, Frank; Blümmel, Anne-Sophie; Freudl, Roland; Müller, Matthias
2012-01-01
The twin-arginine translocation (Tat) pathway of bacteria and plant chloroplasts mediates the transmembrane transport of folded proteins, which harbour signal sequences with a conserved twin-arginine motif. Many Tat translocases comprise the three membrane proteins TatA, TatB and TatC. TatC was previously shown to be involved in recognizing twin-arginine signal peptides. Here we show that beyond recognition, TatC mediates the transmembrane insertion of a twin-arginine signal sequence, thereby translocating the signal sequence cleavage site across the bilayer. In the absence of TatB, this can lead to the removal of the signal sequence even from a translocation-incompetent substrate. Hence interaction of twin-arginine signal peptides with TatB counteracts their premature cleavage uncoupled from translocation. This capacity of TatB is not shared by the homologous TatA protein. Collectively our results suggest that TatC is an insertase for twin-arginine signal peptides and that translocation-proficient signal sequence recognition requires the concerted action of TatC and TatB. PMID:23250441
Transmembrane insertion of twin-arginine signal peptides is driven by TatC and regulated by TatB.
Fröbel, Julia; Rose, Patrick; Lausberg, Frank; Blümmel, Anne-Sophie; Freudl, Roland; Müller, Matthias
2012-01-01
The twin-arginine translocation (Tat) pathway of bacteria and plant chloroplasts mediates the transmembrane transport of folded proteins, which harbour signal sequences with a conserved twin-arginine motif. Many Tat translocases comprise the three membrane proteins TatA, TatB and TatC. TatC was previously shown to be involved in recognizing twin-arginine signal peptides. Here we show that beyond recognition, TatC mediates the transmembrane insertion of a twin-arginine signal sequence, thereby translocating the signal sequence cleavage site across the bilayer. In the absence of TatB, this can lead to the removal of the signal sequence even from a translocation-incompetent substrate. Hence interaction of twin-arginine signal peptides with TatB counteracts their premature cleavage uncoupled from translocation. This capacity of TatB is not shared by the homologous TatA protein. Collectively our results suggest that TatC is an insertase for twin-arginine signal peptides and that translocation-proficient signal sequence recognition requires the concerted action of TatC and TatB.
Whole Wiskott‑Aldrich syndrome protein gene deletion identified by high throughput sequencing.
He, Xiangling; Zou, Runying; Zhang, Bing; You, Yalan; Yang, Yang; Tian, Xin
2017-11-01
Wiskott‑Aldrich syndrome (WAS) is a rare X‑linked recessive immunodeficiency disorder, characterized by thrombocytopenia, small platelets, eczema and recurrent infections associated with increased risk of autoimmunity and malignancy disorders. Mutations in the WAS protein (WASP) gene are responsible for WAS. To date, WASP mutations, including missense/nonsense, splicing, small deletions, small insertions, gross deletions, and gross insertions have been identified in patients with WAS. In addition, WASP‑interacting proteins are suspected in patients with clinical features of WAS, in whom the WASP gene sequence and mRNA levels are normal. The present study aimed to investigate the application of next generation sequencing in definitive diagnosis and clinical therapy for WAS. A 5 month‑old child with WAS who displayed symptoms of thrombocytopenia was examined. Whole exome sequence analysis of genomic DNA showed that the coverage and depth of WASP were extremely low. Quantitative polymerase chain reaction indicated total WASP gene deletion in the proband. In conclusion, high throughput sequencing is useful for the verification of WAS on the genetic profile, and has implications for family planning guidance and establishment of clinical programs.
A Forward Genetic Screening for Prostate Cancer Progression Genes
2012-10-01
sequence reads. For verifying the prevalence of insertions in tumors, PCR was performed on genomic DNA corresponding to 15 insertional mutations using...and has been utilized with great effect in many organisms, from the bacterium to the fruit fly Drosophila melanogaster [1,2]. The Sleeping Beauty (SB...TX SL JC TN. References 1. Cooley L, Kelley R, Spradling A (1988) Insertional mutagenesis of the Drosophila genome with single P elements. Science
He, S Y; Schoedel, C; Chatterjee, A K; Collmer, A
1991-01-01
The plant pathogenic enterobacterium Erwinia chrysanthemi EC16 secretes several extracellular, plant cell wall-degrading enzymes, including pectate lyase isozyme PelE. Secretion kinetics of 35S-labeled PelE indicated that the precursor of PelE was rapidly processed by the removal of the amino-terminal signal peptide and that the resulting mature PelE remained cell bound for less than 60 s before being secreted to the bacterial medium. PelE-PhoA (alkaline phosphatase) hybrid proteins generated in vivo by TnphoA insertions were mostly localized in the periplasm of E. chrysanthemi, and one hybrid protein was observed to be associated with the outer membrane of E. chrysanthemi in an out gene-dependent manner. A gene fusion resulting in the substitution of the beta-lactamase signal peptide for the first six amino acids of the PelE signal peptide did not prevent processing or secretion of PelE in E. chrysanthemi. When pelE was overexpressed, mature PelE protein accumulated in the periplasm rather than the cytoplasm in cells of E. chrysanthemi and Escherichia coli MC4100 (pCPP2006), which harbors a functional cluster of E. chrysanthemi out genes. Removal of the signal peptide from pre-PelE was SecA dependent in E. coli MM52 even in the presence of the out gene cluster. These data indicate that the extracellular secretion of pectic enzymes by E. chrysanthemi is an extension of the Sec-dependent pathway for general export of proteins across the bacterial inner membrane. Images PMID:1829728
Effects of Gravity on Ignition and Combustion Characteristics of Externally Heated Polyethylene Film
NASA Astrophysics Data System (ADS)
Ikeda, Mitsumasa
2018-04-01
The objective of this research is to investigate the effects of gravity on the ignition and the combustion characteristics of the Polyethylene (PE) film by outer heating. Combustion experiments of PE film were carried out in a normal gravity field and the microgravity field. In the microgravity experiments, it was carried out in 50 m-class drop facility. Here it can be realized 10- 4G microgravity field in about 2.5-3.0 second. The PE film is heated by the inserted high-temperature chamber. In the experiments, the PE was used film type. The chamber temperature was fixed at 900 K and 1000 K. In the case of microgravity field, the ignition delay period has become about 50 percent shorter than that in the case of the normal gravitational field. In the normal gravity field, since the PE surface layer is cooled by natural convection, the ignition delay period is considered to be longer than that in the microgravity field. The combustion time in the normal gravity was about 0.8 sec. In the microgravity field, the combustion time was more than 2 sec, and it could not be measured during the free fall period.
NASA Technical Reports Server (NTRS)
Fite, E. Brian
2006-01-01
A 1.294 pressure ratio, 725 ft/sec tip speed, variable pitch low noise fan was designed and tested in the NASA Glenn 9- by 15-foot Wind Tunnel. The design included a casing treatment that used recirculation to extend the fan stall line and provide an acceptable operating range. Overall aerodynamic experimental results are presented for this low tip speed, low noise fan without casing treatment as well as using several variants of the casing treatment that moved the air extraction and insertion axial locations. Measurements were made to assess effects on performance, operability, and noise. An unusual instability was discovered near the design operating line and is documented in the fan operating range. Measurements were made to compare stall margin improvements as well as measure the performance impact of the casing treatments. Experimental results in the presence of simulated inlet distortion, via screens, are presented for the baseline and recirculation casing treatment configurations. Estimates are made for the quantity of recirculation weight flow based on limited instrumentation in the recirculation system along with discussion of results and conclusions
Improved Protocols for Illumina Sequencing
Bronner, Iraad F.; Quail, Michael A.; Turner, Daniel J.; Swerdlow, Harold
2013-01-01
In this unit, we describe a set of improvements we have made to the standard Illumina protocols to make the sequencing process more reliable in a high-throughput environment, reduce amplification bias, narrow the distribution of insert sizes, and reliably obtain high yields of data. PMID:19582764
ERIC Educational Resources Information Center
Galewsky, Samuel
2000-01-01
Introduces a series of molecular genetics laboratories where students pick a single colony from a Drosophila melanogester embryo cDNA library and purify the plasmid, then analyze the insert through restriction digests and gel electrophoresis. (Author/YDS)
Optimized scheduling technique of null subcarriers for peak power control in 3GPP LTE downlink.
Cho, Soobum; Park, Sang Kyu
2014-01-01
Orthogonal frequency division multiple access (OFDMA) is a key multiple access technique for the long term evolution (LTE) downlink. However, high peak-to-average power ratio (PAPR) can cause the degradation of power efficiency. The well-known PAPR reduction technique, dummy sequence insertion (DSI), can be a realistic solution because of its structural simplicity. However, the large usage of subcarriers for the dummy sequences may decrease the transmitted data rate in the DSI scheme. In this paper, a novel DSI scheme is applied to the LTE system. Firstly, we obtain the null subcarriers in single-input single-output (SISO) and multiple-input multiple-output (MIMO) systems, respectively; then, optimized dummy sequences are inserted into the obtained null subcarrier. Simulation results show that Walsh-Hadamard transform (WHT) sequence is the best for the dummy sequence and the ratio of 16 to 20 for the WHT and randomly generated sequences has the maximum PAPR reduction performance. The number of near optimal iteration is derived to prevent exhausted iterations. It is also shown that there is no bit error rate (BER) degradation with the proposed technique in LTE downlink system.
Optimized Scheduling Technique of Null Subcarriers for Peak Power Control in 3GPP LTE Downlink
Park, Sang Kyu
2014-01-01
Orthogonal frequency division multiple access (OFDMA) is a key multiple access technique for the long term evolution (LTE) downlink. However, high peak-to-average power ratio (PAPR) can cause the degradation of power efficiency. The well-known PAPR reduction technique, dummy sequence insertion (DSI), can be a realistic solution because of its structural simplicity. However, the large usage of subcarriers for the dummy sequences may decrease the transmitted data rate in the DSI scheme. In this paper, a novel DSI scheme is applied to the LTE system. Firstly, we obtain the null subcarriers in single-input single-output (SISO) and multiple-input multiple-output (MIMO) systems, respectively; then, optimized dummy sequences are inserted into the obtained null subcarrier. Simulation results show that Walsh-Hadamard transform (WHT) sequence is the best for the dummy sequence and the ratio of 16 to 20 for the WHT and randomly generated sequences has the maximum PAPR reduction performance. The number of near optimal iteration is derived to prevent exhausted iterations. It is also shown that there is no bit error rate (BER) degradation with the proposed technique in LTE downlink system. PMID:24883376
A Psychological and Neuroanatomical Model of Obsessive-Compulsive Disorder
Huey, Edward D.; Zahn, Roland; Krueger, Frank; Moll, Jorge; Kapogiannis, Dimitrios; Wassermann, Eric M.; Grafman, Jordan
2009-01-01
Imaging, surgical, and lesion studies suggest that the prefrontal cortex (orbitofrontal and anterior cingulate cortexes), basal ganglia, and thalamus are involved in the pathogenesis of obsessive-compulsive disorder (OCD). On the basis of these findings several models of OCD have been developed, but have had difficulty fully integrating the psychological and neuroanatomical findings of OCD. Recent research in the field of cognitive neuroscience on the normal function of these brain areas demonstrates the role of the orbitofrontal cortex in reward, the anterior cingulate cortex in error detection, the basal ganglia in affecting the threshold for activation of motor and behavioral programs, and the prefrontal cortex in storing memories of behavioral sequences (called “structured event complexes” or SECs). The authors propose that the initiation of these SECs can be accompanied by anxiety that is relieved with completion of the SEC, and that a deficit in this process could be responsible for many of the symptoms of OCD. Specifically, the anxiety can form the basis of an obsession, and a compulsion can be an attempt to receive relief from the anxiety by repeating parts of, or an entire, SEC. The authors discuss empiric support for, and specific experimental predictions of, this model. The authors believe that this model explains the specific symptoms, and integrates the psychology and neuroanatomy of OCD better than previous models. PMID:19196924
Pappas, Eleftherios P; Seimenis, Ioannis; Dellios, Dimitrios; Kollias, Georgios; Lampropoulos, Kostas I; Karaiskos, Pantelis
2018-06-25
This work focuses on MR-related sequence dependent geometric distortions, which are associated with B 0 inhomogeneity and patient-induced distortion (susceptibility differences and chemical shift effects), in MR images used in stereotactic radiosurgery (SRS) applications. Emphasis is put on characterizing distortion at target brain areas identified by gadolinium diethylenetriamine pentaacetic acid (Gd-DTPA) paramagnetic contrast agent uptake. A custom-made phantom for distortion detection was modified to accommodate two small cylindrical inserts, simulating small brain targets. The inserts were filled with Gd-DTPA solutions of various concentrations (0-20 mM). The phantom was scanned at 1.5 T unit using both the reversed read gradient polarity (to determine the overall distortion as reflected by the inserts centroid offset) and the field mapping (to determine B 0 inhomogeneity related distortion in the vicinity of the inserts) techniques. Post-Gd patient images involving a total of 10 brain metastases/targets were also studied using a similar methodology. For the specific imaging conditions, contrast agent presence was found to evidently affect phantom insert position, with centroid offset extending up to 0.068 mm mM -1 (0.208 ppm mM -1 ). The Gd-DTPA induced distortion in patient images was of the order of 0.5 mm for the MRI protocol used, in agreement with the phantom results. Total localization uncertainty of metastases-targets in patient images ranged from 0.35 mm to 0.87 mm, depending on target location, with an average value of 0.54 mm (2.24 ppm). This relative wide range of target localization uncertainty results from the fact that the B 0 inhomogeneity distortion vector in a specific location may add to or partly counterbalance Gd-DTPA induced distortion, thus increasing or decreasing, respectively, the total sequence dependent distortion. Although relatively small, the sequence dependent distortion in Gd-DTPA enhanced brain images can be easily taken into account for SRS treatment planning and target definition purposes by carefully inspecting both the forward and reversed polarity series.
Comparison of large-insert, small-insert and pyrosequencing libraries for metagenomic analysis.
Danhorn, Thomas; Young, Curtis R; DeLong, Edward F
2012-11-01
The development of DNA sequencing methods for characterizing microbial communities has evolved rapidly over the past decades. To evaluate more traditional, as well as newer methodologies for DNA library preparation and sequencing, we compared fosmid, short-insert shotgun and 454 pyrosequencing libraries prepared from the same metagenomic DNA samples. GC content was elevated in all fosmid libraries, compared with shotgun and 454 libraries. Taxonomic composition of the different libraries suggested that this was caused by a relative underrepresentation of dominant taxonomic groups with low GC content, notably Prochlorales and the SAR11 cluster, in fosmid libraries. While these abundant taxa had a large impact on library representation, we also observed a positive correlation between taxon GC content and fosmid library representation in other low-GC taxa, suggesting a general trend. Analysis of gene category representation in different libraries indicated that the functional composition of a library was largely a reflection of its taxonomic composition, and no additional systematic biases against particular functional categories were detected at the level of sequencing depth in our samples. Another important but less predictable factor influencing the apparent taxonomic and functional library composition was the read length afforded by the different sequencing technologies. Our comparisons and analyses provide a detailed perspective on the influence of library type on the recovery of microbial taxa in metagenomic libraries and underscore the different uses and utilities of more traditional, as well as contemporary 'next-generation' DNA library construction and sequencing technologies for exploring the genomics of the natural microbial world.
Flórez, Ana Belén; Ammor, Mohammed Salim; Delgado, Susana; Mayo, Baltasar
2006-12-01
An erm(B) gene carried on the Lactobacillus johnsonii G41 chromosome and the upstream and downstream regions were fully sequenced. Apparently, a 1,495-bp segment of pRE25 from Enterococcus faecalis carrying the erm(B) gene became inserted, by an unknown mechanism, into the L. johnsonii chromosome.
Vandergaast, Rianna; Hoover, Lisa I; Zheng, Kang; Fredericksen, Brenda L
2014-04-09
West Nile virus (WNV) is a positive-sense RNA arbovirus responsible for recent outbreaks of severe neurological disease within the US and Europe. Large-scale analyses of antiviral compounds that inhibit virus replication have been limited due to the lack of an adequate WN reporter virus. Previous attempts to insert a reporter into the 3' untranslated region of WNV generated unstable viruses, suggesting that this region does not accommodate additional nucleotides. Here, we engineered two WNV infectious clones containing insertions at the Capsid (C)/Capsid Anchor (CA) junction of the viral polyprotein. Recombinant viruses containing a TAT(1-67) or Gaussia Luciferase (GLuc) gene at this location were successfully recovered. However, rapid loss of most, if not all, of the reporter sequence occurred for both viruses, indicating that the reporter viruses were not stable. While the GLuc viruses predominantly reverted back to wild-type WNV length, the TAT viruses retained up to 75 additional nucleotides of the reporter sequence. These additional nucleotides were stable over at least five passages and did not significantly alter WNV fitness. Thus, the C/CA junction of WNV can tolerate additional nucleotides, though insertions are subject to certain constraints.
Vandergaast, Rianna; Hoover, Lisa I.; Zheng, Kang; Fredericksen, Brenda L.
2014-01-01
West Nile virus (WNV) is a positive-sense RNA arbovirus responsible for recent outbreaks of severe neurological disease within the US and Europe. Large-scale analyses of antiviral compounds that inhibit virus replication have been limited due to the lack of an adequate WN reporter virus. Previous attempts to insert a reporter into the 3’ untranslated region of WNV generated unstable viruses, suggesting that this region does not accommodate additional nucleotides. Here, we engineered two WNV infectious clones containing insertions at the Capsid (C)/Capsid Anchor (CA) junction of the viral polyprotein. Recombinant viruses containing a TAT(1-67) or Gaussia Luciferase (GLuc) gene at this location were successfully recovered. However, rapid loss of most, if not all, of the reporter sequence occurred for both viruses, indicating that the reporter viruses were not stable. While the GLuc viruses predominantly reverted back to wild-type WNV length, the TAT viruses retained up to 75 additional nucleotides of the reporter sequence. These additional nucleotides were stable over at least five passages and did not significantly alter WNV fitness. Thus, the C/CA junction of WNV can tolerate additional nucleotides, though insertions are subject to certain constraints. PMID:24721788
Chromosomal 16S Ribosomal RNA Methyltransferase RmtE1 in Escherichia coli Sequence Type 448
Li, Bin; Pacey, Marissa P.
2017-01-01
We identified rmtE1, an uncommon 16S ribosomal methyltransferase gene, in an aminoglycoside- and cephalosporin-resistant Escherichia coli sequence type 448 clinical strain co-harboring blaCMY-2. Long-read sequencing revealed insertion of a 101,257-bp fragment carrying both resistance genes to the chromosome. Our findings underscore E. coli sequence type 448 as a potential high-risk multidrug-resistant clone. PMID:28418308
Observations on the responses of muscle to mechanical and electrical stimuli
Meadows, J. C.
1971-01-01
Responses to mechanical and electrical stimuli have been studied in vastus medialis in four young adults. Percussion causes an immediate, brief contraction in those muscle fibres passing beneath the site of the blow. This is accompanied by EMG activity which is propagated along the muscle fibres at a normal velocity of around 4 m/sec. The EMG activity lasts much longer than that produced by a single electrical stimulus to muscle fibres because repetitive firing occurs in some of the muscle fibres activated mechanically. This response to percussion is unaffected by nerve blockade with 2% xylocaine. Percussion close to the motor point may cause delayed fasciculation due to activation of intramuscular motor nerve fibres. This, too, is unaffected by nerve blockade. Some observations on EMG insertional activity provoked by needle movement are reported. It is concluded that muscle has a basic tendency to discharge repetitively when stimulated by mechanical means and that EMG insertional activity and the EMG response to percussion reported in this paper are both manifestations of this same tendency, which is increased in the myotonias. Images PMID:4251668
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zhang, Guojun
Staphylococcal enterotoxin C2 (SEC2), a member of bacterial superantigen, is one of the most potent known activators of T lymphocytes. With this property, SEC2 has already been used in clinic as a tumor immunotherapy agent in China. To increase the antitumor activity, a SEC2 mutant named ST-4 (GKVTG102-106WWH) with amino acid substitutions in T cell receptor (TCR)-binding domain was generated by site-directed mutagenesis, and the molecular mechanism of the enhanced antitumor activity was investigated. Results showed that ST-4 could activate much more Vβ 8.2 and 8.3 T cells and NK cells compared with SEC2, and exhibited significantly enhanced immunocyte stimulationmore » and antitumor activity in vitro. The synthetic peptide sequencing the residues of mutant TCR-binding domain could competitively inhibit the immunocyte stimulation activity of ST-4. Most importantly, ST-4 up-regulated granzyme B and perforin at both mRNA and protein levels. We also found that expression of proapoptotic proteins cytochrome c, BAX and activation of caspase-3, 9 was up-regulated, and antiapoptotic protein Bcl-xL was down-regulated in the treatment with either ST-4 or SEC2. When granzyme B inhibitor or perforin inhibitor is presented, tumor cell viability was significantly rescued. Taken together, we demonstrate that increased ST-4-TCR recognition contributed to massive T cells and NK cells activation. These activated cells released up-regulated granzyme B and perforin, which induced the enhanced tumor cells apoptosis by mitochondrial apoptotic pathway, and ultimately led to enhanced tumor cell growth inhibition. ST-4 may be a promising candidate for antitumor clinic usage in future. - Highlights: • We obtained a SEC2 mutant ST-4 with enhanced superantigen and antitumor activity. • Increased ST-4-TCR recognition contributed to massive T cells and NK cells activation. • Up-regulated GzmB and PRF1 in T cell by ST-4 induced enhanced tumor cells apoptosis. • Enhanced tumor cell apoptosis induced by ST-4 via mitochondrial apoptotic pathway.« less
Gowrisankar, Sivakumar; Lerner-Ellis, Jordan P; Cox, Stephanie; White, Emily T; Manion, Megan; LeVan, Kevin; Liu, Jonathan; Farwell, Lisa M; Iartchouk, Oleg; Rehm, Heidi L; Funke, Birgit H
2010-11-01
Medical sequencing for diseases with locus and allelic heterogeneities has been limited by the high cost and low throughput of traditional sequencing technologies. "Second-generation" sequencing (SGS) technologies allow the parallel processing of a large number of genes and, therefore, offer great promise for medical sequencing; however, their use in clinical laboratories is still in its infancy. Our laboratory offers clinical resequencing for dilated cardiomyopathy (DCM) using an array-based platform that interrogates 19 of more than 30 genes known to cause DCM. We explored both the feasibility and cost effectiveness of using PCR amplification followed by SGS technology for sequencing these 19 genes in a set of five samples enriched for known sequence alterations (109 unique substitutions and 27 insertions and deletions). While the analytical sensitivity for substitutions was comparable to that of the DCM array (98%), SGS technology performed better than the DCM array for insertions and deletions (90.6% versus 58%). Overall, SGS performed substantially better than did the current array-based testing platform; however, the operational cost and projected turnaround time do not meet our current standards. Therefore, efficient capture methods and/or sample pooling strategies that shorten the turnaround time and decrease reagent and labor costs are needed before implementing this platform into routine clinical applications.
2018-01-01
Virus-induced gene silencing (VIGS) is used extensively for gene function studies in plants. VIGS is inexpensive and rapid compared with silencing conducted through stable transformation, but many virus-silencing vectors, especially in grasses, induce only transient silencing phenotypes. A major reason for transient phenotypes is the instability of the foreign gene fragment (insert) in the vector during VIGS. Here, we report the development of a Brome mosaic virus (BMV)-based vector that better maintains inserts through modification of the original BMV vector RNA sequence. Modification of the BMV RNA3 sequence yielded a vector, BMVCP5, that better maintained phytoene desaturase and heat shock protein70-1 (HSP70-1) inserts in Nicotiana benthamiana and maize (Zea mays). Longer maintenance of inserts was correlated with greater target gene silencing and more extensive visible silencing phenotypes displaying greater tissue penetration and involving more leaves. The modified vector accumulated similarly to the original vector in N. benthamiana after agroinfiltration, thus maintaining a high titer of virus in this intermediate host used to produce virus inoculum for grass hosts. For HSP70, silencing one family member led to a large increase in the expression of another family member, an increase likely related to the target gene knockdown and not a general effect of virus infection. The cause of the increased insert stability in the modified vector is discussed in relationship to its recombination and accumulation potential. The modified vector will improve functional genomic studies in grasses, and the conceptual methods used to improve the vector may be applied to other VIGS vectors. PMID:29127260
A single gene mutation that increases maize seed weight
DOE Office of Scientific and Technical Information (OSTI.GOV)
Giroux, M.J.; Shaw, J.; Hannah, L.C.
1996-06-11
The maize endosperm-specific gene shrunken2 (Sh2) encodes the large subunit of the heterotetrameric starch synthetic enzyme adenosine diphosphoglucose pyrophosphorylase (AGP; EC 2.7.7.27). Here we exploit an in vivo, site-specific mutagenesis system to create short insertion mutations in a region of the gene known to be involved in the allosteric regulation of AGP. The site-specific mutagen is the transposable element dissociation (Ds). Approximately one-third (8 of 23) of the germinal revertants sequenced restored the wild-type sequence, whereas the remaining revertants contained insertions of 3 or 6 bp. All revertants retained the original reading frame 3 feet to the insertion site andmore » involved the addition of tyrosine and/or serine. Each insertion revertant reduced total AGP activity and the amount of the SH2 protein. The revertant containing additional tyrosine and serine residues increased seed weight 11-18% without increasing or decreasing the percentage of starch. Other insertion revertants lacking an additional serine reduced seed weight. Reduced sensitivity to phosphate, a long-known inhibitor of AGP, was found in the high seed-weight revertant. This alteration is likely universally important since insertion of tyrosine and serine in the potato large subunit of AGP at the comparable position and expression in Escherichia coli also led to a phosphate-insensitive enzyme. These results show that single gene mutations giving rise to increased seed weight, and therefore perhaps yield, are clearly possible in a plant with a long history of intensive and successful breeding efforts. 20 refs., 5 figs., 5 tabs.« less
Cercosporin-deficient mutants by plasmid tagging in the asexual fungus Cercospora nicotianae.
Chung, K-R; Ehrenshaft, M; Wetzel, D K; Daub, M E
2003-11-01
We have successfully adapted plasmid insertion and restriction enzyme-mediated integration (REMI) to produce cercosporin toxin-deficient mutants in the asexual phytopathogenic fungus Cercospora nicotianae. The use of pre-linearized plasmid or restriction enzymes in the transformation procedure significantly decreased the transformation frequency, but promoted a complicated and undefined mode of plasmid integration that leads to mutations in the C. nicotianae genome. Vector DNA generally integrated in multiple copies, and no increase in single-copy insertion was observed when enzymes were added to the transformation mixture. Out of 1873 transformants tested, 39 putative cercosporin toxin biosynthesis ( ctb) mutants were recovered that showed altered levels of cercosporin production. Seven ctb mutants were recovered using pre-linearized plasmids without the addition of enzymes, and these were considered to be non-REMI mutants. The correlation between a specific insertion and a mutant phenotype was confirmed using rescued plasmids as gene disruption vectors in the wild-type strain. Six out of fifteen rescued plasmids tested yielded cercosporin-deficient transformants when re-introduced into the wild-type strain, suggesting a link between the insertion site and the cercosporin-deficient phenotype. Sequence analysis of a fragment flanking the insert site recovered from one insertion mutant showed it to be disrupted in sequences with high homology to the acyl transferase domain of polyketide synthases from other fungi. Disruption of this polyketide synthase gene ( CTB1) using a rescued plasmid resulted in mutants that were defective in cercosporin production. Thus, we provide the first molecular evidence that cercosporin is synthesized via a polyketide pathway as previously hypothesized.
Hermetic fiber optic-to-metal connection technique
Kramer, Daniel P.
1992-09-01
A glass-to-glass hermetic sealing technique is disclosed which can be used to splice lengths of glass fibers together. A solid glass preform is inserted into the cavity of a metal component which is then heated to melt the glass. An end of an optical fiber is then advanced into the molten glass and the entire structure cooled to solidify the glass in sealing engagement with the optical fiber end and the metal cavity. The surface of the re-solidified glass may be machined for mating engagement with another component to make a spliced fiber optic connection. The resultant structure has a helium leak rate of less than 1.times.10.sup.-8 cm.sup.3 /sec.
Implementation of an experimental fault-tolerant memory system
NASA Technical Reports Server (NTRS)
Carter, W. C.; Mccarthy, C. E.
1976-01-01
The experimental fault-tolerant memory system described in this paper has been designed to enable the modular addition of spares, to validate the theoretical fault-secure and self-testing properties of the translator/corrector, to provide a basis for experiments using the new testing and correction processes for recovery, and to determine the practicality of such systems. The hardware design and implementation are described, together with methods of fault insertion. The hardware/software interface, including a restricted single error correction/double error detection (SEC/DED) code, is specified. Procedures are carefully described which, (1) test for specified physical faults, (2) ensure that single error corrections are not miscorrections due to triple faults, and (3) enable recovery from double errors.
Studies on the primary structure of short polysaccharides using SEC MALDI mass spectroscopy.
Garozzo, D; Spina, E; Cozzolino, R; Cescutti, P; Fett, W F
2000-01-12
The introduction of size-exclusion chromatography (SEC) analysis of polysaccharides prior to MALDI mass spectroscopy accounts for the determination of the molecular mass of the repeating unit when neutral homopolymers are investigated. In the case of natural polysaccharides characterised by more complicated structural features (presence of non-carbohydrate substituents, charged groups, etc.), this mass value usually is in agreement with more than one sugar composition. Therefore, it is not sufficient to give the correct monosaccharidic composition of the polysaccharide investigated. To solve this problem, MALDI spectra were recorded on the permethylated sample and post-source decay experiments were performed on precursor ions. In this way, the composition (in terms of Hex, HexNAc, etc.), size and sequence of the repeating unit were determined.
Mapping Ribonucleotides Incorporated into DNA by Hydrolytic End-Sequencing.
Orebaugh, Clinton D; Lujan, Scott A; Burkholder, Adam B; Clausen, Anders R; Kunkel, Thomas A
2018-01-01
Ribonucleotides embedded within DNA render the DNA sensitive to the formation of single-stranded breaks under alkali conditions. Here, we describe a next-generation sequencing method called hydrolytic end sequencing (HydEn-seq) to map ribonucleotides inserted into the genome of Saccharomyce cerevisiae strains deficient in ribonucleotide excision repair. We use this method to map several genomic features in wild-type and replicase variant yeast strains.
Lam, Kathy N; Charles, Trevor C
2015-01-01
Clone libraries provide researchers with a powerful resource to study nucleic acid from diverse sources. Metagenomic clone libraries in particular have aided in studies of microbial biodiversity and function, and allowed the mining of novel enzymes. Libraries are often constructed by cloning large inserts into cosmid or fosmid vectors. Recently, there have been reports of GC bias in fosmid metagenomic libraries, and it was speculated to be a result of fragmentation and loss of AT-rich sequences during cloning. However, evidence in the literature suggests that transcriptional activity or gene product toxicity may play a role. To explore possible mechanisms responsible for sequence bias in clone libraries, we constructed a cosmid library from a human microbiome sample and sequenced DNA from different steps during library construction: crude extract DNA, size-selected DNA, and cosmid library DNA. We confirmed a GC bias in the final cosmid library, and we provide evidence that the bias is not due to fragmentation and loss of AT-rich sequences but is likely occurring after DNA is introduced into Escherichia coli. To investigate the influence of strong constitutive transcription, we searched the sequence data for promoters and found that rpoD/σ(70) promoter sequences were underrepresented in the cosmid library. Furthermore, when we examined the genomes of taxa that were differentially abundant in the cosmid library relative to the original sample, we found the bias to be more correlated with the number of rpoD/σ(70) consensus sequences in the genome than with simple GC content. The GC bias of metagenomic libraries does not appear to be due to DNA fragmentation. Rather, analysis of promoter sequences provides support for the hypothesis that strong constitutive transcription from sequences recognized as rpoD/σ(70) consensus-like in E. coli may lead to instability, causing loss of the plasmid or loss of the insert DNA that gives rise to the transcription. Despite widespread use of E. coli to propagate foreign DNA in metagenomic libraries, the effects of in vivo transcriptional activity on clone stability are not well understood. Further work is required to tease apart the effects of transcription from those of gene product toxicity.
pYEMF, a pUC18-derived XcmI T-vector for efficient cloning of PCR products.
Gu, Jingsong; Ye, Chunjiang
2011-03-01
A 1330-bp DNA sequence with two XcmI cassettes was inserted into pUC18 to construct an efficient XcmI T-vector parent plasmid, pYEMF. The large size of the inserted DNA fragment improved T-vector cleavage efficiency, and guaranteed good separation of the molecular components after restriction digestion. The pYEMF-T-vector generated from parent plasmid pYEMF permits blue/white colony screening; cloning efficiency analysis showed that most white colonies (>75%) were putative transformants which carried the cloning product. The sequence analysis and design approach presented here will facilitate applications in the fields of molecular biology and genetic engineering.
Endogenous Retrovirus EAV-HP Linked to Blue Egg Phenotype in Mapuche Fowl
Alcalde, José A.; Wang, Chen; Han, Jian-Lin; Gongora, Jaime; Gourichon, David; Tixier-Boichard, Michèle; Hanotte, Olivier
2013-01-01
Oocyan or blue/green eggshell colour is an autosomal dominant trait found in native chickens (Mapuche fowl) of Chile and in some of their descendants in European and North American modern breeds. We report here the identification of an endogenous avian retroviral (EAV-HP) insertion in oocyan Mapuche fowl and European breeds. Sequencing data reveals 100% retroviral identity between the Mapuche and European insertions. Quantitative real-time PCR analysis of European oocyan chicken indicates over-expression of the SLCO1B3 gene (P<0.05) in the shell gland and oviduct. Predicted transcription factor binding sites in the long terminal repeats (LTR) indicate AhR/Ar, a modulator of oestrogen, as a possible promoter/enhancer leading to reproductive tissue-specific over-expression of the SLCO1B3 gene. Analysis of all jungle fowl species Gallus sp. supports the retroviral insertion to be a post-domestication event, while identical LTR sequences within domestic chickens are in agreement with a recent de novo mutation. PMID:23990950
Endogenous retrovirus EAV-HP linked to blue egg phenotype in Mapuche fowl.
Wragg, David; Mwacharo, Joram M; Alcalde, José A; Wang, Chen; Han, Jian-Lin; Gongora, Jaime; Gourichon, David; Tixier-Boichard, Michèle; Hanotte, Olivier
2013-01-01
Oocyan or blue/green eggshell colour is an autosomal dominant trait found in native chickens (Mapuche fowl) of Chile and in some of their descendants in European and North American modern breeds. We report here the identification of an endogenous avian retroviral (EAV-HP) insertion in oocyan Mapuche fowl and European breeds. Sequencing data reveals 100% retroviral identity between the Mapuche and European insertions. Quantitative real-time PCR analysis of European oocyan chicken indicates over-expression of the SLCO1B3 gene (P<0.05) in the shell gland and oviduct. Predicted transcription factor binding sites in the long terminal repeats (LTR) indicate AhR/Ar, a modulator of oestrogen, as a possible promoter/enhancer leading to reproductive tissue-specific over-expression of the SLCO1B3 gene. Analysis of all jungle fowl species Gallus sp. supports the retroviral insertion to be a post-domestication event, while identical LTR sequences within domestic chickens are in agreement with a recent de novo mutation.
Jia, Pingping; Chastain, Megan; Zou, Ying; Her, Chengtao
2017-01-01
Abstract Aberrant formation of interstitial telomeric sequences (ITSs) promotes genome instabilities. However, it is unclear how aberrant ITS formation is suppressed in human cells. Here, we report that MLH1, a key protein involved in mismatch repair (MMR), suppresses telomeric sequence insertion (TSI) at intra-chromosomal regions. The frequency of TSI can be elevated by double-strand break (DSB) inducer and abolished by ATM/ATR inhibition. Suppression of TSI requires MLH1 recruitment to DSBs, indicating that MLH1's role in DSB response/repair is important for suppressing TSI. Moreover, TSI requires telomerase activity but is independent of the functional status of p53 and Rb. Lastly, we show that TSI is associated with chromosome instabilities including chromosome loss, micronuclei formation and chromosome breakage that are further elevated by replication stress. Our studies uncover a novel link between MLH1, telomerase, telomere and genome stability. PMID:28180301
Pereira, J O P; Freitas, B M; Jorge, D M M; Torres, D C; Soares, C E A; Grangeiro, T B
2009-01-01
Melipona quinquefasciata is a ground-nesting South American stingless bee whose geographic distribution was believed to comprise only the central and southern states of Brazil. We obtained partial sequences (about 500-570 bp) of first internal transcribed spacer (ITS1) nuclear ribosomal DNA from Melipona specimens putatively identified as M. quinquefasciata collected from different localities in northeastern Brazil. To confirm the taxonomic identity of the northeastern samples, specimens from the state of Goiás (Central region of Brazil) were included for comparison. All sequences were deposited in GenBank (accession numbers EU073751-EU073759). The mean nucleotide divergence (excluding sites with insertions/deletions) in the ITS1 sequences was only 1.4%, ranging from 0 to 4.1%. When the sites with insertions/deletions were also taken into account, sequence divergences varied from 0 to 5.3%. In all pairwise comparisons, the ITS1 sequence from the specimens collected in Goiás was most divergent compared to the ITS1 sequences of the bees from the other locations. However, neighbor-joining phylogenetic analysis showed that all ITS1 sequences from northeastern specimens along with the sample of Goiás were resolved in a single clade with a bootstrap support of 100%. The ITS1 sequencing data thus support the occurrence of M. quinquefasciata in northeast Brazil.
ERIC Educational Resources Information Center
Laming, Donald
2006-01-01
This article reports some calculations on free-recall data from B. Murdock and J. Metcalfe (1978), with vocal rehearsal during the presentation of a list. Given the sequence of vocalizations, with the stimuli inserted in their proper places, it is possible to predict the subsequent sequence of recalls--the predictions taking the form of a…
Ancestral and derived protein import pathways in the mitochondrion of Reclinomonas americana.
Tong, Janette; Dolezal, Pavel; Selkrig, Joel; Crawford, Simon; Simpson, Alastair G B; Noinaj, Nicholas; Buchanan, Susan K; Gabriel, Kipros; Lithgow, Trevor
2011-05-01
The evolution of mitochondria from ancestral bacteria required that new protein transport machinery be established. Recent controversy over the evolution of these new molecular machines hinges on the degree to which ancestral bacterial transporters contributed during the establishment of the new protein import pathway. Reclinomonas americana is a unicellular eukaryote with the most gene-rich mitochondrial genome known, and the large collection of membrane proteins encoded on the mitochondrial genome of R. americana includes a bacterial-type SecY protein transporter. Analysis of expressed sequence tags shows R. americana also has components of a mitochondrial protein translocase or "translocase in the inner mitochondrial membrane complex." Along with several other membrane proteins encoded on the mitochondrial genome Cox11, an assembly factor for cytochrome c oxidase retains sequence features suggesting that it is assembled by the SecY complex in R. americana. Despite this, protein import studies show that the RaCox11 protein is suited for import into mitochondria and functional complementation if the gene is transferred into the nucleus of yeast. Reclinomonas americana provides direct evidence that bacterial protein transport pathways were retained, alongside the evolving mitochondrial protein import machinery, shedding new light on the process of mitochondrial evolution.
Peyret, Hadrien; Gehin, Annick; Thuenemann, Eva C.; Blond, Donatienne; El Turabi, Aadil; Beales, Lucy; Clarke, Dean; Gilbert, Robert J. C.; Fry, Elizabeth E.; Stuart, David I.; Holmes, Kris; Stonehouse, Nicola J.; Whelan, Mike; Rosenberg, William; Lomonossoff, George P.; Rowlands, David J.
2015-01-01
The core protein of the hepatitis B virus, HBcAg, assembles into highly immunogenic virus-like particles (HBc VLPs) when expressed in a variety of heterologous systems. Specifically, the major insertion region (MIR) on the HBcAg protein allows the insertion of foreign sequences, which are then exposed on the tips of surface spike structures on the outside of the assembled particle. Here, we present a novel strategy which aids the display of whole proteins on the surface of HBc particles. This strategy, named tandem core, is based on the production of the HBcAg dimer as a single polypeptide chain by tandem fusion of two HBcAg open reading frames. This allows the insertion of large heterologous sequences in only one of the two MIRs in each spike, without compromising VLP formation. We present the use of tandem core technology in both plant and bacterial expression systems. The results show that tandem core particles can be produced with unmodified MIRs, or with one MIR in each tandem dimer modified to contain the entire sequence of GFP or of a camelid nanobody. Both inserted proteins are correctly folded and the nanobody fused to the surface of the tandem core particle (which we name tandibody) retains the ability to bind to its cognate antigen. This technology paves the way for the display of natively folded proteins on the surface of HBc particles either through direct fusion or through non-covalent attachment via a nanobody. PMID:25830365
Konkel, Miriam K; Walker, Jerilyn A; Hotard, Ashley B; Ranck, Megan C; Fontenot, Catherine C; Storer, Jessica; Stewart, Chip; Marth, Gabor T; Batzer, Mark A
2015-08-29
The goal of the 1000 Genomes Consortium is to characterize human genome structural variation (SV), including forms of copy number variations such as deletions, duplications, and insertions. Mobile element insertions, particularly Alu elements, are major contributors to genomic SV among humans. During the pilot phase of the project we experimentally validated 645 (611 intergenic and 34 exon targeted) polymorphic "young" Alu insertion events, absent from the human reference genome. Here, we report high resolution sequencing of 343 (322 unique) recent Alu insertion events, along with their respective target site duplications, precise genomic breakpoint coordinates, subfamily assignment, percent divergence, and estimated A-rich tail lengths. All the sequenced Alu loci were derived from the AluY lineage with no evidence of retrotransposition activity involving older Alu families (e.g., AluJ and AluS). AluYa5 is currently the most active Alu subfamily in the human lineage, followed by AluYb8, and many others including three newly identified subfamilies we have termed AluYb7a3, AluYb8b1, and AluYa4a1. This report provides the structural details of 322 unique Alu variants from individual human genomes collectively adding about 100 kb of genomic variation. Many Alu subfamilies are currently active in human populations, including a surprising level of AluY retrotransposition. Human Alu subfamilies exhibit continuous evolution with potential drivers sprouting new Alu lineages. © The Author(s) 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.
Short interspersed elements (SINEs) are a major source of canine genomic diversity.
Wang, Wei; Kirkness, Ewen F
2005-12-01
SINEs are retrotransposons that have enjoyed remarkable reproductive success during the course of mammalian evolution, and have played a major role in shaping mammalian genomes. Previously, an analysis of survey-sequence data from an individual dog (a poodle) indicated that canine genomes harbor a high frequency of alleles that differ only by the absence or presence of a SINEC_Cf repeat. Comparison of this survey-sequence data with a draft genome sequence of a distinct dog (a boxer) has confirmed this prediction, and revealed the chromosomal coordinates for >10,000 loci that are bimorphic for SINEC_Cf insertions. Analysis of SINE insertion sites from the genomes of nine additional dogs indicates that 3%-5% are absent from either the poodle or boxer genome sequences--suggesting that an additional 10,000 bimorphic loci could be readily identified in the general dog population. We describe a methodology that can be used to identify these loci, and could be adapted to exploit these bimorphic loci for genotyping purposes. Approximately half of all annotated canine genes contain SINEC_Cf repeats, and these elements are occasionally transcribed. When transcribed in the antisense orientation, they provide splice acceptor sites that can result in incorporation of novel exons. The high frequency of bimorphic SINE insertions in the dog population is predicted to provide numerous examples of allele-specific transcription patterns that will be valuable for the study of differential gene expression among multiple dog breeds.
Widespread and evolutionary analysis of a MITE family Monkey King in Brassicaceae.
Dai, Shutao; Hou, Jinna; Long, Yan; Wang, Jing; Li, Cong; Xiao, Qinqin; Jiang, Xiaoxue; Zou, Xiaoxiao; Zou, Jun; Meng, Jinling
2015-06-19
Miniature inverted repeat transposable elements (MITEs) are important components of eukaryotic genomes, with hundreds of families and many copies, which may play important roles in gene regulation and genome evolution. However, few studies have investigated the molecular mechanisms involved. In our previous study, a Tourist-like MITE, Monkey King, was identified from the promoter region of a flowering time gene, BnFLC.A10, in Brassica napus. Based on this MITE, the characteristics and potential roles on gene regulation of the MITE family were analyzed in Brassicaceae. The characteristics of the Tourist-like MITE family Monkey King in Brassicaceae, including its distribution, copies and insertion sites in the genomes of major Brassicaceae species were analyzed in this study. Monkey King was actively amplified in Brassica after divergence from Arabidopsis, which was indicated by the prompt increase in copy number and by phylogenetic analysis. The genomic variations caused by Monkey King insertions, both intra- and inter-species in Brassica, were traced by PCR amplification. Genomic sequence analysis showed that most complete Monkey King elements are located in gene-rich regions, less than 3kb from genes, in both the B. rapa and A. thaliana genomes. Sixty-seven Brassica expressed sequence tags carrying Monkey King fragments were also identified from the NCBI database. Bisulfite sequencing identified specific DNA methylation of cytosine residues in the Monkey King sequence. A fragment containing putative TATA-box motifs in the MITE sequence could bind with nuclear protein(s) extracted from leaves of B. napus plants. A Monkey King-related microRNA, bna-miR6031, was identified in the microRNA database. In transgenic A. thaliana, when the Monkey King element was inserted upstream of 35S promoter, the promoter activity was weakened. Monkey King, a Brassicaceae Tourist-like MITE family, has amplified relatively recently and has induced intra- and inter-species genomic variations in Brassica. Monkey King elements are most abundant in the vicinity of genes and may have a substantial effect on genome-wide gene regulation in Brassicaceae. Monkey King insertions potentially regulate gene expression and genome evolution through epigenetic modification and new regulatory motif production.
Ahmad, Muhammad Khairi; Tabana, Yasser M; Ahmed, Mowaffaq Adam; Sandai, Doblin Anak; Mohamed, Rafeezul; Ismail, Ida Shazrina; Zulkiflie, Nurulisa; Yunus, Muhammad Amir
2017-12-01
A norovirus maintains its viability, infectivity and virulence by its ability to replicate. However, the biological mechanisms of the process remain to be explored. In this work, the NanoLuc™ Luciferase gene was used to develop a reporter-tagged replicon system to study norovirus replication. The NanoLuc™ Luciferase reporter protein was engineered to be expressed as a fusion protein for MNV-1 minor capsid protein, VP2. The foot-and-mouth disease virus 2A (FMDV2A) sequence was inserted between the 3'end of the reporter gene and the VP2 start sequence to allow co-translational 'cleavage' of fusion proteins during intracellular transcript expression. Amplification of the fusion gene was performed using a series of standard and overlapping polymerase chain reactions. The resulting amplicon was then cloned into three readily available backbones of MNV-1 cDNA clones. Restriction enzyme analysis indicated that the NanoLucTM Luciferase gene was successfully inserted into the parental MNV-1 cDNA clone. The insertion was further confirmed by using DNA sequencing. NanoLuc™ Luciferase-tagged MNV-1 cDNA clones were successfully engineered. Such clones can be exploited to develop robust experimental assays for in vitro assessments of viral RNA replication.
Isolation and Expression of the Lysis Genes of Actinomyces naeslundii Phage Av-1
Delisle, Allan L.; Barcak, Gerard J.; Guo, Ming
2006-01-01
Like most gram-positive oral bacteria, Actinomyces naeslundii is resistant to salivary lysozyme and to most other lytic enzymes. We are interested in studying the lysins of phages of this important oral bacterium as potential diagnostic and therapeutic agents. To identify the Actinomyces phage genes encoding these species-specific enzymes in Escherichia coli, we constructed a new cloning vector, pAD330, that can be used to enrich for and isolate phage holin genes, which are located adjacent to the lysin genes in most phage genomes. Cloned holin insert sequences were used to design sequencing primers to identify nearby lysin genes by using whole phage DNA as the template. From partial digestions of A. naeslundii phage Av-1 genomic DNA we were able to clone, in independent experiments, inserts that complemented the defective λ holin in pAD330, as evidenced by extensive lysis after thermal induction. The DNA sequence of the inserts in these plasmids revealed that both contained the complete lysis region of Av-1, which is comprised of two holin-like genes, designated holA and holB, and an endolysin gene, designated lysA. We were able to subclone and express these genes and determine some of the functional properties of their gene products. PMID:16461656
A surprisingly large RNase P RNA in Candida glabrata
KACHOURI, RYM; STRIBINSKIS, VILIUS; ZHU, YANGLONG; RAMOS, KENNETH S.; WESTHOF, ERIC; LI, YONG
2005-01-01
We have found an extremely large ribonuclease P (RNase P) RNA (RPR1) in the human pathogen Candida glabrata and verified that this molecule is expressed and present in the active enzyme complex of this hemiascomycete yeast. A structural alignment of the C. glabrata sequence with 36 other hemiascomycete RNase P RNAs (abbreviated as P RNAs) allows us to characterize the types of insertions. In addition, 15 P RNA sequences were newly characterized by searching in the recently sequenced genomes Candida albicans, C. glabrata, Debaryomyces hansenii, Eremothecium gossypii, Kluyveromyces lactis, Kluyveromyces waltii, Naumovia castellii, Saccharomyces kudriavzevii, Saccharomyces mikatae, and Yarrowia lipolytica; and by PCR amplification for other Candida species (Candida guilliermondii, Candida krusei, Candida parapsilosis, Candida stellatoidea, and Candida tropicalis). The phylogenetic comparative analysis identifies a hemiascomycete secondary structure consensus that presents a conserved core in all species with variable insertions or deletions. The most significant variability is found in C. glabrata P RNA in which three insertions exceeding in total 700 nt are present in the Specificity domain. This P RNA is more than twice the length of any other homologous P RNAs known in the three domains of life and is eight times the size of the smallest. RNase P RNA, therefore, represents one of the most diversified noncoding RNAs in terms of size variation and structural diversity. PMID:15987816
DOE Office of Scientific and Technical Information (OSTI.GOV)
Langlois, S.; Kastelein, J.J.; Hayden, M.R.
1989-02-01
Lipoprotein lipase is an important enzyme involved in triacylglycerol metabolism. Primary LPL deficiency is a genetic disorder that is usually manifested by a severe elevation in triacylglycerol levels. The authors have used a recently isolated LPL cDNA clone to study 15 probands from 11 families with this inherited disorder. Surprisingly, 7 of the probands from 4 families, of different ancestries, had a similar insertion in their LPL gene. In contrast to other human genetic disorders, where insertions are rare causes of mutation, this insertion accounts for a significant proportion of the alleles causing LPL deficiency. Detailed restriction mapping of themore » insertion revealed that it was unlikely to be a duplication of neighboring DNA and that it was not similar to the consensus sequence of human L1 repetitive elements. This suggests that there must be other mechanisms of insertional mutagenesis in human genetic disease besides transposition of mobile L1 repetitive elements.« less
van der Klift, Heleen M; Tops, Carli M; Hes, Frederik J; Devilee, Peter; Wijnen, Juul T
2012-07-01
Heterozygous germline mutations in the mismatch repair gene PMS2 predispose carriers for Lynch syndrome, an autosomal dominant predisposition to cancer. Here, we present a LINE-1-mediated retrotranspositional insertion in PMS2 as a novel mutation type for Lynch syndrome. This insertion, detected with Southern blot analysis in the genomic DNA of the patient, is characterized as a 2.2 kb long 5' truncated SVA_F element. The insertion is not detectable by current diagnostic testing limited to MLPA and direct Sanger sequencing on genomic DNA. The molecular nature of this insertion could only be resolved in RNA from cultured lymphocytes in which nonsense-mediated RNA decay was inhibited. Our report illustrates the technical problems encountered in the detection of this mutation type. Especially large heterozygous insertions will remain unnoticed because of preferential amplification of the smaller wild-type allele in genomic DNA, and are probably underreported in the mutation spectra of autosomal dominant disorders. © 2012 Wiley Periodicals, Inc.
Engineering RNA phage MS2 virus-like particles for peptide display
NASA Astrophysics Data System (ADS)
Jordan, Sheldon Keith
Phage display is a powerful and versatile technology that enables the selection of novel binding functions from large populations of randomly generated peptide sequences. Random sequences are genetically fused to a viral structural protein to produce complex peptide libraries. From a sufficiently complex library, phage bearing peptides with practically any desired binding activity can be physically isolated by affinity selection, and, since each particle carries in its genome the genetic information for its own replication, the selectants can be amplified by infection of bacteria. For certain applications however, existing phage display platforms have limitations. One such area is in the field of vaccine development, where the goal is to identify relevant epitopes by affinity-selection against an antibody target, and then to utilize them as immunogens to elicit a desired antibody response. Today, affinity selection is usually conducted using display on filamentous phages like M13. This technology provides an efficient means for epitope identification, but, because filamentous phages do not display peptides in the high-density, multivalent arrays the immune system prefers to recognize, they generally make poor immunogens and are typically useless as vaccines. This makes it necessary to confer immunogenicity by conjugating synthetic versions of the peptides to more immunogenic carriers. Unfortunately, when introduced into these new structural environments, the epitopes often fail to elicit relevant antibody responses. Thus, it would be advantageous to combine the epitope selection and immunogen functions into a single platform where the structural constraints present during affinity selection can be preserved during immunization. This dissertation describes efforts to develop a peptide display system based on the virus-like particles (VLPs) of bacteriophage MS2. Phage display technologies rely on (1) the identification of a site in a viral structural protein that is present on the surface of the virus particle and can accept foreign sequence insertions without disruption of protein folding and viral particle assembly, and (2) on the encapsidation of nucleic acid sequences encoding both the VLP and the peptide it displays. The experiments described here are aimed at satisfying the first of these two requirements by engineering efficient peptide display at two different sites in MS2 coat protein. First, we evaluated the suitability of the N-terminus of MS2 coat for peptide insertions. It was observed that random N-terminal 10-mer fusions generally disrupted protein folding and VLP assembly, but by bracketing the foreign sequences with certain specific dipeptides, these defects could be suppressed. Next, the suitability of a coat protein surface loop for foreign sequence insertion was tested. Specifically, random sequence peptides were inserted into the N-terminal-most AB-loop of a coat protein single-chain dimer. Again we found that efficient display required the presence of appropriate dipeptides bracketing the peptide insertion. Finally, it was shown that an N-terminal fusion that tended to interfere specifically with capsid assembly could be efficiently incorporated into mosaic particles when co-expressed with wild-type coat protein.
Macé, Matthias; Crouau-Roy, Brigitte
2008-01-01
Background The early radiation of the Cetartiodactyla is complex, and unambiguous molecular characters are needed to clarify the positions of hippotamuses, camels and pigs relative to the remaining taxa (Cetacea and Ruminantia). There is also a need for informative genealogic markers for Y-chromosome population genetics as well as a sexing method applicable to all species from this group. We therefore studied the sequence variation of a partial sequence of the evolutionary conserved amelogenin gene to assess its potential use in each of these fields. Results and discussion We report a large interstitial insertion in the Y amelogenin locus in most of the Cetartiodactyla lineages (cetaceans and ruminants). This sex-linked size polymorphism is the result of a 460–465 bp inserted element in intron 4 of the amelogenin gene of Ruminants and Cetaceans. Therefore, this polymorphism can easily be used in a sexing assay for these species. When taking into account this shared character in addition to nucleotide sequence, gene genealogy follows sex-chromosome divergence in Cetartiodactyla whereas it is more congruent with zoological history when ignoring these characters. This could be related to a loss of homology between chromosomal copies given the old age of the insertion. The 1 kbp Amel-Y amplified fragment is also characterized by high nucleotide diversity (64 polymorphic sites spanning over 1 kbp in seven haplotypes) which is greater than for other Y-chromosome sequence markers studied so far but less than the mitochondrial control region. Conclusion The gender-dependent polymorphism we have identified is relevant not only for phylogenic inference within the Cetartiodactyla but also for Y-chromosome based population genetics and gender determination in cetaceans and ruminants. One single protocol can therefore be used for studies in population and evolutionary genetics, reproductive biotechnologies, and forensic science. PMID:18925953
Cheriyan, Manoj; Chan, Siu-Hong; Perler, Francine
2014-12-12
Inteins self-catalytically cleave out of precursor proteins while ligating the surrounding extein fragments with a native peptide bond. Much attention has been lavished on these molecular marvels with the hope of understanding and harnessing their chemistry for novel biochemical transformations including coupling peptides from synthetic or biological origins and controlling protein function. Despite an abundance of powerful applications, the use of inteins is still hampered by limitations in our understanding of their specificity (defined as flanking sequences that permit splicing) and the challenge of inserting inteins into target proteins. We examined the frequently used Nostoc punctiforme Npu DnaE intein after the C-extein cysteine nucleophile (Cys+1) was mutated to serine or threonine. Previous studies demonstrated reduced rates and/or splicing yields with the Npu DnaE intein after mutation of Cys+1 to Ser+1. In this study, genetic selection identified extein sequences with Ser+1 that enabled the Npu DnaE intein to splice with only a 5-fold reduction in rate compared to the wild-type Cys+1 intein and without mutation of the intein itself to activate Ser+1 as a nucleophile. Three different proteins spliced efficiently after insertion of the intein flanked by the selected sequences. We then used this selected specificity to achieve traceless splicing in a targeted enzyme at a location predicted by primary sequence similarity to only the selected C-extein sequence. This study highlights the latent catalytic potential of the Npu DnaE intein to splice with an alternative nucleophile and enables broader intein utility by increasing insertion site choices. Copyright © 2014. Published by Elsevier Ltd.
Burke, W D; Calalang, C C; Eickbush, T H
1987-01-01
Two classes of DNA elements interrupt a fraction of the rRNA repeats of Bombyx mori. We have analyzed by genomic blotting and sequence analysis one class of these elements which we have named R2. These elements occupy approximately 9% of the rDNA units of B. mori and appear to be homologous to the type II rDNA insertions detected in Drosophila melanogaster. Approximately 25 copies of R2 exist within the B. mori genome, of which at least 20 are located at a precise location within otherwise typical rDNA units. Nucleotide sequence analysis has revealed that the 4.2-kilobase-pair R2 element has a single large open reading frame, occupying over 82% of the total length of the element. The central region of this 1,151-amino-acid open reading frame shows homology to the reverse transcriptase enzymes found in retroviruses and certain transposable elements. Amino acid homology of this region is highest to the mobile line 1 elements of mammals, followed by the mitochondrial type II introns of fungi, and the pol gene of retroviruses. Less homology exists with transposable elements of D. melanogaster and Saccharomyces cerevisiae. Two additional regions of sequence homology between L1 and R2 elements were also found outside the reverse transcriptase region. We suggest that the R2 elements are retrotransposons that are site specific in their insertion into the genome. Such mobility would enable these elements to occupy a small fraction of the rDNA units of B. mori despite their continual elimination from the rDNA locus by sequence turnover. Images PMID:2439905
Contamination of sequence databases with adaptor sequences
DOE Office of Scientific and Technical Information (OSTI.GOV)
Yoshikawa, Takeo; Sanders, A.R.; Detera-Wadleigh, S.D.
Because of the exponential increase in the amount of DNA sequences being added to the public databases on a daily basis, it has become imperative to identify sources of contamination rapidly. Previously, contaminations of sequence databases have been reported to alert the scientific community to the problem. These contaminations can be divided into two categories. The first category comprises host sequences that have been difficult for submitters to manage or control. Examples include anomalous sequences derived from Escherichia coli, which are inserted into the chromosomes (and plasmids) of the bacterial hosts. Insertion sequences are highly mobile and are capable ofmore » transposing themselves into plasmids during cloning manipulation. Another example of the first category is the infection with yeast genomic DNA or with bacterial DNA of some commercially available cDNA libraries from Clontech. The second category of database contamination is due to the inadvertent inclusion of nonhost sequences. This category includes incorporation of cloning-vector sequences and multicloning sites in the database submission. M13-derived artifacts have been common, since M13-based vectors have been widely used for subcloning DNA fragments. Recognizing this problem, the National Center for Biotechnology Information (NCBI) started to screen, in April 1994, all sequences directly submitted to GenBank, against a set of vector data retrieved from GenBank by use of key-word searches, such as {open_quotes}vector.{close_quotes} In this report, we present evidence for another sequence artifact that is widespread but that, to our knowledge, has not yet been reported. 11 refs., 1 tab.« less
LoRTE: Detecting transposon-induced genomic variants using low coverage PacBio long read sequences.
Disdero, Eric; Filée, Jonathan
2017-01-01
Population genomic analysis of transposable elements has greatly benefited from recent advances of sequencing technologies. However, the short size of the reads and the propensity of transposable elements to nest in highly repeated regions of genomes limits the efficiency of bioinformatic tools when Illumina or 454 technologies are used. Fortunately, long read sequencing technologies generating read length that may span the entire length of full transposons are now available. However, existing TE population genomic softwares were not designed to handle long reads and the development of new dedicated tools is needed. LoRTE is the first tool able to use PacBio long read sequences to identify transposon deletions and insertions between a reference genome and genomes of different strains or populations. Tested against simulated and genuine Drosophila melanogaster PacBio datasets, LoRTE appears to be a reliable and broadly applicable tool to study the dynamic and evolutionary impact of transposable elements using low coverage, long read sequences. LoRTE is an efficient and accurate tool to identify structural genomic variants caused by TE insertion or deletion. LoRTE is available for download at http://www.egce.cnrs-gif.fr/?p=6422.
Flanking sequence determination and event-specific detection of genetically modified wheat B73-6-1.
Xu, Junyi; Cao, Jijuan; Cao, Dongmei; Zhao, Tongtong; Huang, Xin; Zhang, Piqiao; Luan, Fengxia
2013-05-01
In order to establish a specific identification method for genetically modified (GM) wheat, exogenous insert DNA and flanking sequence between exogenous fragment and recombinant chromosome of GM wheat B73-6-1 were successfully acquired by means of conventional polymerase chain reaction (PCR) and thermal asymmetric interlaced (TAIL)-PCR strategies. Newly acquired exogenous fragment covered the full-length sequence of transformed genes such as transformed plasmid and corresponding functional genes including marker uidA, herbicide-resistant bar, ubiquitin promoter, and high-molecular-weight gluten subunit. The flanking sequence between insert DNA revealed high similarity with Triticum turgidum A gene (GenBank: AY494981.1). A specific PCR detection method for GM wheat B73-6-1 was established on the basis of primers designed according to the flanking sequence. This specific PCR method was validated by GM wheat, GM corn, GM soybean, GM rice, and non-GM wheat. The specifically amplified target band was observed only in GM wheat B73-6-1. This method is of high specificity, high reproducibility, rapid identification, and excellent accuracy for the identification of GM wheat B73-6-1.
Hobbs, A A; Rosen, J M
1982-01-01
The complete sequences of rat alpha- and gamma-casein mRNAs have been determined. The 1402-nucleotide alpha- and 864-nucleotide gamma-casein mRNAs both encode 15 amino acid signal peptides and mature proteins of 269 and 164 residues, respectively. Considerable homology between the 5' non-coding regions, and the regions encoding the signal peptides and the phosphorylation sites, in these mRNAs as compared to several other rodent casein mRNAs, was observed. Significant homology was also detected between rat alpha- and bovine alpha s1-casein. Comparison of the rodent and bovine sequences suggests that the caseins evolved at about the time of the appearance of the primitive mammals. This may have occurred by intragenic duplication of a nucleotide sequence encoding a primitive phosphorylation site, -(Ser)n-Glu-Glu-, and intergenic duplication resulting in the small casein multigene family. A unique feature of the rat alpha-casein sequence is an insertion in the coding region containing 10 repeated elements of 18 nucleotides each. This insertion appears to have occurred 7-12 million years ago, just prior to the divergence of rat and mouse. Images PMID:6298707
deCamp, Allan C; Rolland, Morgane; Edlefsen, Paul T; Sanders-Buell, Eric; Hall, Breana; Magaret, Craig A; Fiore-Gartland, Andrew J; Juraska, Michal; Carpp, Lindsay N; Karuna, Shelly T; Bose, Meera; LePore, Steven; Miller, Shana; O'Sullivan, Annemarie; Poltavee, Kultida; Bai, Hongjun; Dommaraju, Kalpana; Zhao, Hong; Wong, Kim; Chen, Lennie; Ahmed, Hasan; Goodman, Derrick; Tay, Matthew Z; Gottardo, Raphael; Koup, Richard A; Bailer, Robert; Mascola, John R; Graham, Barney S; Roederer, Mario; O'Connell, Robert J; Michael, Nelson L; Robb, Merlin L; Adams, Elizabeth; D'Souza, Patricia; Kublin, James; Corey, Lawrence; Geraghty, Daniel E; Frahm, Nicole; Tomaras, Georgia D; McElrath, M Juliana; Frenkel, Lisa; Styrchak, Sheila; Tovanabutra, Sodsai; Sobieszczyk, Magdalena E; Hammer, Scott M; Kim, Jerome H; Mullins, James I; Gilbert, Peter B
2017-01-01
Although the HVTN 505 DNA/recombinant adenovirus type 5 vector HIV-1 vaccine trial showed no overall efficacy, analysis of breakthrough HIV-1 sequences in participants can help determine whether vaccine-induced immune responses impacted viruses that caused infection. We analyzed 480 HIV-1 genomes sampled from 27 vaccine and 20 placebo recipients and found that intra-host HIV-1 diversity was significantly lower in vaccine recipients (P ≤ 0.04, Q-values ≤ 0.09) in Gag, Pol, Vif and envelope glycoprotein gp120 (Env-gp120). Furthermore, Env-gp120 sequences from vaccine recipients were significantly more distant from the subtype B vaccine insert than sequences from placebo recipients (P = 0.01, Q-value = 0.12). These vaccine effects were associated with signatures mapping to CD4 binding site and CD4-induced monoclonal antibody footprints. These results suggest either (i) no vaccine efficacy to block acquisition of any viral genotype but vaccine-accelerated Env evolution post-acquisition; or (ii) vaccine efficacy against HIV-1s with Env sequences closest to the vaccine insert combined with increased acquisition due to other factors, potentially including the vaccine vector.
Edlefsen, Paul T.; Sanders-Buell, Eric; Hall, Breana; Magaret, Craig A.; Fiore-Gartland, Andrew J.; Juraska, Michal; Carpp, Lindsay N.; Karuna, Shelly T.; Bose, Meera; LePore, Steven; Miller, Shana; O'Sullivan, Annemarie; Poltavee, Kultida; Bai, Hongjun; Dommaraju, Kalpana; Zhao, Hong; Wong, Kim; Chen, Lennie; Ahmed, Hasan; Goodman, Derrick; Tay, Matthew Z.; Gottardo, Raphael; Koup, Richard A.; Bailer, Robert; Mascola, John R.; Graham, Barney S.; Roederer, Mario; O’Connell, Robert J.; Michael, Nelson L.; Robb, Merlin L.; Adams, Elizabeth; D’Souza, Patricia; Kublin, James; Corey, Lawrence; Geraghty, Daniel E.; Frahm, Nicole; Tomaras, Georgia D.; McElrath, M. Juliana; Frenkel, Lisa; Styrchak, Sheila; Tovanabutra, Sodsai; Sobieszczyk, Magdalena E.; Hammer, Scott M.; Kim, Jerome H.; Mullins, James I.; Gilbert, Peter B.
2017-01-01
Although the HVTN 505 DNA/recombinant adenovirus type 5 vector HIV-1 vaccine trial showed no overall efficacy, analysis of breakthrough HIV-1 sequences in participants can help determine whether vaccine-induced immune responses impacted viruses that caused infection. We analyzed 480 HIV-1 genomes sampled from 27 vaccine and 20 placebo recipients and found that intra-host HIV-1 diversity was significantly lower in vaccine recipients (P ≤ 0.04, Q-values ≤ 0.09) in Gag, Pol, Vif and envelope glycoprotein gp120 (Env-gp120). Furthermore, Env-gp120 sequences from vaccine recipients were significantly more distant from the subtype B vaccine insert than sequences from placebo recipients (P = 0.01, Q-value = 0.12). These vaccine effects were associated with signatures mapping to CD4 binding site and CD4-induced monoclonal antibody footprints. These results suggest either (i) no vaccine efficacy to block acquisition of any viral genotype but vaccine-accelerated Env evolution post-acquisition; or (ii) vaccine efficacy against HIV-1s with Env sequences closest to the vaccine insert combined with increased acquisition due to other factors, potentially including the vaccine vector. PMID:29149197
El Kafsi, Hela; Binesse, Johan; Loux, Valentin; Buratti, Julien; Boudebbouze, Samira; Dervyn, Rozenn; Hammani, Amal; Maguin, Emmanuelle; van de Guchte, Maarten
2014-07-17
Lactobacillus delbrueckii subsp. lactis CNRZ327 is a dairy bacterium with anti-inflammatory properties both in vitro and in vivo. Here, we report the genome sequence of this bacterium, which appears to contain no less than 215 insertion sequence (IS) elements, an exceptionally high number regarding the small genome size of the strain. Copyright © 2014 El Kafsi et al.
Designing robust watermark barcodes for multiplex long-read sequencing.
Ezpeleta, Joaquín; Krsticevic, Flavia J; Bulacio, Pilar; Tapia, Elizabeth
2017-03-15
To attain acceptable sample misassignment rates, current approaches to multiplex single-molecule real-time sequencing require upstream quality improvement, which is obtained from multiple passes over the sequenced insert and significantly reduces the effective read length. In order to fully exploit the raw read length on multiplex applications, robust barcodes capable of dealing with the full single-pass error rates are needed. We present a method for designing sequencing barcodes that can withstand a large number of insertion, deletion and substitution errors and are suitable for use in multiplex single-molecule real-time sequencing. The manuscript focuses on the design of barcodes for full-length single-pass reads, impaired by challenging error rates in the order of 11%. The proposed barcodes can multiplex hundreds or thousands of samples while achieving sample misassignment probabilities as low as 10-7 under the above conditions, and are designed to be compatible with chemical constraints imposed by the sequencing process. Software tools for constructing watermark barcode sets and demultiplexing barcoded reads, together with example sets of barcodes and synthetic barcoded reads, are freely available at www.cifasis-conicet.gov.ar/ezpeleta/NS-watermark . ezpeleta@cifasis-conicet.gov.ar. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com
Comparative analysis of myostatin gene and promoter sequences of Qinchuan and Red Angus cattle.
He, Y L; Wu, Y H; Quan, F S; Liu, Y G; Zhang, Y
2013-09-04
To better understand the function of the myostatin gene and its promoter region in bovine, we amplified and sequenced the myostatin gene and promoter from the blood of Qinchuan and Red Angus cattle by using polymerase chain reaction. The sequences of Qinchuan and Red Angus cattle were compared with those of other cattle breeds available in GenBank. Exon splice sites were confirmed by mRNA sequencing. Compared to the published sequence (GenBank accession No. AF320998), 69 single nucleotide polymorphisms (SNPs) were identified in the Qinchuan myostatin gene, only one of which was an insertion mutation in Qinchuan cattle. There was a 16-bp insertion in the first 705-bp intron in 3 Qinchuan cattle. A total of 7 SNPs were identified in exon 3, in which the mutation occurred in the third base of the codon and was synonymous. On comparing the Qinchuan myostatin gene sequence to that of Red Angus cattle, a total of 50 SNPs were identified in the first and third exons. In addition, there were 18 SNPs identified in the Qinchuan cattle promoter region compared with those of other cattle compared to the Red Angus cattle myostatin promoter region. breeds (GenBank accession No. AF348479), but only 14 SNPs when compared to the Red Angus cattle myostatin promoter region.
De novo insertion of an intron into the mammalian sex determining gene, SRY
O’Neill, Rachel J. Waugh; Brennan, Francine E.; Delbridge, Margaret L.; Crozier, Ross H.; Graves, Jennifer A. Marshall
1998-01-01
Two theories have been proposed to explain the evolution of introns within eukaryotic genes. The introns early theory, or “exon theory of genes,” proposes that introns are ancient and that recombination within introns provided new exon structure, and thus new genes. The introns late theory, or “insertional theory of introns,” proposes that ancient genes existed as uninterrupted exons and that introns have been introduced during the course of evolution. There is still controversy as to how intron–exon structure evolved and whether the majority of introns are ancient or novel. Although there is extensive evidence in support of the introns early theory, phylogenetic comparisons of several genes indicate recent gain and loss of introns within these genes. However, no example has been shown of a protein coding gene, intronless in its ancestral form, which has acquired an intron in a derived form. The mammalian sex determining gene, SRY, is intronless in all mammals studied to date, as is the gene from which it recently evolved. However, we report here comparisons of genomic and cDNA sequences that now provide evidence of a de novo insertion of an intron into the SRY gene of dasyurid marsupials. This recently (approximately 45 million years ago) inserted sequence is not homologous with known transposable elements. Our data demonstrate that introns may be inserted as spliced units within a developmentally crucial gene without disrupting its function. PMID:9465071
Genome-Wide Transposon Mutagenesis in Pathogenic Leptospira Species▿ ‡
Murray, Gerald L.; Morel, Viviane; Cerqueira, Gustavo M.; Croda, Julio; Srikram, Amporn; Henry, Rebekah; Ko, Albert I.; Dellagostin, Odir A.; Bulach, Dieter M.; Sermswan, Rasana W.; Adler, Ben; Picardeau, Mathieu
2009-01-01
Leptospira interrogans is the most common cause of leptospirosis in humans and animals. Genetic analysis of L. interrogans has been severely hindered by a lack of tools for genetic manipulation. Recently we developed the mariner-based transposon Himar1 to generate the first defined mutants in L. interrogans. In this study, a total of 929 independent transposon mutants were obtained and the location of insertion determined. Of these mutants, 721 were located in the protein coding regions of 551 different genes. While sequence analysis of transposon insertion sites indicated that transposition occurred in an essentially random fashion in the genome, 25 unique transposon mutants were found to exhibit insertions into genes encoding 16S or 23S rRNAs, suggesting these genes are insertional hot spots in the L. interrogans genome. In contrast, loci containing notionally essential genes involved in lipopolysaccharide and heme biosynthesis showed few transposon insertions. The effect of gene disruption on the virulence of a selected set of defined mutants was investigated using the hamster model of leptospirosis. Two attenuated mutants with disruptions in hypothetical genes were identified, thus validating the use of transposon mutagenesis for the identification of novel virulence factors in L. interrogans. This library provides a valuable resource for the study of gene function in L. interrogans. Combined with the genome sequences of L. interrogans, this provides an opportunity to investigate genes that contribute to pathogenesis and will provide a better understanding of the biology of L. interrogans. PMID:19047402
Genome-wide transposon mutagenesis in pathogenic Leptospira species.
Murray, Gerald L; Morel, Viviane; Cerqueira, Gustavo M; Croda, Julio; Srikram, Amporn; Henry, Rebekah; Ko, Albert I; Dellagostin, Odir A; Bulach, Dieter M; Sermswan, Rasana W; Adler, Ben; Picardeau, Mathieu
2009-02-01
Leptospira interrogans is the most common cause of leptospirosis in humans and animals. Genetic analysis of L. interrogans has been severely hindered by a lack of tools for genetic manipulation. Recently we developed the mariner-based transposon Himar1 to generate the first defined mutants in L. interrogans. In this study, a total of 929 independent transposon mutants were obtained and the location of insertion determined. Of these mutants, 721 were located in the protein coding regions of 551 different genes. While sequence analysis of transposon insertion sites indicated that transposition occurred in an essentially random fashion in the genome, 25 unique transposon mutants were found to exhibit insertions into genes encoding 16S or 23S rRNAs, suggesting these genes are insertional hot spots in the L. interrogans genome. In contrast, loci containing notionally essential genes involved in lipopolysaccharide and heme biosynthesis showed few transposon insertions. The effect of gene disruption on the virulence of a selected set of defined mutants was investigated using the hamster model of leptospirosis. Two attenuated mutants with disruptions in hypothetical genes were identified, thus validating the use of transposon mutagenesis for the identification of novel virulence factors in L. interrogans. This library provides a valuable resource for the study of gene function in L. interrogans. Combined with the genome sequences of L. interrogans, this provides an opportunity to investigate genes that contribute to pathogenesis and will provide a better understanding of the biology of L. interrogans.
Influence of motion on face recognition.
Bonfiglio, Natale S; Manfredi, Valentina; Pessa, Eliano
2012-02-01
The influence of motion information and temporal associations on recognition of non-familiar faces was investigated using two groups which performed a face recognition task. One group was presented with regular temporal sequences of face views designed to produce the impression of motion of the face rotating in depth, the other group with random sequences of the same views. In one condition, participants viewed the sequences of the views in rapid succession with a negligible interstimulus interval (ISI). This condition was characterized by three different presentation times. In another condition, participants were presented a sequence with a 1-sec. ISI among the views. That regular sequences of views with a negligible ISI and a shorter presentation time were hypothesized to give rise to better recognition, related to a stronger impression of face rotation. Analysis of data from 45 participants showed a shorter presentation time was associated with significantly better accuracy on the recognition task; however, differences between performances associated with regular and random sequences were not significant.
An Improved Brome mosaic virus Silencing Vector: Greater Insert Stability and More Extensive VIGS.
Ding, Xin Shun; Mannas, Stephen W; Bishop, Bethany A; Rao, Xiaolan; Lecoultre, Mitchell; Kwon, Soonil; Nelson, Richard S
2018-01-01
Virus-induced gene silencing (VIGS) is used extensively for gene function studies in plants. VIGS is inexpensive and rapid compared with silencing conducted through stable transformation, but many virus-silencing vectors, especially in grasses, induce only transient silencing phenotypes. A major reason for transient phenotypes is the instability of the foreign gene fragment (insert) in the vector during VIGS. Here, we report the development of a Brome mosaic virus (BMV)-based vector that better maintains inserts through modification of the original BMV vector RNA sequence. Modification of the BMV RNA3 sequence yielded a vector, BMVCP5, that better maintained phytoene desaturase and heat shock protein70-1 ( HSP70-1 ) inserts in Nicotiana benthamiana and maize ( Zea mays ). Longer maintenance of inserts was correlated with greater target gene silencing and more extensive visible silencing phenotypes displaying greater tissue penetration and involving more leaves. The modified vector accumulated similarly to the original vector in N. benthamiana after agroinfiltration, thus maintaining a high titer of virus in this intermediate host used to produce virus inoculum for grass hosts. For HSP70 , silencing one family member led to a large increase in the expression of another family member, an increase likely related to the target gene knockdown and not a general effect of virus infection. The cause of the increased insert stability in the modified vector is discussed in relationship to its recombination and accumulation potential. The modified vector will improve functional genomic studies in grasses, and the conceptual methods used to improve the vector may be applied to other VIGS vectors. © 2018 American Society of Plant Biologists. All Rights Reserved.
Protective Socket For Integrated Circuits
NASA Technical Reports Server (NTRS)
Wilkinson, Chris; Henegar, Greg
1988-01-01
Socket for intergrated circuits (IC's) protects from excessive voltages and currents or from application of voltages and currents in wrong sequence during insertion or removal. Contains built-in switch that opens as IC removed, disconnecting leads from signals and power. Also protects other components on circuit board from transients produced by insertion and removal of IC. Makes unnecessary to turn off power to entire circuit board so other circuits on board continue to function.
Going, going, gone: predicting the fate of genomic insertions in plant RNA viruses.
Willemsen, Anouk; Carrasco, José L; Elena, Santiago F; Zwart, Mark P
2018-05-10
Horizontal gene transfer is common among viruses, while they also have highly compact genomes and tend to lose artificial genomic insertions rapidly. Understanding the stability of genomic insertions in viral genomes is therefore relevant for explaining and predicting their evolutionary patterns. Here, we revisit a large body of experimental research on a plant RNA virus, tobacco etch potyvirus (TEV), to identify the patterns underlying the stability of a range of homologous and heterologous insertions in the viral genome. We obtained a wide range of estimates for the recombination rate-the rate at which deletions removing the insertion occur-and these appeared to be independent of the type of insertion and its location. Of the factors we considered, recombination rate was the best predictor of insertion stability, although we could not identify the specific sequence characteristics that would help predict insertion instability. We also considered experimentally the possibility that functional insertions lead to higher mutational robustness through increased redundancy. However, our observations suggest that both functional and non-functional increases in genome size decreased the mutational robustness. Our results therefore demonstrate the importance of recombination rates for predicting the long-term stability and evolution of viral RNA genomes and suggest that there are unexpected drawbacks to increases in genome size for mutational robustness.
Using SINEs to probe ancient explosive speciation: "hidden" radiation of African cichlids?
Terai, Yohey; Takahashi, Kazuhiko; Nishida, Mutsumi; Sato, Tetsu; Okada, Norihiro
2003-06-01
Cichlid fishes of the east African Great Lakes represent a paradigm of adaptive radiation. We conducted a phylogenetic analysis of cichlids including pan-African and west African species by using insertion patterns of short interspersed elements (SINEs) at orthologous loci. The monophyly of the east African cichlids was consistently supported by seven independent insertions of SINE sequences that are uniquely shared by these species. In addition, data from four other loci indicated that the genera Tilapia (pan-African) and Steatocranus (west African) are the closest relatives to east African cichlids. However, relationships among Tilapia, Steatocranus, and the east African clade were ambiguous because of incongruencies among topologies suggested by insertion patterns of SINEs at six other loci. One plausible explanation for this phenomenon is incomplete lineage sorting of alleles containing or missing a SINE insertion at these loci during ancestral speciation. Such incomplete sorting may have taken place earlier than 14 MYA, followed by random and stochastic fixation of the alleles in subsequent lineages. These observations prompted us to consider the possibility that cichlid speciation occurred at an accelerated rate during this period when the African Great Lakes did not exist. The SINE method could be useful for detecting ancient exclusive speciation events that tend to remain hidden during conventional sequence analyses because of accumulated point mutations.
Haider, Clifton R; Borisch, Eric A; Glockner, James F; Mostardi, Petrice M; Rossman, Phillip J; Young, Phillip M; Riederer, Stephen J
2010-10-01
High temporal and spatial resolution is desired in imaging of vascular abnormalities having short arterial-to-venous transit times. Methods that exploit temporal correlation to reduce the observed frame time demonstrate temporal blurring, obfuscating bolus dynamics. Previously, a Cartesian acquisition with projection reconstruction-like (CAPR) sampling method has been demonstrated for three-dimensional contrast-enhanced angiographic imaging of the lower legs using two-dimensional sensitivity-encoding acceleration and partial Fourier acceleration, providing 1mm isotropic resolution of the calves, with 4.9-sec frame time and 17.6-sec temporal footprint. In this work, the CAPR acquisition is further undersampled to provide a net acceleration approaching 40 by eliminating all view sharing. The tradeoff of frame time and temporal footprint in view sharing is presented and characterized in phantom experiments. It is shown that the resultant 4.9-sec acquisition time, three-dimensional images sets have sufficient spatial and temporal resolution to clearly portray arterial and venous phases of contrast passage. It is further hypothesized that these short temporal footprint sequences provide diagnostic quality images. This is tested and shown in a series of nine contrast-enhanced MR angiography patient studies performed with the new method.
Ong, Emily; Ho, Christopher; Miles, Peter
2011-03-01
To compare the efficiency of orthodontic archwire sequences produced by three manufacturers. Prospective, randomized clinical trial with three parallel groups. Private orthodontic practice in Caloundra, QLD, Australia. One hundred and thirty-two consecutive patients were randomized to one of three archwire sequence groups: (i) 3M Unitek, 0·014 inch Nitinol, 0·017 inch × 0·017 inch heat activated Ni-Ti; (ii) GAC international, 0·014 inch Sentalloy, 0·016 × 0·022 inch Bioforce; and (iii) Ormco corporation, 0·014 inch Damon Copper Ni-Ti, 0·014 × 0·025 inch Damon Copper Ni-Ti. All patients received 0·018 × 0·025 inch slot Victory Series™ brackets. Mandibular impressions were taken before the insertion of each archwire. Patients completed discomfort surveys according to a seven-point Likert Scale at 4 h, 24 h, 3 days and 7 days after the insertion of each archwire. Efficiency was measured by time required to reach the working archwire, mandibular anterior alignment and level of discomfort. No significant differences were found in the reduction of irregularity between the archwire sequences at any time-point (T1: P = 0·12; T2: P = 0·06; T3: P = 0·21) or in the time to reach the working archwire (P = 0·28). No significant differences were found in the overall discomfort scores between the archwire sequences (4 h: P = 0·30; 24 h: P = 0·18; 3 days: P = 0·53; 7 days: P = 0·47). When the time-points were analysed individually, the 3M Unitek archwire sequence induced significantly less discomfort than GAC and Ormco archwires 24 h after the insertion of the third archwire (P = 0·02). This could possibly be attributed to the progression in archwire material and archform. The archwire sequences were similar in alignment efficiency and overall discomfort. Progression in archwire dimension and archform may contribute to discomfort levels. This study provides clinical justification for three common archwire sequences in 0·018 × 0·025 inch slot brackets.
Shaw, Frances L.; Mulholland, Francis; Le Gall, Gwénaëlle; Porcelli, Ida; Hart, Dave J.; Pearson, Bruce M.
2012-01-01
The food-borne bacterial pathogen Campylobacter jejuni efficiently utilizes organic acids such as lactate and formate for energy production. Formate is rapidly metabolized via the activity of the multisubunit formate dehydrogenase (FDH) enzyme, of which the FdhA subunit is predicted to contain a selenocysteine (SeC) amino acid. In this study we investigated the function of the cj1500 and cj1501 genes of C. jejuni, demonstrate that they are involved in selenium-controlled production of FDH, and propose the names fdhT and fdhU, respectively. Insertional inactivation of fdhT or fdhU in C. jejuni resulted in the absence of FdhA and FdhB protein expression, reduced fdhABC RNA levels, the absence of FDH enzyme activity, and the lack of formate utilization, as assessed by 1H nuclear magnetic resonance. The fdhABC genes are transcribed from a single promoter located two genes upstream of fdhA, and the decrease in fdhABC RNA levels in the fdhU mutant is mediated at the posttranscriptional level. FDH activity and the ability to utilize formate were restored by genetic complementation with fdhU and by supplementation of the growth media with selenium dioxide. Disruption of SeC synthesis by inactivation of the selA and selB genes also resulted in the absence of FDH activity, which could not be restored by selenium supplementation. Comparative genomic analysis suggests a link between the presence of selA and fdhTU orthologs and the predicted presence of SeC in FdhA. The fdhTU genes encode accessory proteins required for FDH expression and activity in C. jejuni, possibly by contributing to acquisition or utilization of selenium. PMID:22609917
ERIC Educational Resources Information Center
Chen, Shuming
2018-01-01
An iridium(III)-mediated C-H functionalization sequence involving a concerted cyclometalation-deprotonation/migratory insertion pathway is reported for the undergraduate chemistry laboratory. The air- and water-stable iridacycle intermediates are readily isolated and characterized by NMR spectroscopy. Both steps of the experiment are performed at…
Isolation and characterization of microsatellite markers in Fraser fir (Abies fraseri)
S.A. Josserand; K.M. Potter; G. Johnson; J.A. Bowen; J. Frampton; C.D. Nelson
2006-01-01
We describe the isolation and characterization of 14 microsatellite loci from Fraser fir (Abies fraseri). These markers originated from cloned inserts enriched for DNA sequences containing tandem di- and tri-nucleotide repeats. In total, 36 clones were selected, sequenced and evaluated. Polymerase chain reaction (PCR) primers for 14 of these...
Young, Robert S
2016-07-01
Frequent evolutionary birth and death events have created a large quantity of biologically important, lineage-specific DNA within mammalian genomes. The birth and death of DNA sequences is so frequent that the total number of these insertions and deletions in the human population remains unknown, although there are differences between these groups, e.g. transposable elements contribute predominantly to sequence insertion. Functional turnover - where the activity of a locus is specific to one lineage, but the underlying DNA remains conserved - can also drive birth and death. However, this does not appear to be a major driver of divergent transcriptional regulation. Both sequence and functional turnover have contributed to the birth and death of thousands of functional promoters in the human and mouse genomes. These findings reveal the pervasive nature of evolutionary birth and death and suggest that lineage-specific regions may play an important but previously underappreciated role in human biology and disease. © 2016 The Authors BioEssays Published by WILEY Periodicals, Inc.
Identification and Characterization of Domesticated Bacterial Transposases
Gallie, Jenna; Rainey, Paul B.
2017-01-01
Abstract Selfish genetic elements, such as insertion sequences and transposons are found in most genomes. Transposons are usually identifiable by their high copy number within genomes. In contrast, REP-associated tyrosine transposases (RAYTs), a recently described class of bacterial transposase, are typically present at just one copy per genome. This suggests that RAYTs no longer copy themselves and thus they no longer function as a typical transposase. Motivated by this possibility we interrogated thousands of fully sequenced bacterial genomes in order to determine patterns of RAYT diversity, their distribution across chromosomes and accessory elements, and rate of duplication. RAYTs encompass exceptional diversity and are divisible into at least five distinct groups. They possess features more similar to housekeeping genes than insertion sequences, are predominantly vertically transmitted and have persisted through evolutionary time to the point where they are now found in 24% of all species for which at least one fully sequenced genome is available. Overall, the genomic distribution of RAYTs suggests that they have been coopted by host genomes to perform a function that benefits the host cell. PMID:28910967
Efficient privacy-preserving string search and an application in genomics.
Shimizu, Kana; Nuida, Koji; Rätsch, Gunnar
2016-06-01
Personal genomes carry inherent privacy risks and protecting privacy poses major social and technological challenges. We consider the case where a user searches for genetic information (e.g. an allele) on a server that stores a large genomic database and aims to receive allele-associated information. The user would like to keep the query and result private and the server the database. We propose a novel approach that combines efficient string data structures such as the Burrows-Wheeler transform with cryptographic techniques based on additive homomorphic encryption. We assume that the sequence data is searchable in efficient iterative query operations over a large indexed dictionary, for instance, from large genome collections and employing the (positional) Burrows-Wheeler transform. We use a technique called oblivious transfer that is based on additive homomorphic encryption to conceal the sequence query and the genomic region of interest in positional queries. We designed and implemented an efficient algorithm for searching sequences of SNPs in large genome databases. During search, the user can only identify the longest match while the server does not learn which sequence of SNPs the user queried. In an experiment based on 2184 aligned haploid genomes from the 1000 Genomes Project, our algorithm was able to perform typical queries within [Formula: see text] 4.6 s and [Formula: see text] 10.8 s for client and server side, respectively, on laptop computers. The presented algorithm is at least one order of magnitude faster than an exhaustive baseline algorithm. https://github.com/iskana/PBWT-sec and https://github.com/ratschlab/PBWT-sec shimizu-kana@aist.go.jp or Gunnar.Ratsch@ratschlab.org Supplementary data are available at Bioinformatics online. © The Author 2016. Published by Oxford University Press.
Efficient privacy-preserving string search and an application in genomics
Shimizu, Kana; Nuida, Koji; Rätsch, Gunnar
2016-01-01
Motivation: Personal genomes carry inherent privacy risks and protecting privacy poses major social and technological challenges. We consider the case where a user searches for genetic information (e.g. an allele) on a server that stores a large genomic database and aims to receive allele-associated information. The user would like to keep the query and result private and the server the database. Approach: We propose a novel approach that combines efficient string data structures such as the Burrows–Wheeler transform with cryptographic techniques based on additive homomorphic encryption. We assume that the sequence data is searchable in efficient iterative query operations over a large indexed dictionary, for instance, from large genome collections and employing the (positional) Burrows–Wheeler transform. We use a technique called oblivious transfer that is based on additive homomorphic encryption to conceal the sequence query and the genomic region of interest in positional queries. Results: We designed and implemented an efficient algorithm for searching sequences of SNPs in large genome databases. During search, the user can only identify the longest match while the server does not learn which sequence of SNPs the user queried. In an experiment based on 2184 aligned haploid genomes from the 1000 Genomes Project, our algorithm was able to perform typical queries within ≈ 4.6 s and ≈ 10.8 s for client and server side, respectively, on laptop computers. The presented algorithm is at least one order of magnitude faster than an exhaustive baseline algorithm. Availability and implementation: https://github.com/iskana/PBWT-sec and https://github.com/ratschlab/PBWT-sec. Contacts: shimizu-kana@aist.go.jp or Gunnar.Ratsch@ratschlab.org Supplementary information: Supplementary data are available at Bioinformatics online. PMID:27153731
Takahara, Taro; Imai, Yutaka; Yamashita, Tomohiro; Yasuda, Seiei; Nasu, Seiji; Van Cauteren, Marc
2004-01-01
To examine a new way of body diffusion weighted imaging (DWI) using the short TI inversion recovery-echo planar imaging (STIR-EPI) sequence and free breathing scanning (diffusion weighted whole body imaging with background body signal suppression; DWIBS) to obtain three-dimensional displays. 1) Apparent contrast-to-noise ratios (AppCNR) between lymph nodes and surrounding fat tissue were compared in three types of DWI with and without breath-holding, with variable lengths of scan time and slice thickness. 2) The STIR-EPI sequence and spin echo-echo planar imaging (SE-EPI) sequence with chemical shift selective (CHESS) pulse were compared in terms of their degree of fat suppression. 3) Eleven patients with neck, chest, and abdominal malignancy were scanned with DWIBS for evaluation of feasibility. Whole body imaging was done in a later stage of the study using the peripheral vascular coil. The AppCNR of 8 mm slice thickness images reconstructed from 4 mm slice thickness source images obtained in a free breathing scan of 430 sec were much better than 9 mm slice thickness breath-hold scans obtained in 25 sec. High resolution multi-planar reformat (MPR) and maximum intensity projection (MIP) images could be made from the data set of 4 mm slice thickness images. Fat suppression was much better in the STIR-EPI sequence than SE-EPI with CHESS pulse. The feasibility of DWIBS was showed in clinical scans of 11 patients. Whole body images were successfully obtained with adequate fat suppression. Three-dimensional DWIBS can be obtained with this technique, which may allow us to screen for malignancies in the whole body.
Haplotype estimation using sequencing reads.
Delaneau, Olivier; Howie, Bryan; Cox, Anthony J; Zagury, Jean-François; Marchini, Jonathan
2013-10-03
High-throughput sequencing technologies produce short sequence reads that can contain phase information if they span two or more heterozygote genotypes. This information is not routinely used by current methods that infer haplotypes from genotype data. We have extended the SHAPEIT2 method to use phase-informative sequencing reads to improve phasing accuracy. Our model incorporates the read information in a probabilistic model through base quality scores within each read. The method is primarily designed for high-coverage sequence data or data sets that already have genotypes called. One important application is phasing of single samples sequenced at high coverage for use in medical sequencing and studies of rare diseases. Our method can also use existing panels of reference haplotypes. We tested the method by using a mother-father-child trio sequenced at high-coverage by Illumina together with the low-coverage sequence data from the 1000 Genomes Project (1000GP). We found that use of phase-informative reads increases the mean distance between switch errors by 22% from 274.4 kb to 328.6 kb. We also used male chromosome X haplotypes from the 1000GP samples to simulate sequencing reads with varying insert size, read length, and base error rate. When using short 100 bp paired-end reads, we found that using mixtures of insert sizes produced the best results. When using longer reads with high error rates (5-20 kb read with 4%-15% error per base), phasing performance was substantially improved. Copyright © 2013 The American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.
27 CFR 20.179 - Package identification number or serial number.
Code of Federal Regulations, 2011 CFR
2011-04-01
... the time of a change, the numbering series in use at the time of the change may be continued. (Sec... at the same time on which all of the marks required by § 20.178 (a)(1) and (a)(3) through (a)(8) are... number “1” and continuing in regular sequence. The dealer shall use a separate but similar number series...
27 CFR 20.179 - Package identification number or serial number.
Code of Federal Regulations, 2013 CFR
2013-04-01
... the time of a change, the numbering series in use at the time of the change may be continued. (Sec... at the same time on which all of the marks required by § 20.178 (a)(1) and (a)(3) through (a)(8) are... number “1” and continuing in regular sequence. The dealer shall use a separate but similar number series...
27 CFR 20.179 - Package identification number or serial number.
Code of Federal Regulations, 2012 CFR
2012-04-01
... the time of a change, the numbering series in use at the time of the change may be continued. (Sec... at the same time on which all of the marks required by § 20.178 (a)(1) and (a)(3) through (a)(8) are... number “1” and continuing in regular sequence. The dealer shall use a separate but similar number series...
27 CFR 20.179 - Package identification number or serial number.
Code of Federal Regulations, 2014 CFR
2014-04-01
... the time of a change, the numbering series in use at the time of the change may be continued. (Sec... at the same time on which all of the marks required by § 20.178 (a)(1) and (a)(3) through (a)(8) are... number “1” and continuing in regular sequence. The dealer shall use a separate but similar number series...
27 CFR 20.179 - Package identification number or serial number.
Code of Federal Regulations, 2010 CFR
2010-04-01
... the time of a change, the numbering series in use at the time of the change may be continued. (Sec... at the same time on which all of the marks required by § 20.178 (a)(1) and (a)(3) through (a)(8) are... number “1” and continuing in regular sequence. The dealer shall use a separate but similar number series...
Neill, Nicholas J; Ballif, Blake C; Lamb, Allen N; Parikh, Sumit; Ravnan, J Britt; Schultz, Roger A; Torchia, Beth S; Rosenfeld, Jill A; Shaffer, Lisa G
2011-04-01
Insertions occur when a segment of one chromosome is translocated and inserted into a new region of the same chromosome or a non-homologous chromosome. We report 71 cases with unbalanced insertions identified using array CGH and FISH in 4909 cases referred to our laboratory for array CGH and found to have copy-number abnormalities. Although the majority of insertions were non-recurrent, several recurrent unbalanced insertions were detected, including three der(Y)ins(Y;18)(q?11.2;p11.32p11.32)pat inherited from parents carrying an unbalanced insertion. The clinical significance of these recurrent rearrangements is unclear, although the small size, limited gene content, and inheritance pattern of each suggests that the phenotypic consequences may be benign. Cryptic, submicroscopic duplications were observed at or near the insertion sites in two patients, further confounding the clinical interpretation of these insertions. Using FISH, linear amplification, and array CGH, we identified a 126-kb duplicated region from 19p13.3 inserted into MECP2 at Xq28 in a patient with symptoms of Rett syndrome. Our results demonstrate that although the interpretation of most non-recurrent insertions is unclear without high-resolution insertion site characterization, the potential for an otherwise benign duplication to result in a clinically relevant outcome through the disruption of a gene necessitates the use of FISH to determine whether copy-number gains detected by array CGH represent tandem duplications or unbalanced insertions. Further follow-up testing using techniques such as linear amplification or sequencing should be used to determine gene involvement at the insertion site after FISH has identified the presence of an insertion.
Deak, P.; Omar, M. M.; Saunders, RDC.; Pal, M.; Komonyi, O.; Szidonya, J.; Maroy, P.; Zhang, Y.; Ashburner, M.; Benos, P.; Savakis, C.; Siden-Kiamos, I.; Louis, C.; Bolshakov, V. N.; Kafatos, F. C.; Madueno, E.; Modolell, J.; Glover, D. M.
1997-01-01
We have established a collection of 2460 lethal or semi-lethal mutant lines using a procedure thought to insert single P elements into vital genes on the third chromosome of Drosophila melanogaster. More than 1200 randomly selected lines were examined by in situ hybridization and 90% found to contain single insertions at sites that mark 89% of all lettered subdivisions of the Bridges' map. A set of chromosomal deficiencies that collectively uncover ~25% of the euchromatin of chromosome 3 reveal lethal mutations in 468 lines corresponding to 145 complementation groups. We undertook a detailed analysis of the cytogenetic interval 86E-87F and identified 87 P-element-induced mutations falling into 38 complementation groups, 16 of which correspond to previously known genes. Twenty-one of these 38 complementation groups have at least one allele that has a P-element insertion at a position consistent with the cytogenetics of the locus. We have rescued P elements and flanking chromosomal sequences from the 86E-87F region in 35 lines with either lethal or genetically silent P insertions, and used these as probes to identify cosmids and P1 clones from the Drosophila genome projects. This has tied together the physical and genetic maps and has linked 44 previously identified cosmid contigs into seven ``supercontigs'' that span the interval. STS data for sequences flanking one side of the P-element insertions in 49 lines has identified insertions in the αγ element at 87C, two known transposable elements, and the open reading frames of seven putative single copy genes. These correspond to five known genes in this interval, and two genes identified by the homology of their predicted products to known proteins from other organisms. PMID:9409831
Bonanno, Ludivine; Loukiadis, Estelle; Mariani-Kurkdjian, Patricia; Oswald, Eric; Garnier, Lucille; Michel, Valérie
2015-01-01
Shiga toxin-producing Escherichia coli (STEC) is a food-borne pathogen that may be responsible for severe human infections. Only a limited number of serotypes, including O26:H11, are involved in the majority of serious cases and outbreaks. The main virulence factors, Shiga toxins (Stx), are encoded by bacteriophages. Seventy-four STEC O26:H11 strains of various origins (including human, dairy, and cattle) were characterized for their stx subtypes and Stx phage chromosomal insertion sites. The majority of food and cattle strains possessed the stx1a subtype, while human strains carried mainly stx1a or stx2a. The wrbA and yehV genes were the main Stx phage insertion sites in STEC O26:H11, followed distantly by yecE and sbcB. Interestingly, the occurrence of Stx phages inserted in the yecE gene was low in dairy strains. In most of the 29 stx-negative E. coli O26:H11 strains also studied here, these bacterial insertion sites were vacant. Multilocus sequence typing of 20 stx-positive or stx-negative E. coli O26:H11 strains showed that they were distributed into two phylogenetic groups defined by sequence type 21 (ST21) and ST29. Finally, an EspK-carrying phage was found inserted in the ssrA gene in the majority of the STEC O26:H11 strains but in only a minority of the stx-negative E. coli O26:H11 strains. The differences in the stx subtypes and Stx phage insertion sites observed in STEC O26:H11 according to their origin might reflect that strains circulating in cattle and foods are clonally distinct from those isolated from human patients. PMID:25819955
Charles, Mathieu; Belcram, Harry; Just, Jérémy; Huneau, Cécile; Viollet, Agnès; Couloux, Arnaud; Segurens, Béatrice; Carter, Meredith; Huteau, Virginie; Coriton, Olivier; Appels, Rudi; Samain, Sylvie; Chalhoub, Boulos
2008-01-01
Transposable elements (TEs) constitute >80% of the wheat genome but their dynamics and contribution to size variation and evolution of wheat genomes (Triticum and Aegilops species) remain unexplored. In this study, 10 genomic regions have been sequenced from wheat chromosome 3B and used to constitute, along with all publicly available genomic sequences of wheat, 1.98 Mb of sequence (from 13 BAC clones) of the wheat B genome and 3.63 Mb of sequence (from 19 BAC clones) of the wheat A genome. Analysis of TE sequence proportions (as percentages), ratios of complete to truncated copies, and estimation of insertion dates of class I retrotransposons showed that specific types of TEs have undergone waves of differential proliferation in the B and A genomes of wheat. While both genomes show similar rates and relatively ancient proliferation periods for the Athila retrotransposons, the Copia retrotransposons proliferated more recently in the A genome whereas Gypsy retrotransposon proliferation is more recent in the B genome. It was possible to estimate for the first time the proliferation periods of the abundant CACTA class II DNA transposons, relative to that of the three main retrotransposon superfamilies. Proliferation of these TEs started prior to and overlapped with that of the Athila retrotransposons in both genomes. However, they also proliferated during the same periods as Gypsy and Copia retrotransposons in the A genome, but not in the B genome. As estimated from their insertion dates and confirmed by PCR-based tracing analysis, the majority of differential proliferation of TEs in B and A genomes of wheat (87 and 83%, respectively), leading to rapid sequence divergence, occurred prior to the allotetraploidization event that brought them together in Triticum turgidum and Triticum aestivum, <0.5 million years ago. More importantly, the allotetraploidization event appears to have neither enhanced nor repressed retrotranspositions. We discuss the apparent proliferation of TEs as resulting from their insertion, removal, and/or combinations of both evolutionary forces. PMID:18780739
Final technical report for: Insertional Mutagenesis of Brachypodium distachyon DE-AI02-07ER64452
DOE Office of Scientific and Technical Information (OSTI.GOV)
John, Vogel P.
Several bioenergy grasses are poised to become a major source of energy in the United States. Despite their increasing importance, we know little about the basic biology underlying the traits that control the utility of grasses as energy crops. Better knowledge of grass biology (e.g. identification of the genes that control cell wall composition, plant architecture, cell size, cell division, reproduction, nutrient uptake, carbon flux, etc.) could be used to design rational strategies for crop improvement and shorten the time required to domesticate these species. The use of an appropriate model system is an efficient way to gain this knowledge.more » Brachypodium distachyon is a small annual grass with all the attributes needed to be a modern model organism including simple growth requirements, fast generation time, small stature, small genome size and self-fertility. These attributes led to the recommendation in the DOE’s “Breaking the Biological Barriers to Cellulosic Ethanol: A Joint Research Agenda” report to propose developing and using B. distachyon as a model for energy crops to accelerate their domestication. Strategic investments (e.g. genome sequencing) in B. distachyon by the DOE are now bearing fruit and B. distachyon is being used as a model grass by hundreds of laboratories worldwide. Sequence indexed insertional mutants are an extremely powerful tool for both forward and reverse genetics. They allow researchers to order mutants in any gene tagged in the collection by simply emailing a request. The goal of this project was to create a collection of sequence indexed insertional mutants (T-DNA lines) for the model grass Brachypodium distachyon in order to facilitate research by the scientific community. During the course of this grant we created a collection of 23,649 B. distachyon T-DNA lines and identified 26,112 unique insertion sites. The collection can be queried through the project website (http://jgi.doe.gov/our-science/science-programs/plant-genomics/brachypodium/brachypodium-t-dna-collection/) and through the Phytozome genome browser (http://phytozome.jgi.doe.gov/pz/portal.html). The collection has been heavily utilized by the research community and, as of October 23, 2015, 223 orders for 12,069 seeds packets have been filled. In addition to creating this resource, we also optimized methods for transformation and sequencing DNA flanking insertion sites.« less
Palzkill, T G; Oliver, S G; Newlon, C S
1986-01-01
Four fragments of Saccharomyces cerevisiae chromosome III DNA which carry ARS elements have been sequenced. Each fragment contains multiple copies of sequences that have at least 10 out of 11 bases of homology to a previously reported 11 bp core consensus sequence. A survey of these new ARS sequences and previously reported sequences revealed the presence of an additional 11 bp conserved element located on the 3' side of the T-rich strand of the core consensus. Subcloning analysis as well as deletion and transposon insertion mutagenesis of ARS fragments support a role for 3' conserved sequence in promoting ARS activity. PMID:3529036
Federal Register 2010, 2011, 2012, 2013, 2014
2010-02-24
... part 950 of this chapter. title. Sec. 1264.3(a), Sec. 926.4........ Sec. 1264.4. Introductory text. Sec...).. Sec. 1264.3(a)(2). Introductory text. Sec. 1264.4(c)(1)......... Sec. 926.3(a)(3).. Sec. 1264.3(a)(3...)......... Sec. 950.7 of this Sec. 950.7 of this chapter. title. Sec. 1269.3(a), Sec. Sec. Sec. Sec. Introductory...
Hamze, Faeze; Ganjalikhan Nasab, Seyed Abdolreza; Eskandarizadeh, Ali; Shahravan, Arash; Akhavan Fard, Fatemeh; Sinaee, Neda
2018-01-01
Due to thermal hazard during composite restorations, this study was designed to scan the pulp temperature by thermocouple and infrared camera during photo polymerizing different composites. A mesio-occlso-distal (MOD) cavity was prepared in an extracted tooth and the K-type thermocouple was fixed in its pulp chamber. Subsequently, 1 mm increment of each composites were inserted (four composite types were incorporated) and photo polymerized employing either LED or QTH systems for 60 sec while the temperature was recorded with 10 sec intervals. Ultimately, the same tooth was hemisected bucco-lingually and the amalgam was removed. The same composite curing procedure was repeated while the thermogram was recorded using an infrared camera. Thereafter, the data was analyzed by repeated measured ANOVA followed by Tukey's HSD Post Hoc test for multiple comparisons ( α =0.05). The pulp temperature was significantly increased (repeated measures) during photo polymerization ( P =0.000) while there was no significant difference among the results recorded by thermocouple comparing to infrared camera ( P >0.05). Moreover, different composite materials and LCUs lead to similar outcomes ( P >0.05). Although various composites have significant different chemical compositions, they lead to similar pulp thermal changes. Moreover, both the infrared camera and the thermocouple would record parallel results of dental pulp temperature.
Circular permutant GFP insertion folding reporters
Waldo, Geoffrey S [Santa Fe, NM; Cabantous, Stephanie [Los Alamos, NM
2008-06-24
Provided are methods of assaying and improving protein folding using circular permutants of fluorescent proteins, including circular permutants of GFP variants and combinations thereof. The invention further provides various nucleic acid molecules and vectors incorporating such nucleic acid molecules, comprising polynucleotides encoding fluorescent protein circular permutants derived from superfolder GFP, which polynucleotides include an internal cloning site into which a heterologous polynucleotide may be inserted in-frame with the circular permutant coding sequence, and which when expressed are capable of reporting on the degree to which a polypeptide encoded by such an inserted heterologous polynucleotide is correctly folded by correlation with the degree of fluorescence exhibited.
Circular permutant GFP insertion folding reporters
Waldo, Geoffrey S; Cabantous, Stephanie
2013-02-12
Provided are methods of assaying and improving protein folding using circular permutants of fluorescent proteins, including circular permutants of GFP variants and combinations thereof. The invention further provides various nucleic acid molecules and vectors incorporating such nucleic acid molecules, comprising polynucleotides encoding fluorescent protein circular permutants derived from superfolder GFP, which polynucleotides include an internal cloning site into which a heterologous polynucleotide may be inserted in-frame with the circular permutant coding sequence, and which when expressed are capable of reporting on the degree to which a polypeptide encoded by such an inserted heterologous polynucleotide is correctly folded by correlation with the degree of fluorescence exhibited.
Circular permutant GFP insertion folding reporters
Waldo, Geoffrey S [Santa Fe, NM; Cabantous, Stephanie [Los Alamos, NM
2011-06-14
Provided are methods of assaying and improving protein folding using circular permutants of fluorescent proteins, including circular permutants of GFP variants and combinations thereof. The invention further provides various nucleic acid molecules and vectors incorporating such nucleic acid molecules, comprising polynucleotides encoding fluorescent protein circular permutants derived from superfolder GFP, which polynucleotides include an internal cloning site into which a heterologous polynucleotide may be inserted in-frame with the circular permutant coding sequence, and which when expressed are capable of reporting on the degree to which a polypeptide encoded by such an inserted heterologous polynucleotide is correctly folded by correlation with the degree of fluorescence exhibited.
Circular permutant GFP insertion folding reporters
Waldo, Geoffrey S.; Cabantous, Stephanie
2013-04-16
Provided are methods of assaying and improving protein folding using circular permutants of fluorescent proteins, including circular permutants of GFP variants and combinations thereof. The invention further provides various nucleic acid molecules and vectors incorporating such nucleic acid molecules, comprising polynucleotides encoding fluorescent protein circular permutants derived from superfolder GFP, which polynucleotides include an internal cloning site into which a heterologous polynucleotide may be inserted in-frame with the circular permutant coding sequence, and which when expressed are capable of reporting on the degree to which a polypeptide encoded by such an inserted heterologous polynucleotide is correctly folded by correlation with the degree of fluorescence exhibited.
Gwynn, Babette; Lueders, Kira; Sands, Mark S.; Birkenmeier, Edward H.
1998-01-01
The severity of human mucopolysaccharidosis type VII (MPS VII), or Sly syndrome, depends on the relative activity of the enzyme β-glucuronidase. Loss of β-glucuronidase activity can cause hydrops fetalis, with in utero or postnatal death of the patient. In this report, we show that β-glucuronidase activity is not detectable by a standard fluorometric assay in C3H/HeOuJ (C3H) mice homozygous for a new mutation, gusmps2J. These gusmps2J/gusmps2J mice are born and survive much longer than the previously characterized β-glucuronidase-null B6.C-H-2bm1/ByBir-gusmps (gusmps/gusmps) mice. Northern blot analysis of liver from gusmps2J/gusmps2J mice demonstrates a 750-bp reduction in size of β-glucuronidase mRNA. A 5.4-kb insertion in the Gus-sh nucleotide sequence from these mice was localized by Southern blot analysis to intron 8. The ends of the inserted sequences were cloned by inverse PCR and revealed an intracisternal A-particle (IAP) element inserted near the 3′ end of the intron. The sequence of the long terminal repeat (LTR) regions of the IAP most closely matches that of a composite LTR found in transposed IAPs previously identified in the C3H strain. The inserted IAP may contribute to diminished β-glucuronidase activity either by interfering with transcription or by destabilizing the message. The resulting phenotype is much less severe than that previously described in the gusmps/gusmps mouse and provides an opportunity to study MPS VII on a genetic background that clearly modulates disease severity. PMID:9774663
Beam diagnostics in the CIRFEL
DOE Office of Scientific and Technical Information (OSTI.GOV)
Krishnaswamy, J.; Lehrman, I.S.; Hartley, R.
1995-12-31
The CIRFEL system has been operating with electron energies in the range of 11 to 12 MeV and RF pulse length of 3 to 4 {mu}secs. The electrons produced by a Magnesium photocathode illuminated by a 261nm mode locked laser are accelerated in the RF gun, and further boosted in energy by a booster section downstream of the RIF gun. The electrons are energy selected in the bending section before insertion into a permanent magnet wiggler. We describe several recent diagnostic measurements carried out on the CIRFEL system: emittance measurements in two different sections of the beam line, energy andmore » energy spread measurements, and jitter characteristics of the photo cathode drive laser as well as the electron beam energy.« less
NASA Technical Reports Server (NTRS)
Soderman, P. T.
1982-01-01
Acoustical performance and pressure drop were measured for two types of splitters designed to attenuate sound propagating in ducts - resonant-cavity baffles and fiberglass-filled baffles. Arrays of four baffles were evaluated in the 7- by 10-foot wind tunnel number 1 at Ames Research Center at flow speeds from 0 to 41 m/sec. The baffles were 2.1 m high, 305 to 406 mm thick, and 3.1 to 4.4 m long. Emphasis was on measurements of silencer insertion loss as affected by variations of such parameters as baffle length, baffle thickness, perforated skin geometry, cavity size and shape, cavity damping, wind speed, and acoustic field directivity. An analytical method for predicting silencer performance is described and compared with measurements. With the addition of cavity damping in the form of 25-mm foam linings, the insertion loss above 250 Hz of the resonant-cavity baffles was improved 2 to 7 db compared with the undamped baffles; the loss became equal to or greater than the insertion loss of comparable size fiberglass baffles at frequencies above 250 Hz. Variations of cavity size and shape showed that a series of cavities with triangular cross-sections (i.e., variable depth) were superior to cavities with rectangular cross sections (i.e., constant depth). In wind, the undamped, resonant-cavity baffles generated loud cavity-resonance tones; the tones could be eliminated by cavity damping.
Namouchi, Amine; Mardassi, Helmi
2006-11-01
Evidence suggests that insertion of the IS6110 element is not without consequence to the biology of Mycobacterium tuberculosis complex strains. Thus, mapping of multiple IS6110 insertion sites in the genome of biomedically relevant clinical isolates would result in a better understanding of the role of this mobile element, particularly with regard to transmission, adaptability and virulence. In the present paper, we describe a versatile strategy, referred to as GL-PCR, that amplifies IS6110-flanking sequences based on the construction of a genomic library. M. tuberculosis chromosomal DNA is fully digested with HincII and then ligated into a plasmid vector between T7 and T3 promoter sequences. The ligation reaction product is transformed into Escherichia coli and selective PCR amplification targeting both 5' and 3' IS6110-flanking sequences are performed on the plasmid library DNA. For this purpose, four separate PCR reactions are performed, each combining an outward primer specific for one IS6110 end with either T7 or T3 primer. Determination of the nucleotide sequence of the PCR products generated from a single ligation reaction allowed mapping of 21 out of the 24 IS6110 copies of two 12 banded M. tuberculosis strains, yielding an overall sensitivity of 87,5%. Furthermore, by simply comparing the migration pattern of GL-PCR-generated products, the strategy proved to be as valuable as IS6110 RFLP for molecular typing of M. tuberculosis complex strains. Importantly, GL-PCR was able to discriminate between strains differing by a single IS6110 band.
Lee, Hae-Lim; Jansen, Robert K; Chumley, Timothy W; Kim, Ki-Joong
2007-05-01
The chloroplast (cp) DNA sequence of Jasminum nudiflorum (Oleaceae-Jasmineae) is completed and compared with the large single-copy region sequences from 6 related species. The cp genomes of the tribe Jasmineae (Jasminum and Menodora) show several distinctive rearrangements, including inversions, gene duplications, insertions, inverted repeat expansions, and gene and intron losses. The ycf4-psaI region in Jasminum section Primulina was relocated as a result of 2 overlapping inversions of 21,169 and 18,414 bp. The 1st, larger inversion is shared by all members of the Jasmineae indicating that it occurred in the common ancestor of the tribe. Similar rearrangements were also identified in the cp genome of Menodora. In this case, 2 fragments including ycf4 and rps4-trnS-ycf3 genes were moved by 2 additional inversions of 14 and 59 kb that are unique to Menodora. Other rearrangements in the Oleaceae are confined to certain regions of the Jasminum and Menodora cp genomes, including the presence of highly repeated sequences and duplications of coding and noncoding sequences that are inserted into clpP and between rbcL and psaI. These insertions are correlated with the loss of 2 introns in clpP and a serial loss of segments of accD. The loss of the accD gene and clpP introns in both the monocot family Poaceae and the eudicot family Oleaceae are clearly independent evolutionary events. However, their genome organization is surprisingly similar despite the distant relationship of these 2 angiosperm families.
GASP: Gapped Ancestral Sequence Prediction for proteins
Edwards, Richard J; Shields, Denis C
2004-01-01
Background The prediction of ancestral protein sequences from multiple sequence alignments is useful for many bioinformatics analyses. Predicting ancestral sequences is not a simple procedure and relies on accurate alignments and phylogenies. Several algorithms exist based on Maximum Parsimony or Maximum Likelihood methods but many current implementations are unable to process residues with gaps, which may represent insertion/deletion (indel) events or sequence fragments. Results Here we present a new algorithm, GASP (Gapped Ancestral Sequence Prediction), for predicting ancestral sequences from phylogenetic trees and the corresponding multiple sequence alignments. Alignments may be of any size and contain gaps. GASP first assigns the positions of gaps in the phylogeny before using a likelihood-based approach centred on amino acid substitution matrices to assign ancestral amino acids. Important outgroup information is used by first working down from the tips of the tree to the root, using descendant data only to assign probabilities, and then working back up from the root to the tips using descendant and outgroup data to make predictions. GASP was tested on a number of simulated datasets based on real phylogenies. Prediction accuracy for ungapped data was similar to three alternative algorithms tested, with GASP performing better in some cases and worse in others. Adding simple insertions and deletions to the simulated data did not have a detrimental effect on GASP accuracy. Conclusions GASP (Gapped Ancestral Sequence Prediction) will predict ancestral sequences from multiple protein alignments of any size. Although not as accurate in all cases as some of the more sophisticated maximum likelihood approaches, it can process a wide range of input phylogenies and will predict ancestral sequences for gapped and ungapped residues alike. PMID:15350199
Windsor, Aaron J.; Schranz, M. Eric; Formanová, Nataša; Gebauer-Jung, Steffi; Bishop, John G.; Schnabelrauch, Domenica; Kroymann, Juergen; Mitchell-Olds, Thomas
2006-01-01
Comparative genomics provides insight into the evolutionary dynamics that shape discrete sequences as well as whole genomes. To advance comparative genomics within the Brassicaceae, we have end sequenced 23,136 medium-sized insert clones from Boechera stricta, a wild relative of Arabidopsis (Arabidopsis thaliana). A significant proportion of these sequences, 18,797, are nonredundant and display highly significant similarity (BLASTn e-value ≤ 10−30) to low copy number Arabidopsis genomic regions, including more than 9,000 annotated coding sequences. We have used this dataset to identify orthologous gene pairs in the two species and to perform a global comparison of DNA regions 5′ to annotated coding regions. On average, the 500 nucleotides upstream to coding sequences display 71.4% identity between the two species. In a similar analysis, 61.4% identity was observed between 5′ noncoding sequences of Brassica oleracea and Arabidopsis, indicating that regulatory regions are not as diverged among these lineages as previously anticipated. By mapping the B. stricta end sequences onto the Arabidopsis genome, we have identified nearly 2,000 conserved blocks of microsynteny (bracketing 26% of the Arabidopsis genome). A comparison of fully sequenced B. stricta inserts to their homologous Arabidopsis genomic regions indicates that indel polymorphisms >5 kb contribute substantially to the genome size difference observed between the two species. Further, we demonstrate that microsynteny inferred from end-sequence data can be applied to the rapid identification and cloning of genomic regions of interest from nonmodel species. These results suggest that among diploid relatives of Arabidopsis, small- to medium-scale shotgun sequencing approaches can provide rapid and cost-effective benefits to evolutionary and/or functional comparative genomic frameworks. PMID:16607030
Klarhöfer, Markus; Dilharreguy, Bixente; van Gelderen, Peter; Moonen, Chrit T W
2003-10-01
A 3D sequence for dynamic susceptibility imaging is proposed which combines echo-shifting principles (such as PRESTO), sensitivity encoding (SENSE), and partial-Fourier acquisition. The method uses a moderate SENSE factor of 2 and takes advantage of an alternating partial k-space acquisition in the "slow" phase encode direction allowing an iterative reconstruction using high-resolution phase estimates. Offering an isotropic spatial resolution of 4 x 4 x 4 mm(3), the novel sequence covers the whole brain including parts of the cerebellum in 0.5 sec. Its temporal signal stability is comparable to that of a full-Fourier, full-FOV EPI sequence having the same dynamic scan time but much less brain coverage. Initial functional MRI experiments showed consistent activation in the motor cortex with an average signal change slightly less than that of EPI. Copyright 2003 Wiley-Liss, Inc.
Child Development and Structural Variation in the Human Genome
ERIC Educational Resources Information Center
Zhang, Ying; Haraksingh, Rajini; Grubert, Fabian; Abyzov, Alexej; Gerstein, Mark; Weissman, Sherman; Urban, Alexander E.
2013-01-01
Structural variation of the human genome sequence is the insertion, deletion, or rearrangement of stretches of DNA sequence sized from around 1,000 to millions of base pairs. Over the past few years, structural variation has been shown to be far more common in human genomes than previously thought. Very little is currently known about the effects…
USDA-ARS?s Scientific Manuscript database
Copy number variations (CNVs) are large insertions, deletions or duplications in the genome that vary between members of a species and are known to affect a wide variety of phenotypic traits. In this study, we identified CNVs in a population of bulls using low coverage next-generation sequence data....
Mateos, L M; Schäfer, A; Kalinowski, J; Martin, J F; Pühler, A
1996-10-01
Conjugative transfer of mobilizable derivatives of the Escherichia coli narrow-host-range plasmids pBR322, pBR325, pACYC177, and pACYC184 from E. coli to species of the gram-positive genera Corynebacterium and Brevibacterium resulted in the integration of the plasmids into the genomes of the recipient bacteria. Transconjugants appeared at low frequencies and reproducibly with a delay of 2 to 3 days compared with matings with replicative vectors. Southern analysis of corynebacterial transconjugants and nucleotide sequences from insertion sites revealed that integration occurs at different locations and that different parts of the vector are involved in the process. Integration is not dependent on indigenous insertion sequence elements but results from recombination between very short homologous DNA segments (8 to 12 bp) present in the vector and in the host DNA. In the majority of the cases (90%), integration led to cointegrate formation, and in some cases, deletions or rearrangements occurred during the recombination event. Insertions were found to be quite stable even in the absence of selective pressure.
Mateos, L M; Schäfer, A; Kalinowski, J; Martin, J F; Pühler, A
1996-01-01
Conjugative transfer of mobilizable derivatives of the Escherichia coli narrow-host-range plasmids pBR322, pBR325, pACYC177, and pACYC184 from E. coli to species of the gram-positive genera Corynebacterium and Brevibacterium resulted in the integration of the plasmids into the genomes of the recipient bacteria. Transconjugants appeared at low frequencies and reproducibly with a delay of 2 to 3 days compared with matings with replicative vectors. Southern analysis of corynebacterial transconjugants and nucleotide sequences from insertion sites revealed that integration occurs at different locations and that different parts of the vector are involved in the process. Integration is not dependent on indigenous insertion sequence elements but results from recombination between very short homologous DNA segments (8 to 12 bp) present in the vector and in the host DNA. In the majority of the cases (90%), integration led to cointegrate formation, and in some cases, deletions or rearrangements occurred during the recombination event. Insertions were found to be quite stable even in the absence of selective pressure. PMID:8824624
Chi, Sylvia Ighem; Urbarova, Ilona; Johansen, Steinar D
2018-04-30
The mitochondrial genomes of sea anemones are dynamic in structure. Invasion by genetic elements, such as self-catalytic group I introns or insertion-like sequences, contribute to sea anemone mitochondrial genome expansion and complexity. By using next generation sequencing we investigated the complete mtDNAs and corresponding transcriptomes of the temperate sea anemone Anemonia viridis and its closer tropical relative Anemonia majano. Two versions of fused homing endonuclease gene (HEG) organization were observed among the Actiniidae sea anemones; in-frame gene fusion and pseudo-gene fusion. We provided support for the pseudo-gene fusion organization in Anemonia species, resulting in a repressed HEG from the COI-884 group I intron. orfA, a putative protein-coding gene with insertion-like features, was present in both Anemonia species. Interestingly, orfA and COI expression were significantly up-regulated upon long-term environmental stress corresponding to low seawater pH conditions. This study provides new insights to the dynamics of sea anemone mitochondrial genome structure and function. Copyright © 2018 Elsevier B.V. All rights reserved.
Identification of atypical ATRNL1 insertion to EML4-ALK fusion gene in NSCLC.
Robesova, Blanka; Bajerova, Monika; Hausnerova, Jitka; Skrickova, Jana; Tomiskova, Marcela; Dvorakova, Dana
2015-03-01
We herein present a rare case of an EML4-ALK positive patient. A 61-year-old man was diagnosed with locoregional non-small cell lung cancer (NSCLC). No EGFR mutations were detected, and therefore the ALK rearrangement was evaluated using immunohistochemistry (IHC), fluorescence in situ hybridization (FISH) and the reverse transcription PCR (RT-PCR) method for EML4-ALK. All methods showed a positive result and, therefore, the patient was treated with crizotinib with a good therapeutic response. However, a detailed RT-PCR analysis and sequencing revealed an unexpected 138 bp insertion of attractin-like 1 (ATRNL1) gene into the EML4-ALK fusion gene. In our case, the positive therapeutic response suggests that ATRNL1 insertion does not affect EML4-ALK's sensitivity to crizotinib. This case shows great EML4-ALK heterogeneity and also that basic detection methods (IHC, FISH) cannot fully specify ALK rearrangement but in many cases a full specification seems to be important for an effective TKI indication, and sequencing ALK variants might contribute to optimized patient selection. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.
The development of a cisgenic apple plant.
Vanblaere, Thalia; Szankowski, Iris; Schaart, Jan; Schouten, Henk; Flachowsky, Henryk; Broggini, Giovanni A L; Gessler, Cesare
2011-07-20
Cisgenesis represents a step toward a new generation of GM crops. The lack of selectable genes (e.g. antibiotic or herbicide resistance) in the final product and the fact that the inserted gene(s) derive from organisms sexually compatible with the target crop should rise less environmental concerns and increase consumer's acceptance. Here we report the generation of a cisgenic apple plant by inserting the endogenous apple scab resistance gene HcrVf2 under the control of its own regulatory sequences into the scab susceptible apple cultivar Gala. A previously developed method based on Agrobacterium-mediated transformation combined with a positive and negative selection system and a chemically inducible recombination machinery allowed the generation of apple cv. Gala carrying the scab resistance gene HcrVf2 under its native regulatory sequences and no foreign genes. Three cisgenic lines were chosen for detailed investigation and were shown to carry a single T-DNA insertion and express the target gene HcrVf2. This is the first report of the generation of a true cisgenic plant. Copyright © 2011 Elsevier B.V. All rights reserved.
Thermal stability of G-rich anti-parallel DNA triplexes upon insertion of LNA and α-L-LNA.
Kosbar, Tamer R; Sofan, Mamdouh A; Abou-Zeid, Laila; Pedersen, Erik B
2015-05-14
G-rich anti-parallel DNA triplexes were modified with LNA or α-L-LNA in their Watson-Crick and TFO strands. The triplexes were formed by targeting a pyrimidine strand to a putative hairpin formed by Hoogsteen base pairing in order to use the UV melting method to evaluate the stability of the triplexes. Their thermal stability was reduced when the TFO strand was modified with LNA or α-L-LNA. The same trend was observed when the TFO strand and the purine Watson-Crick strand both were modified with LNA. When all triad components were modified with α-L-LNA and LNA in the middle of the triplex, the thermal melting was increased. When the pyrimidine sequence was modified with a single insertion of LNA or α-L-LNA the ΔTm increased. Moreover, increasing the number of α-L-LNA in the pyrimidine target sequence to six insertions, leads to a high increase in the thermal stability. The conformational S-type structure of α-L-LNA in anti-parallel triplexes is preferable for triplex stability.
Efficient transposition of the Tnt1 tobacco retrotransposon in the model legume Medicago truncatula.
d'Erfurth, Isabelle; Cosson, Viviane; Eschstruth, Alexis; Lucas, Helene; Kondorosi, Adam; Ratet, P
2003-04-01
The tobacco element, Tnt1, is one of the few active retrotransposons in plants. Its transposition is activated during protoplast culture in tobacco and tissue culture in the heterologous host Arabidopsis thaliana. Here, we report its transposition in the R108 line of Medicago truncatula during the early steps of the in vitro transformation-regeneration process. Two hundred and twenty-five primary transformants containing Tnt1 were obtained. Among them, 11.2% contained only transposed copies of the element, indicating that Tnt1 transposed very early and efficiently during the in vitro transformation process, possibly even before the T-DNA integration. The average number of insertions per transgenic line was estimated to be about 15. These insertions were stable in the progeny and could be separated by segregation. Inspection of the sequences flanking the insertion sites revealed that Tnt1 had no insertion site specificity and often inserted in genes (one out of three insertions). Thus, our work demonstrates the functioning of an efficient transposable element in leguminous plants. These results indicate that Tnt1 can be used as a powerful tool for insertion mutagenesis in M. truncatula.
Kuno, Sotaro; Yoshida, Takashi; Kamikawa, Ryoma; Hosoda, Naohiko; Sako, Yoshihiko
2010-01-01
The cyanophage Ma-LMM01, specifically-infecting Microcystis aeruginosa, has an insertion sequence (IS) element that we named IS607-cp showing high nucleotide similarity to a counterpart in the genome of the cyanobacterium Cyanothece sp. We tested 21 strains of M. aeruginosa for the presence of IS607-cp using PCR and detected the element in strains NIES90, NIES112, NIES604, and RM6. Thermal asymmetric interlaced PCR (TAIL-PCR) revealed each of these strains has multiple copies of IS607-cp. Some of the ISs were classified into three types based on their inserted positions; IS607-cp-1 is common in strains NIES90, NIES112 and NIES604, whereas IS607-cp-2 and IS607-cp-3 are specific to strains NIES90 and RM6, respectively. This multiplicity may reflect the replicative transposition of IS607-cp. The sequence of IS607-cp in Ma-LMM01 showed robust affinity to those found in M. aeruginosa and Cyanothece spp. in a phylogenetic tree inferred from counterparts of various bacteria. This suggests the transfer of IS607-cp between the cyanobacterium and its cyanophage. We discuss the potential role of Ma-LMM01-related phages as donors of IS elements that may mediate the transfer of IS607-cp; and thereby partially contribute to the genome plasticity of M. aeruginosa.
Ahmad, Muhammad Khairi; Tabana, Yasser M; Ahmed, Mowaffaq Adam; Sandai, Doblin Anak; Mohamed, Rafeezul; Ismail, Ida Shazrina; Zulkiflie, Nurulisa; Yunus, Muhammad Amir
2017-01-01
Background A norovirus maintains its viability, infectivity and virulence by its ability to replicate. However, the biological mechanisms of the process remain to be explored. In this work, the NanoLuc™ Luciferase gene was used to develop a reporter-tagged replicon system to study norovirus replication. Methods The NanoLuc™ Luciferase reporter protein was engineered to be expressed as a fusion protein for MNV-1 minor capsid protein, VP2. The foot-and-mouth disease virus 2A (FMDV2A) sequence was inserted between the 3′end of the reporter gene and the VP2 start sequence to allow co-translational ‘cleavage’ of fusion proteins during intracellular transcript expression. Amplification of the fusion gene was performed using a series of standard and overlapping polymerase chain reactions. The resulting amplicon was then cloned into three readily available backbones of MNV-1 cDNA clones. Results Restriction enzyme analysis indicated that the NanoLucTM Luciferase gene was successfully inserted into the parental MNV-1 cDNA clone. The insertion was further confirmed by using DNA sequencing. Conclusion NanoLuc™ Luciferase-tagged MNV-1 cDNA clones were successfully engineered. Such clones can be exploited to develop robust experimental assays for in vitro assessments of viral RNA replication. PMID:29379384
Multi-asteroid comet missions using solar electric propulsion.
NASA Technical Reports Server (NTRS)
Bender, D. F.; Bourke, R. D.
1972-01-01
Multitarget flyby missions to asteroids and comets are attractive candidates for solar electric propulsion (SEP) application because SEP can efficiently provide the thrust required for carefully chosen sequences of encounters. In this paper, techniques for finding encounter sequences for these missions are described, and examples involving flyby and rendezvous missions to P/Encke, P/Kopff and 20/Massalia are presented. In addition, examples of four asteroid flyby sequences are given. Encounters typically have flyby speeds on the order of 5-10 km/sec and are limited only by navigational capability as regards flyby distance, which is taken as zero in the study. Flights traversing the asteroid belt can be modified by SEP to pass one or more asteroids, and the performance penalty is small if the encounters are properly spaced.
Copy number determination of genetically-modified hematopoietic stem cells.
Schuesler, Todd; Reeves, Lilith; Kalle, Christof von; Grassman, Elke
2009-01-01
Human gene transfer with gammaretroviral, murine leukemia virus (MLV) based vectors has been shown to effectively insert and express transgene sequences at a level of therapeutic benefit. However, there are numerous reports of disruption of the normal cellular processes caused by the viral insertion, even of replication deficient gammaretroviral vectors. Current gammaretroviral and lentiviral vectors do not control the site of insertion into the genome, hence, the possibility of disruption of the target cell genome. Risk related to viral insertions is linked to the number of insertions of the transgene into the cellular DNA, as has been demonstrated for replication competent and replication deficient retroviruses in experiments. At high number of insertions per cell, cell transformation due to vector induced activation of proto-oncogenes is more likely to occur, in particular since more than one transforming event is needed for oncogenesis. Thus, determination of the vector copy number in bulk transduced populations, individual colony forming units, and tissue from the recipient of the transduced cells is an increasingly important safety assay and has become a standard, though not straightforward assay, since the inception of quantitative PCR.
Ribosomes slide on lysine-encoding homopolymeric A stretches
Koutmou, Kristin S; Schuller, Anthony P; Brunelle, Julie L; Radhakrishnan, Aditya; Djuranovic, Sergej; Green, Rachel
2015-01-01
Protein output from synonymous codons is thought to be equivalent if appropriate tRNAs are sufficiently abundant. Here we show that mRNAs encoding iterated lysine codons, AAA or AAG, differentially impact protein synthesis: insertion of iterated AAA codons into an ORF diminishes protein expression more than insertion of synonymous AAG codons. Kinetic studies in E. coli reveal that differential protein production results from pausing on consecutive AAA-lysines followed by ribosome sliding on homopolymeric A sequence. Translation in a cell-free expression system demonstrates that diminished output from AAA-codon-containing reporters results from premature translation termination on out of frame stop codons following ribosome sliding. In eukaryotes, these premature termination events target the mRNAs for Nonsense-Mediated-Decay (NMD). The finding that ribosomes slide on homopolymeric A sequences explains bioinformatic analyses indicating that consecutive AAA codons are under-represented in gene-coding sequences. Ribosome ‘sliding’ represents an unexpected type of ribosome movement possible during translation. DOI: http://dx.doi.org/10.7554/eLife.05534.001 PMID:25695637
Retroviral DNA Integration Directed by HIV Integration Protein in Vitro
NASA Astrophysics Data System (ADS)
Bushman, Frederic D.; Fujiwara, Tamio; Craigie, Robert
1990-09-01
Efficient retroviral growth requires integration of a DNA copy of the viral RNA genome into a chromosome of the host. As a first step in analyzing the mechanism of integration of human immunodeficiency virus (HIV) DNA, a cell-free system was established that models the integration reaction. The in vitro system depends on the HIV integration (IN) protein, which was partially purified from insect cells engineered to express IN protein in large quantities. Integration was detected in a biological assay that scores the insertion of a linear DNA containing HIV terminal sequences into a λ DNA target. Some integration products generated in this assay contained five-base pair duplications of the target DNA at the recombination junctions, a characteristic of HIV integration in vivo; the remaining products contained aberrant junctional sequences that may have been produced in a variation of the normal reaction. These results indicate that HIV IN protein is the only viral protein required to insert model HIV DNA sequences into a target DNA in vitro.
Swanson, Stephanie; Ioerger, Thomas R.; Rigel, Nathan W.; Miller, Brittany K.; Braunstein, Miriam
2015-01-01
ABSTRACT While SecA is the ATPase component of the major bacterial secretory (Sec) system, mycobacteria and some Gram-positive pathogens have a second paralog, SecA2. In bacteria with two SecA paralogs, each SecA is functionally distinct, and they cannot compensate for one another. Compared to SecA1, SecA2 exports a distinct and smaller set of substrates, some of which have roles in virulence. In the mycobacterial system, some SecA2-dependent substrates lack a signal peptide, while others contain a signal peptide but possess features in the mature protein that necessitate a role for SecA2 in their export. It is unclear how SecA2 functions in protein export, and one open question is whether SecA2 works with the canonical SecYEG channel to export proteins. In this study, we report the structure of Mycobacterium tuberculosis SecA2 (MtbSecA2), which is the first structure of any SecA2 protein. A high level of structural similarity is observed between SecA2 and SecA1. The major structural difference is the absence of the helical wing domain, which is likely to play a role in how MtbSecA2 recognizes its unique substrates. Importantly, structural features critical to the interaction between SecA1 and SecYEG are preserved in SecA2. Furthermore, suppressor mutations of a dominant-negative secA2 mutant map to the surface of SecA2 and help identify functional regions of SecA2 that may promote interactions with SecYEG or the translocating polypeptide substrate. These results support a model in which the mycobacterial SecA2 works with SecYEG. IMPORTANCE SecA2 is a paralog of SecA1, which is the ATPase of the canonical bacterial Sec secretion system. SecA2 has a nonredundant function with SecA1, and SecA2 exports a distinct and smaller set of substrates than SecA1. This work reports the crystal structure of SecA2 of Mycobacterium tuberculosis (the first SecA2 structure reported for any organism). Many of the structural features of SecA1 are conserved in the SecA2 structure, including putative contacts with the SecYEG channel. Several structural differences are also identified that could relate to the unique function and selectivity of SecA2. Suppressor mutations of a secA2 mutant map to the surface of SecA2 and help identify functional regions of SecA2 that may promote interactions with SecYEG. PMID:26668263
Bacterio-opsin mutants of Halobacterium halobium
Betlach, Mary; Pfeifer, Felicitas; Friedman, James; Boyer, Herbert W.
1983-01-01
The bacterio-opsin (bop) gene of Halobacterium halobium R1 has been cloned with about 40 kilobases of flanking genomic sequence. The 40-kilobase segment is derived from the (G+C)-rich fraction of the chromosome and is not homologous to the major (pHH1) or minor endogenous covalently closed circular DNA species of H. halobium. A 5.1-kilobase Pst I fragment containing the bop gene was subcloned in pBR322 and a partial restriction map was determined. Defined restriction fragments of this clone were used as probes to analyze the defects associated with the bop gene in 12 bacterio-opsin mutants. Eleven out of 12 of the mutants examined had inserts ranging from 350 to 3,000 base pairs either in the bop gene or up to 1,400 base pairs upstream. The positions of the inserts were localized to four regions in the 5.1-kilobase genomic fragment: within the gene (one mutant), in a region that overlaps the 5′ end of the gene (seven mutants), and in two different upstream regions (three mutants). Two revertants of the mutant with the most distal insert had an additional insert in the same region. The polar effects of these inserts are discussed in terms of inactivation of a regulatory gene or disruption of part of a coordinately expressed operon. Given the defined nature of the bop mRNA—i.e., it has a 5′ leader sequence of three ribonucleotides—these observations indicate that the bop mRNA might be processed from a large mRNA transcript. Images PMID:16593291
Lineages of Streptococcus equi ssp. equi in the Irish equine industry.
Moloney, Emma; Kavanagh, Kerrie S; Buckley, Tom C; Cooney, Jakki C
2013-01-01
Streptococcus equi ssp. equi is the causative agent of 'Strangles' in horses. This is a debilitating condition leading to economic loss, yard closures and cancellation of equestrian events. There are multiple genotypes of S. equi ssp. equi which can cause disease, but to date there has been no systematic study of strains which are prevalent in Ireland. This study identified and classified Streptococcus equi ssp. equi strains isolated from within the Irish equine industry. Two hundred veterinary isolates were subjected to SLST (single locus sequence typing) based on an internal sequence from the seM gene of Streptococcus equi ssp equi. Of the 171 samples which successfully gave an amplicon, 162 samples (137 Irish and 24 UK strains) gave robust DNA sequence information. Analysis of the sequences allowed division of the isolates into 19 groups, 13 of which contain at least 2 isolates and 6 groups containing single isolates. There were 19 positions where a DNA SNP (single nucleotide polymorphism) occurs, and one 3 bp insertion. All groups had multiple (2-8) SNPs. Of the SNPs 17 would result in an amino acid change in the encoded protein. Interestingly, the single isolate EI8, which has 6 SNPs, has the three base pair insertion which is not seen in any other isolate, this would result in the insertion of an Ile residue at position 62 in that protein sequence. Comparison of the relevant region in the determined sequences with the UK Streptococcus equi seM MLST database showed that Group B (15 isolates) and Group I (2 isolates), as well as the individual isolates EI3 and EI8, are unique to Ireland, and some groups are most likely of UK origin (Groups F and M), but many more probably passed back and forth between the two countries. The strains occurring in Ireland are not clonal and there is a considerable degree of sequence variation seen in the seM gene. There are two major clades causing infection in Ireland and these strains are also common in the UK.
Lineages of Streptococcus equi ssp. equi in the Irish equine industry
2013-01-01
Background Streptococcus equi ssp. equi is the causative agent of ‘Strangles’ in horses. This is a debilitating condition leading to economic loss, yard closures and cancellation of equestrian events. There are multiple genotypes of S. equi ssp. equi which can cause disease, but to date there has been no systematic study of strains which are prevalent in Ireland. This study identified and classified Streptococcus equi ssp. equi strains isolated from within the Irish equine industry. Results Two hundred veterinary isolates were subjected to SLST (single locus sequence typing) based on an internal sequence from the seM gene of Streptococcus equi ssp equi. Of the 171 samples which successfully gave an amplicon, 162 samples (137 Irish and 24 UK strains) gave robust DNA sequence information. Analysis of the sequences allowed division of the isolates into 19 groups, 13 of which contain at least 2 isolates and 6 groups containing single isolates. There were 19 positions where a DNA SNP (single nucleotide polymorphism) occurs, and one 3 bp insertion. All groups had multiple (2–8) SNPs. Of the SNPs 17 would result in an amino acid change in the encoded protein. Interestingly, the single isolate EI8, which has 6 SNPs, has the three base pair insertion which is not seen in any other isolate, this would result in the insertion of an Ile residue at position 62 in that protein sequence. Comparison of the relevant region in the determined sequences with the UK Streptococcus equi seM MLST database showed that Group B (15 isolates) and Group I (2 isolates), as well as the individual isolates EI3 and EI8, are unique to Ireland, and some groups are most likely of UK origin (Groups F and M), but many more probably passed back and forth between the two countries. Conclusions The strains occurring in Ireland are not clonal and there is a considerable degree of sequence variation seen in the seM gene. There are two major clades causing infection in Ireland and these strains are also common in the UK. PMID:23731628
Doublet, Benoît; Praud, Karine; Bertrand, Sophie; Collard, Jean-Marc; Weill, François-Xavier; Cloeckaert, Axel
2008-10-01
Salmonella genomic island 1 (SGI1) is an integrative mobilizable element that harbors a multidrug resistance (MDR) gene cluster. Since its identification in epidemic Salmonella enterica serovar Typhimurium DT104 strains, variant SGI1 MDR gene clusters conferring different MDR phenotypes have been identified in several S. enterica serovars and classified as SGI1-A to -O. A study was undertaken to characterize SGI1 from serovar Kentucky strains isolated from travelers returning from Africa. Several strains tested were found to contain the partially characterized variant SGI1-K, recently described in a serovar Kentucky strain isolated in Australia. This variant contained only one cassette array, aac(3)-Id-aadA7, and an adjacent mercury resistance module. Here, the uncharacterized part of SGI1-K was sequenced. Downstream of the mer module similar to that found in Tn21, a mosaic genetic structure was found, comprising (i) part of Tn1721 containing the tetracycline resistance genes tetR and tet(A); (ii) part of Tn5393 containing the streptomycin resistance genes strAB, IS1133, and a truncated tnpR gene; and (iii) a Tn3-like region containing the tnpR gene and the beta-lactamase bla(TEM-1) gene flanked by two IS26 elements in opposite orientations. The rightmost IS26 element was shown to be inserted into the S044 open reading frame of the SGI1 backbone. This variant MDR region was named SGI1-K1 according to the previously described variant SGI1-K. Other SGI1-K MDR regions due to different IS26 locations, inversion, and partial deletions were characterized and named SGI1-K2 to -K5. Two new SGI1 variants named SGI1-P1 and -P2 contained only the Tn3-like region comprising the beta-lactamase bla(TEM-1) gene flanked by the two IS26 elements inserted into the SGI1 backbone. Three other new variants harbored only one IS26 element inserted in place of the MDR region of SGI1 and were named SGI1-Q1 to -Q3. Thus, in serovar Kentucky, the SGI1 MDR region undergoes recombinational and insertional events of transposon and insertion sequences, resulting in a higher diversity of MDR gene clusters than previously reported and consequently a higher diversity of MDR phenotypes.
Masking as an effective quality control method for next-generation sequencing data analysis.
Yun, Sajung; Yun, Sijung
2014-12-13
Next generation sequencing produces base calls with low quality scores that can affect the accuracy of identifying simple nucleotide variation calls, including single nucleotide polymorphisms and small insertions and deletions. Here we compare the effectiveness of two data preprocessing methods, masking and trimming, and the accuracy of simple nucleotide variation calls on whole-genome sequence data from Caenorhabditis elegans. Masking substitutes low quality base calls with 'N's (undetermined bases), whereas trimming removes low quality bases that results in a shorter read lengths. We demonstrate that masking is more effective than trimming in reducing the false-positive rate in single nucleotide polymorphism (SNP) calling. However, both of the preprocessing methods did not affect the false-negative rate in SNP calling with statistical significance compared to the data analysis without preprocessing. False-positive rate and false-negative rate for small insertions and deletions did not show differences between masking and trimming. We recommend masking over trimming as a more effective preprocessing method for next generation sequencing data analysis since masking reduces the false-positive rate in SNP calling without sacrificing the false-negative rate although trimming is more commonly used currently in the field. The perl script for masking is available at http://code.google.com/p/subn/. The sequencing data used in the study were deposited in the Sequence Read Archive (SRX450968 and SRX451773).
Potential Links between Hepadnavirus and Bornavirus Sequences in the Host Genome and Cancer.
Honda, Tomoyuki
2017-01-01
Various viruses leave their sequences in the host genomes during infection. Such events occur mainly in retrovirus infection but also sometimes in DNA and non-retroviral RNA virus infections. If viral sequences are integrated into the genomes of germ line cells, the sequences can become inherited as endogenous viral elements (EVEs). The integration events of viral sequences may have oncogenic potential. Because proviral integrations of some retroviruses and/or reactivation of endogenous retroviruses are closely linked to cancers, viral insertions related to non-retroviral viruses also possibly contribute to cancer development. This article focuses on genomic viral sequences derived from two non-retroviral viruses, whose endogenization is already reported, and discusses their possible contributions to cancer. Viral insertions of hepatitis B virus play roles in the development of hepatocellular carcinoma. Endogenous bornavirus-like elements, the only non-retroviral RNA virus-related EVEs found in the human genome, may also be involved in cancer formation. In addition, the possible contribution of the interactions between viruses and retrotransposons, which seem to be a major driving force for generating EVEs related to non-retroviral RNA viruses, to cancers will be discussed. Future studies regarding the possible links described here may open a new avenue for the development of novel therapeutics for tumor virus-related cancers and/or provide novel insights into EVE functions.
Howard, Thomas P; Hayward, Andrew P; Tordillos, Anthony; Fragoso, Christopher; Moreno, Maria A; Tohme, Joe; Kausch, Albert P; Mottinger, John P; Dellaporta, Stephen L
2014-01-01
Since their initial discovery, transposons have been widely used as mutagens for forward and reverse genetic screens in a range of organisms. The problems of high copy number and sequence divergence among related transposons have often limited the efficiency at which tagged genes can be identified. A method was developed to identity the locations of Mutator (Mu) transposons in the Zea mays genome using a simple enrichment method combined with genome resequencing to identify transposon junction fragments. The sequencing library was prepared from genomic DNA by digesting with a restriction enzyme that cuts within a perfectly conserved motif of the Mu terminal inverted repeats (TIR). Paired-end reads containing Mu TIR sequences were computationally identified and chromosomal sequences flanking the transposon were mapped to the maize reference genome. This method has been used to identify Mu insertions in a number of alleles and to isolate the previously unidentified lazy plant1 (la1) gene. The la1 gene is required for the negatively gravitropic response of shoots and mutant plants lack the ability to sense gravity. Using bioinformatic and fluorescence microscopy approaches, we show that the la1 gene encodes a cell membrane and nuclear localized protein. Our Mu-Taq method is readily adaptable to identify the genomic locations of any insertion of a known sequence in any organism using any sequencing platform.
Howard, Thomas P.; Hayward, Andrew P.; Tordillos, Anthony; Fragoso, Christopher; Moreno, Maria A.; Tohme, Joe; Kausch, Albert P.; Mottinger, John P.; Dellaporta, Stephen L.
2014-01-01
Since their initial discovery, transposons have been widely used as mutagens for forward and reverse genetic screens in a range of organisms. The problems of high copy number and sequence divergence among related transposons have often limited the efficiency at which tagged genes can be identified. A method was developed to identity the locations of Mutator (Mu) transposons in the Zea mays genome using a simple enrichment method combined with genome resequencing to identify transposon junction fragments. The sequencing library was prepared from genomic DNA by digesting with a restriction enzyme that cuts within a perfectly conserved motif of the Mu terminal inverted repeats (TIR). Paired-end reads containing Mu TIR sequences were computationally identified and chromosomal sequences flanking the transposon were mapped to the maize reference genome. This method has been used to identify Mu insertions in a number of alleles and to isolate the previously unidentified lazy plant1 (la1) gene. The la1 gene is required for the negatively gravitropic response of shoots and mutant plants lack the ability to sense gravity. Using bioinformatic and fluorescence microscopy approaches, we show that the la1 gene encodes a cell membrane and nuclear localized protein. Our Mu-Taq method is readily adaptable to identify the genomic locations of any insertion of a known sequence in any organism using any sequencing platform. PMID:24498020