Science.gov

Sample records for self-compartmentalizing protease family

  1. Cystatins, serpins and other families of protease inhibitors in plants.

    PubMed

    Volpicella, Mariateresa; Leoni, Claudia; Costanza, Alessandra; De Leo, Francesca; Gallerani, Raffaele; Ceci, Luigi R

    2011-08-01

    Plant protease inhibitors (PIs) are generally small proteins present in high concentrations in storage tissues (tubers and seeds), and to a lower level in leaves. Even if most of them are active against serine and cysteine proteases, PIs active against aspartic proteases and carboxypeptidases have also been identified. Inhibitors of serine proteases are further classifiable in several families on the basis of their structural features. They comprise the families known as Bowman-Birk, Kunitz, Potato I and Potato II, which are the subject of review articles included in this special issue. In the present article we aim to give an overview of other families of plant PIs, active either against serine proteases or other class of proteases, describing their distribution, activity and main structural characteristics.

  2. A new member of the plasma protease inhibitor gene family.

    PubMed Central

    Ragg, H

    1986-01-01

    A 2.1-kb cDNA clone representing a new member of the protease inhibitor family was isolated from a human liver cDNA library. The inhibitor, named human Leuserpin 2 (hLS2), comprises 480 amino acids and contains a leucine residue at its putative reactive center. HLS2 is about 25-28% homologous to three human members of the plasma protease inhibitor family: antithrombin III, alpha 1-antitrypsin and alpha 1-antichymotrypsin. A comparison with published partial amino acid sequences shows that hLS2 is closely related to the thrombin inhibitor heparin cofactor II. Images PMID:3003690

  3. Evolution of the protease-activated receptor family in vertebrates

    PubMed Central

    JIN, MIN; YANG, HAI-WEI; TAO, AI-LIN; WEI, JI-FU

    2016-01-01

    Belonging to the G protein-coupled receptor (GPcr) family, the protease-activated receptors (Pars) consist of 4 members, PAR1-4. PARs mediate the activation of cells via thrombin, serine and other proteases. Such protease-triggered signaling events are thought to be critical for hemostasis, thrombosis and other normal pathological processes. In the present study, we examined the evolution of PARs by analyzing phylogenetic trees, chromosome location, selective pressure and functional divergence based on the 169 functional gene alignment sequences from 57 vertebrate gene sequences. We found that the 4 PARs originated from 4 invertebrate ancestors by phylogenetic trees analysis. The selective pressure results revealed that only PAR1 appeared by positive selection during its evolution, while the other PAR members did not. In addition, we noticed that although these PARs evolved separately, the results of functional divergence indicated that their evolutional rates were similar and their functions did not significantly diverge. The findings of our study provide valuable insight into the evolutionary history of the vertebrate PAR family. PMID:26820116

  4. Proteases.

    PubMed

    Barrett, A J

    2001-05-01

    The processes of growth and remodeling of cells and tissues in multicellular organisms require the breakdown of old protein molecules, in concert with the synthesis of new ones. For example, many newly-synthesized molecules require proteolytic processing to convert them to biologically active forms. Proteolysis can terminate the activity of a protein--e.g., capsases mediate apoptosis, which is a vital step in the life cycle of the cell. Proteolysis contributes to defense systems too, as the recognition of peptide fragments of foreign proteins triggers the immune response. Proteases are the class of enzymes involved in these important reactions. This unit discusses the general categories of proteases, and sets the stage for addition of overview units on cysteine proteases, aspartic proteases, and metalloproteases, as well as protocol units featuring techniques for analyzing mammalian and yeast proteasomes and protease inhibitors, among other topics.

  5. Differential expression of a protease gene family in African Trypanosomes

    PubMed Central

    Helm, Jared R.; Wilson, Mary E.; Donelson, John E.

    2008-01-01

    During their life cycle African trypanosomes must quickly adapt to the different environments of the tsetse fly midgut and the mammalian bloodstream by modulating expression of many of their genes. One group of these differentially expressed genes encodes different forms of a major surface protease. Using a luciferase reporter gene transiently or permanently transfected into trypanosomes, we show here that the 3′-UTRs of these protease genes are responsible for their differential expression. Deletion analysis of the 389-bp 3′-UTR of one of the protease genes, MSP-B, demonstrated that it contains a U-rich regulatory region of about 23 bp (UCGUCUGUUAUUUCUUAGUCCAG), which suppresses expression of the reporter protein in bloodstream trypanosomes by as much as 25-fold, but has little effect on the reporter expression in procyclic (tsetse fly) trypanosomes. Replacing the entire 3′-UTR with just this 23-bp element mimicked most of the suppression effect of the complete 3′-UTR. Northern blots showed that the 23-bp element influences the steady state RNA level, but not enough to account for the 25-fold suppression effect. Polysome analyses showed that in procyclic trypanosomes more of the total protease mRNA is associated with intermediate-sized and large polysomes than in bloodstream trypanosomes. Thus, the 23-bp element of this protease gene affects both the level of RNA and its translation. PMID:18848586

  6. Natural cysteine protease inhibitors in protozoa: Fifteen years of the chagasin family.

    PubMed

    Costa, Tatiana F R; Lima, Ana Paula C A

    2016-03-01

    Chagasin-type inhibitors comprise natural inhibitors of papain-like cysteine proteases that are distributed among Protist, Bacteria and Archaea. Chagasin was identified in the pathogenic protozoa Trypanosoma cruzi as an approximately 11 kDa protein that is a tight-binding and highly thermostable inhibitor of papain, cysteine cathepsins and endogenous parasite cysteine proteases. It displays an Imunoglobulin-like fold with three exposed loops to one side of the molecule, where amino acid residues present in conserved motifs at the tips of each loop contact target proteases. Differently from cystatins, the loop 2 of chagasin enters the active-site cleft, making direct contact with the catalytic residues, while loops 4 and 6 embrace the enzyme from the sides. Orthologues of chagasin are named Inhibitors of Cysteine Peptidases (ICP), and share conserved overall tri-dimensional structure and mode of binding to proteases. ICPs are tentatively distributed in three families: in family I42 are grouped chagasin-type inhibitors that share conserved residues at the exposed loops; family I71 contains Plasmodium ICPs, which are large proteins having a chagasin-like domain at the C-terminus, with lower similarity to chagasin in the conserved motif at loop 2; family I81 contains Toxoplasma ICP. Recombinant ICPs tested so far can inactivate protozoa cathepsin-like proteases and their mammalian counterparts. Studies on their biological roles were carried out in a few species, mainly using transgenic protozoa, and the conclusions vary. However, in all cases, alterations in the levels of expression of chagasin/ICPs led to substantial changes in one or more steps of parasite biology, with higher incidence in influencing their interaction with the hosts. We will cover most of the findings on chagasin/ICP structural and functional properties and overview the current knowledge on their roles in protozoa.

  7. Using the SUBcellular database for Arabidopsis proteins to localize the Deg protease family

    PubMed Central

    Tanz, Sandra K.; Castleden, Ian; Hooper, Cornelia M.; Small, Ian; Millar, A. Harvey

    2014-01-01

    Sub-functionalization during the expansion of gene families in eukaryotes has occurred in part through specific subcellular localization of different family members. To better understand this process in plants, compiled records of large-scale proteomic and fluorescent protein localization datasets can be explored and bioinformatic predictions for protein localization can be used to predict the gaps in experimental data. This process can be followed by targeted experiments to test predictions. The SUBA3 database is a free web-service at http://suba.plantenergy.uwa.edu.au that helps users to explore reported experimental data and predictions concerning proteins encoded by gene families and to define the experiments required to locate these homologous sets of proteins. Here we show how SUBA3 can be used to explore the subcellular location of the Deg protease family of ATP-independent serine endopeptidases (Deg1–Deg16). Combined data integration and new experiments refined location information for Deg1 and Deg9, confirmed Deg2, Deg5, and Deg8 in plastids and Deg 15 in peroxisomes and provide substantial experimental evidence for mitochondrial localized Deg proteases. Two of these, Deg3 and Deg10, additionally localized to the plastid, revealing novel dual-targeted Deg proteases in the plastid and the mitochondrion. SUBA3 is continually updated to ensure that researchers can use the latest published data when planning the experimental steps remaining to localize gene family functions. PMID:25161662

  8. Structures of a bi-functional Kunitz-type STI family inhibitor of serine and aspartic proteases: Could the aspartic protease inhibition have evolved from a canonical serine protease-binding loop?

    PubMed

    Guerra, Yasel; Valiente, Pedro A; Pons, Tirso; Berry, Colin; Rudiño-Piñera, Enrique

    2016-08-01

    Bi-functional inhibitors from the Kunitz-type soybean trypsin inhibitor (STI) family are glycosylated proteins able to inhibit serine and aspartic proteases. Here we report six crystal structures of the wild-type and a non-glycosylated mutant of the bifunctional inhibitor E3Ad obtained at different pH values and space groups. The crystal structures show that E3Ad adopts the typical β-trefoil fold of the STI family exhibiting some conformational changes due to pH variations and crystal packing. Despite the high sequence identity with a recently reported potato cathepsin D inhibitor (PDI), three-dimensional structures obtained in this work show a significant conformational change in the protease-binding loop proposed for aspartic protease inhibition. The E3Ad binding loop for serine protease inhibition is also proposed, based on structural similarity with a novel non-canonical conformation described for the double-headed inhibitor API-A from the Kunitz-type STI family. In addition, structural and sequence analyses suggest that bifunctional inhibitors of serine and aspartic proteases from the Kunitz-type STI family are more similar to double-headed inhibitor API-A than other inhibitors with a canonical protease-binding loop.

  9. A computational module assembled from different protease family motifs identifies PI PLC from Bacillus cereus as a putative prolyl peptidase with a serine protease scaffold.

    PubMed

    Rendón-Ramírez, Adela; Shukla, Manish; Oda, Masataka; Chakraborty, Sandeep; Minda, Renu; Dandekar, Abhaya M; Ásgeirsson, Bjarni; Goñi, Félix M; Rao, Basuthkar J

    2013-01-01

    Proteolytic enzymes have evolved several mechanisms to cleave peptide bonds. These distinct types have been systematically categorized in the MEROPS database. While a BLAST search on these proteases identifies homologous proteins, sequence alignment methods often fail to identify relationships arising from convergent evolution, exon shuffling, and modular reuse of catalytic units. We have previously established a computational method to detect functions in proteins based on the spatial and electrostatic properties of the catalytic residues (CLASP). CLASP identified a promiscuous serine protease scaffold in alkaline phosphatases (AP) and a scaffold recognizing a β-lactam (imipenem) in a cold-active Vibrio AP. Subsequently, we defined a methodology to quantify promiscuous activities in a wide range of proteins. Here, we assemble a module which encapsulates the multifarious motifs used by protease families listed in the MEROPS database. Since APs and proteases are an integral component of outer membrane vesicles (OMV), we sought to query other OMV proteins, like phospholipase C (PLC), using this search module. Our analysis indicated that phosphoinositide-specific PLC from Bacillus cereus is a serine protease. This was validated by protease assays, mass spectrometry and by inhibition of the native phospholipase activity of PI-PLC by the well-known serine protease inhibitor AEBSF (IC50 = 0.018 mM). Edman degradation analysis linked the specificity of the protease activity to a proline in the amino terminal, suggesting that the PI-PLC is a prolyl peptidase. Thus, we propose a computational method of extending protein families based on the spatial and electrostatic congruence of active site residues.

  10. Antigen receptor-induced B lymphocyte apoptosis mediated via a protease of the caspase family.

    PubMed

    Andjelic, S; Liou, H C

    1998-02-01

    An extensive body of data, in a variety of systems, denoted the caspase family of proteases as a key player in the execution of programmed cell death. This family consists of cysteine proteases that cleave after asparagine-containing motifs. It is well established that the caspases are essential for the apoptosis mediated by Fas (CD95) and TNF receptor p55, molecules that contain the "death domain" in the cytoplasmic tail. However, little is known about the mechanisms underlying the antigen receptor-mediated cell death in B lymphocytes, a process instrumental in negative selection of potentially autoreactive B cells. Here, we investigated the involvement of caspases in cell death triggered via the antigen receptor in B lymphocytes (BCR) by using specific inhibitors. Initially, we used a well-established cell line, CH31, which is a model of B cell tolerance, to demonstrate that these proteases indeed participate in the BCR-induced apoptotic pathway. Next, we confirmed the physiological relevance of the caspase-mediated cell death pathway in splenic B cell populations isolated ex vivo that were induced to undergo apoptosis by extensive cross-linking of their BCR. Most interestingly, our data demonstrated that caspases regulate not only the nuclear DNA fragmentation, but also the surface membrane phosphatidylserine translocation as well as the degradation of a specific nuclear substrate. Taken together, this report supports the hypothesis that regulation of the caspase family is crucial in controlling the life/death decision in B lymphocytes mediated by the antigen receptor signal transduction.

  11. Phylogeny and evolution of the aspartyl protease family from clinically relevant Candida species.

    PubMed

    Parra-Ortega, B; Cruz-Torres, H; Villa-Tanaca, L; Hernández-Rodríguez, C

    2009-05-01

    Aspartyl proteases are a class of enzymes that include the yeast aspartyl proteases and secreted aspartyl protease (Sap) superfamilies. Several Sap superfamily members have been demonstrated or suggested as virulence factors in opportunistic pathogens of the genus Candida. Candida albicans, Candida tropicalis, Candida dubliniensis and Candida parapsilosis harbour 10, four, eight and three SAP genes, respectively. In this work, genome mining and phylogenetic analyses revealed the presence of new members of the Sap superfamily in C. tropicalis (8), Candida guilliermondii (8), C. parapsilosis(11) and Candida lusitaniae (3). A total of 12 Sap families, containing proteins with at least 50% similarity, were discovered in opportunistic, pathogenic Candida spp. In several Sap families, at least two subfamilies or orthologous groups were identified, each defined by > 90% sequence similitude, functional similarity and synteny among its members. No new members of previously described Sap families were found in a Candida spp. clinical strain collection; however, the universality of SAPT gene distribution among C. tropicalis strains was demonstrated. In addition, several features of opportunistic pathogenic Candida species, such as gene duplications and inversions, similitude, synteny, putative transcription factor binding sites and genome traits of SAP gene superfamily were described in a molecular evolutionary context.

  12. Inhibition of outer membrane proteases of the omptin family by aprotinin.

    PubMed

    Brannon, John R; Burk, David L; Leclerc, Jean-Mathieu; Thomassin, Jenny-Lee; Portt, Andrea; Berghuis, Albert M; Gruenheid, Samantha; Le Moual, Hervé

    2015-06-01

    Bacterial proteases are important virulence factors that inactivate host defense proteins and contribute to tissue destruction and bacterial dissemination. Outer membrane proteases of the omptin family, exemplified by Escherichia coli OmpT, are found in some Gram-negative bacteria. Omptins cleave a variety of substrates at the host-pathogen interface, including plasminogen and antimicrobial peptides. Multiple omptin substrates relevant to infection have been identified; nonetheless, an effective omptin inhibitor remains to be found. Here, we purified native CroP, the OmpT ortholog in the murine pathogen Citrobacter rodentium. Purified CroP was found to readily cleave both a synthetic fluorescence resonance energy transfer substrate and the murine cathelicidin-related antimicrobial peptide. In contrast, CroP was found to poorly activate plasminogen into active plasmin. Although classical protease inhibitors were ineffective against CroP activity, we found that the serine protease inhibitor aprotinin displays inhibitory potency in the micromolar range. Aprotinin was shown to act as a competitive inhibitor of CroP activity and to interfere with the cleavage of the murine cathelicidin-related antimicrobial peptide. Importantly, aprotinin was able to inhibit not only CroP but also Yersinia pestis Pla and, to a lesser extent, E. coli OmpT. We propose a structural model of the aprotinin-omptin complex in which Lys15 of aprotinin forms salt bridges with conserved negatively charged residues of the omptin active site.

  13. Ligand heterogeneity of the cysteine protease binding protein family in the parasitic protist Entamoeba histolytica.

    PubMed

    Marumo, Konomi; Nakada-Tsukui, Kumiko; Tomii, Kentaro; Nozaki, Tomoyoshi

    2014-08-01

    Lysosomal soluble proteins are targeted to endosomes and lysosomes by specific receptors resident in the endoplasmic reticulum and/or the Golgi apparatus. The enteric protozoan parasite Entamoeba histolytica has a novel class of lysosomal targeting receptors, named the cysteine protease binding protein family (CPBF). Among 11 CPBFs (CPBF1-11), ligands for three members, CPBF1, CPBF6 and CPBF8, were previously shown to be cysteine proteases, α- and γ- amylases, and β-hexosaminidase and lysozymes, respectively. To further understand the heterogeneity of the ligands of CPBFs, we attempted to isolate and identify the ligands for other members of CPBFs, namely CPBF2, 3, 4, 5, 7, 9, 10 and 11, by immunoprecipitation and mass spectrometric analysis. We found that CPBF2 and CPBF10 bound to α-amylases while CPBF7 bound to β-hexosaminidases. It is intriguing that cysteine protease are exclusively recognised by CPBF1, whereas three α-amylases and β-hexosaminidases are redundantly recognised by three and two CPBFs, respectively. It was shown by bioinformatics analysis and phylogenetic reconstruction that each CPBF contains six prepeptidase carboxyl-terminal domains, and the domain configuration is evolutionarily conserved among CPBFs. Taken together, CPBFs with unique and conserved domain organisation have a remarkable ligand heterogeneity toward cysteine protease and carbohydrate degradation enzymes. Further structural studies are needed to elucidate the structural basis of the ligand specificity.

  14. Inactivation of the Deg protease family in the cyanobacterium Synechocystis sp. PCC 6803 has impact on the outer cell layers.

    PubMed

    Cheregi, Otilia; Miranda, Hélder; Gröbner, Gerhard; Funk, Christiane

    2015-11-01

    The serine type Deg/HtrA proteases are distributed in a wide range of organisms from Escherichia coli to humans. The cyanobacterium Synechocystis sp. PCC 6803 possesses three Deg protease orthologues: HtrA, HhoA and HhoB. Previously we compared Synechocystis 6803 wild type cells exposed to mild or severe stress conditions with a mutant lacking all three Deg proteases and demonstrated that stress had strong impact on the proteomes and metabolomes. To identify the biochemical processes, which this protease family is involved in, here we compared Synechocystis sp. PCC 6803 wild type cells with a mutant lacking all three Deg proteases grown under normal growth conditions (30°C and 40 μmol photons m(-2) s(-1)). Deletion of the Deg proteases lead to the down-regulation of proteins related to the biosynthesis of outer cell layers (e.g. the GDP mannose 4,6-dehydratase) and affected protein secretion. During the late growth phase of the culture Deg proteases were found to be secreted to the extracellular medium of the Synechocystis sp. PCC 6803 wild type strain. While cyanobacterial Deg proteases seem to act mainly in the periplasmic space, deletion of the three proteases influences the proteome and metabolome of the whole cell. Impairments in the outer cell layers of the triple mutant might explain the higher sensitivity toward light and oxidative stress, which was observed earlier by Barker and coworkers.

  15. Serotype-Specific Structural Differences in the Protease-Cofactor Complexes of the Dengue Virus Family

    SciTech Connect

    Chandramouli, Sumana; Joseph, Jeremiah S.; Daudenarde, Sophie; Gatchalian, Jovylyn; Cornillez-Ty, Cromwell; Kuhn, Peter

    2010-03-04

    With an estimated 40% of the world population at risk, dengue poses a significant threat to human health, especially in tropical and subtropical regions. Preventative and curative efforts, such as vaccine development and drug discovery, face additional challenges due to the occurrence of four antigenically distinct serotypes of the causative dengue virus (DEN1 to -4). Complex immune responses resulting from repeat assaults by the different serotypes necessitate simultaneous targeting of all forms of the virus. One of the promising targets for drug development is the highly conserved two-component viral protease NS2B-NS3, which plays an essential role in viral replication by processing the viral precursor polyprotein into functional proteins. In this paper, we report the 2.1-{angstrom} crystal structure of the DEN1 NS2B hydrophilic core (residues 49 to 95) in complex with the NS3 protease domain (residues 1 to 186) carrying an internal deletion in the N terminus (residues 11 to 20). While the overall folds within the protease core are similar to those of DEN2 and DEN4 proteases, the conformation of the cofactor NS2B is dramatically different from those of other flaviviral apoprotease structures. The differences are especially apparent within its C-terminal region, implicated in substrate binding. The structure reveals for the first time serotype-specific structural elements in the dengue virus family, with the reported alternate conformation resulting from a unique metal-binding site within the DEN1 sequence. We also report the identification of a 10-residue stretch within NS3pro that separates the substrate-binding function from the catalytic turnover rate of the enzyme. Implications for broad-spectrum drug discovery are discussed.

  16. Human mast cell tryptase: Multiple cDNAs and genes reveal a multigene serine protease family

    SciTech Connect

    Vanderslice, P.; Ballinger, S.M., Tam, E.K.; Goldstein, S.M.; Craik, C.S.; Caughey, G.H. )

    1990-05-01

    Three different cDNAs and a gene encoding human skin mast cell tryptase have been cloned and sequenced in their entirety. The deduced amino acid sequences reveal a 30-amino acid prepropeptide followed by a 245-amino acid catalytic domain. The C-terminal undecapeptide of the human preprosequence is identical in dog tryptase and appears to be part of a prosequence unique among serine proteases. The differences among the three human tryptase catalytic domains include the loss of a consensus N-glycosylation site in one cDNA, which may explain some of the heterogeneity in size and susceptibility to deglycosylation seen in tryptase preparations. All three tryptase cDNAs are distinct from a recently reported cDNA obtained from a human lung mast cell library. A skin tryptase cDNA was used to isolate a human tryptase gene, the exons of which match one of the skin-derived cDNAs. The organization of the {approx}1.8-kilobase-pair tryptase gene is unique and is not closely related to that of any other mast cell or leukocyte serine protease. The 5{prime} regulatory regions of the gene share features with those of other serine proteases, including mast cell chymase, but are unusual in being separated from the protein-coding sequence by an intron. High-stringency hybridization of a human genomic DNA blot with a fragment of the tryptase gene confirms the presence of multiple tryptase genes. These findings provide genetic evidence that human mast cell tryptases are the products of a multigene family.

  17. Human mast cell tryptase: multiple cDNAs and genes reveal a multigene serine protease family.

    PubMed Central

    Vanderslice, P; Ballinger, S M; Tam, E K; Goldstein, S M; Craik, C S; Caughey, G H

    1990-01-01

    Three different cDNAs and a gene encoding human skin mast cell tryptase have been cloned and sequenced in their entirety. The deduced amino acid sequences reveal a 30-amino acid prepropeptide followed by a 245-amino acid catalytic domain. The C-terminal undecapeptide of the human preprosequence is identical in dog tryptase and appears to be part of a prosequence unique among serine proteases. The differences among the three human tryptase catalytic domains include the loss of a consensus N-glycosylation site in one cDNA, which may explain some of the heterogeneity in size and susceptibility to deglycosylation seen in tryptase preparations. All three tryptase cDNAs are distinct from a recently reported cDNA obtained from a human lung mast cell library. A skin tryptase cDNA was used to isolate a human tryptase gene, the exons of which match one of the skin-derived cDNAs. The organization of the approximately 1.8-kilobase-pair tryptase gene is unique and is not closely related to that of any other mast cell or leukocyte serine protease. The 5' regulatory regions of the gene share features with those of other serine proteases, including mast cell chymase, but are unusual in being separated from the protein-coding sequence by an intron. High-stringency hybridization of a human genomic DNA blot with a fragment of the tryptase gene confirms the presence of multiple tryptase genes. These findings provide genetic evidence that human mast cell tryptases are the products of a multigene family. Images PMID:2187193

  18. Untangling structure-function relationships in the rhomboid family of intramembrane proteases.

    PubMed

    Brooks, Cory L; Lemieux, M Joanne

    2013-12-01

    Rhomboid proteases are a family of integral membrane proteins that have been implicated in critical regulatory roles in a wide array of cellular processes and signaling events. The determination of crystal structures of the prokaryotic rhomboid GlpG from Escherichia coli and Haemophilus influenzae has ushered in an era of unprecedented understanding into molecular aspects of intramembrane proteolysis by this fascinating class of protein. A combination of structural studies by X-ray crystallography, and biophysical and spectroscopic analyses, combined with traditional enzymatic and functional analysis has revealed fundamental aspects of rhomboid structure, substrate recognition and the catalytic mechanism. This review summarizes these remarkable advances by examining evidence for the proposed catalytic mechanism derived from inhibitor co-crystal structures, conflicting models of rhomboid-substrate interaction, and recent work on the structure and function of rhomboid cytosolic domains. In addition to exploring progress on aspects of rhomboid structure, areas for future research and unaddressed questions are emphasized and highlighted. This article is part of a Special Issue entitled: Intramembrane Proteases.

  19. Non-erythroid alpha-spectrin breakdown by calpain and interleukin 1 beta-converting-enzyme-like protease(s) in apoptotic cells: contributory roles of both protease families in neuronal apoptosis.

    PubMed Central

    Nath, R; Raser, K J; Stafford, D; Hajimohammadreza, I; Posner, A; Allen, H; Talanian, R V; Yuen, P; Gilbertsen, R B; Wang, K K

    1996-01-01

    The cytoskeletal protein non-erythroid alpha-spectrin is well documented as an endogenous calpain substrate, especially under pathophysiological conditions. In cell necrosis (e.g. maitotoxin-treated neuroblastoma SH-SY5Y cells), alpha-spectrin breakdown products (SBDPs) of 150 kDa and 145 kDa were produced by cellular calpains. In contrast, in neuronal cells undergoing apoptosis (cerebellar granule neurons subjected to low potassium and SH-SY5Y cells treated with staurosporine), an additional SBDP of 120 kDa was also observed. The formation of the 120 kDa SBDP was insensitive to calpain inhibitors but was completely blocked by an interleukin 1 beta-converting-enzyme (ICE)-like protease inhibitor, Z-Asp-CH2OC(O)-2,6-dichlorobenzene. Autolytic activation of both calpain and the ICE homologue CPP32 was also observed in apoptotic cells. alpha-Spectrin can also be cleaved in vitro by purified calpains to produce the SBDP doublet of 150/145 kDa and by ICE and ICE homologues [ICH-1, ICH-2 and CPP32(beta)] to produce a 150 kDa SBDP. In addition, CPP32 and ICE also produced a 120 kDa SBDP. Furthermore inhibition of either ICE-like protease(s) or calpain protects both granule neurons and SH-SY5Y cells against apoptosis. Our results suggest that both protease families participate in the expression of neuronal apoptosis. PMID:8920967

  20. Inhibition of interleukin 1β converting enzyme family proteases reduces ischemic and excitotoxic neuronal damage

    PubMed Central

    Hara, Hideaki; Friedlander, Robert M.; Gagliardini, Valeria; Ayata, Cenk; Fink, Klaus; Huang, Zhihong; Shimizu-Sasamata, Masao; Yuan, Junying; Moskowitz, Michael A.

    1997-01-01

    The interleukin 1β converting enzyme (ICE) family plays a pivotal role in programmed cell death and has been implicated in stroke and neurodegenerative diseases. During reperfusion after filamentous middle cerebral artery occlusion, ICE-like cleavage products and tissue immunoreactive interleukin 1β (IL-1β) levels increased in ischemic mouse brain. Ischemic injury decreased after intracerebroventricular injections of ICE-like protease inhibitors, N-benzyloxycarbonyl-Val-Ala-Asp-fluoromethylketone (z-VAD.FMK), acetyl-Tyr-Val-Ala-Asp-chloromethylketone, or a relatively selective inhibitor of CPP32-like caspases, N-benzyloxycarbonyl-Asp-Glu-Val-Asp-fluoromethylketone, but not a cathepsin B inhibitor, N-benzyloxycarbonyl-Phe-Ala-fluoromethylketone. z-VAD.FMK decreased ICE-like cleavage products and tissue immunoreactive IL-1β levels in ischemic mouse brain and reduced tissue damage when administered to rats as well. Only z-VAD.FMK and acetyl-Tyr-Val-Ala-Asp-chloromethylketone reduced brain swelling, and N-benzyloxycarbonyl-Asp-Glu-Val-Asp-fluoromethylketone did not attenuate the ischemia-induced increase in tissue IL-1β levels. The three cysteine protease inhibitors significantly improved behavioral deficits, thereby showing that functional recovery of ischemic neuronal tissue can follow blockade of enzymes associated with apoptotic cell death. Finally, we examined the effect of z-VAD.FMK on excitotoxicity and found that it protected against α-amino-3-hydroxy-5-methyl-4-isoxazole propionate-induced or to a lesser extent N-methyl-d-aspartate-induced excitotoxic brain damage. Thus, ICE-like and CPP32-like caspases contribute to mechanisms of cell death in ischemic and excitotoxic brain injury and provide therapeutic targets for stroke and neurodegenerative brain damage. PMID:9050895

  1. Phylogenetic distribution of protease inhibitors of the Kazal-family within the Arthropoda.

    PubMed

    van Hoef, Vincent; Breugelmans, Bert; Spit, Jornt; Simonet, Gert; Zels, Sven; Vanden Broeck, Jozef

    2013-03-01

    In mammalian pancreatic cells, the pancreatic secretory trypsin inhibitor (PSTI) belonging to the Kazal-family prevents the premature activation of digestive enzymes and thus plays an important role in a protective mechanism against tissue destruction by autophagy. Although a similar protective mechanism exists in Arthropoda, the distribution of these inhibitors in this phylum remains obscure. A comprehensive in silico search of nucleotide databases, revealed the presence of members of the Kazal-family in the four major subphyla of the Arthropoda. Especially in the Hexapoda and the Crustacea these inhibitors are widespread, while in the Chelicerata and Myriapoda only a few Kazal-like protease inhibitors were found. A sequence alignment of inhibitors retrieved in the digestive system of insects revealed a conservation of the PSTI characteristics and strong resemblance to vertebrate PSTI. A phylogenetic analysis of these inhibitors showed that they generally cluster according to their order. The results of this data mining study provide new evidence for the existence of an ancient protective mechanism in metazoan digestive systems. Kazal-like inhibitors, which play an important protective role in the pancreas of vertebrates, also seem to be present in Arthropoda.

  2. Novel IgG-Degrading Enzymes of the IgdE Protease Family Link Substrate Specificity to Host Tropism of Streptococcus Species.

    PubMed

    Spoerry, Christian; Hessle, Pontus; Lewis, Melanie J; Paton, Lois; Woof, Jenny M; von Pawel-Rammingen, Ulrich

    2016-01-01

    Recently we have discovered an IgG degrading enzyme of the endemic pig pathogen S. suis designated IgdE that is highly specific for porcine IgG. This protease is the founding member of a novel cysteine protease family assigned C113 in the MEROPS peptidase database. Bioinformatical analyses revealed putative members of the IgdE protease family in eight other Streptococcus species. The genes of the putative IgdE family proteases of S. agalactiae, S. porcinus, S. pseudoporcinus and S. equi subsp. zooepidemicus were cloned for production of recombinant protein into expression vectors. Recombinant proteins of all four IgdE family proteases were proteolytically active against IgG of the respective Streptococcus species hosts, but not against IgG from other tested species or other classes of immunoglobulins, thereby linking the substrate specificity to the known host tropism. The novel IgdE family proteases of S. agalactiae, S. pseudoporcinus and S. equi showed IgG subtype specificity, i.e. IgdE from S. agalactiae and S. pseudoporcinus cleaved human IgG1, while IgdE from S. equi was subtype specific for equine IgG7. Porcine IgG subtype specificities of the IgdE family proteases of S. porcinus and S. pseudoporcinus remain to be determined. Cleavage of porcine IgG by IgdE of S. pseudoporcinus is suggested to be an evolutionary remaining activity reflecting ancestry of the human pathogen to the porcine pathogen S. porcinus. The IgG subtype specificity of bacterial proteases indicates the special importance of these IgG subtypes in counteracting infection or colonization and opportunistic streptococci neutralize such antibodies through expression of IgdE family proteases as putative immune evasion factors. We suggest that IgdE family proteases might be valid vaccine targets against streptococci of both human and veterinary medical concerns and could also be of therapeutic as well as biotechnological use.

  3. Development of activity-based probes for trypsin-family serine proteases.

    PubMed

    Pan, Zhengying; Jeffery, Douglas A; Chehade, Kareem; Beltman, Jerlyn; Clark, James M; Grothaus, Paul; Bogyo, Matthew; Baruch, Amos

    2006-06-01

    A series of diphenylphosphonate-based probes were developed for the trypsin-like serine proteases. These probes selectively target serine proteases rather than general serine hydrolases that are targets for fluorophosphonate-based probes. This increased selectivity allows detection of low abundance serine proteases in complex proteomes using simple SDS-PAGE methods. We present here the application of multiple probes in enzyme activity profiling of intact mast cells, a type of inflammatory cell implicated in allergy and autoimmune diseases.

  4. [Proprotein convertases - family of serine proteases with a broad spectrum of physiological functions].

    PubMed

    Małuch, Izabela; Walewska, Aleksandra; Sikorska, Emilia; Prahl, Adam

    2016-01-01

    A large group of secretory proteins involved in proper functioning of living organisms, is synthesized as inactive precursor molecules. Their biologically active forms are obtained as a result of numerous post-translational modifications. Some of these processes occur irreversibly, permanently changing the initial compound structure. An example of such modifications is catalytic treatment of proteins performed by proteolytic enzymes. Among five separate classes of these enzymes, the most numerous are serine proteases. Mammalian proprotein convertases (PCs), which include: furin, PC1/3, PC2, PACE4, PC4, PC5/6, PC7, PCSK9, SKI-1, represent serine endoproteases family. PCs play a key role in the activation of a number of precursor proteins causing formation of biologically active forms of enzymes, hormones, signaling molecules, transcription and growth factors. This article summarizes current state of knowledge on biosynthesis, structure and substrate specificity of PCs, identifies the relationship between location and intracellular activity of these enzymes, and their physiological functions in mammals.

  5. The ADAMs family of proteases: new biomarkers and therapeutic targets for cancer?

    PubMed Central

    2011-01-01

    The ADAMs are transmembrane proteins implicated in proteolysis and cell adhesion. Forty gene members of the family have been identified, of which 21 are believed to be functional in humans. As proteases, their main substrates are the ectodomains of other transmembrane proteins. These substrates include precursor forms of growth factors, cytokines, growth factor receptors, cytokine receptors and several different types of adhesion molecules. Although altered expression of specific ADAMs has been implicated in different diseases, their best-documented role is in cancer formation and progression. ADAMs shown to play a role in cancer include ADAM9, ADAM10, ADAM12, ADAM15 and ADAM17. Two of the ADAMs, i.e., ADAM10 and 17 appear to promote cancer progression by releasing HER/EGFR ligands. The released ligands activate HER/EGFR signalling that culminates in increased cell proliferation, migration and survival. Consistent with a causative role in cancer, several ADAMs are emerging as potential cancer biomarkers for aiding cancer diagnosis and predicting patient outcome. Furthermore, a number of selective ADAM inhibitors, especially against ADAM10 and ADAM17, have been shown to have anti-cancer effects. At least one of these inhibitors is now undergoing clinical trials in patients with breast cancer. PMID:21906355

  6. Purification of human von Willebrand factor-cleaving protease and its identification as a new member of the metalloproteinase family.

    PubMed

    Fujikawa, K; Suzuki, H; McMullen, B; Chung, D

    2001-09-15

    von Willebrand factor (vWF) is synthesized in megakaryocytes and endothelial cells as a very large multimer, but circulates in plasma as a group of multimers ranging from 500 to 10 000 kd. An important mechanism for depolymerization of the large multimers is the limited proteolysis by a vWF-cleaving protease present in plasma. The absence or inactivation of the vWF-cleaving protease results in the accumulation of large multimers, which may cause thrombotic thrombocytopenic purpura. The vWF-cleaving protease was first described as a Ca(++)-dependent proteinase with an apparent molecular weight of approximately 300 kd. Thus far, however, it has not been isolated and characterized. In this study, the purification of human vWF-cleaving protease from a commercial preparation of factor VIII/vWF concentrate by means of several column chromatographic steps, including 2 steps of heparin-Sepharose column, is reported. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis analysis of the anion exchange and gel filtration column fractions showed that the vWF-cleaving protease activity corresponded to a protein band of 150 kd. After reduction, it migrated with an apparent weight of 190 kd. The amino terminal sequence of the 150-kd band was AAGGIL(H)LE(L)L(D)AXG(P)X(V)XQ (single-letter amino acid codes), with the tentative residues shown in parentheses. A search of the human genome sequence identified the vWF-cleaving protease as a new member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin type I motif) family of metalloproteinase. An active site sequence of HEIGHSFGLEHE (single-letter amino acid codes) was located at 150 residues from the N terminus of the protein.

  7. Cysteine protease-binding protein family 6 mediates the trafficking of amylases to phagosomes in the enteric protozoan Entamoeba histolytica.

    PubMed

    Furukawa, Atsushi; Nakada-Tsukui, Kumiko; Nozaki, Tomoyoshi

    2013-05-01

    Phagocytosis plays a pivotal role in nutrient acquisition and evasion from the host defense systems in Entamoeba histolytica, the intestinal protozoan parasite that causes amoebiasis. We previously reported that E. histolytica possesses a unique class of a hydrolase receptor family, designated the cysteine protease-binding protein family (CPBF), that is involved in trafficking of hydrolases to lysosomes and phagosomes, and we have also reported that CPBF1 and CPBF8 bind to cysteine proteases or β-hexosaminidase α-subunit and lysozymes, respectively. In this study, we showed by immunoprecipitation that CPBF6, one of the most highly expressed CPBF proteins, specifically binds to α-amylase and γ-amylase. We also found that CPBF6 is localized in lysosomes, based on immunofluorescence imaging. Immunoblot and proteome analyses of the isolated phagosomes showed that CPBF6 mediates transport of amylases to phagosomes. We also demonstrated that the carboxyl-terminal cytosolic region of CPBF6 is engaged in the regulation of the trafficking of CPBF6 to phagosomes. Our proteome analysis of phagosomes also revealed new potential phagosomal proteins.

  8. Characterization of the entire cystatin gene family in barley and their target cathepsin L-like cysteine-proteases, partners in the hordein mobilization during seed germination.

    PubMed

    Martinez, Manuel; Cambra, Ines; Carrillo, Laura; Diaz-Mendoza, Mercedes; Diaz, Isabel

    2009-11-01

    Plant cystatins are inhibitors of cysteine-proteases of the papain C1A and legumain C13 families. Cystatin data from multiple plant species have suggested that these inhibitors act as defense proteins against pests and pathogens and as regulators of protein turnover. In this study, we characterize the entire cystatin gene family from barley (Hordeum vulgare), which contain 13 nonredundant genes, and identify and characterize their target enzymes, the barley cathepsin L-like proteases. Cystatins and proteases were expressed and purified from Escherichia coli cultures. Each cystatin was found to have different inhibitory capability against barley cysteine-proteases in in vitro inhibitory assays using specific substrates. Real-time reverse transcription-polymerase chain reaction revealed that inhibitors and enzymes present a wide variation in their messenger RNA expression patterns. Their transcripts were mainly detected in developing and germinating seeds, and some of them were also expressed in leaves and roots. Subcellular localization of cystatins and cathepsin L-like proteases fused to green fluorescent protein demonstrated the presence of both protein families throughout the endoplasmic reticulum and the Golgi complex. Proteases and cystatins not only colocalized but also interacted in vivo in the plant cell, as revealed by bimolecular fluorescence complementation. The functional relationship between cystatins and cathepsin L-like proteases was inferred from their common implication as counterparts of mobilization of storage proteins upon barley seed germination. The opposite pattern of transcription expression in gibberellin-treated aleurones presented by inhibitors and enzymes allowed proteases to specifically degrade B, C, and D hordeins stored in the endosperm of barley seeds.

  9. Determinants of Affinity and Proteolytic Stability in Interactions of Kunitz Family Protease Inhibitors with Mesotrypsin

    SciTech Connect

    Salameh, M.A.; Soares, A.; Navaneetham, D.; Sinha, D.; Walsh, P. N.; Radisky, E. S.

    2010-11-19

    An important functional property of protein protease inhibitors is their stability to proteolysis. Mesotrypsin is a human trypsin that has been implicated in the proteolytic inactivation of several protein protease inhibitors. We have found that bovine pancreatic trypsin inhibitor (BPTI), a Kunitz protease inhibitor, inhibits mesotrypsin very weakly and is slowly proteolyzed, whereas, despite close sequence and structural homology, the Kunitz protease inhibitor domain of the amyloid precursor protein (APPI) binds to mesotrypsin 100 times more tightly and is cleaved 300 times more rapidly. To define features responsible for these differences, we have assessed the binding and cleavage by mesotrypsin of APPI and BPTI reciprocally mutated at two nonidentical residues that make direct contact with the enzyme. We find that Arg at P{sub 1} (versus Lys) favors both tighter binding and more rapid cleavage, whereas Met (versus Arg) at P'{sub 2} favors tighter binding but has minimal effect on cleavage. Surprisingly, we find that the APPI scaffold greatly enhances proteolytic cleavage rates, independently of the binding loop. We draw thermodynamic additivity cycles analyzing the interdependence of P1 and P'{sub 2} substitutions and scaffold differences, finding multiple instances in which the contributions of these features are nonadditive. We also report the crystal structure of the mesotrypsin {center_dot} APPI complex, in which we find that the binding loop of APPI displays evidence of increased mobility compared with BPTI. Our data suggest that the enhanced vulnerability of APPI to mesotrypsin cleavage may derive from sequence differences in the scaffold that propagate increased flexibility and mobility to the binding loop.

  10. Determinants of Affinity and Proteolytic Stability in Interactions of Kunitz Family Protease Inhibitors with Mesotrypsin

    SciTech Connect

    M Salameh; A Soares; D Navaneetham; D Sinha; P Walsh; E Radisky

    2011-12-31

    An important functional property of protein protease inhibitors is their stability to proteolysis. Mesotrypsin is a human trypsin that has been implicated in the proteolytic inactivation of several protein protease inhibitors. We have found that bovine pancreatic trypsin inhibitor (BPTI), a Kunitz protease inhibitor, inhibits mesotrypsin very weakly and is slowly proteolyzed, whereas, despite close sequence and structural homology, the Kunitz protease inhibitor domain of the amyloid precursor protein (APPI) binds to mesotrypsin 100 times more tightly and is cleaved 300 times more rapidly. To define features responsible for these differences, we have assessed the binding and cleavage by mesotrypsin of APPI and BPTI reciprocally mutated at two nonidentical residues that make direct contact with the enzyme. We find that Arg at P{sub 1} (versus Lys) favors both tighter binding and more rapid cleavage, whereas Met (versus Arg) at P'{sub 2} favors tighter binding but has minimal effect on cleavage. Surprisingly, we find that the APPI scaffold greatly enhances proteolytic cleavage rates, independently of the binding loop. We draw thermodynamic additivity cycles analyzing the interdependence of P{sub 1} and P'{sub 2} substitutions and scaffold differences, finding multiple instances in which the contributions of these features are nonadditive. We also report the crystal structure of the mesotrypsin-APPI complex, in which we find that the binding loop of APPI displays evidence of increased mobility compared with BPTI. Our data suggest that the enhanced vulnerability of APPI to mesotrypsin cleavage may derive from sequence differences in the scaffold that propagate increased flexibility and mobility to the binding loop.

  11. Crystallization and preliminary crystallographic studies of human kallikrein 7, a serine protease of the multigene kallikrein family

    PubMed Central

    Fernández, Israel S.; Ständker, Ludger; Forssmann, Wolf-Georg; Giménez-Gallego, Guillermo; Romero, Antonio

    2007-01-01

    Human kallikreins are a group of serine proteases of high sequence homology whose genes are grouped as a single cluster at chromosome 19. Although the physiological roles of kallikreins are generally still unknown, members of the kallikrein family have been clearly implicated in pathological situations such as cancer and psoriasis. Human kallikrein 7 (hK7) has been shown to be involved in pathological keratinization, psoriasis and ovarian cancer. In order to gain insight into the molecular structure of this protein, hK7 was crystallized after recombinant production in its folded and active form using a periplasmic secretion vector in Escherichia coli. The crystals belonged to the rhombohedral space group H32 and diffracted to 2.8 Å. The phase problem was solved by molecular replacement using the mouse kallikrein-related protein neuropsin. Completion of the model and structure refinement are under way. PMID:17671364

  12. The HtrA/DegP family protease MamE is a bifunctional protein with roles in magnetosome protein localization and magnetite biomineralization

    PubMed Central

    Quinlan, Anna; Murat, Dorothée; Vali, Hojatollah; Komeili, Arash

    2011-01-01

    Summary Magnetotactic bacteria contain nanometer-sized, membrane-bound organelles, called magnetosomes, which are tasked with the biomineralization of small crystals of the iron oxide magnetite allowing the organism to use geomagnetic field lines for navigation. A key player in this process is the HtrA/DegP family protease MamE. In its absence, Magnetospirillum magneticum str AMB-1 is able to form magnetosome membranes but not magnetite crystals, a defect previously linked to the mislocalization of magnetosome proteins. In this work we use a directed genetic approach to find that MamE, and another predicted magnetosome-associated protease, MamO, likely function as proteases in vivo. However, as opposed to the complete loss of mamE where no biomineralization is observed, the protease-deficient variant of this protein still supports the initiation and formation of small, 20 nm-sized crystals of magnetite, too small to hold a permanent magnetic dipole moment. This analysis also reveals that MamE is a bifunctional protein with a protease-independent role in magnetosome protein localization and a protease-dependent role in maturation of small magnetite crystals. Together these results imply the existence of a previously unrecognized “checkpoint” in biomineralization where MamE moderates the completion of magnetite formation and thus committal to magneto-aerotaxis as the organism’s dominant mode of navigating the environment. PMID:21414040

  13. Loss-of-function analyses defines vital and redundant functions of the Plasmodium rhomboid protease family.

    PubMed

    Lin, Jing-Wen; Meireles, Patrícia; Prudêncio, Miguel; Engelmann, Sabine; Annoura, Takeshi; Sajid, Mohammed; Chevalley-Maurel, Séverine; Ramesar, Jai; Nahar, Carolin; Avramut, Cristina M C; Koster, Abraham J; Matuschewski, Kai; Waters, Andrew P; Janse, Chris J; Mair, Gunnar R; Khan, Shahid M

    2013-04-01

    Rhomboid-like proteases cleave membrane-anchored proteins within their transmembrane domains. In apicomplexan parasites substrates include molecules that function in parasite motility and host cell invasion. While two Plasmodium rhomboids, ROM1 and ROM4, have been examined, the roles of the remaining six rhomboids during the malaria parasite's life cycle are unknown. We present systematic gene deletion analyses of all eight Plasmodium rhomboid-like proteins as a means to discover stage-specific phenotypes and potential functions in the rodent malaria model, P. berghei. Four rhomboids (ROM4, 6, 7 and 8) are refractory to gene deletion, suggesting an essential role during asexual blood stage development. In contrast ROM1, 3, 9 and 10 were dispensable for blood stage development and exhibited no, subtle or severe defects in mosquito or liver development. Parasites lacking ROM9 and ROM10 showed no major phenotypic defects. Parasites lacking ROM1 presented a delay in blood stage patency following liver infection, but in contrast to a previous study blood stage parasites had similar growth and virulence characteristics as wild type parasites. Parasites lacking ROM3 in mosquitoes readily established oocysts but failed to produce sporozoites. ROM3 is the first apicomplexan rhomboid identified to play a vital role in sporogony.

  14. The gene encoding DRAP (BACE2), a glycosylated transmembrane protein of the aspartic protease family, maps to the down critical region.

    PubMed

    Acquati, F; Accarino, M; Nucci, C; Fumagalli, P; Jovine, L; Ottolenghi, S; Taramelli, R

    2000-02-18

    We applied cDNA selection methods to a genomic clone (YAC 761B5) from chromosome 21 located in the so-called 'Down critical region' in 21q22.3. Starting from human fetal heart and brain mRNAs we obtained and sequenced several cDNA clones. One of these clones (Down region aspartic protease (DRAP), named also BACE2 according to the gene nomenclature) revealed a striking nucleotide and amino acid sequence identity with several motifs present in members of the aspartic protease family. In particular the amino acid sequences comprising the two catalytic sites found in all mammalian aspartic proteases are perfectly conserved. Interestingly, the predicted protein shows a typical membrane spanning region; this is at variance with most other known aspartic proteases, which are soluble molecules. We present preliminary evidence, on the basis of in vitro translation studies and cell transfection, that this gene encodes a glycosylated protein which localizes mainly intracellularly but to some extent also to the plasma membrane. Furthermore DRAP/BACE2 shares a high homology with a newly described beta-secretase enzyme (BACE-1) which is a transmembrane aspartic protease. The implications of this finding for Down syndrome are discussed.

  15. Antimicrobial peptide inhibition of fungalysin proteases that target plant type 19 Family IV defense chitinases

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Cereal crops and other plants produce secreted seed chitinases that reduce pathogenic infection, most likely by targeting the fungal chitinous cell wall. We have shown that corn (Zea mays) produces three GH family 19, plant class IV chitinases, that help in protecting the plant against Fusarium and ...

  16. A Genomic Analysis of Rat Proteases and Protease Inhibitors

    PubMed Central

    Puente, Xose S.; López-Otín, Carlos

    2004-01-01

    Proteases perform important roles in multiple biological and pathological processes. The availability of the rat genome sequence has facilitated the analysis of the complete protease repertoire or degradome of this model organism. The rat degradome consists of at least 626 proteases and homologs, which are distributed into 24 aspartic, 160 cysteine, 192 metallo, 221 serine, and 29 threonine proteases. This distribution is similar to that of the mouse degradome but is more complex than that of the human degradome composed of 561 proteases and homologs. This increased complexity of rat proteases mainly derives from the expansion of several families, including placental cathepsins, testases, kallikreins, and hematopoietic serine proteases, involved in reproductive or immunological functions. These protease families have also evolved differently in rat and mouse and may contribute to explain some functional differences between these closely related species. Likewise, genomic analysis of rat protease inhibitors has shown some differences with mouse protease inhibitors and the expansion of families of cysteine and serine protease inhibitors in rodents with respect to human. These comparative analyses may provide new views on the functional diversity of proteases and inhibitors and contribute to the development of innovative strategies for treating proteolysis diseases. PMID:15060002

  17. GlyGly-CTERM and Rhombosortase: A C-Terminal Protein Processing Signal in a Many-to-One Pairing with a Rhomboid Family Intramembrane Serine Protease

    PubMed Central

    Haft, Daniel H.; Varghese, Neha

    2011-01-01

    The rhomboid family of serine proteases occurs in all domains of life. Its members contain at least six hydrophobic membrane-spanning helices, with an active site serine located deep within the hydrophobic interior of the plasma membrane. The model member GlpG from Escherichia coli is heavily studied through engineered mutant forms, varied model substrates, and multiple X-ray crystal studies, yet its relationship to endogenous substrates is not well understood. Here we describe an apparent membrane anchoring C-terminal homology domain that appears in numerous genera including Shewanella, Vibrio, Acinetobacter, and Ralstonia, but excluding Escherichia and Haemophilus. Individual genomes encode up to thirteen members, usually homologous to each other only in this C-terminal region. The domain's tripartite architecture consists of motif, transmembrane helix, and cluster of basic residues at the protein C-terminus, as also seen with the LPXTG recognition sequence for sortase A and the PEP-CTERM recognition sequence for exosortase. Partial Phylogenetic Profiling identifies a distinctive rhomboid-like protease subfamily almost perfectly co-distributed with this recognition sequence. This protease subfamily and its putative target domain are hereby renamed rhombosortase and GlyGly-CTERM, respectively. The protease and target are encoded by consecutive genes in most genomes with just a single target, but far apart otherwise. The signature motif of the Rhombo-CTERM domain, often SGGS, only partially resembles known cleavage sites of rhomboid protease family model substrates. Some protein families that have several members with C-terminal GlyGly-CTERM domains also have additional members with LPXTG or PEP-CTERM domains instead, suggesting there may be common themes to the post-translational processing of these proteins by three different membrane protein superfamilies. PMID:22194940

  18. Crystallization and preliminary crystallographic studies of human kallikrein 7, a serine protease of the multigene kallikrein family

    SciTech Connect

    Fernández, Israel S.; Ständker, Ludger; Forssmann, Wolf-Georg; Giménez-Gallego, Guillermo; Romero, Antonio

    2007-08-01

    The cloning, expression, purification and crystallization of recombinant human kallikrein 7, directly synthesized in the active form in E. coli, is described. Diffraction data were collected to 2.8 Å resolution from native crystals. Human kallikreins are a group of serine proteases of high sequence homology whose genes are grouped as a single cluster at chromosome 19. Although the physiological roles of kallikreins are generally still unknown, members of the kallikrein family have been clearly implicated in pathological situations such as cancer and psoriasis. Human kallikrein 7 (hK7) has been shown to be involved in pathological keratinization, psoriasis and ovarian cancer. In order to gain insight into the molecular structure of this protein, hK7 was crystallized after recombinant production in its folded and active form using a periplasmic secretion vector in Escherichia coli. The crystals belonged to the rhombohedral space group H32 and diffracted to 2.8 Å. The phase problem was solved by molecular replacement using the mouse kallikrein-related protein neuropsin. Completion of the model and structure refinement are under way.

  19. Storage Protein Accumulation in the Absence of the Vacuolar Processing Enzyme Family of Cysteine ProteasesW⃞

    PubMed Central

    Gruis, Darren; Schulze, Jan; Jung, Rudolf

    2004-01-01

    The role(s) of specific proteases in seed protein processing is only vaguely understood; indeed, the overall role of processing in stable protein deposition has been the subject of more speculation than direct investigation. Seed-type members of the vacuolar processing enzyme (VPE) family were hypothesized to perform a unique function in seed protein processing, but we demonstrated previously that Asn-specific protein processing in developing Arabidopsis seeds occurs independently of this VPE activity. Here, we describe the unexpected expression of vegetative-type VPEs in developing seeds and test the role(s) of all VPEs in seed storage protein accumulation by systematically stacking knockout mutant alleles of all four members (αVPE, βVPE, γVPE, and δVPE) of the VPE gene family in Arabidopsis. The complete removal of VPE function in the αvpe βvpe γvpe δvpe quadruple mutant resulted in a total shift of storage protein accumulation from wild-type processed polypeptides to a finite number of prominent alternatively processed polypeptides cleaved at sites other than the conserved Asn residues targeted by VPE. Although alternatively proteolyzed legumin-type globulin polypeptides largely accumulated as intrasubunit disulfide-linked polypeptides with apparent molecular masses similar to those of VPE-processed legumin polypeptides, they showed markedly altered solubility and protein assembly characteristics. Instead of forming 11S hexamers, alternatively processed legumin polypeptides were deposited primarily as 9S complexes. However, despite the impact on seed protein processing, plants devoid of all known functional VPE genes appeared unchanged with regard to protein content in mature seeds, relative mobilization rates of protein reserves during germination, and vegetative growth. These findings indicate that VPE-mediated Asn-specific proteolytic processing, and the physiochemical property changes attributed to this specific processing step, are not required for

  20. A novel family of ubiquitin-specific proteases in chick skeletal muscle with distinct N- and C-terminal extensions.

    PubMed Central

    Baek, S H; Park, K C; Lee, J I; Kim, K I; Yoo, Y J; Tanaka, K; Baker, R T; Chung, C H

    1998-01-01

    We have recently identified a cDNA for a ubiquitin-specific protease (UBP), UBP41, that encodes the smallest functional UBP identified to date, using an Escherichia coli-based in vivo screening method. In the present study we isolated highly related cDNAs encoding a new family of UBP enzymes, named UBP46, UBP52 and UBP66. These UBPs have virtually identical catalytic domains spanning the sequence of UBP41 between the active-site Cys and the His box (95% identity). However, they possess distinct N- and/or C-terminal extensions. Moreover, they are more closely related to each other than to any other members of the UBP family. Thus these chick UBPs must define a novel family of de-ubiquitinating enzymes and should represent the first example among the UBP family enzymes, whose multiplicity is achieved by variation in their N- and C-terminal extensions. The chick UBPs were expressed in E. coli, and purified from the cells to apparent homogeneity using 125I-labelled ubiquitin-alphaNH-MHISPPEPESEEEEEHYC as a substrate. Each of the purified UBP46, UBP52 and UBP66 enzymes behaved as proteins of similar sizes under both denaturing and non-denaturing conditions, suggesting that all of them consist of a single polypeptide chain. The UBP enzymes cleaved the C-terminus of the ubiquitin moiety in natural and engineered fusions irrespective of their sizes and thus are active against ubiquitin-beta-galactosidase as well as a ubiquitin C-terminal extension protein of 80 amino acids. All UBPs except UBP66 released free ubiquitin from poly-His-tagged di-ubiquitin. However, the isopeptidase activity for hydrolysing polyubiquitinated lysozyme conjugates was not detected from these UBPs, which makes these UBPs distinct from UBP41. These results suggest that the chick UBPs may play an important role in production of free ubiquitin from linear polyubiquitin chains and of certain ribosomal proteins from ubiquitin fusion proteins. PMID:9729477

  1. The lone S41 family C-terminal processing protease in Staphylococcus aureus is localized to the cell wall and contributes to virulence.

    PubMed

    Carroll, Ronan K; Rivera, Frances E; Cavaco, Courtney K; Johnson, Grant M; Martin, David; Shaw, Lindsey N

    2014-08-01

    Staphylococcus aureus is a versatile pathogen of humans and a continued public health concern due to the rise and spread of multidrug-resistant strains. As part of an ongoing investigation into the pathogenic mechanisms of this organism we previously demonstrated that an intracellular N-terminal processing protease is required for S. aureus virulence. Following on from this, here we examine the role of CtpA, the lone C-terminal processing protease of S. aureus. CtpA, a member of the S41 family, is a serine protease whose homologues in Gram-negative bacteria have been implicated in a range of biological functions, including pathogenesis. We demonstrate that S. aureus CtpA is localized to the bacterial cell wall and expression of the ctpA gene is maximal upon exposure to conditions encountered during infection. Disruption of the ctpA gene leads to decreased heat tolerance and increased sensitivity when exposed to components of the host immune system. Finally we demonstrate that the ctpA(-) mutant strain is attenuated for virulence in a murine model of infection. Our results represent the first characterization of a C-terminal processing protease in a pathogenic Gram-positive bacterium and show that it plays a critical role during infection.

  2. Highly sensitive and adaptable fluorescence-quenched pair discloses the substrate specificity profiles in diverse protease families.

    PubMed

    Poreba, Marcin; Szalek, Aleksandra; Rut, Wioletta; Kasperkiewicz, Paulina; Rutkowska-Wlodarczyk, Izabela; Snipas, Scott J; Itoh, Yoshifumi; Turk, Dusan; Turk, Boris; Overall, Christopher M; Kaczmarek, Leszek; Salvesen, Guy S; Drag, Marcin

    2017-02-23

    Internally quenched fluorescent (IQF) peptide substrates originating from FRET (Förster Resonance Energy Transfer) are powerful tool for examining the activity and specificity of proteases, and a variety of donor/acceptor pairs are extensively used to design individual substrates and combinatorial libraries. We developed a highly sensitive and adaptable donor/acceptor pair that can be used to investigate the substrate specificity of cysteine proteases, serine proteases and metalloproteinases. This novel pair comprises 7-amino-4-carbamoylmethylcoumarin (ACC) as the fluorophore and 2,4-dinitrophenyl-lysine (Lys(DNP)) as the quencher. Using caspase-3, caspase-7, caspase-8, neutrophil elastase, legumain, and two matrix metalloproteinases (MMP2 and MMP9), we demonstrated that substrates containing ACC/Lys(DNP) exhibit 7 to 10 times higher sensitivity than conventional 7-methoxy-coumarin-4-yl acetic acid (MCA)/Lys(DNP) substrates; thus, substantially lower amounts of substrate and enzyme can be used for each assay. We therefore propose that the ACC/Lys(DNP) pair can be considered a novel and sensitive scaffold for designing substrates for any group of endopeptidases. We further demonstrate that IQF substrates containing unnatural amino acids can be used to investigate protease activities/specificities for peptides containing post-translationally modified amino acids. Finally, we used IQF substrates to re-investigate the P1-Asp characteristic of caspases, thus demonstrating that some human caspases can also hydrolyze substrates after glutamic acid.

  3. Highly sensitive and adaptable fluorescence-quenched pair discloses the substrate specificity profiles in diverse protease families

    PubMed Central

    Poreba, Marcin; Szalek, Aleksandra; Rut, Wioletta; Kasperkiewicz, Paulina; Rutkowska-Wlodarczyk, Izabela; Snipas, Scott J.; Itoh, Yoshifumi; Turk, Dusan; Turk, Boris; Overall, Christopher M.; Kaczmarek, Leszek; Salvesen, Guy S.; Drag, Marcin

    2017-01-01

    Internally quenched fluorescent (IQF) peptide substrates originating from FRET (Förster Resonance Energy Transfer) are powerful tool for examining the activity and specificity of proteases, and a variety of donor/acceptor pairs are extensively used to design individual substrates and combinatorial libraries. We developed a highly sensitive and adaptable donor/acceptor pair that can be used to investigate the substrate specificity of cysteine proteases, serine proteases and metalloproteinases. This novel pair comprises 7-amino-4-carbamoylmethylcoumarin (ACC) as the fluorophore and 2,4-dinitrophenyl-lysine (Lys(DNP)) as the quencher. Using caspase-3, caspase-7, caspase-8, neutrophil elastase, legumain, and two matrix metalloproteinases (MMP2 and MMP9), we demonstrated that substrates containing ACC/Lys(DNP) exhibit 7 to 10 times higher sensitivity than conventional 7-methoxy-coumarin-4-yl acetic acid (MCA)/Lys(DNP) substrates; thus, substantially lower amounts of substrate and enzyme can be used for each assay. We therefore propose that the ACC/Lys(DNP) pair can be considered a novel and sensitive scaffold for designing substrates for any group of endopeptidases. We further demonstrate that IQF substrates containing unnatural amino acids can be used to investigate protease activities/specificities for peptides containing post-translationally modified amino acids. Finally, we used IQF substrates to re-investigate the P1-Asp characteristic of caspases, thus demonstrating that some human caspases can also hydrolyze substrates after glutamic acid. PMID:28230157

  4. Proteomics and phylogenetic analysis of the cathepsin L protease family of the helminth pathogen Fasciola hepatica: expansion of a repertoire of virulence-associated factors.

    PubMed

    Robinson, Mark W; Tort, Jose F; Lowther, Jonathan; Donnelly, Sheila M; Wong, Emily; Xu, Weibo; Stack, Colin M; Padula, Matthew; Herbert, Ben; Dalton, John P

    2008-06-01

    Cathepsin L proteases secreted by the helminth pathogen Fasciola hepatica have functions in parasite virulence including tissue invasion and suppression of host immune responses. Using proteomics methods alongside phylogenetic studies we characterized the profile of cathepsin L proteases secreted by adult F. hepatica and hence identified those involved in host-pathogen interaction. Phylogenetic analyses showed that the Fasciola cathepsin L gene family expanded by a series of gene duplications followed by divergence that gave rise to three clades associated with mature adult worms (Clades 1, 2, and 5) and two clades specific to infective juvenile stages (Clades 3 and 4). Consistent with these observations our proteomics studies identified representatives from Clades 1, 2, and 5 but not from Clades 3 and 4 in adult F. hepatica secretory products. Clades 1 and 2 account for 67.39 and 27.63% of total secreted cathepsin Ls, respectively, suggesting that their expansion was positively driven and that these proteases are most critical for parasite survival and adaptation. Sequence comparison studies revealed that the expansion of cathepsin Ls by gene duplication was followed by residue changes in the S2 pocket of the active site. Our biochemical studies showed that these changes result in alterations in substrate binding and suggested that the divergence of the cathepsin L family produced a repertoire of enzymes with overlapping and complementary substrate specificities that could cleave host macromolecules more efficiently. Although the cathepsin Ls are produced as zymogens containing a prosegment and mature domain, all secreted enzymes identified by MS were processed to mature active enzymes. The prosegment region was highly conserved between the clades except at the boundary of prosegment and mature enzyme. Despite the lack of conservation at this section, sites for exogenous cleavage by asparaginyl endopeptidases and a Leu-Ser[downward arrow]His motif for

  5. Characterization of the Entire Cystatin Gene Family in Barley and Their Target Cathepsin L-Like Cysteine-Proteases, Partners in the Hordein Mobilization during Seed Germination1[W

    PubMed Central

    Martinez, Manuel; Cambra, Ines; Carrillo, Laura; Diaz-Mendoza, Mercedes; Diaz, Isabel

    2009-01-01

    Plant cystatins are inhibitors of cysteine-proteases of the papain C1A and legumain C13 families. Cystatin data from multiple plant species have suggested that these inhibitors act as defense proteins against pests and pathogens and as regulators of protein turnover. In this study, we characterize the entire cystatin gene family from barley (Hordeum vulgare), which contain 13 nonredundant genes, and identify and characterize their target enzymes, the barley cathepsin L-like proteases. Cystatins and proteases were expressed and purified from Escherichia coli cultures. Each cystatin was found to have different inhibitory capability against barley cysteine-proteases in in vitro inhibitory assays using specific substrates. Real-time reverse transcription-polymerase chain reaction revealed that inhibitors and enzymes present a wide variation in their messenger RNA expression patterns. Their transcripts were mainly detected in developing and germinating seeds, and some of them were also expressed in leaves and roots. Subcellular localization of cystatins and cathepsin L-like proteases fused to green fluorescent protein demonstrated the presence of both protein families throughout the endoplasmic reticulum and the Golgi complex. Proteases and cystatins not only colocalized but also interacted in vivo in the plant cell, as revealed by bimolecular fluorescence complementation. The functional relationship between cystatins and cathepsin L-like proteases was inferred from their common implication as counterparts of mobilization of storage proteins upon barley seed germination. The opposite pattern of transcription expression in gibberellin-treated aleurones presented by inhibitors and enzymes allowed proteases to specifically degrade B, C, and D hordeins stored in the endosperm of barley seeds. PMID:19759340

  6. Supermarket Proteases.

    ERIC Educational Resources Information Center

    Hagar, William G.; Bullerwell, Lornie D.

    2003-01-01

    Presents a laboratory activity on enzymes. Uses common items found in the supermarket that contain protease enzymes, such as contact lens cleaner and meat tenderizer. Demonstrates the digestion of gelatin proteins as part of enzymatic reactions. (Author/SOE)

  7. Identification and Characterization of a Novel Aspergillus fumigatus Rhomboid Family Putative Protease, RbdA, Involved in Hypoxia Sensing and Virulence

    PubMed Central

    Vaknin, Yakir; Hillmann, Falk; Iannitti, Rossana; Ben Baruch, Netali; Sandovsky-Losica, Hana; Shadkchan, Yona; Romani, Luigina; Brakhage, Axel

    2016-01-01

    Aspergillus fumigatus is the most common pathogenic mold infecting humans and a significant cause of morbidity and mortality in immunocompromised patients. In invasive pulmonary aspergillosis, A. fumigatus spores are inhaled into the lungs, undergoing germination and invasive hyphal growth. The fungus occludes and disrupts the blood vessels, leading to hypoxia and eventual tissue necrosis. The ability of this mold to adapt to hypoxia is regulated in part by the sterol regulatory element binding protein (SREBP) SrbA and the DscA to DscD Golgi E3 ligase complex critical for SREBP activation by proteolytic cleavage. Loss of the genes encoding these proteins results in avirulence. To identify novel regulators of hypoxia sensing, we screened the Neurospora crassa gene deletion library under hypoxia and identified a novel rhomboid family protease essential for hypoxic growth. Deletion of the A. fumigatus rhomboid homolog rbdA resulted in an inability to grow under hypoxia, hypersensitivity to CoCl2, nikkomycin Z, fluconazole, and ferrozine, abnormal swollen tip morphology, and transcriptional dysregulation—accurately phenocopying deletion of srbA. In vivo, rbdA deletion resulted in increased sensitivity to phagocytic killing, a reduced inflammatory Th1 and Th17 response, and strongly attenuated virulence. Phenotypic rescue of the ΔrbdA mutant was achieved by expression and nuclear localization of the N terminus of SrbA, including its HLH domain, further indicating that RbdA and SrbA act in the same signaling pathway. In summary, we have identified RbdA, a novel putative rhomboid family protease in A. fumigatus that mediates hypoxia adaptation and fungal virulence and that is likely linked to SrbA cleavage and activation. PMID:27068092

  8. An oocyte-specific astacin family protease, alveolin, is released from cortical granules to trigger egg envelope hardening during fertilization in medaka (Oryzias latipes).

    PubMed

    Shibata, Yasushi; Iwamatsu, Takashi; Suzuki, Norio; Young, Graham; Naruse, Kiyoshi; Nagahama, Yoshitaka; Yoshikuni, Michiyasu

    2012-12-15

    It has long been hypothesized that in fishes the contents of cortical granules are involved in the hardening of egg envelope following fertilization. We previously purified the egg envelope hardening initiation factor from the exudates released from activated medaka (Oryzias latipes) eggs and tentatively termed this protein alveolin. Alveolin is a member of the astacin metalloprotease family and was proposed to be a protease which hydrolyzes ZPB at one restricted position to allow starting cross-linking with ZPC. Here, we investigated the complete pathway from biosynthesis and accumulation to secretion of alveolin. A single alveolin transcript was detected only in ovarian preparations, confirming the specific expression of alveolin in the ovary. In situ hybridization indicated that the alveolin mRNA is already expressed in the very early previtellogenic oocytes. However, immunocytochemical studies revealed that the appearance of alveolin protein was delayed until the beginning of the vitellogenic stage. The cortical granules isolated from unfertilized eggs contained a high molecular weight form of glycosylated alveolin with a 50kDa relative molecular mass. Hypotonic treatment burst isolated granules in vitro and transformed alveolin to a 21.5kDa form, which is the same size as that of natural alveolin released from eggs upon fertilization. This transformation was inhibited in the presence of leupeptin and 4-(2-aminoethyl) benzenesulfonyl fluoride hydrochloride (AEBSF), suggesting that a serine protease is involved in alveolin activation upon fertilization. Furthermore, the phylogenetic relationship of alveolin with other vertebrate astacin family members was analyzed. The result shows that alveolin and its teleostean homologs make a new group which is separate from either the hatching enzyme, meprin and BMP1/tolloid groups.

  9. A Zinc-Dependent Protease AMZ-tk from a Thermophilic Archaeon is a New Member of the Archaemetzincin Protein Family

    PubMed Central

    Jia, Baolei; Li, Zhengqun; Liu, Jinliang; Sun, Ying; Jia, Xiaomeng; Xuan, Yuan Hu; Zhang, Jiayan; Jeon, Che Ok

    2015-01-01

    A putative zinc-dependent protease (TK0512) in Thermococcus kodakarensis KOD1 shares a conserved motif with archaemetzincins, which are metalloproteases found in archaea, bacteria, and eukarya. Phylogenetic and sequence analyses showed that TK0512 and its homologues in Thermococcaceae represent new members in the archaemetzincins family, which we named AMZ-tk. We further confirmed its proteolytic activity biochemically by overexpression of the recombinant AMZ-tk in Escherichia coli and characterization of the purified enzyme. In the presence of zinc, the purified enzyme degraded casein, while adding EDTA strongly inhibited the enzyme activity. AMZ-tk also exhibited self-cleavage activity that required Zn2+. These results demonstrated that AMZ-tk is a zinc-dependent protease within the archaemetzincin family. The enzyme displayed activity at alkaline pHs ranging from 7.0 to 10.0, with the optimal pH being 8.0. The optimum temperature for the catalytic activity of AMZ-tk was 55°C. Quantitative reverse transcription-PCR revealed that transcription of AMZ-tk was also up-regulated after exposing the cells to 55 and 65°C. Mutant analysis suggested that Zn2+ binding histidine and catalytic glutamate play key roles in proteolysis. AMZ-tk was thermostable on incubation for 4 h at 70°C in the presence of EDTA. AMZ-tk also retained >50% of its original activity in the presence of both laboratory surfactants and commercial laundry detergents. AMZ-tk further showed antibacterial activity against several bacteria. Therefore, AMZ-tk is of considerable interest for many purposes in view of its activity at alkaline pH, detergents, and thermostability. PMID:26733945

  10. SLC6 family transporter SNF-10 is required for protease-mediated activation of sperm motility in C. elegans

    PubMed Central

    Fenker, Kristin E.; Hansen, Angela A.; Chong, Conrad A.; Jud, Molly C.; Duffy, Brittany A.; Norton, J. Paul; Hansen, Jody M.; Stanfield, Gillian M.

    2014-01-01

    Summary Motility of sperm is crucial for their directed migration to the egg. The acquisition and modulation of motility are regulated to ensure that sperm move when and where needed, thereby promoting reproductive success. One specific example of this phenomenon occurs during differentiation of the amoeboid sperm of C. elegans as they activate from a round spermatid to a mature, crawling spermatozoon. Sperm activation is regulated by redundant pathways to occur at a specific time and place for each sex. Here, we report the identification of the solute carrier 6 (SLC6) transporter protein SNF-10 as a key regulator of C. elegans sperm activation in response to male protease activation signals. We find that SNF-10 is present in sperm and is required for activation by the male but not by the hermaphrodite. Loss of both snf-10 and a hermaphrodite activation factor render sperm completely insensitive to activation. Using in vitro assays, we find that snf-10 mutant sperm show a specific deficit in response to protease treatment but not to other activators. Prior to activation, SNF-10 is present in the plasma membrane, where it represents a strong candidate to receive signals that lead to subcellular morphogenesis. After activation, it shows polarized localization to the cell body region that is dependent on membrane fusions mediated by the dysferlin FER-1. Our discovery of snf-10 offers insight into the mechanisms differentially employed by the two sexes to accomplish the common goal of producing functional sperm, as well as how the physiology of nematode sperm may be regulated to control motility as it is in mammals. PMID:24929237

  11. Control of Entamoeba histolytica adherence involves metallosurface protease 1, an M8 family surface metalloprotease with homology to leishmanolysin.

    PubMed

    Teixeira, Jose E; Sateriale, Adam; Bessoff, Kovi E; Huston, Christopher D

    2012-06-01

    Invasive amebiasis due to Entamoeba histolytica infection is an important cause of morbidity in developing countries. The E. histolytica genome contains two homologues to the metalloprotease leishmanolysin gene, Entamoeba histolytica MSP-1 (EhMSP-1) and EhMSP-2, while the commensal ameba Entamoeba dispar has lost EhMSP-1. In this study, we sought to characterize E. histolytica metallosurface protease 1 (EhMSP-1). Using immunoprecipitation and a model substrate, we found that EhMSP-1 was a functional metalloprotease. Confocal microscopy and flow cytometry revealed that EhMSP-1 localized to the cell surface and revealed the existence of distinct, nonclonal trophozoite populations with high and low EhMSP-1 surface abundance that became synchronized following serum starvation. Phenotypic assays were performed after silencing EhMSP-1. Adherence of EhMSP-1-deficient trophozoites to tissue culture cell monolayers was more than five times greater than that of control amebas, but surface staining of several antigens, including the galactose adherence lectin, was unchanged. EhMSP-1 silencing similarly increased adherence to both viable and apoptotic Jurkat lymphocytes. Tissue culture cell monolayer destruction was reduced by EhMSP-1 silencing, although it was blocked almost completely by inhibiting cysteine proteases. Consistent with a primary defect in regulation of amebic adherence, EhMSP-1 silencing also resulted in reduced mobility on tissue culture cell monolayers and in increased phagocytosis. In conclusion, EhMSP-1 was shown to be a surface metalloprotease involved in regulation of amebic adherence, with additional effects on cell motility, cell monolayer destruction, and phagocytosis.

  12. Mutagenesis and crystallographic studies of the catalytic residues of the papain family protease bleomycin hydrolase: new insights into active-site structure

    PubMed Central

    O'Farrell, Paul A.; Joshua-Tor, Leemor

    2006-01-01

    Bleomycin hydrolase (BH) is a hexameric papain family cysteine protease which is involved in preparing peptides for antigen presentation and has been implicated in tumour cell resistance to bleomycin chemotherapy. Structures of active-site mutants of yeast BH yielded unexpected results. Replacement of the active-site asparagine with alanine, valine or leucine results in the destabilization of the histidine side chain, demonstrating unambiguously the role of the asparagine residue in correctly positioning the histidine for catalysis. Replacement of the histidine with alanine or leucine destabilizes the asparagine position, indicating a delicate arrangement of the active-site residues. In all of the mutants, the C-terminus of the protein, which lies in the active site, protrudes further into the active site. All mutants were compromised in their catalytic activity. The structures also revealed the importance of a tightly bound water molecule which stabilizes a loop near the active site and which is conserved throughout the papain family. It is displaced in a number of the mutants, causing destabilization of this loop and a nearby loop, resulting in a large movement of the active-site cysteine. The results imply that this water molecule plays a key structural role in this family of enzymes. PMID:17007609

  13. Allium sativum Protease Inhibitor: A Novel Kunitz Trypsin Inhibitor from Garlic Is a New Comrade of the Serpin Family

    PubMed Central

    Shamsi, Tooba Naz; Parveen, Romana; Amir, Mohd.; Baig, Mohd. Affan; Qureshi, M. Irfan; Ali, Sher; Fatima, Sadaf

    2016-01-01

    Purpose This study was aimed to purify and characterize the Protease inhibitor (PI) from a plant Allium sativum (garlic) with strong medicinal properties and to explore its phytodrug potentials. Methods Allium sativum Protease Inhibitor (ASPI) was purified using ammonium sulphate fractionation and Fast Protein Liquid Chromatography on anion exchanger Hi-Trap DEAE column. The purified protein was analyzed for its purity and molecular weight by SDS PAGE. The confirmation of presence of trypsin inhibiting PI was performed by MALDI TOF-TOF and analyzed by MASCOT database. The ASPI was further investigated for its kinetic properties and stability under extreme conditions of pH, temperature and chemical denaturants. Secondary structure was determined by Circular Dichorism (CD) spectroscopy. Results ASPI of ~15 kDa inhibited trypsin and matched "truncated kunitz Trypsin Inhibitor (Glycine max)" in MASCOT database. The purified ASPI showed 30376.1371 U/mg specific activity with a fold purity of 159.92 and yield ~93%. ASPI was quite stable in the range of pH 2–12 showing a decline in the activity around pH 4–5 suggesting that the pI value of the protein as ASPI aggregates in this range. ASPI showed stability to a broad range of temperature (10–80°C) but declined beyond 80°C. Further, detergents, oxidizing agents and reducing agents demonstrated change in ASPI activity under varying concentrations. The kinetic analysis revealed sigmoidal relationship of velocity with substrate concentration with Vmax 240.8 (μM/min) and Km value of 0.12 μM. ASPI showed uncompetitive inhibition with a Ki of 0.08±0.01 nM). The Far UV CD depicted 2.0% α -helices and 51% β -sheets at native pH. Conclusions To conclude, purified ~15 kDa ASPI exhibited fair stability in wide range of pH and temperature Overall, there was an increase in purification fold with remarkable yield. Chemical modification studies suggested the presence of lysine and tryptophan residues as lead amino acids

  14. Cathepsin proteases in Toxoplasma gondii

    PubMed Central

    Dou, Zhicheng; Carruthers, Vern B.

    2014-01-01

    Cysteine proteases are important for the growth and survival of apicomplexan parasites that infect humans. The apicomplexan Toxoplasma gondii expresses five members of the C1 family of cysteine proteases, including one cathepsin L-like (TgCPL), one cathepsin B-like (TgCPB), and three cathepsin C-like (TgCPC1, 2 and 3) proteases. Recent genetic, biochemical and structural studies reveal that cathepsins function in microneme and rhoptry protein maturation, host cell invasion, replication, and nutrient acquisition.. Here, we review the key features and roles of T. gondii cathepsins and discuss the therapeutic potential for specific inhibitor development. PMID:21660658

  15. NMR characterization and conformational analysis of a potent papain-family cathepsin L-like cysteine protease inhibitor with different behaviour in polar and apolar media

    NASA Astrophysics Data System (ADS)

    Rotondo, Archimede; Ettari, Roberta; Zappalà, Maria; De Micheli, Carlo; Rotondo, Enrico

    2014-11-01

    We recently reported the synthesis, of a potent papain-family cathepsin L-like cysteine protease inhibitor, as new lead compound for the development of new drugs that can be used as antiprotozoal agents. The investigation of its conformational profile is crucial for the in-depth understanding of its biological behaviour. Our careful NMR analysis has been based on the complete and total assignment of 1H, 13C, 15N and 19F signals of the molecule in both CDCl3 and CD3OH, which could reproduce in some way a scenario of polar and not polar phases into the biological environment. In this way it has been unveiled a different behaviour of the molecule in polar and apolar media. In CDCl3 it is possible to define stable conformational arrangements on the basis of the detected through space contacts, whereas, in CD3OH a greater conformational freedom is envisaged: (a) by the overlap of any of the CH2 diastereotopic resonances (unable to distinguish asymmetric molecular sides because of the free rotation about the single bonded chains), (b) by the less definite measured vicinities not consistent with just one conformation and (c) by the evident loss or switching of key intramolecular hydrogen interactions.

  16. Serine Proteases of Parasitic Helminths

    PubMed Central

    Yang, Yong; Wen, Yun jun; Cai, Ya Nan; Vallée, Isabelle; Boireau, Pascal; Liu, Ming Yuan; Cheng, Shi Peng

    2015-01-01

    Serine proteases form one of the most important families of enzymes and perform significant functions in a broad range of biological processes, such as intra- and extracellular protein metabolism, digestion, blood coagulation, regulation of development, and fertilization. A number of serine proteases have been identified in parasitic helminths that have putative roles in parasite development and nutrition, host tissues and cell invasion, anticoagulation, and immune evasion. In this review, we described the serine proteases that have been identified in parasitic helminths, including nematodes (Trichinella spiralis, T. pseudospiralis, Trichuris muris, Anisakis simplex, Ascaris suum, Onchocerca volvulus, O. lienalis, Brugia malayi, Ancylostoma caninum, and Steinernema carpocapsae), cestodes (Spirometra mansoni, Echinococcus granulosus, and Schistocephalus solidus), and trematodes (Fasciola hepatica, F. gigantica, and Schistosoma mansoni). Moreover, the possible biological functions of these serine proteases in the endogenous biological phenomena of these parasites and in the host-parasite interaction were also discussed. PMID:25748703

  17. Genotype-dependent expression of specific members of potato protease inhibitor gene families in different tissues and in response to wounding and nematode infection.

    PubMed

    Turrà, David; Bellin, Diana; Lorito, Matteo; Gebhardt, Christiane

    2009-05-01

    Protease inhibitors (PIs) are small ubiquitous proteins with a variety of biological functions in plants, including protein stabilization, modulation of apoptosis and defense against pathogens. Kunitz-like inhibitors (PKPIs) and proteinase inhibitors 1 (PI-1) are abundant in storage organs of potato plants and are up-regulated in other tissues in response to biotic and abiotic stress. However, little information is available on genotype-dependent regulation of individual PKPI group- and PI-1 genes. We isolated, sequenced and characterized four novel full-length PI-1 cDNAs (PPI3A2, PPI3A4, PPI2C4 and PPI2C1A) from Solanum tuberosum cv. Desirée. Specific primers were developed for PI-1 genes PPI3A2, PPI3B2 and PPI2C4 and the three PKPI homology groups A, B and C. Their expression profiles were studied by semi-quantitative RT-PCR in comparison with transcripts of the PI-1, Pin2 and PR1 gene families in various tissues, after wounding and Globodera rostochiensis infection of nematode-resistant genotypes P40 and LB7/4/c-I-7, and susceptible cv. Desirée. Individual PI-1 genes and PKPI homology groups were expressed in a tissue- and genotype-dependent manner after wounding and nematode infection. The differences in PI expression patterns were related to the intensity, type of inhibitors produced, and the kinetics of induction. Therefore, different genotype-environment combinations produce different sets of PI transcripts. Potato plants reacted to G. rostochiensis infection by modulating PKPI, PI-1 and Pin2, but not PR1 gene expression, suggesting that the jasmonic acid but not the salicylic acid defense signaling pathway is activated. PI expression profiles were not correlated with the resistance status of the potato genotype infected with G. rostochiensis.

  18. Structure and mechanism of rhomboid protease.

    PubMed

    Ha, Ya; Akiyama, Yoshinori; Xue, Yi

    2013-05-31

    Rhomboid protease was first discovered in Drosophila. Mutation of the fly gene interfered with growth factor signaling and produced a characteristic phenotype of a pointed head skeleton. The name rhomboid has since been widely used to describe a large family of related membrane proteins that have diverse biological functions but share a common catalytic core domain composed of six membrane-spanning segments. Most rhomboid proteases cleave membrane protein substrates near the N terminus of their transmembrane domains. How these proteases function within the confines of the membrane is not completely understood. Recent progress in crystallographic analysis of the Escherichia coli rhomboid protease GlpG in complex with inhibitors has provided new insights into the catalytic mechanism of the protease and its conformational change. Improved biochemical assays have also identified a substrate sequence motif that is specifically recognized by many rhomboid proteases.

  19. Proteases as Insecticidal Agents

    PubMed Central

    Harrison, Robert L.; Bonning, Bryony C.

    2010-01-01

    Proteases from a variety of sources (viruses, bacteria, fungi, plants, and insects) have toxicity towards insects. Some of these insecticidal proteases evolved as venom components, herbivore resistance factors, or microbial pathogenicity factors, while other proteases play roles in insect development or digestion, but exert an insecticidal effect when over-expressed from genetically engineered plants or microbial pathogens. Many of these proteases are cysteine proteases, although insect-toxic metalloproteases and serine proteases have also been examined. The sites of protease toxic activity range from the insect midgut to the hemocoel (body cavity) to the cuticle. This review discusses these insecticidal proteases along with their evaluation and use as potential pesticides. PMID:22069618

  20. Yeast extracellular proteases.

    PubMed

    Ogrydziak, D M

    1993-01-01

    Many species of yeast secrete significant amounts of protease(s). In this article, results of numerous surveys of yeast extracellular protease production have been compiled and inconsistencies in the data and limitations of the methodology have been examined. Regulation, purification, characterization, and processing of yeast extracellular proteases are reviewed. Results obtained from the sequences of cloned genes, especially the Saccharomyces cerevisiae Bar protease, the Candida albicans acid protease, and the Yarrowia lipolytica alkaline protease, have been emphasized. Biotechnological applications and the medical relevance of yeast extracellular proteases are covered. Yeast extracellular proteases have potential in beer and wine stabilization, and they probably contribute to pathogenicity of Candida spp. Yeast extracellular protease genes also provide secretion and processing signals for yeast expression systems designed for secretion of heterologous proteins. Coverage of the secretion of foreign proteases such as prochymosin, urokinase, and tissue plasminogen activator by yeast in included.

  1. Diversity, Structures, and Collagen-Degrading Mechanisms of Bacterial Collagenolytic Proteases.

    PubMed

    Zhang, Yu-Zhong; Ran, Li-Yuan; Li, Chun-Yang; Chen, Xiu-Lan

    2015-09-01

    Bacterial collagenolytic proteases are important because of their essential role in global collagen degradation and because of their virulence in some human bacterial infections. Bacterial collagenolytic proteases include some metalloproteases of the M9 family from Clostridium or Vibrio strains, some serine proteases distributed in the S1, S8, and S53 families, and members of the U32 family. In recent years, there has been remarkable progress in discovering new bacterial collagenolytic proteases and in investigating the collagen-degrading mechanisms of bacterial collagenolytic proteases. This review provides comprehensive insight into bacterial collagenolytic proteases, especially focusing on the structures and collagen-degrading mechanisms of representative bacterial collagenolytic proteases in each family. The roles of bacterial collagenolytic proteases in human diseases and global nitrogen cycling, together with the biotechnological and medical applications for these proteases, are also briefly discussed.

  2. Diversity, Structures, and Collagen-Degrading Mechanisms of Bacterial Collagenolytic Proteases

    PubMed Central

    Zhang, Yu-Zhong; Ran, Li-Yuan; Li, Chun-Yang

    2015-01-01

    Bacterial collagenolytic proteases are important because of their essential role in global collagen degradation and because of their virulence in some human bacterial infections. Bacterial collagenolytic proteases include some metalloproteases of the M9 family from Clostridium or Vibrio strains, some serine proteases distributed in the S1, S8, and S53 families, and members of the U32 family. In recent years, there has been remarkable progress in discovering new bacterial collagenolytic proteases and in investigating the collagen-degrading mechanisms of bacterial collagenolytic proteases. This review provides comprehensive insight into bacterial collagenolytic proteases, especially focusing on the structures and collagen-degrading mechanisms of representative bacterial collagenolytic proteases in each family. The roles of bacterial collagenolytic proteases in human diseases and global nitrogen cycling, together with the biotechnological and medical applications for these proteases, are also briefly discussed. PMID:26150451

  3. A Multifunctional Protease Inhibitor To Regulate Endolysosomal Function

    PubMed Central

    2011-01-01

    Proteases constitute a major class of drug targets. Endosomal compartments harbor several protease families whose attenuation may be beneficial to a number of biological processes, including inflammation, cancer metastasis, antigen presentation, and parasite clearance. As a step toward the goal of generalized but targeted protease inhibition in the endocytic pathway, we describe here the synthesis, characterization, and cellular application of a novel multifunctional protease inhibitor. We show that pepstatin A, a potent but virtually insoluble inhibitor of cathepsins D and E, can be conjugated to a single site on cystatin C, a potent inhibitor of the papain-like cysteine proteases (PLCP) and of asparagine endopeptidease (AEP), to create a highly soluble compound capable of suppressing the activity of all 3 principal protease families found in endosomes and lysosomes. We demonstrate that this cystatin–pepstatin inhibitor (CPI) can be taken up by cells to modulate protease activity and affect biological responses. PMID:21910425

  4. CtpB Assembles a Gated Protease Tunnel Regulating Cell-Cell Signaling during Spore Formation in Bacillus subtilis

    PubMed Central

    Mastny, Markus; Heuck, Alexander; Kurzbauer, Robert; Heiduk, Anja; Boisguerin, Prisca; Volkmer, Rudolf; Ehrmann, Michael; Rodrigues, Christopher D.A.; Rudner, David Z.; Clausen, Tim

    2013-01-01

    Summary Spore formation in Bacillus subtilis relies on a regulated intramembrane proteolysis (RIP) pathway that synchronizes mother-cell and forespore development. To address the molecular basis of this SpoIV transmembrane signaling, we carried out a structure-function analysis of the activating protease CtpB. Crystal structures reflecting distinct functional states show that CtpB constitutes a ring-like protein scaffold penetrated by two narrow tunnels. Access to the proteolytic sites sequestered within these tunnels is controlled by PDZ domains that rearrange upon substrate binding. Accordingly, CtpB resembles a minimal version of a self-compartmentalizing protease regulated by a unique allosteric mechanism. Moreover, biochemical analysis of the PDZ-gated channel combined with sporulation assays reveal that activation of the SpoIV RIP pathway is induced by the concerted activity of CtpB and a second signaling protease, SpoIVB. This proteolytic mechanism is of broad relevance for cell-cell communication, illustrating how distinct signaling pathways can be integrated into a single RIP module. PMID:24243021

  5. CtpB assembles a gated protease tunnel regulating cell-cell signaling during spore formation in Bacillus subtilis.

    PubMed

    Mastny, Markus; Heuck, Alexander; Kurzbauer, Robert; Heiduk, Anja; Boisguerin, Prisca; Volkmer, Rudolf; Ehrmann, Michael; Rodrigues, Christopher D A; Rudner, David Z; Clausen, Tim

    2013-10-24

    Spore formation in Bacillus subtilis relies on a regulated intramembrane proteolysis (RIP) pathway that synchronizes mother-cell and forespore development. To address the molecular basis of this SpoIV transmembrane signaling, we carried out a structure-function analysis of the activating protease CtpB. Crystal structures reflecting distinct functional states show that CtpB constitutes a ring-like protein scaffold penetrated by two narrow tunnels. Access to the proteolytic sites sequestered within these tunnels is controlled by PDZ domains that rearrange upon substrate binding. Accordingly, CtpB resembles a minimal version of a self-compartmentalizing protease regulated by a unique allosteric mechanism. Moreover, biochemical analysis of the PDZ-gated channel combined with sporulation assays reveal that activation of the SpoIV RIP pathway is induced by the concerted activity of CtpB and a second signaling protease, SpoIVB. This proteolytic mechanism is of broad relevance for cell-cell communication, illustrating how distinct signaling pathways can be integrated into a single RIP module.

  6. A family of serine proteases of Clavibacter michiganensis subsp. michiganensis: chpC plays a role in colonization of the host plant tomato.

    PubMed

    Stork, Ines; Gartemann, Karl-Heinz; Burger, Annette; Eichenlaub, Rudolf

    2008-09-01

    Genes for seven putative serine proteases (ChpA-ChpG) belonging to the trypsin subfamily and homologous to the virulence factor pat-1 were identified on the chromosome of Clavibacter michiganensis subsp. michiganensis (Cmm) NCPPB382. All proteases have signal peptides indicating export of these proteins. Their putative function is suggested by two motifs and an aspartate residue typical for serine proteases. Furthermore, six cysteine residues are located at conserved positions. The genes are clustered in a chromosomal region of about 50 kb with a significantly lower G + C content than common for Cmm. The genes chpA, chpB and chpD are pseudogenes as they contain frame shifts and/or in-frame stop codons. The genes chpC and chpG were inactivated by the insertion of an antibiotic resistance cassette. The chpG mutant was not impaired in virulence. However, in planta the titre of the chpC mutant was drastically reduced and only weak disease symptoms were observed. Complementation of the chpC mutant by the wild-type allele restored full virulence. ChpC is the first chromosomal gene of Cmm identified so far that affects the interaction of the pathogen with the host plant.

  7. Investigations with Protease.

    ERIC Educational Resources Information Center

    Yip, Din Yan

    1997-01-01

    Presents two simple and reliable ways for measuring protease activity that can be used for a variety of investigations in a range of biology class levels. The investigations use protease from a variety of sources. (DDR)

  8. Secreted fungal aspartic proteases: A review.

    PubMed

    Mandujano-González, Virginia; Villa-Tanaca, Lourdes; Anducho-Reyes, Miguel Angel; Mercado-Flores, Yuridia

    2016-01-01

    The aspartic proteases, also called aspartyl and aspartate proteases or acid proteases (E.C.3.4.23), belong to the endopeptidase family and are characterized by the conserved sequence Asp-Gly-Thr at the active site. These enzymes are found in a wide variety of microorganisms in which they perform important functions related to nutrition and pathogenesis. In addition, their high activity and stability at acid pH make them attractive for industrial application in the food industry; specifically, they are used as milk-coagulating agents in cheese production or serve to improve the taste of some foods. This review presents an analysis of the characteristics and properties of secreted microbial aspartic proteases and their potential for commercial application.

  9. Proteases as therapeutics

    PubMed Central

    Craik, Charles S.; Page, Michael J.; Madison, Edwin L.

    2015-01-01

    Proteases are an expanding class of drugs that hold great promise. The U.S. FDA (Food and Drug Administration) has approved 12 protease therapies, and a number of next generation or completely new proteases are in clinical development. Although they are a well-recognized class of targets for inhibitors, proteases themselves have not typically been considered as a drug class despite their application in the clinic over the last several decades; initially as plasma fractions and later as purified products. Although the predominant use of proteases has been in treating cardiovascular disease, they are also emerging as useful agents in the treatment of sepsis, digestive disorders, inflammation, cystic fibrosis, retinal disorders, psoriasis and other diseases. In the present review, we outline the history of proteases as therapeutics, provide an overview of their current clinical application, and describe several approaches to improve and expand their clinical application. Undoubtedly, our ability to harness proteolysis for disease treatment will increase with our understanding of protease biology and the molecular mechanisms responsible. New technologies for rationally engineering proteases, as well as improved delivery options, will expand greatly the potential applications of these enzymes. The recognition that proteases are, in fact, an established class of safe and efficacious drugs will stimulate investigation of additional therapeutic applications for these enzymes. Proteases therefore have a bright future as a distinct therapeutic class with diverse clinical applications. PMID:21406063

  10. Characterization of EspC, a 110-kilodalton protein secreted by enteropathogenic Escherichia coli which is homologous to members of the immunoglobulin A protease-like family of secreted proteins.

    PubMed Central

    Stein, M; Kenny, B; Stein, M A; Finlay, B B

    1996-01-01

    Enteropathogenic Escherichia coli (EPEC) secretes at least five proteins. Two of these proteins, EspA and EspB (previously called EaeB), activate signal transduction pathways in host epithelial cells. While the role of the other three proteins (39, 40, and 110 kDa) remains undetermined, secretion of all five proteins is under the control of perA, a known positive regulator of several EPEC virulence factors. On the basis of amino-terminal protein sequence data, we cloned and sequenced the gene which encodes the 110-kDa secreted protein and examined its possible role in EPEC signaling and interaction with epithelial cells. In accordance with the terminology used for espA and espB, we called this gene espC, for EPEC-secreted protein C. We found significant homology between the predicted EspC protein sequence and a family of immunoglobulin A (IgA) protease-like proteins which are widespread among pathogenic bacteria. Members of this protein family are found in avian pathogenic Escherichia coli (Tsh), Haemophilus influenzae (Hap), and Shigella flexneri (SepA). Although these proteins and EspC do not encode IgA protease activity, they have considerable homology with IgA protease from Neisseria gonorrhoeae and H. influenzae and appear to use a export system for secretion. We found that genes homologous to espC also exist in other pathogenic bacteria which cause attaching and effacing lesions, including Hafnia alvei biotype 19982, Citrobacter freundii biotype 4280, and rabbit diarrheagenic E. coli (RDEC-1). Although these strains secrete various proteins similar in molecular size to the proteins secreted by EPEC, we did not detect secretion of a 110-kDa protein by these strains. To examine the possible role of EspC in EPEC interactions with epithelial cells, we constructed a deletion mutant in espC by allelic exchange and characterized the mutant by standard tissue culture assays. We found that EspC is not necessary for mediating EPEC-induced signal transduction in He

  11. Protease inhibitor from Moringa oleifera with potential for use as therapeutic drug and as seafood preservative

    PubMed Central

    Bijina, B.; Chellappan, Sreeja; Krishna, Jissa G.; Basheer, Soorej M.; Elyas, K.K.; Bahkali, Ali H.; Chandrasekaran, M.

    2011-01-01

    Protease inhibitors are well known to have several applications in medicine and biotechnology. Several plant sources are known to return potential protease inhibitors. In this study plants belonging to different families of Leguminosae, Malvaceae, Rutaceae, Graminae and Moringaceae were screened for the protease inhibitor. Among them Moringa oleifera, belonging to the family Moringaceae, recorded high level of protease inhibitor activity after ammonium sulfate fractionation. M. oleifera, which grows throughout most of the tropics and having several industrial and medicinal uses, was selected as a source of protease inhibitor since so far no reports were made on isolation of the protease inhibitor. Among the different parts of M. oleifera tested, the crude extract isolated from the mature leaves and seeds showed the highest level of inhibition against trypsin. Among the various extraction media evaluated, the crude extract prepared in phosphate buffer showed maximum recovery of the protease inhibitor. The protease inhibitor recorded high inhibitory activity toward the serine proteases thrombin, elastase, chymotrypsin and the cysteine proteases cathepsin B and papain which have more importance in pharmaceutical industry. The protease inhibitor also showed complete inhibition of activities of the commercially available proteases of Bacillus licheniformis and Aspergillus oryzae. However, inhibitory activities toward subtilisin, esperase, pronase E and proteinase K were negligible. Further, it was found that the protease inhibitor could prevent proteolysis in a commercially valuable shrimp Penaeus monodon during storage indicating the scope for its application as a seafood preservative. This is the first report on isolation of a protease inhibitor from M. oleifera. PMID:23961135

  12. Detergent alkaline proteases: enzymatic properties, genes, and crystal structures.

    PubMed

    Saeki, Katsuhisa; Ozaki, Katsuya; Kobayashi, Tohru; Ito, Susumu

    2007-06-01

    Subtilisin-like serine proteases from bacilli have been used in various industrial fields worldwide, particularly in the production of laundry and automatic dishwashing detergents. They belong to family A of the subtilase superfamily, which is composed of three clans, namely, true subtilisins, high-alkaline proteases, and intracellular proteases. We succeeded in the large-scale production of a high-alkaline protease (M-protease) from alkaliphilic Bacillus clausii KSM-K16, and the enzyme has been introduced into compact heavy-duty laundry detergents. We have also succeeded in the industrial-scale production of a new alkaline protease, KP-43, which was originally resistant to chemical oxidants and to surfactants, produced by alkaliphilic Bacillus sp. strain KSM-KP43 and have incorporated it into laundry detergents. KP-43 and related proteases form a new clan, oxidatively stable proteases, in subtilase family A. In this review, we describe the enzymatic properties, gene sequences, and crystal structures of M-protease, KP-43, and related enzymes.

  13. Serine proteases inhibiting cyanopeptides.

    PubMed

    Radau, G

    2000-08-01

    There are many compounds inhibiting serine proteases which play an important role in the human organism. This article reviews publications on the low-molecular weight, serine protease inhibitory cyanopeptides and reports on new developments in establishing structure-activity relationships.

  14. Bacterial proteases, untapped antimicrobial drug targets.

    PubMed

    Culp, Elizabeth; Wright, Gerard D

    2017-04-01

    Bacterial proteases are an extensive collection of enzymes that have vital roles in cell viability, stress response and pathogenicity. Although their perturbation clearly offers the potential for antimicrobial drug development, both as traditional antibiotics and anti-virulence drugs, they are not yet the target of any clinically used therapeutics. Here we describe the potential for and recent progress in the development of compounds targeting bacterial proteases with a focus on AAA+ family proteolytic complexes and signal peptidases (SPs). Caseinolytic protease (ClpP) belongs to the AAA+ family of proteases, a group of multimeric barrel-shaped complexes whose activity is tightly regulated by associated AAA+ ATPases. The opportunity for chemical perturbation of these complexes is demonstrated by compounds targeting ClpP for inhibition, activation or perturbation of its associated ATPase. Meanwhile, SPs are also a proven antibiotic target. Responsible for the cleavage of targeting peptides during protein secretion, both type I and type II SPs have been successfully targeted by chemical inhibitors. As the threat of pan-antibiotic resistance continues to grow, these and other bacterial proteases offer an arsenal of novel antibiotic targets ripe for development.

  15. Structural determinants of tobacco vein mottling virus protease substrate specificity.

    PubMed

    Sun, Ping; Austin, Brian P; Tözsér, József; Waugh, David S

    2010-11-01

    Tobacco vein mottling virus (TVMV) is a member of the Potyviridae, one of the largest families of plant viruses. The TVMV genome is translated into a single large polyprotein that is subsequently processed by three virally encoded proteases. Seven of the nine cleavage events are carried out by the NIa protease. Its homolog from the tobacco etch virus (TEV) is a widely used reagent for the removal of affinity tags from recombinant proteins. Although TVMV protease is a close relative of TEV protease, they exhibit distinct sequence specificities. We report here the crystal structure of a catalytically inactive mutant TVMV protease (K65A/K67A/C151A) in complex with a canonical peptide substrate (Ac-RETVRFQSD) at 1.7-Å resolution. As observed in several crystal structures of TEV protease, the C-terminus (∼20 residues) of TVMV protease is disordered. Unexpectedly, although deleting the disordered residues from TEV protease reduces its catalytic activity by ∼10-fold, an analogous truncation mutant of TVMV protease is significantly more active. Comparison of the structures of TEV and TVMV protease in complex with their respective canonical substrate peptides reveals that the S3 and S4 pockets are mainly responsible for the differing substrate specificities. The structure of TVMV protease suggests that it is less tolerant of variation at the P1' position than TEV protease. This conjecture was confirmed experimentally by determining kinetic parameters k(cat) and K(m) for a series of oligopeptide substrates. Also, as predicted by the cocrystal structure, we confirm that substitutions in the P6 position are more readily tolerated by TVMV than TEV protease.

  16. Structural determinants of tobacco vein mottling virus protease substrate specificity

    SciTech Connect

    Sun, Ping; Austin, Brian P.; Tozer, Jozsef; Waugh, David

    2010-10-28

    Tobacco vein mottling virus (TVMV) is a member of the Potyviridae, one of the largest families of plant viruses. The TVMV genome is translated into a single large polyprotein that is subsequently processed by three virally encoded proteases. Seven of the nine cleavage events are carried out by the NIa protease. Its homolog from the tobacco etch virus (TEV) is a widely used reagent for the removal of affinity tags from recombinant proteins. Although TVMV protease is a close relative of TEV protease, they exhibit distinct sequence specificities. We report here the crystal structure of a catalytically inactive mutant TVMV protease (K65A/K67A/C151A) in complex with a canonical peptide substrate (Ac-RETVRFQSD) at 1.7-{angstrom} resolution. As observed in several crystal structures of TEV protease, the C-terminus ({approx}20 residues) of TVMV protease is disordered. Unexpectedly, although deleting the disordered residues from TEV protease reduces its catalytic activity by {approx}10-fold, an analogous truncation mutant of TVMV protease is significantly more active. Comparison of the structures of TEV and TVMV protease in complex with their respective canonical substrate peptides reveals that the S3 and S4 pockets are mainly responsible for the differing substrate specificities. The structure of TVMV protease suggests that it is less tolerant of variation at the P1{prime} position than TEV protease. This conjecture was confirmed experimentally by determining kinetic parameters k{sub cat} and K{sub m} for a series of oligopeptide substrates. Also, as predicted by the cocrystal structure, we confirm that substitutions in the P6 position are more readily tolerated by TVMV than TEV protease.

  17. Bacterial proteases and virulence.

    PubMed

    Frees, Dorte; Brøndsted, Lone; Ingmer, Hanne

    2013-01-01

    Bacterial pathogens rely on proteolysis for variety of purposes during the infection process. In the cytosol, the main proteolytic players are the conserved Clp and Lon proteases that directly contribute to virulence through the timely degradation of virulence regulators and indirectly by providing tolerance to adverse conditions such as those experienced in the host. In the membrane, HtrA performs similar functions whereas the extracellular proteases, in close contact with host components, pave the way for spreading infections by degrading host matrix components or interfering with host cell signalling to short-circuit host cell processes. Common to both intra- and extracellular proteases is the tight control of their proteolytic activities. In general, substrate recognition by the intracellular proteases is highly selective which is, in part, attributed to the chaperone activity associated with the proteases either encoded within the same polypeptide or on separate subunits. In contrast, substrate recognition by extracellular proteases is less selective and therefore these enzymes are generally expressed as zymogens to prevent premature proteolytic activity that would be detrimental to the cell. These extracellular proteases are activated in complex cascades involving auto-processing and proteolytic maturation. Thus, proteolysis has been adopted by bacterial pathogens at multiple levels to ensure the success of the pathogen in contact with the human host.

  18. The Two-step Biosynthesis of Cyclic Peptides from Linear Precursors in a Member of the Plant Family Caryophyllaceae Involves Cyclization by a Serine Protease-like Enzyme*

    PubMed Central

    Barber, Carla J. S.; Pujara, Pareshkumar T.; Reed, Darwin W.; Chiwocha, Shiela; Zhang, Haixia; Covello, Patrick S.

    2013-01-01

    Caryophyllaceae-type cyclic peptides (CPs) of 5–12 proteinogenic amino acids occur in 10 plant families. In Saponaria vaccaria (Caryophyllaceae), they have been shown to be formed from linear peptide precursors derived from ribosomal translation. There is also evidence for such precursors in other members of the Caryophyllaceae, Rutaceae, and Linaceae families. The biosynthesis of CP in the developing seeds of S. vaccaria was investigated with respect to the enzymes involved in precursor processing. Through biochemical assays with seed extracts and synthetic peptides, an enzyme named oligopeptidase 1 (OLP1) was found that catalyzes the cleavage of intermediates at the N terminus of the incipient CP. A second enzyme, peptide cyclase 1 (PCY1), which was separated chromatographically from OLP1, was found to act on the product of OLP1, giving rise to a cyclic peptide and concomitant removal of a C-terminal flanking sequence. PCY1 was partially purified, and using the methods of proteomics, a full-length cDNA clone encoding an enzyme matching the properties of PCY1 was obtained. The substrate specificity of purified recombinant PCY1, believed to be the first cloned plant enzyme whose function is peptide cyclization, was tested with synthetic peptides. The results are discussed in the light of CP biosynthetic systems of other organisms. PMID:23486480

  19. Characterization of the interleukin-1beta-converting enzyme/ced-3-family protease, caspase-3/CPP32, in Hodgkin's disease: lack of caspase-3 expression in nodular lymphocyte predominance Hodgkin's disease.

    PubMed

    Izban, K F; Wrone-Smith, T; Hsi, E D; Schnitzer, B; Quevedo, M E; Alkan, S

    1999-05-01

    Apoptosis (programmed cell death) serves an important role in the normal morphogenesis, immunoregulation, and homeostatic mechanisms in both normal and neoplastic cells. Caspase-3/CPP32, a member of the ICE/Ced-3-family of cysteine proteases, is an important downstream mediator of several complex proteolytic cascades that result in apoptosis in both hematopoietic and nonhematopoietic cells. Previous studies have demonstrated that caspase-3 is commonly expressed in classical Hodgkin's disease (CHD); however, the biological significance of its expression in Hodgkin's disease is unknown. In this report, the expression of caspase-3 in nodular lymphocyte predominance Hodgkin's disease (NLPHD) was evaluated by immunohistochemistry; in addition, we investigated the role of caspase-3 in CD95 (Fas)-mediated apoptosis in three CHD cell lines. Formalin-fixed, paraffin-embedded tissue sections from 11 cases of NLPHD were immunostained for caspase-3 using a polyclonal rabbit antibody that detects both the 32-kd zymogen and the 20-kd active subunit of the caspase-3 protease. Only 1/11 cases of NLPHD demonstrated caspase-3 immunopositivity in lymphocytic/histiocytic cells. Caspase-3 expression was also evaluated in three CHD cell lines, HS445, L428, and KMH2. Whereas caspase-3 expression was detected in HS445 and L428 cell lines, no expression was found in KMH2 cells by immunohistochemical staining. Treatment of HS445 and L428 cell lines for 72 hours with agonistic CD95 monoclonal antibody induced marked apoptosis that was significantly inhibited by pretreatment with the caspase-3 inhibitor, DEVD-FMK, as determined by terminal deoxynucleotidyl transferase-mediated dUTP nick end-labeling assay and flow cytometric analysis of 7-amino-actinomycin D staining. In addition, a significant increase in caspase-3 activity as determined by an enzyme colorimetric assay was detected in HS445 and L428 cells after 48 hours of CD95 stimulation. In marked contrast, treatment of caspase-3

  20. Functional Implications of Domain Organization Within Prokaryotic Rhomboid Proteases.

    PubMed

    Panigrahi, Rashmi; Lemieux, M Joanne

    2015-01-01

    Intramembrane proteases are membrane embedded enzymes that cleave transmembrane substrates. This interesting class of enzyme and its water mediated substrate cleavage mechanism occurring within the hydrophobic lipid bilayer has drawn the attention of researchers. Rhomboids are a family of ubiquitous serine intramembrane proteases. Bacterial forms of rhomboid proteases are mainly composed of six transmembrane helices that are preceded by a soluble N-terminal domain. Several crystal structures of the membrane domain of the E. coli rhomboid protease ecGlpG have been solved. Independently, the ecGlpG N-terminal cytoplasmic domain structure was solved using both NMR and protein crystallography. Despite these structures, we still do not know the structure of the full-length protein, nor do we know the functional role of these domains in the cell. This chapter will review the structural and functional roles of the different domains associated with prokaryotic rhomboid proteases. Lastly, we will address questions remaining in the field.

  1. [Chloroplast Deg proteases].

    PubMed

    Grabsztunowicz, Magda; Luciński, Robert; Baranek, Małgorzata; Sikora, Bogna; Jackowski, Grzegorz

    2011-01-01

    For some chloroplast proteases ATP binding and hydrolysis is not necessary for their catalytic activity, most probably because even strongly unfolded substrates may penetrate their catalytic chamber. Deg1, 2, 5 and 8 are the best known of Arabidopsis thaliana ATP- independent chloroplast proteases, encoded by orthologues of genes coding for DegP, DegQ and DegS proteases of Escherichia coli. Current awareness in the area of structure and functions of chloroplast Degs is much more limited vs the one about their bacterial counterparts. Deg5 and Deg8 form a catalytic heterododecamer which is loosely attached to luminal side of thylakoid membrane. The complex catalyses--supported by Deg1 and one of FtsH proteases--the degradation of PsbA damaged due to plant exposition to elevated irradiance and thus these protease are of key importance for the plants' sensitivity to photoinhibition. Deg2 role in the disposal of damaged PsbA has not been elucidated. Recombinant Deg1 may degrade PsbO and plastocyanin in vitro but it is not clear whether this reaction is performed in vivo as well.

  2. The site-2 protease.

    PubMed

    Rawson, Robert B

    2013-12-01

    The site-2 protease (S2P) is an unusually-hydrophobic integral membrane protease. It cleaves its substrates, which are membrane-bound transcription factors, within membrane-spanning helices. Although structural information for S2P from animals is lacking, the available data suggest that cleavage may occur at or within the lipid bilayer. In mammalian cells, S2P is essential owing to its activation of the sterol regulatory element binding proteins (SREBPs); in the absence of exogenous lipid, cells lacking S2P cannot survive. S2P is also important in the endoplasmic reticulum (ER) stress response, activating several different membrane-bound transcription factors. Human patients harboring reduction-of-function mutations in S2P exhibit an array of pathologies ranging from skin defects to neurological abnormalities. Surprisingly, Drosophila melanogaster lacking S2P are viable and fertile. This article is part of a Special Issue entitled: Intramembrane Proteases.

  3. Purification, characterization and identification of a senescence related serine protease in dark-induced senescent wheat leaves.

    PubMed

    Wang, Renxian; Liu, Shaowei; Wang, Jin; Dong, Qiang; Xu, Langlai; Rui, Qi

    2013-11-01

    Senescence-related proteases play important roles in leaf senescence by regulating protein degradation and nutrient recycling. A 98.9kDa senescence-related protease EP3 in wheat leaves was purified by ammonium sulfate precipitation, Q-Sepharose fast flow anion exchange chromatography and gel slicing after gel electrophoresis. Due to its relatively high thermal stability, its protease activity did not decrease after incubation at 40°C for 1-h. EP3 protease was suggested to be a metal-dependent serine protease, because its activity was inhibited by serine protease inhibitors PMSF and AEBSF and metal related protease inhibitor EGTA. It was identified as a subtilisin-like serine protease of the S8A family based on data from both mass spectrometry and the cloned cDNA sequence. Therefore, these data suggest that a serine protease of the S8A subfamily with specific biochemical properties is involved in senescence-associated protein degradation.

  4. The Crystal Structure of GXGD Membrane Protease FlaK

    SciTech Connect

    J Hu; Y Xue; S Lee; Y Ha

    2011-12-31

    The GXGD proteases are polytopic membrane proteins with catalytic activities against membrane-spanning substrates that require a pair of aspartyl residues. Representative members of the family include preflagellin peptidase, type 4 prepilin peptidase, presenilin and signal peptide peptidase. Many GXGD proteases are important in medicine. For example, type 4 prepilin peptidase may contribute to bacterial pathogenesis, and mutations in presenilin are associated with Alzheimer's disease. As yet, there is no atomic-resolution structure in this protease family. Here we report the crystal structure of FlaK, a preflagellin peptidase from Methanococcus maripaludis, solved at 3.6 {angstrom} resolution. The structure contains six transmembrane helices. The GXGD motif and a short transmembrane helix, helix 4, are positioned at the centre, surrounded by other transmembrane helices. The crystal structure indicates that the protease must undergo conformational changes to bring the GXGD motif and a second essential aspartyl residue from transmembrane helix 1 into close proximity for catalysis. A comparison of the crystal structure with models of presenilin derived from biochemical analysis reveals three common transmembrane segments that are similarly arranged around the active site. This observation reinforces the idea that the prokaryotic and human proteases are evolutionarily related. The crystal structure presented here provides a framework for understanding the mechanism of the GXGD proteases, and may facilitate the rational design of inhibitors that target specific members of the family.

  5. The crystal structure of GXGD membrane protease FlaK

    SciTech Connect

    Hu, Jian; Xue, Yi; Lee, Sangwon; Ha, Ya

    2011-09-20

    The GXGD proteases are polytopic membrane proteins with catalytic activities against membrane-spanning substrates that require a pair of aspartyl residues. Representative members of the family include preflagellin peptidase, type 4 prepilin peptidase, presenilin and signal peptide peptidase. Many GXGD proteases are important in medicine. For example, type 4 prepilin peptidase may contribute to bacterial pathogenesis, and mutations in presenilin are associated with Alzheimer's disease. As yet, there is no atomic-resolution structure in this protease family. Here we report the crystal structure of FlaK, a preflagellin peptidase from Methanococcus maripaludis, solved at 3.6 {angstrom} resolution. The structure contains six transmembrane helices. The GXGD motif and a short transmembrane helix, helix 4, are positioned at the centre, surrounded by other transmembrane helices. The crystal structure indicates that the protease must undergo conformational changes to bring the GXGD motif and a second essential aspartyl residue from transmembrane helix 1 into close proximity for catalysis. A comparison of the crystal structure with models of presenilin derived from biochemical analysis reveals three common transmembrane segments that are similarly arranged around the active site. This observation reinforces the idea that the prokaryotic and human proteases are evolutionarily related. The crystal structure presented here provides a framework for understanding the mechanism of the GXGD proteases, and may facilitate the rational design of inhibitors that target specific members of the family.

  6. A primitive enzyme for a primitive cell: the protease required for excystation of Giardia.

    PubMed

    Ward, W; Alvarado, L; Rawlings, N D; Engel, J C; Franklin, C; McKerrow, J H

    1997-05-02

    Protozoan parasites of the genus Giardia are one of the earliest lineages of eukaryotic cells. To initiate infection, trophozoites emerge from a cyst in the host. Excystation is blocked by specific cysteine protease inhibitors. Using a biotinylated inhibitor, the target protease was identified and its corresponding gene cloned. The protease was localized to vesicles that release their contents just prior to excystation. The Giardia protease is the earliest known branch of the cathepsin B family. Its phylogeny confirms that the cathepsin B lineage evolved in primitive eukaryotic cells, prior to the divergence of plant and animal kingdoms, and underscores the diversity of cellular functions that this enzyme family facilitates.

  7. A New Subtilase-Like Protease Deriving from Fusarium equiseti with High Potential for Industrial Applications.

    PubMed

    Juntunen, Kari; Mäkinen, Susanna; Isoniemi, Sari; Valtakari, Leena; Pelzer, Alexander; Jänis, Janne; Paloheimo, Marja

    2015-09-01

    A gene encoding a novel extracellular subtilisin-like protease was cloned from the ascomycete Fusarium equiseti and expressed in Trichoderma reesei. The F. equiseti protease (Fe protease) showed excellent performance in stain removal and good compatibility with several commercial laundry detergent formulations, suggesting that it has high potential for use in various industrial applications. The recombinant enzyme was purified and characterized. The temperature optimum of the Fe protease was 60 °C and it showed high activity in the pH range of 6-10, with a sharp decline in activity at pH above 10. The amino acid specificity of the Fe protease was studied using casein, cytochrome c, and ubiquitin as substrates. The Fe protease had broad substrate specificity: almost all amino acid residues were accepted at position P1, even though it showed some preference for cleavage at the C-terminal side of asparagine and histidine residues. The S4 subsite of Fe protease favors aspartic acid and threonine. The other well-characterized proteases from filamentous fungi, Proteinase K from Engyodontium album, Thermomycolin from Malbranchea sulfurea, and alkaline subtilisins from Bacillus species prefer hydrophobic amino acids in both the S1 and S4 subsites. Due to its different specificity compared to the members of the S8 family of clan SB of proteases, we consider that the Fe protease is a new protease. It does not belong to any previously defined IUBMB groups of proteases.

  8. Proteases in bacterial pathogenesis.

    PubMed

    Ingmer, Hanne; Brøndsted, Lone

    2009-11-01

    Bacterial pathogens rely on proteolysis for protein quality control under adverse conditions experienced in the host, as well as for the timely degradation of central virulence regulators. We have focused on the contribution of the conserved Lon, Clp, HtrA and FtsH proteases to pathogenesis and have highlighted common biological processes for which their activities are important for virulence.

  9. Laundry performance of subtilisin proteases.

    PubMed

    Wolff, A M; Showell, M S; Venegas, M G; Barnett, B L; Wertz, W C

    1996-01-01

    Effective laundry protease performance against susceptible stains depends upon both the enzyme itself and the environment in which it must work. In order to technically design superior laundry proteases, a model for protease's mechanism of action in detergents was developed which has been substantiated through-the-wash. While evaluation of this model and/or a given protease's effectiveness could be judged by a variety of methods, the utility of using visual wash performance comparisons, analytical, and stain characterization studies is described. Finally, data comparing the performance of wild type Subtilisin proteases with mutants designed via the projected model are given, demonstrating possible utility of the system.

  10. Rabbit endogenous retrovirus-H encodes a functional protease.

    PubMed

    Voisset, Cécile; Myers, Richard E; Carne, Alex; Kellam, Paul; Griffiths, David J

    2003-01-01

    Recent studies have revealed that 'human retrovirus-5' sequences found in human samples belong to a rabbit endogenous retrovirus family named RERV-H. A part of the gag-pro region of the RERV-H genome was amplified by PCR from DNA in human samples and several forms of RERV-H protease were expressed in bacteria. The RERV-H protease was able to cleave itself from a precursor protein and was also able to cleave the RERV-H Gag polyprotein precursor in vitro whereas a form of the protease with a mutation engineered into the active site was inactive. Potential N- and C-terminal autocleavage sites were characterized. The RERV-H protease was sensitive to pepstatin A, showing it to be an aspartic protease. Moreover, it was strongly inhibited by PYVPheStaAMT, a pseudopeptide inhibitor specific for Mason-Pfizer monkey virus and avian myeloblastosis-associated virus. A structural model of the RERV-H protease was constructed that, together with the activity data, confirms that this is a retroviral aspartic protease.

  11. From proteases to proteomics.

    PubMed

    Neurath, H

    2001-04-01

    This personal and professional autobiography covers the 50-yr period of 1950-2000 and includes the following topics: History of the University of Washington School of Medicine and its Department of Biochemistry (Mount Rainier and the University of Washington, recruiting faculty, biology, research programs); scientific editing (publication, Biochemistry, Protein Science, electronic publication); Europe revisited (Heidelberg, approaching retirement, the German Research Center, reunion in Vienna); and 50 yr of research on proteolytic enzymes (trypsin, carboxypeptidases, mast cell proteases, future developments).

  12. From proteases to proteomics

    PubMed Central

    Neurath, Hans

    2001-01-01

    This personal and professional autobiography covers the 50-yr period of 1950–2000 and includes the following topics: History of the University of Washington School of Medicine and its Department of Biochemistry (Mount Rainier and the University of Washington, recruiting faculty, biology, research programs); scientific editing (publication, Biochemistry, Protein Science, electronic publication); Europe revisited (Heidelberg, approaching retirement, the German Research Center, reunion in Vienna); and 50 yr of research on proteolytic enzymes (trypsin, carboxypeptidases, mast cell proteases, future developments). PMID:11274481

  13. Proteases in blood clotting.

    PubMed

    Walsh, Peter N; Ahmad, Syed S

    2002-01-01

    The serine proteases, cofactors and cell-receptor molecules that comprise the haemostatic mechanism are highly conserved modular proteins that have evolved to participate in biochemical reactions in blood coagulation, anticoagulation and fibrinolysis. Blood coagulation is initiated by exposure of tissue factor, which forms a complex with factor VIIa and factor X, which results in the generation of small quantities of thrombin and is rapidly shutdown by the tissue factor pathway inhibitor. The generation of these small quantities of thrombin then activates factor XI, resulting in a sequence of events that lead to the activation of factor IX, factor X and prothrombin. Sufficient thrombin is generated to effect normal haemostasis by converting fibrinogen into fibrin. The anticoagulant pathways that regulate blood coagulation include the protein C anticoagulant mechanism, the serine protease inhibitors in plasma, and the Kunitz-like inhibitors, tissue factor pathway inhibitor and protease nexin 2. Finally, the fibrinolytic mechanism that comprises the activation of plasminogen into plasmin prevents excessive fibrin accumulation by promoting local dissolution of thrombi and promoting wound healing by reestablishment of blood flow.

  14. Cloning, expression and activity analysis of a novel fibrinolytic serine protease from Arenicola cristata

    NASA Astrophysics Data System (ADS)

    Zhao, Chunling; Ju, Jiyu

    2015-06-01

    The full-length cDNA of a protease gene from a marine annelid Arenicola cristata was amplified through rapid amplification of cDNA ends technique and sequenced. The size of the cDNA was 936 bp in length, including an open reading frame encoding a polypeptide of 270 amino acid residues. The deduced amino acid sequnce consisted of pro- and mature sequences. The protease belonged to the serine protease family because it contained the highly conserved sequence GDSGGP. This protease was novel as it showed a low amino acid sequence similarity (< 40%) to other serine proteases. The gene encoding the active form of A. cristata serine protease was cloned and expressed in E. coli. Purified recombinant protease in a supernatant could dissolve an artificial fibrin plate with plasminogen-rich fibrin, whereas the plasminogen-free fibrin showed no clear zone caused by hydrolysis. This result suggested that the recombinant protease showed an indirect fibrinolytic activity of dissolving fibrin, and was probably a plasminogen activator. A rat model with venous thrombosis was established to demonstrate that the recombinant protease could also hydrolyze blood clot in vivo. Therefore, this recombinant protease may be used as a thrombolytic agent for thrombosis treatment. To our knowledge, this study is the first of reporting the fibrinolytic serine protease gene in A. cristata.

  15. Functional interplay between tetraspanins and proteases.

    PubMed

    Yáñez-Mó, María; Gutiérrez-López, Maria Dolores; Cabañas, Carlos

    2011-10-01

    Several recent publications have described examples of physical and functional interations between tetraspanins and specific membrane proteases belonging to the TM-MMP and α-(ADAMs) and γ-secretases families. Collectively, these examples constitute an emerging body of evidence supporting the notion that tetraspanin-enriched microdomains (TEMs) represent functional platforms for the regulation of key cellular processes including the release of surface protein ectodomains ("shedding"), regulated intramembrane proteolysis ("RIPing") and matrix degradation and assembly. These cellular processes in turn play a crucial role in an array of physiological and pathological phenomena. Thus, TEMs may represent new therapeutical targets that may simultaneously affect the proteolytic activity of different enzymes and their substrates. Agonistic or antagonistic antibodies and blocking soluble peptides corresponding to tetraspanin functional regions may offer new opportunities in the treatment of pathologies such as chronic inflammation, cancer, or Alzheimer's disease. In this review article, we will discuss all these aspects of functional regulation of protease activities by tetraspanins.

  16. Serine protease inhibitors suppress pancreatic endogenous proteases and modulate bacterial neutral proteases.

    PubMed

    Nduaguibe, Chikodili C; Bentsi-Barnes, Kwamina; Mullen, Yoko; Kandeel, Fouad; Al-Abdullah, Ismail

    2010-01-01

    Pefabloc, Trasylol and Urinary Trypsin Inhibitor (UTI) have been reported to be effective serine protease inhibitors that impair pancreatic endogenous proteases resulting in improved islet yield. Here we evaluated the effect of these inhibitors on endogenous proteases (trypsin, chymotrypsin and elastase), bacterial neutral proteases (thermolysin and neutral protease) and islet isolation digestion samples. Protease activity was measured using a fluorimetric assay and islet function was assessed by dynamic perifusion. Trypsin, chymotrypsin and elastase were significantly inhibited by Pefabloc and UTI. Trasylol showed strong inhibitory effects on trypsin and chymotrypsin but also decreased thermolysin activity. UTI was found to inhibit the activity of endogenous proteases and increase the activity of bacterial neutral proteases. Human islets exposed to Pefabloc had reduced insulin response, unlike Trasylol or UTI, which had no detrimental effect on insulin secretion. Although Trasylol was an effective inhibitor of endogenous proteases, FDA regulatory issues preclude its use in clinical application and thus in the isolation process. UTI has the greatest potential because it impairs endogenous pancreatic proteases and enhances digestion enzymes.

  17. Protease-mediated drug delivery

    NASA Astrophysics Data System (ADS)

    Dickson, Eva F.; Goyan, Rebecca L.; Kennedy, James C.; Mackay, M.; Mendes, M. A. K.; Pottier, Roy H.

    2003-12-01

    Drugs used in disease treatment can cause damage to both malignant and normal tissue. This toxicity limits the maximum therapeutic dose. Drug targeting is of high interest to increase the therapeutic efficacy of the drug without increasing systemic toxicity. Certain tissue abnormalities, disease processes, cancers, and infections are characterized by high levels of activity of specific extracellular and/or intracellular proteases. Abnormally high activity levels of specific proteases are present at sites of physical or chemical trauma, blood clots, malignant tumors, rheumatoid arthritis, inflammatory bowel disease, gingival disease, glomerulonerphritis, and acute pancreatitis. Abnormal protease activity is suspected in development of liver thrombosis, pulmonary emphysema, atherosclerosis, and muscular dystrophy. Inactiviating disease-associated proteases by the administration of appropriate protease inhibitors has had limited success. Instead, one could use such proteases to target drugs to treat the condition. Protease mediated drug delivery offers such a possibility. Solubilizing groups are attached to insoluble drugs via a polypeptide chain which is specifically cleavable by certian proteases. When the solubilized drug enounters the protease, the solubilizing moieties are cleaved, and the drug precipitates at the disease location. Thus, a smaller systemic dosage could result in a therapeutic drug concentration at the treatment site with less systemic toxicity.

  18. Cysteine Proteases: Modes of Activation and Future Prospects as Pharmacological Targets

    PubMed Central

    Verma, Sonia; Dixit, Rajnikant; Pandey, Kailash C.

    2016-01-01

    Proteolytic enzymes are crucial for a variety of biological processes in organisms ranging from lower (virus, bacteria, and parasite) to the higher organisms (mammals). Proteases cleave proteins into smaller fragments by catalyzing peptide bonds hydrolysis. Proteases are classified according to their catalytic site, and distributed into four major classes: cysteine proteases, serine proteases, aspartic proteases, and metalloproteases. This review will cover only cysteine proteases, papain family enzymes which are involved in multiple functions such as extracellular matrix turnover, antigen presentation, processing events, digestion, immune invasion, hemoglobin hydrolysis, parasite invasion, parasite egress, and processing surface proteins. Therefore, they are promising drug targets for various diseases. For preventing unwanted digestion, cysteine proteases are synthesized as zymogens, and contain a prodomain (regulatory) and a mature domain (catalytic). The prodomain acts as an endogenous inhibitor of the mature enzyme. For activation of the mature enzyme, removal of the prodomain is necessary and achieved by different modes. The pro-mature domain interaction can be categorized as protein–protein interactions (PPIs) and may be targeted in a range of diseases. Cysteine protease inhibitors are available that can block the active site but no such inhibitor available yet that can be targeted to block the pro-mature domain interactions and prevent it activation. This review specifically highlights the modes of activation (processing) of papain family enzymes, which involve auto-activation, trans-activation and also clarifies the future aspects of targeting PPIs to prevent the activation of cysteine proteases. PMID:27199750

  19. Role of rhomboid proteases in bacteria.

    PubMed

    Rather, Philip

    2013-12-01

    The first member of the rhomboid family of intramembrane serine proteases in bacteria was discovered almost 20years ago. It is now known that rhomboid proteins are widely distributed in bacteria, with some bacteria containing multiple rhomboids. At the present time, only a single rhomboid-dependent function in bacteria has been identified, which is the cleavage of TatA in Providencia stuartii. Mutational analysis has shown that loss of the GlpG rhomboid in Escherichia coli alters cefotaxime resistance, loss of the YqgP (GluP) rhomboid in Bacillus subtilis alters cell division and glucose uptake, and loss of the MSMEG_5036 and MSMEG_4904 genes in Mycobacterium smegmatis results in altered colony morphology, biofilm formation and antibiotic susceptibilities. However, the cellular substrates for these proteins have not been identified. In addition, analysis of the rhombosortases, together with their possible Gly-Gly CTERM substrates, may shed new light on the role of these proteases in bacteria. This article is part of a Special Issue entitled: Intramembrane Proteases.

  20. Insights into the Cyanobacterial Deg/HtrA Proteases

    PubMed Central

    Cheregi, Otilia; Wagner, Raik; Funk, Christiane

    2016-01-01

    Proteins are the main machinery for all living processes in a cell; they provide structural elements, regulate biochemical reactions as enzymes, and are the interface to the outside as receptors and transporters. Like any other machinery proteins have to be assembled correctly and need maintenance after damage, e.g., caused by changes in environmental conditions, genetic mutations, and limitations in the availability of cofactors. Proteases and chaperones help in repair, assembly, and folding of damaged and misfolded protein complexes cost-effective, with low energy investment compared with neo-synthesis. Despite their importance for viability, the specific biological role of most proteases in vivo is largely unknown. Deg/HtrA proteases, a family of serine-type ATP-independent proteases, have been shown in higher plants to be involved in the degradation of the Photosystem II reaction center protein D1. The objective of this review is to highlight the structure and function of their cyanobacterial orthologs. Homology modeling was used to find specific features of the SynDeg/HtrA proteases of Synechocystis sp. PCC 6803. Based on the available data concerning their location and their physiological substrates we conclude that these Deg proteases not only have important housekeeping and chaperone functions within the cell, but also are needed for remodeling the cell exterior. PMID:27252714

  1. Pnserpin: A Novel Serine Protease Inhibitor from Extremophile Pyrobaculum neutrophilum

    PubMed Central

    Zhang, Huan; Fei, Rui; Xue, Baigong; Yu, Shanshan; Zhang, Zuoming; Zhong, Sheng; Gao, Yuanqi; Zhou, Xiaoli

    2017-01-01

    Serine protease inhibitors (serpins) are native inhibitors of serine proteases, constituting a large protein family with members spread over eukaryotes and prokaryotes. However, only very few prokaryotic serpins, especially from extremophiles, have been characterized to date. In this study, Pnserpin, a putative serine protease inhibitor from the thermophile Pyrobaculum neutrophilum, was overexpressed in Escherichia coli for purification and characterization. It irreversibly inhibits chymotrypsin-, trypsin-, elastase-, and subtilisin-like proteases in a temperature range from 20 to 100 °C in a concentration-dependent manner. The stoichiometry of inhibition (SI) of Pnserpin for proteases decreases as the temperature increases, indicating that the inhibitory activity of Pnserpin increases with the temperature. SDS-PAGE (sodium dodecyl sulfate polyacrylamide gel electrophoresis) showed that Pnserpin inhibits proteases by forming a SDS-resistant covalent complex. Homology modeling and molecular dynamic simulations predicted that Pnserpin can form a stable common serpin fold. Results of the present work will help in understanding the structural and functional characteristics of thermophilic serpin and will broaden the current knowledge about serpins from extremophiles. PMID:28067849

  2. Protease inhibitors and proteolytic signalling cascades in insects.

    PubMed

    Gubb, David; Sanz-Parra, Arantza; Barcena, Laura; Troxler, Laurent; Fullaondo, Ane

    2010-12-01

    Proteolytic signalling cascades control a wide range of physiological responses. In order to respond rapidly, protease activity must be maintained at a basal level: the component zymogens must be sequentially activated and actively degraded. At the same time, signalling cascades must respond precisely: high target specificity is required. The insects have a wide range of trapping- and tight-binding protease inhibitors, which can regulate the activity of individual proteases. In addition, the interactions between component proteases of a signalling cascade can be modified by serine protease homologues. The suicide-inhibition mechanism of serpin family inhibitors gives rapid turnover of both protease and inhibitor, but target specificity is inherently broad. Similarly, the TEP/macroglobulins have extremely broad target specificity, which suits them for roles as hormone transport proteins and sensors of pathogenic virulence factors. The tight-binding inhibitors, on the other hand, have a lock-and-key mechanism capable of high target specificity. In addition, proteins containing multiple tight-binding inhibitory domains may act as scaffolds for the assembly of signalling complexes. Proteolytic cascades regulated by combinations of different types of inhibitor could combine the rapidity of suicide-inhibitors with the specificity lock-and-key inhibitors. This would allow precise control of physiological responses and may turn out to be a general rule.

  3. Proteomic Substrate Identification for Membrane Proteases in the Brain

    PubMed Central

    Müller, Stephan A.; Scilabra, Simone D.; Lichtenthaler, Stefan F.

    2016-01-01

    Cell-cell communication in the brain is controlled by multiple mechanisms, including proteolysis. Membrane-bound proteases generate signaling molecules from membrane-bound precursor proteins and control the length and function of cell surface membrane proteins. These proteases belong to different families, including members of the “a disintegrin and metalloprotease” (ADAM), the beta-site amyloid precursor protein cleaving enzymes (BACE), membrane-type matrix metalloproteases (MT-MMP) and rhomboids. Some of these proteases, in particular ADAM10 and BACE1 have been shown to be essential not only for the correct development of the mammalian brain, but also for myelination and maintaining neuronal connections in the adult nervous system. Additionally, these proteases are considered as drug targets for brain diseases, including Alzheimer’s disease (AD), schizophrenia and cancer. Despite their biomedical relevance, the molecular functions of these proteases in the brain have not been explored in much detail, as little was known about their substrates. This has changed with the recent development of novel proteomic methods which allow to identify substrates of membrane-bound proteases from cultured cells, primary neurons and other primary brain cells and even in vivo from minute amounts of mouse cerebrospinal fluid (CSF). This review summarizes the recent advances and highlights the strengths of the individual proteomic methods. Finally, using the example of the Alzheimer-related proteases BACE1, ADAM10 and γ-secretase, as well as ADAM17 and signal peptide peptidase like 3 (SPPL3), we illustrate how substrate identification with novel methods is instrumental in elucidating broad physiological functions of these proteases in the brain and other organs. PMID:27790089

  4. Interdomain Contacts and the Stability of Serralysin Protease from Serratia marcescens.

    PubMed

    Zhang, Liang; Morrison, Anneliese J; Thibodeau, Patrick H

    2015-01-01

    The serralysin family of bacterial metalloproteases is associated with virulence in multiple modes of infection. These extracellular proteases are members of the Repeats-in-ToXin (RTX) family of toxins and virulence factors, which mediated virulence in E. coli, B. pertussis, and P. aeruginosa, as well as other animal and plant pathogens. The serralysin proteases are structurally dynamic and their folding is regulated by calcium binding to a C-terminal domain that defines the RTX family of proteins. Previous studies have suggested that interactions between N-terminal sequences and this C-terminal domain are important for the high thermal and chemical stabilities of the RTX proteases. Extending from this, stabilization of these interactions in the native structure may lead to hyperstabilization of the folded protein. To test this hypothesis, cysteine pairs were introduced into the N-terminal helix and the RTX domain and protease folding and activity were assessed. Under stringent pH and temperature conditions, the disulfide-bonded mutant showed increased protease activity and stability. This activity was dependent on the redox environment of the refolding reaction and could be blocked by selective modification of the cysteine residues before protease refolding. These data demonstrate that the thermal and chemical stability of these proteases is, in part, mediated by binding between the RTX domain and the N-terminal helix and demonstrate that stabilization of this interaction can further stabilize the active protease, leading to additional pH and thermal tolerance.

  5. Interdomain Contacts and the Stability of Serralysin Protease from Serratia marcescens

    PubMed Central

    Zhang, Liang; Morrison, Anneliese J.; Thibodeau, Patrick H.

    2015-01-01

    The serralysin family of bacterial metalloproteases is associated with virulence in multiple modes of infection. These extracellular proteases are members of the Repeats-in-ToXin (RTX) family of toxins and virulence factors, which mediated virulence in E. coli, B. pertussis, and P. aeruginosa, as well as other animal and plant pathogens. The serralysin proteases are structurally dynamic and their folding is regulated by calcium binding to a C-terminal domain that defines the RTX family of proteins. Previous studies have suggested that interactions between N-terminal sequences and this C-terminal domain are important for the high thermal and chemical stabilities of the RTX proteases. Extending from this, stabilization of these interactions in the native structure may lead to hyperstabilization of the folded protein. To test this hypothesis, cysteine pairs were introduced into the N-terminal helix and the RTX domain and protease folding and activity were assessed. Under stringent pH and temperature conditions, the disulfide-bonded mutant showed increased protease activity and stability. This activity was dependent on the redox environment of the refolding reaction and could be blocked by selective modification of the cysteine residues before protease refolding. These data demonstrate that the thermal and chemical stability of these proteases is, in part, mediated by binding between the RTX domain and the N-terminal helix and demonstrate that stabilization of this interaction can further stabilize the active protease, leading to additional pH and thermal tolerance. PMID:26378460

  6. A family of serine proteases expressed exclusively in myelo-monocytic cells specifically processes the nuclear factor-kappa B subunit p65 in vitro and may impair human immunodeficiency virus replication in these cells

    PubMed Central

    1994-01-01

    Two groups of U937 promonocytic cells were obtained by limiting dilution cloning which differed strikingly in their ability to support human immunodeficiency virus 1 (HIV-1) replication. "Plus" clones replicated the virus efficiently, whereas "minus" clones did not. We examined these clones for differences in nuclear factor (NF)-kappa B activity which might account for the observed phenomenon. Stimulation of plus clones liberated the classical p50-p65 complex from cytoplasmic pools, whereas minus clones produced an apparently novel, faster- migrating complex, as judged by electrophoretic mobility shift assays. It is surprising that the faster-migrating complex was composed also of p50 and p65. However, the p65 subunit was COOH-terminally truncated, as shown by immunoprecipitation. The truncation resulted from limited proteolysis of p65 during cellular extraction which released particular lysosomal serine proteases, such as elastase, cathepsin G, and proteinase 3. These specific proteases are coordinately expressed and were present exclusively in the minus U937 clones, but not in the plus clones, as demonstrated in the case of cathepsin G. In addition, these proteases were detected in certain subclones of THP-1 and HL-60 cells and in primary monocytes, in each case correlating with the truncated from of p65. We demonstrate in vitro cleavage of p65 by purified elastase and cathepsin G. It is possible that particular serine proteases may have inhibiting effects on the replication of HIV-1 in myelo-monocytic cells. The data also demonstrate that special precautions must be taken when making extracts from myelo-monocytic cells. PMID:7931077

  7. Cysteine proteases as therapeutic targets: does selectivity matter? A systematic review of calpain and cathepsin inhibitors

    PubMed Central

    Siklos, Marton; BenAissa, Manel; Thatcher, Gregory R.J.

    2015-01-01

    Cysteine proteases continue to provide validated targets for treatment of human diseases. In neurodegenerative disorders, multiple cysteine proteases provide targets for enzyme inhibitors, notably caspases, calpains, and cathepsins. The reactive, active-site cysteine provides specificity for many inhibitor designs over other families of proteases, such as aspartate and serine; however, a) inhibitor strategies often use covalent enzyme modification, and b) obtaining selectivity within families of cysteine proteases and their isozymes is problematic. This review provides a general update on strategies for cysteine protease inhibitor design and a focus on cathepsin B and calpain 1 as drug targets for neurodegenerative disorders; the latter focus providing an interesting query for the contemporary assumptions that irreversible, covalent protein modification and low selectivity are anathema to therapeutic safety and efficacy. PMID:26713267

  8. A lead discovery strategy driven by a comprehensive analysis of proteases in the peptide substrate space.

    PubMed

    Sukuru, Sai Chetan K; Nigsch, Florian; Quancard, Jean; Renatus, Martin; Chopra, Rajiv; Brooijmans, Natasja; Mikhailov, Dmitri; Deng, Zhan; Cornett, Allen; Jenkins, Jeremy L; Hommel, Ulrich; Davies, John W; Glick, Meir

    2010-11-01

    We present here a comprehensive analysis of proteases in the peptide substrate space and demonstrate its applicability for lead discovery. Aligned octapeptide substrates of 498 proteases taken from the MEROPS peptidase database were used for the in silico analysis. A multiple-category naïve Bayes model, trained on the two-dimensional chemical features of the substrates, was able to classify the substrates of 365 (73%) proteases and elucidate statistically significant chemical features for each of their specific substrate positions. The positional awareness of the method allows us to identify the most similar substrate positions between proteases. Our analysis reveals that proteases from different families, based on the traditional classification (aspartic, cysteine, serine, and metallo), could have substrates that differ at the cleavage site (P1-P1') but are similar away from it. Caspase-3 (cysteine protease) and granzyme B (serine protease) are previously known examples of cross-family neighbors identified by this method. To assess whether peptide substrate similarity between unrelated proteases could reliably translate into the discovery of low molecular weight synthetic inhibitors, a lead discovery strategy was tested on two other cross-family neighbors--namely cathepsin L2 and matrix metallo proteinase 9, and calpain 1 and pepsin A. For both these pairs, a naïve Bayes classifier model trained on inhibitors of one protease could successfully enrich those of its neighbor from a different family and vice versa, indicating that this approach could be prospectively applied to lead discovery for a novel protease target with no known synthetic inhibitors.

  9. Proteases from psychrotrophs: an overview.

    PubMed

    Kasana, Ramesh Chand

    2010-05-01

    Proteases are hydrolytic enzymes which catalyze the total hydrolysis of proteins in to amino acids. Although proteolytic enzymes can be obtained from animals and plants but microorganisms are the preferred source for industrial applications in view of scientific and economical advantage. Among various groups of microbes, psychrotrophs are ideal candidates for enzymes production keeping in mind that enzymes active at low temperature and stable under alkaline condition, in presence of oxidants and detergents are in large demand as laundry additive. The proteases from psychrotrophs also find application in environmental bioremediation, food and molecular biology. During the previous two decades, proteases from psychrotrophs have received increased attention because of their wide range of applications, but the full potential of psychrotrophic proteases has not been exploited. This review focuses attention on the present status of knowledge on the production, optimization, molecular characteristics, applications, substrate specificity, and crystal structure of psychrotrophic proteases. The review will help in making strategies for exploitation of psychrotrophic protease resources and improvement of enzymes to obtain more robust proteases of industrial and biotechnological significance.

  10. Purification and characterization of an alkaline protease from Micrococcus sp. isolated from the South China Sea

    NASA Astrophysics Data System (ADS)

    Hou, Enling; Xia, Tao; Zhang, Zhaohui; Mao, Xiangzhao

    2017-04-01

    Protease is wildly used in various fields, such as food, medicine, washing, leather, cosmetics and other industrial fields. In this study, an alkaline protease secreted by Micrococcus NH54PC02 isolated from the South China Sea was purified and characterized. The growth curve and enzyme activity curve indicated that the cell reached a maximum concentration at the 30th hour and the enzyme activity reached the maximum value at the 36th hour. The protease was purified with 3 steps involving ammonium sulfate precipitation, ion-exchange chromatography and hydrophobic chromatography with 8.22-fold increase in specific activity and 23.68% increase in the recovery. The molecular mass of the protease was estimated to be 25 kDa by SDS-PAGE analysis. The optimum temperature and pH for the protease activity were 50°C and pH 10.0, respectively. The protease showed a strong stability in a wide range of pH values ranging from 6.0-11.0, and maintained 90% enzyme activity in strong alkaline environment with pH 11.0. Inhibitor trials indicated that the protease might be serine protease. But it also possessed the characteristic of metalloprotease as it could be strongly inhibited by EDTA and strongly stimulated by Mn2+. Evaluation of matrix-assisted laser desorption ionization/time-of-flight MS (MALDI-TOF-TOF/MS) showed that the protease might belong to the peptidase S8 family.

  11. Visceral hypersensitivity in inflammatory bowel diseases and irritable bowel syndrome: The role of proteases

    PubMed Central

    Ceuleers, Hannah; Van Spaendonk, Hanne; Hanning, Nikita; Heirbaut, Jelena; Lambeir, Anne-Marie; Joossens, Jurgen; Augustyns, Koen; De Man, Joris G; De Meester, Ingrid; De Winter, Benedicte Y

    2016-01-01

    Proteases, enzymes catalyzing the hydrolysis of peptide bonds, are present at high concentrations in the gastrointestinal tract. Besides their well-known role in the digestive process, they also function as signaling molecules through the activation of protease-activated receptors (PARs). Based on their chemical mechanism for catalysis, proteases can be classified into several classes: serine, cysteine, aspartic, metallo- and threonine proteases represent the mammalian protease families. In particular, the class of serine proteases will play a significant role in this review. In the last decades, proteases have been suggested to play a key role in the pathogenesis of visceral hypersensitivity, which is a major factor contributing to abdominal pain in patients with inflammatory bowel diseases and/or irritable bowel syndrome. So far, only a few preclinical animal studies have investigated the effect of protease inhibitors specifically on visceral sensitivity while their effect on inflammation is described in more detail. In our accompanying review we describe their effect on gastrointestinal permeability. On account of their promising results in the field of visceral hypersensitivity, further research is warranted. The aim of this review is to give an overview on the concept of visceral hypersensitivity as well as on the physiological and pathophysiological functions of proteases herein. PMID:28058009

  12. Membrane-anchored serine proteases in health and disease

    PubMed Central

    Bugge, Thomas; Wu, Qingyu

    2013-01-01

    Serine proteases of the trypsin-like family have long been recognized to be critical effectors of biological processes as diverse as digestion, blood coagulation, fibrinolysis, and immunity. In recent years, a subgroup of these enzymes has been identified that are anchored directly to plasma membranes, either by a carboxy-terminal transmembrane domain (Type I), an amino-terminal transmembrane domain with a cytoplasmic extension (Type II or TTSP), or through a glycosyl-phosphatidylinositol (GPI) linkage. Recent biochemical, cellular, and in vivo analyses have now established that membrane-anchored serine proteases are key pericellular contributors to processes vital for development and the maintenance of homeostasis. This chapter will review our current knowledge of the biological and physiological functions of these proteases, their molecular substrates, and their contributions to disease. PMID:21238933

  13. Application of Protease Technology in Dermatology

    PubMed Central

    Del Rosso, James Q.

    2013-01-01

    This article reviews background on proteases and their functions, their physiological significance in skin, and the potential implications of incorporating specific proteases and protease blends into dermatological products, including skin care formulations. The history of protease blend formulations used in wound model studies and for other disorders is reviewed. In vitro data with use of a specific 3-protease blend with evaluation of the impact on various skin proteins and peptides is also discussed in this article. PMID:23882305

  14. Serine proteases, serine protease inhibitors, and protease-activated receptors: roles in synaptic function and behavior.

    PubMed

    Almonte, Antoine G; Sweatt, J David

    2011-08-17

    Serine proteases, serine protease inhibitors, and protease-activated receptors have been intensively investigated in the periphery and their roles in a wide range of processes-coagulation, inflammation, and digestion, for example-have been well characterized (see Coughlin, 2000; Macfarlane et al., 2001; Molinari et al., 2003; Wang et al., 2008; Di Cera, 2009 for reviews). A growing number of studies demonstrate that these protein systems are widely expressed in many cell types and regions in mammalian brains. Accumulating lines of evidence suggest that the brain has co-opted the activities of these interesting proteins to regulate various processes underlying synaptic activity and behavior. In this review, we discuss emerging roles for serine proteases in the regulation of mechanisms underlying synaptic plasticity and memory formation.

  15. The non-death role of metacaspase proteases.

    PubMed

    Shrestha, Amit; Megeney, Lynn A

    2012-01-01

    The activation of caspase proteases and the targeting of protein substrates act as key steps in the engagement and conduct of apoptosis/programmed cell death. However, the discovery of caspase involvement in diverse non-apoptotic cellular functions strongly suggests that these proteins may have evolved from a core behavior unrelated to the induction of cell death. The presence of similar proteases, termed metacaspases, in single cell organisms supports the contention that such proteins may have co-evolved or derived from a critical non-death function. Indeed, the benefit(s) for single cell life forms to retain proteins solely dedicated to self destruction would be countered by a strong selection pressure to curb or eliminate such processes. Examination of metacaspase biology provides evidence that these ancient protease forerunners of the caspase family also retain versatility in function, i.e., death and non-death cell functions. Here, we provide a critical review that highlights the non-death roles of metacaspases that have been described thus far, and the impact that these observations have for our understanding of the evolution and cellular utility of this protease family.

  16. Mast Cell Proteases and Inflammation

    PubMed Central

    Dai, Hongyan; Korthuis, Ronald J.

    2011-01-01

    Mast cells are best known for their role in allergic reactions but are also now recognized for their important contributions to a number of disparate inflammatory conditions through the release of inflammatory mediators, serglycin and other proteoglycans, and proteases. Because these tissue resident inflammatory cells express proteases in such great abundance and their enzymatic activity results in cleavage of a multitude of proteins and peptides, which in turn modify tissue function, their substrate specificity, tissue distribution, and mode of action have become the subjects of great interest. Although mast cell protease-dependent proteolysis is critical to host defense against invading pathogens, regulation of these hydrolytic enzymes is essential to limiting self-induced damage as well. Indeed, dysregulated release of mast cell proteases is now recognized to contribute to the pathogenesis of a number of inflammatory conditions including asthma, abdominal aortic aneurysm formation, vessel damage in atherosclerosis and hypertension, arthritis, and ischemia/reperfusion injury. Understanding how mast cell proteases contribute to inflammation will thus help unravel molecular mechanisms that underlie such immunologic disorders and will help identify new therapeutic targets for drug development. PMID:22125569

  17. A novel serine protease with caspase- and legumain-like activities from edible basidiomycete Flammulina velutipes.

    PubMed

    Iketani, Aya; Nakamura, Mayumi; Suzuki, Yuya; Awai, Koichiro; Shioi, Yuzo

    2013-03-01

    A serine protease with caspase- and legumain-like activities from basidiocarps of the edible basidiomycete Flammulina velutipes was characterized. The protease was purified to near homogeneity by three steps of chromatography using acetyl-Tyr-Val-Ala-Asp-4-methylcoumaryl-7-amide (Ac-YVAD-MCA) as a substrate. The enzyme was termed FvSerP (F. velutipes serine protease). This enzyme activity was completely inhibited by the caspase-specific inhibitor, Ac-YVAD-CHO, as well as moderately inhibited by serine protease inhibitors. Based on the N-terminal sequence, the cDNA of FvSerP was identified. The deduced protease sequence was a peptide composed of 325 amino acids with a molecular mass of 34.5 kDa. The amino acid sequence of FvSerP showed similarity to neither caspases nor to the plant subtilisin-like serine protease with caspase-like activity called saspase. FvSerP shared identity to the functionally unknown genes from class of Agaricomycetes, with similarity to the peptidase S41 domain of a serine protease. It was thus concluded that this enzyme is likely a novel serine protease with caspase- and legumain-like activities belonging to the peptidase S41 family and distributed in the class Agaricomycetes. This enzyme possibly functions in autolysis, a type of programmed cell death that occurs in the later stages of development of basidiocarps with reference to their enzymatic functions.

  18. Identification of the recognition sequence and target proteins for DJ-1 protease.

    PubMed

    Mitsugi, Hitomi; Niki, Takeshi; Takahashi-Niki, Kazuko; Tanimura, Kyoko; Yoshizawa-Kumagaye, Kumiko; Tsunemi, Masahiko; Iguchi-Ariga, Sanae M M; Ariga, Hiroyoshi

    2013-08-19

    DJ-1, the product of familial Parkinson's disease gene and an oncogene, is a cysteine protease which plays a role in anti-oxidative stress reaction. In this study, we identified the recognition sequence for DJ-1 protease by using recombinant DJ-1 and a peptide library. Protease activity of DJ-1 lacking C-terminal α-helix (DJ-1ΔH9) was stronger than that of full-sized DJ-1, and the most susceptible sequence digested by DJ-1ΔH9 was valine-lysine-valine-alanine (VKVA) under the optimal conditions of pH 5.5 and 0 mM NaCl. Divalent ions, especially Cu²⁺, were inhibitory to DJ-1's protease activity. c-abl oncogene 1 product (ABL1) and kinesin family member 1B (KIF1B) containing VKVA were digested by DJ-1ΔH9.

  19. Evolutionary optimization of peptide substrates for proteases that exhibit rapid hydrolysis kinetics.

    PubMed

    Boulware, Kevin T; Jabaiah, Abeer; Daugherty, Patrick S

    2010-06-15

    Protease cleavage site recognition motifs can be identified using protease substrate discovery methodologies, but typically exhibit non-optimal specificity and activity. To enable evolutionary optimization of substrate cleavage kinetics, a two-color cellular library of peptide substrates (CLiPS) methodology was developed. Two-color CLiPS was applied to identify peptide substrates for the tobacco etch virus (TEV) protease from a random pentapeptide library, which were then optimized by screening of a focused, extended substrate library. Quantitative library screening yielded seven amino acid substrates exhibiting rapid hydrolysis by TEV protease and high sequence similarity to the native seven-amino-acid substrate, with a strong consensus of EXLYPhiQG. Comparison of hydrolysis rates for a family of closely related substrates indicates that the native seven-residue TEV substrate co-evolved with TEV protease to facilitate highly efficient hydrolysis. Consensus motifs revealed by screening enabled database identification of a family of related, putative viral protease substrates. More generally, our results suggest that substrate evolution using CLiPS may be useful for optimizing substrate selectivity and activity to enable the design of more effective protease activity probes, molecular imaging agents, and prodrugs.

  20. Cytomegalovirus protease targeted prodrug development.

    PubMed

    Sabit, Hairat; Dahan, Arik; Sun, Jing; Provoda, Chester J; Lee, Kyung-Dall; Hilfinger, John H; Amidon, Gordon L

    2013-04-01

    Human cytomegalovirus (HCMV) is a prevalent virus that infects up to 90% of the population. The goal of this research is to determine if small molecular prodrug substrates can be developed for a specific HCMV encoded protease and thus achieve site-specific activation. HCMV encodes a 256 amino acid serine protease that is responsible for capsid assembly, an essential process for herpes virus production. The esterase activity of the more stable HCMV A143T/A144T protease mutant was evaluated with model p-nitrophenol (ONp) esters, Boc-Xaa-ONp (Ala, Leu, Ile, Val, Gln, Phe at the Xaa position). We demonstrate that the A143T/A144T mutant has esterase activity toward specific small ester compounds, e.g., Boc-L-Ala-ONp. Mono amino acid and dipeptide prodrugs of ganciclovir (GCV) were also synthesized and evaluated for hydrolysis by the A143T/A144T protease mutant in solution. Hydrolysis of these prodrugs was also evaluated in Caco-2 cell homogenates, human liver microsomes (HLMs), and rat and human plasma. For the selectivity potential of the prodrugs, the hydrolysis ratio was evaluated as a percentage of prodrug hydrolyzed by the HCMV protease over the percentages of prodrug hydrolyses by Caco-2 cell homogenates, HLMs, and human/rat plasma. A dipeptide prodrug of ganciclovir, Ac-l-Gln-l-Ala-GCV, emerged as a potential selective prodrug candidate. The results of this research demonstrate that targeting prodrugs for activation by a specific protease encoded by the infectious HCMV pathogen may be achievable.

  1. Highly potent fibrinolytic serine protease from Streptomyces.

    PubMed

    Uesugi, Yoshiko; Usuki, Hirokazu; Iwabuchi, Masaki; Hatanaka, Tadashi

    2011-01-05

    We introduce a highly potent fibrinolytic serine protease from Streptomyces omiyaensis (SOT), which belongs to the trypsin family. The fibrinolytic activity of SOT was examined using in vitro assays and was compared with those of known fibrinolytic enzymes such as plasmin, tissue-type plasminogen activator (t-PA), urokinase, and nattokinase. Compared to other enzymes, SOT showed remarkably higher hydrolytic activity toward mimic peptides of fibrin and plasminogen. The fibrinolytic activity of SOT is about 18-fold higher than that of plasmin, and is comparable to that of t-PA by fibrin plate assays. Furthermore, SOT had some plasminogen activator-like activity. Results show that SOT and nattokinase have very different fibrinolytic and fibrinogenolytic modes, engendering significant synergetic effects of SOT and nattokinase on fibrinolysis. These results suggest that SOT presents important possibilities for application in the therapy of thrombosis.

  2. Active protease mapping in 2DE gels.

    PubMed

    Zhao, Zhenjun; Russell, Pamela J

    2009-01-01

    Proteases act as the molecular mediators of many vital biological processes. To understand the function of each protease, it needs to be separated from other proteins and characterized in its natural, biologically active form. In the method described in this chapter, proteases in a biological sample are separated under nonreducing conditions in 2DE gels. A specific small protease substrate, tagged with a fluorescent dye, is copolymerized into the SDS gel in the second dimension. After electrophoresis, the proteins are renatured by washing the gel with Triton X-100 solution or Milli Q water to remove SDS. The gel is then incubated in a protease assay buffer. The hydrolysis of the tagged specific substrate by the renatured protease releases the free fluorescent dye, which fluoresces in situ. The fluorescent spots indicate the location of the specific proteases in the gel and the specificity of the proteases.

  3. Synthesis of macrocyclic trypanosomal cysteine protease inhibitors.

    PubMed

    Chen, Yen Ting; Lira, Ricardo; Hansell, Elizabeth; McKerrow, James H; Roush, William R

    2008-11-15

    The importance of cysteine proteases in parasites, compounded with the lack of redundancy compared to their mammalian hosts makes proteases attractive targets for the development of new therapeutic agents. The binding mode of K11002 to cruzain, the major cysteine protease of Trypanosoma cruzi was used in the design of conformationally constrained inhibitors. Vinyl sulfone-containing macrocycles were synthesized via olefin ring-closing metathesis and evaluated against cruzain and the closely related cysteine protease, rhodesain.

  4. Design, Synthesis and Biological Evaluation of a Library of Thiocarbazates and their Activity as Cysteine Protease Inhibitors

    PubMed Central

    Liu, Zhuqing; Myers, Michael C.; Shah, Parag P.; Beavers, Mary Pat; Benedetti, Phillip A.; Diamond, Scott L.

    2010-01-01

    Recently, we identified a novel class of potent cathepsin L inhibitors, characterized by a thiocarbazate warhead. Given the potential of these compounds to inhibit other cysteine proteases, we designed and synthesized a library of thiocarbazates containing diversity elements at three positions. Biological characterization of this library for activity against a panel proteases indicated a significant preference for members of the papain family of cysteine proteases over serine, metallo-, and certain classes of cysteine proteases, such as caspases. Several very potent inhibitors of Cathepsin L and S were identified. The SAR data was employed in docking studies in an effort to understand the structural elements required for Cathepsin S inhibition. This study provides the basis for the design of highly potent and selective inhibitors of the papain family of cysteine proteases. PMID:20438448

  5. Plant cysteine proteases that evoke itch activate protease-activated receptors

    PubMed Central

    Reddy, V.B.; Lerner, E.A.

    2013-01-01

    Background Bromelain, ficin and papain are cysteine proteases from plants that produce itch upon injection into skin. Their mechanism of action has not been considered previously. Objectives To determine the mechanism by which these proteases function. Methods The ability of these proteases to activate protease-activated receptors was determined by ratiometric calcium imaging. Results We show here that bromelain, ficin and papain activate protease-activated receptors 2 and 4. Conclusions Bromelain, ficin and papain function as signalling molecules and activate protease-activated receptors. Activation of these receptors is the likely mechanism by which these proteases evoke itch. PMID:20491769

  6. Curcumin derivatives as HIV-1 protease inhibitors

    SciTech Connect

    Sui, Z.; Li, J.; Craik, C.S.; Ortiz de Montellano, P.R.

    1993-12-31

    Curcumin, a non-toxic natural compound from Curcuma longa, has been found to be an HIV-1 protease inhibitor. Some of its derivatives were synthesized and their inhibitory activity against the HIV-1 protease was tested. Curcumin analogues containing boron enhanced the inhibitory activity. At least of the the synthesized compounds irreversibly inhibits the HIV-1 protease.

  7. Purification, primary structures and evolution of coagulant proteases from Deinagkistrodon actus venom.

    PubMed

    Nikandrov, Nikolai N; Deshimaru, Masanobu; Tani, Ayako; Chijiwa, Takahito; Shibata, Hiroki; Chang, Chang-Chun; Fukumaki, Yasuyuki; Ito, Tatsumi; Ohno, Motonori

    2005-12-15

    Deinagkistrodon (formerly Agkistrodon) actus (Taiwan) snake venom was found to contain at least seven closely related coagulant proteases. One of them, named actibin, was purified to homogeneity by means of four chromatographic steps. Actibin acted on fibrinogen to form fibrin clots with extremely high specific activity of 1,630 NIH units/mg and preferentially released fibrinopeptide A. Actibin was an acidic glycoprotein (pI 3.4) with molecular weight of 41,000, which was reduced to 28,800 after deglycosylation with N-glycanase. The k(cat)/K(m) values of actibin for hydrolysis of tosyl-l-arginine methyl ester and benzoyl-l-arginine p-nitroanilide were one-third to a half those for thrombin, reflecting a high potency of actibin in fibrinogen clotting. The amidase activities of actibin and its family proteases were inhibited by 3,4-dichloroisocoumarin, a serine protease inhibitor, indicating that actibin and its family proteases are serine proteases. Four cDNAs, named DaP1 and DaP7-DaP9, encoding D. actus coagulant proteases were cloned. All cDNAs contain an open reading frame of 780 bp coding for 260 amino acid residues, including a signal peptide of 24 amino acid residues. Their amino acid sequences predicted are highly homologous to one another with one to five amino acid substitutions. When four D. actus protease cDNAs were compared with the cDNAs coding for Trimeresurus flavoviridis and T. gramineus venom serine proteases, accelerated evolution was clearly observed. Similarity of the nucleotide sequences of four D. actus protease cDNAs with no synonymous and one to five nonsynonymous substitutions seems not to be in direct conformity with accelerated evolution. This possibly suggests that they have evolved to a similar direction to enhance their clotting activity rather than to produce other physiological activities.

  8. Design of new potent HTLV-1 protease inhibitors: in silico study.

    PubMed

    Kheirabadi, Mitra; Maleki, Javad; Soufian, Safieh; Hosseini, Samaneh

    2016-03-01

    HTLV-1 and HIV-1 are two major causes for severe T-cell leukemia disease and acquired immune deficiency syndrome (AIDS). HTLV-1 protease, a member of aspartic acid protease family, plays important roles in maturation during virus replication cycle. The impairment of these proteases results in uninfectious HTLV-1virions.Similar to HIV-1protease deliberate mutations that confer drug resistance on HTLV-1 are frequently seen in this protease. Therefore, inhibition of HTLV-1 protease activity is expected to disrupt HTLV-1's ability to replicate and infect additional cells. In this study, we initially designed fifteen inhibitory compounds based on the conformations of a class of HIV-1 aspartyl protease inhibitors, sulfonamid-peptoid. Five compounds were chosen based on the goodness of their Drug-Likeness scoreusing "Lipinsk's rule of five". Here, using protein-ligand docking approach we compared the inhibitory constants of these compounds to those available in literatures and observed significantly higher inhibition for two compounds, SP-4 and SP-5. Our data suggest that the addition of two cyclic hydrocarbons to both ends of sulfonamide peptoids leads to the formation of new hydrophobic interactions due to the semi-circular form of these compounds, connecting the first chain of protease to the two ends of tested ligands via Hydrophobic interactions. We conclude that hydrophobic force plays an important role in suppressing protease activity especially for HTLV-1 protease, which in turn prevents the virus maturity. Therefore, designing and development of new ligands based on aromatic hydrocarbons in both ends of inhibitors is very promising for efficient treatment.

  9. Design of new potent HTLV-1 protease inhibitors: in silico study

    PubMed Central

    Kheirabadi, Mitra; Maleki, Javad; Soufian, Safieh; Hosseini, Samaneh

    2016-01-01

    HTLV-1 and HIV-1 are two major causes for severe T-cell leukemia disease and acquired immune deficiency syndrome (AIDS). HTLV-1 protease, a member of aspartic acid protease family, plays important roles in maturation during virus replication cycle. The impairment of these proteases results in uninfectious HTLV-1virions.Similar to HIV-1protease deliberate mutations that confer drug resistance on HTLV-1 are frequently seen in this protease. Therefore, inhibition of HTLV-1 protease activity is expected to disrupt HTLV-1’s ability to replicate and infect additional cells. In this study, we initially designed fifteen inhibitory compounds based on the conformations of a class of HIV-1 aspartyl protease inhibitors, sulfonamid-peptoid. Five compounds were chosen based on the goodness of their Drug-Likeness scoreusing “Lipinsk’s rule of five”. Here, using protein-ligand docking approach we compared the inhibitory constants of these compounds to those available in literatures and observed significantly higher inhibition for two compounds, SP-4 and SP-5. Our data suggest that the addition of two cyclic hydrocarbons to both ends of sulfonamide peptoids leads to the formation of new hydrophobic interactions due to the semi-circular form of these compounds, connecting the first chain of protease to the two ends of tested ligands via Hydrophobic interactions. We conclude that hydrophobic force plays an important role in suppressing protease activity especially for HTLV-1 protease, which in turn prevents the virus maturity. Therefore, designing and development of new ligands based on aromatic hydrocarbons in both ends of inhibitors is very promising for efficient treatment. PMID:27844017

  10. Proteases of Stored Product Insects and Their Inhibition by Specific Protease Inhibitors from Soybeans and Wheat Grain

    DTIC Science & Technology

    1989-12-15

    PROTEASES; PROTEASE INHIBITORS; STORED-PRODUCT INISECTS; TRIBOLIUM CASIANEUH; MIDGUT PROTEASES; TENEBRIO MOLITOR MIDGUT-PROTEASES; LOCUST CAECAL...separation and identification of numerous midgut proteases in Tenebrio and Tribolium . The PAGE-gelatin matrix revealed the inhibitory effect of BBI...the proteinaceous trypsin-chymotrypsin inhibitor from soybeans) on several Tribolium proteases - an effect which was not detectable in inhibition

  11. Distinct contribution of Toxoplasma gondii rhomboid proteases 4 and 5 to micronemal protein protease 1 activity during invasion.

    PubMed

    Rugarabamu, George; Marq, Jean-Baptiste; Guérin, Amandine; Lebrun, Maryse; Soldati-Favre, Dominique

    2015-07-01

    Host cell entry by the Apicomplexa is associated with the sequential secretion of invasion factors from specialized apical organelles. Secretion of micronemal proteins (MICs) complexes by Toxoplasma gondii facilitates parasite gliding motility, host cell attachment and entry, as well as egress from infected cells. The shedding of MICs during these steps is mediated by micronemal protein proteases MPP1, MPP2 and MPP3. The constitutive activity of MPP1 leads to the cleavage of transmembrane MICs and is linked to the surface rhomboid protease 4 (ROM4) and possibly to rhomboid protease 5 (ROM5). To determine their importance and respective contribution to MPP1 activity, in this study ROM4 and ROM5 genes were abrogated using Cre-recombinase and CRISPR-Cas9 nuclease, respectively, and shown to be dispensable for parasite survival. Parasites lacking ROM4 predominantly engage in twirling motility and exhibit enhanced attachment and impaired invasion, whereas intracellular growth and egress is not affected. The substrates MIC2 and MIC6 are not cleaved in rom4-ko parasites, in contrast, intramembrane cleavage of AMA1 is reduced but not completely abolished. Shedding of MICs and invasion are not altered in the absence of ROM5; however, this protease responsible for the residual cleavage of AMA1 is able to cleave other AMA family members and exhibits a detectable contribution to invasion in the absence of ROM4.

  12. Bacterial proteases in IBD and IBS.

    PubMed

    Steck, Natalie; Mueller, Kerstin; Schemann, Michael; Haller, Dirk

    2012-11-01

    Proteases play a decisive role in health and disease. They fulfil diverse functions and have been associated with the pathology of gastrointestinal disorders such as inflammatory bowel disease (IBD) and irritable bowel syndrome (IBS). The current knowledge focuses on host-derived proteases including matrix metalloproteinases, various serine proteases and cathepsins. The possible contribution of bacterial proteases has been largely ignored in the pathogenesis of IBD and IBS, although there is increasing evidence, especially demonstrated for proteases from pathogenic bacteria. The underlying mechanisms extend to proteases from commensal bacteria which may be relevant for disease susceptibility. The intestinal microbiota and its proteolytic capacity exhibit the potential to contribute to the pathogenesis of IBD and IBS. This review highlights the relevance of host- and bacteria-derived proteases and their signalling mechanisms.

  13. Biotechnology of Cold-Active Proteases

    PubMed Central

    Joshi, Swati; Satyanarayana, Tulasi

    2013-01-01

    The bulk of Earth’s biosphere is cold (<5 °C) and inhabited by psychrophiles. Biocatalysts from psychrophilic organisms (psychrozymes) have attracted attention because of their application in the ongoing efforts to decrease energy consumption. Proteinases as a class represent the largest category of industrial enzymes. There has been an emphasis on employing cold-active proteases in detergents because this allows laundry operations at ambient temperatures. Proteases have been used in environmental bioremediation, food industry and molecular biology. In view of the present limited understanding and availability of cold-active proteases with diverse characteristics, it is essential to explore Earth’s surface more in search of an ideal cold-active protease. The understanding of molecular and mechanistic details of these proteases will open up new avenues to tailor proteases with the desired properties. A detailed account of the developments in the production and applications of cold-active proteases is presented in this review. PMID:24832807

  14. Proteases of germinating winged-bean (Psophocarpus tetragonolobus) seeds: purification and characterization of an acidic protease.

    PubMed

    Usha, R; Singh, M

    1996-01-15

    Two major classes of protease are shown to occur in germinating winged-bean (Psophocarpus tetragonolobus) seeds, by assaying extracts at pH 8.0 and pH 5.1 with [14C]gelatin as substrate. At pH 8.0, the activity profile of the enzyme shows a steady rise throughout the period of germination, whereas the activity at the acidic pH is very low up to day 5 and then increases sharply reaching a peak on day 11, followed by an equally sharp decline. The winged-bean acidic protease (WbAP) has been purified to apparent homogeneity, as attested by a single protein band on both PAGE and SDS/PAGE. WbAP is a monomeric enzyme with a molecular mass of 35 kDa and a pH optimum of 6.0. It is a thiol protease that does not belong to the papain family and it has tightly bound Ca2+ as shown by 45Ca(2+)-exchange studies. Besides gelatin and casein, it hydrolyses a 29 kDa winged-bean protein, indicating a prospective physiological role for it in storage-protein mobilization. Immunoblot analysis shows that it occurs only in the seeds and sprouting tubers of this plant and also that it is synthesized in developing seeds just before desiccation. It appears that the newly synthesized enzyme is inactive, and activation takes place around day 6 of germination. However, neither the mechanism of activation nor the signal that triggers it is clearly understood.

  15. Modulation of the epithelial sodium channel (ENaC) by bacterial metalloproteases and protease inhibitors.

    PubMed

    Butterworth, Michael B; Zhang, Liang; Liu, Xiaoning; Shanks, Robert M; Thibodeau, Patrick H

    2014-01-01

    The serralysin family of metalloproteases is associated with the virulence of multiple gram-negative human pathogens, including Pseudomonas aeruginosa and Serratia marcescens. The serralysin proteases share highly conserved catalytic domains and show evolutionary similarity to the mammalian matrix metalloproteases. Our previous studies demonstrated that alkaline protease (AP) from Pseudomonas aeruginosa is capable of activating the epithelial sodium channel (ENaC), leading to an increase in sodium absorption in airway epithelia. The serralysin proteases are often co-expressed with endogenous, intracellular or periplasmic inhibitors, which putatively protect the bacterium from unwanted or unregulated protease activities. To evaluate the potential use of these small protein inhibitors in regulating the serralysin induced activation of ENaC, proteases from Pseudomonas aeruginosa and Serratia marcescens were purified for characterization along with a high affinity inhibitor from Pseudomonas. Both proteases showed activity against in vitro substrates and could be blocked by near stoichiometric concentrations of the inhibitor. In addition, both proteases were capable of activating ENaC when added to the apical surfaces of multiple epithelial cells with similar slow activation kinetics. The high-affinity periplasmic inhibitor from Pseudomonas effectively blocked this activation. These data suggest that multiple metalloproteases are capable of activating ENaC. Further, the endogenous, periplasmic bacterial inhibitors may be useful for modulating the downstream effects of the serralysin virulence factors under physiological conditions.

  16. Structural Mechanisms of Inactivation in Scabies Mite Serine Protease Paralogues

    SciTech Connect

    Fischer, Katja; Langendorf, Christopher G.; Irving, James A.; Reynolds, Simone; Willis, Charlene; Beckham, Simone; Law, Ruby H.P.; Yang, Sundy; Bashtannyk-Puhalovich, Tanya A.; McGowan, Sheena; Whisstock, James C.; Pike, Robert N.; Kemp, David J.; Buckle, Ashley M.

    2009-08-07

    The scabies mite (Sarcoptes scabiei) is a parasite responsible for major morbidity in disadvantaged communities and immuno-compromised patients worldwide. In addition to the physical discomfort caused by the disease, scabies infestations facilitate infection by Streptococcal species via skin lesions, resulting in a high prevalence of rheumatic fever/heart disease in affected communities. The scabies mite produces 33 proteins that are closely related to those in the dust mite group 3 allergen and belong to the S1-like protease family (chymotrypsin-like). However, all but one of these molecules contain mutations in the conserved active-site catalytic triad that are predicted to render them catalytically inactive. These molecules are thus termed scabies mite inactivated protease paralogues (SMIPPs). The precise function of SMIPPs is unclear; however, it has been suggested that these proteins might function by binding and protecting target substrates from cleavage by host immune proteases, thus preventing the host from mounting an effective immune challenge. In order to begin to understand the structural basis for SMIPP function, we solved the crystal structures of SMIPP-S-I1 and SMIPP-S-D1 at 1.85 {angstrom} and 2.0 {angstrom} resolution, respectively. Both structures adopt the characteristic serine protease fold, albeit with large structural variations over much of the molecule. In both structures, mutations in the catalytic triad together with occlusion of the S1 subsite by a conserved Tyr200 residue is predicted to block substrate ingress. Accordingly, we show that both proteases lack catalytic function. Attempts to restore function (via site-directed mutagenesis of catalytic residues as well as Tyr200) were unsuccessful. Taken together, these data suggest that SMIPPs have lost the ability to bind substrates in a classical 'canonical' fashion, and instead have evolved alternative functions in the lifecycle of the scabies mite.

  17. Nelfinavir: fourth protease inhibitor approved.

    PubMed

    1997-01-01

    The Food and Drug Administration (FDA) has granted accelerated approval to nelfinavir in both adult and pediatric formulations. Agouron, the manufacturer, used innovative computerized drug design techniques to discover, design, and refine the nelfinavir molecule. Nelfinavir is marketed under the trade name Viracept, and costs $5,000 per year. Early clinical trials find it to be as powerful as the other protease inhibitors, but with a different resistance profile. The drug has relatively few drug indications; however, several compounds have been contraindicated.

  18. Protease Profiling in Prostate Cancer

    DTIC Science & Technology

    2004-05-01

    acid synthase, which contains a serine hydrolase domain. We identified a lead inhibitor of this domain of fatty acid synthase, called Orlistat, which...SUBJECT TERMS 15. NUMBER OF PAGES Prostate cancer, tumor biology, protease, proteomics, transgenic, 20 animal model, fatty acid synthase, orlistat 16...the enzymes we identified is fatty acid synthase. Fatty acid synthase is the sole enzyme responsible for the cellular synthesis of fatty acids . This

  19. Evaluation on Potential Contributions of Protease Activated Receptors Related Mediators in Allergic Inflammation

    PubMed Central

    Zhang, Huiyun; Zeng, Xiaoning; He, Shaoheng

    2014-01-01

    Protease activated receptors (PARs) have been recognized as a distinctive four-member family of seven transmembrane G protein-coupled receptors (GPCRs) that can be cleaved by certain serine proteases. In recent years, there has been considerable interest in the role of PARs in allergic inflammation, the fundamental pathologic changes of allergy, but the potential roles of PARs in allergy remain obscure. Since many of these proteases are produced and actively involved in the pathologic process of inflammation including exudation of plasma components, inflammatory cell infiltration, and tissue damage and repair, PARs appear to make important contribution to allergy. The aim of the present review is to summarize the expression of PARs in inflammatory and structural cells, the influence of agonists or antagonists of PARs on cell behavior, and the involvement of PARs in allergic disorders, which will help us to better understand the roles of serine proteases and PARs in allergy. PMID:24876677

  20. Structural basis of ubiquitin recognition by the deubiquitinating protease USP2.

    PubMed

    Renatus, Martin; Parrado, Shirley Gil; D'Arcy, Allan; Eidhoff, Ulf; Gerhartz, Bernd; Hassiepen, Ulrich; Pierrat, Benoit; Riedl, Ralph; Vinzenz, Daniela; Worpenberg, Susanne; Kroemer, Markus

    2006-08-01

    Deubiquitinating proteases reverse protein ubiquitination and rescue their target proteins from destruction by the proteasome. USP2, a cysteine protease and a member of the ubiquitin specific protease family, is overexpressed in prostate cancer and stabilizes fatty acid synthase, which has been associated with the malignancy of some aggressive prostate cancers. Here, we report the structure of the human USP2 catalytic domain in complex with ubiquitin. Ubiquitin uses two major sites for the interaction with the protease. Both sites are required simultaneously, as shown by USP2 inhibition assays with peptides and ubiquitin mutants. In addition, a layer of ordered water molecules mediates key interactions between ubiquitin and USP2. As several of those molecules are found at identical positions in the previously solved USP7/ubiquitin-aldehyde complex structure, we suggest a general mechanism of water-mediated ubiquitin recognition by USPs.

  1. Protease induced plasticity: matrix metalloproteinase-1 promotes neurostructural changes through activation of protease activated receptor 1

    PubMed Central

    Allen, Megan; Ghosh, Suhasini; Ahern, Gerard P.; Villapol, Sonia; Maguire-Zeiss, Kathleen A.; Conant, Katherine

    2016-01-01

    Matrix metalloproteinases (MMPs) are a family of secreted endopeptidases expressed by neurons and glia. Regulated MMP activity contributes to physiological synaptic plasticity, while dysregulated activity can stimulate injury. Disentangling the role individual MMPs play in synaptic plasticity is difficult due to overlapping structure and function as well as cell-type specific expression. Here, we develop a novel system to investigate the selective overexpression of a single MMP driven by GFAP expressing cells in vivo. We show that MMP-1 induces cellular and behavioral phenotypes consistent with enhanced signaling through the G-protein coupled protease activated receptor 1 (PAR1). Application of exogenous MMP-1, in vitro, stimulates PAR1 dependent increases in intracellular Ca2+ concentration and dendritic arborization. Overexpression of MMP-1, in vivo, increases dendritic complexity and induces biochemical and behavioral endpoints consistent with increased GPCR signaling. These data are exciting because we demonstrate that an astrocyte-derived protease can influence neuronal plasticity through an extracellular matrix independent mechanism. PMID:27762280

  2. Molecular Imaging of Proteases in Cancer

    PubMed Central

    Yang, Yunan; Hong, Hao; Zhang, Yin; Cai, Weibo

    2010-01-01

    Proteases play important roles during tumor angiogenesis, invasion, and metastasis. Various molecular imaging techniques have been employed for protease imaging: optical (both fluorescence and bioluminescence), magnetic resonance imaging (MRI), single-photon emission computed tomography (SPECT), and positron emission tomography (PET). In this review, we will summarize the current status of imaging proteases in cancer with these techniques. Optical imaging of proteases, in particular with fluorescence, is the most intensively validated and many of the imaging probes are already commercially available. It is generally agreed that the use of activatable probes is the most accurate and appropriate means for measuring protease activity. Molecular imaging of proteases with other techniques (i.e. MRI, SPECT, and PET) has not been well-documented in the literature which certainly deserves much future effort. Optical imaging and molecular MRI of protease activity has very limited potential for clinical investigation. PET/SPECT imaging is suitable for clinical investigation; however the optimal probes for PET/SPECT imaging of proteases in cancer have yet to be developed. Successful development of protease imaging probes with optimal in vivo stability, tumor targeting efficacy, and desirable pharmacokinetics for clinical translation will eventually improve cancer patient management. Not limited to cancer, these protease-targeted imaging probes will also have broad applications in other diseases such as arthritis, atherosclerosis, and myocardial infarction. PMID:20234801

  3. Biofluid proteases profiling in diabetes mellitus.

    PubMed

    Trindade, Fábio; Ferreira, Rita; Amado, Francisco; Vitorino, Rui

    2015-01-01

    The investigation of protease relevance in biologic systems beyond catabolism of proteins and peptides to amino acids has stimulated interest as to their role in the pathogenesis of several disorders including diabetes mellitus (DM). Evaluation of proteases and the assessment of their activity in biofluids are fundamental to elucidate these proteolytic systems in DM and its related complications. In contrast to traditional immunoassay or substrate based approaches that targeted specific proteases and their inhibitors, the field of degradomics has provided a comprehensive approach to study these enzymes. Although the degradome contains over 500 proteases, very few have been associated with DM and its micro- and macrovascular complications. In this paper, we review these proteases and their respective inhibitors with emphasis on DM. It is likely that future research will expand these initial studies and look to develop high throughput automated technologies to identify and characterize biofluid proteases of diagnostic and prognostic value in other pathologies.

  4. Advances in protease engineering for laundry detergents.

    PubMed

    Vojcic, Ljubica; Pitzler, Christian; Körfer, Georgette; Jakob, Felix; Ronny Martinez; Maurer, Karl-Heinz; Schwaneberg, Ulrich

    2015-12-25

    Proteases are essential ingredients in modern laundry detergents. Over the past 30 years, subtilisin proteases employed in the laundry detergent industry have been engineered by directed evolution and rational design to tailor their properties towards industrial demands. This comprehensive review discusses recent success stories in subtilisin protease engineering. Advances in protease engineering for laundry detergents comprise simultaneous improvement of thermal resistance and activity at low temperatures, a rational strategy to modulate pH profiles, and a general hypothesis for how to increase promiscuous activity towards the production of peroxycarboxylic acids as mild bleaching agents. The three protease engineering campaigns presented provide in-depth analysis of protease properties and have identified principles that can be applied to improve or generate enzyme variants for industrial applications beyond laundry detergents.

  5. Bacterial proteases: targets for diagnostics and therapy.

    PubMed

    Kaman, W E; Hays, J P; Endtz, H P; Bikker, F J

    2014-07-01

    Proteases are essential for the proliferation and growth of bacteria, and are also known to contribute to bacterial virulence. This makes them interesting candidates as diagnostic and therapeutic targets for infectious diseases. In this review, the authors discuss the most recent developments and potential applications for bacterial proteases in the diagnosis and treatment of bacterial infections. Current and future bacterial protease targets are described and their limitations outlined.

  6. Nucleotide sequences encoding a thermostable alkaline protease

    DOEpatents

    Wilson, David B.; Lao, Guifang

    1998-01-01

    Nucleotide sequences, derived from a thermophilic actinomycete microorganism, which encode a thermostable alkaline protease are disclosed. Also disclosed are variants of the nucleotide sequences which encode a polypeptide having thermostable alkaline proteolytic activity. Recombinant thermostable alkaline protease or recombinant polypeptide may be obtained by culturing in a medium a host cell genetically engineered to contain and express a nucleotide sequence according to the present invention, and recovering the recombinant thermostable alkaline protease or recombinant polypeptide from the culture medium.

  7. Nucleotide sequences encoding a thermostable alkaline protease

    DOEpatents

    Wilson, D.B.; Lao, G.

    1998-01-06

    Nucleotide sequences, derived from a thermophilic actinomycete microorganism, which encode a thermostable alkaline protease are disclosed. Also disclosed are variants of the nucleotide sequences which encode a polypeptide having thermostable alkaline proteolytic activity. Recombinant thermostable alkaline protease or recombinant polypeptide may be obtained by culturing in a medium a host cell genetically engineered to contain and express a nucleotide sequence according to the present invention, and recovering the recombinant thermostable alkaline protease or recombinant polypeptide from the culture medium. 3 figs.

  8. Proteolytic crosstalk in multi-protease networks

    NASA Astrophysics Data System (ADS)

    Ogle, Curtis T.; Mather, William H.

    2016-04-01

    Processive proteases, such as ClpXP in E. coli, are conserved enzyme assemblies that can recognize and rapidly degrade proteins. These proteases are used for a number of purposes, including degrading mistranslated proteins and controlling cellular stress response. However, proteolytic machinery within the cell is limited in capacity and can lead to a bottleneck in protein degradation, whereby many proteins compete (‘queue’) for proteolytic resources. Previous work has demonstrated that such queueing can lead to pronounced statistical relationships between different protein counts when proteins compete for a single common protease. However, real cells contain many different proteases, e.g. ClpXP, ClpAP, and Lon in E. coli, and it is not clear how competition between proteins for multiple classes of protease would influence the dynamics of cellular networks. In the present work, we theoretically demonstrate that a multi-protease proteolytic bottleneck can substantially couple the dynamics for both simple and complex (oscillatory) networks, even between substrates with substantially different affinities for protease. For these networks, queueing often leads to strong positive correlations between protein counts, and these correlations are strongest near the queueing theoretic point of balance. Furthermore, we find that the qualitative behavior of these networks depends on the relative size of the absolute affinity of substrate to protease compared to the cross affinity of substrate to protease, leading in certain regimes to priority queue statistics.

  9. Proteases at work: cues for understanding neural development and degeneration

    PubMed Central

    Saftig, Paul; Bovolenta, Paola

    2015-01-01

    Proteolytical processing of membrane bound molecules is a fundamental mechanism for the degradation of these proteins as well as for controlling cell-to-cell communication, which is at the basis of tissue development and homeostasis. Members of families of metalloproteinases and intra-membrane proteases are major effectors of these events. A recent workshop in Baeza, Spain, was devoted to discuss how this mechanism coordinates brain development and how its dysfunction leads to brain pathologies. Herein we summarize the findings presented during this workshop, which illuminate the role of metalloproteinases, including matrix metalloproteinase, A Disintegrin and Metalloproteinase-proteases and intra-membrane proteases, in the regulation of neurogenesis, axon guidance, and synaptogenesis as well as in neurodegeneration. Indeed, there is increasing evidence that proteolysis at the membrane is directly linked to neuropathologies such as Alzheimer Disease and autism spectrum or prion disorders. These proteolytic events are tightly regulated and we are just at the beginning of understanding how these processes could be exploited to design therapeutic treatments aimed at alleviating psychiatric and neurodegenerative pathologies. PMID:25999813

  10. The Degradome database: expanding roles of mammalian proteases in life and disease

    PubMed Central

    Pérez-Silva, José G.; Español, Yaiza; Velasco, Gloria; Quesada, Víctor

    2016-01-01

    Since the definition of the degradome as the complete repertoire of proteases in a given organism, the combined effort of numerous laboratories has greatly expanded our knowledge of its roles in biology and pathology. Once the genomic sequences of several important model organisms were made available, we presented the Degradome database containing the curated sets of known protease genes in human, chimpanzee, mouse and rat. Here, we describe the updated Degradome database, featuring 81 new protease genes and 7 new protease families. Notably, in this short time span, the number of known hereditary diseases caused by mutations in protease genes has increased from 77 to 119. This increase reflects the growing interest on the roles of the degradome in multiple diseases, including cancer and ageing. Finally, we have leveraged the widespread adoption of new webtools to provide interactive graphic views that show information about proteases in the global context of the degradome. The Degradome database can be accessed through its web interface at http://degradome.uniovi.es. PMID:26553809

  11. The Degradome database: expanding roles of mammalian proteases in life and disease.

    PubMed

    Pérez-Silva, José G; Español, Yaiza; Velasco, Gloria; Quesada, Víctor

    2016-01-04

    Since the definition of the degradome as the complete repertoire of proteases in a given organism, the combined effort of numerous laboratories has greatly expanded our knowledge of its roles in biology and pathology. Once the genomic sequences of several important model organisms were made available, we presented the Degradome database containing the curated sets of known protease genes in human, chimpanzee, mouse and rat. Here, we describe the updated Degradome database, featuring 81 new protease genes and 7 new protease families. Notably, in this short time span, the number of known hereditary diseases caused by mutations in protease genes has increased from 77 to 119. This increase reflects the growing interest on the roles of the degradome in multiple diseases, including cancer and ageing. Finally, we have leveraged the widespread adoption of new webtools to provide interactive graphic views that show information about proteases in the global context of the degradome. The Degradome database can be accessed through its web interface at http://degradome.uniovi.es.

  12. Modeling of protease I collagenolytic enzyme from the fiddler crab Uca pugilator

    NASA Astrophysics Data System (ADS)

    Arnoux, B.; Lecroisey, A.; Ducruix, A.

    1990-06-01

    Collagenolytic protease I from the fiddler crab Uca pugilator belongs to the serine proteases of the trypsin family. A graphic molecular model was built using information from sequences and X-ray structures of four homologous proteins which were superimposed to define structurally conserved regions. Protease I sequence was aligned, with sequences of the model proteins, without permitting any deletion or insertion in these regions. Elastase α-carbon chain was selected as a template molecule. For the structurally variable regions, fragments of the four homologous proteins which were `closest' in sequence were selected. Intramolecular steric hindrance, that resulted from the substitution of the residues of the templates by protease I residues, was corrected by adjustment of the side-chain conformational angles. The model was then optimized by energy minimization. The primary specificity pocket in the model of collagenolytic protease I predicts a substrate preference for both P1 hydrophobic and positively charged residues which is in agreement with the biochemical observations. As soybean trypsin inhibitor (STI) is known to inhibit collagenolytic protease I, a tentative model of the complex was constructed and possibilities of interaction examined.

  13. Purification and characterization of a novel extracellular alkaline protease from Cellulomonas bogoriensis.

    PubMed

    Li, Fan; Yang, Liyuan; Lv, Xue; Liu, Dongbo; Xia, Hongmei; Chen, Shan

    2016-05-01

    An extracellular alkaline protease produced by the alkali-tolerant Cellulomonas bogoriensis was purified by a combination of ammonium sulfate precipitation and cation exchange chromatography. The purity of the protease was detected by sodium dodecyl sulfate-polyacrylamide gel electrophoresis, and its molecular weight was confirmed to be 18.3 kDa. The enzyme showed optimum activity at 60 °C and pH 11. The stability of the protease was maintained at a wide temperature range of 4-60 °C and pH range of 3-12. Irreversible inhibition of the enzyme activity by phenylmethylsulfonyl fluoride and tosyl-l-phenylalanine chloromethyl ketone demonstrated that the purified enzyme is a chymotrypsin of the serine protease family. The Km and Vmax of the protease activity on casein were 19.2 mg/mL and 25000 μg/min/mg, respectively. The broad substrate specificity and remarkable stability in the presence of organic solvents, salt, and commercial detergents, as well as its excellent stain removal and dehairing capability, make the purified alkaline protease a promising candidate for industrial applications.

  14. Purification and characterization of a prothrombin-activating protease from Nephila clavata.

    PubMed

    Joo, Han-Seung; Park, Gun-Chun; Cho, Woo Ri; Tak, Eunsik; Paik, Seung R; Chang, Chung-Soon

    2002-03-01

    We report upon the purification and characterization of a novel prothrombin-activating enzyme from the body fluid (total homogenates of isolated digestive tract without eggs, spinnerets and silk glands) of the spider, Nephila clavata by a combination of acetone fractionation, ion exchange, and Soybean trypsin inhibitor-Sepharose chromatography. Analysis of the purified enzyme with SDS-PAGE and gel filtration revealed a single polypeptide chain with an apparent molecular weight of 24kDa. The proteolytic activity of the enzyme was stable up to 50 degrees C, however, it became unstable over 55 degrees C. The enzyme had an optimum pH of 8, and Ca(2+) was not required for the enzyme activity. According to inhibition profiles obtained with several serine protease inhibitors such as PMSF and benzamidine, the purified protease is a member of the serine proteases. Bz-Ile-Glu(gamma-OR)- Gly-Arg-pNA and Z-Arg-Gly-Arg-pNA which are known as substrates for factor Xa, were hydrolyzed favorably by the enzyme. And the Nephila protease could produce thrombin from prothrombin at nM range, and form the turbid ring using fibrinogen-agarose plate. The results obtained confirmed that the purified protease is a potent prothrombin-activating activity belonging to the family of serine protease.

  15. Bacterial proteases from the intracellular vacuole niche; protease conservation and adaptation for pathogenic advantage.

    PubMed

    Huston, Wilhelmina M

    2010-06-01

    Proteases with important roles for bacterial pathogens that specifically reside within intracellular vacuoles are frequently homologous to those that have important virulence functions for other bacteria. Research has identified that some of these conserved proteases have evolved specialized functions for intracellular vacuole-residing bacteria. Unique proteases with pathogenic functions have also been described from Chlamydia, Mycobacteria, and Legionella. These findings suggest that there are further novel functions for proteases from these bacteria that remain to be described. This review summarizes the recent findings of novel protease functions from the intracellular human pathogenic bacteria that reside exclusively in vacuoles.

  16. Lysosomal cysteine proteases: structure, function and inhibition of cathepsins.

    PubMed

    Roberts, Rebecca

    2005-12-01

    Lysosomal cysteine proteases, a subgroup of the cathepsin family, are critical for normal cellular functions such as general protein turnover, antigen processing and bone remodeling. In the past decade, the number of identified human cathepsins has more than doubled and their known role in several pathologies has expanded rapidly. Increased understanding of the structure and mechanism of this class of enzymes has brought on a new fervor in the design of small molecule inhibitors with the hope of producing specific, therapeutic drugs for diseases such as arthritis, allergy, multiple sclerosis, atherosclerosis, Alzheimer's disease and cancer.

  17. Genome-wide identification, evolutuionary and expression analysis of aspartic proteases gene superfamily in grape

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Aspartic proteases (APs) are a large family of proteolytic enzymes in vertebrates, plants, yeast, nematodes, parasites, fungi, and viruses. In plants, they are involved in many biological processes, such as plant senescence, stress response, programmed cell death, and reproduction. Prior to the pr...

  18. Protease-degradable electrospun fibrous hydrogels

    NASA Astrophysics Data System (ADS)

    Wade, Ryan J.; Bassin, Ethan J.; Rodell, Christopher B.; Burdick, Jason A.

    2015-03-01

    Electrospun nanofibres are promising in biomedical applications to replicate features of the natural extracellular matrix (ECM). However, nearly all electrospun scaffolds are either non-degradable or degrade hydrolytically, whereas natural ECM degrades proteolytically, often through matrix metalloproteinases. Here we synthesize reactive macromers that contain protease-cleavable and fluorescent peptides and are able to form both isotropic hydrogels and electrospun fibrous hydrogels through a photoinitiated polymerization. These biomimetic scaffolds are susceptible to protease-mediated cleavage in vitro in a protease dose-dependent manner and in vivo in a subcutaneous mouse model using transdermal fluorescent imaging to monitor degradation. Importantly, materials containing an alternate and non-protease-cleavable peptide sequence are stable in both in vitro and in vivo settings. To illustrate the specificity in degradation, scaffolds with mixed fibre populations support selective fibre degradation based on individual fibre degradability. Overall, this represents a novel biomimetic approach to generate protease-sensitive fibrous scaffolds for biomedical applications.

  19. Structure of the Autocatalytic Cysteine Protease Domain of Potyvirus Helper-component Proteinase*

    PubMed Central

    Guo, Bihong; Lin, Jinzhong; Ye, Keqiong

    2011-01-01

    The helper-component proteinase (HC-Pro) of potyvirus is involved in polyprotein processing, aphid transmission, and suppression of antiviral RNA silencing. There is no high resolution structure reported for any part of HC-Pro, hindering mechanistic understanding of its multiple functions. We have determined the crystal structure of the cysteine protease domain of HC-Pro from turnip mosaic virus at 2.0 Å resolution. As a protease, HC-Pro only cleaves a Gly-Gly dipeptide at its own C terminus. The structure represents a postcleavage state in which the cleaved C terminus remains tightly bound at the active site cleft to prevent trans activity. The structure adopts a compact α/β-fold, which differs from papain-like cysteine proteases and shows weak similarity to nsP2 protease from Venezuelan equine encephalitis alphavirus. Nevertheless, the catalytic cysteine and histidine residues constitute an active site that is highly similar to these in papain-like and nsP2 proteases. HC-Pro recognizes a consensus sequence YXVGG around the cleavage site between the two glycine residues. The structure delineates the sequence specificity at sites P1–P4. Structural modeling and covariation analysis across the Potyviridae family suggest a tryptophan residue accounting for the glycine specificity at site P1′. Moreover, a surface of the protease domain is conserved in potyvirus but not in other genera of the Potyviridae family, likely due to extra functional constrain. The structure provides insight into the catalysis mechanism, cis-acting mode, cleavage site specificity, and other functions of the HC-Pro protease domain. PMID:21543324

  20. Propeptides of eukaryotic proteases encode histidines to exploit organelle pH for regulation.

    PubMed

    Elferich, Johannes; Williamson, Danielle M; Krishnamoorthy, Bala; Shinde, Ujwal

    2013-08-01

    Eukaryotic cells maintain strict control over protein secretion, in part by using the pH gradient maintained within their secretory pathway. How eukaryotic proteins evolved from prokaryotic orthologs to exploit the pH gradient for biological functions remains a fundamental question in cell biology. Our laboratory previously demonstrated that protein domains located within precursor proteins, propeptides, encode histidine-driven pH sensors to regulate organelle-specific activation of the eukaryotic proteases furin and proprotein convertase-1/3. Similar findings have been reported in other unrelated protease families. By analyzing >10,000 unique proteases within evolutionarily unrelated families, we show that eukaryotic propeptides are enriched in histidines compared with prokaryotic orthologs. On this basis, we hypothesize that eukaryotic proteins evolved to enrich histidines within their propeptides to exploit the tightly controlled pH gradient of the secretory pathway, thereby regulating activation within specific organelles. Enrichment of histidines in propeptides may therefore be used to predict the presence of pH sensors in other proteases or even protease substrates.

  1. Protease and Protease-Activated Receptor-2 Signaling in the Pathogenesis of Atopic Dermatitis

    PubMed Central

    Lee, Sang Eun; Jeong, Se Kyoo

    2010-01-01

    Proteases in the skin are essential to epidermal permeability barrier homeostasis. In addition to their direct proteolytic effects, certain proteases signal to cells by activating protease-activated receptors (PARs), the G-protein-coupled receptors. The expression of functional PAR-2 on human skin and its role in inflammation, pruritus, and skin barrier homeostasis have been demonstrated. Atopic dermatitis (AD) is a multifactorial inflammatory skin disease characterized by genetic barrier defects and allergic inflammation, which is sustained by gene-environmental interactions. Recent studies have revealed aberrant expression and activation of serine proteases and PAR-2 in the lesional skin of AD patients. The imbalance between proteases and protease inhibitors associated with genetic defects in the protease/protease inhibitor encoding genes, increase in skin surface pH, and exposure to proteolytically active allergens contribute to this aberrant protease/PAR-2 signaling in AD. The increased protease activity in AD leads to abnormal desquamation, degradation of lipid-processing enzymes and antimicrobial peptides, and activation of primary cytokines, thereby leading to permeability barrier dysfunction, inflammation, and defects in the antimicrobial barrier. Moreover, up-regulated proteases stimulate PAR-2 in lesional skin of AD and lead to the production of cytokines and chemokines involved in inflammation and immune responses, itching sensation, and sustained epidermal barrier perturbation with easier allergen penetration. In addition, PAR-2 is an important sensor for exogenous danger molecules, such as exogenous proteases from various allergens, and plays an important role in AD pathogenesis. Together, these findings suggest that protease activity or PAR-2 may be a future target for therapeutic intervention for the treatment of AD. PMID:20879045

  2. Protease and protease-activated receptor-2 signaling in the pathogenesis of atopic dermatitis.

    PubMed

    Lee, Sang Eun; Jeong, Se Kyoo; Lee, Seung Hun

    2010-11-01

    Proteases in the skin are essential to epidermal permeability barrier homeostasis. In addition to their direct proteolytic effects, certain proteases signal to cells by activating protease-activated receptors (PARs), the G-protein-coupled receptors. The expression of functional PAR-2 on human skin and its role in inflammation, pruritus, and skin barrier homeostasis have been demonstrated. Atopic dermatitis (AD) is a multifactorial inflammatory skin disease characterized by genetic barrier defects and allergic inflammation, which is sustained by gene-environmental interactions. Recent studies have revealed aberrant expression and activation of serine proteases and PAR-2 in the lesional skin of AD patients. The imbalance between proteases and protease inhibitors associated with genetic defects in the protease/protease inhibitor encoding genes, increase in skin surface pH, and exposure to proteolytically active allergens contribute to this aberrant protease/ PAR-2 signaling in AD. The increased protease activity in AD leads to abnormal desquamation, degradation of lipid-processing enzymes and antimicrobial peptides, and activation of primary cytokines, thereby leading to permeability barrier dysfunction, inflammation, and defects in the antimicrobial barrier. Moreover, up-regulated proteases stimulate PAR-2 in lesional skin of AD and lead to the production of cytokines and chemokines involved in inflammation and immune responses, itching sensation, and sustained epidermal barrier perturbation with easier allergen penetration. In addition, PAR-2 is an important sensor for exogenous danger molecules, such as exogenous proteases from various allergens, and plays an important role in AD pathogenesis. Together, these findings suggest that protease activity or PAR-2 may be a future target for therapeutic intervention for the treatment of AD.

  3. A biotechnology perspective of fungal proteases

    PubMed Central

    de Souza, Paula Monteiro; Bittencourt, Mona Lisa de Assis; Caprara, Carolina Canielles; de Freitas, Marcela; de Almeida, Renata Paula Coppini; Silveira, Dâmaris; Fonseca, Yris Maria; Ferreira, Edivaldo Ximenes; Pessoa, Adalberto; Magalhães, Pérola Oliveira

    2015-01-01

    Proteases hydrolyze the peptide bonds of proteins into peptides and amino acids, being found in all living organisms, and are essential for cell growth and differentiation. Proteolytic enzymes have potential application in a wide number of industrial processes such as food, laundry detergent and pharmaceutical. Proteases from microbial sources have dominated applications in industrial sectors. Fungal proteases are used for hydrolyzing protein and other components of soy beans and wheat in soy sauce production. Proteases can be produced in large quantities in a short time by established methods of fermentation. The parameters such as variation in C/N ratio, presence of some sugars, besides several other physical factors are important in the development of fermentation process. Proteases of fungal origin can be produced cost effectively, have an advantage faster production, the ease with which the enzymes can be modified and mycelium can be easily removed by filtration. The production of proteases has been carried out using submerged fermentation, but conditions in solid state fermentation lead to several potential advantages for the production of fungal enzymes. This review focuses on the production of fungal proteases, their distribution, structural-functional aspects, physical and chemical parameters, and the use of these enzymes in industrial applications. PMID:26273247

  4. A biotechnology perspective of fungal proteases.

    PubMed

    de Souza, Paula Monteiro; Bittencourt, Mona Lisa de Assis; Caprara, Carolina Canielles; de Freitas, Marcela; de Almeida, Renata Paula Coppini; Silveira, Dâmaris; Fonseca, Yris Maria; Ferreira Filho, Edivaldo Ximenes; Pessoa Junior, Adalberto; Magalhães, Pérola Oliveira

    2015-06-01

    Proteases hydrolyze the peptide bonds of proteins into peptides and amino acids, being found in all living organisms, and are essential for cell growth and differentiation. Proteolytic enzymes have potential application in a wide number of industrial processes such as food, laundry detergent and pharmaceutical. Proteases from microbial sources have dominated applications in industrial sectors. Fungal proteases are used for hydrolyzing protein and other components of soy beans and wheat in soy sauce production. Proteases can be produced in large quantities in a short time by established methods of fermentation. The parameters such as variation in C/N ratio, presence of some sugars, besides several other physical factors are important in the development of fermentation process. Proteases of fungal origin can be produced cost effectively, have an advantage faster production, the ease with which the enzymes can be modified and mycelium can be easily removed by filtration. The production of proteases has been carried out using submerged fermentation, but conditions in solid state fermentation lead to several potential advantages for the production of fungal enzymes. This review focuses on the production of fungal proteases, their distribution, structural-functional aspects, physical and chemical parameters, and the use of these enzymes in industrial applications.

  5. Regulation of protease production in Clostridium sporogenes.

    PubMed Central

    Allison, C; Macfarlane, G T

    1990-01-01

    The physiological and nutritional factors that regulate protease synthesis in Clostridium sporogenes C25 were studied in batch and continuous cultures. Formation of extracellular proteases occurred at the end of active growth and during the stationary phase in batch cultures. Protease production was inversely related to growth rate in glucose-excess and glucose-limited chemostats over the range D = 0.05 to 0.70 h-1. In pulse experiments, glucose, ammonia, phosphate, and some amino acids (tryptophan, proline, tyrosine, and isoleucine) strongly repressed protease synthesis. This repression was not relieved by addition of 4 mM cyclic AMP, cyclic GMP, or dibutyryl cyclic AMP. Protease formation was markedly inhibited by 4 mM ATP and ADP, but GTP and GDP had little effect on the process. It is concluded that protease production by C. sporogenes is strongly influenced by the amount of energy available to the cells, with the highest levels of protease synthesis occurring under energy-limiting conditions. PMID:2268158

  6. Cysteine Proteases from Bloodfeeding Arthropod Ectoparasites

    PubMed Central

    Sojka, Daniel; Francischetti, Ivo M. B.; Calvo, Eric; Kotsyfakis, Michalis

    2012-01-01

    Cysteine proteases have been discovered in various bloodfeeding ectoparasites. Here, we assemble the available information about the function of these peptidases and reveal their role in hematophagy and parasite development. While most of the data shed light on key proteolytic events that play a role in arthropod physiology, we also report on the association of cysteine proteases with arthropod vectorial capacity. With emphasis on ticks, specifically Ixodes ricinus, we finally propose a model about the contribution of cysteine peptidases to blood digestion, and how their concerted action with other tick midgut proteases leads to the absorbance of nutrients by the midgut epithelial cells. PMID:21660665

  7. Protease and protease inhibitory activity in pregnant and postpartum involuting uterus

    SciTech Connect

    Milwidsky, A.; Beller, U.; Palti, Z.; Mayer, M.

    1982-08-15

    The presence of two distinct proteolytic activities in the rat uterus was confirmed with /sup 14/C-labeled globin used as a sensitive protein substrate and following release of label into the trichloroacetic acid-soluble supernatant fraction. Protease I is a cytoplasmic acid protease while protease II is associated with the pellet fraction, can be extracted by 0.6 M sodium chloride, and is active at pH 7.0. Protease I activity is low during pregnancy and markedly increases at term achieving maximal activity at day 3 post partum with a subsequent decline to preterm activity values. Lactation did not affect the uterine protease I activity. Protease II activity is not significantly different during pregnancy, at term, and post partum. The presence of an inhibitor of protease I was suggested by a decrease in enzyme activity with an increased cytosolic protein concentration. The inhibitor also lessened bovine trypsin activity but had no effect on protease II. Although its inhibitory potency on trypsin fluctuated during the various uterine physiologic stages, these changes appeared to be statistically insignificant. Human uterine samples were also found to contain the two protease activities with similar changes in protease I post partum. It is suggested that, both in the rat and in man, uterine involution post partum is associated with a marked increase in activity of acid cytosolic protease, while a particulate neutral protease and a soluble inhibitor of trypsin, which are also present in uterine cells, do not appear to play a significant role in the dissolution of uterine tissues after parturition.

  8. Isolation and characterization of two serine proteases from metagenomic libraries of the Gobi and Death Valley deserts.

    PubMed

    Neveu, Julie; Regeard, Christophe; DuBow, Michael S

    2011-08-01

    The screening of environmental DNA metagenome libraries for functional activities can provide an important source of new molecules and enzymes. In this study, we identified 17 potential protease-producing clones from two metagenomic libraries derived from samples of surface sand from the Gobi and Death Valley deserts. Two of the proteases, DV1 and M30, were purified and biochemically examined. These two proteases displayed a molecular mass of 41.5 kDa and 45.7 kDa, respectively, on SDS polyacrylamide gels. Alignments with known protease sequences showed less than 55% amino acid sequence identity. These two serine proteases appear to belong to the subtilisin (S8A) family and displayed several unique biochemical properties. Protease DV1 had an optimum pH of 8 and an optimal activity at 55°C, while protease M30 had an optimum pH >11 and optimal activity at 40°C. The properties of these enzymes make them potentially useful for biotechnological applications and again demonstrate that metagenomic approaches can be useful, especially when coupled with the study of novel environments such as deserts.

  9. An Alkaline Protease from Bacillus pumilus MP 27: Functional Analysis of Its Binding Model toward Its Applications As Detergent Additive

    PubMed Central

    Baweja, Mehak; Tiwari, Rameshwar; Singh, Puneet K.; Nain, Lata; Shukla, Pratyoosh

    2016-01-01

    A proteolytic strain of Bacillus pumilus MP 27 was isolated from water samples of Southern ocean produced alkaline protease. Since protease production need expensive ingredients, an economically viable process was developed by using low cost carbon source, wheat straw, supplemented with peptone. This protease was active within temperature ranges 10–70°C at pH 9. This process was optimized by response surface methodology using a Box Bekhman design by Design Expert 7.0 software that increased the protease activity to 776.5 U/ml. Moreover, the enzyme was extremely stable at a broad range of temperature and pH retaining 69% of its activity at 50°C and 70% at pH 11. The enzyme exhibited excellent compatibility with surfactants and commercial detergents, showing 87% stability with triton X-100 and 100% stability with Tide commercial detergent. The results of the wash performance analysis demonstrated considerably good de-staining at 50 and 4°C with low supplementation (109 U/ml). Molecular modeling of the protease revealed the presence of serine proteases, subtilase family and serine active site and further docking supported the association of catalytic site with the various substrates. Certainly, such protease can be considered as a good detergent additive in detergent industry with a possibility to remove the stains effectively even in a cold wash. PMID:27536284

  10. Presenilin-like GxGD membrane proteases have dual roles as proteolytic enzymes and ion channels.

    PubMed

    Kuo, Ivana Y; Hu, Jian; Ha, Ya; Ehrlich, Barbara E

    2015-03-06

    The GxGD proteases function to cleave protein substrates within the membrane. As these proteases contain multiple transmembrane domains typical of ion channels, we examined if GxGD proteases also function as ion channels. We tested the putative dual function by examining two archeobacterial GxGD proteases (PSH and FlaK), with known three-dimensional structures. Both are in the same GxGD family as presenilin, a protein mutated in Alzheimer Disease. Here, we demonstrate that PSH and FlaK form cation channels in lipid bilayers. A mutation that affected the enzymatic activity of FlaK rendered the channel catalytically inactive and altered the ion selectivity, indicating that the ion channel and the catalytic activities are linked. We report that the GxGD proteases, PSH and FlaK, are true "chanzymes" with interdependent ion channel and protease activity conferred by a single structural domain embedded in the membrane, supporting the proposal that higher-order proteases, including presenilin, have channel function.

  11. Immune evasion by pathogenic Leptospira strains: the secretion of proteases that directly cleave complement proteins.

    PubMed

    Fraga, Tatiana Rodrigues; Courrol, Daniella Dos Santos; Castiblanco-Valencia, Mónica Marcela; Hirata, Izaura Yoshico; Vasconcellos, Sílvio Arruda; Juliano, Luiz; Barbosa, Angela Silva; Isaac, Lourdes

    2014-03-01

    Leptospirosis is an infectious disease of public health importance. To successfully colonize the host, pathogens have evolved multiple strategies to escape the complement system. Here we demonstrate that the culture supernatant of pathogenic but not saprophytic Leptospira inhibit the three complement pathways. We showed that the proteolytic activity in the supernatants of pathogenic strains targets the central complement molecule C3 and specific proteins from each pathway, such as factor B, C2, and C4b. The proteases cleaved α and β chains of C3 and work in synergy with host regulators to inactivate C3b. Proteolytic activity was inhibited by 1,10-phenanthroline, suggesting the participation of metalloproteases. A recombinant leptospiral metalloprotease from the thermolysin family cleaved C3 in serum and could be one of the proteases responsible for the supernatant activity. We conclude that pathogenic leptospiral proteases can deactivate immune effector molecules and represent potential targets to the development of new therapies in leptospirosis.

  12. A cysteine protease isolated from the latex of Ficus microcarpa: purification and biochemical characterization.

    PubMed

    Mnif, Ibtissem Hamza; Siala, Rayda; Nasri, Rim; Mhamdi, Samiha; Nasri, Moncef; Kamoun, Alya Sellami

    2015-02-01

    A plant protease named microcarpain was purified from the latex of Ficus microcarpa by acetonic (20-40 % saturation) precipitation, Sephadex G-75 filtration, and Mono Q-Sefinose FF chromatography. The protease was purified with a yield of 9.25 % and a purification factor of 8. The molecular weight of the microcarpain was estimated to be 20 kDa by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE). The purified enzyme showed maximum activity at pH 8.0 and at a temperature of 70 °C. Proteolytic activity was strongly inhibited by dithio-bis-nitrobenzoic acid (DTNB), Hg(2+), and Cu(2+). The N-terminal amino acid sequence of the purified microcarpain "VPETVDWRSKGAV" showed high homology with a protease from Arabidopsis thaliana. Inhibition studies and N-terminal sequence classified the enzyme as a member of the cysteine peptidases family.

  13. Role of cockroach proteases in allergic disease.

    PubMed

    Page, Kristen

    2012-10-01

    Allergic asthma is on the rise in developed countries, and cockroach exposure is a major risk factor for the development of asthma. In recent years, a number of studies have investigated the importance of allergen-associated proteases in modulating allergic airway inflammation. Many of the studies have suggested the importance of allergen-associated proteases as having a direct role on airway epithelial cells and dendritic cells. In most cases, activation of the protease activated receptor (PAR)-2 has been implicated as a mechanism behind the potent allergenicity associated with cockroaches. In this review, we focus on recent evidence linking cockroach proteases to activation of a variety of cells important in allergic airway inflammation and the role of PAR-2 in this process. We will highlight recent data exploring the potential mechanisms involved in the biological effects of the allergen.

  14. Structural and Functional Characterization of Cleavage and Inactivation of Human Serine Protease Inhibitors by the Bacterial SPATE Protease EspPα from Enterohemorrhagic E. coli

    PubMed Central

    Weiss, André; Joerss, Hanna; Brockmeyer, Jens

    2014-01-01

    EspPα and EspI are serine protease autotransporters found in enterohemorrhagic Escherichia coli. They both belong to the SPATE autotransporter family and are believed to contribute to pathogenicity via proteolytic cleavage and inactivation of different key host proteins during infection. Here, we describe the specific cleavage and functional inactivation of serine protease inhibitors (serpins) by EspPα and compare this activity with the related SPATE EspI. Serpins are structurally related proteins that regulate vital protease cascades, such as blood coagulation and inflammatory host response. For the rapid determination of serpin cleavage sites, we applied direct MALDI-TOF-MS or ESI-FTMS analysis of coincubations of serpins and SPATE proteases and confirmed observed cleavage positions using in-gel-digest of SDS-PAGE-separated degradation products. Activities of both serpin and SPATE protease were assessed in a newly developed photometrical assay using chromogenic peptide substrates. EspPα cleaved the serpins α1-protease inhibitor (α1-PI), α1-antichymotrypsin, angiotensinogen, and α2-antiplasmin. Serpin cleavage led to loss of inhibitory function as demonstrated for α1-PI while EspPα activity was not affected. Notably, EspPα showed pronounced specificity and cleaved procoagulatory serpins such as α2-antiplasmin while the anticoagulatory antithrombin III was not affected. Together with recently published research, this underlines the interference of EspPα with hemostasis or inflammatory responses during infection, while the observed interaction of EspI with serpins is likely to be not physiologically relevant. EspPα-mediated serpin cleavage occurred always in flexible loops, indicating that this structural motif might be required for substrate recognition. PMID:25347319

  15. Cysteine protease antigens cleave CD123, the α subunit of murine IL-3 receptor, on basophils and suppress IL-3-mediated basophil expansion

    SciTech Connect

    Nishikado, Hideto; Fujimura, Tsutomu; Taka, Hikari; Mineki, Reiko; Ogawa, Hideoki; Okumura, Ko; Takai, Toshiro

    2015-05-01

    Th2 type immune responses are essential for protective immunity against parasites and play crucial roles in allergic disorders. Helminth parasites secrete a variety of proteases for their infectious cycles including for host entry, tissue migration, and suppression of host immune effector cell function. Furthermore, a number of pathogen-derived antigens, as well as allergens such as papain, belong to the family of cysteine proteases. Although the link between protease activity and Th2 type immunity is well documented, the mechanisms by which proteases regulate host immune responses are largely unknown. Here, we demonstrate that the cysteine proteases papain and bromelain selectively cleave the α subunit of the IL-3 receptor (IL-3Rα/CD123) on the surface of murine basophils. The decrease in CD123 expression on the cell surface, and the degradation of the extracellular domain of recombinant CD123 were dependent on the protease activity of papain and bromelain. Pre-treatment of murine basophils with papain resulted in inhibition of IL-3-IL-3R signaling and suppressed IL-3- but not thymic stromal lymphopoietin-induced expansion of basophils in vitro. Our unexpected findings illuminate a novel mechanism for the regulation of basophil functions by protease antigens. Because IL-3 plays pivotal roles in the activation and proliferation of basophils and in protective immunity against helminth parasites, pathogen-derived proteases might contribute to the pathogenesis of infections by regulating IL-3-mediated functions in basophils. - Highlights: • We identified the murine IL3R as a novel target of papain-family cysteine proteases. • Papain-family cysteine proteases cleaved IL3Rα/CD123 on murine basophils. • Papain suppressed IL3- but not TSLP-induced expansion of murine basophils. • The inactivation of IL3R might be a strategy for pathogens to suppress host immunity.

  16. Protease Mediated Anti-Cancer Therapy

    DTIC Science & Technology

    2006-08-01

    anticancer therapy and focal light illumination is expected to be an effective treatment with reduced phototoxicity given the quenched state of the...to months following photodynamic therapy (PDT). Herein, we report a novel design of protease-mediated photosensitization by which phototoxicity can...W81XWH-05-1-0515 TITLE: Protease Mediated Anti-Cancer Therapy PRINCIPAL INVESTIGATOR: Ching-Hsuan Tung CONTRACTING ORGANIZATION

  17. Comparative genomic analysis of aspartic proteases in eight parasitic platyhelminths: insights into functions and evolution.

    PubMed

    Wang, Shuai; Wei, Wei; Luo, Xuenong; Wang, Sen; Hu, Songnian; Cai, Xuepeng

    2015-03-15

    We performed genome-wide identifications and comparative genomic analyses of the predicted aspartic proteases (APs) from eight parasitic flatworms, focusing on their evolution, potentials as drug targets and expression patterns. The results revealed that: i) More members of family A01 were identified from the schistosomes than from the cestodes; some evidence implied gene loss events along the class Cestoda, which may be related to the different ways to ingest host nutrition; ii) members in family A22 were evolutionarily highly conserved among all the parasites; iii) one retroviral-like AP in family A28 shared a highly similar predicted 3D structure with the HIV protease, implying its potential to be inhibited by HIV inhibitor-like molecules; and iiii) retrotransposon-associated APs were extensively expanded among these parasites. These results implied that the evolutionary histories of some APs in these parasites might relate to adaptations to their parasitism and some APs might have potential serving as intervention targets.

  18. The serine protease domain of MASP-3: enzymatic properties and crystal structure in complex with ecotin.

    PubMed

    Gaboriaud, Christine; Gupta, Rajesh Kumar; Martin, Lydie; Lacroix, Monique; Serre, Laurence; Teillet, Florence; Arlaud, Gérard J; Rossi, Véronique; Thielens, Nicole M

    2013-01-01

    Mannan-binding lectin (MBL), ficolins and collectin-11 are known to associate with three homologous modular proteases, the MBL-Associated Serine Proteases (MASPs). The crystal structures of the catalytic domains of MASP-1 and MASP-2 have been solved, but the structure of the corresponding domain of MASP-3 remains unknown. A link between mutations in the MASP1/3 gene and the rare autosomal recessive 3MC (Mingarelli, Malpuech, Michels and Carnevale,) syndrome, characterized by various developmental disorders, was discovered recently, revealing an unexpected important role of MASP-3 in early developmental processes. To gain a first insight into the enzymatic and structural properties of MASP-3, a recombinant form of its serine protease (SP) domain was produced and characterized. The amidolytic activity of this domain on fluorescent peptidyl-aminomethylcoumarin substrates was shown to be considerably lower than that of other members of the C1r/C1s/MASP family. The E. coli protease inhibitor ecotin bound to the SP domains of MASP-3 and MASP-2, whereas no significant interaction was detected with MASP-1, C1r and C1s. A tetrameric complex comprising an ecotin dimer and two MASP-3 SP domains was isolated and its crystal structure was solved and refined to 3.2 Å. Analysis of the ecotin/MASP-3 interfaces allows a better understanding of the differential reactivity of the C1r/C1s/MASP protease family members towards ecotin, and comparison of the MASP-3 SP domain structure with those of other trypsin-like proteases yields novel hypotheses accounting for its zymogen-like properties in vitro.

  19. The Serine Protease Domain of MASP-3: Enzymatic Properties and Crystal Structure in Complex with Ecotin

    PubMed Central

    Gaboriaud, Christine; Gupta, Rajesh Kumar; Martin, Lydie; Lacroix, Monique; Serre, Laurence; Teillet, Florence; Arlaud, Gérard J.; Rossi, Véronique; Thielens, Nicole M.

    2013-01-01

    Mannan-binding lectin (MBL), ficolins and collectin-11 are known to associate with three homologous modular proteases, the MBL-Associated Serine Proteases (MASPs). The crystal structures of the catalytic domains of MASP-1 and MASP-2 have been solved, but the structure of the corresponding domain of MASP-3 remains unknown. A link between mutations in the MASP1/3 gene and the rare autosomal recessive 3MC (Mingarelli, Malpuech, Michels and Carnevale,) syndrome, characterized by various developmental disorders, was discovered recently, revealing an unexpected important role of MASP-3 in early developmental processes. To gain a first insight into the enzymatic and structural properties of MASP-3, a recombinant form of its serine protease (SP) domain was produced and characterized. The amidolytic activity of this domain on fluorescent peptidyl-aminomethylcoumarin substrates was shown to be considerably lower than that of other members of the C1r/C1s/MASP family. The E. coli protease inhibitor ecotin bound to the SP domains of MASP-3 and MASP-2, whereas no significant interaction was detected with MASP-1, C1r and C1s. A tetrameric complex comprising an ecotin dimer and two MASP-3 SP domains was isolated and its crystal structure was solved and refined to 3.2 Å. Analysis of the ecotin/MASP-3 interfaces allows a better understanding of the differential reactivity of the C1r/C1s/MASP protease family members towards ecotin, and comparison of the MASP-3 SP domain structure with those of other trypsin-like proteases yields novel hypotheses accounting for its zymogen-like properties in vitro. PMID:23861840

  20. Acid protease production in fungal root endophytes.

    PubMed

    Mayerhofer, Michael S; Fraser, Erica; Kernaghan, Gavin

    2015-01-01

    Fungal endophytes are ubiquitous in healthy root tissue, but little is known about their ecosystem functions, including their ability to utilize organic nutrient sources such as proteins. Root-associated fungi may secrete proteases to access the carbon and mineral nutrients within proteins in the soil or in the cells of their plant host. We compared the protein utilization patterns of multiple isolates of the root endophytes Phialocephala fortinii s.l., Meliniomyces variabilis and Umbelopsis isabellina with those of two ectomycorrhizal (ECM) fungi, Hebeloma incarnatulum and Laccaria bicolor, and the wood-decay fungus Irpex lacteus at pH values of 2-9 on liquid BSA media. We also assessed protease activity using a fluorescently labeled casein assay and gelatin zymography and characterized proteases using specific protease inhibitors. I. lacteus and U. isabellina utilized protein efficiently, while the ECM fungi exhibited poor protein utilization. ECM fungi secreted metallo-proteases and had pH optima above 4, while other fungi produced aspartic proteases with lower pH optima. The ascomycetous root endophytes M. variabilis and P. fortinii exhibited intermediate levels of protein utilization and M. variabilis exhibited a very low pH optimum. Comparing proteolytic profiles between fungal root endophytes and fungi with well defined ecological roles provides insight into the ecology of these cryptic root associates.

  1. Comprehensive Analysis of a Vibrio parahaemolyticus Strain Extracellular Serine Protease VpSP37

    PubMed Central

    Bennici, Carmelo; Quatrini, Paola; Catania, Valentina; Mazzola, Salvatore; Ghersi, Giulio; Cuttitta, Angela

    2015-01-01

    Proteases play an important role in the field of tissue dissociation combined with regenerative medicine. During the years new sources of proteolytic enzymes have been studied including proteases from different marine organisms both eukaryotic and prokaryotic. Herein we have purified a secreted component of an isolate of Vibrio parahaemolyticus, with electrophoretic mobilities corresponding to 36 kDa, belonging to the serine proteases family. Sequencing of the N-terminus enabled the in silico identification of the whole primary structure consisting of 345 amino acid residues with a calculated molecular mass of 37.4 KDa. The purified enzyme, named VpSP37, contains a Serine protease domain between residues 35 and 276 and a canonical Trypsin/Chimotrypsin 3D structure. Functional assays were performed to evaluate protease activity of purified enzyme. Additionally the performance of VpSP37 was evaluated in tissue dissociations experiments and the use of such enzyme as a component of enzyme blend for tissue dissociation procedures is strongly recommended. PMID:26162075

  2. Structural Evidence for Regulation and Specificity of Flaviviral Proteases and Evolution of the Flaviviridae Fold

    SciTech Connect

    Aleshin,A.; Shiryaev, S.; Strongin, A.; Liddington, R.

    2007-01-01

    Pathogenic members of the flavivirus family, including West Nile Virus (WNV) and Dengue Virus (DV), are growing global threats for which there are no specific treatments. The two-component flaviviral enzyme NS2B-NS3 cleaves the viral polyprotein precursor within the host cell, a process that is required for viral replication. Here, we report the crystal structure of WNV NS2B-NS3pro both in a substrate-free form and in complex with the trypsin inhibitor aprotinin/BPTI. We show that aprotinin binds in a substrate-mimetic fashion in which the productive conformation of the protease is fully formed, providing evidence for an 'induced fit' mechanism of catalysis and allowing us to rationalize the distinct substrate specificities of WNV and DV proteases. We also show that the NS2B cofactor of WNV can adopt two very distinct conformations and that this is likely to be a general feature of flaviviral proteases, providing further opportunities for regulation. Finally, by comparing the flaviviral proteases with the more distantly related Hepatitis C virus, we provide insights into the evolution of the Flaviviridae fold. Our work should expedite the design of protease inhibitors to treat a range of flaviviral infections.

  3. MALT1 Protease Activity Controls the Expression of Inflammatory Genes in Keratinocytes upon Zymosan Stimulation.

    PubMed

    Schmitt, Anja; Grondona, Paula; Maier, Tabea; Brändle, Marc; Schönfeld, Caroline; Jäger, Günter; Kosnopfel, Corinna; Eberle, Franziska C; Schittek, Birgit; Schulze-Osthoff, Klaus; Yazdi, Amir S; Hailfinger, Stephan

    2016-04-01

    The protease activity of the paracaspase mucosa-associated lymphoid tissue lymphoma translocation gene 1 (MALT1) plays an important role in antigen receptor-mediated lymphocyte activation by controlling the activity of the transcription factor nuclear factor-κB and is thus essential for the expression of inflammatory target genes. MALT1 is not only present in cells of the hematopoietic lineage, but is ubiquitously expressed. Here we report that stimulation with zymosan or Staphylococcus aureus induced MALT1 protease activity in human primary keratinocytes. Inhibition of the Src family of kinases or novel protein kinase C isoforms as well as silencing of CARMA2 or BCL10 interfered with activation of MALT1 protease. Silencing or inhibition of MALT1 protease strongly decreased the expression of important inflammatory genes such as TNFα, IL-17C, CXCL8 and HBD-2. MALT1-inhibited cells were unable to mount an antimicrobial response upon zymosan stimulation or phorbolester/ionomycin treatment, demonstrating a central role of MALT1 protease activity in keratinocyte immunity and suggesting MALT1 as a potential target in inflammatory skin diseases.

  4. Biochemical characterization of a detergent-stable serine alkaline protease from Caldicoprobacter guelmensis.

    PubMed

    Bouacem, Khelifa; Bouanane-Darenfed, Amel; Laribi-Habchi, Hassiba; Elhoul, Mouna Ben; Hmida-Sayari, Aïda; Hacene, Hocine; Ollivier, Bernard; Fardeau, Marie-Laure; Jaouadi, Bassem; Bejar, Samir

    2015-11-01

    Caldicoprobacter guelmensis isolated from the hydrothermal hot spring of Guelma (Algeria) produced high amounts of extracellular thermostable serine alkaline protease (called SAPCG) (23,000U/mL). The latter was purified by ammonium sulphate precipitation, UNO Q-6 FPLC and Zorbex PSM 300 HPLC, and submitted to biochemical characterization assays. Matrix assisted laser desorption ionization-time of flight mass spectrometry (MALDI-TOF/MS) analysis revealed that the purified enzyme was a monomer, with a molecular mass of 55,824.19Da. The 19 N-terminal residue sequence of SAPCG showed high homology with those of microbial proteases. The enzyme was completely inhibited by phenylmethanesulfonyl fluoride (PMSF) and diiodopropyl fluorophosphates (DFP), which suggested its belonging to the serine protease family. It showed optimum protease activity at pH 10 and 70°C with casein as a substrate. The thermoactivity and thermostability of SAPCG were enhanced in the presence of 2mM Ca(2+). Its half-life times at 80 and 90°C were 180 and 60min, respectively. Interestingly, the SAPCG protease exhibited significant compatibility with iSiS and Persil, and wash performance analysis revealed that it could remove blood-stains effectively. Overall, SAPCG displayed a number of attractive properties that make it a promising candidate for future applications as an additive in detergent formulations.

  5. Activation of Bacteroides fragilis toxin by a novel bacterial protease contributes to anaerobic sepsis

    PubMed Central

    Choi, Vivian M.; Herrou, Julien; Hecht, Aaron L.; Teoh, Wei Ping; Turner, Jerrold R.; Crosson, Sean; Wardenburg, Juliane Bubeck

    2016-01-01

    Bacteroides fragilis is the leading cause of anaerobic bacteremia and sepsis 1. Enterotoxigenic strains producing B. fragilis toxin (BFT, fragilysin) contribute to colitis 2 and intestinal malignancy 3, yet are also isolated in bloodstream infection 4,5. It is not known whether these strains harbor unique genetic determinants that confer virulence in extra-intestinal disease. We demonstrate that BFT contributes to sepsis and identify a B. fragilis protease, fragipain (Fpn), which is required for endogenous activation of BFT through removal of its auto-inhibitory prodomain. Structural analysis of Fpn reveals a His-Cys catalytic dyad characteristic of C11 family cysteine proteases that are conserved in multiple pathogenic Bacteroides spp and Clostridium spp. Fpn-deficient enterotoxigenic B. fragilis is attenuated in its ability to induce sepsis, however Fpn is dispensable in B. fragilis colitis wherein host proteases mediate BFT activation. Our findings define a role for B. fragilis enterotoxin and its activating protease in the pathogenesis of bloodstream infection, indicating a greater complexity of cellular targeting and action of BFT than previously appreciated. The expression of fpn by both toxigenic and non-toxigenic strains suggests this protease may contribute to anaerobic sepsis beyond its role in toxin activation, potentially serving as a target for disease modification. PMID:27089515

  6. Structure, Mechanism and Inhibition of γ-Secretase and Presenilin-Like Proteases

    PubMed Central

    Wolfe, Michael S.

    2010-01-01

    Presenilin is the catalytic component of γ-secretase, a complex aspartyl protease and a founding member of intramembrane-cleaving proteases. γ-Secretase is involved in the pathogenesis of Alzheimer’s disease and a top target for therapeutic intervention. However, the protease complex processes a variety of transmembrane substrates, including the Notch receptor, raising concerns about toxicity. Nevertheless, γ-secretase inhibitors and modulators have been identified that allow Notch processing and signalling to continue, and promising compounds are entering clinical trials. Molecular and biochemical studies offer a model for how this protease hydrolyzes transmembrane domains in the confines of the lipid bilayer. Progress has also been made toward structure elucidation of presenilin and the γ-secretase complex by electron microscopy as well as by studying cysteine-mutant presenilins. The signal peptide peptidase (SPP) family of proteases are distantly related to presenilins. However, the SPPs work as single polypeptides without the need for cofactors and otherwise appear to be simple model systems for presenilin in the γ-secretase complex. SPP biology, structure, and inhibition will also be discussed. PMID:20482315

  7. PCSK9: an enigmatic protease.

    PubMed

    Lopez, Dayami

    2008-04-01

    Proprotein convertase subtilisin/kexin type 9 (PCSK9) plays a critical role in cholesterol metabolism by controlling the levels of low density lipoprotein (LDL) particles that circulate in the bloodstream. Several gain-of-function and loss-of-function mutations in the PCSK9 gene, that occur naturally, have been identified and linked to hypercholesterolemia and hypocholesterolemia, respectively. PCSK9 expression has been shown to be regulated by sterol regulatory element binding proteins (SREBPs) and statins similar to other genes involved in cholesterol homeostasis. The most critical finding concerning PCSK9 is that this protease is able to influence the number of LDL receptor molecules expressed on the cell surface. Studies have demonstrated that PCSK9 acts mainly by enhancing degradation of LDL receptor protein in the liver. Inactivation of PCSK9 in mice reduces plasma cholesterol levels primarily by increasing hepatic expression of LDL receptor protein and thereby accelerating clearance of circulating LDL cholesterol. The objective of this review is to summarize the current information related to the regulation and function of PCSK9 and to identify gaps in our present knowledge.

  8. Carbohydrate protease conjugates: Stabilized proteases for peptide synthesis

    SciTech Connect

    Wartchow, C.A.; Wang, Peng; Bednarski, M.D.; Callstrom, M.R. |

    1995-12-31

    The synthesis of oligopeptides using stable carbohydrate protease conjugates (CPCs) was examined in acetonitrile solvent systems. CPC[{alpha}-chymotrypsin] was used for the preparation of peptides containing histidine, phenylalanine, tryptophan in the P{sub 1} position in 60-93% yield. The CPC[{alpha}-chymotrypsin]-catalyzed synthesis of octamer Z-Gly-Gly-Phe-Gly-Gly-Phe-Gly-Gly-OEt from Z-Gly-Gly-Phe-Gly-Gly-Phe-OMe was achieved in 71% yield demonstrating that synthesis peptides containing both hydrophylic and hydrophobic amino acids. The P{sub 2} specificity of papain for aromatic residues was utilized for the 2 + 3 coupling of Z-Tyr-Gly-OMe to H{sub 2}N-Gly-Phe-Leu-OH to generate the leucine enkephalin derivative in 79% yield. Although papain is nonspecific for the hydrolysis of N-benzyloxycarbonyl amino acid methyl esters in aqueous solution, the rates of synthesis for these derivitives with nucleophile leucine tert-butyl ester differed by nearly 2 orders of magnitude. CPC[thermolysin] was used to prepare the aspartame precursor Z-Asp-Phe-OMe in 90% yield. The increased stability of CPCs prepared from periodate-modified poly(2-methacryl- amido-2-deoxy-D-glucose), poly(2-methacrylamido-2-deoxy-D-galactose), and poly(5-methacryl-amido-5-deoxy-D-ribose), carbohydrate materials designed to increase the aldehyde concentration in aqueous solution, suggests that the stability of CPCs is directly related to the aldehyde concentration of the carbohydrate material. Periodate oxidation of poly(2-methacrylamido-2-deoxy-D-glucose) followed by covalent attachment to {alpha}-chymotrypsin gave a CPC with catalytic activity in potassium phosphate buffer at 90{degrees}C for 2 h. 1 fig., 1 tab., 40 refs.

  9. Protease Inhibitors Targeting Coronavirus and Filovirus Entry

    PubMed Central

    Zhou, Yanchen; Vedantham, Punitha; Lu, Kai; Agudelo, Juliet; Carrion, Ricardo; Nunneley, Jerritt W.; Barnard, Dale; Pöhlmann, Stefan; McKerrow, James H.; Renslo, Adam R.; Simmons, Graham

    2016-01-01

    In order to gain entry into cells, diverse viruses, including Ebola virus, SARS-coronavirus and the emerging MERS-coronavirus, depend on activation of their envelope glycoproteins by host cell proteases. The respective enzymes are thus excellent targets for antiviral intervention. In cell culture, activation of Ebola virus, as well as SARS- and MERS-coronavirus can be accomplished by the endosomal cysteine proteases, cathepsin L (CTSL) and cathepsin B (CTSB). In addition, SARS- and MERS-coronavirus can use serine proteases localized at the cell surface, for their activation. However, it is currently unclear which protease(s) facilitate viral spread in the infected host. We report here that the cysteine protease inhibitor K11777, ((2S)-N-[(1E,3S)-1-(benzenesulfonyl)-5-phenylpent-1-en-3-yl]-2-{[(E)-4-methylpiperazine-1-carbonyl]amino}-3-phenylpropanamide) and closely-related vinylsulfones act as broad-spectrum antivirals by targeting cathepsin-mediated cell entry. K11777 is already in advanced stages of development for a number of parasitic diseases, such as Chagas disease, and has proven to be safe and effective in a range of animal models. K11777 inhibition of SARS-CoV and Ebola virus entry was observed in the sub-nanomolar range. In order to assess, whether cysteine or serine proteases promote viral spread in the host, we compared the antiviral activity of an optimized K11777-derivative with that of camostat, an inhibitor of TMPRSS2 and related serine proteases. Employing a pathogenic animal model of SARS-CoV infection, we demonstrated that viral spread and pathogenesis of SARS-CoV is driven by serine rather than cysteine proteases and can be effectively prevented by camostat. Camostat has been clinically used to treat chronic pancreatitis, and thus represents an exciting potential therapeutic for respiratory coronavirus infections. Our results indicate that camostat, or similar serine protease inhibitors, might be an effective option for treatment of SARS and

  10. Evaluation of proteases and protease inhibitors in Heterodera glycines cysts obtained from laboratory and field populations

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Proteases and proteases inhibitors were evaluated in a number of preparations of Heterodera glycines cysts obtained from glasshouse cultures (GH) and field (LR) populations. Using a FRET-peptide library comprising 512 peptide substrate pools that detect 4 endoprotease types (aspartic, cysteine, meta...

  11. Intervention for hyperlipidemia associated with protease inhibitors.

    PubMed

    Melroe, N H; Kopaczewski, J; Henry, K; Huebsch, J

    1999-01-01

    In the past 3 years, treatment for HIV infection has significantly improved the prognosis for HIV-infected persons. The administration of protease inhibitors for the treatment of HIV infection has had a significant role in the reduction of AIDS-related complications. Recent findings have indicated that protease inhibitors may significantly increase lipids to levels that pose a health risk that may be greater than the illness itself. This article reviews the initial findings of a study that investigated the impact of interventions for the treatment of protease inhibitor-related hyperlipidemia. The purpose of the study was to determine if initiation of interventions based on the National Cholesterol Education Program Guidelines would be effective in lowering protease inhibitor-related hyperlipidemia without disrupting the effectiveness of the HIV therapy. A total of 45 HIV-infected individuals who were taking a protease inhibitor and had abnormally elevated lipids were enrolled into this study. Mean serum cholesterol level prior to initiation of a protease inhibitor regimen was 170 mg/dl as compared to a mean cholesterol at time of enrollment of 289 mg/dl and triglycerides of 879 mg/dl. Interventions included diet and exercise and the prescription of gemfibrozil alone or in combination with atorvatstatin. During the course of the study, overall intervention significantly reduced serum cholesterol level to 201 mg/dl (p. 01) over a study period of ten months. Case studies of five medical events related to hyperlipidemia are included. Currently, 26 participants continue in the study. Sixteen participants discontinued protease inhibitor therapy during the course of the study and thus ended their participation.

  12. Site-Directed Mutagenesis and Structural Studies Suggest that the Germination Protease, GPR, in Spores of Bacillus Species Is an Atypical Aspartic Acid Protease

    PubMed Central

    Carroll, Thomas M.; Setlow, Peter

    2005-01-01

    Germination protease (GPR) initiates the degradation of small, acid-soluble spore proteins (SASP) during germination of spores of Bacillus and Clostridium species. The GPR amino acid sequence is not homologous to members of the major protease families, and previous work has not identified residues involved in GPR catalysis. The current work has focused on identifying catalytically essential amino acids by mutagenesis of Bacillus megaterium gpr. A residue was selected for alteration if it (i) was conserved among spore-forming bacteria, (ii) was a potential nucleophile, and (iii) had not been ruled out as inessential for catalysis. GPR variants were overexpressed in Escherichia coli, and the active form (P41) was assayed for activity against SASP and the zymogen form (P46) was assayed for the ability to autoprocess to P41. Variants inactive against SASP and unable to autoprocess were analyzed by circular dichroism spectroscopy and multiangle laser light scattering to determine whether the variant's inactivity was due to loss of secondary or quaternary structure, respectively. Variation of D127 and D193, but no other residues, resulted in inactive P46 and P41, while variants of each form were well structured and tetrameric, suggesting that D127 and D193 are essential for activity and autoprocessing. Mapping these two aspartate residues and a highly conserved lysine onto the B. megaterium P46 crystal structure revealed a striking similarity to the catalytic residues and propeptide lysine of aspartic acid proteases. These data indicate that GPR is an atypical aspartic acid protease. PMID:16199582

  13. Identification of covalent active site inhibitors of dengue virus protease

    PubMed Central

    Koh-Stenta, Xiaoying; Joy, Joma; Wang, Si Fang; Kwek, Perlyn Zekui; Wee, John Liang Kuan; Wan, Kah Fei; Gayen, Shovanlal; Chen, Angela Shuyi; Kang, CongBao; Lee, May Ann; Poulsen, Anders; Vasudevan, Subhash G; Hill, Jeffrey; Nacro, Kassoum

    2015-01-01

    Dengue virus (DENV) protease is an attractive target for drug development; however, no compounds have reached clinical development to date. In this study, we utilized a potent West Nile virus protease inhibitor of the pyrazole ester derivative class as a chemical starting point for DENV protease drug development. Compound potency and selectivity for DENV protease were improved through structure-guided small molecule optimization, and protease-inhibitor binding interactions were validated biophysically using nuclear magnetic resonance. Our work strongly suggests that this class of compounds inhibits flavivirus protease through targeted covalent modification of active site serine, contrary to an allosteric binding mechanism as previously described. PMID:26677315

  14. Lysosomal protease expression in mature enamel.

    PubMed

    Tye, Coralee E; Lorenz, Rachel L; Bartlett, John D

    2009-01-01

    The enamel matrix proteins (amelogenin, enamelin and ameloblastin) are degraded by matrix metalloproteinase-20 and kallikrein-4 during enamel development and mature enamel is virtually protein free. The precise mechanism of removal and degradation of the enamel protein cleavage products from the matrix, however, remains poorly understood. It has been proposed that receptor-mediated endocytosis allows for the cleaved proteins to be removed from the matrix during enamel formation and then transported to the lysosome for further degradation. This study aims to identify lysosomal proteases that are present in maturation-stage enamel organ. RNA from first molars of 11-day-old mice was collected and expression was initially assessed by RT-PCR and then quantified by qPCR. The pattern of expression of selected proteases was assessed by immunohistochemical staining of demineralized mouse incisors. With the exception of cathepsin G, all lysosomal proteases assessed were expressed in maturation-stage enamel organ. Identified proteases included cathepsins B, D, F, H, K, L, O, S and Z. Tripeptidyl peptidases I and II as well as dipeptidyl peptidases I, II, III and IV were also found to be expressed. Immunohistochemical staining confirmed that the maturation-stage ameloblasts express cathepsins L and S and tripeptidyl peptidase II. Our results suggest that the ameloblasts are enriched by a large number of lysosomal proteases at maturation that are likely involved in the degradation of the organic matrix.

  15. Production of alkaline protease from Cellulosimicrobium cellulans

    PubMed Central

    Ferracini-Santos, Luciana; Sato, Hélia H

    2009-01-01

    Cellulosimicrobium cellulans is one of the microorganisms that produces a wide variety of yeast cell wall-degrading enzymes, β-1,3-glucanase, protease and chitinase. Dried cells of Saccharomyces cerevisiae were used as carbon and nitrogen source for cell growth and protease production. The medium components KH2PO4, KOH and dried yeast cells showed a significant effect (p<0.05) on the factorial fractional design. A second design was prepared using two factors: pH and percentage of dried yeast cells. The results showed that the culture medium for the maximum production of protease was 0.2 g/l of MgSO4.7H2O, 2.0 g/l of (NH4)2SO4 and 8% of dried yeast cells in 0.15M phosphate buffer at pH 8.0. The maximum alkaline protease production was 7.0 ± 0.27 U/ml over the center point. Crude protease showed best activity at 50ºC and pH 7.0-8.0, and was stable at 50ºC. PMID:24031317

  16. 3C-like protease of rabbit hemorrhagic disease virus: identification of cleavage sites in the ORF1 polyprotein and analysis of cleavage specificity.

    PubMed Central

    Wirblich, C; Sibilia, M; Boniotti, M B; Rossi, C; Thiel, H J; Meyers, G

    1995-01-01

    Rabbit hemorrhagic disease virus, a positive-stranded RNA virus of the family Caliciviridae, encodes a trypsin-like cysteine protease as part of a large polyprotein. Upon expression in Escherichia coli, the protease releases itself from larger precursors by proteolytic cleavages at its N and C termini. Both cleavage sites were determined by N-terminal sequence analysis of the cleavage products. Cleavage at the N terminus of the protease occurred with high efficiency at an EG dipeptide at positions 1108 and 1109. Cleavage at the C terminus of the protease occurred with low efficiency at an ET dipeptide at positions 1251 and 1252. To study the cleavage specificity of the protease, amino acid substitutions were introduced at the P2, P1, and P1' positions at the cleavage site at the N-terminal boundary of the protease. This analysis showed that the amino acid at the P1 position is the most important determinant for substrate recognition. Only glutamic acid, glutamine, and aspartic acid were tolerated at this position. At the P1' position, glycine, serine, and alanine were the preferred substrates of the protease, but a number of amino acids with larger side chains were also tolerated. Substitutions at the P2 position had only little effect on the cleavage efficiency. Cell-free expression of the C-terminal half of the ORF1 polyprotein showed that the protease catalyzes cleavage at the junction of the RNA polymerase and the capsid protein. An EG dipeptide at positions 1767 and 1768 was identified as the putative cleavage site. Our data show that rabbit hemorrhagic disease virus encodes a trypsin-like cysteine protease that is similar to 3C proteases with regard to function and specificity but is more similar to 2A proteases with regard to size. PMID:7474137

  17. Large lateral movement of transmembrane helix S5 is not required for substrate access to the active site of rhomboid intramembrane protease.

    PubMed

    Xue, Yi; Ha, Ya

    2013-06-07

    Rhomboids represent an evolutionarily ancient protease family. Unlike most other proteases, they are polytopic membrane proteins and specialize in cleaving transmembrane protein substrates. The polar active site of rhomboid protease is embedded in the membrane and normally closed. For the bacterial rhomboid GlpG, it has been proposed that one of the transmembrane helices (S5) of the protease can rotate to open a lateral gate, enabling substrate to enter the protease from inside the membrane. Here, we studied the conformational change in GlpG by solving the cocrystal structure of the protease with a mechanism-based inhibitor. We also examined the lateral gating model by cross-linking S5 to a neighboring helix (S2). The crystal structure shows that inhibitor binding displaces a capping loop (L5) from the active site but causes only minor shifts in the transmembrane helices. Cross-linking S5 and S2, which not only restricts the lateral movement of S5 but also prevents substrate from passing between the two helices, does not hinder the ability of the protease to cleave a membrane protein substrate in detergent solution and in reconstituted membrane vesicles. Taken together, these data suggest that a large lateral movement of the S5 helix is not required for substrate access to the active site of rhomboid protease.

  18. Cleavage Entropy as Quantitative Measure of Protease Specificity

    PubMed Central

    Fuchs, Julian E.; von Grafenstein, Susanne; Huber, Roland G.; Margreiter, Michael A.; Spitzer, Gudrun M.; Wallnoefer, Hannes G.; Liedl, Klaus R.

    2013-01-01

    A purely information theory-guided approach to quantitatively characterize protease specificity is established. We calculate an entropy value for each protease subpocket based on sequences of cleaved substrates extracted from the MEROPS database. We compare our results with known subpocket specificity profiles for individual proteases and protease groups (e.g. serine proteases, metallo proteases) and reflect them quantitatively. Summation of subpocket-wise cleavage entropy contributions yields a measure for overall protease substrate specificity. This total cleavage entropy allows ranking of different proteases with respect to their specificity, separating unspecific digestive enzymes showing high total cleavage entropy from specific proteases involved in signaling cascades. The development of a quantitative cleavage entropy score allows an unbiased comparison of subpocket-wise and overall protease specificity. Thus, it enables assessment of relative importance of physicochemical and structural descriptors in protease recognition. We present an exemplary application of cleavage entropy in tracing substrate specificity in protease evolution. This highlights the wide range of substrate promiscuity within homologue proteases and hence the heavy impact of a limited number of mutations on individual substrate specificity. PMID:23637583

  19. Cleavage entropy as quantitative measure of protease specificity.

    PubMed

    Fuchs, Julian E; von Grafenstein, Susanne; Huber, Roland G; Margreiter, Michael A; Spitzer, Gudrun M; Wallnoefer, Hannes G; Liedl, Klaus R

    2013-04-01

    A purely information theory-guided approach to quantitatively characterize protease specificity is established. We calculate an entropy value for each protease subpocket based on sequences of cleaved substrates extracted from the MEROPS database. We compare our results with known subpocket specificity profiles for individual proteases and protease groups (e.g. serine proteases, metallo proteases) and reflect them quantitatively. Summation of subpocket-wise cleavage entropy contributions yields a measure for overall protease substrate specificity. This total cleavage entropy allows ranking of different proteases with respect to their specificity, separating unspecific digestive enzymes showing high total cleavage entropy from specific proteases involved in signaling cascades. The development of a quantitative cleavage entropy score allows an unbiased comparison of subpocket-wise and overall protease specificity. Thus, it enables assessment of relative importance of physicochemical and structural descriptors in protease recognition. We present an exemplary application of cleavage entropy in tracing substrate specificity in protease evolution. This highlights the wide range of substrate promiscuity within homologue proteases and hence the heavy impact of a limited number of mutations on individual substrate specificity.

  20. Insect response to plant defensive protease inhibitors.

    PubMed

    Zhu-Salzman, Keyan; Zeng, Rensen

    2015-01-07

    Plant protease inhibitors (PIs) are natural plant defense proteins that inhibit proteases of invading insect herbivores. However, their anti-insect efficacy is determined not only by their potency toward a vulnerable insect system but also by the response of the insect to such a challenge. Through the long history of coevolution with their host plants, insects have developed sophisticated mechanisms to circumvent antinutritional effects of dietary challenges. Their response takes the form of changes in gene expression and the protein repertoire in cells lining the alimentary tract, the first line of defense. Research in insect digestive proteases has revealed the crucial roles they play in insect adaptation to plant PIs and has brought about a new appreciation of how phytophagous insects employ this group of molecules in both protein digestion and counterdefense. This review provides researchers in related fields an up-to-date summary of recent advances.

  1. A novel detergent-stable solvent-tolerant serine thiol alkaline protease from Streptomyces koyangensis TN650.

    PubMed

    Ben Elhoul, Mouna; Zaraî Jaouadi, Nadia; Rekik, Hatem; Bejar, Wacim; Boulkour Touioui, Souraya; Hmidi, Maher; Badis, Abdelmalek; Bejar, Samir; Jaouadi, Bassem

    2015-08-01

    An alkaline proteinase (STAP) was produced from strain TN650 isolated from a Tunisian off-shore oil field and assigned as Streptomyces koyangensis strain TN650 based on physiological and biochemical properties and 16S rRNA gene sequencing. Matrix assisted laser desorption ionization-time of flight mass spectrometry (MALDI-TOF/MS) analysis revealed that the purified enzyme was a monomer with a molecular mass of 45125.17-Da. The enzyme had an NH2-terminal sequence of TQSNPPSWGLDRIDQTTAFTKACSIKY, thus sharing high homology with those of Streptomyces proteases. The results showed that this protease was completely inhibited by phenylmethanesulfonyl fluoride (PMSF), diiodopropyl fluorophosphates (DFP), and partially inhibited by 5,5-dithio-bis-(2-nitro benzoic acid) (DTNB), which strongly suggested its belonging to the serine thiol protease family. Using casein as a substrate, the optimum pH and temperature values for protease activity were pH 10 and 70 °C, respectively. The protease was stable at pH 7-10 and 30-60 °C for 24 h. STAP exhibited high catalytic efficiency, significant detergent stability, and elevated organic solvent resistance compared to the SG-XIV proteases from S. griseus and KERAB from Streptomyces sp. AB1. The stap gene encoding STAP was isolated, and its DNA sequence was determined. These properties make STAP a potential candidate for future application in detergent formulations and non-aqueous peptide biocatalysis.

  2. The Occurrence of Type S1A Serine Proteases in Sponge and Jellyfish

    NASA Technical Reports Server (NTRS)

    Rojas, Ana; Doolittle, Russell F.

    2003-01-01

    Although serine proteases are found in all kinds of cellular organisms and many viruses, the classic "chymotrypsin family" (Group S1A by th e 1998 Barrett nomenclature) has an unusual phylogenetic distribution , being especially common in animals, entirely absent from plants and protists, and rare among fungi. The distribution in Bacteria is larg ely restricted to the genus Streptomyces, although a few isolated occ urrences in other bacteria have been reported. The family may be enti rely absent from Archaea. Although more than a thousand sequences have been reported for enzymes of this type from animals, none of them ha ve been from early diverging phyla like Porifera or Cnidaria, We now report the existence of Group SlA serine proteases in a sponge (phylu m Porifera) and a jellyfish (phylum Cnidaria), making it safe to conc lude that all animal groups possess these enzymes.

  3. Calcium-induced folding and stabilization of the Pseudomonas aeruginosa alkaline protease.

    PubMed

    Zhang, Liang; Conway, James F; Thibodeau, Patrick H

    2012-02-03

    Pseudomonas aeruginosa is an opportunistic pathogen that contributes to the mortality of immunocompromised individuals and patients with cystic fibrosis. Pseudomonas infection presents clinical challenges due to its ability to form biofilms and modulate host-pathogen interactions through the secretion of virulence factors. The calcium-regulated alkaline protease (AP), a member of the repeats in toxin (RTX) family of proteins, is implicated in multiple modes of infection. A series of full-length and truncation mutants were purified for structural and functional studies to evaluate the role of Ca(2+) in AP folding and activation. We find that Ca(2+) binding induces RTX folding, which serves to chaperone the folding of the protease domain. Subsequent association of the RTX domain with an N-terminal α-helix stabilizes AP. These results provide a basis for the Ca(2+)-mediated regulation of AP and suggest mechanisms by which Ca(2+) regulates the RTX family of virulence factors.

  4. Current and Novel Inhibitors of HIV Protease

    PubMed Central

    Pokorná, Jana; Machala, Ladislav; Řezáčová, Pavlína; Konvalinka, Jan

    2009-01-01

    The design, development and clinical success of HIV protease inhibitors represent one of the most remarkable achievements of molecular medicine. This review describes all nine currently available FDA-approved protease inhibitors, discusses their pharmacokinetic properties, off-target activities, side-effects, and resistance profiles. The compounds in the various stages of clinical development are also introduced, as well as alternative approaches, aiming at other functional domains of HIV PR. The potential of these novel compounds to open new way to the rational drug design of human viruses is critically assessed. PMID:21994591

  5. Seminal and colostral protease inhibitors on leukocytes.

    PubMed

    Veselský, L; Cechová, D; Hruban, V; Klaudy, J

    1982-01-01

    For detection of protease inhibitors from cow colostrum (CTI) and bull seminal plasma (BUSI I and BUSI II) on the surface of leukocytes, immunological methods were used. An agglutination and an immunofluorescence test demonstrated components on the surface of bovine, porcine and ovine granulocytes and lymphocytes which were immunologically identical with the protease inhibitors isolated from cow colostrum and bull seminal plasma. When antisera against (CTI, BUSI and BUSI II were absorbed by bovine and porcine liver, kidney and spleen homogenate or by bovine and porcine granulocytes or lymphocytes, the immunological tests were negative.

  6. Subtilases: the superfamily of subtilisin-like serine proteases.

    PubMed Central

    Siezen, R. J.; Leunissen, J. A.

    1997-01-01

    Subtilases are members of the clan (or superfamily) of subtilisin-like serine proteases. Over 200 subtilases are presently known, more than 170 of which with their complete amino acid sequence. In this update of our previous overview (Siezen RJ, de Vos WM, Leunissen JAM, Dijkstra BW, 1991, Protein Eng 4:719-731), details of more than 100 new subtilases discovered in the past five years are summarized, and amino acid sequences of their catalytic domains are compared in a multiple sequence alignment. Based on sequence homology, a subdivision into six families is proposed. Highly conserved residues of the catalytic domain are identified, as are large or unusual deletions and insertions. Predictions have been updated for Ca(2+)-binding sites, disulfide bonds, and substrate specificity, based on both sequence alignment and three-dimensional homology modeling. PMID:9070434

  7. Detection of protease and protease activity using a single nanoscrescent SERS probe

    DOEpatents

    Liu, Gang L.; Ellman, Jonathan A.; Lee, Luke P.; Chen, Fanqing Frank

    2013-01-29

    This invention pertains to the in vitro detection of proteases using a single peptide-conjugate nanocrescent surface enhanced Raman scattering (SERS) probes with at least nanomolar sensitivity. The probe enables detection of proteolytic activity in extremely small volume and at low concentration. In certain embodiments the probes comprise an indicator for the detection of an active protease, where the indicator comprises a nanocrescent attached to a peptide, where said peptide comprises a recognition site for the protease and a Raman tag attached to the peptide.

  8. [Peptide hydrolases with catalytic dyad Ser-Lys. Similarity and distinctions of the active centers of ATP-dependent Lon proteases, LexA repressors, signal peptidases and C-terminal processing proteases].

    PubMed

    Rotanova, T V

    2002-01-01

    It is established that ATP-dependent protease Lon family belongs to the serine-lysine peptide hydrolases clan. Significant similarity of amino acid sequences of proteases Lon and repressors LexA in the regions including the catalytic serine and lysine residues is revealed by comparing primary structures of different families of the enzymes with Ser-Lys catalytic dyad. The both Lon and LexA families are shown to be divided into two subfamilies in accordance with the nature of amino acids in the catalytically active serine environment. Putative DNA binding sites are revealed in proteolytic domains of Lon A subfamily. Similarities and distinctions of the all families peptide hydrolases of the clan in the regions of their active centers are discussed.

  9. RC1339/APRc from Rickettsia conorii Is a Novel Aspartic Protease with Properties of Retropepsin-Like Enzymes

    PubMed Central

    Cruz, Rui; Huesgen, Pitter; Riley, Sean P.; Wlodawer, Alexander; Faro, Carlos; Overall, Christopher M.; Martinez, Juan J.; Simões, Isaura

    2014-01-01

    Members of the species Rickettsia are obligate intracellular, gram-negative, arthropod-borne pathogens of humans and other mammals. The life-threatening character of diseases caused by many Rickettsia species and the lack of reliable protective vaccine against rickettsioses strengthens the importance of identifying new protein factors for the potential development of innovative therapeutic tools. Herein, we report the identification and characterization of a novel membrane-embedded retropepsin-like homologue, highly conserved in 55 Rickettsia genomes. Using R. conorii gene homologue RC1339 as our working model, we demonstrate that, despite the low overall sequence similarity to retropepsins, the gene product of rc1339 APRc (for Aspartic Protease from Rickettsia conorii) is an active enzyme with features highly reminiscent of this family of aspartic proteases, such as autolytic activity impaired by mutation of the catalytic aspartate, accumulation in the dimeric form, optimal activity at pH 6, and inhibition by specific HIV-1 protease inhibitors. Moreover, specificity preferences determined by a high-throughput profiling approach confirmed common preferences between this novel rickettsial enzyme and other aspartic proteases, both retropepsins and pepsin-like. This is the first report on a retropepsin-like protease in gram-negative intracellular bacteria such as Rickettsia, contributing to the analysis of the evolutionary relationships between the two types of aspartic proteases. Additionally, we have also shown that APRc is transcribed and translated in R. conorii and R. rickettsii and is integrated into the outer membrane of both species. Finally, we demonstrated that APRc is sufficient to catalyze the in vitro processing of two conserved high molecular weight autotransporter adhesin/invasion proteins, Sca5/OmpB and Sca0/OmpA, thereby suggesting the participation of this enzyme in a relevant proteolytic pathway in rickettsial life-cycle. As a novel bona fide member

  10. Structural and Functional Determinants of γ-Secretase, an Intramembrane Protease Implicated in Alzheimer’s Disease

    PubMed Central

    Fraering, Patrick C

    2007-01-01

    Alzheimer’s disease is the most common form of neurodegenerative diseases in humans, characterized by the progressive accumulation and aggregation of amyloid-β peptides (Aβ) in brain regions subserving memory and cognition. These 39-43 amino acids long peptides are generated by the sequential proteolytic cleavages of the amyloid-β precursor protein (APP) by β- and γ-secretases, with the latter being the founding member of a new class of intramembrane-cleaving proteases (I-CliPs) characterized by their intramembranous catalytic residues hydrolyzing the peptide bonds within the transmembrane regions of their respective substrates. These proteases include the S2P family of metalloproteases, the Rhomboid family of serine proteases, and two aspartyl proteases: the signal peptide peptidase (SPP) and γ-secretase. In sharp contrast to Rhomboid and SPP that function as a single component, γ-secretase is a multi-component protease with complex assembly, maturation and activation processes. Recently, two low-resolution three-dimensional structures of γ-secretase and three high-resolution structures of the GlpG rhomboid protease have been obtained almost simultaneously by different laboratories. Although these proteases are unrelated by sequence or evolution, they seem to share common functional and structural mechanisms explaining how they catalyze intramembrane proteolysis. Indeed, a water-containing chamber in the catalytic cores of both γ-secretase and GlpG rhomboid provides the hydrophilic environment required for proteolysis and a lateral gating mechanism controls substrate access to the active site. The studies that have identified and characterized the structural determinants critical for the assembly and activity of the γ-secretase complex are reviewed here. PMID:19415127

  11. Investigational protease inhibitors as antiretroviral therapies

    PubMed Central

    Midde, Narasimha M.; Patters, Benjamin J.; Rao, PSS; Cory, Theodore J.; Kumar, Santosh

    2017-01-01

    Introduction Highly Active Antiretroviral Therapy (HAART) has tremendously improved the life expectancy of the HIV-infected population over the past three decades. Protease inhibitors have been one of the major classes of drugs in HAART regimens that are effective in treating HIV. However, the emergence of resistance and cross-resistance against protease inhibitors encourages researchers to develop new PIs with broad-spectrum activity, as well as novel means of enhancing the efficacy of existing PIs. Areas covered In this article we discuss recent advances in HIV protease inhibitor (PI) development, focusing on both investigational and experimental agents. We also include a section on pharmacokinetic booster drugs for improved bioavailability of protease inhibitors. Further, we discuss novel drug delivery systems using a variety of nanocarriers for the delivery of PIs across the blood-brain barrier to treat the HIV in the brain. Expert opinion We discuss our opinion on the promises and challenges on the development of novel investigational and experimental PIs that are less toxic and more effective in combating drug-resistance. Further, we discuss the future of novel nanocarriers that have been developed to deliver PIs to the brain cells. Although these are promising findings, many challenges need to be overcome prior to making them a viable option. PMID:27415449

  12. Molecular markers of serine protease evolution

    PubMed Central

    Krem, Maxwell M.; Di Cera, Enrico

    2001-01-01

    The evolutionary history of serine proteases can be accounted for by highly conserved amino acids that form crucial structural and chemical elements of the catalytic apparatus. These residues display non- random dichotomies in either amino acid choice or serine codon usage and serve as discrete markers for tracking changes in the active site environment and supporting structures. These markers categorize serine proteases of the chymotrypsin-like, subtilisin-like and α/β-hydrolase fold clans according to phylogenetic lineages, and indicate the relative ages and order of appearance of those lineages. A common theme among these three unrelated clans of serine proteases is the development or maintenance of a catalytic tetrad, the fourth member of which is a Ser or Cys whose side chain helps stabilize other residues of the standard catalytic triad. A genetic mechanism for mutation of conserved markers, domain duplication followed by gene splitting, is suggested by analysis of evolutionary markers from newly sequenced genes with multiple protease domains. PMID:11406580

  13. Transient ECM protease activity promotes synaptic plasticity

    PubMed Central

    Magnowska, Marta; Gorkiewicz, Tomasz; Suska, Anna; Wawrzyniak, Marcin; Rutkowska-Wlodarczyk, Izabela; Kaczmarek, Leszek; Wlodarczyk, Jakub

    2016-01-01

    Activity-dependent proteolysis at a synapse has been recognized as a pivotal factor in controlling dynamic changes in dendritic spine shape and function; however, excessive proteolytic activity is detrimental to the cells. The exact mechanism of control of these seemingly contradictory outcomes of protease activity remains unknown. Here, we reveal that dendritic spine maturation is strictly controlled by the proteolytic activity, and its inhibition by the endogenous inhibitor (Tissue inhibitor of matrix metalloproteinases-1 – TIMP-1). Excessive proteolytic activity impairs long-term potentiation of the synaptic efficacy (LTP), and this impairment could be rescued by inhibition of protease activity. Moreover LTP is altered persistently when the ability of TIMP-1 to inhibit protease activity is abrogated, further demonstrating the role of such inhibition in the promotion of synaptic plasticity under well-defined conditions. We also show that dendritic spine maturation involves an intermediate formation of elongated spines, followed by their conversion into mushroom shape. The formation of mushroom-shaped spines is accompanied by increase in AMPA/NMDA ratio of glutamate receptors. Altogether, our results identify inhibition of protease activity as a critical regulatory mechanism for dendritic spines maturation. PMID:27282248

  14. Trypanosomatid cysteine protease activity may be enhanced by a kininogen-like moiety from host serum.

    PubMed Central

    Lonsdale-Eccles, J D; Mpimbaza, G W; Nkhungulu, Z R; Olobo, J; Smith, L; Tosomba, O M; Grab, D J

    1995-01-01

    African trypanosomes contain cysteine proteases (trypanopains) the activity of which can be measured by in vitro digestion of fibrinogen, after electrophoresis in fibrinogen-containing SDS/polyacrylamide gels. When assessed by this procedure, trypanopain from Trypanosoma brucei (trypanopain-Tb) is estimated to have a molecular mass of 28 kDa. However, two additional bands of trypanopain activity (87 kDa and 105 kDa) are observed if serum is added to the trypanopain before electrophoresis. Formation of the 87 and 105 kDa bands is frequently accompanied by a reduction in the intensity of the 28 kDa activity which suggests that the extra bands are complexes of the 28 kDa trypanopain-Tb and a molecule from rat serum called rat trypanopain moledulator (rTM). The rTM-induced activation of cysteine proteases is not restricted to T. brucei as it is also observed with proteases from other protozoan parasites such as bloodstream forms of Trypanosoma congolense and the mammalian-infective in vitro-derived promastigote forms of Leishmania donovani and Leishmania major. The physical properties of rTM resemble those of the kininogen family of cysteine protease inhibitors. rTM is an acidic (pI 4.7) heat-stable 68 kDa glycoprotein with 15 kDa protease-susceptible domains. This resemblance between rTM and kininogens was confirmed by the positive, albeit weak, immunoreactivity between anti-(human low-molecular-mass kininogen) antibody and rTM as well as anti-rTM antibody and human low-molecular-mass kininogen. Furthermore, commercial preparations of human-low-molecular-mass kininogen and chicken egg white cystatin mimicked rTM by forming extra bands of proteolytic activity in the presence of trypanopain-Tb. In some instances, low-molecular-mass kininogen was also observed to increase the rate of hydrolysis of 7-(benzyloxycarbonyl-phenylalanyl-arginyl-amido)-4- methylcoumarin by live T. brucei. Although this effect was rather erratic, in no instance was significant inhibition

  15. Characterization of a novel protease from Aeribacillus pallidus strain VP3 with potential biotechnological interest.

    PubMed

    Mechri, Sondes; Ben Elhoul Berrouina, Mouna; Omrane Benmrad, Maroua; Zaraî Jaouadi, Nadia; Rekik, Hatem; Moujehed, Emna; Chebbi, Alif; Sayadi, Sami; Chamkha, Mohamed; Bejar, Samir; Jaouadi, Bassem

    2017-01-01

    The present study investigates the purification and physico-chemical characterization of an extracellular protease from the Aeribacillus pallidus strain VP3 previously isolated from a geothermal oil-field (Sfax, Tunisia). The maximum protease activity recorded after 22h of incubation at 45°C was 3000U/ml. Pure enzyme, designated as SPVP, was obtained after ammonium sulfate fractionation (40-60%)-dialysis followed by heat-treatment (70°C for 30min) and UNO Q-6 FPLC anion-exchange chromatography. The purified enzyme is a monomer of molecular mass about 29kDa. The sequence of the 25 NH2-terminal residues of SPVP showed a high homology with those of Bacillus proteases. The almost complete inhibition by PMSF and DIFP confirmed that SPVP is a member of serine protease family. Its optima of pH and temperature were pH 10 and 60°C, respectively. Its half-life times at 70 and 80°C were 8 and 4h, respectively. Its catalytic efficiency was higher than those of SAPCG, Alcalase Ultra 2.5L, and Thermolysin type X. SPVP exhibited excellent stability to detergents and wash performance analysis revealed that it could remove blood-stains effectively and high resistance against organic solvents. These properties make SPVP a potential candidate for applications in detergent formulations and non-aqueous peptide biocatalysis.

  16. Two Membrane-Anchored Aspartic Proteases Contribute to Pollen and Ovule Development1[OPEN

    PubMed Central

    Gao, Hui; Zhang, Yinghui; Wang, Wanlei; Zhao, Keke; Liu, Chunmei; Bai, Lin; Li, Rui

    2017-01-01

    Aspartic proteases are a class of proteolytic enzymes with conserved aspartate residues, which are implicated in protein processing, maturation, and degradation. Compared with yeast and animals, plants possess a larger aspartic protease family. However, little is known about most of these enzymes. Here, we characterized two Arabidopsis (Arabidopsis thaliana) putative glycosylphosphatidylinositol (GPI)-anchored aspartic protease genes, A36 and A39, which are highly expressed in pollen and pollen tubes. a36 and a36 a39 mutants display significantly reduced pollen activity. Transmission electron microscopy and terminal-deoxynucleotidyl transferase-mediated nick end labeling assays further revealed that the unviable pollen in a36 a39 may undergo unanticipated apoptosis-like programmed cell death. The degeneration of female gametes also occurred in a36 a39. Aniline Blue staining, scanning electron microscopy, and semi in vitro guidance assays indicated that the micropylar guidance of pollen tubes is significantly compromised in a36 a39. A36 and A39 that were fused with green fluorescent protein are localized to the plasma membrane and display punctate cytosolic localization and colocalize with the GPI-anchored protein COBRA-LIKE10. Furthermore, in a36 a39, the abundance of highly methylesterified homogalacturonans and xyloglucans was increased significantly in the apical pollen tube wall. These results indicate that A36 and A39, two putative GPI-anchored aspartic proteases, play important roles in plant reproduction in Arabidopsis. PMID:27872247

  17. Roles of proteases during invasion and egress by Plasmodium and Toxoplasma.

    PubMed

    Dowse, Timothy J; Koussis, Konstantinos; Blackman, Michael J; Soldati-Favre, Dominique

    2008-01-01

    Apicomplexan pathogens replicate exclusively within the confines of a host cell. Entry into (invasion) and exit from (egress) these cells requires an array of specialized parasite molecules, many of which have long been considered to have potential as targets of drug or vaccine-based therapies. In this chapter the authors discuss the current state of knowledge regarding the role of parasite proteolytic enzymes in these critical steps in the life cycle of two clinically important apicomplexan genera, Plasmodium and Toxoplasma. At least three distinct proteases of the cysteine mechanistic class have been implicated in egress of the malaria parasite from cells of its vertebrate and insect host. In contrast, the bulk of the evidence indicates a prime role for serine proteases of the subtilisin and rhomboid families in invasion by both parasites. Whereas proteases involved in egress may function predominantly to degrade host cell structures, proteases involved in invasion probably act primarily as maturases and 'sheddases', required to activate and ultimately remove ligands involved in interactions with the host cell.

  18. Mirolase, a novel subtilisin-like serine protease from the periodontopathogen Tannerella forsythia.

    PubMed

    Ksiazek, Miroslaw; Karim, Abdulkarim Y; Bryzek, Danuta; Enghild, Jan J; Thøgersen, Ida B; Koziel, Joanna; Potempa, Jan

    2015-03-01

    The genome of Tannerella forsythia, an etiological factor of chronic periodontitis, contains several genes encoding putative proteases. Here, we characterized a subtilisin-like serine protease of T. forsythia referred to as mirolase. Recombinant full-length latent promirolase [85 kDa, without its signal peptide (SP)] processed itself through sequential autoproteolytic cleavages into a mature enzyme of 40 kDa. Mirolase latency was driven by the N-terminal prodomain (NTP). In stark contrast to almost all known subtilases, the cleaved NTP remained non-covalently associated with mirolase, inhibiting its proteolytic, but not amidolytic, activity. Full activity was observed only after the NTP was gradually, and fully, degraded. Both activity and processing was absolutely dependent on calcium ions, which were also essential for enzyme stability. As a consequence, both serine protease inhibitors and calcium ions chelators inhibited mirolase activity. Activity assays using an array of chromogenic substrates revealed that mirolase specificity is driven not only by the substrate-binding subsite S1, but also by other subsites. Taken together, mirolase is a calcium-dependent serine protease of the S8 family with the unique mechanism of activation that may contribute to T. forsythia pathogenicity by degradation of fibrinogen, hemoglobin, and the antimicrobial peptide LL-37.

  19. Crystal structure of a novel cysteinless plant Kunitz-type protease inhibitor

    SciTech Connect

    Hansen, Daiane; Macedo-Ribeiro, Sandra; Verissimo, Paula; Yoo Im, Sonia; Sampaio, Misako Uemura; Oliva, Maria Luiza Vilela . E-mail: olivaml.bioq@epm.br

    2007-09-07

    Bauhinia bauhinioides Cruzipain Inhibitor (BbCI) is a cysteine protease inhibitor highly homologous to plant Kunitz-type inhibitors. However, in contrast to classical Kunitz family inhibitors it lacks cysteine residues and therefore disulfide bridges. BbCI is also distinct in the ability to inactivate enzymes belonging to two different classes, cysteine and serine proteases. Besides inhibiting the cysteine protease cruzipain, BbCI also inhibits cathepsin L and the serine proteases HNE (human neutrophil elastase) and PPE (porcine pancreatic elastase). Monoclinic crystals of the recombinant inhibitor that diffract to 1.7 A resolution were obtained using hanging drop method by vapor diffusion at 18 {sup o}C. The refined structure shows the conservative {beta}-trefoil fold features of the Kunitz inhibitors. In BbCI, one of the two characteristic S-S bonds is replaced by the water-mediated interaction between Tyr125 and Gly132. In this work we explore the structural differences between Kunitz-type inhibitors and analyze the essential interactions that maintain the protein structural stability preserving its biological function.

  20. Mirolase, a novel subtilisin-like serine protease from the periodontopathogen Tannerella forsythia

    PubMed Central

    Ksiazek, Miroslaw; Karim, Abdulkarim Y.; Bryzek, Danuta; Enghild, Jan J.; Thøgersen, Ida B.; Koziel, Joanna; Potempa, Jan

    2015-01-01

    The genome of Tannerella forsythia, an etiologic factor of chronic periodontitis, contains several genes encoding putative proteases. Here, we characterized a subtilisin-like serine protease of T. forsythia referred to as mirolase. Recombinant full-length latent promirolase (85 kDa, without its signal peptide) processed itself through sequential autoproteolytic cleavages into a mature enzyme of 40 kDa. Mirolase latency was driven by the N-terminal prodomain (NTP). In stark contrast to almost all known subtilases, the cleaved NTP remained non-covalently associated with mirolase, inhibiting its proteolytic, but not amidolytic, activity. Full activity was observed only after the NTP was gradually, and fully, degraded. Both activity and processing was absolutely dependent on calcium ions, which were also essential for enzyme stability. As a consequence, both serine protease inhibitors and calcium ions chelators inhibited mirolase activity. Activity assays using an array of chromogenic substrates revealed that mirolase specificity is driven not only by the substrate-binding subsite S1, but also by other subsites. Taken together mirolase is a calcium-dependent serine protease of the S8 family with the unique mechanism of activation that may contribute to T. forsythia pathogenicity by degradation of fibrinogen, hemoglobin and the antimicrobial peptide LL-37. PMID:25391881

  1. Active site conformational changes of prostasin provide a new mechanism of protease regulation by divalent cations

    SciTech Connect

    Spraggon, Glen; Hornsby, Michael; Shipway, Aaron; Tully, David C.; Bursulaya, Badry; Danahay, Henry; Harris, Jennifer L.; Lesley, Scott A.

    2010-01-12

    Prostasin or human channel-activating protease 1 has been reported to play a critical role in the regulation of extracellular sodium ion transport via its activation of the epithelial cell sodium channel. Here, the structure of the extracellular portion of the membrane associated serine protease has been solved to high resolution in complex with a nonselective d-FFR chloromethyl ketone inhibitor, in an apo form, in a form where the apo crystal has been soaked with the covalent inhibitor camostat and in complex with the protein inhibitor aprotinin. It was also crystallized in the presence of the divalent cation Ca{sup +2}. Comparison of the structures with each other and with other members of the trypsin-like serine protease family reveals unique structural features of prostasin and a large degree of conformational variation within specificity determining loops. Of particular interest is the S1 subsite loop which opens and closes in response to basic residues or divalent ions, directly binding Ca{sup +2} cations. This induced fit active site provides a new possible mode of regulation of trypsin-like proteases adapted in particular to extracellular regions with variable ionic concentrations such as the outer membrane layer of the epithelial cell.

  2. Cleavage Specificity Analysis of Six Type II Transmembrane Serine Proteases (TTSPs) Using PICS with Proteome-Derived Peptide Libraries

    PubMed Central

    Béliveau, François; Leduc, Richard; Overall, Christopher M.

    2014-01-01

    Background Type II transmembrane serine proteases (TTSPs) are a family of cell membrane tethered serine proteases with unclear roles as their cleavage site specificities and substrate degradomes have not been fully elucidated. Indeed just 52 cleavage sites are annotated in MEROPS, the database of proteases, their substrates and inhibitors. Methodology/Principal Finding To profile the active site specificities of the TTSPs, we applied Proteomic Identification of protease Cleavage Sites (PICS). Human proteome-derived database searchable peptide libraries were assayed with six human TTSPs (matriptase, matriptase-2, matriptase-3, HAT, DESC and hepsin) to simultaneously determine sequence preferences on the N-terminal non-prime (P) and C-terminal prime (P’) sides of the scissile bond. Prime-side cleavage products were isolated following biotinylation and identified by tandem mass spectrometry. The corresponding non-prime side sequences were derived from human proteome databases using bioinformatics. Sequencing of 2,405 individual cleaved peptides allowed for the development of the family consensus protease cleavage site specificity revealing a strong specificity for arginine in the P1 position and surprisingly a lysine in P1′ position. TTSP cleavage between R↓K was confirmed using synthetic peptides. By parsing through known substrates and known structures of TTSP catalytic domains, and by modeling the remainder, structural explanations for this strong specificity were derived. Conclusions Degradomics analysis of 2,405 cleavage sites revealed a similar and characteristic TTSP family specificity at the P1 and P1′ positions for arginine and lysine in unfolded peptides. The prime side is important for cleavage specificity, thus making these proteases unusual within the tryptic-enzyme class that generally has overriding non-prime side specificity. PMID:25211023

  3. Proteases and Protease Inhibitors of Urinary Extracellular Vesicles in Diabetic Nephropathy

    PubMed Central

    Tataruch, Dorota; Gu, Dongfeng; Liu, Xinyu; Forsblom, Carol; Groop, Per-Henrik; Holthofer, Harry

    2015-01-01

    Diabetic nephropathy (DN) is one of the major complications of diabetes mellitus (DM), leads to chronic kidney disease (CKD), and, ultimately, is the main cause for end-stage kidney disease (ESKD). Beyond urinary albumin, no reliable biomarkers are available for accurate early diagnostics. Urinary extracellular vesicles (UEVs) have recently emerged as an interesting source of diagnostic and prognostic disease biomarkers. Here we used a protease and respective protease inhibitor array to profile urines of type 1 diabetes patients at different stages of kidney involvement. Urine samples were divided into groups based on the level of albuminuria and UEVs isolated by hydrostatic dialysis and screened for relative changes of 34 different proteases and 32 protease inhibitors, respectively. Interestingly, myeloblastin and its natural inhibitor elafin showed an increase in the normo- and microalbuminuric groups. Similarly, a characteristic pattern was observed in the array of protease inhibitors, with a marked increase of cystatin B, natural inhibitor of cathepsins L, H, and B as well as of neutrophil gelatinase-associated Lipocalin (NGAL) in the normoalbuminuric group. This study shows for the first time the distinctive alterations in comprehensive protease profiles of UEVs in diabetic nephropathy and uncovers intriguing mechanistic, prognostic, and diagnostic features of kidney damage in diabetes. PMID:25874235

  4. Comparative study on the protease inhibitors from fish eggs

    NASA Astrophysics Data System (ADS)

    Ustadi; Kim, K. Y.; Kim, S. M.

    2005-07-01

    The protease inhibitor was purified from five different fish eggs. The molecular weights of Pacific herring, chum salmon, pond smelt, glassfish, and Alaska pollock egg protease inhibitors were 120, 89, 84.5, 17, and l6.8kDa, respectively. The specific inhibitory activity of glassfish egg protease inhibitor was the highest followed by those of Pacific herring and Alaska pollock in order. The specific inhibitory activity and purity of glassfish egg protease inhibitor were 19.70 Umg-1 protein and 164.70 folds of purification, respectively. Glassfish egg protease inhibitor was reasonably stable at 50-65°C and pH 8, which was more stable at high temperature and pH than protease inhibitors from the other fish species. Glassfish egg protease inhibitor was noncompetitive with inhibitor constant ( K i) of 4.44 nmolL-1.

  5. Management of protease inhibitor-associated hyperlipidemia.

    PubMed

    Penzak, Scott R; Chuck, Susan K

    2002-01-01

    Dyslipidemia, characterized by elevated serum levels of triglycerides and reduced levels of total cholesterol, low-density lipoprotein-cholesterol (LDL-C) and high-density lipoprotein-cholesterol, has been recognized in patients with human immunodeficiency virus (HIV) infection. It is thought that elevated levels of circulating cytokines, such as tumor necrosis factor-alpha and interferon-alpha, may alter lipid metabolism in patients with HIV infection. Protease inhibitors, such as saquinavir, indinavir and ritonavir, have been found to decrease mortality and improve quality of life in patients with HIV infection. However, these drugs have been associated with a syndrome of fat redistribution, insulin resistance, and hyperlipidemia. Elevations in serum total cholesterol and triglyceride levels, along with dyslipidemia that typically occurs in patients with HIV infection, may predispose patients to complications such as premature atherosclerosis and pancreatitis. It has been estimated that hypercholesterolemia and hypertriglyceridemia occur in greater than 50% of protease inhibitor recipients after 2 years of therapy, and that the risk of developing hyperlipidemia increases with the duration of treatment with protease inhibitors. In general, treatment of hyperlipidemia should follow National Cholesterol Education Program guidelines; efforts should be made to modify/control coronary heart disease risk factors (i.e. smoking; hypertension; diabetes mellitus) and maximize lifestyle modifications, primarily dietary intervention and exercise, in these patients. Where indicated, treatment usually consists of either pravastatin or atorvastatin for patients with elevated serum levels of LDL-C and/or total cholesterol. Atorvastatin is more potent in lowering serum total cholesterol and triglycerides compared with other hydroxymethylglutaryl coenzyme A (HMG-CoA) reductase inhibitors, but it is also associated with more drug interactions compared with pravastatin. Simvastatin

  6. Structure of protease-cleaved Escherichia coli α-2-macroglobulin reveals a putative mechanism of conformational activation for protease entrapment

    PubMed Central

    Fyfe, Cameron D.; Grinter, Rhys; Josts, Inokentijs; Mosbahi, Khedidja; Roszak, Aleksander W.; Cogdell, Richard J.; Wall, Daniel M.; Burchmore, Richard J. S.; Byron, Olwyn; Walker, Daniel

    2015-01-01

    Bacterial α-2-macroglobulins have been suggested to function in defence as broad-spectrum inhibitors of host proteases that breach the outer membrane. Here, the X-ray structure of protease-cleaved Escherichia coli α-2-macroglobulin is described, which reveals a putative mechanism of activation and conformational change essential for protease inhibition. In this competitive mechanism, protease cleavage of the bait-region domain results in the untethering of an intrinsically disordered region of this domain which disrupts native interdomain interactions that maintain E. coli α-2-macroglobulin in the inactivated form. The resulting global conformational change results in entrapment of the protease and activation of the thioester bond that covalently links to the attacking protease. Owing to the similarity in structure and domain architecture of Escherichia coli α-2-macroglobulin and human α-2-macro­globulin, this protease-activation mechanism is likely to operate across the diverse members of this group. PMID:26143919

  7. Luteoloside Acts as 3C Protease Inhibitor of Enterovirus 71 In Vitro

    PubMed Central

    Cao, Zeyu; Ding, Yue; Ke, Zhipeng; Cao, Liang; Li, Na; Ding, Gang; Wang, Zhenzhong; Xiao, Wei

    2016-01-01

    Luteoloside is a member of the flavonoids family that exhibits several bioactivities including anti-microbial and anti-cancer activities. However, the antiviral activity of luteoloside against enterovirus 71 (EV71) and the potential mechanism(s) responsible for this effect remain unknown. In this study, the antiviral potency of luteoloside against EV71 and its inhibitory effects on 3C protease activity were evaluated. First, we investigated the cytotoxicity of luteoloside against rhabdomyosarcoma (RD) cells, which was the cell line selected for an in vitro infection model. In a subsequent antiviral assay, the cytopathic effect of EV71 was significantly and dose-dependently relieved by the administration of luteoloside (EC50 = 0.43 mM, selection index = 5.3). Using a plaque reduction assay, we administered luteoloside at various time points and found that the compound reduced EV71 viability in RD cells rather than increasing defensive mobilization or viral absorption. Moreover, biochemical studies focused on VP1 (a key structural protein of EV71) mRNA transcript and protein levels also revealed the inhibitory effects of luteoloside on the EV71 viral yield. Finally, we performed inhibition assays using luteoloside to evaluate its effect on recombinant 3C protease activity. Our results demonstrated that luteoloside blocked 3C protease enzymatic activity in a dose-dependent manner (IC50 = 0.36 mM) that was similar to the effect of rutin, which is a well-known C3 protease inhibitor. Collectively, the results from this study indicate that luteoloside can block 3C protease activity and subsequently inhibit EV71 production in vitro. PMID:26870944

  8. Purification and characterization of secretory serine protease from necrotrophic oomycete, Pythium myriotylum Dreschler.

    PubMed

    Aswati Nair, Ravindranathan; Geethu, Chellappan

    2015-01-01

    Progressive increase in extracellular proteolytic activity with respect to growth was detected in cultures of necrotrophic oomycete Pythium myriotylum Dreschler with maximum activity detected at stationary phase of growth. The secretory protease from P. myriotylum designated, spPm1 was purified to homogeneity giving a single band of 47 kDa molecular mass on non-reducing SDS-PAGE and exhibiting caseinolytic activity in the zymogram. Under reducing conditions, an additional band of 27.0 kDa molecular size observed was subjected to matrix-assisted laser desorption/ionization-time-of-flight mass spectrometry (MALDI-TOF-MS) analysis. Resulting peptide identified as an autolytic product and generated under reducing conditions on SDS-PAGE, showed homology to domains of oomycete effector molecules. spPm1 retained proteolytic activity over broad pH (5.0-12.0) and temperature (10-80 °C) ranges with optimal pH and temperature at 8.0 and 60 °C respectively. spPm1 was identified as a serine protease following experiments with inhibitors specific to various protease groups. spPm1 displayed high stability to surfactants, organic solvents, oxidizing agents and to metal-ion chelator, EDTA. Kinetic parameters, Km and Vmax were determined as 0.04 mM and 7.52 U min(-1) mg(-1) respectively. Preferential hydrolysis of synthetic fluorogenic substrate, SAAPPPA (N-succinyl-L-alanyl-alanyl-proline-phenylalanine-p-nitroanilide) confirmed spPm1 as belonging to subtilisin serine protease family. The excellent stability of spPm1 protease characterized from P. myriotylum is discussed with respect to its potential industrial applications.

  9. Isolation and Identification of an Extracellular Subtilisin-Like Serine Protease Secreted by the Bat Pathogen Pseudogymnoascus destructans

    PubMed Central

    Pannkuk, Evan L.; Risch, Thomas S.; Savary, Brett J.

    2015-01-01

    White nose syndrome (WNS) is a cutaneous fungal disease of bats. WNS is responsible for unprecedented mortalities in North American cave bat populations. There have been few descriptions of enzyme activities that may function in WNS host/pathogen interactions, while no study has isolated and described secreted proteases. To address the hypothesis that Pseudogymnoascus destructans secretes extracellular proteases that function in wing necrosis during WNS infection, the object of this study was to culture P. destructans on various media, then isolate and structurally identify those proteases accumulated stably in the culture medium. We found a single dominant protease activity on minimal nutrient broth enriched with protein substrates, which was strongly inhibited by phenylmethylsulfonyl fluoride. This P. destructans serine protease (PdSP1) was isolated by preparative isoelectric focusing and concanavalin A lectin affinity chromatography. PdSP1 showed a molecular weight 27,900 (estimated by SDS-PAGE), broad pH optimum 6-8, and temperature optimum 60°C. Structural characterization of PdSP1 by MALDI-TOF MS, Orbitrap MS/MS, and Edman amino-terminal peptide sequencing matched it directly to a hypothetical protein accession from the sequenced P. destructans genome that is further identified as a MEROPS family S8A subtilisin-like serine peptidase. Two additional isoforms, PdSP2 and PdSP3, were identified in the P. destructans genome with 90% and 53% homology, respectively. P. destructans S8A serine proteases showed closer sequence conservation to P. pannorum and plant pathogenic fungi than to human pathogenic dermatophytes. Peptide-specific polyclonal antibodies developed from the PdSP1 sequence detected the protein in western blots. These subtilisin-like serine proteases are candidates for further functional studies in WNS host-pathogen interaction. PMID:25785714

  10. Isolation and identification of an extracellular subtilisin-like serine protease secreted by the bat pathogen Pseudogymnoascus destructans.

    PubMed

    Pannkuk, Evan L; Risch, Thomas S; Savary, Brett J

    2015-01-01

    White nose syndrome (WNS) is a cutaneous fungal disease of bats. WNS is responsible for unprecedented mortalities in North American cave bat populations. There have been few descriptions of enzyme activities that may function in WNS host/pathogen interactions, while no study has isolated and described secreted proteases. To address the hypothesis that Pseudogymnoascus destructans secretes extracellular proteases that function in wing necrosis during WNS infection, the object of this study was to culture P. destructans on various media, then isolate and structurally identify those proteases accumulated stably in the culture medium. We found a single dominant protease activity on minimal nutrient broth enriched with protein substrates, which was strongly inhibited by phenylmethylsulfonyl fluoride. This P. destructans serine protease (PdSP1) was isolated by preparative isoelectric focusing and concanavalin A lectin affinity chromatography. PdSP1 showed a molecular weight 27,900 (estimated by SDS-PAGE), broad pH optimum 6-8, and temperature optimum 60°C. Structural characterization of PdSP1 by MALDI-TOF MS, Orbitrap MS/MS, and Edman amino-terminal peptide sequencing matched it directly to a hypothetical protein accession from the sequenced P. destructans genome that is further identified as a MEROPS family S8A subtilisin-like serine peptidase. Two additional isoforms, PdSP2 and PdSP3, were identified in the P. destructans genome with 90% and 53% homology, respectively. P. destructans S8A serine proteases showed closer sequence conservation to P. pannorum and plant pathogenic fungi than to human pathogenic dermatophytes. Peptide-specific polyclonal antibodies developed from the PdSP1 sequence detected the protein in western blots. These subtilisin-like serine proteases are candidates for further functional studies in WNS host-pathogen interaction.

  11. Bcl-2 inhibits the mitochondrial release of an apoptogenic protease

    PubMed Central

    1996-01-01

    Bcl-2 belongs to a family of apoptosis-regulatory proteins which incorporate into the outer mitochondrial as well as nuclear membranes. The mechanism by which the proto-oncogene product Bcl-2 inhibits apoptosis is thus far elusive. We and others have shown previously that the first biochemical alteration detectable in cells undergoing apoptosis, well before nuclear changes become manifest, is a collapse of the mitochondrial inner membrane potential (delta psi m), suggesting the involvement of mitochondrial products in the apoptotic cascade. Here we show that mitochondria contain a pre-formed approximately 50-kD protein which is released upon delta psi m disruption and which, in a cell-free in vitro system, causes isolated nuclei to undergo apoptotic changes such as chromatin condensation and internucleosomal DNA fragmentation. This apoptosis-inducing factor (AIF) is blocked by N- benzyloxycarbonyl-Val-Ala-Asp.fluoromethylketone (Z-VAD.fmk), an antagonist of interleukin-1 beta-converting enzyme (ICE)-like proteases that is also an efficient inhibitor of apoptosis in cells. We have tested the effect of Bcl-2 on the formation, release, and action of AIF. When preventing mitochondrial permeability transition (which accounts for the pre-apoptotic delta psi m disruption in cells), Bcl-2 hyperexpressed in the outer mitochondrial membrane also impedes the release of AIF from isolated mitochondria in vitro. In contrast, Bcl-2 does not affect the formation of AIF, which is contained in comparable quantities in control mitochondria and in mitochondria from Bcl-2- hyperexpressing cells. Furthermore, the presence of Bcl-2 in the nuclear membrane does not interfere with the action of AIF on the nucleus, nor does Bcl-2 hyperexpression protect cells against AIF. It thus appears that Bcl-2 prevents apoptosis by favoring the retention of an apoptogenic protease in mitochondria. PMID:8879205

  12. Protease-activated receptors and prostaglandins in inflammatory lung disease

    PubMed Central

    Peters, Terence; Henry, Peter J

    2009-01-01

    Protease-activated receptors (PARs) are a novel family of G protein-coupled receptors. Signalling through PARs typically involves the cleavage of an extracellular region of the receptor by endogenous or exogenous proteases, which reveals a tethered ligand sequence capable of auto-activating the receptor. A considerable body of evidence has emerged over the past 20 years supporting a prominent role for PARs in a variety of human physiological and pathophysiological processes, and thus substantial attention has been directed towards developing drug-like molecules that activate or block PARs via non-proteolytic pathways. PARs are widely expressed within the respiratory tract, and their activation appears to exert significant modulatory influences on the level of bronchomotor tone, as well as on the inflammatory processes associated with a range of respiratory tract disorders. Nevertheless, there is debate as to whether the principal response to PAR activation is an augmentation or attenuation of airways inflammation. In this context, an important action of PAR activators may be to promote the generation and release of prostanoids, such as prostglandin E2, which have well-established anti-inflammatory effects in the lung. In this review, we primarily focus on the relationship between PARs, prostaglandins and inflammatory processes in the lung, and highlight their potential role in selected respiratory tract disorders, including pulmonary fibrosis, asthma and chronic obstructive pulmonary disease. This article is part of a themed issue on Mediators and Receptors in the Resolution of Inflammation. To view this issue visit http://www3.interscience.wiley.com/journal/121548564/issueyear?year=2009 PMID:19845685

  13. Enteropeptidase, a type II transmembrane serine protease.

    PubMed

    Zheng, X Long; Kitamoto, Yasunori; Sadler, J Evan

    2009-06-01

    Enteropeptidase, a type II transmembrane serine protease, is localized to the brush border of the duodenal and jejunal mucosa. It is synthesized as a zymogen (proenteropeptidase) that requires activation by another protease, either trypsin or possibly duodenase. Active enteropeptidase then converts the pancreatic precursor, trypsinogen, to trypsin by cleavage of the specific trypsinogen activation peptide, Asp-Asp-Asp-Asp-Lys- Ile that is highly conserved in vertebrates. Trypsin, in turn, activates other digestive zymogens such as chymotrypsinogen, proelastase, procarboxypeptidase and prolipase in the lumen of the gut. The important biological function of enteropeptidase is highlighted by the manifestation of severe diarrhea, failure to thrive, hypoproteinemia and edema as a result of congenital deficiency of enteropeptidase activity in the gut. Conversely, duodenopancreatic reflux of proteolytically active enteropeptidase may cause acute and chronic pancreatitis.

  14. Mycobacterial Caseinolytic Protease Gene Regulator ClgR Is a Substrate of Caseinolytic Protease

    PubMed Central

    Yamada, Yoshiyuki

    2017-01-01

    ABSTRACT The mycobacterial caseinolytic protease ClpP1P2 is a degradative protease that recently gained interest as a genetically and pharmacologically validated drug target for tuberculosis. The first whole-cell active ClpP1P2 inhibitor, the human proteasome inhibitor bortezomib, is currently undergoing lead optimization to introduce selectivity for the bacterial target. How inhibition of ClpP1P2 translates into whole-cell antimicrobial activity is little understood. Previous work has shown that the caseinolytic protease gene regulator ClgR is an activator of the clpP1P2 genes and also suggested that this transcription factor may be a substrate of the protease. Here, we employ promoter activity reporters and direct mRNA level measurements showing that bortezomib treatment of Mycobacterium bovis BCG increased transcription of clpP1P2 and other ClgR-dependent promoters, suggesting that inhibition of ClpP1P2 increases cellular ClgR levels. Then, we carried out red fluorescent protein-ClgR fusion analyses to show that ClgR is indeed a substrate of ClpP1P2 and to identify ClgR’s C-terminal nonapeptide APVVSLAVA as the signal sufficient for recognition and efficient protein degradation by ClpP1P2. Interestingly, accumulation of ClgR appears to be toxic for bacilli, suggesting a mechanism for how pharmacological inhibition of ClpP1P2 protease activity by bortezomib translates into whole-cell antibacterial activity. IMPORTANCE With 9 million new cases and more than 1 million deaths per year, tuberculosis, caused by Mycobacterium tuberculosis, is the biggest infectious disease killer globally. New drugs for the treatment of the drug-resistant forms of the disease are needed. Recently, a new target-lead couple, the mycobacterial protease ClpP1P2 and the human anticancer drug bortezomib, was identified. However, we know little about how expression of this protease is regulated, which proteins in the bacterium it degrades, how the protease recognizes its target proteins

  15. Acanthamoeba protease activity promotes allergic airway inflammation via protease-activated receptor 2.

    PubMed

    Park, Mi Kyung; Cho, Min Kyoung; Kang, Shin Ae; Park, Hye-Kyung; Kim, Dong-Hee; Yu, Hak Sun

    2014-01-01

    Acanthamoeba is a free-living amoeba commonly present in the environment and often found in human airway cavities. Acanthamoeba possesses strong proteases that can elicit allergic airway inflammation. To our knowledge, the aeroallergenicity of Acanthamoeba has not been reported. We repeatedly inoculated mice with Acanthamoeba trophozoites or excretory-secretory (ES) proteins intra-nasally and evaluated symptoms and airway immune responses. Acanthamoeba trophozoites or ES proteins elicited immune responses in mice that resembled allergic airway inflammation. ES proteins had strong protease activity and activated the expression of several chemokine genes (CCL11, CCL17, CCL22, TSLP, and IL-25) in mouse lung epithelial cells. The serine protease inhibitor phenyl-methane-sulfonyl fluoride (PMSF) inhibited ES protein activity. ES proteins also stimulated dendritic cells and enhanced the differentiation of naive T cells into IL-4-secreting T cells. After repeated inoculation of the protease-activated receptor 2 knockout mouse with ES proteins, airway inflammation and Th2 immune responses were markedly reduced, but not to basal levels. Furthermore, asthma patients had higher Acanthamoeba-specific IgE titers than healthy controls and we found Acanthamoeba specific antigen from house dust in typical living room. Our findings suggest that Acanthamoeba elicits allergic airway symptoms in mice via a protease allergen. In addition, it is possible that Acanthamoeba may be one of the triggers human airway allergic disease.

  16. HIV-protease inhibitors block the replication of both vesicular stomatitis and influenza viruses at an early post-entry replication step

    SciTech Connect

    Federico, Maurizio

    2011-08-15

    The inhibitors of HIV-1 protease (PIs) have been designed to block the activity of the viral aspartyl-protease. However, it is now accepted that this family of inhibitors can also affect the activity of cell proteases. Since the replication of many virus species requires the activity of host cell proteases, investigating the effects of PIs on the life cycle of viruses other than HIV would be of interest. Here, the potent inhibition induced by saquinavir and nelfinavir on the replication of both vesicular stomatitis and influenza viruses is described. These are unrelated enveloped RNA viruses infecting target cells upon endocytosis and intracellular fusion. The PI-induced inhibition was apparently a consequence of a block at the level of the fusion between viral envelope and endosomal membranes. These findings would open the way towards the therapeutic use of PIs against enveloped RNA viruses other than HIV.

  17. Extracellular proteases from eight psychrotolerant Antarctic strains.

    PubMed

    Vazquez, Susana C; Coria, Silvia H; MacCormack, Walter P

    2004-01-01

    Extracellular proteases from 8 Antarctic psychrotolerant Pseudomonas sp. strains were purified and characterised. All of them are neutral metalloproteases, have an apparent molecular mass of 45kDa, optimal activity at 40 degrees C and pH 7-9, retaining significant activity at pH 5-11. With the exception of P96-18, which is less stable, all retain more than 50% activity after 3 h of incubation at pH 5-9 and show low thermal stability (their half-life times range from 20 to 60 min at 40 degrees C and less than 5 min at 50 degrees C). These proteases can be used in commercial processes carried out at neutral pH and moderate temperatures, and are of special interest for their application in mixtures of enzymes where final thermal selective inactivation is needed. Results also highlight the relevance of Antarctic biotopes for the isolation of protease-producing enzymes active at low temperatures.

  18. Corruption of Innate Immunity by Bacterial Proteases

    PubMed Central

    Potempa, Jan; Pike, Robert N.

    2009-01-01

    The innate immune system of the human body has developed numerous mechanisms to control endogenous and exogenous bacteria and thus prevent infections by these microorganisms. These mechanisms range from physical barriers such as the skin or mucosal epithelium to a sophisticated array of molecules and cells that function to suppress or prevent bacterial infection. Many bacteria express a variety of proteases, ranging from non-specific and powerful enzymes that degrade many proteins involved in innate immunity to proteases that are extremely precise and specific in their mode of action. Here we have assembled a comprehensive picture of how bacterial proteases affect the host’s innate immune system to gain advantage and cause infection. This picture is far from being complete since the numbers of mechanisms utilized are as astonishing as they are diverse, ranging from degradation of molecules vital to innate immune mechanisms to subversion of the mechanisms to allow the bacterium to hide from the system or take advantage of it. It is vital that such mechanisms are elucidated to allow strategies to be developed to aid the innate immune system in controlling bacterial infections. PMID:19756242

  19. Effect of lanthanides on Porphyromonas gingivalis proteases.

    PubMed

    Sunkara, Sasi K; Ciancio, Sebastian G; Sojar, Hakimuddin T

    2010-01-01

    Host and bacterial proteases play a vital role in periodontitis. Inhibitors of these proteases are necessary for control of this disease. The purpose of this study was to evaluate the effect of lanthanides on proteins from Porphyromonas gingivalis, a major pathogen in periodontitis. Benzoyl-L-Arg-p-nitroanilide (BAPNA); H-Gly-Pro-pNA x HCl and gelatin were used to evaluate the activity of P. gingivalis proteins in the presence of lanthanides. Proteins extracted from cell surfaces and culture media of P. gingivalis were assessed for activity in the presence of different lanthanides by BAPNA assay. Only gadolinium chloride was used for H-Gly-Pro-pNA x HCl assay and gelatin-zymography. Concentration-dependent reduction of absorbance was observed in the presence of lanthanides with BAPNA and a similar observation was made with gadolinium chloride using H-Gly-Pro-pNa. Collagenolytic activity in cell surface extracts and culture media-precipitated proteins was absent in the presence of gadolinium chloride. These results suggest that the lanthanide gadolinium can be a potential inhibitor of P. gingivalis proteases.

  20. Corruption of innate immunity by bacterial proteases.

    PubMed

    Potempa, Jan; Pike, Robert N

    2009-01-01

    The innate immune system of the human body has developed numerous mechanisms to control endogenous and exogenous bacteria and thus prevent infections by these microorganisms. These mechanisms range from physical barriers such as the skin or mucosal epithelium to a sophisticated array of molecules and cells that function to suppress or prevent bacterial infection. Many bacteria express a variety of proteases, ranging from non-specific and powerful enzymes that degrade many proteins involved in innate immunity to proteases that are extremely precise and specific in their mode of action. Here we have assembled a comprehensive picture of how bacterial proteases affect the host's innate immune system to gain advantage and cause infection. This picture is far from being complete since the numbers of mechanisms utilized are as astonishing as they are diverse, ranging from degradation of molecules vital to innate immune mechanisms to subversion of the mechanisms to allow the bacterium to hide from the system or take advantage of it. It is vital that such mechanisms are elucidated to allow strategies to be developed to aid the innate immune system in controlling bacterial infections.

  1. Using in silico techniques: Isolation and characterization of an insect cuticle-degrading-protease gene from Beauveria bassiana.

    PubMed

    Khan, Sehroon; Nadir, Sadia; Wang, Xuewen; Khan, Afsar; Xu, Jianchu; Li, Meng; Tao, Lihong; Khan, Siraj; Karunarathna, Samantha C

    2016-08-01

    Cuticle-degrading-proteases (CDPs) secreted by Beauveria spp. are pivotal biocontrol substances, possessing commercial potential for developing bio-pesticides. Therefore, a thoughtful and contemplative understanding and assessment of the structural and functional features of these proteases would markedly assist the development of biogenic pesticides. Computational molecular biology is a new facile alternative approach to the tedious experimental molecular biology; therefore, by using bioinformatics tools, we isolated and characterized an insect CDP gene from Beauveria bassiana 70 s.l. genomic DNA. The CDP gene (1240 bp with GeneBank accession no. KT804651.1) consisted of three introns and four CDS exons, and shared 74-100% sequence identity to the reference CDP genes. Its phylogenetic tree results showed a unique evolution pattern, and the predicted amino acid peptide (PAAP) consisted of 344 amino acid residues with pI, molecular weight, instability index, grand average hydropathicity value and aliphatic index of 7.2, 35.4 kDa, 24.45, -0.149, and 76.63, respectively. The gene possessed 74-89% amino acid sequence similarity to the 12 reference strains. Three motifs (Peptidase_S8 subtilase family) were detected in the PAAP, and the computed 3D structure possessed 79.09% structural identity to alkaline serine proteases. The PAAP had four (three serine proteases and one Pyridoxal-dependent decarboxylase) conserved domains, a disulfide bridge, two calcium binding sites, MY domain, and three predicted active sites in the serine family domains. These results will set the groundwork for further exploitation of proteases and understanding the mechanism of disease caused by cuticle-degrading-serine-proteases from entomopathogenic fungi.

  2. Diverse enzymatic specificities of digestive proteases, 'intestains', enable Colorado potato beetle larvae to counteract the potato defence mechanism.

    PubMed

    Gruden, Kristina; Popovic, Tatjana; Cimerman, Nina; Krizaj, Igor; Strukelj, Borut

    2003-02-01

    In response to insect attack, high levels of proteinase inhibitors are synthesised in potato leaves. This can cause inefficient protein digestion in insects, leading to reduced growth, delayed development and lower fecundity. It has been suggested that Colorado potato beetle overcomes this defence mechanism by inducing the production of a set of cysteine proteases that are resistant to potato proteinase inhibitors. Experiments with gut extracts showed that these proteases have unusual inhibition profiles as they are not inhibited by most of the cystatins but are strongly inhibited by thyropins. In this study we have isolated three cysteine proteases from adapted guts of Colorado potato beetle larvae, named intestains 1, 2 and 3, the first cysteine proteases known to be involved in extracellular protein digestion. The N-terminal sequences suggest their classification into the papain family. Intestains differ in substrate specificities and inhibitory profiles. Their substrate specificities suggest that intestains 1 and 2 are general digestive enzymes, while intestain 3 has a more specific function. The inhibitory profile of intestain 1 is similar to that of proteases of the papain family. However, the Ki values for the interaction of intestain 2 with the same set of inhibitors are several hundred fold higher, which would enable the enzyme to circumvent the potato defence mechanism characterised by high concentrations of protease inhibitors in attacked potato leaves. A further, different strategy of the Colorado potato beetle to avoid potato defence is exhibited by intestain 3, which is able to cleave off the N-terminus of model cystatin and thus inactivate the inhibitor. These results suggest that the Colorado potato beetle combines different strategies to counteract plant defence mechanisms.

  3. Serine protease activity in developmental stages of Eimeria tenella.

    PubMed

    Fetterer, R H; Miska, K B; Lillehoj, H; Barfield, R C

    2007-04-01

    A number of complex processes are involved in Eimeria spp. survival, including control of sporulation, intracellular invasion, evasion of host immune responses, successful reproduction, and nutrition. Proteases have been implicated in many of these processes, but the occurrence and functions of serine proteases have not been characterized. Bioinformatic analysis suggests that the Eimeria tenella genome contains several serine proteases that lack homology to trypsin. Using RT-PCR, a gene encoding a subtilisin-like and a rhomboid protease-like serine protease was shown to be developmentally regulated, both being poorly expressed in sporozoites (SZ) and merozoites (MZ). Casein substrate gel electrophoresis of oocyst extracts during sporulation demonstrated bands of proteolytic activity with relative molecular weights (Mr) of 18, 25, and 45 kDa that were eliminated by coincubation with serine protease inhibitors. A protease with Mr of 25 kDa was purified from extracts of unsporulated oocysts by a combination of affinity and anion exchange chromatography. Extracts of SZ contained only a single band of inhibitor-sensitive proteolytic activity at 25 kDa, while the pattern of proteases from extracts of MZ was similar to that of oocysts except for the occurrence of a 90 kDa protease, resistant to protease inhibitors. Excretory-secretory products (ESP) from MZ contained AEBSF (4-[2-Aminoethyl] benzenesulphonyl fluoride)-sensitive protease activity with a specific activity about 10 times greater than that observed in MZ extracts. No protease activity was observed in the ESP from SZ. Pretreatment of SZ with AEBSF significantly reduced SZ invasion and the release of the microneme protein, MIC2. The current results suggest that serine proteases are present in all the developmental stages examined.

  4. A functional proteomics screen of proteases in colorectal carcinoma.

    PubMed Central

    McKerrow, J. H.; Bhargava, V.; Hansell, E.; Huling, S.; Kuwahara, T.; Matley, M.; Coussens, L.; Warren, R.

    2000-01-01

    BACKGROUND: Proteases facilitate several steps in cancer progression. To identify proteases most suitable for drug targeting, actual enzyme activity and not messenger RNA levels or immunoassay of protein is the ideal assay readout. MATERIALS AND METHODS: An automated microtiter plate assay format was modified to allow detection of all four major classes of proteases in tissue samples. Fifteen sets of colorectal carcinoma biopsies representing primary tumor, adjacent normal colon, and liver metastases were screened for protease activity. RESULTS: The major proteases detected were matrix metalloproteases (MMP9, MMP2, and MMP1), cathepsin B, cathepsin D, and the mast cell serine proteases, tryptase and chymase. Matrix metalloproteases were expressed at higher levels in the primary tumor than in adjacent normal tissue. The mast cell proteases, in contrast, were at very high levels in adjacent normal tissue, and not detectable in the metastases. Cathepsin B activity was significantly higher in the primary tumor, and highest in the metastases. The major proteases detected by activity assays were then localized in biopsy sections by immunohistochemistry. Mast cell proteases were abundant in adjacent normal tissue, because of infiltration of the lamina propria by mast cells. Matrix metalloproteases were localized to the tumor cells themselves; whereas, cathepsin B was predominantly expressed by macrophages at the leading edge of invading tumors. Although only low levels of urinary plasminogen activator were detected by direct enzyme assay, immunohistochemistry showed abundant protein within the tumor. CONCLUSIONS: This analysis, surveying all major classes of proteases by assays of activity rather than immunolocalization or in situ hybridization alone, serves to identify proteases whose activity is not completely balanced by endogenous inhibitors and which may be essential for tumor progression. These proteases are logical targets for initial efforts to produce low

  5. Enzymatic characterization of germination-specific cysteine protease-1 expressed transiently in cotyledons during the early phase of germination.

    PubMed

    Tsuji, Akihiko; Tsukamoto, Kana; Iwamoto, Keiko; Ito, Yuka; Yuasa, Keizo

    2013-01-01

    Papain-like cysteine protease activity that shows a unique transient expression profile in cotyledons of daikon radish during germination was detected. The enzyme showed a distinct elution pattern on DEAE-cellulose compared with cathepsin B-like and Responsive to dessication-21 cysteine protease. Although this activity was not detected in seed prior to imbibition, the activity increased markedly and reached a maximum at 2 days after imbibition and then decreased rapidly and completely disappeared after 5 days. Using cystatin-Sepharose, the 26 kDa cysteine protease (DRCP26) was isolated from cotyledons at 2 days after imbibition. The deduced amino acid sequence from the cDNA nucleotide sequence indicated that DRCP26 is an orthologue of Arabidopsis unidentified protein, germination-specific cysteine protease-1, belonging to the C1 family of cysteine protease predicted from genetic information. In an effort to characterize the enzymatic properties of DRCP26, the enzyme was purified to homogeneity from cotyledons at 48 h after imbibition. The best synthetic substrate for the enzyme was carbobenzoxy-Phe-Arg-4-methylcoumaryl-7-amide. All model peptides were digested to small peptides by the enzyme, suggesting that DRCP26 possesses broad cleavage specificity. These results indicated that DRCP26 plays a role in the mobilization of storage proteins in the early phase of seed germination.

  6. Structural Insight into Serine Protease Rv3671c that Protects M. tuberculosis from Oxidative and Acidic Stress

    SciTech Connect

    Biswas, Tapan; Small, Jennifer; Vandal, Omar; Odaira, Toshiko; Deng, Haiteng; Ehrt, Sabine; Tsodikov, Oleg V.

    2010-11-15

    Rv3671c, a putative serine protease, is crucial for persistence of Mycobacterium tuberculosis in the hostile environment of the phagosome. We show that Rv3671c is required for M. tuberculosis resistance to oxidative stress in addition to its role in protection from acidification. Structural and biochemical analyses demonstrate that the periplasmic domain of Rv3671c is a functional serine protease of the chymotrypsin family and, remarkably, that its activity increases on oxidation. High-resolution crystal structures of this protease in an active strained state and in an inactive relaxed state reveal that a solvent-exposed disulfide bond controls the protease activity by constraining two distant regions of Rv3671c and stabilizing it in the catalytically active conformation. In vitro biochemical studies confirm that activation of the protease in an oxidative environment is dependent on this reversible disulfide bond. These results suggest that the disulfide bond modulates activity of Rv3671c depending on the oxidative environment in vivo.

  7. A secretory protease inhibitor requires androgens for its expression in male sex accessory tissues but is expressed constitutively in pancreas.

    PubMed Central

    Mills, J S; Needham, M; Parker, M G

    1987-01-01

    A full length cDNA clone encoding a mouse prostatic secretory glycoprotein (p12) whose synthesis is dependent upon testicular androgens has been cloned and characterized. The predicted amino acid sequence of p12 shares extensive homology with several members of the Kazal family of secretory protease inhibitors, in particular the pancreatic secretory trypsin inhibitors. In agreement with sequence data, prostatic secretory p12, purified from mouse ventral prostate secretion, exhibits anti-trypsin activity. Steady-state levels of protease inhibitor mRNA in ventral prostate are reduced from approximately 0.06% in normal mice to undetectable after androgen withdrawal but are inducible within 4 h by re-administration of testosterone. Androgen-dependent expression of the secretory protease inhibitor mRNA was also observed in coagulating gland and seminal vesicle. In seminal vesicle, a tissue of different embryonic origin to the prostate, the kinetics of secretory protease inhibitor mRNA loss after castration are not as rapid as in the ventral prostate and coagulating gland. Low-level androgen independent expression was also observed in the pancreas. There appears to be a single gene for this secretory protease inhibitor and yet expression is markedly stimulated by testosterone in the sex accessory tissues and unaffected by this hormone in the pancreas. Images Fig. 3. Fig. 4. Fig. 5. Fig. 6. Fig. 7. PMID:3428272

  8. Type II transmembrane serine proteases as potential targets for cancer therapy

    PubMed Central

    Murray, Andrew S.; Varela, Fausto A.

    2016-01-01

    Carcinogenesis is accompanied by increased protein and activity levels of extracellular cell-surface proteases that are capable of modifying the tumor micro-environment by directly cleaving the extracellular matrix, as well as activating growth factors and proinflammatory mediators involved in proliferation and invasion of cancer cells, and recruitment of inflammatory cells. These complex processes ultimately potentiate neoplastic progression leading to local tumor cell invasion, entry into the vasculature, and metastasis to distal sites. Several members of the type II transmembrane serine protease (TTSP) family have been shown to play critical roles in cancer progression. In this review the knowledge collected over the past two decades about the molecular mechanisms underlying the pro-cancerous properties of selected TTSPs will be summarized. Furthermore, we will discuss how these insights may facilitate the translation into clinical settings in the future by specifically targeting TTSPs as part of novel cancer treatment regimens. PMID:27078673

  9. Granulosain I, a cysteine protease isolated from ripe fruits of Solanum granuloso-leprosum (Solanaceae).

    PubMed

    Vallés, Diego; Bruno, Mariela; López, Laura M I; Caffini, Néstor O; Cantera, Ana María B

    2008-08-01

    A new cysteine peptidase (Granulosain I) was isolated from ripe fruits of Solanum granuloso-leprosum Dunal (Solanaceae) by means of precipitation with organic solvent and cation exchange chromatography. The enzyme showed a single band by SDS-PAGE, its molecular mass was 24,746 Da (MALDI-TOF/MS) and its isoelectric point was higher than 9.3. It showed maximum activity (more than 90%) in the pH range 7-8.6. Granulosain I was completely inhibited by E-64 and activated by the addition of cysteine or 2-mercaptoethanol, confirming its cysteinic nature. The kinetic studies carried out with PFLNA as substrate, showed an affinity (Km 0.6 mM) slightly lower than those of other known plant cysteine proteases (papain and bromelain). The N-terminal sequence of granulosain I (DRLPASVDWRGKGVLVLVKNQGQC) exhibited a close homology with other cysteine proteases belonging to the C1A family.

  10. Reaching the Melting Point: Degradative Enzymes and Protease Inhibitors Involved in Baculovirus Infection and Dissemination

    PubMed Central

    Ishimwe, Egide; Hodgson, Jeffrey J.; Clem, Rollie J.; Passarelli, A. Lorena

    2015-01-01

    Baculovirus infection of a host insect involves several steps, beginning with initiation of virus infection in the midgut, followed by dissemination of infection from the midgut to other tissues in the insect, and finally culminating in “melting” or liquefaction of the host, which allows for horizontal spread of infection to other insects. While all of the viral gene products are involved in ultimately reaching this dramatic infection endpoint, this review focuses on two particular types of baculovirus-encoded proteins: degradative enzymes and protease inhibitors. Neither of these types of proteins is commonly found in other virus families, but they both play important roles in baculovirus infection. The types of degradative enzymes and protease inhibitors encoded by baculoviruses are discussed, as are the roles of these proteins in the infection process. PMID:25724418

  11. A potential Kazal-type serine protease inhibitor involves in kinetics of protease inhibition and bacteriostatic activity.

    PubMed

    Kumaresan, Venkatesh; Harikrishnan, Ramaswamy; Arockiaraj, Jesu

    2015-02-01

    Kazal-type serine protease inhibitor (KSPI) is a pancreatic secretary trypsin inhibitor which involves in various cellular component regulations including development and defense process. In this study, we have characterized a KSPI cDNA sequence of freshwater striped murrel fish Channa striatus (Cs) at molecular level. Cellular location analysis predicted that the CsKSPI was an extracellular protein. The domain analysis showed that the CsKSPI contains a Kazal domain at 47-103 along with its family signature between 61 and 83. Phylogenetically, CsKSPI is closely related to KSPI from Maylandia zebra and formed a sister group with mammals. The 2D structure of CsKSPI showed three α-helical regions which are connected with random coils, one helix at signal sequence and two at the Kazal domain region. The relative gene expression showed that the CsKSPI was highly expressed in gills and its expression was induced upon fungus (Aphanomyces invadans), bacteria (Aeromonas hydrophila) and poly I:C (a viral analogue) challenge. The CsKSPI recombinant protein was produced to characterize and study the CsKSPI gene specific functions. The recombinant CsKSPI strongly inhibited trypsin compared to other tested proteases. The results of the kinetic activity of CsKSPI against trypsin was V(max)s = 1.62 nmol/min, K(M)s = 0.21 mM and K(i)s = 15.37 nM. Moreover, the recombinant CsKSPI inhibited the growth of Gram-negative bacteria A. hydrophila at 20 μM and Gram-positive bacteria Bacillus subtilis at the MIC50 of 15 μM. Overall, the study indicated that the CsKSPI was a potential trypsin inhibitor which involves in antimicrobial activity.

  12. Diversity of both the cultivable protease-producing bacteria and bacterial extracellular proteases in the coastal sediments of King George Island, Antarctica.

    PubMed

    Zhou, Ming-Yang; Wang, Guang-Long; Li, Dan; Zhao, Dian-Li; Qin, Qi-Long; Chen, Xiu-Lan; Chen, Bo; Zhou, Bai-Cheng; Zhang, Xi-Ying; Zhang, Yu-Zhong

    2013-01-01

    Protease-producing bacteria play a vital role in degrading sedimentary organic nitrogen. However, the diversity of these bacteria and their extracellular proteases in most regions remain unknown. In this paper, the diversity of the cultivable protease-producing bacteria and of bacterial extracellular proteases in the sediments of Maxwell Bay, King George Island, Antarctica was investigated. The cultivable protease-producing bacteria reached 10(5) cells/g in all 8 sediment samples. The cultivated protease-producing bacteria were mainly affiliated with the phyla Actinobacteria, Firmicutes, Bacteroidetes, and Proteobacteria, and the predominant genera were Bacillus (22.9%), Flavobacterium (21.0%) and Lacinutrix (16.2%). Among these strains, Pseudoalteromonas and Flavobacteria showed relatively high protease production. Inhibitor analysis showed that nearly all the extracellular proteases from the bacteria were serine proteases or metalloproteases. These results begin to address the diversity of protease-producing bacteria and bacterial extracellular proteases in the sediments of the Antarctic Sea.

  13. Economic Methods of Ginger Protease'sextraction and Purification

    NASA Astrophysics Data System (ADS)

    Qiao, Yuanyuan; Tong, Junfeng; Wei, Siqing; Du, Xinyong; Tang, Xiaozhen

    This article reports the ginger protease extraction and purification methods from fresh ginger rhizome. As to ginger protease extraction, we adapt the steps of organic solvent dissolving, ammonium sulfate depositing and freeze-drying, and this method can attain crude enzyme powder 0.6% weight of fresh ginger rhizome. The purification part in this study includes two steps: cellulose ion exchange (DEAE-52) and SP-Sephadex 50 chromatography, which can purify crude ginger protease through ion and molecular weight differences respectively.

  14. Engineering Environmentally-Stable Proteases to Specifically Neutralize Protein Toxins

    DTIC Science & Technology

    2013-10-01

    agents , such as Soman and Sarin . 2. Linkage to binding molecules Conjugating an antibody (or any other binding module) with an initiating protease...to develop the tools and principles necessary to engineer subtilisin proteases which specifically target and deactivate biological warfare agent (BWA...warfare agent (BWA) toxins. We have engineered and evolved subtilisin proteases to specifically target and deactivate BoNT, SEB, ricin, and B

  15. Crystal structure of the cysteine protease inhibitor 2 from Entamoeba histolytica: Functional convergence of a common protein fold

    SciTech Connect

    Casados-Vázquez, Luz E.; Lara-González, Samuel; Brieb, Luis G.

    2012-04-18

    Cysteine proteases (CP) are key pathogenesis and virulence determinants of protozoan parasites. Entamoeba histolytica contains at least 50 cysteine proteases; however, only three (EhCP1, EhCP2 and EhCP5) are responsible for approximately 90% of the cysteine protease activity in this parasite. CPs are expressed as inactive zymogens. Because the processed proteases are potentially cytotoxic, protozoan parasites have developed mechanisms to regulate their activity. Inhibitors of cysteine proteases (ICP) of the chagasin-like inhibitor family (MEROPS family I42) were recently identified in bacteria and protozoan parasites. E. histolytica contains two ICP-encoding genes of the chagasin-like inhibitor family. EhICP1 localizes to the cytosol, whereas EhICP2 is targeted to phagosomes. Herein, we report two crystal structures of EhICP2. The overall structure of EhICP2 consists of eight {beta}-strands and closely resembles the immunoglobulin fold. A comparison between the two crystal forms of EhICP2 indicates that the conserved BC, DE and FG loops form a flexible wedge that may block the active site of CPs. The positively charged surface of the wedge-forming loops in EhICP2 contrasts with the neutral surface of the wedge-forming loops in chagasin. We postulate that the flexibility and positive charge observed in the DE and FG loops of EhICP2 may be important to facilitate the initial binding of this inhibitor to the battery of CPs present in E. histolytica.

  16. Extracellular Bacterial Proteases in Chronic Wounds: A Potential Therapeutic Target?

    PubMed Central

    Suleman, Louise

    2016-01-01

    Significance: Bacterial biofilms are considered to be responsible for over 80% of persistent infections, including chronic lung infections, osteomyelitis, periodontitis, endocarditis, and chronic wounds. Over 60% of chronic wounds are colonized with bacteria that reside within a biofilm. The exaggerated proteolytic environment of chronic wounds, more specifically elevated matrix metalloproteinases, is thought to be one of the possible reasons as to why chronic wounds fail to heal. However, the role of bacterial proteases within chronic wounds is not fully understood. Recent Advances: Recent research has shown that bacterial proteases can enable colonization and facilitate bacterial immune evasion. The inhibition of bacterial proteases such as Pseudomonas aeruginosa elastase B (LasB) has resulted in the disruption of the bacterial biofilm in vitro. P. aeruginosa is thought to be a key pathogen in chronic wound infection, and therefore, the disruption of these biofilms, potentially through the targeting of P. aeruginosa bacterial proteases, is an attractive therapeutic endeavor. Critical Issues: Disrupting biofilm formation through the inhibition of bacterial proteases may lead to the dissemination of bacteria from the biofilm, allowing planktonic cells to colonize new sites within the wound. Future Directions: Despite a plethora of evidence supporting the role of bacterial proteases as virulence factors in infection, there remains a distinct lack of research into the effect of bacterial proteases in chronic wounds. To assess the viability of targeting bacterial proteases, future research should aim to understand the role of these proteases in a variety of chronic wound subtypes. PMID:27785379

  17. Fibrin(ogen)olytic activity of bumblebee venom serine protease

    SciTech Connect

    Qiu Yuling; Choo, Young Moo; Yoon, Hyung Joo; Jia Jingming; Cui Zheng; Wang Dong; Kim, Doh Hoon; Sohn, Hung Dae; Jin, Byung Rae

    2011-09-01

    Bee venom is a rich source of pharmacologically active components; it has been used as an immunotherapy to treat bee venom hypersensitivity, and venom therapy has been applied as an alternative medicine. Here, we present evidence that the serine protease found in bumblebee venom exhibits fibrin(ogen)olytic activity. Compared to honeybee venom, bumblebee venom contains a higher content of serine protease, which is one of its major components. Venom serine proteases from bumblebees did not cross-react with antibodies against the honeybee venom serine protease. We provide functional evidence indicating that bumblebee (Bombus terrestris) venom serine protease (Bt-VSP) acts as a fibrin(ogen)olytic enzyme. Bt-VSP activates prothrombin and directly degrades fibrinogen into fibrin degradation products. However, Bt-VSP is not a plasminogen activator, and its fibrinolytic activity is less than that of plasmin. Taken together, our results define roles for Bt-VSP as a prothrombin activator, a thrombin-like protease, and a plasmin-like protease. These findings offer significant insight into the allergic reaction sequence that is initiated by bee venom serine protease and its potential usefulness as a clinical agent in the field of hemostasis and thrombosis. - Graphical abstract: Display Omitted Highlights: > Bumblebee venom serine protease (Bt-VSP) is a fibrin(ogen)olytic enzyme. > Bt-VSP activates prothrombin. > Bt-VSP directly degrades fibrinogen into fibrin degradation products. > Bt-VSP is a hemostatically active protein that is a potent clinical agent.

  18. Extracellular Bacterial Proteases in Chronic Wounds: A Potential Therapeutic Target?

    PubMed

    Suleman, Louise

    2016-10-01

    Significance: Bacterial biofilms are considered to be responsible for over 80% of persistent infections, including chronic lung infections, osteomyelitis, periodontitis, endocarditis, and chronic wounds. Over 60% of chronic wounds are colonized with bacteria that reside within a biofilm. The exaggerated proteolytic environment of chronic wounds, more specifically elevated matrix metalloproteinases, is thought to be one of the possible reasons as to why chronic wounds fail to heal. However, the role of bacterial proteases within chronic wounds is not fully understood. Recent Advances: Recent research has shown that bacterial proteases can enable colonization and facilitate bacterial immune evasion. The inhibition of bacterial proteases such as Pseudomonas aeruginosa elastase B (LasB) has resulted in the disruption of the bacterial biofilm in vitro. P. aeruginosa is thought to be a key pathogen in chronic wound infection, and therefore, the disruption of these biofilms, potentially through the targeting of P. aeruginosa bacterial proteases, is an attractive therapeutic endeavor. Critical Issues: Disrupting biofilm formation through the inhibition of bacterial proteases may lead to the dissemination of bacteria from the biofilm, allowing planktonic cells to colonize new sites within the wound. Future Directions: Despite a plethora of evidence supporting the role of bacterial proteases as virulence factors in infection, there remains a distinct lack of research into the effect of bacterial proteases in chronic wounds. To assess the viability of targeting bacterial proteases, future research should aim to understand the role of these proteases in a variety of chronic wound subtypes.

  19. Cloning and analysis of WF146 protease, a novel thermophilic subtilisin-like protease with four inserted surface loops.

    PubMed

    Wu, Jiang; Bian, Yan; Tang, Bing; Chen, Xiangdong; Shen, Ping; Peng, Zhenrong

    2004-01-30

    Cloning and sequencing of the gene encoding WF146 protease, an extracellular subtilisin-like protease from the thermophile Bacillus sp. WF146, revealed that the WF146 protease was translated as a 416-amino acid precursor consisting of a putative 18-amino acid signal peptide, a 10-kDa N-terminal propeptide and a 32-kDa mature protease region. The mature WF146 protease shares a high degree of amino acid sequence identity with two psychrophilic subtilisins, S41 (68.2%) and S39 (65.4%), and a mesophilic subtilisin, SSII (67.1%). Significantly, these closely related proteases adapted to different temperatures all had four inserted surface loops not found in other subtilisins. However, unlike those of S41, S39 and SSII, the inserted loops of the WF146 protease possessed stabilizing features, such as the introduction of Pro residues into the loop regions. Interestingly, the WF146 protease contained five of the seven mutations previously found in a hyperstable variant of subtilisin S41 obtained by directed evolution. The proform of WF146 protease (pro-WF146 protease) was overexpressed in Escherichia coli in an inactive soluble form. After heat treatment, the 42-kDa pro-WF146 protease converted to a 32-kDa active mature form by processing the N-terminal propeptide. The purified mature WF146 protease hydrolyzed casein with an optimum temperature of 85 degrees C, and lost activity with a half-life of 30 min at 80 degrees C in the presence of 10 mM CaCl2.

  20. Reversible Unfolding of Rhomboid Intramembrane Proteases

    PubMed Central

    Panigrahi, Rashmi; Arutyunova, Elena; Panwar, Pankaj; Gimpl, Katharina; Keller, Sandro; Lemieux, M. Joanne

    2016-01-01

    Denaturant-induced unfolding of helical membrane proteins provides insights into their mechanism of folding and domain organization, which take place in the chemically heterogeneous, anisotropic environment of a lipid membrane. Rhomboid proteases are intramembrane proteases that play key roles in various diseases. Crystal structures have revealed a compact helical bundle with a buried active site, which requires conformational changes for the cleavage of transmembrane substrates. A dimeric form of the rhomboid protease has been shown to be important for activity. In this study, we examine the mechanism of refolding for two distinct rhomboids to gain insight into their secondary structure-activity relationships. Although helicity is largely abolished in the unfolded states of both proteins, unfolding is completely reversible for HiGlpG but only partially reversible for PsAarA. Refolding of both proteins results in reassociation of the dimer, with a 90% regain of catalytic activity for HiGlpG but only a 70% regain for PsAarA. For both proteins, a broad, gradual transition from the native, folded state to the denatured, partly unfolded state was revealed with the aid of circular dichroism spectroscopy as a function of denaturant concentration, thus arguing against a classical two-state model as found for many globular soluble proteins. Thermal denaturation has irreversible destabilizing effects on both proteins, yet reveals important functional details regarding substrate accessibility to the buried active site. This concerted biophysical and functional analysis demonstrates that HiGlpG, with a simple six-transmembrane-segment organization, is more robust than PsAarA, which has seven predicted transmembrane segments, thus rendering HiGlpG amenable to in vitro studies of membrane-protein folding. PMID:27028647

  1. Multiple Proteases to Localize Oxidation Sites

    PubMed Central

    Gu, Liqing; Robinson, Renã A. S.

    2015-01-01

    Proteins present in cellular environments with high levels of reactive oxygen and nitrogen species and/or low levels of antioxidants are highly susceptible to oxidative post-translational modification (PTM). Irreversible oxidative PTMs can generate a complex distribution of modified protein molecules, recently termed as proteoforms. Using ubiquitin as a model system, we mapped oxidative modification sites using trypsin, Lys-C, and Glu-C peptides. Several M+16 Da proteoforms were detected as well as proteoforms that include other previously unidentified oxidative modifications. This work highlights the use of multiple protease digestions to give insights to the complexity of oxidative modifications possible in bottom-up analyses. PMID:25775238

  2. Rapid Release of Protease Inhibitors from Soybeans

    PubMed Central

    Hwang, David L.; Yang, Wen-Kuang; Foard, Donald E.; Lin, K.-T. -Davis

    1978-01-01

    Specific antisera were prepared against the Bowman-Birk trypsin inhibitor and four other trypsin inhibitors of low molecular weight isolated from soybeans (Glycine max L. cv. Tracy). These antisera were used to detect the presence and amount of the inhibitors in: (a) seeds and protein extracts of soybean meal; (b) seedlings; and (c) the water surrounding the seeds and roots of seedlings. Lectin activities in seeds, seedlings, and water were also determined at the same time as the protease inhibitor activities. By competitive inhibition of immunoprecipitation, the combined five low molecular weight protease inhibitors were found to constitute the following percentages of proteins (w/w): 6.3% in defatted soybean meal; 8.1% of the protein extracted from the meal by a buffer of pH 8.6; 8.3, 14.7, 15.2, 16.1, 17.2, and 18.9% of the protein in a lyophilisate of water in which seeds were incubated for 4, 8, 12, 16, 20, and 24 hours, respectively; 8.2% in a lyophilisate of water in which roots of seedlings grew for 20 days; 1.5% in cotyledons; and less than 0.1% in epicotyls, hypocotyls, and roots of 12-day-old seedlings. Hemagglutination activities, expressed as the lowest amount of protein required to give a positive agglutination of 0.2 ml of 2% rabbit red blood cells, were as follows: purified soybean lectin, 0.08 μg; lyophilisate of water in which seeds were incubated for 4, 8, 12, 16, 20, and 24 hours, 10, 2.5, 5, 5, and 2.5 μg, respectively; lyophilisate of water in which roots grew for 20 days, 5 μg; 12-day-old cotyledons, roots, epicotyls, and hypocotyls, 12.5, 100, >1,000, and >500 μg, respectively. The results indicate that a large amount of protease inhibitors as well as lectins are released from seeds during the first 8 hours of imbibition. Neither lima bean trypsin inhibitor (mol wt, 10,000) nor Kunitz soybean trypsin inhibitor (mol wt, 21,500) showed competitive inhibition in tests with antisera against low molecular weight soybean protease inhibitors

  3. Increased activity of unlinked Zika virus NS2B/NS3 protease compared to linked Zika virus protease.

    PubMed

    Kuiper, Benjamin D; Slater, Kristin; Spellmon, Nicholas; Holcomb, Joshua; Medapureddy, Prasanna; Muzzarelli, Kendall M; Yang, Zhe; Ovadia, Reuben; Amblard, Franck; Kovari, Iulia A; Schinazi, Raymond F; Kovari, Ladislau C

    2017-03-22

    Zika virus (ZIKV) is a flavivirus spread by daytime-active Aedes spp. mosquitoes such as A. aegypti and A. albopictus. Previously thought to be a mild infection, the latest ZIKV outbreak in the Americas is causally associated with more severe symptoms as well as severe birth defects, such as microcephaly. Currently no vaccine or antiviral exists. However, recent progress has demonstrated the viral NS2B/NS3 protease may be a suitable target for the development of small-molecule antiviral agents. To better understand the ZIKV protease, we expressed, purified, and characterized unlinked and linked NS2B/NS3 protease corresponding to an isolate from the recent outbreak in Puerto Rico. Unlinked ZIKV protease is more active and binds substrate with greater affinity than linked ZIKV protease. Therefore, we propose that unlinked ZIKV protease be used when evaluating or designing ZIKV protease inhibitors. Additionally, potent inhibitors of related viral proteases, like West Nile Virus and Dengue virus, may serve as advanced starting points to identify and develop ZIKV protease inhibitors.

  4. Structure of protease-cleaved Escherichia coli α-2-macroglobulin reveals a putative mechanism of conformational activation for protease entrapment

    SciTech Connect

    Fyfe, Cameron D.; Grinter, Rhys; Josts, Inokentijs; Mosbahi, Khedidja; Roszak, Aleksander W.; Cogdell, Richard J.; Wall, Daniel M.; Burchmore, Richard J. S.; Byron, Olwyn; Walker, Daniel

    2015-06-30

    The X-ray structure of protease-cleaved E. coli α-2-macroglobulin is described, which reveals a putative mechanism of activation and conformational change essential for protease inhibition. Bacterial α-2-macroglobulins have been suggested to function in defence as broad-spectrum inhibitors of host proteases that breach the outer membrane. Here, the X-ray structure of protease-cleaved Escherichia coli α-2-macroglobulin is described, which reveals a putative mechanism of activation and conformational change essential for protease inhibition. In this competitive mechanism, protease cleavage of the bait-region domain results in the untethering of an intrinsically disordered region of this domain which disrupts native interdomain interactions that maintain E. coli α-2-macroglobulin in the inactivated form. The resulting global conformational change results in entrapment of the protease and activation of the thioester bond that covalently links to the attacking protease. Owing to the similarity in structure and domain architecture of Escherichia coli α-2-macroglobulin and human α-2-macroglobulin, this protease-activation mechanism is likely to operate across the diverse members of this group.

  5. Regulated proteolysis by cortical granule serine protease 1 at fertilization.

    PubMed

    Haley, Sheila A; Wessel, Gary M

    2004-05-01

    Cortical granules are specialized organelles whose contents interact with the extracellular matrix of the fertilized egg to form the block to polyspermy. In sea urchins, the granule contents form a fertilization envelope (FE), and this construction is critically dependent upon protease activity. An autocatalytic serine protease, cortical granule serine protease 1 (CGSP1), has been identified in the cortical granules of Strongylocentrotus purpuratus eggs, and here we examined the regulation of the protease activity and tested potential target substrates of CGSP1. We found that CGSP1 is stored in its full-length, enzymatically quiescent form in the granule, and is inactive at pH 6.5 or below. We determined the pH of the cortical granule by fluorescent indicators and micro-pH probe measurements and found the granules to be pH 5.5, a condition inhibitory to CGSP1 activity. Exposure of the protease to the pH of seawater (pH 8.0) at exocytosis immediately activates the protease. Activation of eggs at pH 6.5 or lower blocks activation of the protease and the resultant FE phenotypes are indistinguishable from a protease-null phenotype. We find that native cortical granule targets of the protease are beta-1,3 glucanase, ovoperoxidase, and the protease itself, but the structural proteins of the granule are not proteolyzed by CGSP1. Whole mount immunolocalization experiments demonstrate that inhibition of CGSP1 activity affects the localization of ovoperoxidase but does not alter targeting of structural proteins to the FE. The mistargeting of ovoperoxidase may lead to spurious peroxidative cross-linking activity and contribute to the lethality observed in protease-null cells. Thus, CGSP1 is proteolytically active only when secreted, due to the low pH of the cortical granules, and it has a small population of targets for cleavage within the cortical granules.

  6. Secretion of Proteases by an Opportunistic Fungal Pathogen Scedosporium aurantiacum

    PubMed Central

    Kautto, Liisa; Nevalainen, Helena

    2017-01-01

    Scedosporium aurantiacum is an opportunistic filamentous fungus increasingly isolated from the sputum of cystic fibrosis patients, and is especially prevalent in Australia. At the moment, very little is known about the infection mechanism of this fungus. Secreted proteases have been shown to contribute to fungal virulence in several studies with other fungi. Here we have compared the profiles of proteases secreted by a clinical isolate Scedosporium aurantiacum (WM 06.482) and an environmental strain (WM 10.136) grown on a synthetic cystic fibrosis sputum medium supplemented with casein or mucin. Protease activity was assessed using class-specific substrates and inhibitors. Subtilisin-like and trypsin-like serine protease activity was detected in all cultures. The greatest difference in the secretion of proteases between the two strains occurred in mucin-supplemented medium, where the activities of the elastase-like, trypsin-like and aspartic proteases were, overall, 2.5–75 fold higher in the clinical strain compared to the environmental strain. Proteases secreted by the two strains in the mucin-supplemented medium were further analyzed by mass spectrometry. Six homologs of fungal proteases were identified from the clinical strain and five from the environmental strain. Of these, three were common for both strains including a subtilisin peptidase, a putative leucine aminopeptidase and a PA-SaNapH-like protease. Trypsin-like protease was identified by mass spectrometry only in the clinical isolate even though trypsin-like activity was present in all cultures. In contrast, high elastase-like activity was measured in the culture supernatant of the clinical strain but could not be identified by mass spectrometry searching against other fungi in the NCBI database. Future availability of an annotated genome will help finalise identification of the S. aurantiacum proteases. PMID:28060882

  7. Secretion of Proteases by an Opportunistic Fungal Pathogen Scedosporium aurantiacum.

    PubMed

    Han, Zhiping; Kautto, Liisa; Nevalainen, Helena

    2017-01-01

    Scedosporium aurantiacum is an opportunistic filamentous fungus increasingly isolated from the sputum of cystic fibrosis patients, and is especially prevalent in Australia. At the moment, very little is known about the infection mechanism of this fungus. Secreted proteases have been shown to contribute to fungal virulence in several studies with other fungi. Here we have compared the profiles of proteases secreted by a clinical isolate Scedosporium aurantiacum (WM 06.482) and an environmental strain (WM 10.136) grown on a synthetic cystic fibrosis sputum medium supplemented with casein or mucin. Protease activity was assessed using class-specific substrates and inhibitors. Subtilisin-like and trypsin-like serine protease activity was detected in all cultures. The greatest difference in the secretion of proteases between the two strains occurred in mucin-supplemented medium, where the activities of the elastase-like, trypsin-like and aspartic proteases were, overall, 2.5-75 fold higher in the clinical strain compared to the environmental strain. Proteases secreted by the two strains in the mucin-supplemented medium were further analyzed by mass spectrometry. Six homologs of fungal proteases were identified from the clinical strain and five from the environmental strain. Of these, three were common for both strains including a subtilisin peptidase, a putative leucine aminopeptidase and a PA-SaNapH-like protease. Trypsin-like protease was identified by mass spectrometry only in the clinical isolate even though trypsin-like activity was present in all cultures. In contrast, high elastase-like activity was measured in the culture supernatant of the clinical strain but could not be identified by mass spectrometry searching against other fungi in the NCBI database. Future availability of an annotated genome will help finalise identification of the S. aurantiacum proteases.

  8. Hemostatic, milk clotting and blood stain removal potential of cysteine proteases from Calotropis gigantea (L.) R. Br. Latex

    PubMed Central

    Bindhu, Omana Sukumaran; Singh, Maheshwari Kumari

    2014-01-01

    Introduction: Plant latex is a natural source of biologically active compounds and several hydrolytic enzymes responsible for their diverse health benefits. Recent past has witnessed substantial progress in understanding their supplementary industrial and pharmaceutical utility. Calotropis gigantea is one of the important latex producing plants belonging to asclepediaceae family with wide ethnopharmacological applications and is rich in proteolytic enzymes. Present study investigates hemostatic, milk clotting and blood stain removal potential of C. gigantea latex proteases. Materials and Methods: The protease activity of crude enzyme (CE), obtained by centrifugation followed by ammonium sulphate precipitation and dialysis, was assayed using casein as the substrate. Effect of pH, temperature and specific inhibitors on protease activity was determined. Native PAGE and in gel protease activity of CE was performed. Hemostatic (Fibrinogen polymerization, fibrinogen agarose plate and blood clot lysis assays), milk clotting and blood stain removal efficacies of CE were determined. Results: CE exhibited high caseinolytic activity. Enzyme activity was optimum at 37-50ºC and pH 8.0. Fibrinogen polymerization assay showed concentration dependent increase in turbidity indicating thrombin like activity which was further confirmed by fibrinogen agarose plate assays. Clot lysis assay indicated 92.41% thrombolysis by CE in 90 min. CE also revealed significantly high ratio of milk clotting to protease activity (Milk Clotting Index, MCI = 827.59 ± 1.52). Complete destaining of blood stained fabric was observed when incubated with 1% detergent incorporated with 0.1mg/ml CE. The study highlights and validates the compound application potential of latex cysteine proteases from C. gigantea. PMID:24991114

  9. Proteomic approaches to identify substrates of the three Deg/HtrA proteases of the cyanobacterium Synechocystis sp. PCC 6803.

    PubMed

    Tam, Lam X; Aigner, Harald; Timmerman, Evy; Gevaert, Kris; Funk, Christiane

    2015-06-15

    The family of Deg/HtrA proteases plays an important role in quality control of cellular proteins in a wide range of organisms. In the genome of the cyanobacterium Synechocystis sp. PCC 6803, a model organism for photosynthetic research and renewable energy products, three Deg proteases are encoded, termed HhoA, HhoB and HtrA. In the present study, we compared wild-type (WT) Synechocystis cells with the single insertion mutants ΔhhoA, ΔhhoB and ΔhtrA. Protein expression of the remaining Deg/HtrA proteases was strongly affected in the single insertion mutants. Detailed proteomic studies using DIGE (difference gel electrophoresis) and N-terminal COFRADIC (N-terminal combined fractional diagonal chromatography) revealed that inactivation of a single Deg protease has similar impact on the proteomes of the three mutants; differences to WT were observed in enzymes involved in the major metabolic pathways. Changes in the amount of phosphate permease system Pst-1 were observed only in the insertion mutant ΔhhoB. N-terminal COFRADIC analyses on cell lysates of ΔhhoB confirmed changed amounts of many cell envelope proteins, including the phosphate permease systems, compared with WT. In vitro COFRADIC studies were performed to identify the specificity profiles of the recombinant proteases rHhoA, rHhoB or rHtrA added to the Synechocystis WT proteome. The combined in vivo and in vitro N-terminal COFRADIC datasets propose RbcS as a natural substrate for HhoA, PsbO for HhoB and HtrA and Pbp8 for HtrA. We therefore suggest that each Synechocystis Deg protease protects the cell through different, but connected mechanisms.

  10. Drosophila melanogaster clip-domain serine proteases: Structure, function and regulation.

    PubMed

    Veillard, Florian; Troxler, Laurent; Reichhart, Jean-Marc

    2016-03-01

    Mammalian chymotrypsin-like serine proteases (SPs) are one of the best-studied family of enzymes with roles in a wide range of physiological processes, including digestion, blood coagulation, fibrinolysis and humoral immunity. Extracellular SPs can form cascades, in which one protease activates the zymogen of the next protease in the chain, to amplify physiological or pathological signals. These extracellular SPs are generally multi-domain proteins, with pro-domains that are involved in protein-protein interactions critical for the sequential organization of the cascades, the control of their intensity and their proper localization. Far less is known about invertebrate SPs than their mammalian counterparts. In insect genomes, SPs and their proteolytically inactive homologs (SPHs) constitute large protein families. In addition to the chymotrypsin fold, many of these proteins contain additional structural domains, often with conserved mammalian orthologues. However, the largest group of arthropod SP regulatory modules is the clip domains family, which has only been identified in arthropods. The clip-domain SPs are extracellular and have roles in the immune response and embryonic development. The powerful reverse-genetics tools in Drosophila melanogaster have been essential to identify the functions of clip-SPs and their organization in sequential cascades. This review focuses on the current knowledge of Drosophila clip-SPs and presents, when necessary, data obtained in other insect models. We will first cover the biochemical and structural features of clip domain SPs and SPHs. Clip-SPs are implicated in three main biological processes: the control of the dorso-ventral patterning during embryonic development; the activation of the Toll-mediated response to microbial infections and the prophenoloxydase cascade, which triggers melanization. Finally, we review the regulation of SPs and SPHs, from specificity of activation to inhibition by endogenous or pathogen

  11. Structural determinants of MALT1 protease activity.

    PubMed

    Wiesmann, Christian; Leder, Lukas; Blank, Jutta; Bernardi, Anna; Melkko, Samu; Decock, Arnaud; D'Arcy, Allan; Villard, Frederic; Erbel, Paulus; Hughes, Nicola; Freuler, Felix; Nikolay, Rainer; Alves, Juliano; Bornancin, Frederic; Renatus, Martin

    2012-05-25

    The formation of the CBM (CARD11-BCL10-MALT1) complex is pivotal for antigen-receptor-mediated activation of the transcription factor NF-κB. Signaling is dependent on MALT1 (mucosa-associated lymphoid tissue lymphoma translocation protein 1), which not only acts as a scaffolding protein but also possesses proteolytic activity mediated by its caspase-like domain. It remained unclear how the CBM activates MALT1. Here, we provide biochemical and structural evidence that MALT1 activation is dependent on its dimerization and show that mutations at the dimer interface abrogate activity in cells. The unliganded protease presents itself in a dimeric yet inactive state and undergoes substantial conformational changes upon substrate binding. These structural changes also affect the conformation of the C-terminal Ig-like domain, a domain that is required for MALT1 activity. Binding to the active site is coupled to a relative movement of caspase and Ig-like domains. MALT1 binding partners thus may have the potential of tuning MALT1 protease activity without binding directly to the caspase domain.

  12. Prions in Variably Protease-Sensitive Prionopathy: An Update

    PubMed Central

    Zou, Wen-Quan; Gambetti, Pierluigi; Xiao, Xiangzhu; Yuan, Jue; Langeveld, Jan; Pirisinu, Laura

    2013-01-01

    Human prion diseases, including sporadic, familial, and acquired forms such as Creutzfeldt-Jakob disease (CJD), are caused by prions in which an abnormal prion protein (PrPSc) derived from its normal cellular isoform (PrPC) is the only known component. The recently-identified variably protease-sensitive prionopathy (VPSPr) is characterized not only by an atypical clinical phenotype and neuropathology but also by the deposition in the brain of a peculiar PrPSc. Like other forms of human prion disease, the pathogenesis of VPSPr also currently remains unclear. However, the findings of the peculiar features of prions from VPSPr and of the possible association of VPSPr with a known genetic prion disease linked with a valine to isoleucine mutation at residue 180 of PrP reported recently, may be of great importance in enhancing our understanding of not only this atypical human prion disease in particular, but also other prion diseases in general. In this review, we highlight the physicochemical and biological properties of prions from VPSPr and discuss the pathogenesis of VPSPr including the origin and formation of the peculiar prions. PMID:25437202

  13. Effect of proteases on the. beta. -thromboglobulin radioimmunoassay

    SciTech Connect

    Donlon, J.A.; Helgeson, E.A.; Donlon, M.A.

    1985-02-11

    Rat peritoneal mast cells and mast cell granules were evaluated by radioimmunoassay for the presence of ..beta..-thromboglobulin and platelet factor 4. The initial assays indicated that a ..beta..-thromboglobulin cross reacting material was released from mast cells by compound 48/80 in a similar dose-dependent manner as histamine release. The material was also found to be associated with purified granules. However, the use of protease inhibitors in the buffers completely abolished the positive assays. Further evaluation of the effects of various proteases on the ..beta..-thromboglobulin assay indicated that elastase would also generate a false positive assay which could then be neutralized by the use of ..cap alpha../sub 1/-antitrypsin as a protease inhibitor. There was no protease effect on the platelet factor 4 radioimmunoassay which always showed no detectable amounts with mast cells, granules or proteases. These results clearly indicate the artifactual positive assays which can arise when using certain radioimmunoassay tests in the presence of cell proteases. The use of protease inhibitors is a necessary control when applying a radioimmunoassay to a system with potentially active proteases. 24 references, 2 figures, 4 tables.

  14. Serine protease activities in Leishmania (Leishmania) chagasi promastigotes.

    PubMed

    da Silva-López, Raquel Elisa; dos Santos, Tatiana Resende; Morgado-Díaz, José Andrés; Tanaka, Marcelo Neves; de Simone, Salvatore Giovanni

    2010-10-01

    The present work reports the isolation, biochemical characterization, and subcellular location of serine proteases from aqueous, detergent soluble, and culture supernatant of Leishmania chagasi promastigote extracts, respectively, LCSII, LCSI, and LCSIII. The active enzyme molecular masses of LCSII were about 105, 66, and 60 kDa; of LCSI, 60 and 58 kDa; and of LCSIII, approximately 76 and 68 kDa. Optimal pH for the enzymes was 7.0 for LCSI and LCSIII and 8.5 for LCSII, and the optimal temperature for all enzymes was 37°C, using α-N-ρ-tosyl-L: -arginine methyl ester as substrate. Assay of thermal stability indicated that LCSIII is the more stable enzyme. Hemoglobin, bovine serum albumin, and ovalbumin were hydrolyzed by LCSII and LCSI but not by LCSIII. Inhibition studies suggested that enzymes belong to the serine protease class modulated by divalent cations. Rabbit antiserum against 56-kDa serine protease of Leishmania amazonensis identified proteins in all extracts of L. chagasi. Furthermore, immunocytochemistry demonstrated that serine proteases are located in flagellar pocket region and cytoplasmic vesicles of L. chagasi promastigotes. These findings indicate that L. chagasi serine proteases differ from L. amazonensis proteases and all known flagellate proteases, but display some similarities with serine proteases from other Leishmania species, suggesting a conservation of this enzymatic activity in the genus.

  15. Expression and characterization of Coprothermobacter proteolyticus alkaline serine protease

    Technology Transfer Automated Retrieval System (TEKTRAN)

    TECHNICAL ABSTRACT A putative protease gene (aprE) from the thermophilic bacterium Coprothermobacter proteolyticus was cloned and expressed in Bacillus subtilis. The enzyme was determined to be a serine protease based on inhibition by PMSF. Biochemical characterization demonstrated the enzyme had...

  16. The crystal structure of the cysteine protease Xylellain from Xylella fastidiosa reveals an intriguing activation mechanism.

    PubMed

    Leite, Ney Ribeiro; Faro, Aline Regis; Dotta, Maria Amélia Oliva; Faim, Livia Maria; Gianotti, Andreia; Silva, Flavio Henrique; Oliva, Glaucius; Thiemann, Otavio Henrique

    2013-02-14

    Xylella fastidiosa is responsible for a wide range of economically important plant diseases. We report here the crystal structure and kinetic data of Xylellain, the first cysteine protease characterized from the genome of the pathogenic X. fastidiosa strain 9a5c. Xylellain has a papain-family fold, and part of the N-terminal sequence blocks the enzyme active site, thereby mediating protein activity. One novel feature identified in the structure is the presence of a ribonucleotide bound outside the active site. We show that this ribonucleotide plays an important regulatory role in Xylellain enzyme kinetics, possibly functioning as a physiological mediator.

  17. Identification of a new soybean Kunitz trypsin inhibitor mutation and its effect on Bowman-Birk protease inhibitor content in soybean seed

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Soybean seeds possess anti-nutritional compounds which inactivate digestive proteases, principally corresponding to two families: Kunitz Trypsin Inhibitors (KTi) and Bowman-Birk Inhibitors (BBI). High levels of raw soybeans/soybean meal in feed mixtures can cause poor weight gain and pancreatic abno...

  18. Alkaline protease production by a strain of marine yeasts

    NASA Astrophysics Data System (ADS)

    Ping, Wang; Zhenming, Chi; Chunling, Ma

    2006-07-01

    Yeast strain 10 with high yield of protease was isolated from sediments of saltern near Qingdao, China. The protease had the highest activity at pH 9.0 and 45°C. The optimal medium for the maximum alkaline protease production of strain 10 was 2.5g soluble starch and 2.0g NaNO3 in 100mL seawater with initial pH 6.0. The optimal cultivation conditions for the maximum protease production were temperature 24.5°C, aeration rate 8.0L min-1 and agitation speed 150r min-1 Under the optimal conditions, 623.1 U mg-1 protein of alkaline protease was reached in the culture within 30h of fermentation.

  19. Poliovirus protease 3C(pro) kills cells by apoptosis.

    PubMed

    Barco, A; Feduchi, E; Carrasco, L

    2000-01-20

    The tetracycline-based Tet-Off expression system has been used to analyze the effects of poliovirus protease 3C(pro) on human cells. Stable HeLa cell clones that express this poliovirus protease under the control of an inducible, tightly regulated promoter were obtained. Tetracycline removal induces synthesis of 3C protease, followed by drastic morphological alterations and cellular death. Degradation of cellular DNA in nucleosomes and generation of apoptotic bodies are observed from the second day after 3C(pro) induction. The cleavage of poly(ADP-ribose) polymerase, an enzyme involved in DNA repair, occurs after induction of 3C(pro), indicating caspase activation by this poliovirus protease. The 3C(pro)-induced apoptosis is blocked by the caspase inhibitor z-VAD-fmk. Our findings suggest that the protease 3C is responsible for triggering apoptosis in poliovirus-infected cells by a mechanism that involves caspase activation.

  20. Purification and characterization of an alkaline protease from Acetes chinensis

    NASA Astrophysics Data System (ADS)

    Xu, Jiachao; Liu, Xin; Li, Zhaojie; Xu, Jie; Xue, Changhu; Gao, Xin

    2005-07-01

    An alkaline protease from Acetes chinensis was purified and characterized in this study. The steps of purification include ammonium sulfate precipitation, ion-exchange chromatography with Q-sepharose Fast Flow, gel filtration chromatography with S300 and the second ion-exchange chromatography with Q-sepharose Fast Flow. The protease was isolated and purified, which was present and active on protein substrates (azocasein and casein). The specific protease activity was 17.15 folds and the recovery was 4.67. The molecular weight of the protease was estimated at 23.2 kD by SDS-PAGE. With azocasein as the susbstrate, the optimal temperature was 55°C and the optimal pH value was 5.5. Ion Ca2+ could enhance the proteolytic activity of the protease, while Cu2+, EDTA and PMSF could inhibit its activity.

  1. The Serine Protease HhoA from Synechocystis sp. Strain PCC 6803: Substrate Specificity and Formation of a Hexameric Complex Are Regulated by the PDZ Domain▿

    PubMed Central

    Huesgen, Pitter F.; Scholz, Philipp; Adamska, Iwona

    2007-01-01

    Enzymes of the ATP-independent Deg serine endopeptidase family are very flexible with regard to their substrate specificity. Some family members cleave only one substrate, while others act as general proteases on unfolded substrates. The proteolytic activity of Deg proteases is regulated by PDZ protein interaction domains. Here we characterized the HhoA protease from Synechocystis sp. strain PCC 6803 in vitro using several recombinant protein constructs. The proteolytic activity of HhoA was found to increase with temperature and basic pH and was stimulated by the addition of Mg2+ or Ca2+. We found that the single PDZ domain of HhoA played a critical role in regulating protease activity and in the assembly of a hexameric complex. Deletion of the PDZ domain strongly reduced proteolysis of a sterically challenging resorufin-labeled casein substrate, but unlabeled β-casein was still degraded. Reconstitution of the purified HhoA with total membrane proteins isolated from Synechocystis sp. wild-type strain PCC 6803 and a ΔhhoA mutant resulted in specific degradation of selected proteins at elevated temperatures. We concluded that a single PDZ domain of HhoA plays a critical role in defining the protease activity and oligomerization state, combining the functions that are attributed to two PDZ domains in the homologous DegP protease from Escherichia coli. Based on this first enzymatic study of a Deg protease from cyanobacteria, we propose a general role for HhoA in the quality control of extracytoplasmic proteins, including membrane proteins, in Synechocystis sp. strain PCC 6803. PMID:17616590

  2. Identification and Characterization of IgdE, a Novel IgG-degrading Protease of Streptococcus suis with Unique Specificity for Porcine IgG*

    PubMed Central

    Spoerry, Christian; Seele, Jana; Valentin-Weigand, Peter; Baums, Christoph G.; von Pawel-Rammingen, Ulrich

    2016-01-01

    Streptococcus suis is a major endemic pathogen of pigs causing meningitis, arthritis, and other diseases. Zoonotic S. suis infections are emerging in humans causing similar pathologies as well as severe conditions such as toxic shock-like syndrome. Recently, we discovered an IdeS family protease of S. suis that exclusively cleaves porcine IgM and represents the first virulence factor described, linking S. suis to pigs as their natural host. Here we report the identification and characterization of a novel, unrelated protease of S. suis that exclusively targets porcine IgG. This enzyme, designated IgdE for immunoglobulin G-degrading enzyme of S. suis, is a cysteine protease distinct from previous characterized streptococcal immunoglobulin degrading proteases of the IdeS family and mediates efficient cleavage of the hinge region of porcine IgG with a high degree of specificity. The findings that all S. suis strains investigated possess the IgG proteolytic activity and that piglet serum samples contain specific antibodies against IgdE strongly indicate that the protease is expressed in vivo during infection and represents a novel and putative important bacterial virulence/colonization determinant, and a thus potential therapeutic target. PMID:26861873

  3. Crystallization and preliminary X-ray diffraction studies of the cysteine protease ervatamin A from Ervatamia coronaria

    SciTech Connect

    Chakraborty, Sibani; Biswas, Sampa; Chakrabarti, Chandana; Dattagupta, Jiban K.

    2005-06-01

    Ervatamin A is a papain-family cysteine protease with high activity and stability. It has been isolated and purified from the latex of the medicinal flowering plant E. coronaria and crystallized by the vapour-diffusion technique. Crystals diffracted to 2.1 Å and the structure was solved by molecular replacement. The ervatamins are highly stable cysteine proteases that are present in the latex of the medicinal plant Ervatamia coronaria and belong to the papain family, members of which share similar amino-acid sequences and also a similar fold comprising two domains. Ervatamin A from this family, a highly active protease compared with others from the same source, has been purified to homogeneity by ion-exchange chromatography and crystallized by the vapour-diffusion method. Needle-shaped crystals of ervatamin A diffract to 2.1 Å resolution and belong to space group C222{sub 1}, with unit-cell parameters a = 31.10, b = 144.17, c = 108.61 Å. The solvent content using an ervatamin A molecular weight of 27.6 kDa is 43.9%, with a V{sub M} value of 2.19 Å{sup 3} Da{sup −1} assuming one protein molecule in the asymmetric unit. A molecular-replacement solution has been found using the structure of ervatamin C as a search model.

  4. Proteases of Stored Product Insects and Their Inhibition by Specific Protease Inhibitors from Soybeans and Wheat Grain

    DTIC Science & Technology

    1988-10-16

    Tenebria molitor MIDGUT PROTEASES; LOCUST CAECAL PROTEASES; BOWMAN-BIRK TRYPSIN-CHMOTRYPSIN INHIBITOR (SOYBEANS) CHICKPEAS TRYPSIN-CHYMOTRYPSIN...and Kunitz (STI) from soybeans, CI from chickpeas , chicken ovomucoid and turkey ovomucoid. It was Jnactivated by phenylemthvsulfonyl fluoride (PMSF...soybeans and Cl from chickpeas , by chicken ovomucoid and turkey overmucoid, as well as by the Kunitz (STI) soybean trypsin inhibitor that hardly

  5. Family Therapy

    MedlinePlus

    Tests and Procedures Family therapy By Mayo Clinic Staff Family therapy is a type of psychological counseling (psychotherapy) that helps family members improve communication and resolve conflicts. Family therapy is usually provided ...

  6. Family Life

    MedlinePlus

    ... With Family and Friends > Family Life Request Permissions Family Life Approved by the Cancer.Net Editorial Board , ... your outlook on the future. Friends and adult family members The effects of cancer on your relationships ...

  7. PEGylated substrates of NSP4 protease: A tool to study protease specificity

    NASA Astrophysics Data System (ADS)

    Wysocka, Magdalena; Gruba, Natalia; Grzywa, Renata; Giełdoń, Artur; Bąchor, Remigiusz; Brzozowski, Krzysztof; Sieńczyk, Marcin; Dieter, Jenne; Szewczuk, Zbigniew; Rolka, Krzysztof; Lesner, Adam

    2016-03-01

    Herein we present the synthesis of a novel type of peptidomimetics composed of repeating diaminopropionic acid residues modified with structurally diverse heterobifunctional polyethylene glycol chains (abbreviated as DAPEG). Based on the developed compounds, a library of fluorogenic substrates was synthesized. Further library deconvolution towards human neutrophil serine protease 4 (NSP4) yielded highly sensitive and selective internally quenched peptidomimetic substrates. In silico analysis of the obtained peptidomimetics revealed the presence of an interaction network with distant subsites located on the enzyme surface.

  8. Novel pseudosymmetric inhibitors of HIV-1 protease

    SciTech Connect

    Faessler, A.; Roesel, J.; Gruetter, M.; Tintelnot-Blomley, M.; Alteri, E.; Bold, G.; Lang, M.

    1993-12-31

    Taking into account the unique C-2 symmetric nature of the HIV-1 protease homodimer, the authors have designed and synthesized novel inhibitors featuring an almost symmetric structure. Compounds containing the easily accessible Phe[CH(OH)CH{sub 2}N(NH)]Cha dipeptide isostere as a nonhydrolyzable replacement of the scissile amide bond of the natural substrate are potent inhibitors in vitro with IC{sub 50} values of 9 to 50 nM. The antiviral activity depends mainly on the nature of the anylated valine residues linked to the dipeptide mimic. In this series, CGP 53820 combines both high potency and excellent specificity. Its predicted symmetric binding pattern is illustrated by the X-ray structure analysis performed with the corresponding enzyme-inhibitor complex.

  9. Crystal structure of a complex between Serratia marcescens metallo-protease and an inhibitor from Erwinia chrysanthemi.

    PubMed

    Baumann, U; Bauer, M; Létoffé, S; Delepelaire, P; Wandersman, C

    1995-05-05

    The crystal structure of the complex between the 50 kDa metallo-endoproteinase from Serratia marcescens (SMP), a member of the metzincin superfamily, and an inhibitor from Erwinia chrysanthemi (Inh) was solved by molecular replacement using the known structure of SMP, and refined at 2.30 A resolution to a crystallographic R-factor of 0.195. The E. chrysanthemi inhibitor folds into a compact eight-stranded antiparallel beta-barrel of simple up-down topology such as is found for members of the retinol binding protein family. It mainly interacts with the protease via its five N-terminal residues, which insert into the active site cleft, occupying the S' sites. The first N-terminal residue, SerI1, is partially cleaved off by the protease, while SerI2 makes a hydrogen bond with the catalytically active glutamic acid, Glu177, of the protease. Further interactions are made between one face of the inhibitor formed by the strands s3, s4 and s5 and the protease segment 218 to 228, which is located immediately after the characteristic "Met-turn" of the metzincins.

  10. Cloning, expression, and characterization of a milk-clotting aspartic protease gene (Po-Asp) from Pleurotus ostreatus.

    PubMed

    Yin, Chaomin; Zheng, Liesheng; Chen, Liguo; Tan, Qi; Shang, Xiaodong; Ma, Aimin

    2014-02-01

    An aspartic protease gene from Pleurotus ostreatus (Po-Asp) had been cloned based on the 3' portion of cDNA in our previous work. The Po-Asp cDNA contained 1,324 nucleotides with an open reading frame (ORF) of 1,212 bp encoding 403 amino acid residues. The putative amino acid sequence included a signal peptide, an activation peptide, two most possible N-glycosylation sites and two conserved catalytic active site. The mature polypeptide with 327 amino acid residues had a calculated molecular mass of 35.3 kDa and a theoretical isoelectric point of 4.57. Basic Local Alignment Search Tool analysis showed 68-80 % amino acid sequence identical to other basidiomycetous aspartic proteases. Sequence comparison and evolutionary analysis revealed that Po-Asp is a member of fungal aspartic protease family. The DNA sequence of Po-Asp is 1,525 bp in length without untranslated region, consisting of seven exons and six introns. The Po-Asp cDNA without signal sequence was expressed in Pichia pastoris and sodium dodecyl sulfate-polyacrylamide gel electrophoresis demonstrated the molecular mass of recombinant Po-Asp was about 43 kDa. The crude recombinant aspartic protease had milk-clotting activity.

  11. Identification of two new keratinolytic proteases from a Bacillus pumilus strain using protein analysis and gene sequencing.

    PubMed

    Fellahi, Soltana; Chibani, Abdelwaheb; Feuk-Lagerstedt, Elisabeth; Taherzadeh, Mohammad J

    2016-12-01

    The Bacillus strain (CCUG 66887) has a high capacity to excrete keratinase with the ability to degrade both alpha- and beta keratin. In this study we aimed to show the characteristics of the keratinolytic protease and to identify its gene by using liquid chromatography-electrospray ionization tandem mass spectrometry methods (nanoHPLC-ESI-MS/MS) followed by Mascot data base search. The results showed that the enzyme in fact consists of two different keratinases, both with a molecular mass of 38 kDa. Further, DNA sequencing generated the open reading frame (ORF) of one of the genes (Ker1), and de novo genome sequencing identified the ORF of the second gene (Ker2). The two keratinase genes contain 1153 base pairs each and have a gene similarity of 67 %. In addition, the Bacillus strain was classified as Bacillus pumilus and its genes were annotated in the GeneBank at NCBI (accession: CP011109.1). Amino acid sequences alignment with known B. pumilus proteases indicated that the two keratinases of B. pumilus strain C4 are subtilisin-like serine proteases belonging to the Protease S8 family. Taken together, these result suggest the two keratinases as promising candidates for enzymatic processing of keratinous wastes in waste refinery.

  12. Human DESC1 serine protease confers tumorigenic properties to MDCK cells and it is upregulated in tumours of different origin

    PubMed Central

    Viloria, C G; Peinado, J R; Astudillo, A; García-Suárez, O; González, M V; Suárez, C; Cal, S

    2007-01-01

    Proteolysis of the extracellular matrix components plays a crucial role in the regulation of the cellular and physiological processes, and different pathologies have been associated with the loss or gain of function of proteolytic enzymes. DESC1 (differentially expressed in squamous cell carcinoma gene 1), a member of the TTSP (type II transmembrane serine protease) family of serine proteases, is an epithelial-specific enzyme that has been found downregulated in squamous cell carcinoma of the head and neck region. We describe new properties of DESC1 suggesting that this protease may be involved in the progression of some type of tumours. Thus, this enzyme hydrolyses some extracellular matrix components, such as fibronectin, gelatin or fibrinogen. Moreover, Madin–Darby canine kidney (MDCK) cells expressing exogenous human DESC1 acquire properties associated with tumour growth such as enhanced motility and an increase of tubular forms in a 3D collagen lattice following HGF treatment. Finally, we generated polyclonal anti-DESC1 antibodies and immunohistochemical analysis in tissues different from head and neck region indicated that this protease was overexpressed in tumours of diverse origins. Taken together, our results suggest that DESC1 could be considered as a potential therapeutic target in some type of tumours. PMID:17579619

  13. Effects of detergents on the West Nile virus protease activity.

    PubMed

    Ezgimen, Manolya D; Mueller, Niklaus H; Teramoto, Tadahisa; Padmanabhan, R

    2009-05-01

    Detergents such as Triton X-100 are often used in drug discovery research to weed out small molecule promiscuous and non-specific inhibitors which act by aggregation in solution and undesirable precipitation in aqueous assay buffers. We evaluated the effects of commonly used detergents, Triton X-100, Tween-20, Nonidet-40 (NP-40), Brij-35, and CHAPS, on the enzymatic activity of West Nile virus (WNV) protease. Unexpectedly, Triton X-100, Tween-20, and NP-40 showed an enhancement of in vitro WNV protease activity from 2 to 2.5-fold depending on the detergent and its concentration. On the other hand, Brij-35, at 0.001% enhanced the protease activity by 1.5-fold and CHAPS had the least enhancing effect. The kinetic analysis showed that the increase in protease activity by Triton X-100 was dose-dependent. Furthermore, at Triton X-100 and Tween-20 concentrations higher than 0.001%, the inhibition of compound B, one of the lead compounds against WNV protease identified in a high throughput screen (IC(50) value of 5.7+/-2.5 microM), was reversed. However, in the presence of CHAPS, compound B still showed good inhibition of WNV protease. Our results, taken together, indicate that nonionic detergents, Triton X-100, Tween, and NP-40 are unsuitable for the purpose of discrimination of true versus promiscuous inhibitors of WNV protease in high throughput assays.

  14. Exploring a new serine protease from Cucumis sativus L.

    PubMed

    Nafeesa, Zohara; Shivalingu, B R; Vivek, H K; Priya, B S; Swamy, S Nanjunda

    2015-03-01

    Coagulation is an important physiological process in hemostasis which is activated by sequential action of proteases. This study aims to understand the involvement of aqueous fruit extract of Cucumis sativus L. (AqFEC) European burp less variety in blood coagulation cascade. AqFEC hydrolyzed casein in a dose-dependent manner. The presence of protease activity was further confirmed by casein zymography which revealed the possible presence of two high molecular weight protease(s). The proteolytic activity was inhibited only by phenyl methyl sulphonyl fluoride suggesting the presence of serine protease(s). In a dose-dependent manner, AqFEC also hydrolysed Aα and Bβ subunits of fibrinogen, whereas it failed to degrade the γ subunit of fibrinogen even at a concentration as high as 100 μg and incubation time up to 4 h. AqFEC reduced the clotting time of citrated plasma by 87.65%. The protease and fibrinogenolytic activity of AqFEC suggests its possible role in stopping the bleeding and ensuing wound healing process.

  15. Salt stress represses production of extracellular proteases in Bacillus pumilus.

    PubMed

    Liu, R F; Huang, C L; Feng, H

    2015-05-11

    Bacillus pumilus is able to secrete subtilisin-like prote-ases, one of which has been purified and characterized biochemically, demonstrating great potential for use in industrial applications. In the current study, the biosynthesis and transcription of extracellular pro-teases in B. pumilus (BA06) under salt stress were investigated using various methods, including a proteolytic assay, zymogram analysis, and real-time PCR. Our results showed that total extracellular proteolytic activity, both in fermentation broth and on milk-containing agar plates, was considerably repressed by salt in a dosage-dependent manner. As Bacillus species usually secret multiple extracellular proteases, a vari-ety of individual extracellular protease encoding genes were selected for real-time PCR analysis. It was shown that proteases encoded by the aprE and aprX genes were the major proteases in the fermentation broth in terms of their transcripts in B. pumilus. Further, transcription of aprE, aprX, and epr genes was indeed repressed by salt stress. In con-trast, transcription of other genes (e.g., vpr and wprA) was not repressed or significantly affected by the salt. Conclusively, salt stress represses total extracellular proteolytic activity in B. pumilus, which can largely be ascribed to suppression of the major protease-encoding genes (aprE, aprX) at the transcriptional level. In contrast, transcription of other pro-tease-encoding genes (e.g., vpr, wprA) was not repressed by salt stress.

  16. Screening and characterization of protease producing actinomycetes from marine saltern.

    PubMed

    Suthindhiran, Krish; Jayasri, Mangalam Achuthananda; Dipali, Dipa; Prasar, Apurva

    2014-10-01

    In the course of systematic screening program for bioactive actinomycetes, an alkaline protease producing halophilic strain Actinopolyspora sp. VITSDK2 was isolated from marine saltern, Southern India. The strain was identified as Actinopolyspora based on its phenotypic and phylogenetic characters. The protease was partially purified using ammonium sulfate precipitation and subsequently by DEAE cellulose column chromatography. The enzyme was further purified using HPLC and the molecular weight was found to be 22 kDa as determined by SDS-PAGE analysis. The purified protease exhibited pH stability in a wide range of 4-12 with optimum at 10.0. The enzyme was found to be stable between 25 and 80 °C and displayed a maximum activity at 60 °C. The enzyme activity was increased marginally in presence of Mn(2+) , Mg(2+) , and Ca(2+) and decreased in presence of Cu(2+) . PMSF and DFP completely inhibited the activity suggesting it belongs to serine protease. Further, the proteolytic activity was abolished in presence of N-tosyl-L-lysine chloromethyl ketone suggesting this might be chymotrypsin-like serine protease. The protease was 96% active when kept for 10 days at room temperature. The results indicate that the enzyme belong to chymotrypsin-like serine protease exhibiting both pH and thermostability, which can be used for various applications in industries.

  17. German cockroach frass proteases cleave pro-matrix metalloproteinase-9.

    PubMed

    Hughes, Valerie S; Page, Kristen

    2007-01-01

    Matrix metalloproteinase (MMP)-9, secreted as pro-MMP-9, is cleaved by serine proteases at the N-terminus to generate active MMP-9. Pro-MMP-9 has been found in the bronchoalveolar lavage fluid of patients with asthma. Because many inhaled aeroallergens contain active proteases, the authors sought to determine whether German cockroach (GC) fecal remnants (frass) and house dust mite (HDM) were able to cleave pro-MMP-9. Treatment of recombinant human (rh) pro-MMP-9 with GC frass resulted in a dose- and time-dependent cleavage. This was abrogated by pretreating frass with an inhibitor of serine, but not cysteine protease activity. GC frass also induced cleavage of pro-MMP-9 from primary human neutrophils dependent on the active serine proteases in GC frass. HDM was less potent at cleaving pro-MMP-9. Alpha1-antitrypsin (A1AT), a naturally occurring protease inhibitor, attenuated GC frass-induced cleavage of pro-MMP-9. A1AT partially inactivated the serine protease activity in GC frass, while GC frass cleaved A1AT in a dose- and time-dependent manner. These data suggest that GC frass-derived serine proteases could regulate the activity of MMP-9 and that A1AT may play an important role in modulating GC frass activity in vivo. These data suggest a mechanism by which inhalation of GC frass could regulate airway remodeling through the activation of pro-MMP-9.

  18. Laundry detergent compatibility of the alkaline protease from Bacillus cereus.

    PubMed

    Banik, Rathindra Mohan; Prakash, Monika

    2004-01-01

    The endogenous protease activity in various commercially available laundry detergents of international companies was studied. The maximum protease activity was found at 50 degrees C in pH range 10.5-11.0 in all the tested laundry detergents. The endogenous protease activity in the tested detergents retained up to 70% on incubation at 40 degrees C for 1 h, whereas less than 30% activity was only found on incubation at 50 degrees C for 1 h. The alkaline protease from an alkalophilic strain of Bacillus cereus was studied for its compatibility in commercial detergents. The cell free fermented broth from shake flask culture of the organism showed maximum activity at pH 10.5 and 50 degrees C. The protease from B. cereus showed much higher residual activity (more than 80%) on incubation with laundry detergents at 50 degrees C for 1 h or longer. The protease enzyme from B. cereus was found to be superior over the endogenous proteases present in the tested commercial laundry detergents in comparison to the enzyme stability during the washing at higher temperature, e.g., 40-50 degrees C.

  19. Role of protease-activated receptors 2 (PAR2) in ocular infections and inflammation

    PubMed Central

    Tripathi, Trivendra; Alizadeh, Hassan

    2015-01-01

    Protease-activated receptors (PARs) belong to a unique family of G protein-coupled receptors (GPCRs) that are cleaved at an activation site within the N-terminal exodomain by a variety of proteinases, essentially of the serine (Ser) proteinase family. After cleavage, the new N-terminal sequence functions as a tethered ligand, which binds intramolecularly to activate the receptor and initiate signaling. Cell signals induced through the activation of PARs appear to play a significant role in innate and adoptive immune responses of the cornea, which is constantly exposed to proteinases under physiological or pathophysiological conditions. Activation of PARs interferes with all aspects of the corneal physiology such as barrier function, transports, innate and adoptive immune responses, and functions of corneal nerves. It is not known whether the proteinase released from the microorganism can activate PARs and triggers the inflammatory responses. The role of PAR2 expressed by the corneal epithelial cells and activation by serine protease released from microorganism is discussed here. Recent evidences suggest that activation of PAR2, by the serine proteinases, play an important role in innate and inflammatory responses of the corneal infection. PMID:26078987

  20. Characterization of the protease activity of detergents: laboratory practicals for studying the protease profile and activity of various commercial detergents.

    PubMed

    Valls, Cristina; Pujadas, Gerard; Garcia-Vallve, Santi; Mulero, Miquel

    2011-07-01

    Detergent enzymes account for about 30% of the total worldwide production of enzymes and are one of the largest and most successful applications of modern industrial biotechnology. Proteases can improve the wash performance of household, industrial, and institutional laundry detergents used to remove protein-based stains such as blood, grass, body fluids, and food soils. This article describes two easy and cheap laboratory exercises to study the presence, profile, and basic enzymology of detergent proteases. These laboratory practicals are based on the determination of the detergent protease activity of various commercial detergents using the N-succinyl-L-alanyl-L-alanyl-L-prolyl-L-phenylalanine p-nitroanilide method and the bovine serum albumin degradation capacity. Students are also required to elucidate the enzymatic subtype of detergent proteases by studying the inhibitory potential of several types of protease inhibitors revealed by the same experimental methodology. Additionally, the results of the exercises can be used to provide additional insights on elementary enzymology by studying the influence of several important parameters on protease activity such as temperature (in this article) and the influence of pH and effects of surfactants and oxidizers (proposed). Students also develop laboratory skills, problem-solving capacities, and the ability to write a laboratory report. The exercises are mainly designed for an advanced undergraduate project in the biochemistry and biotechnology sciences. Globally, these laboratory practicals show students the biotechnological applications of proteases in the detergent industry and also reinforce important enzymology concepts.

  1. 21 CFR 184.1027 - Mixed carbohydrase and protease enzyme product.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 21 Food and Drugs 3 2014-04-01 2014-04-01 false Mixed carbohydrase and protease enzyme product... Substances Affirmed as GRAS § 184.1027 Mixed carbohydrase and protease enzyme product. (a) Mixed carbohydrase and protease enzyme product is an enzyme preparation that includes carbohydrase and protease...

  2. Detection of Legume Protease Inhibitors by the Gel-X-ray Film Contact Print Technique

    ERIC Educational Resources Information Center

    Mulimani, Veerappa H.; Sudheendra, Kulkarni; Giri, Ashok P.

    2002-01-01

    Redgram (Cajanus cajan L.) extracts have been analyzed for the protease inhibitors using a new, sensitive, simple, and rapid method for detection of electrophoretically separated protease inhibitors. The detection involves equilibrating the gel successively in the protease assay buffer and protease solution, rinsing the gel in assay buffer, and…

  3. Purification, characterization, and gene cloning of thermopsin, a thermostable acid protease from Sulfolobus acidocaldarius.

    PubMed

    Lin, X; Tang, J

    1990-01-25

    A thermostable, acid proteolytic activity has been found to be associated with the cells and in the culture medium of Sulfolobus acidocaldarius, an archaebacterium. This acid protease, which has been named thermopsin, was purified to homogeneity from the culture medium by a five-step procedure including column chromatographies on DEAE-Sepharose CL-6B, phenyl-Sepharose CL-4B, Sephadex G-100, monoQ (fast protein liquid chromatography), and gel filtration (high pressure liquid chromatography). The purified thermopsin produced a single band on sodium dodecyl sulfate-polyacrylamide gel electrophoresis and the proteolytic activity was associated with the band. Thermopsin is a single-chain protein as indicated by gel electrophoresis and by a single NH2-terminal sequence. It has maximal proteolytic activity at pH 2 and 90 degrees C. A genomic library of S. acidocaldarius was prepared and screened by an oligonucleotide probe designed from the NH2-terminal sequence of thermopsin. Five positive clones were isolated. From these clones the thermopsin gene was mapped and sequenced. The nucleotide sequence showed that the thermopsin structure is encoded in 1020 bases. In the deduced protein sequence, there are 41 amino acid residues (including the initiation Met) preceding the NH2-terminal position of thermopsin. Most of these residues appear to be characteristic of a leader sequence. However, the presence in this region of a short pro sequence cannot be ruled out. Thermopsin contains a single cysteine at residue 237 that is not essential for activity (Fusek, M., Lin, X.-L., Tang, J. (1990) J. Biol. Chem. 265, 1496-1501. Thermopsin has no apparent sequence similarity to aspartic proteases of the pepsin family nor to pepstatin-insensitive acid protease (Maita, T., Nagata, S., Matsuda, G., Murata, S., Oda, K., Murao, S., and Tsura, D. (1984) J. Biochem. 95, 465-475) and thus may represent a new class of acid proteases. Also absent is the characteristic active site aspartyl sequence

  4. Crystal Structure of Human Taspase1, a Crucial Protease Regulating the Function of MLL

    SciTech Connect

    Khan,J.; Dunn, B.; Tong, L.

    2005-01-01

    Taspase1 catalyzes the proteolytic processing of the mixed lineage leukemia (MLL) nuclear protein, which is required for maintaining Hox gene expression patterns. Chromosomal translocations of the MLL gene are associated with leukemia in infants. Taspase1, a threonine aspartase, is a member of the type 2 asparaginase family, but is the only protease in this family. We report here the crystal structures of human activated Taspase1 and its proenzyme, as well as the characterization of the effects of mutations in the active site region using a newly developed fluorogenic assay. The structure of Taspase1 has significant differences from other asparaginases, especially near the active site. Mutation of the catalytic nucleophile, Thr234, abolishes autocatalytic processing in cis but does not completely block proteolysis in trans. The structure unexpectedly showed the binding of a chloride ion in the active site, and our kinetic studies confirm that chlorides ions are inhibitors of this enzyme at physiologically relevant concentrations.

  5. Identification of two components of the Serratia marcescens metalloprotease transporter: protease SM secretion in Escherichia coli is TolC dependent.

    PubMed

    Létoffé, S; Ghigo, J M; Wandersman, C

    1993-11-01

    The Serratia marcescens metalloprotease (protease SM) belongs to a family of proteins secreted from gram-negative bacteria by a signal peptide-independent pathway which requires a specific transporter consisting of three proteins: two in the inner membrane and one in the outer membrane. The prtDSM and prtESM genes encoding the two S. marcescens inner membrane components were cloned and expressed in Escherichia coli. Their nucleotide sequence revealed high overall homology with the two analogous inner membrane components of the Erwinia chrysanthemi protease secretion apparatus and lower, but still significant, homology with the two analogous inner membrane components of the E. coli hemolysin transporter. When expressed in E. coli, these two proteins, PrtDSM and PrtESM, allowed the secretion of protease SM only in the presence of TolC protein, the outer membrane component of the hemolysin transporter.

  6. The role of proteases in regulating Eph/ephrin signaling

    PubMed Central

    Atapattu, Lakmali; Lackmann, Martin; Janes, Peter W

    2014-01-01

    Proteases regulate a myriad of cell functions, both in normal and disease states. In addition to protein turnover, they regulate a range of signaling processes, including those mediated by Eph receptors and their ephrin ligands. A variety of proteases is reported to directly cleave Ephs and/or ephrins under different conditions, to promote receptor and/or ligand shedding, and regulate receptor/ligand internalisation and signaling. They also cleave other adhesion proteins in response to Eph-ephrin interactions, to indirectly facilitate Eph-mediated functions. Proteases thus contribute to Eph/ephrin mediated changes in cell-cell and cell-matrix interactions, in cell morphology and in cell migration and invasion, in a manner which appears to be tightly regulated by, and co-ordinated with, Eph signaling. This review summarizes the current literature describing the function and regulation of protease activities during Eph/ephrin-mediated cell signaling. PMID:25482632

  7. Expression, purification and crystallization of a birnavirus-encoded protease, VP4, from blotched snakehead virus (BSNV)

    SciTech Connect

    Lee, Jaeyong; Feldman, Anat R.; Delmas, Bernard; Paetzel, Mark

    2006-04-01

    The expression, purification and crystallization of a viral protease from the blotched snakehead virus (BSNV) are described and the diffraction data collected to 2.5 Å from two different crystal forms are reported. Blotched snakehead virus (BSNV) is a member of the Birnaviridae family that requires a virally encoded protease known as VP4 in order to process its polyprotein into viral capsid protein precursors (pVP2 and VP3). VP4 belongs to a family of serine proteases that utilize a serine/lysine catalytic dyad mechanism. A mutant construct of VP4 with a short C-terminal truncation was overexpressed in Escherichia coli and purified to homogeneity for crystallization. Using the sitting-drop vapour-diffusion method at room temperature, protein crystals with two distinct morphologies were observed. Cubic crystals grown in PEG 2000 MME and magnesium acetate at pH 8.5 belong to space group I23, with unit-cell parameters a = b = c = 143.8 Å. Trigonal crystals grown in ammonium sulfate and glycerol at pH 8.5 belong to space group P321/P312, with unit-cell parameters a = b = 158.2, c = 126.4 Å.

  8. Structural Insights into the Protease-like Antigen Plasmodium falciparum SERA5 and Its Noncanonical Active-Site Serine

    SciTech Connect

    Hodder, Anthony N.; Malby, Robyn L.; Clarke, Oliver B.; Fairlie, W. Douglas; Colman, Peter M.; Crabb, Brendan S.; Smith, Brian J.

    2009-08-28

    The sera genes of the malaria-causing parasite Plasmodium encode a family of unique proteins that are maximally expressed at the time of egress of parasites from infected red blood cells. These multi-domain proteins are unique, containing a central papain-like cysteine-protease fragment enclosed between the disulfide-linked N- and C-terminal domains. However, the central fragment of several members of this family, including serine repeat antigen 5 (SERA5), contains a serine (S596) in place of the active-site cysteine. Here we report the crystal structure of the central protease-like domain of Plasmodium falciparum SERA5, revealing a number of anomalies in addition to the putative nucleophilic serine: (1) the structure of the putative active site is not conducive to binding substrate in the canonical cysteine-protease manner; (2) the side chain of D594 restricts access of substrate to the putative active site; and (3) the S{sub 2} specificity pocket is occupied by the side chain of Y735, reducing this site to a small depression on the protein surface. Attempts to determine the structure in complex with known inhibitors were not successful. Thus, despite having revealed its structure, the function of the catalytic domain of SERA5 remains an enigma.

  9. The structures of Arabidopsis Deg5 and Deg8 reveal new insights into HtrA proteases

    SciTech Connect

    Sun, Wei; Gao, Feng; Fan, Haitian; Shan, Xiaoyue; Sun, Renhua; Liu, Lin; Gong, Weimin

    2013-05-01

    The crystal structures of Arabidopsis Deg5 and Deg8 have been determined to resolutions of 2.6 and 2.0 Å, respectively, revealing novel structural features of HtrA proteases. Plant Deg5 and Deg8 are two members of the HtrA proteases, a family of oligomeric serine endopeptidases that are involved in a variety of protein quality-control processes. These two HtrA proteases are located in the thylakoid lumen and participate in high-light stress responses by collaborating with other chloroplast proteins. Deg5 and Deg8 degrade photodamaged D1 protein of the photosystem II reaction centre, allowing its in situ replacement. Here, the crystal structures of Arabidopsis thaliana Deg5 (S266A) and Deg8 (S292A) are reported at 2.6 and 2.0 Å resolution, respectively. The Deg5 trimer contains two calcium ions in a central channel, suggesting a link between photodamage control and calcium ions in chloroplasts. Previous structures of HtrA proteases have indicated that their regulation usually requires C-terminal PDZ domain(s). Deg5 is unique in that it contains no PDZ domain and the trimeric structure of Deg5 (S266A) reveals a novel catalytic triad conformation. A similar triad conformation is observed in the hexameric structure of the single PDZ-domain-containing Deg8 (S292A). These findings suggest a novel activation mechanism for plant HtrA proteases and provide structural clues to their function in light-stress response.

  10. A novel organic solvent- and detergent-stable serine alkaline protease from Trametes cingulata strain CTM10101.

    PubMed

    Omrane Benmrad, Maroua; Moujehed, Emna; Ben Elhoul, Mouna; Zaraî Jaouadi, Nadia; Mechri, Sondes; Rekik, Hatem; Kourdali, Sidali; El Hattab, Mohamed; Badis, Abdelmalek; Sayadi, Sami; Bejar, Samir; Jaouadi, Bassem

    2016-10-01

    A protease-producing fungus was isolated from an alkaline wastewater of chemical industries and identified as Trametes cingulata strain CTM10101 on the basis of the ITS rDNA gene-sequencing. It was observed that the fungus strongly produce extracellular protease grown at 30°C in potato-dextrose-broth (PDB) optimized media (13500U/ml). The pure serine protease isolated by Trametes cingulata (designated SPTC) was purified by ammonium sulfate precipitation-dialysis followed by heat-treatment and UNO S-1 FPLC cation-exchange chromatography. The chemical characterization carried on include phisico-chemical determination and spectroscopie analysis. The MALDI-TOF/MS analysis revealed that the purified enzyme was a monomer with a molecular mass of 31405.16-Da. The enzyme had an NH2-terminal sequence of ALTTQTEAPWALGTVSHKGQAST, thus sharing high homology with those of fungal-proteases. The optimum pH and temperature values of its proteolytic activity were pH 9 and 60°C, respectively, and its half-life times at 60 and 70°C were 9 and 5-h, respectively. It was completely inhibited by PMSF and DFP, which strongly suggested its belonging to the serine protease family. Compared to Flavourzyme(®)500L from Aspergillus oryzae and Thermolysin typeX from Geobacillus stearothermophilus, SPTC displayed higher levels of hydrolysis, substrate specificity, and catalytic efficiency as well as elevated organic solvent tolerance and considerable detergent stability. Finally, SPTC could potentially be used in peptide synthesis and detergent formulations.

  11. Antiviral Potential of a Novel Compound CW-33 against Enterovirus A71 via Inhibition of Viral 2A Protease

    PubMed Central

    Wang, Ching-Ying; Huang, An-Cheng; Hour, Mann-Jen; Huang, Su-Hua; Kung, Szu-Hao; Chen, Chao-Hsien; Chen, I-Chieh; Chang, Yuan-Shiun; Lien, Jin-Cherng; Lin, Cheng-Wen

    2015-01-01

    Enterovirus A71 (EV-A71) in the Picornaviridae family causes hand-foot-and-mouth disease, aseptic meningitis, severe central nervous system disease, even death. EV-A71 2A protease cleaves Type I interferon (IFN)-α/β receptor 1 (IFNAR1) to block IFN-induced Jak/STAT signaling. This study investigated anti-EV-A7l activity and synergistic mechanism(s) of a novel furoquinoline alkaloid compound CW-33 alone and in combination with IFN-β. Anti-EV-A71 activities of CW-33 alone and in combination with IFN-β were evaluated by inhibitory assays of virus-induced apoptosis, plaque formation, and virus yield. CW-33 showed antiviral activities with an IC50 of near 200 μM in EV-A71 plaque reduction and virus yield inhibition assays. While, anti-EV-A71 activities of CW-33 combined with 100 U/mL IFN-β exhibited a synergistic potency with an IC50 of approximate 1 μM in plaque reduction and virus yield inhibition assays. Molecular docking revealed CW-33 binding to EV-A71 2A protease active sites, correlating with an inhibitory effect of CW33 on in vitro enzymatic activity of recombinant 2A protease (IC50 = 53.1 μM). Western blotting demonstrated CW-33 specifically inhibiting 2A protease-mediated cleavage of IFNAR1. CW-33 also recovered Type I IFN-induced Tyk2 and STAT1 phosphorylation as well as 2′,5′-OAS upregulation in EV-A71 infected cells. The results demonstrated CW-33 inhibiting viral 2A protease activity to reduce Type I IFN antagonism of EV-A71. Therefore, CW-33 combined with a low-dose of Type I IFN could be applied in developing alternative approaches to treat EV-A71 infection. PMID:26090728

  12. Proteases in cardiometabolic diseases: Pathophysiology, molecular mechanisms and clinical applications

    PubMed Central

    Hua, Yinan; Nair, Sreejayan

    2014-01-01

    Cardiovascular disease is the leading cause of death in the U.S. and other developed country. Metabolic syndrome, including obesity, diabetes/insulin resistance, hypertension and dyslipidemia is major threat for public health in the modern society. It is well established that metabolic syndrome contributes to the development of cardiovascular disease collective called as cardiometabolic disease. Despite documented studies in the research field of cardiometabolic disease, the underlying mechanisms are far from clear. Proteases are enzymes that break down proteins, many of which have been implicated in various diseases including cardiac disease. Matrix metalloproteinase (MMP), calpain, cathepsin and caspase are among the major proteases involved in cardiac remodeling. Recent studies have also implicated proteases in the pathogenesis of cardiometabolic disease. Elevated expression and activities of proteases in atherosclerosis, coronary heart disease, obesity/insulin-associated heart disease as well as hypertensive heart disease have been documented. Furthermore, transgenic animals that are deficient in or overexpress proteases allow scientists to understand the causal relationship between proteases and cardiometabolic disease. Mechanistically, MMPs and cathepsins exert their effect on cardiometabolic diseases mainly through modifying the extracellular matrix. However, MMP and cathepsin are also reported to affect intracellular proteins, by which they contribute to the development of cardiometabolic diseases. On the other hand, activation of calpain and caspases has been shown to influence intracellular signaling cascade including the NF-κB and apoptosis pathways. Clinically, proteases are reported to function as biomarkers of cardiometabolic diseases. More importantly, the inhibitors of proteases are credited with beneficial cardiometabolic profile, although the exact molecular mechanisms underlying these salutary effects are still under investigation. A better

  13. Photoactivated Spatiotemporally-Responsive Nanosensors of in Vivo Protease Activity.

    PubMed

    Dudani, Jaideep S; Jain, Piyush K; Kwong, Gabriel A; Stevens, Kelly R; Bhatia, Sangeeta N

    2015-12-22

    Proteases play diverse and important roles in physiology and disease, including influencing critical processes in development, immune responses, and malignancies. Both the abundance and activity of these enzymes are tightly regulated and highly contextual; thus, in order to elucidate their specific impact on disease progression, better tools are needed to precisely monitor in situ protease activity. Current strategies for detecting protease activity are focused on functionalizing synthetic peptide substrates with reporters that emit detection signals following peptide cleavage. However, these activity-based probes lack the capacity to be turned on at sites of interest and, therefore, are subject to off-target activation. Here we report a strategy that uses light to precisely control both the location and time of activity-based sensing. We develop photocaged activity-based sensors by conjugating photolabile molecules directly onto peptide substrates, thereby blocking protease cleavage by steric hindrance. At sites of disease, exposure to ultraviolet light unveils the nanosensors to allow proteases to cleave and release a reporter fragment that can be detected remotely. We apply this spatiotemporally controlled system to probe secreted protease activity in vitro and tumor protease activity in vivo. In vitro, we demonstrate the ability to dynamically and spatially measure metalloproteinase activity in a 3D model of colorectal cancer. In vivo, veiled nanosensors are selectively activated at the primary tumor site in colorectal cancer xenografts to capture the tumor microenvironment-enriched protease activity. The ability to remotely control activity-based sensors may offer a valuable complement to existing tools for measuring biological activity.

  14. Effects of cultural conditions on protease production by Aeromonas hydrophila.

    PubMed Central

    O'Reilly, T; Day, D F

    1983-01-01

    Production of extracellular proteolytic activity by Aeromonas hydrophila was influenced by temperature, pH, and aeration. Conditions which produced maximal growth also resulted in maximal protease production. Enzyme production appeared to be modulated by an inducer catabolite repression system whereby NH4+ and glucose repressed enzyme production and complex nitrogen and nonglucose, carbon energy sources promoted it. Under nutritional stress, protease production was high, despite poor growth. PMID:6342534

  15. Family Folklore

    ERIC Educational Resources Information Center

    Kotkin, Amy J.; Baker, Holly C.

    1977-01-01

    Discusses the Family Folklore Program of the Smithsonian Institution's annual Festival of American Folklife, in which the whole family can be involved in tracing family history through story telling, photographs, etc. (MS)

  16. Familial hypertriglyceridemia

    MedlinePlus

    ... page: //medlineplus.gov/ency/article/000397.htm Familial hypertriglyceridemia To use the sharing features on this page, please enable JavaScript. Familial hypertriglyceridemia is a common disorder passed down through families. ...

  17. Family History

    MedlinePlus

    Your family history includes health information about you and your close relatives. Families have many factors in common, including their genes, ... as heart disease, stroke, and cancer. Having a family member with a disease raises your risk, but ...

  18. Family Arguments

    MedlinePlus

    ... Spread the Word Shop AAP Find a Pediatrician Family Life Medical Home Family Dynamics Adoption & Foster Care ... Life Listen Español Text Size Email Print Share Family Arguments Page Content Article Body We seem to ...

  19. The roles of intramembrane proteases in protozoan parasites.

    PubMed

    Sibley, L David

    2013-12-01

    Intramembrane proteolysis is widely conserved throughout different forms of life, with three major types of proteases being known for their ability to cleave peptide bonds directly within the transmembrane domains of their substrates. Although intramembrane proteases have been extensively studied in humans and model organisms, they have only more recently been investigated in protozoan parasites, where they turn out to play important and sometimes unexpected roles. Signal peptide peptidases are involved in endoplasmic reticulum (ER) quality control and signal peptide degradation from exported proteins. Recent studies suggest that repurposing inhibitors developed for blocking presenilins may be useful for inhibiting the growth of Plasmodium, and possibly other protozoan parasites, by blocking signal peptide peptidases. Rhomboid proteases, originally described in the fly, are also widespread in parasites, and are especially expanded in apicomplexans. Their study in parasites has revealed novel roles that expand our understanding of how these proteases function. Within this diverse group of parasites, rhomboid proteases contribute to processing of adhesins involved in attachment, invasion, intracellular replication, phagocytosis, and immune evasion, placing them at the vertex of host-parasite interactions. This article is part of a Special Issue entitled: Intramembrane Proteases.

  20. Temporal dependence of cysteine protease activation following excitotoxic hippocampal injury.

    PubMed

    Berry, J N; Sharrett-Field, L J; Butler, T R; Prendergast, M A

    2012-10-11

    Excitotoxic insults can lead to intracellular signaling cascades that contribute to cell death, in part by activation of proteases, phospholipases, and endonucleases. Cysteine proteases, such as calpains, are calcium (Ca(2+))-activated enzymes which degrade cytoskeletal proteins, including microtubule-associated proteins, tubulin, and spectrin, among others. The current study used the organotypic hippocampal slice culture model to examine whether pharmacologic inhibition of cysteine protease activity inhibits N-methyl-D-aspartate- (NMDA-) induced excitotoxic (20 μM NMDA) cell death and changes in synaptophysin immunoreactivity. Significant NMDA-induced cytotoxicity (as measured by propidium iodide [PI] uptake) was found in the CA1 region of the hippocampus at all timepoints examined (24, 72, 120 h), an effect significantly attenuated by co-exposure to the selective NMDA receptor antagonist DL-2-Amino-5-phosphonopentanoic acid (APV), but not MDL-28170, a potent cysteine protease inhibitor. Results indicated sparing of NMDA-induced loss of the synaptic vesicular protein synaptophysin in all regions of the hippocampus by MDL-28170, though only at early timepoints after injury. These results suggest Ca(2+)-dependent recruitment of cysteine proteases within 24h of excitotoxic insult, but activation of alternative cellular degrading mechanisms after 24h. Further, these data suggest that synaptophysin may be a substrate for calpains and related proteases.

  1. The Inflammatory Actions of Coagulant and Fibrinolytic Proteases in Disease

    PubMed Central

    Schuliga, Michael

    2015-01-01

    Aside from their role in hemostasis, coagulant and fibrinolytic proteases are important mediators of inflammation in diseases such as asthma, atherosclerosis, rheumatoid arthritis, and cancer. The blood circulating zymogens of these proteases enter damaged tissue as a consequence of vascular leak or rupture to become activated and contribute to extravascular coagulation or fibrinolysis. The coagulants, factor Xa (FXa), factor VIIa (FVIIa), tissue factor, and thrombin, also evoke cell-mediated actions on structural cells (e.g., fibroblasts and smooth muscle cells) or inflammatory cells (e.g., macrophages) via the proteolytic activation of protease-activated receptors (PARs). Plasmin, the principle enzymatic mediator of fibrinolysis, also forms toll-like receptor-4 (TLR-4) activating fibrin degradation products (FDPs) and can release latent-matrix bound growth factors such as transforming growth factor-β (TGF-β). Furthermore, the proteases that convert plasminogen into plasmin (e.g., urokinase plasminogen activator) evoke plasmin-independent proinflammatory actions involving coreceptor activation. Selectively targeting the receptor-mediated actions of hemostatic proteases is a strategy that may be used to treat inflammatory disease without the bleeding complications of conventional anticoagulant therapies. The mechanisms by which proteases of the coagulant and fibrinolytic systems contribute to extravascular inflammation in disease will be considered in this review. PMID:25878399

  2. Characterizing Protease Specificity: How Many Substrates Do We Need?

    PubMed

    Schauperl, Michael; Fuchs, Julian E; Waldner, Birgit J; Huber, Roland G; Kramer, Christian; Liedl, Klaus R

    2015-01-01

    Calculation of cleavage entropies allows to quantify, map and compare protease substrate specificity by an information entropy based approach. The metric intrinsically depends on the number of experimentally determined substrates (data points). Thus a statistical analysis of its numerical stability is crucial to estimate the systematic error made by estimating specificity based on a limited number of substrates. In this contribution, we show the mathematical basis for estimating the uncertainty in cleavage entropies. Sets of cleavage entropies are calculated using experimental cleavage data and modeled extreme cases. By analyzing the underlying mathematics and applying statistical tools, a linear dependence of the metric in respect to 1/n was found. This allows us to extrapolate the values to an infinite number of samples and to estimate the errors. Analyzing the errors, a minimum number of 30 substrates was found to be necessary to characterize substrate specificity, in terms of amino acid variability, for a protease (S4-S4') with an uncertainty of 5 percent. Therefore, we encourage experimental researchers in the protease field to record specificity profiles of novel proteases aiming to identify at least 30 peptide substrates of maximum sequence diversity. We expect a full characterization of protease specificity helpful to rationalize biological functions of proteases and to assist rational drug design.

  3. Regulation of intestinal permeability: The role of proteases

    PubMed Central

    Van Spaendonk, Hanne; Ceuleers, Hannah; Witters, Leonie; Patteet, Eveline; Joossens, Jurgen; Augustyns, Koen; Lambeir, Anne-Marie; De Meester, Ingrid; De Man, Joris G; De Winter, Benedicte Y

    2017-01-01

    The gastrointestinal barrier is - with approximately 400 m2 - the human body’s largest surface separating the external environment from the internal milieu. This barrier serves a dual function: permitting the absorption of nutrients, water and electrolytes on the one hand, while limiting host contact with noxious luminal antigens on the other hand. To maintain this selective barrier, junction protein complexes seal the intercellular space between adjacent epithelial cells and regulate the paracellular transport. Increased intestinal permeability is associated with and suggested as a player in the pathophysiology of various gastrointestinal and extra-intestinal diseases such as inflammatory bowel disease, celiac disease and type 1 diabetes. The gastrointestinal tract is exposed to high levels of endogenous and exogenous proteases, both in the lumen and in the mucosa. There is increasing evidence to suggest that a dysregulation of the protease/antiprotease balance in the gut contributes to epithelial damage and increased permeability. Excessive proteolysis leads to direct cleavage of intercellular junction proteins, or to opening of the junction proteins via activation of protease activated receptors. In addition, proteases regulate the activity and availability of cytokines and growth factors, which are also known modulators of intestinal permeability. This review aims at outlining the mechanisms by which proteases alter the intestinal permeability. More knowledge on the role of proteases in mucosal homeostasis and gastrointestinal barrier function will definitely contribute to the identification of new therapeutic targets for permeability-related diseases.

  4. Characterizing Protease Specificity: How Many Substrates Do We Need?

    PubMed Central

    Schauperl, Michael; Fuchs, Julian E.; Waldner, Birgit J.; Huber, Roland G.; Kramer, Christian; Liedl, Klaus R.

    2015-01-01

    Calculation of cleavage entropies allows to quantify, map and compare protease substrate specificity by an information entropy based approach. The metric intrinsically depends on the number of experimentally determined substrates (data points). Thus a statistical analysis of its numerical stability is crucial to estimate the systematic error made by estimating specificity based on a limited number of substrates. In this contribution, we show the mathematical basis for estimating the uncertainty in cleavage entropies. Sets of cleavage entropies are calculated using experimental cleavage data and modeled extreme cases. By analyzing the underlying mathematics and applying statistical tools, a linear dependence of the metric in respect to 1/n was found. This allows us to extrapolate the values to an infinite number of samples and to estimate the errors. Analyzing the errors, a minimum number of 30 substrates was found to be necessary to characterize substrate specificity, in terms of amino acid variability, for a protease (S4-S4’) with an uncertainty of 5 percent. Therefore, we encourage experimental researchers in the protease field to record specificity profiles of novel proteases aiming to identify at least 30 peptide substrates of maximum sequence diversity. We expect a full characterization of protease specificity helpful to rationalize biological functions of proteases and to assist rational drug design. PMID:26559682

  5. Protease inhibitors from several classes work synergistically against Callosobruchus maculatus.

    PubMed

    Amirhusin, Bahagiawati; Shade, Richard E; Koiwa, Hisashi; Hasegawa, Paul M; Bressan, Ray A; Murdock, Larry L; Zhu-Salzman, Keyan

    2007-07-01

    Targeting multiple digestive proteases may be more effective in insect pest control than inhibition of a single enzyme class. We therefore explored possible interactions of three antimetabolic protease inhibitors fed to cowpea bruchids in artificial diets, using a recombinant soybean cysteine protease inhibitor scN, an aspartic protease inhibitor pepstatin A, and soybean Kunitz trypsin inhibitor KI. scN and pepstatin, inhibiting major digestive cysteine and aspartic proteases, respectively, significantly prolonged the developmental time of cowpea bruchids individually. When combined, the anti-insect effect was synergistic, i.e., the toxicity of the mixture was markedly greater than that of scN or pepstatin alone. KI alone did not impact insect development even at relatively high concentrations, but its anti-insect properties became apparent when acting jointly with scN or scN plus pepstatin. Incubating KI with bruchid midgut extract showed that it was partially degraded. This instability may explain its lack of anti-insect activity. However, this proteolytic degradation was inhibited by scN and/or pepstatin. Protection of KI from proteolysis in the insect digestive tract thus could be the basis for the synergistic effect. These observations support the concept that cowpea bruchid gut proteases play a dual role; digesting protein for nutrient needs and protecting insects by inactivating dietary proteins that may otherwise be toxic. Our results also suggest that transgenic resistance strategies that involve multigene products are likely to have enhanced efficacy and durability.

  6. 2-D zymographic analysis of Broccoli (Brassica oleracea L. var. Italica) florets proteases: follow up of cysteine protease isotypes in the course of post-harvest senescence.

    PubMed

    Rossano, Rocco; Larocca, Marilena; Riccio, Paolo

    2011-09-01

    Zymographic analysis of Broccoli florets (Brassica oleracea L. var. Italica) revealed the presence of acidic metallo-proteases, serine proteases and cysteine proteases. Under conditions which were denaturing for the other proteases, the study was restricted to cysteine proteases. 2-D zymography, a technique that combines IEF and zymography was used to show the presence of 11 different cysteine protease spots with molecular mass of 44 and 47-48kDa and pIs ranging between 4.1 and 4.7. pI differences could be ascribed to different degrees of phosphorylation that partly disappeared in the presence of alkaline phosphatase. Post-harvest senescence of Broccoli florets was characterized by decrease in protein and chlorophyll contents and increase of protease activity. In particular, as determined by 2-D zymography, the presence of cysteine protease clearly increased during senescence, a finding that may represent a useful tool for the control of the aging process.

  7. Dual origin of gut proteases in Formosan subterranean termites (Coptotermes formosanus Shiraki) (Isoptera: Rhinotermitidae).

    PubMed

    Sethi, Amit; Xue, Qing-Gang; La Peyre, Jerome F; Delatte, Jennifer; Husseneder, Claudia

    2011-07-01

    Cellulose digestion in lower termites, mediated by carbohydrases originating from both termite and endosymbionts, is well characterized. In contrast, limited information exists on gut proteases of lower termites, their origins and roles in termite nutrition. The objective of this study was to characterize gut proteases of the Formosan subterranean termite (Coptotermes formosanus Shiraki) (Isoptera: Rhinotermitidae). The protease activity of extracts from gut tissues (fore-, mid- and hindgut) and protozoa isolated from hindguts of termite workers was quantified using hide powder azure as a substrate and further characterized by zymography with gelatin SDS-PAGE. Midgut extracts showed the highest protease activity followed by the protozoa extracts. High level of protease activity was also detected in protozoa culture supernatants after 24 h incubation. Incubation of gut and protozoa extracts with class-specific protease inhibitors revealed that most of the proteases were serine proteases. All proteolytic bands identified after gelatin SDS-PAGE were also inhibited by serine protease inhibitors. Finally, incubation with chromogenic substrates indicated that extracts from fore- and hindgut tissues possessed proteases with almost exclusively trypsin-like activity while both midgut and protozoa extracts possessed proteases with trypsin-like and subtilisin/chymotrypsin-like activities. However, protozoa proteases were distinct from midgut proteases (with different molecular mass). Our results suggest that the Formosan subterranean termite not only produces endogenous proteases in its gut tissues, but also possesses proteases originating from its protozoan symbionts.

  8. Investigations on a hyper-proteolytic mutant of Beauveria bassiana: broad substrate specificity and high biotechnological potential of a serine protease.

    PubMed

    Borgi, Ines; Gargouri, Ali

    2014-02-01

    A new strain of Beauveria bassiana was identified on the basis of the 18S rRNA gene sequence homology. This strain, called P2, is a spontaneously arisen mutant that was isolated after successive sub-culturing the wild-type B. bassiana P1 strain. P2 showed hyper-production of extracellular protease(s) as much as ninefold more than P1. An extracellular protease (SBP) having a molecular weight of 32 kDa was purified from the P2 strain. SBP was completely inhibited by the phenyl methyl sulphonyl fluoride, which suggests that it belongs to the serine protease family. Based on the homology analysis of its N-terminal and the gene sequences, the enzyme was identified as subtilisin. The enzyme displays maximum activity at 60 °C and pH 8, and was stable at pH 6-12. The enzyme hydrolyses natural proteins such as keratin and is activated in presence of β-mercaptoethanol and Tween detergents. SBP was compatible with some laundry detergent formulations and showed high efficacy in the removal of blood stains from cotton fabric. Moreover, it was observed to degrade the melanised feathers and to hydrolyse the gelatine from X-ray films. All these results highlight the suitability of SBP protease as a very efficient microbial bio-resource.

  9. Protease Production by Different Thermophilic Fungi

    NASA Astrophysics Data System (ADS)

    Macchione, Mariana M.; Merheb, Carolina W.; Gomes, Eleni; da Silva, Roberto

    A comparative study was carried out to evaluate protease production in solid-state fermentation (SSF) and submerged fermentation (SmF) by nine different thermophilic fungi — Thermoascus aurantiacus Miehe, Thermomyces lanuginosus, T. lanuginosus TO.03, Aspergillus flavus 1.2, Aspergillus sp. 13.33, Aspergillus sp. 13.34, Aspergillus sp. 13.35, Rhizomucor pusillus 13.36 and Rhizomucor sp. 13.37 — using substrates containing proteins to induce enzyme secretion. Soybean extract (soybean milk), soybean flour, milk powder, rice, and wheat bran were tested. The most satisfactory results were obtained when using wheat bran in SSF. The fungi that stood out in SSF were T. lanuginosus, T. lanuginosus TO.03, Aspergillus sp. 13.34, Aspergillus sp. 13.35, and Rhizomucor sp. 13.37, and those in SmF were T. aurantiacus, T. lanuginosus TO.03, and 13.37. In both fermentation systems, A. flavus 1.2 and R. pusillus 13.36 presented the lowest levels of proteolytic activity.

  10. A Kazal-Type Serine Protease Inhibitor from the Defense Gland Secretion of the Subterranean Termite Coptotermes formosanus Shiraki

    PubMed Central

    Negulescu, Horia; Guo, Youzhong; Garner, Thomas P.; Goodwin, Octavia Y.; Henderson, Gregg; Laine, Roger A.; Macnaughtan, Megan A.

    2015-01-01

    Coptotermes formosanus is an imported, subterranean termite species with the largest economic impact in the United States. The frontal glands of the soldier caste termites comprising one third of the body mass, contain a secretion expelled through a foramen in defense. The small molecule composition of the frontal gland secretion is well-characterized, but the proteins remain to be identified. Herein is reported the structure and function of one of several proteins found in the termite defense gland secretion. TFP4 is a 6.9 kDa, non-classical group 1 Kazal-type serine protease inhibitor with activity towards chymotrypsin and elastase, but not trypsin. The 3-dimensional solution structure of TFP4 was solved with nuclear magnetic resonance spectroscopy, and represents the first structure from the taxonomic family, Rhinotermitidae. Based on the structure of TFP4, the protease inhibitor active loop (Cys8 to Cys16) was identified. PMID:25978745

  11. Family Literacy

    ERIC Educational Resources Information Center

    Holloway, John H.

    2004-01-01

    Research indicates that family literacy programs can provide opportunities for educational success for parents and children. The benefits reaped by the children in family literacy workshops are presented.

  12. A New Pepstatin-Insensitive Thermopsin-Like Protease Overproduced in Peptide-Rich Cultures of Sulfolobus solfataricus

    PubMed Central

    Gogliettino, Marta; Riccio, Alessia; Cocca, Ennio; Rossi, Mosè; Palmieri, Gianna; Balestrieri, Marco

    2014-01-01

    In this study, we gain insight into the extracellular proteolytic system of Sulfolobus solfataricus grown on proteinaceous substrates, providing further evidence that acidic proteases were specifically produced in response to peptide-rich media. The main proteolytic component was the previously isolated SsMTP (Sulfolobus solfataricus multi-domain thermopsin-like protease), while the less abundant (named SsMTP-1) one was purified, characterized and identified as the sso1175 gene-product. The protein revealed a multi-domain organization shared with the cognate SsMTP with a catalytic domain followed by several tandemly-repeated motifs. Moreover, both enzymes were found spread across the Crenarchaeota phylum and belonging to the thermopsin family, although segregated into diverse phylogenetic clusters. SsMTP-1 showed a 75-kDa molecular mass and was stable in the temperature range 50–90 °C, with optimal activity at 70 °C and pH 2.0. Serine, metallo and aspartic protease inhibitors did not affect the enzyme activity, designating SsMTP-1 as a new member of the pepstatin-insensitive aspartic protease family. The peptide-bond-specificity of SsMTP-1 in the cleavage of the oxidized insulin B chain was uncommon amongst thermopsins, suggesting that it could play a distinct, but cooperative role in the protein degradation machinery. Interestingly, predictions of the transmembrane protein topology of SsMTP and SsMTP-1 strongly suggest a possible contribution in signal-transduction pathways. PMID:24566144

  13. German cockroach frass proteases modulate the innate immune response via activation of protease-activated receptor-2.

    PubMed

    Day, Scottie B; Zhou, Ping; Ledford, John R; Page, Kristen

    2010-01-01

    Allergen exposure can induce an early innate immune response; however, the mechanism by which this occurs has not been addressed. In this report, we demonstrate a role for the active serine proteases in German cockroach (GC) feces (frass) and protease-activated receptor (PAR)-2 in modulating the innate immune response. A single exposure of GC frass induced inflammatory cytokine production and cellular infiltration in the airways of mice. In comparison, exposure to protease-depleted GC frass resulted in diminution of inflammatory cytokine production and airway neutrophilia, but had no effect on macrophage infiltration. Selective activation of PAR-2 confirmed that PAR-2 was sufficient to induce airway inflammation. Exposure of GC frass to PAR-2-deficient mice led to decreased immune responses to GC frass compared to wild-type mice. Using the macrophage as an early marker of the innate immune response, we found that GC frass induced significant release of tumor necrosis factor-alpha from primary alveolar macrophages. This effect was dependent on the intrinsic proteases in GC frass. We confirmed GC frass-induced cytokine expression was mediated by activation of NF-kappaB and ERK in a macrophage cell line. Collectively, these data suggest a central role for GC frass protease-PAR-2 activation in regulating the innate immune response through the activation of alveolar macrophages. Understanding the potential role of protease-PAR-2 activation as a danger signal or adjuvant could yield attractive therapeutic targets.

  14. Contribution of Aspartic Proteases in Candida Virulence. Protease Inhibitors against Candida Infections.

    PubMed

    Staniszewska, Monika; Małgorzata, Bondaryk; Zbigniew, Ochal

    2016-08-09

    Candida species are the major opportunistic human pathogens accounting for 70-90% of all invasive fungal infections. Candida spp, especially C. albicans, are able to produce and secrete hydrolytic enzymes, particularly aspartic proteases (Saps). These enzymes production is an evolutionary adaptation of pathogens to utilize nutrients and survive in host. Sap1-10 are believed to contribute to the adhesion and invasion of host tissues through the degradation of cell surface structures. Aspartic proteases control several steps in innate immune evasion and they degrade proteins related to immunological defense (antibodies, complement and cytokines), allowing the fungus to escape from the first line of host defense. The existing ways to identify potential drug targets rely on specific subset like virulence genes, transcriptional and stress response factors. Candida virulence factors like Sap isoenzymes can be pivotal targets for drug development. The identification of mechanism of a non-canonical inflammasome exerted by Saps could open novel therapeutic strategies to dampen hyperinflammatory response in candidiasis.

  15. Muslim families and family therapy.

    PubMed

    Daneshpour, M

    1998-07-01

    Muslim immigrant families living in the United States may well come to the attention of mental health professionals. This article examines the applicability of the Anglo-American models of family therapy to Muslim immigrant families. The most significant differences in value systems between the Muslim and Anglo-American cultures is Muslim families' preference for greater connectedness, a less flexible and more hierarchical family structure, and an implicit communication style. Systemic thinking, which deals with the pattern of relationships, is valid for all families regardless of cultural differences. However, the preferred directions of change for Muslim families need to be integrated into the assessment and goals for family therapy.

  16. A Trichomonas vaginalis Rhomboid Protease and Its Substrate Modulate Parasite Attachment and Cytolysis of Host Cells

    PubMed Central

    Riestra, Angelica M.; Gandhi, Shiv; Sweredoski, Michael J.; Moradian, Annie; Hess, Sonja; Urban, Sinisa; Johnson, Patricia J.

    2015-01-01

    Trichomonas vaginalis is an extracellular eukaryotic parasite that causes the most common, non-viral sexually transmitted infection worldwide. Although disease burden is high, molecular mechanisms underlying T. vaginalis pathogenesis are poorly understood. Here, we identify a family of putative T. vaginalis rhomboid proteases and demonstrate catalytic activity for two, TvROM1 and TvROM3, using a heterologous cell cleavage assay. The two T. vaginalis intramembrane serine proteases display different subcellular localization and substrate specificities. TvROM1 is a cell surface membrane protein and cleaves atypical model rhomboid protease substrates, whereas TvROM3 appears to localize to the Golgi apparatus and recognizes a typical model substrate. To identify TvROM substrates, we interrogated the T. vaginalis surface proteome using both quantitative proteomic and bioinformatic approaches. Of the nine candidates identified, TVAG_166850 and TVAG_280090 were shown to be cleaved by TvROM1. Comparison of amino acid residues surrounding the predicted cleavage sites of TvROM1 substrates revealed a preference for small amino acids in the predicted transmembrane domain. Over-expression of TvROM1 increased attachment to and cytolysis of host ectocervical cells. Similarly, mutations that block the cleavage of a TvROM1 substrate lead to its accumulation on the cell surface and increased parasite adherence to host cells. Together, these data indicate a role for TvROM1 and its substrate(s) in modulating attachment to and lysis of host cells, which are key processes in T. vaginalis pathogenesis. PMID:26684303

  17. New binding site conformations of the dengue virus NS3 protease accessed by molecular dynamics simulation.

    PubMed

    de Almeida, Hugo; Bastos, Izabela M D; Ribeiro, Bergmann M; Maigret, Bernard; Santana, Jaime M

    2013-01-01

    Dengue fever is caused by four distinct serotypes of the dengue virus (DENV1-4), and is estimated to affect over 500 million people every year. Presently, there are no vaccines or antiviral treatments for this disease. Among the possible targets to fight dengue fever is the viral NS3 protease (NS3PRO), which is in part responsible for viral processing and replication. It is now widely recognized that virtual screening campaigns should consider the flexibility of target protein by using multiple active conformational states. The flexibility of the DENV NS3PRO could explain the relatively low success of previous virtual screening studies. In this first work, we explore the DENV NS3PRO conformational states obtained from molecular dynamics (MD) simulations to take into account protease flexibility during the virtual screening/docking process. To do so, we built a full NS3PRO model by multiple template homology modeling. The model comprised the NS2B cofactor (essential to the NS3PRO activation), a glycine flexible link and the proteolytic domain. MD simulations had the purpose to sample, as closely as possible, the ligand binding site conformational landscape prior to inhibitor binding. The obtained conformational MD sample was clustered into four families that, together with principal component analysis of the trajectory, demonstrated protein flexibility. These results allowed the description of multiple binding modes for the Bz-Nle-Lys-Arg-Arg-H inhibitor, as verified by binding plots and pair interaction analysis. This study allowed us to tackle protein flexibility in our virtual screening campaign against the dengue virus NS3 protease.

  18. Purification and partial characterization of thiol protease inhibitors from embryos of the brine shrimp Artemia.

    PubMed

    Warner, A H; Sonnenfeld-Karcz, M J

    1992-01-01

    Thiol protease inhibitor (TPI) proteins in embryos of the brine shrimp Artemia were purified to apparent homogeneity and several of their properties were studied. Four protein fractions containing thiol protease inhibitor activity were obtained by high performance liquid chromatography of Artemia embryo proteins on a C-18 reverse-phase column and these were designated as TPI-1a, -1b, -2, and -3. Acrylamide gel electrophoresis showed that TPI-1a and TPI-1b each consisted of two bands of 11.8 and 13.6 kilodaltons (kDa), while TPI-2 and TPI-3 consisted of only one band of 12.5 kDa. Isoelectric focusing experiments demonstrated that TPI-3 contained one band at pH 5.3, while both TPI-1b and TPI-2 yielded bands at pH 5.2 and 5.3. TPI-1a did not yield any major bands. Amino acid composition analyses of the Artemia TPI proteins showed them to be remarkably similar to one another. All were rich in valine and aspartic and glutamic acids, and devoid of cysteine. Partial trypsin digestion of TPI-1b, TPI-2, and TPI-3 yielded several peptides with identical mobilities on a reverse-phase column and several other peptides with different mobilities, suggesting that the multiple forms of Artemia TPIs may have originated from the same parental protein. N-terminal amino acid sequence analyses of TPI-3 suggest that Artemia TPI proteins are members of the type I cystatin family of protease inhibitors.

  19. Streptococcus agalactiae CspA is a serine protease that inactivates chemokines.

    PubMed

    Bryan, Joshua D; Shelver, Daniel W

    2009-03-01

    Streptococcus agalactiae (group B Streptococcus [GBS]) remains a leading cause of invasive infections in neonates and has emerged as a pathogen of the immunocompromised and elderly populations. The virulence mechanisms of GBS are relatively understudied and are still poorly understood. Previous evidence indicated that the GBS cspA gene is necessary for full virulence and the cleavage of fibrinogen. The predicted cspA product displays homology to members of the extracellular cell envelope protease family. CXC chemokines, many of which can recruit neutrophils to sites of infection, are important signaling peptides of the immune system. In this study, we purified CspA and demonstrated that it readily cleaved the CXC chemokines GRO-alpha, GRO-beta, GRO-gamma, neutrophil-activating peptide 2 (NAP-2), and granulocyte chemotactic protein 2 (GCP-2) but did not cleave interleukin-8. CspA did not cleave a panel of other test substrates, suggesting that it possesses a certain degree of specificity. CXC chemokines also underwent cleavage by whole GBS cells in a cspA-dependent manner. CspA abolished the abilities of three representative CXC chemokines, GRO-gamma, NAP-2, and GCP-2, to attract and activate neutrophils. Genetic and biochemical evidence indicated that CspA is a serine protease with S575 at its active site. D180 was also implicated as part of the signature serine protease catalytic triad, and both S575 and D180 were required for both N-terminal and C-terminal autocatalytic processing of CspA.

  20. Protoporphyrins Enhance Oligomerization and Enzymatic Activity of HtrA1 Serine Protease

    PubMed Central

    Jo, Hakryul; Patterson, Victoria; Stoessel, Sean; Kuan, Chia-Yi; Hoh, Josephine

    2014-01-01

    High temperature requirement protein A1 (HtrA1), a secreted serine protease of the HtrA family, is associated with a multitude of human diseases. However, the exact functions of HtrA1 in these diseases remain poorly understood. We seek to unravel the mechanisms of HtrA1 by elucidating its interactions with chemical or biological modulators. To this end, we screened a small molecule library of 500 bioactive compounds to identify those that alter the formation of extracellular HtrA1 complexes in the cell culture medium. An initial characterization of two novel hits from this screen showed that protoporphyrin IX (PPP-IX), a precursor in the heme biosynthetic pathway, and its metalloporphyrin (MPP) derivatives fostered the oligomerization of HtrA1 by binding to the protease domain. As a result of the interaction with MPPs, the proteolytic activity of HtrA1 against Fibulin-5, a specific HtrA1 substrate in age-related macular degeneration (AMD), was increased. This physical interaction could be abolished by the missense mutations of HtrA1 found in patients with cerebral autosomal recessive arteriopathy with subcortical infarcts and leukoencephalopathy (CARASIL). Furthermore, knockdown of HtrA1 attenuated apoptosis induced by PPP-IX. These results suggest that PPP-IX, or its derivatives, and HtrA1 may function as co-factors whereby porphyrins enhance oligomerization and the protease activity of HtrA1, while active HtrA1 elevates the pro-apoptotic actions of porphyrin derivatives. Further analysis of this interplay may shed insights into the pathogenesis of diseases such as AMD, CARASIL and protoporphyria, as well as effective therapeutic development. PMID:25506911

  1. A Trichomonas vaginalis Rhomboid Protease and Its Substrate Modulate Parasite Attachment and Cytolysis of Host Cells.

    PubMed

    Riestra, Angelica M; Gandhi, Shiv; Sweredoski, Michael J; Moradian, Annie; Hess, Sonja; Urban, Sinisa; Johnson, Patricia J

    2015-12-01

    Trichomonas vaginalis is an extracellular eukaryotic parasite that causes the most common, non-viral sexually transmitted infection worldwide. Although disease burden is high, molecular mechanisms underlying T. vaginalis pathogenesis are poorly understood. Here, we identify a family of putative T. vaginalis rhomboid proteases and demonstrate catalytic activity for two, TvROM1 and TvROM3, using a heterologous cell cleavage assay. The two T. vaginalis intramembrane serine proteases display different subcellular localization and substrate specificities. TvROM1 is a cell surface membrane protein and cleaves atypical model rhomboid protease substrates, whereas TvROM3 appears to localize to the Golgi apparatus and recognizes a typical model substrate. To identify TvROM substrates, we interrogated the T. vaginalis surface proteome using both quantitative proteomic and bioinformatic approaches. Of the nine candidates identified, TVAG_166850 and TVAG_280090 were shown to be cleaved by TvROM1. Comparison of amino acid residues surrounding the predicted cleavage sites of TvROM1 substrates revealed a preference for small amino acids in the predicted transmembrane domain. Over-expression of TvROM1 increased attachment to and cytolysis of host ectocervical cells. Similarly, mutations that block the cleavage of a TvROM1 substrate lead to its accumulation on the cell surface and increased parasite adherence to host cells. Together, these data indicate a role for TvROM1 and its substrate(s) in modulating attachment to and lysis of host cells, which are key processes in T. vaginalis pathogenesis.

  2. Toxoplasma gondii cathepsin proteases are undeveloped prominent vaccine antigens against toxoplasmosis

    PubMed Central

    2013-01-01

    Background Toxoplasma gondii, an obligate intracellular apicomplexan parasite, infects a wide range of warm-blooded animals including humans. T. gondii expresses five members of the C1 family of cysteine proteases, including cathepsin B-like (TgCPB) and cathepsin L-like (TgCPL) proteins. TgCPB is involved in ROP protein maturation and parasite invasion, whereas TgCPL contributes to proteolytic maturation of proTgM2AP and proTgMIC3. TgCPL is also associated with the residual body in the parasitophorous vacuole after cell division has occurred. Both of these proteases are potential therapeutic targets in T. gondii. The aim of this study was to investigate TgCPB and TgCPL for their potential as DNA vaccines against T. gondii. Methods Using bioinformatics approaches, we analyzed TgCPB and TgCPL proteins and identified several linear-B cell epitopes and potential Th-cell epitopes in them. Based on these results, we assembled two single-gene constructs (TgCPB and TgCPL) and a multi-gene construct (pTgCPB/TgCPL) with which to immunize BALB/c mice and test their effectiveness as DNA vaccines. Results TgCPB and TgCPL vaccines elicited strong humoral and cellular immune responses in mice, both of which were Th-1 cell mediated. In addition, all of the vaccines protected the mice against infection with virulent T. gondii RH tachyzoites, with the multi-gene vaccine (pTgCPB/TgCPL) providing the highest level of protection. Conclusions T. gondii CPB and CPL proteases are strong candidates for development as novel DNA vaccines. PMID:23651838

  3. Characterization of a chemostable serine alkaline protease from Periplaneta americana

    PubMed Central

    2013-01-01

    Background Proteases are important enzymes involved in numerous essential physiological processes and hold a strong potential for industrial applications. The proteolytic activity of insects’ gut is endowed by many isoforms with diverse properties and specificities. Thus, insect proteases can act as a tool in industrial processes. Results In the present study, purification and properties of a serine alkaline protease from Periplaneta americana and its potential application as an additive in various bio-formulations are reported. The enzyme was purified near to homogeneity by using acetone precipitation and Sephadex G-100 gel filtration chromatography. Enzyme activity was increased up to 4.2 fold after gel filtration chromatography. The purified enzyme appeared as single protein-band with a molecular mass of ~ 27.8 kDa in SDS-PAGE. The optimum pH and temperature for the proteolytic activity for purified protein were found around pH 8.0 and 60°C respectively. Complete inhibition of the purified enzyme by phenylmethylsulfonyl fluoride confirmed that the protease was of serine-type. The purified enzyme revealed high stability and compatibility towards detergents, oxidizing, reducing, and bleaching agents. In addition, enzyme also showed stability towards organic solvents and commercial detergents. Conclusion Several important properties of a serine protease from P. Americana were revealed. Moreover, insects can serve as excellent and alternative source of industrially important proteases with unique properties, which can be utilized as additives in detergents, stain removers and other bio-formulations. Properties of the P. americana protease accounted in the present investigation can be exploited further in various industrial processes. As an industrial prospective, identification of enzymes with varying essential properties from different insect species might be good approach and bioresource. PMID:24229392

  4. Kinetics of alkaline protease production by Streptomyces griseoflavus PTCC1130

    PubMed Central

    Hosseini, Seyed Vesal; Saffari, Zahra; Farhanghi, Ali; Atyabi, Seyed Mohammad; Norouzian, Dariush

    2016-01-01

    Background and Objectives: Proteases are a group of enzymes that catalyze the degradation of proteins resulting in the production of their amino acid constituents. They are the most important group of industrial enzymes which account for about 60% of total enzymes in the market and produced mainly by microorganisms. The attempts were made to study the kinetic parameters of protease produced by Streptomyces griseoflavus PTCC1130. Materials and Methods: Streptomyces griseoflavus PTCC1130 was grown on casein agar. Different media such as BM1, BM2, BM3 and BM4 were prepared. Data obtained from growth and protease production were subjected to kinetics evaluation. Casein was used as substrate for protease activity and the released soluble peptide bearing aromatic amino acid were quantified by Folin Cioclateaue reagent. Protein content of the enzyme and the sugar utilized by the organism were estimated by Bradford and Miller’s methods respectively. Results: Basal Medium named as BM1, BM2, BM3 and BM4(50 mL in 250 mL Erlen Meyer flasks) were screened out to evaluate protease production by Streptomyces griseoflavus PTCC1130. They were inoculated with known amount of seed culture and kept on rotary shaker. To obtain the specific growth rate, wet weight of biomass was plotted against the time. The clarified supernatant was used for the analysis of protease by measuring the soluble peptide containing aromatic amino acid residues employing Folin Cioclateaue reagent. Our results showed that maximum level of enzyme production (14035 U/L) was occurred at late exponential phase using Basal Medium supplemented with zinc sulfate (0.5g/L), casein (10g/L) at pH 6.5. Conclusions: A kinetic study of protease production by Streptomyces griseoflavus PTCC1130 provided highly quantitative information regarding the behavior of a system, which is essential to study the fermentation process. Exploitation of such kinetics analysis would be useful in commercialization of microbial enzyme

  5. Protease increases fermentation rate and ethanol yield in dry-grind ethanol production.

    PubMed

    Johnston, David B; McAloon, Andrew J

    2014-02-01

    The effects of acid protease and urea addition during the fermentation step were evaluated. The fermentations were also tested with and without the addition of urea to determine if protease altered the nitrogen requirements of the yeast. Results show that the addition of the protease had a statistically significant effect on the fermentation rate and yield. Fermentation rates and yields were improved with the addition of the protease over the corresponding controls without protease. Protease addition either with or with added urea resulted in a higher final ethanol yield than without the protease addition. Urea addition levels >1200 ppm of supplemental nitrogen inhibited ethanol production. The economic effects of the protease addition were evaluated by using process engineering and economic models developed at the Eastern Regional Research Center. The decrease in overall processing costs from protease addition was as high as $0.01/L (4 ¢/gal) of denatured ethanol produced.

  6. Expression, purification and molecular modeling of the NIa protease of Cardamom mosaic virus.

    PubMed

    Jebasingh, T; Pandaranayaka, Eswari P J; Mahalakshmi, A; Kasin Yadunandam, A; Krishnaswamy, S; Usha, R

    2013-01-01

    The NIa protease of Potyviridae is the major viral protease that processes potyviral polyproteins. The NIa protease coding region of Cardamom mosaic virus (CdMV) is amplified from the viral cDNA, cloned and expressed in Escherichia coli. NIa protease forms inclusion bodies in E.coli. The inclusion bodies are solubilized with 8 M urea, refolded and purified by Nickel-Nitrilotriacetic acid affinity chromatography. Three-dimensional modeling of the CdMV NIa protease is achieved by threading approach using the homologous X-ray crystallographic structure of Tobacco etch mosaic virus NIa protease. The model gave an insight in to the substrate specificities of the NIa proteases and predicted the complementation of nearby residues in the catalytic triad (H42, D74 and C141) mutants in the cis protease activity of CdMV NIa protease.

  7. The structure of a universally employed enzyme: V8 protease from Staphylococcus aureus

    SciTech Connect

    Prasad, Lata; Leduc, Yvonne; Hayakawa, Koto; Delbaere, Louis T.J.

    2008-06-27

    V8 protease, an extracellular protease of Staphylococcus aureus, is related to the pancreatic serine proteases. The enzyme cleaves peptide bonds exclusively on the carbonyl side of aspartate and glutamate residues. Unlike the pancreatic serine proteases, V8 protease possesses no disulfide bridges. This is a major evolutionary difference, as all pancreatic proteases have at least two disulfide bridges. The structure of V8 protease shows structural similarity with several other serine proteases, specifically the epidermolytic toxins A and B from S. aureus and trypsin, in which the conformation of the active site is almost identical. V8 protease is also unique in that the positively charged N-terminus is involved in determining the substrate-specificity of the enzyme.

  8. Family Privilege

    ERIC Educational Resources Information Center

    Seita, John R.

    2014-01-01

    Family privilege is defined as "strengths and supports gained through primary caring relationships." A generation ago, the typical family included two parents and a bevy of kids living under one roof. Now, every variation of blended caregiving qualifies as family. But over the long arc of human history, a real family was a…

  9. HIV-1 protease-induced apoptosis

    PubMed Central

    2014-01-01

    Background Apoptosis is one of the presumptive causes of CD4+ T cell depletion during HIV infection and progression to AIDS. However, the precise role of HIV-1 in this process remains unexplained. HIV-1 protease (PR) has been suggested as a possible factor, but a direct link between HIV-1 PR enzymatic activity and apoptosis has not been established. Results Here, we show that expression of active HIV-1 PR induces death in HeLa and HEK-293 cells via the mitochondrial apoptotic pathway. This conclusion is based on in vivo observations of the direct localization of HIV-1 PR in mitochondria, a key player in triggering apoptosis. Moreover, we observed an HIV-1 PR concentration-dependent decrease in mitochondrial membrane potential and the role of HIV-1 PR in activation of caspase 9, PARP cleavage and DNA fragmentation. In addition, in vitro data demonstrated that HIV-1 PR mediates cleavage of mitochondrial proteins Tom22, VDAC and ANT, leading to release of AIF and Hsp60 proteins. By using yeast two-hybrid screening, we also identified a new HIV-1 PR interaction partner, breast carcinoma-associated protein 3 (BCA3). We found that BCA3 accelerates p53 transcriptional activity on the bax promoter, thus elevating the cellular level of pro-apoptotic Bax protein. Conclusion In summary, our results describe the involvement of HIV-1 PR in apoptosis, which is caused either by a direct effect of HIV-1 PR on mitochondrial membrane integrity or by its interaction with cellular protein BCA3. PMID:24886575

  10. Cell-specific and developmental expression of lectican-cleaving proteases in mouse hippocampus and neocortex.

    PubMed

    Levy, C; Brooks, J M; Chen, J; Su, J; Fox, M A

    2015-03-01

    Mounting evidence has demonstrated that a specialized extracellular matrix exists in the mammalian brain and that this glycoprotein-rich matrix contributes to many aspects of brain development and function. The most prominent supramolecular assemblies of these extracellular matrix glycoproteins are perineuronal nets, specialized lattice-like structures that surround the cell bodies and proximal neurites of select classes of interneurons. Perineuronal nets are composed of lecticans, a family of chondroitin sulfate proteoglycans that includes aggrecan, brevican, neurocan, and versican. These lattice-like structures emerge late in postnatal brain development, coinciding with the ending of critical periods of brain development. Despite our knowledge of the presence of lecticans in perineuronal nets and their importance in regulating synaptic plasticity, we know little about the development or distribution of the extracellular proteases that are responsible for their cleavage and turnover. A subset of a large family of extracellular proteases (called a disintegrin and metalloproteinase with thrombospondin motifs [ADAMTS]) is responsible for endogenously cleaving lecticans. We therefore explored the expression pattern of two aggrecan-degrading ADAMTS family members, ADAMTS15 and ADAMTS4, in the hippocampus and neocortex. Here, we show that both lectican-degrading metalloproteases are present in these brain regions and that each exhibits a distinct temporal and spatial expression pattern. Adamts15 mRNA is expressed exclusively by parvalbumin-expressing interneurons during synaptogenesis, whereas Adamts4 mRNA is exclusively generated by telencephalic oligodendrocytes during myelination. Thus, ADAMTS15 and ADAMTS4 not only exhibit unique cellular expression patterns but their developmental upregulation by these cell types coincides with critical aspects of neural development.

  11. Alkaline protease from Thermoactinomyces sp. RS1 mitigates industrial pollution.

    PubMed

    Verma, Amit; Ansari, Mohammad W; Anwar, Mohmmad S; Agrawal, Ruchi; Agrawal, Sanjeev

    2014-05-01

    Proteases have found a wide application in the several industrial processes, such as laundry detergents, protein recovery or solubilization, prion degradation, meat tenderizations, and in bating of hides and skins in leather industries. But the main hurdle in industrial application of proteases is their economical production on a large scale. The present investigation aimed to exploit the locally available inexpensive agricultural and household wastes for alkaline protease production using Thermoactinomyces sp. RS1 via solid-state fermentation (SSF) technique. The alkaline enzyme is potentially useful as an additive in commercial detergents to mitigate pollution load due to extensive use of caustic soda-based detergents. Thermoactinomyces sp. RS1 showed good protease production under SSF conditions of 55 °C, pH 9, and 50 % moisture content with potato peels as solid substrate. The presented findings revealed that crude alkaline protease produced by Thermoactinomyces sp. RS1 via SSF is of potential application in silver recovery from used X-ray films.

  12. Mitochondrial cereblon functions as a Lon-type protease

    PubMed Central

    Kataoka, Kosuke; Nakamura, China; Asahi, Toru; Sawamura, Naoya

    2016-01-01

    Lon protease plays a major role in the protein quality control system in mammalian cell mitochondria. It is present in the mitochondrial matrix, and degrades oxidized and misfolded proteins, thereby protecting the cell from various extracellular stresses, including oxidative stress. The intellectual disability-associated and thalidomide-binding protein cereblon (CRBN) contains a large, highly conserved Lon domain. However, whether CRBN has Lon protease-like function remains unknown. Here, we determined if CRBN has a protective function against oxidative stress, similar to Lon protease. We report that CRBN partially distributes in mitochondria, suggesting it has a mitochondrial function. To specify the mitochondrial role of CRBN, we mitochondrially expressed CRBN in human neuroblastoma SH-SY5Y cells. The resulting stable SH-SY5Y cell line showed no apparent effect on the mitochondrial functions of fusion, fission, and membrane potential. However, mitochondrially expressed CRBN exhibited protease activity, and was induced by oxidative stress. In addition, stably expressed cells exhibited suppressed neuronal cell death induced by hydrogen peroxide. These results suggest that CRBN functions specifically as a Lon-type protease in mitochondria. PMID:27417535

  13. Mitochondrial cereblon functions as a Lon-type protease.

    PubMed

    Kataoka, Kosuke; Nakamura, China; Asahi, Toru; Sawamura, Naoya

    2016-07-15

    Lon protease plays a major role in the protein quality control system in mammalian cell mitochondria. It is present in the mitochondrial matrix, and degrades oxidized and misfolded proteins, thereby protecting the cell from various extracellular stresses, including oxidative stress. The intellectual disability-associated and thalidomide-binding protein cereblon (CRBN) contains a large, highly conserved Lon domain. However, whether CRBN has Lon protease-like function remains unknown. Here, we determined if CRBN has a protective function against oxidative stress, similar to Lon protease. We report that CRBN partially distributes in mitochondria, suggesting it has a mitochondrial function. To specify the mitochondrial role of CRBN, we mitochondrially expressed CRBN in human neuroblastoma SH-SY5Y cells. The resulting stable SH-SY5Y cell line showed no apparent effect on the mitochondrial functions of fusion, fission, and membrane potential. However, mitochondrially expressed CRBN exhibited protease activity, and was induced by oxidative stress. In addition, stably expressed cells exhibited suppressed neuronal cell death induced by hydrogen peroxide. These results suggest that CRBN functions specifically as a Lon-type protease in mitochondria.

  14. Hydrophobic Core Flexibility Modulates Enzyme Activity in HIV-1 Protease

    SciTech Connect

    Mittal, Seema; Cai, Yufeng; Nalam, Madhavi N.L.; Bolon, Daniel N.A.; Schiffer, Celia A.

    2012-09-11

    Human immunodeficiency virus Type-1 (HIV-1) protease is crucial for viral maturation and infectivity. Studies of protease dynamics suggest that the rearrangement of the hydrophobic core is essential for enzyme activity. Many mutations in the hydrophobic core are also associated with drug resistance and may modulate the core flexibility. To test the role of flexibility in protease activity, pairs of cysteines were introduced at the interfaces of flexible regions remote from the active site. Disulfide bond formation was confirmed by crystal structures and by alkylation of free cysteines and mass spectrometry. Oxidized and reduced crystal structures of these variants show the overall structure of the protease is retained. However, cross-linking the cysteines led to drastic loss in enzyme activity, which was regained upon reducing the disulfide cross-links. Molecular dynamics simulations showed that altered dynamics propagated throughout the enzyme from the engineered disulfide. Thus, altered flexibility within the hydrophobic core can modulate HIV-1 protease activity, supporting the hypothesis that drug resistant mutations distal from the active site can alter the balance between substrate turnover and inhibitor binding by modulating enzyme activity.

  15. A Tunable, Modular Approach to Fluorescent Protease-Activated Reporters

    PubMed Central

    Wu, Peng; Nicholls, Samantha B.; Hardy, Jeanne A.

    2013-01-01

    Proteases are one of the most important and historically utilized classes of drug targets. To effectively interrogate this class of proteins, which encodes nearly 2% of the human proteome, it is necessary to develop effective and cost-efficient methods that report on their activity both in vitro and in vivo. We have developed a robust reporter of caspase proteolytic activity, called caspase-activatable green fluorescent protein (CA-GFP). The caspases play central roles in homeostatic regulation, as they execute programmed cell death, and in drug design, as caspases are involved in diseases ranging from cancer to neurodegeneration. CA-GFP is a genetically encoded dark-to-bright fluorescent reporter of caspase activity in in vitro, cell-based, and animal systems. Based on the CA-GFP platform, we developed reporters that can discriminate the activities of caspase-6 and -7, two highly related proteases. A second series of reporters, activated by human rhinovirus 3C protease, demonstrated that we could alter the specificity of the reporter by reengineering the protease recognition sequence. Finally, we took advantage of the spectrum of known fluorescent proteins to generate green, yellow, cyan, and red reporters, paving the way for multiplex protease monitoring. PMID:23561537

  16. Plant proteases for bioactive peptides release: A review.

    PubMed

    Mazorra-Manzano, M A; Ramírez-Suarez, J C; Yada, R Y

    2017-04-10

    Proteins are a potential source of health promoting biomolecules with medical, nutraceutical and food applications. Nowadays, bioactive peptides production, its isolation, characterization and strategies for its delivery to target sites are a matter of intensive research. In vitro and in vivo studies regarding the bioactivity of peptides has generated strong evidence of their health benefits. Dairy proteins are considered the richest source of bioactive peptides, however proteins from animal and vegetable origin also have been shown to be important sources. Enzymatic hydrolysis has been the process most commonly used for bioactive peptide production. Most commercial enzymatic preparations frequently used are from animal (e.g., trypsin and pepsin) and microbial (e.g., Alcalase® and Neutrase®) sources. Although the use of plant proteases is still relatively limited to papain and bromelain from papaya and pineapple, respectively, the application of new plant proteases is increasing. This review presents the latest knowledge in the use and diversity of plant proteases for bioactive peptides release from food-proteins including both available commercial plant proteases as well as new potential plant sources. Furthermore, the properties of peptides released by plant proteases and health benefits associated in the control of disorders such as hypertension, diabetes, obesity, and cancer are reviewed.

  17. Non-proteolytic functions of microbial proteases increase pathological complexity.

    PubMed

    Jarocki, Veronica M; Tacchi, Jessica L; Djordjevic, Steven P

    2015-03-01

    Proteases are enzymes that catalyse hydrolysis of peptide bonds thereby controlling the shape, size, function, composition, turnover and degradation of other proteins. In microbes, proteases are often identified as important virulence factors and as such have been targets for novel drug design. It is emerging that some proteases possess additional non-proteolytic functions that play important roles in host epithelia adhesion, tissue invasion and in modulating immune responses. These additional "moonlighting" functions have the potential to obfuscate data interpretation and have implications for therapeutic design. Moonlighting enzymes comprise a subcategory of multifunctional proteins that possess at least two distinct biological functions on a single polypeptide chain. Presently, identifying moonlighting proteins relies heavily on serendipitous empirical data with clues arising from proteins lacking signal peptides that are localised to the cell surface. Here, we describe examples of microbial proteases with additional non-proteolytic functions, including streptococcal pyrogenic exotoxin B, PepO and C5a peptidases, mycoplasmal aminopeptidases, mycobacterial chaperones and viral papain-like proteases. We explore how these non-proteolytic functions contribute to host cell adhesion, modulate the coagulation pathway, assist in non-covalent folding of proteins, participate in cell signalling, and increase substrate repertoire. We conclude by describing how proteomics has aided in moonlighting protein discovery, focusing attention on potential moonlighters in microbial exoproteomes.

  18. Microbial aspartic proteases: current and potential applications in industry.

    PubMed

    Theron, Louwrens W; Divol, Benoit

    2014-11-01

    Aspartic proteases are a relatively small group of proteolytic enzymes that are active in acidic environments and are found across all forms of life. Certain microorganisms secrete such proteases as virulence agents and/or in order to break down proteins thereby liberating assimilable sources of nitrogen. Some of the earlier applications of these proteolytic enzymes are found in the manufacturing of cheese where they are used as milk-clotting agents. Over the last decade, they have received tremendous research interest because of their involvement in human diseases. Furthermore, there has also been a growing interest on these enzymes for their applications in several other industries. Recent research suggests in particular that they could be used in the wine industry to prevent the formation of protein haze while preserving the wines' organoleptic properties. In this mini-review, the properties and mechanisms of action of aspartic proteases are summarized. Thereafter, a brief overview of the industrial applications of this specific class of proteases is provided. The use of aspartic proteases as alternatives to clarifying agents in various beverage industries is mentioned, and the potential applications in the wine industry are thoroughly discussed.

  19. Muslim Families and Family Therapy.

    ERIC Educational Resources Information Center

    Daneshpour, Manijeh

    1998-01-01

    Examines the applicability of the Anglo-American models of family therapy to Muslim immigrant families. The differences in value systems are the Muslim families' preferences for greater connectedness, a less flexible and more hierarchical family structure, and an implicit communication style. Suggests that directions for change for Muslims need to…

  20. Diversity of both the cultivable protease-producing bacteria and their extracellular proteases in the sediments of the South China sea.

    PubMed

    Zhou, Ming-Yang; Chen, Xiu-Lan; Zhao, Hui-Lin; Dang, Hong-Yue; Luan, Xi-Wu; Zhang, Xi-Ying; He, Hai-Lun; Zhou, Bai-Cheng; Zhang, Yu-Zhong

    2009-10-01

    Protease-producing bacteria are known to play an important role in degrading sedimentary particular organic nitrogen, and yet, their diversity and extracellular proteases remain largely unknown. In this paper, the diversity of the cultivable protease-producing bacteria and their extracellular proteases in the sediments of the South China Sea was investigated. The richness of the cultivable protease-producing bacteria reached 10(6) cells/g in all sediment samples. Analysis of the 16S rRNA gene sequences revealed that the predominant cultivated protease-producing bacteria are Gammaproteobacteria affiliated with the genera Pseudoalteromonas, Alteromonas, Marinobacter, Idiomarina, Halomonas, Vibrio, Shewanella, Pseudomonas, and Rheinheimera, with Alteromonas (34.6%) and Pseudoalteromonas (28.2%) as the predominant groups. Inhibitor analysis showed that nearly all the extracellular proteases from the bacteria are serine proteases or metalloproteases. Moreover, these proteases have different hydrolytic ability to different proteins, reflecting they may belong to different kinds of serine proteases or metalloproteases. To our knowledge, this study represents the first report of the diversity of bacterial proteases in deep-sea sediments.

  1. Azurocidin and a homologous serine protease from neutrophils. Differential antimicrobial and proteolytic properties.

    PubMed Central

    Campanelli, D; Detmers, P A; Nathan, C F; Gabay, J E

    1990-01-01

    Two 29-kD polypeptides, azurocidin and p29b, were purified to homogeneity from human neutrophils by acid extraction of azurophil granule membrane-associated material followed by gel filtration and reverse-phase chromatography. Azurocidin and p29b share NH2-terminal sequence homology with each other as well as with elastase, cathepsin G, and other serine proteases. p29b bound [3H]diisopropyl fluorophosphate and hydrolyzed elastin, casein, and hemoglobin. A peptide substrate for p29b could not be identified. Azurocidin neither bound [3H]diisopropyl fluorophosphate nor hydrolyzed any of the proteins, peptides, or esters tested. In microbicidal assays, purified azurocidin was comparable to p29b in activity against Escherichia coli, Streptococcus faecalis, and Candida albicans. The antimicrobial activity of azurocidin was enhanced under mildly acidic conditions, but was inhibited in a dose-dependent manner by NaCl, CaCl2, or serum. Immunoblot analysis with monospecific antibodies localized greater than 90% of the azurocidin and greater than 75% of the p29b to azurophil granule-rich fractions of PMN lysates. Immunoelectron microscopy confirmed the localization of azurocidin to the azurophil granules. Azurocidin associated with the azurophil granule membrane, but did not appear to be an integral membrane protein. Thus, azurocidin and p29b are members of a family of serine protease homologs stored in azurophil granules and may play a role in inflammatory and antimicrobial processes involving PMN. Images PMID:2312733

  2. A Cysteine Protease Is Critical for Babesia spp. Transmission in Haemaphysalis Ticks

    PubMed Central

    Tsuji, Naotoshi; Miyoshi, Takeharu; Battsetseg, Badger; Matsuo, Tomohide; Xuan, Xuenan; Fujisaki, Kozo

    2008-01-01

    Vector ticks possess a unique system that enables them to digest large amounts of host blood and to transmit various animal and human pathogens, suggesting the existence of evolutionally acquired proteolytic mechanisms. We report here the molecular and reverse genetic characterization of a multifunctional cysteine protease, longipain, from the babesial parasite vector tick Haemaphysalis longicornis. Longipain shares structural similarity with papain-family cysteine proteases obtained from invertebrates and vertebrates. Endogenous longipain was mainly expressed in the midgut epithelium and was specifically localized at lysosomal vacuoles and possibly released into the lumen. Its expression was up-regulated by host blood feeding. Enzymatic functional assays using in vitro and in vivo substrates revealed that longipain hydrolysis occurs over a broad range of pH and temperature. Haemoparasiticidal assays showed that longipain dose-dependently killed tick-borne Babesia parasites, and its babesiacidal effect occurred via specific adherence to the parasite membranes. Disruption of endogenous longipain by RNA interference revealed that longipain is involved in the digestion of the host blood meal. In addition, the knockdown ticks contained an increased number of parasites, suggesting that longipain exerts a killing effect against the midgut-stage Babesia parasites in ticks. Our results suggest that longipain is essential for tick survival, and may have a role in controlling the transmission of tick-transmittable Babesia parasites. PMID:18483546

  3. Regulation of distinct pools of amyloid β-protein by multiple cellular proteases

    PubMed Central

    2013-01-01

    Alzheimer’s disease (AD) is a progressive, age-related neurodegenerative disorder characterized by extracellular and intracellular deposition of the amyloid β-protein (Aβ). The study of rare, familial forms of AD has shown that sustained elevations in the production of Aβ (either all forms or specific pathogenic variants thereof) are sufficient to trigger the full spectrum of cognitive and histopathological features of the disease. Although the exact cause or causes remain unknown, emerging evidence suggests that impairments in the clearance of Aβ, after it is produced, may underlie the vast majority of sporadic AD cases. This review focuses on Aβ-degrading proteases (AβDPs), which have emerged as particularly important mediators of Aβ clearance. A wide variety of proteases that – by virtue of their particular regional and subcellular localization profiles – define distinct pools of Aβ have been identified. Different pools of Aβ, in turn, may contribute differentially to the pathogenesis of the disease. The study of individual AβDPs, therefore, promises to offer new insights into the mechanistic basis of AD pathogenesis and, ultimately, may facilitate the development of effective methods for its prevention or treatment or both. PMID:23953275

  4. Disruption of SUMO-Specific Protease 2 Induces Mitochondria Mediated Neurodegeneration

    PubMed Central

    Fu, Jiang; Yu, H.-M. Ivy; Chiu, Shang-Yi; Mirando, Anthony J.; Maruyama, Eri O.; Cheng, Jr-Gang; Hsu, Wei

    2014-01-01

    Post-translational modification of proteins by small ubiquitin-related modifier (SUMO) is reversible and highly evolutionarily conserved from yeasts to humans. Unlike ubiquitination with a well-established role in protein degradation, sumoylation may alter protein function, activity, stability and subcellular localization. Members of SUMO-specific protease (SENP) family, capable of SUMO removal, are involved in the reversed conjugation process. Although SUMO-specific proteases are known to reverse sumoylation in many well-defined systems, their importance in mammalian development and pathogenesis remains largely elusive. In patients with neurodegenerative diseases, aberrant accumulation of SUMO-conjugated proteins has been widely described. Several aggregation-prone proteins modulated by SUMO have been implicated in neurodegeneration, but there is no evidence supporting a direct involvement of SUMO modification enzymes in human diseases. Here we show that mice with neural-specific disruption of SENP2 develop movement difficulties which ultimately results in paralysis. The disruption induces neurodegeneration where mitochondrial dynamics is dysregulated. SENP2 regulates Drp1 sumoylation and stability critical for mitochondrial morphogenesis in an isoform-specific manner. Although dispensable for development of neural cell types, this regulatory mechanism is necessary for their survival. Our findings provide a causal link of SUMO modification enzymes to apoptosis of neural cells, suggesting a new pathogenic mechanism for neurodegeneration. Exploring the protective effect of SENP2 on neuronal cell death may uncover important preventive and therapeutic strategies for neurodegenerative diseases. PMID:25299344

  5. Mapping inhibitor binding modes on an active cysteine protease via nuclear magnetic resonance spectroscopy.

    PubMed

    Lee, Gregory M; Balouch, Eaman; Goetz, David H; Lazic, Ana; McKerrow, James H; Craik, Charles S

    2012-12-18

    Cruzain is a member of the papain/cathepsin L family of cysteine proteases, and the major cysteine protease of the protozoan Trypanosoma cruzi, the causative agent of Chagas disease. We report an autoinduction methodology that provides soluble cruzain in high yields (>30 mg/L in minimal medium). These increased yields provide sufficient quantities of active enzyme for use in nuclear magnetic resonance (NMR)-based ligand mapping. Using circular dichroism and NMR spectroscopy, we also examined the solution-state structural dynamics of the enzyme in complex with a covalently bound vinyl sulfone inhibitor (K777). We report the backbone amide and side chain carbon chemical shift assignments of cruzain in complex with K777. These resonance assignments were used to identify and map residues located in the substrate binding pocket, including the catalytic Cys25 and His162. Selective [(15)N]Cys, [(15)N]His, and [(13)C]Met labeling was performed to quickly assess cruzain-ligand interactions for a set of eight low-molecular weight compounds exhibiting micromolar binding or inhibition. Chemical shift perturbation mapping verified that six of the eight compounds bind to cruzain at the active site. Three different binding modes were delineated for the compounds, namely, covalent, noncovalent, and noninteracting. These results provide examples of how NMR spectroscopy can be used to screen compounds for fast evaluation of enzyme-inhibitor interactions to facilitate lead compound identification and subsequent structural studies.

  6. Targeted Deletion of a Plasmodium Site-2 Protease Impairs Life Cycle Progression in the Mammalian Host

    PubMed Central

    Goulielmaki, Evi; Chalari, Anna; Withers-Martinez, Chrislaine; Siden-Kiamos, Inga; Matuschewski, Kai

    2017-01-01

    Site-2 proteases (S2P) belong to the M50 family of metalloproteases, which typically perform essential roles by mediating activation of membrane–bound transcription factors through regulated intramembrane proteolysis (RIP). Protease-dependent liberation of dormant transcription factors triggers diverse cellular responses, such as sterol regulation, Notch signalling and the unfolded protein response. Plasmodium parasites rely on regulated proteolysis for controlling essential pathways throughout the life cycle. In this study we examine the Plasmodium-encoded S2P in a murine malaria model and show that it is expressed in all stages of Plasmodium development. Localisation studies by endogenous gene tagging revealed that in all invasive stages the protein is in close proximity to the nucleus. Ablation of PbS2P by reverse genetics leads to reduced growth rates during liver and blood infection and, hence, virulence attenuation. Strikingly, absence of PbS2P was compatible with parasite life cycle progression in the mosquito and mammalian hosts under physiological conditions, suggesting redundant or dispensable roles in vivo. PMID:28107409

  7. Low molecular weight serine protease inhibitors from insects are proteins with highly conserved sequences.

    PubMed

    Boigegrain, R A; Pugnière, M; Paroutaud, P; Castro, B; Brehélin, M

    2000-02-01

    A low molecular weight protease inhibitor peptide found in ovaries of the desert locust Schistocerca gregaria (SGPI-2), was purified from plasma of the same locust and sequenced. It was named SGCI. It was found active towards chymotrypsin and human leukocyte elastase. SGCI was synthesized using a solid-phase procedure and the sequence of its reactive site for chymotrypsin was determined. Compared with an inhibitor purified earlier from another locust species, the total sequence of SGCI showed 88% identity. In particular, the sequence of the reactive site of these inhibitors was identical. Our search for a closely related peptide in an insect species far removed from locusts, the lepidopteran Spodoptera littoralis, was unfruitful but a different chymotrypsin inhibitor, belonging to the Kazal family, was found whose mass is greater than that of SGCI (20 vs 3.6 kDa). Its N-terminal sequence shares 80% identity with that of a chymotrypsin inhibitor purified earlier from the haemolymph of another lepidopteran. Conservation of the amino acid sequence in the reactive site seems to be an exception among protease inhibitors.

  8. A kallikrein-like serine protease in prostatic fluid cleaves the predominant seminal vesicle protein.

    PubMed Central

    Lilja, H

    1985-01-01

    A 33-kD glycoprotein, known as the "prostate-specific antigen," was purified to homogeneity from human seminal plasma. The prostatic protein was identified as a serine protease, and its NH2-terminal sequence strongly suggests that it belongs to the family of glandular kallikreins. The structural protein of human seminal coagulum, the predominant protein in seminal vesicle secretion, was rapidly cleaved by the prostatic enzyme, which suggests that this seminal vesicle protein may serve as the physiological substrate for the protease. The prostatic enzyme hydrolyzed arginine- and lysine-containing substrates with a distinct preference for the former. All synthetic substrates tested were poor substrates for the enzyme. Synthetic Factor XIa substrate (pyro-glutamyl-prolyl-arginine-p-nitroanilide), and the synthetic kallikrein substrate (H-D-prolyl-phenylalanyl-arginine-p-nitroanilide) were hydrolyzed with maximum specific activities at 23 degrees C of 79 and 34 nmol/min per mg and Km values of 1.0 and 0.45 mM, respectively. Synthetic substrates for plasmin, chymotrypsin, and elastase were either not hydrolyzed by the enzyme at all, or only hydrolyzed very slowly. Images PMID:3902893

  9. Saccharomyces cerevisiae SMT4 encodes an evolutionarily conserved protease with a role in chromosome condensation regulation.

    PubMed Central

    Strunnikov, A V; Aravind, L; Koonin, E V

    2001-01-01

    In a search for regulatory genes affecting the targeting of the condensin complex to chromatin in Saccharomyces cerevisiae, we identified a member of the adenovirus protease family, SMT4. SMT4 overexpression suppresses the temperature-sensitive conditional lethal phenotype of smc2-6, but not smc2-8 or smc4-1. A disruption allele of SMT4 has a prominent chromosome phenotype: impaired targeting of Smc4p-GFP to rDNA chromatin. Site-specific mutagenesis of the predicted protease active site cysteine and histidine residues of Smt4p abolishes the SMT4 function in vivo. The previously uncharacterized SIZ1 (SAP and Miz) gene, which encodes a protein containing a predicted DNA-binding SAP module and a Miz finger, is identified as a bypass suppressor of the growth defect associated with the SMT4 disruption. The SIZ1 gene disruption is synthetically lethal with the SIZ2 deletion. We propose that SMT4, SIZ1, and SIZ2 are involved in a novel pathway of chromosome maintenance. PMID:11333221

  10. The serine protease hepsin mediates urinary secretion and polymerisation of Zona Pellucida domain protein uromodulin

    PubMed Central

    Brunati, Martina; Perucca, Simone; Han, Ling; Cattaneo, Angela; Consolato, Francesco; Andolfo, Annapaola; Schaeffer, Céline; Olinger, Eric; Peng, Jianhao; Santambrogio, Sara; Perrier, Romain; Li, Shuo; Bokhove, Marcel; Bachi, Angela; Hummler, Edith; Devuyst, Olivier; Wu, Qingyu; Jovine, Luca; Rampoldi, Luca

    2015-01-01

    Uromodulin is the most abundant protein in the urine. It is exclusively produced by renal epithelial cells and it plays key roles in kidney function and disease. Uromodulin mainly exerts its function as an extracellular matrix whose assembly depends on a conserved, specific proteolytic cleavage leading to conformational activation of a Zona Pellucida (ZP) polymerisation domain. Through a comprehensive approach, including extensive characterisation of uromodulin processing in cellular models and in specific knock-out mice, we demonstrate that the membrane-bound serine protease hepsin is the enzyme responsible for the physiological cleavage of uromodulin. Our findings define a key aspect of uromodulin biology and identify the first in vivo substrate of hepsin. The identification of hepsin as the first protease involved in the release of a ZP domain protein is likely relevant for other members of this protein family, including several extracellular proteins, as egg coat proteins and inner ear tectorins. DOI: http://dx.doi.org/10.7554/eLife.08887.001 PMID:26673890

  11. Family Violence and Family Physicians

    PubMed Central

    Herbert, Carol P.

    1991-01-01

    The acronym IDEALS summarizes family physicians' obligations when violence is suspected: to identify family violence; document injuries; educate families and ensure safety for victims; access resources and coordinate care; co-operate in the legal process; and provide support for families. Failure to respond reflects personal and professional experience and attitudes, fear of legal involvement, and lack of knowledge. Risks of intervention include physician burnout, physician overfunctioning, escalation of violence, and family disruption. PMID:21228987

  12. Continuous Proteolysis with a stabilized stabilized protease. I. Chemical stabilization of an alkaline protease.

    PubMed

    Boudrant, J; Cuq, J L; Cheftel, C

    1976-12-01

    Due to the loss of enzymatic activity as a function of time, an alkaline protease, selected for the continuous preparation of protein hydrolysates (J. Boudrant and C. Cheftel, Biotechnol. Bioeng., 18,1735, 1976), was chemically stabilized by a simple treatment with glutaraldehyde. Two fractions, soluble and insoluble, were obtained. The activities of these two fractions were measured with casein and N-benzoyl-L-arginine ethyl ester (BAEE) as a function of glutaraldehyde concentration used. It was noted that the insoluble fraction was practically inactive with the first substrate and that the heat stability of the soluble form was likewise enhanced. Molecular weights of these two forms were unchanged, but the uv-spectrum of the soluble form was modified. From amino acid analysis, it appears that this treatment mainly provokes a decrease in lysine content.

  13. Evidence for Reduced Drug Susceptibility without Emergence of Major Protease Mutations following Protease Inhibitor Monotherapy Failure in the SARA Trial

    PubMed Central

    Sutherland, Katherine A.; Parry, Chris M.; McCormick, Adele; Kapaata, Anne; Lyagoba, Fred; Kaleebu, Pontiano; Gilks, Charles F.; Goodall, Ruth; Spyer, Moira; Kityo, Cissy; Pillay, Deenan; Gupta, Ravindra K.

    2015-01-01

    Background Major protease mutations are rarely observed following failure with protease inhibitors (PI), and other viral determinants of failure to PI are poorly understood. We therefore characterized Gag-Protease phenotypic susceptibility in subtype A and D viruses circulating in East Africa following viral rebound on PIs. Methods Samples from baseline and treatment failure in patients enrolled in the second line LPV/r trial SARA underwent phenotypic susceptibility testing. Data were expressed as fold-change in susceptibility relative to a LPV-susceptible reference strain. Results We cloned 48 Gag-Protease containing sequences from seven individuals and performed drug resistance phenotyping from pre-PI and treatment failure timepoints in seven patients. For the six patients where major protease inhibitor resistance mutations did not emerge, mean fold-change EC50 to LPV was 4.07 fold (95% CI, 2.08–6.07) at the pre-PI timepoint. Following viral failure the mean fold-change in EC50 to LPV was 4.25 fold (95% CI, 1.39–7.11, p = 0.91). All viruses remained susceptible to DRV. In our assay system, the major PI resistance mutation I84V, which emerged in one individual, conferred a 10.5-fold reduction in LPV susceptibility. One of the six patients exhibited a significant reduction in susceptibility between pre-PI and failure timepoints (from 4.7 fold to 9.6 fold) in the absence of known major mutations in protease, but associated with changes in Gag: V7I, G49D, R69Q, A120D, Q127K, N375S and I462S. Phylogenetic analysis provided evidence of the emergence of genetically distinct viruses at the time of treatment failure, indicating ongoing viral evolution in Gag-protease under PI pressure. Conclusions Here we observe in one patient the development of significantly reduced susceptibility conferred by changes in Gag which may have contributed to treatment failure on a protease inhibitor containing regimen. Further phenotype-genotype studies are required to elucidate genetic

  14. A facile analytical method for the identification of protease gene profiles from Bacillus thuringiensis strains.

    PubMed

    Chen, Fu-Chu; Shen, Li-Fen; Chak, Kin-Fu

    2004-01-01

    Five pairs of degenerate universal primers have been designed to identify the general protease gene profiles from some distinct Bacillus thuringiensis strains. Based on the PCR amplification patterns and DNA sequences of the cloned fragments, it was noted that the protease gene profiles of the three distinct strains of B. thuringiensis subsp. kurstaki HD73, tenebrionis and israelensis T14001 are varied. Seven protease genes, neutral protease B (nprB), intracellular serine protease A (ispA), extracellular serine protease (vpr), envelope-associated protease (prtH), neutral protease F (nprF), thermostable alkaline serine protease and alkaline serine protease (aprS), with known functions were identified from three distinct B. thuringiensis strains. In addition, five DNA sequences with unknown functions were also identified by this facile analytical method. However, based on the alignment of the derived protein sequences with the protein domain database, it suggested that at least one of these unknown genes, yunA, might be highly protease-related. Thus, the proposed PCR-mediated amplification design could be a facile method for identifying the protease gene profiles as well as for detecting novel protease genes of the B. thuringiensis strains.

  15. New therapeutic strategies in HCV: second-generation protease inhibitors.

    PubMed

    Clark, Virginia C; Peter, Joy A; Nelson, David R

    2013-02-01

    Telaprevir and boceprevir are the first direct-acting antiviral agents approved for use in HCV treatment and represent a significant advance in HCV therapy. However, these first-generation drugs also have significant limitations related to thrice-daily dosing, clinically challenging side-effect profiles, low barriers to resistance and a lack of pan-genotype activity. A second wave of protease inhibitors are in phase II and III trials and promise to provide a drug regimen with a better dosing schedule and improved tolerance. These second-wave protease inhibitors will probably be approved in combination with PEG-IFN and Ribavirin (RBV), as well as future all-oral regimens. The true second-generation protease inhibitors are in earlier stages of development and efficacy data are anxiously awaited as they may provide pan-genotypic antiviral activity and a high genetic barrier to resistance.

  16. Acid phosphatase and protease activities in immobilized rat skeletal muscles

    NASA Technical Reports Server (NTRS)

    Witzmann, F. A.; Troup, J. P.; Fitts, R. H.

    1982-01-01

    The effect of hind-limb immobilization on selected Iysosomal enzyme activities was studied in rat hing-limb muscles composed primarily of type 1. 2A, or 2B fibers. Following immobilization, acid protease and acid phosphatase both exhibited signifcant increases in their activity per unit weight in all three fiber types. Acid phosphatase activity increased at day 14 of immobilization in the three muscles and returned to control levels by day 21. Acid protease activity also changed biphasically, displaying a higher and earlier rise than acid phosphatase. The pattern of change in acid protease, but not acid phosphatase, closely parallels observed muscle wasting. The present data therefore demonstrate enhanced proteolytic capacity of all three fiber types early during muscular atrophy. In addition, the data suggest a dependence of basal hydrolytic and proteolytic activities and their adaptive response to immobilization on muscle fiber composition.

  17. Peptide synthesis in neat organic solvents with novel thermostable proteases.

    PubMed

    Toplak, Ana; Nuijens, Timo; Quaedflieg, Peter J L M; Wu, Bian; Janssen, Dick B

    2015-06-01

    Biocatalytic peptide synthesis will benefit from enzymes that are active at low water levels in organic solvent compositions that allow good substrate and product solubility. To explore the use of proteases from thermophiles for peptide synthesis under such conditions, putative protease genes of the subtilase class were cloned from Thermus aquaticus and Deinococcus geothermalis and expressed in Escherichia coli. The purified enzymes were highly thermostable and catalyzed efficient peptide bond synthesis at 80°C and 60°C in neat acetonitrile with excellent conversion (>90%). The enzymes tolerated high levels of N,N-dimethylformamide (DMF) as a cosolvent (40-50% v/v), which improved substrate solubility and gave good conversion in 5+3 peptide condensation reactions. The results suggest that proteases from thermophiles can be used for peptide synthesis under harsh reaction conditions.

  18. Tobacco Etch Virus protease: A shortcut across biotechnologies.

    PubMed

    Cesaratto, Francesca; Burrone, Oscar R; Petris, Gianluca

    2016-08-10

    About thirty years ago, studies on the RNA genome of Tobacco Etch Virus revealed the presence of an efficient and specific protease, called Tobacco Etch Virus protease (TEVp), that was part of the Nuclear Inclusion a (NIa) enzyme. TEVp is an efficient and specific protease of 27kDa that has become a valuable biotechnological tool. Nowadays TEVp is a unique endopeptidase largely exploited in biotechnology from industrial applications to in vitro and in vivo cellular studies. A number of TEVp mutants with different rate of cleavage, stability and specificity have been reported. Similarly, a panel of different target cleavage sites, derived from the canonical ENLYFQ-G/S site, has been established. In this review we describe these aspects of TEVp and some of its multiple applications. A particular focus is on the use and molecular biology of TEVp in living cells and organisms.

  19. Cleaning protocols for crystallization robots: preventing protease contamination.

    PubMed

    Naschberger, Andreas; Fürnrohr, Barbara G; Dunzendorfer-Matt, Theresia; Bonagura, Christopher A; Wright, David; Scheffzek, Klaus; Rupp, Bernhard

    2015-01-01

    The protease in the commonly used commercial low-foam enzyme cleaner Zymit cannot be completely blocked by EDTA, a widely used inhibitor of metalloproteases, at concentrations of up to 5 mM. Severe protein degradation was observed in crystallization drops after EDTA-containing wash steps unless residual Zymit protease was removed with NaOH at a concentration of at least 0.1 M. Wash steps with 0.1% SDS were also ineffective in completely removing the remaining Zymit activity. Protocols including wash steps with at least 0.1 M NaOH, as for example specified in the original ZENM protocol, are recommended to completely deactivate Zymit protease activity.

  20. Lvserpin3 is involved in shrimp innate immunity via the inhibition of bacterial proteases and proteases involved in prophenoloxidase system.

    PubMed

    Liu, Yongjie; Liu, Tao; Hou, Fujun; Wang, Xianzong; Liu, Xiaolin

    2016-01-01

    Serine protease inhibitor, represented by serpin, plays an important inhibitory role on proteases involved in the immune responses. To clarify the immune characterizations of serpin, a novel serpin (Lvserpin3) encoding for 410 amino acids with a 23-amino acid signal peptide and a serpin domain was identified from the Pacific white shrimp Litopenaeus vannamei. Lvserpin3 expressed strongest in hepatopancreas, and was significantly up-regulated in the early stage upon Vibrio anguillarum, Micrococcus lysodeikticus or White Spot Syndrome Virus (WSSV) infection. Suppression of Lvserpin3 by dsRNA led to a significant increase in the transcripts of LvPPAF, LvproPO and phenoloxidase (PO) activity, and also led to the high cumulative mortality. The recombinant Lvserpin3 protein (rLvserpin3) inhibited the proteases secreted by M. lysodeikticus and Bacillus subtilis, and further exhibited inhibitory role on the growth of B. subtilis and M. lysodeikticu. Moreover, rLvserpin3 was found to be able to block the activation of prophenoloxidase system. Taken together, the results imply that Lvserpin3 may be involved in shrimp innate immunity via the inhibition of bacterial proteases and proteases involved in prophenoloxidase system.

  1. Streptococcus pneumoniae serine protease HtrA, but not SFP or PrtA, is a major virulence factor in pneumonia.

    PubMed

    de Stoppelaar, Sacha F; Bootsma, Hester J; Zomer, Aldert; Roelofs, Joris J T H; Hermans, Peter W M; van 't Veer, Cornelis; van der Poll, Tom

    2013-01-01

    Streptococcus (S.) pneumoniae is a common causative pathogen in pneumonia. Serine protease orthologs expressed by a variety of bacteria have been found of importance for virulence. Previous studies have identified two serine proteases in S. pneumoniae, HtrA (high-temperature requirement A) and PrtA (cell wall-associated serine protease A), that contributed to virulence in models of pneumonia and intraperitoneal infection respectively. We here sought to identify additional S. pneumoniae serine proteases and determine their role in virulence. The S. pneumoniae D39 genome contains five putative serine proteases, of which HtrA, Subtilase Family Protein (SFP) and PrtA were selected for insertional mutagenesis because they are predicted to be secreted and surface exposed. Mutant D39 strains lacking serine proteases were constructed by in-frame insertion deletion mutagenesis. Pneumonia was induced by intranasal infection of mice with wild-type or mutant D39. After high dose infection, only D39ΔhtrA showed reduced virulence, as reflected by strongly reduced bacterial loads, diminished dissemination and decreased lung inflammation. D39ΔprtA induced significantly less lung inflammation together with smaller infiltrated lung surface, but without influencing bacterial loads. After low dose infection, D39ΔhtrA again showed strongly reduced bacterial loads; notably, pneumococcal burdens were also modestly lower in lungs after infection with D39Δsfp. These data confirm the important role for HtrA in S. pneumoniae virulence. PrtA contributes to lung damage in high dose pneumonia; it does not however contribute to bacterial outgrowth in pneumococcal pneumonia. SFP may facilitate S. pneumoniae growth after low dose infection.

  2. Computational study of the resistance shown by the Subtype B / HIV-1 Protease to currently known inhibitors †

    PubMed Central

    Genoni, Alessandro; Morra, Giulia; Merz, Kenneth M.; Colombo, Giorgio

    2010-01-01

    Human Immunodeficiency Virus type 1 Protease (HIV-1 PR) is an essential enzyme in the HIV-1 life cycle. As such, this protein represents a major drug target in AIDS therapy, but emerging resistance to anti-retroviral inhibitor cocktails, due to high viral mutation rates, represents a significant challenge in AIDS treatment. Many mutations are not located within the active site or binding pocket, nor they do significantly modify the 3D structural organization of the enzyme; hence, the mechanism(s) by which they alter inhibitor affinity for the Protease remains uncertain. In this article, we present an all-atom computational analysis of the dynamic residue-residue coordination between the active site residues and the rest of the protein and of the energetic properties of different HIV-1 PR complexes. We analyze both the wild type form and mutated forms that induce drug resistance. In particular, the results show differences between the wild type and the mutants in their mechanism of dynamic coordination, in the signal propagation between the active site residues and the rest of the protein and in the energy-networks responsible for the stabilization of the bound inhibitor conformation. Finally, we propose a dynamic and energetic explanation for HIV-1 Protease drug resistance and, through this model, we identify a possible new site that could be helpful in the design of a new family of HIV-1 PR allosteric inhibitors. PMID:20415450

  3. Novel zinc protease gene isolated from Dictyostelium discoideum is structurally related to mammalian leukotriene A4 hydrolase.

    PubMed

    Fan, D; Hou, L S

    2015-12-09

    The allantoicase (allC) gene of Dictyostelium discoideum allC RNAi mutant strain was silenced using the RNA interference technique. The mutant strain is motile, aggregated, and could not undergo further morphological development. The growth rate is high and the cells show a shortened cell cycle comparing with wild-type D. discoideum. However, the mechanisms regarding these actions remain unclear. mRNA differential display was used in this study to identify genetic differences. A novel D. discoideum gene (GenBank accession number: KC759140) encoding a new zinc protease was cloned. The amino acid sequence of the novel gene exhibited a conserved zinc-binding domain (HEX2HX18E) that allowed its classification into the M1 family of metallopeptidases. The gene encoded a 345-amino acid protein with a theoretical molecular mass of 39.69 kDa and a theoretical pI of 6.05. This protein showed strong homology with leukotriene A4 (LTA4) hydrolase of Homo sapiens (41% identity and 60% similarity at the amino acid level). By analyzing quantitative reverse transcription-polymerase chain reaction data, this zinc protease gene was more highly expressed in D. discoideum allC RNAi mutant type than in wild-type KAx-3 cells during the trophophase. The novel zinc protease gene may function as an LTA4 hydrolase and contribute to the shortening of the allC RNAi mutant cell cycle.

  4. The extracellular protease stl functions to inhibit migration of v'ch1 sensory neuron during Drosophila embryogenesis.

    PubMed

    Lhamo, Tashi; Ismat, Afshan

    2015-08-01

    Proper migration of cells through the dense and complex extracellular matrix (ECM) requires constant restructuring of the ECM to allow cells to move forward in a smooth manner. This restructuring can occur through the action of extracellular enzymes. Among these extracellular enzymes is the ADAMTS (A Disintegrin And Metalloprotease with ThromboSpondin repeats) family of secreted extracellular proteases. Drosophila stl encodes an ADAMTS protease expressed in and around the peripheral nervous system (PNS) during embryogenesis. The absence of stl displayed one specific neuron, the v'ch1 sensory neuron, migrating to its target sooner than in wild type. During normal development, the v'ch1 sensory neuron migrates dorsally at the same time it is extending an axon ventrally toward the CNS. Surprisingly, in the absence of stl, the v'ch1 neuron migrated further dorsally as compared to the wild type at stage 15, but did not migrate past its correct target at stage 16, suggesting a novel role for this extracellular protease in inhibiting migration of this neuron past a certain point.

  5. The crystal structure of the secreted aspartic protease 1 from Candida parapsilosis in complex with pepstatin A

    SciTech Connect

    Dostál, Jiří; Brynda, Jiří; Hrušková-Heidingsfeldová, Olga; Sieglová, Irena; Pichová, Iva; Řezáčová, Pavlína

    2010-09-01

    Opportunistic pathogens of the genus Candida cause infections representing a major threat to long-term survival of immunocompromised patients. Virulence of the Candida pathogens is enhanced by production of extracellular proteolytic enzymes and secreted aspartic proteases (Saps) are therefore studied as potential virulence factors and possible targets for therapeutic drug design. Candida parapsilosis is less invasive than C. albicans, however, it is one of the leading causative agents of yeast infections. We report three-dimensional crystal structure of Sapp1p from C. parapsilosis in complex with pepstatin A, the classical inhibitor of aspartic proteases. The structure of Sapp1p was determined from protein isolated from its natural source and represents the first structure of Sap from C. parapsilosis. Overall fold and topology of Sapp1p is very similar to the archetypic fold of monomeric aspartic protease family and known structures of Sap isoenzymes from C. albicans and Sapt1p from C. tropicalis. Structural comparison revealed noticeable differences in the structure of loops surrounding the active site. This resulted in differential character, shape, and size of the substrate binding site explaining divergent substrate specificities and inhibitor affinities. Determination of structures of Sap isoenzymes from various species might contribute to the development of new Sap-specific inhibitors.

  6. Bowman-Birk protease inhibitor from the seeds of Vigna unguiculata forms a highly stable dimeric structure.

    PubMed

    Rao, K N; Suresh, C G

    2007-10-01

    Different protease inhibitors including Bowman-Birk type (BBI) have been reported from the seeds of Vigna unguiculata. Protease isoinhibitors of double-headed Bowman-Birk type from the seeds of Vigna unguiculata have been purified and characterized. The BBI from Vigna unguiculata (Vu-BBI) has been found to undergo self-association to form very stable dimers and more complex oligomers, by size-exclusion chromatography and SDS-PAGE in the presence of urea. Many BBIs have been reported to undergo self-association to form homodimers or more complex oligomers in solution. Only one dimeric crystal structure of a BBI (pea-BBI) is reported to date. We report the three-dimensional structure of a Vu-BBI determined at 2.5 A resolution. Although, the inhibitor has a monomer fold similar to that found in other known structures of Bowman-Birk protease inhibitors, its quaternary structure is different from that commonly observed in this family. The structural elements responsible for the stability of monomer molecule and dimeric association are discussed. The Vu-BBI may use dimeric or higher quaternary association to maintain the physiological state and to execute its biological function.

  7. Isolation and Biochemical Characterization of a New Thrombin-Like Serine Protease from Bothrops pirajai Snake Venom

    PubMed Central

    Zaqueo, Kayena D.; Kayano, Anderson M.; Simões-Silva, Rodrigo; Moreira-Dill, Leandro S.; Fernandes, Carla F. C.; Fuly, André L.; Maltarollo, Vinícius G.; Honório, Kathia M.; da Silva, Saulo L.; Acosta, Gerardo; Caballol, Maria Antonia O.; de Oliveira, Eliandre; Albericio, Fernando; Calderon, Leonardo A.; Soares, Andreimar M.; Stábeli, Rodrigo G.

    2014-01-01

    This paper presents a novel serine protease (SP) isolated from Bothrops pirajai, a venomous snake found solely in Brazil that belongs to the Viperidae family. The identified SP, named BpirSP-39, was isolated by three chromatographic steps (size exclusion, bioaffinity, and reverse phase chromatographies). The molecular mass of BpirSP-39 was estimated by SDS-PAGE and confirmed by mass spectrometry (39,408.32 Da). The protein was able to form fibrin networks, which was not observed in the presence of serine protease inhibitors, such as phenylmethylsulfonyl fluoride (PMSF). Furthermore, BpirSP-39 presented considerable thermal stability and was apparently able to activate factor XIII of the blood coagulation cascade, unlike most serine proteases. BpirSP-39 was capable of hydrolyzing different chromogenic substrates tested (S-2222, S-2302, and S-2238) while Cu2+ significantly diminished BspirSP-39 activity on the three tested substrates. The enzyme promoted platelet aggregation and also exhibited fibrinogenolytic, fibrinolytic, gelatinolytic, and amidolytic activities. The multiple alignment showed high sequence similarity to other thrombin-like enzymes from snake venoms. These results allow us to conclude that a new SP was isolated from Bothrops pirajai snake venom. PMID:24719874

  8. Isolation and biochemical characterization of a new thrombin-like serine protease from Bothrops pirajai snake venom.

    PubMed

    Zaqueo, Kayena D; Kayano, Anderson M; Simões-Silva, Rodrigo; Moreira-Dill, Leandro S; Fernandes, Carla F C; Fuly, André L; Maltarollo, Vinícius G; Honório, Kathia M; da Silva, Saulo L; Acosta, Gerardo; Caballol, Maria Antonia O; de Oliveira, Eliandre; Albericio, Fernando; Calderon, Leonardo A; Soares, Andreimar M; Stábeli, Rodrigo G

    2014-01-01

    This paper presents a novel serine protease (SP) isolated from Bothrops pirajai, a venomous snake found solely in Brazil that belongs to the Viperidae family. The identified SP, named BpirSP-39, was isolated by three chromatographic steps (size exclusion, bioaffinity, and reverse phase chromatographies). The molecular mass of BpirSP-39 was estimated by SDS-PAGE and confirmed by mass spectrometry (39,408.32 Da). The protein was able to form fibrin networks, which was not observed in the presence of serine protease inhibitors, such as phenylmethylsulfonyl fluoride (PMSF). Furthermore, BpirSP-39 presented considerable thermal stability and was apparently able to activate factor XIII of the blood coagulation cascade, unlike most serine proteases. BpirSP-39 was capable of hydrolyzing different chromogenic substrates tested (S-2222, S-2302, and S-2238) while Cu(2+) significantly diminished BspirSP-39 activity on the three tested substrates. The enzyme promoted platelet aggregation and also exhibited fibrinogenolytic, fibrinolytic, gelatinolytic, and amidolytic activities. The multiple alignment showed high sequence similarity to other thrombin-like enzymes from snake venoms. These results allow us to conclude that a new SP was isolated from Bothrops pirajai snake venom.

  9. Molecular characterization and expression analysis of Cathepsin B and L cysteine proteases from rock bream (Oplegnathus fasciatus).

    PubMed

    Whang, Ilson; De Zoysa, Mahanama; Nikapitiya, Chamilani; Lee, Youngdeuk; Kim, Yucheol; Lee, Sukkyoung; Oh, Chulhong; Jung, Sung-Ju; Oh, Myung-Joo; Choi, Cheol Young; Yeo, Sang-Yeob; Kim, Bong-Seok; Kim, Se-Jae; Lee, Jehee

    2011-03-01

    Cathepsins are lysosomal cysteine proteases of the papain family that play an important role in intracellular protein degradation and turn over within the lysosomal system. In the present study, full-length sequences of cathepsin B (RbCathepsin B) and L (RbCathepsin L) were identified after transcriptome sequencing of rock bream Oplegnathus fasciatus mixed tissue cDNA. Cathepsin B was composed of 330 amino acid residues with 36 kDa predicted molecular mass. RbCathepsin L contained 336 amino acid residues encoding for a 38 kDa predicted molecular mass protein. The sequencing analysis results showed that both cathepsin B and L contain the characteristic papain family cysteine protease signature and active sites for the eukaryotic thiol proteases of cysteine, asparagine and histidine. In addition, RbCathepsin L contained EF hand Ca(2+) binding and cathepsin propeptide inhibitor domains. The rock bream cathepsin B and L showed the highest amino acid identity of 90 and 95% to Lutjanus argentimaculatus cathepsin B and Lates calcarifer cathepsin L, respectively. By phylogenetic analysis, cathepsin B and L exhibited a high degree of evolutionary relationship to respective cathepsin family members of the papain superfamily. Quantitative real-time RT-PCR analysis results confirmed that the expression of cathepsin B and L genes was constitutive in all examined tissues isolated from un-induced rock bream. Moreover, activation of RbCathepsin B and L mRNA was observed in both lipopolysaccharide (LPS) and Edwardsiella tarda challenged liver and blood cells, indicating a role of immune response in rock bream.

  10. Taspase1: a 'misunderstood' protease with translational cancer relevance.

    PubMed

    Wünsch, D; Hahlbrock, A; Jung, S; Schirmeister, T; van den Boom, J; Schilling, O; Knauer, S K; Stauber, R H

    2016-06-30

    Proteolysis is not only a critical requirement for life, but the executing enzymes also play important roles in numerous pathological conditions, including cancer. Therefore, targeting proteases is clearly relevant for improving cancer patient care. However, to effectively control proteases, a profound knowledge of their mechanistic function as well as their regulation and downstream signalling in health and disease is required. The highly conserved protease Threonine Aspartase1 (Taspase1) is overexpressed in numerous liquid and solid malignancies and was characterized as a 'non-oncogene addiction' protease. Although Taspase1 was shown to cleave various regulatory proteins in humans as well as leukaemia provoking mixed lineage leukaemia fusions, our knowledge on its detailed functions and the underlying mechanisms contributing to cancer is still incomplete. Despite superficial similarity to type 2 asparaginases as well as Ntn proteases, such as the proteasome, Taspase1-related research so far gives us the picture of a unique protease exhibiting special features. Moreover, neither effective genetic nor chemical inhibitors for this enzyme are available so far, thus hampering not only to further dissect Taspase1's pathobiological functions but also precluding the assessment of its clinical impact. Based on recent insights, we here critically review the current knowledge of Taspase1's structure-function relationship and its mechanistic relevance for tumorigenesis obtained from in vitro and in vivo cancer models. We provide a comprehensive overview of tumour entities for which Taspase1 might be of predictive and therapeutic value, and present the respective experimental evidence. To stimulate progress in the field, a comprehensive overview of Taspase1 targeting approaches is presented, including coverage of Taspase1-related patents. We conclude by discussing future inhibition strategies and relevant challenges, which need to be resolved by the field.

  11. Association of a protease with polytene chromosomes of Drosophila melanogaster.

    PubMed

    Cavagnaro, J; Pierce, D A; Lucchesi, J C; Chae, C B

    1980-11-01

    Incubation of Drosophila salivary glands with radioactive diisopropyl fluorophosphate results in the uniform labeling of polytene chromosomes. Extensive labeling is seen only when chromosome squashes are prepared by a formaldehyde fixation procedure and not by standard acetic acid techniques. The labeling is inhibited in the presence of tosylphenylalanine chloromethyl ketone and phenylmethane sulfonylfluoride but not by tosyllysine chloromethyl ketone, suggesting that a chymotrypsin-like serine protease is associated with the chromosomes. Protease inhibitors show no apparent effect on heat-shock specific puffing.

  12. [Cytokines and proteases involved in pathogenesis of COPD].

    PubMed

    Yamaya, Atsuyo; Osanai, Kazuhiro

    2011-10-01

    COPD is characterized by persistence of chronic inflammation in small airways and alveoli. Macrophages, neutrophils, and a specialized subset of T lymphocytes orchestrate the mild inflammation. This article focuses on humoral factors such as cytokines and chemokines that recruit these inflammatory and immune cells to the lungs, and proteases/antiproteases that ultimately cause structural derangement in the terminal respiratory zones. In addition to the classical protease and antiprotease imbalance hypothesis, alveolar homeostasis abnormality that comes from imbalance of lung constitutional cell apoptosis and regeneration may play a role in emphysema development. Also, autoimmunity to elastin degradation products may take part in the disease.

  13. The chlamydial protease CPAF: important or not, important for what?

    PubMed

    Häcker, Georg

    2014-05-01

    The protease CPAF is only found in Chlamydiales and in at least most bacteria that share with Chlamydia the biphasic life-style in a cytosolic inclusion. CPAF is intriguing: it appears to be secreted from the inclusion across the inclusion membrane into the cytosol. A bacterial protease ravaging in the cytosol of a human cell may cause a plethora of effects. Curiously, very few are known. The current discussion is bogged down by a focus on experimental artifact, while proposed functions of CPAF remain speculative. I here make the attempt to summarize what we know about CPAF.

  14. Regulation by proteolysis: energy-dependent proteases and their targets.

    PubMed Central

    Gottesman, S; Maurizi, M R

    1992-01-01

    A number of critical regulatory proteins in both prokaryotic and eukaryotic cells are subject to rapid, energy-dependent proteolysis. Rapid degradation combined with control over biosynthesis provides a mechanism by which the availability of a protein can be limited both temporally and spatially. Highly unstable regulatory proteins are involved in numerous biological functions, particularly at the commitment steps in developmental pathways and in emergency responses. The proteases involved in energy-dependent proteolysis are large proteins with the ability to use ATP to scan for appropriate targets and degrade complete proteins in a processive manner. These cytoplasmic proteases are also able to degrade many abnormal proteins in the cell. PMID:1480111

  15. Identification of Genotypic Changes in Human Immunodeficiency Virus Protease That Correlate with Reduced Susceptibility to the Protease Inhibitor Lopinavir among Viral Isolates from Protease Inhibitor-Experienced Patients

    PubMed Central

    Kempf, Dale J.; Isaacson, Jeffrey D.; King, Martin S.; Brun, Scott C.; Xu, Yi; Real, Kathryn; Bernstein, Barry M.; Japour, Anthony J.; Sun, Eugene; Rode, Richard A.

    2001-01-01

    The association of genotypic changes in human immunodeficiency virus (HIV) protease with reduced in vitro susceptibility to the new protease inhibitor lopinavir (previously ABT-378) was explored using a panel of viral isolates from subjects failing therapy with other protease inhibitors. Two statistical tests showed that specific mutations at 11 amino acid positions in protease (L10F/I/R/V, K20M/R, L24I, M46I/L, F53L, I54L/T/V, L63P, A71I/L/T/V, V82A/F/T, I84V, and L90M) were associated with reduced susceptibility. Mutations at positions 82, 54, 10, 63, 71, and 84 were most closely associated with relatively modest (4- and 10-fold) changes in phenotype, while the K20M/R and F53L mutations, in conjunction with multiple other mutations, were associated with >20- and >40-fold-reduced susceptibility, respectively. The median 50% inhibitory concentrations (IC50) of lopinavir against isolates with 0 to 3, 4 or 5, 6 or 7, and 8 to 10 of the above 11 mutations were 0.8-, 2.7-, 13.5-, and 44.0-fold higher, respectively, than the IC50 against wild-type HIV. On average, the IC50 of lopinavir increased by 1.74-fold per mutation in isolates containing three or more mutations. Each of the 16 viruses that displayed a >20-fold change in susceptibility contained mutations at residues 10, 54, 63, and 82 and/or 84, along with a median of three mutations at residues 20, 24, 46, 53, 71, and 90. The number of protease mutations from the 11 identified in these analyses (the lopinavir mutation score) may be useful for the interpretation of HIV genotypic resistance testing with respect to lopinavir-ritonavir (Kaletra) regimens and may provide insight into the genetic barrier to resistance to lopinavir-ritonavir in both antiretroviral therapy-naive and protease inhibitor-experienced patients. PMID:11462018

  16. Family Violence

    MedlinePlus

    ... Deployment & Transition Home » Health & Wellness » Family Violence Family Violence Recognize the warning signs . Know how to report. ... Love Every Day Making Relationships Work National Domestic Violence Hotline Signs of Child Abuse INSTALLATION PROGRAM DIRECTORY ...

  17. Family Involvement.

    ERIC Educational Resources Information Center

    Liontos, Lynn Balster

    1992-01-01

    Family involvement in schools will work only when perceived as an enlarged concept focusing on all children, including those from at-risk families. Each publication reviewed here is specifically concerned with family involvement strategies concerned with all children or targeted at primarily high risk students. Susan McAllister Swap looks at three…

  18. Family Support.

    ERIC Educational Resources Information Center

    Wieck, Colleen, Ed.; McBride, Marijo, Ed.

    1990-01-01

    This "Feature Issue" of the quarterly journal "Impact" presents 19 brief articles on family support systems in the United States for persons with developmental disabilities and their families. Emphasis is on provisions of Public Law 99-457. Articles include: "Family Support in the United States: Setting a Course for the…

  19. Purification and biochemical characterization of two detergent-stable serine alkaline proteases from Streptomyces sp. strain AH4.

    PubMed

    Touioui, Souraya Boulkour; Jaouadi, Nadia Zaraî; Boudjella, Hadjira; Ferradji, Fatma Zohra; Belhoul, Mouna; Rekik, Hatem; Badis, Abdelmalek; Bejar, Samir; Jaouadi, Bassem

    2015-07-01

    Streptomyces sp. strain AH4 exhibited a high ability to produce two extracellular proteases when cultured on a yeast malt-extract (ISP2)-casein-based medium. Pure proteins were obtained after heat treatment (30 min at 70 °C) and ammonium sulphate fractionation (30-60 %), followed by size exclusion HPLC column. Matrix assisted laser desorption ionization-time of flight mass spectrometry analysis revealed that the purified enzymes (named SAPS-P1 and SAPS-P2) were monomers with molecular masses of 36,417.13 and 21,099.10 Da, respectively. Their identified N-terminal amino acid displayed high homologies with those of Streptomyces proteases. While SAPS-P1 was optimally active at pH 12.0 and 70 °C, SAPS-P2 showed optimum activity at pH 10.0 and 60 °C. Both enzymes were completely stable within a wide range of temperature (45-75 °C) and pH (8.0-11.5). They were noted to be completely inhibited by phenylmethanesulfonyl fluoride and diisopropyl fluorophosphates, which confirmed their belonging to the serine proteases family. Compared to SAPS-P2, SAPS-P1 showed high thermostability and excellent stability towards bleaching, denaturing, and oxidizing agents. Both enzymes displayed marked stability and compatibility with a wide range of commercial laundry detergents and significant catalytic efficiencies compared to Subtilisin Carlsberg and Protease SG-XIV. Overall, the results indicated that SAPS-P1 and SAPS-P2 can be considered as potential promising candidates for future application as bioadditives in detergent formulations.

  20. Entamoeba histolytica rhomboid protease 1 has a role in migration and motility as validated by two independent genetic approaches.

    PubMed

    Rastew, Elena; Morf, Laura; Singh, Upinder

    2015-07-01

    Rhomboid proteins represent a recently discovered family of intramembrane proteases present in a broad range of organisms and with increasing links to human diseases. The enteric parasite Entamoeba histolytica has evolved multiple mechanisms to adapt to the human host environment and establish infection. Our recent studies identified EhROM1 as a functional E. histolytica rhomboid protease with roles in adhesion to and phagocytosis of host cells. Since those studies were performed in a non-virulent strain, roles in parasite virulence could not be assessed. We focused this study on the comparison and validation of two genetic manipulation techniques: overexpression of a dominant-negative catalytic mutant of EhROM1 and knock down of EhROM1 using a RNAi-based silencing approach followed by functional studies of phenotypic analyses in virulent parasites. Both the EhROM1 catalytic mutant and parasites with EhROM1 downregulation were reduced in cytotoxicity, hemolytic activity, and directional and non-directional transwell migration. Importantly, the role for EhROM1 in cell migration mimics similar roles for rhomboid proteases from mammalian and apicomplexan systems. However, the EhROM1 catalytic mutant and EhROM1 downregulation parasites had different phenotypes for erythrophagocytosis, while complement resistance was not affected in either strain. In summary, in this study we genetically manipulated E. histolytica rhomboid protease EhROM1 by two different approaches and identified similarly attenuated phenotypes by both approaches, suggesting a novel role for EhROM1 in amebic motility.

  1. The Kunitz-Type Protein ShPI-1 Inhibits Serine Proteases and Voltage-Gated Potassium Channels

    PubMed Central

    García-Fernández, Rossana; Peigneur, Steve; Pons, Tirso; Alvarez, Carlos; González, Lidice; Chávez, María A.; Tytgat, Jan

    2016-01-01

    The bovine pancreatic trypsin inhibitor (BPTI)-Kunitz-type protein ShPI-1 (UniProt: P31713) is the major protease inhibitor from the sea anemone Stichodactyla helianthus. This molecule is used in biotechnology and has biomedical potential related to its anti-parasitic effect. A pseudo wild-type variant, rShPI-1A, with additional residues at the N- and C-terminal, has a similar three-dimensional structure and comparable trypsin inhibition strength. Further insights into the structure-function relationship of rShPI-1A are required in order to obtain a better understanding of the mechanism of action of this sea anemone peptide. Using enzyme kinetics, we now investigated its activity against other serine proteases. Considering previous reports of bifunctional Kunitz-type proteins from anemones, we also studied the effect of rShPI-1A on voltage-gated potassium (Kv) channels. rShPI-1A binds Kv1.1, Kv1.2, and Kv1.6 channels with IC50 values in the nM range. Hence, ShPI-1 is the first member of the sea anemone type 2 potassium channel toxins family with tight-binding potency against several proteases and different Kv1 channels. In depth sequence analysis and structural comparison of ShPI-1 with similar protease inhibitors and Kv channel toxins showed apparent non-sequence conservation for known key residues. However, we detected two subtle patterns of coordinated amino acid substitutions flanking the conserved cysteine residues at the N- and C-terminal ends. PMID:27089366

  2. Gastrointestinal absorption and biological activities of serine and cysteine proteases of animal and plant origin: review on absorption of serine and cysteine proteases.

    PubMed

    Lorkowski, Gerhard

    2012-01-01

    Research has confirmed that peptides and larger protein molecules pass through the mucosal barrier of the gastrointestinal tract. Orally administered serine and cysteine proteases of plant and animal origin also reach blood and lymph as intact, high molecular weight and physiologically active protein molecules. Their absorption may be supported by a self-enhanced paracellular transport mechanism resulting in sub-nanomolar concentration of transiently free protease molecules or, in a complex with anti-proteases, at higher concentrations. Data from pharmacokinetic investigations reveals dose linearity for maximum plasma levels of free proteases not unusual for body proteases and a high inter-individual variability. There is no interference with each other after oral administration of protease combinations, and absorption follows an unusual invasion and elimination kinetic due to slow velocity of absorption and a fast 100% protein binding to anti-proteases. Oral application of proteases leads to increased proteolytic serum activity and increased plasma concentrations of the corresponding anti-proteases. Their biological activity is determined by their proteolytic activity as free proteases on soluble peptides/proteins or cell surface receptors (e.g. protease activated receptors) and their activity in the complex formed with their specific and/or unspecific anti-proteases. The anti-protease-complexes, during immune reaction and injuries often loaded with different cytokines, are cleared from body fluids and tissue by receptor mediated endocytosis on hepatocytes and/or blood cells. Oral administration of enteric coated tablets containing proteolytic enzymes of plant and animal origin may be a safe method to stabilize, positively influence or enhance physiological and immunological processes during disease processes and in healthy consumers.

  3. Italian families and family interventions.

    PubMed

    Casacchia, Massimo; Roncone, Rita

    2014-06-01

    In Italy, as in many countries, relatives are closely involved in caring for persons with physical and mental disorders. The Italian scenario lends itself to routine involvement of family members in psychiatric treatment because, despite becoming smaller and smaller, Italian families keep close ties, and men and women do not leave the parental home until relatively late. The authors describe the impact of international family psychosocial research on the Italian mental health services (MHSs) and the main psychosocial interventions currently in use, including family psychoeducational interventions and the "Milan family therapy approach." They also highlight the contribution Italian researchers have given to the study of important variables in integrated mental disorder care, such as family burden of care, relatives' attitudes, family functioning, and satisfaction with the MHSs. Finally, they discuss the difficulties of implementing and disseminating family interventions within the Italian MHS, despite the growing evidence of their effectiveness.

  4. The effects of bioprocess parameters on extracellular proteases in a recombinant Aspergillus niger B1-D.

    PubMed

    Li, Qiang; Harvey, Linda M; McNeil, Brian

    2008-02-01

    Although host proteases are often considered to have a negative impact upon heterologous protein production by filamentous fungi, relatively little is known about the pattern of their appearance in recombinant fungal bioprocesses. In the present study, we investigated extracellular proteases from a filamentous fungus, Aspergillus niger B1-D, genetically modified to secrete hen egg white lysozyme (HEWL). Our findings indicate that extracellular protease activity is only detected after the carbon source is completely utilised in batch cultures. The proteases are predominantly acid proteases and have optimal temperature for activity at around 45 degrees C. Their activity could be partially inhibited by protease inhibitors, indicating the existence of at least four kinds of proteases in these culture fluids, aspartic-, serine-, cysteine-, and metallo-proteases. Oxygen enrichment does not have any noticeable effects on extracellular protease activity except that the onset of protease activity appears earlier in oxygen enrichment runs. Oxygen enrichment stimulates HEWL production substantially, and we propose that it is related to fungal morphology. Thermal stress imposed by raising process temperature (from 25 to 30 and 35 degrees C) in early exponential phase, led to appearance of protease activity in the medium following the heat shock. Continued cultivation at high temperatures significantly reduced HEWL production, which was associated with increased activity of the extracellular proteases in these cultures.

  5. Teaching Foundational Topics and Scientific Skills in Biochemistry within the Conceptual Framework of HIV Protease

    ERIC Educational Resources Information Center

    Johnson, R. Jeremy

    2014-01-01

    HIV protease has served as a model protein for understanding protein structure, enzyme kinetics, structure-based drug design, and protein evolution. Inhibitors of HIV protease are also an essential part of effective HIV/AIDS treatment and have provided great societal benefits. The broad applications for HIV protease and its inhibitors make it a…

  6. Emerging technologies for protease engineering: New tools to clear out disease.

    PubMed

    Guerrero, Jennifer L; Daugherty, Patrick S; O'Malley, Michelle A

    2017-01-01

    Proteases regulate many biological processes through their ability to activate or inactive their target substrates. Because proteases catalytically turnover proteins and peptides, they present unique opportunities for use in biotechnological and therapeutic applications. However, many proteases are capable of cleaving multiple physiological substrates. Therefore their activity, expression, and localization are tightly controlled to prevent unwanted proteolysis. Currently, the use of protease therapeutics has been limited to a handful of proteases with narrow substrate specificities, which naturally limits their toxicity. Wider application of proteases is contingent upon the development of methods for engineering protease selectivity, activity, and stability. Recent advances in the development of high-throughput, bacterial and yeast-based methods for protease redesign have yielded protease variants with novel specificities, reduced toxicity, and increased resistance to inhibitors. Here, we highlight new tools for protease engineering, including methods suitable for the redesign of human secreted proteases, and future opportunities to exploit the catalytic activity of proteases for therapeutic benefit. Biotechnol. Bioeng. 2017;114: 33-38. © 2016 Wiley Periodicals, Inc.

  7. A novel serine protease inhibitor from Bungarus fasciatus venom.

    PubMed

    Lu, Jia; Yang, Hailong; Yu, Haining; Gao, Weikai; Lai, Ren; Liu, Jingze; Liang, Xingcai

    2008-03-01

    By Sephadex G-50 gel filtration, cation-exchange CM-Sephadex C-25 chromatography and reversed phase high-performance liquid chromatography (HPLC), a novel serine protease inhibitor named bungaruskunin was purified and characterized from venom of Bungarus fasciatus. Its cDNA was also cloned from the cDNA library of B. fasciatus venomous glands. The predicted precursor is composed of 83 amino acid (aa) residues including a 24-aa signal peptide and a 59-aa mature bungaruskunin. Bungaruskunin showed maximal similarity (64%) with the predicted serine protease inhibitor blackelin deduced from the cDNA sequence of the red-bellied black snake Pseudechis porphyriacus. Bungaruskunin is a Kunitz protease inhibitor with a conserved Kunitz domain and could exert inhibitory activity against trypsin, chymotrypsin, and elastase. By screening the cDNA library, two new B chains of beta-bungarotoxin are also identified. The overall structures of bungaruskunin and beta-bungarotoxin B chains are similar; especially they have highly conserved signal peptide sequences. These findings strongly suggest that snake Kunitz/BPTI protease inhibitors and neurotoxic homologs may have originated from a common ancestor.

  8. Design, synthesis, and activity of nanocellulosic protease sensors

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Here we contrast the molecular assembly, and biochemical utility of nanocellulosic materials prepared from cotton and wood as protease sensors. The cotton-based nanocellulosic substrates were prepared in a variety of ways to produce nanocrystals, films and aerogels, which were derivatized with eithe...

  9. Protease inhibitors interfere with the necessary factors of carcinogenesis.

    PubMed

    Troll, W

    1989-05-01

    Many tumor promoters are inflammatory agents that stimulate the formation of oxygen radicals (.O2-) and hydrogen peroxide (H2O2) in phagocytic neutrophils. The neutrophils use the oxygen radicals to kill bacteria, which are recognized by the cell membrane of phagocytic cells causing a signal to mount the oxygen response. The tumor promoter isolated from croton oil, 12-O-tetradecanoylphorbol-13-acetate (TPA), mimics the signal, causing an oxygen radical release that is intended to kill bacteria; instead, it injures cells in the host. Oxygen radicals cause single strand breaks in DNA and modify DNA bases. These damaging reactions appear to be related to tumor promotion, as three types of chemopreventive agents, retinoids, onion oil, and protease inhibitors, suppress the induction of oxygen radicals in phagocytic neutrophils and suppress tumor promotion in skin cancer in mice. Protease inhibitors also suppress breast and colon cancers in mice. Protease inhibitors capable of inhibiting chymotrypsin show a greater suppression of the oxygen effect and are better suppressors of tumor promotion. In addition, oxygen radicals may be one of the many agents that cause activation of oncogenes. Since retinoids and protease inhibitors suppress the expression of the ras oncogene in NIH 3T3 cells, NIH 3T3 cells may serve as a relatively facile model for finding and measuring chemopreventive agents that interfere with the carcinogenic process.

  10. Botulinum neurotoxin: a deadly protease with applications to human medicine

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Botulinum neurotoxins (BoNTs) are some of the most potent biological toxins to humans. They are synthesized by the gram-positive, spore-forming bacterium Clostridium botulinum. BoNT is secreted from the bacterium as a ~150 kDa polypeptide which is cleaved by bacterial or host proteases into a ~50 kD...

  11. Processing and targeting of the thiol protease aleurain: Progress report

    SciTech Connect

    Rogers, J.C.

    1988-01-01

    This study addresses the processing and targeting of the thiol protease aleurain in monocots. A probe derived from the aleurain cDNA specific for the 5'-most 400 bp (a region encoding the first 140 amino acids of the preprotein hybridized to at least 3 separate elements in the barley genome; only one represented the aleurain gene. In contrast, a probe specific for the remaining 2/23 of the cDNA (representing the protease domain) hybridized to only a single copy sequence. To know if this pattern pertained in other, closely related, monocots, we probed Southern blots of genomic DNA from maize, rye, oats, sorghum, and pearl millet with each probe. In each instance except for maize DNA, the 5' domain probe hybridizes to several fragments in addition to those identified by the protease domain probe. Presumable the darkest hybridization in each represents the fragment carrying the sequences homologous to barley aleurain. The fragments from a given restriction enzyme identified by the protease domain probe in sorghum, millet, and maize, were indistinguishable in size indicating that the gene sequences, as well as flanking DNA, are so well conserved among the group that the location of the hexanucleotide sequences have not diverged. (3 refs., 3 figs.)

  12. Unveiling antimicrobial peptide-generating human proteases using PROTEASIX.

    PubMed

    Bastos, Paulo; Trindade, Fábio; Ferreira, Rita; Casteleiro, Mercedes Arguello; Stevens, Robert; Klein, Julie; Vitorino, Rui

    2017-02-27

    Extracting information from peptidomics data is a major current challenge, as endogenous peptides can result from the activity of multiple enzymes. Proteolytic enzymes can display overlapping or complementary specificity. The activity spectrum of human endogenous peptide-generating proteases is not fully known. Hence, the indirect study of proteolytic enzymes through the analysis of its substrates is largely hampered. Antimicrobial peptides (AMPs) represent a primordial set of immune defense molecules generated by proteolytic cleavage of precursor proteins. These peptides can be modulated by host and microorganismal stimuli, which both dictate proteolytic enzymes' expression and activity. Peptidomics is an attractive approach to identify peptides with a biological role and to assess proteolytic activity. However, bioinformatics tools to deal with peptidomics data are lacking. PROTEASIX is an excellent choice for the prediction of AMPs-generating proteases based on the reconstitution of a substrate's cleavage sites and the crossing of such information with known proteases' specificity retrieved by several publicly available databases. Therefore, the focus of the present tutorial is to explore the potential of PROTEASIX when gather information concerning proteases involved in the generation of human AMPs and to teach the user how to make the most out of peptidomics results using PROTEASIX.

  13. Post-translational control of genetic circuits using Potyvirus proteases

    PubMed Central

    Fernandez-Rodriguez, Jesus; Voigt, Christopher A.

    2016-01-01

    Genetic engineering projects often require control over when a protein is degraded. To this end, we use a fusion between a degron and an inactivating peptide that can be added to the N-terminus of a protein. When the corresponding protease is expressed, it cleaves the peptide and the protein is degraded. Three protease:cleavage site pairs from Potyvirus are shown to be orthogonal and active in exposing degrons, releasing inhibitory domains and cleaving polyproteins. This toolbox is applied to the design of genetic circuits as a means to control regulator activity and degradation. First, we demonstrate that a gate can be constructed by constitutively expressing an inactivated repressor and having an input promoter drive the expression of the protease. It is also shown that the proteolytic release of an inhibitory domain can improve the dynamic range of a transcriptional gate (200-fold repression). Next, we design polyproteins containing multiple repressors and show that their cleavage can be used to control multiple outputs. Finally, we demonstrate that the dynamic range of an output can be improved (8-fold to 190-fold) with the addition of a protease-cleaved degron. Thus, controllable proteolysis offers a powerful tool for modulating and expanding the function of synthetic gene circuits. PMID:27298256

  14. Mast Cell Proteases as Protective and Inflammatory Mediators

    PubMed Central

    Caughey, George H.

    2014-01-01

    Proteases are the most abundant class of proteins produced by mast cells. Many of these are stored in membrane-enclosed intracellular granules until liberated by degranulating stimuli, which include cross-linking of high affinity IgE receptor FcεRI by IgE bound to multivalent allergen. Understanding and separating the functions of the proteases is important because expression differs among mast cells in different tissue locations. Differences between laboratory animals and humans in protease expression also influence the degree of confidence with which results obtained in animal models of mast cell function can be extrapolated to humans. The inflammatory potential of mast cell proteases was the first aspect of their biology to be explored and has received the most attention, in part because some of them—notably tryptases and chymases—are biomarkers of local and systemic mast cell degranulation and anaphylaxis. Although some of the proteases indeed augment allergic inflammation and are potential targets for inhibition to treat asthma and related allergic disorders, they are protective and even anti-inflammatory in some settings. For example, mast cell tryptases may protect from serious bacterial lung infections and may limit the “rubor” component of inflammation caused by vasodilating neuropeptides in the skin. Chymases help to maintain intestinal barrier function and to expel parasitic worms, and may support blood pressure during anaphylaxis by generating angiotensin II. In other life-or-death examples, carboxypeptidase A3 and other mast cell peptidases limit systemic toxicity of endogenous peptides like endothelin and neurotensin during septic peritonitis, and inactivate venom-associated peptides. On the other hand, mast cell peptidase-mediated destruction of protective cytokines, like IL-6, can enhance mortality from sepsis. Peptidases released from mast cells also influence non-mast cell proteases, such as by activating matrix metalloproteinase cascades

  15. Biochemical Aspects of a Serine Protease from Caesalpinia echinata Lam. (Brazilwood) Seeds: A Potential Tool to Access the Mobilization of Seed Storage Proteins

    PubMed Central

    Praxedes-Garcia, Priscila; Cruz-Silva, Ilana; Gozzo, Andrezza Justino; Abreu Nunes, Viviane; Torquato, Ricardo José; Tanaka, Aparecida Sadae; Figueiredo-Ribeiro, Rita de Cássia; Gonzalez, Yamile Gonzalez; Araújo, Mariana da Silva

    2012-01-01

    Several proteins have been isolated from seeds of leguminous, but this is the first report that a protease was obtained from seeds of Caesalpinia echinata Lam., a tree belonging to the Fabaceae family. This enzyme was purified to homogeneity by hydrophobic interaction and anion exchange chromatographies and gel filtration. This 61-kDa serine protease (CeSP) hydrolyses H-D-prolyl-L-phenylalanyl-L-arginine-p-nitroanilide (Km 55.7 μM) in an optimum pH of 7.1, and this activity is effectively retained until 50°C. CeSP remained stable in the presence of kosmotropic anions (PO4 3−, SO4 2−, and CH3COO−) or chaotropic cations (K+ and Na+). It is strongly inhibited by TLCK, a serine protease inhibitor, but not by E-64, EDTA or pepstatin A. The characteristics of the purified enzyme allowed us to classify it as a serine protease. The role of CeSP in the seeds cannot be assigned yet but is possible to infer that it is involved in the mobilization of seed storage proteins. PMID:22629147

  16. Heterologous expression of Cenchritis muricatus protease inhibitor II (CmPI-II) in Pichia pastoris system: Purification, isotopic labeling and preliminary characterization.

    PubMed

    Cabrera-Muñoz, Aymara; Rojas, Laritza; Gil, Dayrom F; González-González, Yamile; Mansur, Manuel; Camejo, Ayamey; Pires, José R; Alonso-Del-Rivero Antigua, Maday

    2016-10-01

    Cenchritis muricatus protease inhibitor II (CmPI-II) is a tight-binding serine protease inhibitor of the Kazal family with an atypical broad specificity, being active against several proteases such as bovine pancreatic trypsin, human neutrophil elastase and subtilisin A. CmPI-II 3D structures are necessary for understanding the molecular basis of its activity. In the present work, we describe an efficient and straightforward recombinant expression strategy, as well as a cost-effective procedure for isotope labeling for NMR structure determination purposes. The vector pCM101 containing the CmPI-II gene, under the control of Pichia pastoris AOX1 promoter was constructed. Methylotrophic Pichia pastoris strain KM71H was then transformed with the plasmid and the recombinant protein (rCmPI-II) was expressed in benchtop fermenter in unlabeled or (15)N-labeled forms using ammonium chloride ((15)N, 99%) as the sole nitrogen source. Protein purification was accomplished by sequential cation exchange chromatography in STREAMLINE DirectHST, anion exchange chromatography on Hitrap Q-Sepharose FF and gel filtration on Superdex 75 10/30, yielding high quantities of pure rCmPI-II and (15)N rCmPI-II. Recombinant proteins displayed similar functional features as compared to the natural inhibitor and NMR spectra indicated folded and homogeneously labeled samples, suitable for further studies of structure and protease-inhibitor interactions.

  17. Chikungunya virus infectivity, RNA replication and non-structural polyprotein processing depend on the nsP2 protease's active site cysteine residue.

    PubMed

    Rausalu, Kai; Utt, Age; Quirin, Tania; Varghese, Finny S; Žusinaite, Eva; Das, Pratyush Kumar; Ahola, Tero; Merits, Andres

    2016-11-15

    Chikungunya virus (CHIKV), genus Alphavirus, family Togaviridae, has a positive-stand RNA genome approximately 12 kb in length. In infected cells, the genome is translated into non-structural polyprotein P1234, an inactive precursor of the viral replicase, which is activated by cleavages carried out by the non-structural protease, nsP2. We have characterized CHIKV nsP2 using both cell-free and cell-based assays. First, we show that Cys478 residue in the active site of CHIKV nsP2 is indispensable for P1234 processing. Second, the substrate requirements of CHIKV nsP2 are quite similar to those of nsP2 of related Semliki Forest virus (SFV). Third, substitution of Ser482 residue, recently reported to contribute to the protease activity of nsP2, with Ala has almost no negative effect on the protease activity of CHIKV nsP2. Fourth, Cys478 to Ala as well as Trp479 to Ala mutations in nsP2 completely abolished RNA replication in CHIKV and SFV trans-replication systems. In contrast, trans-replicases with Ser482 to Ala mutation were similar to wild type counterparts. Fifth, Cys478 to Ala as well as Trp479 to Ala mutations in nsP2 abolished the rescue of infectious virus from CHIKV RNA transcripts while Ser482 to Ala mutation had no effect. Thus, CHIKV nsP2 is a cysteine protease.

  18. Highly efficient and easy protease-mediated protein purification.

    PubMed

    Last, Daniel; Müller, Janett; Dawood, Ayad W H; Moldenhauer, Eva J; Pavlidis, Ioannis V; Bornscheuer, Uwe T

    2016-02-01

    As both research on and application of proteins are rarely focused on the resistance towards nonspecific proteases, this property remained widely unnoticed, in particular in terms of protein purification and related fields. In the present study, diverse aspects of protease-mediated protein purification (PMPP) were explored on the basis of the complementary proteases trypsin and proteinase K as well as the model proteins green fluorescent protein (GFP) from Aequorea victoria, lipase A from Candida antarctica (CAL-A), a transaminase from Aspergillus fumigatus (AspFum), quorum quenching lactonase AiiA from Bacillus sp., and an alanine dehydrogenase from Thermus thermophilus (AlaDH). While GFP and AiiA were already known to be protease resistant, the thermostable enzymes CAL-A, AspFum, and AlaDH were selected due to the documented correlation between thermostability and protease resistance. As proof of principle for PMPP, recombinant GFP remained unaffected whereas most Escherichia coli (E. coli) host proteins were degraded by trypsin. PMPP was highly advantageous compared to the widely used heat-mediated purification of commercial CAL-A. The resistance of AspFum towards trypsin was improved by rational protein design introducing point mutation R20Q. Trypsin also served as economical and efficient substitute for site-specific endopeptidases for the removal of a His-tag fused to AiiA. Moreover, proteolysis of host enzymes with interfering properties led to a strongly improved sensitivity and accuracy of the NADH assay in E. coli cell lysate for AlaDH activity measurements. Thus, PMPP is an attractive alternative to common protein purification methods and facilitates also enzyme characterization in cell lysate.

  19. Nematicidal Bacteria Associated to Pinewood Nematode Produce Extracellular Proteases

    PubMed Central

    Francisco, Romeu; Verissimo, Paula; Santos, Susana S.; Fonseca, Luís; Abrantes, Isabel M. O.; Morais, Paula V.

    2013-01-01

    Bacteria associated with the nematode Bursaphelenchus xylophilus, a pathogen of trees and the causal agent of pine wilt disease (PWD) may play a role in the disease. In order to evaluate their role (positive or negative to the tree), strains isolated from the track of nematodes from infected Pinus pinaster trees were screened, in vitro, for their nematicidal potential. The bacterial products, from strains more active in killing nematodes, were screened in order to identify and characterize the nematicidal agent. Forty-seven strains were tested and, of these, 21 strains showed capacity to produce extracellular products with nematicidal activity. All Burkholderia strains were non-toxic. In contrast, all Serratia strains except one exhibited high toxicity. Nematodes incubated with Serratia strains showed, by SEM observation, deposits of bacteria on the nematode cuticle. The most nematicidal strain, Serratia sp. A88copa13, produced proteases in the supernatant. The use of selective inhibitors revealed that a serine protease with 70 kDa was majorly responsible for the toxicity of the supernatant. This extracellular serine protease is different phylogenetically, in size and biochemically from previously described proteases. Nematicidal assays revealed differences in nematicidal activity of the proteases to different species of Bursaphelenchus, suggesting its usefulness in a primary screen of the nematodes. This study offers the basis for further investigation of PWD and brings new insights on the role bacteria play in the defense of pine trees against B. xylophilus. Understanding all the factors involved is important in order to develop strategies to control B. xylophilus dispersion. PMID:24244546

  20. Crystal structure of Clostridium botulinum neurotoxin protease in a product-bound state: Evidence for noncanonical zinc protease activity.

    PubMed

    Segelke, Brent; Knapp, Mark; Kadkhodayan, Saloumeh; Balhorn, Rod; Rupp, Bernhard

    2004-05-04

    Clostridium botulinum neurotoxins (BoNTs), the most potent toxins known, disrupt neurotransmission through proteolysis of proteins involved in neuroexocytosis. The light chains of BoNTs are unique zinc proteases that have stringent substrate specificity and require exceptionally long substrates. We have determined the crystal structure of the protease domain from BoNT serotype A (BoNT/A). The structure reveals a homodimer in a product-bound state, with loop F242-V257 from each monomer deeply buried in its partner's catalytic site. The loop, which acts as a substrate, is oriented in reverse of the canonical direction for other zinc proteases. The Y249-Y250 peptide bond of the substrate loop is hydrolyzed, leaving the Y249 product carboxylate coordinated to the catalytic zinc. From the crystal structure of the BoNT/A protease, detailed models of noncanonical binding and proteolysis can be derived which we propose are also consistent with BoNT/A binding and proteolysis of natural substrate synaptosome-associated protein of 25 kDa (SNAP-25). The proposed BoNT/A substrate-binding mode and catalytic mechanism are markedly different from those previously proposed for the BoNT serotype B.

  1. Characterization of the Protease Activity of Detergents: Laboratory Practicals for Studying the Protease Profile and Activity of Various Commercial Detergents

    ERIC Educational Resources Information Center

    Valls, Cristina; Pujadas, Gerard; Garcia-Vallve, Santi; Mulero, Miquel

    2011-01-01

    Detergent enzymes account for about 30% of the total worldwide production of enzymes and are one of the largest and most successful applications of modern industrial biotechnology. Proteases can improve the wash performance of household, industrial, and institutional laundry detergents used to remove protein-based stains such as blood, grass, body…

  2. Proteases of Wood Rot Fungi with Emphasis on the Genus Pleurotus

    PubMed Central

    Inácio, Fabíola Dorneles; Ferreira, Roselene Oliveira; de Araujo, Caroline Aparecida Vaz; Brugnari, Tatiane; Castoldi, Rafael; Peralta, Rosane Marina; de Souza, Cristina Giatti Marques

    2015-01-01

    Proteases are present in all living organisms and they play an important role in physiological conditions. Cell growth and death, blood clotting, and immune defense are all examples of the importance of proteases in maintaining homeostasis. There is growing interest in proteases due to their use for industrial purposes. The search for proteases with specific characteristics is designed to reduce production costs and to find suitable properties for certain industrial sectors, as well as good producing organisms. Ninety percent of commercialized proteases are obtained from microbial sources and proteases from macromycetes have recently gained prominence in the search for new enzymes with specific characteristics. The production of proteases from saprophytic basidiomycetes has led to the identification of various classes of proteases. The genus Pleurotus has been extensively studied because of its ligninolytic enzymes. The characteristics of this genus are easy cultivation techniques, high yield, low nutrient requirements, and excellent adaptation. There are few studies in the literature about proteases of Pleurotus spp. This review gathers together information about proteases, especially those derived from basidiomycetes, and aims at stimulating further research about fungal proteases because of their physiological importance and their application in various industries such as biotechnology and medicine. PMID:26180792

  3. Identification and characterization of a chymotrypsin-like serine protease from periodontal pathogen, Tannerella forsythia.

    PubMed

    Hockensmith, K; Dillard, K; Sanders, B; Harville, B A

    2016-11-01

    Tannerella forsythia is a bacteria associated with severe periodontal disease. This study reports identification and characterization of a membrane-associated serine protease from T. forsythia. The protease was isolated from T. forsythia membrane fractions and shown to cleave both gelatin and type I collagen. The protease was able to cleave both substrates over a wide range of pH values, however optimal cleavage occurred at pH 7.5 for gelatin and 8.0 for type I collagen. The protease was also shown to cleave both gelatin and type I collagen at the average reported temperature for the gingival sulcus however it showed a lack of thermal stability with a complete loss of activity by 60 °C. When treated with protease inhibitors the enzyme's activity could only be completely inhibited by serine protease inhibitors antipain and phenylmethanesulfonyl fluoride (PMSF). Further characterization of the protease utilized serine protease synthetic peptides. The protease cleaved N-succinyl-Ala-Ala-Pro-Phe p-nitroanilide but not Nα-benzoyl-dl-arginine p-nitroanilide (BAPNA) or N-methoxysuccinyl-Ala-Ala-Pro-Val p-nitroanilide indicating that the protease is a chymotrypsin-like serine protease. Since type I collagen is a major component in the gingival tissues and periodontal ligament, identification and characterization of this enzyme provides important information regarding the role of T. forsythia in periodontal disease.

  4. Fungal fermentation of whey incorporated with certain supplements for the production of proteases.

    PubMed

    Ashour, S A; el-Shora, H M; Metwally, M; Habib, S A

    1996-01-01

    The pattern and the extent of formation of proteases and secretion varied with the fungus, age and/or the nature of the co-supplement. Addition of yeast extract induced the best yield of proteases from both Aspergillus niger and A. terreus. Proteases from A. niger were highly induced by glutamic acid, alanine or albumin, with minor differences, whereas gelatin, peptone, aspartic acid, casein or acetamide stimulated the accumulation of proteases in the culture medium of A. terreus. Galactose stimulated the yield of the enzyme particularly with A. terreus while most C-supplements inhibited such processes, more prominently in the presence of cellulose or starch. Incorporation of nicotinic acid and wheat bran initiated the maximum productivity of proteases from A. niger and A. terreus, respectively. Co+2 and Cu+2 highly stimulated the output of proteases from A. niger and A. terreus, respectively. Co+2 and Ca+2 stimulated the enzyme activity of alkaline and acid proteases from A. terreus and acid proteases from A. niger. The other six cations and DTT inhibited variably the three proteases particularly alkaline proteases from A. terreus indicating that proteases from various sources even from closely related species showed different properties.

  5. Purification and biochemical characterization of an alkaline protease from marine bacteria Pseudoalteromonas sp. 129-1.

    PubMed

    Wu, Shimei; Liu, Ge; Zhang, Dechao; Li, Chaoxu; Sun, Chaomin

    2015-12-01

    An extracellular alkaline protease produced by marine bacteria strain Pseudoalteromonas sp. 129-1 was purified by ammonium sulphate precipitation, anion exchange chromatography, and gel filtration. The purity of the protease was confirmed by SDS-PAGE and molecular mass was estimated to be 35 kDa. The protease maintained considerable activity and stability at a wide temperature range of 10-60 °C and pH range of 6-11, and optimum activity was detected at temperature of 50 °C and pH of 8. Metallo-protease inhibitor, EDTA, had no inhibitory effect on protease activity even at concentration up to 15 mM, whereas 15 mM PMSF, a common serine protease inhibitor, greatly inactivated the protease. The high stability of the protease in the presence of surfactants (SDS, Tween 80, and Triton X-100), oxidizing agent H(2)O(2), and commercial detergents was observed. Moreover, the protease was tolerant to most of the tested organic solvents, and saline tolerant up to 30%. Interestingly, biofilm of Pseudomonas aeruginosa PAO1 was greatly reduced by 0.01 mg ml(-1) of the protease, and nearly completely abolished with the concentration of 1 mg ml(-1). Collectively, the protease showed valuable feathers as an additive in laundry detergent and non-toxic anti-biofilm agent.

  6. Copper inhibits the HIV-1 protease by both oxygen-dependent and oxygen-independent mechanisms

    SciTech Connect

    Karlstroem, A.R.; Levine, R.L. )

    1991-03-11

    The protease encoded by HIV-1 is essential for the processing of the viral polyproteins encoded by the gag and pol genes into mature viral proteins. Mutation or deletion of the protease gene blocks replication of the virus, making the protease an attractive target for antiviral therapy. The authors found that the HIV-1 protease is inhibited by micromolar concentrations of Cu{sup 2+}. Protease was 50% inhibited by exposure to 5 {mu}M copper for 5 min while exposure to 25 {mu}M caused complete inhibition. This inhibition was not oxygen-dependent and was not reversed by treatment with EDTA, presumably due to the slow off-rate of copper from the protease. Consistent with this interpretation, enzyme activity was recovered after denaturation and refolding of the copper exposed protease. Titration of the inactivated enzyme with Ellman's reagent demonstrated a loss of one of the two sulfhydryl groups present in the molecule, suggesting that copper inhibition was mediated through binding to a cysteine. This was confirmed in studies with a chemically synthesize, mutant protease in which the two cysteine residues were replaced by {alpha}-amino butyrate: The mutant protease was not inhibited by copper. However, both the wild-type and mutant protease were inactivated when exposed to copper, oxygen, and dithiothreitol. This inactivation required oxygen. Thus, the protease can also be inactivated by metal catalyzed oxidation (MCO), a presumably irreversible covalent modification.

  7. Development of marine biotechnology as a resource for novel proteases and their role in modern biotechnology.

    PubMed

    Homaei, Ahmad; Lavajoo, Fatemeh; Sariri, Reyhaneh

    2016-07-01

    Marine environment consists of the largest sources diversified genetic pool of material with an enormous potential for a wide variety of enzymes including proteases. A protease hydrolyzes the peptide bond and most of proteases possess many industrial applications. Marine proteases differ considerably from those found in internal or external organs of invertebrates and vertebrates. In common with all enzymes, external factors such as temperature, pH and type of media are important for the activity, catalytic efficiency, stability and proper functioning of proteases. In this review valuable characteristics of proteases in marine organisms and their applications are gathered from a wide literature survey. Considering their biochemical significance and their increasing importance in biotechnology, a thorough understanding of marine proteases functioning could be of prime importance.

  8. Production of plant proteases in vivo and in vitro--a review.

    PubMed

    González-Rábade, Nuria; Badillo-Corona, Jesús Agustín; Aranda-Barradas, Juan Silvestre; Oliver-Salvador, María Del Carmen

    2011-01-01

    In the latest two decades, the interest received by plant proteases has increased significantly. Plant enzymes such as proteases are widely used in medicine and the food industry. Some proteases, like papain, bromelain and ficin are used in various processes such as brewing, meat softening, milk-clotting, cancer treatment, digestion and viral disorders. These enzymes can be obtained from their natural source or through in vitro cultures, in order to ensure a continuous source of plant enzymes. The focus of this review will be the production of plant proteases both in vivo and in vitro, with particular emphasis on the different types of commercially important plant proteases that have been isolated and characterized from naturally grown plants. In vitro approaches for the production of these proteases is also explored, focusing on the techniques that do not involve genetic transformation of the plants and the attempts that have been made in order to enhance the yield of the desired proteases.

  9. Robust substrate profiling method reveals striking differences in specificities of serum and lung fluid proteases.

    PubMed

    Watson, Douglas S; Jambunathan, Kalyani; Askew, David S; Kodukula, Krishna; Galande, Amit K

    2011-08-01

    Proteases are candidate biomarkers and therapeutic targets for many diseases. Sensitive and robust techniques are needed to quantify proteolytic activities within the complex biological milieu. We hypothesized that a combinatorial protease substrate library could be used effectively to identify similarities and differences between serum and bronchoalveolar lavage fluid (BALF), two body fluids that are clinically important for developing targeted therapies and diagnostics. We used a concise library of fluorogenic probes to map the protease substrate specificities of serum and BALF from guinea pigs. Differences in the proteolytic fingerprints of the two fluids were striking: serum proteases cleaved substrates containing cationic residues and proline, whereas BALF proteases cleaved substrates containing aliphatic and aromatic residues. Notably, cleavage of proline-containing substrates dominated all other protease activities in both human and guinea pig serum. This substrate profiling approach provides a foundation for quantitative comparisons of protease specificities between complex biological samples.

  10. [Development of agonists/antagonists for protease-activated receptors (PARs) and the possible therapeutic application to gastrointestinal diseases].

    PubMed

    Sekiguchi, Fumiko

    2005-06-01

    Protease-activated receptors (PARs), a family of G-protein-coupled seven-transmembrane-domain receptors, are activated by proteolytic unmasking of the N-terminal cryptic tethered ligand by certain serine proteases. Among four PAR family members cloned to date, PAR-1, PAR-2, and PAR-4 can also be activated through a non-enzymatic mechanism, which is achieved by direct binding of exogenously applied synthetic peptides based on the tethered ligand sequence, known as PARs-activating peptides, to the body of the receptor. Various peptide mimetics have been synthesized as agonists for PARs with improved potency, selectivity, and stability. Some peptide mimetics and/or nonpeptide compounds have also been developed as antagonists for PAR-1 and PAR-4. PARs are widely distributed in the mammalian body, especially throughout the alimentary systems, and play various roles in physiological/pathophysiological conditions, i.e., modulation of salivary, gastric, or pancreatic glandular exocrine secretion, gastrointestinal smooth muscle motility, gastric mucosal cytoprotection, suppression/facilitation of visceral pain and inflammation, etc. Thus PARs are now considered novel therapeutic targets, and development of selective agonists and/or antagonists for PARs might provide a novel strategy for the treatment of various diseases that are resistant to current therapeutics.

  11. Roles within the Family

    MedlinePlus

    ... Family Life Family Life Family Life Medical Home Family Dynamics Media Work & Play Getting Involved in Your Community ... AAP Find a Pediatrician Family Life Medical Home Family Dynamics Adoption & Foster Care Communication & Discipline Types of Families ...

  12. Improving Family Communications

    MedlinePlus

    ... Family Life Family Life Family Life Medical Home Family Dynamics Media Work & Play Getting Involved in Your Community ... AAP Find a Pediatrician Family Life Medical Home Family Dynamics Adoption & Foster Care Communication & Discipline Types of Families ...

  13. A novel carboxyl-terminal protease derived from Paenibacillus lautus CHN26 exhibiting high activities at multiple sites of substrates

    PubMed Central

    2013-01-01

    Background Carboxyl-terminal protease (CtpA) plays essential functions in posttranslational protein processing in prokaryotic and eukaryotic cells. To date, only a few bacterial ctpA genes have been characterized. Here we cloned and characterized a novel CtpA. The encoding gene, ctpAp (ctpA of Paenibacillus lautus), was derived from P. lautus CHN26, a Gram-positive bacterium isolated by functional screening. Recombinant protein was obtained from protein over-expression in Escherichia coli and the biochemical properties of the enzyme were investigated. Results Screening of environmental sediment samples with a skim milk-containing medium led to the isolation of a P. lautus CHN26 strain that exhibited a high proteolytic activity. A gene encoding a carboxyl-terminal protease (ctpAp) was cloned from the isolate and characterized. The deduced mature protein contains 466 aa with a calculated molecular mass of 51.94 kDa, displaying 29-38% amino acid sequence identity to characterized bacterial CtpA enzymes. CtpAp contains an unusual catalytic dyad (Ser309-Lys334) and a PDZ substrate-binding motif, characteristic for carboxyl-terminal proteases. CtpAp was expressed as a recombinant protein and characterized. The purified enzyme showed an endopeptidase activity, which effectively cleaved α S1- and β- casein substrates at carboxyl-terminus as well as at multiple internal sites. Furthermore, CtpAp exhibited a high activity at room temperature and strong tolerance to conventional protease inhibitors, demonstrating that CtpAp is a novel endopeptidase. Conclusions Our work on CtpA represents the first investigation of a member of Family II CtpA enzymes. The gene was derived from a newly isolated P. lautus CHN26 strain exhibiting a high protease activity in the skim milk assay. We have demonstrated that CtpAp is a novel endopeptidase with distinct cleavage specificities, showing a strong potential in biotechnology and industry applications. PMID:24161150

  14. Family Life.

    ERIC Educational Resources Information Center

    Naturescope, 1986

    1986-01-01

    Focuses on various aspects of mammal family life ranging from ways different species are born to how different mammals are raised. Learning activities include making butter from cream, creating birth announcements for mammals, and playing a password game on family life. (ML)

  15. Family Reunification

    ERIC Educational Resources Information Center

    Wulczyn, Fred

    2004-01-01

    Reunifying children placed in foster care with their birth parents is a primary goal of the child welfare system. Yet, relatively little is known about the reunification process. This article analyzes new data on trends in family reunification and discovers: (1) Although most children still exit foster care through family reunification, exit…

  16. Family Empowerment.

    ERIC Educational Resources Information Center

    Sinclair, Mary F., Ed.; And Others

    1992-01-01

    This feature issue of IMPACT focuses on the empowerment of families with a member who has a developmental disability. It presents strategies and models for a collaborative, respectful approach to service provision, and presents the experiences of families in seeking support and assistance. Feature articles include "Two Generations of…

  17. Family Workshops

    ERIC Educational Resources Information Center

    Bennett, Dave; Rees-Jones, Tanny

    1978-01-01

    A Family Workshop is an informal, multidisciplined educational program for adults and children, organized by a team of teachers. This article discusses the Lavender Hill Family Workshop, one of many, which attempts to provide education in various subject areas for adults and for children while also integrating both objectives in order to educate…

  18. Family, Extended

    ERIC Educational Resources Information Center

    Patton, Jessica Rae

    2006-01-01

    Parents are a child's first and most influential teacher. People hear this truism often, yet nowhere has the author seen it more taken to heart than at Tower Street Elementary School. The school's efforts to form a true partnership with students' families--from involving families in the first day of school, to the principal making home visits, to…

  19. Family Potyviridae

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The International Committee on the Taxonomy of Viruses potyvirus study group has revised the description of the family Potyviridae for inclusion in the ICTV 9th report. Characteristic features of each genus within the family is presented. Revised criteria for demarcation and nomenclature of viral sp...

  20. IL-33-mediated innate response and adaptive immune cells contribute to maximum responses of protease allergen-induced allergic airway inflammation.

    PubMed

    Kamijo, Seiji; Takeda, Haruna; Tokura, Tomoko; Suzuki, Mayu; Inui, Kyoko; Hara, Mutsuko; Matsuda, Hironori; Matsuda, Akira; Oboki, Keisuke; Ohno, Tatsukuni; Saito, Hirohisa; Nakae, Susumu; Sudo, Katsuko; Suto, Hajime; Ichikawa, Saori; Ogawa, Hideoki; Okumura, Ko; Takai, Toshiro

    2013-05-01

    How the innate and adaptive immune systems cooperate in the natural history of allergic diseases has been largely unknown. Plant-derived allergen, papain, and mite allergens, Der f 1 and Der p 1, belong to the same family of cysteine proteases. We examined the role of protease allergens in the induction of Ab production and airway inflammation after repeated intranasal administration without adjuvants and that in basophil/mast cell stimulation in vitro. Papain induced papain-specific IgE/IgG1 and lung eosinophilia. Der f 1 induced Der f 1-specific IgG1 and eosinophilia. Although papain-, Der f 1-, and Der p 1-stimulated basophils expressed allergy-inducing cytokines, including IL-4 in vitro, basophil-depleting Ab and mast cell deficiency did not suppress the papain-induced in vivo responses. Protease inhibitor-treated allergens and a catalytic site mutant did not induce the responses. These results indicate that protease activity is essential to Ab production and eosinophilia in vivo and basophil activation in vitro. IL-33-deficient mice lacked eosinophilia and had reduced papain-specific IgE/IgG1. Coadministration of OVA with papain induced OVA-specific IgE/IgG1, which was reduced in IL-33-deficient mice. We demonstrated IL-33 release, subsequent IL-33-dependent IL-5/IL-13 release, and activation of T1/ST2-expressing lineage(-)CD25(+)CD44(+) innate lymphoid cells in the lung after papain inhalation, suggesting the contribution of the IL-33-type 2 innate lymphoid cell-IL-5/IL-13 axis to the papain-induced airway eosinophilia. Rag2-deficient mice, which lack adaptive immune cells, showed significant, but less severe, eosinophilia. Collectively, these results suggest cooperation of adaptive immune cells and IL-33-responsive innate cells in protease-dependent allergic airway inflammation.

  1. The subtilisin-like protease SBT3 contributes to insect resistance in tomato

    PubMed Central

    Meyer, Michael; Huttenlocher, Franziska; Cedzich, Anna; Procopio, Susanne; Stroeder, Jasper; Pau-Roblot, Corinne; Lequart-Pillon, Michelle; Pelloux, Jérôme; Stintzi, Annick; Schaller, Andreas

    2016-01-01

    Subtilisin-like proteases (SBTs) constitute a large family of extracellular plant proteases, the function of which is still largely unknown. In tomato plants, the expression of SBT3 was found to be induced in response to wounding and insect attack in injured leaves but not in healthy systemic tissues. The time course of SBT3 induction resembled that of proteinase inhibitor II and other late wound response genes suggesting a role for SBT3 in herbivore defense. Consistent with such a role, larvae of the specialist herbivore Manduca sexta performed better on transgenic plants silenced for SBT3 expression (SBT3-SI). Supporting a contribution of SBT3 to systemic wound signaling, systemic induction of late wound response genes was attenuated in SBT3-SI plants. The partial loss of insect resistance may thus be explained by a reduction in systemic defense gene expression. Alternatively, SBT3 may play a post-ingestive role in plant defense. Similar to other anti-nutritive proteins, SBT3 was found to be stable and active in the insect’s digestive system, where it may act on unidentified proteins of insect or plant origin. Finally, a reduction in the level of pectin methylesterification that was observed in transgenic plants with altered levels of SBT3 expression suggested an involvement of SBT3 in the regulation of pectin methylesterases (PMEs). While such a role has been described in other systems, PME activity and the degree of pectin methylesterification did not correlate with the level of insect resistance in SBT3-SI and SBT3 overexpressing plants and are thus unrelated to the observed resistance phenotype. PMID:27259555

  2. Structure of the N-terminal fragment of Escherichia coli Lon protease

    SciTech Connect

    Li, Mi; Gustchina, Alla; Rasulova, Fatima S.; Melnikov, Edward E.; Maurizi, Michael R.; Rotanova, Tatyana V.; Dauter, Zbigniew; Wlodawer, Alexander

    2010-08-01

    The medium-resolution structure of the N-terminal fragment of E. coli Lon protease shows that this part of the enzyme consists of two compact domains and a very long α-helix. The structure of a recombinant construct consisting of residues 1–245 of Escherichia coli Lon protease, the prototypical member of the A-type Lon family, is reported. This construct encompasses all or most of the N-terminal domain of the enzyme. The structure was solved by SeMet SAD to 2.6 Å resolution utilizing trigonal crystals that contained one molecule in the asymmetric unit. The molecule consists of two compact subdomains and a very long C-terminal α-helix. The structure of the first subdomain (residues 1–117), which consists mostly of β-strands, is similar to that of the shorter fragment previously expressed and crystallized, whereas the second subdomain is almost entirely helical. The fold and spatial relationship of the two subdomains, with the exception of the C-terminal helix, closely resemble the structure of BPP1347, a 203-amino-acid protein of unknown function from Bordetella parapertussis, and more distantly several other proteins. It was not possible to refine the structure to satisfactory convergence; however, since almost all of the Se atoms could be located on the basis of their anomalous scattering the correctness of the overall structure is not in question. The structure reported here was also compared with the structures of the putative substrate-binding domains of several proteins, showing topological similarities that should help in defining the binding sites used by Lon substrates.

  3. Characterization of a papain-like cysteine protease essential for the survival of Babesia ovis merozoites.

    PubMed

    Carletti, Tamara; Barreto, Carmo; Mesplet, Maria; Mira, Anabela; Weir, William; Shiels, Brian; Oliva, Abel Gonzalez; Schnittger, Leonhard; Florin-Christensen, Monica

    2016-02-01

    Babesia ovis, a tick-transmitted intraerythrocytic protozoan parasite, causes severe infections in small ruminants from Southern Europe, Middle East, and Northern Africa. With the aim of finding potential targets for the development of control methods against this parasite, sequence analysis of its genome led to the identification of four putative cysteine proteases of the C1A family. Orthology between B. ovis, B. bovis, T. annulata, and T. parva sequences showed that each B. ovis C1A peptidase sequence clustered within one of the four ortholog groups previously reported for these piroplasmids. The ortholog of bovipain-2 of B. bovis and falcipain-2 of Plasmodium falciparum, respectively, was designated "ovipain-2" and further characterized. In silico analysis showed that ovipain-2 has the typical topology of papain-like cysteine peptidases and a highly similar predicted three dimensional structure to bovipain-2 and falcipain-2, suggesting susceptibility to similar inhibitors. Immunoblotting using antibodies raised against a recombinant form of ovipain-2 (r-ovipain-2) demonstrated expression of ovipain-2 in in vitro cultured B. ovis merozoites. By immunofluorescence, these antibodies reacted with merozoites and stained the cytoplasm of infected erythrocytes. This suggests that ovipain-2 is secreted by the parasite and could be involved in intra- and extracellular digestion of hemoglobin and/or cleavage of erythrocyte proteins facilitating parasite egress. A significant reduction in the percentage of parasitized erythrocytes was obtained upon incubation of B. ovis in vitro cultures with anti-r-ovipain-2 antibodies, indicating an important functional role for ovipain-2 in the intra erythrocytic development cycle of this parasite. Finally, studies of the reactivity of sera from B. ovis-positive and negative sheep against r-ovipain-2 showed that this protease is expressed in vivo, and can be recognized by host antibodies. The results of this study suggest that ovipain-2

  4. Serine Protease-mediated Host Invasion by the Parasitic Nematode Steinernema carpocapsae*

    PubMed Central

    Toubarro, Duarte; Lucena-Robles, Miguel; Nascimento, Gisela; Santos, Romana; Montiel, Rafael; Veríssimo, Paula; Pires, Euclides; Faro, Carlos; Coelho, Ana V.; Simões, Nelson

    2010-01-01

    Steinernema carpocapsae is an insect parasitic nematode used in biological control, which infects insects penetrating by mouth and anus and invading the hemocoelium through the midgut wall. Invasion has been described as a key factor in nematode virulence and suggested to be mediated by proteases. A serine protease cDNA from the parasitic stage was sequenced (sc-sp-1); the recombinant protein was produced in an Escherichia coli system, and a native protein was purified from the secreted products. Both proteins were confirmed by mass spectrometry to be encoded by the sc-sp-1 gene. Sc-SP-1 has a pI of 8.7, a molecular mass of 27.3 kDa, a catalytic efficiency of 22.2 × 104 s−1 m−1 against N-succinyl-Ala-Ala-Pro-Phe-pNA, and is inhibited by chymostatin (IC 0.07) and PMSF (IC 0.73). Sc-SP-1 belongs to the chymotrypsin family, based on sequence and biochemical analysis. Only the nematode parasitic stage expressed sc-sp-1. These nematodes in the midgut lumen, prepared to invade the insect hemocoelium, expressed higher levels than those already in the hemocoelium. Moreover, parasitic nematode sense insect peritrophic membrane and hemolymph more quickly than they do other tissues, which initiates sc-sp-1 expression. Ex vivo, Sc-SP-1 was able to bind to insect midgut epithelium and to cause cell detachment from basal lamina. In vitro, Sc-SP-1 formed holes in an artificial membrane model (Matrigel), whereas Sc-SP-1 treated with PMSF did not, very likely because it hydrolyzes matrix glycoproteins. These findings highlight the S. carpocapsae-invasive process that is a key step in the parasitism thus opening new perspectives for improving nematode virulence to use in biological control. PMID:20656686

  5. Protease Substrate Profiling by N-Terminal COFRADIC.

    PubMed

    Staes, An; Van Damme, Petra; Timmerman, Evy; Ruttens, Bart; Stes, Elisabeth; Gevaert, Kris; Impens, Francis

    2017-01-01

    Detection of (neo-)N-terminal peptides is essential for identifying protease cleavage sites . We here present an update of a well-established and efficient selection method for enriching N-terminal peptides out of peptide mixtures: N-terminal COFRADIC (COmbined FRActional DIagonal Chromatography). This method is based on the old concept of diagonal chromatography, which involves a peptide modification step in between otherwise identical chromatographic separations, with this modification step finally allowing for the isolation of N-terminal peptides by longer retention of non-N-terminal peptides on the resin. N-terminal COFRADIC has been successfully applied in many protease-centric studies, as well as for studies on protein alpha-N-acetylation and on characterizing alternative translation initiation events.

  6. Acquisition of accurate data from intramolecular quenched fluorescence protease assays.

    PubMed

    Arachea, Buenafe T; Wiener, Michael C

    2017-04-01

    The Intramolecular Quenched Fluorescence (IQF) protease assay utilizes peptide substrates containing donor-quencher pairs that flank the scissile bond. Following protease cleavage, the dequenched donor emission of the product is subsequently measured. Inspection of the IQF literature indicates that rigorous treatment of systematic errors in observed fluorescence arising from inner-filter absorbance (IF) and non-specific intermolecular quenching (NSQ) is incompletely performed. As substrate and product concentrations vary during the time-course of enzyme activity, iterative solution of the kinetic rate equations is, generally, required to obtain the proper time-dependent correction to the initial velocity fluorescence data. Here, we demonstrate that, if the IQF assay is performed under conditions where IF and NSQ are approximately constant during the measurement of initial velocity for a given initial substrate concentration, then a simple correction as a function of initial substrate concentration can be derived and utilized to obtain accurate initial velocity data for analysis.

  7. A high molecular weight protease in liver cytosol.

    PubMed

    Rose, I A; Warms, J V; Hershko, A

    1979-09-10

    A high molecular weight (greater than 400,000) protease active with [3H]leucine-labeled globin has been found in the postmicrosomal fraction of mouse kidney, brain, heart, spleen, and tumor cells and is most active in liver. The presence in liver was unexpected because liver cytosol is very ineffective in the breakdown of endogenous, labeled proteins. The enzyme has a number of properties that distinguish it from known cathepsins in addition to its high molecular weight. It is most active at pH approximately 7.5. When purified, it is unstable above 20 degrees C and is stabilized by metal chelating agents such as citrate, creatine-P, and glycerate-3-P. It is an -SH protease, but its thermal instability is not affected by 1 mM dithiothreitol. The enzyme is not lysosomal.

  8. Cold Denaturation of the HIV-1 Protease Monomer.

    PubMed

    Rösner, Heike I; Caldarini, Martina; Prestel, Andreas; Vanoni, Maria A; Broglia, Ricardo A; Aliverti, Alessandro; Tiana, Guido; Kragelund, Birthe B

    2017-02-28

    The human immunodeficiency virus-1 (HIV-1) protease is a complex protein that in its active form adopts a homodimer dominated by β-sheet structures. We have discovered a cold-denatured state of the monomeric subunit of HIV-1 protease that is populated above 0 °C and therefore directly accessible to various spectroscopic approaches. Using nuclear magnetic resonance secondary chemical shifts, temperature coefficients, and protein dynamics, we suggest that the cold-denatured state populates a compact wet globule containing transient non-native-like α-helical elements. From the linearity of the temperature coefficients and the hydrodynamic radii, we propose that the overall architecture of the cold-denatured state is maintained over the temperature range studied.

  9. Neural ECM proteases in learning and synaptic plasticity.

    PubMed

    Tsilibary, Effie; Tzinia, Athina; Radenovic, Lidija; Stamenkovic, Vera; Lebitko, Tomasz; Mucha, Mariusz; Pawlak, Robert; Frischknecht, Renato; Kaczmarek, Leszek

    2014-01-01

    Recent studies implicate extracellular proteases in synaptic plasticity, learning, and memory. The data are especially strong for such serine proteases as thrombin, tissue plasminogen activator, neurotrypsin, and neuropsin as well as matrix metalloproteinases, MMP-9 in particular. The role of those enzymes in the aforementioned phenomena is supported by the experimental results on the expression patterns (at the gene expression and protein and enzymatic activity levels) and functional studies, including knockout mice, specific inhibitors, etc. Counterintuitively, the studies have shown that the extracellular proteolysis is not responsible mainly for an overall degradation of the extracellular matrix (ECM) and loosening perisynaptic structures, but rather allows for releasing signaling molecules from the ECM, transsynaptic proteins, and latent form of growth factors. Notably, there are also indications implying those enzymes in the major neuropsychiatric disorders, probably by contributing to synaptic aberrations underlying such diseases as schizophrenia, bipolar, autism spectrum disorders, and drug addiction.

  10. Intestinal proteases of free-living and parasitic astigmatid mites.

    PubMed

    Holt, Deborah C; Burgess, Stewart T G; Reynolds, Simone L; Mahmood, Wajahat; Fischer, Katja

    2013-02-01

    Among arthropod pests, mites are responsible for considerable damage to crops, humans and other animals. However, detailed physiological data on these organisms remain sparse, mainly because of their small size but possibly also because of their extreme diversity. Focusing on intestinal proteases, we draw together information from three distinct mite species that all feed on skin but have separately adapted to a free-living, a strictly ecto-parasitic and a parasitic lifestyle. A wide range of studies involving immunohistology, molecular biology, X-ray crystallography and enzyme biochemistry of mite gut proteases suggests that these creatures have diverged considerably as house dust mites, sheep scab mites and scabies mites. Each species has evolved a particular variation of a presumably ancestral repertoire of digestive enzymes that have become specifically adapted to their individual environmental requirements.

  11. Mitochondrial proteases and protein quality control in ageing and longevity.

    PubMed

    Hamon, Marie-Paule; Bulteau, Anne-Laure; Friguet, Bertrand

    2015-09-01

    Mitochondria have been implicated in the ageing process and the lifespan modulation of model organisms. Mitochondria are the main providers of energy in eukaryotic cells but also represent both a major source of reactive oxygen species and targets for protein oxidative damage. Since protein damage can impair mitochondrial function, mitochondrial proteases are critically important for protein maintenance and elimination of oxidized protein. In the mitochondrial matrix, protein quality control is mainly achieved by the Lon and Clp proteases which are also key players in damaged mitochondrial proteins degradation. Accumulation of damaged macromolecules resulting from oxidative stress and failure of protein maintenance constitutes a hallmark of cellular and organismal ageing and is believed to participate to the age-related decline of cellular function. Hence, age-related impairment of mitochondrial protein quality control may therefore contribute to the age-associated build-up of oxidized protein and alterations of mitochondrial redox and protein homeostasis.

  12. Cockroach induces inflammatory responses through protease-dependent pathways.

    PubMed

    Wada, Kota; Matsuwaki, Yoshinori; Moriyama, Hiroshi; Kita, Hirohito

    2011-01-01

    Exposure to cockroaches is a major risk factor for asthma. Products from cockroaches may contain proteases and ligands for pattern recognition receptors. These molecules may activate airway inflammatory cells, such as eosinophils, that are involved in asthma. Among inner-city children, cockroach allergens play an especially important role in increasing asthma morbidity. The molecular mechanism for this association between cockroach exposure and asthma is not fully understood. Enzymatic activities from cockroaches activate inflammatory cells in the airways and may also exacerbate certain human airway diseases, such as asthma. We recently reported that cockroach extracts contain pepstatin A-sensitive proteases that activate PAR-2 and induce activation and degranulation of human eosinophils. This review focuses on the effects of cockroach on various inflammatory cells, including eosinophils, epithelial cells, fibroblasts, dendritic cells, and T cells, in allergic reactions.

  13. Design and Validation of Novel Chikungunya Virus Protease Inhibitors.

    PubMed

    Das, Pratyush Kumar; Puusepp, Laura; Varghese, Finny S; Utt, Age; Ahola, Tero; Kananovich, Dzmitry G; Lopp, Margus; Merits, Andres; Karelson, Mati

    2016-12-01

    Chikungunya virus (CHIKV; genus Alphavirus) is the causative agent of chikungunya fever. CHIKV replication can be inhibited by some broad-spectrum antiviral compounds; in contrast, there is very little information about compounds specifically inhibiting the enzymatic activities of CHIKV replication proteins. These proteins are translated in the form of a nonstructural (ns) P1234 polyprotein precursor from the CHIKV positive-strand RNA genome. Active forms of replicase enzymes are generated using the autoproteolytic activity of nsP2. The available three-dimensional (3D) structure of nsP2 protease has made it a target for in silico drug design; however, there is thus far little evidence that the designed compounds indeed inhibit the protease activity of nsP2 and/or suppress CHIKV replication. In this study, a set of 12 compounds, predicted to interact with the active center of nsP2 protease, was designed using target-based modeling. The majority of these compounds were shown to inhibit the ability of nsP2 to process recombinant protein and synthetic peptide substrates. Furthermore, all compounds found to be active in these cell-free assays also suppressed CHIKV replication in cell culture, the 50% effective concentration (EC50) of the most potent inhibitor being ∼1.5 μM. Analysis of stereoisomers of one compound revealed that inhibition of both the nsP2 protease activity and CHIKV replication depended on the conformation of the inhibitor. Combining the data obtained from different assays also indicates that some of the analyzed compounds may suppress CHIKV replication using more than one mechanism.

  14. Botulinum neurotoxin A protease: discovery of natural product exosite inhibitors.

    PubMed

    Silhár, Peter; Capková, Katerina; Salzameda, Nicholas T; Barbieri, Joseph T; Hixon, Mark S; Janda, Kim D

    2010-03-10

    A new mechanistic class of BoNT/A zinc metalloprotease inhibitors, from Echinacea, exemplified by the natural product d-chicoric acid (I1) is disclosed. A detailed evaluation of chicoric acid's mechanism of inhibition reveals that the inhibitor binds to an exosite, displays noncompetitive partial inhibition, and is synergistic with a competitive active site inhibitor when used in combination. Other components found in Echinacea, I3 and I4, were also inhibitors of the protease.

  15. Epsilon substituted lysinol derivatives as HIV-1 protease inhibitors.

    PubMed

    Jones, Kristen L G; Holloway, M Katharine; Su, Hua-Poo; Carroll, Steven S; Burlein, Christine; Touch, Sinoeun; DiStefano, Daniel J; Sanchez, Rosa I; Williams, Theresa M; Vacca, Joseph P; Coburn, Craig A

    2010-07-15

    A series of HIV-1 protease inhibitors containing an epsilon substituted lysinol backbone was synthesized. Two novel synthetic routes using N-boc-L-glutamic acid alpha-benzyl ester and 2,6-diaminopimelic acid were developed. Incorporation of this epsilon substituent enabled access to the S2 pocket of the enzyme, affording high potency inhibitors. Modeling studies and synthetic efforts suggest the potency increase is due to both conformational bias and van der Waals interactions with the S2 pocket.

  16. Family Health and Family Planning.

    ERIC Educational Resources Information Center

    World Health Organization, Copenhagen (Denmark). Regional Office for Europe.

    This document is made up of a selection of some of the papers distributed to participants in courses on "Family Health and Family Planning" which have been organized each year since 1973 by the International Children's Center and the World Health Organization Regional Office for Europe. Six courses, held between 1973 and 1978, brought together a…

  17. Enhanced Thermostability of a Fungal Alkaline Protease by Different Additives

    PubMed Central

    Nirmal, Nilesh P.; Laxman, R. Seeta

    2014-01-01

    A fungal strain (Conidiobolus brefeldianus MTCC 5184) isolated from plant detritus secreted a high activity alkaline protease. Thermostability studies of the fungal alkaline protease (FAP) revealed that the protease is stable up to 50°C with 40% residual activity after one hour. Effect of various additives such as sugars, sugar alcohols, polyols, and salts, on the thermostability of FAP was evaluated. Among the additives tested, glycerol, mannitol, xylitol, sorbitol, and trehalose were found to be very effective in increasing the stability of FAP, which was found to be concentration dependent. Fivefold increase in residual activity of FAP was observed in the presence of trehalose (50%) and sorbitol (50%) at 50°C for 4 h, compared to FAP without additive. Other additives like calcium at 20 mM and 10–15% ammonium sulphate showed lower stability improvement than trehalose and sorbitol. NaCl, MgCl2, K2HPO4, and glycine were found to be poor stabilizers and showed only a marginal improvement. PEG 6000 did not show any increase in stability but was found to be slightly inhibitory. PMID:25105022

  18. New roles for perforins and proteases in apicomplexan egress.

    PubMed

    Roiko, Marijo S; Carruthers, Vern B

    2009-10-01

    Egress is a pivotal step in the life cycle of intracellular pathogens initiating the transition from an expiring host cell to a fresh target cell. While much attention has been focused on understanding cell invasion by intracellular pathogens, recent work is providing a new appreciation of mechanisms and therapeutic potential of microbial egress. This review highlights recent insight into cell egress by apicomplexan parasites and emerging contributions of membranolytic and proteolytic secretory products, along with host proteases. New findings suggest that Toxoplasma gondii secretes a pore-forming protein, TgPLP1, during egress that facilitates parasite escape from the cell by perforating the parasitophorous membrane. Also, in a cascade of proteolytic events, Plasmodium falciparum late-stage schizonts activate and secrete a subtilisin, PfSUB1, which processes enigmatic putative proteases called serine-repeat antigens that contribute to merozoite egress. A new report also suggests that calcium-activated host proteases called calpains aid parasite exit, possibly by acting upon the host cytoskeleton. Together these discoveries reveal important new molecular players involved in the principal steps of egress by apicomplexans.

  19. Luminal Cathepsin G and Protease-Activated Receptor 4

    PubMed Central

    Dabek, Marta; Ferrier, Laurent; Roka, Richard; Gecse, Krisztina; Annahazi, Anita; Moreau, Jacques; Escourrou, Jean; Cartier, Christel; Chaumaz, Gilles; Leveque, Mathilde; Ait-Belgnaoui, Afifa; Wittmann, Tibor; Theodorou, Vassilia; Bueno, Lionel

    2009-01-01

    Impairment of the colonic epithelial barrier and neutrophil infiltration are common features of inflammatory bowel disease. Luminal proteases affect colonic permeability through protease-activated receptors (PARs). We evaluated: (i) whether fecal supernatants from patients with ulcerative colitis (UC) trigger alterations of colonic paracellular permeability and inflammation, and (ii) the roles of cathepsin G (Cat-G), a neutrophil serine protease, and its selective receptor, PAR4, in these processes. Expression levels of both PAR4 and Cat-G were determined in colonic biopsies from UC and healthy subjects. The effects of UC fecal supernatants on colonic paracellular permeability were measured in murine colonic strips. Involvement of Cat-G and PAR4 was evaluated using pepducin P4pal-10 and specific Cat-G inhibitor (SCGI), respectively. In addition, the effect of PAR4-activating peptide was assessed. UC fecal supernatants, either untreated or pretreated with SCGI, were infused into mice, and myeloperoxidase activity was determined. PAR4 was found to be overexpressed in UC colonic biopsies. Increased colonic paracellular permeability that was triggered by UC fecal supernatants was blocked by both SCGI (77%) and P4pal-10 (85%). Intracolonic infusion of UC fecal supernatants into mice increased myeloperoxidase activity. This effect was abolished by SCGI. These observations support that both Cat-G and PAR4 play key roles in generating and/or amplifying relapses in UC and provide a rationale for the development of new therapeutic agents in the treatment of this disease. PMID:19528350

  20. Functional Divergence of Two Secreted Immune Proteases of Tomato.

    PubMed

    Ilyas, Muhammad; Hörger, Anja C; Bozkurt, Tolga O; van den Burg, Harrold A; Kaschani, Farnusch; Kaiser, Markus; Belhaj, Khaoula; Smoker, Matthew; Joosten, Matthieu H A J; Kamoun, Sophien; van der Hoorn, Renier A L

    2015-08-31

    Rcr3 and Pip1 are paralogous secreted papain-like proteases of tomato. Both proteases are inhibited by Avr2 from the fungal pathogen Cladosporium fulvum, but only Rcr3 acts as a co-receptor for Avr2 recognition by the tomato Cf-2 immune receptor. Here, we show that Pip1-depleted tomato plants are hyper-susceptible to fungal, bacterial, and oomycete plant pathogens, demonstrating that Pip1 is an important broad-range immune protease. By contrast, in the absence of Cf-2, Rcr3 depletion does not affect fungal and bacterial infection levels but causes increased susceptibility only to the oomycete pathogen Phytophthora infestans. Rcr3 and Pip1 reside on a genetic locus that evolved over 36 million years ago. These proteins differ in surface-exposed residues outside the substrate-binding groove, and Pip1 is 5- to 10-fold more abundant than Rcr3. We propose a model in which Rcr3 and Pip1 diverged functionally upon gene duplication, possibly driven by an arms race with pathogen-derived inhibitors or by coevolution with the Cf-2 immune receptor detecting inhibitors of Rcr3, but not of Pip1.

  1. Pathogen-secreted proteases activate a novel plant immune pathway.

    PubMed

    Cheng, Zhenyu; Li, Jian-Feng; Niu, Yajie; Zhang, Xue-Cheng; Woody, Owen Z; Xiong, Yan; Djonović, Slavica; Millet, Yves; Bush, Jenifer; McConkey, Brendan J; Sheen, Jen; Ausubel, Frederick M

    2015-05-14

    Mitogen-activated protein kinase (MAPK) cascades play central roles in innate immune signalling networks in plants and animals. In plants, however, the molecular mechanisms of how signal perception is transduced to MAPK activation remain elusive. Here we report that pathogen-secreted proteases activate a previously unknown signalling pathway in Arabidopsis thaliana involving the Gα, Gβ, and Gγ subunits of heterotrimeric G-protein complexes, which function upstream of an MAPK cascade. In this pathway, receptor for activated C kinase 1 (RACK1) functions as a novel scaffold that binds to the Gβ subunit as well as to all three tiers of the MAPK cascade, thereby linking upstream G-protein signalling to downstream activation of an MAPK cascade. The protease-G-protein-RACK1-MAPK cascade modules identified in these studies are distinct from previously described plant immune signalling pathways such as that elicited by bacterial flagellin, in which G proteins function downstream of or in parallel to an MAPK cascade without the involvement of the RACK1 scaffolding protein. The discovery of the new protease-mediated immune signalling pathway described here was facilitated by the use of the broad host range, opportunistic bacterial pathogen Pseudomonas aeruginosa. The ability of P. aeruginosa to infect both plants and animals makes it an excellent model to identify novel immunoregulatory strategies that account for its niche adaptation to diverse host tissues and immune systems.

  2. [Extracellular proteases of mycelial fungi as participants of pathogenic processes].

    PubMed

    Dunaevskiĭ, Ia E; Matveeva, A R; Fatkhullina, G N; Beliakova, G A; Kolomiets, T M; Kovalenko, E D; Belozerskiĭ, M A

    2008-01-01

    The interest in proteases secreted by mycelial fungi is due to several reasons of which one of the most important is their involvement in the initiation and development of the pathogenic process. A comparison of saprophytic and phytopathogenic mycelial fungi revealed one characteristic feature, namely, the appearance of a new trypsin-like activity in phytopathogens that is absent in saprophytes. To clear up the question of whether the degree of pathogenicity of a fungus is related to the activity of secreted trypsin-like protease, several species of Fusarium of various pathogenicity were compared. In two species, F. sporotrichioides (which causes ear fusa-riosis of rye) and F. heterosporum (the causative agent of root rot in wheat), a clear correlation between the activity and pathogenicity was revealed: the more pathogenetic F. sporotrichioides exhibited a higher extracellular trypsin-like activity than the less pathogenetic species F. heterosporum. Thus, the presence of trypsin-like activity in a saprotroph-pathogen pair may be an indicator of the pathogenicity of a fungus; in some cases, the value of this activity may indicate the degree of its pathogenicity. This suggests that trypsin-like proteases specific to phytopathogens are directly involved in the pathogenetic process, probably, through interaction with the "sentry" protein or the product of the resistance gene.

  3. Optimum production and characterization of an acid protease from marine yeast Metschnikowia reukaufii W6b

    NASA Astrophysics Data System (ADS)

    Li, Jing; Peng, Ying; Wang, Xianghong; Chi, Zhenming

    2010-12-01

    The marine yeast strain W6b isolated from sediment of the South China Sea was found to produce a cell-bound acid protease. The crude acid protease produced by this marine yeast showed the highest activity at pH 3.5 and 40 °C. The optimal pH and temperature for the crude acid protease were in agreement with those for acid protease produced by the terrestrial yeasts. The optimal medium of the acid protease production was seawater containing 1.0% glucose, 1.5% casein, and 0.5% yeast extract, and the optimal cultivation conditions of the acid protease production were pH 4.0, a temperature of 25 °C and a shaking speed of 140 rmin-1. Under the optimal conditions, 72.5 UmL-1 of acid protease activity could be obtained in cell suspension within 48 h of fermentation at shake flask level. The acid protease production was induced by high-molecular-weight nitrogen sources and repressed by low-molecular-weight nitrogen sources. Skimmed-milk-clotting test showed that the crude acid protease from the cell suspension of the yeast W6b had high skimmed milk coagulability. The acid protease produced by M. reukaufii W6b may have highly potential applications in cheese, food and fermentation industries.

  4. Multiple Classes of Immune-Related Proteases Associated with the Cell Death Response in Pepper Plants

    PubMed Central

    Bae, Chungyun; Kim, Su-min; Lee, Dong Ju; Choi, Doil

    2013-01-01

    Proteases regulate a large number of biological processes in plants, such as metabolism, physiology, growth, and defense. In this study, we carried out virus-induced gene silencing assays with pepper cDNA clones to elucidate the biological roles of protease superfamilies. A total of 153 representative protease genes from pepper cDNA were selected and cloned into a Tobacco rattle virus-ligation independent cloning vector in a loss-of-function study. Silencing of 61 proteases resulted in altered phenotypes, such as the inhibition of shoot growth, abnormal leaf shape, leaf color change, and lethality. Furthermore, the silencing experiments revealed that multiple proteases play a role in cell death and immune response against avirulent and virulent pathogens. Among these 153 proteases, 34 modulated the hypersensitive cell death response caused by infection with an avirulent pathogen, and 16 proteases affected disease symptom development caused by a virulent pathogen. Specifically, we provide experimental evidence for the roles of multiple protease genes in plant development and immune defense following pathogen infection. With these results, we created a broad sketch of each protease function. This information will provide basic information for further understanding the roles of the protease superfamily in plant growth, development, and defense. PMID:23696830

  5. A Culture-Based Method for Determining the Production of Secreted Protease Inhibitors

    PubMed Central

    Quintero, David; Bermudes, David

    2014-01-01

    We have developed a culture-based method for determining the production of secreted protease inhibitors. The assay utilizes standard proteolysis detection plates to support microbial growth followed by infiltrating the plate with a protease and subsequently detecting the remaining protein by trichloroacetic acid (TCA) precipitation, or by bromocreosol green (BCG) or Ponseau S (PS) staining. The presence of a protease inhibitor can be observed in the form of a protected zone of protein around the protease inhibitor-producing strain. Using the protease inhibitors α-2-macroglobulin, aprotinin, leupeptin, and bestatin and the primary and secondary forms of Photorhabdus luminescens in combination with the protease trypsin, we were able to demonstrate that the assay is specific for the cognate inhibitor of the protease and for bacteria secreting protease inhibitors. In addition, when casein-containing plates were used, the size of the diffusion zone was inversely correlated with the molecular weight of the inhibitor allowing a relative estimation of the protease inhibitor molecular weight. This assay is useful for detecting the presence of microbial secreted protease inhibitors and may reveal their production by microorganisms that were not previously recognized to produce them. PMID:24632514

  6. Enteric bacterial proteases in inflammatory bowel disease- pathophysiology and clinical implications.

    PubMed

    Carroll, Ian M; Maharshak, Nitsan

    2013-01-01

    Numerous reports have identified a dysbiosis in the intestinal microbiota in patients suffering from inflammatory bowel diseases (IBD), yet the mechanism(s) in which this complex microbial community initiates or perpetuates inflammation remains unclear. The purpose of this review is to present evidence for one such mechanism that implicates enteric microbial derived proteases in the pathogenesis of IBD. We highlight and discuss studies demonstrating that proteases and protease receptors are abundant in the digestive system. Additionally, we investigate studies demonstrating an association between increased luminal protease activity and activation of protease receptors, ultimately resulting in increased intestinal permeability and exacerbation of colitis in animal models as well as in human IBD. Proteases are essential for the normal functioning of bacteria and in some cases can serve as virulence factors for pathogenic bacteria. Although not classified as traditional virulence factors, proteases originating from commensal enteric bacteria also have a potential association with intestinal inflammation via increased enteric permeability. Reports of increased protease activity in stools from IBD patients support a possible mechanism for a dysbiotic enteric microbiota in IBD. A better understanding of these pathways and characterization of the enteric bacteria involved, their proteases, and protease receptors may pave the way for new therapeutic approaches for these diseases.

  7. Detergent-compatible proteases: microbial production, properties, and stain removal analysis.

    PubMed

    Niyonzima, Francois Niyongabo; More, Sunil

    2015-01-01

    Proteases are one of the most important commercial enzymes used in various industrial domains such as detergent and leather industries. The alkaline proteases as well as other detergent-compatible enzymes such as lipases and amylases serve now as the key components in detergent formulations. They break down various stains during fabric washing. The search for detergent-compatible proteases with better properties is a continuous exercise. The current trend is to use detergent-compatible proteases that are stable over a wide temperature range. Although the proteases showing stability at elevated pH have the capacity to be used in detergent formulations, their usage can be significant if they are also stable and compatible with detergent and detergent ingredients, and also able to remove protein stains. Despite the existence of some reviews on alkaline proteases, there is no specification for the use of alkaline proteases as detergent additives. The present review describes the detergent-compatible proteases tested as detergent additives. An overview was provided for screening, optimization, purification, and properties of detergent compatible proteases, with an emphasis on the stability and compatibility of the alkaline proteases with the detergent and detergent compounds, as well as stain removal examination methods.

  8. Asteroid families

    NASA Astrophysics Data System (ADS)

    Nesvorný, David; Bottke, William F.; Vokrouhlický, David; Morbidelli, Alessandro; Jedicke, Robert

    An asteroid family is a group of asteroids with similar orbits and spectra that was produced by a collisional breakup of a large parent body. To identify asteroid families, researchers look for clusters of asteroid positions in the space of proper orbital elements. These elements, being more constant over time than osculating orbital elements, provide a dynamical criterion of whether a group of bodies has a common ancestor. More than fifty asteroid families have been identified to date. Their analysis produced several important insights into the physics of large scale collisions, dynamical processes affecting small bodies in the Solar System, and surface and interior properties of asteroids.

  9. Analysis of binding properties and specificity through identification of the interface forming residues (IFR) for serine proteases in silico docked to different inhibitors

    PubMed Central

    2010-01-01

    Background Enzymes belonging to the same super family of proteins in general operate on variety of substrates and are inhibited by wide selection of inhibitors. In this work our main objective was to expand the scope of studies that consider only the catalytic and binding pocket amino acids while analyzing enzyme specificity and instead, include a wider category which we have named the Interface Forming Residues (IFR). We were motivated to identify those amino acids with decreased accessibility to solvent after docking of different types of inhibitors to sub classes of serine proteases and then create a table (matrix) of all amino acid positions at the interface as well as their respective occupancies. Our goal is to establish a platform for analysis of the relationship between IFR characteristics and binding properties/specificity for bi-molecular complexes. Results We propose a novel method for describing binding properties and delineating serine proteases specificity by compiling an exhaustive table of interface forming residues (IFR) for serine proteases and their inhibitors. Currently, the Protein Data Bank (PDB) does not contain all the data that our analysis would require. Therefore, an in silico approach was designed for building corresponding complexes The IFRs are obtained by "rigid body docking" among 70 structurally aligned, sequence wise non-redundant, serine protease structures with 3 inhibitors: bovine pancreatic trypsin inhibitor (BPTI), ecotine and ovomucoid third domain inhibitor. The table (matrix) of all amino acid positions at the interface and their respective occupancy is created. We also developed a new computational protocol for predicting IFRs for those complexes which were not deciphered experimentally so far, achieving accuracy of at least 0.97. Conclusions The serine proteases interfaces prefer polar (including glycine) residues (with some exceptions). Charged residues were found to be uniquely prevalent at the interfaces between the

  10. Enzymatic milk clotting activity in artichoke (Cynara scolymus) leaves and alpine thistle (Carduus defloratus) flowers. Immobilization of alpine thistle aspartic protease.

    PubMed

    Esposito, Marilena; Di Pierro, Prospero; Dejonghe, Winnie; Mariniello, Loredana; Porta, Raffaele

    2016-08-01

    Two different milk clotting enzymes, belonging to the aspartic protease family, were extracted from both artichoke leaves and alpine thistle flowers, and the latter was covalently immobilized by using a polyacrylic support containing polar epoxy groups. Our findings showed that the alpine thistle aspartic protease was successfully immobilized at pH 7.0 on Immobeads IB-150P beads and that, under these experimental conditions, an immobilization yield of about 68% and a recovery of about 54% were obtained. Since the enzyme showed an optimal pH of 5.0, a value very similar to the one generally used for milk clotting during cheese making, and exhibited a satisfactory stability over time, the use of such immobilized vegetable rennet for the production of novel dairy products is suggested.

  11. The protease inhibitor chagasin of Trypanosoma cruzi adopts an immunoglobulin-type fold and may have arisen by horizontal gene transfer.

    PubMed

    Rigden, D J; Monteiro, A C; Grossi de Sá, M F

    2001-08-24

    Chagasin, a protein from Trypanosoma cruzi, is the first member of a new family of tight binding cysteine protease inhibitors [Monteiro, A.C.S., Abrahamson, M., Lima, A.P.C., Vannier-Santos, M.A. and Scharfstein, J. (2001) J. Cell Sci., in press] [corrected]. Despite its lack of significant sequence identity with known proteins, convincing structural models, using variable light chain templates, could be constructed on the basis of threading results. Experimental support for the final structure came from inhibition data for overlapping oligopeptides spanning the chagasin sequence. Chagasin therefore exemplifies a new protease inhibitor structural class and a new natural use for an immunoglobulin-like domain. Limited sequence resemblance suggests that chagasin may represent the result of a rare horizontal gene transfer from host to parasite.

  12. In vivo sequence diversity of the protease of human immunodeficiency virus type 1: presence of protease inhibitor-resistant variants in untreated subjects.

    PubMed Central

    Lech, W J; Wang, G; Yang, Y L; Chee, Y; Dorman, K; McCrae, D; Lazzeroni, L C; Erickson, J W; Sinsheimer, J S; Kaplan, A H

    1996-01-01

    We have evaluated the sequence diversity of the protease human immunodeficiency virus type 1 in vivo. Our analysis of 246 protease coding domain sequences obtained from 12 subjects indicates that amino acid substitutions predicted to give rise to protease inhibitor resistance may be present in patients who have not received protease inhibitors. In addition, we demonstrated that amino acid residues directly involved in enzyme-substrate interactions may be varied in infected individuals. Several of these substitutions occurred in combination either more or less frequently than would be expected if their appearance was independent, suggesting that one substitution may compensate for the effects of another. Taken together, our analysis indicates that the human immunodeficiency virus type 1 protease has flexibility sufficient to vary critical subsites in vivo, thereby retaining enzyme function and viral pathogenicity. PMID:8627733

  13. The coat protein and NIa protease of two potyviridae family members independently confer superinfection exclusion

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Superinfection exclusion (SIE) is an antagonistic virus-virus interaction whereby initial infection by one virus prevents subsequent infection by closely related viruses. Although SIE has been described in diverse viruses infecting plants, humans, and animals, its mechanisms, including involvement o...

  14. Familial dysautonomia

    MedlinePlus

    Riley-Day syndrome; FD; Hereditary sensory and autonomic neuropathy - type III (HSAN III); Autonomic crises - familial dysautonomia ... PA: Elsevier; 2016:chap 107. Sarnat HB. Autonomic neuropathies. In: Kliegman RM, Stanton BF, St. Geme JW, ...

  15. Unusual families.

    PubMed

    Golombok, Susan

    2005-03-01

    The introduction of assisted reproduction has led to unusual forms of procreation. This article describes the social consequences of lesbian motherhood and of families headed by single heterosexual mothers.

  16. Contribution of Gag and protease to variation in susceptibility to protease inhibitors between different strains of subtype B human immunodeficiency virus type 1.

    PubMed

    Sutherland, Katherine A; Mbisa, Jean L; Cane, Patricia A; Pillay, Deenan; Parry, Chris M

    2014-01-01

    Recent reports have shown that human immunodeficiency virus type 1 (HIV-1) Gag can directly affect susceptibility to protease inhibitors (PIs) in the absence of known resistance mutations in protease. Inclusion of co-evolved Gag alongside protease in phenotypic drug susceptibility assays can alter PI susceptibility in comparison with protease with a WT Gag. Using a single-replication-cycle assay encompassing full-length Gag together with protease we demonstrated significant variation in PI susceptibility between a number of PI-naïve subtype B viruses. Six publicly available subtype B molecular clones, namely HXB2, NL4-3, SF2, YU2, JRFL and 89.6, displayed up to nine-fold reduced PI susceptibility in comparison with the assay reference strain. For two molecular clones, YU2 and JRFL, Gag contributed solely to the observed reduction in susceptibility, with the N-terminal region of Gag contributing significantly. Gag and protease from treatment-naïve, patient-derived viruses also demonstrated significant variation in susceptibility, with up to a 17-fold reduction to atazanavir in comparison with the assay reference strain. In contrast to the molecular clones, protease was the main determinant of the reduced susceptibility. Common polymorphisms in protease, including I13V, L63P and A71T, were shown to contribute to this reduction in PI susceptibility, in the absence of major resistance mutations. This study demonstrated significant variation in PI susceptibility of treatment-naïve patient viruses, and provided further evidence of the independent role of Gag, the protease substrate and in particular the N-terminus of Gag in PI susceptibility. It also highlighted the importance of considering co-evolved Gag and protease when assessing PI susceptibility.

  17. Proteases of Stored Product Insects and their Inhibition by Specific Protease Inhibitors from Soybeans and Wheat Grain

    DTIC Science & Technology

    1989-01-31

    CHYMOTRYPSINS; BOWMAN-BIRK TRYPSIN-CHYMOTRYPSIN INHIBITOR (SOYBEANS); CHICKPEAS TRYPSIN-CHYMOTRYPSIN INHIBITOR; SOYBEAN PROTEASE INHIBITORS 20. ABSTRACT...could be fully inhibited at a 1:1 molar ratio by the naturally-occuring proteinaceous trypsin inhibitors BBI from soybeans and CI from chickpeas ...substrates. These activities were fully inhibited by the proteinaceous trypsin-chymotrypsin inhibitors BBI from soybeans and CI from chickpeas when assayed

  18. Proteases of Stored Product Insects and their Inhibition by Specific Protease Inhibitors from Soybeans and Wheat Grain.

    DTIC Science & Technology

    1987-06-30

    CHMOTRYPSIN INHIBITOR (SOYBEANS) CHICKPEAS TRYPSIN-CHYMOTRYPSIN INHIBITOR; SOYBEAN PROTEASE INHIBITORS 20. ABSTRACT (Coninue, on reverse aide It necessary...CI from chickpeas . Attempts are now in progress to separate and isolate these trypsin-and chymotrypsin-like enzymes. (3) Locust proteinases...and from chickpeas (CI). In addition, a specific Tribolium proteinase inhibitor from soybeans was separated. SIGNIFICANT FINDINGS A. The detection of

  19. Proteases of Stored Product Insects and their Inhibition by Specific Protease Inhibitors from Soybeans and Wheat Grain.

    DTIC Science & Technology

    1988-01-31

    PROTEASES; INSECT TRYPSINS and CHYMOTRYPSINS; BOWMAN-BIRK TRYPSIN-CHYMOTRYPSIN INHIBITOR (SOYBEANS); CHICKPEAS TRYPSIN-CHYMOTRYPSIN INHIBLTOR; SOYBEAN...inhibitors from legume .seeds, such as the Bowman-Birk inhibitor (BBI) from soybeans and CI from chickpeas . The purified and partially-characterized insect DD...inhibited by the trypsin - chymotrypsin inhibitors BBI from soybeans and CI from chickpeas . Separation and purification of these enzymes by gel

  20. Family dysfunction

    PubMed Central

    Hayaki, Chie; Anno, Kozo; Shibata, Mao; Iwaki, Rie; Kawata, Hiroshi; Sudo, Nobuyuki; Hosoi, Masako

    2016-01-01

    Abstract Previous studies have shown differences in the psychosocial factors related to chronic localized pain (CLP) and chronic widespread pain (CWP). However, no studies have done an evaluation of differences between CLP and CWP from the viewpoint of family functioning. We did a cross-sectional study in a tertiary care setting to investigate possible differences in the relation of CWP and CLP to family functioning. Patients with CLP (N = 126) or CWP (N = 75) were assessed for family functioning by the Family Assessment Device (FAD) and a comparison was done. Logistic regression analysis was used to estimate associations of family functioning subscales with pain status (CWP vs CLP), controlling for demographic variables, pain variables; pain duration, pain ratings, pain disability, and psychological factors; depression, anxiety, and catastrophizing. The odds ratios (ORs) for the presence of CWP were calculated. Compared to patients with CLP, patients with CWP showed a lower functional status for Roles and Affective Involvement. The ORs for CWP were significantly higher in lower functioning Roles (OR: 2.38, 95% CI: 1.21–4.65) and Affective Involvement (OR: 2.86, 95% CI: 1.56–5.24) after adjusting for demographic variables. The significant association of CWP to Roles and Affective Involvement remained after controlling for the pain variables and psychological factors. This study shows that the families of patients with CWP have poorer family functioning than those with CLP. Our findings suggest that early identification and interventions for the family dysfunction of chronic pain patients are important to the treatment and prevention of CWP. PMID:27930535

  1. SARS hCoV papain-like protease is a unique Lys48 linkage-specific di-distributive deubiquitinating enzyme.

    PubMed

    Békés, Miklós; Rut, Wioletta; Kasperkiewicz, Paulina; Mulder, Monique P C; Ovaa, Huib; Drag, Marcin; Lima, Christopher D; Huang, Tony T

    2015-06-01

    Ubiquitin (Ub) and the Ub-like (Ubl) modifier interferon-stimulated gene 15 (ISG15) participate in the host defence of viral infections. Viruses, including the severe acute respiratory syndrome human coronavirus (SARS hCoV), have co-opted Ub-ISG15 conjugation pathways for their own advantage or have evolved effector proteins to counter pro-inflammatory properties of Ub-ISG15-conjugated host proteins. In the present study, we compare substrate specificities of the papain-like protease (PLpro) from the recently emerged Middle East respiratory syndrome (MERS) hCoV to the related protease from SARS, SARS PLpro. Through biochemical assays, we show that, similar to SARS PLpro, MERS PLpro is both a deubiquitinating (DUB) and a deISGylating enzyme. Further analysis of the intrinsic DUB activity of these viral proteases revealed unique differences between the recognition and cleavage specificities of polyUb chains. First, MERS PLpro shows broad linkage specificity for the cleavage of polyUb chains, whereas SARS PLpro prefers to cleave Lys48-linked polyUb chains. Secondly, MERS PLpro cleaves polyUb chains in a 'mono-distributive' manner (one Ub at a time) and SARS PLpro prefers to cleave Lys48-linked polyUb chains by sensing a di-Ub moiety as a minimal recognition element using a 'di-distributive' cleavage mechanism. The di-distributive cleavage mechanism for SARS PLpro appears to be uncommon among USP (Ub-specific protease)-family DUBs, as related USP family members from humans do not display such a mechanism. We propose that these intrinsic enzymatic differences between SARS and MERS PLpro will help to identify pro-inflammatory substrates of these viral DUBs and can guide in the design of therapeutics to combat infection by coronaviruses.

  2. Identification of novel malarial cysteine protease inhibitors using structure-based virtual screening of a focused cysteine protease inhibitor library.

    PubMed

    Shah, Falgun; Mukherjee, Prasenjit; Gut, Jiri; Legac, Jennifer; Rosenthal, Philip J; Tekwani, Babu L; Avery, Mitchell A

    2011-04-25

    Malaria, in particular that caused by Plasmodium falciparum , is prevalent across the tropics, and its medicinal control is limited by widespread drug resistance. Cysteine proteases of P. falciparum , falcipain-2 (FP-2) and falcipain-3 (FP-3), are major hemoglobinases, validated as potential antimalarial drug targets. Structure-based virtual screening of a focused cysteine protease inhibitor library built with soft rather than hard electrophiles was performed against an X-ray crystal structure of FP-2 using the Glide docking program. An enrichment study was performed to select a suitable scoring function and to retrieve potential candidates against FP-2 from a large chemical database. Biological evaluation of 50 selected compounds identified 21 diverse nonpeptidic inhibitors of FP-2 with a hit rate of 42%. Atomic Fukui indices were used to predict the most electrophilic center and its electrophilicity in the identified hits. Comparison of predicted electrophilicity of electrophiles in identified hits with those in known irreversible inhibitors suggested the soft-nature of electrophiles in the selected target compounds. The present study highlights the importance of focused libraries and enrichment studies in structure-based virtual screening. In addition, few compounds were screened against homologous human cysteine proteases for selectivity analysis. Further evaluation of structure-activity relationships around these nonpeptidic scaffolds could help in the development of selective leads for antimalarial chemotherapy.

  3. Using C. elegans to Identify the Protease Targets of Serpins In Vivo

    PubMed Central

    Bhatia, Sangeeta R.; Miedel, Mark T.; Chotoo, Cavita K.; Graf, Nathan J.; Hood, Brian L.; Conrads, Thomas P.; Silverman, Gary A.; Luke, Cliff J.

    2015-01-01

    Most serpins inhibit serine and/or cysteine proteases, and their inhibitory activities are usually defined in vitro. However, the physiological protease targets of most serpins are unknown despite many years of research. This may be due to the rapid degradation of the inactive serpin:protease complexes and/or the conditions under which the serpin inhibits the protease. The model organism Caenorhabditis elegans is an ideal system for identifying protease targets due to powerful forward and reverse genetics, as well as the ease of creating transgenic animals. Using combinatorial approaches of genetics and biochemistry in C. elegans, the true in vivo protease targets of the endogenous serpins can be elucidated. PMID:21683259

  4. Recent developments in production and biotechnological applications of cold-active microbial proteases.

    PubMed

    Kuddus, Mohammed; Ramteke, Pramod W

    2012-11-01

    Microbial proteases that occupy a pivotal position with respect to their commercial applications are most important hydrolytic enzymes and have been studied extensively since the advent of enzymology. Cold-adapted microorganisms are potential source of cold-active proteases and they have been isolated from the cold regions. Although there are many microbial sources available for producing proteases, only few are recognized as commercial producer. Cold-active proteases along with their producing microbes are of commercial value and find multiple applications in various industrial and biotechnological sectors such as additives in detergents, additives in food industries, environmental bioremediations, biotransformation and molecular biology applications. Therefore, cold-active proteases are the enzymes of choice for many biotechnologists, microbiologists, biochemists, environmentalists and biochemical engineers. In the present review, we discuss some novel sources along with recent developments in production and biotechnological applications of cold-active microbial proteases.

  5. A tobacco etch virus protease with increased substrate tolerance at the P1' position.

    PubMed

    Renicke, Christian; Spadaccini, Roberta; Taxis, Christof

    2013-01-01

    Site-specific proteases are important tools for in vitro and in vivo cleavage of proteins. They are widely used for diverse applications, like protein purification, assessment of protein-protein interactions or regulation of protein localization, abundance or activity. Here, we report the development of a procedure to select protease variants with altered specificity based on the well-established Saccharomyces cerevisiae adenine auxotrophy-dependent red/white colony assay. We applied this method on the tobacco etch virus (TEV) protease to obtain a protease variant with altered substrate specificity at the P1' Position. In vivo experiments with tester substrates showed that the mutated TEV protease still efficiently recognizes the sequence ENLYFQ, but has almost lost all bias for the amino acid at the P1' Position. Thus, we generated a site-specific protease for synthetic approaches requiring in vivo generation of proteins or peptides with a specific N-terminal amino acid.

  6. A survey of IgA protease production among clinical isolates of Proteeae.

    PubMed

    Senior, B W; Albrechtsen, M; Kerr, M A

    1988-01-01

    A collection of 100 strains of Proteeae, in which all species within the tribe were represented, was examined for IgA protease production. The strains were isolated from various clinical specimens from sick and healthy persons in several countries. IgA protease-producing strains were not found amongst species of Providencia and Morganella but were common in Proteus spp. All the strains of P. mirabilis and P. penneri and many of the strains of P. vulgaris examined produced an EDTA-sensitive protease that cleaved the IgA heavy chain outside the hinge region. The proteus enzyme was different in this respect from the EDTA-sensitive, hinge-cutting proteases of other bacteria. The ability to produce IgA protease was unrelated to the O antigenicity, biotype or bacteriocin type of the strain. IgA protease production may be an important virulence mechanism for Proteus strains.

  7. Targeting Proteases in Cardiovascular Diseases by Mass Spectrometry-Based Proteomics

    PubMed Central

    Klingler, Diana; Hardt, Markus

    2012-01-01

    Proteases hydrolyze peptide bonds, thereby controlling the function of proteins and peptides on the posttranslational level. In the cardiovascular system, proteases play pivotal roles in the regulation of blood pressure, coagulation and other essential physiological processes. Accordingly, proteases are prime targets for therapeutic interventions and diagnostics. Proteases are part of complex proteolytic networks comprised of enzymes, inhibitors, activators, substrates and cleavage products. Analyzing these networks on a system-wide level is essential to understanding cardiovascular function and how dysregulation can lead to pathological conditions. Mass spectrometry-based quantitative and dynamic proteomics approaches are leading the way to enhance our knowledge of proteolytic networks such as the renin-angiotensin-system. Here, we critically review proteomics tools utilized in protease biology and provide an overview on how these methods can be used to characterize and validate protease function. PMID:22511707

  8. Cupincin: A Unique Protease Purified from Rice (Oryza sativa L.) Bran Is a New Member of the Cupin Superfamily

    PubMed Central

    Sreedhar, Roopesh; Kaul Tiku, Purnima

    2016-01-01

    Cupin superfamily is one of the most diverse super families. This study reports the purification and characterization of a novel cupin domain containing protease from rice bran for the first time. Hypothetical protein OsI_13867 was identified and named as cupincin. Cupincin was purified to 4.4 folds with a recovery of 4.9%. Cupincin had an optimum pH and temperature of pH 4.0 and 60°C respec