Selective sweep at the Drosophila melanogaster Suppressor of Hairless locus and its association with the In(2L)t inversion polymorphism.

PubMed Central

Depaulis, F; Brazier, L; Veuille, M

1999-01-01

The hitchhiking model of population genetics predicts that an allele favored by Darwinian selection can replace haplotypes from the same locus previously established at a neutral mutation-drift equilibrium. This process, known as "selective sweep," was studied by comparing molecular variation between the polymorphic In(2L)t inversion and the standard chromosome. Sequence variation was recorded at the Suppressor of Hairless (Su[H]) gene in an African population of Drosophila melanogaster. We found 47 nucleotide polymorphisms among 20 sequences of 1.2 kb. Neutrality tests were nonsignificant at the nucleotide level. However, these sites were strongly associated, because 290 out of 741 observed pairwise combinations between them were in significant linkage disequilibrium. We found only seven haplotypes, two occurring in the 9 In(2L)t chromosomes, and five in the 11 standard chromosomes, with no shared haplotype. Two haplotypes, one in each chromosome arrangement, made up two-thirds of the sample. This low haplotype diversity departed from neutrality in a haplotype test. This pattern supports a selective sweep hypothesis for the Su(H) chromosome region. PMID:10388820

Polymorphisms in HLA-DPB1 Are Associated With Differences in Rubella Virus–Specific Humoral Immunity After Vaccination

PubMed Central

Lambert, Nathaniel D.; Haralambieva, Iana H.; Kennedy, Richard B.; Ovsyannikova, Inna G.; Pankratz, Vernon Shane; Poland, Gregory A.

2015-01-01

Vaccination with live attenuated rubella virus induces a strong immune response in most individuals. However, small numbers of subjects never reach or maintain protective antibody levels, and there is a high degree of variability in immune response. We have previously described genetic polymorphisms in HLA and other candidate genes that are associated with interindividual differences in humoral immunity to rubella virus. To expand our previous work, we performed a genome-wide association study (GWAS) to discover single-nucleotide polymorphisms (SNPs) associated with rubella virus–specific neutralizing antibodies. We identified rs2064479 in the HLA-DPB1 genetic region as being significantly associated with humoral immune response variations after rubella vaccination (P = 8.62 × 10−8). All other significant SNPs in this GWAS were located near the HLA-DPB1 gene (P ≤ 1 × 10−7). These findings demonstrate that polymorphisms in HLA-DPB1 are strongly associated with interindividual differences in neutralizing antibody levels to rubella vaccination and represent a validation of our previous HLA work. PMID:25293367

Neutral mutation as the source of genetic variation in life history traits.

PubMed

Brcić-Kostić, Krunoslav

2005-08-01

The mechanism underlying the maintenance of adaptive genetic variation is a long-standing question in evolutionary genetics. There are two concepts (mutation-selection balance and balancing selection) which are based on the phenotypic differences between alleles. Mutation - selection balance and balancing selection cannot properly explain the process of gene substitution, i.e. the molecular evolution of quantitative trait loci affecting fitness. I assume that such loci have non-essential functions (small effects on fitness), and that they have the potential to evolve into new functions and acquire new adaptations. Here I show that a high amount of neutral polymorphism at these loci can exist in real populations. Consistent with this, I propose a hypothesis for the maintenance of genetic variation in life history traits which can be efficient for the fixation of alleles with very small selective advantage. The hypothesis is based on neutral polymorphism at quantitative trait loci and both neutral and adaptive gene substitutions. The model of neutral - adaptive conversion (NAC) assumes that neutral alleles are not neutral indefinitely, and that in specific and very rare situations phenotypic (relative fitness) differences between them can appear. In this paper I focus on NAC due to phenotypic plasticity of neutral alleles. The important evolutionary consequence of NAC could be the increased adaptive potential of a population. Loci responsible for adaptation should be fast evolving genes with minimally discernible phenotypic effects, and the recent discovery of genes with such characteristics implicates them as suitable candidates for loci involved in adaptation.

Differential fitness of allelic isozymes in the marine gastropods Littorina punctata and Littorina neritoides, exposed to the environmental stress of the combined effects of cadmium and mercury pollution

NASA Astrophysics Data System (ADS)

Lavie, Batia; Nevo, Eviatar

1987-07-01

The present study tested the separate and the interactive pollution effects of cadmium and mercury on the electrophoretically detected allelic isozyme frequencies of the enzyme phosphoglucose isomerase for two species of littoral marine gastropods — Littorina punctata and L. neritoides — and the enzyme amino peptidase for L. neritoides. Our results indicate differential survivorship of allelic isozyme genotypes specific for each type of pollutant and for their interaction, as well as trends common to all pollutants. Theoretically the results reflect the adaptive nature of at least some allozymic genotypes in these marine gastropods and seem inconsistent with the neutral theory of allozyme polymorphisms. Practically, the results reinforce earlier conclusions that changes in the frequency of allelic isozymes may be used as a genetic monitor of pollution.

Similar Efficacies of Selection Shape Mitochondrial and Nuclear Genes in Both Drosophila melanogaster and Homo sapiens.

PubMed

Cooper, Brandon S; Burrus, Chad R; Ji, Chao; Hahn, Matthew W; Montooth, Kristi L

2015-08-21

Deleterious mutations contribute to polymorphism even when selection effectively prevents their fixation. The efficacy of selection in removing deleterious mitochondrial mutations from populations depends on the effective population size (Ne) of the mitochondrial DNA and the degree to which a lack of recombination magnifies the effects of linked selection. Using complete mitochondrial genomes from Drosophila melanogaster and nuclear data available from the same samples, we reexamine the hypothesis that nonrecombining animal mitochondrial DNA harbor an excess of deleterious polymorphisms relative to the nuclear genome. We find no evidence of recombination in the mitochondrial genome, and the much-reduced level of mitochondrial synonymous polymorphism relative to nuclear genes is consistent with a reduction in Ne. Nevertheless, we find that the neutrality index, a measure of the excess of nonsynonymous polymorphism relative to the neutral expectation, is only weakly significantly different between mitochondrial and nuclear loci. This difference is likely the result of the larger proportion of beneficial mutations in X-linked relative to autosomal loci, and we find little to no difference between mitochondrial and autosomal neutrality indices. Reanalysis of published data from Homo sapiens reveals a similar lack of a difference between the two genomes, although previous studies have suggested a strong difference in both species. Thus, despite a smaller Ne, mitochondrial loci of both flies and humans appear to experience similar efficacies of purifying selection as do loci in the recombining nuclear genome. Copyright © 2015 Cooper et al.

Contrasting Histories of Three Gene Regions Associated with In(3l)payne of Drosophila Melanogaster

PubMed Central

Hasson, E.; Eanes, W. F.

1996-01-01

In the present report, we studied nucleotide variation in three gene regions of Drosophila melanogaster, spanning >5 kb and showing different degrees of association with the cosmopolitan inversion In(3-L)Payne. The analysis of sequence variation in the regions surrounding the breakpoints and the heat shock 83 (Hsp83) gene locus, located close to the distal breakpoint, revealed the absence of shared polymorphisms and the presence of a number of fixed differences between arrangements, indicating absence of genetic exchange. In contrast, for the esterase-6 gene region, located in the center of the inversion, we observed the presence of shared polymorphisms between arrangements suggesting genetic exchange. In the regions close to the breakpoints, the common St arrangement is 10 times more polymorphic than inverted chromosomes. We propose that the lack of recombination between arrangements in these regions coupled with genetic hitchhiking is the best explanation for the low heterozygosity observed in inverted lines. Using the data for the breakpoints, we estimate that this inversion polymorphism is around 0.36 million yr old. Although it is widely accepted that inversions are examples of balanced polymorphisms, none of the current neutrality tests including our Monte Carlo simulations showed significant departure from neutral expectations. PMID:8978045

Neutral null models for diversity in serial transfer evolution experiments.

PubMed

Harpak, Arbel; Sella, Guy

2014-09-01

Evolution experiments with microorganisms coupled with genome-wide sequencing now allow for the systematic study of population genetic processes under a wide range of conditions. In learning about these processes in natural, sexual populations, neutral models that describe the behavior of diversity and divergence summaries have played a pivotal role. It is therefore natural to ask whether neutral models, suitably modified, could be useful in the context of evolution experiments. Here, we introduce coalescent models for polymorphism and divergence under the most common experimental evolution assay, a serial transfer experiment. This relatively simple setting allows us to address several issues that could affect diversity patterns in evolution experiments, whether selection is operating or not: the transient behavior of neutral polymorphism in an experiment beginning from a single clone, the effects of randomness in the timing of cell division and noisiness in population size in the dilution stage. In our analyses and discussion, we emphasize the implications for experiments aimed at measuring diversity patterns and making inferences about population genetic processes based on these measurements. © 2014 The Author(s). Evolution © 2014 The Society for the Study of Evolution.

Neutral Genomic Microevolution of a Recently Emerged Pathogen, Salmonella enterica Serovar Agona

PubMed Central

Litrup, Eva; Murphy, Ronan; Cormican, Martin; Fanning, Seamus; Brown, Derek; Guttman, David S.; Brisse, Sylvain; Achtman, Mark

2013-01-01

Salmonella enterica serovar Agona has caused multiple food-borne outbreaks of gastroenteritis since it was first isolated in 1952. We analyzed the genomes of 73 isolates from global sources, comparing five distinct outbreaks with sporadic infections as well as food contamination and the environment. Agona consists of three lineages with minimal mutational diversity: only 846 single nucleotide polymorphisms (SNPs) have accumulated in the non-repetitive, core genome since Agona evolved in 1932 and subsequently underwent a major population expansion in the 1960s. Homologous recombination with other serovars of S. enterica imported 42 recombinational tracts (360 kb) in 5/143 nodes within the genealogy, which resulted in 3,164 additional SNPs. In contrast to this paucity of genetic diversity, Agona is highly diverse according to pulsed-field gel electrophoresis (PFGE), which is used to assign isolates to outbreaks. PFGE diversity reflects a highly dynamic accessory genome associated with the gain or loss (indels) of 51 bacteriophages, 10 plasmids, and 6 integrative conjugational elements (ICE/IMEs), but did not correlate uniquely with outbreaks. Unlike the core genome, indels occurred repeatedly in independent nodes (homoplasies), resulting in inaccurate PFGE genealogies. The accessory genome contained only few cargo genes relevant to infection, other than antibiotic resistance. Thus, most of the genetic diversity within this recently emerged pathogen reflects changes in the accessory genome, or is due to recombination, but these changes seemed to reflect neutral processes rather than Darwinian selection. Each outbreak was caused by an independent clade, without universal, outbreak-associated genomic features, and none of the variable genes in the pan-genome seemed to be associated with an ability to cause outbreaks. PMID:23637636

The Role of Natural Killer (NK) Cells and NK Cell Receptor Polymorphisms in the Assessment of HIV-1 Neutralization

DTIC Science & Technology

2012-04-11

neutralization) and non-neutralizing antibody-dependent HIV inhibition, which may provide the opportunity to delineate the dominant antibody function (s) in...immunity, there has been a considerable effort to develop a vaccine that will elicit antibodies with some or all of these functions [19], and to... function (s) in polyclonal vaccine responses. 15. SUBJECT TERMS 16. SECURITY CLASSIFICATION OF: 17. LIMITATION OF ABSTRACT Same as Report (SAR) 18

[Prevalence of gene polymorphisms associated with immune-dependent diseases in the populations of North Eurasia].

PubMed

Cherednichenko, A A; Trifonova, E A; Vagaitseva, K V; Bocharova, A V; Varzari, A M; Radzhabov, M O; Stepanov, V A

2015-01-01

The data on distribution of genetic diversity in gene polymorphisms associated with autoimmune and allergic diseases and with regulation of immunoglobulin E and cytokines levels in 26 populations of the Northern Eurasia is presented. Substantial correlation between the values of average expected heterozygosity by 44 gene polymorphisms with climatic and geographical factors has not been revealed. Clustering of population groups in correspondence with their geographic locations is observed. The degree of gene differentiation among populations and the selective neutrality of gene polymorphisms have been assessed. The results of our work evidence the substantial genetic diversity and differentiation of human populations by studied genes.

Polymorphisms in HLA-DPB1 are associated with differences in rubella virus-specific humoral immunity after vaccination.

PubMed

Lambert, Nathaniel D; Haralambieva, Iana H; Kennedy, Richard B; Ovsyannikova, Inna G; Pankratz, Vernon Shane; Poland, Gregory A

2015-03-15

Vaccination with live attenuated rubella virus induces a strong immune response in most individuals. However, small numbers of subjects never reach or maintain protective antibody levels, and there is a high degree of variability in immune response. We have previously described genetic polymorphisms in HLA and other candidate genes that are associated with interindividual differences in humoral immunity to rubella virus. To expand our previous work, we performed a genome-wide association study (GWAS) to discover single-nucleotide polymorphisms (SNPs) associated with rubella virus-specific neutralizing antibodies. We identified rs2064479 in the HLA-DPB1 genetic region as being significantly associated with humoral immune response variations after rubella vaccination (P = 8.62 × 10(-8)). All other significant SNPs in this GWAS were located near the HLA-DPB1 gene (P ≤ 1 × 10(-7)). These findings demonstrate that polymorphisms in HLA-DPB1 are strongly associated with interindividual differences in neutralizing antibody levels to rubella vaccination and represent a validation of our previous HLA work. © The Author 2014. Published by Oxford University Press on behalf of the Infectious Diseases Society of America. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

Coalescent patterns for chromosomal inversions in divergent populations

PubMed Central

Guerrero, Rafael F.; Rousset, François; Kirkpatrick, Mark

2012-01-01

Chromosomal inversions allow genetic divergence of locally adapted populations by reducing recombination between chromosomes with different arrangements. Divergence between populations (or hybridization between species) is expected to leave signatures in the neutral genetic diversity of the inverted region. Quantitative expectations for these patterns, however, have not been obtained. Here, we develop coalescent models of neutral sites linked to an inversion polymorphism in two locally adapted populations. We consider two scenarios of local adaptation: selection on the inversion breakpoints and selection on alleles inside the inversion. We find that ancient inversion polymorphisms cause genetic diversity to depart dramatically from neutral expectations. Other situations, however, lead to patterns that may be difficult to detect; important determinants are the age of the inversion and the rate of gene flux between arrangements. We also study inversions under genetic drift, finding that they produce patterns similar to locally adapted inversions of intermediate age. Our results are consistent with empirical observations, and provide the foundation for quantitative analyses of the roles that inversions have played in speciation. PMID:22201172

Prioritization based on neutral genetic diversity may fail to conserve important characteristics in cattle breeds.

PubMed

Hall, S J G; Lenstra, J A; Deeming, D C

2012-06-01

Conservation of the intraspecific genetic diversity of livestock species requires protocols that assess between-breed genetic variability and also take into account differences among individuals within breeds. Here, we focus on variation between breeds. Conservation of neutral genetic variation has been seen as promoting, through linkage processes, the retention of useful and potentially useful variation. Using public information on beef cattle breeds, with a total of 165 data sets each relating to a breed comparison of a performance variable, we have tested this paradigm by calculating the correlations between pairwise breed differences in performance and pairwise genetic distances deduced from biochemical and immunological polymorphisms, microsatellites and single-nucleotide polymorphisms. As already observed in floral and faunal biodiversity, significant positive correlations (n=54) were found, but many correlations were non-significant (n=100) or significantly negative (n=11). This implies that maximizing conserved neutral genetic variation with current techniques may conserve breed-level genetic variation in some traits but not in others and supports the view that genetic distance measurements based on neutral genetic variation are not sufficient as a determinant of conservation priority among breeds. © 2011 Blackwell Verlag GmbH.

Population genomics of the Arabidopsis thaliana flowering time gene network.

PubMed

Flowers, Jonathan M; Hanzawa, Yoshie; Hall, Megan C; Moore, Richard C; Purugganan, Michael D

2009-11-01

The time to flowering is a key component of the life-history strategy of the model plant Arabidopsis thaliana that varies quantitatively among genotypes. A significant problem for evolutionary and ecological genetics is to understand how natural selection may operate on this ecologically significant trait. Here, we conduct a population genomic study of resequencing data from 52 genes in the flowering time network. McDonald-Kreitman tests of neutrality suggested a strong excess of amino acid polymorphism when pooling across loci. This excess of replacement polymorphism across the flowering time network and a skewed derived frequency spectrum toward rare alleles for both replacement and noncoding polymorphisms relative to synonymous changes is consistent with a large class of deleterious polymorphisms segregating in these genes. Assuming selective neutrality of synonymous changes, we estimate that approximately 30% of amino acid polymorphisms are deleterious. Evidence of adaptive substitution is less prominent in our analysis. The photoperiod regulatory gene, CO, and a gibberellic acid transcription factor, AtMYB33, show evidence of adaptive fixation of amino acid mutations. A test for extended haplotypes revealed no examples of flowering time alleles with haplotypes comparable in length to those associated with the null fri(Col) allele reported previously. This suggests that the FRI gene likely has a uniquely intense or recent history of selection among the flowering time genes considered here. Although there is some evidence for adaptive evolution in these life-history genes, it appears that slightly deleterious polymorphisms are a major component of natural molecular variation in the flowering time network of A. thaliana.

The influence of 5-HTTLPR transporter genotype on amygdala-subgenual anterior cingulate cortex connectivity in autism spectrum disorder.

PubMed

Velasquez, Francisco; Wiggins, Jillian Lee; Mattson, Whitney I; Martin, Donna M; Lord, Catherine; Monk, Christopher S

2017-04-01

Social deficits in autism spectrum disorder (ASD) are linked to amygdala functioning and functional connection between the amygdala and subgenual anterior cingulate cortex (sACC) is involved in the modulation of amygdala activity. Impairments in behavioral symptoms and amygdala activation and connectivity with the sACC seem to vary by serotonin transporter-linked polymorphic region (5-HTTLPR) variant genotype in diverse populations. The current preliminary investigation examines whether amygdala-sACC connectivity differs by 5-HTTLPR genotype and relates to social functioning in ASD. A sample of 108 children and adolescents (44 ASD) completed an fMRI face-processing task. Youth with ASD and low expressing 5-HTTLPR genotypes showed significantly greater connectivity than youth with ASD and higher expressing genotypes as well as typically developing (TD) individuals with both low and higher expressing genotypes, in the comparison of happy vs. baseline faces and happy vs. neutral faces. Moreover, individuals with ASD and higher expressing genotypes exhibit a negative relationship between amygdala-sACC connectivity and social dysfunction. Altered amygdala-sACC coupling based on 5-HTTLPR genotype may help explain some of the heterogeneity in neural and social function observed in ASD. This is the first ASD study to combine genetic polymorphism analyses and functional connectivity in the context of a social task. Copyright © 2016 The Authors. Published by Elsevier Ltd.. All rights reserved.

Binary polymorphic cocrystals: an update on the available literature in the Cambridge Structural Database, including a new polymorph of the pharmaceutical 1:1 cocrystal theophylline-3,4-dihydroxybenzoic acid.

PubMed

Mnguni, Malitsatsi J; Michael, Joseph P; Lemmerer, Andreas

2018-06-01

An analysis and classification of the 2925 neutral binary organic cocrystals in the Cambridge Structural Database is reported, focusing specifically on those both showing polymorphism and containing an active pharmaceutical ingredient (API). The search was confined to molecules having only C, H, N, O, S and halogens atoms. It was found that 400 out of 2925 cocrystals can be classified as pharmaceutical cocrystals, containing at least one API, and that of those, 56 can be classified as being polymorphic cocrystals. In general, the total number of polymorphic cocrystal systems of any type stands at 125. In addition, a new polymorph of the pharmaceutical cocrystal theophylline-3,4-dihydroxybenzoic acid (1/1), C 7 H 8 N 4 O 2 ·C 7 H 6 O 4 , is reported.

Evolution of the complementary sex-determination gene of honey bees: balancing selection and trans-species polymorphisms.

PubMed

Cho, Soochin; Huang, Zachary Y; Green, Daniel R; Smith, Deborah R; Zhang, Jianzhi

2006-11-01

The mechanism of sex determination varies substantively among evolutionary lineages. One important mode of genetic sex determination is haplodiploidy, which is used by approximately 20% of all animal species, including >200,000 species of the entire insect order Hymenoptera. In the honey bee Apis mellifera, a hymenopteran model organism, females are heterozygous at the csd (complementary sex determination) locus, whereas males are hemizygous (from unfertilized eggs). Fertilized homozygotes develop into sterile males that are eaten before maturity. Because homozygotes have zero fitness and because common alleles are more likely than rare ones to form homozygotes, csd should be subject to strong overdominant selection and negative frequency-dependent selection. Under these selective forces, together known as balancing selection, csd is expected to exhibit a high degree of intraspecific polymorphism, with long-lived alleles that may be even older than the species. Here we sequence the csd genes as well as randomly selected neutral genomic regions from individuals of three closely related species, A. mellifera, Apis cerana, and Apis dorsata. The polymorphic level is approximately seven times higher in csd than in the neutral regions. Gene genealogies reveal trans-species polymorphisms at csd but not at any neutral regions. Consistent with the prediction of rare-allele advantage, nonsynonymous mutations are found to be positively selected in csd only in early stages after their appearances. Surprisingly, three different hypervariable repetitive regions in csd are present in the three species, suggesting variable mechanisms underlying allelic specificities. Our results provide a definitive demonstration of balancing selection acting at the honey bee csd gene, offer insights into the molecular determinants of csd allelic specificities, and help avoid homozygosity in bee breeding.

Distribution of polymorphisms IL4-590 C/T and IL4 RP2 in the human populations of Madeira, Azores, Portugal, Cape Verde and Guinea-Bissau.

PubMed

Berenguer, Anabela G; Câmara, Rita A; Brehm, António D; Oliveira, Susana; Fernandes, Ana T

2012-01-01

The IL4 gene is located on chromosome 5q23.3-31.2. Polymorphisms within this cytokine gene, like the derivative allele T of IL4-590, have been reported as being associated to elevated IgE serum levels and asthma. In the present work, the allelic and genotypic frequency of the IL4-590 and IL4 RP2 polymorphisms was carried out in 599 individuals from Madeira, Azores, Portugal mainland, Cape Verde and Guinea-Bissau and in a sample of 101 asthmatics from Madeira population. In all populations the polymorphisms were in LD and presented a significant dissimilar allelic and genotypic distribution (p<0.05) except between mainland Portugal and Madeira when compared to Azores. Significant differences regarding both loci were found between Madeira population and the group of asthmatics. Genotype 183183TT frequency is higher for African populations while 253253CC prevails in Caucasian populations. The existence of a Hardy-Weinberg Disequilibrium in Guinea-Bissau population not observed in neutral markers leads to the hypothesis of natural selection occurring in these loci probably associated to a rapid population growth an hypothesis strengthened by neutral STRs D5S818 and CSF1PO gene diversity.

Distribution of polymorphisms IL4-590 C/T and IL4 RP2 in the human populations of Madeira, Azores, Portugal, Cape Verde and Guinea-Bissau

PubMed Central

Berenguer, Anabela G; Câmara, Rita A; Brehm, António D; Oliveira, Susana; Fernandes, Ana T

2012-01-01

The IL4 gene is located on chromosome 5q23.3-31.2. Polymorphisms within this cytokine gene, like the derivative allele T of IL4-590, have been reported as being associated to elevated IgE serum levels and asthma. In the present work, the allelic and genotypic frequency of the IL4-590 and IL4 RP2 polymorphisms was carried out in 599 individuals from Madeira, Azores, Portugal mainland, Cape Verde and Guinea-Bissau and in a sample of 101 asthmatics from Madeira population. In all populations the polymorphisms were in LD and presented a significant dissimilar allelic and genotypic distribution (p<0.05) except between mainland Portugal and Madeira when compared to Azores. Significant differences regarding both loci were found between Madeira population and the group of asthmatics. Genotype 183183TT frequency is higher for African populations while 253253CC prevails in Caucasian populations. The existence of a Hardy-Weinberg Disequilibrium in Guinea-Bissau population not observed in neutral markers leads to the hypothesis of natural selection occurring in these loci probably associated to a rapid population growth an hypothesis strengthened by neutral STRs D5S818 and CSF1PO gene diversity. PMID:22724055

The serotonin transporter gene polymorphism and the effect of baseline on amygdala response to emotional faces.

PubMed

von dem Hagen, Elisabeth A H; Passamonti, Luca; Nutland, Sarah; Sambrook, Jennifer; Calder, Andrew J

2011-03-01

Previous research has found that a common polymorphism in the serotonin transporter gene (5-HTTLPR) is an important mediator of individual differences in brain responses associated with emotional behaviour. In particular, relative to individuals homozygous for the l-allele, carriers of the s-allele display heightened amygdala activation to emotional compared to non-emotional stimuli. However, there is some debate as to whether this difference is driven by increased activation to emotional stimuli, resting baseline differences between the groups, or decreased activation to neutral stimuli. We performed functional imaging during an implicit facial expression processing task in which participants viewed angry, sad and neutral faces. In addition to neutral faces, we included two further baseline conditions, houses and fixation. We found increased amygdala activation in s-allele carriers relative to l-homozygotes in response to angry faces compared to neutral faces, houses and fixation. When comparing neutral faces to houses or fixation, we found no significant difference in amygdala response between the two groups. In addition, there was no significant difference between the groups in response to fixation when compared with a houses baseline. Overall, these results suggest that the increased amygdala response observed in s-allele carriers to emotional faces is primarily driven by an increased response to emotional faces rather than a decreased response to neutral faces or an increased resting baseline. The results are discussed in relation to the tonic and phasic hypotheses of 5-HTTLPR-mediated modulation of amygdala activity. Copyright © 2010 Elsevier Ltd. All rights reserved.

Evidence for Hitchhiking of Deleterious Mutations within the Human Genome

PubMed Central

Chun, Sung; Fay, Justin C.

2011-01-01

Deleterious mutations present a significant obstacle to adaptive evolution. Deleterious mutations can inhibit the spread of linked adaptive mutations through a population; conversely, adaptive substitutions can increase the frequency of linked deleterious mutations and even result in their fixation. To assess the impact of adaptive mutations on linked deleterious mutations, we examined the distribution of deleterious and neutral amino acid polymorphism in the human genome. Within genomic regions that show evidence of recent hitchhiking, we find fewer neutral but a similar number of deleterious SNPs compared to other genomic regions. The higher ratio of deleterious to neutral SNPs is consistent with simulated hitchhiking events and implies that positive selection eliminates some deleterious alleles and increases the frequency of others. The distribution of disease-associated alleles is also altered in hitchhiking regions. Disease alleles within hitchhiking regions have been associated with auto-immune disorders, metabolic diseases, cancers, and mental disorders. Our results suggest that positive selection has had a significant impact on deleterious polymorphism and may be partly responsible for the high frequency of certain human disease alleles. PMID:21901107

Association of CRTC1 polymorphisms with obesity markers in subjects from the general population with lifetime depression.

PubMed

Quteineh, Lina; Preisig, Martin; Rivera, Margarita; Milaneschi, Yuri; Castelao, Enrique; Gholam-Rezaee, Mehdi; Vandenberghe, Frederik; Saigi-Morgui, Nuria; Delacrétaz, Aurélie; Cardinaux, Jean-René; Willemsen, Gonneke; Boomsma, Dorret I; Penninx, Brenda W J H; Ching-López, Ana; Conus, Philippe; Eap, Chin B

2016-07-01

Psychiatric disorders have been hypothesized to share common etiological pathways with obesity, suggesting related neurobiological bases. We aimed to examine whether CRTC1 polymorphisms were associated with major depressive disorder (MDD) and to test the association of these polymorphisms with obesity markers in several large case-control samples with MDD. The association between CRTC1 polymorphisms and MDD was investigated in three case-control samples with MDD (PsyCoLaus n1=3,362, Radiant n2=3,148 and NESDA/NTR n3=4,663). The effect of CRTC1 polymorphisms on obesity markers was then explored. CRTC1 polymorphisms were not associated with MDD in the three samples. CRTC1 rs6510997C>T was significantly associated with fat mass in the PsyCoLaus study. In fact, a protective effect of this polymorphism was found in MDD cases (n=1,434, β=-1.32%, 95% CI -2.07 to -0.57, p<0.001), but not in controls. In the Radiant study, CRTC1 polymorphisms were associated with BMI, exclusively in individuals with MDD (n=2,138, β=-0.75kg/m(2), 95% CI -1.30 to -0.21, p=0.007), while no association with BMI was found in the NESDA/NTR study. Estimated fat mass using bioimpedance that capture more accurately adiposity was only present in the PsyCoLaus sample. CRTC1 polymorphisms seem to play a role with obesity markers in individuals with MDD rather than non-depressive individuals. Therefore, the weak association previously reported in the population-based samples was driven by cases diagnosed with lifetime MDD. However, CRTC1 seems not to be implicated directly in the development of psychiatric diseases. Copyright © 2016 Elsevier B.V. All rights reserved.

Continental-scale footprint of balancing and positive selection in a small rodent (Microtus arvalis).

PubMed

Fischer, Martin C; Foll, Matthieu; Heckel, Gerald; Excoffier, Laurent

2014-01-01

Genetic adaptation to different environmental conditions is expected to lead to large differences between populations at selected loci, thus providing a signature of positive selection. Whereas balancing selection can maintain polymorphisms over long evolutionary periods and even geographic scale, thus leads to low levels of divergence between populations at selected loci. However, little is known about the relative importance of these two selective forces in shaping genomic diversity, partly due to difficulties in recognizing balancing selection in species showing low levels of differentiation. Here we address this problem by studying genomic diversity in the European common vole (Microtus arvalis) presenting high levels of differentiation between populations (average F ST = 0.31). We studied 3,839 Amplified Fragment Length Polymorphism (AFLP) markers genotyped in 444 individuals from 21 populations distributed across the European continent and hence over different environmental conditions. Our statistical approach to detect markers under selection is based on a Bayesian method specifically developed for AFLP markers, which treats AFLPs as a nearly codominant marker system, and therefore has increased power to detect selection. The high number of screened populations allowed us to detect the signature of balancing selection across a large geographic area. We detected 33 markers potentially under balancing selection, hence strong evidence of stabilizing selection in 21 populations across Europe. However, our analyses identified four-times more markers (138) being under positive selection, and geographical patterns suggest that some of these markers are probably associated with alpine regions, which seem to have environmental conditions that favour adaptation. We conclude that despite favourable conditions in this study for the detection of balancing selection, this evolutionary force seems to play a relatively minor role in shaping the genomic diversity of the common vole, which is more influenced by positive selection and neutral processes like drift and demographic history.

Further exploration of the conformational space of α-synuclein fibrils: solid-state NMR assignment of a high-pH polymorph.

PubMed

Verasdonck, Joeri; Bousset, Luc; Gath, Julia; Melki, Ronald; Böckmann, Anja; Meier, Beat H

2016-04-01

Polymorphism is a common and important phenomenon for protein fibrils which has been linked to the appearance of strains in prion and other neurodegenerative diseases. Parkinson disease is a frequently occurring neurodegenerative pathology, tightly associated with the formation of Lewy bodies. These deposits mainly consist of α-synuclein in fibrillar, β-sheet-rich form. α-synuclein is known to form numerous different polymorphs, which show distinct structural features. Here, we describe the chemical shift assignments, and derive the secondary structure, of a polymorph that was fibrillized at higher-than-physiological pH conditions. The fibrillar core contains residues 40-95, with both the C- and N-terminus not showing any ordered, rigid parts. The chemical shifts are similar to those recorded previously for an assigned polymorph that was fibrillized at neutral pH.

Assessing Date Palm Genetic Diversity Using Different Molecular Markers.

PubMed

Atia, Mohamed A M; Sakr, Mahmoud M; Adawy, Sami S

2017-01-01

Molecular marker technologies which rely on DNA analysis provide powerful tools to assess biodiversity at different levels, i.e., among and within species. A range of different molecular marker techniques have been developed and extensively applied for detecting variability in date palm at the DNA level. Recently, the employment of gene-targeting molecular marker approaches to study biodiversity and genetic variations in many plant species has increased the attention of researchers interested in date palm to carry out phylogenetic studies using these novel marker systems. Molecular markers are good indicators of genetic distances among accessions, because DNA-based markers are neutral in the face of selection. Here we describe the employment of multidisciplinary molecular marker approaches: amplified fragment length polymorphism (AFLP), start codon targeted (SCoT) polymorphism, conserved DNA-derived polymorphism (CDDP), intron-targeted amplified polymorphism (ITAP), simple sequence repeats (SSR), and random amplified polymorphic DNA (RAPD) to assess genetic diversity in date palm.

Predicting change in symptoms of depression during the transition to university: the roles of BDNF and working memory capacity.

PubMed

LeMoult, Joelle; Carver, Charles S; Johnson, Sheri L; Joormann, Jutta

2015-03-01

Studies on depression risk emphasize the importance of both cognitive and genetic vulnerability factors. The present study has provided the first examination of whether working memory capacity, the BDNF Val66Met polymorphism, and their interaction predict changes in symptoms of depression during the transition to university. Early in the semester, students completed a self-report measure of depressive symptoms and a modified version of the reading span task to assess working memory capacity in the presence of both neutral and negative distractors. Whole blood was genotyped for the BDNF Val66Met polymorphism. Students returned at the end of the semester to complete additional self-report questionnaires. Neither working memory capacity nor the BDNF Val66Met polymorphism predicted change in depressive symptoms either independently or in interaction with self-reported semester difficulty. The BDNF Val66Met polymorphism, however, moderated the association between working memory capacity and symptom change. Among met carriers, lower working memory capacity in the presence of negative-but not neutral-distractors was associated with increased symptoms of depression over the semester. For the val/val group, working memory capacity did not predict symptom change. These findings contribute directly to biological and cognitive models of depression and highlight the importance of examining Gene × Cognition interactions when investigating risk for depression.

Multilocus patterns of polymorphism and selection across the X chromosome of Caenorhabditis remanei.

PubMed

Cutter, Asher D

2008-03-01

Natural selection and neutral processes such as demography, mutation, and gene conversion all contribute to patterns of polymorphism within genomes. Identifying the relative importance of these varied components in evolution provides the principal challenge for population genetics. To address this issue in the nematode Caenorhabditis remanei, I sampled nucleotide polymorphism at 40 loci across the X chromosome. The site-frequency spectrum for these loci provides no evidence for population size change, and one locus presents a candidate for linkage to a target of balancing selection. Selection for codon usage bias leads to the non-neutrality of synonymous sites, and despite its weak magnitude of effect (N(e)s approximately 0.1), is responsible for profound patterns of diversity and divergence in the C. remanei genome. Although gene conversion is evident for many loci, biased gene conversion is not identified as a significant evolutionary process in this sample. No consistent association is observed between synonymous-site diversity and linkage-disequilibrium-based estimators of the population recombination parameter, despite theoretical predictions about background selection or widespread genetic hitchhiking, but genetic map-based estimates of recombination are needed to rigorously test for a diversity-recombination relationship. Coalescent simulations also illustrate how a spurious correlation between diversity and linkage-disequilibrium-based estimators of recombination can occur, due in part to the presence of unbiased gene conversion. These results illustrate the influence that subtle natural selection can exert on polymorphism and divergence, in the form of codon usage bias, and demonstrate the potential of C. remanei for detecting natural selection from genomic scans of polymorphism.

Polymorphism in exon 2 encoding the putative ligand binding pocket of the bovine insulin-like growth factor 1 receptor affects milk traits in four different cattle breeds.

PubMed

Szewczuk, M

2017-02-01

As a member of the somatotropic axis, insulin-like growth factor I receptor (IGF1R) seems to be a promising candidate gene. Two silent polymorphisms, identified by MspI and TaqI restriction enzymes, were selected within exon 2, encoding the majority of the putative ligand binding pocket. A total of 1169 cows of four pure breeds (Polish Holstein Friesian, Montbeliarde, Jersey and Holstein Friesian) were genotyped. The T (IGF1R/e2/MspI) and G (IGF1R/e2/TaqI) alleles were found to be prevalent. Three combinations of genotypes (TT/GG, TT/AG and CT/GG) were associated with the highest productivity (milk, protein and fat yields) among all breeds under study, as opposed to individuals carrying the worst CC/AA combination. In view of the specific structure of the ligand binding pocket and the significance of insulin-like growth factor I signalling promoting the development and differentiation in a variety of tissues (not only limited to mammary gland), the existence of missense mutation is unlikely. Potential mutations are likely limited to mRNA transcription and further post-transcriptional modifications. Further investigations should follow searching for the most useful IGF1R haplotypes, associated with higher milk production traits, exerting at the same time positive or neutral impact on health and welfare of individuals. © 2016 Blackwell Verlag GmbH.

Polymorphisms in VDR gene in Tunisian postmenopausal women are associated with osteopenia phenotype.

PubMed

Sassi, R; Sahli, H; Souissi, C; Sellami, S; Ben Ammar El Gaaied, A

2015-01-01

Osteopenia is characterized by intermediate values of bone mineral density (BMD) as compared to normal and osteoporotic subjects. BMD, a surrogate phenotype for osteoporosis, is influenced in part by genetic factors. Among the genes associated with BMD, the vitamin D receptor (VDR) was the first gene studied as a potential candidate associated with BMD in adult and postmenopausal bone loss. However, results are controversial. To determine whether VDR polymorphisms ApaI and TaqI are associated with BMD, osteopenia, osteoporosis and low-impact fracture risk in North Africans, these genotypes were analyzed in 566 postmenopausal Tunisian women. In postmenopausal Tunisian women, the GT ApaI genotype seems to be protective against osteoporosis development (p = 0.02; odds ratio = 0.54). Moreover, the presence of the combined GT/TT genotype of ApaI and TaqI polymorphisms is more frequent in normal BMD women than in osteoporotic women (p = 0.00; odds ratio = 0.41). Interestingly, the GG ApaI genotype is associated with osteopenia development (p = 0.02; odds ratio = 1.86) and also the TT TaqI polymorphism (p = 0.02; odds ratio = 1.53). The GG ApaI genotype is associated with a three times risk of vertebral fracture. The ApaI polymorphism showed an association with osteopenia and low-impact vertebral fracture incidence but not with osteoporosis. The TaqI polymorphism is associated specifically with the osteopenia phenotype. The presence of the two polymorphisms increases the risk to develop osteopenia in postmenopausal Tunisian women. Osteopenia seems to be genetically determined. However, osteoporosis is the result of interaction between genetic and environmental factors.

Utilizing BlueJ to Teach Polymorphism in an Advanced Object-Oriented Programming Course

ERIC Educational Resources Information Center

Alkazemi, Basem Y.; Grami, Grami M.

2012-01-01

Teaching Polymorphism can be best implemented by using a combination of bottom-up and top-down approaches. However, from our observation and students' self-reporting, the former seems to be the predominant in the Saudi context. We try to investigate whether applying a more balanced approach in teaching the comprehensive concept of Polymorphism…

Novelty-seeking DRD4 polymorphisms are associated with human migration distance out-of-Africa after controlling for neutral population gene structure.

PubMed

Matthews, Luke J; Butler, Paul M

2011-07-01

Numerous lines of evidence suggest that Homo sapiens evolved as a distinct species in Africa by 150,000 years before the present (BP) and began major migrations out-of-Africa ∼50,000 BP. By 20,000 BP, our species had effectively colonized the entire Old World, and by 12,000 BP H. sapiens had a global distribution. We propose that this rapid migration into new habitats selected for individuals with low reactivity to novel stressors. Certain dopamine receptor D4 (DRD4) polymorphisms are associated with low neuronal reactivity and increased exploratory behavior, novelty seeking, and risk taking, collectively considered novelty-seeking trait (NS). One previous report (Chen et al.: Evol Hum Behav 20 (1999) 309-324) demonstrated a correlation between migratory distance and the seven-repeat (7R) VNTR DRD4 allele at exon 3 for human populations. This study, however, failed to account for neutral genetic processes (drift and admixture) that might create such a correlation in the absence of natural selection. Furthermore, additional loci surrounding DRD4 are now recognized to influence NS. Herein we account for neutral genetic structure by modeling the nonindependence of neutral allele frequencies between human populations. We retest the DRD4 exon 3 alleles, and also test two other loci near DRD4 that are associated with NS. We conclude there is an association between migratory distance and DRD4 exon 3 2R and 7R alleles that cannot be accounted for by neutral genetic processes alone. Copyright © 2011 Wiley-Liss, Inc.

Molecular Population Genetics of Sex Determination Genes: The Transformer Gene of Drosophila Melanogaster

PubMed Central

Walthour, C. S.; Schaeffer, S. W.

1994-01-01

The transformer locus (tra) produces an RNA processing protein that alternatively splices the doublesex pre-mRNA in the sex determination hierarchy of Drosophila melanogaster. Comparisons of the tra coding region among Drosophila species have revealed an unusually high degree of divergence in synonymous and nonsynonymous sites. In this study, we tested the hypothesis that the tra gene will be polymorphic in synonymous and nonsynonymous sites within species by investigating nucleotide sequence variation in eleven tra alleles within D. melanogaster. Of the 1063 nucleotides examined, two synonymous sites were polymorphic and no amino acid variation was detected. Three statistical tests were used to detect departures from an equilibrium neutral model. Two tests failed to reject a neutral model of molecular evolution because of low statisitical power associated with low levels of genetic variation (Tajima/Fu and Li). The Hudson, Kreitman, and Aguade test rejected a neutral model when the tra region was compared to the 5'-flanking region of alcohol dehydrogenase (Adh). The lack of variability in the tra gene is consistent with a recent selective sweep of a beneficial allele in or near the tra locus. PMID:8013913

The CYP2B6 G516T polymorphism influences CD4+ T-cell counts in HIV-positive patients receiving antiretroviral therapy in an ethnically diverse region of the Amazon.

PubMed

Queiroz, Maria Alice Freitas; Laurentino, Rogério Valois; da Silva Graça Amoras, Ednelza; Araújo, Mauro Sérgio Moura de; Gomes, Samara Tatielle Monteiro; Lima, Sandra Souza; Vallinoto, Antonio Carlos Rosário; de Oliveira Guimarães Ishak, Marluísa; Ishak, Ricardo; Machado, Luiz Fernando Almeida

2017-02-01

Cytochrome P450 (CYP) enzyme polymorphisms seem to significantly influence the variability of the responses to certain antiretroviral drugs and their toxicity levels. The objective of this study was to evaluate the influence of the CYP2B6 G516T polymorphism on hepatic, renal, immunological, and viral marker changes in HIV-1-positive patients receiving treatment in an ethnically diverse region of the Amazon. CYP2B6 G516T genotyping was performed by real-time PCR (RT-PCR) in samples from 185 patients. Urea, creatinine, aspartate aminotransferase (AST), alanine aminotransferase (ALT), CD4 + /CD8 + T-cell counts, and HIV-1 plasma viral load were measured. The polymorphic CYP2B6 G516T allele frequency was 0.36, which is different from the frequencies in other ethnic groups. The polymorphic genotype was associated with changes in the urea and ALT levels, although the median values were within the normal range. The TT genotype was also associated with significantly lower CD4 + T-cell counts in patients using efavirenz. The CYP2B6 G516T polymorphism seems to affect the response to efavirenz treatment by reducing CD4 + T-cell counts in patients with a high degree of miscegenation who use this antiretroviral agent. Copyright © 2016 The Authors. Published by Elsevier Ltd.. All rights reserved.

HSP90, HSPA8, HIF-1 alpha and HSP70-2 polymorphisms in breast cancer: a case-control study.

PubMed

Zagouri, Flora; Sergentanis, Theodoros N; Gazouli, Maria; Tsigginou, Alexandra; Dimitrakakis, Constantine; Papaspyrou, Irene; Eleutherakis-Papaiakovou, Evaggelos; Chrysikos, Dimosthenis; Theodoropoulos, George; Zografos, George C; Antsaklis, Aris; Dimopoulos, Athanassios-Meletios; Papadimitriou, Christos A

2012-12-01

This case control study aims to investigate the role of HSP90 Gln488His (C > G), HSP70-2 P1/P2, HIF-1 alpha C1772T and HSPA8 intronic 1541-1542delGT polymorphisms as potential risk factors and/or prognostic markers for breast cancer. 113 consecutive incident cases of histologically confirmed ductal breast cancer and 124 healthy cases were recruited. The above mentioned polymorphisms were genotyped; multivariate logistic regression was performed. HSP90 GG (His/His) genotype was associated with elevated breast cancer risk. Similarly, the allele dose-response model pointed to increase in breast cancer risk per G allele. HSP70-2 P1/P2, HSPA8 intronic 1541-1542delGT and HIF-1 alpha polymorphisms were not associated with breast cancer risk, as evidenced by the dose-response allele models. The positive association between HSP90 G allele and breast cancer risk seemed to pertain to both premenopausal and postmenopausal women. With respect to survival analysis, none of the aforementioned polymorphisms was associated with either disease-free survival or overall survival. HSP90α Gln488His polymorphism seems to be a risk factor for breast cancer. On the other hand, our study did not point to excess risk conferred by HSPA8 1541-1542delGT, Hsp70-2 P1/P2 and HIF-1α C1772T.

Association of TNF-α polymorphism rs1800629 with multisomatoform disorder in a group of German patients and healthy controls: an explorative study.

PubMed

Harms, Katharina C; Kapitza, Karl P; Pahl, Lisa; Tran, Anh-Thu; Volkmann, Lilly; Buers, Dennis; Karst, Matthias; Stuhrmann, Manfred; Bernateck, Michael

2013-02-01

The etiology of multisomatoform disorder (MSD) is still largely unknown, but genetic factors seem to have an influence on pathogenesis. Pain is a major symptom of MSD and polymorphisms of different proinflammatory cytokines have been found associated with pain in former studies. Therefore, we presumed that cytokine polymorphisms could also be associated with MSD. Groups of 148 MSD patients with pain as the leading clinical symptom and 149 age and gender matched healthy controls participated in this study. Nine cytokine polymorphisms were genotyped and statistically analyzed for associations with MSD. Allelic and genotypic associations were found for rs16944 (interleukin 1β), rs1800629 (tumor necrosis factor) and rs909253 (lymphotoxin α). After correcting for multiple testing, the association of rs1800629 with MSD remained significant. The rare A-allele was correlated with MSD (p=0.007). Since the common G-allele of rs1800629 (TNFα) occurs much more often in the control group than in the MSD group it is assumed to be protective. Being carrier of the A-allele seems to be a risk factor for MSD. Copyright © 2012 Elsevier Ltd. All rights reserved.

Adaptive and neutral markers both show continent-wide population structure of mountain pine beetle (Dendroctonus ponderosae).

PubMed

Batista, Philip D; Janes, Jasmine K; Boone, Celia K; Murray, Brent W; Sperling, Felix A H

2016-09-01

Assessments of population genetic structure and demographic history have traditionally been based on neutral markers while explicitly excluding adaptive markers. In this study, we compared the utility of putatively adaptive and neutral single-nucleotide polymorphisms (SNPs) for inferring mountain pine beetle population structure across its geographic range. Both adaptive and neutral SNPs, and their combination, allowed range-wide structure to be distinguished and delimited a population that has recently undergone range expansion across northern British Columbia and Alberta. Using an equal number of both adaptive and neutral SNPs revealed that adaptive SNPs resulted in a stronger correlation between sampled populations and inferred clustering. Our results suggest that adaptive SNPs should not be excluded prior to analysis from neutral SNPs as a combination of both marker sets resulted in better resolution of genetic differentiation between populations than either marker set alone. These results demonstrate the utility of adaptive loci for resolving population genetic structure in a nonmodel organism.

Evolution of disease response genes in loblolly pine: insights from candidate genes.

PubMed

Ersoz, Elhan S; Wright, Mark H; González-Martínez, Santiago C; Langley, Charles H; Neale, David B

2010-12-06

Host-pathogen interactions that may lead to a competitive co-evolution of virulence and resistance mechanisms present an attractive system to study molecular evolution because strong, recent (or even current) selective pressure is expected at many genomic loci. However, it is unclear whether these selective forces would act to preserve existing diversity, promote novel diversity, or reduce linked neutral diversity during rapid fixation of advantageous alleles. In plants, the lack of adaptive immunity places a larger burden on genetic diversity to ensure survival of plant populations. This burden is even greater if the generation time of the plant is much longer than the generation time of the pathogen. Here, we present nucleotide polymorphism and substitution data for 41 candidate genes from the long-lived forest tree loblolly pine, selected primarily for their prospective influences on host-pathogen interactions. This dataset is analyzed together with 15 drought-tolerance and 13 wood-quality genes from previous studies. A wide range of neutrality tests were performed and tested against expectations from realistic demographic models. Collectively, our analyses found that axr (auxin response factor), caf1 (chromatin assembly factor) and gatabp1 (gata binding protein 1) candidate genes carry patterns consistent with directional selection and erd3 (early response to drought 3) displays patterns suggestive of a selective sweep, both of which are consistent with the arm-race model of disease response evolution. Furthermore, we have identified patterns consistent with diversifying selection at erf1-like (ethylene responsive factor 1), ccoaoemt (caffeoyl-CoA-O-methyltransferase), cyp450-like (cytochrome p450-like) and pr4.3 (pathogen response 4.3), expected under the trench-warfare evolution model. Finally, a drought-tolerance candidate related to the plant cell wall, lp5, displayed patterns consistent with balancing selection. In conclusion, both arms-race and trench-warfare models seem compatible with patterns of polymorphism found in different disease-response candidate genes, indicating a mixed strategy of disease tolerance evolution for loblolly pine, a major tree crop in southeastern United States.

Intrapopulation polymorphism in Anopheles messeae (An. maculipennis complex) inferred by molecular analysis.

PubMed

Di Luca, Marco; Boccolini, Daniela; Marinuccil, Marino; Romi, Roberto

2004-07-01

We evaluated the internal transcribed spacer two (ITS2) sequence to detect intraspecific polymorphism in the Palearctic Anopheles maculipennis complex, analyzing 52 populations from 12 countries and representing six species. For An. messene, two fragments of the cytochrome oxidase I (COI) gene were also evaluated. The results were compared with GenBank sequences and data from the literature. ITS2 analysis revealed evident intraspecific polymorphism for An. messeae and a slightly less evident polymorphism for An. melanoon, whereas for each of the other species, 100% identity was found among populations. ITS2 analysis of An. messeae identified five haplotypes that were consistent with the geographical origin of the populations. ITS2 seems to be a reliable marker of intraspecific polymorphism for this complex, whereas the COI gene is apparently uninformative.

Polymorphism and selection in the major histocompatibility complex DRA and DQA genes in the family Equidae.

PubMed

Janova, Eva; Matiasovic, Jan; Vahala, Jiri; Vodicka, Roman; Van Dyk, Enette; Horin, Petr

2009-07-01

The major histocompatibility complex genes coding for antigen binding and presenting molecules are the most polymorphic genes in the vertebrate genome. We studied the DRA and DQA gene polymorphism of the family Equidae. In addition to 11 previously reported DRA and 24 DQA alleles, six new DRA sequences and 13 new DQA alleles were identified in the genus Equus. Phylogenetic analysis of both DRA and DQA sequences provided evidence for trans-species polymorphism in the family Equidae. The phylogenetic trees differed from species relationships defined by standard taxonomy of Equidae and from trees based on mitochondrial or neutral gene sequence data. Analysis of selection showed differences between the less variable DRA and more variable DQA genes. DRA alleles were more often shared by more species. The DQA sequences analysed showed strong amongst-species positive selection; the selected amino acid positions mostly corresponded to selected positions in rodent and human DQA genes.

A PAX3 polymorphism (T315K) in a family exhibiting Waardenburg Syndrome type 2.

PubMed

Wang, C; Kim, E; Attaie, A; Smith, T N; Wilcox, E R; Lalwani, A K

1998-02-01

Waardenburg Syndrome (WS) is an autosomal-dominant disorder phenotypically characterized by sensorineural hearing loss and pigmentary disturbances. Presence of dystopia canthorum is indicative of WS type 1 and results from defects in the PAX3 gene, whereas normally located medial canthi is characteristic of type 2 WS (WS2) and is associated with defects in the microphthalmia-associated transcription factor (MIFT) gene. Here a neutral polymorphism is reported in the PAX3 gene (T315K) in a family with WS2. Copyright 1998 Academic Press Limited

IL-17A, IL-17RC polymorphisms and IL17 plasma levels in Tunisian patients with rheumatoid arthritis

PubMed Central

Chahbi, Mayssa; Haouami, Youssra; Sfar, Imen; Abdelmoula, Leila; Ben Abdallah, Taieb; Gorgi, Yousr

2018-01-01

Background Interleukin-17 (IL-17), a cytokine mainly secreted by Th17 cells, seems to play a significant role in the pathogenesis of rheumatoid arthritis (RA). Functional genetic polymorphisms in IL-17 and its receptor genes can influence either qualitatively or quantitatively their functions. Therefore, we aimed to study the impact of IL17-A and IL17RC polymorphisms on plasma level of IL-17 and RA susceptibility and severity. Methods In this context, IL-17A*rs2275913 and IL-17RC*rs708567 polymorphisms were investigated together with the quantification of IL17 plasma level in 115 RA patients and 91 healthy control subjects matched in age, sex and ethnic origin. Results There were no statistically significant associations between IL-17A and IL-17RC studied polymorphisms and RA susceptibility. In contrast, IL-17A plasma levels were significantly higher in patients (55.07 pg/ml) comparatively to controls (4.75 pg/ml), p<10E-12. A ROC curve was used to evaluate the performance of plasma IL-17 in detecting RA. Given 100% specificity, the highest sensitivity of plasma IL-17A was 61.7% at a cut-off value of 18.25 pg/ml; p < 10E-21, CI = [0.849–0.939]. Analytic results showed that the IgM-rheumatoid factor and anti-CCP antibodies were significantly less frequent in patients with the IL-17RC*A/A genotype than those carrying *G/G and *G/A genotypes; p = 0.013 and p = 0.015, respectively. Otherwise, IL-17 plasma levels’ analysis showed a significant association with the activity of RA (DAS28≥5.1 = 74.71 pg/ml vs. DAS28<5.1 = 11.96 pg/ml), p<10E-6. Conclusion IL-17A*rs2275913 (G/A) and IL-17RC*rs708567 (G/A) polymorphisms did not seem to influence RA susceptibility in Tunisian population. This result agrees with those reported previously. Plasma IL-17A level seems to be predictive of severe RA occurrence. PMID:29584788

High-resolution single-nucleotide polymorphism array-profiling in myeloproliferative neoplasms identifies novel genomic aberrations

PubMed Central

Stegelmann, Frank; Bullinger, Lars; Griesshammer, Martin; Holzmann, Karlheinz; Habdank, Marianne; Kuhn, Susanne; Maile, Carmen; Schauer, Stefanie; Döhner, Hartmut; Döhner, Konstanze

2010-01-01

Single-nucleotide polymorphism arrays allow for genome-wide profiling of copy-number alterations and copy-neutral runs of homozygosity at high resolution. To identify novel genetic lesions in myeloproliferative neoplasms, a large series of 151 clinically well characterized patients was analyzed in our study. Copy-number alterations were rare in essential thrombocythemia and polycythemia vera. In contrast, approximately one third of myelofibrosis patients exhibited small genomic losses (less than 5 Mb). In 2 secondary myelofibrosis cases the tumor suppressor gene NF1 in 17q11.2 was affected. Sequencing analyses revealed a mutation in the remaining NF1 allele of one patient. In terms of copy-neutral aberrations, no chromosomes other than 9p were recurrently affected. In conclusion, novel genomic aberrations were identified in our study, in particular in patients with myelofibrosis. Further analyses on single-gene level are necessary to uncover the mechanisms that are involved in the pathogenesis of myeloproliferative neoplasms. PMID:20015882

A comparative study of two polymorphs of L-aspartic acid hydrochloride.

PubMed

Benali-Cherif, Rim; Takouachet, Radhwane; Bendeif, El-Eulmi; Benali-Cherif, Nourredine

2014-07-01

Two polymorphs of L-aspartic acid hydrochloride, C4H8NO4(+)·Cl(-), were obtained from the same aqueous solution. Their crystal structures have been determined from single-crystal data collected at 100 K. The crystal structures revealed three- and two-dimensional hydrogen-bonding networks for the triclinic and orthorhombic polymorphs, respectively. The cations and anions are connected to one another via N-H···Cl and O-H···Cl interactions and form alternating cation-anion layer-like structures. The two polymorphs share common structural features; however, the conformations of the L-aspartate cations and the crystal packings are different. Furthermore, the molecular packing of the orthorhombic polymorph contains more interesting interactions which seems to be a favourable factor for more efficient charge transfer within the crystal.

Migraine and genetic polymorphisms: an overview.

PubMed

Pizza, Vincenzo; Agresta, Anella; Agresta, Antonio; Lamaida, Eros; Lamaida, Norman; Infante, Francesco; Capasso, Anna

2012-01-01

The relationship between genetic polymorphisms and migraine as a cause of an increased risk of thrombotic disorders development is still debated In this respect, factor V Leiden, factor V (H1299R), prothrombin G20210A, factor XIII (V34L), β-fibrinogen, MTHFR (C677T), MTHFR (A1298C), APO E, PAI-1, HPA-1 and ACE I/D seem to play a determinant role in vascular diseases related to migraine. The present review analyzes both the incidence of the above genetic vascular mutations in migraineurs and the most re-cent developments related to genetic polymorphisms and migraine.

Migraine and Genetic Polymorphisms: An Overview

PubMed Central

Pizza, Vincenzo; Agresta, Anella; Agresta, Antonio; Lamaida, Eros; Lamaida, Norman; Infante, Francesco; Capasso, Anna

2012-01-01

The relationship between genetic polymorphisms and migraine as a cause of an increased risk of thrombotic disorders development is still debated In this respect, factor V Leiden, factor V (H1299R), prothrombin G20210A, factor XIII (V34L), β-fibrinogen, MTHFR (C677T), MTHFR (A1298C), APO E, PAI-1, HPA-1 and ACE I/D seem to play a determinant role in vascular diseases related to migraine. The present review analyzes both the incidence of the above genetic vascular mutations in migraineurs and the most re-cent developments related to genetic polymorphisms and migraine. PMID:22962564

Spatial and temporal drivers of phenotypic diversity in polymorphic snakes.

PubMed

Cox, Christian L; Davis Rabosky, Alison R

2013-08-01

Color polymorphism in natural populations presents an ideal opportunity to study the evolutionary drivers of phenotypic diversity. Systems with striking spatial, temporal, and qualitative variation in color can be leveraged to study the mechanisms promoting the distribution of different types of variation in nature. We used the highly polymorphic ground snake (Sonora semiannulata), a putative coral snake mimic with both cryptic and conspicuous morphs, to compare patterns of neutral genetic variation and variation over space and time in color polymorphism to investigate the mechanistic drivers of phenotypic variation across scales. We found that strong selection promotes color polymorphism across spatial and temporal scales, with morph frequencies differing markedly between juvenile and adult age classes within a single population, oscillating over time within multiple populations, and varying drastically over the landscape despite minimal population genetic structure. However, we found no evidence that conspicuousness of morphs was related to which color pattern was favored by selection or to any geographic factors, including sympatry with coral snakes. We suggest that complex patterns of phenotypic variation in polymorphic systems may be a fundamental outcome of the conspicuousness of morphs and that explicit tests of temporal and geographic variation are critical to the interpretation of conspicuousness and mimicry.

The Gender Subtext of Organizational Learning

ERIC Educational Resources Information Center

Raaijmakers, Stephan; Bleijenbergh, Inge; Fokkinga, Brigit; Visser, Max

2018-01-01

Purpose: This paper aims to challenge the alleged gender-neutral character of Argyris and Schön's theory of organizational learning (1978). While theories in organizational science seem gender neutral at the surface, a closer analysis reveals they are often based on men's experiences. Design/methodology/approach: This paper uses the method of…

Cyclin D1 G870A polymorphism and breast cancer risk: a meta-analysis comprising 9,911 cases and 11,171 controls.

PubMed

Sergentanis, Theodoros N; Economopoulos, Konstantinos P

2011-11-01

Cyclin D1 represents a key molecule in the regulation of cell cycle. CCND1 G870A (rs603965) polymorphism has drawn considerable attention as the A allele may generate a variant splice product with possible oncogenic actions. A meta-analysis examining the association between CCND1 G870A polymorphism and breast cancer risk was performed. Separate analyses on Caucasian and Chinese populations were also implemented. Eligible articles were identified for the period up to July 2010. Pooled odds ratios (OR) were appropriately derived from fixed-effects or random-effects models. Sensitivity analysis excluding studies whose genotype frequencies in controls significantly deviated from Hardy-Weinberg Equilibrium (HWE) was performed. Nine case-control studies on Caucasians (7,304 cases and 8,149 controls) and four case-control studies on Chinese (2,607 cases and 3,022 controls) were eligible. At the overall analysis the A allele seemed to be associated with elevated breast cancer risk; the effect seemed to be confined to homozygous carriers (pooled OR = 1.091, 95% CI: 1.008-1.179, P = 0.030, fixed effects) as heterozygous carriers did not exhibit significantly elevated breast cancer risk. No statistically significant associations were demonstrated in Caucasians. On the other hand, Chinese AA carriers exhibited marginally elevated breast cancer risk (pooled OR = 1.144, 95% CI: 0.984-1.329, P = 0.080, fixed effects). Nevertheless, the controls in two out of the four Chinese studies deviated from HWE. In conclusion, this meta-analysis suggests that the A allele of the CCND1 G870A polymorphism may confer additional breast cancer risk when it comes to homozygosity and Chinese populations. The need for additional, methodologically sound studies on Chinese populations seems warranted.

Population genomics of Pacific lamprey: adaptive variation in a highly dispersive species.

PubMed

Hess, Jon E; Campbell, Nathan R; Close, David A; Docker, Margaret F; Narum, Shawn R

2013-06-01

Unlike most anadromous fishes that have evolved strict homing behaviour, Pacific lamprey (Entosphenus tridentatus) seem to lack philopatry as evidenced by minimal population structure across the species range. Yet unexplained findings of within-region population genetic heterogeneity coupled with the morphological and behavioural diversity described for the species suggest that adaptive genetic variation underlying fitness traits may be responsible. We employed restriction site-associated DNA sequencing to genotype 4439 quality filtered single nucleotide polymorphism (SNP) loci for 518 individuals collected across a broad geographical area including British Columbia, Washington, Oregon and California. A subset of putatively neutral markers (N = 4068) identified a significant amount of variation among three broad populations: northern British Columbia, Columbia River/southern coast and 'dwarf' adults (F(CT) = 0.02, P ≪ 0.001). Additionally, 162 SNPs were identified as adaptive through outlier tests, and inclusion of these markers revealed a signal of adaptive variation related to geography and life history. The majority of the 162 adaptive SNPs were not independent and formed four groups of linked loci. Analyses with matsam software found that 42 of these outlier SNPs were significantly associated with geography, run timing and dwarf life history, and 27 of these 42 SNPs aligned with known genes or highly conserved genomic regions using the genome browser available for sea lamprey. This study provides both neutral and adaptive context for observed genetic divergence among collections and thus reconciles previous findings of population genetic heterogeneity within a species that displays extensive gene flow. © 2012 John Wiley & Sons Ltd.

Patterns of gene variation in central and marginal populations of Drosophila robusta.

PubMed

Prakash, S

1973-10-01

The central and marginal populations of D. robusta differ greatly in the level of inversion polymorphism; the marginal populations are monomorphic or nearly so and the central populations are highly polymorphic. This paper presents the frequencies of alleles at forty gene loci in various populations of D. robusta, studied by electrophoresis of proteins and enzymes. Population samples were obtained from eight widely separated populations of D. robusta which included the central, the extreme marginal and the intervening populations between the center and the margins. We find that the proportion of polymorphic loci and average heterozygosity per individual is slightly higher in the marginal populations than the central populations. In D. robusta on an average, 39% of the loci are polymorphic and the average proportion of loci heterozygous per individual is 11%. A breakdown of loci in three categories, viz, hydrolytic enzymes and some other enzymes, larval proteins and glycolytic and Kreb's cycle enzymes, shows that in all populations the level of polymorphism is highest in the hydrolytic enzymes, intermediate in larval proteins and least in the glycolytic and Kreb's cycle enzymes. On the average, the proportion of loci heterozygous per individual for three groups of loci is: hydrolytic enzymes and others (.164), larval proteins (.115) and glycolytic and Kreb's cycle enzymes (.037). We also observe that in all populations the level of polymorphism on the X chromosome is far less than the expected 38%; in salivary gland cells the euchromatic length of the X chromosome is 38% of the entire genome. Lower levels of polymorphism for the X chromosome loci are explained due to low probability of balanced polymorphisms for the X-linked loci since the conditions for establishment of balanced polymorphism for X-linked loci are more restrictive than for the autosomal loci.-The polymorphic loci can be grouped according to pattern of allele frequencies in different populations as follows: (1) The allele frequencies are similar in all populations at the XDH, Pep-1 and Hex-1 loci. (2) The alleles at the Est-1, Est-2, Amy loci and the AP-4(1.0) and the LAP-1(.90) alleles show north south clinal change in frequency. (3) There is north south and east west differentiation at the Pt-5, Pt-8 and Pt-9 loci and the allele AP-4(.81). (4) Polymorphism at loci such as Fum, B.Ox, Hex-8, Pep-2 and Pep-3 are restricted to only one or two of the populations. (5) Allele frequencies at the MDH and ODH loci fluctuate between populations. (6) Allele frequencies at many polymorphic loci such as Est-1, Est-2, LAP-1, AP-4, Pt-5, Pt-8, Pt-9, Pt-16, MDH, Fum change clinally within a gene arrangement. The pattern of gene variation in D. robusta is very complex and cannot be easily explained due to migration of neutral alleles between once-isolated populations or to semi-isolation of neutral alleles. The observations of the pattern of allele variation in different populations, high levels of polymorphism in the marginal populations which have small population size and low levels of polymorphism of the X chromosome loci all support the argument in favor of balancing selection as the main mechanism for the maintenance of these polymorphisms. Environmental factors must play a role in the maintenance of a great deal of these polymorphisms, since we observe clinal allele frequency changes even within a given inversion type.

Patterns of Gene Variation in Central and Marginal Populations of DROSOPHILA ROBUSTA

PubMed Central

Prakash, Satya

1973-01-01

The central and marginal populations of D. robusta differ greatly in the level of inversion polymorphism; the marginal populations are monomorphic or nearly so and the central populations are highly polymorphic. This paper presents the frequencies of alleles at forty gene loci in various populations of D. robusta, studied by electrophoresis of proteins and enzymes. Population samples were obtained from eight widely separated populations of D. robusta which included the central, the extreme marginal and the intervening populations between the center and the margins. We find that the proportion of polymorphic loci and average heterozygosity per individual is slightly higher in the marginal populations than the central populations. In D. robusta on an average, 39% of the loci are polymorphic and the average proportion of loci heterozygous per individual is 11%. A breakdown of loci in three categories, viz, hydrolytic enzymes and some other enzymes, larval proteins and glycolytic and Kreb's cycle enzymes, shows that in all populations the level of polymorphism is highest in the hydrolytic enzymes, intermediate in larval proteins and least in the glycolytic and Kreb's cycle enzymes. On the average, the proportion of loci heterozygous per individual for three groups of loci is: hydrolytic enzymes and others (.164), larval proteins (.115) and glycolytic and Kreb's cycle enzymes (.037). We also observe that in all populations the level of polymorphism on the X chromosome is far less than the expected 38%; in salivary gland cells the euchromatic length of the X chromosome is 38% of the entire genome. Lower levels of polymorphism for the X chromosome loci are explained due to low probability of balanced polymorphisms for the X-linked loci since the conditions for establishment of balanced polymorphism for X-linked loci are more restrictive than for the autosomal loci.—The polymorphic loci can be grouped according to pattern of allele frequencies in different populations as follows: (1) The allele frequencies are similar in all populations at the XDH, Pep-1 and Hex-1 loci. (2) The alleles at the Est-1, Est-2, Amy loci and the AP-41.0 and the LAP-1.90 alleles show north south clinal change in frequency. (3) There is north south and east west differentiation at the Pt-5, Pt-8 and Pt-9 loci and the allele AP-4.81. (4) Polymorphism at loci such as Fum, B.Ox, Hex-8, Pep-2 and Pep-3 are restricted to only one or two of the populations. (5) Allele frequencies at the MDH and ODH loci fluctuate between populations. (6) Allele frequencies at many polymorphic loci such as Est-1, Est-2, LAP-1, AP-4, Pt-5, Pt-8, Pt-9, Pt-16, MDH, Fum change clinally within a gene arrangement. The pattern of gene variation in D. robusta is very complex and cannot be easily explained due to migration of neutral alleles between once-isolated populations or to semi-isolation of neutral alleles. The observations of the pattern of allele variation in different populations, high levels of polymorphism in the marginal populations which have small population size and low levels of polymorphism of the X chromosome loci all support the argument in favor of balancing selection as the main mechanism for the maintenance of these polymorphisms. Environmental factors must play a role in the maintenance of a great deal of these polymorphisms, since we observe clinal allele frequency changes even within a given inversion type. PMID:4203580

Glucocorticoid receptor polymorphism in obesity and glucose homeostasis.

PubMed

Majer-Łobodzińska, Agnieszka; Adamiec-Mroczek, Joanna

2017-01-01

Glucocorticoid receptor (GR) activity plays a significant role in the etiology of obesity and is essential for glucose homeostasis, the development of hyperinsulinaemia and subsequent increased fat deposition. Several polymorphisms in the GR gene have been described, and at least three of them seem to be associated with altered glucocorticoid sensitivity and changes in glucose homeostasis, and other metabolic parameters. The N363S polymorphism has been associated with increased sensitivity to glucocorticoides, increased insulin response to dexamethasone and increased plasma glucose level. BclI polymorphism is associated with increased abdominal obesity, hyperinsulinaemia and increased insulin resistance. Another polymorphism, ER22/23EK, in contrast to the others, is associated with relative resistance to glucocoricides actions and more beneficial metabolic profile-lower insulin resistance level, decreased lower cardiovascular risk and subseuent prolongation of life time. More research is still needed to understand the mechanisms behind these associations at the molecular level.

Genetic Changes in Fluctuating Vole Populations: Selective VS. Nonselective Forces

PubMed Central

Gaines, Michael S.; Whittam, Thomas S.

1980-01-01

The Lewontin-Krakauer test for selective neutrality of polymorphisms was applied to temporal variation in gene frequency at five electrophoretic loci in each of four fluctuating vole populations over a three-year period. The results indicate that changes in gene frequencies were primarily due to nonselective forces. PMID:7021314

Fine mapping of canine parvovirus B cell epitopes.

PubMed

López de Turiso, J A; Cortés, E; Ranz, A; García, J; Sanz, A; Vela, C; Casal, J I

1991-10-01

In this report we describe the topological mapping of neutralizing domains of canine parvovirus (CPV). We obtained 11 CPV-specific monoclonal antibodies (MAbs), six of which are neutralizing. The reactivities were as determined by ELISA and Western blot (immunoblot) analysis. VP2, the most abundant protein of the CPV capsid, seemed to contain all the neutralization sites. Also, an almost full-length genomic clone of CPV was constructed in the bacterial plasmid pUC18 to enable expression of CPV proteins. All the neutralizing MAbs recognized recombinant VP2 when it was expressed as a free protein in Escherichia coli but not when expressed as a fusion protein with glutathione-S-transferase. When two large fragments containing about 85% and 67% of the C terminus of VP2 were expressed, no neutralization sites were detected. When fusion proteins containing the N terminus were expressed, two linear determinants were mapped, one between residues 1 to 10 of VP2, and the other between amino acids 11 and 23. The peptide 11 GQPAVRNERATGS 23, recognized by MAb 3C9, was synthesized chemically and checked for immunogenicity, not being able to induce neutralizing activity. Although the antibody response in rabbits to all the fusion proteins was uniformly high, the anti-CPV response was very variable. Protein from pCPVEx11, which contains a T cell epitope (peptide PKIFINLAKKKKAG) present in the VP1-specific region as well as the B cell epitopes, seemed to be the most effective in inducing virus neutralization.

Camouflage effects of various colour-marking morphs against different microhabitat backgrounds in a polymorphic pygmy grasshopper Tetrix japonica.

PubMed

Tsurui, Kaori; Honma, Atsushi; Nishida, Takayoshi

2010-07-06

Colour-marking polymorphism is widely distributed among cryptic species. To account for the adaptive significance of such polymorphisms, several hypotheses have been proposed to date. Although these hypotheses argue over the degree of camouflage effects of marking morphs (and the interactions between morphs and their microhabitat backgrounds), as far as we know, most empirical evidence has been provided under unnatural conditions (i.e., using artificial prey). Tetrix japonica, a pygmy grasshopper, is highly polymorphic in colour-markings and occurs in both sand and grass microhabitats. Even within a microhabitat, T. japonica is highly polymorphic. Using humans as dummy predators and printed photographs in which various morphs of grasshoppers were placed against different backgrounds, we addressed three questions to test the neutral, background heterogeneity, and differential crypsis hypotheses in four marking-type morphs: 1) do the morphs differ in the degree of crypsis in each microhabitat, 2) are different morphs most cryptic in specific backgrounds of the microhabitats, and 3) does the morph frequency reflect the degree of crypsis? The degree of camouflage differed among the four morphs; therefore, the neutral hypothesis was rejected. Furthermore, the order of camouflage advantage among morphs differed depending on the two types of backgrounds (sand and grass), although the grass background consistently provided greater camouflage effects. Thus, based on our results, we could not reject the background heterogeneity hypothesis. Under field conditions, the more cryptic morphs comprised a minority of the population. Overall, our results demonstrate that the different morphs were not equivalent in the degree of crypsis, but the degree of camouflage of the morphs was not consistent with the morph frequency. These findings suggest that trade-offs exist between the camouflage benefit of body colouration and other fitness components, providing a better understanding of the adaptive significance of colour-markings and presumably supporting the differential crypsis hypothesis.

Disguised Ideologies in Counseling and Social Justice Work

ERIC Educational Resources Information Center

Harrist, Steve; Richardson, Frank C.

2012-01-01

A social justice orientation for counseling is appealing to many but appears to some to violate counselor neutrality and respect for client freedom and rights. Confusion about neutrality and advocacy in the counseling field seems to reflect confused assumptions and values in the wider culture. As a result, counseling is guided more by a disguised…

Liberal Democracy and Objective Journalism: Partners or Adversaries?

ERIC Educational Resources Information Center

Reeb, Richard H., Jr.

Contemporary journalism, although claiming to be politically objective and neutral, has become a powerful critic of the conduct of the government, often seeming to be a force for the reordering of national priorities along leftist lines. This "adversary journalism" of the past 15 years has strayed a long way from the neutral journalism…

The evolution of small insertions and deletions in the coding genes of Drosophila melanogaster.

PubMed

Chong, Zechen; Zhai, Weiwei; Li, Chunyan; Gao, Min; Gong, Qiang; Ruan, Jue; Li, Juan; Jiang, Lan; Lv, Xuemei; Hungate, Eric; Wu, Chung-I

2013-12-01

Studies of protein evolution have focused on amino acid substitutions with much less systematic analysis on insertion and deletions (indels) in protein coding genes. We hence surveyed 7,500 genes between Drosophila melanogaster and D. simulans, using D. yakuba as an outgroup for this purpose. The evolutionary rate of coding indels is indeed low, at only 3% of that of nonsynonymous substitutions. As coding indels follow a geometric distribution in size and tend to fall in low-complexity regions of proteins, it is unclear whether selection or mutation underlies this low rate. To resolve the issue, we collected genomic sequences from an isogenic African line of D. melanogaster (ZS30) at a high coverage of 70× and analyzed indel polymorphism between ZS30 and the reference genome. In comparing polymorphism and divergence, we found that the divergence to polymorphism ratio (i.e., fixation index) for smaller indels (size ≤ 10 bp) is very similar to that for synonymous changes, suggesting that most of the within-species polymorphism and between-species divergence for indels are selectively neutral. Interestingly, deletions of larger sizes (size ≥ 11 bp and ≤ 30 bp) have a much higher fixation index than synonymous mutations and 44.4% of fixed middle-sized deletions are estimated to be adaptive. To our surprise, this pattern is not found for insertions. Protein indel evolution appear to be in a dynamic flux of neutrally driven expansion (insertions) together with adaptive-driven contraction (deletions), and these observations provide important insights for understanding the fitness of new mutations as well as the evolutionary driving forces for genomic evolution in Drosophila species.

Genomic Microsatellites as Evolutionary Chronometers: A Test in Wild Cats

PubMed Central

Driscoll, Carlos A.; Menotti-Raymond, Marilyn; Nelson, George; Goldstein, David; O'Brien, Stephen J.

2002-01-01

Nuclear microsatellite loci (2- to 5-bp tandem repeats) would seem to be ideal markers for population genetic monitoring because of their abundant polymorphism, wide dispersal in vertebrate genomes, near selective neutrality, and ease of assessment; however, questions about their mode of generation, mutation rates and ascertainment bias have limited interpretation considerably. We have assessed the patterns of genomic diversity for ninety feline microsatellite loci among previously characterized populations of cheetahs, lions and pumas in recapitulating demographic history. The results imply that the microsatellite diversity measures (heterozygosity, allele reconstitution and microsatellite allele variance) offer proportionate indicators, albeit with large variance, of historic population bottlenecks and founder effects. The observed rate of reconstruction of new alleles plus the growth in the breadth of microsatellite allele size (variance) was used here to develop genomic estimates of time intervals following historic founder events in cheetahs (12,000 yr ago), in North American pumas (10,000–17,000 yr ago), and in Asiatic lions of the Gir Forest (1000–4000 yr ago). [Supplemental material available online at http://rex.nci.nih.gov/lgd/front_page.htm and at http://www.genome.org.] PMID:11875029

Population genetics of polymorphism and divergence for diploid selection models with arbitrary dominance.

PubMed

Williamson, Scott; Fledel-Alon, Adi; Bustamante, Carlos D

2004-09-01

We develop a Poisson random-field model of polymorphism and divergence that allows arbitrary dominance relations in a diploid context. This model provides a maximum-likelihood framework for estimating both selection and dominance parameters of new mutations using information on the frequency spectrum of sequence polymorphisms. This is the first DNA sequence-based estimator of the dominance parameter. Our model also leads to a likelihood-ratio test for distinguishing nongenic from genic selection; simulations indicate that this test is quite powerful when a large number of segregating sites are available. We also use simulations to explore the bias in selection parameter estimates caused by unacknowledged dominance relations. When inference is based on the frequency spectrum of polymorphisms, genic selection estimates of the selection parameter can be very strongly biased even for minor deviations from the genic selection model. Surprisingly, however, when inference is based on polymorphism and divergence (McDonald-Kreitman) data, genic selection estimates of the selection parameter are nearly unbiased, even for completely dominant or recessive mutations. Further, we find that weak overdominant selection can increase, rather than decrease, the substitution rate relative to levels of polymorphism. This nonintuitive result has major implications for the interpretation of several popular tests of neutrality.

Electronic structures and spectra of two antioxidants: uric acid and ascorbic acid

NASA Astrophysics Data System (ADS)

Shukla, M. K.; Mishra, P. C.

1996-04-01

Electronic absorption and fluorescence spectra of aqueous solutions of two well known antioxidants, uric acid and ascorbic acid (vitamin C), have been studied at different pH. The observed spectra have been interpreted in terms of neutral and anionic forms of the molecules with the help of molecular orbital calculations. The N 3 site of uric acid has been shown to be the most acidic. Fluorescence of uric acid seems to originate from an anion of the molecule in a wide pH range. Around pH 3, both the neutral and anionic forms of ascorbic acid appear to be present in aqueous solutions. In aqueous media, ascorbic acid appears to get converted easily to its dehydro form and this conversion does not seem to be reversible. An anion of dehydroascorbic acid seems to be formed on heating dehydroascorbic acid in aqueous solutions.

Balancing selection is common in the extended MHC region but most alleles with opposite risk profile for autoimmune diseases are neutrally evolving

PubMed Central

2011-01-01

Background Several susceptibility genetic variants for autoimmune diseases have been identified. A subset of these polymorphisms displays an opposite risk profile in different autoimmune conditions. This observation open interesting questions on the evolutionary forces shaping the frequency of these alleles in human populations. We aimed at testing the hypothesis whereby balancing selection has shaped the frequency of opposite risk alleles. Results Since balancing selection signatures are expected to extend over short genomic portions, we focused our analyses on 11 regions carrying putative functional polymorphisms that may represent the disease variants (and the selection targets). No exceptional nucleotide diversity was observed for ZSCAN23, HLA-DMB, VARS2, PTPN22, BAT3, C6orf47, and IL10; summary statistics were consistent with evolutionary neutrality for these gene regions. Conversely, CDSN/PSORS1C1, TRIM10/TRIM40, BTNL2, and TAP2 showed extremely high nucleotide diversity and most tests rejected neutrality, suggesting the action of balancing selection. For TAP2 and BTNL2 these signatures are not secondary to linkage disequilibrium with HLA class II genes. Nonetheless, with the exception of variants in TRIM40 and CDSN, our data suggest that opposite risk SNPs are not selection targets but rather have accumulated as neutral variants. Conclusion Data herein indicate that balancing selection is common within the extended MHC region and involves several non-HLA loci. Yet, the evolutionary history of most SNPs with an opposite effect for autoimmune diseases is consistent with evolutionary neutrality. We suggest that variants with an opposite effect on autoimmune diseases should not be considered a distinct class of disease alleles from the evolutionary perspective and, in a few cases, the opposite effect on distinct diseases may derive from complex haplotype structures in regions with high genetic diversity. PMID:21682861

DNA sequence variation and selection of tag single-nucleotide polymorphisms at candidate genes for drought-stress response in Pinus taeda L.

PubMed

González-Martínez, Santiago C; Ersoz, Elhan; Brown, Garth R; Wheeler, Nicholas C; Neale, David B

2006-03-01

Genetic association studies are rapidly becoming the experimental approach of choice to dissect complex traits, including tolerance to drought stress, which is the most common cause of mortality and yield losses in forest trees. Optimization of association mapping requires knowledge of the patterns of nucleotide diversity and linkage disequilibrium and the selection of suitable polymorphisms for genotyping. Moreover, standard neutrality tests applied to DNA sequence variation data can be used to select candidate genes or amino acid sites that are putatively under selection for association mapping. In this article, we study the pattern of polymorphism of 18 candidate genes for drought-stress response in Pinus taeda L., an important tree crop. Data analyses based on a set of 21 putatively neutral nuclear microsatellites did not show population genetic structure or genomewide departures from neutrality. Candidate genes had moderate average nucleotide diversity at silent sites (pi(sil) = 0.00853), varying 100-fold among single genes. The level of within-gene LD was low, with an average pairwise r2 of 0.30, decaying rapidly from approximately 0.50 to approximately 0.20 at 800 bp. No apparent LD among genes was found. A selective sweep may have occurred at the early-response-to-drought-3 (erd3) gene, although population expansion can also explain our results and evidence for selection was not conclusive. One other gene, ccoaomt-1, a methylating enzyme involved in lignification, showed dimorphism (i.e., two highly divergent haplotype lineages at equal frequency), which is commonly associated with the long-term action of balancing selection. Finally, a set of haplotype-tagging SNPs (htSNPs) was selected. Using htSNPs, a reduction of genotyping effort of approximately 30-40%, while sampling most common allelic variants, can be gained in our ongoing association studies for drought tolerance in pine.

Genomic polymorphism, recombination, and linkage disequilibrium in human major histocompatibility complex-encoded antigen-processing genes.

PubMed Central

van Endert, P M; Lopez, M T; Patel, S D; Monaco, J J; McDevitt, H O

1992-01-01

Recently, two subunits of a large cytosolic protease and two putative peptide transporter proteins were found to be encoded by genes within the class II region of the major histocompatibility complex (MHC). These genes have been suggested to be involved in the processing of antigenic proteins for presentation by MHC class I molecules. Because of the high degree of polymorphism in MHC genes, and previous evidence for both functional and polypeptide sequence polymorphism in the proteins encoded by the antigen-processing genes, we tested DNA from 27 consanguineous human cell lines for genomic polymorphism by restriction fragment length polymorphism (RFLP) analysis. These studies demonstrate a strong linkage disequilibrium between TAP1 and LMP2 RFLPs. Moreover, RFLPs, as well as a polymorphic stop codon in the telomeric TAP2 gene, appear to be in linkage disequilibrium with HLA-DR alleles and RFLPs in the HLA-DO gene. A high rate of recombination, however, seems to occur in the center of the complex, between the TAP1 and TAP2 genes. Images PMID:1360671

Identification of amino acid substitutions with compensational effects in the attachment protein of canine distemper virus.

PubMed

Sattler, Ursula; Khosravi, Mojtaba; Avila, Mislay; Pilo, Paola; Langedijk, Johannes P; Ader-Ebert, Nadine; Alves, Lisa A; Plattet, Philippe; Origgi, Francesco C

2014-07-01

The hemagglutinin (H) gene of canine distemper virus (CDV) encodes the receptor-binding protein. This protein, together with the fusion (F) protein, is pivotal for infectivity since it contributes to the fusion of the viral envelope with the host cell membrane. Of the two receptors currently known for CDV (nectin-4 and the signaling lymphocyte activation molecule [SLAM]), SLAM is considered the most relevant for host susceptibility. To investigate how evolution might have impacted the host-CDV interaction, we examined the functional properties of a series of missense single nucleotide polymorphisms (SNPs) naturally accumulating within the H-gene sequences during the transition between two distinct but related strains. The two strains, a wild-type strain and a consensus strain, were part of a single continental outbreak in European wildlife and occurred in distinct geographical areas 2 years apart. The deduced amino acid sequence of the two H genes differed at 5 residues. A panel of mutants carrying all the combinations of the SNPs was obtained by site-directed mutagenesis. The selected mutant, wild type, and consensus H proteins were functionally evaluated according to their surface expression, SLAM binding, fusion protein interaction, and cell fusion efficiencies. The results highlight that the most detrimental functional effects are associated with specific sets of SNPs. Strikingly, an efficient compensational system driven by additional SNPs appears to come into play, virtually neutralizing the negative functional effects. This system seems to contribute to the maintenance of the tightly regulated function of the H-gene-encoded attachment protein. Importance: To investigate how evolution might have impacted the host-canine distemper virus (CDV) interaction, we examined the functional properties of naturally occurring single nucleotide polymorphisms (SNPs) in the hemagglutinin gene of two related but distinct strains of CDV. The hemagglutinin gene encodes the attachment protein, which is pivotal for infection. Our results show that few SNPs have a relevant detrimental impact and they generally appear in specific combinations (molecular signatures). These drastic negative changes are neutralized by compensatory mutations, which contribute to maintenance of an overall constant bioactivity of the attachment protein. This compensational mechanism might reflect the reaction of the CDV machinery to the changes occurring in the virus following antigenic variations critical for virulence. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

The New Superconductor tP-SrPd2Bi2: Structural Polymorphism and Superconductivity in Intermetallics.

PubMed

Xie, Weiwei; Seibel, Elizabeth M; Cava, Robert J

2016-04-04

We consider a system where structural polymorphism suggests the possible existence of superconductivity through the implied structural instability. SrPd2Bi2 has two polymorphs, which can be controlled by the synthesis temperature: a tetragonal form (CaBe2Ge2-type) and a monoclinic form (BaAu2Sb2-type). Although the crystallographic difference between the two forms may, at first, seem trivial, we show that tetragonal SrPd2Bi2 is superconducting at 2.0 K, whereas monoclinic SrPd2Bi2 is not. We rationalize this finding and place it in context with other 1-2-2 phases.

Metal enrichment in the neutral gas of star-forming galaxies

NASA Astrophysics Data System (ADS)

Lebouteiller, V.; Kunth, D.; Désert, J.-M.; Thuan, T. X.

2009-05-01

We derive the chemical composition of the neutral gas in the blue compact dwarf (BCD) Pox 36 observed with FUSE. Metals (N, O, Ar, and Fe) are underabundant as compared to the ionized gas associated with H II regions by a factor ~7. The neutral gas, although it is not pristine, is thus probably less chemically evolved than the ionized gas. This could be due to different dispersal and mixing timescales. Results are compared to those of other BCDs observed with FUSE. The metallicity of the neutral gas in BCDs seems to reach a lower threshold of ~1/50Zsolar for extremely-metal poor galaxies.

Differentiation of animal fats from different origins: use of polymorphic features detected by Raman spectroscopy.

PubMed

Motoyama, Michiyo; Ando, Masahiro; Sasaki, Keisuke; Hamaguchi, Hiro-O

2010-11-01

Food safety requires the development of reliable techniques that ensure the origin of animal fats. In the present work, we try to verify the efficacy of using the polymorphic features of fats for discriminating animal-fat origins. We use Raman spectroscopy to collect the structural information of fat crystals. It is shown that a single Raman band at 1417 cm(-1) successfully differentiates pork fats from beef fats. This band is known to be characteristic of the β'-polymorph of fats. Pork fats show this band because they contain the β'-polymorph after rapid cooling to 0 °C. In beef-pork-fat mixtures, this band is not detected even in the presence of 50% pork fat; an addition of beef fat to pork fat is likely to produce a mixed fat with a completely different polymorphic behavior. This method seems to have the potential to detect beef products contaminated with pork-adipose tissue.

A systematic review and meta-analysis of MTHFR polymorphisms in methotrexate toxicity prediction in pediatric acute lymphoblastic leukemia.

PubMed

Lopez-Lopez, E; Martin-Guerrero, I; Ballesteros, J; Garcia-Orad, A

2013-12-01

Methotrexate (MTX) is an important component of therapy used to treat childhood acute lymphoblastic leukemia (ALL). Two single-nucleotide polymorphisms (SNPs) in the methylenetetrahydrofolate reductase (MTHFR) gene, C677T and A1298C, affect MTHFR activity. A large body of studies has investigated the potential role of MTHFR SNPs in MTX toxicity in pediatric ALL. However, the results are controversial. In this review and meta-analysis, we critically evaluate the relationship between the C677T and A1298C polymorphisms of MTHFR and MTX toxicity in pediatric ALL. The majority of published reports do not find associations between MTHFR polymorphisms and toxicity in pediatric ALL. When associations are reported, often the results are contradictory to each other. The meta-analysis confirms a lack of association. In conclusion, MTHFR, C677T and A1298C polymorphisms do not seem to be good markers of MTX-related toxicity in pediatric ALL.

Isolation and characterization of 30 microsatellite loci for Cunninghamia lanceolata (Taxodiaceae)1

PubMed Central

Wang, Si-Si; Zhang, Yang; Liu, De-Chen; Sun, Xiao-Wei; Wang, Rong; Li, Yuan-Yuan

2017-01-01

Premise of the study: To quantify the population-level genetic characteristics of Cunninghamia lanceolata (Taxodiaceae), an important timber conifer, we developed 30 pairs of microsatellite primers based on the nuclear genome. Methods and Results: Using the streptavidin-biotin capture system, we developed 14 polymorphic and 16 monomorphic microsatellites. Polymorphisms were detected in 14 loci using 94 individual trees that were collected from three C. lanceolata populations in Hubei and Zhejiang provinces and in Chongqing Municipality, China. There were three to 30 alleles per locus, and the observed and expected heterozygosities ranged from 0.0313–0.8333 and from 0.0313–0.9246, respectively. Cross-species amplification showed that two to seven polymorphic loci were functional in three of the five related species that were collected. Conclusions: Our newly developed microsatellite primers provide neutral molecular markers that are beneficial to future studies of population genetics and germplasm conservation of C. lanceolata. PMID:28989826

Discovery of Genome-Wide Microsatellite Markers in Scombridae: A Pilot Study on Albacore Tuna

PubMed Central

Nikolic, Natacha; Duthoy, Stéphanie; Destombes, Antoine; Bodin, Nathalie; West, Wendy; Puech, Alexis; Bourjea, Jérôme

2015-01-01

Recent developments in sequencing technologies and bioinformatics analysis provide a greater amount of DNA sequencing reads at a low cost. Microsatellites are the markers of choice for a variety of population genetic studies, and high quality markers can be discovered in non-model organisms, such as tuna, with these recent developments. Here, we use a high-throughput method to isolate microsatellite markers in albacore tuna, Thunnus alalunga, based on coupling multiplex enrichment and next-generation sequencing on 454 GS-FLX Titanium pyrosequencing. The crucial minimum number of polymorphic markers to infer evolutionary and ecological processes for this species has been described for the first time. We provide 1670 microsatellite design primer pairs, and technical and molecular genetics selection resulting in 43 polymorphic microsatellite markers. On this panel, we characterized 34 random and selectively neutral markers («neutral») and 9 «non-neutral» markers. The variability of «neutral» markers was screened with 136 individuals of albacore tuna from southwest Indian Ocean (42), northwest Indian Ocean (31), South Africa (31), and southeast Atlantic Ocean (32). Power analysis demonstrated that the panel of genetic markers can be applied in diversity and population genetics studies. Global genetic diversity for albacore was high with a mean number of alleles at 16.94; observed heterozygosity 66% and expected heterozygosity 77%. The number of individuals was insufficient to provide accurate results on differentiation. Of the 9 «non-neutral» markers, 3 were linked to a sequence of known function. The one is located to a sequence having an immunity function (ThuAla-Tcell-01) and the other to a sequence having energy allocation function (ThuAla-Hki-01). These two markers were genotyped on the 136 individuals and presented different diversity levels. ThuAla-Tcell-01 has a high number of alleles (20), heterozygosity (87–90%), and assignment index. ThuAla-Hki-01 has a lower number of alleles (9), low heterozygosity (24–27%), low assignment index and significant inbreeding. Finally, the 34 «neutral» and 3 «non-neutral» microsatellites markers were tested on four economically important Scombridae species—Thunnus albacares, Thunnus thynnus, Thunnus obesus, and Acanthocybium solandri. PMID:26544051

Single nucleotide polymorphisms/haplotypes associated with multiple rubella-specific immune response outcomes post-MMR immunization in healthy children.

PubMed

Ovsyannikova, Inna G; Salk, Hannah M; Larrabee, Beth R; Pankratz, V Shane; Poland, Gregory A

2015-10-01

The observed heterogeneity in rubella-specific immune response phenotypes post-MMR vaccination is thought to be explained, in part, by inter-individual genetic variation. In this study, single nucleotide polymorphisms (SNPs) and multiple haplotypes in several candidate genes were analyzed for associations with more than one rubella-specific immune response outcome, including secreted IFN-γ, secreted IL-6, and neutralizing antibody titers. Overall, we identified 23 SNPs in 10 different genes that were significantly associated with at least two rubella-specific immune responses. Of these SNPs, we detected eight in the PVRL3 gene, five in the PVRL1 gene, one in the TRIM22 gene, two in the IL10RB gene, two in the TLR4 gene, and five in other genes (PVR, ADAR, ZFP57, MX1, and BTN2A1/BTN3A3). The PVRL3 gene haplotype GACGGGGGCAGCAAAAAGAAGAGGAAAGAACAA was significantly associated with both higher IFN-γ secretion (t-statistic 4.43, p < 0.0001) and higher neutralizing antibody titers (t-statistic 3.14, p = 0.002). Our results suggest that there is evidence of multigenic associations among identified gene SNPs and that polymorphisms in these candidate genes contribute to the overall observed differences between individuals in response to live rubella virus vaccine. These results will aid our understanding of mechanisms behind rubella-specific immune response to MMR vaccine and influence the development of vaccines in the future.

Codon Usage Selection Can Bias Estimation of the Fraction of Adaptive Amino Acid Fixations.

PubMed

Matsumoto, Tomotaka; John, Anoop; Baeza-Centurion, Pablo; Li, Boyang; Akashi, Hiroshi

2016-06-01

A growing number of molecular evolutionary studies are estimating the proportion of adaptive amino acid substitutions (α) from comparisons of ratios of polymorphic and fixed DNA mutations. Here, we examine how violations of two of the model assumptions, neutral evolution of synonymous mutations and stationary base composition, affect α estimation. We simulated the evolution of coding sequences assuming weak selection on synonymous codon usage bias and neutral protein evolution, α = 0. We show that weak selection on synonymous mutations can give polymorphism/divergence ratios that yield α-hat (estimated α) considerably larger than its true value. Nonstationary evolution (changes in population size, selection, or mutation) can exacerbate such biases or, in some scenarios, give biases in the opposite direction, α-hat < α. These results demonstrate that two factors that appear to be prevalent among taxa, weak selection on synonymous mutations and non-steady-state nucleotide composition, should be considered when estimating α. Estimates of the proportion of adaptive amino acid fixations from large-scale analyses of Drosophila melanogaster polymorphism and divergence data are positively correlated with codon usage bias. Such patterns are consistent with α-hat inflation from weak selection on synonymous mutations and/or mutational changes within the examined gene trees. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Genome-wide signals of positive selection in human evolution

PubMed Central

Enard, David; Messer, Philipp W.; Petrov, Dmitri A.

2014-01-01

The role of positive selection in human evolution remains controversial. On the one hand, scans for positive selection have identified hundreds of candidate loci, and the genome-wide patterns of polymorphism show signatures consistent with frequent positive selection. On the other hand, recent studies have argued that many of the candidate loci are false positives and that most genome-wide signatures of adaptation are in fact due to reduction of neutral diversity by linked deleterious mutations, known as background selection. Here we analyze human polymorphism data from the 1000 Genomes Project and detect signatures of positive selection once we correct for the effects of background selection. We show that levels of neutral polymorphism are lower near amino acid substitutions, with the strongest reduction observed specifically near functionally consequential amino acid substitutions. Furthermore, amino acid substitutions are associated with signatures of recent adaptation that should not be generated by background selection, such as unusually long and frequent haplotypes and specific distortions in the site frequency spectrum. We use forward simulations to argue that the observed signatures require a high rate of strongly adaptive substitutions near amino acid changes. We further demonstrate that the observed signatures of positive selection correlate better with the presence of regulatory sequences, as predicted by the ENCODE Project Consortium, than with the positions of amino acid substitutions. Our results suggest that adaptation was frequent in human evolution and provide support for the hypothesis of King and Wilson that adaptive divergence is primarily driven by regulatory changes. PMID:24619126

Genome-Wide Association Study on the Development of Cross-Reactive Neutralizing Antibodies in HIV-1 Infected Individuals

PubMed Central

Euler, Zelda; van Gils, Marit J.; Boeser-Nunnink, Brigitte D.; Schuitemaker, Hanneke; van Manen, Daniëlle

2013-01-01

Broadly neutralizing antibodies may protect against HIV-1 acquisition. In natural infection, only 10–30% of patients have cross-reactive neutralizing humoral immunity which may relate to viral and or host factors. To explore the role of host genetic markers in the formation of cross-reactive neutralizing activity (CrNA) in HIV-1 infected individuals, we performed a genome-wide association study (GWAS), in participants of the Amsterdam Cohort Studies with known CrNA in their sera. Single-nucleotide polymorphisms (SNPs) with the strongest P-values are located in the major histocompatibility complex (MHC) region, close to MICA (P = 7.68×10−7), HLA-B (P = 6.96×10−6) and in the coding region of HCP5 (P = 1.34×10−5). However, none of the signals reached genome-wide significance. Our findings underline the potential involvement of genes close or within the MHC region with the development of CrNA. PMID:23372753

Quantifying evolutionary dynamics from variant-frequency time series

NASA Astrophysics Data System (ADS)

Khatri, Bhavin S.

2016-09-01

From Kimura’s neutral theory of protein evolution to Hubbell’s neutral theory of biodiversity, quantifying the relative importance of neutrality versus selection has long been a basic question in evolutionary biology and ecology. With deep sequencing technologies, this question is taking on a new form: given a time-series of the frequency of different variants in a population, what is the likelihood that the observation has arisen due to selection or neutrality? To tackle the 2-variant case, we exploit Fisher’s angular transformation, which despite being discovered by Ronald Fisher a century ago, has remained an intellectual curiosity. We show together with a heuristic approach it provides a simple solution for the transition probability density at short times, including drift, selection and mutation. Our results show under that under strong selection and sufficiently frequent sampling these evolutionary parameters can be accurately determined from simulation data and so they provide a theoretical basis for techniques to detect selection from variant or polymorphism frequency time-series.

Quantifying evolutionary dynamics from variant-frequency time series.

PubMed

Khatri, Bhavin S

2016-09-12

From Kimura's neutral theory of protein evolution to Hubbell's neutral theory of biodiversity, quantifying the relative importance of neutrality versus selection has long been a basic question in evolutionary biology and ecology. With deep sequencing technologies, this question is taking on a new form: given a time-series of the frequency of different variants in a population, what is the likelihood that the observation has arisen due to selection or neutrality? To tackle the 2-variant case, we exploit Fisher's angular transformation, which despite being discovered by Ronald Fisher a century ago, has remained an intellectual curiosity. We show together with a heuristic approach it provides a simple solution for the transition probability density at short times, including drift, selection and mutation. Our results show under that under strong selection and sufficiently frequent sampling these evolutionary parameters can be accurately determined from simulation data and so they provide a theoretical basis for techniques to detect selection from variant or polymorphism frequency time-series.

Extreme Conservation and Non-Neutral Evolution of the cpmA Circadian Locus in a Globally Distributed Chroococcidiopsis sp. from Naturally Stressful Habitats

PubMed Central

Dvornyk, Volodymyr; Jahan, Akhee Sabiha

2012-01-01

Cyanobacteria are among the most ancient organisms known to have circadian rhythms. The cpmA gene is involved in controlling the circadian output signal. We studied polymorphism and divergence of this gene in six populations of a stress-tolerant cyanobacterium, Chroococcidiopsis sp., sampled in extreme habitats across the globe. Despite high haplotype diversity (0.774), nucleotide diversity of cpmA is very low (π = 0.0034): the gene appears to be even more conserved than housekeeping genes. Even though the populations were sampled thousands kilometers apart, they manifested virtually no genetic differentiation at this locus (FST = 0.0228). Using various tests for neutrality, we determined that evolution of cpmA significantly departures from the neutral model and is governed by episodic positive selection. PMID:22844070

Resistin polymorphims, plasma resistin levels and obesity in Tunisian volunteers.

PubMed

Zayani, Nesrine; Hamdouni, Haithem; Boumaiza, Imen; Achour, Ons; Neffati, Fadoua; Omezzine, Asma; Najjar, Mohamed Fadhel; Bouslama, Ali

2018-02-01

Adipose tissue is an important endocrine organ that secretes a number of adipokines, like Resistin (RETN); it's an adipocytes-secreted cytokine and has been proposed as a link between obesity and diabetes. Many resistin gene polymorphisms were described and their implication in obesity was controversial. This study was to investigate the prevalence of single nucleotide polymorphisms (SNPs) in RETN gene 420C/G; 44G/A; 62G/A; 394C/G and 299 G/A and their association with Resistin level and obesity in Tunisian volunteers. We recruited 169 nonobese (mean age=42.16-14.26 years; mean body mass index [BMI]=24.51-3.69 kg/m 2 ) and 160 obese (mean age=47.86-11.17 years; mean BMI=36-4.78 kg/m 2 ). Genotyping was performed using polymerase chain reaction-restriction fragment length polymorphism. Anthropometric parameters, lipid levels, Glycemia and insulinemia were measured, BMI was calculated and insulinresistance was evaluated with the homeostasis model assessment insulin resistance (HOMA-IR) and resistin level was measured by ELISA. Statistical analyses were performed by SPSS19.0. After adjustment for confounding parameters; the Odds Ratio (OR) of obesity associated with mutated genotypes at 420C/G compared with normal genotype was as: OR=2.17; 95% CI [1.28-3.68], P=.004. The serum Resistin levels present no significant association with all RETN polymorphisms and it was significantly associated with BMI (P=.047). In our haplotype analysis, one haplotype seems to be protective and one other seems to be the highest risk to obesity. The 420 C/G Polymorphism were associated with obesity and Leptin concentration in our population. © 2017 Wiley Periodicals, Inc.

The effects of gender and COMT Val158Met polymorphism on fearful facial affect recognition: a fMRI study.

PubMed

Kempton, Matthew J; Haldane, Morgan; Jogia, Jigar; Christodoulou, Tessa; Powell, John; Collier, David; Williams, Steven C R; Frangou, Sophia

2009-04-01

The functional catechol-O-methyltransferase (COMT Val108/158Met) polymorphism has been shown to have an impact on tasks of executive function, memory and attention and recently, tasks with an affective component. As oestrogen reduces COMT activity, we focused on the interaction between gender and COMT genotype on brain activations during an affective processing task. We used functional MRI (fMRI) to record brain activations from 74 healthy subjects who engaged in a facial affect recognition task; subjects viewed and identified fearful compared to neutral faces. There was no main effect of the COMT polymorphism, gender or genotypexgender interaction on task performance. We found a significant effect of gender on brain activations in the left amygdala and right temporal pole, where females demonstrated increased activations over males. Within these regions, Val/Val carriers showed greater signal magnitude compared to Met/Met carriers, particularly in females. The COMT Val108/158Met polymorphism impacts on gender-related patterns of activation in limbic and paralimbic regions but the functional significance of any oestrogen-related COMT inhibition appears modest.

Artificial electromagnetism for neutral atoms: Escher staircase and Laughlin liquids

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mueller, Erich J.

2004-10-01

We present a method for creating fields that couple to neutral atoms in the same way that electromagnetic fields couple to charged particles. We show that this technique opens the door for a range of neutral atom experiments, including probing the interplay between periodic potentials and quantum Hall effects. Furthermore, we propose, and analyze, seemingly paradoxical geometries which can be engineered through these techniques. For example, we show how to create a ring of sites where an atom continuously reduces its potential energy by moving in a clockwise direction.

Non-rigid molecule of copper(II) diiminate Cu[CF3C(NH)C(F)C(NH)CF3]2, its conformational polymorphism in crystal and structure in solutions (Raman, UV-vis and quantum chemistry study)

NASA Astrophysics Data System (ADS)

Bukalov, Sergey S.; Aysin, Rinat R.; Leites, Larissa A.; Kurykin, Mikhail A.; Khrustalev, Victor N.

2015-10-01

Calculation of potential energy surface (PES) of isolated molecule of copper(II) diiminate Cu[CF3С(NH)C(F)C(NH)CF3]2 (1) resulted a double-well curve with the minima corresponding to equivalent screwed conformations. The low barrier leads to molecular non-rigidity which seems to be the reason of conformational polymorphism in crystals, reported in [1]. For one of newly found polymorphs, the X-ray structure was determined. The differences in the Raman and UV-vis spectra between differently colored species and their solutions were revealed, they are determined by different geometries of Cu(II) coordination polyhedron and different systems of intermolecular interactions in crystals. Transformations of the polymorphs under thermal, mechanical and photo exposures were studied.

BDNF Binds Its Pro-Peptide with High Affinity and the Common Val66Met Polymorphism Attenuates the Interaction

PubMed Central

Uegaki, Koichi; Kumanogoh, Haruko; Mizui, Toshiyuki; Hirokawa, Takatsugu; Ishikawa, Yasuyuki; Kojima, Masami

2017-01-01

Most growth factors are initially synthesized as precursors then cleaved into bioactive mature domains and pro-domains, but the biological roles of pro-domains are poorly understood. In the present study, we investigated the pro-domain (or pro-peptide) of brain-derived neurotrophic factor (BDNF), which promotes neuronal survival, differentiation and synaptic plasticity. The BDNF pro-peptide is a post-processing product of the precursor BDNF. Using surface plasmon resonance and biochemical experiments, we first demonstrated that the BDNF pro-peptide binds to mature BDNF with high affinity, but not other neurotrophins. This interaction was more enhanced at acidic pH than at neutral pH, suggesting that the binding is significant in intracellular compartments such as trafficking vesicles rather than the extracellular space. The common Val66Met BDNF polymorphism results in a valine instead of a methionine in the pro-domain, which affects human brain functions and the activity-dependent secretion of BDNF. We investigated the influence of this variation on the interaction between BDNF and the pro-peptide. Interestingly, the Val66Met polymorphism stabilized the heterodimeric complex of BDNF and its pro-peptide. Furthermore, compared with the Val-containing pro-peptide, the complex with the Met-type pro-peptide was more stable at both acidic and neutral pH, suggesting that the Val66Met BDNF polymorphism forms a more stable complex. A computational modeling provided an interpretation to the role of the Val66Met mutation in the interaction of BDNF and its pro-peptide. Lastly, we performed electrophysiological experiments, which indicated that the BDNF pro-peptide, when pre-incubated with BDNF, attenuated the ability of BDNF to inhibit hippocampal long-term depression (LTD), suggesting a possibility that the BDNF pro-peptide may interact directly with BDNF and thereby inhibit its availability. It was previously reported that the BDNF pro-domain exerts a chaperone-like function and assists the folding of the BDNF protein. However, our results suggest a new role for the BDNF pro-domain (or pro-peptide) following proteolytic cleave of precursor BDNF, and provide insight into the Val66Met polymorphism. PMID:28498321

Trans-species polymorphism at antimicrobial innate immunity cathelicidin genes of Atlantic cod and related species

PubMed Central

Árnason, Einar

2015-01-01

Natural selection, the most important force in evolution, comes in three forms. Negative purifying selection removes deleterious variation and maintains adaptations. Positive directional selection fixes beneficial variants, producing new adaptations. Balancing selection maintains variation in a population. Important mechanisms of balancing selection include heterozygote advantage, frequency-dependent advantage of rarity, and local and fluctuating episodic selection. A rare pathogen gains an advantage because host defenses are predominantly effective against prevalent types. Similarly, a rare immune variant gives its host an advantage because the prevalent pathogens cannot escape the host’s apostatic defense. Due to the stochastic nature of evolution, neutral variation may accumulate on genealogical branches, but trans-species polymorphisms are rare under neutrality and are strong evidence for balancing selection. Balanced polymorphism maintains diversity at the major histocompatibility complex (MHC) in vertebrates. The Atlantic cod is missing genes for both MHC-II and CD4, vital parts of the adaptive immune system. Nevertheless, cod are healthy in their ecological niche, maintaining large populations that support major commercial fisheries. Innate immunity is of interest from an evolutionary perspective, particularly in taxa lacking adaptive immunity. Here, we analyze extensive amino acid and nucleotide polymorphisms of the cathelicidin gene family in Atlantic cod and closely related taxa. There are three major clusters, Cath1, Cath2, and Cath3, that we consider to be paralogous genes. There is extensive nucleotide and amino acid allelic variation between and within clusters. The major feature of the results is that the variation clusters by alleles and not by species in phylogenetic trees and discriminant analysis of principal components. Variation within the three groups shows trans-species polymorphism that is older than speciation and that is suggestive of balancing selection maintaining the variation. Using Bayesian and likelihood methods positive and negative selection is evident at sites in the conserved part of the genes and, to a larger extent, in the active part which also shows episodic diversifying selection, further supporting the argument for balancing selection. PMID:26038731

[Cardiovascular Effects of Antidiabetic Therapies].

PubMed

Laubner, Katharina; Seufert, Jochen

2017-05-01

Type 2- diabetes mellitus (T2DM) represents a major risk factor for cardiovascular complications and mortality. Strict glucose control in the early course of the disease prevents cardiovascular complications only in the long run. Non-medical therapies (diet, exercise, body weight reduction) bear little evidence for positive cardiovascular effects.Bariatric surgery is not number one choice in therapy of T2DM. Metformin seems to provide positive cardiovascular effects. Insulin seems to be cardiovascular neutral, as well as the DPP4-inhibitors Saxagliptin, Sitagliptin and Alogliptin. Concerning GLP-1-RAs, Lixisenatide has a neutral cardiovascular effect, whereas Liraglutide and Semaglutide reduce cardiovascular outcomes. The SGLT2-inhibitor Empagliflozin reduces cardiovascular mortality, total mortality and hospitalization by heart failure. © Georg Thieme Verlag KG Stuttgart · New York.

Total Marketing: A Study of Image

DTIC Science & Technology

1990-08-01

marketing , and advertising are all successful in creating an initial awareness of the military. Potential recruits see recruiters at their schools, they...Direct mail marketing is impressive at first but soon wears out. It does not seem to provide new information. " Advertising , to the extent that it...awareness, current recruiting efforts net out as: Recruiter Contact - Negative Advertising - Neutral Direct Marketing - Neutral * 2. Recruitment Stage

Genotyping of presenilin-1 polymorphism in amyotrophic lateral sclerosis.

PubMed

Panas, M; Karadima, G; Kalfakis, N; Psarrou, O; Floroskoufi, P; Kladi, A; Petersen, M B; Vassilopoulos, D

2000-12-01

The mechanisms underlying motor neuron degeneration in amyotrophic lateral sclerosis are not fully understood. Recent studies suggest that apoptosis is involved in the abnormal neural death that occurs in this devastating disease. Presenilin-1, a transmembrane protein, seems to be implicated in apoptosis. To determine whether presenilin-1 intron 8 polymorphism has an influence in the course of amyotrophic lateral sclerosis, we examined this polymorphism genotypes in a large group of patients (n = 72) with amyotrophic lateral sclerosis and in a random sample of 213 healthy individuals. The results showed a significant difference in genotype (P < 0.04) and allele (P < 0.03) distribution between patients controls. These results suggest a possible intervention of presenilin-1 in the pathogenesis of amyotrophic lateral sclerosis.

Molecular evolution of the leptin exon 3 in some species of the family Canidae.

PubMed

Chmurzynska, Agata; Zajac, Magdalena; Switonski, Marek

2003-01-01

The structure of the leptin gene seems to be well conserved. The polymorphism of this gene in four species belonging to the Canidae family (the dog (Canis familiaris)--16 different breeds, the Chinese racoon dog (Nyctereutes procyonoides procyonoides), the red fox (Vulpes vulpes) and the arctic fox (Alopex lagopus)) were studied with the use of single strand conformation polymorphism (SSCP), restriction fragment length polymorphism (RFLP) and DNA sequencing techniques. For exon 2, all species presented the same SSCP pattern, while in exon 3 some differences were found. DNA sequencing of exon 3 revealed the presence of six nucleotide substitutions, differentiating the studied species. Three of them cause amino acid substitutions as well. For all dog breeds studied, SSCP patterns were identical.

Selective Strolls: Fixation and Extinction in Diploids Are Slower for Weakly Selected Mutations Than for Neutral Ones.

PubMed

Mafessoni, Fabrizio; Lachmann, Michael

2015-12-01

In finite populations, an allele disappears or reaches fixation due to two main forces, selection and drift. Selection is generally thought to accelerate the process: a selected mutation will reach fixation faster than a neutral one, and a disadvantageous one will quickly disappear from the population. We show that even in simple diploid populations, this is often not true. Dominance and recessivity unexpectedly slow down the evolutionary process for weakly selected alleles. In particular, slightly advantageous dominant and mildly deleterious recessive mutations reach fixation slightly more slowly than neutral ones (at most 5%). This phenomenon determines genetic signatures opposite to those expected under strong selection, such as increased instead of decreased genetic diversity around the selected site. Furthermore, we characterize a new phenomenon: mildly deleterious recessive alleles, thought to represent a wide fraction of newly arising mutations, on average survive in a population slightly longer than neutral ones, before getting lost. Consequently, these mutations are on average slightly older than neutral ones, in contrast with previous expectations. Furthermore, they slightly increase the amount of weakly deleterious polymorphisms, as a consequence of the longer unconditional sojourn times compared to neutral mutations. Copyright © 2015 by the Genetics Society of America.

Methylenetetrahydrofolate reductase C677T and A1298C gene polymorphisms and therapy-related toxicity in children treated for acute lymphoblastic leukemia and non-Hodgkin lymphoma.

PubMed

Kantar, Mehmet; Kosova, Buket; Cetingul, Nazan; Gumus, Sevinc; Toroslu, Ertug; Zafer, Nur; Topcuoglu, Nejat; Aksoylar, Serap; Cinar, Mehtap; Tetik, Asli; Eroglu, Zuhal

2009-06-01

This study aimed to investigate the association of the methylenetetrahydrofolate reductase (MTHFR) gene C677T and A1298C polymorphisms with serum drug levels and toxicities after high-dose methotrexate (MTX) infusion. The study included 37 children with acute lymphoblastic leukemia or non-Hodgkin lymphoma. Serum MTX levels and toxicities of bone marrow, liver and kidney were analysed. Genotype analysis of the C677T and A1298C gene polymorphisms from genomic DNA of the subjects was performed by real-time PCR. Subjects with MTHFR polymorphism for C677T (CT, TT) had significantly higher MTX levels at 24 h (p = 0.009), and these genotypes did not seem to cause toxicity. Subjects with MTHFR polymorphism for A1298C (AC, CC) had significantly higher MTX levels at 48 h (p = 0.02), and had more grade III/IV anemia (p = 0.02), thrombocytopenia (p = 0.0001), elevated AST levels (p = 0.04) and frequent febrile neutropenic episodes (p = 0.004). The present study suggests that A1298C gene, but not C677T polymorphism is associated with MTX-related toxicity.

Endometriosis and RAS system gene polymorphisms: the association of ACE A2350G polymorphism with endometriosis in Polish individuals.

PubMed

Kowalczyńska, Liliana J; Ferenc, Tomasz; Wojciechowski, Michał; Mordalska, Anna; Pogoda, Krzysztof; Malinowski, Andrzej

2014-05-01

To analyze the polymorphisms of angiotensin I converting enzyme (ACE) gene (insertion/deletion [I/D], A2350G) and angiotensin II type 1 receptor gene (A1166C) in women with endometriosis and to determine the correlation of the identified genotypes with the severity of the disease. Additionally, to estimate the prognostic value of the polymorphisms in patients with endometriosis treated due to infertility. The study group included 241 women, the control group (without endometriosis)-127. The molecular analysis was performed by polymerase chain reaction (PCR) and PCR-restriction fragment length polymorphism technique. For I/D ACE and A1166C AT1 polymorphisms no significant differences were observed between the study and control groups and between the severity grades of the disease (p>0.05). For A2350G ACE polymorphism the frequency of genotypes for the study and control groups respectively was the following: AA-31.54%, AG-54.36%, GG-14.11% and AA-55.12%, AG-36.22%, GG-8.66% (x(2)=19.36, p<0.0001). Statistically significant differences were found between the frequency of A and G alleles between both groups (x(2)=15.16, p=0.0001), but not when individual grades of the disease severity were compared. There was no association between the investigated polymorphisms and the effect of infertility treatment. A2350G polymorphism (allele G, AG genotype) of ACE gene seems to be associated with the development of endometriosis.

Immunoglobulin GM and KM genes and measles vaccine-induced humoral immunity.

PubMed

Ovsyannikova, Inna G; Larrabee, Beth R; Schaid, Daniel J; Poland, Gregory A

2017-10-04

Identifying genetic polymorphisms that explain variations in humoral immunity to live measles virus vaccine is of great interest. Immunoglobulin GM (heavy chain) and KM (light chain) allotypes are genetic markers known to be associated with susceptibility to several infectious diseases. We assessed associations between GM and KM genotypes and measles vaccine humoral immunity (neutralizing antibody titers) in a combined cohort (n=1796) of racially diverse healthy individuals (age 18-41years). We did not discover any significant associations between GM and/or KM genotypes and measles vaccine-induced neutralizing antibody titers. African-American subjects had higher neutralizing antibody titers than Caucasians (1260mIU/mL vs. 740mIU/mL, p=7.10×10 -13 ), and those titers remained statistically significant (p=1.68×10 -09 ) after adjusting for age at enrollment and time since last vaccination. There were no statistically significant sex-specific differences in measles-induced neutralizing antibody titers in our study (p=0.375). Our data indicate a surprising lack of evidence for an association between GM and KM genotypes and measles-specific neutralizing antibody titers, despite the importance of these immune response genes. Copyright © 2017 Elsevier Ltd. All rights reserved.

Gene Presence-Absence Polymorphism in Castrating Anther-Smut Fungi: Recent Gene Gains and Phylogeographic Structure.

PubMed

Hartmann, Fanny E; Rodríguez de la Vega, Ricardo C; Brandenburg, Jean-Tristan; Carpentier, Fantin; Giraud, Tatiana

2018-04-01

Gene presence-absence polymorphisms segregating within species are a significant source of genetic variation but have been little investigated to date in natural populations. In plant pathogens, the gain or loss of genes encoding proteins interacting directly with the host, such as secreted proteins, probably plays an important role in coevolution and local adaptation. We investigated gene presence-absence polymorphism in populations of two closely related species of castrating anther-smut fungi, Microbotryum lychnidis-dioicae (MvSl) and M. silenes-dioicae (MvSd), from across Europe, on the basis of Illumina genome sequencing data and high-quality genome references. We observed presence-absence polymorphism for 186 autosomal genes (2% of all genes) in MvSl, and only 51 autosomal genes in MvSd. Distinct genes displayed presence-absence polymorphism in the two species. Genes displaying presence-absence polymorphism were frequently located in subtelomeric and centromeric regions and close to repetitive elements, and comparison with outgroups indicated that most were present in a single species, being recently acquired through duplications in multiple-gene families. Gene presence-absence polymorphism in MvSl showed a phylogeographic structure corresponding to clusters detected based on SNPs. In addition, gene absence alleles were rare within species and skewed toward low-frequency variants. These findings are consistent with a deleterious or neutral effect for most gene presence-absence polymorphism. Some of the observed gene loss and gain events may however be adaptive, as suggested by the putative functions of the corresponding encoded proteins (e.g., secreted proteins) or their localization within previously identified selective sweeps. The adaptive roles in plant and anther-smut fungi interactions of candidate genes however need to be experimentally tested in future studies.

Gene Presence–Absence Polymorphism in Castrating Anther-Smut Fungi: Recent Gene Gains and Phylogeographic Structure

PubMed Central

Rodríguez de la Vega, Ricardo C; Brandenburg, Jean-Tristan; Carpentier, Fantin; Giraud, Tatiana

2018-01-01

Abstract Gene presence–absence polymorphisms segregating within species are a significant source of genetic variation but have been little investigated to date in natural populations. In plant pathogens, the gain or loss of genes encoding proteins interacting directly with the host, such as secreted proteins, probably plays an important role in coevolution and local adaptation. We investigated gene presence–absence polymorphism in populations of two closely related species of castrating anther-smut fungi, Microbotryum lychnidis-dioicae (MvSl) and M. silenes-dioicae (MvSd), from across Europe, on the basis of Illumina genome sequencing data and high-quality genome references. We observed presence–absence polymorphism for 186 autosomal genes (2% of all genes) in MvSl, and only 51 autosomal genes in MvSd. Distinct genes displayed presence–absence polymorphism in the two species. Genes displaying presence–absence polymorphism were frequently located in subtelomeric and centromeric regions and close to repetitive elements, and comparison with outgroups indicated that most were present in a single species, being recently acquired through duplications in multiple-gene families. Gene presence–absence polymorphism in MvSl showed a phylogeographic structure corresponding to clusters detected based on SNPs. In addition, gene absence alleles were rare within species and skewed toward low-frequency variants. These findings are consistent with a deleterious or neutral effect for most gene presence–absence polymorphism. Some of the observed gene loss and gain events may however be adaptive, as suggested by the putative functions of the corresponding encoded proteins (e.g., secreted proteins) or their localization within previously identified selective sweeps. The adaptive roles in plant and anther-smut fungi interactions of candidate genes however need to be experimentally tested in future studies. PMID:29722826

An innovative way to highlight the power of each polymorphism on elite athletes phenotype expression.

PubMed

Contrò, Valentina; Schiera, Gabriella; Abbruzzo, Antonino; Bianco, Antonino; Amato, Alessandra; Sacco, Alessia; Macchiarella, Alessandra; Palma, Antonio; Proia, Patrizia

2018-01-12

The purpose of this study was to determine the probability of soccer players having the best genetic background that could increase performance, evaluating the polymorphism that are considered Performance Enhancing Polymorphism (PEPs) distributed on five genes: PPARα, PPARGC1A, NRF2, ACE e CKMM. Particularly, we investigated how each polymorphism works directly or through another polymorphism to distinguish elite athletes from non-athletic population. Sixty professional soccer players (age 22.5 ± 2.2) and sixty healthy volunteers (age 21.2± 2.3) were enrolled. Samples of venous blood was used to prepare genomic DNA. The polymorphic sites were scanned using PCR-RFLP protocols with different enzyme. We used a multivariate logistic regression analysis to demonstrate an association between the five PEPs and elite phenotype. We found statistical significance in NRF2 (AG/GG genotype) polymorphism/soccer players association (p < 0.05) as well as a stronger association in ACE polymorphism (p =0.02). Particularly, we noticed that the ACE ID genotype and even more the II genotype are associated with soccer player phenotype. Although the other PEPs had no statistical significance, we proved that some of these may work indirectly, amplifying the effect of another polymorphism; for example, seems that PPARα could acts on NRF2 (GG) enhancing the effect of the latter, notwithstanding it had not shown a statistical significance. In conclusion, to establish if a polymorphism can influence the performance, it is necessary to understand how they act and interact, directly and indirectly, on each other.

Susceptibility to breast cancer and three polymorphisms of GSTZ1.

PubMed

Saadat, Iraj; Khalili, Maryam; Nafissi, Samane; Omidvari, Shahpour; Saadat, Mostafa

2012-03-01

Glutathione S-transferases class zeta (GSTζ) is involved in the detoxification of xenobiotic compounds and catalyzes the biotransformation of a variety of α-haloacids including dichloroacetic acid and chlorofluoroacetic acid. It has been reported that, in mice, deficiency of Gstz1 (a member of GSTζ) resulted in the generation of a constant level of oxidative stress. The present study was carried out to investigate the association between genetic polymorphisms of GSTZ1 (in promoter site G-1002A and in coding sites Glu32Lys and Gly42Arg) and risk of breast cancer. We included 106 females with breast cancer and 106 healthy females frequency matched for age. The study polymorphisms were not associated with risk of breast cancer (p>0.05). The polymorphisms of GSTZ1 showed strong linkage disequilibrium among cancer patients and control subjects (p<0.0001). There was no significant difference between cancer patients and controls for frequencies of the GSTZ1 haplotypes (p>0.05). It seems there is no meaningful relationship between the genetic polymorphisms of GSTZ1 and risk of breast cancer.

The Collision of Plausibility with Reality: Lifting the Veil of the Ethical Neutrality of Technology

ERIC Educational Resources Information Center

Borgmann, Albert

2012-01-01

Technology, thought of as the ensemble of utilities and devices and of their impact on our lives, proceeds in steps, each of which seems plausible. This kind of development also encourages the view that technology is value-neutral. It always can be used both for good and ill, and we decide how to use it. The production of food and the development…

Polymorphisms in monolignol biosynthetic genes are associated with biomass yield and agronomic traits in European maize (Zea mays L.).

PubMed

Chen, Yongsheng; Zein, Imad; Brenner, Everton Alen; Andersen, Jeppe Reitan; Landbeck, Mathias; Ouzunova, Milena; Lübberstedt, Thomas

2010-01-15

Reduced lignin content leads to higher cell wall digestibility and, therefore, better forage quality and increased conversion of lignocellulosic biomass into ethanol. However, reduced lignin content might lead to weaker stalks, lodging, and reduced biomass yield. Genes encoding enzymes involved in cell wall lignification have been shown to influence both cell wall digestibility and yield traits. In this study, associations between monolignol biosynthetic genes and plant height (PHT), days to silking (DTS), dry matter content (DMC), and dry matter yield (DMY) were identified by using a panel of 39 European elite maize lines. In total, 10 associations were detected between polymorphisms or tight linkage disequilibrium (LD) groups within the COMT, CCoAOMT2, 4CL1, 4CL2, F5H, and PAL genomic fragments, respectively, and the above mentioned traits. The phenotypic variation explained by these polymorphisms or tight LD groups ranged from 6% to 25.8% in our line collection. Only 4CL1 and F5H were found to have polymorphisms associated with both yield and forage quality related characters. However, no pleiotropic polymorphisms affecting both digestibility of neutral detergent fiber (DNDF), and PHT or DMY were discovered, even under less stringent statistical conditions. Due to absence of pleiotropic polymorphisms affecting both forage yield and quality traits, identification of optimal monolignol biosynthetic gene haplotype(s) combining beneficial quantitative trait polymorphism (QTP) alleles for both quality and yield traits appears possible within monolignol biosynthetic genes. This is beneficial to maximize forage and bioethanol yield per unit land area.

Polymorphisms in monolignol biosynthetic genes are associated with biomass yield and agronomic traits in European maize (Zea mays L.)

PubMed Central

2010-01-01

Background Reduced lignin content leads to higher cell wall digestibility and, therefore, better forage quality and increased conversion of lignocellulosic biomass into ethanol. However, reduced lignin content might lead to weaker stalks, lodging, and reduced biomass yield. Genes encoding enzymes involved in cell wall lignification have been shown to influence both cell wall digestibility and yield traits. Results In this study, associations between monolignol biosynthetic genes and plant height (PHT), days to silking (DTS), dry matter content (DMC), and dry matter yield (DMY) were identified by using a panel of 39 European elite maize lines. In total, 10 associations were detected between polymorphisms or tight linkage disequilibrium (LD) groups within the COMT, CCoAOMT2, 4CL1, 4CL2, F5H, and PAL genomic fragments, respectively, and the above mentioned traits. The phenotypic variation explained by these polymorphisms or tight LD groups ranged from 6% to 25.8% in our line collection. Only 4CL1 and F5H were found to have polymorphisms associated with both yield and forage quality related characters. However, no pleiotropic polymorphisms affecting both digestibility of neutral detergent fiber (DNDF), and PHT or DMY were discovered, even under less stringent statistical conditions. Conclusion Due to absence of pleiotropic polymorphisms affecting both forage yield and quality traits, identification of optimal monolignol biosynthetic gene haplotype(s) combining beneficial quantitative trait polymorphism (QTP) alleles for both quality and yield traits appears possible within monolignol biosynthetic genes. This is beneficial to maximize forage and bioethanol yield per unit land area. PMID:20078869

Positive selection drives the evolution of a major histocompatibility complex gene in an endangered Mexican salamander species complex.

PubMed

Tracy, Karen E; Kiemnec-Tyburczy, Karen M; DeWoody, J Andrew; Parra-Olea, Gabriela; Zamudio, Kelly R

2015-06-01

Immune gene evolution can be critical to species survival in the face of infectious disease. In particular, polymorphism in the genes of the major histocompatibility complex (MHC) helps vertebrates combat novel and diverse pathogens by increasing the number of pathogen-derived proteins that can initiate the host's acquired immune response. In this study, we used a combination of presumably adaptive and neutral markers to investigate MHC evolution in populations of five salamander species within the Ambystoma velasci complex, a group consisting of 15 recently diverged species, several of which are endangered. We isolated 31 unique MHC class II β alleles from 75 total individuals from five species in this complex. MHC heterozygosity was significantly lower than expected for all five species, and we found no clear relationship between number of MHC alleles and species range, life history, or level of heterozygosity. We inferred a phylogeny representing the evolutionary history of Ambystoma MHC, with which we found signatures of positive selection on the overall gene, putative peptide-binding residues, and allelic lineages. We identified several instances of trans-species polymorphism, a hallmark of balancing selection observed in other groups of closely related species. In contrast, we did not detect comparable allelic diversity or signatures of selection on neutral loci. Additionally, we identified 17 supertypes among the 44 unique Ambystoma alleles, indicating that these sequences may encode functionally distinct MHC variants. We therefore have strong evidence that positive selection is a major evolutionary force driving patterns of MHC polymorphism in this recently radiated species complex.

A Neutrality Test for Detecting Selection on DNA Methylation Using Single Methylation Polymorphism Frequency Spectrum

PubMed Central

Wang, Jun; Fan, Chuanzhu

2015-01-01

Inheritable epigenetic mutations (epimutations) can contribute to transmittable phenotypic variation. Thus, epimutations can be subject to natural selection and impact the fitness and evolution of organisms. Based on the framework of the modified Tajima’s D test for DNA mutations, we developed a neutrality test with the statistic “Dm” to detect selection forces on DNA methylation mutations using single methylation polymorphisms. With computer simulation and empirical data analysis, we compared the Dm test with the original and modified Tajima’s D tests and demonstrated that the Dm test is suitable for detecting selection on epimutations and outperforms original/modified Tajima’s D tests. Due to the higher resetting rate of epimutations, the interpretation of Dm on epimutations and Tajima’s D test on DNA mutations could be different in inferring natural selection. Analyses using simulated and empirical genome-wide polymorphism data suggested that genes under genetic and epigenetic selections behaved differently. We applied the Dm test to recently originated Arabidopsis and human genes, and showed that newly evolved genes contain higher level of rare epialleles, suggesting that epimutation may play a role in origination and evolution of genes and genomes. Overall, we demonstrate the utility of the Dm test to detect whether the loci are under selection regarding DNA methylation. Our analytical metrics and methodology could contribute to our understanding of evolutionary processes of genes and genomes in the field of epigenetics. The Perl script for the “Dm” test is available at http://fanlab.wayne.edu/ (last accessed December 18, 2014). PMID:25539727

Genetic diversity of the HLA-G coding region in Amerindian populations from the Brazilian Amazon: a possible role of natural selection.

PubMed

Mendes-Junior, C T; Castelli, E C; Meyer, D; Simões, A L; Donadi, E A

2013-12-01

HLA-G has an important role in the modulation of the maternal immune system during pregnancy, and evidence that balancing selection acts in the promoter and 3'UTR regions has been previously reported. To determine whether selection acts on the HLA-G coding region in the Amazon Rainforest, exons 2, 3 and 4 were analyzed in a sample of 142 Amerindians from nine villages of five isolated tribes that inhabit the Central Amazon. Six previously described single-nucleotide polymorphisms (SNPs) were identified and the Expectation-Maximization (EM) and PHASE algorithms were used to computationally reconstruct SNP haplotypes (HLA-G alleles). A new HLA-G allele, which originated in Amerindian populations by a crossing-over event between two widespread HLA-G alleles, was identified in 18 individuals. Neutrality tests evidenced that natural selection has a complex part in the HLA-G coding region. Although balancing selection is the type of selection that shapes variability at a local level (Native American populations), we have also shown that purifying selection may occur on a worldwide scale. Moreover, the balancing selection does not seem to act on the coding region as strongly as it acts on the flanking regulatory regions, and such coding signature may actually reflect a hitchhiking effect.

Interferon lambda 4 (IFNL4) gene polymorphism is associated with spontaneous clearance of HCV in HIV-1 positive patients.

PubMed

Alves, Camila Fernanda da Silveira; Grott, Camila Schultz; Lunge, Vagner Ricardo; Béria, Jorge Umberto; Tietzmann, Daniela Cardoso; Stein, Airton Tetelbom; Simon, Daniel

2016-01-01

Approximately one-third of the individuals infected with human immunodeficiency virus type 1 (HIV-1) are co-infected with hepatitis C virus (HCV). Co-infected patients have an increased risk for developing end-stage liver diseases. Variants upstream of the IFNL3 gene have been associated with spontaneous and treatment-induced clearance of HCV infection. Recently, a novel polymorphism was discovered, denoted IFNL4 ΔG > TT (rs368234815), which seems to be a better predictor of spontaneous clearance than the IFNL4 rs12979860 polymorphism. We aimed to determine the prevalence of the IFNL4 ΔG > TT variants and to evaluate the association with spontaneous clearance of HCV infection in Brazilian HIV-1 patients. The IFNL4 ΔG > TT genotypes were analyzed by polymerase chain reaction followed by restriction digestion in 138 HIV-1 positive patients who had an anti-HCV positive result. Spontaneous clearance of HCV was observed in 34 individuals (24.6%). IFNL4 genotype distribution was significantly different between individuals who had spontaneous clearance and chronic HCV patients (p=0.002). The probability of spontaneous clearance of HCV infection for patients with the IFNL4 TT/TT genotype was 3.6 times higher than for patients carrying the IFNL4 ΔG allele (OR=3.63, 95% CI:1.51-8.89, p=0.001). The IFNL4 ΔG > TT polymorphism seems to be better than IFNL4 rs12979860 to predict spontaneous clearance of the HCV in Brazilian HIV-1 positive patients.

Interferon lambda 4 (IFNL4) gene polymorphism is associated with spontaneous clearance of HCV in HIV-1 positive patients

PubMed Central

Alves, Camila Fernanda da Silveira; Grott, Camila Schultz; Lunge, Vagner Ricardo; Béria, Jorge Umberto; Tietzmann, Daniela Cardoso; Stein, Airton Tetelbom; Simon, Daniel

2016-01-01

Abstract Approximately one-third of the individuals infected with human immunodeficiency virus type 1 (HIV-1) are co-infected with hepatitis C virus (HCV). Co-infected patients have an increased risk for developing end-stage liver diseases. Variants upstream of the IFNL3 gene have been associated with spontaneous and treatment-induced clearance of HCV infection. Recently, a novel polymorphism was discovered, denoted IFNL4 ΔG > TT (rs368234815), which seems to be a better predictor of spontaneous clearance than the IFNL4 rs12979860 polymorphism. We aimed to determine the prevalence of the IFNL4 ΔG > TT variants and to evaluate the association with spontaneous clearance of HCV infection in Brazilian HIV-1 patients. The IFNL4 ΔG > TT genotypes were analyzed by polymerase chain reaction followed by restriction digestion in 138 HIV-1 positive patients who had an anti-HCV positive result. Spontaneous clearance of HCV was observed in 34 individuals (24.6%). IFNL4 genotype distribution was significantly different between individuals who had spontaneous clearance and chronic HCV patients (p=0.002). The probability of spontaneous clearance of HCV infection for patients with the IFNL4 TT/TT genotype was 3.6 times higher than for patients carrying the IFNL4 ΔG allele (OR=3.63, 95% CI:1.51-8.89, p=0.001). The IFNL4 ΔG > TT polymorphism seems to be better than IFNL4 rs12979860 to predict spontaneous clearance of the HCV in Brazilian HIV-1 positive patients. PMID:27560987

Molecular evolution of the leptin exon 3 in some species of the family Canidae

PubMed Central

Chmurzynska, Agata; Zajac, Magdalena; Switonski, Marek

2003-01-01

The structure of the leptin gene seems to be well conserved. The polymorphism of this gene in four species belonging to the Canidae family (the dog (Canis familiaris) – 16 different breeds, the Chinese racoon dog (Nyctereutes procyonoides procyonoides), the red fox (Vulpes vulpes) and the arctic fox (Alopex lagopus)) were studied with the use of single strand conformation polymorphism (SSCP), restriction fragment length polymorphism (RFLP) and DNA sequencing techniques. For exon 2, all species presented the same SSCP pattern, while in exon 3 some differences were found. DNA sequencing of exon 3 revealed the presence of six nucleotide substitutions, differentiating the studied species. Three of them cause amino acid substitutions as well. For all dog breeds studied, SSCP patterns were identical. PMID:12939206

Electrostatic control of phospholipid polymorphism.

PubMed

Tarahovsky, Y S; Arsenault, A L; MacDonald, R C; McIntosh, T J; Epand, R M

2000-12-01

A regular progression of polymorphic phase behavior was observed for mixtures of the anionic phospholipid, cardiolipin, and the cationic phospholipid derivative, 1, 2-dioleoyl-sn-glycero-3-ethylphosphocholine. As revealed by freeze-fracture electron microscopy and small-angle x-ray diffraction, whereas the two lipids separately assume only lamellar phases, their mixtures exhibit a symmetrical (depending on charge ratio and not polarity) sequence of nonlamellar phases. The inverted hexagonal phase, H(II,) formed from equimolar mixtures of the two lipids, i.e., at net charge neutrality (charge ratio (CR((+/-))) = 1:1). When one type of lipid was in significant excess (CR((+/-)) = 2:1 or CR((+/-)) = 1:2), a bicontinuous cubic structure was observed. These cubic phases were very similar to those sometimes present in cellular organelles that contain cardiolipin. Increasing the excess of cationic or anionic charge to CR((+/-)) = 4:1 or CR((+/-)) = 1:4 led to the appearance of membrane bilayers with numerous interlamellar contacts, i.e., sponge structures. It is evident that interactions between cationic and anionic moieties can influence the packing of polar heads and hence control polymorphic phase transitions. The facile isothermal, polymorphic interconversion of these lipids may have important biological and technical implications.

Signatures of Sex-Antagonistic Selection on Recombining Sex Chromosomes

PubMed Central

Kirkpatrick, Mark; Guerrero, Rafael F.

2014-01-01

Sex-antagonistic (SA) selection has major evolutionary consequences: it can drive genomic change, constrain adaptation, and maintain genetic variation for fitness. The recombining (or pseudoautosomal) regions of sex chromosomes are a promising setting in which to study SA selection because they tend to accumulate SA polymorphisms and because recombination allows us to deploy the tools of molecular evolution to locate targets of SA selection and quantify evolutionary forces. Here we use coalescent models to characterize the patterns of polymorphism expected within and divergence between recombining X and Y (or Z and W) sex chromosomes. SA selection generates peaks of divergence between X and Y that can extend substantial distances away from the targets of selection. Linkage disequilibrium between neutral sites is also inflated. We show how the pattern of divergence is altered when the SA polymorphism or the sex-determining region was recently established. We use data from the flowering plant Silene latifolia to illustrate how the strength of SA selection might be quantified using molecular data from recombining sex chromosomes. PMID:24578352

Is M235T polymorphism of the angiotensinogen gene involved in the development of endometriosis?

PubMed

Kowalczyńska, Liliana J; Ferenc, Tomasz; Wojciechowski, Michał; Mordalska, Anna; Pogoda, Krzysztof; Malinowski, Andrzej

2017-01-01

The aim of the study was to analyze the M235T polymorphism of the angiotensinogen (AGT) gene in women with endometriosis and to identify correlations between identified genotypes and the disease progression, its stage and clinical course as well as to evaluate the prognostic value of the investigated polymorphism in patients with endometriosis treated for infertility. The study group consisted of 241 women with minimal to severe stage of endometriosis, the control group (without endometriosis) - 127. The molecular analysis was performed by PCR-RFLP technique. The analysis of the frequency of genotypes and alleles of M235T polymorphism showed no significant differences between the study and the control groups and between the severity grades of the disease (p > 0.05). No such differences were reported in the case of different localizations of the disease lesions, either. Evaluation of the correlations related to pain accompanying endometriosis did not demonstrate association with any genotypes of the analyzed AGT gene poly-morphism. Comparison of the results obtained in the group in which infertility treatment was successful (n = 54) and in those who failed to conceive (n = 73) did not show the correlation between the investigated polymorphism and the effect of infertility treatment. M235T polymorphism of the AGT gene seems unrelated to the development or the clinical course of en-dometriosis. No prognostic value has been found of the investigated polymorphism in predicting the effects of infertility treatment in women with endometriosis.

Vitamin D pathway gene polymorphisms affecting daclatasvir plasma concentration at 2 weeks and 1 month of therapy.

PubMed

Cusato, Jessica; Nicolò, Amedeo De; Boglione, Lucio; Favata, Fabio; Ariaudo, Alessandra; Pinna, Simone Mornese; Carcieri, Chiara; Guido, Federica; Cariti, Giuseppe; Perri, Giovanni Di; D'Avolio, Antonio

2018-06-01

Vitamin D (VD) influences genetic expression through its receptor (VDR). VD pathway gene polymorphisms seem to influence antiviral drug pharmacokinetics and therapeutic outcome/toxicity. We investigated the association between daclatasvir (DCV) plasma concentrations and genetic variants (SNPs) associated with the VD pathway. Chronic hepatitis C patients treated with DCV from 2014 to 2016 were included. Genotypes were assessed through real-time PCR and plasma concentrations through liquid chromatography. A total of 52 patients were analyzed. DCV levels were influenced by CYP24A1 rs2248359T>C polymorphism at 2 weeks and VDR Cdx2 A>G at 1 month of treatment. Linear regression analysis showed baseline BMI, alanine aminotransferase and hematocrit as significant predictors of DCV concentrations at 2 weeks, BMI and hematocrit at baseline, VDR Cdx2 AG/GG and FokI TC/CC at 1 month. These results showed a possible role of VD pathway gene polymorphisms in influencing DCV plasma concentrations, but further studies are required.

Genetic polymorphisms of Interleukin-18 are not associated with allograft function in kidney transplant recipients.

PubMed

do Nascimento, Wenna Gleyce Araújo; Cilião, Daiani Alves; Genre, Julieta; Gondim, Dikson Dibe; Alves, Renata Gomes; Hassan, Neife Deghaide; Lima, Francisco Pignataro; Pereira, Maurício Galvão; Donadi, Eduardo Antônio; de Oliveira Crispim, Janaina Cristiana

2014-06-01

Interleukin 18 (IL-18) is a proinflammatory cytokine that plays a role in host defense by upregulating both innate and acquired immune responses. Analysis of IL18 polymorphisms may be clinically important since their roles have been recognized in a variety of inflammatory and autoimmune disorders. However, the role of this cytokine polymorphisms in kidney transplant still remains unclear. In this study, we evaluated the associations between IL18 polymorphisms and graft function assessed by creatinine clearance in kidney transplant recipients. A total of 82 kidney transplant recipients and 183 healthy controls were enrolled, and frequencies of alleles, genotypes and haplotypes for IL18 polymorphisms were determined and compared with creatinine clearance. The -607C/A (rs1946518) and -137C/G (rs187238) variant alleles in the IL18 gene were determined by polymerase chain reaction. In our study, no significant association was found between the IL18 variants and creatinine clearance (p > 0.05). Nonetheless, polymorphism analysis revealed an increase in the frequency of the IL18 major haplotype -607C/-137G in kidney transplant patients (odds ratio 2.57, 95% confidence interval 1.45-4.55, p = 0.0014). Finally, we found that IL18 polymorphisms did not influence the renal function and that IL18 haplotype -607C/-137G seems to be associated with kidney transplant recipients.

Genetic polymorphisms of Interleukin-18 are not associated with allograft function in kidney transplant recipients

PubMed Central

do Nascimento, Wenna Gleyce Araújo; Cilião, Daiani Alves; Genre, Julieta; Gondim, Dikson Dibe; Alves, Renata Gomes; Hassan, Neife Deghaide; Lima, Francisco Pignataro; Pereira, Maurício Galvão; Donadi, Eduardo Antônio; de Oliveira Crispim, Janaina Cristiana

2014-01-01

Interleukin 18 (IL-18) is a proinflammatory cytokine that plays a role in host defense by upregulating both innate and acquired immune responses. Analysis of IL18 polymorphisms may be clinically important since their roles have been recognized in a variety of inflammatory and autoimmune disorders. However, the role of this cytokine polymorphisms in kidney transplant still remains unclear. In this study, we evaluated the associations between IL18 polymorphisms and graft function assessed by creatinine clearance in kidney transplant recipients. A total of 82 kidney transplant recipients and 183 healthy controls were enrolled, and frequencies of alleles, genotypes and haplotypes for IL18 polymorphisms were determined and compared with creatinine clearance. The -607C/A (rs1946518) and -137C/G (rs187238) variant alleles in the IL18 gene were determined by polymerase chain reaction. In our study, no significant association was found between the IL18 variants and creatinine clearance (p > 0.05). Nonetheless, polymorphism analysis revealed an increase in the frequency of the IL18 major haplotype -607C/-137G in kidney transplant patients (odds ratio 2.57, 95% confidence interval 1.45–4.55, p = 0.0014). Finally, we found that IL18 polymorphisms did not influence the renal function and that IL18 haplotype -607C/-137G seems to be associated with kidney transplant recipients. PMID:25071398

Unraveling the sequence-dependent polymorphic behavior of d(CpG) steps in B-DNA.

PubMed

Dans, Pablo Daniel; Faustino, Ignacio; Battistini, Federica; Zakrzewska, Krystyna; Lavery, Richard; Orozco, Modesto

2014-10-01

We have made a detailed study of one of the most surprising sources of polymorphism in B-DNA: the high twist/low twist (HT/LT) conformational change in the d(CpG) base pair step. Using extensive computations, complemented with database analysis, we were able to characterize the twist polymorphism in the d(CpG) step in all the possible tetranucleotide environment. We found that twist polymorphism is coupled with BI/BII transitions, and, quite surprisingly, with slide polymorphism in the neighboring step. Unexpectedly, the penetration of cations into the minor groove of the d(CpG) step seems to be the key element in promoting twist transitions. The tetranucleotide environment also plays an important role in the sequence-dependent d(CpG) polymorphism. In this connection, we have detected a previously unexplored intramolecular C-H···O hydrogen bond interaction that stabilizes the low twist state when 3'-purines flank the d(CpG) step. This work explains a coupled mechanism involving several apparently uncorrelated conformational transitions that has only been partially inferred by earlier experimental or theoretical studies. Our results provide a complete description of twist polymorphism in d(CpG) steps and a detailed picture of the molecular choreography associated with this conformational change. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

Association between ACE (rs4646994), FABP2 (rs1799883), MTHFR (rs1801133), FTO (rs9939609) Genes Polymorphism and Type 2 Diabetes with Dyslipidemia.

PubMed

Raza, Syed Tasleem; Abbas, Shania; Siddiqi, Zeba; Mahdi, Farzana

2017-01-01

Diabetic dyslipidemia is one of the leading causes of coronary artery disease (CAD) death. Genetic and environmental factors play an important role in the development of type 2 diabetes mellitus (T2DM) and dyslipidemia. The present study was aimed to investigate the association of ACE (rs4646994), FABP2 (rs1799883), MTHFR (rs1801133) and FTO (rs9939609) genes polymorphism in T2DM with dyslipidemia. Totally, 559 subjects including 221 T2DM cases with dyslipidemia, 158 T2DM without dyslipidemia and 180 controls were enrolled. ACE genes polymorphism was evaluated by polymerase chain reaction (PCR), while MTHFR , FABP2 , FTO genes polymorphisms were evaluated by PCR and restriction fragment length polymorphism (RFLP). Significant association of ACE and MTHFR genes polymorphisms were found in both group of cases [T2DM with dyslipidemia (P<0.001, and P=0.008, respectively) and T2DM without dyslipidemia (P=0.003, and P=0.010, respectively)] while FABP2 and FTO genes polymorphisms were significantly associated with T2DM without dyslipidemia (P=0.038, and P= 0.019, respectively). This study concludes that ACE , FABP2 , FTO and MTHFR genes are associated with T2DM. Additionally, it also seems that ACE and MTHFR genes might be further associated with the development of dyslipidemia in T2DM cases.

TS gene polymorphisms are not good markers of response to 5-FU therapy in stage III colon cancer patients.

PubMed

Fariña-Sarasqueta, A; Gosens, M J E M; Moerland, E; van Lijnschoten, I; Lemmens, V E P P; Slooter, G D; Rutten, H J T; van den Brule, Adriaan J C

2011-08-01

Although the predictive and prognostic value of thymidylate synthase (TS) expression and gene polymorphism in colon cancer has been widely studied, the results are inconclusive probably because of methodological differences. With this study, we aimed to elucidate the role of TS gene polymorphisms genotyping in therapy response in stage III colon carcinoma patients treated with 5-FU adjuvant chemotherapy. 251 patients diagnosed with stage III colon carcinoma treated with surgery followed by 5-FU based adjuvant therapy were selected. The variable number of tandem repeats (VNTR) and the single nucleotide polymorphism (SNP) in the 5'untranslated region of the TS gene were genotyped. There was a positive association between tumor T stage and the VNTR genotypes (p = 0.05). In both univariate and multivariate survival analysis no effects of the studied polymorphisms on survival were found. However, there was an association between both polymorphisms and age. Among patients younger than 60 years, the patients homozygous for 2R seemed to have a better overall survival, whereas among the patients older than 67 this longer survival was seen by the carriers of other genotypes. We conclude that the TS VNTR and SNP do not predict response to 5-FU therapy in patients with stage III colon carcinoma. However, age appears to modify the effects of TS polymorphisms on survival.

TS gene polymorphisms are not good markers of response to 5-FU therapy in stage III colon cancer patients.

PubMed

Fariña-Sarasqueta, A; Gosens, M J E M; Moerland, E; van Lijnschoten, I; Lemmens, V E P P; Slooter, G D; Rutten, H J T; van den Brule, A J C

2010-01-01

Although the predictive and prognostic value of thymidylate synthase (TS) expression and gene polymorphism in colon cancer has been widely studied, the results are inconclusive probably because of methodological differences. With this study, we aimed to elucidate the role of TS gene polymorphisms genotyping in therapy response in stage III colon carcinoma patients treated with 5-FU adjuvant chemotherapy. 251 patients diagnosed with stage III colon carcinoma treated with surgery followed by 5-FU based adjuvant therapy were selected. The variable number of tandem repeats (VNTR) and the single nucleotide polymorphism (SNP) in the 5'-untranslated region of the TS gene were genotyped. There was a positive association between tumor T stage and the VNTR genotypes (p=0.05).In both univariate and multivariate survival analysis no effects of the studied polymorphisms on survival were found. However, there was an association between both polymorphisms and age. Among patients younger than 60 years, the patients homozygous for 2R seemed to have a better overall survival, whereas among the patients older than 67 this longer survival was seen by the carriers of other genotypes. We conclude that the TS VNTR and SNP do not predict response to 5-FU therapy in patients with stage III colon carcinoma. However, age appears to modify the effects of TS polymorphisms on survival.

TS Gene Polymorphisms Are Not Good Markers of Response to 5-FU Therapy in Stage III Colon Cancer Patients

PubMed Central

Fariña-Sarasqueta, A.; Gosens, M. J. E. M.; Moerland, E.; van Lijnschoten, I.; Lemmens, V. E. P. P.; Slooter, G. D.; Rutten, H. J. T.; van den Brule, A. J. C.

2010-01-01

Aim: Although the predictive and prognostic value of thymidylate synthase (TS) expression and gene polymorphism in colon cancer has been widely studied, the results are inconclusive probably because of methodological differences. With this study, we aimed to elucidate the role of TS gene polymorphisms genotyping in therapy response in stage III colon carcinoma patients treated with 5-FU adjuvant chemotherapy. Patients and Methods: 251 patients diagnosed with stage III colon carcinoma treated with surgery followed by 5-FU based adjuvant therapy were selected. The variable number of tandem repeats (VNTR) and the single nucleotide polymorphism (SNP) in the 5′-untranslated region of the TS gene were genotyped. Results: There was a positive association between tumor T stage and the VNTR genotypes (p=0.05). In both univariate and multivariate survival analysis no effects of the studied polymorphisms on survival were found. However, there was an association between both polymorphisms and age. Among patients younger than 60 years, the patients homozygous for 2R seemed to have a better overall survival, whereas among the patients older than 67 this longer survival was seen by the carriers of other genotypes. Conclusion: We conclude that the TS VNTR and SNP do not predict response to 5-FU therapy in patients with stage III colon carcinoma. However, age appears to modify the effects of TS polymorphisms on survival. PMID:20966539

Unsupportive social interactions and affective states: examining associations of two oxytocin-related polymorphisms.

PubMed

McInnis, Opal A; McQuaid, Robyn J; Matheson, Kimberly; Anisman, Hymie

2017-01-01

Two single-nucleotide polymorphisms (SNPs) on oxytocin-related genes, specifically the oxytocin receptor (OXTR) rs53576 and the CD38 rs3796863 variants, have been associated with alterations in prosocial behaviors. A cross-sectional study was conducted among undergraduate students (N = 476) to examine associations between the OXTR and CD38 polymorphisms and unsupportive social interactions and mood states. Results revealed no association between perceived levels of unsupportive social interactions and the OXTR polymorphism. However, A carriers of the CD38 polymorphism, a variant previously associated with elevated oxytocin, reported greater perceived peer unsupportive interactions compared to CC carriers. As expected, perceived unsupportive interactions from peers was associated with greater negative affect, which was moderated by the CD38 polymorphism. Specifically, this relation was stronger among CC carriers of the CD38 polymorphism (a variant thought to be linked to lower oxytocin). When examining whether the OXTR polymorphism moderated the relation between unsupportive social interactions from peers and negative affect there was a trend toward significance, however, this did not withstand multiple testing corrections. These findings are consistent with the perspective that a variant on an oxytocin polymorphism that may be tied to lower oxytocin is related to poor mood outcomes in association with negative social interactions. At the same time, having a genetic constitution presumed to be associated with higher oxytocin was related to increased perceptions of unsupportive social interactions. These seemingly paradoxical findings could be related to previous reports in which variants associated with prosocial behaviors were also tied to relatively more effective coping styles to deal with challenges.

Molecular and immunohistochemical analysis of P53 in phaeochromocytoma.

PubMed Central

Dahia, P. L.; Aguiar, R. C.; Tsanaclis, A. M.; Bendit, I.; Bydlowski, S. P.; Abelin, N. M.; Toledo, S. P.

1995-01-01

We searched for mutations of the p53 gene in 25 phaeochromocytomas using polymerase chain reaction-single strand conformation polymorphism (PCR-SSCP) analysis of the entire conserved region of the gene, encompassing exons 4-8; expression of the p53 protein was assessed by immunohistochemistry. No mutations were found, while a polymorphism in codon 72 was observed. Immunohistochemistry revealed nuclear p53 overexpression in one tumour sample. We conclude that mutations of the 'hotspot' region of the p53 gene do not seem to play a role in the pathogenesis of phaeochromocytoma. Images Figure 1 Figure 2 Figure 3 PMID:7577469

Is there any pristine gas in nearby starburst galaxies?

NASA Astrophysics Data System (ADS)

Lebouteiller, Vianney; Kunth, Daniel

2008-12-01

We derive the chemical composition of the neutral gas in the blue compact dwarf (BCD) Pox 36 observed with FUSE. Metals (N, O, Ar, and Fe) are underabundant as compared to the ionized gas associated with H ii regions by a factor ~7. The neutral gas, although it is not pristine, is thus probably less chemically evolved than the ionized gas. This could be due to different dispersal and mixing timescales. Results are compared to those of other BCDs observed with FUSE. The metallicity of the neutral gas in BCDs seems to reach a lower threshold of ~1/50 Z⊙ for extremely-metal poor galaxies.

The 894G>T endothelial nitric oxide synthase genetic polymorphism affects hemodynamic responses to mental stress performed before and after exercise.

PubMed

Rocha, Natália Galito; Neves, Fabricia Junqueira; Silva, Bruno Moreira; Sales, Allan Robson Kluser; Nóbrega, Antonio Claudio

2012-03-01

Nitric oxide is the primary mediator of vasodilation during mental stress. Since genetic polymorphisms in the nitric oxide synthase (eNOS) gene seem to impair the production of NO, this study aimed to evaluate the effect of an exercise bout on hemodynamic responses to mental stress in subjects with the 894G>T polymorphism of eNOS. Subjects without (wild-type group; n = 16) or with (polymorphic-type group; n = 19) the 894G>T polymorphism underwent a mental stress challenge before and after a maximal cardiopulmonary exercise test. Blood pressure was measured by auscultation and forearm blood flow by venous occlusion plethysmography. The groups were similar regarding anthropometric, metabolic, resting blood pressure and exercise variables. Before exercise, systolic blood pressure response during mental stress was higher in the polymorphic-type group (∆wild-type: 8.0 ± 2.0% vs. ∆polymorphic-type: 12.5 ± 1.8%, P = 0.01), while the increase in forearm vascular conductance was similar between the groups (∆wild-type 90.8 ± 26.4% vs. ∆polymorphic-type: 86.3 ± 24.1%, P = 0.44). After exercise, the systolic blood pressure at baseline and during mental stress was lower than before exercise in the whole group (P < 0.05), but the pressure response during mental stress was still higher in the polymorphic-type group (∆wild-type: 5.8 ± 1.5% vs. ∆polymorphic-type: 10.2 ± 1.4%, P = 0.01). The increase in forearm vascular conductance was inhibited only in the polymorphic-type group (∆before exercise 86.3 ± 24.1% vs. ∆after exercise: 41.5 ± 12.6%, P = 0.04). In conclusion, these results suggest the 894G>T eNOS polymorphism is associated with altered hemodynamic responses to mental stress both before and after a single bout of dynamic exercise with potential clinical implications.

Evaluation of the relationship between polymorphisms in CYP2C19 and the pharmacokinetics of omeprazole, pantoprazole and rabeprazole.

PubMed

Román, Manuel; Ochoa, Dolores; Sánchez-Rojas, Sergio Daniel; Talegón, Maria; Prieto-Pérez, Rocio; Rivas, Ângela; Abad-Santos, Francisco; Cabaleiro, Teresa

2014-01-01

To evaluate the possible association between polymorphisms in CYP2C19 and the pharmacokinetics of omeprazole, rabeprazole and pantoprazole. 151 healthy volunteers were evaluated for polymorphisms in the CYP2C19 gene using real-time polymerase chain reaction. Plasma concentrations were measured using high-performance liquid chromatography coupled to mass spectrometry. Carriers of the *2 allele displayed poor metabolism for all the PPIs studied (around 50% decrease in clearance). Subjects with the *17 allele showed a light increase in clearance compared with *1/*1 (not significant). CYP2C19*2 is associated with decreased clearance of all the PPIs, that could be associated with higher drug efficacy. CYP2C19*17 could increase clearance of these drugs, although the effect seems small.

PSSRdb: a relational database of polymorphic simple sequence repeats extracted from prokaryotic genomes.

PubMed

Kumar, Pankaj; Chaitanya, Pasumarthy S; Nagarajaram, Hampapathalu A

2011-01-01

PSSRdb (Polymorphic Simple Sequence Repeats database) (http://www.cdfd.org.in/PSSRdb/) is a relational database of polymorphic simple sequence repeats (PSSRs) extracted from 85 different species of prokaryotes. Simple sequence repeats (SSRs) are the tandem repeats of nucleotide motifs of the sizes 1-6 bp and are highly polymorphic. SSR mutations in and around coding regions affect transcription and translation of genes. Such changes underpin phase variations and antigenic variations seen in some bacteria. Although SSR-mediated phase variation and antigenic variations have been well-studied in some bacteria there seems a lot of other species of prokaryotes yet to be investigated for SSR mediated adaptive and other evolutionary advantages. As a part of our on-going studies on SSR polymorphism in prokaryotes we compared the genome sequences of various strains and isolates available for 85 different species of prokaryotes and extracted a number of SSRs showing length variations and created a relational database called PSSRdb. This database gives useful information such as location of PSSRs in genomes, length variation across genomes, the regions harboring PSSRs, etc. The information provided in this database is very useful for further research and analysis of SSRs in prokaryotes.

An Angiopoietin-2 gene polymorphism in unexplained intrauterine fetal death: a multi-center study.

PubMed

Huber, Ambros; Grimm, Christoph; Pietrowski, Detlef; Zeillinger, Robert; Bettendorf, Hertha; Husslein, Peter; Hefler, Lukas

2005-02-01

Angiopoietin-2 (Ang-2) is a potent regulator of angiogenesis and vascular tone. As vascular processes have been proposed to be involved in the pathogenesis of pregnancy associated complications such as late unexplained intrauterine fetal death (IUFD), we determined whether a common G/A polymorphism of the Ang-2 gene (ANGPT2) is associated with this condition. In a multicenter case-control study, we evaluated the common G/A polymorphism within exon 4 of the ANGPT2 gene using PCR in 90 women with IUFD and 90 healthy women with at least one uncomplicated full term pregnancy and no history of IUFD. Genotype (p=0.2; OR=1.4 [0.8-2.6]) and allele frequencies (p=0.1; OR=1.4 [0.9-2.1]) of the ANGPT2 polymorphism did not differ between women with IUFD and healthy women. A multivariate regression analysis with smoking habits and preexisting diabetes as covariates did not change the results. We are the first to report on a common polymorphism of the ANGPT2 gene in patients with late IUFD. The investigated ANGPT2 poylmorphism does not seem to be a candidate gene for IUFD in Caucasian women.

MAOA-VNTR polymorphism modulates context-dependent dopamine release and aggressive behavior in males.

PubMed

Schlüter, Thorben; Winz, Oliver; Henkel, Karsten; Eggermann, Thomas; Mohammadkhani-Shali, Siamak; Dietrich, Claudia; Heinzel, Alexander; Decker, Michel; Cumming, Paul; Zerres, Klaus; Piel, Markus; Mottaghy, Felix M; Vernaleken, Ingo

2016-01-15

A recent [(18)F]FDOPA-PET study reports negative correlations between dopamine synthesis rates and aggressive behavior. Since dopamine is among the substrates for monoamine oxidase A (MAOA), this investigation examines whether functional allelic variants of the MAOA tandem repeat (VNTR) promotor polymorphism, which is known to modulate aggressive behavior, influences dopamine release and aggression in response to violent visual stimuli. We selected from a genetic prescreening sample, strictly case-matched groups of 2×12 healthy male subjects with VNTRs predictive of high (MAOA-High) and low (MAOA-Low) MAOA expression. Subjects underwent pairs of PET sessions (dopamine D2/3 ligand [(18)F]DMFP) while viewing a movie of neutral content, versus violent content. Directly afterwards, aggressive behavior was assessed by the Point Subtraction Aggression Paradigm (PSAP). Finally, PET data of 23 participants and behavioral data of 22 participants were analyzed due to post hoc exclusion criteria. In the genetic prescreening sample MAOA-Low carriers had significantly increased scores on the Buss-Perry Aggression Questionnaire. In the PET-study-group, aggressive behavior under the emotional neutral condition was significantly higher in the MAOA-Low group. Interestingly, the two MAOA-groups showed inverse dopaminergic and behavioral reactions to the violent movie: The MAOA-High group showed higher dopamine release and increased aggression after the violent movie; MAOA-Low subjects showed decreases in aggressive behavior and no consistent dopamine release. These results indicate a possible impact of the MAOA-promotor polymorphism on the neurobiological modulation of aggressive behavior. However, the data do not support approaches stating that MAOA-Low fosters aggression by a simple pro-dopaminergic mechanism. Copyright © 2015 Elsevier Inc. All rights reserved.

Characterization of the gene encoding the polymorphic immunodominant molecule, a neutralizing antigen of Theileria parva

DOE Office of Scientific and Technical Information (OSTI.GOV)

Toye, P.G.; Metzelaar, M.J.; Wijngaard, P.L.J.

1995-08-01

Theileria parva, a tick-transmitted protozoan parasite related to Plasmodium spp., causes the disease East Coast fever, an acute and usually fatal lymphoproliferative disorder of cattle in Africa. Previous studies using sera from cattle that have survived infection identified a polymorphic immunodominant molecule (PIM) that is expressed by both the infective sporozoite stage of the parasite and the intracellular schizont. Here we show that mAb specific for the PIM Ag can inhibit sporozoite invasion of lymphocytes in vitro. A cDNA clone encoding the PIM Ag of the T. parva (Muguga) stock was obtained by using these mAb in a novel eukaryoticmore » expression cloning system that allows isolation of cDNA encoding cytoplasmic or surface Ags. To establish the molecular basis of the polymorphism of PIM, the cDNA of the PIM Ag from a buffalo-derived T. parva stock was isolated and its sequence was compared with that of the cattle-derived Muguga PIM. The two cDNAs showed considerable identity in both the 5{prime} and 3{prime} regions, but there was substantial sequence divergence in the central regions. Several types of repeated sequences were identified in the variant regions. In the Muguga form of the molecule, there were five tandem repeats of the tetrapeptide, QPEP, that were shown, by transfection of a deleted version of the PIM gene, not to react with several anti-PIM mAbs. By isolating and sequencing the genomic version of the gene, we identified two small introns in the 3{prime} region of the gene. Finally, we showed that polyclonal rat Abs against recombinant PIM neutralize sporozoite infectivity in vitro, suggesting that the PIM Ag should be evaluated for its capacity to immunize cattle against East Coast Fever.« less

Integrating mRNA and Protein Sequencing Enables the Detection and Quantitative Profiling of Natural Protein Sequence Variants of Populus trichocarpa.

PubMed

Abraham, Paul E; Wang, Xiaojing; Ranjan, Priya; Nookaew, Intawat; Zhang, Bing; Tuskan, Gerald A; Hettich, Robert L

2015-12-04

Next-generation sequencing has transformed the ability to link genotypes to phenotypes and facilitates the dissection of genetic contribution to complex traits. However, it is challenging to link genetic variants with the perturbed functional effects on proteins encoded by such genes. Here we show how RNA sequencing can be exploited to construct genotype-specific protein sequence databases to assess natural variation in proteins, providing information about the molecular toolbox driving cellular processes. For this study, we used two natural genotypes selected from a recent genome-wide association study of Populus trichocarpa, an obligate outcrosser with tremendous phenotypic variation across the natural population. This strategy allowed us to comprehensively catalogue proteins containing single amino acid polymorphisms (SAAPs), as well as insertions and deletions. We profiled the frequency of 128 types of naturally occurring amino acid substitutions, including both expected (neutral) and unexpected (non-neutral) SAAPs, with a subset occurring in regions of the genome having strong polymorphism patterns consistent with recent positive and/or divergent selection. By zeroing in on the molecular signatures of these important regions that might have previously been uncharacterized, we now provide a high-resolution molecular inventory that should improve accessibility and subsequent identification of natural protein variants in future genotype-to-phenotype studies.

The hepcidin gene promoter nc.-1010C > T; -582A > G haplotype modulates serum ferritin in individuals carrying the common H63D mutation in HFE gene.

PubMed

Silva, Bruno; Pita, Lina; Gomes, Susana; Gonçalves, João; Faustino, Paula

2014-12-01

Hereditary hemochromatosis is an autosomal recessive disorder characterized by severe iron overload. It is usually associated with homozygosity for the HFE gene mutation c.845G > A; p.C282Y. However, in some cases, another HFE mutation (c.187C > G; p.H63D) seems to be associated with the disease. Its penetrance is very low, suggesting the possibility of other iron genetic modulators being involved. In this work, we have screened for HAMP promoter polymorphisms in 409 individuals presenting normal or increased serum ferritin levels together with normal or H63D-mutated HFE genotypes. Our results show that the hepcidin gene promoter TG haplotype, originated by linkage of the nc.-1010C > T and nc.-582A > G polymorphisms, is more frequent in the HFE_H63D individuals presenting serum ferritin levels higher than 300 μg/L than in those presenting the HFE_H63D mutation but with normal serum ferritin levels or in the normal control group.Moreover, it was observed that the TG haplotype was associated to increased serum ferritin levels in the overall pool of HFE_H63D individuals. Thus, our data suggest that screening for these polymorphisms could be of interest in order to explain the phenotype. However, this genetic condition seems to have no clinical significance.

Genomic and Metabolomic Profile Associated to Microalbuminuria

PubMed Central

Marrachelli, Vannina G.; Monleon, Daniel; Rentero, Pilar; Mansego, María L.; Morales, Jose Manuel; Galan, Inma; Segura, Remedios; Martinez, Fernando; Martin-Escudero, Juan Carlos; Briongos, Laisa; Marin, Pablo; Lliso, Gloria; Chaves, Felipe Javier; Redon, Josep

2014-01-01

To identify factors related with the risk to develop microalbuminuria using combined genomic and metabolomic values from a general population study. One thousand five hundred and two subjects, Caucasian, more than 18 years, representative of the general population, were included. Blood pressure measurement and albumin/creatinine ratio were measured in a urine sample. Using SNPlex, 1251 SNPs potentially associated to urinary albumin excretion (UAE) were analyzed. Serum metabolomic profile was assessed by 1H NMR spectra using a Brucker Advance DRX 600 spectrometer. From the total population, 1217 (mean age 54±19, 50.6% men, ACR>30 mg/g in 81 subjects) with high genotyping call rate were analysed. A characteristic metabolomic profile, which included products from mitochondrial and extra mitochondrial metabolism as well as branched amino acids and their derivative signals, were observed in microalbuminuric as compare to normoalbuminuric subjects. The comparison of the metabolomic profile between subjects with different UAE status for each of the genotypes associated to microalbuminuria revealed two SNPs, the rs10492025_TT of RPH3A gene and the rs4359_CC of ACE gene, with minimal or no statistically significant differences. Subjects with and without microalbuminuria, who shared the same genotype and metabolomic profile, differed in age. Microalbuminurics with the CC genotype of the rs4359 polymorphism and with the TT genotype of the rs10492025 polymorphism were seven years older and seventeen years younger, respectively as compared to the whole microalbuminuric subjects. With the same metabolomic environment, characteristic of subjects with microalbuminuria, the TT genotype of the rs10492025 polymorphism seems to increase and the CC genotype of the rs4359 polymorphism seems to reduce risk to develop microalbuminuria. PMID:24918908

Selfish genes, pleiotropy and the origin of recombination.

PubMed Central

Hey, J

1998-01-01

If multiple linked polymorphisms are under natural selection, then conflicts arise and the efficiency of natural selection is hindered relative to the case of no linkage. This simple interaction between linkage and natural selection creates an opportunity for mutations that raise the level of recombination to increase in frequency and have an enhanced chance of fixation. This important finding by S. Otto and N. Barton means that mutations that raise the recombination rate, but are otherwise neutral, will be selectively favored under fairly general circumstances of multilocus selection and linkage. The effect described by Otto and Barton, which was limited to neutral modifiers, can also be extended to include all modifiers of recombination, both beneficial and deleterious. Computer simulations show that beneficial mutations that also increase recombination have an increased chance of fixation. Similarly, deleterious mutations that also decrease recombination have an increased chance of fixation. The results suggest that a simple model of recombination modifiers, including both neutral and pleiotropic modifiers, is a necessary explanation for the evolutionary origin of recombination. PMID:9691060

The population genetics of the alpha-2 globin locus of orangutans (Pongo pygmaeus).

PubMed

Steiper, Michael E; Wolfe, Nathan D; Karesh, William B; Kilbourn, Annelisa M; Bosi, Edwin J; Ruvolo, Maryellen

2005-03-01

In this study, the molecular population genetics of the orangutan's alpha-2 globin (HBA2) gene were investigated in order to test for the action of natural selection. Haplotypes from 28 orangutan chromosomes were collected from a 1.46-kilobase region of the alpha-2 globin locus. While many aspects of the data were consistent with neutrality, the observed heterogeneous distribution of polymorphisms was inconsistent with neutral expectations. Furthermore, a single amino acid variant, found in both the Bornean and the Sumatran orangutan subspecies, was associated with different alternative synonymous variants in each subspecies, suggesting that the allele may have spread separately through the two subspecies after two distinct origination events. This variant is not in Hardy-Weinberg equilibrium (HWE). These observations are consistent with neutral models that incorporate population structure and models that invoke selection. The orangutan Plasmodium parasite is a plausible selective agent that may underlie the variation at alpha-2 globin in orangutans.

Exome sequencing-driven discovery of coding polymorphisms associated with common metabolic phenotypes.

PubMed

Albrechtsen, A; Grarup, N; Li, Y; Sparsø, T; Tian, G; Cao, H; Jiang, T; Kim, S Y; Korneliussen, T; Li, Q; Nie, C; Wu, R; Skotte, L; Morris, A P; Ladenvall, C; Cauchi, S; Stančáková, A; Andersen, G; Astrup, A; Banasik, K; Bennett, A J; Bolund, L; Charpentier, G; Chen, Y; Dekker, J M; Doney, A S F; Dorkhan, M; Forsen, T; Frayling, T M; Groves, C J; Gui, Y; Hallmans, G; Hattersley, A T; He, K; Hitman, G A; Holmkvist, J; Huang, S; Jiang, H; Jin, X; Justesen, J M; Kristiansen, K; Kuusisto, J; Lajer, M; Lantieri, O; Li, W; Liang, H; Liao, Q; Liu, X; Ma, T; Ma, X; Manijak, M P; Marre, M; Mokrosiński, J; Morris, A D; Mu, B; Nielsen, A A; Nijpels, G; Nilsson, P; Palmer, C N A; Rayner, N W; Renström, F; Ribel-Madsen, R; Robertson, N; Rolandsson, O; Rossing, P; Schwartz, T W; Slagboom, P E; Sterner, M; Tang, M; Tarnow, L; Tuomi, T; van't Riet, E; van Leeuwen, N; Varga, T V; Vestmar, M A; Walker, M; Wang, B; Wang, Y; Wu, H; Xi, F; Yengo, L; Yu, C; Zhang, X; Zhang, J; Zhang, Q; Zhang, W; Zheng, H; Zhou, Y; Altshuler, D; 't Hart, L M; Franks, P W; Balkau, B; Froguel, P; McCarthy, M I; Laakso, M; Groop, L; Christensen, C; Brandslund, I; Lauritzen, T; Witte, D R; Linneberg, A; Jørgensen, T; Hansen, T; Wang, J; Nielsen, R; Pedersen, O

2013-02-01

Human complex metabolic traits are in part regulated by genetic determinants. Here we applied exome sequencing to identify novel associations of coding polymorphisms at minor allele frequencies (MAFs) >1% with common metabolic phenotypes. The study comprised three stages. We performed medium-depth (8×) whole exome sequencing in 1,000 cases with type 2 diabetes, BMI >27.5 kg/m(2) and hypertension and in 1,000 controls (stage 1). We selected 16,192 polymorphisms nominally associated (p < 0.05) with case-control status, from four selected annotation categories or from loci reported to associate with metabolic traits. These variants were genotyped in 15,989 Danes to search for association with 12 metabolic phenotypes (stage 2). In stage 3, polymorphisms showing potential associations were genotyped in a further 63,896 Europeans. Exome sequencing identified 70,182 polymorphisms with MAF >1%. In stage 2 we identified 51 potential associations with one or more of eight metabolic phenotypes covered by 45 unique polymorphisms. In meta-analyses of stage 2 and stage 3 results, we demonstrated robust associations for coding polymorphisms in CD300LG (fasting HDL-cholesterol: MAF 3.5%, p = 8.5 × 10(-14)), COBLL1 (type 2 diabetes: MAF 12.5%, OR 0.88, p = 1.2 × 10(-11)) and MACF1 (type 2 diabetes: MAF 23.4%, OR 1.10, p = 8.2 × 10(-10)). We applied exome sequencing as a basis for finding genetic determinants of metabolic traits and show the existence of low-frequency and common coding polymorphisms with impact on common metabolic traits. Based on our study, coding polymorphisms with MAF above 1% do not seem to have particularly high effect sizes on the measured metabolic traits.

G-231A and G+70C Polymorphisms of Endothelin Receptor Type-A Gene could Affect the Psoriasis Area and Severity Index Score and Endothelin 1 Levels.

PubMed

Okan, Gökhan; Yıldız, Zeynep; Gökdemir, Gonca; Yorulmaz, Eda; Vural, Pervin; Doğru-Abbasoğlu, Semra; Uysal, Müjdat

2015-01-01

The etiopathogenesis of psoriasis has not been clearly elucidated although the role of chronic inflammation, imbalance between pro- and anti-inflammatory cytokines, and many immunological events have been established. Endothelin 1 (EDN1) and endothelin receptor type-A (EDNRA) are implicated in the inflammatory process. The relationships between EDN1 and EDNRA polymorphisms with several diseases have been found. This study examined the possible association of EDN1 (G5665T and T-1370G) and EDNRA (G-231A and G + 70C) single nucleotide polymorphisms (SNPs) with the occurence of psoriasis, and evaluated the relationship between genotypes and clinical/laboratory manifestation of psoriasis. We analyzed genotype and allele distributions of the above-mentioned polymorphisms in 151 patients with psoriasis and 152 healthy controls by real-time PCR combined with melting curve analysis. We did not find significant differences in the genotype and allele distributions of EDN1 T-1370G, EDNRA G-231A, and EDNRA G+70C polymorphisms between patients with psoriasis and healthy controls. Psoriasis area and severity index (PASI) score of EDNRA -231 polymorphic A allele carrying subjects (AA and AA + AG) was higher than that of wild homozygotes (P = 0.044 and P = 0.027, respectively). In addition, EDN1 levels in EDNRA+70 polymorphic C allele carriers (CC + CG) were elevated when compared with GG genotype; however, the difference was at borderline significance (P = 0.05). Although there were no associations between studied polymorphisms and psoriasis susceptibility, the PASI score and EDN1 levels seem to be affected by EDNRA G-231A and G + 70C polymorphisms.

Association of serum lipids and coronary artery disease with polymorphisms in the apolipoprotein AI-CIII-AIV gene cluster

PubMed Central

Rai, Himanshu; Sinha, Nakul; Finn, James; Agrawal, Suraksha; Mastana, Sarabjit

2016-01-01

Abstract Genetic variants are considered as one of the main determinants of the concentration of serum lipids and coronary artery disease (CAD). Polymorphisms in the Apolipoprotein (Apo) AI-CIII-AIV gene cluster has been known to affect the concentrations of various lipid sub-fractions and the risk of CAD. The present study assessed associations between polymorphisms of the Apo AI-CIII-AIV gene cluster, [ApoA-I,-75G > A, (rs1799837); ApoC-III 3238C > G, (SstI), (rs5128) and ApoA-IV, Thr347Ser(347A > T), (rs675)] with serum lipids and their contributions to CAD in North Indian population. We recruited age, sex matched, 200 CAD patients and 200 healthy controls and tested them for fasting levels of serum lipids. We genotyped selected polymorphisms using polymerase chain reaction-restriction fragment length polymorphism. There were no statistically significant association of selected polymorphisms (or their combinations) with CAD even after employing additive, dominant and recessive models. However there was significant association of selected polymorphisms with various lipid traits amongst the control cohort (p < 0.05). Mean levels of high density lipoprotein cholesterol and triglycerides were found to be significantly higher among controls carrying at least one mutant allele at ApoA1-75G > A (p = 0.019) and ApoCIII SstI (p < 0.001) polymorphism respectively. Our study observed that the selected polymorphisms in the ApoAI-CIII-AIV gene cluster although significantly affect various lipid traits but this affect does not seem to translate into association with CAD, at least among North Indian population. PMID:28261635

Association of GABA(B)R1 receptor gene polymorphism with obstructive sleep apnea syndrome.

PubMed

Bayazit, Yildirim A; Yilmaz, Metin; Kokturk, Oguz; Erdal, M Emin; Ciftci, Tansu; Gokdogan, Tuba; Kemaloglu, Yusuf; Ileri, Fikret

2007-01-01

GABA(B)R (gamma-amino butyric acid B receptor)-mediated neurotransmission has been implicated in the pathophysiology of a variety of neuropsychiatric disorders. GABA(B)R1 gene variants were identified by single-strand conformation analysis. The nucleotide exchanges cause a substitution of alanine to valine in exon 1a1 (Ala20Val), a substitution of glycine to serine in exon 7 (Gly489Ser) and a silent C to G nucleotide exchange encoding the amino acid phenylalanine in exon 11 (Phe658Phe). The significance of GABA(B)R1a gene polymorphism in obstructive sleep apnea syndrome (OSAS) as well as the association of these polymorphisms with the polysomnography findings in OSAS patients are not known. In this study, we aimed to assess the significance of 3 different GABA(B)R1 gene polymorphisms (Ala20Val, Gly489Ser and Phe658Phe) in OSAS. Seventy-five patients (23 female and 52 male) with OSAS and 99 healthy volunteers (51 female, 48 male) were included in the study to assess Ala20Val, Gly489Ser and Phe658Phe polymorphisms of the GABA(B)R1 gene. For the Ala20Val variants, there was no significant difference between the genotypes and allele frequencies of the patients and controls, nor between both genders (p > 0.05). For Phe658Phe polymorphism, there was no significant difference between genotypes and allele frequencies of the patients and controls (p > 0.05). However, the C/C genotype was overrepresented and the T/C genotype was less frequent in male than female patients (p = 0.03). The C/C genotype was overrepresented and the T/C genotype was less frequent in male patients than male controls (p = 0.01). For GABA(B)R1-Gly489Ser polymorphism, all of the patients and controls had G/G genotype. The apnea arousal index scores of the male patients with C/C genotype were significantly higher than in the patients with C/T genotype (p = 0.01). The percent total sleep time in non-REM 1 scores of the male patients with T/T genotype were significantly higher than in the patients with T/C genotype (p = 0.021). The percent total sleep time in non-REM 2 scores of the female patients with C/C genotype were significantly higher than in the patients with C/T genotype (p = 0.006). The Ala20Val polymorphism of the GABA(B)R1 gene may be associated with OSAS, whereas Gly489Ser polymorphism does not seem to be involved in OSAS. The C/C variant of the Phe658Phe polymorphism GABA(B)R1 gene seems associated with the occurrence of OSAS and is also associated with some sleep related parameters (apnea arousal index and percent total sleep time in non-REM) recorded by polysomnography. Copyright (c) 2007 S. Karger AG, Basel.

Vitamin D receptor gene Alw I, Fok I, Apa I, and Taq I polymorphisms in patients with urinary stone.

PubMed

Seo, Ill Young; Kang, In-Hong; Chae, Soo-Cheon; Park, Seung Chol; Lee, Young-Jin; Yang, Yun Sik; Ryu, Soo Bang; Rim, Joung Sik

2010-04-01

To evaluate vitamin D receptor (VDR) gene polymorphisms in Korean patients so as to identify the candidate genes associated with urinary stones. Urinary stones are a multifactorial disease that includes various genetic factors. A normal control group of 535 healthy subjects and 278 patients with urinary stones was evaluated. Of 125 patients who presented stone samples, 102 had calcium stones on chemical analysis. The VDR gene Alw I, Fok I, Apa I, and Taq I polymorphisms were evaluated using the polymerase chain reaction-restriction fragment length polymorphism analysis. Allelic and genotypic frequencies were calculated to identify associations in both groups. The haplotype frequencies of the VDR gene polymorphisms for multiple loci were also determined. For the VDR gene Alw I, Fok I, Apa I, and Taq I polymorphisms, there was no statistically significant difference between the patients with urinary stones and the healthy controls. There was also no statistically significant difference between the patients with calcium stones and the healthy controls. A novel haplotype (Ht 4; CTTT) was identified in 13.5% of the patients with urinary stones and in 8.3% of the controls (P = .001). The haplotype frequencies were significantly different between the patients with calcium stones and the controls (P = .004). The VDR gene Alw I, Fok I, Apa I, and Taq I polymorphisms does not seem to be candidate genetic markers for urinary stones in Korean patients. However, 1 novel haplotype of the VDR gene polymorphisms for multiple loci might be a candidate genetic marker. Copyright 2010 Elsevier Inc. All rights reserved.

G protein polymorphisms do not predict weight loss and improvement of hypertension in severely obese patients.

PubMed

Potoczna, Natascha; Wertli, Maria; Steffen, Rudolph; Ricklin, Thomas; Lentes, Klaus-Ulrich; Horber, Fritz F

2004-11-01

Both the gene encoding the alpha subunit of G stimulatory proteins (GNAS1) and the beta3 subunit gene (GNB3) of G proteins are associated with obesity and/or hypertension. Moreover, the TT/TC825 polymorphism of GNB3 predicts greater weight loss than the CC825 polymorphism in obese patients (mean body mass index, 35 kg/m2) undergoing a structured nonpharmacologic weight loss program. Gastric banding enforces a low-calorie diet by diminishing the need for volitional adherence. It is unknown whether these polymorphisms predict the variable weight loss in patients after bariatric surgery. Three hundred and four severely obese patients (mean +/- SEM age, 42 +/- 1 years; 245 women and 59 men; mean +/- SEM body mass index, 43.9 +/- 0.3 kg/m2) followed prospectively for at least 3 years after surgery were genotyped for the GNB3 C825T, G814A, and GNAS1 T393 polymorphisms. All analyses were performed blinded to the phenotypic characteristics of the study group. Frequencies of polymorphisms were comparable to those previously published. No polymorphism studied predicted 3-year weight loss or was associated with high blood pressure in severely obese patients after gastric banding. Multivariate analysis of potentially confounding factors such as reoperation rate or use of sibutramine or orlistat revealed similar results (P > 0.1). Regardless of the mechanism(s) involved for these discordant findings, GNB3 C825T, G814A, and GNAS1 T393C polymorphisms do not seem to be reliable predictors of long-term weight loss.

The Relationship between Neutralization Techniques and Induced Abortion

PubMed Central

Kalateh Sadati, Ahmad; Tabei, Seyed Ziaaddin; Salehzadeh, Hamzeh; Rahnavard, Farnaz; Namavar Jahromi, Bahia; Hemmati, Soroor

2014-01-01

Background: Induced abortion is not only a serious threat for women’s health, but also a controversial topic for its ethical and moral problems. We aimed to evaluate the relationship between neutralization techniques and attempting to commit abortion in married women with unintended pregnancy. Methods: After in-depth interviews with some women who had attempted abortion, neutralization themes were gathered. Next, to analyze the data quantitatively, a questionnaire was created including demographic and psychosocial variables specifically related to neutralization. The participants were divided into two groups (abortion and control) of unintended pregnancy and were then compared. Results: Analysis of psychosocial variables revealed a significant difference in the two groups at neutralization, showing that neutralization in the control group (56.97±10.24) was higher than that in the abortion group (44.19±12.44). To evaluate the findings more accurately, we examined the causal factors behind the behaviors of the abortion group. Binary logistic regression showed that among psychosocial factors, neutralization significantly affected abortion (95% CI=1.07-1.35). Conclusion: Despite the network of many factors affecting induced abortion, neutralization plays an important role in reinforcing the tendency to attempt abortion. Furthermore, the decline of religious beliefs, as a result of the secular context of the modern world, seems to have an important role in neutralizing induced abortion. PMID:25349851

Background Selection in Partially Selfing Populations

PubMed Central

Roze, Denis

2016-01-01

Self-fertilizing species often present lower levels of neutral polymorphism than their outcrossing relatives. Indeed, selfing automatically increases the rate of coalescence per generation, but also enhances the effects of background selection and genetic hitchhiking by reducing the efficiency of recombination. Approximations for the effect of background selection in partially selfing populations have been derived previously, assuming tight linkage between deleterious alleles and neutral loci. However, loosely linked deleterious mutations may have important effects on neutral diversity in highly selfing populations. In this article, I use a general method based on multilocus population genetics theory to express the effect of a deleterious allele on diversity at a linked neutral locus in terms of moments of genetic associations between loci. Expressions for these genetic moments at equilibrium are then computed for arbitrary rates of selfing and recombination. An extrapolation of the results to the case where deleterious alleles segregate at multiple loci is checked using individual-based simulations. At high selfing rates, the tight linkage approximation underestimates the effect of background selection in genomes with moderate to high map length; however, another simple approximation can be obtained for this situation and provides accurate predictions as long as the deleterious mutation rate is not too high. PMID:27075726

Molecular evolution of the Li/li chemical defence polymorphism in white clover (Trifolium repens L.).

PubMed

Olsen, K M; Sutherland, B L; Small, L L

2007-10-01

White clover (Trifolium repens) is naturally polymorphic for cyanogenesis (hydrogen cyanide release following tissue damage). The ecological factors favouring cyanogenic and acyanogenic plants have been examined in numerous studies over the last half century, making this one of the best-documented examples of an adaptive polymorphism in plants. White clover cyanogenesis is controlled by two, independently segregating Mendelian genes: Ac/ac controls the presence/absence of cyanogenic glucosides; and Li/li controls the presence/absence of their hydrolysing enzyme, linamarase. In this study, we examine the molecular evolution and population genetics of Li as it relates to the cyanogenesis polymorphism. We report here that Li exists as a single-copy gene in plants possessing linamarase activity, and that the absence of enzyme activity in li/li plants is correlated with the absence of much or all of the gene from the white clover genome. Consistent with this finding, we confirm by reverse transcription-polymerase chain reaction that Li gene expression is absent in plants lacking enzyme activity. In a molecular population genetic analysis of Li and three unlinked genes using a worldwide sample of clover plants, we find an absence of nucleotide variation and statistically significant deviations from neutrality at Li; these findings are consistent with recent positive directional selection at this cyanogenesis locus.

Foundational errors in the Neutral and Nearly-Neutral theories of evolution in relation to the Synthetic Theory: is a new evolutionary paradigm necessary?

PubMed

Valenzuela, Carlos Y

2013-01-01

The Neutral Theory of Evolution (NTE) proposes mutation and random genetic drift as the most important evolutionary factors. The most conspicuous feature of evolution is the genomic stability during paleontological eras and lack of variation among taxa; 98% or more of nucleotide sites are monomorphic within a species. NTE explains this homology by random fixation of neutral bases and negative selection (purifying selection) that does not contribute either to evolution or polymorphisms. Purifying selection is insufficient to account for this evolutionary feature and the Nearly-Neutral Theory of Evolution (N-NTE) included negative selection with coefficients as low as mutation rate. These NTE and N-NTE propositions are thermodynamically (tendency to random distributions, second law), biotically (recurrent mutation), logically and mathematically (resilient equilibria instead of fixation by drift) untenable. Recurrent forward and backward mutation and random fluctuations of base frequencies alone in a site make life organization and fixations impossible. Drift is not a directional evolutionary factor, but a directional tendency of matter-energy processes (second law) which threatens the biotic organization. Drift cannot drive evolution. In a site, the mutation rates among bases and selection coefficients determine the resilient equilibrium frequency of bases that genetic drift cannot change. The expected neutral random interaction among nucleotides is zero; however, huge interactions and periodicities were found between bases of dinucleotides separated by 1, 2... and more than 1,000 sites. Every base is co-adapted with the whole genome. Neutralists found that neutral evolution is independent of population size (N); thus neutral evolution should be independent of drift, because drift effect is dependent upon N. Also, chromosome size and shape as well as protein size are far from random.

Dogs' comprehension of referential emotional expressions: familiar people and familiar emotions are easier.

PubMed

Merola, I; Prato-Previde, E; Lazzaroni, M; Marshall-Pescini, S

2014-03-01

Dogs have been shown to discriminate between human facial expressions, and they seem to use human emotional communication to regulate their behaviour towards an external object/situation. However, it is still not clear (1) whether they just respond to the emotional message received with a corresponding increase/decrease in their level of activation or whether they perceive that the emotional message refers to a specific object, (2) which emotional message they use to modify their behaviour (i.e. whether they are following the positive message or avoiding the negative one) and (3) whether their familiarity with the informant has an effect on the dogs' behaviour. To address these issues, five groups of dogs were tested in two experiments. The first group observed the owner delivering two different emotional messages (happiness and fear) towards two identical objects hidden behind barriers, and the second group observed the owner delivering the same emotional messages but with no-objects present in the room. The third and the fourth groups observed the owner delivering a happy versus a neutral, and a negative versus a neutral emotional message towards the hidden objects. Finally, the fifth group observed a stranger acting like the owner of the first group. When the owner was acting as the informant, dogs seemed to be capable of distinguishing between a fearful and happy emotional expression and preferentially chose to investigate a box eliciting an expression of happiness rather than of fear or neutrality. Dogs, however, seemed to have greater difficulty in distinguishing between the fearful and neutral emotional messages delivered by the owner and between the happy and fearful expressions delivered by the stranger. Results suggest that dogs have learned to associate their owners' positive emotional messages to positive outcomes, and hence use their communicative messages to guide their actions. However, negative emotional messages and those delivered by strangers are not as clear to dogs.

Insights into the mechanism of the formation of the most stable crystal polymorph of milk fat in model protein matrices.

PubMed

Ramel, P R; Marangoni, A G

2017-09-01

The effect of incorporation and presence of various ingredients in a model sodium caseinate-based imitation cheese matrix on the polymorphism of milk fat was comprehensively described using powder x-ray diffraction, differential scanning calorimetry, and microscopy. With anhydrous milk fat (AMF) in bulk used as control, the embedding of AMF as droplets in a protein matrix was found to result in a greater extent of formation of the β polymorph than AMF alone and AMF homogenized with water and salts solution. The use of other protein matrices such as soy and whey protein isolate gels revealed that the nature of the protein and other factors associated with it (i.e., hydrophobicity and molecular structure) do not seem to play a role in the formation of the β polymorph. These results indicated that the most important factor in the formation of the β polymorph is the physical constraints imposed by a solid protein matrix, which forces the triacylglycerols in milk fat to arrange themselves in the most stable crystal polymorph. Characterization of the crystal structure of milk fat or fats in general within a food matrix could provide insights into the complex thermal and rheological behavior of foods with added fats. Copyright © 2017 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

Association analysis of the functional MAOA gene promoter and MAOB gene intron 13 polymorphisms in tension type headache patients.

PubMed

Edgnülü, Tuba G; Özge, Aynur; Erdal, Nurten; Kuru, Oktay; Erdal, Mehmet E

2014-01-01

Monoamine oxidase (MAO) enzymes play an important role in the etiology of many neurological diseases. Tension type headache (TTH) treatments contain inhibitors for selective re-uptake of serotonin and monoamine oxidase inhibitors. MAO (EC 1.4.3.4) has two isoenzymes known as MAOA and MAOB. A promoter polymorphism of a variable number of tandem repeats (VNTR) in the MAOA gene seems to affect MAOA transcriptional activity in vitro. Also, G/A polymorphism in intron 13 (rs1799836) of the MAOB gene have been previously found to be associated with the variability of MAOB enzyme activity. The aim of our study was to investigate a possible association of monoamine oxidase (MAOA and MAOB) gene polymorphisms in tension type headache. MAO gene polymorphisms were examined in a group of 120 TTH patients and in another 168 unrelated healthy volunteers (control group). MAOA promoter and MAOB intron 13 polymorphisms were genotyped using PCR-based methods. An overall comparison between the genotype of MAOA and MAOB genes and allele frequencies of the patients and the control group did not reveal any statistically significant difference between the patients and the control group (p=0.162). Factors like estrogen dosage, the limited number of male patients and other genes' neurotransmitters involved in the etiology of TTH could be responsible for our non-significant results.

Understanding the coherence of the severity effect and optimism phenomena: Lessons from attention.

PubMed

Harris, Adam J L

2017-04-01

Claims that optimism is a near-universal characteristic of human judgment seem to be at odds with recent results from the judgment and decision making literature suggesting that the likelihood of negative outcomes are overestimated relative to neutral outcomes. In an attempt to reconcile these seemingly contrasting phenomena, inspiration is drawn from the attention literature in which there is evidence that both positive and negative stimuli can have attentional privilege relative to neutral stimuli. This result provides a framework within which I consider three example phenomena that purport to demonstrate that people's likelihood estimates are optimistic: Wishful thinking; Unrealistic comparative optimism and Asymmetric belief updating. The framework clarifies the relationships between these phenomena and stimulates future research questions. Generally, whilst results from the first two phenomena appear reconcilable in this conceptualisation, further research is required in reconciling the third. Copyright © 2016 Elsevier Inc. All rights reserved.

Resolving the Conflict Between Associative Overdominance and Background Selection

PubMed Central

Zhao, Lei; Charlesworth, Brian

2016-01-01

In small populations, genetic linkage between a polymorphic neutral locus and loci subject to selection, either against partially recessive mutations or in favor of heterozygotes, may result in an apparent selective advantage to heterozygotes at the neutral locus (associative overdominance) and a retardation of the rate of loss of variability by genetic drift at this locus. In large populations, selection against deleterious mutations has previously been shown to reduce variability at linked neutral loci (background selection). We describe analytical, numerical, and simulation studies that shed light on the conditions under which retardation vs. acceleration of loss of variability occurs at a neutral locus linked to a locus under selection. We consider a finite, randomly mating population initiated from an infinite population in equilibrium at a locus under selection. With mutation and selection, retardation occurs only when S, the product of twice the effective population size and the selection coefficient, is of order 1. With S >> 1, background selection always causes an acceleration of loss of variability. Apparent heterozygote advantage at the neutral locus is, however, always observed when mutations are partially recessive, even if there is an accelerated rate of loss of variability. With heterozygote advantage at the selected locus, loss of variability is nearly always retarded. The results shed light on experiments on the loss of variability at marker loci in laboratory populations and on the results of computer simulations of the effects of multiple selected loci on neutral variability. PMID:27182952

Epigenetic changes detected in micropropagated hop plants.

PubMed

Peredo, Elena L; Arroyo-García, Rosa; Revilla, M Angeles

2009-07-01

Micropropagation is a widely used technique in hops (Humulus lupulus L.). However, to the best of our knowledge, the genetic and epigenetic stability of the microplants has never been tested before. In the present study, two hop accessions were established in vitro and micropropagated for 2 years. The genetic and epigenetic stability of the in vitro plants was analyzed with several molecular techniques: random amplified DNA polymorphism (RAPD), retrotransposon microsatellite amplified polymorphism (REMAP), and methylation-sensitive amplification polymorphism (MSAP). No genetic variation among control and treated plants was found, even after 12 cycles of micropropagation. Epigenetic variation was detected, first, when field and in vitro samples were compared. Nearly a 30% of the detected fragments presented the same pattern of alterations in all the vitroplants. Second, lower levels of epigenetic variation were detected among plants from the different subcultures. Part of this detected variation seemed to be accumulated along the 12 sequential subcultures tested.

Assessing the germplasm of Laminaria (phaeophyceae) with random amplified polymorphic DNA (RAPD) method

NASA Astrophysics Data System (ADS)

He, Yingjun; Zou, Yuping; Wang, Xiaodong; Zheng, Zhiguo; Zhang, Daming; Duan, Delin

2003-06-01

Eighteen gametophytes including L. japonica, L. ochotensis and L. longissima, were verified with random amplified polymorphic DNA (RAPD) technique. Eighteen ten-base primers were chosen from 100 primers selected for final amplification test. Among the total of 205 bands amplified, 181 (88.3%) were polymorphic. The genetic distance among different strains ranged from 0.072 to 0.391. The dendrogram constructed by unweighted pair-group method with arithmetic (UPGMA) method showed that the female and male gametophytes of the same cell lines could be grouped in pairs respectively. It indicated that RAPD analysis could be used not only to distinguish different strains of Laminaria, but also to distinguish male and female gametophyte within the same cell lines. There is ambiguous systematic relationship if judged merely by the present data. It seems that the use of RAPD marker is limited to elucidation of the phylogenetic relationship among the species of Laminaria.

Templated sequence insertion polymorphisms in the human genome

NASA Astrophysics Data System (ADS)

Onozawa, Masahiro; Aplan, Peter

2016-11-01

Templated Sequence Insertion Polymorphism (TSIP) is a recently described form of polymorphism recognized in the human genome, in which a sequence that is templated from a distant genomic region is inserted into the genome, seemingly at random. TSIPs can be grouped into two classes based on nucleotide sequence features at the insertion junctions; Class 1 TSIPs show features of insertions that are mediated via the LINE-1 ORF2 protein, including 1) target-site duplication (TSD), 2) polyadenylation 10-30 nucleotides downstream of a “cryptic” polyadenylation signal, and 3) preference for insertion at a 5’-TTTT/A-3’ sequence. In contrast, class 2 TSIPs show features consistent with repair of a DNA double-strand break via insertion of a DNA “patch” that is derived from a distant genomic region. Survey of a large number of normal human volunteers demonstrates that most individuals have 25-30 TSIPs, and that these TSIPs track with specific geographic regions. Similar to other forms of human polymorphism, we suspect that these TSIPs may be important for the generation of human diversity and genetic diseases.

Lack of Association between Polymorphisms of Hepatic Lipase with Lipid Profile in Young Jordanian Adults

PubMed Central

Khabour, Omar F; Alomari, Mahmoud A; Alzoubi, Karem H; Gharaibeh, Mohammad Y; Alhashimi, Farah H

2014-01-01

The human hepatic lipase (LIPC) gene encodes hepatic lipase, an enzyme involved in lipoprotein metabolism and regulation. Therefore, variants in LIPC gene may influence plasma lipoprotein levels. In this study, the association of LIPC C-514T and G-250A polymorphisms with plasma lipid profiles in 348 young Jordanians was investigated. Genotyping of C-514T and G-250A was performed by polymerase chain reaction and subsequent digestion with DraI and NiaIII restriction enzymes, respectively, while Roche analyzer was used to determine plasma total cholesterol, triglycerides, low-and high-density lipoprotein. The G-250 and C-514 alleles were most abundant in Jordanians with 79 and 80% frequencies, respectively. Additionally, no difference was found in the lipid–lipoprotein profile between the different genotype groups of C-514T or G-250A polymorphisms, even when males and females were examined separately (P > 0.05). In young Jordanian adults, the examined LIPC polymorphisms seem to play a limited role in determining the lipid profile. PMID:25278769

Differences in selection drive olfactory receptor genes in different directions in dogs and wolf.

PubMed

Chen, Rui; Irwin, David M; Zhang, Ya-Ping

2012-11-01

The olfactory receptor (OR) gene family is the largest gene family found in mammalian genomes. It is known to evolve through a birth-and-death process. Here, we characterized the sequences of 16 segregating OR pseudogenes in the samples of the wolf and the Chinese village dog (CVD) and compared them with the sequences from dogs of different breeds. Our results show that the segregating OR pseudogenes in breed dogs are under strong purifying selection, while evolving neutrally in the CVD, and show a more complicated pattern in the wolf. In the wolf, we found a trend to remove deleterious polymorphisms and accumulate nondeleterious polymorphisms. On the basis of protein structure of the ORs, we found that the distribution of different types of polymorphisms (synonymous, nonsynonymous, tolerated, and untolerated) varied greatly between the wolf and the breed dogs. In summary, our results suggest that different forms of selection have acted on the segregating OR pseudogenes in the CVD since domestication, breed dogs after breed formation, and ancestral wolf population, which has driven the evolution of these genes in different directions.

Signatures of sex-antagonistic selection on recombining sex chromosomes.

PubMed

Kirkpatrick, Mark; Guerrero, Rafael F

2014-06-01

Sex-antagonistic (SA) selection has major evolutionary consequences: it can drive genomic change, constrain adaptation, and maintain genetic variation for fitness. The recombining (or pseudoautosomal) regions of sex chromosomes are a promising setting in which to study SA selection because they tend to accumulate SA polymorphisms and because recombination allows us to deploy the tools of molecular evolution to locate targets of SA selection and quantify evolutionary forces. Here we use coalescent models to characterize the patterns of polymorphism expected within and divergence between recombining X and Y (or Z and W) sex chromosomes. SA selection generates peaks of divergence between X and Y that can extend substantial distances away from the targets of selection. Linkage disequilibrium between neutral sites is also inflated. We show how the pattern of divergence is altered when the SA polymorphism or the sex-determining region was recently established. We use data from the flowering plant Silene latifolia to illustrate how the strength of SA selection might be quantified using molecular data from recombining sex chromosomes. Copyright © 2014 by the Genetics Society of America.

Destination memory for emotional information in older adults.

PubMed

El Haj, Mohamad; Fasotti, Luciano; Allain, Philippe

2015-01-01

BACKGROUND/STUDY CONTEXT: Destination memory, remembering the destination of the information that one tells, shows significant age-related decline. In the present paper, the authors sought to determine whether destination memory can be improved in older adults using emotional stimuli. This aim was motivated by findings showing better context memory for emotional than for neutral information in older adults. Younger and older adults were asked to tell neutral facts to three types of faces: a neutral one, an emotionally positive one, and an emotionally negative one. On a later recognition test, participants were asked to associate each previously told fact with the face to whom it was told. Destination memory performance was better for facts told to negative than to positive faces, and the latter memory was better than for neutral faces in older adults. Older adults seem to place higher emphasis on emotional material relative to neutral faces, showing better memory for the association between statements and emotional faces.

Quantum-chemical studies on the favored and rare tautomers of neutral and redox adenine.

PubMed

Raczyńska, Ewa D; Makowski, Mariusz; Zientara-Rytter, Katarzyna; Kolczyńska, Katarzyna; Stępniewski, Tomasz M; Hallmann, Małgorzata

2013-02-21

All possible twenty-three prototropic tautomers of neutral and redox adenine (nine amine and fourteen imine forms, including geometric isomerism of the exo ═NH group) were examined in vacuo {DFT(B3LYP)/6-311+G(d,p)}. The NH → NH conversions as well as those usually omitted, NH → CH and CH → CH, were considered. An interesting change of the tautomeric preference occurs when proceeding from neutral to reduced adenine. One-electron reduction favors the nonaromatic amine C8H-N10H tautomer. This tautomeric preference is similar to that (C2H) for reduced imidazole. Water molecules (PCM model) seem to not change this trend. They influence solely the relative energies. The DFT vertical detachment energy in the gas phase is positive for each tautomer, e.g., 0.03 eV for N9H-N10H and 1.84 eV for C8H-N10H. The DFT adiabatic electron affinity for the favored process, neutral N9H-N10H → reduced C8H-N10H (ground states), is equal to 0.18 eV at 0 K (ZPE included). One-electron oxidation does not change the tautomeric preference in the gas phase. The aromatic amine N9H-N10H tautomer is favored for the oxidized molecule similarly as for the neutral one. The DFT adiabatic ionization potential for the favored process, neutral N9H-N10H → oxidized N9H-N10H (ground states), is equal to 8.12 eV at 0 K (ZPE included). Water molecules (PCM model) seem to influence solely the composition of the tautomeric mixture and the relative energies. They change the energies of the oxidation and reduction processes by ca. 2 eV.

DNA Sequence Variation at the Period Locus within and among Species of the Drosophila Melanogaster Complex

PubMed Central

Kliman, R. M.; Hey, J.

1993-01-01

A 1.9-kilobase region of the period locus was sequenced in six individuals of Drosophila melanogaster and from six individuals of each of three sibling species: Drosophila simulans, Drosophila sechellia and Drosophila mauritiana. Extensive genealogical analysis of 174 polymorphic sites reveals a complex history. It appears that D. simulans, as a large population still segregating very old lineages, gave rise to the island species D. mauritiana and D. sechellia. Rather than considering these speciation events as having produced ``sister'' taxa, it seems more appropriate to consider D. simulans a parent species to D. sechellia and D. mauritiana. The order, in time, of these two phylogenetic events remains unclear. D. mauritiana supports a large number of polymorphisms, many of which are shared with D. simulans, and so appears to have begun and persisted as a large population. In contrast, D. sechellia has very little variation and seems to have experienced a severe population bottleneck. Alternatively, the low variation in D. sechellia could be due to recent directional selection and genetic hitchhiking at or near the per locus. PMID:8436278

Unraveling Selection in the Mitochondrial Genome of Drosophila

PubMed Central

Ballard, JWO.; Kreitman, M.

1994-01-01

We examine mitochondrial DNA variation at the cytochrome b locus within and between three species of Drosophila to determine whether patterns of variation conform to the predictions of neutral molecular evolution. The entire 1137-bp cytochrome b locus was sequenced in 16 lines of Drosophila melanogaster, 18 lines of Drosophila simulans and 13 lines of Drosophila yakuba. Patterns of variation depart from neutrality by several test criteria. Analysis of the evolutionary clock hypothesis shows unequal rates of change along D. simulans lineages. A comparison within and between species of the ratio of amino acid replacement change to synonymous change reveals a relative excess of amino acid replacement polymorphism compared to the neutral prediction, suggestive of slightly deleterious or diversifying selection. There is evidence for excess homozygosity in our world wide sample of D. melanogaster and D. simulans alleles, as well as a reduction in the number of segregating sites in D. simulans, indicative of selective sweeps. Furthermore, a test of neutrality for codon usage shows the direction of mutations at third positions differs among different topological regions of the gene tree. The analyses indicate that molecular variation and evolution of mtDNA are governed by many of the same selective forces that have been shown to govern nuclear genome evolution and suggest caution be taken in the use of mtDNA as a ``neutral'' molecular marker. PMID:7851772

The Effect of Polymorphisms in DNA Repair Genes and Carcinogen Metabolizers on Leukocyte Telomere Length: A Cohort of Healthy Spanish Smokers.

PubMed

Verde, Zoraida; Reinoso-Barbero, Luis; Chicharro, Luis; Resano, Pilar; Sánchez-Hernández, Ignacio; Rodríguez González-Moro, Jose Miguel; Bandrés, Fernando; Gómez-Gallego, Félix; Santiago, Catalina

2016-04-01

Smoking implies exposure to carcinogenic agents that causes DNA damage, which could be suspected to enhance telomere attrition. To protect and deal with DNA damage, cells possess mechanisms that repair and neutralize harmful substances. Polymorphisms altering DNA repair capacity or carcinogen metabolism may lead to synergistic effects with tobacco carcinogen-induced shorter telomere length independently of cancer interaction. The aim of this study was to explore the association between leukocyte telomere length (LTL) and several genetic polymorphisms in DNA repair genes and carcinogen metabolizers in a cohort of healthy smokers. We evaluated the effect of six genetic polymorphisms in cytochrome P1A1 (Ile462Val), XRCC1 (Arg399Gln), APEX1 (Asp148Glu), XRCC3 (Thr241Met), and XPD (Asp312Asn; Lys751Gln) on LTL in a cohort of 145 healthy smokers in addition to smoking habits. Logistic regression analysis showed an association between XRCC1 399Gln allele and shorter telomere length (OR = 5.03, 95% CI = 1.08% to 23.36%). There were not association between the rest of polymorphisms analyzed and LTL. Continuous exposure to tobacco could overwhelm the DNA repair machinery, making the effect of the polymorphisms that reduce repair capacity more pronounced. Analyzing the function of smoking-induced DNA-repair genes and LTL is an important goal in order to identify therapeutic targets to treat smoking-induced diseases. © The Author 2015. Published by Oxford University Press on behalf of the Society for Research on Nicotine and Tobacco. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

The Paraoxonase 1 Gene c.-108C>T SNP in the Promoter Is Associated with Risk for Glioma in Mexican Patients, but Not the p.L55M or p.Q192R Polymorphisms in the Coding Region.

PubMed

González-Herrera, Lizbeth; Gamas-Trujillo, Pablo Alejandro; Medina-Escobedo, Gilberto; Oaxaca-Castillo, David; Pérez-Mendoza, Gerardo; Williams-Jacquez, Dayana; Canto-Cetina, Thelma; Vargas-García, Rubén Darío

2015-09-01

To evaluate the association of the paraoxonase 1 (PON1) gene polymorphisms c.-108C>T, p.L55M, and p.Q192R with the risk of glioma in Southeast Mexico. Decreased PON1 activity caused by polymorphisms has been observed in gliomas, thus supporting the theory that PON1 is involved in tumorigenesis in the brain. Sixty-seven glioma patients and 58 control individuals were included. Three PON1 polymorphisms were genotyped by real-time PCR allelic discrimination using TaqMan probes: c.-108C>T in the promoter region, p.Q192R and p.L55M, both of which were in the coding region. Allele, genotype, and haplotype frequencies were assessed in cases and controls to test for statistical associations (STATA 10.2 package). Significant differences were found for the PON1 c.-108C>T polymorphism between the cases and controls. Compared to the controls the cases were more likely to be CT heterozygous (p =  0.002) or TT homozygous (p = 0.036); similarly cases were more likely to possess a T allele (p = 0.032). In contrast, the p.L55M and p.Q192R polymorphisms did not show significant differences between the glioma cases and controls (p > 0.05). The PON1 c.-108C>T polymorphism in the promoter region is associated with genetic risk for glioma. Conversely, p.L55M and p.Q192R polymorphisms in the coding region do not seem to have an influence in this population.

Prognostic role of the CDNK1B V109G polymorphism in multiple endocrine neoplasia type 1

PubMed Central

Circelli, Luisa; Ramundo, Valeria; Marotta, Vincenzo; Sciammarella, Concetta; Marciello, Francesca; Del Prete, Michela; Sabatino, Lina; Pasquali, Daniela; Izzo, Francesco; Scala, Stefania; Colao, Annamaria; Faggiano, Antongiulio; Colantuoni, Vittorio

2015-01-01

CDKN1B encodes the cyclin-dependent kinase inhibitor p27/Kip1. CDKN1B mutations and polymorphisms are involved in tumorigenesis; specifically, the V109G single nucleotide polymorphism has been linked to different tumours with controversial results. Multiple endocrine neoplasia type 1 (MEN1) is a rare autosomal dominant syndrome, characterized by the development of different types of neuroendocrine tumours and increased incidence of other malignancies. A clear genotype–phenotype correlation in MEN1 has not been established yet. In this study, we assessed whether the CDKN1B V109G polymorphism was associated with the development of aggressive tumours in 55 consecutive patients affected by MEN1. The polymorphism was investigated by PCR amplification of germline DNA followed by direct sequencing. Baseline and follow-up data of tumour types and their severity were collected and associated with the genetic data. MEN1-related aggressive and other malignant tumours of any origin were detected in 16.1% of wild-type and 33.3% of polymorphism allele-bearing patients (P = NS). The time interval between birth and the first aggressive tumour was significantly shorter in patients with the CDKN1B V109G polymorphism (median 46 years) than in those without (median not reached; P = 0.03). Similarly, shorter was the time interval between MEN1 diagnosis and age of the first aggressive tumour (P = 0.02). Overall survival could not be estimated as 96% patients were still alive at the time of the study. In conclusion, CDKN1B V109G polymorphism seems to play a role in the development of aggressive tumours in MEN1. PMID:25824098

Sequence variations of the bovine prion protein gene (PRNP) in native Korean Hanwoo cattle

PubMed Central

Choi, Sangho

2012-01-01

Bovine spongiform encephalopathy (BSE) is one of the fatal neurodegenerative diseases known as transmissible spongiform encephalopathies (TSEs) caused by infectious prion proteins. Genetic variations correlated with susceptibility or resistance to TSE in humans and sheep have not been reported for bovine strains including those from Holstein, Jersey, and Japanese Black cattle. Here, we investigated bovine prion protein gene (PRNP) variations in Hanwoo cattle [Bos (B.) taurus coreanae], a native breed in Korea. We identified mutations and polymorphisms in the coding region of PRNP, determined their frequency, and evaluated their significance. We identified four synonymous polymorphisms and two non-synonymous mutations in PRNP, but found no novel polymorphisms. The sequence and number of octapeptide repeats were completely conserved, and the haplotype frequency of the coding region was similar to that of other B. taurus strains. When we examined the 23-bp and 12-bp insertion/deletion (indel) polymorphisms in the non-coding region of PRNP, Hanwoo cattle had a lower deletion allele and 23-bp del/12-bp del haplotype frequency than healthy and BSE-affected animals of other strains. Thus, Hanwoo are seemingly less susceptible to BSE than other strains due to the 23-bp and 12-bp indel polymorphisms. PMID:22705734

Are genetic variants in the platelet-derived growth factor [beta] gene associated with chronic pancreatitis?

PubMed

Muddana, Venkata; Park, James; Lamb, Janette; Yadav, Dhiraj; Papachristou, Georgios I; Hawes, Robert H; Brand, Randall; Slivka, Adam; Whitcomb, David C

2010-11-01

Platelet-derived growth factor [beta] (PDGF-[beta]) is a major signal in proliferation and matrix synthesis through activated pancreatic stellate cells, leading to fibrosis of the pancreas. Recurrent acute pancreatitis (RAP) seems to predispose to chronic pancreatitis (CP) in some patients but not others. We tested the hypothesis that 2 known PDGF-[beta] polymorphisms are associated with progression from RAP to CP. We also tested the hypothesis that PDGF-[beta] polymorphisms in combination with environmental risk factors such as alcohol and smoking are associated with CP. Three hundred eighty-two patients with CP (n = 176) and RAP (n = 206) and 251 controls were evaluated. Platelet-derived growth factor [beta] polymorphisms +286 A/G (rs#1800818) seen in 5'-UTR and +1135 A/C (rs#1800817) in first intron were genotyped using single-nucleotide polymorphism polymerase chain reaction approach and confirmed by DNA sequencing. The genotypic frequencies for PDGF-[beta] polymorphisms in positions +286 and +1135 were found to be similar in controls and patients with RAP and CP. There was no difference in genotypic frequencies among RAP, CP, and controls in subjects in the alcohol and smoking subgroups. Known variations in the PDGF-[beta] gene do not have a significant effect on promoting or preventing fibrogenesis in pancreatitis. Further evaluation of this important pathway is warranted.

Heated oligonucleotide ligation assay (HOLA): an affordable single nucleotide polymorphism assay.

PubMed

Black, W C; Gorrochotegui-Escalante, N; Duteau, N M

2006-03-01

Most single nucleotide polymorphism (SNP) detection requires expensive equipment and reagents. The oligonucleotide ligation assay (OLA) is an inexpensive SNP assay that detects ligation between a biotinylated "allele-specific detector" and a 3' fluorescein-labeled "reporter" oligonucleotide. No ligation occurs unless the 3' detector nucleotide is complementary to the SNP nucleotide. The original OLA used chemical denaturation and neutralization. Heated OLA (HOLA) instead uses a thermal stable ligase and cycles of denaturing and hybridization for ligation and SNP detection. The cost per genotype is approximately US$1.25 with two-allele SNPs or approximately US$1.75 with three-allele SNPs. We illustrate the development of HOLA for SNP detection in the Early Trypsin and Abundant Trypsin loci in the mosquito Aedes aegypti (L.) and at the a-glycerophosphate dehydrogenase locus in the mosquito Anopheles gambiae s.s.

Paraoxonase 1 (PON1) gene-108C>T and p.Q192R polymorphisms and arylesterase activity of the enzyme in patients with dementia.

PubMed

Bednarska-Makaruk, Małgorzata Ewa; Krzywkowski, Tomasz; Graban, Alla; Lipczyńska-Łojkowska, Wanda; Bochyńska, Anna; Rodo, Maria; Wehr, Hanna; Ryglewicz, Danuta Krystyna

2013-01-01

Paraoxonase 1 (PON1) activity was determined using phenylacetate as substrate (arylesterase activity) in 304 individuals with dementia--136 recognised as probable Alzheimer's disease (AD), 64 as dementia of vascular origin (VaD) and 104 as mixed dementia (MD) and in 129 persons without symptoms of dementia and in a good general health. -108C>T polymorphism in the PON1 gene promoter and p.Q192R polymorphism in the coding region were identified. PON1 activity was significantly lower in demented patients as compared with controls particularly in dementia of a neurodegenerative character (AD and MD). The prevalence of PON1-108T allele carriers was significantly higher in the AD group than in controls. The frequencies of the p.Q192R genotypes did not differ significantly between the investigated groups. An association of the rare T-R haplotype with dementia, particularly with dementia of the neurodegenerative type, was found. Multivariate regression analysis showed a significant association of PON1 activity with PON1 -108C>T and p.Q192R polymorphisms. The influence not only of promoter -108C>T, but also of p.Q192R polymorphism on PON1 arylesterase activity was observed. One has to admit that this kind of polymorphism does not preclude interference with the enzyme activity. It could be concluded that the PON1 gene promoter polymorphism plays an additional role in Alzheimer's disease development. It seems however that PON1 activity has a dominating influence on the dementia risk.

Depressive symptoms in schizophrenia and dopamine and serotonin gene polymorphisms.

PubMed

Peitl, Vjekoslav; Štefanović, Mario; Karlović, Dalibor

2017-07-03

Although depressive symptoms seem to be frequent in schizophrenia they have received significantly less attention than other symptom domains. As impaired serotonergic and dopaminergic neurotransmission is implicated in the pathogenesis of depression and schizophrenia this study sought to investigate the putative association between several functional gene polymorphisms (SERT 5-HTTLPR, MAO-A VNTR, COMT Val158Met and DAT VNTR) and schizophrenia. Other objectives of this study were to closely examine schizophrenia symptom domains by performing factor analysis of the two most used instruments in this setting (Positive and negative syndrome scale - PANSS and Calgary depression rating scale - CDSS) and to examine the influence of investigated gene polymorphisms on the schizophrenia symptom domains, focusing on depressive scores. A total of 591 participants were included in the study (300 schizophrenic patients and 291 healthy volunteers). 192 (64%) of schizophrenic patients had significant depressive symptoms. Genotype distribution revealed no significant differences regarding all investigated polymorphisms except the separate gender analysis for MAO-A gene polymorphism which revealed significantly more allele 3 carriers in schizophrenic males. Factor analysis of the PANSS scale revealed the existence of five separate factors (symptom domains), while the CDSS scale revealed two distinct factors. Several investigated gene polymorphisms (mostly SERT and MAO-A, but also COMT) significantly influenced two factors from the PANSS (aggressive/impulsive and negative symptoms) and one from the CDSS scale (suicidality), respectively. Depressive symptoms in schizophrenic patients may be influenced by functional gene polymorphisms, especially those implicated in serotonergic neurotransmission. Copyright © 2017 Elsevier Inc. All rights reserved.

Impact of estrogen receptor α gene and oxytocin receptor gene polymorphisms on female sexuality

PubMed Central

Armeni, Anastasia K; Assimakopoulos, Konstantinos; Marioli, Dimitra; Koika, Vassiliki; Michaelidou, Euthychia; Mourtzi, Niki; Iconomou, Gregoris

2017-01-01

Over the past decades, research attention has increasingly been paid to the neurobiological component of sexual behavior. The aim of the present study was to investigate the correlation of estrogen receptor α (ERA) gene polymorphism (rs2234693-PvuII) (T→C substitution) and oxytocin receptor gene polymorphism (rs53576) (G→A substitution) with sexuality parameters of young, healthy women. One hundred thirty-three Greek heterosexual women, students in higher education institutions, 20–25 years of age, sexually active, with normal menstrual cycles (28–35 days), were recruited in the study. Exclusion criteria were chronic and/or major psychiatric diseases, use of oral contraceptive pills (OCs), polycystic ovary syndrome (PCOS), thyroid diseases as well as drugs that are implicated in hypothalamus–pituitary–gonadal axis. T allele (wildtype) of rs2234693 (PvuII) polymorphism of ERA gene was correlated with increased levels of arousal and lubrication, whereas A allele (polymorphic) of rs53576 (OXTR) polymorphism was correlated with increased arousal levels. The simultaneous presence of both T allele of rs2234693 (PvuII) and A allele of rs53576 (OXTR) polymorphisms (T + A group) was correlated with increased arousal, orgasm levels as well as female sexual function index full score. To our knowledge, this is the first study to investigate the interaction between ERA and OXTR with regard to sexual function in women. Female sexuality is a complex behavioral trait that encompasses both biological and psychological components. It seems that variability in female sexual response stems from genetic variability that characterizes endocrine, neurotransmitter and central nervous system influences. PMID:28069897

The relationship between ACE polymorphism and panic disorder.

PubMed

Gulec-Yılmaz, Seda; Gulec, Huseyın; Dalan, Altay Burak; Cetın, Bugra; Tımırcı-Kahraman, Ozlem; Ogut, Dıcle Bılge; Atasoy, Hande; Dırımen, Gulız Arikan; Gultekın, Guldal Inal; Isbır, Turgay

2014-01-01

The angiotensin converting enzyme (ACE) gene, which has been found to have an insertion and deletion polymorphism (I/D), is of increasing interest in etiology and treatment of various psychiatric disorders such as panic disorder. The present study aimed to investigate the relationship between ACE polymorphism and panic disorder. In this study, 43 patients diagnosed with panic disorder at the Erenköy Mental and Neurological Diseases Training and Research Hospital, Istanbul and 41 healthy controls were enrolled. The ACE gene insertion/deletion polymorphism of exon 16 was evaluated using the polymerase chain reaction method. There was a significant association between I/D genotype and panic disorder (p=0.003). However, the frequency of the I allele was found to be significantly higher in patients compared to controls (p=0.002). In addition, we recognized a significant association between I/D polymorphism and respiratory-type panic disorder in patients. Carriers of the D allele also had an increased risk of respiratory type panic disorder patients (p=0.034). Moreover, the result of Spearman correlation analysis showed an association with ACE D allele and severity of panic disorder (p<0.001). We suggest that the I/D polymorphism of the ACE gene is associated with panic disorder and particularly respiratory-type panic disorder in patients. The I/D polymorphism of the ACE gene seems to influence therapeutic outcome in patients suffering from panic disorder. Our results indicate that ACE D allele is associated with the severity of panic disorder. Copyright © 2014 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved.

The Joint Effects of Background Selection and Genetic Recombination on Local Gene Genealogies

PubMed Central

Zeng, Kai; Charlesworth, Brian

2011-01-01

Background selection, the effects of the continual removal of deleterious mutations by natural selection on variability at linked sites, is potentially a major determinant of DNA sequence variability. However, the joint effects of background selection and genetic recombination on the shape of the neutral gene genealogy have proved hard to study analytically. The only existing formula concerns the mean coalescent time for a pair of alleles, making it difficult to assess the importance of background selection from genome-wide data on sequence polymorphism. Here we develop a structured coalescent model of background selection with recombination and implement it in a computer program that efficiently generates neutral gene genealogies for an arbitrary sample size. We check the validity of the structured coalescent model against forward-in-time simulations and show that it accurately captures the effects of background selection. The model produces more accurate predictions of the mean coalescent time than the existing formula and supports the conclusion that the effect of background selection is greater in the interior of a deleterious region than at its boundaries. The level of linkage disequilibrium between sites is elevated by background selection, to an extent that is well summarized by a change in effective population size. The structured coalescent model is readily extendable to more realistic situations and should prove useful for analyzing genome-wide polymorphism data. PMID:21705759

Dopamine D4 receptor polymorphism modulates cue-elicited heroin craving in Chinese.

PubMed

Shao, Chunhong; Li, Yifeng; Jiang, Kaida; Zhang, Dandan; Xu, Yifeng; Lin, Ling; Wang, Qiuying; Zhao, Min; Jin, Li

2006-06-01

Subjective craving, which contributes to the continuation of drug use in active abuser and the occurrence of relapse in detoxified abusers, is considered to be a central phenomenon in addiction. Dopamine pathway has been implicated in the mechanism underlying the cue-elicited craving for a variety of addictive substances. The objective of this study was to test the hypothesis that heroin addicts carrying D4 dopamine receptor gene (DRD4) variable number tandem repeat (VNTR) long type allele would have higher craving after exposure to a heroin-related cue. Craving was induced by a series of exposure to neutral and heroin-related cue and were assessed in a cohort of Chinese heroin abusers (n=420) recruited from the Voluntary Drug Dependence Treatment Center at Shanghai. Significantly stronger cue-elicited heroin craving was found in individuals carrying DRD4 VNTR long type allele than the non-carriers (F=31.040, p<0.001). As for baseline craving and mean change in craving responding to neutral stimuli, no significance was found (1.06+/-0.34 vs 1.07+/-0.36, F=0.067, p=0.797 and 0.42+/-0.34 vs 0.45+/-0.37, F=0.277, p=0.599, respectively). The results of our study suggest that DRD4 VNTR polymorphism contributes to cue-elicited craving in heroin dependence, indicating DRD4 VNTR represents one of potential genetic risk factors for cue-induced craving.

The joint effects of background selection and genetic recombination on local gene genealogies.

PubMed

Zeng, Kai; Charlesworth, Brian

2011-09-01

Background selection, the effects of the continual removal of deleterious mutations by natural selection on variability at linked sites, is potentially a major determinant of DNA sequence variability. However, the joint effects of background selection and genetic recombination on the shape of the neutral gene genealogy have proved hard to study analytically. The only existing formula concerns the mean coalescent time for a pair of alleles, making it difficult to assess the importance of background selection from genome-wide data on sequence polymorphism. Here we develop a structured coalescent model of background selection with recombination and implement it in a computer program that efficiently generates neutral gene genealogies for an arbitrary sample size. We check the validity of the structured coalescent model against forward-in-time simulations and show that it accurately captures the effects of background selection. The model produces more accurate predictions of the mean coalescent time than the existing formula and supports the conclusion that the effect of background selection is greater in the interior of a deleterious region than at its boundaries. The level of linkage disequilibrium between sites is elevated by background selection, to an extent that is well summarized by a change in effective population size. The structured coalescent model is readily extendable to more realistic situations and should prove useful for analyzing genome-wide polymorphism data.

Insights into water-mediated ion clustering in aqueous CaSO4 solutions: pre-nucleation cluster characteristics studied by ab initio calculations and molecular dynamics simulations.

PubMed

Li, Hui-Ji; Yan, Dan; Cai, Hou-Qin; Yi, Hai-Bo; Min, Xiao-Bo; Xia, Fei-Fei

2017-05-10

The molecular structure of growth units building crystals is a fundamental issue in the crystallization processes from aqueous solutions. In this work, a systematic investigation of pre-nucleation clusters and their hydration characteristics in aqueous CaSO 4 solutions was performed using ab initio calculations and molecular dynamics (MD) simulations. The results of ab initio calculations and MD simulations indicate that the dominant species in aqueous CaSO 4 solutions are monodentate ion-associated structures. Compared with charged ion clusters, neutral clusters are more likely to be present in an aqueous CaSO 4 solution. Neutral (CaSO 4 ) m clusters are probably the growth units involved in the pre-nucleation or crystallization processes. Meanwhile, hydration behavior around ion associated species in aqueous CaSO 4 solutions plays an important role in related phase/polymorphism selections. Upon ion clustering, the residence of some water molecules around Ca 2+ in ion-associated species is weakened while that of some bridging waters is enhanced due to dual interaction by Ca 2+ and SO 4 2- . Some phase/polymorphism selections can be achieved in aqueous CaSO 4 solutions by controlling the hydration around pre-nucleation clusters. Moreover, the association trend between calcium and sulfate is found to be relatively strong, which hints at the low solubility of calcium sulfate in water.

Toll-like receptor polymorphisms in malaria-endemic populations

PubMed Central

Greene, Jennifer A; Moormann, Ann M; Vulule, John; Bockarie, Moses J; Zimmerman, Peter A; Kazura, James W

2009-01-01

Background Toll-like receptors (TLR) and related downstream signaling pathways of innate immunity have been implicated in the pathogenesis of Plasmodium falciparum malaria. Because of their potential role in malaria pathogenesis, polymorphisms in these genes may be under selective pressure in populations where this infectious disease is endemic. Methods A post-PCR Ligation Detection Reaction-Fluorescent Microsphere Assay (LDR-FMA) was developed to determine the frequencies of TLR2, TLR4, TLR9, MyD88-Adaptor Like Protein (MAL) single nucleotide polymorphisms (SNPs), and TLR2 length polymorphisms in 170 residents of two regions of Kenya where malaria transmission is stable and high (holoendemic) or episodic and low, 346 residents of a malaria holoendemic region of Papua New Guinea, and 261 residents of North America of self-identified ethnicity. Results The difference in historical malaria exposure between the two Kenyan sites has significantly increased the frequency of malaria protective alleles glucose-6-phoshpate dehydrogenase (G6PD) and Hemoglobin S (HbS) in the holoendemic site compared to the episodic transmission site. However, this study detected no such difference in the TLR2, TLR4, TLR9, and MAL allele frequencies between the two study sites. All polymorphisms were in Hardy Weinberg Equilibrium in the Kenyan and Papua New Guinean populations. TLR9 SNPs and length polymorphisms within the TLR2 5' untranslated region were the only mutant alleles present at a frequency greater than 10% in all populations. Conclusion Similar frequencies of TLR2, TLR4, TLR9, and MAL genetic polymorphisms in populations with different histories of malaria exposure suggest that these innate immune pathways have not been under strong selective pressure by malaria. Genotype frequencies are consistent with Hardy-Weinberg Equilibrium and the Neutral Theory, suggesting that genetic drift has influenced allele frequencies to a greater extent than selective pressure from malaria or any other infectious agents in these populations. PMID:19317913

Sepsis in acute myeloid leukaemia patients receiving high-dose chemotherapy: no impact of chitotriosidase and mannose-binding lectin polymorphisms.

PubMed

Klostergaard, Anja; Steffensen, Rudi; Møller, Jens K; Peterslund, Niels; Juhl-Christensen, Caroline; Mølle, Ingolf

2010-07-01

Infections after chemotherapy often cause significant morbidity in patients with acute myeloid leukaemia (AML). Chitotriosidase (CHIT) and mannose-binding lectin (MBL) are part of the innate immune system. Polymorphism in the CHIT-coding gene (CHIT1) may be associated with Gram-negative sepsis in children with AML, and polymorphism in the MBL-coding gene (MBL2) seems to modify the risk of infections in several patient groups. The purpose of this study was to investigate the possible associations between polymorphisms in CHIT1, MBL2 and sepsis in adult patients treated with high-dose chemotherapy for AML. We included 190 patients treated with 526 cycles of chemotherapy. The follow-up period was 6 months from the diagnosis of AML. Prophylactic antibiotics were not used. We identified 604 febrile episodes with 246 episodes of sepsis. Thirty-two patients (17%) either died from infection or infection was a major concomitant factor for death. No significant associations between CHIT1 polymorphism and sepsis (P = 0.85) or death caused by sepsis (P = 0.14) were found. Furthermore, no significant associations between MBL2 polymorphism and sepsis (P = 0.76) or death caused by sepsis (P = 0.24) were observed. The severe and long-lasting neutropenia and mucositis after chemotherapy may explain why the MBL system does not protect against sepsis in patients with AML. Replacement therapy with recombinant MBL is not likely to decrease the risk of sepsis in patients with AML.

Genetic Susceptibility to Cardiac and Digestive Clinical Forms of Chronic Chagas Disease: Involvement of the CCR5 59029 A/G Polymorphism.

PubMed

de Oliveira, Amanda Priscila; Bernardo, Cássia Rubia; Camargo, Ana Vitória da Silveira; Ronchi, Luiz Sérgio; Borim, Aldenis Albaneze; de Mattos, Cinara Cássia Brandão; de Campos Júnior, Eumildo; Castiglioni, Lílian; Netinho, João Gomes; Cavasini, Carlos Eugênio; Bestetti, Reinaldo Bulgarelli; de Mattos, Luiz Carlos

2015-01-01

The clinical manifestations of chronic Chagas disease include the cardiac form of the disease and the digestive form. Not all the factors that act in the variable clinical course of this disease are known. This study investigated whether the CCR5Δ32 (rs333) and CCR5 59029 A/G (promoter region--rs1799987) polymorphisms of the CCR5 gene are associated with different clinical forms of chronic Chagas disease and with the severity of left ventricular systolic dysfunction in patients with chronic Chagas heart disease (CCHD). The antibodies anti-T. cruzi were identified by ELISA. PCR and PCR-RFLP were used to identify the CCR5Δ32 and CCR5 59029 A/G polymorphisms. The chi-square test was used to compare variables between groups. There was a higher frequency of the AA genotype in patients with CCHD compared with patients with the digestive form of the disease and the control group. The results also showed a high frequency of the AG genotype in patients with the digestive form of the disease compared to the other groups. The results of this study show that the CCR5Δ32 polymorphism does not seem to influence the different clinical manifestations of Chagas disease but there is involvement of the CCR5 59029 A/G polymorphism in susceptibility to the different forms of chronic Chagas disease. Besides, these polymorphisms do not influence left ventricular systolic dysfunction in patients with CCHD.

Polymorphism in the promoter region of the Toll-like receptor 9 gene and cervical human papillomavirus infection.

PubMed

Oliveira, Lucas Boeno; Louvanto, Karolina; Ramanakumar, Agnihotram V; Franco, Eduardo L; Villa, Luisa L

2013-08-01

Polymorphism in the Toll-like receptor (TLR) 9 gene has been shown to have a significant role in some diseases; however, little is known about its possible role in the natural history of human papillomavirus (HPV) infections. We investigated the association between a single-nucleotide polymorphism (SNP) (rs5743836) in the promoter region of TLR9 (T1237C) and type-specific HPV infections. Specimens were derived from a cohort of 2462 women enrolled in the Ludwig-McGill Cohort Study. We randomly selected 500 women who had a cervical HPV infection detected at least once during the study as cases. We defined two control groups: (i) a random sample of 300 women who always tested HPV negative, and (ii) a sample of 234 women who were always HPV negative but had a minimum of ten visits during the study. TLR9 genotyping was performed using bidirectional PCR amplification of specific alleles. Irrespective of group, the WT homozygous TLR9 genotype (TT) was the most common form, followed by the heterozygous (TC) and the mutant homozygous (CC) forms. There were no consistent associations between polymorphism and infection risk, either overall or by type or species. Likewise, there were no consistently significant associations between polymorphism and HPV clearance or persistence. We concluded that this polymorphism in the promoter region of TLR9 gene does not seem to have a mediating role in the natural history of the HPV infection.

Genetic variation of loci potentially under selection confounds species-genetic diversity correlations in a fragmented habitat.

PubMed

Bertin, Angeline; Gouin, Nicolas; Baumel, Alex; Gianoli, Ernesto; Serratosa, Juan; Osorio, Rodomiro; Manel, Stephanie

2017-01-01

Positive species-genetic diversity correlations (SGDCs) are often thought to result from the parallel influence of neutral processes on genetic and species diversity. Yet, confounding effects of non-neutral mechanisms have not been explored. Here, we investigate the impact of non-neutral genetic diversity on SGDCs in high Andean wetlands. We compare correlations between plant species diversity and genetic diversity (GD) calculated with and without loci potentially under selection (outlier loci). The study system includes 2188 specimens from five species (three common aquatic macroinvertebrate and two dominant plant species) that were genotyped for 396 amplified fragment length polymorphism loci. We also appraise the importance of neutral processes on SGDCs by investigating the influence of habitat fragmentation features. Significant positive SGDCs were detected for all five species (mean SGDC = 0.52 ± 0.05). While only a few outlier loci were detected in each species, they resulted in significant decreases in GD and in SGDCs. This supports the hypothesis that neutral processes drive species-genetic diversity relationships in high Andean wetlands. Unexpectedly, the effects on genetic diversity GD of the habitat fragmentation characteristics in this study increased with the presence of outlier loci in two species. Overall, our results reveal pitfalls in using habitat features to infer processes driving SGDCs and show that a few loci potentially under selection are enough to cause a significant downward bias in SGDC. Investigating confounding effects of outlier loci thus represents a useful approach to evidence the contribution of neutral processes on species-genetic diversity relationships. © 2016 John Wiley & Sons Ltd.

Adaptive Genetic Divergence along Narrow Environmental Gradients in Four Stream Insects

PubMed Central

Watanabe, Kozo; Kazama, So; Omura, Tatsuo; Monaghan, Michael T.

2014-01-01

A central question linking ecology with evolutionary biology is how environmental heterogeneity can drive adaptive genetic divergence among populations. We examined adaptive divergence of four stream insects from six adjacent catchments in Japan by combining field measures of habitat and resource components with genome scans of non-neutral Amplified Fragment Length Polymorphism (AFLP) loci. Neutral genetic variation was used to measure gene flow and non-neutral genetic variation was used to test for adaptive divergence. We identified the environmental characteristics contributing to divergence by comparing genetic distances at non-neutral loci between sites with Euclidean distances for each of 15 environmental variables. Comparisons were made using partial Mantel tests to control for geographic distance. In all four species, we found strong evidence for non-neutral divergence along environmental gradients at between 6 and 21 loci per species. The relative contribution of these environmental variables to each species' ecological niche was quantified as the specialization index, S, based on ecological data. In each species, the variable most significantly correlated with genetic distance at non-neutral loci was the same variable along which each species was most narrowly distributed (i.e., highest S). These were gradients of elevation (two species), chlorophyll-a, and ammonia-nitrogen. This adaptive divergence occurred in the face of ongoing gene flow (F st = 0.01–0.04), indicating that selection was strong enough to overcome homogenization at the landscape scale. Our results suggest that adaptive divergence is pronounced, occurs along different environmental gradients for different species, and may consistently occur along the narrowest components of species' niche. PMID:24681871

Population growth enhances the mean fixation time of neutral mutations and the persistence of neutral variation.

PubMed

Waxman, D

2012-06-01

A fundamental result of population genetics states that a new mutation, at an unlinked neutral locus in a randomly mating diploid population, has a mean time of fixation of ∼4N(e) generations, where N(e) is the effective population size. This result is based on an assumption of fixed population size, which does not universally hold in natural populations. Here, we analyze such neutral fixations in populations of changing size within the framework of the diffusion approximation. General expressions are derived for the mean and variance of the fixation time in changing populations. Some explicit results are given for two cases: (i) the effective population size undergoes a sudden change, representing a sudden population expansion or a sudden bottleneck; (ii) the effective population changes linearly for a limited period of time and then remains constant. Additionally, a lower bound for the mean time of fixation is obtained for an effective population size that increases with time, and this is applied to exponentially growing populations. The results obtained in this work show, among other things, that for populations that increase in size, the mean time of fixation can be enhanced, sometimes substantially so, over 4N(e,0) generations, where N(e,0) is the effective population size at the time the mutation arises. Such an enhancement is associated with (i) an increased probability of neutral polymorphism in a population and (ii) an enhanced persistence of high-frequency neutral variation, which is the variation most likely to be observed.

The interplay between local ecology, divergent selection, and genetic drift in population divergence of a sexually antagonistic female trait.

PubMed

Green, Kristina Karlsson; Svensson, Erik I; Bergsten, Johannes; Härdling, Roger; Hansson, Bengt

2014-07-01

Genetically polymorphic species offer the possibility to study maintenance of genetic variation and the potential role for genetic drift in population divergence. Indirect inference of the selection regimes operating on polymorphic traits can be achieved by comparing population divergence in neutral genetic markers with population divergence in trait frequencies. Such an approach could further be combined with ecological data to better understand agents of selection. Here, we infer the selective regimes acting on a polymorphic mating trait in an insect group; the dorsal structures (either rough or smooth) of female diving beetles. Our recent work suggests that the rough structures have a sexually antagonistic function in reducing male mating attempts. For two species (Dytiscus lapponicus and Graphoderus zonatus), we could not reject genetic drift as an explanation for population divergence in morph frequencies, whereas for the third (Hygrotus impressopunctatus) we found that divergent selection pulls morph frequencies apart across populations. Furthermore, population morph frequencies in H. impressopunctatus were significantly related to local bioclimatic factors, providing an additional line of evidence for local adaptation in this species. These data, therefore, suggest that local ecological factors and sexual conflict interact over larger spatial scales to shape population divergence in the polymorphism. © 2014 The Author(s). Evolution © 2014 The Society for the Study of Evolution.

Sequence-related amplified polymorphism (SRAP) markers: A potential resource for studies in plant molecular biology(1.).

PubMed

Robarts, Daniel W H; Wolfe, Andrea D

2014-07-01

In the past few decades, many investigations in the field of plant biology have employed selectively neutral, multilocus, dominant markers such as inter-simple sequence repeat (ISSR), random-amplified polymorphic DNA (RAPD), and amplified fragment length polymorphism (AFLP) to address hypotheses at lower taxonomic levels. More recently, sequence-related amplified polymorphism (SRAP) markers have been developed, which are used to amplify coding regions of DNA with primers targeting open reading frames. These markers have proven to be robust and highly variable, on par with AFLP, and are attained through a significantly less technically demanding process. SRAP markers have been used primarily for agronomic and horticultural purposes, developing quantitative trait loci in advanced hybrids and assessing genetic diversity of large germplasm collections. Here, we suggest that SRAP markers should be employed for research addressing hypotheses in plant systematics, biogeography, conservation, ecology, and beyond. We provide an overview of the SRAP literature to date, review descriptive statistics of SRAP markers in a subset of 171 publications, and present relevant case studies to demonstrate the applicability of SRAP markers to the diverse field of plant biology. Results of these selected works indicate that SRAP markers have the potential to enhance the current suite of molecular tools in a diversity of fields by providing an easy-to-use, highly variable marker with inherent biological significance.

Sequence-related amplified polymorphism (SRAP) markers: A potential resource for studies in plant molecular biology1

PubMed Central

Robarts, Daniel W. H.; Wolfe, Andrea D.

2014-01-01

In the past few decades, many investigations in the field of plant biology have employed selectively neutral, multilocus, dominant markers such as inter-simple sequence repeat (ISSR), random-amplified polymorphic DNA (RAPD), and amplified fragment length polymorphism (AFLP) to address hypotheses at lower taxonomic levels. More recently, sequence-related amplified polymorphism (SRAP) markers have been developed, which are used to amplify coding regions of DNA with primers targeting open reading frames. These markers have proven to be robust and highly variable, on par with AFLP, and are attained through a significantly less technically demanding process. SRAP markers have been used primarily for agronomic and horticultural purposes, developing quantitative trait loci in advanced hybrids and assessing genetic diversity of large germplasm collections. Here, we suggest that SRAP markers should be employed for research addressing hypotheses in plant systematics, biogeography, conservation, ecology, and beyond. We provide an overview of the SRAP literature to date, review descriptive statistics of SRAP markers in a subset of 171 publications, and present relevant case studies to demonstrate the applicability of SRAP markers to the diverse field of plant biology. Results of these selected works indicate that SRAP markers have the potential to enhance the current suite of molecular tools in a diversity of fields by providing an easy-to-use, highly variable marker with inherent biological significance. PMID:25202637

Spatial and temporal distribution of the neutral polymorphisms in the last ZFX intron: analysis of the haplotype structure and genealogy.

PubMed Central

Jaruzelska, J; Zietkiewicz, E; Batzer, M; Cole, D E; Moisan, J P; Scozzari, R; Tavaré, S; Labuda, D

1999-01-01

With 10 segregating sites (simple nucleotide polymorphisms) in the last intron (1089 bp) of the ZFX gene we have observed 11 haplotypes in 336 chromosomes representing a worldwide array of 15 human populations. Two haplotypes representing 77% of all chromosomes were distributed almost evenly among four continents. Five of the remaining haplotypes were detected in Africa and 4 others were restricted to Eurasia and the Americas. Using the information about the ancestral state of the segregating positions (inferred from human-great ape comparisons), we applied coalescent analysis to estimate the age of the polymorphisms and the resulting haplotypes. The oldest haplotype, with the ancestral alleles at all the sites, was observed at low frequency only in two groups of African origin. Its estimated age of 740 to 1100 kyr corresponded to the time to the most recent common ancestor. The two most frequent worldwide distributed haplotypes were estimated at 550 to 840 and 260 to 400 kyr, respectively, while the age of the continentally restricted polymorphisms was 120 to 180 kyr and smaller. Comparison of spatial and temporal distribution of the ZFX haplotypes suggests that modern humans diverged from the common ancestral stock in the Middle Paleolithic era. Subsequent range expansion prevented substantial gene flow among continents, separating African groups from populations that colonized Eurasia and the New World. PMID:10388827

Spatial and temporal distribution of the neutral polymorphisms in the last ZFX intron: analysis of the haplotype structure and genealogy.

PubMed

Jaruzelska, J; Zietkiewicz, E; Batzer, M; Cole, D E; Moisan, J P; Scozzari, R; Tavaré, S; Labuda, D

1999-07-01

With 10 segregating sites (simple nucleotide polymorphisms) in the last intron (1089 bp) of the ZFX gene we have observed 11 haplotypes in 336 chromosomes representing a worldwide array of 15 human populations. Two haplotypes representing 77% of all chromosomes were distributed almost evenly among four continents. Five of the remaining haplotypes were detected in Africa and 4 others were restricted to Eurasia and the Americas. Using the information about the ancestral state of the segregating positions (inferred from human-great ape comparisons), we applied coalescent analysis to estimate the age of the polymorphisms and the resulting haplotypes. The oldest haplotype, with the ancestral alleles at all the sites, was observed at low frequency only in two groups of African origin. Its estimated age of 740 to 1100 kyr corresponded to the time to the most recent common ancestor. The two most frequent worldwide distributed haplotypes were estimated at 550 to 840 and 260 to 400 kyr, respectively, while the age of the continentally restricted polymorphisms was 120 to 180 kyr and smaller. Comparison of spatial and temporal distribution of the ZFX haplotypes suggests that modern humans diverged from the common ancestral stock in the Middle Paleolithic era. Subsequent range expansion prevented substantial gene flow among continents, separating African groups from populations that colonized Eurasia and the New World.

Polymorphisms of genes involved in polycyclic aromatic hydrocarbons’ biotransformation and atherosclerosis

PubMed Central

Marinković, Natalija; Pašalić, Daria; Potočki, Slavica

2013-01-01

Polycyclic aromatic hydrocarbons (PAHs) are among the most prevalent environmental pollutants and result from the incomplete combustion of hydrocarbons (coal and gasoline, fossil fuel combustion, byproducts of industrial processing, natural emission, cigarette smoking, etc.). The first phase of xenobiotic biotransformation in the PAH metabolism includes activities of cytochrome P450 from the CYP1 family and microsomal epoxide hydrolase. The products of this biotransformation are reactive oxygen species that are transformed in the second phase through the formation of conjugates with glutathione, glucuronate or sulphates. PAH exposure may lead to PAH-DNA adduct formation or induce an inflammatory atherosclerotic plaque phenotype. Several genetic polymorphisms of genes encoded for enzymes involved in PAH biotransformation have been proven to lead to the development of diseases. Enzyme CYP P450 1A1, which is encoded by the CYP1A1 gene, is vital in the monooxygenation of lipofilic substrates, while GSTM1 and GSTT1 are the most abundant isophorms that conjugate and neutralize oxygen products. Some single nucleotide polymorphisms of the CYP1A1 gene as well as the deletion polymorphisms of GSTT1 and GSTM1 may alter the final specific cellular inflammatory respond. Occupational exposure or conditions from the living environment can contribute to the production of PAH metabolites with adverse effects on human health. The aim of this study was to obtain data on biotransformation and atherosclerosis, as well as data on the gene polymorphisms involved in biotransformation, in order to better study gene expression and further elucidate the interaction between genes and the environment. PMID:24266295

Nonneutral mitochondrial DNA variation in humans and chimpanzees

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nachman, M.W.; Aquadro, C.F.; Brown, W.M.

1996-03-01

We sequenced the NADH dehydrogenase subunit 3 (ND3) gene from a sample of 61 humans, five common chimpanzees, and one gorilla to test whether patterns of mitochondrial DNA (mtDNA) variation are consistent with a neutral model of molecular evolution. Within humans and within chimpanzees, the ratio of replacement to silent nucleotide substitutions was higher than observed in comparisons between species, contrary to neutral expectations. To test the generality of this result, we reanalyzed published human RFLP data from the entire mitochondrial genome. Gains of restriction sites relative to a known human mtDNA sequence were used to infer unambiguous nucleotide substitutions.more » We also compared the complete mtDNA sequences of three humans. Both the RFLP data and the sequence data reveal a higher ratio of replacement to silent nucleotide substitutions within humans than is seen between species. This pattern is observed at most or all human mitochondrial genes and is inconsistent with a strictly neutral model. These data suggest that many mitochondrial protein polymorphisms are slightly deleterious, consistent with studies of human mitochondrial diseases. 59 refs., 2 figs., 8 tabs.« less

Testing the link between population genetic differentiation and clade diversification in Costa Rican orchids.

PubMed

Kisel, Yael; Moreno-Letelier, Alejandra C; Bogarín, Diego; Powell, Martyn P; Chase, Mark W; Barraclough, Timothy G

2012-10-01

Species population genetics could be an important factor explaining variation in clade species richness. Here, we use newly generated amplified fragment length polymorphism (AFLP) data to test whether five pairs of sister clades of Costa Rican orchids that differ greatly in species richness also differ in average neutral genetic differentiation within species, expecting that if the strength of processes promoting differentiation within species is phylogenetically heritable, then clades with greater genetic differentiation should diversify more. Contrary to expectation, neutral genetic differentiation does not correlate directly with total diversification in the clades studied. Neutral genetic differentiation varies greatly among species and shows no heritability within clades. Half of the variation in neutral genetic differentiation among populations can be explained by ecological variables, and species-level traits explain the most variation. Unexpectedly, we find no isolation by distance in any species, but genetic differentiation is greater between populations occupying different niches. This pattern corresponds with those observed for microscopic eukaryotes and could reflect effective widespread dispersal of tiny and numerous orchid seeds. Although not providing a definitive answer to whether population genetics processes affect clade diversification, this work highlights the potential for addressing new macroevolutionary questions using a comparative population genetic approach. © 2012 The Author(s). Evolution© 2012 The Society for the Study of Evolution.

Pathogenicity of missense mutations in SURF1 deficiency inducing the Leigh syndrome. Importance in diagnosis.

PubMed

Dubot, A; Hervouet, E; Mandon, G; Zabot, M T; Godinot, C

2004-06-01

Leigh syndrome with cytochrome oxidase (COX) deficiency has been associated with SURF1 mutations. For patient diagnosis, distinction between neutral polymorphisms and pathogenic missense SURF1 mutations in Leigh syndrome is essential. We show that several missense SURF1 mutations did not allow a stable protein to be expressed. Absence of immunologically reactive SURF1 is, therefore, helpful to demonstrate their pathogenicity. In addition, we show that out of two previously described missense mutations housed by the same allele, only one, the T737 C was pathogenic. Indeed, transfection of T737 C mutated SURF1 in SURF1-deficient cells did not restore normal SURF1 stability and COX activity. On the contrary, the G604 C-mutated SURF1 did it and, hence, is a neutral variant.

Association between A218C polymorphism of the tryptophan-hydroxylase-1 gene, harm avoidance and binge eating behavior in bulimia nervosa.

PubMed

Monteleone, Palmiero; Tortorella, Alfonso; Martiadis, Vassilis; Serino, Ismene; Di Filippo, Carmela; Maj, Mario

2007-06-21

Genes involved in serotonin transmission are likely involved in the biological predisposition to bulimia nervosa. We investigated whether the A218C polymorphism of the tryptophan-hydroxylase-1 gene was associated to bulimia nervosa and/or to some phenotypic aspects of the disorder. One hundred eighty Caucasian women (91 patients with bulimia nervosa and 89 healthy controls) were enrolled into the study. They underwent a blood sample collection for A218C polymorphism of the tryptophan-hydroxylase-1 genotyping and a clinical evaluation assessing comorbidity for Axis I and II psychiatric disorders, harm avoidance personality dimension and bulimic symptoms. The distribution of both tryptophan-hydroxylase-1 A218C genotypes and alleles did not significantly differ between patients and controls. Bulimic women with the AA genotype exhibited a more severe binge eating behavior and higher harm avoidance scores than those with CC genotype. These findings support the idea that tryptophan-hydroxylase-1 A218C polymorphism does not play a part in the genetic susceptibility to bulimia nervosa, but it seems to be involved in predisposing bulimic patients to a more disturbed eating behavior and higher harm avoidance.

Accumulation of slightly deleterious mutations in the mitochondrial genome: a hallmark of animal domestication.

PubMed

Hughes, Austin L

2013-02-15

The hypothesis that domestication leads to a relaxation of purifying selection on mitochondrial (mt) genomes was tested by comparative analysis of mt genes from dog, pig, chicken, and silkworm. The three vertebrate species showed mt genome phylogenies in which domestic and wild isolates were intermingled, whereas the domestic silkworm (Bombyx mori) formed a distinct cluster nested within its closest wild relative (Bombyx mandarina). In spite of these differences in phylogenetic pattern, significantly greater proportions of nonsynonymous SNPs than of synonymous SNPs were unique to the domestic populations of all four species. Likewise, in all four species, significantly greater proportions of RNA-encoding SNPs than of synonymous SNPs were unique to the domestic populations. Thus, domestic populations were characterized by an excess of unique polymorphisms in two categories generally subject to purifying selection: nonsynonymous sites and RNA-encoding sites. Many of these unique polymorphisms thus seem likely to be slightly deleterious; the latter hypothesis was supported by the generally lower gene diversities of polymorphisms unique to domestic populations in comparison to those of polymorphisms shared by domestic and wild populations. Copyright © 2012 Elsevier B.V. All rights reserved.

APOE polymorphism as a potential determinant of functional fitness in the elderly regardless of nutritional status.

PubMed

Snejdrlova, Michaela; Kalvach, Zdenek; Topinkova, Eva; Vrablik, Michal; Prochazkova, Renata; Kvasilova, Marie; Lanska, Vera; Zlatohlavek, Lukas; Prusikova, Martina; Ceska, Richard

2011-01-01

Life expectancy is determined by a combination of genetic predisposition (~25%) and environmental influences (~75%). Nevertheless a stronger genetic influence is anticipated in long-living individuals. Apolipoprotein E (APOE) gene belongs among the most studied candidate genes of longevity. We evaluated the relation of APOE polymorphism and fitness status in the elderly. We examined a total number of 128 subjects, over 80 years of age. Using a battery of functional tests their fitness status was assessed and the subjects were stratified into 5 functional categories according to Spirduso´s classification. Biochemistry analysis was performed by enzymatic method using automated analyzers. APOE gene polymorphism was analysed performed using PCR-RFLP. APOE4 allele carriers had significantly worse fitness status compared to non-carriers (p=0.025). Multiple logistic regression analysis showed the APOE4 carriers had higher risk (p=0.05) of functional unfitness compared to APOE2/E3 individuals. APOE gene polymorphism seems be an important genetic contributor to frailty development in the elderly. While APOE2 carriers tend to remain functionally fit till higher age, the functional status of APOE4 carriers deteriorates more rapidly. © 2011 Neuroendocrinology Letters

First principles study of structural, electronic and optical properties of polymorphic forms of Rb 2Te

NASA Astrophysics Data System (ADS)

Alay-e-Abbas, S. M.; Shaukat, A.

2011-05-01

First-principles density functional theory calculations have been performed for structural, electronic and optical properties of three polymorphic forms of rubidium telluride. Our calculations show that the sequence of pressure induced phase transitions for Rb 2Te is Fm3¯m → Pnma → P6 3/mmc which is governed by the coordination numbers of the anions. From our calculated low transition pressure value for the Fm3¯m phase to the Pnma phase transition of Rb 2Te, the experimentally observed meta-stability of Fm3¯m phase at ambient conditions seems reasonable. The electronic band structure has been calculated for all the three phases and the change in the energy band gap is discussed for the transitioning phases. The energy band gaps obtained for the three phases of Rb 2Te decrease on going from the meta-stable phase to the high-pressure phases. Total and partial density of states for the polymorphs of Rb 2Te has been computed to elucidate the contribution of various atomic states on the electronic band structure. Furthermore, optical properties for all the polymorphic forms have been presented in form of the complex dielectric function.

The emotional harbinger effect: poor context memory for cues that previously predicted something arousing.

PubMed

Mather, Mara; Knight, Marisa

2008-12-01

A key function of memory is to use past experience to predict when something important might happen next. Indeed, cues that previously predicted arousing events (emotional harbingers) garner more attention than other cues. However, the current series of five experiments demonstrates that people have poorer memory for the context of emotional harbinger cues than of neutral harbinger cues. Participants first learned that some harbinger cues (neutral tones or faces) predicted emotionally arousing pictures and others predicted neutral pictures. Then they studied associations between the harbinger cues and new contextual details. They were worse at remembering associations with emotional harbingers than with neutral harbingers. Memory was impaired not only for the association between emotional harbingers and nearby digits, but also for contextual details that overlapped with or were intrinsic to the emotional harbingers. However, new cues that were inherently emotionally arousing did not yield the same memory impairments as the emotional harbingers. Thus, emotional harbinger cues seem to suffer more from proactive interference than do neutral harbinger cues, impairing formation of new associations with cues that previously predicted something arousing. 2008 APA, all rights reserved

Localization of neutralization epitopes on adenovirus fiber knob from species C.

PubMed

Lang, Shuai; Wang, Lizheng; Wang, Zixuan; Zhu, Rui; Yan, Jingyi; Wang, Baoming; Wu, Jiaxin; Zhang, Haihong; Wu, Hui; Zhou, Yan; Kong, Wei; Yu, Bin; Yu, Xianghui

2016-04-01

Although potential neutralization epitopes on the fiber knob of adenovirus (AdV) serotype 2 (Ad2) and Ad5 have been revealed, few studies have been carried out to identify neutralization epitopes on the knob from a broader panel of AdV serotypes. In this study, based on sequence and structural analysis of knobs from Ad1, Ad2, Ad5 and Ad6 (all from species C), several trimeric chimeric knob proteins were expressed in Escherichia coli to identify the locations of neutralization epitopes on the knobs by analysing their reactivity with mouse and rabbit polyclonal sera raised against AdVs and human sera with natural AdV infection. The dominant neutralization epitopes were located mainly in the N-terminal part of knobs from Ad1, Ad2 and Ad5, but they seemed to be located in the C-terminal part of the Ad6 knob, with some individual differences in rabbit and human populations. Our study adds to our understanding of humoral immune responses to AdVs and will facilitate the construction of more desirable capsid-modified recombinant Ad5 vectors.

The emotional harbinger effect: Poor context memory for cues that previously predicted something arousing

PubMed Central

Mather, Mara; Knight, Marisa

2009-01-01

A key function of memory is to use past experience to predict when something important might happen next. Indeed, cues that previously predicted arousing events (emotional harbingers) garner more attention than other cues. However, the current series of five experiments demonstrates that people have poorer memory for the context of emotional harbinger cues than of neutral harbinger cues. Participants first learned that some harbinger cues (neutral tones or faces) predicted emotionally arousing pictures and others predicted neutral pictures. Then they studied associations between the harbinger cues and new contextual details. They were worse at remembering associations with emotional harbingers than with neutral harbingers. Memory was impaired not only for the association between emotional harbingers and nearby digits but also for contextual details that overlapped with or were intrinsic to the emotional harbingers. However, new cues that were inherently emotionally arousing did not yield the same memory impairments as the emotional harbingers. Thus, emotional harbinger cues seem to suffer more from proactive interference than do neutral harbinger cues, impairing formation of new associations with cues that previously predicted something arousing. PMID:19102596

Complex genetic diseases: controversy over the Croesus code.

PubMed

Wright, A F; Hastie, N D

2001-01-01

The polarization of views on how best to exploit new information from the Human Genome Project for medicine reflects our ignorance of the genetic architecture underlying common diseases: are susceptibility alleles common or rare, neutral or deleterious, few or many? Single-nucleotide polymorphism (SNP) technology is almost in place to dissect such diseases and to create a personalized medicine, but success is critically dependent on the biology and "Nature to be commanded must be obeyed" (Francis Bacon, 1620, Novum Organum).

Analysis of IL-6, IL-10 and NF-κB Gene Polymorphisms in Aggressive and Chronic Periodontitis.

PubMed

Toker, Hülya; Görgün, Emine Pirim; Korkmaz, Ertan Mahir

2017-06-01

Pro-inflammatory cytokines, interleukin-6 (IL-6), demonstrated to be suppressed by interleukin-10 (IL-10) are known to be regulated by the transcription factor nuclear factor-κB(NF-κB). The aim of this study was to ascertain the association between genetic polymorphism of these genes (IL-6(-174), IL-10(-597) and NF-κB1-94ins/del)) and chronic/aggressive periodontitis. Forty-five patients with chronic periodontitis (CP), 58 patients with aggressive periodontitis (AP) and 38 periodontally healthy subjects were included in this study. Genomic DNA was isolated from whole blood samples. The NF-κB, IL-6, and IL-10 polymorphisms were determined by the polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) method. Among subjects for the ins/ins genotypes of NF-κB1 gene, the AA genotypes of IL-10 presented a higher frequency in chronic periodontitis group than in healthy controls (p=0.023). A statistically significant difference in genotyping frequencies between AP group and healthy controls was observed for the IL-6 gene. The AA genotype of IL-10 was overrepresented in CP and AP groups compared to healthy controls (OR=9.93, 95% CI: 2.11-46.7, OR=5.7, 95% CI: 1.22-26.89, respectively). Within the limits of this study, it can be concluded that the IL-10 (-597) AA genotype is associated with susceptibility to chronic/aggressive periodontitis and IL-6 (-174) GG genotypes and G allele seems to be associated with aggressive periodontitis. Clinical relevance: The results of the current study indicate that IL-6 and IL-10 genotypes seem to be associated with aggressive periodontitis. Also, the AA genotypes of IL-10 presented a higher frequency in chronic periodontitis subjects with carrying NF-κB1 ins/ins genotypes. Copyright© by the National Institute of Public Health, Prague 2017

Consequences of Asexuality in Natural Populations: Insights from Stick Insects.

PubMed

Bast, Jens; Parker, Darren J; Dumas, Zoé; Jalvingh, Kirsten M; Tran Van, Patrick; Jaron, Kamil S; Figuet, Emeric; Brandt, Alexander; Galtier, Nicolas; Schwander, Tanja

2018-07-01

Recombination is a fundamental process with significant impacts on genome evolution. Predicted consequences of the loss of recombination include a reduced effectiveness of selection, changes in the amount of neutral polymorphisms segregating in populations, and an arrest of GC-biased gene conversion. Although these consequences are empirically well documented for nonrecombining genome portions, it remains largely unknown if they extend to the whole genome scale in asexual organisms. We identify the consequences of asexuality using de novo transcriptomes of five independently derived, obligately asexual lineages of stick insects, and their sexual sister-species. We find strong evidence for higher rates of deleterious mutation accumulation, lower levels of segregating polymorphisms and arrested GC-biased gene conversion in asexuals as compared with sexuals. Taken together, our study conclusively shows that predicted consequences of genome evolution under asexuality can indeed be found in natural populations.

A new method for locating changes in a tree reveals distinct nucleotide polymorphism vs. divergence patterns in mouse mitochondrial control region.

PubMed

Galtier, N; Boursot, P

2000-03-01

A new, model-based method was devised to locate nucleotide changes in a given phylogenetic tree. For each site, the posterior probability of any possible change in each branch of the tree is computed. This probabilistic method is a valuable alternative to the maximum parsimony method when base composition is skewed (i.e., different from 25% A, 25% C, 25% G, 25% T): computer simulations showed that parsimony misses more rare --> common than common --> rare changes, resulting in biased inferred change matrices, whereas the new method appeared unbiased. The probabilistic method was applied to the analysis of the mutation and substitution processes in the mitochondrial control region of mouse. Distinct change patterns were found at the polymorphism (within species) and divergence (between species) levels, rejecting the hypothesis of a neutral evolution of base composition in mitochondrial DNA.

Relationships between FTO rs9939609, MC4R rs17782313, and PPARγ rs1801282 polymorphisms and the occurrence of selected metabolic and hormonal disorders in middle-aged and elderly men - a preliminary study.

PubMed

Rotter, Iwona; Skonieczna-Żydecka, Karolina; Kosik-Bogacka, Danuta; Adler, Grażyna; Rył, Aleksandra; Laszczyńska, Maria

2016-01-01

Metabolic disorders, including MetS, obesity, and lipid disorders, may be related to genetic factors. Metabolic disorders are associated with decreased TS levels in aging men. The aim of this study was to evaluate the relationship between FTO rs9939609, MC4R rs17782313, and PPARγ rs1801282 polymorphisms and the presence of MetS and its components, the concurrent lipid disorders, as well as sex hormone concentrations. This study involved 272 men of Caucasian descent aged 50-75 years. Lipid profile, including TCh, LDL, HDL, and TG, was evaluated by spectrophotometric method. Anthropometric measurements concerned WC and blood pressure. MetS was diagnosed according to the criteria of the IDF. Sex hormone profile, including TST, FTS, E 2 , DHEAS, and SHBG, was examined using enzyme-linked immunosorbent assay. Polymorphisms within FTO , MC4R , and PPARγ genes were identified using polymerase chain reaction-restriction fragments length polymorphism. This study did not show links between the analyzed genetic polymorphisms and the presence of MetS, T2DM, HT, and obesity. However, higher concentrations of TCh and LDL were found in men with the FTO rs9939609 polymorphism in the recessive mode of inheritance ( P =0.03 and P =0.05, respectively). Lower WC was found to be associated with MC4R rs17782313 gene inherited in the same model ( P =0.005). FTO rs9939609, MC4R rs17782313, and PPARγ rs1801282 polymorphisms seem to have little effect on the incidence of metabolic malfunctions and no effect on androgen-related disorders in the examined middle-aged and elderly men.

Haemochromatosis HFE gene polymorphisms as potential modifiers of hereditary nonpolyposis colorectal cancer risk and onset age.

PubMed

Shi, Zumin; Johnstone, Daniel; Talseth-Palmer, Bente A; Evans, Tiffany-Jane; Spigelman, Allan D; Groombridge, Claire; Milward, Elizabeth A; Olynyk, John K; Suchy, Janina; Kurzawski, Grzegorz; Lubinski, Jan; Scott, Rodney J

2009-07-01

Hereditary nonpolyposis colorectal cancer (HNPCC) is characterized by germline mutations in DNA mismatch repair genes; however, variation in disease expression suggests that there are potential modifying factors. Polymorphisms of the HFE gene, which cause the iron overload disorder hereditary haemochromatosis, have been proposed as potential risk factors for the development of colorectal cancer (CRC). To understand the relationship between HNPCC disease phenotype and polymorphisms of the HFE gene, a total of 362 individuals from Australia and Poland with confirmed causative MMR gene mutations were genotyped for the HFE C282Y and H63D polymorphisms. A significantly increased risk of developing CRC was observed for H63D homozygotes when compared with combined wild-type homozygotes and heterozygotes (hazard ratio = 2.93, p = 0.007). Evidence for earlier CRC onset was also observed in H63D homozygotes with a median age of onset 6 years earlier than wild type or heterozygous participants (44 vs. 50 years of age). This effect was significant by all tests used (log-rank test p = 0.026, Wilcoxon p = 0.044, Tarone-Ware p = 0.035). No association was identified for heterozygosity of either polymorphism and limitations on power-prevented investigation of C282Y homozygosity or compound C282Y/H63D heterozygosity. In the Australian sample only, women had a significantly reduced risk of developing CRC when compared with men (hazard ratio = 0.58, p = 0.012) independent of HFE genotype for either single nucleotide polymorphisms. In conclusion, homozygosity for the HFE H63D polymorphism seems to be a genetic modifier of disease expression in HNPCC. Understanding the mechanisms by which HFE interrelates with colorectal malignancies could lead to reduction of disease risk in HNPCC.

CTLA-4 gene polymorphisms and their influence on predisposition to autoimmune thyroid diseases (Graves’ disease and Hashimoto's thyroiditis)

PubMed Central

Pastuszak-Lewandoska, Dorota; Sewerynek, Ewa; Domańska, Daria; Gładyś, Aleksandra; Skrzypczak, Renata

2012-01-01

Introduction Autoimmune thyroid disease (AITD) is associated with both genetic and environmental factors which lead to the overactivity of immune system. Cytotoxic T-Lymphocyte Antigen 4 (CTLA-4) gene polymorphisms belong to the main genetic factors determining the susceptibility to AITD (Hashimoto's thyroiditis, HT and Graves' disease, GD) development. The aim of the study was to evaluate the relationship between CTLA-4 polymorphisms (A49G, 1822 C/T and CT60 A/G) and HT and/or GD in Polish patients. Material and methods Molecular analysis involved AITD group, consisting of HT (n=28) and GD (n=14) patients, and a control group of healthy persons (n=20). Genomic DNA was isolated from peripheral blood and CTLA-4 polymorphisms were assessed by polymerase chain reaction-restriction fragment length polymorphism method, using three restriction enzymes: Fnu4HI (A49G), BsmAI (1822 C/T) and BsaAI (CT60 A/G). Results Statistical analysis (χ2 test) confirmed significant differences between the studied groups concerning CTLA-4 A49G genotypes. CTLA-4 A/G genotype was significantly more frequent in AITD group and OR analysis suggested that it might increase the susceptibility to HT. In GD patients, OR analysis revealed statistically significant relationship with the presence of G allele. In controls, CTLA-4 A/A genotype frequency was significantly increased suggesting a protective effect. There were no statistically significant differences regarding frequencies of other genotypes and polymorphic alleles of the CTLA-4 gene (1822 C/T and CT60 A/G) between the studied groups. Conclusions CTLA-4 A49G polymorphism seems to be an important genetic determinant of the risk of HT and GD in Polish patients. PMID:22851994

CTLA-4 gene polymorphisms and their influence on predisposition to autoimmune thyroid diseases (Graves' disease and Hashimoto's thyroiditis).

PubMed

Pastuszak-Lewandoska, Dorota; Sewerynek, Ewa; Domańska, Daria; Gładyś, Aleksandra; Skrzypczak, Renata; Brzeziańska, Ewa

2012-07-04

Autoimmune thyroid disease (AITD) is associated with both genetic and environmental factors which lead to the overactivity of immune system. Cytotoxic T-Lymphocyte Antigen 4 (CTLA-4) gene polymorphisms belong to the main genetic factors determining the susceptibility to AITD (Hashimoto's thyroiditis, HT and Graves' disease, GD) development. The aim of the study was to evaluate the relationship between CTLA-4 polymorphisms (A49G, 1822 C/T and CT60 A/G) and HT and/or GD in Polish patients. Molecular analysis involved AITD group, consisting of HT (n=28) and GD (n=14) patients, and a control group of healthy persons (n=20). Genomic DNA was isolated from peripheral blood and CTLA-4 polymorphisms were assessed by polymerase chain reaction-restriction fragment length polymorphism method, using three restriction enzymes: Fnu4HI (A49G), BsmAI (1822 C/T) and BsaAI (CT60 A/G). Statistical analysis (χ(2) test) confirmed significant differences between the studied groups concerning CTLA-4 A49G genotypes. CTLA-4 A/G genotype was significantly more frequent in AITD group and OR analysis suggested that it might increase the susceptibility to HT. In GD patients, OR analysis revealed statistically significant relationship with the presence of G allele. In controls, CTLA-4 A/A genotype frequency was significantly increased suggesting a protective effect. There were no statistically significant differences regarding frequencies of other genotypes and polymorphic alleles of the CTLA-4 gene (1822 C/T and CT60 A/G) between the studied groups. CTLA-4 A49G polymorphism seems to be an important genetic determinant of the risk of HT and GD in Polish patients.

The ACE-DD genotype is associated with endothelial dysfunction in postmenopausal women.

PubMed

Méthot, Julie; Hamelin, Bettina A; Arsenault, Marie; Bogaty, Peter; Plante, Sylvain; Poirier, Paul

2006-01-01

To evaluate the effects of the angiotensin-converting enzyme (ACE) insertion/deletion (I/D), the angiotensinogen M235T and the angiotensin II type 1 receptor A1166C polymorphisms, and hormone therapy used on endothelial function in postmenopausal women without manifestation of coronary artery disease. Sixty-four postmenopausal women (42 hormone therapy users and 22 hormone therapy nonusers) without clinical manifestation of coronary artery disease were evaluated using external vascular ultrasonography to measure endothelium-dependent (hyperemic response, flow-mediated dilatation) and -independent (nitroglycerin) dilatation. Genotypes were determined by polymerase chain reaction amplification. Women with the ACE-DD genotype displayed a lower flow-mediated dilatation compared to those with the ACE-II genotype (8.4% +/- 3.9% vs 12.6% +/- 5.4%, P = 0.04). Endothelial function was not associated with the angiotensinogen M235T and anglotensin II type 1 receptor A1166C polymorphisms. ACE polymorphism seems to modulate endothelial function among postmenopausal women without hormone therapy (8.2% +/- 5.1% vs 18.4% +/- 5.9% for the DD and the II genotype, respectively, P = 0.02). However, in hormone therapy users, flow-mediated dilatation was similar according to the ACE genotypes. Our findings suggest that ACE-I/D polymorphism is related to endothelial dysfunction in postmenopausal women. Furthermore, a potential interaction between estrogen users and ACE polymorphism on endothelial function may be present.

Nonassociation of homocysteine gene polymorphisms with treatment outcome in South Indian Tamil Rheumatoid Arthritis patients.

PubMed

Muralidharan, Niveditha; Gulati, Reena; Misra, Durga Prasanna; Negi, Vir S

2018-02-01

The aim of the study was to look for any association of MTR 2756A>G and MTRR 66A>G gene polymorphisms with clinical phenotype, methotrexate (MTX) treatment response, and MTX-induced adverse events in South Indian Tamil patients with rheumatoid arthritis (RA). A total of 335 patients with RA were investigated. MTR 2756A>G gene polymorphism was analyzed by PCR-RFLP, and MTRR 66A>G SNP was analyzed by TaqMan 5' nuclease assay. The allele frequencies were compared with HapMap groups. MTR 2756G allele was found to be associated with risk of developing RA. The allele frequencies of MTR 2756A>G and MTRR 66A>G SNPs in controls differed significantly when compared with HapMap groups. Neither of the SNPs influenced the MTX treatment outcome and adverse effects. Neither of the SNPs seems to be associated with MTX treatment outcome and adverse events in South Indian Tamil patients with RA.

FAS and FAS-L Genotype and Expression in Patients With Recurrent Pregnancy Loss

PubMed Central

Banzato, Priscilla Chamelete Andrade; Daher, Silvia; Traina, Évelyn; Torloni, Maria Regina; Gueuvoghlanian-Silva, Bárbara Yasmin; Puccini, Renata Fiorini; Pendeloski, Karen Priscilla Tezotto

2013-01-01

We assessed FAS and FAS-L gene polymorphisms and messenger RNA (mRNA) levels in patients with recurrent pregnancy loss (RPL). This case–control study compared 129 women with RPL with 235 healthy multiparous women (control group). Genomic DNA and total mRNA were extracted from whole blood, and polymorphisms genotyping was performed by polymerase chain reaction (PCR). Messenger RNA expression levels were analyzed by real-time PCR. Data were analyzed by chi-square and Fisher exact tests; P < .05 was considered significant. There were no significant differences in the FAS (670 A/G) genotype or allelic frequencies between the RPL and control groups. We found significant differences in the FAS-L (844 C/T) genotype and allelic frequencies between women with RPL and controls. Patients with RPL had significantly higher FAS-L expression. Our data suggest that FAS-L gene polymorphism is associated with increased susceptibility to RPL. Moreover, women with RPL seem to abnormally express FAS-FAS-L molecules. PMID:23420824

Natural Selection and Recombination Rate Variation Shape Nucleotide Polymorphism Across the Genomes of Three Related Populus Species

PubMed Central

Wang, Jing; Street, Nathaniel R.; Scofield, Douglas G.; Ingvarsson, Pär K.

2016-01-01

A central aim of evolutionary genomics is to identify the relative roles that various evolutionary forces have played in generating and shaping genetic variation within and among species. Here we use whole-genome resequencing data to characterize and compare genome-wide patterns of nucleotide polymorphism, site frequency spectrum, and population-scaled recombination rates in three species of Populus: Populus tremula, P. tremuloides, and P. trichocarpa. We find that P. tremuloides has the highest level of genome-wide variation, skewed allele frequencies, and population-scaled recombination rates, whereas P. trichocarpa harbors the lowest. Our findings highlight multiple lines of evidence suggesting that natural selection, due to both purifying and positive selection, has widely shaped patterns of nucleotide polymorphism at linked neutral sites in all three species. Differences in effective population sizes and rates of recombination largely explain the disparate magnitudes and signatures of linked selection that we observe among species. The present work provides the first phylogenetic comparative study on a genome-wide scale in forest trees. This information will also improve our ability to understand how various evolutionary forces have interacted to influence genome evolution among related species. PMID:26721855

Natural Selection and Recombination Rate Variation Shape Nucleotide Polymorphism Across the Genomes of Three Related Populus Species.

PubMed

Wang, Jing; Street, Nathaniel R; Scofield, Douglas G; Ingvarsson, Pär K

2016-03-01

A central aim of evolutionary genomics is to identify the relative roles that various evolutionary forces have played in generating and shaping genetic variation within and among species. Here we use whole-genome resequencing data to characterize and compare genome-wide patterns of nucleotide polymorphism, site frequency spectrum, and population-scaled recombination rates in three species of Populus: Populus tremula, P. tremuloides, and P. trichocarpa. We find that P. tremuloides has the highest level of genome-wide variation, skewed allele frequencies, and population-scaled recombination rates, whereas P. trichocarpa harbors the lowest. Our findings highlight multiple lines of evidence suggesting that natural selection, due to both purifying and positive selection, has widely shaped patterns of nucleotide polymorphism at linked neutral sites in all three species. Differences in effective population sizes and rates of recombination largely explain the disparate magnitudes and signatures of linked selection that we observe among species. The present work provides the first phylogenetic comparative study on a genome-wide scale in forest trees. This information will also improve our ability to understand how various evolutionary forces have interacted to influence genome evolution among related species. Copyright © 2016 by the Genetics Society of America.

Glycans Flanking the Hypervariable Connecting Peptide between the A and B Strands of the V1/V2 Domain of HIV-1 gp120 Confer Resistance to Antibodies That Neutralize CRF01_AE Viruses

PubMed Central

O’Rourke, Sara M.; Sutthent, Ruengpung; Phung, Pham; Mesa, Kathryn A.; Frigon, Normand L.; To, Briana; Horthongkham, Navin; Limoli, Kay; Wrin, Terri; Berman, Phillip W.

2015-01-01

Understanding the molecular determinants of sensitivity and resistance to neutralizing antibodies is critical for the development of vaccines designed to prevent HIV infection. In this study, we used a genetic approach to characterize naturally occurring polymorphisms in the HIV envelope protein that conferred neutralization sensitivity or resistance. Libraries of closely related envelope genes, derived from virus quasi-species, were constructed from individuals infected with CRF01_AE viruses. The libraries were screened with plasma containing broadly neutralizing antibodies, and neutralization sensitive and resistant variants were selected for sequence analysis. In vitro mutagenesis allowed us to identify single amino acid changes in three individuals that conferred resistance to neutralization by these antibodies. All three mutations created N-linked glycosylation sites (two at N136 and one at N149) proximal to the hypervariable connecting peptide between the C-terminus of the A strand and the N-terminus of the B strand in the four-stranded V1/V2 domain β-sheet structure. Although N136 has previously been implicated in the binding of broadly neutralizing monoclonal antibodies, this glycosylation site appears to inhibit the binding of neutralizing antibodies in plasma from HIV-1 infected subjects. Previous studies have reported that the length of the V1/V2 domain in transmitted founder viruses is shorter and possesses fewer glycosylation sites compared to viruses isolated from chronic infections. Our results suggest that vaccine immunogens based on recombinant envelope proteins from clade CRF01_AE viruses might be improved by inclusion of envelope proteins that lack these glycosylation sites. This strategy might improve the efficacy of the vaccines used in the partially successful RV144 HIV vaccine trial, where the two CRF01_AE immunogens (derived from the A244 and TH023 isolates) both possessed glycosylation sites at N136 and N149. PMID:25793890

Polymorphisms in O-methyltransferase genes are associated with stover cell wall digestibility in European maize (Zea mays L.).

PubMed

Brenner, Everton A; Zein, Imad; Chen, Yongsheng; Andersen, Jeppe R; Wenzel, Gerhard; Ouzunova, Milena; Eder, Joachim; Darnhofer, Birte; Frei, Uschi; Barrière, Yves; Lübberstedt, Thomas

2010-02-12

OMT (O-methyltransferase) genes are involved in lignin biosynthesis, which relates to stover cell wall digestibility. Reduced lignin content is an important determinant of both forage quality and ethanol conversion efficiency of maize stover. Variation in genomic sequences coding for COMT, CCoAOMT1, and CCoAOMT2 was analyzed in relation to stover cell wall digestibility for a panel of 40 European forage maize inbred lines, and re-analyzed for a panel of 34 lines from a published French study. Different methodologies for association analysis were performed and compared. Across association methodologies, a total number of 25, 12, 1, 6 COMT polymorphic sites were significantly associated with DNDF, OMD, NDF, and WSC, respectively. Association analysis for CCoAOMT1 and CCoAOMT2 identified substantially fewer polymorphic sites (3 and 2, respectively) associated with the investigated traits. Our re-analysis on the 34 lines from a published French dataset identified 14 polymorphic sites significantly associated with cell wall digestibility, two of them were consistent with our study. Promising polymorphisms putatively causally associated with variability of cell wall digestibility were inferred from the total number of significantly associated SNPs/Indels. Several polymorphic sites for three O-methyltransferase loci were associated with stover cell wall digestibility. All three tested genes seem to be involved in controlling DNDF, in particular COMT. Thus, considerable variation among Bm3 wildtype alleles can be exploited for improving cell-wall digestibility. Target sites for functional markers were identified enabling development of efficient marker-based selection strategies.

Polymorphisms in O-methyltransferase genes are associated with stover cell wall digestibility in European maize (Zea mays L.)

PubMed Central

2010-01-01

Background OMT (O-methyltransferase) genes are involved in lignin biosynthesis, which relates to stover cell wall digestibility. Reduced lignin content is an important determinant of both forage quality and ethanol conversion efficiency of maize stover. Results Variation in genomic sequences coding for COMT, CCoAOMT1, and CCoAOMT2 was analyzed in relation to stover cell wall digestibility for a panel of 40 European forage maize inbred lines, and re-analyzed for a panel of 34 lines from a published French study. Different methodologies for association analysis were performed and compared. Across association methodologies, a total number of 25, 12, 1, 6 COMT polymorphic sites were significantly associated with DNDF, OMD, NDF, and WSC, respectively. Association analysis for CCoAOMT1 and CCoAOMT2 identified substantially fewer polymorphic sites (3 and 2, respectively) associated with the investigated traits. Our re-analysis on the 34 lines from a published French dataset identified 14 polymorphic sites significantly associated with cell wall digestibility, two of them were consistent with our study. Promising polymorphisms putatively causally associated with variability of cell wall digestibility were inferred from the total number of significantly associated SNPs/Indels. Conclusions Several polymorphic sites for three O-methyltransferase loci were associated with stover cell wall digestibility. All three tested genes seem to be involved in controlling DNDF, in particular COMT. Thus, considerable variation among Bm3 wildtype alleles can be exploited for improving cell-wall digestibility. Target sites for functional markers were identified enabling development of efficient marker-based selection strategies. PMID:20152036

The development of peripartum depressive symptoms is associated with gene polymorphisms of MAOA, 5-HTT and COMT.

PubMed

Doornbos, Bennard; Dijck-Brouwer, D A Janneke; Kema, Ido P; Tanke, Marit A C; van Goor, Saskia A; Muskiet, Frits A J; Korf, Jakob

2009-10-01

Polymorphisms of monoamine-related genes have been associated with depression following life events. The peripartum is a physiologically and psychologically challenging period, characterized by fluctuations in depressive symptoms, therefore facilitating prospective investigations in this gene x environment (G x E) interaction. Eighty nine pregnant women filled in two Edinburgh Postpartum Depression Scale (EPDS) questionnaires during pregnancy and two in the postpartum period. MAOA, COMT and 5-HTT polymorphisms were analyzed. We found a significant interaction between the development of depressive symptoms in the course of pregnancy and polymorphisms in 5-HTT (p=0.019); MAOA (p=0.044) and COMT (p=0.026), and MAOA x COMT (p<0.001). Particularly, women carrying the combination of low activity variants of MAOA and COMT showed increased EPDS scores at week 36 of pregnancy and 6 weeks postpartum, but not during early pregnancy or 12 weeks postpartum. We found that MAOA in combination with COMT appears to regulate not only the stress response in laboratory experiments, but also seems to influence the stress-evoked onset of mood during normal, mild, stressful events, such as experienced in the peripartum period. These findings support the GxE concept for depression, but they underline the complexity of this concept, as the cumulating effects of these polymorphic genes (i.e. MAOA+COMT) might be needed and the effects of these polymorphic genes becomes apparent in special environmental or physiological conditions (i.e. the peripartum period). We therefore suggest that G x E interactions become especially noticeable from longitudinal study designs in specific physiological or social challenging periods.

Genetic Susceptibility to Cardiac and Digestive Clinical Forms of Chronic Chagas Disease: Involvement of the CCR5 59029 A/G Polymorphism

PubMed Central

de Oliveira, Amanda Priscila; Bernardo, Cássia Rubia; Camargo, Ana Vitória da Silveira; Ronchi, Luiz Sérgio; Borim, Aldenis Albaneze; Brandão de Mattos, Cinara Cássia; de Campos Júnior, Eumildo; Castiglioni, Lílian; Netinho, João Gomes; Cavasini, Carlos Eugênio; Bestetti, Reinaldo Bulgarelli; de Mattos, Luiz Carlos

2015-01-01

The clinical manifestations of chronic Chagas disease include the cardiac form of the disease and the digestive form. Not all the factors that act in the variable clinical course of this disease are known. This study investigated whether the CCR5Δ32 (rs333) and CCR5 59029 A/G (promoter region—rs1799987) polymorphisms of the CCR5 gene are associated with different clinical forms of chronic Chagas disease and with the severity of left ventricular systolic dysfunction in patients with chronic Chagas heart disease (CCHD). The antibodies anti-T. cruzi were identified by ELISA. PCR and PCR-RFLP were used to identify the CCR5Δ32 and CCR5 59029 A/G polymorphisms. The chi-square test was used to compare variables between groups. There was a higher frequency of the AA genotype in patients with CCHD compared with patients with the digestive form of the disease and the control group. The results also showed a high frequency of the AG genotype in patients with the digestive form of the disease compared to the other groups. The results of this study show that the CCR5Δ32 polymorphism does not seem to influence the different clinical manifestations of Chagas disease but there is involvement of the CCR5 59029 A/G polymorphism in susceptibility to the different forms of chronic Chagas disease. Besides, these polymorphisms do not influence left ventricular systolic dysfunction in patients with CCHD. PMID:26599761

Sirolimus and tacrolimus trough concentrations and dose requirements after kidney transplantation in relation to CYP3A5 and MDR1 polymorphisms and steroids.

PubMed

Mourad, Michel; Mourad, Georges; Wallemacq, Pierre; Garrigue, Valérie; Van Bellingen, Christophe; Van Kerckhove, Valérie; De Meyer, Martine; Malaise, Jacques; Eddour, Djamila Chaib; Lison, Dominique; Squifflet, Jean Paul; Haufroid, Vincent

2005-10-15

CYP3A5 and MDR1 polymorphisms have been shown to influence tacrolimus blood concentrations and dose requirements. The aim is to determine whether these polymorphisms also affect sirolimus trough concentrations and dose requirements after kidney transplantation. Eighty-five renal transplant recipients receiving sirolimus were included. Twenty-four were treated with a combined sirolimus-tacrolimus regimen. Eighty-one patients received steroids. Sirolimus and tacrolimus were adjusted to a target therapeutic window. CYP3A5 (intron 3) and MDR1 (exons 12, 21, 26) genotypes were correlated to the adjusted trough concentrations and dose requirements for both sirolimus and tacrolimus. There were no significant correlation between adjusted sirolimus trough concentrations or dose requirements and genetic polymorphisms. In a multiple regression model, adjusted-prednisone dose was involved with a positive or negative effect when considering sirolimus dose requirements or adjusted concentrations, respectively. In the subgroup of patients treated by tacrolimus and sirolimus, adjusted tacrolimus doses were higher in patients carrying at least one CYP3A5 *1 allele (median 0.083 vs. 0.035 mg/kg for CYP3A5*3/*3 patients, P<0.05). Adjusted-prednisolone dose and CYP3A5 polymorphism explained up to 61% of the variability in tacrolimus dose requirements. Unlike tacrolimus, sirolimus adjusted trough concentrations and dose requirements seem not affected by CYP3A5 and MDR1 polymorphisms. Adjusted-prednisone dose has a significant impact on tacrolimus and sirolimus dose requirements.

The CYP17 MspA1 Polymorphism and the Gender Dysphoria.

PubMed

Fernández, Rosa; Cortés-Cortés, Joselyn; Esteva, Isabel; Gómez-Gil, Esther; Almaraz, Mari Cruz; Lema, Estefanía; Rumbo, Teresa; Haro-Mora, Juan-Jesús; Roda, Ester; Guillamón, Antonio; Pásaro, Eduardo

2015-06-01

The A2 allele of the CYP17 MspA1 polymorphism has been linked to higher levels of serum testosterone, progesterone, and estradiol. To determine whether the CYP17 MspA1 polymorphism is associated with transsexualism. We analyzed 151 male-to-female (MtF), 142 female-to-male (FtM), 167 control male, and 168 control female individuals. Fragments that included the mutation were amplified by PCR and digested with MspA1. Our data were compared with the allele/genotype frequencies provided by the 1000 Genomes Data Base, and contrasted with a MEDLINE search of the CYP17 MspA1 polymorphism in the literature. We investigated the association between transsexualism and the CYP17 MspA1 polymorphism. A2 frequency was higher in the FtM (0.45) than the female control (0.38) and male control (0.39) groups, or the MtF group (0.36). This FtM > MtF pattern reached statistical significance (P = 0.041), although allele frequencies were not gender specific in the general population (P = 0.887). This observation concurred with the 1000 Genomes Data Base and the MEDLINE search. Our data confirm a sex-dependent allele distribution of the CYP17 MspA1 polymorphism in the transsexual population, FtM > MtF, suggestive of a hypothetical A2 involvement in transsexualism since the allele frequencies in the general population seem to be clearly related to geographic origin and ethnic background, but not sex. © 2015 International Society for Sexual Medicine.

Oscillatory brain dynamics associated with the automatic processing of emotion in words.

PubMed

Wang, Lin; Bastiaansen, Marcel

2014-10-01

This study examines the automaticity of processing the emotional aspects of words, and characterizes the oscillatory brain dynamics that accompany this automatic processing. Participants read emotionally negative, neutral and positive nouns while performing a color detection task in which only perceptual-level analysis was required. Event-related potentials and time frequency representations were computed from the concurrently measured EEG. Negative words elicited a larger P2 and a larger late positivity than positive and neutral words, indicating deeper semantic/evaluative processing of negative words. In addition, sustained alpha power suppressions were found for the emotional compared to neutral words, in the time range from 500 to 1000ms post-stimulus. These results suggest that sustained attention was allocated to the emotional words, whereas the attention allocated to the neutral words was released after an initial analysis. This seems to hold even when the emotional content of the words is task-irrelevant. Copyright © 2014 Elsevier Inc. All rights reserved.

Where the lake meets the sea: strong reproductive isolation is associated with adaptive divergence between lake resident and anadromous three-spined sticklebacks.

PubMed

Ravinet, Mark; Hynes, Rosaleen; Poole, Russell; Cross, Tom F; McGinnity, Phil; Harrod, Chris; Prodöhl, Paulo A

2015-01-01

Contact zones between divergent forms of the same species are often characterised by high levels of phenotypic diversity over small geographic distances. What processes are involved in generating such high phenotypic diversity? One possibility is that introgression and recombination between divergent forms in contact zones results in greater phenotypic and genetic polymorphism. Alternatively, strong reproductive isolation between forms may maintain distinct phenotypes, preventing homogenisation by gene flow. Contact zones between divergent freshwater-resident and anadromous stickleback (Gasterosteus aculeatus L.) forms are numerous and common throughout the species distribution, offering an opportunity to examine these contrasting hypotheses in greater detail. This study reports on an interesting new contact zone located in a tidally influenced lake catchment in western Ireland, characterised by high polymorphism for lateral plate phenotypes. Using neutral and QTL-linked microsatellite markers, we tested whether the high diversity observed in this contact zone arose as a result of introgression or reproductive isolation between divergent forms: we found strong support for the latter hypothesis. Three phenotypic and genetic clusters were identified, consistent with two divergent resident forms and a distinct anadromous completely plated population that migrates in and out of the system. Given the strong neutral differentiation detected between all three morphotypes (mean FST = 0.12), we hypothesised that divergent selection between forms maintains reproductive isolation. We found a correlation between neutral genetic and adaptive genetic differentiation that support this. While strong associations between QTL linked markers and phenotypes were also observed in this wild population, our results support the suggestion that such associations may be more complex in some Atlantic populations compared to those in the Pacific. These findings provide an important foundation for future work investigating the dynamics of gene flow and adaptive divergence in this newly discovered stickleback contact zone.

Where the Lake Meets the Sea: Strong Reproductive Isolation Is Associated with Adaptive Divergence between Lake Resident and Anadromous Three-Spined Sticklebacks

PubMed Central

Ravinet, Mark; Hynes, Rosaleen; Poole, Russell; Cross, Tom F.; McGinnity, Phil; Harrod, Chris; Prodöhl, Paulo A.

2015-01-01

Contact zones between divergent forms of the same species are often characterised by high levels of phenotypic diversity over small geographic distances. What processes are involved in generating such high phenotypic diversity? One possibility is that introgression and recombination between divergent forms in contact zones results in greater phenotypic and genetic polymorphism. Alternatively, strong reproductive isolation between forms may maintain distinct phenotypes, preventing homogenisation by gene flow. Contact zones between divergent freshwater-resident and anadromous stickleback (Gasterosteus aculeatus L.) forms are numerous and common throughout the species distribution, offering an opportunity to examine these contrasting hypotheses in greater detail. This study reports on an interesting new contact zone located in a tidally influenced lake catchment in western Ireland, characterised by high polymorphism for lateral plate phenotypes. Using neutral and QTL-linked microsatellite markers, we tested whether the high diversity observed in this contact zone arose as a result of introgression or reproductive isolation between divergent forms: we found strong support for the latter hypothesis. Three phenotypic and genetic clusters were identified, consistent with two divergent resident forms and a distinct anadromous completely plated population that migrates in and out of the system. Given the strong neutral differentiation detected between all three morphotypes (mean FST = 0.12), we hypothesised that divergent selection between forms maintains reproductive isolation. We found a correlation between neutral genetic and adaptive genetic differentiation that support this. While strong associations between QTL linked markers and phenotypes were also observed in this wild population, our results support the suggestion that such associations may be more complex in some Atlantic populations compared to those in the Pacific. These findings provide an important foundation for future work investigating the dynamics of gene flow and adaptive divergence in this newly discovered stickleback contact zone. PMID:25874617

Particle Environment Package (PEP) for the ESA JUICE mission

NASA Astrophysics Data System (ADS)

Barabash, Stas; Brandt, Pontus; Wurz, Peter; PEP Team

2016-10-01

PEP is a suite of six (6) sensors arranged in 4 units to measure charged and neutral particles in the Jupiter magnetospheres and at the moons to answer four overarching science questions:1. How does the corotating magnetosphere of Jupiter interact with the complex and diverse environment of Ganymede?2. How does the rapidly rotating magnetosphere of Jupiter interact with the seemingly inert Callisto?3. What are the governing mechanisms and their global impacts of release of material into the Jovian magnetosphere from seemingly inert Europa and active Io?4. How do internal and solar wind drivers cause such energetic, time variable and multi-scale phenomena in the steadily rotating giant magnetosphere of Jupiter?PEP measures positive and negative ions, electrons, exospheric neutral gas, thermal plasma and energetic neutral atoms present in all domains of the Jupiter system over nine decades of energy from < 0.001 eV to > 1 MeV with full angular coverage.PEP provides instantaneous measurements of 3D flow of the ion plasma and composition to understand the magnetosphere and magnetosphere-moon interactions. It also measures instantaneously 3D electron plasma to investigate auroral processes at the moon and Jupiter. Measurements of the angular distributions of energetic electrons at sub-second resolution probe the acceleration mechanisms and magnetic field topology and boundaries.PEP combines global imaging via remote sensing using energetic neutral atoms (ENA) with in-situ measurements and performs global imaging of Europa/Io tori and magnetosphere combined with energetic ion measurements. Using low energy ENAs originating from the particle - surface interaction PEP investigate space weathering of the icy moons by precipitation particles. PEP will first-ever directly sample of the exospheres of Europa, Ganymede, and Callisto with extremely high mass resolution (M/ΔM > 1100).The PEP sensors are (1) an ion mass analyzer, (2) an electron spectrometer, (3) a low energy ENA imager, (4) a high energy ENA and energetic ions imager, (5) an energetic electron sensor, and (6) a neutral gas and ions mass spectrometer.

Polymorphisms of Leptin (G2548A) and Leptin Receptor (Q223R and K109R) Genes and Blood Pressure During Pregnancy and the Postpartum Period: A Cohort.

PubMed

Farias, Dayana R; Franco-Sena, Ana B; Rebelo, Fernanda; Salles, Gil F; Struchiner, Cláudio J; Martins, Maisa C; Kac, Gilberto

2017-02-01

The genetic component related to blood pressure (BP) changes during pregnancy is still not elucidated. Thus, the aim of the study was to evaluate the association between leptin and leptin receptor polymorphisms and systolic (SBP) and diastolic BP (DBP) variation during pregnancy and the postpartum period. Prospective cohort of 146 women followed at a Public Health Center in Rio de Janeiro, Brazil, during pregnancy and the postpartum. SBP and DBP (mm Hg) were measured using an automatic sphygmomanometer. DNA was extracted by phenol-chloroform protocol and leptin (G2548A) and leptin receptor genes (Q223R and K109R) polymorphisms were genotyped using real-time PCR method. Statistical analyses included longitudinal linear mixed-effect models. Adjusted longitudinal models showed that women carrying the G-allele of leptin gene's polymorphism began pregnancy with higher BP levels compared to the AA genotype and their levels remained higher throughout pregnancy and the postpartum period (β SBP = 4.5; 95% confidence interval (CI) = 1.0-8.0; P = 0.012; β DBP = 2.9; 95% CI = 0.1-5.8; P = 0.040). There was a significant interaction between leptin gene polymorphism and body mass index (BMI), in which the effect of BMI on increasing BP was steeper in women homozygous for the A-allele, compared with those who had at least one G-allele (β G-allele#BMI = -0.8; 95% CI = -1.5 to -0.1; P = 0.022). We did not find significant associations between leptin receptor polymorphisms and BP changes. The G-allele of leptin gene polymorphism (G2548A) was associated with increased BP levels during pregnancy and the postpartum. Furthermore, leptin polymorphism genotypes seem to modify the well-known effect of BMI on BP. © American Journal of Hypertension, Ltd 2016. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Prognostic role of the CDNK1B V109G polymorphism in multiple endocrine neoplasia type 1.

PubMed

Circelli, Luisa; Ramundo, Valeria; Marotta, Vincenzo; Sciammarella, Concetta; Marciello, Francesca; Del Prete, Michela; Sabatino, Lina; Pasquali, Daniela; Izzo, Francesco; Scala, Stefania; Colao, Annamaria; Faggiano, Antongiulio; Colantuoni, Vittorio

2015-07-01

CDKN1B encodes the cyclin-dependent kinase inhibitor p27/Kip1. CDKN1B mutations and polymorphisms are involved in tumorigenesis; specifically, the V109G single nucleotide polymorphism has been linked to different tumours with controversial results. Multiple endocrine neoplasia type 1 (MEN1) is a rare autosomal dominant syndrome, characterized by the development of different types of neuroendocrine tumours and increased incidence of other malignancies. A clear genotype-phenotype correlation in MEN1 has not been established yet. In this study, we assessed whether the CDKN1B V109G polymorphism was associated with the development of aggressive tumours in 55 consecutive patients affected by MEN1. The polymorphism was investigated by PCR amplification of germline DNA followed by direct sequencing. Baseline and follow-up data of tumour types and their severity were collected and associated with the genetic data. MEN1-related aggressive and other malignant tumours of any origin were detected in 16.1% of wild-type and 33.3% of polymorphism allele-bearing patients (P = NS). The time interval between birth and the first aggressive tumour was significantly shorter in patients with the CDKN1B V109G polymorphism (median 46 years) than in those without (median not reached; P = 0.03). Similarly, shorter was the time interval between MEN1 diagnosis and age of the first aggressive tumour (P = 0.02). Overall survival could not be estimated as 96% patients were still alive at the time of the study. In conclusion, CDKN1B V109G polymorphism seems to play a role in the development of aggressive tumours in MEN1. © 2015 The Authors. Journal of Cellular and Molecular Medicine published by John Wiley & Sons Ltd and Foundation for Cellular and Molecular Medicine.

Spatial variation in colour morph, spotting and allozyme frequencies in the candy-stripe spider, Enoplognatha ovata (Theridiidae) on two Swedish archipelagos.

PubMed

Oxford, G S; Gunnarsson, B

2006-01-01

The selective significance, if any, of many invertebrate visible polymorphisms is still not fully understood. Here we examine colour- and black spotting-morph frequencies in the spider Enoplognatha ovata in populations on two Swedish archipelagos with respect to different spatial scales and, in one archipelago, against the background of variation at four putative neutral allozyme marker loci. Every population studied was polymorphic for colour and 28 out of 30 contained all three colour morphs--lineata, redimita and ovata. We found no evidence for a breakdown in the traditional colour morph designation previously suggested for other northern European populations of this species. For colour there is no significant heterogeneity at spatial scales greater than between local populations within islands. Black spotting frequencies show a similar lack of pattern over larger spatial scales except that there are significant differences between the Stockholm and Göteborg archipelagos. Measures of population differentiation (theta) within the Stockholm islands for the two visible systems show them to be significantly more differentiated than the neutral markers, suggesting local selection acting on them in a population-specific manner. On the basis of previous observations and the distribution of spotting phenotypes on a European scale, it is argued that thermal selection might operate on black spotting during the juvenile stages favouring more spots in continental climates. It is not clear what selective forces act on colour.

Genetic polymorphisms of Echinococcus tapeworms in China as determined by mitochondrial and nuclear DNA sequences ✩

PubMed Central

Nakao, Minoru; Li, Tiaoying; Han, Xiumin; Ma, Xiumin; Xiao, Ning; Qiu, Jiamin; Wang, Hu; Yanagida, Tetsuya; Mamuti, Wulamu; Wen, Hao; Moro, Pedro L.; Giraudoux, Patrick; Craig, Philip S.; Ito, Akira

2009-01-01

The genetic polymorphisms of Echinococcus spp. in the eastern Tibetan Plateau and the Xinjiang Uyghur Autonomous Region were evaluated by DNA sequencing analyses of genes for mitochondrial cytochrome c oxidase subunit 1 (cox1) and nuclear elongation factor-1 alpha (ef1a). We collected 68 isolates of Echinococcus granulosus sensu stricto (s.s.) from Xinjiang and 113 isolates of E. granulosus s. s., 49 isolates of Echinococcus multilocularis and 34 isolates of Echinococcus shiquicus from the Tibetan Plateau. The results of molecular identification by mitochondrial and nuclear markers were identical, suggesting the infrequency of introgressive hybridization. A considerable intraspecific variation was detected in mitochondrial cox1 sequences. The parsimonious network of cox1 haplotypes showed star-like features in E. granulosus s. s. and E. multilocularis, but a divergent feature in E. shiquicus. The cox1 neutrality indexes computed by Tajima's D and Fu's Fs tests showed high negative values in E. granulosus s. s. and E. multilocularis, indicating significant deviations from neutrality. In contrast, the low positive values of both tests were obtained in E. shiquicus. These results suggest the following hypotheses: (i) recent founder effects arose in E. granulosus and E. multilocularis after introducing particular individuals into the endemic areas by anthropogenic movement or natural migration of host mammals, and (ii) the ancestor of E. shiquicus was segregated into the Tibetan Plateau by colonizing alpine mammals and its mitochondrial locus has evolved without bottleneck effects. PMID:19800346

Hb Molfetta [beta126(H4)Val-->Leu, GTG-->CTG]: a new, silent, neutral beta chain variant found in an Italian woman.

PubMed

Qualtieri, Antonio; Le, Pera Maria; Pedace, Vera; Magariello, Angela; Brancati, Carlo

2002-02-01

We have identified a new neutral hemoglobin variant in a pregnant Italian woman, that resulted from a GTG-->CTG replacement at codon 126 of the beta chain, corresponding to a Val-->Leu amino acid change at position beta126(H4). Thermal and isopropanol stability tests were normal and there were no abnormal clinical features. Routine electrophoretic and ion exchange chromatographic methods for hemoglobin separation failed to show this variant, but reversed phase high performance liquid chromatography revealed an abnormal peak eluting near the normal beta chain. No abnormal tryptic peptide was revealed on the high performance liquid chromatographic elution pattern of the total globin digest. The mutation was determined at the DNA level by amplification of the three beta exons by polymerase chain reaction and direct sequencing of one exon that showed an abnormal migration on single strand conformational polymorphism analysis.

Mate choice for neutral and MHC genetic characteristics in Alpine marmots: different targets in different contexts?

PubMed

Ferrandiz-Rovira, Mariona; Allainé, Dominique; Callait-Cardinal, Marie-Pierre; Cohas, Aurélie

2016-07-01

Sexual selection through female mate choice for genetic characteristics has been suggested to be an important evolutionary force maintaining genetic variation in animal populations. However, the genetic targets of female mate choice are not clearly identified and whether female mate choice is based on neutral genetic characteristics or on particular functional loci remains an open question. Here, we investigated the genetic targets of female mate choice in Alpine marmots (Marmota marmota), a socially monogamous mammal where extra-pair paternity (EPP) occurs. We used 16 microsatellites to describe neutral genetic characteristics and two MHC loci belonging to MHC class I and II as functional genetic characteristics. Our results reveal that (1) neutral and MHC genetic characteristics convey different information in this species, (2) social pairs show a higher MHC class II dissimilarity than expected under random mate choice, and (3) the occurrence of EPP increases when social pairs present a high neutral genetic similarity or dissimilarity but also when they present low MHC class II dissimilarity. Thus, female mate choice is based on both neutral and MHC genetic characteristics, and the genetic characteristics targeted seem to be context dependent (i.e., the genes involved in social mate choice and genetic mate choice differ). We emphasize the need for empirical studies of mate choice in the wild using both neutral and MHC genetic characteristics because whether neutral and functional genetic characteristics convey similar information is not universal.

A comparative study of sustained attentional bias on emotional processing in ADHD children to pictures with eye-tracking.

PubMed

Pishyareh, Ebrahim; Tehrani-Doost, Mehdi; Mahmoodi-Gharaie, Javad; Khorrami, Anahita; Rahmdar, Saeid Reza

2015-01-01

ADHD children have anomalous and negative behavior especially in emotionally related fields when compared to other. Evidence indicates that attention has an impact on emotional processing. The present study evaluates the effect of emotional processing on the sustained attention of children with ADHD type C. Sixty participants form two equal groups (each with 30 children) of normal and ADHD children) and each subject met the required selected criterion as either a normal or an ADHD child. Both groups were aged from 6-11-years-old. All pictures were chosen from the International Affective Picture System (IAPS) and presented paired emotional and neutral scenes in the following categories: pleasant-neutral; pleasant-unpleasant; unpleasant-neutral; and neutral-neutral. Sustained attention was evaluated based on the number and duration of total fixation and was compared between the groups with MANOVA analysis. The duration of sustained attention on pleasant in the pleasant-unpleasant pair was significant. Bias in duration of sustained attention on pleasant scenes in pleasant-neutral pairs is significantly different between the groups. Such significant differences might be indicative of ADHD children deficiencies in emotional processing. It seems that the highly deep effect of emotionally unpleasant scenes to gain the focus of ADHD children's attention is responsible for impulsiveness and abnormal processing of emotional stimuli.

Sequence polymorphism in an insect RNA virus field population: A snapshot from a single point in space and time reveals stochastic differences among and within individual hosts

DOE Office of Scientific and Technical Information (OSTI.GOV)

Stenger, Drake C., E-mail: drake.stenger@ars.usda.

Population structure of Homalodisca coagulata Virus-1 (HoCV-1) among and within field-collected insects sampled from a single point in space and time was examined. Polymorphism in complete consensus sequences among single-insect isolates was dominated by synonymous substitutions. The mutant spectrum of the C2 helicase region within each single-insect isolate was unique and dominated by nonsynonymous singletons. Bootstrapping was used to correct the within-isolate nonsynonymous:synonymous arithmetic ratio (N:S) for RT-PCR error, yielding an N:S value ~one log-unit greater than that of consensus sequences. Probability of all possible single-base substitutions for the C2 region predicted N:S values within 95% confidence limits of themore » corrected within-isolate N:S when the only constraint imposed was viral polymerase error bias for transitions over transversions. These results indicate that bottlenecks coupled with strong negative/purifying selection drive consensus sequences toward neutral sequence space, and that most polymorphism within single-insect isolates is composed of newly-minted mutations sampled prior to selection. -- Highlights: •Sampling protocol minimized differential selection/history among isolates. •Polymorphism among consensus sequences dominated by negative/purifying selection. •Within-isolate N:S ratio corrected for RT-PCR error by bootstrapping. •Within-isolate mutant spectrum dominated by new mutations yet to undergo selection.« less

Effects of the BDNF Val66Met polymorphism on neural responses to facial emotion.

PubMed

Mukherjee, Prerona; Whalley, Heather C; McKirdy, James W; McIntosh, Andrew M; Johnstone, Eve C; Lawrie, Stephen M; Hall, Jeremy

2011-03-31

The brain derived neurotrophic factor (BDNF) Val66Met polymorphism has been associated with affective disorders, but its role in emotion processing has not been fully established. Due to the clinically heterogeneous nature of these disorders, studying the effect of genetic variation in the BDNF gene on a common attribute such as fear processing may elucidate how the BDNF Val66Met polymorphism impacts brain function. Here we use functional magnetic resonance imaging examine the effect of the BDNF Val66Met genotype on neural activity for fear processing. Forty healthy participants performed an implicit fear task during scanning, where subjects made gender judgments from facial images with neutral or fearful emotion. Subjects were tested for facial emotion recognition post-scan. Functional connectivity was investigated using psycho-physiological interactions. Subjects were genotyped for the BDNF Val66Met polymorphism and the measures compared between genotype groups. Met carriers showed overactivation in the anterior cingulate cortex (ACC), brainstem and insula bilaterally for fear processing, along with reduced functional connectivity from the ACC to the left hippocampus, and impaired fear recognition ability. The results show that during fear processing, Met allele carriers show an increased neural response in regions previously implicated in mediating autonomic arousal. Further, the Met carriers show decreased functional connectivity with the hippocampus, which may reflect differential retrieval of emotional associations. Together, these effects show significant differences in the neural substrate for fear processing with genetic variation in BDNF. Copyright © 2010 Elsevier Ireland Ltd. All rights reserved.

Diversifying Selection Underlies the Origin of Allozyme Polymorphism at the Phosphoglucose Isomerase Locus in Tigriopus californicus

PubMed Central

Schoville, Sean D.; Flowers, Jonathan M.; Burton, Ronald S.

2012-01-01

The marine copepod Tigriopus californicus lives in intertidal rock pools along the Pacific coast, where it exhibits strong, temporally stable population genetic structure. Previous allozyme surveys have found high frequency private alleles among neighboring subpopulations, indicating that there is limited genetic exchange between populations. Here we evaluate the factors responsible for the diversification and maintenance of alleles at the phosphoglucose isomerase (Pgi) locus by evaluating patterns of nucleotide variation underlying previously identified allozyme polymorphism. Copepods were sampled from eleven sites throughout California and Baja California, revealing deep genetic structure among populations as well as genetic variability within populations. Evidence of recombination is limited to the sample from Pescadero and there is no support for linkage disequilibrium across the Pgi locus. Neutrality tests and codon-based models of substitution suggest the action of natural selection due to elevated non-synonymous substitutions at a small number of sites in Pgi. Two sites are identified as the charge-changing residues underlying allozyme polymorphisms in T. californicus. A reanalysis of allozyme variation at several focal populations, spanning a period of 26 years and over 200 generations, shows that Pgi alleles are maintained without notable frequency changes. Our data suggest that diversifying selection accounted for the origin of Pgi allozymes, while McDonald-Kreitman tests and the temporal stability of private allozyme alleles suggests that balancing selection may be involved in the maintenance of amino acid polymorphisms within populations. PMID:22768211

A nuclear phylogenetic analysis: SNPs, indels and SSRs deliver new insights into the relationships in the ‘true citrus fruit trees’ group (Citrinae, Rutaceae) and the origin of cultivated species

PubMed Central

Garcia-Lor, Andres; Curk, Franck; Snoussi-Trifa, Hager; Morillon, Raphael; Ancillo, Gema; Luro, François; Navarro, Luis; Ollitrault, Patrick

2013-01-01

Background and Aims Despite differences in morphology, the genera representing ‘true citrus fruit trees’ are sexually compatible, and their phylogenetic relationships remain unclear. Most of the important commercial ‘species’ of Citrus are believed to be of interspecific origin. By studying polymorphisms of 27 nuclear genes, the average molecular differentiation between species was estimated and some phylogenetic relationships between ‘true citrus fruit trees’ were clarified. Methods Sanger sequencing of PCR-amplified fragments from 18 genes involved in metabolite biosynthesis pathways and nine putative genes for salt tolerance was performed for 45 genotypes of Citrus and relatives of Citrus to mine single nucleotide polymorphisms (SNPs) and indel polymorphisms. Fifty nuclear simple sequence repeats (SSRs) were also analysed. Key Results A total of 16 238 kb of DNA was sequenced for each genotype, and 1097 single nucleotide polymorphisms (SNPs) and 50 indels were identified. These polymorphisms were more valuable than SSRs for inter-taxon differentiation. Nuclear phylogenetic analysis revealed that Citrus reticulata and Fortunella form a cluster that is differentiated from the clade that includes three other basic taxa of cultivated citrus (C. maxima, C. medica and C. micrantha). These results confirm the taxonomic subdivision between the subgenera Metacitrus and Archicitrus. A few genes displayed positive selection patterns within or between species, but most of them displayed neutral patterns. The phylogenetic inheritance patterns of the analysed genes were inferred for commercial Citrus spp. Conclusions Numerous molecular polymorphisms (SNPs and indels), which are potentially useful for the analysis of interspecific genetic structures, have been identified. The nuclear phylogenetic network for Citrus and its sexually compatible relatives was consistent with the geographical origins of these genera. The positive selection observed for a few genes will help further works to analyse the molecular basis of the variability of the associated traits. This study presents new insights into the origin of C. sinensis. PMID:23104641

A nuclear phylogenetic analysis: SNPs, indels and SSRs deliver new insights into the relationships in the 'true citrus fruit trees' group (Citrinae, Rutaceae) and the origin of cultivated species.

PubMed

Garcia-Lor, Andres; Curk, Franck; Snoussi-Trifa, Hager; Morillon, Raphael; Ancillo, Gema; Luro, François; Navarro, Luis; Ollitrault, Patrick

2013-01-01

Despite differences in morphology, the genera representing 'true citrus fruit trees' are sexually compatible, and their phylogenetic relationships remain unclear. Most of the important commercial 'species' of Citrus are believed to be of interspecific origin. By studying polymorphisms of 27 nuclear genes, the average molecular differentiation between species was estimated and some phylogenetic relationships between 'true citrus fruit trees' were clarified. Sanger sequencing of PCR-amplified fragments from 18 genes involved in metabolite biosynthesis pathways and nine putative genes for salt tolerance was performed for 45 genotypes of Citrus and relatives of Citrus to mine single nucleotide polymorphisms (SNPs) and indel polymorphisms. Fifty nuclear simple sequence repeats (SSRs) were also analysed. A total of 16 238 kb of DNA was sequenced for each genotype, and 1097 single nucleotide polymorphisms (SNPs) and 50 indels were identified. These polymorphisms were more valuable than SSRs for inter-taxon differentiation. Nuclear phylogenetic analysis revealed that Citrus reticulata and Fortunella form a cluster that is differentiated from the clade that includes three other basic taxa of cultivated citrus (C. maxima, C. medica and C. micrantha). These results confirm the taxonomic subdivision between the subgenera Metacitrus and Archicitrus. A few genes displayed positive selection patterns within or between species, but most of them displayed neutral patterns. The phylogenetic inheritance patterns of the analysed genes were inferred for commercial Citrus spp. Numerous molecular polymorphisms (SNPs and indels), which are potentially useful for the analysis of interspecific genetic structures, have been identified. The nuclear phylogenetic network for Citrus and its sexually compatible relatives was consistent with the geographical origins of these genera. The positive selection observed for a few genes will help further works to analyse the molecular basis of the variability of the associated traits. This study presents new insights into the origin of C. sinensis.

Studying the genetic basis of speciation in high gene flow marine invertebrates

PubMed Central

2016-01-01

A growing number of genes responsible for reproductive incompatibilities between species (barrier loci) exhibit the signals of positive selection. However, the possibility that genes experiencing positive selection diverge early in speciation and commonly cause reproductive incompatibilities has not been systematically investigated on a genome-wide scale. Here, I outline a research program for studying the genetic basis of speciation in broadcast spawning marine invertebrates that uses a priori genome-wide information on a large, unbiased sample of genes tested for positive selection. A targeted sequence capture approach is proposed that scores single-nucleotide polymorphisms (SNPs) in widely separated species populations at an early stage of allopatric divergence. The targeted capture of both coding and non-coding sequences enables SNPs to be characterized at known locations across the genome and at genes with known selective or neutral histories. The neutral coding and non-coding SNPs provide robust background distributions for identifying FST-outliers within genes that can, in principle, identify specific mutations experiencing diversifying selection. If natural hybridization occurs between species, the neutral coding and non-coding SNPs can provide a neutral admixture model for genomic clines analyses aimed at finding genes exhibiting strong blocks to introgression. Strongylocentrotid sea urchins are used as a model system to outline the approach but it can be used for any group that has a complete reference genome available. PMID:29491951

Association between HLA-E gene polymorphism and unexplained recurrent spontaneous abortion (RSA) in Iranian women.

PubMed

Fotoohi, Maryam; Ghasemi, Nasrin; Mirghanizadeh, Seyed Ali; Vakili, Mahmood; Samadi, Morteza

2016-07-01

Human leukocyte antigen-E (HLA-E)is a non-classical major histocompatibility complex (MHC) class I antigens which expressed on extra villous cytotrophoblast, which interacts with NKG2A, is an inhibitory receptor on natural killer (NK) cells and leading to down regulation of immune response in the maternal-fetal interface and provides maternal immune tolerance of the fetus. This study was designated to investigate the gene frequencies of E0101 and E0103 in HLA-E gene in Iranian women with recurrent spontaneous abortion (RSA). Amplification Refractory Mutation System (ARMS-PCR) technique was carried out to detect polymorphism in exon 3 of the HLA-E gene in women with RSA and controls (n=200). Differences between groups were analyzed by SPSS19 software using (2) test. There was no significant difference in the allele frequencies of the HLA-E polymorphism between RSA and fertile controls but HLA-E 0101/0103 heterozygous genotype was found to be significantly higher in RSA group (p=0.006, OR=1.73), so this genotype might confer susceptibility to RSA. Our results suggest that HLA-E 0101/0103 heterozygous genotype leads to increase of RSA risk. It seems that by genotyping of HLA-E polymorphism, we can predict the risk of RSA in infertile women.

Aquaporin-4 polymorphisms and brain/body weight ratio in sudden infant death syndrome (SIDS).

PubMed

Studer, Jacqueline; Bartsch, Christine; Haas, Cordula

2014-07-01

Failure in the regulation of homeostatic water balance in the brain is associated with severe cerebral edema and increased brain weights and may also play an important role in the pathogenesis of sudden infant death syndrome (SIDS). We genotyped three single-nucleotide polymorphisms in the aquaporin-4 water channel-encoding gene (AQP4), which were previously shown to be associated with (i) SIDS in Norwegian infants (rs2075575), (ii) severe brain edema (rs9951307), and (iii) increased brain water permeability (rs3906956). We also determined whether the brain/body weight ratio is increased in SIDS infants compared with sex- and age-matched controls. Genotyping of the three AQP4 single-nucleotide polymorphisms was performed in 160 Caucasian SIDS infants and 181 healthy Swiss adults using a single-base extension method. Brain and body weights were measured during autopsy in 157 SIDS and 59 non-SIDS infants. No differences were detected in the allelic frequencies of the three AQP4 single-nucleotide polymorphisms between SIDS and adult controls. The brain/body weight ratio was similarly distributed in SIDS and non-SIDS infants. Variations in the AQP4 gene seem of limited significance as predisposing factors in Caucasian SIDS infants. Increased brain weights may only become evident in conjunction with environmental or other genetic risk factors.

The rs2516839 Polymorphism of the USF1 Gene May Modulate Serum Triglyceride Levels in Response to Cigarette Smoking

PubMed Central

Niemiec, Pawel; Nowak, Tomasz; Iwanicki, Tomasz; Gorczynska-Kosiorz, Sylwia; Balcerzyk, Anna; Krauze, Jolanta; Grzeszczak, Wladyslaw; Wiecha, Maria; Zak, Iwona

2015-01-01

Single nucleotide polymorphisms (SNPs) of the USF1 gene (upstream stimulatory factor 1) influence plasma lipid levels. This study aims to determine whether USF1 SNPs interact with traditional risk factors of atherosclerosis to increase coronary artery disease (CAD) risk. In the present study serum lipid levels and USF1 gene polymorphisms (rs2516839 and rs3737787) were determined in 470 subjects: 235 patients with premature CAD and 235 controls. A trend of increasing triglycerides (TG) levels in relation to the C allele dose of rs2516839 SNP was observed. The synergistic effect of cigarette smoking and C allele carrier state on CAD risk was also found (SIM = 2.69, p = 0.015). TG levels differentiated significantly particular genotypes in smokers (1.53 mmol/L for TT, 1.80 mmol/L for CT and 2.27 mmol/L for CC subjects). In contrast, these differences were not observed in the non-smokers subgroup (1.57 mmol/L for TT, 1.46 mmol/L for CT and 1.49 mmol/L for CC subjects). In conclusion, the rs2516839 polymorphism may modulate serum triglyceride levels in response to cigarette smoking. Carriers of the C allele seem to be particularly at risk of CAD, when exposed to cigarette smoking. PMID:26068452

Molecular screening of the ghrelin gene in Italian obese children: the Leu72Met variant is associated with an earlier onset of obesity.

PubMed

Miraglia del Giudice, E; Santoro, N; Cirillo, G; Raimondo, P; Grandone, A; D'Aniello, A; Di Nardo, M; Perrone, L

2004-03-01

To test whether ghrelin variants could play a role in modulating some aspects of the obese phenotype during childhood. We screened the ghrelin gene in 300 Italian obese children and adolescents (mean age 10.5+/-3.2 y; range 4-19 y) and 200 controls by using the single-strand conformation polymorphism and the restriction fragment length polymoprhism analysis. No mutations were detected with the exception of two previously described polymorphisms, Arg51Gln and Leu72Met. For both variations, allelic frequencies were similar between patients and controls. Interestingly, we showed that the Leu72Met polymorphism was associated with differences in the age at obesity onset. Patients with the Met72 allele became obese earlier than homozygous patients for the wild Leu72 allele. The logrank test comparing the plots of the complement of Kaplan-Meier estimates between the two groups of patients was statistically significant (P<0.0001). It is unlikely that ghrelin variations cause the obesity due to single-gene mutations. The Leu72Met polymorphism of the ghrelin gene seems to play a role in anticipating the onset of obesity among children suggesting, therefore, that ghrelin may be involved in the pathophysiology of human adiposity.

DNA variation in a conifer, Cryptomeria japonica (Cupressaceae sensu lato).

PubMed Central

Kado, Tomoyuki; Yoshimaru, Hiroshi; Tsumura, Yoshihiko; Tachida, Hidenori

2003-01-01

We investigated the nucleotide variation of a conifer, Cryptomeria japonica, and the divergence between this species and its closest relative, Taxodium distichum, at seven nuclear loci (Acl5, Chi1, Ferr, GapC, HemA, Lcyb, and Pat). Samples of C. japonica were collected from three areas, Kantou-Toukai, Hokuriku, and Iwate. No apparent geographic differentiation was found among these samples. However, the frequency spectrum of the nucleotide polymorphism revealed excesses of intermediate-frequency variants, which suggests that the population was not panmictic and a constant size in the past. The average nucleotide diversity, pi, for silent sites was 0.00383. However, values of pi for silent sites vary among loci. Comparisons of polymorphism to divergence among loci (the HKA test) showed that the polymorphism at the Acl5 locus was significantly lower. We also observed a nearly significant excess of replacement polymorphisms at the Lcyb locus. These results suggested possibilities of natural selection acting at some of the loci. Intragenic recombination was detected only once at the Chi1 locus and was not detected at the other loci. The low level of population recombination rate, 4Nr, seemed to be due to both low level of recombination, r, and small population size, N. PMID:12930759

Cloning of soluble alkaline phosphatase cDNA and molecular basis of the polymorphic nature in alkaline phosphatase isozymes of Bombyx mori midgut.

PubMed

Itoh, M; Kanamori, Y; Takao, M; Eguchi, M

1999-02-01

A cDNA coding for soluble type alkaline phosphatase (sALP) of Bombyx mori was isolated. Deduced amino acid sequence showed high identities to various ALPs and partial similarities to ATPase of Manduca sexta. Using this cDNA sequence as a probe, the molecular basis of electrophoretic polymorphism in sALP and membrane-bound type ALP (mALP) was studied. As for mALP, the result suggested that post-translational modification was important for the proteins to express activity and to represent their extensive polymorphic nature, whereas the magnitude of activities was mainly regulated by transcription. On the other hand, sALP zymogram showed poor polymorphism, but one exception was the null mutant, in which the sALP gene was largely lost. Interestingly, the sALP gene was shown to be transcribed into two mRNAs of different sizes, 2.0 and 2.4 Kb. In addition to the null mutant of sALP, we found a null mutant for mALP. Both of these mutants seem phenotypically silent, suggesting that the functional differentiation between these isozymes is not perfect, so that they can still work mutually and complement each other as an indispensable enzyme for B. mori.

No effect of C1473G polymorphism in the tryptophan hydroxylase 2 gene on the response of the brain serotonin system to chronic fluoxetine treatment in mice.

PubMed

Bazhenova, Ekaterina Y; Sinyakova, Nadezhda A; Kulikova, Elizabeth A; Kazarinova, Irina A; Bazovkina, Daria V; Gainetdinov, Raul R; Kulikov, Alexander V

2017-07-13

Selective serotonin reuptake inhibitors (SSRIs) are antidepressants that block serotonin transporter (SERT) and increase serotonin (5-HT) level in the synaptic cleft. The interaction between SERT and the key enzyme of 5-HT synthesis in the brain, tryptophan hydroxylase 2 (TPH2), is essential to maintain the brain 5-HT level. The G allele of C1473G polymorphism in Tph2 gene decreases enzyme activity by half in mouse brain. Here we studied effect of C1473G polymorphism on the reaction of brain 5-HT system to chronic fluoxetine treatment (120mg/l in drinking water, for 3 weeks) in adult males of the congenic B6-1473C and B6-1473G mouse lines with high and low enzyme activity, respectively. The polymorphism did not affect the levels of 5-HT, its metabolite, 5-hydroxyindoleacetic acid (5-HIAA) and Tph2 gene mRNA in the brain. Fluoxetine significantly attenuated 5-HT levels in the cortex and striatum, 5-HIAA concentrations in the cortex, hippocampus, striatum and midbrain, and Tph2 gene expression in the midbrain. However, we did not observed any effect of the genotype x treatment interaction on these neurochemical characteristics. Therefore, C1473G polymorphism does not seem to play an essential role in the reaction of the brain 5-HT system to chronic fluoxetine treatment. Copyright © 2017 Elsevier B.V. All rights reserved.

Evaluation of the adenosine deaminase (ADA) G22A gene polymorphism with recurrent spontaneous abortion among Egyptian patients.

PubMed

Farhan, Hanan Mohamed; Abu-Gabal, Khadiga; Katta, Maha; Ibrahim, Raghda

2017-01-01

Adenosine and deoxyadenosine metabolism is influenced by adenosine deaminase (ADA) enzyme. ADA increases in different diseases and is considered as one of the markers for cell-mediated immunity. Pregnancy is associated with depressed cell-mediated immunity. The level of ADA expression, which seems to play a key role in maintaining pregnancy, is influenced by adenosine deaminase G22A gene polymorphism. We aimed in our study to evaluate the association of ADA G22A gene polymorphism with recurrent spontaneous abortion (RSA) in Egyptian women. Adenosine deaminase G22A gene polymorphism was genotyped in 40 patients (age range 22-39 years) with a history of RSA, selected from those attending the Gynaecology and Obstetrics Clinic of Beni-Suef University Hospital, and 20 age-matched healthy women as a control group, using polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) analysis. In our study, no statistically significant difference was found between RSA patients and control group as regards ADA G22A genotypes (p = 0.653) and alleles (p = 0.697). A comparison of the frequencies of ADA alleles in RSA patients as regards the below-35-years-old age group revealed that ADA 2(A) allele was associated with a low risk for RSA in patients aged 35 years old or younger (p = 0.008). In conclusion, our study revealed an age-dependent protective value of ADA 2(A) allele in recurrent spontaneous abortions among the Egyptian population.

On the relative roles of background selection and genetic hitchhiking in shaping human cytomegalovirus genetic diversity.

PubMed

Renzette, Nicholas; Kowalik, Timothy F; Jensen, Jeffrey D

2016-01-01

A central focus of population genetics has been examining the contribution of selective and neutral processes in shaping patterns of intraspecies diversity. In terms of selection specifically, surveys of higher organisms have shown considerable variation in the relative contributions of background selection and genetic hitchhiking in shaping the distribution of polymorphisms, although these analyses have rarely been extended to bacteria and viruses. Here, we study the evolution of a ubiquitous, viral pathogen, human cytomegalovirus (HCMV), by analysing the relationship among intraspecies diversity, interspecies divergence and rates of recombination. We show that there is a strong correlation between diversity and divergence, consistent with expectations of neutral evolution. However, after correcting for divergence, there remains a significant correlation between intraspecies diversity and recombination rates, with additional analyses suggesting that this correlation is largely due to the effects of background selection. In addition, a small number of loci, centred on long noncoding RNAs, also show evidence of selective sweeps. These data suggest that HCMV evolution is dominated by neutral mechanisms as well as background selection, expanding our understanding of linked selection to a novel class of organisms. © 2015 John Wiley & Sons Ltd.

Spread of an Inactive Form of Caspase-12 in Humans Is Due to Recent Positive Selection

PubMed Central

Xue, Yali ; Daly, Allan ; Yngvadottir, Bryndis ; Liu, Mengning ; Coop, Graham ; Kim, Yuseob ; Sabeti, Pardis ; Chen, Yuan ; Stalker, Jim ; Huckle, Elizabeth ; Burton, John ; Leonard, Steven ; Rogers, Jane ; Tyler-Smith, Chris 

2006-01-01

The human caspase-12 gene is polymorphic for the presence or absence of a stop codon, which results in the occurrence of both active (ancestral) and inactive (derived) forms of the gene in the population. It has been shown elsewhere that carriers of the inactive gene are more resistant to severe sepsis. We have now investigated whether the inactive form has spread because of neutral drift or positive selection. We determined its distribution in a worldwide sample of 52 populations and resequenced the gene in 77 individuals from the HapMap Yoruba, Han Chinese, and European populations. There is strong evidence of positive selection from low diversity, skewed allele-frequency spectra, and the predominance of a single haplotype. We suggest that the inactive form of the gene arose in Africa ∼100–500 thousand years ago (KYA) and was initially neutral or almost neutral but that positive selection beginning ∼60–100 KYA drove it to near fixation. We further propose that its selective advantage was sepsis resistance in populations that experienced more infectious diseases as population sizes and densities increased. PMID:16532395

DnaSAM: Software to perform neutrality testing for large datasets with complex null models.

PubMed

Eckert, Andrew J; Liechty, John D; Tearse, Brandon R; Pande, Barnaly; Neale, David B

2010-05-01

Patterns of DNA sequence polymorphisms can be used to understand the processes of demography and adaptation within natural populations. High-throughput generation of DNA sequence data has historically been the bottleneck with respect to data processing and experimental inference. Advances in marker technologies have largely solved this problem. Currently, the limiting step is computational, with most molecular population genetic software allowing a gene-by-gene analysis through a graphical user interface. An easy-to-use analysis program that allows both high-throughput processing of multiple sequence alignments along with the flexibility to simulate data under complex demographic scenarios is currently lacking. We introduce a new program, named DnaSAM, which allows high-throughput estimation of DNA sequence diversity and neutrality statistics from experimental data along with the ability to test those statistics via Monte Carlo coalescent simulations. These simulations are conducted using the ms program, which is able to incorporate several genetic parameters (e.g. recombination) and demographic scenarios (e.g. population bottlenecks). The output is a set of diversity and neutrality statistics with associated probability values under a user-specified null model that are stored in easy to manipulate text file. © 2009 Blackwell Publishing Ltd.

Determining the Effect of Natural Selection on Linked Neutral Divergence across Species

PubMed Central

Phung, Tanya N.; Lohmueller, Kirk E.

2016-01-01

A major goal in evolutionary biology is to understand how natural selection has shaped patterns of genetic variation across genomes. Studies in a variety of species have shown that neutral genetic diversity (intra-species differences) has been reduced at sites linked to those under direct selection. However, the effect of linked selection on neutral sequence divergence (inter-species differences) remains ambiguous. While empirical studies have reported correlations between divergence and recombination, which is interpreted as evidence for natural selection reducing linked neutral divergence, theory argues otherwise, especially for species that have diverged long ago. Here we address these outstanding issues by examining whether natural selection can affect divergence between both closely and distantly related species. We show that neutral divergence between closely related species (e.g. human-primate) is negatively correlated with functional content and positively correlated with human recombination rate. We also find that neutral divergence between distantly related species (e.g. human-rodent) is negatively correlated with functional content and positively correlated with estimates of background selection from primates. These patterns persist after accounting for the confounding factors of hypermutable CpG sites, GC content, and biased gene conversion. Coalescent models indicate that even when the contribution of ancestral polymorphism to divergence is small, background selection in the ancestral population can still explain a large proportion of the variance in divergence across the genome, generating the observed correlations. Our findings reveal that, contrary to previous intuition, natural selection can indirectly affect linked neutral divergence between both closely and distantly related species. Though we cannot formally exclude the possibility that the direct effects of purifying selection drive some of these patterns, such a scenario would be possible only if more of the genome is under purifying selection than currently believed. Our work has implications for understanding the evolution of genomes and interpreting patterns of genetic variation. PMID:27508305

Determining the Effect of Natural Selection on Linked Neutral Divergence across Species.

PubMed

Phung, Tanya N; Huber, Christian D; Lohmueller, Kirk E

2016-08-01

A major goal in evolutionary biology is to understand how natural selection has shaped patterns of genetic variation across genomes. Studies in a variety of species have shown that neutral genetic diversity (intra-species differences) has been reduced at sites linked to those under direct selection. However, the effect of linked selection on neutral sequence divergence (inter-species differences) remains ambiguous. While empirical studies have reported correlations between divergence and recombination, which is interpreted as evidence for natural selection reducing linked neutral divergence, theory argues otherwise, especially for species that have diverged long ago. Here we address these outstanding issues by examining whether natural selection can affect divergence between both closely and distantly related species. We show that neutral divergence between closely related species (e.g. human-primate) is negatively correlated with functional content and positively correlated with human recombination rate. We also find that neutral divergence between distantly related species (e.g. human-rodent) is negatively correlated with functional content and positively correlated with estimates of background selection from primates. These patterns persist after accounting for the confounding factors of hypermutable CpG sites, GC content, and biased gene conversion. Coalescent models indicate that even when the contribution of ancestral polymorphism to divergence is small, background selection in the ancestral population can still explain a large proportion of the variance in divergence across the genome, generating the observed correlations. Our findings reveal that, contrary to previous intuition, natural selection can indirectly affect linked neutral divergence between both closely and distantly related species. Though we cannot formally exclude the possibility that the direct effects of purifying selection drive some of these patterns, such a scenario would be possible only if more of the genome is under purifying selection than currently believed. Our work has implications for understanding the evolution of genomes and interpreting patterns of genetic variation.

Restriction fragment length polymorphisms in dairy and beef cattle at the growth hormone and prolactin loci.

PubMed

Hallerman, E M; Nave, A; Kashi, Y; Holzer, Z; Soller, M; Beckmann, J S

1987-01-01

Two bovine populations, a Holstein-Friesian dairy stock and a synthetic (Baladi X Hereford X Simmental X Charolais) beef stock, were screened for restriction fragment length polymorphisms (RFLPs) at the growth hormone and prolactin genes. Most RFLPs at the growth hormone gene are apparently the consequence of an insertion/deletion event which was localized to a region downstream of the structural gene. The restriction map for the genomic region including the growth hormone gene was extended. Two HindIII RFLPs at the growth hormone locus, as well as several RFLPs at the prolactin gene, seemed to be the consequence of a series of point mutations. The results are discussed in terms of the possibility that minor genomic variability underlies quantitative genetic variation.

Role of Brain-Derived Neurotrophic Factor in Beneficial Effects of Repetitive Transcranial Magnetic Stimulation for Upper Limb Hemiparesis after Stroke.

PubMed

Niimi, Masachika; Hashimoto, Kenji; Kakuda, Wataru; Miyano, Satoshi; Momosaki, Ryo; Ishima, Tamaki; Abo, Masahiro

2016-01-01

Repetitive transcranial magnetic stimulation (rTMS) can improve upper limb hemiparesis after stroke but the mechanism underlying its efficacy remains elusive. rTMS seems to alter brain-derived neurotrophic factor (BDNF) and such effect is influenced by BDNF gene polymorphism. To investigate the molecular effects of rTMS on serum levels of BDNF, its precursor proBDNF and matrix metalloproteinase-9 (MMP-9) in poststroke patients with upper limb hemiparesis. Poststroke patients with upper limb hemiparesis were studied. Sixty-two patients underwent rehabilitation plus rTMS combination therapy and 33 patients underwent rehabilitation monotherapy without rTMS for 14 days at our hospital. One Hz rTMS was applied over the motor representation of the first dorsal interosseous muscle on the non-lesional hemisphere. Fugl-Meyer Assessment and Wolf Motor Function (WMFT) were used to evaluate motor function on the affected upper limb before and after intervention. Blood samples were collected for analysis of BDNF polymorphism and measurement of BDNF, proBDNF and MMP-9 levels. Two-week combination therapy increased BDNF and MMP-9 serum levels, but not serum proBDNF. Serum BDNF and MMP-9 levels did not correlate with motor function improvement, though baseline serum proBDNF levels correlated negatively and significantly with improvement in WMFT (ρ = -0.422, p = 0.002). The outcome of rTMS therapy was not altered by BDNF gene polymorphism. The combination therapy of rehabilitation plus low-frequency rTMS seems to improve motor function in the affected limb, by activating BDNF processing. BDNF and its precursor proBDNF could be potentially suitable biomarkers for poststroke motor recovery.

Interaction between MTHFR 677C>T and periconceptional folic acid supplementation in the risk of Hypospadias.

PubMed

Dokter, Elisabeth M J; van Rooij, Iris A L M; Wijers, Charlotte H W; Groothuismink, Johanne M; van der Biezen, Jan Jaap; Feitz, Wout F J; Roeleveld, Nel; van der Zanden, Loes F M

2016-04-01

Hypospadias is a congenital malformation with both environmental factors and genetic predisposition involved in the pathogenesis. The role of maternal periconceptional folic acid supplement use in the development of hypospadias is unclear. As folate levels may also be influenced by the C677T polymorphism in the methylenetetrahydrofolate reductase (MTHFR) gene, we hypothesize that a gene-environment interaction between this polymorphism and folic acid use is involved in the etiology of hypospadias. We conducted a case-control study among 855 hypospadias cases and 713 population-based controls from the AGORA data- and biobank. Folic acid supplement use was derived from maternal questionnaires and infant and maternal DNA was used to determine the MTHFR C677T polymorphism using Taqman assays. We performed separate analyses for different hypospadias phenotypes (anterior/middle/posterior). Hypospadias was neither associated with folic acid use or the MTHFR C677T polymorphism, nor with their interaction. However, we did find an association with middle hypospadias when no supplements were used (odds ratio = 1.6; 95% confidence interval, 1.1-2.4), especially in infants carrying the CT/TT genotype (odds ratio = 2.5; 95% confidence interval, 1.4-4.7). In addition, more infants with these genotypes seemed to have posterior hypospadias, regardless of folic acid use. Our study does not suggest a major role for folic acid supplements or the MTHFR C677T polymorphism in the etiology of hypospadias in general, but not using folic acid and/or carrying the MTHFR C677T polymorphism may be associated with middle and posterior hypospadias. Therefore, we stress the importance of studying gene-environment interactions preferably in stratified analyses for different hypospadias phenotypes. © 2016 Wiley Periodicals, Inc.

Association of ADIPOQ, leptin, LEPR, and resistin polymorphisms with obesity parameters in Hammam Sousse Sahloul Heart Study.

PubMed

Zayani, Nesrine; Omezzine, Asma; Boumaiza, Imen; Achour, Ons; Rebhi, Lamia; Rejeb, Jihen; Ben Rejeb, Nabila; Ben Abdelaziz, Ahmed; Bouslama, Ali

2017-11-01

Adipose tissue is an important endocrine organ that secretes a number of adipokines, such as adiponectin (ADIPOQ), leptin (LEP), leptin receptor (LEPR), and resistin (RETN) which may be implicated in obesity. Some adipokines' polymorphisms of genes might influence their concentrations and/or activities. Our aim was to study the relationship between seven SNPs in ADIPOQ (+45T

Correlation of IMPDH1 gene polymorphisms with subclinical acute rejection and mycophenolic acid exposure parameters on day 28 after renal transplantation.

PubMed

Kagaya, Hideaki; Miura, Masatomo; Saito, Mitsuru; Habuchi, Tomonori; Satoh, Shigeru

2010-08-01

The risk of acute rejection in patients with higher exposure to mycophenolic acid (MPA), the active metabolite of mycophenolate mofetil (MMF), might be due to inosine 5'-monophosphate dehydrogenase (IMPDH) polymorphisms. The correlations with subclinical acute rejection, IMPDH1 polymorphisms and MPA exposure on day 28 post-transplantation were investigated in 82 Japanese recipients. Renal transplant recipients were given combination immunosuppressive therapy consisting of tacrolimus and 1.0, 1.5 or 2.0 g/day of MMF in equally divided doses every 12 hr at designated times. There were no significant differences in the incidence of subclinical acute rejection between IMPDH1 rs2278293 or rs2278294 polymorphisms (p = 0.243 and 0.735, respectively). However, in the high MPA night-time exposure range (AUC > 60 microg x h/ml and C(0 )> or = 1.9 microg/ml), there was a significant difference in the incidence of subclinical acute rejection between IMPDH1 rs2278293 A/A, A/G and G/G genotypes (each p = 0.019), but not the IMPDH1 rs2278294 genotype. In the higher daytime MPA exposure range, patients with the IMPDH1 rs2278293 G/G genotype also tended to develop subclinical acute rejection. In patients with the IMPDH rs2278293 A/A genotype, the risk of subclinical acute rejection episode tends to be low and the administration of MMF was effective. The risk of subclinical acute rejection for recipients who cannot adapt in therapeutic drug monitoring (TDM) of MPA seems to be influenced by IMPDH1 rs2278293 polymorphism. The prospective analysis of IMPDH1 rs2278293 polymorphism as well as monitoring of MPA plasma concentration after transplantation might help to improve MMF therapy.

Association of the ACTN3 R577X Polymorphism in Polish Power-Orientated Athletes

PubMed Central

Cięszczyk, Paweł; Eider, Jerzy; Ostanek, Magdalena; Arczewska, Aleksandra; Leońska-Duniec, Agata; Sawczyn, Stanisław; Ficek, Krzysztof; Krupecki, Krzysztof

2011-01-01

Alpha-actinins are an ancient family of actin-binding proteins that play structural and regulatory roles in cytoskeletal organization. In skeletal muscle, α-actinin-3 protein is an important structural component of the Z disc, where it anchors actin thin filaments, helping to maintain the myofibrillar array. A common nonsense polymorphism in codon 577 of the ACTN3 gene (R577X) results in α-actinin-3 deficiency in XX homozygotes. Based on knowledge about the role of ACTN3 R557X polymorphism in skeletal muscle function, we postulated that the genetic polymorphism of ACTN3 could also improve sprint and power ability. We compared genotypic and allelic frequencies of the ACTN3 R557X polymorphism in two groups of men of the same Caucasian descent: 158 power-orientated athletes and 254 volunteers not involved in competitive sport. The genotype distribution in the group of power-oriented athletes showed significant differences (P=0.008) compared to controls. However, among the investigated subgroups of athletes, only the difference of ACTN3 R577X genotype between sprinters and controls reached statistical significance (P=0.041). The frequencies of the ACTN3 577X allele (30.69% vs. 40.35%; P=0.005) were significantly different in all athletes compared to controls. Our results support the hypothesis that the ACTN3 577XX allele may have some beneficial effect on sprint-power performance, because the ACTN3 XX genotype is significantly reduced in Polish power-oriented athletes compared to controls. This finding seems to be in agreement with previously reported case-control studies. However, ACTN3 polymorphism as a genetic marker for sport talent identification should be interpreted with great caution. PMID:23486986

Gender- and obesity-specific effect of apolipoprotein C3 gene (APOC3) -482C>T polymorphism on triglyceride concentration in Turkish adults.

PubMed

Coban, Neslihan; Onat, Altan; Guclu-Geyik, Filiz; Komurcu-Bayrak, Evrim; Sansoy, Vedat; Hergenc, Gulay; Can, Günay; Erginel-Unaltuna, Nihan

2011-10-18

Apolipoprotein C3 (APOC3) gene polymorphisms are associated with cardiometabolic risk factors, varying in ethnicities. This study aimed to investigate such association between the APOC3 -482C>T polymorphism and cardiometabolic risk factors in the turkish adult risk factor (TARF) study cohort, stratifying by gender and obesity. Randomly selected 1548 individuals (757 male and 791 female, mean age 49.9±11.8 years) were genotyped for -482C>T polymorphism using hybridization probes in a Real-Time PCR LC480 device. The -482TT genotype prevailed 9.9% in men and 11.5% in women. Association between 482C>T polymorphism and dyslipidemia (p=0.036, OR=1.42, 95%Cl=1.02-1.97) was found only in men. Analysis of variance showed that anthropometric and metabolic variables were not differently distributed in APOC3 -482C>T genotypes in the study population. In relation to dyslipidemia and obesity, the -482C>T polymorphism showed significant gender-by-genotype interactions (p<0.01). When the study population was stratified according to gender and obesity, homozygotes for the T allele were associated strongly with (by 45%) elevated fasting triglyceride concentrations in obese men (p=0.009) and homeostatic model assessment (HOMA) index in non-obese women (p=0.013). Furthermore, in the same subgroups, the associations of the fasting triglyceride concentrations and HOMA index with the TT genotype remained after adjustment for risk factors (p<0.05). APOC3 -482TT genotype is independently associated with elevated fasting triglyceride concentrations in obese men. Presence of obesity seems to be required for this genotype to induce markedly elevated triglycerides. Furthermore, it is associated with the dyslipidemia in men, without requirement of obesity.

The V471A Polymorphism in Autophagy-Related Gene ATG7 Modifies Age at Onset Specifically in Italian Huntington Disease Patients

PubMed Central

Metzger, Silke; Walter, Carolin; Riess, Olaf; Roos, Raymund A. C.; Nielsen, Jørgen E.; Craufurd, David; Nguyen, Huu Phuc

2013-01-01

The cause of Huntington disease (HD) is a polyglutamine repeat expansion of more than 36 units in the huntingtin protein, which is inversely correlated with the age at onset of the disease. However, additional genetic factors are believed to modify the course and the age at onset of HD. Recently, we identified the V471A polymorphism in the autophagy-related gene ATG7, a key component of the autophagy pathway that plays an important role in HD pathogenesis, to be associated with the age at onset in a large group of European Huntington disease patients. To confirm this association in a second independent patient cohort, we analysed the ATG7 V471A polymorphism in additional 1,464 European HD patients of the “REGISTRY” cohort from the European Huntington Disease Network (EHDN). In the entire REGISTRY cohort we could not confirm a modifying effect of the ATG7 V471A polymorphism. However, analysing a modifying effect of ATG7 in these REGISTRY patients and in patients of our previous HD cohort according to their ethnic origin, we identified a significant effect of the ATG7 V471A polymorphism on the HD age at onset only in the Italian population (327 patients). In these Italian patients, the polymorphism is associated with a 6-years earlier disease onset and thus seems to have an aggravating effect. We could specify the role of ATG7 as a genetic modifier for HD particularly in the Italian population. This result affirms the modifying influence of the autophagic pathway on the course of HD, but also suggests population-specific modifying mechanisms in HD pathogenesis. PMID:23894380

Type F botulism due to neurotoxigenic Clostridium baratii from an unknown source in an adult.

PubMed

McCroskey, L M; Hatheway, C L; Woodruff, B A; Greenberg, J A; Jurgenson, P

1991-11-01

Type F botulism was confirmed in a 54-year-old male with signs compatible with botulism who reported to the emergency unit of a hospital. Botulinal neurotoxin was detected in the patient's serum and fecal specimens, and a neurotoxigenic organism whose physiologic characteristics correspond to those of Clostridium baratii was isolated. The toxin produced by the isolate was neutralized by type F botulinal antitoxin and cross-neutralized with lower efficiency by type E antitoxin. The patient's food history was not suggestive of botulism, and it seems likely that the illness was due to colonization of the gut.

Type F botulism due to neurotoxigenic Clostridium baratii from an unknown source in an adult.

PubMed Central

McCroskey, L M; Hatheway, C L; Woodruff, B A; Greenberg, J A; Jurgenson, P

1991-01-01

Type F botulism was confirmed in a 54-year-old male with signs compatible with botulism who reported to the emergency unit of a hospital. Botulinal neurotoxin was detected in the patient's serum and fecal specimens, and a neurotoxigenic organism whose physiologic characteristics correspond to those of Clostridium baratii was isolated. The toxin produced by the isolate was neutralized by type F botulinal antitoxin and cross-neutralized with lower efficiency by type E antitoxin. The patient's food history was not suggestive of botulism, and it seems likely that the illness was due to colonization of the gut. PMID:1774272

Vanishing Boundaries: When Teaching "about" Religion Becomes "Spiritual Guidance" in the Classroom

ERIC Educational Resources Information Center

Simmons, John K.

2006-01-01

This article revisits the pedagogical dilemma of maintaining neutrality in the religious studies/theology classroom. I argue that if the boundary between teaching about religion and actually teaching spirituality seems to be vanishing, it is because the boundary was inappropriately constructed in the first place. To the extent that the religious…

Friendship Meeting or Blocking Circle? Identities in the Laminated Spaces of a Playground Conflict

ERIC Educational Resources Information Center

Wohlwend, Karen E.

2007-01-01

Drawing from an incident that took place during a year-long investigation of children's play and peer culture on a school playground, the author argues that seemingly neutral child-centered techniques can maintain and even strengthen existing gender inequalities as teachers and children access "laminated" but contradictory identity…

Are genes associated with energy metabolism important in asthma and BMI?

PubMed

Szczepankiewicz, Aleksandra; Breborowicz, Anna; Sobkowiak, Paulina; Popiel, Anna

2009-02-01

Increased serum leptin levels have been observed in asthmatic patients. Leptin, via proliferation and activation of Th2 cells, may induce inflammation in asthma. It has also been demonstrated that leptin mRNA expression and protein levels increase in response to inflammatory stimuli. We hypothesized that polymorphisms in the leptin receptor, leptin and ghrelin genes, may affect their expression and, therefore, be responsible for altered response to increased leptin levels observed in asthma. To our knowledge, there were no studies on a potential role of LEPR, LEP, and GHRL polymorphisms in asthma. We analyzed 129 pediatric patients with asthma and 114 healthy children from the control group ranging from 6 to 18 years of age. The diagnosis of allergic asthma was based on clinical symptoms, the lung function test, and the positive skin prick test and/or increased immunoglobulin E (IgE) levels. Polymorphisms were genotyped by the polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) method. Statistical analyses were performed with Statistica v.7.1 software (Statistica, StatSoft, Poland; available free at http://www.broad.mit.edu/mpg/haploview/index.php). Linkage disequilibrium analysis was performed with Haploview v.4.0. We observed a statistically significant association of the 3'UTR A/G and the -2549A/G polymorphisms of the leptin gene with asthma. No association with asthma was observed for the K109R and the Q223R polymorphisms of the LEPR gene and the Met72Leu polymorphism of the ghrelin gene. In the analysis of body mass index (BMI) stratified by genotype, we found an association of the -2549A/G LEP, but not of LEPR and GHRL polymorphisms, with higher BMI values in asthmatic patients. We found suggestive evidence for linkage between the two polymorphisms of the LEPR gene (D' = 0.84 CI: 0.71-0.92; r(2) = 0.29) in linkage disequilibrium analysis: The GG haplotype was more frequent in the control healthy group (p = 0.057). No linkage disequilibrium was detected between LEP polymorphisms. Polymorphisms of the leptin gene may be associated with asthma and higher BMI in asthmatic patients. Polymorphisms of the LEPR and GHRL seem unlikely to be associated with asthma or BMI in our sample. The results of haplotype analysis for the LEPR gene may suggest a protective role of the GG haplotype against asthma; however, studies on larger groups are necessary to confirm the observed trend towards association.

Age-related macular degeneration-associated silent polymorphisms in HtrA1 impair its ability to antagonize insulin-like growth factor 1.

PubMed

Jacobo, Sarah Melissa P; Deangelis, Margaret M; Kim, Ivana K; Kazlauskas, Andrius

2013-05-01

Synonymous single nucleotide polymorphisms (SNPs) within a transcript's coding region produce no change in the amino acid sequence of the protein product and are therefore intuitively assumed to have a neutral effect on protein function. We report that two common variants of high-temperature requirement A1 (HTRA1) that increase the inherited risk of neovascular age-related macular degeneration (NvAMD) harbor synonymous SNPs within exon 1 of HTRA1 that convert common codons for Ala34 and Gly36 to less frequently used codons. The frequent-to-rare codon conversion reduced the mRNA translation rate and appeared to compromise HtrA1's conformation and function. The protein product generated from the SNP-containing cDNA displayed enhanced susceptibility to proteolysis and a reduced affinity for an anti-HtrA1 antibody. The NvAMD-associated synonymous polymorphisms lie within HtrA1's putative insulin-like growth factor 1 (IGF-1) binding domain. They reduced HtrA1's abilities to associate with IGF-1 and to ameliorate IGF-1-stimulated signaling events and cellular responses. These observations highlight the relevance of synonymous codon usage to protein function and implicate homeostatic protein quality control mechanisms that may go awry in NvAMD.

Codon 219 polymorphism of PRNP in healthy caucasians and Creutzfeldt-Jakob disease patients

DOE Office of Scientific and Technical Information (OSTI.GOV)

Petraroli, R.; Pocchiari, M.

1996-04-01

A number of point and insert mutations of the PrP gene (PRNP) have been linked to familial Creutzfeldt-Jakob disease (CJD) and Gerstmann-Straussler-Scheinker disease (GSS). Moreover, the methionine/valine homozygosity at the polymorphic codon 129 of PRNP may cause a predisposition to sporadic and iatrogenic CJD or may control the age at onset of familial cases carrying either the 144-bp insertion or codon 178, codon 198, and codon 210 pathogenic mutations in PRNP. In addition, the association of methionine or valine at codon 129 and the point mutation at codon 178 on the same allele seem to play an important role inmore » determining either fatal familial insomnia or CJD. However, it is noteworthy that a relationship between codon 129 polymorphism and accelerated pathogenesis (early age at onset or shorter duration of the disease) has not been seen in familial CJD patients with codon 200 mutation or in GSS patients with codon 102 mutation, arguing that other, as yet unidentified, gene products or environmental factors, or both, may influence the clinical expression of these diseases. 17 refs.« less

Evolution of MHC class I genes in the endangered loggerhead sea turtle (Caretta caretta) revealed by 454 amplicon sequencing.

PubMed

Stiebens, Victor A; Merino, Sonia E; Chain, Frédéric J J; Eizaguirre, Christophe

2013-04-30

In evolutionary and conservation biology, parasitism is often highlighted as a major selective pressure. To fight against parasites and pathogens, genetic diversity of the immune genes of the major histocompatibility complex (MHC) are particularly important. However, the extensive degree of polymorphism observed in these genes makes it difficult to conduct thorough population screenings. We utilized a genotyping protocol that uses 454 amplicon sequencing to characterize the MHC class I in the endangered loggerhead sea turtle (Caretta caretta) and to investigate their evolution at multiple relevant levels of organization. MHC class I genes revealed signatures of trans-species polymorphism across several reptile species. In the studied loggerhead turtle individuals, it results in the maintenance of two ancient allelic lineages. We also found that individuals carrying an intermediate number of MHC class I alleles are larger than those with either a low or high number of alleles. Multiple modes of evolution seem to maintain MHC diversity in the loggerhead turtles, with relatively high polymorphism for an endangered species.

Meta-analysis of human leukocyte antigen genetic polymorphisms and susceptibility to chronic myelogenous leukemia in Chinese population.

PubMed

Zhang, Min-Yue; Chen, Fang-Yuan; Zhong, Hua

2011-12-01

Human leukocyte antigen (HLA) genetic polymorphisms are assumed to be correlated to the risk of chronic myelogenous leukemia (CML) in various ethnicities. Up to now, no clear consensus has been reached. Our goal is to address this issue in Chinese population. By searching the data in PubMed, Embase and four Chinese databases (prior to July 2010), the association of HLA genetic polymorphisms with CML has been fixed as the research objective. We studied a totality of 12 studies, comprising 2281 CML cases and 41000 health controls. The data demonstrated that HLA-A*11, A*74, HLA-B*40, B*47, B*55 and B*81 alleles were correlated with the increasing risk of CML. Nevertheless, HLA-DRB1*13 allele seemed to contribute to the genetic protection to CML. Conclusively we suggested that certain HLA alleles might be in association with the pathogenesis of CML in Chinese population. Due to little statistical scale, larger studies and particularly in a mono-people background, our hypothesis need to be further investigated in the future. Copyright © 2011 Elsevier Ltd. All rights reserved.

Evaluation of the Role of -137G/C Single Nucleotide Polymorphism (rs187238) and Gene Expression Levels of the IL-18 in Patients with Coronary Artery Disease.

PubMed

Hoseini, Fatemeh; Mahmazi, Sanaz; Mahmoodi, Khalil; Jafari, Gholam Ali; Soltanpour, Mohammad Soleiman

2018-03-01

Interleukin-18 (IL-18) is a proinflammatory and proatherogenic cytokine, and its genetic variations may contribute to the development of coronary artery disease (CAD). We sought to investigate the role of -137G/C polymorphism and gene expression levels of IL-18 in patients with CAD. The study population included 100 patients with angiographically proven CAD and 100 matched controls. Total RNA and DNA were extracted from leukocytes using appropriate kits. The genotype of -137G/C polymorphism and gene expression level of IL-18 was determined using allele-specific polymerase chain reaction (PCR) and real-time (RT)-PCR assay, respectively. The genotypic and allelic distribution of IL-18 -137G/C polymorphism was not significantly different between the two groups ( p > 0.050). Moreover, the -137G/C polymorphism did not increase the risk of CAD in dominant and recessive genetic models ( p > 0.050). However, subgroup analysis of CAD patients revealed that the IL-18 -137G/C polymorphism was significantly associated with increased risk of CAD in hypertensive patients (odds ratio (OR) = 7.51; 95% confidence interval (CI): 1.24-25.17; p = 0.019) and smokers (OR = 4.90; 95% CI: 1.21-19.70; p = 0.031) but not in the diabetic subpopulation ( p = 0.261). The genotype distribution of IL-18 -137G/C genetic polymorphism was significantly different among patients with one, two, and three stenotic vessels ( p < 0.050). The gene expression level of IL-18 was significantly higher in the CAD group than the control group ( p < 0.001). Moreover, the carriers of CC genotype had significantly lower gene expression levels of IL-18 than carriers of GG genotype ( p < 0.050). The -137G/C polymorphism of IL-18 may be associated with the CAD risk in hypertensive and smoker subgroup of CAD patients. The -137G/C polymorphism seems to play an important role in determining the severity of CAD. Increased IL-18 gene expression level is a significant risk factor for the development of CAD. The CC genotype of -137G/C polymorphism is associated with lower IL-18 gene expression levels.

Association of genetic markers within the BMP15 gene with anovulation and infertility in women with polycystic ovary syndrome.

PubMed

Gónzalez, Alejandro; Ramírez-Lorca, Reposo; Calatayud, Carmen; Mendoza, Nicolás; Ruiz, Agustín; Sáez, Maria Eugenia; Morón, Francisco Jesús

2008-08-01

We analyzed two polymorphisms (-9C>G and IVS1+905A>G) within the BMP15 gene in women from Spain with polycystic ovary syndrome (PCOS). In this study, the BMP15 gene does not seem to be associated with PCOS. Nonetheless, we observed in both markers a genetic association with anovulation or infertility in these patients.

Analysis of the Functional Polymorphism in the Cytochrome P450 CYP2C8 Gene rs11572080 with Regard to Colorectal Cancer Risk

PubMed Central

Ladero, José M.; Agúndez, José A. G.; Martínez, Carmen; Amo, Gemma; Ayuso, Pedro; García-Martín, Elena

2012-01-01

In addition to the known effects on drug metabolism and response, functional polymorphisms of genes coding for xenobiotic-metabolizing enzymes (XME) play a role in cancer. Genes coding for XME act as low-penetrance genes and confer modest but consistent and significant risks for a variety of cancers related to the interaction of environmental and genetic factors. Consistent evidence supports a role for polymorphisms of the cytochrome P450 CYP2C9 gene as a protecting factor for colorectal cancer susceptibility. It has been shown that CYP2C8 and CYP2C9 overlap in substrate specificity. Because CYP2C8 has the common functional polymorphisms rs11572080 and rs10509681 (CYP2C8*3), it could be speculated that part of the findings attributed to CYP2C9 polymorphisms may actually be related to the presence of polymorphisms in the CYP2C8 gene. Nevertheless, little attention has been paid to the role of the CYP2C8 polymorphism in colorectal cancer. We analyzed the influence of the CYP2C8*3 allele in the risk of developing colorectal cancer in genomic DNA from 153 individuals suffering colorectal cancer and from 298 age- and gender-matched control subjects. Our findings do not support any effect of the CYP2C8*3 allele (OR for carriers of functional CYP2C8 alleles = 0.50 (95% CI = 0.16–1.59; p = 0.233). The absence of a relative risk related to CYP2C8*3 did not vary depending on the tumor site. We conclude that the risk of developing colorectal cancer does not seem to be related to the commonest functional genetic variation in the CYP2C8 gene. PMID:23420707

Nontuberculous mycobacterial infection with concurrent IgG4-related lymphadenopathy.

PubMed

Liu, Ting-Ting; Weng, Shao-Wen; Wang, Ming-Chung; Huang, Wan-Ting

2016-03-01

Disseminated nontuberculous mycobacteria (NTM) infection with concurrent IgG4-related lymphadenopathy has not been reported. We described a patient with neutralizing autoantibodies to interferon-gamma (IFN-γ) and elevated levels of serum IgG4 presenting with generalized lymphadenopathy and reactive dermatosis. Histologically, lymph nodes (LNs) showed effaced nodal architecture with polymorphic infiltrates, mimicking angioimmunoblastic T-cell lymphoma. Both the absolute number and the ratio of IgG4+ plasma cells to IgG+ plasma cells were increased. Mycobacterium abscessus was isolated from cultures of LNs, and demonstrated by polymerase chain reaction-restriction fragment length polymorphism. The skin biopsy showed neutrophilic dermatosis, consistent with Sweet syndrome. The patient met the criteria of both adult-onset immunodeficiency syndrome and IgG4-related lymphadenopathy. This case provides evidence of disseminated NTM infection with concurrent type III IgG4-related lymphadenopathy in the patient with anti-IFN-γ autoantibodies. © 2015 APMIS. Published by John Wiley & Sons Ltd.

TSLP-elicited basophil responses can mediate the pathogenesis of eosinophilic esophagitis

PubMed Central

Noti, Mario; Tait Wojno, Elia D.; Kim, Brian S.; Siracusa, Mark C.; Giacomin, Paul R.; Nair, Meera G.; Benitez, Alain J.; Ruymann, Kathryn R.; Muir, Amanda B.; Hill, David A.; Chikwava, Kudakwashe R.; Moghaddam, Amin E.; Sattentau, Quentin J.; Alex, Aneesh; Zhou, Chao; Yearley, Jennifer H.; Menard-Katcher, Paul; Kubo, Masato; Obata-Ninomiya, Kazushige; Karasuyama, Hajime; Comeau, Michael R.; Brown-Whitehorn, Terri; de Waal Malefyt, Rene; Sleiman, Patrick M.; Hakonarson, Hakon; Cianferoni, Antonella; Falk, Gary W.; Wang, Mei-Lun; Spergel, Jonathan M.; Artis, David

2014-01-01

Eosinophilic esophagitis (EoE) is a food allergy-associated inflammatory disease characterized by esophageal eosinophilia. EoE has become increasingly common, but current management strategies are nonspecific. Thus, there is an urgent need to identify specific immunological pathways that could be targeted to treat this disease. EoE is associated with polymorphisms in the gene that encodes thymic stromal lymphopoietin (TSLP), a cytokine that promotes allergic inflammation, but how TSLP might contribute to EoE disease pathogenesis remains unknown. Here, we describe a new mouse model of EoE-like disease that developed independently of IgE but was dependent on TSLP-elicited basophils. Therapeutic TSLP neutralization or basophil depletion also ameliorated established EoE-like disease. Critically, in human subjects with EoE, we observed elevated TSLP levels and exaggerated basophil responses in esophageal biopsies, and a gain-of-function TSLP polymorphism was associated with increased basophil responses. Together, these data suggest that the TSLP-basophil axis could be therapeutically targeted to treat EoE. PMID:23872715

Frequency of the AGT Pro11Leu polymorphism in humans: Does diet matter?

PubMed

Ségurel, Laure; Lafosse, Sophie; Heyer, Evelyne; Vitalis, Renaud

2010-01-01

The Pro11Leu substitution in the AGXT gene, which causes primary hyperoxaluria type 1, is found with high frequency in some human populations (e.g., 5-20% in Caucasians). It has been suggested that this detrimental mutation could have been positively selected in populations with a meat-rich diet. In order to test this hypothesis, we investigated the occurrence of Pro11Leu in both herder and agriculturalist populations from Central Asia. We found a lower frequency of this detrimental mutation in herders, whose diet is more meat-rich, as compared to agriculturalists, which therefore challenges the universality of the previous claim. Furthermore, when combining our original data with previously published results, we could show that the worldwide genetic differentiation measured at the Pro11Leu polymorphism does not depart from neutrality. Hence, the distribution of the variation observed in the AGXT gene could be due to demographic history, rather than local adaptation to diet.

Chromosomal Inversions, Natural Selection and Adaptation in the Malaria Vector Anopheles funestus

PubMed Central

Ayala, Diego; Fontaine, Michael C.; Cohuet, Anna; Fontenille, Didier; Vitalis, Renaud; Simard, Frédéric

2011-01-01

Chromosomal polymorphisms, such as inversions, are presumably involved in the rapid adaptation of populations to local environmental conditions. Reduced recombination between alternative arrangements in heterozygotes may protect sets of locally adapted genes, promoting ecological divergence and potentially leading to reproductive isolation and speciation. Through a comparative analysis of chromosomal inversions and microsatellite marker polymorphisms, we hereby present biological evidence that strengthens this view in the mosquito Anopheles funestus s.s, one of the most important and widespread malaria vectors in Africa. Specimens were collected across a wide range of geographical, ecological, and climatic conditions in Cameroon. We observed a sharp contrast between population structure measured at neutral microsatellite markers and at chromosomal inversions. Microsatellite data detected only a weak signal for population structuring among geographical zones (FST < 0.013, P < 0.01). By contrast, strong differentiation among ecological zones was revealed by chromosomal inversions (FST > 0.190, P < 0.01). Using standardized estimates of FST, we show that inversions behave at odds with neutral expectations strongly suggesting a role of environmental selection in shaping their distribution. We further demonstrate through canonical correspondence analysis that heterogeneity in eco-geographical variables measured at specimen sampling sites explained 89% of chromosomal variance in A. funestus. These results are in agreement with a role of chromosomal inversions in ecotypic adaptation in this species. We argue that this widespread mosquito represents an interesting model system for the study of chromosomal speciation mechanisms and should provide ample opportunity for comparative studies on the evolution of reproductive isolation and speciation in major human malaria vectors. PMID:20837604

Low Major Histocompatibility Complex Class II Variation in the Endangered Indo-Pacific Humpback Dolphin (Sousa chinensis): Inferences About the Role of Balancing Selection.

PubMed

Zhang, Xiyang; Lin, Wenzhi; Zhou, Ruilian; Gui, Duan; Yu, Xinjian; Wu, Yuping

2016-03-01

It has been widely reported that the major histocompatibility complex (MHC) is under balancing selection due to its immune function across terrestrial and aquatic mammals. The comprehensive studies at MHC and other neutral loci could give us a synthetic evaluation about the major force determining genetic diversity of species. Previously, a low level of genetic diversity has been reported among the Indo-Pacific humpback dolphin (Sousa chinensis) in the Pearl River Estuary (PRE) using both mitochondrial marker and microsatellite loci. Here, the expression and sequence polymorphism of 2 MHC class II genes (DQB and DRB) in 32 S. chinensis from PRE collected between 2003 and 2011 were investigated. High ratios of non-synonymous to synonymous substitution rates, codon-based selection analysis, and trans-species polymorphism (TSP) support the hypothesis that balancing selection acted on S. chinensis MHC sequences. However, only 2 haplotypes were detected at either DQB or DRB loci. Moreover, the lack of deviation from the Hardy-Weinberg expectation at DRB locus combined with the relatively low heterozygosity at both DQB locus and microsatellite loci suggested that balancing selection might not be sufficient, which further suggested that genetic drift associated with historical bottlenecks was not mitigated by balancing selection in terms of the loss of MHC and neutral variation in S. chinensis. The combined results highlighted the importance of maintaining the genetic diversity of the endangered S. chinensis. © The American Genetic Association 2016. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

A low-density SNP array for analyzing differential selection in freshwater and marine populations of threespine stickleback (Gasterosteus aculeatus).

PubMed

Ferchaud, Anne-Laure; Pedersen, Susanne H; Bekkevold, Dorte; Jian, Jianbo; Niu, Yongchao; Hansen, Michael M

2014-10-06

The threespine stickleback (Gasterosteus aculeatus) has become an important model species for studying both contemporary and parallel evolution. In particular, differential adaptation to freshwater and marine environments has led to high differentiation between freshwater and marine stickleback populations at the phenotypic trait of lateral plate morphology and the underlying candidate gene Ectodysplacin (EDA). Many studies have focused on this trait and candidate gene, although other genes involved in marine-freshwater adaptation may be equally important. In order to develop a resource for rapid and cost efficient analysis of genetic divergence between freshwater and marine sticklebacks, we generated a low-density SNP (Single Nucleotide Polymorphism) array encompassing markers of chromosome regions under putative directional selection, along with neutral markers for background. RAD (Restriction site Associated DNA) sequencing of sixty individuals representing two freshwater and one marine population led to the identification of 33,993 SNP markers. Ninety-six of these were chosen for the low-density SNP array, among which 70 represented SNPs under putatively directional selection in freshwater vs. marine environments, whereas 26 SNPs were assumed to be neutral. Annotation of these regions revealed several genes that are candidates for affecting stickleback phenotypic variation, some of which have been observed in previous studies whereas others are new. We have developed a cost-efficient low-density SNP array that allows for rapid screening of polymorphisms in threespine stickleback. The array provides a valuable tool for analyzing adaptive divergence between freshwater and marine stickleback populations beyond the well-established candidate gene Ectodysplacin (EDA).

Clines in quantitative traits: The role of migration patterns and selection scenarios

PubMed Central

Geroldinger, Ludwig; Bürger, Reinhard

2015-01-01

The existence, uniqueness, and shape of clines in a quantitative trait under selection toward a spatially varying optimum is studied. The focus is on deterministic diploid two-locus n-deme models subject to various migration patterns and selection scenarios. Migration patterns may exhibit isolation by distance, as in the stepping-stone model, or random dispersal, as in the island model. The phenotypic optimum may change abruptly in a single environmental step, more gradually, or not at all. Symmetry assumptions are imposed on phenotypic optima and migration rates. We study clines in the mean, variance, and linkage disequilibrium (LD). Clines result from polymorphic equilibria. The possible equilibrium configurations are determined as functions of the migration rate. Whereas for weak migration, many polymorphic equilibria may be simultaneously stable, their number decreases with increasing migration rate. Also for intermediate migration rates polymorphic equilibria are in general not unique, however, for loci of equal effects the corresponding clines in the mean, variance, and LD are unique. For sufficiently strong migration, no polymorphism is maintained. Both migration pattern and selection scenario exert strong influence on the existence and shape of clines. The results for discrete demes are compared with those from models in which space varies continuously and dispersal is modeled by diffusion. Comparisons with previous studies, which investigated clines under neutrality or under linkage equilibrium, are performed. If there is no long-distance migration, the environment does not change abruptly, and linkage is not very tight, populations are almost everywhere close to linkage equilibrium. PMID:25446959

Association of RAGE gene polymorphism with circulating AGEs level and paraoxonase activity in relation to macro-vascular complications in Indian type 2 diabetes mellitus patients.

PubMed

Bansal, Savita; Chawla, Diwesh; Banerjee, Basu Dev; Madhu, Sri Venkata; Tripathi, Ashok Kumar

2013-09-10

Sustained interaction of advanced glycation end products (AGEs) with their receptor RAGE and subsequent signaling plays an important role in the development of diabetic complications. Genetic variation of RAGE gene may be associated with the development of vascular complications in type 2 diabetes mellitus (T2DM). The present study aimed to explore the possible association of RAGE gene polymorphisms namely -374T/A, -429T/C and G82S with serum level of AGEs, paraoxonase (PON1) activity and macro-vascular complications (MVC) in Indian type 2 diabetes mellitus patients (T2DM). A total of 265 diabetic patients, including DM without any complications (n=135), DM-MVC (n=130) and 171 healthy individuals were enrolled. Genotyping of RAGE variants were assessed by polymerase chain reaction-restriction fragment length polymorphism. Serum AGEs were estimated by ELISA and fluorometrically. and PON1 activity was assessed spectrophotometrically. Of the three examined SNPs, association of -429T/C polymorphism with MVC in T2DM was observed (OR=3.001, p=0.001) in the dominant model. Allele 'A' of -374T/A polymorphism seems to confer better cardiac outcome in T2DM. Patients carrying C allele (-429T/C) and S allele (G82S) had significantly higher AGEs levels. -429T/C polymorphism was also found to be associated with low PON1 activity. Interaction analysis revealed that the risk of development of MVC was higher in T2DM patients carrying both a CC genotype of -429T/C polymorphism and a higher level of AGEs (OR=1.343, p=0.040). RAGE gene polymorphism has a significant effect on AGEs level and PON1 activity in diabetic subjects compared to healthy individuals. Diabetic patients with a CC genotype of -429T/C are prone to develop MVC, more so if AGEs levels are high and PON1 activity is low. Copyright © 2013 Elsevier B.V. All rights reserved.

Association between ACE gene I/D polymorphism and clinical presentation and prognosis of sarcoidosis.

PubMed

Alía, P; Mañá, J; Capdevila, O; Alvarez, A; Navarro, M A

2005-01-01

Serum angiotensin converting enzyme (SACE) concentration is considered a marker of sarcoidosis activity. This concentration is influenced by an insertion/deletion (I/D) polymorphism of the ACE gene, such that SACE levels follow the pattern DD>ID>II. The aim of our work was to study the relationship between I/D polymorphism and susceptibility to sarcoidosis, as well as the relation between this polymorphism and the clinical presentation and evolution of the disease in 177 sarcoidosis patients. A group of 104 individuals without sarcoidosis was included as control. Genotyping was done by a polymerase chain reaction (PCR) method, and SACE concentration at diagnosis was determined by a kinetic method. No differences were observed in genotype or allele distributions between patients and controls, nor between patients considering the type of presentation (Löfgren versus non-Löfgren) and evolution of the disease (acute versus chronic). As reported for healthy populations, SACE concentrations followed the pattern DD>ID>II in sarcoidosis patients, but significant differences between genotypes existed only in the Löfgren group (p = 0.003) and in acute patients (p = 0.02). SACE concentrations at diagnosis were lower in acute patients (p = 0.05) and in Löfgren's syndrome (p = 0.04), but this seemed to occur only in ID individuals (p = 0.02 and p = 0.01, respectively). No relation was thus found between I/D polymorphism and susceptibility to sarcoidosis, but ACE I/D genotyping may improve the assessment of disease activity, both at diagnosis and during the follow-up of treated and untreated patients.

Evaluation of the adenosine deaminase (ADA) G22A gene polymorphism with recurrent spontaneous abortion among Egyptian patients

PubMed Central

Abu-Gabal, Khadiga; Katta, Maha; Ibrahim, Raghda

2017-01-01

Introduction Adenosine and deoxyadenosine metabolism is influenced by adenosine deaminase (ADA) enzyme. ADA increases in different diseases and is considered as one of the markers for cell-mediated immunity. Pregnancy is associated with depressed cell-mediated immunity. The level of ADA expression, which seems to play a key role in maintaining pregnancy, is influenced by adenosine deaminase G22A gene polymorphism. We aimed in our study to evaluate the association of ADA G22A gene polymorphism with recurrent spontaneous abortion (RSA) in Egyptian women. Material and methods Adenosine deaminase G22A gene polymorphism was genotyped in 40 patients (age range 22-39 years) with a history of RSA, selected from those attending the Gynaecology and Obstetrics Clinic of Beni-Suef University Hospital, and 20 age-matched healthy women as a control group, using polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) analysis. Results In our study, no statistically significant difference was found between RSA patients and control group as regards ADA G22A genotypes (p = 0.653) and alleles (p = 0.697). A comparison of the frequencies of ADA alleles in RSA patients as regards the below-35-years-old age group revealed that ADA 2(A) allele was associated with a low risk for RSA in patients aged 35 years old or younger (p = 0.008). Conclusions In conclusion, our study revealed an age-dependent protective value of ADA 2(A) allele in recurrent spontaneous abortions among the Egyptian population. PMID:29204093

[Association between VDR gene polymorphisms and HOMA index for prediabetes in Ningxia].

PubMed

Liao, Sha; He, Jun; Li, Xiaoxia; Xu, Honexia; Liu, Xiuying; Zhao, Yi; Zhang, Yuhong

2016-03-01

To explore the association between the vitamin D receptor (VDR) gene polymorphisms and HOMA index in prediabetes. On the basis of a cross-sectional study which was conducted in Ningxia during 2008-2012, 339 controls and 468 subjects with prediabetes were selected according to ADA diabetes diagnosis standards. Anthropometric data and blood samples were collected in the field investigation. Blood biochemistry analyses and insulin determination were carried out in the laboratory. The whole blood DNA was extracted for genotyping. The BMI, WC, FPG and HOMA-IR of individuals with prediabetes were higher than those of the controls, while the HOMA-B and HOMA-S in cases were lower than those of the controls (P < 0.05). In BsmI, individuals with prediabetes carrying genotype BB/Bb showed lower HOMA-B than bb carrier, and they showed significantly higher HOMA-S than bb carriers (P < 0.05). After adjusting age, sex, BMI, TC, TG and SBP, low level HOMA-B index was the risk factor of prediabetes in individuals who carried genotype BB/Bb for BsmI and genotype FF/Ff/ff for FokI (OR > 1 , P < 0.05 ), and the genotype ff got the highest risk level (OR = 10.59). In FokI, the Ff carriers with low level HOMA-S and HOM-IR were also the risk factors of prediabetes (OR > 1, P < 0.05). The VDR gene polymorphisms appeared to be associated with HOMA index in prediabetes. The BsmI polymorphism seemed to influence HOMA-B, while the FokI polymorphism influence HOMA-B and HOMA-IR at different levels.

Effects of mannose-binding lectin polymorphisms on irinotecan-induced febrile neutropenia.

PubMed

van der Bol, Jessica M; de Jong, Floris A; van Schaik, Ron H; Sparreboom, Alex; van Fessem, Marianne A; van de Geijn, Fleur E; van Daele, Paul L; Verweij, Jaap; Sleijfer, Stefan; Mathijssen, Ron H

2010-01-01

Mannose-binding lectin (MBL) is important in the innate immune response. MBL2 gene polymorphisms affect MBL expression, and genotypes yielding low MBL levels have been associated with an elevated risk for infections in hematological cancer patients undergoing chemotherapy. However, these reported associations are inconsistent, and data on patients with solid tumors are lacking. Here, we investigated the effects of MBL2 genotypes on irinotecan-induced febrile neutropenia in patients with solid tumors. Irinotecan-treated patients were genotyped for the MBL2 gene. Two promoter (-550 H/L and -221 X/Y) and three exon polymorphisms (52 A/D, 54 A/B, and 57 A/C) were determined, together with known risk factors for irinotecan-induced toxicity. Neutropenia and febrile neutropenia were recorded during the first course. Of the 133 patients, 28% experienced severe neutropenia and 10% experienced febrile neutropenia. No associations were found between exon polymorphisms and febrile neutropenia. However, patients with the H/H promoter genotype, associated with high MBL levels, experienced significantly more febrile neutropenia than patients with the H/L and L/L genotypes (20% versus 13% versus 5%). Moreover, patients with the HYA haplotype encountered significantly more febrile neutropenia than patients without this high MBL-producing haplotype (16% versus 4%). In the subgroup with wild-type exon polymorphisms (A/A), patients with the high MBL promoter phenotype had the highest incidence of febrile neutropenia, regardless of known risk factors. Patients with high MBL2 promoter genotypes and haplotypes seem more at risk for developing febrile neutropenia. If confirmed, these preliminary findings may contribute to more individualized approaches of irinotecan treatment.

NEUTRALIZING THE DISINHERITED--SOME PSYCHOLOGICAL ASPECTS OF UNDERSTANDING THE POOR.

ERIC Educational Resources Information Center

RAINWATER, LEE

MEMBERS OF THE DOMINANT SOCIETY IN THE UNITED STATES, BOTH SOCIAL SCIENTISTS AND LAYMEN, PERCEIVE THE POOR IN WAYS WHICH ALLOW THEM TO RESOLVE THE ANXIETY THEY EXPERIENCE WHEN THEY RECOGNIZE THAT THE POOR LIVE A LIFE WHICH IS OSTENSIBLY UNLIVABLE. ONE MODE OF PERCEPTION, WHICH UNDERLIES SEEMINGLY SOPHISTICATED VIEWS, AND IS FOUND IN THE ATTITUDE…

Concentrations and apparent digestibility of lignin and carbohydrate fractions in cell walls of whole-crop cereal silages

USDA-ARS?s Scientific Manuscript database

Whole-crop cereal silage (WCCS) of oats generally has lower fiber digestibility than WCCS of barley. When investigated more closely, the difference seems mainly to be in the digestibility of the hemicellulosic fraction (HC), where HC is calculated as neutral detergent fibre (NDF) – acid detergent fi...

Shapes of cometary isophotes with Maxwellian distribution of initial velocities for neutral molecules

NASA Astrophysics Data System (ADS)

Žáček, P.; Wolf, M.

2017-10-01

This paper contains necessary modification of Bessel's equations for the axial cometary syndyne. This correction provides the accurate values of molecular acceleration in a cometary tail and precise values of decay constants for radiating molecules and their lifetimes. In consequence the hypothesis of the predissociation of molecules seems to be useless.

No Easy Choice: Value Dilemmas of Education Reform and Economic Rationalism in Hong Kong

ERIC Educational Resources Information Center

Tse, Thomas Kwan-Choi

2005-01-01

Like other public policies, education policies are laden with values and are often highly "ideologically charged." Given this close entanglement with value conflicts or dilemmas, it is no longer valid or feasible to pursue seemingly value-free or value-neutral analysis when studying policies. Since education policy is contested terrain,…

Funding Mechanisms, Cost Drivers, and the Distribution of Education Funds in Alberta: A Case Study.

ERIC Educational Resources Information Center

Neu, Dean; Taylor, Alison

2000-01-01

Critical analysis of historical financial data of the Calgary Board of Education (CBE) examined the impact of Alberta's 1994 funding changes on the CBE and the distribution of Alberta's education funding. Findings illustrate how funding mechanisms are used to govern from a distance and how seemingly neutral accounting/funding techniques function…

Rise of the Digitized Public Intellectual: Death of the Professor in the Network Neutral Internet Age

ERIC Educational Resources Information Center

Lange, Joshua

2015-01-01

The centralised discourse claiming ownership of "knowledge" and "higher education" seems to be declining as the decentralising discourse extolling open source software and informal social network communication are emerging: yet the two are complementary when higher education is seen as a commodity. Thus, in the internet age of…

Reward Retroactively Enhances Memory Consolidation for Related Items

ERIC Educational Resources Information Center

Patil, Anuya; Murty, Vishnu P.; Dunsmoor, Joseph E.; Phelps, Elizabeth A.; Davachi, Lila

2017-01-01

Reward motivation has been shown to modulate episodic memory processes in order to support future adaptive behavior. However, for a memory system to be truly adaptive, it should enhance memory for rewarded events as well as for neutral events that may seem inconsequential at the time of encoding but can gain importance later. Here, we investigated…

A Critical Discourse Analysis of Donald Trump's Sexist Ideology

ERIC Educational Resources Information Center

Darweesh, Abbas Degan; Abdullah, Nesaem Mehdi

2016-01-01

Language is not always seen as a neutral vehicle which represents reality. It is sometimes described as a tool which is drawn on to discriminate, insult, abuse, and belittle others. This is evident in the case of sexism which is seen as language that discriminates against women by representing them negatively or which seems to implicitly assume…

Acquired RhD mosaicism identifies fibrotic transformation of thrombopoietin receptor-mutated essential thrombocythemia.

PubMed

Montemayor-Garcia, Celina; Coward, Rebecca; Albitar, Maher; Udani, Rupa; Jain, Prachi; Koklanaris, Eleftheria; Battiwalla, Minoo; Keel, Siobán; Klein, Harvey G; Barrett, A John; Ito, Sawa

2017-09-01

Acquired copy-neutral loss of heterozygosity has been described in myeloid malignant progression with an otherwise normal karyotype. A 65-year-old woman with MPL-mutated essential thrombocythemia and progression to myelofibrosis was noted upon routine pretransplant testing to have mixed field reactivity with anti-D and an historic discrepancy in RhD type. The patient had never received transfusions or transplantation. Gel immunoagglutination revealed group A red blood cells and a mixed-field reaction for the D phenotype, with a predominant D-negative population and a small subset of circulating red blood cells carrying the D antigen. Subsequent genomic microarray single nucleotide polymorphism profiling revealed copy-neutral loss of heterozygosity of chromosome 1 p36.33-p34.2, a known molecular mechanism underlying fibrotic progression of MPL-mutated essential thrombocythemia. The chromosomal region affected by this copy-neutral loss of heterozygosity encompassed the RHD, RHCE, and MPL genes. We propose a model of chronological molecular events that is supported by RHD zygosity assays in peripheral lymphoid and myeloid-derived cells. Copy-neutral loss of heterozygosity events that lead to clonal selection and myeloid malignant progression may also affect the expression of adjacent unrelated genes, including those encoding for blood group antigens. Detection of mixed-field reactions and investigation of discrepant blood typing results are important for proper transfusion support of these patients and can provide useful surrogate markers of myeloproliferative disease progression. © 2017 AABB.

In vitro neutralization of HCV by goat antibodies against peptides encompassing regions downstream of HVR-1 of E2 glycoprotein.

PubMed

Tabll, Ashraf A; Atef, Khaled; Bader El Din, Noha G; El Abd, Yasmine S; Salem, Ahmed; Sayed, Ahmed A; Dawood, Reham M; Omran, Moataza H; El-Awady, Mostafa K

2014-01-01

This article aims at testing several in vitro systems with various viral sources and cell lines for propagation of HCV to evaluate goat antibodies raised against three E2 epitopes in viral neutralization experiments. Four human cell lines (Huh-7, Huh-7.5, HepG2, and CaCo2) were tested using two different HCV viral sources; Genotype 4 infected sera and J6/JFH HCV cc particles. Neutralization capacity of goat Abs against conserved E2 epitopes; p412 (a.a 412-419), p517 (a.a 517-531), and p430 (a.a 430-447) were examined in the above mentioned in vitro systems. Although infection with patients' sera seems to mimic the in vitro situation, it has limited replication rates as compared with HCV cc particularly in Huh7.5 cells. Non-HCV adapted Huh-7 cells were also found susceptible for transfection with J6/JFH virus but at much slower kinetics. The results of the neutralization assay showed that anti p412 and anti p517 were highly neutralizing to HCVcc. Our data demonstrate that antibodies directed against the viral surface glycoprotein E2 reduced the infectivity of the J6/JFH virus and are promising agents for immunotherapy and HCV vaccine development.

Physician-Assisted Suicide: Why Neutrality by Organized Medicine Is Neither Neutral Nor Appropriate.

PubMed

Sulmasy, Daniel P; Finlay, Ilora; Fitzgerald, Faith; Foley, Kathleen; Payne, Richard; Siegler, Mark

2018-05-02

It has been proposed that medical organizations adopt neutrality with respect to physician-assisted suicide (PAS), given that the practice is legal in some jurisdictions and that membership is divided. We review developments in end-of-life care and the role of medical organizations with respect to the legalization of PAS since the 1990s. We argue that moving from opposition to neutrality is not ethically neutral, but a substantive shift from prohibited to optional. We argue that medical organizations already oppose many practices that are legal in many jurisdictions, and that unanimity among membership has not been required for any other clinical or ethical policy positions. Moreover, on an issue so central to the meaning of medical professionalism, it seems important for organized medicine to take a stand. We subsequently review the arguments in favor of PAS (arguments from autonomy and mercy, and against the distinction between killing and allowing to die (K/ATD)) and the arguments against legalization (the limits of autonomy, effects on the patient-physician relationship, the meaning of healing, the validity of the K/ATD distinction, the social nature of suicide, the availability of alternatives, the propensity for incremental extension, and the meaning of control). We conclude that organized medicine should continue its opposition to PAS.

Poly(acrylic acid) to induce competitive crystallization of a theophylline/oxalic acid cocrystal and a theophylline polymorph

NASA Astrophysics Data System (ADS)

Jang, Jisun; Kim, Il Won

2016-01-01

Polymeric additives to induce competitive crystallization of pharmaceutical compounds were explored. A cocrystal of theophylline and oxalic acid was used as a model system, and poly(acrylic acid), poly(caprolactone), and poly(ethylene glycol) were the additives. The cocrystal formation was selectively hindered with addition of poly(acrylic acid). First the size of the cocrystals were reduced, and eventually the cocrystallization was inhibited to generate neat theophylline crystals. The theophylline crystals were of a distinctively different crystal structure from known polymorphs, based on powder X-ray diffraction. They were also obtained in nanoscale size, when millimeter-scale crystals formed without poly(acrylic acid). Polymeric additives that could form specific interactions with crystallizing compounds seem to be useful tools for the phase and size control of pharmaceutical crystals.

Genetic association of CCR5 promoter single nucleotide polymorphism in seronegative and seropositive rheumatoid arthritis.

PubMed

Lima, Guadalupe; Furuzawa-Carballeda, Janette; Ramos-Bello, Dolores; Jakez-Ocampo, Juan; Pascual-Ramos, Virginia; Núñez-Alvarez, Carlos A; Granados, Julio; Llorente, Luis

2012-06-01

The aim of this study was to investigate the possible role of the CCR5 59029 A→G promoter point mutation polymorphism in determining the susceptibility to rheumatoid factor-positive and rheumatoid factor-negative rheumatoid arthritis. This polymorphism was assessed in 85 seropositive and 39 seronegative rheumatoid arthritis patients and in 126 healthy individuals of the same geographic and ethnic origin. We found an increase in the genetic frequency of the A allele in the 59029 A→G promoter region of the CCR5 receptor in patients with rheumatoid arthritis compared with healthy controls (p = 0.01; OR = 1.5, 95% CI (1.0-2.2). Likewise, the homozygous state for the A allele was found to be more frequent in rheumatoid arthritis patients, again when compared with healthy controls (p = 0.03; OR = 1.8, 95% CI 1.0-3.0). The increased frequency of the A allele was more evident in the more benign, seronegative rheumatoid arthritis group when compared with controls (p = 0.003; OR 2.4 95% CI 1.3-4.4), and when combining the A homozygous and the AG heterozygous patients compared with healthy subjects. These results suggest that this CCR5 promoter polymorphism seems to play an important role in determining different clinical courses in both forms of rheumatoid arthritis.

The brain-derived neurotrophic factor (BDNF) gene Val66Met polymorphism affects memory performance in older adults.

PubMed

Azeredo, Lucas A de; De Nardi, Tatiana; Levandowski, Mateus L; Tractenberg, Saulo G; Kommers-Molina, Julia; Wieck, Andrea; Irigaray, Tatiana Q; Silva, Irênio G da; Grassi-Oliveira, Rodrigo

2017-01-01

Memory impairment is an important contributor to the reduction in quality of life experienced by older adults, and genetic risk factors seem to contribute to variance in age-related cognitive decline. Brain-derived neurotrophic factor (BDNF) is an important nerve growth factor linked with development and neural plasticity. The Val66Met polymorphism in the BDNF gene has been associated with impaired episodic memory in adults, but whether this functional variant plays a role in cognitive aging remains unclear. The purpose of this study was to investigate the effects of the BDNF Val66Met polymorphism on memory performance in a sample of elderly adults. Eighty-seven subjects aged > 55 years were recruited using a community-based convenience sampling strategy in Porto Alegre, Brazil. The logical memory subset of the Wechsler Memory Scale-Revised was used to assess immediate verbal recall (IVR), delayed verbal recall (DVR), and memory retention rate. BDNF Met allele carriers had lower DVR scores (p = 0.004) and a decline in memory retention (p = 0.017) when compared to Val/Val homozygotes. However, we found no significant differences in IVR between the two groups (p = 0.088). These results support the hypothesis of the BDNF Val66Met polymorphism as a risk factor associated with cognitive impairment, corroborating previous findings in young and older adults.

Adenylyl Cyclase 9 Polymorphisms Reveal Potential Link to HDL Function and Cardiovascular Events in Multiple Pathologies: Potential Implications in Sickle Cell Disease.

PubMed

Niesor, Eric J; Benghozi, Renée; Amouyel, Philippe; Ferdinand, Keith C; Schwartz, Gregory G

2015-12-01

Adenylyl cyclase 9 (ADCY9) mediates β2-adrenoceptor (β2-AR) signalling. Both proteins are associated with caveolae, specialized cholesterol-rich membrane substructures. Apolipoprotein A1 (ApoA1), the major protein component of high-density lipoprotein (HDL), removes cholesterol from cell membrane and caveolae and may thereby influence β2-AR signalling, shown in vitro to be modulated by cholesterol. Patients with Sickle Cell Disease (SCD) typically have low HDL and ApoA1 levels. In patients, mainly of African origin, with SCD, β2-AR activation may trigger adhesion of red blood cells to endothelial cells, leading to vascular occlusive events. Moreover, ADCY9 polymorphism is associated with risk of stroke in SCD. In recent clinical trials, ADCY9 polymorphism was found to be a discriminant factor associated with the risk of cardiovascular (CV) events in Caucasian patients treated with the HDL-raising compound dalcetrapib. We hypothesize that these seemingly disparate observations share a common mechanism related to interaction of HDL/ApoA1 and ADCY9 on β2-AR signalling. This review also raises the importance of characterizing polymorphisms that determine the response to HDL-raising and -mimicking agents in the non-Caucasian population at high risk of CV diseases and suffering from SCD. This may facilitate personalized CV treatments.

No association of defined variability in leptin, leptin receptor, adiponectin, proopiomelanocortin and ghrelin gene with food preferences in the Czech population.

PubMed

Bienertova-Vasku, Julie; Bienert, Petr; Tomandl, Josef; Forejt, Martin; Vavrina, Martin; Kudelkova, Jana; Vasku, Anna

2008-02-01

Previously, it has been reported that mutations in the genes encoding for adipokines may be associated with impaired food intake and may serve as potential obesity biomarkers. The aim of this study was to investigate the possible associations of defined variability in leptin, leptin receptor, adiponectin, proopiomelanocortin and ghrelin genes with food preferences in the obese and non-obese Czech population and evaluate their potential as the obesity susceptibility genes. Using PCR followed by restriction analysis, we studied 185 volunteers. Basic anthropometrical characteristics associated to obesity were measured and the food intake was monitored using a 7-day record method. In the group of obese individuals, a subset of 34 morbidly obese patients was studied for plasma leptin and soluble leptin receptor levels. None of the examined polymorphisms was associated to anthropometrical or demographic characteristics of the study subjects. The Gln223Arg polymorphism within the leptin receptor gene was significantly associated with lower plasma leptin levels (the RR genotype being more frequent in patients with lower plasma leptin levels; P = 0.001). No associations of the examined polymorphisms with food preferences was observed. Based on our results, the examined polymorphisms in the adipokine genes do not seem to be the major risk factor for obesity development in the Czech population nor significantly affect food preferences.

Genetic Aspects of Preeclampsia and the HELLP Syndrome

PubMed Central

Mortensen, Jan Helge; Nagy, Bálint

2014-01-01

Both preeclampsia and the HELLP syndrome have their origin in the placenta. The aim of this study is to review genetic factors involved in development of preeclampsia and the HELLP syndrome using literature search in PubMed. A familial cohort links chromosomes 2q, 5q, and 13q to preeclampsia. The chromosome 12q is coupled with the HELLP syndrome. The STOX1 gene, the ERAP1 and 2 genes, the syncytin envelope gene, and the −670 Fas receptor polymorphisms are involved in the development of preeclampsia. The ACVR2A gene on chromosome 2q22 is also implicated. The toll-like receptor-4 (TLR-4) and factor V Leiden mutation participate both in development of preeclampsia and the HELLP syndrome. Carriers of the TT and the CC genotype of the MTHFR C677T polymorphism seem to have an increased risk of the HELLP syndrome. The placental levels of VEGF mRNA are reduced both in women with preeclampsia and in women with the HELLP syndrome. The BclI polymorphism is engaged in development of the HELLP syndrome but not in development of severe preeclampsia. The ACE I/D polymorphism affects uteroplacental and umbilical artery blood flows in women with preeclampsia. In women with preeclampsia and the HELLP syndrome several genes in the placenta are deregulated. Preeclampsia and the HELLP syndrome are multiplex genetic diseases. PMID:24991435

Processing of unattended, simple negative pictures resists perceptual load.

PubMed

Sand, Anders; Wiens, Stefan

2011-05-11

As researchers debate whether emotional pictures can be processed irrespective of spatial attention and perceptual load, negative and neutral pictures of simple figure-ground composition were shown at fixation and were surrounded by one, two, or three letters. When participants performed a picture discrimination task, there was evidence for motivated attention; that is, an early posterior negativity (EPN) and late positive potential (LPP) to negative versus neutral pictures. When participants performed a letter discrimination task, the EPN was unaffected whereas the LPP was reduced. Although performance decreased substantially with the number of letters (one to three), the LPP did not decrease further. Therefore, attention to simple, negative pictures at fixation seems to resist manipulations of perceptual load.

Limited Evidence for Classic Selective Sweeps in African Populations

PubMed Central

Granka, Julie M.; Henn, Brenna M.; Gignoux, Christopher R.; Kidd, Jeffrey M.; Bustamante, Carlos D.; Feldman, Marcus W.

2012-01-01

While hundreds of loci have been identified as reflecting strong-positive selection in human populations, connections between candidate loci and specific selective pressures often remain obscure. This study investigates broader patterns of selection in African populations, which are underrepresented despite their potential to offer key insights into human adaptation. We scan for hard selective sweeps using several haplotype and allele-frequency statistics with a data set of nearly 500,000 genome-wide single-nucleotide polymorphisms in 12 highly diverged African populations that span a range of environments and subsistence strategies. We find that positive selection does not appear to be a strong determinant of allele-frequency differentiation among these African populations. Haplotype statistics do identify putatively selected regions that are shared across African populations. However, as assessed by extensive simulations, patterns of haplotype sharing between African populations follow neutral expectations and suggest that tails of the empirical distributions contain false-positive signals. After highlighting several genomic regions where positive selection can be inferred with higher confidence, we use a novel method to identify biological functions enriched among populations’ empirical tail genomic windows, such as immune response in agricultural groups. In general, however, it seems that current methods for selection scans are poorly suited to populations that, like the African populations in this study, are affected by ascertainment bias and have low levels of linkage disequilibrium, possibly old selective sweeps, and potentially reduced phasing accuracy. Additionally, population history can confound the interpretation of selection statistics, suggesting that greater care is needed in attributing broad genetic patterns to human adaptation. PMID:22960214

Multilocus Patterns of Nucleotide Diversity, Linkage Disequilibrium and Demographic History of Norway Spruce [Picea abies (L.) Karst

PubMed Central

Heuertz, Myriam; De Paoli, Emanuele; Källman, Thomas; Larsson, Hanna; Jurman, Irena; Morgante, Michele; Lascoux, Martin; Gyllenstrand, Niclas

2006-01-01

DNA polymorphism at 22 loci was studied in an average of 47 Norway spruce [Picea abies (L.) Karst.] haplotypes sampled in seven populations representative of the natural range. The overall nucleotide variation was limited, being lower than that observed in most plant species so far studied. Linkage disequilibrium was also restricted and did not extend beyond a few hundred base pairs. All populations, with the exception of the Romanian population, could be divided into two main domains, a Baltico–Nordic and an Alpine one. Mean Tajima's D and Fay and Wu's H across loci were both negative, indicating the presence of an excess of both rare and high-frequency-derived variants compared to the expected frequency spectrum in a standard neutral model. Multilocus neutrality tests based on D and H led to the rejection of the standard neutral model and exponential growth in the whole population as well as in the two main domains. On the other hand, in all three cases the data are compatible with a severe bottleneck occurring some hundreds of thousands of years ago. Hence, demographic departures from equilibrium expectations and population structure will have to be accounted for when detecting selection at candidate genes and in association mapping studies, respectively. PMID:17057229

Vaccine-elicited antibody that neutralizes H5N1 influenza and variants binds the receptor site and polymorphic sites

DOE PAGES

Winarski, Katie L.; Thornburg, Natalie J.; Yu, Yingchun; ...

2015-07-13

Antigenic drift of circulating seasonal influenza viruses necessitates an international vaccine effort to reduce the impact on human health. A critical feature of the seasonal vaccine is that it stimulates an already primed immune system to diversify memory B cells to recognize closely related, but antigenically distinct, influenza glycoproteins (hemagglutinins). Influenza pandemics arise when hemagglutinins to which no preexisting adaptive immunity exists acquire the capacity to infect humans. Hemagglutinin 5 is one subtype to which little preexisting immunity exists and is only a few acquired mutations away from the ability to transmit efficiently between ferrets, and possibly humans. In thismore » paper, we describe the structure and molecular mechanism of neutralization by H5.3, a vaccine-elicited antibody that neutralizes hemagglutinin 5 viruses and variants with expanded host range. H5.3 binds in the receptor-binding site, forming contacts that recapitulate many of the sialic acid interactions, as well as multiple peripheral interactions, yet is not sensitive to mutations that alter sialic acid binding. H5.3 is highly specific for a subset of H5 strains, and this specificity arises from interactions to the periphery of the receptor-binding site. Finally, H5.3 is also extremely potent, despite retaining germ line-like conformational flexibility.« less

Vaccine-elicited antibody that neutralizes H5N1 influenza and variants binds the receptor site and polymorphic sites

DOE Office of Scientific and Technical Information (OSTI.GOV)

Winarski, Katie L.; Thornburg, Natalie J.; Yu, Yingchun

Antigenic drift of circulating seasonal influenza viruses necessitates an international vaccine effort to reduce the impact on human health. A critical feature of the seasonal vaccine is that it stimulates an already primed immune system to diversify memory B cells to recognize closely related, but antigenically distinct, influenza glycoproteins (hemagglutinins). Influenza pandemics arise when hemagglutinins to which no preexisting adaptive immunity exists acquire the capacity to infect humans. Hemagglutinin 5 is one subtype to which little preexisting immunity exists and is only a few acquired mutations away from the ability to transmit efficiently between ferrets, and possibly humans. In thismore » paper, we describe the structure and molecular mechanism of neutralization by H5.3, a vaccine-elicited antibody that neutralizes hemagglutinin 5 viruses and variants with expanded host range. H5.3 binds in the receptor-binding site, forming contacts that recapitulate many of the sialic acid interactions, as well as multiple peripheral interactions, yet is not sensitive to mutations that alter sialic acid binding. H5.3 is highly specific for a subset of H5 strains, and this specificity arises from interactions to the periphery of the receptor-binding site. Finally, H5.3 is also extremely potent, despite retaining germ line-like conformational flexibility.« less

Functional Effects of Genetic Polymorphisms in the N-acetyltransferase 1 Coding and 3′ Untranslated Regions

PubMed Central

Zhu, Yuanqi; States, J. Christopher; Wang, Yang; Hein, David W.

2011-01-01

BACKGROUND The functional effects of N-acetyltransferase 1 (NAT1) polymorphisms and haplotypes are poorly understood, compromising the validity of associations reported with diseases including birth defects and numerous cancers. METHODS We investigated the effects of genetic polymorphisms within the NAT1 coding region and the 3′-untranslated region (3′-UTR) and their associated haplotypes on N- and O-acetyltransferase catalytic activities, and NAT1 mRNA and protein levels following recombinant expression in COS-1 cells. RESULTS 1088T>A (rs1057126; 3′-UTR) and 1095C>A (rs15561; 3′-UTR) each slightly reduced NAT1 catalytic activity and NAT1 mRNA and protein levels. A 9-base pair (TAATAATAA) deletion between nucleotides 1065-1090 (3′-UTR) reduced NAT1 catalytic activity and NAT1 mRNA and protein levels. In contrast, a 445G>A (rs4987076; V149I), 459G>A (rs4986990; T153T), 640T>G (rs4986783; S214A) coding region haplotype present in NAT1*11 increased NAT1 catalytic activity and NAT1 protein, but not NAT1 mRNA levels. A combination of the 9-base pair (TAATAATAA) deletion and the 445G>A, 459G>A, 640T>G coding region haplotypes, both present in NAT1*11, appeared to neutralize the opposing effects on NAT1 protein and catalytic activity, resulting in levels of NAT1 protein and catalytic activity that did not differ significantly from the NAT1*4 reference. CONCLUSIONS Since 1095C>A (3′-UTR) is the sole polymorphism present in NAT1*3, our data suggests that NAT1*3 is not functionally equivalent to the NAT1*4 reference. Furthermore, our findings provide biological support for reported associations of 1088T>A and 1095C>A polymorphisms with birth defects. PMID:21290563

Polymorphic Imprinting of SLC38A4 Gene in Bovine Placenta.

PubMed

Xu, Da; Zhang, Cui; Li, Junliang; Wang, Guannan; Chen, Weina; Li, Dongjie; Li, Shijie

2018-05-21

Imprinted genes are characterized by monoallelic expression that is dependent on parental origin. Comparative analysis of imprinted genes between species is a powerful tool for understanding the biological significance of genomic imprinting. The slc38a4 gene encodes a neutral amino acid transporter and is identified as imprinted in mice. In this study, the imprinting status of SLC38A4 was assessed in bovine adult tissues and placenta using a polymorphism-based approach. Results indicate that SLC38A4 is not imprinted in eight adult bovine tissues including heart, liver, spleen, lung, kidney, muscle, fat, and brain. It was interesting to note that SLC38A4 showed polymorphic status in five heterogeneous placentas, with three exhibiting paternal monoallelic expression and two exhibiting biallelic expression. Monoallelic expression of imprinted genes is generally associated with allele-specific differentially methylation regions (DMRs) of CpG islands (CGIs)-encompassed promoter; therefore, the DNA methylation statuses of three CGIs in the SLC38A4 promoter and exon 1 region were tested in three placentas (two exhibiting paternal monoallelic and one showing biallelic expression of SLC38A4) and their corresponding paternal sperms. Unexpectedly, extreme hypomethylation (< 3%) of the DNA was observed in all the three detected placentas and their corresponding paternal sperms. The absence of DMR in bovine SLC38A4 promoter region implied that DNA methylation of these three CGIs does not directly or indirectly affect the polymorphic imprinting of SLC38A4 in bovine placenta. This suggested other epigenetic features other than DNA methylation are needed in regulating the imprinting of bovine SLC38A4, which is different from that of mouse with respect to a DMR existence at the mouse's slc38a4 promoter region. Although further work is needed, this first characterization of polymorphic imprinting status of SLC38A4 in cattle placenta provides valuable information on investigating the genomic imprinting phenomenon itself.

Toll-like receptor variation in the bottlenecked population of the Seychelles warbler: computer simulations see the 'ghost of selection past' and quantify the 'drift debt'.

PubMed

Gilroy, D L; Phillips, K P; Richardson, D S; van Oosterhout, C

2017-07-01

Balancing selection can maintain immunogenetic variation within host populations, but detecting its signal in a postbottlenecked population is challenging due to the potentially overriding effects of drift. Toll-like receptor genes (TLRs) play a fundamental role in vertebrate immune defence and are predicted to be under balancing selection. We previously characterized variation at TLR loci in the Seychelles warbler (Acrocephalus sechellensis), an endemic passerine that has undergone a historical bottleneck. Five of seven TLR loci were polymorphic, which is in sharp contrast to the low genomewide variation observed. However, standard population genetic statistical methods failed to detect a contemporary signature of selection at any TLR locus. We examined whether the observed TLR polymorphism could be explained by neutral evolution, simulating the population's demography in the software DIYABC. This showed that the posterior distributions of mutation rates had to be unrealistically high to explain the observed genetic variation. We then conducted simulations with an agent-based model using typical values for the mutation rate, which indicated that weak balancing selection has acted on the three TLR genes. The model was able to detect evidence of past selection elevating TLR polymorphism in the prebottleneck populations, but was unable to discern any effects of balancing selection in the contemporary population. Our results show drift is the overriding evolutionary force that has shaped TLR variation in the contemporary Seychelles warbler population, and the observed TLR polymorphisms might be merely the 'ghost of selection past'. Forecast models predict immunogenetic variation in this species will continue to be eroded in the absence of contemporary balancing selection. Such 'drift debt' occurs when a gene pool has not yet reached its new equilibrium level of polymorphism, and this loss could be an important threat to many recently bottlenecked populations. © 2017 European Society For Evolutionary Biology. Journal of Evolutionary Biology © 2017 European Society For Evolutionary Biology.

The Influence of pH on Prokaryotic Cell Size and Temperature

NASA Astrophysics Data System (ADS)

Sundararajan, D.; Gutierrez, F.; Heim, N. A.; Payne, J.

2015-12-01

The pH of a habitat is essential to an organism's growth and success in its environment. Although most organisms maintain a neutral internal pH, their environmental pH can vary greatly. However, little research has been done concerning an organism's environmental pH across a wide range of taxa. We studied pH tolerance in prokaryotes and its relationship with biovolume, taxonomic classification, and ideal temperature. We had three hypotheses: pH and temperature are not correlated; pH tolerance is similar within taxonomic groups; and extremophiles have small cell sizes. To test these hypotheses, we used pH, size, and taxonomic data from The Prokaryotes. We found that the mean optimum external pH was neutral for prokaryotes as a whole and when divided by domain, phylum, and class. Using ANOVA to test for pH within and among group variances, we found that variation of pH in domains, phyla, classes, and families was greater than between them. pH and size did not show much of a correlation, except that the largest and smallest sized prokaryotes had nearly neutral pH. This seems significant because extremophiles need to divert more of their energy from growth to maintain a neutral internal pH. Acidophiles showed a larger range of optimum pH values than alkaliphiles. A similar result was seen with the minimum and maximum pH values of acidophiles and alkaliphiles. While acidophiles were spread out and had some alkaline maximum values, alkaliphiles had smaller ranges, and unlike some acidophiles that had pH minimums close to zero, alkaliphile pH maximums did not go beyond a pH of 12. No statistically significant differences were found between sizes of acidophiles and alkaliphiles. However, optimum temperatures of acidophiles and alkaliphiles did have a statistically significant difference. pH and temperature had a negative correlation. Therefore, pH seems to have a correlation with cell size, temperature, and taxonomy to some extent.

Effects of organic and inorganic compounds of diesel exhaust particles on the mucociliary epithelium: An experimental study on the frog palate preparation.

PubMed

Trindade, Sergio Henrique Kiemle; Seriani, Robson; Lorenzi-Filho, Geraldo; de Mello Júnior, João Ferreira; Sennes, Luiz Ubirajara; Saldiva, Paulo Hilário Nascimento; Macchione, Mariângela

2018-02-01

The toxic actions of acute exposition to different diesel exhaust particles (DEPA) fractions on the mucociliary epithelium are not yet fully understood due to different concentrations of organic and inorganic elements. These chemicals elements produce damage to the respiratory epithelium and exacerbate pre-existent diseases. In our study we showed these differences in two experimental studies. Study I (dose-response curve - DRCS): Forty frog-palates were exposed to the following dilutions: frog ringer, intact DEPA diluted in frog-ringer at 3mg/L, 6mg/L and 12mg/L. Study II (DEPF) (DEPA fractions diluted at 12mg/L): Fifty palates - Frog ringer, intact DEPA, DEPA treated with hexane, nitric acid and methanol. Variables analyzed: relative time of mucociliary transport (MCT), ciliary beating frequency (CBF) and morphometric analysis for mucin profile (neutral/acid) and vacuolization. The Results of DRCS: Group DEPA-12mg/L presented a significant increase in the MCT (p<0.05), proportional volume of acid mucus (p<0.05) and decreased proportional volume of neutral mucus and vacuoles (p<0.05). In relation of DEPF: A significant increase in the MCT associated to a decrease in the proportional volume of neutral mucus was founded in nitric acid group. In addition, a significant increase in the proportional volume of acid mucus was found in methanol group. We concluded that: 1) Increasing concentrations of intact DEPA can progressively increase MCT and promote an acidification of intra-epithelial mucins associated to a depletion of neutral mucus. 2) Intact DEPA seem to act as secretagogue substance, promoting mucus extrusion and consequently reducing epithelial thickness. 3) Organic fraction of low polarity seems to play a pivotal role on the acute toxicity to the mucociliary epithelium, by promoting a significant increase in the MCT associated to changes in the chemical profile of the intracellular mucins. Copyright © 2017 Elsevier Inc. All rights reserved.

Polymorphisms at the innate immune receptor TLR2 are associated with Borrelia infection in a wild rodent population

PubMed Central

Tschirren, Barbara; Andersson, Martin; Scherman, Kristin; Westerdahl, Helena; Mittl, Peer R. E.; Råberg, Lars

2013-01-01

The discovery of the key role of Toll-like receptors (TLRs) in initiating innate immune responses and modulating adaptive immunity has revolutionized our understanding of vertebrate defence against pathogens. Yet, despite their central role in pathogen recognition and defence initiation, there is little information on how variation in TLRs influences disease susceptibility in natural populations. Here, we assessed the extent of naturally occurring polymorphisms at TLR2 in wild bank voles (Myodes glareolus) and tested for associations between TLR2 variants and infection with Borrelia afzelii, a common tick-transmitted pathogen in rodents and one of the causative agents of human Lyme disease. Bank voles in our population had 15 different TLR2 haplotypes (10 different haplotypes at the amino acid level), which grouped in three well-separated clusters. In a large-scale capture–mark–recapture study, we show that voles carrying TLR2 haplotypes of one particular cluster (TLR2c2) were almost three times less likely to be Borrelia infected than animals carrying other haplotypes. Moreover, neutrality tests suggested that TLR2 has been under positive selection. This is, to our knowledge, the first demonstration of an association between TLR polymorphism and parasitism in wildlife, and a striking example that genetic variation at innate immune receptors can have a large impact on host resistance. PMID:23554395

Polymorphisms at the innate immune receptor TLR2 are associated with Borrelia infection in a wild rodent population.

PubMed

Tschirren, Barbara; Andersson, Martin; Scherman, Kristin; Westerdahl, Helena; Mittl, Peer R E; Råberg, Lars

2013-05-22

The discovery of the key role of Toll-like receptors (TLRs) in initiating innate immune responses and modulating adaptive immunity has revolutionized our understanding of vertebrate defence against pathogens. Yet, despite their central role in pathogen recognition and defence initiation, there is little information on how variation in TLRs influences disease susceptibility in natural populations. Here, we assessed the extent of naturally occurring polymorphisms at TLR2 in wild bank voles (Myodes glareolus) and tested for associations between TLR2 variants and infection with Borrelia afzelii, a common tick-transmitted pathogen in rodents and one of the causative agents of human Lyme disease. Bank voles in our population had 15 different TLR2 haplotypes (10 different haplotypes at the amino acid level), which grouped in three well-separated clusters. In a large-scale capture-mark-recapture study, we show that voles carrying TLR2 haplotypes of one particular cluster (TLR2c2) were almost three times less likely to be Borrelia infected than animals carrying other haplotypes. Moreover, neutrality tests suggested that TLR2 has been under positive selection. This is, to our knowledge, the first demonstration of an association between TLR polymorphism and parasitism in wildlife, and a striking example that genetic variation at innate immune receptors can have a large impact on host resistance.

Single Nucleotide Polymorphism Array Analysis of Bone Marrow Failure Patients Reveals Characteristic Patterns of Genetic Changes

PubMed Central

Babushok, Daria V.; Xie, Hongbo M.; Roth, Jacquelyn J.; Perdigones, Nieves; Olson, Timothy S.; Cockroft, Joshua D.; Gai, Xiaowu; Perin, Juan C.; Li, Yimei; Paessler, Michele E.; Hakonarson, Hakon; Podsakoff, Gregory M.; Mason, Philip J.; Biegel, Jaclyn A.; Bessler, Monica

2013-01-01

Summary The bone marrow failure syndromes (BMFS) are a heterogeneous group of rare blood disorders characterized by inadequate haematopoiesis, clonal evolution, and increased risk of leukaemia. Single nucleotide polymorphism arrays (SNP-A) have been proposed as a tool for surveillance of clonal evolution in BMFS. To better understand the natural history of BMFS and to assess the clinical utility of SNP-A in these disorders, we analysed 124 SNP-A from a comprehensively characterized cohort of 91 patients at our BMFS centre. SNP-A were correlated with medical histories, haematopathology, cytogenetic and molecular data. To assess clonal evolution, longitudinal analysis of SNP-A was performed in 25 patients. We found that acquired copy number-neutral loss of heterozygosity (CN-LOH) was significantly more frequent in acquired aplastic anaemia (aAA) than in other BMFS (odds ratio 12.2, p<0.01). Homozygosity by descent was most common in congenital BMFS, frequently unmasking autosomal recessive mutations. Copy number variants (CNVs) were frequently polymorphic, and we identified CNVs enriched in neutropenia and aAA. Our results suggest that acquired CN-LOH is a general phenomenon in aAA that is probably mechanistically and prognostically distinct from typical CN-LOH of myeloid malignancies. Our analysis of clinical utility of SNP-A shows the highest yield of detecting new clonal haematopoiesis at diagnosis and at relapse. PMID:24116929

Single nucleotide polymorphism array analysis of bone marrow failure patients reveals characteristic patterns of genetic changes.

PubMed

Babushok, Daria V; Xie, Hongbo M; Roth, Jacquelyn J; Perdigones, Nieves; Olson, Timothy S; Cockroft, Joshua D; Gai, Xiaowu; Perin, Juan C; Li, Yimei; Paessler, Michele E; Hakonarson, Hakon; Podsakoff, Gregory M; Mason, Philip J; Biegel, Jaclyn A; Bessler, Monica

2014-01-01

The bone marrow failure syndromes (BMFS) are a heterogeneous group of rare blood disorders characterized by inadequate haematopoiesis, clonal evolution, and increased risk of leukaemia. Single nucleotide polymorphism arrays (SNP-A) have been proposed as a tool for surveillance of clonal evolution in BMFS. To better understand the natural history of BMFS and to assess the clinical utility of SNP-A in these disorders, we analysed 124 SNP-A from a comprehensively characterized cohort of 91 patients at our BMFS centre. SNP-A were correlated with medical histories, haematopathology, cytogenetic and molecular data. To assess clonal evolution, longitudinal analysis of SNP-A was performed in 25 patients. We found that acquired copy number-neutral loss of heterozygosity (CN-LOH) was significantly more frequent in acquired aplastic anaemia (aAA) than in other BMFS (odds ratio 12·2, P < 0·01). Homozygosity by descent was most common in congenital BMFS, frequently unmasking autosomal recessive mutations. Copy number variants (CNVs) were frequently polymorphic, and we identified CNVs enriched in neutropenia and aAA. Our results suggest that acquired CN-LOH is a general phenomenon in aAA that is probably mechanistically and prognostically distinct from typical CN-LOH of myeloid malignancies. Our analysis of clinical utility of SNP-A shows the highest yield of detecting new clonal haematopoiesis at diagnosis and at relapse. © 2013 John Wiley & Sons Ltd.

Immediacy Bias in Emotion Perception: Current Emotions Seem More Intense than Previous Emotions

ERIC Educational Resources Information Center

Van Boven, Leaf; White, Katherine; Huber, Michaela

2009-01-01

People tend to perceive immediate emotions as more intense than previous emotions. This "immediacy bias" in emotion perception occurred for exposure to emotional but not neutral stimuli (Study 1), when emotional stimuli were separated by both shorter (2 s; Studies 1 and 2) and longer (20 min; Studies 3, 4, and 5) delays, and for emotional…

English Language Learning in Mexico: A Case Study of Implementing Problem Based Learning into a Technology Enhanced Writing Curriculum

ERIC Educational Resources Information Center

Graham, Leah Sharice

2006-01-01

English for Academic Purposes literature is often criticized for its very functional interpretation of language (e.g. Benesch, 2001) which ignores the intellectual, cultural, and social side of learning in an attempt to appear "neutral." Furthermore, writing is the EAP skill area which seems to provide students with the most difficulty.…

Data from complete mtDNA sequencing of Tunisian centenarians: testing haplogroup association and the "golden mean" to longevity.

PubMed

Costa, Marta D; Cherni, Lotfi; Fernandes, Verónica; Freitas, Fernando; Ammar El Gaaied, Amel Ben; Pereira, Luísa

2009-04-01

Since the mitochondrial theory of ageing was proposed, mitochondrial DNA (mtDNA) diversity has been largely studied in old people, however complete genomes are still rare, being limited to Japanese and UK/US samples. In this work, we evaluated possible longevity associated polymorphisms/haplogroups in an African population, from Tunisia, by performing complete mtDNA sequencing. This population has a mixed Eurasian/sub-Saharan mtDNA gene pool, which could potentially facilitate the evaluation of association for sub-Saharan lineages. Sub-Saharan haplogroups were shown to be significantly less represented in centenarians (9.5%) than in controls (54.5%), but it is not possible to rule out an influence of population structure, which is high in these populations. No recurrent polymorphism were more frequent in centenarians than in controls, and although the Tunisian centenarians presented less synonymous and replacement polymorphisms than controls, this difference was not statistically significant. So far, it does not seem that centenarians have significantly less mildly deleterious substitutions, not only in Tunisia but also in Japanese and UK/US samples, as tested here, not favouring a "golden mean" to longevity.

Genetic characterization of the dihydrofolate reductase gene of Pneumocystis jirovecii isolates from Portugal.

PubMed

Costa, Marina C; Esteves, Francisco; Antunes, Francisco; Matos, Olga

2006-12-01

The aim of the present study was to evaluate the genetic variation of Pneumocystis jirovecii dihydrofolate reductase (DHFR) gene in an immunocompromised Portuguese population and to investigate the possible association between DHFR genotypes and P. jirovecii pneumonia (PcP) prophylaxis with co-trimoxazole. One hundred and thirty-eight P. jirovecii isolates were submitted to DHFR genetic characterization by PCR and sequencing. In the studied population, 72.7% of the patients presented sequences identical to the wild-type sequence of the P. jirovecii DHFR gene and 27.3% presented point substitutions. A total of nine substitution sites were identified; four synonymous substitutions at nucleotide positions 201, 272, 312 and 381 were detected in 31 patients. Five non-synonymous substitutions were observed, leading to the DHFR mutations Leu-13-->Ser, Asn-23-->Ser, Ser-31-->Phe, Met-52-->Leu and Ala-67-->Val. With the exception of the polymorphism at position 312 and the mutation at codon 52, all polymorphisms were reported in this study for the first time. Our results suggest that DHFR gene polymorphisms are frequent in the Portuguese immunocompromised population but do not seem to be associated with PcP prophylaxis failure (P = 0.748 and P = 0.730).

SNPs in DNA repair or oxidative stress genes and late subcutaneous fibrosis in patients following single shot partial breast irradiation

PubMed Central

2012-01-01

Background The aim of this study was to evaluate the potential association between single nucleotide polymorphisms related response to radiotherapy injury, such as genes related to DNA repair or enzymes involved in anti-oxidative activities. The paper aims to identify marker genes able to predict an increased risk of late toxicity studying our group of patients who underwent a Single Shot 3D-CRT PBI (SSPBI) after BCS (breast conserving surgery). Methods A total of 57 breast cancer patients who underwent SSPBI were genotyped for SNPs (single nucleotide polymorphisms) in XRCC1, XRCC3, GST and RAD51 by Pyrosequencing technology. Univariate analysis (ORs and 95% CI) was performed to correlate SNPs with the risk of developing ≥ G2 fibrosis or fat necrosis. Results A higher significant risk of developing ≥ G2 fibrosis or fat necrosis in patients with: polymorphic variant GSTP1 (Ile105Val) (OR = 2.9; 95%CI, 0.88-10.14, p = 0.047). Conclusions The presence of some SNPs involved in DNA repair or response to oxidative stress seem to be able to predict late toxicity. Trial Registration ClinicalTrials.gov: NCT01316328 PMID:22272830

TPH2 polymorphisms and alcohol-related suicide.

PubMed

Zupanc, Tomaž; Pregelj, Peter; Tomori, Martina; Komel, Radovan; Paska, Alja Videtič

2011-02-18

Substantial evidence from family, twin, and adoption studies corroborates implication of genetic and environmental factors, as well as their interactions, on suicidal behavior and alcoholism risk. Serotonergic disfunction seems to be involved in the pathophysiology of substance abuse, and has also an important role in suicidal behavior. Recent studies of the tryptophan hydroxylase 2 showed mild or no association with suicide and alcohol-related suicide. We performed SNP and alcohol analysis on 388 suicide victims and 227 controls. The results showed association between suicide (Pχ²=0.043) and alcohol-related suicide (Pχ²=0.021) for SNP Rs1843809. A tendency for association was determined also for polymorphism Rs1386493 (Pχ²=0.055) and alcohol-related suicide. Data acquired from psychological autopsies in a subsample of suicide victims (n=79) determined more impulsive behavior (Pχ²=0.016) and verbal aggressive behavior (Pχ²=0.025) in the subgroup with alcohol misuse or dependency. In conclusion, our results suggest implication of polymorphisms in suicide and alcohol-related suicide, but further studies are needed to clarify the interplay among serotonergic system disfunction, suicide, alcohol dependence, impulsivity and the role of TPH2 enzyme. © 2010 Elsevier Ireland Ltd. All rights reserved.

Comparative study of crystallization process in metallic melts using ab initio molecular dynamics simulations

NASA Astrophysics Data System (ADS)

Debela, Tekalign T.; Wang, X. D.; Cao, Q. P.; Zhang, D. X.; Jiang, J. Z.

2017-05-01

The crystallization process of liquid metals is studied using ab initio molecular dynamics simulations. The evolution of short-range order during quenching in Pb and Zn liquids is compared with body-centered cubic (bcc) Nb and V, and hexagonal closed-packed (hcp) Mg. We found that the fraction and type of the short-range order depends on the system under consideration, in which the icosahedral symmetry seems to dominate in the body-centered cubic metals. Although the local atomic structures in stable liquids are similar, liquid hcp-like Zn, bcc-like Nb and V can be deeply supercooled far below its melting point before crystallization while the supercooled temperature range in liquid Pb is limited. Further investigations into the nucleation process reveal the process of polymorph selection. In the body-centered cubic systems, the polymorph selection occurs in the supercooled state before the nucleation is initiated, while in the closed-packed systems it starts at the time of onset of crystallization. Atoms with bcc-like lattices in all studied supercooled liquids are always detected before the polymorph selection. It is also found that the bond orientational ordering is strongly correlated with the crystallization process in supercooled Zn and Pb liquids.

Complement Component C3 Variant (R102G) and the Risk of Neovascular Age-Related Macular Degeneration in a Tunisian Population.

PubMed

Habibi, Imen; Sfar, Imen; Kort, Fedra; Bouraoui, Rim; Chebil, Ahmed; Limaiem, Rim; Ayed, Saloua; Ben Abdallah, Taïeb; El Matri, Leila; Gorgi, Yousr

2017-04-01

Purpose To explore the association between the polymorphism (S/F) p.R102G in the complement component 3 ( C3 ) gene and age-related macular degeneration (AMD) in a Tunisian population. Methods The molecular study was performed by polymerase chain reaction using sequence-specific primers (PCR-SSP) in 207 control subjects free of any eye disease (fundus normal) and 145 patients with exudative AMD. The CH50 activity and quantification of C3 and C4 have been made by technical home method and nephelometry, respectively. Results The prevalence of C3 GG genotype polymorphism was significantly higher in AMD patients compared to controls (OR: 2.41, IC 95% [1.90-3.05], p = 0.0007). However, no correlation was found between this allelic variant and the type of neovascularization. Similarly, there is no association between this polymorphism and the presence of functional and/or quantitative hypocomplementemia. Conclusions The C3 GG genotype of the gene could be a susceptibility factor for AMD in the Tunisian population. However, it does not seem to influence the clinical profile of the disease. Georg Thieme Verlag KG Stuttgart · New York.

Role of Caspase-9 Gene Ex5+32 G>A (rs1052576) Variant in Susceptibility to Primary Brain Tumors.

PubMed

Ozdogan, Selcuk; Kafadar, Ali; Yilmaz, Seda Gulec; Timirci-Kahraman, Ozlem; Gormus, Uzay; Isbir, Turgay

2017-09-01

This study is the first to evaluate the relationship of caspase-9 (CASP-9) gene polymorphism with the risk for primary brain tumor development. The study group included 43 glioma and 27 meningioma patients and 76 healthy individuals. CASP-9 gene Ex5+32 G>A (rs1052576) polymorphism was analyzed by real-time polymerase chain reaction (RT-PCR). Individuals with the CASP-9 GG genotype had significantly decreased risk of developing a glioma brain tumor (p=0.024). Additionally, the GA genotype was significantly lower in patients with glioma than the control group (p=0.019). A significantly decreased risk of developing glioma was found in the A allele carrier group (p=0.024). However, there was no statistically significant relationship between CASP-9 polymorphism and brain meningioma (p=0.493). CASP-9 (rs1052576) mutant A allele seems to be a protective factor for glioma brain tumor. Future studies with a larger sample size will clarify the possible roles of CASP-9 gene in the etiology and progression of primary brain tumors. Copyright© 2017, International Institute of Anticancer Research (Dr. George J. Delinasios), All rights reserved.

Thrombin activatable fibrinolysis inhibitor and clot lysis time in pregnant patients with antiphospholipid syndrome: relationship with pregnancy outcome and thrombosis.

PubMed

Martinez-Zamora, Maria Angeles; Tassies, Dolors; Carmona, Francisco; Espinosa, Gerard; Cervera, Ricard; Reverter, Juan Carlos; Balasch, Juan

2009-12-01

Antiphospholipid syndrome (APS) pregnancies are associated with thrombotic obstetric complications, despite treatment. This study evaluated Thrombin Activatable Fibrinolysis Inhibitor (TAFI) levels, TAFI gene polymorphisms and Clot Lysis Time (CLT) in pregnant patients with APS in relation to pregnancy outcome and thrombosis. Group 1 consisted of 67 pregnant patients with APS. Group 2 included 66 pregnant patients with uneventful term pregnancies and delivery. Patients were sampled during each trimester and at baseline. TAFI antigen and CLT and two polymorphisms of the TAFI gene, Ala147Thr and +1542C/G, were determined. Significantly prolonged CLT was found at baseline in Group 1. Allele distribution of the TAFI gene polymorphisms was similar in both groups. Basal TAFI and CLT in patients with APS having an adverse or a good obstetrical outcome were similar. Comparison of TAFI and CLT baseline levels in patients with APS with or without previous thrombosis showed no statistical differences. Patients with APS have impairment in fibrinolysis evidenced by prolonged CLT at baseline. TAFI and CLT do not seem to be useful as markers of obstetric outcome or risk of thrombosis in patients with APS.

Orangutan Alu quiescence reveals possible source element: support for ancient backseat drivers

PubMed Central

2012-01-01

Background Sequence analysis of the orangutan genome revealed that recent proliferative activity of Alu elements has been uncharacteristically quiescent in the Pongo (orangutan) lineage, compared with all previously studied primate genomes. With relatively few young polymorphic insertions, the genomic landscape of the orangutan seemed like the ideal place to search for a driver, or source element, of Alu retrotransposition. Results Here we report the identification of a nearly pristine insertion possessing all the known putative hallmarks of a retrotranspositionally competent Alu element. It is located in an intronic sequence of the DGKB gene on chromosome 7 and is highly conserved in Hominidae (the great apes), but absent from Hylobatidae (gibbon and siamang). We provide evidence for the evolution of a lineage-specific subfamily of this shared Alu insertion in orangutans and possibly the lineage leading to humans. In the orangutan genome, this insertion contains three orangutan-specific diagnostic mutations which are characteristic of the youngest polymorphic Alu subfamily, AluYe5b5_Pongo. In the Homininae lineage (human, chimpanzee and gorilla), this insertion has acquired three different mutations which are also found in a single human-specific Alu insertion. Conclusions This seemingly stealth-like amplification, ongoing at a very low rate over millions of years of evolution, suggests that this shared insertion may represent an ancient backseat driver of Alu element expansion. PMID:22541534

Orangutan Alu quiescence reveals possible source element: support for ancient backseat drivers.

PubMed

Walker, Jerilyn A; Konkel, Miriam K; Ullmer, Brygg; Monceaux, Christopher P; Ryder, Oliver A; Hubley, Robert; Smit, Arian Fa; Batzer, Mark A

2012-04-30

Sequence analysis of the orangutan genome revealed that recent proliferative activity of Alu elements has been uncharacteristically quiescent in the Pongo (orangutan) lineage, compared with all previously studied primate genomes. With relatively few young polymorphic insertions, the genomic landscape of the orangutan seemed like the ideal place to search for a driver, or source element, of Alu retrotransposition. Here we report the identification of a nearly pristine insertion possessing all the known putative hallmarks of a retrotranspositionally competent Alu element. It is located in an intronic sequence of the DGKB gene on chromosome 7 and is highly conserved in Hominidae (the great apes), but absent from Hylobatidae (gibbon and siamang). We provide evidence for the evolution of a lineage-specific subfamily of this shared Alu insertion in orangutans and possibly the lineage leading to humans. In the orangutan genome, this insertion contains three orangutan-specific diagnostic mutations which are characteristic of the youngest polymorphic Alu subfamily, AluYe5b5_Pongo. In the Homininae lineage (human, chimpanzee and gorilla), this insertion has acquired three different mutations which are also found in a single human-specific Alu insertion. This seemingly stealth-like amplification, ongoing at a very low rate over millions of years of evolution, suggests that this shared insertion may represent an ancient backseat driver of Alu element expansion.

Potential Links between Impaired One-Carbon Metabolism Due to Polymorphisms, Inadequate B-Vitamin Status, and the Development of Alzheimer’s Disease

PubMed Central

Troesch, Barbara; Weber, Peter; Mohajeri, M. Hasan

2016-01-01

Alzheimer’s disease (AD) is the major cause of dementia and no preventive or effective treatment has been established to date. The etiology of AD is poorly understood, but genetic and environmental factors seem to play a role in its onset and progression. In particular, factors affecting the one-carbon metabolism (OCM) are thought to be important and elevated homocysteine (Hcy) levels, indicating impaired OCM, have been associated with AD. We aimed at evaluating the role of polymorphisms of key OCM enzymes in the etiology of AD, particularly when intakes of relevant B-vitamins are inadequate. Our review indicates that a range of compensatory mechanisms exist to maintain a metabolic balance. However, these become overwhelmed if the activity of more than one enzyme is reduced due to genetic factors or insufficient folate, riboflavin, vitamin B6 and/or vitamin B12 levels. Consequences include increased Hcy levels and reduced capacity to synthetize, methylate and repair DNA, and/or modulated neurotransmission. This seems to favor the development of hallmarks of AD particularly when combined with increased oxidative stress e.g., in apolipoprotein E (ApoE) ε4 carriers. However, as these effects can be compensated at least partially by adequate intakes of B-vitamins, achieving optimal B-vitamin status for the general population should be a public health priority. PMID:27973419

Development of a single nucleotide polymorphism barcode to genotype Plasmodium vivax infections.

PubMed

Baniecki, Mary Lynn; Faust, Aubrey L; Schaffner, Stephen F; Park, Daniel J; Galinsky, Kevin; Daniels, Rachel F; Hamilton, Elizabeth; Ferreira, Marcelo U; Karunaweera, Nadira D; Serre, David; Zimmerman, Peter A; Sá, Juliana M; Wellems, Thomas E; Musset, Lise; Legrand, Eric; Melnikov, Alexandre; Neafsey, Daniel E; Volkman, Sarah K; Wirth, Dyann F; Sabeti, Pardis C

2015-03-01

Plasmodium vivax, one of the five species of Plasmodium parasites that cause human malaria, is responsible for 25-40% of malaria cases worldwide. Malaria global elimination efforts will benefit from accurate and effective genotyping tools that will provide insight into the population genetics and diversity of this parasite. The recent sequencing of P. vivax isolates from South America, Africa, and Asia presents a new opportunity by uncovering thousands of novel single nucleotide polymorphisms (SNPs). Genotyping a selection of these SNPs provides a robust, low-cost method of identifying parasite infections through their unique genetic signature or barcode. Based on our experience in generating a SNP barcode for P. falciparum using High Resolution Melting (HRM), we have developed a similar tool for P. vivax. We selected globally polymorphic SNPs from available P. vivax genome sequence data that were located in putatively selectively neutral sites (i.e., intergenic, intronic, or 4-fold degenerate coding). From these candidate SNPs we defined a barcode consisting of 42 SNPs. We analyzed the performance of the 42-SNP barcode on 87 P. vivax clinical samples from parasite populations in South America (Brazil, French Guiana), Africa (Ethiopia) and Asia (Sri Lanka). We found that the P. vivax barcode is robust, as it requires only a small quantity of DNA (limit of detection 0.3 ng/μl) to yield reproducible genotype calls, and detects polymorphic genotypes with high sensitivity. The markers are informative across all clinical samples evaluated (average minor allele frequency > 0.1). Population genetic and statistical analyses show the barcode captures high degrees of population diversity and differentiates geographically distinct populations. Our 42-SNP barcode provides a robust, informative, and standardized genetic marker set that accurately identifies a genomic signature for P. vivax infections.

Development of a Single Nucleotide Polymorphism Barcode to Genotype Plasmodium vivax Infections

PubMed Central

Baniecki, Mary Lynn; Faust, Aubrey L.; Schaffner, Stephen F.; Park, Daniel J.; Galinsky, Kevin; Daniels, Rachel F.; Hamilton, Elizabeth; Ferreira, Marcelo U.; Karunaweera, Nadira D.; Serre, David; Zimmerman, Peter A.; Sá, Juliana M.; Wellems, Thomas E.; Musset, Lise; Legrand, Eric; Melnikov, Alexandre; Neafsey, Daniel E.; Volkman, Sarah K.; Wirth, Dyann F.; Sabeti, Pardis C.

2015-01-01

Plasmodium vivax, one of the five species of Plasmodium parasites that cause human malaria, is responsible for 25–40% of malaria cases worldwide. Malaria global elimination efforts will benefit from accurate and effective genotyping tools that will provide insight into the population genetics and diversity of this parasite. The recent sequencing of P. vivax isolates from South America, Africa, and Asia presents a new opportunity by uncovering thousands of novel single nucleotide polymorphisms (SNPs). Genotyping a selection of these SNPs provides a robust, low-cost method of identifying parasite infections through their unique genetic signature or barcode. Based on our experience in generating a SNP barcode for P. falciparum using High Resolution Melting (HRM), we have developed a similar tool for P. vivax. We selected globally polymorphic SNPs from available P. vivax genome sequence data that were located in putatively selectively neutral sites (i.e., intergenic, intronic, or 4-fold degenerate coding). From these candidate SNPs we defined a barcode consisting of 42 SNPs. We analyzed the performance of the 42-SNP barcode on 87 P. vivax clinical samples from parasite populations in South America (Brazil, French Guiana), Africa (Ethiopia) and Asia (Sri Lanka). We found that the P. vivax barcode is robust, as it requires only a small quantity of DNA (limit of detection 0.3 ng/μl) to yield reproducible genotype calls, and detects polymorphic genotypes with high sensitivity. The markers are informative across all clinical samples evaluated (average minor allele frequency > 0.1). Population genetic and statistical analyses show the barcode captures high degrees of population diversity and differentiates geographically distinct populations. Our 42-SNP barcode provides a robust, informative, and standardized genetic marker set that accurately identifies a genomic signature for P. vivax infections. PMID:25781890

Using classical population genetics tools with heterochroneous data: time matters!

PubMed

Depaulis, Frantz; Orlando, Ludovic; Hänni, Catherine

2009-01-01

New polymorphism datasets from heterochroneous data have arisen thanks to recent advances in experimental and microbial molecular evolution, and the sequencing of ancient DNA (aDNA). However, classical tools for population genetics analyses do not take into account heterochrony between subsets, despite potential bias on neutrality and population structure tests. Here, we characterize the extent of such possible biases using serial coalescent simulations. We first use a coalescent framework to generate datasets assuming no or different levels of heterochrony and contrast most classical population genetic statistics. We show that even weak levels of heterochrony ( approximately 10% of the average depth of a standard population tree) affect the distribution of polymorphism substantially, leading to overestimate the level of polymorphism theta, to star like trees, with an excess of rare mutations and a deficit of linkage disequilibrium, which are the hallmark of e.g. population expansion (possibly after a drastic bottleneck). Substantial departures of the tests are detected in the opposite direction for more heterochroneous and equilibrated datasets, with balanced trees mimicking in particular population contraction, balancing selection, and population differentiation. We therefore introduce simple corrections to classical estimators of polymorphism and of the genetic distance between populations, in order to remove heterochrony-driven bias. Finally, we show that these effects do occur on real aDNA datasets, taking advantage of the currently available sequence data for Cave Bears (Ursus spelaeus), for which large mtDNA haplotypes have been reported over a substantial time period (22-130 thousand years ago (KYA)). Considering serial sampling changed the conclusion of several tests, indicating that neglecting heterochrony could provide significant support for false past history of populations and inappropriate conservation decisions. We therefore argue for systematically considering heterochroneous models when analyzing heterochroneous samples covering a large time scale.

Protective effect of the APOE-e3 allele in Alzheimer's disease

PubMed Central

de-Almada, B.V.P.; de-Almeida, L.D.; Camporez, D.; de-Moraes, M.V.D.; Morelato, R.L.; Perrone, A.M.S.; Belcavello, L.; Louro, I.D.; de-Paula, F.

2011-01-01

Although several alleles of susceptibility to Alzheimer's disease (AD) have been studied in the last decades, few polymorphisms have been considered as risk factors for the disease. Among them, the APOE-e4 allele appears to be the major genetic risk factor for the onset of the disease. However, it is important to confirm the potential susceptibility of these genetic variants in different populations in order to establish a genetic profile for the disease in specific communities. This study analyzed the APOE polymorphisms regarding susceptibility to AD in a sample of 264 individuals (primarily Caucasians; 82 cases and 182 controls) in the population from Vitória, ES, Brazil, by PCR restriction fragment length polymorphism (PCR-RFLP) methods. The patients were selected according to clinical criteria for probable AD. Whereas the e4 allele showed statistically significant positive association with susceptibility to AD (OR = 3.01, 95%CI = 1.96-4.61; P < 0.0001), the e2 allele did not. The results of the e4 allele confirm the role of this polymorphism as a risk factor for AD in the sample studied as observed in other populations. Although the e3 allele has been considered neutral in several studies, our results suggest that it acts as a protective factor against AD in the population studied (OR = 0.46, 95%CI = 0.30-0.67; P < 0.0001). This study may provide a new insight into the role of the APOE-e3 allele in the etiology of AD and might help to estabilish a profile of risk for AD in the population from Vitória, ES. PMID:22068907

Genetic, comparative genomic, and expression analyses of the Mc1r locus in the polychromatic Midas cichlid fish (Teleostei, Cichlidae Amphilophus sp.) species group.

PubMed

Henning, Frederico; Renz, Adina Josepha; Fukamachi, Shoji; Meyer, Axel

2010-05-01

Natural populations of the Midas cichlid species in several different crater lakes in Nicaragua exhibit a conspicuous color polymorphism. Most individuals are dark and the remaining have a gold coloration. The color morphs mate assortatively and sympatric population differentiation has been shown based on neutral molecular data. We investigated the color polymorphism using segregation analysis and a candidate gene approach. The segregation patterns observed in a mapping cross between a gold and a dark individual were consistent with a single dominant gene as a cause of the gold phenotype. This suggests that a simple genetic architecture underlies some of the speciation events in the Midas cichlids. We compared the expression levels of several candidate color genes Mc1r, Ednrb1, Slc45a2, and Tfap1a between the color morphs. Mc1r was found to be up regulated in the gold morph. Given its widespread association in color evolution and role on melanin synthesis, the Mc1r locus was further investigated using sequences derived from a genomic library. Comparative analysis revealed conserved synteny in relation to the majority of teleosts and highlighted several previously unidentified conserved non-coding elements (CNEs) in the upstream and downstream regions in the vicinity of Mc1r. The identification of the CNEs regions allowed the comparison of sequences from gold and dark specimens of natural populations. No polymorphisms were found between in the population sample and Mc1r showed no linkage to the gold phenotype in the mapping cross, demonstrating that it is not causally related to the color polymorphism in the Midas cichlid.

Genetic susceptibility to chronic wasting disease in free-ranging white-tailed deer: complement component C1q and Prnp polymorphisms

USGS Publications Warehouse

Blanchong, Julie A.; Heisey, Dennis M.; Scribner, Kim T.; Libants, Scot V.; Johnson, Chad; Aiken, Judd M.; Langenberg, Julia A.; Samuel, Michael D.

2009-01-01

The genetic basis of susceptibility to chronic wasting disease (CWD) in free-ranging cervids is of great interest. Association studies of disease susceptibility in free-ranging populations, however, face considerable challenges including: the need for large sample sizes when disease is rare, animals of unknown pedigree create a risk of spurious results due to population admixture, and the inability to control disease exposure or dose. We used an innovative matched case–control design and conditional logistic regression to evaluate associations between polymorphisms of complement C1q and prion protein (Prnp) genes and CWD infection in white-tailed deer from the CWD endemic area in south-central Wisconsin. To reduce problems due to admixture or disease-risk confounding, we used neutral genetic (microsatellite) data to identify closely related CWD-positive (n = 68) and CWD-negative (n = 91) female deer to serve as matched cases and controls. Cases and controls were also matched on factors (sex, location, age) previously demonstrated to affect CWD infection risk. For Prnp, deer with at least one Serine (S) at amino acid 96 were significantly less likely to be CWD-positive relative to deer homozygous for Glycine (G). This is the first characterization of genes associated with the complement system in white-tailed deer. No tests for association between any C1q polymorphism and CWD infection were significant at p < 0.05. After controlling for Prnp, we found weak support for an elevated risk of CWD infection in deer with at least one Glycine (G) at amino acid 56 of the C1qC gene. While we documented numerous amino acid polymorphisms in C1q genes none appear to be strongly associated with CWD susceptibility.

Positive, negative, or all relative? Evaluative conditioning of ambivalence.

PubMed

Glaser, Tina; Woud, Marcella L; Labib Iskander, Michael; Schmalenstroth, Vera; Vo, Thuy My

2018-04-01

In evaluative conditioning (EC), the pairing of a positively or negatively valenced stimulus (US) with a neutral stimulus (CS) leads to a corresponding change in liking of the CS. EC research so far has concentrated on using unambiguously positive or negative USs. However, attitude objects are often ambivalent, i.e., can simultaneously possess positive and negative features. The present research investigated whether ambivalence can be evaluatively conditioned and whether contingency awareness moderates this effect. In two studies, positive, negative, neutral, and ambivalent USs were paired with affectively neutral CSs. Results showed standard EC effects that were moderated by contingency awareness. Most interestingly, EC effects were also obtained for the ambivalent USs, indicating that ambivalence can indeed be conditioned. However, contingency awareness seemed to play a lesser role in ambivalence conditioning. Ambivalence EC effects were obtained on subjective and objective direct measures of ambivalence as well as on a more indirect measure. Copyright © 2018 Elsevier B.V. All rights reserved.

Electrophysiological differences in the processing of affective information in words and pictures.

PubMed

Hinojosa, José A; Carretié, Luis; Valcárcel, María A; Méndez-Bértolo, Constantino; Pozo, Miguel A

2009-06-01

It is generally assumed that affective picture viewing is related to higher levels of physiological arousal than is the reading of emotional words. However, this assertion is based mainly on studies in which the processing of either words or pictures has been investigated under heterogenic conditions. Positive, negative, relaxing, neutral, and background (stimulus fragments) words and pictures were presented to subjects in two experiments under equivalent experimental conditions. In Experiment 1, neutral words elicited an enhanced late positive component (LPC) that was associated with an increased difficulty in discriminating neutral from background stimuli. In Experiment 2, high-arousing pictures elicited an enhanced early negativity and LPC that were related to a facilitated processing for these stimuli. Thus, it seems that under some circumstances, the processing of affective information captures attention only with more biologically relevant stimuli. Also, these data might be better interpreted on the basis of those models that postulate a different access to affective information for words and pictures.

Genetic diversity in Egyptian and Italian goat breeds measured with microsatellite polymorphism.

PubMed

Agha, S H; Pilla, F; Galal, S; Shaat, I; D'Andrea, M; Reale, S; Abdelsalam, A Z A; Li, M H

2008-06-01

Seven microsatellite markers were used to study genetic diversity of three Egyptian (Egyptian Baladi, Barki and Zaraibi) and two Italian (Maltese and Montefalcone) goat breeds. The microsatellites showed a high polymorphic information content (PIC) of more than 0.5 in most of the locus-breed combinations and indicated that the loci were useful in assessing within- and between-breed variability of domestic goat (Capra hircus). The expected heterozygosity of the breeds varied from 0.670 to 0.792. In the geographically wider distributed Egyptian Baladi breed there were indications for deviations from random breeding. Analysis of genetic distances and population structure grouped the three Egyptian goat breeds together, and separated them from the two Italian breeds. The studied Mediterranean breeds sampled from African and European populations seem to have differentiated from each other with only little genetic exchange between the geographically isolated populations.

Mycobacterium avium restriction fragment length polymorphism-IS IS1245 and the simple double repetitive element polymerase chain reaction typing method to screen genetic diversity in Brazilian strains.

PubMed

Sequeira, Patrícia Carvalho de; Fonseca, Leila de Souza; Silva, Marlei Gomes da; Saad, Maria Helena Féres

2005-11-01

Simple double repetitive element polymerase chain reaction (MaDRE-PCR) and Pvu II-IS1245 restriction fragment length polymorphism (RFLP) typing methods were used to type 41 Mycobacterium avium isolates obtained from 14 AIDS inpatients and 10 environment and animals specimens identified among 53 mycobacteria isolated from 237 food, chicken, and pig. All environmental and animals strains showed orphan patterns by both methods. By MaDRE-PCR four patients, with multiple isolates, showed different patterns, suggesting polyclonal infection that was confirmed by RFLP in two of them. This first evaluation of MaDRE-PCR on Brazilian M. avium strains demonstrated that the method seems to be useful as simple and less expensive typing method for screening genetic diversity in M. avium strains on selected epidemiological studies, although with limitation on analysis identical patterns except for one band.

Paranormal experience and the COMT dopaminergic gene: a preliminary attempt to associate phenotype with genotype using an underlying brain theory.

PubMed

Raz, Amir; Hines, Terence; Fossella, John; Castro, Daniella

2008-01-01

Paranormal belief and suggestibility seem related. Given our recent findings outlining a putative association between suggestibility and a specific dopaminergic genetic polymorphism, we hypothesized that similar exploratory genetic data may offer supplementary insights into a similar correlation with paranormal belief. With more affordable costs and better technology in the aftermath of the human genome project, genotyping is increasingly ubiquitous. Compelling brain theories guide specific research hypotheses as scientists begin to unravel tentative relationships between phenotype and genotype. In line with a dopaminergic brain theory, we tried to correlate a specific phenotype concerning paranormal belief with a dopaminergic gene (COMT) known for its involvement in prefrontal executive cognition and for a polymorphism that is positively correlated with suggestibility. Although our preliminary findings are inconclusive, the research approach we outline should pave the road to a more scientific account of elucidating paranormal belief.

Evidence for adaptation from standing genetic variation on an antimicrobial peptide gene in the mussel Mytilus edulis.

PubMed

Gosset, Célia C; Do Nascimento, Joana; Augé, Marie-Thérèse; Bierne, Nicolas

2014-06-01

Genome scans of population differentiation identify candidate loci for adaptation but provide little information on how selection has influenced the genetic structure of these loci. Following a genome scan, we investigated the nature of the selection responsible for the outlying differentiation observed between populations of the marine mussel Mytilus edulis at a leucine/arginine polymorphism (L31R) in the antimicrobial peptide MGD2. We analysed DNA sequence polymorphisms, allele frequencies and population differentiation of polymorphisms closely linked to L31R, and pairwise and third-order linkage disequilibria. An outlying level of population differentiation was observed at L31R only, while no departure from panmixia was observed at linked loci surrounding L31R, as in most of the genome. Selection therefore seems to affect L31R directly. Three hypotheses can explain the lack of differentiation in the chromosomal region close to L31R: (i) hitchhiking has occurred but migration and recombination subsequently erased the signal, (ii) selection was weak enough and recombination strong enough to limit the hitchhiking effect to a very small chromosomal region or (iii) selection acted on a pre-existing polymorphism (i.e. standing variation) at linkage equilibrium with its background. Linkage equilibrium was observed between L31R and linked polymorphisms in every population analysed, as expected under the three hypotheses. However, linkage disequilibrium was observed in some populations between pairs of loci located upstream and downstream to L31R, generating a complex pattern of third-order linkage disequilibria which is best explained by the hypothesis of selection on a pre-existing polymorphism. We hypothesise that selection could be either balanced, maintaining alleles at different frequencies depending on the pathogen community encountered locally by mussels, or intermittent, resulting in sporadic fluctuations in allele frequency. © 2014 John Wiley & Sons Ltd.

Polymorphisms in TS, MTHFR and ERCC1 genes as predictive markers in first-line platinum and pemetrexed therapy in NSCLC patients.

PubMed

Krawczyk, Paweł; Kucharczyk, Tomasz; Kowalski, Dariusz M; Powrózek, Tomasz; Ramlau, Rodryg; Kalinka-Warzocha, Ewa; Winiarczyk, Kinga; Knetki-Wróblewska, Magdalena; Wojas-Krawczyk, Kamila; Kałakucka, Katarzyna; Dyszkiewicz, Wojciech; Krzakowski, Maciej; Milanowski, Janusz

2014-12-01

We presented retrospective analysis of up to five polymorphisms in TS, MTHFR and ERCC1 genes as molecular predictive markers for homogeneous Caucasian, non-squamous NSCLC patients treated with pemetrexed and platinum front-line chemotherapy. The following polymorphisms in DNA isolated from 115 patients were analyzed: various number of 28-bp tandem repeats in 5'-UTR region of TS gene, single nucleotide polymorphism (SNP) within the second tandem repeat of TS gene (G>C); 6-bp deletion in 3'-UTR region of the TS (1494del6); 677C>T SNP in MTHFR; 19007C>T SNP in ERCC1. Molecular examinations' results were correlated with disease control rate, progression-free survival (PFS) and overall survival. Polymorphic tandem repeat sequence (2R, 3R) in the enhancer region of TS gene and G>C SNP within the second repeat of 3R allele seem to be important for the effectiveness of platinum and pemetrexed in first-line chemotherapy. The insignificant shortening of PFS in 3R/3R homozygotes as compared to 2R/2R and 2R/3R genotypes were observed, while it was significantly shorter in patients carrying synchronous 3R allele and G nucleotide. The combined analysis of TS VNTR and MTHFR 677C>T SNP revealed shortening of PFS in synchronous carriers of 3R allele in TS and two C alleles in MTHFR. The strongest factors increased the risk of progression were poor PS, weight loss, anemia and synchronous presence of 3R allele and G nucleotide in the second repeat of 3R allele in TS. Moreover, lack of application of second-line chemotherapy, weight loss and poor performance status and above-mentioned genotype of TS gene increased risk of early mortality. The examined polymorphisms should be accounted as molecular predictor factors for pemetrexed- and platinum-based front-line chemotherapy in non-squamous NSCLC patients.

X-ray structural studies and physicochemical characterization of (E)-6-(3,4-dimethoxyphenyl)-1-ethyl-4-mesitylimino-3-methyl- 3,4-dihydro-2(1H)-pyrimidinone polymorphs.

PubMed

Miyamae, A; Kitamura, S; Tada, T; Koda, S; Yasuda, T

1991-10-01

The polymorphism of (E)-6-(3,4-dimethoxyphenyl)-1-ethyl-4-mesitylimino-3-methyl-3,4-di hydro- 2(1 H)-pyrimidinone (FK664; 1) was characterized by using X-ray powder diffractometry, differential scanning calorimetry (DSC), and IR spectroscopy. Structures of two polymorphs (Forms A and B) were determined by X-ray crystallographic analysis. Form A crystallized in the monoclinic space group P2(1)/c, with a = 13.504(2), b = 6.733(1), c = 24.910(8) A, beta = 96.55(4) degrees, z = 4, and dcal = 1.203 g/cm3, while Form B crystallized in the same space group, with a = 8.067(2), b = 15.128(4), c = 18.657(4) A, beta = 102.34(3) degrees, z = 4, and dcal = 1.216 g/cm3. The conformational features of 1 were very similar between the two polymorphs. Compound 1, in both crystal forms, took an energetically reasonable conformation in three rigid planes, such as 2-pyrimidone, trimethylphenyl, and dimethoxyphenyl rings, but the molecules were packed in different ways between the two polymorphs. In the Form B crystal, a short contact was possible, to form pi-pi interactions between two dimethoxyphenyl groups related with the inversion center in the crystal lattice; this interaction seems to contribute to stabilizing the crystal structure of Form B. Both Forms A and B showed only one endothermic peak due to fusion at 115 and 140 degrees C, respectively, on the DSC thermograms; therefore, it is suggested that there are no transition points between the two polymorphs. The heats of fusion obtained from the DSC thermograms were 33.2(2) kJ/mol for Form A and 36.8(1) kJ/mol for Form B.(ABSTRACT TRUNCATED AT 250 WORDS)

Are both sympatric species Ilex perado and Ilex canariensis secretly hybridizing? Indication from nuclear markers collected in Tenerife

PubMed Central

Manen, Jean-François

2004-01-01

Background Intra-specific and intra-individual polymorphism is frequently observed in nuclear markers of Ilex (Aquifoliaceae) and discrepancy between plastid and nuclear phylogenies is the rule in this genus. These observations suggest that inter-specific plastid or/and nuclear introgression played an important role in the process of evolution of Ilex. With the aim of a precise understanding of the evolution of this genus, two distantly related sympatric species collected in Tenerife (Canary Islands), I. perado and I. canariensis, were studied in detail. Introgression between these two species was previously never reported. One plastid marker (the atpB-rbcL spacer) and two nuclear markers, the ribosomal internal transcribed spacer (ITS) and the nuclear encoded plastid glutamine synthetase (nepGS) were analyzed for 13 and 27 individuals of I. perado and I. canariensis, respectively. Results The plastid marker is intra-specifically constant and correlated with species identity. On the other hand, whereas the nuclear markers are conserved in I. perado, they are highly polymorphic in I. canariensis. The presence of pseudogenes and recombination in ITS sequences of I. canariensis explain this polymorphism. Ancestral sequence polymorphism with incomplete lineage sorting, or past or recent hybridization with an unknown species could explain this polymorphism, not resolved by concerted evolution. However, as already reported for many other plants, past or recent introgression of an alien genotype seem the most probable explanation for such a tremendous polymorphism. Conclusions Data do not allow the determination with certitude of the putative species introgressing I. canariensis, but I. perado is suspected. The introgression would be unilateral, with I. perado as the male donor, and the paternal sequences would be rapidly converted in highly divergent and consequently unidentifiable pseudogenes. At least, this study allows the establishment of precautionary measures when nuclear markers are used in phylogenetic studies of genera having experienced introgression such as the genus Ilex. PMID:15550175

Genetic polymorphisms in 5-Fluorouracil-related enzymes predict pathologic response after neoadjuvant chemoradiation for rectal cancer.

PubMed

Nelson, Bailey; Carter, Jane V; Eichenberger, Maurice R; Netz, Uri; Galandiuk, Susan

2016-11-01

Many patients with rectal cancer undergo preoperative neoadjuvant chemoradiation, with approximately 70% exhibiting pathologic downstaging in response to treatment. Currently, there is no accurate test to predict patients who are likely to be complete responders to therapy. 5-Fluorouracil is used regularly in the neoadjuvant treatment of rectal cancer. Genetic polymorphisms affect the activity of thymidylate synthase, an enzyme involved in 5-Fluorouracil metabolism, which may account for observed differences in response to neoadjuvant treatment between patients. Detection of genetic polymorphisms might identify patients who are likely to have a complete response to neoadjuvant therapy and perhaps allow them to avoid operation. DNA was isolated from whole blood taken from patients with newly diagnosed rectal cancer who received neoadjuvant therapy (n = 50). Response to therapy was calculated with a tumor regression score based on histology from the time of operation. Polymerase chain reaction was performed targeting the promoter region of thymidylate synthase. Polymerase chain reaction products were separated using electrophoresis to determine whether patients were homozygous for a double-tandem repeat (2R), a triple-tandem repeat (3R), or were heterozygous (2R/3R). A single nucleotide polymorphism, 3G or 3C, also may be present in the second repeat unit of the triple-tandem repeat allele. Restriction fragment length polymorphism assays were performed in patients with at least one 3R allele using HaeIII. Patients with at least 1 thymidylate synthase 3G allele were more likely to have a complete or partial pathologic response to 5-Fluorouracil neoadjuvant therapy (odds ratio 10.4; 95% confidence interval, 1.3-81.6; P = .01) than those without at least one 3G allele. Identification of rectal cancer patients with specific genetic polymorphisms in enzymes involved in 5-Fluorouracil metabolism seems to predict the likelihood of complete or partial pathologic response to preoperative neoadjuvant therapy. Copyright © 2016 Elsevier Inc. All rights reserved.

Primary hyperoxaluria type 1: diagnostic relevance of mutations and polymorphisms in the alanine:glyoxylate aminotransferase gene (AGXT).

PubMed

Tarn, A C; von Schnakenburg, C; Rumsby, G

1997-09-01

Primary hyperoxaluria type 1 (PH1) is an autosomal recessive disorder of glyoxylate metabolism caused by deficiency of the hepatic peroxisomal enzyme alanine:glyoxylate aminotransferase (AGT). The disease shows considerable phenotypic, enzymatic and genetic heterogeneity. To date, 7 polymorphisms and 11 point mutations have been described in the gene encoding AGT. We report on the prevalence of these polymorphisms and mutations in 79 patients with PH1 with the aim of assessing their diagnostic relevance. A strong association of the C154T, intron 1 insertion and C386T polymorphisms is confirmed and this linkage extends to include the type 1 variant of a polymorphic tandem repeat in intron 4. Only 64 of 158 (40%) PH1 alleles have one of the defined mutations, with the G630A mutation accounting for 39 of these and T853C for 14. Overall only 20 (25%) of the patients studied had the genetic basis of their disease fully explained: 7 were homozygous for the G630A mutation, 5 were homozygous for the T853C mutation, 1 was homozygous for the C819T mutation, and 7 had two different mutations identified and were presumed to be compound heterozygotes. Only the two more frequent G630A and T853C mutations are of general diagnostic relevance for mutation screening. It seems likely that there are a significant number of other mutations, perhaps family-specific, still to be described. There was no apparent difference in the types of mutations in patients presenting in the first year of life (36%), suggesting that other factors, such as periods of dehydration or urinary tract infections, might contribute more to the clinical manifestation than genotype.

Effects of Mannose-Binding Lectin Polymorphisms on Irinotecan-Induced Febrile Neutropenia

PubMed Central

de Jong, Floris A.; van Schaik, Ron H.; Sparreboom, Alex; van Fessem, Marianne A.; van de Geijn, Fleur E.; van Daele, Paul L.; Verweij, Jaap; Sleijfer, Stefan; Mathijssen, Ron H.

2010-01-01

Objective. Mannose-binding lectin (MBL) is important in the innate immune response. MBL2 gene polymorphisms affect MBL expression, and genotypes yielding low MBL levels have been associated with an elevated risk for infections in hematological cancer patients undergoing chemotherapy. However, these reported associations are inconsistent, and data on patients with solid tumors are lacking. Here, we investigated the effects of MBL2 genotypes on irinotecan-induced febrile neutropenia in patients with solid tumors. Patients and Methods. Irinotecan-treated patients were genotyped for the MBL2 gene. Two promoter (−550 H/L and −221 X/Y) and three exon polymorphisms (52 A/D, 54 A/B, and 57 A/C) were determined, together with known risk factors for irinotecan-induced toxicity. Neutropenia and febrile neutropenia were recorded during the first course. Results. Of the 133 patients, 28% experienced severe neutropenia and 10% experienced febrile neutropenia. No associations were found between exon polymorphisms and febrile neutropenia. However, patients with the H/H promoter genotype, associated with high MBL levels, experienced significantly more febrile neutropenia than patients with the H/L and L/L genotypes (20% versus 13% versus 5%). Moreover, patients with the HYA haplotype encountered significantly more febrile neutropenia than patients without this high MBL-producing haplotype (16% versus 4%). In the subgroup with wild-type exon polymorphisms (A/A), patients with the high MBL promoter phenotype had the highest incidence of febrile neutropenia, regardless of known risk factors. Conclusion. Patients with high MBL2 promoter genotypes and haplotypes seem more at risk for developing febrile neutropenia. If confirmed, these preliminary findings may contribute to more individualized approaches of irinotecan treatment. PMID:20930093

Salt forms of the pharmaceutical amide dihydrocarbamazepine.

PubMed

Buist, Amanda R; Kennedy, Alan R

2016-02-01

Carbamazepine (CBZ) is well known as a model active pharmaceutical ingredient used in the study of polymorphism and the generation and comparison of cocrystal forms. The pharmaceutical amide dihydrocarbamazepine (DCBZ) is a less well known material and is largely of interest here as a structural congener of CBZ. Reaction of DCBZ with strong acids results in protonation of the amide functionality at the O atom and gives the salt forms dihydrocarbamazepine hydrochloride {systematic name: [(10,11-dihydro-5H-dibenzo[b,f]azepin-5-yl)(hydroxy)methylidene]azanium chloride, C15H15N2O(+)·Cl(-)}, dihydrocarbamazepine hydrochloride monohydrate {systematic name: [(10,11-dihydro-5H-dibenzo[b,f]azepin-5-yl)(hydroxy)methylidene]azanium chloride monohydrate, C15H15N2O(+)·Cl(-)·H2O} and dihydrocarbamazepine hydrobromide monohydrate {systematic name: [(10,11-dihydro-5H-dibenzo[b,f]azepin-5-yl)(hydroxy)methylidene]azanium bromide monohydrate, C15H15N2O(+)·Br(-)·H2O}. The anhydrous hydrochloride has a structure with two crystallographically independent ion pairs (Z' = 2), wherein both cations adopt syn conformations, whilst the two hydrated species are mutually isostructural and have cations with anti conformations. Compared to neutral dihydrocarbamazepine structures, protonation of the amide group is shown to cause changes to both the molecular (C=O bond lengthening and C-N bond shortening) and the supramolecular structures. The amide-to-amide and dimeric hydrogen-bonding motifs seen for neutral polymorphs and cocrystalline species are replaced here by one-dimensional polymeric constructs with no direct amide-to-amide bonds. The structures are also compared with, and shown to be closely related to, those of the salt forms of the structurally similar pharmaceutical carbamazepine.

Differential effect of the 5-HTT gene-linked polymorphic region on emotional eating during stress exposure following tryptophan challenge.

PubMed

Markus, C Rob; Verschoor, Ellen; Smeets, Tom

2012-04-01

Stress and negative moods, which are thought to be partly mediated by reduced brain serotonin function, often increase emotional eating in dieting women (restrainers). Because the short (S) allele polymorphism in the serotonin transporter gene (5-HTTLPR) is associated with serotonin dysfunction, S allele compared to long (L) allele 5-HTTLPR genotypes may be more susceptible to stress-induced emotional eating. Consequently, serotonin challenge via tryptophan (TRP)-rich protein hydrolysate (TPH) may alleviate stress-induced emotional eating particularly in S/S allele carriers. We tested whether acute stress affects emotional eating in women with high or low dietary restraints depending on their 5-HTTLPR genotype and TPH intake. Nineteen female subjects who were homozygous for the short-allele 5-HTTLPR genotype (S'/S'=S/L(G), L(G)/L(G): restrainers vs. nonrestrainers) and 23 female subjects who were homozygous for the long-allele 5-HTTLPR genotype (L'/L'=L(A)/L(A): restrainers vs. nonrestrainers) were tested in a double-blind, placebo-controlled crossover study of stress-induced emotional eating following intake of TPH or a placebo. TPH intake significantly increased the plasma TRP/large neutral amino acid ratio (P<.0001) in the L'/L' group (70%) compared to the S'/S' group (30%). TPH reduced food intake in both groups, but in the L'/L' group, it also reduced stress-induced negative mood (P=.037) and the desire for sweet, high-fat foods (P=.011) regardless of dietary restraint. Since TPH caused a greater increase in the plasma TRP/large neutral amino acid ratio in the L'/L' group compared to S'/S' group, the exclusive beneficial effects of L'/L' genotype may be due to enhanced brain 5-HT function. Copyright © 2012 Elsevier Inc. All rights reserved.

Analysis of spatial patterns informs community assembly and sampling requirements for Collembola in forest soils

NASA Astrophysics Data System (ADS)

Dirilgen, Tara; Juceviča, Edite; Melecis, Viesturs; Querner, Pascal; Bolger, Thomas

2018-01-01

The relative importance of niche separation, non-equilibrial and neutral models of community assembly has been a theme in community ecology for many decades with none appearing to be applicable under all circumstances. In this study, Collembola species abundances were recorded over eleven consecutive years in a spatially explicit grid and used to examine (i) whether observed beta diversity differed from that expected under conditions of neutrality, (ii) whether sampling points differed in their relative contributions to overall beta diversity, and (iii) the number of samples required to provide comparable estimates of species richness across three forest sites. Neutrality could not be rejected for 26 of the forest by year combinations. However, there is a trend toward greater structure in the oldest forest, where beta diversity was greater than predicted by neutrality on five of the eleven sampling dates. The lack of difference in individual- and sample-based rarefaction curves also suggests randomness in the system at this particular scale of investigation. It seems that Collembola communities are not spatially aggregated and assembly is driven primarily by neutral processes particularly in the younger two sites. Whether this finding is due to small sample size or unaccounted for environmental variables cannot be determined. Variability between dates and sites illustrates the potential of drawing incorrect conclusions if data are collected at a single site and a single point in time.

Helium Energetic Neutral Atoms from the Heliosphere: Perspectives for Future Observations

NASA Astrophysics Data System (ADS)

Swaczyna, Paweł; Grzedzielski, Stan; Bzowski, Maciej

2017-05-01

Observations of energetic neutral atoms (ENAs) allow for remote sensing of plasma properties in distant regions of the heliosphere. So far, most of the observations have concerned only hydrogen atoms. In this paper, we present perspectives for observations of helium energetic neutral atoms (He ENAs). We calculated the expected intensities of He ENAs created by the neutralization of helium ions in the inner heliosheath and through the secondary ENA mechanism in the outer heliosheath. We found that the dominant source region for He ENAs is the inner heliosheath. The obtained magnitudes of intensity spectra suggest that He ENAs can be observed with future ENA detectors, as those planned on Interstellar Mapping and Acceleration Probe. Observing He ENAs is most likely for energies from a few to a few tens of keV/nuc. Estimates of the expected count rates show that the ratio of helium to hydrogen atoms registered in the detectors can be as low as 1:104. Consequently, the detectors need to be equipped with an appropriate mass spectrometer capability, allowing for recognition of chemical elements. Due to the long mean free paths of helium ions in the inner heliosheath, He ENAs are produced also in the distant heliospheric tail. This implies that observations of He ENAs can resolve its structure, which seems challenging from observations of hydrogen ENAs since energetic protons are neutralized before they progress deeper in the heliospheric tail.

Insecticide-driven patterns of genetic variation in the dengue vector Aedes aegypti in Martinique Island.

PubMed

Marcombe, Sébastien; Paris, Margot; Paupy, Christophe; Bringuier, Charline; Yebakima, André; Chandre, Fabrice; David, Jean-Philippe; Corbel, Vincent; Despres, Laurence

2013-01-01

Effective vector control is currently challenged worldwide by the evolution of resistance to all classes of chemical insecticides in mosquitoes. In Martinique, populations of the dengue vector Aedes aegypti have been intensively treated with temephos and deltamethrin insecticides over the last fifty years, resulting in heterogeneous levels of resistance across the island. Resistance spreading depends on standing genetic variation, selection intensity and gene flow among populations. To determine gene flow intensity, we first investigated neutral patterns of genetic variability in sixteen populations representative of the many environments found in Martinique and experiencing various levels of insecticide pressure, using 6 microsatellites. Allelic richness was lower in populations resistant to deltamethrin, and consanguinity was higher in populations resistant to temephos, consistent with a negative effect of insecticide pressure on neutral genetic diversity. The global genetic differentiation was low, suggesting high gene flow among populations, but significant structure was found, with a pattern of isolation-by-distance at the global scale. Then, we investigated adaptive patterns of divergence in six out of the 16 populations using 319 single nucleotide polymorphisms (SNPs). Five SNP outliers displaying levels of genetic differentiation out of neutral expectations were detected, including the kdr-V1016I mutation in the voltage-gated sodium channel gene. Association tests revealed a total of seven SNPs associated with deltamethrin resistance. Six other SNPs were associated with temephos resistance, including two non-synonymous substitutions in an alkaline phosphatase and in a sulfotransferase respectively. Altogether, both neutral and adaptive patterns of genetic variation in mosquito populations appear to be largely driven by insecticide pressure in Martinique.

Capturing neutral and adaptive genetic diversity for conservation in a highly structured tree species.

PubMed

Rodríguez-Quilón, Isabel; Santos-Del-Blanco, Luis; Serra-Varela, María Jesús; Koskela, Jarkko; González-Martínez, Santiago C; Alía, Ricardo

2016-10-01

Preserving intraspecific genetic diversity is essential for long-term forest sustainability in a climate change scenario. Despite that, genetic information is largely neglected in conservation planning, and how conservation units should be defined is still heatedly debated. Here, we use maritime pine (Pinus pinaster Ait.), an outcrossing long-lived tree with a highly fragmented distribution in the Mediterranean biodiversity hotspot, to prove the importance of accounting for genetic variation, of both neutral molecular markers and quantitative traits, to define useful conservation units. Six gene pools associated to distinct evolutionary histories were identified within the species using 12 microsatellites and 266 single nucleotide polymorphisms (SNPs). In addition, height and survival standing variation, their genetic control, and plasticity were assessed in a multisite clonal common garden experiment (16 544 trees). We found high levels of quantitative genetic differentiation within previously defined neutral gene pools. Subsequent cluster analysis and post hoc trait distribution comparisons allowed us to define 10 genetically homogeneous population groups with high evolutionary potential. They constitute the minimum number of units to be represented in a maritime pine dynamic conservation program. Our results uphold that the identification of conservation units below the species level should account for key neutral and adaptive components of genetic diversity, especially in species with strong population structure and complex evolutionary histories. The environmental zonation approach currently used by the pan-European genetic conservation strategy for forest trees would be largely improved by gradually integrating molecular and quantitative trait information, as data become available. © 2016 by the Ecological Society of America.

Improved volatile fatty acids anaerobic production from waste activated sludge by pH regulation: Alkaline or neutral pH?

PubMed

Ma, Huijun; Chen, Xingchun; Liu, He; Liu, Hongbo; Fu, Bo

2016-02-01

In this study, the anaerobic fermentation was carried out for volatile fatty acids (VFAs) production at different pH (between 7.0 and 10.0) conditions with untreated sludge and heat-alkaline pretreated waste activated sludge. In the fermentation with untreated sludge, the extent of hydrolysis of organic matters and extent of acidification at alkaline pH are 54.37% and 30.37%, respectively, resulting in the highest VFAs yield at 235.46mg COD/gVS of three pH conditions. In the fermentation with heat-alkaline pretreated sludge, the acidification rate and VFAs yield at neutral pH are 30.98% and 240.14mg COD/gVS, respectively, which are higher than that at other pH conditions. With the glucose or bovine serum albumin as substrate for VFAs production, the neutral pH showed a higher VFAs concentration than the alkaline pH condition. The results of terminal restriction fragment length polymorphism (T-RFLP) analysis indicated that the alkaline pH caused low microbial richness. Based on the results in this study, we demonstrated that the alkaline pH is favor of hydrolysis of organic matter in sludge while neutral pH improved the acidogenesis for the VFAs production from sludge. Our finding is obvious different to the previous research and helpful for the understanding of how heat-alkaline pretreatment and alkaline fermentation influence the VFAs production, and beneficial to the development of VFAs production process. Copyright © 2015 Elsevier Ltd. All rights reserved.

Genomic validation of the differential preservation of population history in modern human cranial anatomy.

PubMed

Reyes-Centeno, Hugo; Ghirotto, Silvia; Harvati, Katerina

2017-01-01

In modern humans, the significant correlation between neutral genetic loci and cranial anatomy suggests that the cranium preserves a population history signature. However, there is disagreement on whether certain parts of the cranium preserve this signature to a greater degree than other parts. It is also unclear how different quantitative measures of phenotype affect the association of genetic variation and anatomy. Here, we revisit these matters by testing the correlation of genetic distances and various phenotypic distances for ten modern human populations. Geometric morphometric shape data from the crania of adult individuals (n = 224) are used to calculate phenotypic P ST , Procrustes, and Mahalanobis distances. We calculate their correlation to neutral genetic distances, F ST , derived from single nucleotide polymorphisms (SNPs). We subset the cranial data into landmark configurations that include the neurocranium, the face, and the temporal bone in order to evaluate whether these cranial regions are differentially correlated to neutral genetic variation. Our results show that P ST , Mahalanobis, and Procrustes distances are correlated with F ST distances to varying degrees. They indicate that overall cranial shape is significantly correlated with neutral genetic variation. Of the component parts examined, P ST distances for both the temporal bone and the face have a stronger association with F ST distances than the neurocranium. When controlling for population divergence time, only the whole cranium and the temporal bone have a statistically significant association with F ST distances. Our results confirm that the cranium, as a whole, and the temporal bone can be used to reconstruct modern human population history. © 2016 Wiley Periodicals, Inc.

Association of cytokine gene polymorphisms in CWP and its severity in Turkish coal workers

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ates, I.; Suzen, H.S.; Yucesoy, B.

2008-10-15

Cytokines appear to play a key role in some inflammatory reactions affecting the interactions among pro- and anti-inflammatory mechanisms that result in several diseases such as coal workers' pneumoconiosis (CWP). In this study, to determine the cytokine gene profiles of Turkish coal miners, we performed genotyping analysis to investigate the polymorphisms of CWP-related pro-inflammatory (TNFA, IL1A, IL1B, and IL6) and anti-inflammatory cytokines (IL-1RN and TGFB1). Genotyping was carried out by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) technique. TNFA (-238) gene polymorphism principally affected CWP development and severity (OR=3.47: 95% CI, 1.12-10.77 and OR=4.30: 95% CI, 1.25-14.74, respectively) and alsomore » risk of CWP (OR=3.79: 95% CI, 1.37-10.46). The TNFA (-308) variant was associated with a risk for the CWP severity (OR = 2.84: 95% CI, 1.08-7.39). A protective effect of IL6 was found on the development (OR = 0.48: 95% CI, 0.21-0.93) and severity of CWP (OR = 0.37: 95% CI, 0.15-0.91). We suggest that TNFA (-238) variant may be a risk factor in both development and the severity, of CWP while TNFA (-308) variant seems to be important only in disease severity On the other hand, IL6 variant may have a protective effect on the development and disease severity.« less

Apolipoprotein E gene polymorphism and gender.

PubMed

Kolovou, Genovefa; Damaskos, Dimitris; Anagnostopoulou, Katherine; Cokkinos, Dennis V

2009-01-01

Many studies have shown that the prevalence and onset of coronary heart disease (CHD) is sex-dependent. CHD prevalence is lower in women than in men at all ages. Furthermore, women's age of CHD onset seems to be 10 yr later. This is widely attributed to the fact that men have less favorable CHD risk factors (eg, plasma lipid profile) compared to women. Mean levels of protective high density lipoprotein cholesterol are lower, while triglyceride levels are higher in men than in women. It is possible that many of the genes involved in lipid metabolism, such as Apolipoprotein (Apo) E, as well as their polymorphisms, may be expressed in a sexually dimorphic manner. The human Apo E gene is polymorphic, encoding one of 3 common epsilon (epsilon) alleles (epsilon 2, epsilon 3, epsilon 4), with the epsilon 3 allele occurring most frequently (78%) in the Caucasian population. Association studies have shown a protective effect on CHD in epsilon 2 carriers and a harmful effect in epsilon 4 carriers. However, there are conflicting results regarding such allelic effects in respect to gender. This review is focused on the gender-related influence of Apo E polymorphism in respect to plasma lipid levels and the risk of CHD. Additionally, an effort is made to determine if this relation exists and if it can be satisfactorily explained. The studies cited here demonstrate a complex, multifactorial association between these factors, in need of further corroboration in greater population samples.

Does the MTHFR A1298C Polymorphism Modulate the Cardiorespiratory Response to Training?

PubMed

Cięszczyk, Paweł; Zarębska, Aleksandra; Jastrzębski, Zbigniew; Sawczyn, Michał; Kozakiewicz-Drobnik, Izabela; Leońska-Duniec, Agata; Kaczmarczyk, Mariusz; Maciejewska-Skrendo, Agnieszka; Żmijewski, Piotr; Trybek, Grzegorz; Smółka, Wojciech; Pilch, Jan; Leźnicka, Katarzyna; Lulińska-Kuklik, Ewelina; Sawczuk, Marek; Massidda, Myosotis

2016-12-01

The 5,10-methylenetetrahydrofolate reductase gene (MTHFR) A1298C polymorphic variant is a candidate to explain the individual differences in trainability and response to exercise training. Therefore, the aim of the study was to verify whether the A1298C polymorphism influenced the aerobic and anaerobic performance as well as body and mass composition in young Polish women following low-high impact aerobic exercise training. Two hundred and one women aged 21 ± 1 years (range 19-24) were included in the study. All of them completed a 12-week exercise training program and were measured for selected somatic features, aerobic capacity and cardiorespiratory fitness indices as well as peak anaerobic power and anaerobic capacity, before and after the intervention. A mixed 2 x 2 ANOVA for 20 dependent variables grouped in three categories was conducted. No significant interaction of the genotype with training for body mass and body composition variables was observed. Although, there were three significant genotype x training interactions for maximal oxygen uptake variables, regardless of body mass i.e.: for VO2max (p < 0.05), HRmax (p < 0.0001) and HRAT/HRmax (p < 0.0001). Significantly greater improvement in VO2max was gained by the CC+AC group compared to the AA genotype group. The present results support the hypothesis that individual differences in trainability are at least in part determined by the genetic component and MTHFR A1298C seems to be one of the many polymorphisms involved.

Neuropsychiatric Genetics of Happiness, Friendships, and Politics: Hypothesizing Homophily (“Birds of a Feather Flock Together”) as a Function of Reward Gene Polymorphisms

PubMed Central

Blum, Kenneth; Oscar-Berman, Marlene; Bowirrat, Abdalla; Giordano, John; Madigan, Margaret; Braverman, Eric R.; Barh, Debmayla; Hauser, Mary; Borsten, Joan; Simpatico, Thomas

2013-01-01

Mindful of the new evolutionary ideas related to an emerging scientific focus known as omics, we propose that spiritual, social, and political behaviors may be tied in part to inheritable reward gene polymorphisms, as has been demonstrated for the addictions. If so, analyses of gene polymorphisms may assist in predicting liberalism or conservatism in partisan attachments. For example, both drinking (alcohol) and obesity seem to cluster in large social networks and are influenced by friends having the same genotype, in particular the DRD2 A1 allele. Likewise, voting, voting turnout and attachment to a particular political ideology is differentially related to various reward genes (e.g., 5HTT, MOA, DRD2, and DRD4), possibly predicting liberalism or conservatism. Moreover, voters’ genetic information may predict presidential outcomes more than the actual issues at hand or the presidential candidates themselves. Thus, political discussions on TV, radio, or other media may be morphed by one’s reward gene polymorphisms and as such, may explain the prevalence of generations of die-hard republicans and equally entrenched democratic legacies. Indeed, even in politics, birds of a feather (homophily) flock together. We caution that our proposal should be viewed mindfully awaiting additional research before definitive statements or conclusions can be derived from the studies to date, and we encourage large scale studies to confirm these earlier reports. PMID:23336089

Surfactant-Assisted Phase-Selective Synthesis of New Cobalt MOFs and Their Efficient Electrocatalytic Hydrogen Evolution Reaction.

PubMed

Wu, Ya-Pan; Zhou, Wei; Zhao, Jun; Dong, Wen-Wen; Lan, Ya-Qian; Li, Dong-Sheng; Sun, Chenghua; Bu, Xianhui

2017-10-09

Reported herein are two new polymorphic Co-MOFs (CTGU-5 and -6) that can be selectively crystallized into the pure 2D or 3D net using an anionic or neutral surfactant, respectively. Each polymorph contains a H 2 O molecule, but differs dramatically in its bonding to the framework, which in turn affects the crystal structure and electrocatalytic performance for hydrogen evolution reaction (HER). Both experimental and computational studies find that 2D CTGU-5 which has coordinates water and more open access to the cobalt site has higher electrocatalytic activity than CTGU-6 with the lattice water. The integration with co-catalysts, such as acetylene black (AB) leads to a composite material, AB&CTGU-5 (1:4) with very efficient HER catalytic properties among reported MOFs. It exhibits superior HER properties including a very positive onset potential of 18 mV, low Tafel slope of 45 mV dec -1 , higher exchange current density of 8.6×10 -4  A cm -2 , and long-term stability. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Facial emotion recognition deficits in relatives of children with autism are not associated with 5HTTLPR.

PubMed

Neves, Maila de Castro Lourenço das; Tremeau, Fabien; Nicolato, Rodrigo; Lauar, Hélio; Romano-Silva, Marco Aurélio; Correa, Humberto

2011-09-01

A large body of evidence suggests that several aspects of face processing are impaired in autism and that this impairment might be hereditary. This study was aimed at assessing facial emotion recognition in parents of children with autism and its associations with a functional polymorphism of the serotonin transporter (5HTTLPR). We evaluated 40 parents of children with autism and 41 healthy controls. All participants were administered the Penn Emotion Recognition Test (ER40) and were genotyped for 5HTTLPR. Our study showed that parents of children with autism performed worse in the facial emotion recognition test than controls. Analyses of error patterns showed that parents of children with autism over-attributed neutral to emotional faces. We found evidence that 5HTTLPR polymorphism did not influence the performance in the Penn Emotion Recognition Test, but that it may determine different error patterns. Facial emotion recognition deficits are more common in first-degree relatives of autistic patients than in the general population, suggesting that facial emotion recognition is a candidate endophenotype for autism.

SNPdbe: constructing an nsSNP functional impacts database.

PubMed

Schaefer, Christian; Meier, Alice; Rost, Burkhard; Bromberg, Yana

2012-02-15

Many existing databases annotate experimentally characterized single nucleotide polymorphisms (SNPs). Each non-synonymous SNP (nsSNP) changes one amino acid in the gene product (single amino acid substitution;SAAS). This change can either affect protein function or be neutral in that respect. Most polymorphisms lack experimental annotation of their functional impact. Here, we introduce SNPdbe-SNP database of effects, with predictions of computationally annotated functional impacts of SNPs. Database entries represent nsSNPs in dbSNP and 1000 Genomes collection, as well as variants from UniProt and PMD. SAASs come from >2600 organisms; 'human' being the most prevalent. The impact of each SAAS on protein function is predicted using the SNAP and SIFT algorithms and augmented with experimentally derived function/structure information and disease associations from PMD, OMIM and UniProt. SNPdbe is consistently updated and easily augmented with new sources of information. The database is available as an MySQL dump and via a web front end that allows searches with any combination of organism names, sequences and mutation IDs. http://www.rostlab.org/services/snpdbe.

Molecular hyperdiversity and evolution in very large populations.

PubMed

Cutter, Asher D; Jovelin, Richard; Dey, Alivia

2013-04-01

The genomic density of sequence polymorphisms critically affects the sensitivity of inferences about ongoing sequence evolution, function and demographic history. Most animal and plant genomes have relatively low densities of polymorphisms, but some species are hyperdiverse with neutral nucleotide heterozygosity exceeding 5%. Eukaryotes with extremely large populations, mimicking bacterial and viral populations, present novel opportunities for studying molecular evolution in sexually reproducing taxa with complex development. In particular, hyperdiverse species can help answer controversial questions about the evolution of genome complexity, the limits of natural selection, modes of adaptation and subtleties of the mutation process. However, such systems have some inherent complications and here we identify topics in need of theoretical developments. Close relatives of the model organisms Caenorhabditis elegans and Drosophila melanogaster provide known examples of hyperdiverse eukaryotes, encouraging functional dissection of resulting molecular evolutionary patterns. We recommend how best to exploit hyperdiverse populations for analysis, for example, in quantifying the impact of noncrossover recombination in genomes and for determining the identity and micro-evolutionary selective pressures on noncoding regulatory elements. © 2013 Blackwell Publishing Ltd.

Markers predicting response to bacillus Calmette-Guérin immunotherapy in high-risk bladder cancer patients: a systematic review.

PubMed

Zuiverloon, Tahlita C M; Nieuweboer, Annemieke J M; Vékony, Hedvig; Kirkels, Wim J; Bangma, Chris H; Zwarthoff, Ellen C

2012-01-01

Currently, bacillus Calmette-Guérin (BCG) intravesical instillations are standard treatment for patients with high-grade non-muscle-invasive bladder cancer; however, no markers are available to predict BCG response. To review the contemporary literature on markers predicting BCG response, to discuss the key issues concerning the identification of predictive markers, and to provide recommendations for further research studies. We performed a systematic review of the literature using PubMed and Embase databases in the period 1996-2010. The free-text search was extended by adding the following keywords: recurrence, progression, survival, molecular marker, prognosis, TP53, Ki-67, RB, fibronectin, immunotherapy, cytokine, interleukin, natural killer, macrophage, PMN, polymorphism, SNP, single nucleotide polymorphism, and gene signature. If thresholds for the detection of urinary interleukin (IL)-8, IL-18, and tumour necrosis factor apoptosis-inducing ligand levels are standardised, measurement of these cytokines holds promise in the assessment of BCG therapy outcome. Studies on immunohistochemical markers (ie, TP53, Ki-67, and retinoblastoma) display contradictory results, probably because of the small patient groups that were used and seem unsuitable to predict BCG response. Exploring combinations of protein levels might prove to be more helpful to establish the effect of BCG therapy. Single nucleotide polymorphisms, either in cytokines or in genes involved in DNA repair, need to be investigated in different ethnicities before their clinical relevance can be determined. Measurement of urinary IL-2 levels seems to be the most potent marker of all the clinical parameters reviewed. IL-2 levels are currently the most promising predictive markers of BCG response. For future studies focusing on new biomarkers, it is essential to make more use of new biomedical techniques such as microRNA profiling and genomewide sequencing. Copyright © 2011 European Association of Urology. Published by Elsevier B.V. All rights reserved.

Ultraviolet carbon lines in the spectrum of the white dwarf BPM 11668

NASA Technical Reports Server (NTRS)

Wegner, G.

1983-01-01

The southern hemisphere DC white dwarf BPM 11668 has been found to show strong ultraviolet lines of neutral carbon using observations from the IUE satellite. This star seems typical of the growing number of DC white dwarfs found to be of this type and appears to have a carbon abundance near C:He = 0.0001, with an effective temperature of 8500 K.

A Change Is Gonna Come: Bloggers "Google Bomb" Veiled Hate Site

ERIC Educational Resources Information Center

Barack, Lauren

2007-01-01

Keying in the search term "Martin Luther King" on Google would result in retrieving martinlutherking.com as the topmost hit. At first glance, it seems like a neutral informational site, but clicking on a few articles will unmask the hate. This site, which is owned by Don Black, a former Grand Wizard of the Ku Klux Klan, references King as a…

Soft Shoulders Ahead: Spurious Signatures of Soft and Partial Selective Sweeps Result from Linked Hard Sweeps

PubMed Central

Schrider, Daniel R.; Mendes, Fábio K.; Hahn, Matthew W.; Kern, Andrew D.

2015-01-01

Characterizing the nature of the adaptive process at the genetic level is a central goal for population genetics. In particular, we know little about the sources of adaptive substitution or about the number of adaptive variants currently segregating in nature. Historically, population geneticists have focused attention on the hard-sweep model of adaptation in which a de novo beneficial mutation arises and rapidly fixes in a population. Recently more attention has been given to soft-sweep models, in which alleles that were previously neutral, or nearly so, drift until such a time as the environment shifts and their selection coefficient changes to become beneficial. It remains an active and difficult problem, however, to tease apart the telltale signatures of hard vs. soft sweeps in genomic polymorphism data. Through extensive simulations of hard- and soft-sweep models, here we show that indeed the two might not be separable through the use of simple summary statistics. In particular, it seems that recombination in regions linked to, but distant from, sites of hard sweeps can create patterns of polymorphism that closely mirror what is expected to be found near soft sweeps. We find that a very similar situation arises when using haplotype-based statistics that are aimed at detecting partial or ongoing selective sweeps, such that it is difficult to distinguish the shoulder of a hard sweep from the center of a partial sweep. While knowing the location of the selected site mitigates this problem slightly, we show that stochasticity in signatures of natural selection will frequently cause the signal to reach its zenith far from this site and that this effect is more severe for soft sweeps; thus inferences of the target as well as the mode of positive selection may be inaccurate. In addition, both the time since a sweep ends and biologically realistic levels of allelic gene conversion lead to errors in the classification and identification of selective sweeps. This general problem of “soft shoulders” underscores the difficulty in differentiating soft and partial sweeps from hard-sweep scenarios in molecular population genomics data. The soft-shoulder effect also implies that the more common hard sweeps have been in recent evolutionary history, the more prevalent spurious signatures of soft or partial sweeps may appear in some genome-wide scans. PMID:25716978

Soft shoulders ahead: spurious signatures of soft and partial selective sweeps result from linked hard sweeps.

PubMed

Schrider, Daniel R; Mendes, Fábio K; Hahn, Matthew W; Kern, Andrew D

2015-05-01

Characterizing the nature of the adaptive process at the genetic level is a central goal for population genetics. In particular, we know little about the sources of adaptive substitution or about the number of adaptive variants currently segregating in nature. Historically, population geneticists have focused attention on the hard-sweep model of adaptation in which a de novo beneficial mutation arises and rapidly fixes in a population. Recently more attention has been given to soft-sweep models, in which alleles that were previously neutral, or nearly so, drift until such a time as the environment shifts and their selection coefficient changes to become beneficial. It remains an active and difficult problem, however, to tease apart the telltale signatures of hard vs. soft sweeps in genomic polymorphism data. Through extensive simulations of hard- and soft-sweep models, here we show that indeed the two might not be separable through the use of simple summary statistics. In particular, it seems that recombination in regions linked to, but distant from, sites of hard sweeps can create patterns of polymorphism that closely mirror what is expected to be found near soft sweeps. We find that a very similar situation arises when using haplotype-based statistics that are aimed at detecting partial or ongoing selective sweeps, such that it is difficult to distinguish the shoulder of a hard sweep from the center of a partial sweep. While knowing the location of the selected site mitigates this problem slightly, we show that stochasticity in signatures of natural selection will frequently cause the signal to reach its zenith far from this site and that this effect is more severe for soft sweeps; thus inferences of the target as well as the mode of positive selection may be inaccurate. In addition, both the time since a sweep ends and biologically realistic levels of allelic gene conversion lead to errors in the classification and identification of selective sweeps. This general problem of "soft shoulders" underscores the difficulty in differentiating soft and partial sweeps from hard-sweep scenarios in molecular population genomics data. The soft-shoulder effect also implies that the more common hard sweeps have been in recent evolutionary history, the more prevalent spurious signatures of soft or partial sweeps may appear in some genome-wide scans. Copyright © 2015 by the Genetics Society of America.

Pathogenesis and Consequences of Uniparental Disomy in Cancer

PubMed Central

Makishima, Hideki; Maciejewski, Jaroslaw P.

2012-01-01

Systematic application of new genome-wide single nucleotide polymorphism arrays has demonstrated that somatically acquired regions of loss of heterozygosity (LOH) without changes in copy number frequently occur in many types of cancer. Until recently, the ubiquity of this type of chromosomal defect had remained unrecognized as it cannot be detected using routine cytogenetic technologies. Random and recurrent patterns of copy-neutral LOH, also referred to as uniparental disomy (UPD), can be found in specific cancer types and probably contribute to clonal outgrowth owing to various mechanisms. In this review we explore the types, topography, genesis, pathophysiological consequences and clinical implications of UPD. PMID:21518781

[Predictive factors of virological response in chronically HCV infected].

PubMed

Lapiński, Tadeusz Wojciech; Flisiak, Robert

2012-09-01

Research on new antivirals drugs applied in the treatment of chronically HCV infected indicate that even the most perfect therapeutic molecules do not guarantee 100% efficacy. Since the beginning of the history of HCV infection treatment clinicians looked for predictors of treatment efficacy. Numerous studies confirm the high probability of cure in patients who cleared HCVinfectional 4 and 12 weeks of therapy. However despite of viral factors, recent research demonstrated predictive role of some host dependent factors. The most important role seems to play genetic factors including polymorphism rs12979860, as well as chemokins including first of all CXCL10 (IP-10). Very interesting seems to be also results of studies on association between vitamine D concentration and treatment efficacy. However in the future the most important predictive factor remain probably early on-treatment viral response.

Prion protein testis specific (PRNT) gene polymorphisms and transcript level in ovine spermatozoa: Implications in freezability, fertilization and embryo production.

PubMed

Pereira, R M; Mesquita, P; Pires, V M R; Baptista, M C; Barbas, J P; Pimenta, J; Horta, A E M; Prates, J A M; Marques, C C

2018-07-15

An essential role of prion protein testis specific (PRNT) and prion protein 2 dublet (PRND) genes in the male reproductive function has been highlighted, although a deeper knowledge for the mechanisms involved is still lacking. Our goal was to determine the importance of the PRNT haplotypic variants and mRNA expression levels in ovine spermatozoa freezability and ability for fertilization and embryo developmental processes. Their association with the PRND gene polymorphisms was also analyzed. DNA from rams belonging to three Portuguese sheep breeds (n = 28) was screened by single-strand conformation polymorphism (SSCP) analysis to identify the PRNT and PRND polymorphisms. Semen collected from these rams was cryopreserved and fertility traits evaluated. The SSCP analyses revealed polymorphisms in the codons 6, 38, 43 and 48 of the PRNT coding region - respectively c.17C > T (p.Ser6Phe, which disrupts a consensus arginine-X-X serine/threonine motif); c.112G > C (p.Gly38 > Arg); and synonymous c.129T > C and c.144A > G. The polymorphisms in codons 6, 38 and 48 occur simultaneously while the one in codon 43 occurs independently. Six haplotypes were identified in the PRNT coding region, resulting in three different amino acid polymorphic variants (6S-38G-43C-48V, S6F-G38R-43C-48V and 6F-38R-43C-48V). The PRNT gene mRNA transcript level in spermatozoa was related to the identified haplotypic variants, either considering the codons 6-38-48 (P ≤ 0.0001) or the codon 43 alone (P ≤ 0.0001) or altogether (P ≤ 0.0001). An interaction between PRNT haplotypes and PRND genotypes on PRNT transcript level was also identified (P = 0.0003). Rams carrying the 17C-112G-144A PRNT haplotype had sperm with the highest post-thawed individual motility (P ≤ 0.03). Combined PRNT and PRND polymorphic variation influenced the post-thawed individual motility (P = 0.01). The male PRNT haplotypic, either considering the codons 6-38-48 and 43 altogether or the codon 43 alone, interfered (P ≤ 0.04) in embryo production rates. In conclusion, our data confirm that the PRNT gene is highly polymorphic in sheep and that the PRNT and PRND genotypes are associated. The identified polymorphisms of PRNT coding region seems to interfere on the ram spermatozoa mRNA transcript level and on male fertility, specifically in sperm freezability and ability for embryo development. Copyright © 2018. Published by Elsevier Inc.

Toward Understanding the Cold, Hot, and Neutral Nature of Chinese Medicines Using in Silico Mode-of-Action Analysis.

PubMed

Fu, Xianjun; Mervin, Lewis H; Li, Xuebo; Yu, Huayun; Li, Jiaoyang; Mohamad Zobir, Siti Zuraidah; Zoufir, Azedine; Zhou, Yang; Song, Yongmei; Wang, Zhenguo; Bender, Andreas

2017-03-27

One important, however, poorly understood, concept of Traditional Chinese Medicine (TCM) is that of hot, cold, and neutral nature of its bioactive principles. To advance the field, in this study, we analyzed compound-nature pairs from TCM on a large scale (>23 000 structures) via chemical space visualizations to understand its physicochemical domain and in silico target prediction to understand differences related to their modes-of-action (MoA) against proteins. We found that overall TCM natures spread into different subclusters with specific molecular patterns, as opposed to forming coherent global groups. Compounds associated with cold nature had a lower clogP and contain more aliphatic rings than the other groups and were found to control detoxification, heat-clearing, heart development processes, and have sedative function, associated with "Mental and behavioural disorders" diseases. While compounds associated with hot nature were on average of lower molecular weight, have more aromatic ring systems than other groups, frequently seemed to control body temperature, have cardio-protection function, improve fertility and sexual function, and represent excitatory or activating effects, associated with "endocrine, nutritional and metabolic diseases" and "diseases of the circulatory system". Compounds associated with neutral nature had a higher polar surface area and contain more cyclohexene moieties than other groups and seem to be related to memory function, suggesting that their nature may be a useful guide for their utility in neural degenerative diseases. We were hence able to elucidate the difference between different nature classes in TCM on the molecular level, and on a large data set, for the first time, thereby helping a better understanding of TCM nature theory and bridging the gap between traditional medicine and our current understanding of the human body.

Physiological Response to Facial Expressions in Peripersonal Space Determines Interpersonal Distance in a Social Interaction Context.

PubMed

Cartaud, Alice; Ruggiero, Gennaro; Ott, Laurent; Iachini, Tina; Coello, Yann

2018-01-01

Accurate control of interpersonal distances in social contexts is an important determinant of effective social interactions. Although comfortable interpersonal distance seems to be dependent on social factors such as the gender, age and activity of the confederates, it also seems to be modulated by the way we represent our peripersonal-action space. To test this hypothesis, the present study investigated the relation between the emotional responses registered through electrodermal activity (EDA) triggered by human-like point-light displays (PLDs) carrying different facial expressions (neutral, angry, happy) when located in the participants peripersonal or extrapersonal space, and the comfort distance with the same PLDs when approaching and crossing the participants fronto-parallel axis on the right or left side. The results show an increase of the phasic EDA for PLDs with angry facial expressions located in the peripersonal space (reachability judgment task), in comparison to the same PLDs located in the extrapersonal space, which was not observed for PLDs with neutral or happy facial expressions. The results also show an increase of the comfort distance for PLDs approaching the participants with an angry facial expression (interpersonal comfort distance judgment task), in comparison to PLDs with happy and neutral ones, which was related to the increase of the physiological response. Overall, the findings indicate that comfort social space can be predicted from the emotional reaction triggered by a confederate when located within the observer's peripersonal space. This suggests that peripersonal-action space and interpersonal-social space are similarly sensitive to the emotional valence of the confederate, which could reflect a common adaptive mechanism in specifying theses spaces to subtend interactions with both the physical and social environment, but also to ensure body protection from potential threats.

Population differentiation and behavioural association of the two 'personality' genes DRD4 and SERT in dunnocks (Prunella modularis).

PubMed

Holtmann, B; Grosser, S; Lagisz, M; Johnson, S L; Santos, E S A; Lara, C E; Robertson, B C; Nakagawa, S

2016-02-01

Quantifying the variation in behaviour-related genes within and between populations provides insight into how evolutionary processes shape consistent behavioural traits (i.e. personality). Deliberate introductions of non-native species offer opportunities to investigate how such genes differ between native and introduced populations and how polymorphisms in the genes are related to variation in behaviour. Here, we compared the genetic variation of the two 'personality' genes, DRD4 and SERT, between a native (United Kingdom, UK) and an introduced (New Zealand, NZ) population of dunnocks, Prunella modularis. The NZ population showed a significantly lower number of single nucleotide polymorphisms (SNPs) compared to the UK population. Standardized F'st estimates of the personality genes and neutral microsatellites indicate that selection (anthropogenic and natural) probably occurred during and post the introduction event. Notably, the largest genetic differentiation was found in the intronic regions of the genes. In the NZ population, we also examined the association between polymorphisms in DRD4 and SERT and two highly repeatable behavioural traits: flight-initiation distance and mating status (promiscuous females and cobreeding males). We found 38 significant associations (for different allele effect models) between the two behavioural traits and the studied genes. Further, 22 of the tested associations showed antagonistic allele effects for males and females. Our findings illustrate how introduction events and accompanying ecological changes could influence the genetic diversity of behaviour-related genes. © 2015 John Wiley & Sons Ltd.

Neural and Genetic Correlates of the Social Sharing of Happiness

PubMed Central

Matsunaga, Masahiro; Kawamichi, Hiroaki; Umemura, Tomohiro; Hori, Reiko; Shibata, Eiji; Kobayashi, Fumio; Suzuki, Kohta; Ishii, Keiko; Ohtsubo, Yohsuke; Noguchi, Yasuki; Ochi, Misaki; Yamasue, Hidenori; Ohira, Hideki

2017-01-01

Happiness is regarded as one of the most fundamental human goals. Given recent reports that positive feelings are contagious (e.g., the presence of a happy person enhances others' happiness) because of the human ability to empathize (i.e., sharing emotions), empathic ability may be a key factor in increasing one's own subjective level of happiness. Based on previous studies indicating that a single nucleotide polymorphism in the serotonin 2A receptor gene [HTR2A rs6311 guanine (G) vs. adenine (A)] is associated with sensitivity to emotional stimuli and several mental disorders such as depression, we predicted that the polymorphism might be associated with the effect of sharing happiness. To elucidate the neural and genetic correlates of the effect of sharing happiness, we first performed functional magnetic resonance imaging (fMRI) during a “happy feelings” evocation task (emotional event imagination task), during which we manipulated the valence of the imagined event (positive, neutral, or negative), as well as the presence of a friend experiencing a positive-valence event (presence or absence). We recruited young adult women for this fMRI study because empathic ability may be higher in women than in men. Participants felt happier (p < 0.01) and the mentalizing/theory-of-mind network, which spans the medial prefrontal cortex, temporoparietal junction, temporal poles, and precuneus, was significantly more active (p < 0.05) in the presence condition than in the absence condition regardless of event valence. Moreover, participants with the GG (p < 0.01) and AG (p < 0.05) genotypes of HTR2A experienced happier feelings as well as greater activation of a part of the mentalizing/theory-of-mind network (p < 0.05) during empathy for happiness (neutral/presence condition) than those with the AA genotype. In a follow-up study with a vignette-based questionnaire conducted in a relatively large sample, male and female participants were presented with the same imagined events wherein their valence and the presence of a friend were manipulated. Results showed genetic differences in happiness-related empathy regardless of sex (p < 0.05). Findings suggest that HTR2A polymorphisms are associated with the effect of sharing happiness by modulating the activity of the mentalizing/theory-of-mind network. PMID:29311795

Neural and Genetic Correlates of the Social Sharing of Happiness.

PubMed

Matsunaga, Masahiro; Kawamichi, Hiroaki; Umemura, Tomohiro; Hori, Reiko; Shibata, Eiji; Kobayashi, Fumio; Suzuki, Kohta; Ishii, Keiko; Ohtsubo, Yohsuke; Noguchi, Yasuki; Ochi, Misaki; Yamasue, Hidenori; Ohira, Hideki

2017-01-01

Happiness is regarded as one of the most fundamental human goals. Given recent reports that positive feelings are contagious (e.g., the presence of a happy person enhances others' happiness) because of the human ability to empathize (i.e., sharing emotions), empathic ability may be a key factor in increasing one's own subjective level of happiness. Based on previous studies indicating that a single nucleotide polymorphism in the serotonin 2A receptor gene [ HTR2A rs6311 guanine (G) vs. adenine (A)] is associated with sensitivity to emotional stimuli and several mental disorders such as depression, we predicted that the polymorphism might be associated with the effect of sharing happiness. To elucidate the neural and genetic correlates of the effect of sharing happiness, we first performed functional magnetic resonance imaging (fMRI) during a "happy feelings" evocation task (emotional event imagination task), during which we manipulated the valence of the imagined event (positive, neutral, or negative), as well as the presence of a friend experiencing a positive-valence event (presence or absence). We recruited young adult women for this fMRI study because empathic ability may be higher in women than in men. Participants felt happier ( p < 0.01) and the mentalizing/theory-of-mind network, which spans the medial prefrontal cortex, temporoparietal junction, temporal poles, and precuneus, was significantly more active ( p < 0.05) in the presence condition than in the absence condition regardless of event valence. Moreover, participants with the GG ( p < 0.01) and AG ( p < 0.05) genotypes of HTR2A experienced happier feelings as well as greater activation of a part of the mentalizing/theory-of-mind network ( p < 0.05) during empathy for happiness (neutral/presence condition) than those with the AA genotype. In a follow-up study with a vignette-based questionnaire conducted in a relatively large sample, male and female participants were presented with the same imagined events wherein their valence and the presence of a friend were manipulated. Results showed genetic differences in happiness-related empathy regardless of sex ( p < 0.05). Findings suggest that HTR2A polymorphisms are associated with the effect of sharing happiness by modulating the activity of the mentalizing/theory-of-mind network.

Integration of genome and phenotypic scanning gives evidence of genetic structure in Mesoamerican common bean (Phaseolus vulgaris L.) landraces from the southwest of Europe.

PubMed

Santalla, M; De Ron, A M; De La Fuente, M

2010-05-01

Southwestern Europe has been considered as a secondary centre of genetic diversity for the common bean. The dispersal of domesticated materials from their centres of origin provides an experimental system that reveals how human selection during cultivation and adaptation to novel environments affects the genetic composition. In this paper, our goal was to elucidate how distinct events could modify the structure and level of genetic diversity in the common bean. The genome-wide genetic composition was analysed at 42 microsatellite loci in individuals of 22 landraces of domesticated common bean from the Mesoamerican gene pool. The accessions were also characterised for phaseolin seed protein and for nine allozyme polymorphisms and phenotypic traits. One of this study's important findings was the complementary information obtained from all the polymorphisms examined. Most of the markers found to be potentially under the influence of selection were located in the proximity of previously mapped genes and quantitative trait loci (QTLs) related to important agronomic traits, which indicates that population genomics approaches are very efficient in detecting QTLs. As it was revealed by outlier simple sequence repeats, loci analysis with STRUCTURE software and multivariate analysis of phenotypic data, the landraces were grouped into three clusters according to seed size and shape, vegetative growth habit and genetic resistance. A total of 151 alleles were detected with an average of 4 alleles per locus and an average polymorphism information content of 0.31. Using a model-based approach, on the basis of neutral markers implemented in the software STRUCTURE, three clusters were inferred, which were in good agreement with multivariate analysis. Geographic and genetic distances were congruent with the exception of a few putative hybrids identified in this study, suggesting a predominant effect of isolation by distance. Genomic scans using both markers linked to genes affected by selection (outlier) and neutral markers showed advantages relative to other approaches, since they help to create a more complete picture of how adaptation to environmental conditions has sculpted the common bean genomes in southern Europe. The use of outlier loci also gives a clue about what selective forces gave rise to the actual phenotypes of the analysed landraces.

HLA polymorphism in the Havasupai: Evidence for balancing selection

DOE Office of Scientific and Technical Information (OSTI.GOV)

Markow, T.; Hedrick, P.W.; Armstrong, C.

1993-10-01

The characterization and analysis of genetic variation at the HLA loci provides important insight for population geneticists trying to understand the evolutionary forces that have shaped human populations. This study describes the HLA-A and HLA-B loci serotyping and statistical analysis on an isolated Native American population, the Havasupai of Arizona. Four alleles at the HLA-A locus were identified, while eight alleles were found at the HLA-B locus. These variants were present as 20 of 32 potential two-locus haplotypes, with five of the six most common haplotypes exhibiting high positive linkage disequilibrium. Significant homozygote deficiency (heterozygosity excess) was detected both atmore » HLA-A and at HLA-B. This deviation from Hardy-Weinberg proportions was not attributable to nonselective causes such as different alleles at both HLA-A and HLA-B was more even than expected from neutrality theory; that is, the observed Hardy-Weinberg homozygosity was only 62.4% of that expected under neutrality. These observations suggest that balancing selection is of major importance in maintaining genetic variation at HLA-A and HLA-B. 52 refs., 5 tabs.« less

Broadly neutralizing epitopes in the Plasmodium vivax vaccine candidate Duffy Binding Protein

DOE PAGES

Chen, Edwin; Salinas, Nichole D.; Huang, Yining; ...

2016-05-18

Plasmodium vivax Duffy Binding Protein (PvDBP) is the most promising vaccine candidate for P. vivax malaria. The polymorphic nature of PvDBP induces strain-specific immune responses, however, and the epitopes of broadly neutralizing antibodies are unknown. These features hamper the rational design of potent DBP-based vaccines and necessitate the identification of globally conserved epitopes. Using X-ray crystallography, small-angle X-ray scattering, hydrogen-deuterium exchange mass spectrometry, and mutational mapping, we have defined epitopes for three inhibitory mAbs (mAbs 2D10, 2H2, and 2C6) and one noninhibitory mAb (3D10) that engage DBP. These studies expand the currently known inhibitory epitope repertoire by establishing protective motifsmore » in subdomain three outside the receptor-binding and dimerization residues of DBP, and introduce globally conserved protective targets. All of the epitopes are highly conserved among DBP alleles. In conclusion, the identification of broadly conserved epitopes of inhibitory antibodies provides critical motifs that should be retained in the next generation of potent vaccines for P. vivax malaria.« less

Learning about evolution from sequence data

NASA Astrophysics Data System (ADS)

Dayarian, Adel; Shraiman, Boris

2012-02-01

Recent advances in sequencing and in laboratory evolution experiments have made possible to obtain quantitative data on genetic diversity of populations and on the dynamics of evolution. This dynamics is shaped by the interplay between selection acting on beneficial and deleterious mutations and recombination which reshuffles genotypes. Mounting evidence suggests that natural populations harbor extensive fitness diversity, yet most of the currently available tools for analyzing polymorphism data are based on the neutral theory. Our aim is to develop methods to analyze genomic data for populations in the presence of the above-mentioned factors. We consider different evolutionary regimes - Muller's ratchet, mutation-recombination-selection balance and positive adaption rate - and revisit a number of observables considered in the nearly-neutral theory of evolution. In particular, we examine the coalescent structure in the presence of recombination and calculate quantities such as the distribution of the coalescent times along the genome, the distribution of haplotype block sizes and the correlation between ancestors of different loci along the genome. In addition, we characterize the probability and time of fixation of mutations as a function of their fitness effect.

Broadly neutralizing epitopes in the Plasmodium vivax vaccine candidate Duffy Binding Protein

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chen, Edwin; Salinas, Nichole D.; Huang, Yining

Plasmodium vivax Duffy Binding Protein (PvDBP) is the most promising vaccine candidate for P. vivax malaria. The polymorphic nature of PvDBP induces strain-specific immune responses, however, and the epitopes of broadly neutralizing antibodies are unknown. These features hamper the rational design of potent DBP-based vaccines and necessitate the identification of globally conserved epitopes. Using X-ray crystallography, small-angle X-ray scattering, hydrogen-deuterium exchange mass spectrometry, and mutational mapping, we have defined epitopes for three inhibitory mAbs (mAbs 2D10, 2H2, and 2C6) and one noninhibitory mAb (3D10) that engage DBP. These studies expand the currently known inhibitory epitope repertoire by establishing protective motifsmore » in subdomain three outside the receptor-binding and dimerization residues of DBP, and introduce globally conserved protective targets. All of the epitopes are highly conserved among DBP alleles. In conclusion, the identification of broadly conserved epitopes of inhibitory antibodies provides critical motifs that should be retained in the next generation of potent vaccines for P. vivax malaria.« less

Scenes for Social Information Processing in Adolescence: Item and factor analytic procedures for psychometric appraisal.

PubMed

Vagos, Paula; Rijo, Daniel; Santos, Isabel M

2016-04-01

Relatively little is known about measures used to investigate the validity and applications of social information processing theory. The Scenes for Social Information Processing in Adolescence includes items built using a participatory approach to evaluate the attribution of intent, emotion intensity, response evaluation, and response decision steps of social information processing. We evaluated a sample of 802 Portuguese adolescents (61.5% female; mean age = 16.44 years old) using this instrument. Item analysis and exploratory and confirmatory factor analytic procedures were used for psychometric examination. Two measures for attribution of intent were produced, including hostile and neutral; along with 3 emotion measures, focused on negative emotional states; 8 response evaluation measures; and 4 response decision measures, including prosocial and impaired social behavior. All of these measures achieved good internal consistency values and fit indicators. Boys seemed to favor and choose overt and relational aggression behaviors more often; girls conveyed higher levels of neutral attribution, sadness, and assertiveness and passiveness. The Scenes for Social Information Processing in Adolescence achieved adequate psychometric results and seems a valuable alternative for evaluating social information processing, even if it is essential to continue investigation into its internal and external validity. (c) 2016 APA, all rights reserved.

Revisiting the Iberian honey bee (Apis mellifera iberiensis) contact zone: maternal and genome-wide nuclear variations provide support for secondary contact from historical refugia.

PubMed

Chávez-Galarza, Julio; Henriques, Dora; Johnston, J Spencer; Carneiro, Miguel; Rufino, José; Patton, John C; Pinto, M Alice

2015-06-01

Dissecting diversity patterns of organisms endemic to Iberia has been truly challenging for a variety of taxa, and the Iberian honey bee is no exception. Surveys of genetic variation in the Iberian honey bee are among the most extensive for any honey bee subspecies. From these, differential and complex patterns of diversity have emerged, which have yet to be fully resolved. Here, we used a genome-wide data set of 309 neutrally tested single nucleotide polymorphisms (SNPs), scattered across the 16 honey bee chromosomes, which were genotyped in 711 haploid males. These SNPs were analysed along with an intergenic locus of the mtDNA, to reveal historical patterns of population structure across the entire range of the Iberian honey bee. Overall, patterns of population structure inferred from nuclear loci by multiple clustering approaches and geographic cline analysis were consistent with two major clusters forming a well-defined cline that bisects Iberia along a northeastern-southwestern axis, a pattern that remarkably parallels that of the mtDNA. While a mechanism of primary intergradation or isolation by distance could explain the observed clinal variation, our results are more consistent with an alternative model of secondary contact between divergent populations previously isolated in glacial refugia, as proposed for a growing list of other Iberian taxa. Despite current intense honey bee management, human-mediated processes have seemingly played a minor role in shaping Iberian honey bee genetic structure. This study highlights the complexity of the Iberian honey bee patterns and reinforces the importance of Iberia as a reservoir of Apis mellifera diversity. © 2015 John Wiley & Sons Ltd.

Phylogeography of screaming hairy armadillo Chaetophractus vellerosus: Successive disjunctions and extinctions due to cyclical climatic changes in southern South America.

PubMed

Poljak, Sebastián; Ferreiro, Alejandro M; Chiappero, Marina B; Sánchez, Julieta; Gabrielli, Magalí; Lizarralde, Marta S

2018-01-01

Little is known about phylogeography of armadillo species native to southern South America. In this study we describe the phylogeography of the screaming hairy armadillo Chaetophractus vellerosus, discuss previous hypothesis about the origin of its disjunct distribution and propose an alternative one, based on novel information on genetic variability. Variation of partial sequences of mitochondrial DNA Control Region (CR) from 73 individuals from 23 localities were analyzed to carry out a phylogeographic analysis using neutrality tests, mismatch distribution, median-joining (MJ) network and paleontological records. We found 17 polymorphic sites resulting in 15 haplotypes. Two new geographic records that expand known distribution of the species are presented; one of them links the distributions of recently synonimized species C. nationi and C. vellerosus. Screaming hairy armadillo phylogeographic pattern can be addressed as category V of Avise: common widespread linages plus closely related lineages confined to one or a few nearby locales each. The older linages are distributed in the north-central area of the species distribution range in Argentina (i.e. ancestral area of distribution). C. vellerosus seems to be a low vagility species that expanded, and probably is expanding, its distribution range while presents signs of genetic structuring in central areas. To explain the disjunct distribution, a hypothesis of extinction of the species in intermediate areas due to quaternary climatic shift to more humid conditions was proposed. We offer an alternative explanation: long distance colonization, based on null genetic variability, paleontological record and evidence of alternance of cold/arid and temperate/humid climatic periods during the last million years in southern South America.

Phylogeography of screaming hairy armadillo Chaetophractus vellerosus: Successive disjunctions and extinctions due to cyclical climatic changes in southern South America

PubMed Central

Ferreiro, Alejandro M.; Chiappero, Marina B.; Sánchez, Julieta; Gabrielli, Magalí; Lizarralde, Marta S.

2018-01-01

Little is known about phylogeography of armadillo species native to southern South America. In this study we describe the phylogeography of the screaming hairy armadillo Chaetophractus vellerosus, discuss previous hypothesis about the origin of its disjunct distribution and propose an alternative one, based on novel information on genetic variability. Variation of partial sequences of mitochondrial DNA Control Region (CR) from 73 individuals from 23 localities were analyzed to carry out a phylogeographic analysis using neutrality tests, mismatch distribution, median-joining (MJ) network and paleontological records. We found 17 polymorphic sites resulting in 15 haplotypes. Two new geographic records that expand known distribution of the species are presented; one of them links the distributions of recently synonimized species C. nationi and C. vellerosus. Screaming hairy armadillo phylogeographic pattern can be addressed as category V of Avise: common widespread linages plus closely related lineages confined to one or a few nearby locales each. The older linages are distributed in the north-central area of the species distribution range in Argentina (i.e. ancestral area of distribution). C. vellerosus seems to be a low vagility species that expanded, and probably is expanding, its distribution range while presents signs of genetic structuring in central areas. To explain the disjunct distribution, a hypothesis of extinction of the species in intermediate areas due to quaternary climatic shift to more humid conditions was proposed. We offer an alternative explanation: long distance colonization, based on null genetic variability, paleontological record and evidence of alternance of cold/arid and temperate/humid climatic periods during the last million years in southern South America. PMID:29324793

Pervasive adaptive protein evolution apparent in diversity patterns around amino acid substitutions in Drosophila simulans.

PubMed

Sattath, Shmuel; Elyashiv, Eyal; Kolodny, Oren; Rinott, Yosef; Sella, Guy

2011-02-10

In Drosophila, multiple lines of evidence converge in suggesting that beneficial substitutions to the genome may be common. All suffer from confounding factors, however, such that the interpretation of the evidence-in particular, conclusions about the rate and strength of beneficial substitutions-remains tentative. Here, we use genome-wide polymorphism data in D. simulans and sequenced genomes of its close relatives to construct a readily interpretable characterization of the effects of positive selection: the shape of average neutral diversity around amino acid substitutions. As expected under recurrent selective sweeps, we find a trough in diversity levels around amino acid but not around synonymous substitutions, a distinctive pattern that is not expected under alternative models. This characterization is richer than previous approaches, which relied on limited summaries of the data (e.g., the slope of a scatter plot), and relates to underlying selection parameters in a straightforward way, allowing us to make more reliable inferences about the prevalence and strength of adaptation. Specifically, we develop a coalescent-based model for the shape of the entire curve and use it to infer adaptive parameters by maximum likelihood. Our inference suggests that ∼13% of amino acid substitutions cause selective sweeps. Interestingly, it reveals two classes of beneficial fixations: a minority (approximately 3%) that appears to have had large selective effects and accounts for most of the reduction in diversity, and the remaining 10%, which seem to have had very weak selective effects. These estimates therefore help to reconcile the apparent conflict among previously published estimates of the strength of selection. More generally, our findings provide unequivocal evidence for strongly beneficial substitutions in Drosophila and illustrate how the rapidly accumulating genome-wide data can be leveraged to address enduring questions about the genetic basis of adaptation.

The Gln223Arg polymorphism of the leptin receptor in Pima Indians: influence on energy expenditure, physical activity and lipid metabolism.

PubMed

Stefan, N; Vozarova, B; Del Parigi, A; Ossowski, V; Thompson, D B; Hanson, R L; Ravussin, E; Tataranni, P A

2002-12-01

Leptin regulates body weight by its receptor-mediated anorectic, thermogenic and antisteatotic effects. Recently, lower leptin binding to the soluble form of the leptin receptor (LEPR) was shown in carriers of the Arg223-encoding allele of the Gln223Arg polymorphism of the LEPR. To investigate whether this variant influences energy metabolism and adiposity in Pima Indians, we genotyped non-diabetic Pima Indians in whom we had measured body composition and 24 h energy expenditure (24 h EE), physical activity level (PAL) and 24 h respiratory quotient (24 h RQ) in a respiratory chamber (n=268) and who had undergone percutaneous fat biopsies from the periumbilical region (n=184). Genotype was not associated with percent body fat (P>0.39), but was associated with 24 h EE, PAL and mean subcutaneous abdominal adipocyte size (SAAS all P<0.05). Homozygotes for the Arg223-encoding allele had lower 24 h EE (P=0.04) and PAL (P=0.007), but larger SAAS (P=0.01) than Gln homozygotes. These findings are consistent with a role of the Gln223Arg polymorphism in reducing peripheral and central leptin binding to the LEPR in humans. However, these effects do not seem to have a major impact on adiposity in this population.

Variability and distribution of COL1A2 (type I collagen) polymorphisms in the central-eastern Mediterranean Basin.

PubMed

Scorrano, Gabriele; Lelli, Roberta; Martínez-Labarga, Cristina; Scano, Giuseppina; Contini, Irene; Hafez, Hani S; Rudan, Pavao; Rickards, Olga

2016-01-01

The most abundant of the collagen protein family, type I collagen is encoded by the COL1A2 gene. The COL1A2 restriction fragment length polymorphisms (RFLPs) EcoRI, RsaI and MspI in samples from several different central-eastern Mediterranean populations were analysed and found to be potentially informative anthropogenetic markers. The objective was to define the genetic variability of COL1A2 in the central-eastern Mediterranean and to shed light on its genetic distribution in human groups over a wide geographic area. PCR-RFLP analysis of EcoRI, RsaI and MspI polymorphisms of the COL1A2 gene was performed on oral swab and blood samples from 308 individuals from the central-eastern Mediterranean Basin. The genetic similarities among these groups and other populations described in the literature were investigated through correspondence analysis. Single-marker data and haplotype frequencies seemed to suggest a genetic homogeneity within the European populations, whereas a certain degree of differentiation was noted for the Egyptians and the Turks. The genetic variability in the central-eastern Mediterranean area is probably a result of the geographical barrier of the Mediterranean Sea, which separated European and African populations over time.

Scrutinizing human MHC polymorphism: Supertype analysis using Poisson-Boltzmann electrostatics and clustering.

PubMed

Mumtaz, Shahzad; Nabney, Ian T; Flower, Darren R

2017-10-01

Peptide-binding MHC proteins are thought the most variable across the human population; the extreme MHC polymorphism observed is functionally important and results from constrained divergent evolution. MHCs have vital functions in immunology and homeostasis: cell surface MHC class I molecules report cell status to CD8+ T cells, NKT cells and NK cells, thus playing key roles in pathogen defence, as well as mediating smell recognition, mate choice, Adverse Drug Reactions, and transplantation rejection. MHC peptide specificity falls into several supertypes exhibiting commonality of binding. It seems likely that other supertypes exist relevant to other functions. Since comprehensive experimental characterization is intractable, structure-based bioinformatics is the only viable solution. We modelled functional MHC proteins by homology and used calculated Poisson-Boltzmann electrostatics projected from the top surface of the MHC as multi-dimensional descriptors, analysing them using state-of-the-art dimensionality reduction techniques and clustering algorithms. We were able to recover the 3 MHC loci as separate clusters and identify clear sub-groups within them, vindicating unequivocally our choice of both data representation and clustering strategy. We expect this approach to make a profound contribution to the study of MHC polymorphism and its functional consequences, and, by extension, other burgeoning structural systems, such as GPCRs. Copyright © 2017 Elsevier Inc. All rights reserved.

The transcobalamin codon 259 polymorphism influences the risk of human spontaneous abortion.

PubMed

Zetterberg, H; Regland, B; Palmér, M; Rymo, L; Zafiropoulos, A; Arvanitis, D A; Spandidos, D A; Blennow, K

2002-12-01

The remethylation cycle of methionine is folate and vitamin B(12) (cobalamin) dependent and appears to be crucial for embryonic development, probably through effects on synthesis of DNA, proteins and polyamines. Transcobalamin (TC) transports vitamin B(12) to the tissues. The objective of the present investigation was to explore the putative association between the major TC genetic polymorphism (Pro259Arg) and human spontaneous abortion. The prevalence of the TC Pro259Arg polymorphism was determined in DNA samples from embryos that had been spontaneously aborted between the 6th and 20th week after conception, and adult controls using solid-phase minisequencing technique. The 259-Pro allele was significantly less frequent in the spontaneous abortion group than in the control group (42.2 and 57.0% respectively; P = 0.005), while the frequency of 259-Arg was significantly increased. There was a lower prevalence of 259-Pro homozygotes in the spontaneous abortion group compared with the control group (9.1 and 32.2% respectively; P < 0.001). The 259-Pro allele seems to have beneficial influences during embryogenesis, conceivably through its positive effect on vitamin B(12) intracellular bioavailability. Our results warrant additional investigations addressing the question if vitamin B(12) supplementation in addition to folic acid supplementation may prevent spontaneous abortion in women planning a pregnancy.

The 5-HTTLPR polymorphism and posttraumatic stress disorder: a meta-analysis.

PubMed

Gressier, Florence; Calati, Raffaella; Balestri, Martina; Marsano, Agnese; Alberti, Siegfried; Antypa, Niki; Serretti, Alessandro

2013-12-01

Environmental and genetic factors contribute to the development of posttraumatic stress disorder (PTSD). Variation in the 5-HTTLPR polymorphism of the serotonin transporter gene has been hypothesized to affect risk for PTSD. With the aim of investigating this association, we conducted a meta-analysis to shed light on prior controversial results and increase statistical power to detect smaller effect sizes. PubMed and ISI databases were searched for studies published until December 2012. Twelve studies have been included, all based on trauma-exposed samples. Data were analyzed with Cochrane Collaboration Review Manager Software (Version 5). Quality and publication bias were assessed. Metaregressions were performed using Comprehensive Meta-Analysis software, Version 2. Taking into account all studies, no association was found between 5-HTTLPR and PTSD (p = .10), with evidence of between-study heterogeneity, which could be partly explained by gender differences. In sensitivity analyses, we found an association between SS genotype and PTSD in high trauma-exposed participants (p < .001). To be a carrier of the SS genotype seems to represent a risk factor for PTSD in high trauma exposure. Further studies focusing on Gene × Environment interactions are needed to better understand the role of this polymorphism in PTSD. Copyright © 2013 International Society for Traumatic Stress Studies.

Analysis of polymorphic patterns in candidate genes in Israeli patients with prostate cancer.

PubMed

Figer, Arie; Friedman, Tal; Manguoglu, Ayse Esra; Flex, Dov; Vazina, Amnon; Novikov, Ilia; Shtrieker, Avi; Sidi, A Ami; Tichler, Thomas; Sapir, Einat Even; Baniel, Jack; Friedman, Eitan

2003-10-01

The precise genes involved in conferring prostate cancer risk in sporadic and familial cases are not fully known. To evaluate the genetic profile within several candidate genes of unselected prostate cancer cases and to correlate this profile with disease parameters. Jewish Israeli prostate cancer patients (n = 224) were genotyped for polymorphisms within candidate genes: p53, ER, VDR, GSTT1, CYP1A1, GSTP1, GSTM1, EPHX and HPC2/ELAC2, followed by analysis of the genotype with relevant clinical and pathologic parameters. The EPHX gene His113 allele was detected in 21.4% (33/154) of patients in whom disease was diagnosed above 61 years, compared with 5.7% (4/70) in earlier onset disease (P < 0.001). Within the group of late-onset disease, the same allele was noted in 5.5% (2/36) with grade I tumors compared with 18% (34/188) with grade II and up (P = 0.004). All other tested polymorphisms were not associated with a distinct clinical or pathologic feature in a statistically significant manner. In Israeli prostate cancer patients, the EPHX His113 allele is seemingly associated with a more advanced, late-onset disease. These preliminary data need to be confirmed by a larger and more ethnically diverse study.

Polymorphism of the MHC class II Eb gene determines the protection against collagen-induced arthritis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gonzalez-Gay, M.A.; Zanelli, E.; Krco, C.J.

1995-05-01

Collagen-induced arthritis (CIA) is an animal model of auto immune polyarthritis, sharing similarities with rheumatoid arthritis (RA). Paradoxally, susceptibility to mouse CIA is controlled by the H2A loci (DQ homologous) while RA is linked to HLA.DR genes (H2E homologous). We recently showed that the E{beta}{sup d} molecule prevents CIA development in susceptible H2{sup q} mice. We addressed the question of whether H2Eb polymorphism will influence CIA incidence as HLA.DRB1 polymorphism does in RA. In F{sub 1} mice, only H2Eb{sup d} and H2Eb{sup s} molecules showed protection. Using recombinant B10.RDD (Eb{sup d/b}) mice, we found that CIA protection was mediated bymore » the first domain of the E{beta}{sup d} molecule. Using peptides covering the third hypervariable region of the E{beta} chain, we found a perfect correlation between presentation of E{beta} peptides by the H2A{sup q} molecule and protection on CIA. Therefore, the mechanism by which H2Eb protects against CIA seems to rely on the affinity of E{beta} peptides for the H2A{sup q} molecule. 35 refs., 2 figs., 3 tabs.« less

Enhancement of the conductivity detection signal in capillary electrophoresis systems using neutral cyclodextrins as sweeping agents.

PubMed

Boublík, Milan; Riesová, Martina; Dubský, Pavel; Gaš, Bohuslav

2018-06-01

Conductivity detection is a universal detection technique often encountered in electrophoretic separation systems, especially in modern chip-electrophoresis based devices. On the other hand, it is sparsely combined with another contemporary trend of enhancing limits of detection by means of various preconcentration strategies. This can be attributed to the fact that a preconcentration experimental setup usually brings about disturbances in a conductivity baseline. Sweeping with a neutral sweeping agent seems a good candidate for overcoming this problem. A neutral sweeping agent does not hinder the conductivity detection while a charged analyte may preconcentrate on its boundary due to a decrease in its effective mobility. This study investigates such sweeping systems theoretically, by means of computer simulations, and experimentally. A formula is provided for the reliable estimation of the preconcentration factor. Additionally, it is demonstrated that the conductivity signal can significantly benefit from slowing down the analyte and thus the overall signal enhancement can easily overweight amplification caused solely by the sweeping process. The overall enhancement factor can be deduced a priori from the linearized theory of electrophoresis implemented in the PeakMaster freeware. Sweeping by neutral cyclodextrin is demonstrated on an amplification of a conductivity signal of flurbiprofen in a real drug sample. Finally, a possible formation of unexpected system peaks in systems with a neutral sweeping agent is revealed by the computer simulation and confirmed experimentally. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

NON-NEUTRALIZED ELECTRIC CURRENT PATTERNS IN SOLAR ACTIVE REGIONS: ORIGIN OF THE SHEAR-GENERATING LORENTZ FORCE

DOE Office of Scientific and Technical Information (OSTI.GOV)

Georgoulis, Manolis K.; Titov, Viacheslav S.; Mikic, Zoran

Using solar vector magnetograms of the highest available spatial resolution and signal-to-noise ratio, we perform a detailed study of electric current patterns in two solar active regions (ARs): a flaring/eruptive and a flare-quiet one. We aim to determine whether ARs inject non-neutralized (net) electric currents in the solar atmosphere, responding to a debate initiated nearly two decades ago that remains inconclusive. We find that well-formed, intense magnetic polarity inversion lines (PILs) within ARs are the only photospheric magnetic structures that support significant net current. More intense PILs seem to imply stronger non-neutralized current patterns per polarity. This finding revises previousmore » works that claim frequent injections of intense non-neutralized currents by most ARs appearing in the solar disk but also works that altogether rule out injection of non-neutralized currents. In agreement with previous studies, we also find that magnetically isolated ARs remain globally current-balanced. In addition, we confirm and quantify the preference of a given magnetic polarity to follow a given sense of electric currents, indicating a dominant sense of twist in ARs. This coherence effect is more pronounced in more compact ARs with stronger PILs and must be of sub-photospheric origin. Our results yield a natural explanation of the Lorentz force, invariably generating velocity and magnetic shear along strong PILs, thus setting a physical context for the observed pre-eruption evolution in solar ARs.« less

Helium Energetic Neutral Atoms from the Heliosphere: Perspectives for Future Observations

DOE Office of Scientific and Technical Information (OSTI.GOV)

Swaczyna, Paweł; Grzedzielski, Stan; Bzowski, Maciej, E-mail: pswaczyna@cbk.waw.pl

2017-05-10

Observations of energetic neutral atoms (ENAs) allow for remote sensing of plasma properties in distant regions of the heliosphere. So far, most of the observations have concerned only hydrogen atoms. In this paper, we present perspectives for observations of helium energetic neutral atoms (He ENAs). We calculated the expected intensities of He ENAs created by the neutralization of helium ions in the inner heliosheath and through the secondary ENA mechanism in the outer heliosheath. We found that the dominant source region for He ENAs is the inner heliosheath. The obtained magnitudes of intensity spectra suggest that He ENAs can bemore » observed with future ENA detectors, as those planned on Interstellar Mapping and Acceleration Probe . Observing He ENAs is most likely for energies from a few to a few tens of keV/nuc. Estimates of the expected count rates show that the ratio of helium to hydrogen atoms registered in the detectors can be as low as 1:10{sup 4}. Consequently, the detectors need to be equipped with an appropriate mass spectrometer capability, allowing for recognition of chemical elements. Due to the long mean free paths of helium ions in the inner heliosheath, He ENAs are produced also in the distant heliospheric tail. This implies that observations of He ENAs can resolve its structure, which seems challenging from observations of hydrogen ENAs since energetic protons are neutralized before they progress deeper in the heliospheric tail.« less

Life History Traits, Protein Evolution, and the Nearly Neutral Theory in Amniotes.

PubMed

Figuet, Emeric; Nabholz, Benoît; Bonneau, Manon; Mas Carrio, Eduard; Nadachowska-Brzyska, Krystyna; Ellegren, Hans; Galtier, Nicolas

2016-06-01

The nearly neutral theory of molecular evolution predicts that small populations should accumulate deleterious mutations at a faster rate than large populations. The analysis of nonsynonymous (dN) versus synonymous (dS) substitution rates in birds versus mammals, however, has provided contradictory results, questioning the generality of the nearly neutral theory. Here we analyzed the impact of life history traits, taken as proxies of the effective population size, on molecular evolutionary and population genetic processes in amniotes, including the so far neglected reptiles. We report a strong effect of species body mass, longevity, and age of sexual maturity on genome-wide patterns of polymorphism and divergence across the major groups of amniotes, in agreement with the nearly neutral theory. Our results indicate that the rate of protein evolution in amniotes is determined in the first place by the efficiency of purifying selection against deleterious mutations-and this is true of both radical and conservative amino acid changes. Interestingly, the among-species distribution of dN/dS in birds did not follow this general trend: dN/dS was not higher in large, long-lived than in small, short-lived species of birds. We show that this unexpected pattern is not due to a more narrow range of life history traits, a lack of correlation between traits and Ne, or a peculiar distribution of fitness effects of mutations in birds. Our analysis therefore highlights the bird dN/dS ratio as a molecular evolutionary paradox and a challenge for future research. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Structural Insights into Antibody Sequestering and Neutralizing of Na+ Channel α-Type Modulator from Old World Scorpion Venom

PubMed Central

Fabrichny, Igor P.; Mondielli, Grégoire; Conrod, Sandrine; Martin-Eauclaire, Marie-France; Bourne, Yves; Marchot, Pascale

2012-01-01

The Old World scorpion Androctonus australis hector (Aah) produces one of the most lethal venoms for humans. Peptidic α-toxins AahI to AahIV are responsible for its potency, with AahII accounting for half of it. All four toxins are high affinity blockers of the fast inactivation phase of mammalian voltage-activated Na+ channels. However, the high antigenic polymorphism of α-toxins prevents production of a polyvalent neutralizing antiserum, whereas the determinants dictating their trapping by neutralizing antibodies remain elusive. From an anti-AahII mAb, we generated an antigen binding fragment (Fab) with high affinity and selectivity for AahII and solved a 2.3 Å-resolution crystal structure of the complex. Sequestering of the C-terminal region of the bound toxin within a groove formed by the Fab combining loops is associated with a toxin orientation and main and side chain conformations that dictate the AahII antigenic specificity and efficient neutralization. From an anti-AahI mAb, we also preformed and crystallized a high affinity AahI-Fab complex. The 1.6 Å-resolution structure solved revealed a Fab molecule devoid of a bound AahI and with combining loops involved in packing interactions, denoting expulsion of the bound antigen upon crystal formation. Comparative analysis of the groove-like combining site of the toxin-bound anti-AahII Fab and planar combining surface of the unbound anti-AahI Fab along with complementary data from a flexible docking approach suggests occurrence of distinctive trapping orientations for the two toxins relative to their respective Fab. This study provides complementary templates for designing new molecules aimed at capturing Aah α-toxins and suitable for immunotherapy. PMID:22371498

Type 2 diabetes mellitus: association study of five candidate genes in an Indian population of Guadeloupe, genetic contribution of FABP2 polymorphism.

PubMed

Boullu-Sanchis, S; Leprêtre, F; Hedelin, G; Donnet, J P; Schaffer, P; Froguel, P; Pinget, M

1999-06-01

We studied by PCR-RFLP 6 polymorphisms in these 5 candidate genes: Ala54Thr in the fatty acid binding protein 2 gene (FABP2), A to G substitution in the uncoupling protein type 1 gene (UCP1), Asp905Tyr in the protein phosphatase type 1 gene (PP1G), Trp64Arg in the human beta 3 adrenergic receptor gene (beta 3AR) and 2 RFLP sites of the vitamin D receptor (VDR) gene (VDRTaq1 and VDRApa1). This study was conducted among 89 cases and 100 controls matched according to age, gender and absence of first degree family link (11 triplets with 2 controls for 1 case and 78 pairs with 1 control for 1 case). Cases and controls were taken among a sample of 429 individuals selected for the study of the prevalence of diabetes in this ethnic group from Guadeloupe. By conditional logistic regression analysis, there was a significant relation (p = 0.02) between the Ala54Thr FABP2 polymorphism and Type 2 DM. Multivariate analysis discriminate the FABP2 polymorphism (p = 0.10), a triglyceridemia over 2 g/l (p < 10(-3)) and high blood pressure (p = 10(-2)) as variables associated with Type 2 DM in this population. These findings suggest that FABP2 does not represent a major gene for Type 2 DM in this migrant Indian population living in Guadeloupe, but seems to be related to the metabolic insulin resistance syndrome.

A comparative genomics strategy for targeted discovery of single-nucleotide polymorphisms and conserved-noncoding sequences in orphan crops.

PubMed

Feltus, F A; Singh, H P; Lohithaswa, H C; Schulze, S R; Silva, T D; Paterson, A H

2006-04-01

Completed genome sequences provide templates for the design of genome analysis tools in orphan species lacking sequence information. To demonstrate this principle, we designed 384 PCR primer pairs to conserved exonic regions flanking introns, using Sorghum/Pennisetum expressed sequence tag alignments to the Oryza genome. Conserved-intron scanning primers (CISPs) amplified single-copy loci at 37% to 80% success rates in taxa that sample much of the approximately 50-million years of Poaceae divergence. While the conserved nature of exons fostered cross-taxon amplification, the lesser evolutionary constraints on introns enhanced single-nucleotide polymorphism detection. For example, in eight rice (Oryza sativa) genotypes, polymorphism averaged 12.1 per kb in introns but only 3.6 per kb in exons. Curiously, among 124 CISPs evaluated across Oryza, Sorghum, Pennisetum, Cynodon, Eragrostis, Zea, Triticum, and Hordeum, 23 (18.5%) seemed to be subject to rigid intron size constraints that were independent of per-nucleotide DNA sequence variation. Furthermore, we identified 487 conserved-noncoding sequence motifs in 129 CISP loci. A large CISP set (6,062 primer pairs, amplifying introns from 1,676 genes) designed using an automated pipeline showed generally higher abundance in recombinogenic than in nonrecombinogenic regions of the rice genome, thus providing relatively even distribution along genetic maps. CISPs are an effective means to explore poorly characterized genomes for both DNA polymorphism and noncoding sequence conservation on a genome-wide or candidate gene basis, and also provide anchor points for comparative genomics across a diverse range of species.

A Comparative Genomics Strategy for Targeted Discovery of Single-Nucleotide Polymorphisms and Conserved-Noncoding Sequences in Orphan Crops1[W

PubMed Central

Feltus, F.A.; Singh, H.P.; Lohithaswa, H.C.; Schulze, S.R.; Silva, T.D.; Paterson, A.H.

2006-01-01

Completed genome sequences provide templates for the design of genome analysis tools in orphan species lacking sequence information. To demonstrate this principle, we designed 384 PCR primer pairs to conserved exonic regions flanking introns, using Sorghum/Pennisetum expressed sequence tag alignments to the Oryza genome. Conserved-intron scanning primers (CISPs) amplified single-copy loci at 37% to 80% success rates in taxa that sample much of the approximately 50-million years of Poaceae divergence. While the conserved nature of exons fostered cross-taxon amplification, the lesser evolutionary constraints on introns enhanced single-nucleotide polymorphism detection. For example, in eight rice (Oryza sativa) genotypes, polymorphism averaged 12.1 per kb in introns but only 3.6 per kb in exons. Curiously, among 124 CISPs evaluated across Oryza, Sorghum, Pennisetum, Cynodon, Eragrostis, Zea, Triticum, and Hordeum, 23 (18.5%) seemed to be subject to rigid intron size constraints that were independent of per-nucleotide DNA sequence variation. Furthermore, we identified 487 conserved-noncoding sequence motifs in 129 CISP loci. A large CISP set (6,062 primer pairs, amplifying introns from 1,676 genes) designed using an automated pipeline showed generally higher abundance in recombinogenic than in nonrecombinogenic regions of the rice genome, thus providing relatively even distribution along genetic maps. CISPs are an effective means to explore poorly characterized genomes for both DNA polymorphism and noncoding sequence conservation on a genome-wide or candidate gene basis, and also provide anchor points for comparative genomics across a diverse range of species. PMID:16607031

The haptoglobin promoter polymorphism rs5471 is the most definitive genetic determinant of serum haptoglobin level in a Ghanaian population.

PubMed

Soejima, Mikiko; Teye, Kwesi; Koda, Yoshiro

2018-08-01

The serum haptoglobin (HP) level varies in various clinical conditions and among individuals. Recently, the common HP alleles, rs5472, and rs2000999 have been reported to associate with serum HP level, but no studies have been done on Africans. Here, we explored the relationship of not only these polymorphisms but also rs5470 and rs5471 to the serum HP level in 121 Ghanaians. Genotyping of rs2000999 was performed by PCR using hydrolysis probes, while the other polymorphisms have been already genotyped. Serum HP level was measured by a sandwich ELISA. We observed a significant association between rs5471 and the serum HP level (p = 0.026). It was also observed within the subgroups of HP 2 /HP 2 and HP 2 /HP 1 . In addition, we detected a trend toward lower HP levels for individuals with the A allele of rs2000999 than those without A, but it was not statistically significant (p = 0.156). However, we did not observe the clear associations between other polymorphisms and serum HP level that were observed for Europeans and Asians because of the small sample size and the complexity of SNPs affecting the HP level. We suggest that rs5471 is a strong genetic determinant of HP levels in Ghanaians, and this seems to be characteristic of Africans. Further investigation using large scale samples will help in understanding the genetic background of individual variability of the serum HP level. Copyright © 2018 Elsevier B.V. All rights reserved.

The -913 G/A glutamine:fructose-6-phosphate aminotransferase gene polymorphism is associated with measures of obesity and intramyocellular lipid content in nondiabetic subjects.

PubMed

Weigert, Cora; Thamer, Claus; Brodbeck, Katrin; Guirguis, Alke; Machicao, Fausto; Machann, Jürgen; Schick, Fritz; Stumvoll, Michael; Fritsche, Andreas; Häring, Hans U; Schleicher, Erwin D

2005-03-01

Increases in glutamine:fructose-6-phosphate aminotransferase (GFAT) protein levels directly activate flux through the hexosamine biosynthetic pathway. This pathway has been involved as a fuel sensor in energy metabolism and development of insulin resistance. We screened the 5'-flanking region of the human GFAT gene for polymorphisms and subsequently genotyped 412 nondiabetic, metabolically characterized Caucasians for the two single-nucleotide polymorphisms (SNP) at positions -913 (G/A) and -1412 (C/G) with rare allele frequencies of 42% and 16%, respectively. The -913 G SNP was associated with significantly higher body mass index and percent body fat in men (P = 0.02 and 0.004, respectively), but not in women (P = 0.47 and 0.26, respectively). In the subgroup of individuals (n = 193) who underwent hyperinsulinemic-euglycemic clamp, an association of the -913 G SNP with insulin sensitivity independent of body mass index was not detected. Moreover, the -913 G allele in a group of 71 individuals who had undergone magnetic resonance spectroscopy was associated with higher intramyocellular lipid content (IMCL) in tibialis anterior muscle (4.21 +/- 0.31 vs. 3.36 +/- 0.35; P = 0.04) independent of percent body fat and maximal aerobic power. The -1412 SNP had no effect on percent body fat, insulin sensitivity, or IMCL. In conclusion, we identified two polymorphisms in the 5'-flanking region of GFAT, of which the -913 SNP seems to alter the risk for obesity and IMCL accumulation in male subjects.

Relationship between GSTM1 and GSTT1 polymorphisms and schizophrenia: a case-control study in a Tunisian population.

PubMed

Raffa, Monia; Lakhdar, Ramzi; Ghachem, Meriem; Barhoumi, Sana; Safar, Mohamed Taher; Bel Hadj Jrad, Besma; Haj Khelil, Amel; Kerkeni, Abdelhamid; Mechri, Anwar

2013-01-10

There is substantial evidence found in the literature that supports the fact that the presence of oxidative stress may play an important role in the pathophysiology of schizophrenia. The glutathione S-transferases (GSTs) forms one of the major detoxifying groups of enzymes responsible for eliminating products of oxidative stress. Interindividual differences observed in the metabolism of xenobiotics have been attributed to the genetic polymorphism of genes coding for enzymes involved in detoxification. Thus, in this study we investigated the association of glutathione S-transferase Mu-1 (GSTM1) and glutathione S-transferase theta-1 (GSTT1) gene deletion polymorphisms and schizophrenia in a Tunisian population. A case-control study including 138 schizophrenic patients and 123 healthy controls was enrolled. The GSTM1 and GSTT1 polymorphisms were analyzed by multiplex polymerase chain reaction (PCR). No association was found between the GSTM1 genotype and schizophrenia, whereas the prevalence of the GSTT1 active genotype was significantly higher in the schizophrenic patients (57.2%) than in the controls (45.5%) with (OR=0.6, IC 0.37-0.99, p=0.039). Thus, we noted a significant association between schizophrenia and GSTT1 active genotype. Furthermore, the combination of the GSTM1 and GSTT1 null genotypes showed a non-significant trend to an increased risk of schizophrenia. The present finding indicated that GSTT1 seems to be a candidate gene for susceptibility to schizophrenia in at least Tunisian population. Copyright © 2012 Elsevier B.V. All rights reserved.

Meta-analysis of factor V Leiden and prothrombin G20210A polymorphism in migraine.

PubMed

Lippi, Giuseppe; Mattiuzzi, Camilla; Cervellin, Gianfranco

2015-01-01

Migraine is a frequent and disabling condition, which exhibits a substantial genetic background and is frequently associated with abnormalities of primary and secondary hemostasis. We performed a systematic literature search and a meta-analysis of available data about the potential associations between migraine and factor V (FV) Leiden or prothrombin (FII) G20210A gene polymorphism. The final number of studies included was 15 (all cross-sectional) about migraine and FV Leiden, and 12 (all cross-sectional) about migraine and FII G20210A polymorphism, with broad inter-study heterogeneity (I², 82 and 85%). The cumulative prevalence of the FV 1691A allele was found to be similar between cases (n = 1450; 4.9%) and controls (n = 3468; 4.7%; P = 0.74). The cumulative prevalence of the FII 20210A allele was also found to be similar between cases (n = 1226; 4.2%) and controls (n = 3144; 4.5%; P = 0.59). Nevertheless, sub-analysis of studies in adults and children revealed that both polymorphisms were not associated with migraine in adults, but FV Leiden and the FII 20210A allele were approximately two-fold more prevalent in children with migraine than in those without. In conclusion, despite migraine exhibits a clear neurovascular origin and is frequently associated with thrombotic disorders, isolate thrombophilic mutations seem to play a negligible pathogenetic role in this condition in adults, whereas the increased prevalence of FV Leiden and the FII 20210A allele in children with migraine deserves further scrutiny.

The selective processing of emotional visual stimuli while detecting auditory targets: an ERP analysis.

PubMed

Schupp, Harald T; Stockburger, Jessica; Bublatzky, Florian; Junghöfer, Markus; Weike, Almut I; Hamm, Alfons O

2008-09-16

Event-related potential studies revealed an early posterior negativity (EPN) for emotional compared to neutral pictures. Exploring the emotion-attention relationship, a previous study observed that a primary visual discrimination task interfered with the emotional modulation of the EPN component. To specify the locus of interference, the present study assessed the fate of selective visual emotion processing while attention is directed towards the auditory modality. While simply viewing a rapid and continuous stream of pleasant, neutral, and unpleasant pictures in one experimental condition, processing demands of a concurrent auditory target discrimination task were systematically varied in three further experimental conditions. Participants successfully performed the auditory task as revealed by behavioral performance and selected event-related potential components. Replicating previous results, emotional pictures were associated with a larger posterior negativity compared to neutral pictures. Of main interest, increasing demands of the auditory task did not modulate the selective processing of emotional visual stimuli. With regard to the locus of interference, selective emotion processing as indexed by the EPN does not seem to reflect shared processing resources of visual and auditory modality.

Anti-MPER antibodies with heterogeneous neutralization capacity are detectable in most untreated HIV-1 infected individuals

PubMed Central

2014-01-01

Background The MPER region of the HIV-1 envelope glycoprotein gp41 is targeted by broadly neutralizing antibodies. However, the localization of this epitope in a hydrophobic environment seems to hamper the elicitation of these antibodies in HIV infected individuals. We have quantified and characterized anti-MPER antibodies by ELISA and by flow cytometry using a collection of mini gp41-derived proteins expressed on the surface of 293T cells. Longitudinal plasma samples from 35 HIV-1 infected individuals were assayed for MPER recognition and MPER-dependent neutralizing capacity using HIV-2 viruses engrafted with HIV-1 MPER sequences. Results Miniproteins devoid of the cysteine loop of gp41 exposed the MPER on 293T cell membrane. Anti-MPER antibodies were identified in most individuals and were stable when analyzed in longitudinal samples. The magnitude of the responses was strongly correlated with the global response to the HIV-1 envelope glycoprotein, suggesting no specific limitation for anti-MPER antibodies. Peptide mapping showed poor recognition of the C-terminal MPER moiety and a wide presence of antibodies against the 2F5 epitope. However, antibody titers failed to correlate with 2F5-blocking activity and, more importantly, with the specific neutralization of HIV-2 chimeric viruses bearing the HIV-1 MPER sequence; suggesting a strong functional heterogeneity in anti-MPER humoral responses. Conclusions Anti-MPER antibodies can be detected in the vast majority of HIV-1 infected individuals and are generated in the context of the global anti-Env response. However, the neutralizing capacity is heterogeneous suggesting that eliciting neutralizing anti-MPER antibodies by immunization might require refinement of immunogens to skip nonneutralizing responses. PMID:24909946

If F(ST) does not measure neutral genetic differentiation, then comparing it with Q(ST) is misleading. Or is it?

PubMed

Edelaar, Pim; Björklund, Mats

2011-05-01

The comparison between neutral genetic differentiation (F(ST) ) and quantitative genetic differentiation (Q(ST) ) is commonly used to test for signatures of selection in population divergence. However, there is an ongoing discussion about what F(ST) actually measures, even resulting in some alternative metrics to express neutral genetic differentiation. If there is a problem with F(ST) , this could have repercussions for its comparison with Q(ST) as well. We show that as the mutation rate of the neutral marker increases, F(ST) decreases: a higher within-population heterozygosity (He) yields a lower F(ST) value. However, the same is true for Q(ST) : a higher mutation rate for the underlying QTL also results in a lower Q(ST) estimate. The effect of mutation rate is equivalent in Q(ST) and F(ST) . Hence, the comparison between Q(ST) and F(ST) remains valid, if one uses neutral markers whose mutation rates are not too high compared to those of quantitative traits. Usage of highly variable neutral markers such as hypervariable microsatellites can lead to serious biases and the incorrect inference that divergent selection has acted on populations. Much of the discussion on F(ST) seems to stem from the misunderstanding that it measures the differentiation of populations, whereas it actually measures the fixation of alleles. In their capacity as measures of population differentiation, Hedrick's G'(ST) and Jost's D reach their maximum value of 1 when populations do not share alleles even when there remains variation within populations, which invalidates them for comparisons with Q(ST) . © 2011 Blackwell Publishing Ltd.

A study on the association of TNF-α(-308), IL-6(-174), IL-10(-1082) and IL-1Ra(VNTR) gene polymorphisms with rheumatic heart disease in Pakistani patients.

PubMed

Rehman, Sadia; Akhtar, Naveed; Saba, Nusrat; Munir, Saeeda; Ahmed, Waqar; Mohyuddin, Aisha; Khanum, Azra

2013-02-01

Inflammation is an important contributor to the pathogenesis of rheumatic heart disease (RHD), a disorder of heart valves caused by a combination of immune, genetic and environmental factors. Cytokines are important mediators of inflammatory and immune responses. The aim of this study was to investigate the role of cytokine gene polymorphisms and their potential usefulness as biomarkers in RHD patients from Pakistan. We screened 150 RHD patients and 204 ethnically matched controls for tumor necrosis factor (TNF)-α(-308)G/A, interleukin (IL)-10(-1082) G/A, interleukin (IL)-6(-174) G/C and a variable number of tandem repeats (VNTRs) polymorphism of the IL-1Ra gene using polymerase chain reaction. The results showed that TNF-α(-308) A and IL-6(-174) G alleles were associated with susceptibility to RHD (p=0.000; OR=2.81; CI=1.5-5.14 and p=0.025; OR=1.50; CI=1.04-2.16 respectively). The TNF-α(-308) AA and GA genotypes were associated with susceptibility to RHD (p=0.012; OR=9.94; CI; 1.21-217.3 and p=0.046; OR=1.97; CI=0.98-3.97 respectively) while the GG genotype seemed to confer resistance (p=0.003; OR=0.39; CI=0.20-0.76). The GG genotype for IL-6(-174) was significantly associated with predisposition to RHD (p=0.015; OR=2.6; CI=1.17-5.85). The A1 (four repeats) and A2 (two repeats) alleles at the IL-1Ra VNTR polymorphism were associated with resistance and susceptibility to RHD respectively. However, this polymorphism deviated from Hardy-Weinberg equilibrium in both patients and controls in our population. TNF-α(-308) and IL-6(-174) polymorphisms may be useful markers for the identification of individuals susceptible to RHD in Pakistan. These individuals could be provided aggressive prophylactic intervention to prevent the morbidity and mortality associated with RHD. Copyright © 2012 Elsevier Ltd. All rights reserved.

Interactive effects of the ACE DD polymorphism with the NOS III homozygous G849T (Glu298-->Asp) variant in determining endothelial function in coronary artery disease.

PubMed

Schmidt, Michael A; Chakrabarti, Anjan K; Kehrer, Chris; Pfeninnger, Dana; Brook, Robert D; Kaciroti, Niko; Duvernoy, Claire; Killeen, Anthony A; Rajagopalan, Sanjay

2003-01-01

The products of nitric oxide synthase (NOS) and angiotensin-converting enzyme (ACE) play a critical role in determining vessel wall structure and function. Polymorphisms in both genes have been independently demonstrated to influence propensity to cardiovascular events. The purpose of this study was to determine the influence of the homozygous G849T (Glu298-->Asp) polymorphism in NOS III on peripheral conduit artery endothelial function and to elucidate the modifier role, if any, of a common ACE polymorphism. Three hundred and ninety-seven consecutive subjects presenting to the cardiac catheterization laboratory of the University of Michigan over a period of 18 months were recruited. DNA was extracted and polymerase chain reaction (PCR) analysis for ACE and NOS polymorphisms performed. Patients with homozygosity for G849T at both loci (TT) who belong to DD and II ACE genotype (groups 1 and 2) and those who are negative for this polymorphism (GG) and belong to either DD or II genotype (groups 3 and 4) were identified. The four groups then underwent determination of conduit endothelial function. Heterozygosity of Glu298-Asp or the ID variant of the ACE were not studied. Median FMD value in the TT-DD group was 0.20 (-3.17, 2.01) compared with 2.23% (-0.29, 4.17) in the GG-II group. Median values in the TT-II and the GG-DD groups were 3.04 (-1.16, 6.61) and 2.46% (-1.83, 6.52) respectively. These values were not statistically significant (p > 0.05 by one-way ANOVA). Median nitroglycerin-mediated dilation in the four groups did not differ between the four groups (p = NS by ANOVA). Atherosclerosis burdens as assessed by angiography were not different across the groups. In conclusion, the homozygous NOS III variant (GG) status does not seem to interact additively with the ACE homozygous DD genotype in determining flow-mediated vasodilation in individuals with established atherosclerosis and pre-existent endothelial dysfunction.

The AGT Gene M235T Polymorphism and Response of Power-Related Variables to Aerobic Training

PubMed Central

Aleksandra, Zarębska; Zbigniew, Jastrzębski; Waldemar, Moska; Agata, Leońska-Duniec; Mariusz, Kaczmarczyk; Marek, Sawczuk; Agnieszka, Maciejewska-Skrendo; Piotr, Żmijewski; Krzysztof, Ficek; Grzegorz, Trybek; Ewelina, Lulińska-Kuklik; Semenova, Ekaterina A.; Ahmetov, Ildus I.; Paweł, Cięszczyk

2016-01-01

The C allele of the M235T (rs699) polymorphism of the AGT gene correlates with higher levels of angiotensin II and has been associated with power and strength sport performance. The aim of the study was to investigate whether or not selected power-related variables and their response to a 12-week program of aerobic dance training are modulated by the AGT M235T genotype in healthy participants. Two hundred and one Polish Caucasian women aged 21 ± 1 years met the inclusion criteria and were included in the study. All women completed a 12-week program of low and high impact aerobics. Wingate peak power and total work capacity, 5 m, 10 m, and 30 m running times and jump height and jump power were determined before and after the training programme. All power-related variables improved significantly in response to aerobic dance training. We found a significant association between the M235T polymorphism and jump-based variables (squat jump (SJ) height, p = 0.005; SJ power, p = 0.015; countermovement jump height, p = 0.025; average of 10 countermovement jumps with arm swing (ACMJ) height, p = 0.001; ACMJ power, p = 0.035). Specifically, greater improvements were observed in the C allele carriers in comparison with TT homozygotes. In conclusion, aerobic dance, one of the most commonly practiced adult fitness activities in the world, provides sufficient training stimuli for augmenting the explosive strength necessary to increase vertical jump performance. The AGT gene M235T polymorphism seems to be not only a candidate gene variant for power/strength related phenotypes, but also a genetic marker for predicting response to training. Key points Aerobic dance provides sufficient training stimuli for the improvement of explosive power. The AGT gene M235T polymorphism is associated with individual variation in the change of power-related phenotypes in response to aerobic dance training. The C allele carriers of the AGT gene M235T polymorphism show greater improvements of jump-based variables in comparison with TT homozygotes. PMID:27928207

A meta-analysis of interleukin-10-1082 promoter genetic polymorphism associated with atherosclerotic risk.

PubMed

Chao, Li; Lei, Huang; Fei, Jin

2014-01-01

This meta-analysis was conducted to assess the relationship between interleukin-10-1082 G/A single nucleotide polymorphism with atherosclerosis (AS) risk. The databases of PubMed, EMBASE, Chinese National Knowledge Infrastructure and Wan-Fang were searched from January 2000 to January 2014. 16 studies (involving 7779 cases and 7271 controls) were finally included. Each eligible study was scored for quality assessment. We adopted the most probably appropriate genetic model (recessive model) after carefully calculation. Between study heterogeneity was explored by subgroup analysis and publication bias was estimated by Begg's funnel plot and Egger's regression test. Statistically significant association was observed between AA genotype with overall AS risk, being mainly in coronary heart disease and stroke subgroups among Asian population, and peripheral artery disease (PAD) subgroup among Caucasians. Interleukin-10-1082 AA genotype is associated with increased overall AS risk. AA carriers of Asians seem to be more susceptible to coronary artery disease and stroke, and Caucasians are more susceptible to PAD.

HLA-G in human reproduction: aspects of genetics, function and pregnancy complications.

PubMed

Hviid, Thomas Vauvert F

2006-01-01

The non-classical human leukocyte antigen (HLA) class Ib genes, HLA-E, -G and -F, are located on chromosome 6 in the human major histocompatibility complex (MHC). HLA class Ib antigens resemble the HLA class Ia antigens in many ways, but several major differences have been described. This review will, in particular, discuss HLA-G and its role in human reproduction and in the human MHC. HLA-G seems to be important in the modulation of the maternal immune system during pregnancy and thereby the maternal acceptance of the semiallogenic fetus. Recent findings regarding aspects of HLA-G polymorphism, the possible significance of this polymorphism in respect to HLA-G function and certain complications of pregnancy (such as pre-eclampsia and recurrent spontaneous abortions (RSA)) are discussed together with possible importance to IVF. Finally, aspects of a possible role of HLA-G in organ transplantation and in inflammatory or autoimmune disease, and of HLA-G in an evolutionary context, are also briefly examined.

Detection of Pneumocystis jirovecii dihydropteroate synthase polymorphisms in patients with Pneumocystis pneumonia.

PubMed

Costa, M C; Gaspar, J; Mansinho, K; Esteves, F; Antunes, F; Matos, O

2005-01-01

In the present study, in order to improve the detection of Pneumocystis jirovecii dihydropteroate synthase (DHPS) mutations in pulmonary specimens of HIV-infected patients with P. jirovecii pneumonia, we evaluated a microfiltration procedure for the removal of human cell contamination and a nested-PCR method, for amplification in specimens with low parasite load. In the studied population, PCR amplification of the DHPS gene was more successful in unfiltered than in filtered specimens, with both touchdown-PCR and nested-PCR procedures (p<0.05 and p<0.001, respectively), but the amount of host DNA in the samples analysed seems to be inversely related with the successful PCR parasite detection. Amplification of P. jirovecii DHPS gene with nested-PCR was achieved in 77.5% of the specimens studied, demonstrating that this is a useful method for the identification of mutations in pulmonary specimens, including samples with low parasite loads, and will facilitate the evaluation of the relationship between the P. jirovecii DHPS polymorphisms and clinical resistance to sulfa drugs.

Association of telomerase gene hTERT polymorphism and malignant gliomas.

PubMed

Carpentier, Catherine; Lejeune, Julie; Gros, Florent; Everhard, Sibille; Marie, Yannick; Kaloshi, Gentian; Laigle-Donadey, Florence; Hoang-Xuan, Khe; Delattre, Jean-Yves; Sanson, Marc

2007-09-01

The MNS16A polymorphism is located in the downstream region of the hTERT gene and affects telomerase activity. MNS16A has been investigated as a potential risk factor and/or prognostic marker for malignant glioma in a cohort of 352 patients (205 glioblastoma, 147 anaplastic gliomas) and 305 controls. The S ("short") allele (which results in a higher telomerase activity) was significantly more frequent in glioma patients compared to the control population (278/704=39.5% vs. 200/610=32.8%; P=0.012). The odd ratios were 1 for LL (taken as reference), 1.33 [0.96; 1.84] for SL and 2.05 [1.22; 3.44] for SS. However, in contrast to a previous report, no significant difference of survival was found between SS, LL and SL allelotypes. We found here the short allele of MNS16A more frequent in glioma patients, but it did not seem to be predictive of survival.

Genetics of osteoporosis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Urano, Tomohiko; Inoue, Satoshi, E-mail: INOUE-GER@h.u-tokyo.ac.jp; Department of Anti-Aging Medicine, Graduate School of Medicine, The University of Tokyo, Tokyo 113-8655

Highlights: • Single-nucleotide polymorphisms (SNPs) associated with osteoporosis were identified. • SNPs mapped close to or within VDR and ESR1 are associated with bone mineral density. • WNT signaling pathway plays a pivotal role in regulating bone mineral density. • Genetic studies will be useful for identification of new therapeutic targets. - Abstract: Osteoporosis is a skeletal disease characterized by low bone mineral density (BMD) and microarchitectural deterioration of bone tissue, which increases susceptibility to fractures. BMD is a complex quantitative trait with normal distribution and seems to be genetically controlled (in 50–90% of the cases), according to studies onmore » twins and families. Over the last 20 years, candidate gene approach and genome-wide association studies (GWAS) have identified single-nucleotide polymorphisms (SNPs) that are associated with low BMD, osteoporosis, and osteoporotic fractures. These SNPs have been mapped close to or within genes including those encoding nuclear receptors and WNT-β-catenin signaling proteins. Understanding the genetics of osteoporosis will help identify novel candidates for diagnostic and therapeutic targets.« less

Association Study between Coronary Artery Disease and rs1333049 and rs10757274 Polymorphisms at 9p21 Locus in South-West Iran

PubMed Central

Foroughmand, Ali Mohammad; Nikkhah, Emad; Galehdari, Hamid; Jadbabaee, Mohammad Hossin

2015-01-01

Objective Coronary artery disease (CAD) is a multi-factorial and heterogenic disease with atherosclerosis plaques formation in internal wall of coronary artery. Plaque formation results to limitation of the blood reaching to myocardium leading to appearance of some problems, such as ischemia, sudden thrombosis veins and myocardial infarction (MI). Several environmental and genetic factors are involved in prevalence and incident of CAD as follows: hypertension, high low density lipoprotein-cholesterol (LDL-C), age, diabetes mellitus, family history of early-onset heart disease and smoking. According to genome wide association studies (GWAS), five polymorphisms in the 9p21 locus seem to be associated with the CAD. We aimed to evaluate the remarkable association of two polymorphisms at 9p21 locus, rs1333049 and rs10757274, with CAD. Materials and Methods This experimental study was conducted in Golestan, Aria Hospitals and Genetics Lab of Shahid Chamran University in the city of Ahvaz, Iran, in 2010- 2011. The collected blood samples belonging to 170 CAD patients (case group) and 100 healthy individuals (control group) were analyzed by tetra-primer amplification refractory mutation system (ARMS)-polymerase chain reaction (PCR) technique. The results were analyzed using software package used for statistical analysis (SPSS; SPSS Inc., USA) version 16. A value of p<0.05 and an odd ratio (OR) with 95% confidence intervals (CI) were considered significant. Results The frequencies of CC, CG and GG genotypes for rs1333049 polymorphism in patients were 18.2, 65.3 and 16.5%, while in controls, the related values were 25, 67 and 8%, respectively. GG genotypes of rs1333049 polymorphism in CAD patients were more than control cases (OR: 0.354, 95%CI: 0.138-0.912, p=0.032). The frequencies of AA, AG and GG genotypes for rs10757274 in CAD patients were 8.2, 58.3 and 33.5%, while in controls, the related values were 35, 63 and 2%, respectively. GG Genotype in rs10757274 polymorphism in CAD patients was found more than control cases (OR: 0.014, 95% CI: 0.003 -0.065, p=0.0001). Conclusion The rs1333049 polymorphism at 9p21 locus shows a weak association with CAD, whereas rs10757274 polymorphism reveals a significant association with CAD. These variants may help the identification of patients with increased risk for coronary artery disease. PMID:25870838

Crosstalk: The Journal of Defense Software Engineering. Volume 22, Number 2, February 2009

DTIC Science & Technology

2009-02-01

IT Investment With Service-Oriented Architecture ( SOA ), Geoffrey Raines examines how an SOA offers federal senior leadership teams an incremental and...values, and is used by 30 million people. [1] Given budget constraints, an incre- mental approach seems to be required. A Path Forward SOA , as implemented...point of view, SOA offers several positive benefits. Language Neutral Integration Web-enabling applications with a com- mon browser interface became a

Methylenetetrahydrofolate reductase gene, homocysteine and coronary artery disease: the A1298C polymorphism does matter. Inferences from a case study (Madeira, Portugal).

PubMed

Freitas, Ana I; Mendonça, Isabel; Guerra, Graça; Brión, Maria; Reis, Roberto P; Carracedo, Angel; Brehm, António

2008-01-01

Elevated levels of plasma homocysteine, an independent risk factor and a strong predictor of mortality in patients with coronary artery disease (CAD), can result from nutritional deficiencies or genetic errors, including methylenetetrahydrofolate reductase (MTHFR) C677T and A1298C polymorphisms. The contribution of these polymorphisms in the development of CAD remains controversial. We analysed the impact of MTHFR C677T and A1298C on fasting homocysteine and CAD in 298 CAD patients proved by angiography and 510 control subjects from the Island of Madeira (Portugal). After adjustment for other risk factors, plasma homocysteine remained independently correlated with CAD. Serum homocysteine was significantly higher in individuals with 677TT and 1298AA genotypes. There was no difference in the distribution of MTHFR677 genotypes between cases and controls but a significant increase in 1298AA prevalence was found in CAD patients. In spite of the clear effect of C677T mutation on elevated homocysteine levels we only found an association between 1298AA genotype and CAD in this population. The simultaneous presence of 677CT and 1298AA genotypes provides a significant risk of developing the disease, while the 1298AC genotype, combined with 677CC, shows a significant trend towards a decrease in CAD occurrence. The data shows an independent association between elevated levels of homocysteine and CAD. Both MTHFR polymorphisms are associated with increased fasting homocysteine (677TT and 1298AA genotypes), but only the 1298AA variant shows an increased prevalence in CAD group. Odds ratio seem to indicate that individuals with the MTHFR 1298AA genotype and the 677CT/1298AA compound genotype had a 1.6-fold increased risk for developing CAD suggesting a possible association of MTHFR polymorphisms with the risk of CAD in Madeira population.

Association of cardiovascular response to an acute resistance training session with the ACE gene polymorphism in sedentary women: a randomized trial.

PubMed

de Souza, Jéssica Cardoso; Tibana, Ramires Alsamir; de Sousa, Nuno Manuel Frade; de Souza, Vinícius Carolino; Karnikowski, Margô G O; Prestes, Jonato; Campbell, Carmen Silvia Grubert

2013-01-10

The aim of the present study was to verify the effects of an acute resistance training (RT) session and insertion/deletion (I/D) polymorphism of the angiotensin-converting enzyme (ACE) on systolic (SBP), diastolic (DBP) and mean blood pressure (MBP), and heart rate (HR). The sample consisted of 27 sedentary women (33.3 ± 8.2 yrs; 69.1 ± 13.8 kg; 1.57 ± 0.05 m; 27.6 ± 5.1 kg/m2) divided into two groups according to their polymorphism I/D (DD = 9; II + ID = 18). Volunteers underwent two experimental sessions: RT - an acute session performed with three sets at 60% of one-repetition maximum (1RM) interspersed with 1 minute rest interval between exercises and sets, and a control session (CON) in which they remained seated for 30 minutes in the laboratory. SBP, DBP, MBP and HR were measured before exercise and during one hour every 10 minutes after sessions, in the seated position. A two-way ANOVA for repeated measures with Tukey's post hoc test was used for the intra and inter-group comparisons. There were no statistically significant differences on SBP, DBP and MBP after the experimental protocols, and no effect of ACE polymorphism (P > 0.05). However, comparing CON versus exercise effect size values (ES), homozygotic carriers of the allele D presented a drop in SBP which was considered moderate, while in allele I carriers it was small, 30 minutes after exercise. In MBP, homozygotic D carriers exhibited a large ES 20 minutes post-exercise. HR was higher at 10, 20 and 30 minutes after exercise as compared to pre-exercise only for carriers of the I allele (  < 0.05). Therefore, an acute RT session reduces clinical BP. In addition to this; it seems that ACE polymorphism had some influence on cardiovascular response to exercise. RBR-6GDYVZ.

Inosine triphosphatase polymorphisms and ribavirin pharmacokinetics as determinants of ribavirin-associate anemia in patients receiving standard anti-HCV treatment.

PubMed

DʼAvolio, Antonio; Ciancio, Alessia; Siccardi, Marco; Smedile, Antonina; Baietto, Lorena; Simiele, Marco; Marucco, Diego Aguilar; Cariti, Giuseppe; Calcagno, Andrea; de Requena, Daniel Gonzalez; Sciandra, Mauro; Cusato, Jessica; Troshina, Giulia; Bonora, Stefano; Rizzetto, Mario; Di Perri, Giovanni

2012-04-01

Functional variants of inosine triphosphatase (ITPA) were recently found to protect against ribavirin (RBV)-induced hemolytic anemia. However, no definitive data are yet available on the role of plasma RBV concentrations on hemoglobin (Hb) decrement. Moreover, no data have been published on the possible interplay between these 2 factors. A retrospective analysis included 167 patients. The ITPA variants rs7270101 and rs1127354 were genotyped and tested using the χ test for association with Hb reduction at week 4. We also investigated, using multivariate logistic regression, the impact of RBV plasma exposure on Hb concentrations. Both single nucleotide polymorphisms were associated with Hb decrease. The carrier of at least 1 variant allele in the functional ITPA single nucleotide polymorphisms was associated with a lower decrement of Hb (-1.1 g/dL), as compared with patients without a variant allele (-2.75 g/dL; P = 4.09 × 10). RBV concentrations were not influenced by ITPA genotypes. A cut-off of 2.3 μg/mL of RBV was found to be associated with anemia (area-under-receiver operating characteristic = 0.630, sensitivity = 50.0%, and specificity = 69.5%, P = 0.008). In multivariate logistic regression analyses, the carrier of a variant allele (P = 0.005) and plasma RBV concentrations <2.3 μg/mL (P = 0.016) were independently associated with protection against clinically significant anemia at week 4. Although no direct relationship was found between ITPA polymorphisms and plasma RBV concentrations, both factors were shown to be significantly associated with anemia. A multivariate regression model based on ITPA genetic polymorphisms and RBV trough concentration was developed for predicting the risk of anemia. By relying upon these 2 variables, an individualized management of anemia seems to be feasible in recipients of pegylated interferon-RBV therapy.

Genetic diversity in populations of Isatis glauca Aucher ex Boiss. ssp. from Central Anatolia in Turkey, as revealed by AFLP analysis.

PubMed

Özbek, Özlem; Görgülü, Elçin; Yıldırımlı, Şinasi

2013-12-01

Isatidae L. is a complex and systematically difficult genus in Brassicaceae. The genus displays great morphological polymorphism, which makes the classification of species and subspecies difficult as it is observed in Isatis glauca Aucher ex Boiss. The aim of this study is characterization of the genetic diversity in subspecies of Isatis glauca Aucher ex Boiss. distributed widely in Central Anatolia, in Turkey by using Amplified Fragment Length Polymorphism (AFLP) technique. Eight different Eco RI-Mse I primer combinations produced 805 AFLP loci, 793 (98.5%) of which were polymorphic in 67 accessions representing nine different populations. The data obtained by AFLP was computed with using GDA (Genetic Data Analysis) and STRUCTURE (version 2.3.3) software programs for population genetics. The mean proportion of the polymorphic locus (P), the mean number of alleles (A), the number of unique alleles (U) and the mean value of gene diversity (He) were 0.59, 1.59, 20, and 0.23 respectively. The coancestry coefficient (ϴ) was 0.24. The optimal number of K was identified as seven. The principal component analysis (PCA) explained 85.61% of the total genetic variation. Isatis glauca ssp. populations showed a high level of genetic diversity, and the AFLP analysis revealed that high polymorphism and differentiated subspecies could be used conveniently for population genetic studies. The principal coordinate analysis (PCoA) based on the dissimilarity matrix, the dendrogram drawn with UPGMA method and STRUCTURE cluster analysis distinguished the accessions successfully. The accessions formed distinctive population structures for populations AA, AB, E, K, and S. Populations AG1 and AG2 seemed to have similar genetic content, in addition, in both populations several hybrid individuals were observed. The accessions did not formed distinctive population structures for both populations AI and ANP. Consequently, Ankara province might be the area, where species Isatis glauca Aucher ex Boiss. originated.

Microsomal triglyceride transfer protein -164 T > C gene polymorphism and risk of cardiovascular disease: results from the EPIC-Potsdam case-cohort study.

PubMed

di Giuseppe, Romina; Pechlivanis, Sonali; Fisher, Eva; Arregui, Maria; Weikert, Beate; Knüppel, Sven; Buijsse, Brian; Fritsche, Andreas; Willich, Stefan N; Joost, Hans-Georg; Boeing, Heiner; Moebus, Susanne; Weikert, Cornelia

2013-01-29

The microsomal triglyceride transfer protein (MTTP) is encoded by the MTTP gene that is regulated by cholesterol in humans. Previous studies investigating the effect of MTTP on ischemic heart disease have produced inconsistent results. Therefore, we have tested the hypothesis that the rare allele of the -164T > C polymorphism in MTTP alters the risk of cardiovascular disease (CVD), depending on the cholesterol levels. The -164T > C polymorphism was genotyped in a case-cohort study (193 incident myocardial infarction (MI) and 131 incident ischemic stroke (IS) cases and 1 978 non-cases) nested within the European Prospective Investigation into Cancer and Nutrition (EPIC)-Potsdam study, comprising 27 548 middle-aged subjects. The Heinz Nixdorf Recall study (30 CVD cases and 1 188 controls) was used to replicate our findings. Genotype frequencies were not different between CVD and CVD free subjects (P = 0.79). We observed an interaction between the -164T > C polymorphism and total cholesterol levels in relation to future CVD. Corresponding stratified analyses showed a significant increased risk of CVD (HR(additve) = 1.38, 95% CI: 1.07 to 1.78) for individuals with cholesterol levels <200 mg/dL in the EPIC-Potsdam study. HR(additive) was 1.06, 95% CI: 0.33 to 3.40 for individuals in the Heinz Nixdorf Recall study. A borderline significant decrease in CVD risk was observed in subjects with cholesterol levels ≥ 200 mg/dL (HR(additve) = 0.77, 95% CI: 0.58 to 1.03) in the EPIC-Potsdam study. A similar trend was observed in the independent cohort (HR(additve) = 0.60, 95% CI: 0.29 to 1.25). Our study suggests an interaction between MTTP -164T > C functional polymorphism with total cholesterol levels. Thereby risk allele carriers with low cholesterol levels may be predisposed to an increased risk of developing CVD, which seems to be abolished among risk allele carriers with high cholesterol levels.

Regulation of plasma factor XIII levels in healthy individuals; a major impact by subunit B intron K c.1952+144 C>G polymorphism.

PubMed

Mezei, Zoltán A; Katona, Éva; Kállai, Judit; Bereczky, Zsuzsanna; Molnár, Éva; Kovács, Bettina; Ajzner, Éva; Bagoly, Zsuzsa; Miklós, Tünde; Muszbek, László

2016-12-01

The regulation of plasma factor XIII (FXIII) levels in healthy individuals has been only partially explored. The identification of major non-genetic and genetic regulatory factors might provide important information on the contribution of FXIII to the risk of cardio/cerebrovascular diseases. To determine the effect of age, smoking, BMI, fibrinogen concentration on plasma FXIII activity, complex FXIII antigen (FXIII-A 2 B 2 ) and total FXIII-B subunit (tFXIII-B) level, to correlate FXIII-B level with the other two FXIII parameters and to assess the variation of FXIII levels in carriers of major FXIII subunit polymorphisms. 268 healthy individuals were enrolled in the study. FXIII activity was measured by the ammonia release assay; FXIII-A 2 B 2 and tFXIII-B were determined by ELISAs. FXIII-A p.Val34Leu, FXIII-B p.His95Arg and FXIII-B intron K c.1952+144 C>G polymorphisms were identified by RT-PCR using melting point analysis with fluorescence resonance energy transfer detection. All investigated FXIII parameters showed significant positive correlation with age and fibrinogen level; gender and BMI influenced only tFXIII-B. A highly significant positive correlation was demonstrated between tFXIII-B and the other FXIII parameters. FXIII-A p.Val34Leu polymorphism had only slight, if any effect on FXIII levels. The FXIII-B Arg95 allele moderately increased all three FXIII parameters, but the effect became statistically significant only after adjustment. The FXIII-B intron K G allele drastically decreased FXIII levels, and it seemed to be in synergism with the FXIII-A Leu34 allele. Plasma FXIII levels are subjected to multifactorial regulation, in which age, fibrinogen level and FXIII-B intron K polymorphism are major determinants. Copyright © 2016 Elsevier Ltd. All rights reserved.

Influence of ADRB2 Gln27Glu and ADRB3 Trp64Arg polymorphisms on body weight and body composition changes after a controlled weight-loss intervention.

PubMed

Szendrei, Barbara; González-Lamuño, Domingo; Amigo, Teresa; Wang, Guan; Pitsiladis, Yannis; Benito, Pedro J; Gomez-Candela, Carmen; Calderón, Francisco J; Cupeiro, Rocío

2016-03-01

The β-2 and β-3 adrenergic receptors (ADRB2 and ADRB3) are thought to play a role in energy expenditure and lipolysis. However, the effects of the ADRB2 glutamine (Gln) 27 glutamic acid (glutamate) (Glu) and ADRB3 tryptophan (Trp) 64 arginine (Arg) polymorphisms on weight loss remain controversial. The aim of this study was to investigate the effect of these polymorphisms on changes in weight and body composition during a controlled weight-loss program. One hundred seventy-three healthy overweight and obese participants (91 women, 82 men) aged 18-50 years participated in a 22-week-long intervention based on a hypocaloric diet and exercise. They were randomly assigned to 1 of 4 groups: strength, endurance, strength and endurance combined, and physical activity recommendations only. Body weight, body mass index (BMI), and body composition variables were assessed before and after the intervention. Genetic analysis was carried out according to standard protocols. No effect of the ADRB2 gene was shown on final weight, BMI, or body composition, although in the supervised male group, Glu27 carriers tended to have greater weight (p = 0.019, 2.5 kg) and BMI (p = 0.019, 0.88 kg/m(2)) reductions than did noncarriers. There seems to be an individual effect of the ADRB3 polymorphism on fat mass (p = 0.004) and fat percentage (p = 0.036), in addition to an interaction with exercise for fat mass (p = 0.038). After the intervention, carriers of the Arg64 allele had a greater fat mass and fat percentage than did noncarriers (p = 0.004, 2.8 kg). In conclusion, the ADRB2 Gln27Glu and ADRB3 Trp64Arg polymorphisms may influence weight loss and body composition, although the current evidence is weak; however, further studies are necessary to clarify their roles.

Polymorphisms within the canine MLPH gene are associated with dilute coat color in dogs

PubMed Central

Philipp, Ute; Hamann, Henning; Mecklenburg, Lars; Nishino, Seiji; Mignot, Emmanuel; Günzel-Apel, Anne-Rose; Schmutz, Sheila M; Leeb, Tosso

2005-01-01

Background Pinschers and other dogs with coat color dilution show a characteristic pigmentation phenotype. The fur colors are a lighter shade, e.g. silvery grey (blue) instead of black and a sandy color (Isabella fawn) instead of red or brown. In some dogs the coat color dilution is sometimes accompanied by hair loss and recurrent skin inflammation, the so called color dilution alopecia (CDA) or black hair follicular dysplasia (BHFD). In humans and mice a comparable pigmentation phenotype without any documented hair loss is caused by mutations within the melanophilin gene (MLPH). Results We sequenced the canine MLPH gene and performed a mutation analysis of the MLPH exons in 6 Doberman Pinschers and 5 German Pinschers. A total of 48 sequence variations was identified within and between the breeds. Three families of dogs showed co-segregation for at least one polymorphism in an MLPH exon and the dilute phenotype. No single polymorphism was identified in the coding sequences or at splice sites that is likely to be causative for the dilute phenotype of all dogs examined. In 18 German Pinschers a mutation in exon 7 (R199H) was consistently associated with the dilute phenotype. However, as this mutation was present in homozygous state in four dogs of other breeds with wildtype pigmentation, it seems unlikely that this mutation is truly causative for coat color dilution. In Doberman Pinschers as well as in Large Munsterlanders with BHFD, a set of single nucleotide polymorphisms (SNPs) around exon 2 was identified that show a highly significant association to the dilute phenotype. Conclusion This study provides evidence that coat color dilution is caused by one or more mutations within or near the MLPH gene in several dog breeds. The data on polymorphisms that are strongly associated with the dilute phenotype will allow the genetic testing of Pinschers to facilitate the breeding of dogs with defined coat colors and to select against Large Munsterlanders carrying BHFD. PMID:15960853

Polymorphisms within the canine MLPH gene are associated with dilute coat color in dogs.

PubMed

Philipp, Ute; Hamann, Henning; Mecklenburg, Lars; Nishino, Seiji; Mignot, Emmanuel; Günzel-Apel, Anne-Rose; Schmutz, Sheila M; Leeb, Tosso

2005-06-16

Pinschers and other dogs with coat color dilution show a characteristic pigmentation phenotype. The fur colors are a lighter shade, e.g. silvery grey (blue) instead of black and a sandy color (Isabella fawn) instead of red or brown. In some dogs the coat color dilution is sometimes accompanied by hair loss and recurrent skin inflammation, the so called color dilution alopecia (CDA) or black hair follicular dysplasia (BHFD). In humans and mice a comparable pigmentation phenotype without any documented hair loss is caused by mutations within the melanophilin gene (MLPH). We sequenced the canine MLPH gene and performed a mutation analysis of the MLPH exons in 6 Doberman Pinschers and 5 German Pinschers. A total of 48 sequence variations was identified within and between the breeds. Three families of dogs showed co-segregation for at least one polymorphism in an MLPH exon and the dilute phenotype. No single polymorphism was identified in the coding sequences or at splice sites that is likely to be causative for the dilute phenotype of all dogs examined. In 18 German Pinschers a mutation in exon 7 (R199H) was consistently associated with the dilute phenotype. However, as this mutation was present in homozygous state in four dogs of other breeds with wildtype pigmentation, it seems unlikely that this mutation is truly causative for coat color dilution. In Doberman Pinschers as well as in Large Munsterlanders with BHFD, a set of single nucleotide polymorphisms (SNPs) around exon 2 was identified that show a highly significant association to the dilute phenotype. This study provides evidence that coat color dilution is caused by one or more mutations within or near the MLPH gene in several dog breeds. The data on polymorphisms that are strongly associated with the dilute phenotype will allow the genetic testing of Pinschers to facilitate the breeding of dogs with defined coat colors and to select against Large Munsterlanders carrying BHFD.

Mutation analysis of BRCA1/2 mutations with special reference to polymorphic SNPs in Indian breast cancer patients.

PubMed

Shah, Nidhi D; Shah, Parth S; Panchal, Yash Y; Katudia, Kalpesh H; Khatri, Nikunj B; Ray, Hari Shankar P; Bhatiya, Upti R; Shah, Sandip C; Shah, Bhavini S; Rao, Mandava V

2018-01-01

Germline mutations BRCA1 and BRCA2 contribute almost equally in the causation of breast cancer (BC). The type of mutations in the Indian population that cause this condition is largely unknown. In this cohort, 79 randomized BC patients were screened for various types of BRCA1 and BRCA2 mutations including frameshift, nonsense, missense, in-frame and splice site types. The purified extracted DNA of each referral patient was subjected to Sanger gene sequencing using Codon Code Analyzer and Mutation Surveyor and next-generation sequencing (NGS) methods with Ion torrent software, after appropriate care. The data revealed that 35 cases were positive for BRCA1 or BRCA2 (35/79: 44.3%). BRCA2 mutations were higher (52.4%) than BRCA1 mutations (47.6%). Five novel mutations detected in this study were p.pro163 frameshift, p.asn997 frameshift, p.ser148 frameshift and two splice site single-nucleotide polymorphisms (SNPs). Additionally, four nonsense and one in-frame deletion were identified, which all seemed to be pathogenic. Polymorphic SNPs contributed the highest percentage of mutations (72/82: 87.8%) and contributed to pathogenic, likely pathogenic, likely benign, benign and variant of unknown significance (VUS). Young age groups (20-60 years) had a high frequency of germline mutations (62/82;75.6%) in the Indian population. This study suggested that polymorphic SNPs contributed a high percentage of mutations along with five novel types. Younger age groups are prone to having BC with a higher mutational rate. Furthermore, the SNPs detected in exons 10, 11 and 16 of BRCA1 and BRCA2 were higher than those in other exons 2, 3 and 9 polymorphic sites in two germline genes. These may be contributory for BC although missense types are known to be susceptible for cancer depending on the type of amino acid replaced in the protein and associated with pathologic events. Accordingly, appropriate counseling and treatment may be suggested.

Metals and dust in the neutral ISM: the Galaxy, Magellanic Clouds, and damped Lyman-α absorbers

NASA Astrophysics Data System (ADS)

De Cia, Annalisa

2018-05-01

Context. The presence of dust in the neutral interstellar medium (ISM) dramatically changes the metal abundances that we measure. Understanding the metal content in the neutral ISM, and a direct comparison between different environments, has been hampered to date because of the degeneracy to the observed ISM abundances caused by the effects of metallicity, the presence of dust, and nucleosynthesis. Aims: We study the metal and dust content in the neutral ISM consistently in different environments, and assess the universality of recently discovered sequences of relative abundances. We also intend to assess the validity of [Zn/Fe] as a tracer of dust in the ISM. This has recently been cast into doubt based on observations of stellar abundances, and needs to be addressed before we can safely use it to study the ISM. Methods: In this letter we present a simple comparison of relative abundances observed in the neutral ISM in the Galaxy, the Magellanic Clouds, and damped Lyman-α absorbers (DLAs). The main novelty in this comparison is the inclusion of the Magellanic Clouds. Results: The same sequences of relative abundances are valid for the Galaxy, Magellanic Clouds, and DLAs. These sequences are driven by the presence of dust in the ISM and seem "universal". Conclusions: The metal and dust properties in the neutral ISM appear to follow a similar behaviour in different environments. This suggests that a dominant fraction of the dust budget is built up from grain growth in the ISM depending of the physical conditions and regardless of the star formation history of the system. In addition, the DLA gas behaves like the neutral ISM, at least from a chemical point of view. Finally, despite the deviations in [Zn/Fe] observed in stellar abundances, [Zn/Fe] is a robust dust tracer in the ISM of different environments, from the Galaxy to DLAs.

You Won't Get Me: Therapist Responses to Patient Impression Management Tactics.

PubMed

Frühauf, Sarah; Figlioli, Patrick; Caspar, Franz

2017-03-01

In psychotherapy, therapist and patient influence each other constantly. We aimed to investigate how therapists respond to patient impression management and influence tactics. For 60 videotaped intake interviews, judges rated therapist responses to patient tactics as neutral, desired, or undesired from the patient perspective. Judges rated the therapist responses in 57% as neutral, in 40% as desired, and in 2% as undesired by the patients. The proportions of response outcomes varied across tactics. Therapist responses were unrelated to therapist and patient sex. Therapist experience was related to their responses to the tactic Supplication. Overall, some patient tactics seem to be more challenging for therapists than others. Awareness of such response tendencies can help therapists prepare their reactions to certain patient impression management and influence tactics. Implications for training and research are presented.

Venus ionosphere: photochemical and thermal diffusion control of ion composition.

PubMed

Bauer, S J; Donahue, T M; Hartle, R E; Taylor, H A

1979-07-06

The major photochemical sources and sinks for ten of the ions measured by the ion mass spectrometer on the Pioneer Venus bus and orbiter spacecraft that are consistent with the neutral gas composition measured on the same spacecraft have been identified. The neutral gas temperature (Tn) as a function of solar zenith angle (chi) derived from measured ion distributions in photochemical equilibrium is given by Tn (K) = 323 cos(1/5)chi. Above 200 kilometers, the altitude behavior of ions is generally controlled by plasma diffusion, with important modifications for minor ions due to thermal diffusion resulting from the observed gradients of plasma temperatures. The dayside equilibrium distributions of ions are sometimes perturbed by plasma convection, while lateral transport of ions from the dayside seems to be a major source of the nightside ionosphere.

The genetic architecture of 3'untranslated region of the MICA gene: polymorphisms and haplotypes.

PubMed

Luo, Jia; Tian, Wei; Liu, Xue Xiang; Yu, JunLong; Li, LiXin; Pan, FengHua

2013-10-01

In this study, the 3'untranslated region (3'UTR) of MHC class I chain-related gene A (MICA) were investigated in 104 healthy, unrelated Han individuals recruited from northern China, using PCR-sequencing method. Nine polymorphic sites were detected, which were in very strong linkage disequilibrium with each other .Seven different MICA 3'UTR alleles were identified, among which UTR1 predominated (0.6971),followed by UTR2 (0.2356). Twenty-one extended haplotypes incorporating the 3'UTR and MICA exons 2-5 were observed in this population. Phylogenetic analysis revealed the existence of two MICA lineages, each with multiple subsets. The 2 lineages were primarily linked to UTR1 and UTR2 in the 3'UTR, respectively. Ewens-Watterson homozygosity statistics at MICA coding and 3'UTR regions were consistent with neutral expectations. Our data provided for the first time the data of genetic variation in the 3'UTR of MICA gene in human populations. The findings are valuable for future studies of the mechanisms underlying MICA post-transcriptional regulation, and will inform studies of evolution of the MHC gene complex. Copyright © 2013 American Society for Histocompatibility and Immunogenetics. Published by Elsevier Inc. All rights reserved.

Nanoparticle titanium dioxide aqueous interfacial energy can be modified to control phase stability, coarsening, and morphology

NASA Astrophysics Data System (ADS)

Finnegan, Michael Patrick

The effect of solution chemistry on the phase stability, coarsening kinetics and morphology of titanium dioxide (TiO2) nanoparticles is investigated in order to attain efficient production pathways to desired nano-structures with optimal properties. To obtain sample, TiO2 was synthesized via hydrolysis of titanium isopropoxide producing an 85% anatase/15% brookite mixture. The titania was hydrothermally heated in an array of temperatures and pH values for various times. There are distinct phase stability fields for nanoscale titania based on pH alone due to slight interface charging behavior differences among the polymorphs. The mixture transforms to rutile below the pH of zero point of charge (ZPC) and remains anatase above the ZPC. This phenomenon is partially reversible. The solution chemistry also dictates the hydrothermal coarsening mechanism of the anatase polymorph. Ostwald ripening (OR) takes place in basic pH where titania solubility is elevated relative to neutral pH where lower solubility prevents rapid OR but allows for coarsening via oriented attachment (OA) of nanoparticles. This OA event can alter the symmetry of anatase causing unexpected and perhaps technically useful morphologies such as straight and curved nanorods during coarsening.

Population-wide sampling of retrotransposon insertion polymorphisms using deep sequencing and efficient detection.

PubMed

Yu, Qichao; Zhang, Wei; Zhang, Xiaolong; Zeng, Yongli; Wang, Yeming; Wang, Yanhui; Xu, Liqin; Huang, Xiaoyun; Li, Nannan; Zhou, Xinlan; Lu, Jie; Guo, Xiaosen; Li, Guibo; Hou, Yong; Liu, Shiping; Li, Bo

2017-09-01

Active retrotransposons play important roles during evolution and continue to shape our genomes today, especially in genetic polymorphisms underlying a diverse set of diseases. However, studies of human retrotransposon insertion polymorphisms (RIPs) based on whole-genome deep sequencing at the population level have not been sufficiently undertaken, despite the obvious need for a thorough characterization of RIPs in the general population. Herein, we present a novel and efficient computational tool called Specific Insertions Detector (SID) for the detection of non-reference RIPs. We demonstrate that SID is suitable for high-depth whole-genome sequencing data using paired-end reads obtained from simulated and real datasets. We construct a comprehensive RIP database using a large population of 90 Han Chinese individuals with a mean ×68 depth per individual. In total, we identify 9342 recent RIPs, and 8433 of these RIPs are novel compared with dbRIP, including 5826 Alu, 2169 long interspersed nuclear element 1 (L1), 383 SVA, and 55 long terminal repeats. Among the 9342 RIPs, 4828 were located in gene regions and 5 were located in protein-coding regions. We demonstrate that RIPs can, in principle, be an informative resource to perform population evolution and phylogenetic analyses. Taking the demographic effects into account, we identify a weak negative selection on SVA and L1 but an approximately neutral selection for Alu elements based on the frequency spectrum of RIPs. SID is a powerful open-source program for the detection of non-reference RIPs. We built a non-reference RIP dataset that greatly enhanced the diversity of RIPs detected in the general population, and it should be invaluable to researchers interested in many aspects of human evolution, genetics, and disease. As a proof of concept, we demonstrate that the RIPs can be used as biomarkers in a similar way as single nucleotide polymorphisms. © The Authors 2017. Published by Oxford University Press.

Using Classical Population Genetics Tools with Heterochroneous Data: Time Matters!

PubMed Central

Depaulis, Frantz; Orlando, Ludovic; Hänni, Catherine

2009-01-01

Background New polymorphism datasets from heterochroneous data have arisen thanks to recent advances in experimental and microbial molecular evolution, and the sequencing of ancient DNA (aDNA). However, classical tools for population genetics analyses do not take into account heterochrony between subsets, despite potential bias on neutrality and population structure tests. Here, we characterize the extent of such possible biases using serial coalescent simulations. Methodology/Principal Findings We first use a coalescent framework to generate datasets assuming no or different levels of heterochrony and contrast most classical population genetic statistics. We show that even weak levels of heterochrony (∼10% of the average depth of a standard population tree) affect the distribution of polymorphism substantially, leading to overestimate the level of polymorphism θ, to star like trees, with an excess of rare mutations and a deficit of linkage disequilibrium, which are the hallmark of e.g. population expansion (possibly after a drastic bottleneck). Substantial departures of the tests are detected in the opposite direction for more heterochroneous and equilibrated datasets, with balanced trees mimicking in particular population contraction, balancing selection, and population differentiation. We therefore introduce simple corrections to classical estimators of polymorphism and of the genetic distance between populations, in order to remove heterochrony-driven bias. Finally, we show that these effects do occur on real aDNA datasets, taking advantage of the currently available sequence data for Cave Bears (Ursus spelaeus), for which large mtDNA haplotypes have been reported over a substantial time period (22–130 thousand years ago (KYA)). Conclusions/Significance Considering serial sampling changed the conclusion of several tests, indicating that neglecting heterochrony could provide significant support for false past history of populations and inappropriate conservation decisions. We therefore argue for systematically considering heterochroneous models when analyzing heterochroneous samples covering a large time scale. PMID:19440242

Genetic Polymorphisms in Host Antiviral Genes: Associations with Humoral and Cellular Immunity to Measles Vaccine

PubMed Central

Haralambieva, Iana H.; Ovsyannikova, Inna G.; Umlauf, Benjamin J.; Vierkant, Robert A.; Pankratz, V. Shane; Jacobson, Robert M.; Poland, Gregory A.

2014-01-01

Host antiviral genes are important regulators of antiviral immunity and plausible genetic determinants of immune response heterogeneity after vaccination. We genotyped and analyzed 307 common candidate tagSNPs from 12 antiviral genes in a cohort of 745 schoolchildren immunized with two doses of measles-mumps-rubella vaccine. Associations between SNPs/haplotypes and measles virus-specific immune outcomes were assessed using linear regression methodologies in Caucasians and African-Americans. Genetic variants within the DDX58/RIG-I gene, including a coding polymorphism (rs3205166/Val800Val), were associated as single-SNPs (p≤0.017; although these SNPs did not remain significant after correction for false discovery rate/FDR) and in haplotype-level analysis, with measles-specific antibody variations in Caucasians (haplotype allele p-value=0.021; haplotype global p-value=0.076). Four DDX58 polymorphisms, in high LD, demonstrated also associations (after correction for FDR) with variations in both measles-specific IFN-γ and IL-2 secretion in Caucasians (p≤0.001, q=0.193). Two intronic OAS1 polymorphisms, including the functional OAS1 SNP rs10774671 (p=0.003), demonstrated evidence of association with a significant allele-dose-related increase in neutralizing antibody levels in African-Americans. Genotype and haplotype-level associations demonstrated the role of ADAR genetic variants, including a non-synonymous SNP (rs2229857/Arg384Lys; p=0.01), in regulating measles virus-specific IFN-γ Elispot responses in Caucasians (haplotype global p-value=0.017). After correction FDR, 15 single-SNP associations (11 SNPs in Caucasians and 4 SNPs in African-Americans) still remained significant at the q-value<0.20. In conclusion, our findings strongly point to genetic variants/genes, involved in antiviral sensing and antiviral control, as critical determinants, differentially modulating the adaptive immune responses to live attenuated measles vaccine in Caucasians and African-Americans. PMID:21939710

The CHRNA3 rs578776 Variant is Associated with an Intrinsic Reward Sensitivity Deficit in Smokers.

PubMed

Robinson, Jason D; Versace, Francesco; Lam, Cho Y; Minnix, Jennifer A; Engelmann, Jeffrey M; Cui, Yong; Karam-Hage, Maher; Shete, Sanjay S; Tomlinson, Gail E; Chen, Tina T-L; Wetter, David W; Green, Charles E; Cinciripini, Paul M

2013-01-01

A compromised brain reward system has been postulated as a key feature of drug dependence. We examined whether several polymorphisms of genes found to regulate nicotinic acetylcholine receptor (nAChR) and dopamine expression were related to an intrinsic reward sensitivity (IRS) deficit we previously identified among a subgroup of smokers using event-related potentials (ERPs). We examined genetic polymorphisms within the CHRNA5-A3-B4 gene cluster (CHRNA3 rs578776, CHRNA5 rs16969968, LOC123688 rs8034191, and CHRNA3 rs1051730), the ANKK1 gene (rs1800497), and the D2 dopamine receptor gene (DRD2 rs1079597, DRD2 rs1799732) from 104 smokers of European ancestry in a smoking cessation trial. Prior to treatment, we recorded ERPs evoked by emotional (both pleasant and unpleasant), neutral, and cigarette-related pictures. Smokers were assigned to two groups (IRS+/IRS-) based on the amplitude of the late positive potential (LPP) component to the pictures, a neural marker of motivational salience. Smokers (n = 42) with blunted brain responses to intrinsically rewarding (pleasant) pictures and enhanced responses to cigarette pictures were assigned to the IRS- group, while smokers (n = 62) with the opposite pattern of LPP responding were assigned to the IRS+ group. Carriers of the protective minor T allele (T/T, C/T) of the CHRNA3 rs578776 were less likely to be members of the IRS- group than those homozygous for the at-risk C allele (C/C). The CHRNA3 rs578776 polymorphism did not differ on questionnaires of nicotine dependence, depressed mood, or trait affective disposition and did not predict abstinence at 6 months after the quit date. These results suggest that polymorphisms of genes influencing nAChR expression are related to an endophenotype of reward sensitivity in smokers.

Reduced MHC and neutral variation in the Galápagos hawk, an island endemic

PubMed Central

2011-01-01

Background Genes at the major histocompatibility complex (MHC) are known for high levels of polymorphism maintained by balancing selection. In small or bottlenecked populations, however, genetic drift may be strong enough to overwhelm the effect of balancing selection, resulting in reduced MHC variability. In this study we investigated MHC evolution in two recently diverged bird species: the endemic Galápagos hawk (Buteo galapagoensis), which occurs in small, isolated island populations, and its widespread mainland relative, the Swainson's hawk (B. swainsoni). Results We amplified at least two MHC class II B gene copies in each species. We recovered only three different sequences from 32 Galápagos hawks, while we amplified 20 unique sequences in 20 Swainson's hawks. Most of the sequences clustered into two groups in a phylogenetic network, with one group likely representing pseudogenes or nonclassical loci. Neutral genetic diversity at 17 microsatellite loci was also reduced in the Galápagos hawk compared to the Swainson's hawk. Conclusions The corresponding loss in neutral diversity suggests that the reduced variability present at Galápagos hawk MHC class II B genes compared to the Swainson's hawk is primarily due to a founder event followed by ongoing genetic drift in small populations. However, purifying selection could also explain the low number of MHC alleles present. This lack of variation at genes involved in the adaptive immune response could be cause for concern should novel diseases reach the archipelago. PMID:21612651

Population genomics of the killer whale indicates ecotype evolution in sympatry involving both selection and drift.

PubMed

Moura, Andre E; Kenny, John G; Chaudhuri, Roy; Hughes, Margaret A; J Welch, Andreanna; Reisinger, Ryan R; de Bruyn, P J Nico; Dahlheim, Marilyn E; Hall, Neil; Hoelzel, A Rus

2014-11-01

The evolution of diversity in the marine ecosystem is poorly understood, given the relatively high potential for connectivity, especially for highly mobile species such as whales and dolphins. The killer whale (Orcinus orca) has a worldwide distribution, and individual social groups travel over a wide geographic range. Even so, regional populations have been shown to be genetically differentiated, including among different foraging specialists (ecotypes) in sympatry. Given the strong matrifocal social structure of this species together with strong resource specializations, understanding the process of differentiation will require an understanding of the relative importance of both genetic drift and local adaptation. Here we provide a high-resolution analysis based on nuclear single-nucleotide polymorphic markers and inference about differentiation at both neutral loci and those potentially under selection. We find that all population comparisons, within or among foraging ecotypes, show significant differentiation, including populations in parapatry and sympatry. Loci putatively under selection show a different pattern of structure compared to neutral loci and are associated with gene ontology terms reflecting physiologically relevant functions (e.g. related to digestion). The pattern of differentiation for one ecotype in the North Pacific suggests local adaptation and shows some fixed differences among sympatric ecotypes. We suggest that differential habitat use and resource specializations have promoted sufficient isolation to allow differential evolution at neutral and functional loci, but that the process is recent and dependent on both selection and drift. © 2014 The Authors. Molecular Ecology published by John Wiley & Sons Ltd.

Population genomics of the killer whale indicates ecotype evolution in sympatry involving both selection and drift

PubMed Central

Moura, Andre E; Kenny, John G; Chaudhuri, Roy; Hughes, Margaret A; J Welch, Andreanna; Reisinger, Ryan R; de Bruyn, P J Nico; Dahlheim, Marilyn E; Hall, Neil; Hoelzel, A Rus

2014-01-01

The evolution of diversity in the marine ecosystem is poorly understood, given the relatively high potential for connectivity, especially for highly mobile species such as whales and dolphins. The killer whale (Orcinus orca) has a worldwide distribution, and individual social groups travel over a wide geographic range. Even so, regional populations have been shown to be genetically differentiated, including among different foraging specialists (ecotypes) in sympatry. Given the strong matrifocal social structure of this species together with strong resource specializations, understanding the process of differentiation will require an understanding of the relative importance of both genetic drift and local adaptation. Here we provide a high-resolution analysis based on nuclear single-nucleotide polymorphic markers and inference about differentiation at both neutral loci and those potentially under selection. We find that all population comparisons, within or among foraging ecotypes, show significant differentiation, including populations in parapatry and sympatry. Loci putatively under selection show a different pattern of structure compared to neutral loci and are associated with gene ontology terms reflecting physiologically relevant functions (e.g. related to digestion). The pattern of differentiation for one ecotype in the North Pacific suggests local adaptation and shows some fixed differences among sympatric ecotypes. We suggest that differential habitat use and resource specializations have promoted sufficient isolation to allow differential evolution at neutral and functional loci, but that the process is recent and dependent on both selection and drift. PMID:25244680

Manganese superoxide dismutase (MnSOD) genetic polymorphisms, dietary antioxidants, and risk of breast cancer.

PubMed

Ambrosone, C B; Freudenheim, J L; Thompson, P A; Bowman, E; Vena, J E; Marshall, J R; Graham, S; Laughlin, R; Nemoto, T; Shields, P G

1999-02-01

Oxidative stress, resulting from the imbalance between prooxidant and antioxidant states, damages DNA, proteins, cell membranes, and mitochondria and seems to play a role in human breast carcinogenesis. Dietary sources of antioxidants (chemical) and endogenous antioxidants (enzymatic), including the polymorphic manganese superoxide dismutase (MnSOD), can act to reduce the load of oxidative stress. We hypothesized that the valine-to-alanine substitution that seems to alter transport of the enzyme into the mitochondrion, changing its efficacy in fighting oxidative stress, was associated with breast cancer risk and that a diet rich in sources of antioxidants could ameliorate the effects on risk. Data were collected in a case-control study of diet and breast cancer in western New York from 1986 to 1991. Caucasian women with incident, primary, histologically confirmed breast cancer were frequency-matched on age and county of residence to community controls. Blood specimens were collected and processed from a subset of participants in the study (266 cases and 295 controls). Using a RFLP that distinguishes a valine (V) to alanine (A) change in the -9 position in the signal sequence of the protein for MnSOD, we characterized MnSOD genotypes in relation to breast cancer risk. We also evaluated the effect of the polymorphism on risk among low and high consumers of fruits and vegetables. Premenopausal women who were homozygous for the A allele had a 4-fold increase in breast cancer risk in comparison to those with 1 or 2 V alleles (odds ratio, 4.3; 95% confidence interval, 1.7-10.8). Risk was most pronounced among women below the median consumption of fruits and vegetables and of dietary ascorbic acid and alpha-tocopherol, with little increased risk for those with diets rich in these foods. Relationships were weaker among postmenopausal women, although the MnSOD AA genotype was associated with an almost 2-fold increase in risk (odds ratio, 1.8; confidence interval, 0.9-3.6). No appreciable modification of risk by diet was detected for these older women. These data support the hypothesis that MnSOD and oxidative stress play a significant role in breast cancer risk, particularly in premenopausal women. The finding that risk was greatest among women who consumed lower amounts of dietary antioxidants and was minimal among high consumers indicates that a diet rich in sources of antioxidants may minimize the deleterious effects of the MnSOD polymorphism, thereby supporting public health recommendations for the consumption of diets rich in fruits and vegetables as a preventive measure against cancer.

The Role of Emotional Landmarks on Topographical Memory.

PubMed

Palmiero, Massimiliano; Piccardi, Laura

2017-01-01

The investigation of the role of emotional landmarks on human navigation has been almost totally neglected in psychological research. Therefore, the extent to which positive and negative emotional landmarks affect topographical memory as compared to neutral emotional landmark was explored. Positive, negative and neutral affect-laden images were selected as landmarks from the International Affective Picture System (IAPS) Inventory. The Walking Corsi test (WalCT) was used in order to test the landmark-based topographical memory. Participants were instructed to learn and retain an eight-square path encompassing positive, negative or neutral emotional landmarks. Both egocentric and allocentric frames of references were considered. Egocentric representation encompasses the object's relation to the self and it is generated from sensory data. Allocentric representation expresses a location with respect to an external frame regardless of the self and it is the basis for long-term storage of complex layouts. In particular, three measures of egocentric and allocentric topographical memory were taken into account: (1) the ability to learn the path; (2) the ability to recall by walking the path five minutes later; (3) the ability to reproduce the path on the outline of the WalCT. Results showed that both positive and negative emotional landmarks equally enhanced the learning of the path as compared to neutral emotional landmarks. In addition, positive emotional landmarks improved the reproduction of the path on the map as compared to negative and neutral emotional landmarks. These results generally show that emotional landmarks enhance egocentric-based topographical memory, whereas positive emotional landmarks seem to be more effective for allocentric-based topographical memory.

The Role of Emotional Landmarks on Topographical Memory

PubMed Central

Palmiero, Massimiliano; Piccardi, Laura

2017-01-01

The investigation of the role of emotional landmarks on human navigation has been almost totally neglected in psychological research. Therefore, the extent to which positive and negative emotional landmarks affect topographical memory as compared to neutral emotional landmark was explored. Positive, negative and neutral affect-laden images were selected as landmarks from the International Affective Picture System (IAPS) Inventory. The Walking Corsi test (WalCT) was used in order to test the landmark-based topographical memory. Participants were instructed to learn and retain an eight-square path encompassing positive, negative or neutral emotional landmarks. Both egocentric and allocentric frames of references were considered. Egocentric representation encompasses the object’s relation to the self and it is generated from sensory data. Allocentric representation expresses a location with respect to an external frame regardless of the self and it is the basis for long-term storage of complex layouts. In particular, three measures of egocentric and allocentric topographical memory were taken into account: (1) the ability to learn the path; (2) the ability to recall by walking the path five minutes later; (3) the ability to reproduce the path on the outline of the WalCT. Results showed that both positive and negative emotional landmarks equally enhanced the learning of the path as compared to neutral emotional landmarks. In addition, positive emotional landmarks improved the reproduction of the path on the map as compared to negative and neutral emotional landmarks. These results generally show that emotional landmarks enhance egocentric-based topographical memory, whereas positive emotional landmarks seem to be more effective for allocentric-based topographical memory. PMID:28539910

Assessment of cervical stiffness in axial rotation among chronic neck pain patients: A trial in the framework of a non-manipulative osteopathic management.

PubMed

Dugailly, P-M; Coucke, A; Salem, W; Feipel, V

2018-03-01

Cervical stiffness is a clinical feature commonly appraised during the functional examination of cervical spine. Measurements of cervical stiffness in axial rotation have not been reported for patients with neck pain. The purpose of this study was to investigate cervical spine stiffness in axial rotation among neck pain patients and asymptomatic subjects, and to analyze the impact of osteopathic management. Thirty-five individuals (17 patients) were enrolled. Measurements were carried out for left-right axial rotation using a torque meter device, prior and after intervention. Passive range of motion, stiffness, and elastic-and neutral zone magnitudes were analyzed. Pain intensity was also collected for patients. The intervention consisted in one single session of non-manipulative osteopathic treatment performed in both groups. A significant main effect of intervention was found for total range of motion and neutral zone. Also, treatment by group interaction was demonstrated for neutral-, elastic zone, stiffness in right axial rotation, and for total neutral zone. Significant changes were observed in the clinical group after intervention, indicating elastic zone decrease and neutral zone increase. In contrast, no significant alteration was detected for the control group. Stiffness characteristics of the cervical spine in axial rotation are prone to be altered in patients with neck pain, but seem to be relieved after a session of non-manipulative manual therapeutic techniques. Further investigations, including randomized clinical trials with various clinical populations and therapeutic modalities, are needed to confirm these preliminary findings. Copyright © 2018 Elsevier Ltd. All rights reserved.

Optical remote sensing of penetration into the lower thermosphere of neutral wind and composition perturbations driven by magnetospheric forcing

NASA Astrophysics Data System (ADS)

Conde, M. G.; Anderson, C.; Hecht, J. H.

2011-12-01

Numerous observations of thermospheric neutral winds at altitudes of 240 km and higher clearly show wind structures occurring at auroral latitudes in response to magnetospheric forcing. It is also known from observations that magnetospheric forcing is not a major driver of winds down at mesopause heights and below. Because it is difficult to measure winds in the intervening "transition region" between these height regimes, very little is known about how deeply the magnetospherically driven neutral wind structures penetrate into the lower thermosphere, what factors affect this penetration, and what consequences it may have for transport of chemical species. Here we will show neutral wind maps obtained at F-region and E-region heights in the auroral zone using Fabry-Perot Doppler spectroscopy of the 630 nm and 558 nm optical emissions. Although thermospheric neutral winds are smoothed by viscosity and inertia, observed responses to magnetospheric forcing still include wind responses on time scales as short as 10 minutes or less, and on length scales shorter than 100 km horizontally and 5 km vertically. The data also show that the degree of penetration of magnetospheric forcing into the lower thermospheric wind field is highly variable from day to day. Signatures of magnetospheric forcing are sometimes seen at altitudes as low as 120 km, whereas at other times the E-region does not seem to respond at all. Possible links will be explored between this variability and the day to day differences seen in the column integrated thermospheric [O]/[N2] ratio over Alaska.

Distinct Trajectories of Massive Recent Gene Gains and Losses in Populations of a Microbial Eukaryotic Pathogen

PubMed Central

Hartmann, Fanny E.; Croll, Daniel

2017-01-01

Abstract Differences in gene content are a significant source of variability within species and have an impact on phenotypic traits. However, little is known about the mechanisms responsible for the most recent gene gains and losses. We screened the genomes of 123 worldwide isolates of the major pathogen of wheat Zymoseptoria tritici for robust evidence of gene copy number variation. Based on orthology relationships in three closely related fungi, we identified 599 gene gains and 1,024 gene losses that have not yet reached fixation within the focal species. Our analyses of gene gains and losses segregating in populations showed that gene copy number variation arose preferentially in subtelomeres and in proximity to transposable elements. Recently lost genes were enriched in virulence factors and secondary metabolite gene clusters. In contrast, recently gained genes encoded mostly secreted protein lacking a conserved domain. We analyzed the frequency spectrum at loci segregating a gene presence–absence polymorphism in four worldwide populations. Recent gene losses showed a significant excess in low-frequency variants compared with genome-wide single nucleotide polymorphism, which is indicative of strong negative selection against gene losses. Recent gene gains were either under weak negative selection or neutral. We found evidence for strong divergent selection among populations at individual loci segregating a gene presence–absence polymorphism. Hence, gene gains and losses likely contributed to local adaptation. Our study shows that microbial eukaryotes harbor extensive copy number variation within populations and that functional differences among recently gained and lost genes led to distinct evolutionary trajectories. PMID:28981698

Simultaneous face and voice processing in schizophrenia.

PubMed

Liu, Taosheng; Pinheiro, Ana P; Zhao, Zhongxin; Nestor, Paul G; McCarley, Robert W; Niznikiewicz, Margaret

2016-05-15

While several studies have consistently demonstrated abnormalities in the unisensory processing of face and voice in schizophrenia (SZ), the extent of abnormalities in the simultaneous processing of both types of information remains unclear. To address this issue, we used event-related potentials (ERP) methodology to probe the multisensory integration of face and non-semantic sounds in schizophrenia. EEG was recorded from 18 schizophrenia patients and 19 healthy control (HC) subjects in three conditions: neutral faces (visual condition-VIS); neutral non-semantic sounds (auditory condition-AUD); neutral faces presented simultaneously with neutral non-semantic sounds (audiovisual condition-AUDVIS). When compared with HC, the schizophrenia group showed less negative N170 to both face and face-voice stimuli; later P270 peak latency in the multimodal condition of face-voice relative to unimodal condition of face (the reverse was true in HC); reduced P400 amplitude and earlier P400 peak latency in the face but not in the voice-face condition. Thus, the analysis of ERP components suggests that deficits in the encoding of facial information extend to multimodal face-voice stimuli and that delays exist in feature extraction from multimodal face-voice stimuli in schizophrenia. In contrast, categorization processes seem to benefit from the presentation of simultaneous face-voice information. Timepoint by timepoint tests of multimodal integration did not suggest impairment in the initial stages of processing in schizophrenia. Published by Elsevier B.V.

Processing emotional words in two languages with one brain: ERP and fMRI evidence from Chinese-English bilinguals.

PubMed

Chen, Peiyao; Lin, Jie; Chen, Bingle; Lu, Chunming; Guo, Taomei

2015-10-01

Emotional words in a bilingual's second language (L2) seem to have less emotional impact compared to emotional words in the first language (L1). The present study examined the neural mechanisms of emotional word processing in Chinese-English bilinguals' two languages by using both event-related potentials (ERPs) and functional magnetic resonance imaging (fMRI). Behavioral results show a robust positive word processing advantage in L1 such that responses to positive words were faster and more accurate compared to responses to neutral words and negative words. In L2, emotional words only received higher accuracies than neutral words. In ERPs, positive words elicited a larger early posterior negativity and a smaller late positive component than neutral words in L1, while a trend of reduced N400 component was found for positive words compared to neutral words in L2. In fMRI, reduced activation was found for L1 emotional words in both the left middle occipital gyrus and the left cerebellum whereas increased activation in the left cerebellum was found for L2 emotional words. Altogether, these results suggest that emotional word processing advantage in L1 relies on rapid and automatic attention capture while facilitated semantic retrieval might help processing emotional words in L2. Copyright © 2015 Elsevier Ltd. All rights reserved.

Candidate gene polymorphisms study between human African trypanosomiasis clinical phenotypes in Guinea.

PubMed

Kaboré, Justin Windingoudi; Ilboudo, Hamidou; Noyes, Harry; Camara, Oumou; Kaboré, Jacques; Camara, Mamadou; Koffi, Mathurin; Lejon, Veerle; Jamonneau, Vincent; MacLeod, Annette; Hertz-Fowler, Christiane; Belem, Adrien Marie Gaston; Matovu, Enock; Bucheton, Bruno; Sidibe, Issa

2017-08-01

Human African trypanosomiasis (HAT), a lethal disease induced by Trypanosoma brucei gambiense, has a range of clinical outcomes in its human host in West Africa: an acute form progressing rapidly to second stage, spontaneous self-cure and individuals able to regulate parasitaemia at very low levels, have all been reported from endemic foci. In order to test if this clinical diversity is influenced by host genetic determinants, the association between candidate gene polymorphisms and HAT outcome was investigated in populations from HAT active foci in Guinea. Samples were collected from 425 individuals; comprising of 232 HAT cases, 79 subjects with long lasting positive and specific serology but negative parasitology and 114 endemic controls. Genotypes of 28 SNPs in eight genes passed quality control and were used for an association analysis. IL6 rs1818879 allele A (p = 0.0001, OR = 0.39, CI95 = [0.24-0.63], BONF = 0.0034) was associated with a lower risk of progressing from latent infection to active disease. MIF rs36086171 allele G seemed to be associated with an increased risk (p = 0.0239, OR = 1.65, CI95 = [1.07-2.53], BONF = 0.6697) but did not remain significant after Bonferroni correction. Similarly MIF rs12483859 C allele seems be associated with latent infections (p = 0.0077, OR = 1.86, CI95 = [1.18-2.95], BONF = 0.2157). We confirmed earlier observations that APOL1 G2 allele (DEL) (p = 0.0011, OR = 2.70, CI95 = [1.49-4.91], BONF = 0.0301) is associated with a higher risk and APOL1 G1 polymorphism (p = 0.0005, OR = 0.45, CI95 = [0.29-0.70], BONF = 0.0129) with a lower risk of developing HAT. No associations were found with other candidate genes. Our data show that host genes are involved in modulating Trypanosoma brucei gambiense infection outcome in infected individuals from Guinea with IL6 rs1818879 being associated with a lower risk of progressing to active HAT. These results enhance our understanding of host-parasite interactions and, ultimately, may lead to the development of new control tools.

An Overview of Radiation-Induced Interface Traps in MOS (Metal-Oxide Semiconductor) Structures

DTIC Science & Technology

1989-11-01

to be Controlled by hole transport to the Si/S1 02 interface and by neutral hydrogen diffusion, respectively. ’We also discuss several models which...trivalent Si which is undergo a dispersive hopping transport which not mobile and a mobile nonbridging oxygen. controls the rate of interface state... control the buildup of ping event itself seems to be a phonon-assisted radiation-induced interface states are subjects tunneling transition between

Middle East: Output expansions boost drilling

DOE Office of Scientific and Technical Information (OSTI.GOV)

NONE

1996-08-01

Iraqi exports may return to the market in limited fashion, but none of the region`s producers seems particularly concerned. They believe that global oil demand is rising fast enough to justify their additions to productive capacity. The paper discusses exploration, drilling and development, and production in Saudi Arabia, Kuwait, the Neutral Zone, Abu Dhabi, Dubai, Oman, Iran, Iraq, Yemen, Qatar, Syria, Turkey, and Sharjah. The paper also briefly mentions activities in Bahrain, Israel, Jordan, and Ras al Khaimah.

Nightside Structure of the Venusian Ionosphere

NASA Astrophysics Data System (ADS)

Ledvina, S. A.; Brecht, S. H.

2017-12-01

The Pioneer Venus Orbiter, PVO, was the first mission to detect large-scale structure in the nightside region of Venus. This structure is often referred to as "tail rays." Since this discovery, there has been continuous discussion as to the cause of the structure. There have been theoretical attempts to explain the structure but no definitive determination of the mechanism. Typically, the wavelengths of the structure were not always consistent with the theory. Three-dimensional hybrid simulations are reported that produce structure on the nightside of Venus. The structure seems consistent with the data. This paper will present the results of the simulations as well as a variety of numerical tests that offer some insight into the mechanism driving the development of the structure. The tests reveal that the ambipolar electric fields as produced by the gradient of the electron pressure seems to be the root cause of the structure. It will be shown that different realizations of the neutral wind modify the structure. The hybrid simulations are three dimensional with neutral winds included in the simulations. The resolution of the simulation is 50 km/cell and lower. The spherical grid used in the simulations to handle chemistry and collisions has a resolution of 5 km radially and under 50 km in the angular directions. It is these high resolution simulations that produce the structure to be discussed in this paper.

Genetic diversity of the merozoite surface protein-3 gene in Plasmodium falciparum populations in Thailand.

PubMed

Pattaradilokrat, Sittiporn; Sawaswong, Vorthon; Simpalipan, Phumin; Kaewthamasorn, Morakot; Siripoon, Napaporn; Harnyuttanakorn, Pongchai

2016-10-21

An effective malaria vaccine is an urgently needed tool to fight against human malaria, the most deadly parasitic disease of humans. One promising candidate is the merozoite surface protein-3 (MSP-3) of Plasmodium falciparum. This antigenic protein, encoded by the merozoite surface protein (msp-3) gene, is polymorphic and classified according to size into the two allelic types of K1 and 3D7. A recent study revealed that both the K1 and 3D7 alleles co-circulated within P. falciparum populations in Thailand, but the extent of the sequence diversity and variation within each allelic type remains largely unknown. The msp-3 gene was sequenced from 59 P. falciparum samples collected from five endemic areas (Mae Hong Son, Kanchanaburi, Ranong, Trat and Ubon Ratchathani) in Thailand and analysed for nucleotide sequence diversity, haplotype diversity and deduced amino acid sequence diversity. The gene was also subject to population genetic analysis (F st ) and neutrality tests (Tajima's D, Fu and Li D* and Fu and Li' F* tests) to determine any signature of selection. The sequence analyses revealed eight unique DNA haplotypes and seven amino acid sequence variants, with a haplotype and nucleotide diversity of 0.828 and 0.049, respectively. Neutrality tests indicated that the polymorphism detected in the alanine heptad repeat region of MSP-3 was maintained by positive diversifying selection, suggesting its role as a potential target of protective immune responses and supporting its role as a vaccine candidate. Comparison of MSP-3 variants among parasite populations in Thailand, India and Nigeria also inferred a close genetic relationship between P. falciparum populations in Asia. This study revealed the extent of the msp-3 gene diversity in P. falciparum in Thailand, providing the fundamental basis for the better design of future blood stage malaria vaccines against P. falciparum.

VDR independent induction of acid-sphingomyelinase by 1,23(OH)2 D3 in gastric cancer cells: Impact on apoptosis and cell morphology.

PubMed

Albi, Elisabetta; Cataldi, Samuela; Ferri, Ivana; Sidoni, Angelo; Traina, Giovanna; Fettucciari, Katia; Ambesi-Impiombato, Francesco Saverio; Lazzarini, Andrea; Curcio, Francesco; Ceccarini, Maria Rachele; Beccari, Tommaso; Codini, Michela

2018-03-01

1 alpha,25-dihydroxyvitamin D 3 (1,23(OH) 2 D 3 ) is known to play a dual role in cancer, by promoting or inhibiting carcinogenesis via 1,23(OH) 2 D 3 receptor (VDR) and phosphatase and tensin homolog deleted on chromosome 10 (PTEN). Fok I polymorphism of VDR may indirectly influence the receptor levels through autoregulation. The involvement of neutral sphingomyelinase in the non-classic VDR-mediated genomic pathway response to 1,23(OH) 2 D 3 treatment has been reported. Until now no information were reported about Fok I polymorphism of VDR in NCI-N87 human gastric cancer cells and the relation between acid sphingomyelinase and 1,23(OH) 2 D 3 . Herein, we showed that NCI-N87 human gastric cancer cells are homozygous for the Fok I 'C' allele; resulting in a three amino acid-truncated protein form of the VDR. Surprisingly 1,23(OH) 2 D 3 treatments strongly down-regulated the expression of VDR whereas acid sphingomyelinase and PTEN expression were upregulated. No changes of neutral sphingomyelinase expression were observed after 1,23(OH) 2 D 3 treatment, whereas acid sphingomyelinase activity increased. Furthermore 1,23(OH) 2 D 3 induced over-expression of caspase 8, CDKN2B, MAP3K5, cytochrome C apoptotic genes. Morphological analysis highlighted some very large round or oval cells and small cells with angular or fusiform extensions, confirmed by MIB-1 immunodetection and Hercep test. Taken together our results indicated that the action of 1,23(OH) 2 D 3 in gastric cancer cells was independent on 1,23(OH) 2 D 3 receptor and suggested the acid sphingomyelinase as a possible target to induce molecular events. Copyright © 2017. Published by Elsevier B.V.

A comprehensive study of small non-frameshift insertions/deletions in proteins and prediction of their phenotypic effects by a machine learning method (KD4i)

PubMed Central

2014-01-01

Background Small insertion and deletion polymorphisms (Indels) are the second most common mutations in the human genome, after Single Nucleotide Polymorphisms (SNPs). Recent studies have shown that they have significant influence on genetic variation by altering human traits and can cause multiple human diseases. In particular, many Indels that occur in protein coding regions are known to impact the structure or function of the protein. A major challenge is to predict the effects of these Indels and to distinguish between deleterious and neutral variants. When an Indel occurs within a coding region, it can be either frameshifting (FS) or non-frameshifting (NFS). FS-Indels either modify the complete C-terminal region of the protein or result in premature termination of translation. NFS-Indels insert/delete multiples of three nucleotides leading to the insertion/deletion of one or more amino acids. Results In order to study the relationships between NFS-Indels and Mendelian diseases, we characterized NFS-Indels according to numerous structural, functional and evolutionary parameters. We then used these parameters to identify specific characteristics of disease-causing and neutral NFS-Indels. Finally, we developed a new machine learning approach, KD4i, that can be used to predict the phenotypic effects of NFS-Indels. Conclusions We demonstrate in a large-scale evaluation that the accuracy of KD4i is comparable to existing state-of-the-art methods. However, a major advantage of our approach is that we also provide the reasons for the predictions, in the form of a set of rules. The rules are interpretable by non-expert humans and they thus represent new knowledge about the relationships between the genotype and phenotypes of NFS-Indels and the causative molecular perturbations that result in the disease. PMID:24742296

Balancing selection and genetic drift at major histocompatibility complex class II genes in isolated populations of golden snub-nosed monkey (Rhinopithecus roxellana)

PubMed Central

2012-01-01

Background Small, isolated populations often experience loss of genetic variation due to random genetic drift. Unlike neutral or nearly neutral markers (such as mitochondrial genes or microsatellites), major histocompatibility complex (MHC) genes in these populations may retain high levels of polymorphism due to balancing selection. The relative roles of balancing selection and genetic drift in either small isolated or bottlenecked populations remain controversial. In this study, we examined the mechanisms maintaining polymorphisms of MHC genes in small isolated populations of the endangered golden snub-nosed monkey (Rhinopithecus roxellana) by comparing genetic variation found in MHC and microsatellite loci. There are few studies of this kind conducted on highly endangered primate species. Results Two MHC genes were sequenced and sixteen microsatellite loci were genotyped from samples representing three isolated populations. We isolated nine DQA1 alleles and sixteen DQB1 alleles and validated expression of the alleles. Lowest genetic variation for both MHC and microsatellites was found in the Shennongjia (SNJ) population. Historical balancing selection was revealed at both the DQA1 and DQB1 loci, as revealed by excess non-synonymous substitutions at antigen binding sites (ABS) and maximum-likelihood-based random-site models. Patterns of microsatellite variation revealed population structure. FST outlier analysis showed that population differentiation at the two MHC loci was similar to the microsatellite loci. Conclusions MHC genes and microsatellite loci showed the same allelic richness pattern with the lowest genetic variation occurring in SNJ, suggesting that genetic drift played a prominent role in these isolated populations. As MHC genes are subject to selective pressures, the maintenance of genetic variation is of particular interest in small, long-isolated populations. The results of this study may contribute to captive breeding and translocation programs for endangered species. PMID:23083308

The maturation inhibitor bevirimat (PA-457) can be active in patients carrying HIV type-1 non-B subtypes and recombinants.

PubMed

Yebra, Gonzalo; Holguín, Africa

2008-01-01

Bevirimat (PA-457) is the first candidate of a new family of antiretroviral drugs, the maturation inhibitors. Its action is based on disruption of the protease cleavage of the Gag precursor region. Six resistance mutations have been described and analysed in virus from both treatment-naive and protease inhibitor (PI)-experienced patients, but only in the subtype B of HIV type-1 (HIV-1) virus. Thus, genotypic resistance in non-B subtypes still requires analysis. HIV-1 sequences of different subtypes (54 B, 81 non-B and recombinants) were analysed for the presence of resistance mutations to bevirimat, located within the capsid (CA) protein and spacer peptide 1 (SP1) cleavage site. No resistance mutations were found, although polymorphisms appeared in some CA-SP1 residues. The C-terminal CA protein and the N-terminal SP1 presented high conservation, whereas C-terminal SP1 was highly variable in sequence and length, with unknown influence in resistance acquisition. The results of the present study confirm an absolute conservation of the residues involved in bevirimat in vitro resistance in a large panel of HIV-1 subtypes and recombinants from both treatment-naive and PI-experienced patients. Treatment alone seemed to increase the polymorphisms account in CRF02_AG recombinant sequences; however, the influence of natural polymorphisms needs to be explored.

Genetic correlation between rheumatoid arthritis and periodontal disease: the role of sex and IL-10.

PubMed

Azzi, L; Rania, S; Spadari, F; Vinci, R; Manfredini, M; Croveri, F; Boggio, A; Tettamanti, L; Tagliabue, A; Silvestre-Rangil, J; Bellintani, C

2017-01-01

The chronic stimulation of the immune system due to the presence of bacterial antigens within periodontal tissues has been associated with several autoimmune diseases, like diabetes mellitus, infective endocarditis or cardiovascular atherosclerosis. The current study aims at evaluating the correlation between Rheumatoid Arthritis (RA) and Periodontal Disease (PD) with special attention to genetic polymorphisms in cytokine expression. A total number of 34 patients affected by RA were recruited. Each of them underwent haematochemical analysis and data were collected for Rheumatoid Factor (RF), Anti-Citrullinated Protein’s Antibody (CCP) and HLA-BDR1. DAS-28 questionnaire for disease activity was fulfilled by the rheumatologist, while a periodontal examination was carried out by the dental clinician and crevicular fluid samples were collected to evaluate the IL-6, IL-10 and VDR polymorphysms. A connection between CCP and IL-10 polymorphisms was found, with IL-10 expressing protecting tendency against periodontal disease when CCP are found in the bloodstream (p=0.0017). Finally, males mainly expressed IL-10 predisposing genes (p=0.046), while females showed a greater tendency to express RF (p=0.014) and CCP (p=0.050). This paper corroborates the idea of a correlation between sex, IL-10 polymorphisms and RA, which should be studied in depth, since recent papers have shown that IL-10 injected into joints seems to decrease inflammation.

Association of the MTHFR 1298A>C (rs1801131) polymorphism with speed and strength sports in Russian and Polish athletes.

PubMed

Zarebska, Aleksandra; Ahmetov, Ildus I; Sawczyn, Stanislaw; Weiner, Alexandra S; Kaczmarczyk, Mariusz; Ficek, Krzysztof; Maciejewska-Karlowska, Agnieszka; Sawczuk, Marek; Leonska-Duniec, Agata; Klocek, Tomasz; Voronina, Elena N; Boyarskikh, Uljana A; Filipenko, Maksim L; Cieszczyk, Pawel

2014-01-01

It has been suggested that DNA hypomethylation because of poorer effectiveness of the 5,10-methylenetetrahydrofolate reductase (MTHFR) enzyme induces muscular growth. We hypothesised that the common, functional 1298A>C polymorphism in the MTHFR gene is associated with athletic status. To test this hypothesis, we investigated the distribution of the 1298A>C variant in Polish (n = 302) and Russian (n = 842) athletes divided into four groups: endurance, strength-endurance, sprint-strength and strength-endurance, as well as in 1540 control participants. We found different genotypes (the AC heterozygote advantage) and allele distributions among sprint-strength athletes and strength athletes than the groups of sedentary controls for each nationality. In the combined study, the allelic frequencies for the 1298C variant were 35.6% in sprint-strength athletes (OR 1.18 [1.02-1.36], P = 0.024 vs. controls) and 38.6% in strength athletes (OR 1.34 [1.10-1.64], P = 0.003 vs. controls). The results of the initial and repetition studies as well as the combined analysis suggest that the functional 1298A>C polymorphism in the MTHFR gene is associated with athletic status. The presence of the C allele seems to be beneficial in sprint-strength and strength athletes. It needs to be established whether and to what extent this effect is mediated by alteration in DNA methylation status.

Plasma visfatin, associated with a genetic polymorphism -1535C>T, is correlated with C-reactive protein in Chinese Han patients with traumatic brain injury.

PubMed

Weng, Jian-Feng; Chen, Jun; Hong, Wei-Cong; Luo, Li-Feng; Yu, Wei; Luo, Shi-Da

2013-02-01

Visfatin is a newly identified pro-inflammatory adipokine and a genetic polymorphism -1535 C>T located in the visfatin gene promoter has been suggested to be associated with the regulation of visfatin expression in some inflammatory illness. However, there were some conflicting results regarding whether this variant is functional or not. This study aimed to examine the relations of the -1535 C>T single nucleotide polymorphism (SNP) of visfatin gene to the plasma visfatin and C-reactive protein concentrations in traumatic brain injury (TBI). 318 Chinese Han patients with TBI were recruited in this study. Plasma visfatin and C-reactive protein levels were significantly different between the genotypes in the SNP-1535 C>T even after adjustment for age, sex and body mass index. The genotype C-C had the highest plasma visfatin and C-reactive protein concentrations. The plasma visfatin and C-reactive protein concentrations between the variant genotypes C-T and T-T did not differ significantly. Plasma visfatin level was significantly associated with plasma C-reactive protein level using multivariate linear regression. Thus, the SNP-1535 C>T of visfatin gene seemed to be potentially involved in the inflammatory component of TBI through a decreased production of visfatin. Copyright © 2012 Elsevier Inc. All rights reserved.

Study of chromosomal region 5p13.1 in Crohn's disease, ulcerative colitis, and rheumatoid arthritis.

PubMed

Perdigones, Nieves; Martín, Ezequiel; Robledo, Gema; Lamas, José Ramón; Taxonera, Carlos; Díaz-Rubio, Manuel; de la Concha, Emilio G; López-Nevot, Miguel Angel; García, Antonio; Gómez-García, María; Fernández-Gutiérrez, Benjamín; Martín, Javier; Urcelay, Elena

2010-08-01

Chromosomal region 5p13 includes regulatory elements of the prostaglandin receptor EP4 (PTGER4) gene and is associated with inflammatory bowel disease (IBD) susceptibility. We aimed at corroborating the association of the PTGER4 risk variant in IBD. Given the proinflammatory activity of prostaglandin E(2) in rheumatoid arthritis (RA), the reduction in incidence and severity of collagen-induced arthritis observed in mice deficient in the prostaglandin receptor EP4, and a modest signal of association found in an RA genome-wide scan, we proposed to extend the investigation of this locus to RA patients. A total of 709 Crohn's disease (CD) patients, 662 ulcerative colitis (UC) patients, and 1369 control subjects were genotyped for rs17234657. This polymorphism was also analyzed in 605 RA patients, and rs6871834 was studied in the RA patient group. Replication of the previous finding in CD was achieved in our independent collections, although with a milder effect (odds ratios = 1.23) than that originally described. No further association of the previously mentioned polymorphisms was detected with either UC or RA patients. We validated this 5p13 signal as a genuine susceptibility factor for CD in Caucasian populations. Our data seem to rule out a major influence of these polymorphisms on UC or RA predisposition. Copyright 2010 American Society for Histocompatibility and Immunogenetics. Published by Elsevier Inc. All rights reserved.

Nutritional Strategies for the Individualized Treatment of Non-Alcoholic Fatty Liver Disease (NAFLD) Based on the Nutrient-Induced Insulin Output Ratio (NIOR).

PubMed

Stachowska, Ewa; Ryterska, Karina; Maciejewska, Dominika; Banaszczak, Marcin; Milkiewicz, Piotr; Milkiewicz, Małgorzata; Gutowska, Izabela; Ossowski, Piotr; Kaczorowska, Małgorzata; Jamioł-Milc, Dominika; Sabinicz, Anna; Napierała, Małgorzata; Wądołowska, Lidia; Raszeja-Wyszomirska, Joanna

2016-07-22

Nutrients play a fundamental role as regulators of the activity of enzymes involved in liver metabolism. In the general population, the action of nutrients may be affected by gene polymorphisms. Therefore, individualization of a diet for individuals with fatty liver seems to be a fundamental step in nutritional strategies. In this study, we tested the nutrient-induced insulin output ratio (NIOR), which is used to identify the correlation between the variants of genes and insulin resistance. We enrolled 171 patients, Caucasian men (n = 104) and women (n = 67), diagnosed with non-alcoholic fatty liver disease (NAFLD). From the pool of genes sensitive to nutrient content, we selected genes characterized by a strong response to the NIOR. The polymorphisms included Adrenergic receptor (b3AR), Tumor necrosis factor (TNFα), Apolipoprotein C (Apo C III). Uncoupling Protein type I (UCP-1), Peroxisome proliferator activated receptor γ2 (PPAR-2) and Apolipoprotein E (APOEs). We performed three dietary interventions: a diet consistent with the results of genotyping (NIOR (+)); typical dietary recommendations for NAFLD (Cust (+)), and a diet opposite to the genotyping results (NIOR (-) and Cust (-)). We administered the diet for six months. The most beneficial changes were observed among fat-sensitive patients who were treated with the NIOR (+) diet. These changes included improvements in body mass and insulin sensitivity and normalization of blood lipids. In people sensitive to fat, the NIOR seems to be a useful tool for determining specific strategies for the treatment of NAFLD.

Serotonin synthesis rate and the tryptophan hydroxylase-2: G-703T polymorphism in social anxiety disorder.

PubMed

Furmark, Tomas; Marteinsdottir, Ina; Frick, Andreas; Heurling, Kerstin; Tillfors, Maria; Appel, Lieuwe; Antoni, Gunnar; Hartvig, Per; Fischer, Håkan; Långström, Bengt; Eriksson, Elias; Fredrikson, Mats

2016-10-01

It is disputed whether anxiety disorders, like social anxiety disorder, are characterized by serotonin over- or underactivity. Here, we evaluated whether our recent finding of elevated neural serotonin synthesis rate in patients with social anxiety disorder could be reproduced in a separate cohort, and whether allelic variation in the tryptophan hydroxylase-2 (TPH2) G-703T polymorphism relates to differences in serotonin synthesis assessed with positron emission tomography. Eighteen social anxiety disorder patients and six healthy controls were scanned during 60 minutes in a resting state using positron emission tomography and 5-hydroxy-L-[β -(11)C]tryptophan, [(11)C]5-HTP, a substrate of the second enzymatic step in serotonin synthesis. Parametric images were generated, using the reference Patlak method, and analysed using Statistical Parametric Mapping (SPM8). Blood samples for genotyping of the TPH2 G-703T polymorphism were obtained from 16 social anxiety disorder patients (T carriers: n=5, GG carriers: n=11). A significantly elevated [(11)C]5-HTP accumulation rate, indicative of enhanced decarboxylase activity and thereby serotonin synthesis capacity, was detected in social anxiety disorder patients compared with controls in the hippocampus and basal ganglia nuclei and, at a more lenient (uncorrected) statistical threshold, in the amygdala and anterior cingulate cortex. In patients, the serotonin synthesis rate in the amygdala and anterior cingulate cortex was significantly elevated in TPH2 T carriers in comparison with GG homozygotes. Our results support that social anxiety disorder entails an overactive presynaptic serotonergic system that, in turn, seems functionally influenced by the TPH2 G-703T polymorphism in emotionally relevant brain regions. © The Author(s) 2016.

Single nucleotide polymorphisms of IFNγ (+874 A/T) and IFNγR1 (-56 C/T) in Iranian patients with TB.

PubMed

Beiranvand, Elham; Abediankenari, Saeid; Valiyari, Samira; Rezaei, Mohammad Sadegh; Rostamian, Mosayeb; Beiranvand, Behnoush; Khaligh, Ali; Khani, Soghra

2016-12-01

Two important genes for controlling TB are IFNγ and IFNγR1. However, little information exists regarding genetic susceptibility of the Iranian TB population. We investigated the single nucleotide polymorphisms (SNPs) in genes of IFNγ (+874 A/T) and IFNγR1 (-56 C/T) and serum level of IFNγ and their influence on TB in patients; 300 patients with TB and 300 healthy controls were enrolled in this study. PCR-restriction fragment length polymorphism was used to identify SNPs and serum level of IFNγ was measured by ELISA. The allelic and the genotypic form of IFNγ+874 A/T SNP of the studied population were not significant (p>0.05). Allele T frequencies of IFNγR1 -56 C/T promoter region in patients with pulmonary TB (PTB) or extrapulmonary TB (EPTB) were significantly greater than allele C. The -56 TT motif of IFNγR1 is associated with both forms of TB (p<0.05). The serum level of IFNγ was significantly higher in patients with TB than in controls, but there was no significant difference between serum level of IFNγ and the studied genotypes (p>0.05). The cause of active TB in the patients seems to be due to the lack of effective IFNγ function or the lack of effective signaling connection between IFNγ and its receptor in presence of -56 C/T polymorphism in promoter region of IFNγR1 gene. © The Author 2016. Published by Oxford University Press on behalf of Royal Society of Tropical Medicine and Hygiene. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Effect of g.9476869G>A myeloperoxidase (MPO) gene polymorphism on the antioxidant activity of milk from Polish Holstein-Friesian cows of the Black-and-White variety (HO).

PubMed

Pokorska, Joanna; Poskart, Karolina; Kułaj, Dominika; Ochrem, Andrzej; Dusza, Magdalena; Gil, Zygmunt; Świętek, Ewa; Makulska, Joanna

2017-05-01

Myeloperoxidase (MPO) is an important enzyme, which is one of the components of the antibacterial system in neutrophils and monocytes. MPO participates in the inflammatory response in multiple locations in the body, including the mammary glands. As a result of the activity of MPO, many oxidising compounds as well as reactive oxygen species are generated. It seems that myeloperoxidase may be a marker linking inflammation processes and oxidative stress. So far, there are no literature data on the association between the MPO gene polymorphism and the antioxidant properties of milk. The aim of the study was to analyse the effect of g.9476869G > A polymorphism of myeloperoxidase (MPO) gene and age of cows on the antioxidant activity of milk and other milk traits in Polish Holstein-Friesian cows. Polymorphism of MPO gene was identified by the PCR-RFLP method using the HphI endonuclease. The total antioxidant capacity of milk samples was measured by the Trolox Equivalent Antioxidant Capacity (TEAC) method. It was found that the GG genotype was the most frequent (0·606). The genotype at the tested MPO locus and the age of the animals affected the antioxidant activity of milk. Milk from cows with the GA genotype was characterised by a significantly higher antioxidant activity than milk from cows with the GG genotype (P < 0·0001). The analysis of interaction showed that cows with the GA genotype and older than 6·5 years produced milk with a significantly higher antioxidant activity compared with younger cows with the same genotype (P < 0·0001), as well as cows with the GG genotype of all ages (P < 0·0001).

Combined effects of the PNPLA3 rs738409, TM6SF2 rs58542926, and MBOAT7 rs641738 variants on NAFLD severity: a multicenter biopsy-based study1[S

PubMed Central

Krawczyk, Marcin; Rau, Monika; Schattenberg, Jörn M.; Bantel, Heike; Pathil, Anita; Demir, Münevver; Kluwe, Johannes; Boettler, Tobias; Lammert, Frank; Geier, Andreas

2017-01-01

The PNPLA3 p.I148M, TM6SF2 p.E167K, and MBOAT7 rs641738 variants represent genetic risk factors for nonalcoholic fatty liver disease (NAFLD). Here we investigate if these polymorphisms modulate both steatosis and fibrosis in patients with NAFLD. We recruited 515 patients with NAFLD (age 16–88 years, 280 female patients). Liver biopsies were performed in 320 patients. PCR-based assays were used to genotype the PNPLA3, TM6SF2, and MBOAT7 variants. Carriers of the PNPLA3 and TM6SF2 risk alleles showed increased serum aspartate aminotransferase and alanine transaminase activities (P < 0.05). The PNPLA3 genotype was associated with steatosis grades S2–S3 (P < 0.001) and fibrosis stages F2–F4 (P < 0.001). The TM6SF2 genotype was associated with steatosis (P = 0.003) but not with fibrosis (P > 0.05). The MBOAT7 variant was solely associated with increased fibrosis (P = 0.046). In the multivariate model, variants PNPLA3 (P = 0.004) and TM6SF2 (P = 0.038) were associated with steatosis. Fibrosis stages were affected by the PNPLA3 (P = 0.042) and MBOAT7 (P = 0.021) but not by the TM6SF2 polymorphism (P > 0.05). The PNPLA3, TM6SF2, and MBOAT7 variants are associated with increased liver injury. The TM6SF2 variant seems to modulate predominantly hepatic fat accumulation, whereas the MBOAT7 polymorphism is linked to fibrosis. The PNPLA3 polymorphism confers risk of both increased steatosis and fibrosis. PMID:27836992

Combined effects of the PNPLA3 rs738409, TM6SF2 rs58542926, and MBOAT7 rs641738 variants on NAFLD severity: a multicenter biopsy-based study.

PubMed

Krawczyk, Marcin; Rau, Monika; Schattenberg, Jörn M; Bantel, Heike; Pathil, Anita; Demir, Münevver; Kluwe, Johannes; Boettler, Tobias; Lammert, Frank; Geier, Andreas

2017-01-01

The PNPLA3 p.I148M, TM6SF2 p.E167K, and MBOAT7 rs641738 variants represent genetic risk factors for nonalcoholic fatty liver disease (NAFLD). Here we investigate if these polymorphisms modulate both steatosis and fibrosis in patients with NAFLD. We recruited 515 patients with NAFLD (age 16-88 years, 280 female patients). Liver biopsies were performed in 320 patients. PCR-based assays were used to genotype the PNPLA3, TM6SF2, and MBOAT7 variants. Carriers of the PNPLA3 and TM6SF2 risk alleles showed increased serum aspartate aminotransferase and alanine transaminase activities (P < 0.05). The PNPLA3 genotype was associated with steatosis grades S2-S3 (P < 0.001) and fibrosis stages F2-F4 (P < 0.001). The TM6SF2 genotype was associated with steatosis (P = 0.003) but not with fibrosis (P > 0.05). The MBOAT7 variant was solely associated with increased fibrosis (P = 0.046). In the multivariate model, variants PNPLA3 (P = 0.004) and TM6SF2 (P = 0.038) were associated with steatosis. Fibrosis stages were affected by the PNPLA3 (P = 0.042) and MBOAT7 (P = 0.021) but not by the TM6SF2 polymorphism (P > 0.05). The PNPLA3, TM6SF2, and MBOAT7 variants are associated with increased liver injury. The TM6SF2 variant seems to modulate predominantly hepatic fat accumulation, whereas the MBOAT7 polymorphism is linked to fibrosis. The PNPLA3 polymorphism confers risk of both increased steatosis and fibrosis. Copyright © 2017 by the American Society for Biochemistry and Molecular Biology, Inc.

Association of the Met-196-Arg variation of human tumor necrosis factor receptor 2 (TNFR2) with paranoid schizophrenia.

PubMed

Thabet, Sihem; Ben Nejma, Mouna; Zaafrane, Ferid; Gaha, Lotfi; Ben Salem, Kamel; Romdhane, Abdelaziz; Nour, Mohamed; Jrad, Besma Bel Hadj

2011-03-01

Research has provided strong evidence for oligodendrocyte and myelin-related genes dysfunction in schizophrenia. Several studies have suggested abnormalities in the expression of myelin-related genes including tumor necrosis factor receptor 2 (TNFR2) involved in the neurodegeneration and remyelination. In order to further assess the role of TNFR2 in schizophrenia, we examined a functional bi-allelic polymorphism associated with an impaired NF-KB signaling and cell survival. In the present case/control study, 220 patients with schizophrenia and 176 healthy controls were genotyped by RFLP-PCR for the T/G polymorphism at the position 676 in exon 6 of the TNFR2 gene. We found a trend towards over-representation of TNFR2 676G in the patients compared to the controls (p=0.19 and 0.09 respectively). Interestingly, when we evaluated the association between this genetic polymorphism and the clinical variables of schizophrenia, our findings indicated that the frequencies of the G/G genotype and the G allele were significantly higher in paranoid (p=0.014 and p=0.012 respectively) and adult-onset paranoid (p=0.004 and p=0.004 respectively) schizophrenia patient group compared to the controls. The potential association was confirmed by a logistic regression model only for development of the paranoid form of schizophrenia (p=0.022) indicating a substantially increased risk for paranoid schizophrenia with inheritance of the TNFR2(G) allele. In conclusion, this polymorphism in TNFR2 or a gene in proximity seems to be associated specifically with paranoid schizophrenia, at least in the Tunisian population. A replication of our findings in other and larger populations could be of particular importance to establish TNFR2 as one of the susceptibility genes of paranoid schizophrenia.

Improvement of a predictive model in ovarian cancer patients submitted to platinum-based chemotherapy: implications of a GST activity profile.

PubMed

Pereira, Deolinda; Assis, Joana; Gomes, Mónica; Nogueira, Augusto; Medeiros, Rui

2016-05-01

The success of chemotherapy in ovarian cancer (OC) is directly associated with the broad variability in platinum response, with implications in patients survival. This heterogeneous response might result from inter-individual variations in the platinum-detoxification pathway due to the expression of glutathione-S-transferase (GST) enzymes. We hypothesized that GSTM1 and GSTT1 polymorphisms might have an impact as prognostic and predictive determinants for OC. We conducted a hospital-based study in a cohort of OC patients submitted to platinum-based chemotherapy. GSTM1 and GSTT1 genotypes were determined by multiplex PCR. GSTM1-null genotype patients presented a significantly longer 5-year survival and an improved time to progression when compared with GSTM1-wt genotype patients (log-rank test, P = 0.001 and P = 0.013, respectively). Multivariate Cox regression analysis indicates that the inclusion of genetic information regarding GSTM1 polymorphism increased the predictive ability of risk of death after OC platinum-based chemotherapy (c-index from 0.712 to 0.833). Namely, residual disease (HR, 4.90; P = 0.016) and GSTM1-wt genotype emerged as more important predictors of risk of death (HR, 2.29; P = 0.039; P = 0.036 after bootstrap). No similar effect on survival was observed regarding GSTT1 polymorphism, and there were no statistically significant differences between GSTM1 and GSTT1 genotypes and the assessed patients' clinical-pathological characteristics. GSTM1 polymorphism seems to have an impact in OC prognosis as it predicts a better response to platinum-based chemotherapy and hence an improved survival. The characterization of the GSTM1 genetic profile might be a useful molecular tool and a putative genetic marker for OC clinical outcome.

P53 gene codon 72 polymorphism in patients with oral squamous cell carcinoma in the population of northern Iran.

PubMed

Sina, Mahmud; Pedram, Mehrdad; Ghojazadeh, Morteza; Kochaki, Ahmad; Aghbali, Amirala

2014-11-01

Squamous cell carcinoma is the most common cancer of the oral cavity, and several etiologic factors are involved in its developing. Single nucleotide polymorphism (SNP) of the P53 gene codon 72 (P53c72) changes the structure of the protein and affects its activity. The prevalence of P53c72 different genotypes, which seems to vary with race and geographic location, has shown a strong correlation with many types of human cancers. The aim of this study was to investigate the correlation between P53c72polymorphism and risk of oral squamous cell carcinoma (OSCC) in the heavily populated Gilan Province in northern Iran. This case-control study was done on 55 paraffin-embedded samples from OSCC patients and 100 samples of non-dysplastic oral cavity lesions. The P53c72 genotypes were determined using the ARMS-PCR method. SPSS-15 software was used for statistical analysis. There were no significant statistical differences found between the prevalence of different P53c72 genotypes in the OSCC group vs. the control. However, the Pro/Pro genotype in OSCC samples showed a strong correlation with age, as 70% of such patients were below 50 years old. Interestingly, a large portion (40%) of the patients with the Pro/Pro genotype had the tumor in the lip area. Although P53c72 polymorphism does not appear to be a predisposing factor for OSCC in the population of Northern Iran, the Pro/Pro genotype could be considered as a risk factor for OSCC in adults below 50 years old and the anatomical location of the tumor.

Polymorphisms in the type I deiodinase gene and frontal function in recurrent depressive disorder.

PubMed

Gałecka, Elżbieta; Talarowska, Monika; Orzechowska, Agata; Górski, Paweł; Szemraj, Janusz

2016-09-01

Significant impairment of some psychological functions, including cognitive functioning, has been characteristically found in depressed patients. Memory disturbances may be related to the levels of thyroid hormones (TH) that are under the influence of different mechanisms and molecules, including deiodinase type 1(D1) - an important determinant of circulating triiodothyronine (T3). We investigated the relationship between two functionally known polymorphisms within the DIO1 gene, i.e. DIO1a-C/T and DIO1b-A/G, and cognitive functioning in patients diagnosed with recurrent depressive disorder (rDD). In the planned analysis we mainly concentrated on the frontal function: working memory, executive functions and verbal fluency. Genetic variants were genotyped in 128 patients using a method based on polymerase chain reaction (PCR). Cognitive functions were assessed by the Trail Making Test, the Stroop Test and the Verbal Fluency Test (VFT). No significant associations were found between DIO1 polymorphisms and cognitive functioning in rDD. Only the CT and TT genotypes of the DIO1a variant were significantly related to verbal fluency. There were no significant differences between the distribution of the genotypes and demographic/medical variables. Based on the study, the examined polymorphisms are not an important risk or protective factor for cognitive impairment in depressive patients. Functional variants within the DIO1 gene that affect triiodothyronine (T3) levels seem not to be associated with cognitive functions. Nevertheless, considering the fact that the DIO1 gene is related to the course and management of depression, further studies on a larger sample size might be suggested. Copyright © 2016 Medical University of Bialystok. Published by Elsevier Urban & Partner Sp. z o.o. All rights reserved.

TNFalpha -308 G/A polymorphism is associated with breast cancer risk: a meta-analysis involving 10,184 cases and 12,911 controls.

PubMed

Fang, Fang; Yao, Lei; Yu, Xiao Jia; Yu, Lu; Wu, Qi; Yu, Long

2010-07-01

Tumor necrosis factor alpha (TNFalpha) is a pleiotropic cytokine which can regulate a wide variety of cellular responses. Low concentrations of TNFalpha seem to increase tumor growth and progression. The -308 G/A polymorphism in TNFalpha has been implicated in breast cancer risk but the published data remain inconclusive. In order to derive a more precise estimation of the relationship, a meta-analysis was performed by searching PubMed, Web of Science, ScienceDirect, EBSCO, CNKI, and Chinese Biomedicine Database. 11 studies including 10,184 cases and 12,911 controls were collected for TNFalpha -308 G/A polymorphism. Crude ORs with 95% CIs were used to assess the strength of association between the TNFalpha -308 G/A polymorphism and breast cancer risk. The pooled ORs were performed for codominant model (GG versus AA; GA versus AA), dominant model (GG + GA versus AA), recessive model (GG versus GA + AA), and G allele versus A allele, respectively. Overall, significantly elevated breast cancer risk was found for recessive model (OR = 1.10, 95% CI = 1.04-1.17) and for G allele versus A allele (OR = 1.08, 95% CI = 1.02-1.14). In the subgroup analysis by ethnicity, significantly increased risks were also found among Caucasians for recessive model and for G allele versus A allele (for recessive model: OR = 1.10, 95% CI = 1.04-1.17; for G allele versus A allele: OR = 1.09, 95% CI = 1.03-1.14). However, no significant associations were found among Asians for all genetic models. In conclusion, this meta-analysis suggests that the TNFalpha -308 G allele is a risk factor for developing breast cancer, especially for Caucasians.

The AGT Gene M235T Polymorphism and Response of Power-Related Variables to Aerobic Training.

PubMed

Aleksandra, Zarębska; Zbigniew, Jastrzębski; Waldemar, Moska; Agata, Leońska-Duniec; Mariusz, Kaczmarczyk; Marek, Sawczuk; Agnieszka, Maciejewska-Skrendo; Piotr, Żmijewski; Krzysztof, Ficek; Grzegorz, Trybek; Ewelina, Lulińska-Kuklik; Semenova, Ekaterina A; Ahmetov, Ildus I; Paweł, Cięszczyk

2016-12-01

The C allele of the M235T (rs699) polymorphism of the AGT gene correlates with higher levels of angiotensin II and has been associated with power and strength sport performance. The aim of the study was to investigate whether or not selected power-related variables and their response to a 12-week program of aerobic dance training are modulated by the AGT M235T genotype in healthy participants. Two hundred and one Polish Caucasian women aged 21 ± 1 years met the inclusion criteria and were included in the study. All women completed a 12-week program of low and high impact aerobics. Wingate peak power and total work capacity, 5 m, 10 m, and 30 m running times and jump height and jump power were determined before and after the training programme. All power-related variables improved significantly in response to aerobic dance training. We found a significant association between the M235T polymorphism and jump-based variables (squat jump (SJ) height, p = 0.005; SJ power, p = 0.015; countermovement jump height, p = 0.025; average of 10 countermovement jumps with arm swing (ACMJ) height, p = 0.001; ACMJ power, p = 0.035). Specifically, greater improvements were observed in the C allele carriers in comparison with TT homozygotes. In conclusion, aerobic dance, one of the most commonly practiced adult fitness activities in the world, provides sufficient training stimuli for augmenting the explosive strength necessary to increase vertical jump performance. The AGT gene M235T polymorphism seems to be not only a candidate gene variant for power/strength related phenotypes, but also a genetic marker for predicting response to training.

ARID5B, CEBPE and PIP4K2A Germline Genetic Polymorphisms and Risk of Childhood Acute Lymphoblastic Leukemia in Mexican Patients: A MIGICCL Study.

PubMed

Bekker-Méndez, Vilma Carolina; Núñez-Enríquez, Juan Carlos; Torres Escalante, José Luis; Alvarez-Olmos, Enrique; González-Montalvoc, Pablo Miguel; Jiménez-Hernández, Elva; Sansón, Aurora Medina; Leal, Yelda A; Ramos-Cervantes, María Teresa; Guerra-Castillo, Francisco Xavier; Ortiz-Maganda, Mónica Patricia; Flores-Lujano, Janet; Pérez-Saldivar, Maria Luisa; Velazquez-Aviña, Martha Margarita; Bolea-Murga, Victoria; Torres-Nava, José Refugio; Amador-Sanchez, Raquel; Solis-Labastida, Karina Anastacia; Rámirez-Bello, Julian; Fragoso, José Manuel; Mejía-Aranguré, Juan Manuel

2016-11-01

Childhood acute lymphoblastic leukemia (ALL) is the leading cause of childhood cancer-related deaths worldwide. Multiples studies have shown that ALL seems to be originated by an interaction between environmental and genetic susceptibility factors. The ARID5B polymorphisms are among the most reproducible ALL associated-risk alleles in different populations. The aim of the present study was to examine the contribution of ARID5B, CEBPE, and PIP4K2 risk alleles for the development of ALL in children from Mexico City and Yucatan, Mexico. A study was conducted with a total of 761 unrelated subjects. Two hundred eighty five ALL cases (111 from Yucatan and 174 from Mexico City) and 476 healthy subjects. Genotyping included the rs7088318 (PIP4K2A), rs10821936 (ARID5B), rs7089424 (ARID5B) and rs2239633 (CEBPE) polymorphisms. Associations between ALL and rs10821936 and rs7089424 ARID5B SNPs were found (OR = 1.9, 95% CI (1.5-2.4) and OR = 2.0, 95% CI (1.6-2.5), respectively). Moreover, a higher risk was observed in the homozygous risk genotypes of carriers from Mexico City (OR = 3.1, 95% CI (2.0-4.9) and OR 3.1, CI 95% (2.0-4.8), respectively). Otherwise, the rs7088318 (PIP4K2A) and rs2239633 (CEBPE) polymorphisms were not associated with ALL risk. Our analysis suggests that ARID5B confers risk for childhood ALL in a Mexican population. Copyright © 2016 IMSS. Published by Elsevier Inc. All rights reserved.

Polymorphisms in the HSP90AA1 5' flanking region are associated with scrapie incubation period in sheep.

PubMed

Marcos-Carcavilla, Ane; Moreno, Carole; Serrano, Magdalena; Laurent, Pascal; Cribiu, Edmond P; Andréoletti, Olivier; Ruesche, Julien; Weisbecker, Jean-Louis; Calvo, Jorge H; Moazami-Goudarzi, Katayoun

2010-07-01

Susceptibility to scrapie is mainly controlled by point mutations at the PRNP locus. However, additional quantitative trait loci (QTL) have been identified across the genome including a region in OAR18. The gene which encodes the inducible form of the cytoplasmic Hsp90 chaperone (HSP90AA1) maps within this region and seems to be associated with the resistance/susceptibility to scrapie in sheep. Here, we have analyzed several polymorphisms which were previously described in the ovine HSP90AA1 5' flanking region and in intron 10 in two naturally scrapie infected Romanov sheep populations. First, we have studied 58 ARQ/VRQ animals pertaining to the sire family where the QTL influencing scrapie incubation period in OAR18 was detected. We have found a significant association between polymorphisms localized at -660 and -528 in the HSP90AA1 5' flanking region and the scrapie incubation period. These two polymorphisms have also been studied in a second sample constituted by 62 VRQ/VRQ sheep showing an extreme incubation period. Results are concordant with the first dataset. Finally, we have studied the HSP90AA1 expression in scrapie and control animals (N = 41) with different HSP90AA1 genotypes by real time PCR on blood samples. The HSP90AA1 expression rate was equivalent in CC(-600)AA(-528) and CG(-600)AG(-528) scrapie resistant animals (ARR/ARR) and was higher in their CC(-600)AA(-528) than in their CG(-600)AG(-528) scrapie susceptible counterparts (VRQ/VRQ). Our results support the hypothesis that the ovine HSP90AA1 gene acts as a modulator of scrapie susceptibility, contributing to the observed differences in the incubation period of scrapie infected animals with the same PRNP genotype.

Vitamin D receptor polymorphisms and survival in patients with cutaneous melanoma: a population-based study.

PubMed

Orlow, Irene; Reiner, Anne S; Thomas, Nancy E; Roy, Pampa; Kanetsky, Peter A; Luo, Li; Paine, Susan; Armstrong, Bruce K; Kricker, Anne; Marrett, Loraine D; Rosso, Stefano; Zanetti, Roberto; Gruber, Stephen B; Anton-Culver, Hoda; Gallagher, Richard P; Dwyer, Terence; Busam, Klaus; Begg, Colin B; Berwick, Marianne

2016-01-01

Factors known to affect melanoma survival include age at presentation, sex and tumor characteristics. Polymorphisms also appear to modulate survival following diagnosis. Result from other studies suggest that vitamin D receptor (VDR) polymorphisms (SNPs) impact survival in patients with glioma, renal cell carcinoma, lung, breast, prostate and other cancers; however, a comprehensive study of VDR polymorphisms and melanoma-specific survival is lacking. We aimed to investigate whether VDR genetic variation influences survival in patients with cutaneous melanoma. The analysis involved 3566 incident single and multiple primary melanoma cases enrolled in the international population-based Genes, Environment, and Melanoma Study. Melanoma-specific survival outcomes were calculated for each of 38 VDR SNPs using a competing risk analysis after adjustment for covariates. There were 254 (7.1%) deaths due to melanoma during the median 7.6 years follow-up period. VDR SNPs rs7299460, rs3782905, rs2239182, rs12370156, rs2238140, rs7305032, rs1544410 (BsmI) and rs731236 (TaqI) each had a statistically significant (trend P values < 0.05) association with melanoma-specific survival in multivariate analysis. One functional SNP (rs2239182) remained significant after adjustment for multiple testing using the Monte Carlo method. None of the SNPs associated with survival were significantly associated with Breslow thickness, ulceration or mitosis. These results suggest that the VDR gene may influence survival from melanoma, although the mechanism by which VDR exerts its effect does not seem driven by tumor aggressiveness. Further investigations are needed to confirm our results and to understand the relationship between VDR and survival in the combined context of tumor and host characteristics. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Vitamin D receptor polymorphisms and survival in patients with cutaneous melanoma: a population-based study

PubMed Central

Orlow, Irene; Reiner, Anne S.; Thomas, Nancy E.; Roy, Pampa; Kanetsky, Peter A.; Luo, Li; Paine, Susan; Armstrong, Bruce K.; Kricker, Anne; Marrett, Loraine D.; Rosso, Stefano; Zanetti, Roberto; Gruber, Stephen B.; Anton-Culver, Hoda; Gallagher, Richard P.; Dwyer, Terence; Busam, Klaus; Begg, Colin B.; Berwick, Marianne

2016-01-01

Factors known to affect melanoma survival include age at presentation, sex and tumor characteristics. Polymorphisms also appear to modulate survival following diagnosis. Result from other studies suggest that vitamin D receptor (VDR) polymorphisms (SNPs) impact survival in patients with glioma, renal cell carcinoma, lung, breast, prostate and other cancers; however, a comprehensive study of VDR polymorphisms and melanoma-specific survival is lacking. We aimed to investigate whether VDR genetic variation influences survival in patients with cutaneous melanoma. The analysis involved 3566 incident single and multiple primary melanoma cases enrolled in the international population-based Genes, Environment, and Melanoma Study. Melanoma-specific survival outcomes were calculated for each of 38 VDR SNPs using a competing risk analysis after adjustment for covariates. There were 254 (7.1%) deaths due to melanoma during the median 7.6 years follow-up period. VDR SNPs rs7299460, rs3782905, rs2239182, rs12370156, rs2238140, rs7305032, rs1544410 (BsmI) and rs731236 (TaqI) each had a statistically significant (trend P values < 0.05) association with melanoma-specific survival in multivariate analysis. One functional SNP (rs2239182) remained significant after adjustment for multiple testing using the Monte Carlo method. None of the SNPs associated with survival were significantly associated with Breslow thickness, ulceration or mitosis. These results suggest that the VDR gene may influence survival from melanoma, although the mechanism by which VDR exerts its effect does not seem driven by tumor aggressiveness. Further investigations are needed to confirm our results and to understand the relationship between VDR and survival in the combined context of tumor and host characteristics. PMID:26521212

CC Genotype Donors for the Interleukin-28B Single-Nucleotide Polymorphism are Associated with Better Outcomes in Hepatitis C after Liver Transplant

PubMed Central

Firpi, Roberto J.; Dong, Huijia; Clark, Virginia C.; Soldevila-Pico, Consuelo; Morelli, Giuseppe; Cabrera, Roniel; Norkina, Oxana; Shuster, Jonathan J.; Nelson, David R.; Liu, Chen

2012-01-01

Background/Aims Interleukin-28B (IL-28B) polymorphism is the strongest pretreatment predictor of viral clearance in the hepatitis C (HCV) population. Donor and recipient IL-28B genomic background may play an important role in post-transplant HCV recurrence. We sought to examine the role of IL-28B polymorphisms of donor and recipients in liver transplant patients with recurrent HCV and its impact on the response to interferon-based therapy. Methods The cohort study consisted of 135 adult liver transplant patients who received interferon-based therapy for recurrent HCV between 1996 and 2005 at the University of Florida. IL-28B single nucleotide polymorphism (rs. 12979860) was characterized using liver tissue from all donors and recipients. Results The CC genotype was observed in approximately 30% of donors and recipients. Sustained viral response (SVR) to HCV therapy was 100% if both recipient and donor were CC genotype, while the SVR was only 25% if neither donor nor recipient had a CC genotype. (Recipient, p=0.025, Donor, p<0.001). Recipients and donors with CC genotype had less fibrosis than recipients with genotypes CT and TT, but the difference was not statistically significant. IL-28B genotype did not seem to play a role in the overall survival in these patients. Conclusion In conclusion, recipient and donor CC genotype is associated with a better treatment response to interferon-based therapy after liver transplant. Our study suggests that using CC genotype donor livers for HCV patients may improve the overall clinical outcome after liver transplantation. PMID:23107586

Sleep homeostatic pressure and PER3 VNTR gene polymorphism influence antidepressant response to sleep deprivation in bipolar depression.

PubMed

Dallaspezia, Sara; Locatelli, Clara; Lorenzi, Cristina; Pirovano, Adele; Colombo, Cristina; Benedetti, Francesco

2016-03-01

Combined Total sleep deprivation (TSD) and light therapy (LT) cause a rapid improvement in bipolar depression which has been hypothesized to be paralleled by changes in sleep homeostasis. Recent studies showed that bipolar patients had lower changes of EEG theta power after sleep and responders to antidepressant TSD+LT slept less and showed a lower increase of EEG theta power then non-responders. A polymorphism in PER3 gene has been associated with diurnal preference, sleep structure and homeostatic response to sleep deprivation in healthy subjects. We hypothesized that the individual variability in the homeostatic response to TSD could be a correlate of antidepressant response and be influenced by genetic factors. We administered three TSD+LT cycles to bipolar depressed patients. Severity of depression was rated on Hamilton Depression Rating Scale. Actigraphic recordings were performed in a group of patients. PER3 polymorphism influenced changes in total sleep time (F=2.24; p=0.024): while PER3(4/4) and PER3(4/5) patients showed a reduction in it after treatment, PER3(5/5) subjects showed an increase of about 40min, suggesting a higher homeostatic pressure. The same polymorphism influenced the change of depressive symptomatology during treatment (F=3.72; p=0.028). Sleep information was recorded till the day after the end of treatment: a longer period of observation could give more information about the possible maintenance of allostatic adaptation. A higher sleep homeostatic pressure reduced the antidepressant response to TSD+LT, while an allostatic adaptation to sleep loss was associated with better response. This process seems to be under genetic control. Copyright © 2015 Elsevier B.V. All rights reserved.

The (CA)n polymorphism of ERβ gene is associated with FtM transsexualism.

PubMed

Fernández, Rosa; Esteva, Isabel; Gómez-Gil, Esther; Rumbo, Teresa; Almaraz, Mari Cruz; Roda, Ester; Haro-Mora, Juan-Jesús; Guillamón, Antonio; Pásaro, Eduardo

2014-03-01

Transsexualism is a gender identity disorder with a multifactorial etiology. Neurodevelopmental processes and genetic factors seem to be implicated. The aim of this study was to investigate the possible influence of the sex hormone-related genes ERβ (estrogen receptor β), AR (androgen receptor), and CYP19A1 (aromatase) in the etiology of female-to-male (FtM) transsexualism. In 273 FtMs and 371 control females, we carried out a molecular analysis of three variable regions: the CA repeats in intron 5 of ERβ; the CAG repeats in exon 1 of AR, and the TTTA repeats in intron 4 of CYP19A1. We investigated the possible influence of genotype on transsexualism by performing a molecular analysis of the variable regions of genes ERβ, AR, and CYP19A1 in 644 individuals (FtMs and control females). FtMs differed significantly from control group with respect to the median repeat length polymorphism ERβ (P = 0.002) but not with respect to the length of the other two studied polymorphisms. The repeat numbers in ERβ were significantly higher in FtMs than in control group, and the likelihood of developing transsexualism was higher (odds ratio: 2.001 [1.15-3.46]) in the subjects with the genotype homozygous for long alleles. There is an association between the ERβ gene and FtM transsexualism. Our data support the finding that ERβ function is directly proportional to the size of the analyzed polymorphism, so a greater number of repeats implies greater transcription activation, possibly by increasing the function of the complex hormone ERβ receptor and thereby encouraging less feminization or a defeminization of the female brain and behavior. © 2013 International Society for Sexual Medicine.

Inferring the distribution of mutational effects on fitness in Drosophila.

PubMed

Loewe, Laurence; Charlesworth, Brian

2006-09-22

The properties of the distribution of deleterious mutational effects on fitness (DDME) are of fundamental importance for evolutionary genetics. Since it is extremely difficult to determine the nature of this distribution, several methods using various assumptions about the DDME have been developed, for the purpose of parameter estimation. We apply a newly developed method to DNA sequence polymorphism data from two Drosophila species and compare estimates of the parameters of the distribution of the heterozygous fitness effects of amino acid mutations for several different distribution functions. The results exclude normal and gamma distributions, since these predict too few effectively lethal mutations and power-law distributions as a result of predicting too many lethals. Only the lognormal distribution appears to fit both the diversity data and the frequency of lethals. This DDME arises naturally in complex systems when independent factors contribute multiplicatively to an increase in fitness-reducing damage. Several important parameters, such as the fraction of effectively neutral non-synonymous mutations and the harmonic mean of non-neutral selection coefficients, are robust to the form of the DDME. Our results suggest that the majority of non-synonymous mutations in Drosophila are under effective purifying selection.

Polymorphism patterns in two tightly linked developmental genes, Idgf1 and Idgf3, of Drosophila melanogaster.

PubMed Central

Zurovcová, Martina; Ayala, Francisco J

2002-01-01

A new developmental gene family, recently identified in D. melanogaster, has been called imaginal disc growth factors (IDGF) because the proteins promote growth of cell lineages derived from imaginal discs. These are the first genes reported that encode polypeptide factors with mitotic activity in invertebrates. Characteristics such as similar arrangement of introns and exons, small size, and different cytological localization make this family an excellent candidate for evolutionary studies. We focus on the loci Idgf1 and Idgf3, two genes that possess the most distinctive features. We examine the pattern of intra- and interspecific nucleotide variation in the sequences from 20 isogenic lines of D. melanogaster and sequences from D. simulans and D. yakuba. While MK, HKA, and Tajima's tests of neutrality fail to reject a neutral model of molecular evolution, Fu and Li's test with outgroup and McDonald's test suggest that balancing selection is modulating the evolution of the Idgf1 locus. The rate of recombination between the two loci is high enough to uncouple any linkage disequilibrium arising between Idgf1 and Idgf3, despite their close physical proximity. PMID:12242232

An engineered vaccine of the Plasmodium vivax Duffy binding protein enhances induction of broadly neutralizing antibodies.

PubMed

Ntumngia, Francis B; Pires, Camilla V; Barnes, Samantha J; George, Miriam T; Thomson-Luque, Richard; Kano, Flora S; Alves, Jessica R S; Urusova, Darya; Pereira, Dhelio B; Tolia, Niraj H; King, Christopher L; Carvalho, Luzia H; Adams, John H

2017-10-23

Plasmodium vivax invasion into human reticulocytes is a complex process. The Duffy binding protein (DBP) dimerization with its cognate receptor is vital for junction formation in the invasion process. Due to its functional importance, DBP is considered a prime vaccine candidate, but variation in B-cell epitopes at the dimer interface of DBP leads to induction of strain-limited immunity. We believe that the polymorphic residues tend to divert immune responses away from functionally conserved epitopes important for receptor binding or DBP dimerization. As a proof of concept, we engineered the vaccine DEKnull to ablate the dominant Bc epitope to partially overcome strain-specific immune antibody responses. Additional surface engineering on the next generation immunogen, DEKnull-2, provides an immunogenicity breakthrough to conserved protective epitopes. DEKnull-2 elicits a stronger broadly neutralizing response and reactivity with long-term persistent antibody responses of acquired natural immunity. By using novel engineered DBP immunogens, we validate that the prime targets of protective immunity are conformational epitopes at the dimer interface. These successful results indicate a potential approach that can be used generally to improve efficacy of other malaria vaccine candidates.

Asymmetric Introgression in the Horticultural Living Fossil Cycas Sect. Asiorientales Using a Genome-Wide Scanning Approach

PubMed Central

Chiang, Yu-Chung; Huang, Bing-Hong; Chang, Chun-Wen; Wan, Yu-Ting; Lai, Shih-Jie; Huang, Shong; Liao, Pei-Chun

2013-01-01

The Asian cycads are mostly allopatric, distributed in small population sizes. Hybridization between allopatric species provides clues in determining the mechanism of species divergence. Horticultural introduction provides the chance of interspecific gene flow between allopatric species. Two allopatrically eastern Asian Cycas sect. Asiorientales species, C. revoluta and C. taitungensis, which are widely distributed in Ryukyus and Fujian Province and endemic to Taiwan, respectively, were planted in eastern Taiwan for horticultural reason. Higher degrees of genetic admixture in cultivated samples than wild populations in both cycad species were detected based on multilocus scans by neutral AFLP markers. Furthermore, bidirectional but asymmetric introgression by horticultural introduction of C. revoluta is evidenced by the reanalyses of species associated loci, which are assumed to be diverged after species divergence. Partial loci introgressed from native cycad to the invaders were also detected at the loci of strong species association. Consistent results tested by all neutral loci, and the species-associated loci, specify the recent introgression from the paradox of sharing of ancestral polymorphisms. Phenomenon of introgression of cultivated cycads implies niche conservation among two geographic-isolated cycads, even though the habitats of the extant wild populations of two species are distinct. PMID:23591840

Facial Expressions and Ability to Recognize Emotions From Eyes or Mouth in Children

PubMed Central

Guarnera, Maria; Hichy, Zira; Cascio, Maura I.; Carrubba, Stefano

2015-01-01

This research aims to contribute to the literature on the ability to recognize anger, happiness, fear, surprise, sadness, disgust and neutral emotions from facial information. By investigating children’s performance in detecting these emotions from a specific face region, we were interested to know whether children would show differences in recognizing these expressions from the upper or lower face, and if any difference between specific facial regions depended on the emotion in question. For this purpose, a group of 6-7 year-old children was selected. Participants were asked to recognize emotions by using a labeling task with three stimulus types (region of the eyes, of the mouth, and full face). The findings seem to indicate that children correctly recognize basic facial expressions when pictures represent the whole face, except for a neutral expression, which was recognized from the mouth, and sadness, which was recognized from the eyes. Children are also able to identify anger from the eyes as well as from the whole face. With respect to gender differences, there is no female advantage in emotional recognition. The results indicate a significant interaction ‘gender x face region’ only for anger and neutral emotions. PMID:27247651

Effects of E × B drift on electron transport across the magnetic field in a miniature microwave discharge neutralizer

NASA Astrophysics Data System (ADS)

Hiramoto, Kenta; Nakagawa, Yuichi; Koizumi, Hiroyuki; Takao, Yoshinori

2017-06-01

Using a three-dimensional particle-in-cell model, electron transport across a magnetic field has been investigated by obtaining the time-varying electric field and plasma parameters in a miniature microwave discharge neutralizer. The size of the neutralizer is 20 × 20 × 4 mm3. Ring-shaped antenna producing 4.2 GHz microwaves and permanent magnets for xenon plasma discharges are present inside. There are four orifices for electron extraction. The simulation area consists of both the discharge chamber and the vacuum region for the extraction. The numerical results show that radial striped patterns occur where the peak electron density is obtained, and the patterns seem to rotate in the azimuthal direction. This characteristic structure is very similar to recent results obtained in Hall thrusters and is probably due to the electron drift instability. Owing to the plasma structure, the azimuthal electric field is generated, which results in the E × B drift velocity in the axial direction with the radial magnetic field of the permanent magnets. This E × B drift velocity is a key factor in the electron transport across the magnetic field, leading to the electron extraction from the discharge chamber.

Compensatory mutations cause excess of antagonistic epistasis in RNA secondary structure folding.

PubMed

Wilke, Claus O; Lenski, Richard E; Adami, Christoph

2003-02-05

The rate at which fitness declines as an organism's genome accumulates random mutations is an important variable in several evolutionary theories. At an intuitive level, it might seem natural that random mutations should tend to interact synergistically, such that the rate of mean fitness decline accelerates as the number of random mutations is increased. However, in a number of recent studies, a prevalence of antagonistic epistasis (the tendency of multiple mutations to have a mitigating rather than reinforcing effect) has been observed. We studied in silico the net amount and form of epistatic interactions in RNA secondary structure folding by measuring the fraction of neutral mutants as a function of mutational distance d. We found a clear prevalence of antagonistic epistasis in RNA secondary structure folding. By relating the fraction of neutral mutants at distance d to the average neutrality at distance d, we showed that this prevalence derives from the existence of many compensatory mutations at larger mutational distances. Our findings imply that the average direction of epistasis in simple fitness landscapes is directly related to the density with which fitness peaks are distributed in these landscapes.

Compensatory mutations cause excess of antagonistic epistasis in RNA secondary structure folding

PubMed Central

Wilke, Claus O; Lenski, Richard E; Adami, Christoph

2003-01-01

Background The rate at which fitness declines as an organism's genome accumulates random mutations is an important variable in several evolutionary theories. At an intuitive level, it might seem natural that random mutations should tend to interact synergistically, such that the rate of mean fitness decline accelerates as the number of random mutations is increased. However, in a number of recent studies, a prevalence of antagonistic epistasis (the tendency of multiple mutations to have a mitigating rather than reinforcing effect) has been observed. Results We studied in silico the net amount and form of epistatic interactions in RNA secondary structure folding by measuring the fraction of neutral mutants as a function of mutational distance d. We found a clear prevalence of antagonistic epistasis in RNA secondary structure folding. By relating the fraction of neutral mutants at distance d to the average neutrality at distance d, we showed that this prevalence derives from the existence of many compensatory mutations at larger mutational distances. Conclusions Our findings imply that the average direction of epistasis in simple fitness landscapes is directly related to the density with which fitness peaks are distributed in these landscapes. PMID:12590655

Emotional facial expressions reduce neural adaptation to face identity.

PubMed

Gerlicher, Anna M V; van Loon, Anouk M; Scholte, H Steven; Lamme, Victor A F; van der Leij, Andries R

2014-05-01

In human social interactions, facial emotional expressions are a crucial source of information. Repeatedly presented information typically leads to an adaptation of neural responses. However, processing seems sustained with emotional facial expressions. Therefore, we tested whether sustained processing of emotional expressions, especially threat-related expressions, would attenuate neural adaptation. Neutral and emotional expressions (happy, mixed and fearful) of same and different identity were presented at 3 Hz. We used electroencephalography to record the evoked steady-state visual potentials (ssVEP) and tested to what extent the ssVEP amplitude adapts to the same when compared with different face identities. We found adaptation to the identity of a neutral face. However, for emotional faces, adaptation was reduced, decreasing linearly with negative valence, with the least adaptation to fearful expressions. This short and straightforward method may prove to be a valuable new tool in the study of emotional processing.

Prompt ionization in the CRIT II barium releases. [Critical Ionization Tests

NASA Technical Reports Server (NTRS)

Torbert, R. B.; Kletzing, C. A.; Liou, K.; Rau, D.

1992-01-01

Observations of electron and ion distributions inside a fast neutral barium jet in the ionosphere show significant fluxes within 4 km of release, presumably related to beam plasma instability processes involved in the Critical Ionization Velocity (CIV) effect. Electron fluxes exceeding 5 x 10 exp 12/sq cm-str-sec-keV were responsible for ionizing both the streaming barium and ambient oxygen. Resulting ion fluxes seem to be consistent with 1-2 percent ionization of the fast barium, as reported by optical observations, although the extended spatial distribution of the optically observed ions is difficult to reconcile with the in situ observations. When the perpendicular velocity of the neutrals falls below critical values, these processes shut off. Although these observations resemble the earlier Porcupine experimental results (Haerendel, 1982), theoretical understanding of the differences between these data and that of earlier negative experiments is still lacking.

Test-retest reliability of subliminal facial affective priming.

PubMed

Dannlowski, Udo; Suslow, Thomas

2006-02-01

Since the seminal 1993 demonstrations o f Murphy an d Zajonc, researchers have replicated and extended findings concerning subliminal affective priming. So far, however, no data on test-retest reliability of affective priming effects are available. A subliminal facial affective priming task was administered to 22 healthy individuals (15 women and 7 men) twice about 7 wk. apart. Happy and sad facial expressions were used as affective primes and neutral Chinese ideographs served as target masks, which had to be evaluated. Neutral facial primes and a no-face condition served as baselines. All participants reported not having seen any of the prime faces at either testing session. Priming scores for affective faces compared to the baselines were computed. Acceptable test-retest correlations (rs) of up to .74 were found for the affective priming scores. Although measured almost 2 mo. apart, subliminal affective priming seems to be a temporally stable effect.