Science.gov

Sample records for self-compartmentalizing protease family

  1. Cystatins, serpins and other families of protease inhibitors in plants.

    PubMed

    Volpicella, Mariateresa; Leoni, Claudia; Costanza, Alessandra; De Leo, Francesca; Gallerani, Raffaele; Ceci, Luigi R

    2011-08-01

    Plant protease inhibitors (PIs) are generally small proteins present in high concentrations in storage tissues (tubers and seeds), and to a lower level in leaves. Even if most of them are active against serine and cysteine proteases, PIs active against aspartic proteases and carboxypeptidases have also been identified. Inhibitors of serine proteases are further classifiable in several families on the basis of their structural features. They comprise the families known as Bowman-Birk, Kunitz, Potato I and Potato II, which are the subject of review articles included in this special issue. In the present article we aim to give an overview of other families of plant PIs, active either against serine proteases or other class of proteases, describing their distribution, activity and main structural characteristics.

  2. Evolution of the protease-activated receptor family in vertebrates

    PubMed Central

    JIN, MIN; YANG, HAI-WEI; TAO, AI-LIN; WEI, JI-FU

    2016-01-01

    Belonging to the G protein-coupled receptor (GPcr) family, the protease-activated receptors (Pars) consist of 4 members, PAR1-4. PARs mediate the activation of cells via thrombin, serine and other proteases. Such protease-triggered signaling events are thought to be critical for hemostasis, thrombosis and other normal pathological processes. In the present study, we examined the evolution of PARs by analyzing phylogenetic trees, chromosome location, selective pressure and functional divergence based on the 169 functional gene alignment sequences from 57 vertebrate gene sequences. We found that the 4 PARs originated from 4 invertebrate ancestors by phylogenetic trees analysis. The selective pressure results revealed that only PAR1 appeared by positive selection during its evolution, while the other PAR members did not. In addition, we noticed that although these PARs evolved separately, the results of functional divergence indicated that their evolutional rates were similar and their functions did not significantly diverge. The findings of our study provide valuable insight into the evolutionary history of the vertebrate PAR family. PMID:26820116

  3. Proteases.

    PubMed

    Barrett, A J

    2001-05-01

    The processes of growth and remodeling of cells and tissues in multicellular organisms require the breakdown of old protein molecules, in concert with the synthesis of new ones. For example, many newly-synthesized molecules require proteolytic processing to convert them to biologically active forms. Proteolysis can terminate the activity of a protein--e.g., capsases mediate apoptosis, which is a vital step in the life cycle of the cell. Proteolysis contributes to defense systems too, as the recognition of peptide fragments of foreign proteins triggers the immune response. Proteases are the class of enzymes involved in these important reactions. This unit discusses the general categories of proteases, and sets the stage for addition of overview units on cysteine proteases, aspartic proteases, and metalloproteases, as well as protocol units featuring techniques for analyzing mammalian and yeast proteasomes and protease inhibitors, among other topics.

  4. Differential expression of a protease gene family in African Trypanosomes

    PubMed Central

    Helm, Jared R.; Wilson, Mary E.; Donelson, John E.

    2008-01-01

    During their life cycle African trypanosomes must quickly adapt to the different environments of the tsetse fly midgut and the mammalian bloodstream by modulating expression of many of their genes. One group of these differentially expressed genes encodes different forms of a major surface protease. Using a luciferase reporter gene transiently or permanently transfected into trypanosomes, we show here that the 3′-UTRs of these protease genes are responsible for their differential expression. Deletion analysis of the 389-bp 3′-UTR of one of the protease genes, MSP-B, demonstrated that it contains a U-rich regulatory region of about 23 bp (UCGUCUGUUAUUUCUUAGUCCAG), which suppresses expression of the reporter protein in bloodstream trypanosomes by as much as 25-fold, but has little effect on the reporter expression in procyclic (tsetse fly) trypanosomes. Replacing the entire 3′-UTR with just this 23-bp element mimicked most of the suppression effect of the complete 3′-UTR. Northern blots showed that the 23-bp element influences the steady state RNA level, but not enough to account for the 25-fold suppression effect. Polysome analyses showed that in procyclic trypanosomes more of the total protease mRNA is associated with intermediate-sized and large polysomes than in bloodstream trypanosomes. Thus, the 23-bp element of this protease gene affects both the level of RNA and its translation. PMID:18848586

  5. Modeling and structural analysis of evolutionarily diverse S8 family serine proteases

    PubMed Central

    Laskar, Aparna; Rodger, Euan James; Chatterjee, Aniruddha; Mandal, Chhabinath

    2011-01-01

    Serine proteases are an abundant class of enzymes that are involved in a wide range of physiological processes and are classified into clans sharing structural homology. The active site of the subtilisin-like clan contains a catalytic triad in the order Asp, His, Ser (S8 family) or a catalytic tetrad in the order Glu, Asp and Ser (S53 family). The core structure and active site geometry of these proteases is of interest for many applications. The aim of this study was to investigate the structural properties of different S8 family serine proteases from a diverse range of taxa using molecular modeling techniques. In conjunction with 12 experimentally determined three-dimensional structures of S8 family members, our predicted structures from an archaeon, protozoan and a plant were used for analysis of the catalytic core. Amino acid sequences were obtained from the MEROPS database and submitted to the LOOPP server for threading based structure prediction. The predicted structures were refined and validated using PROCHECK, SCRWL and MODELYN. Investigation of secondary structures and electrostatic surface potential was performed using MOLMOL. Encompassing a wide range of taxa, our structural analysis provides an evolutionary perspective on S8 family serine proteases. Focusing on the common core containing the catalytic site of the enzyme, the analysis presented here is beneficial for future molecular modeling strategies and structure-based rational drug design. PMID:22125392

  6. The rhomboid protease family: a decade of progress on function and mechanism.

    PubMed

    Urban, Sinisa; Dickey, Seth W

    2011-10-27

    Rhomboid proteases are the largest family of enzymes that hydrolyze peptide bonds within the cell membrane. Although discovered to be serine proteases only a decade ago, rhomboid proteases are already considered to be the best understood intramembrane proteases. The presence of rhomboid proteins in all domains of life emphasizes their importance but makes their evolutionary history difficult to chart with confidence. Phylogenetics nevertheless offers three guiding principles for interpreting rhomboid function. The near ubiquity of rhomboid proteases across evolution suggests broad, organizational roles that are not directly essential for cell survival. Functions have been deciphered in only about a dozen organisms and fall into four general categories: initiating cell signaling in animals, facilitating bacterial quorum sensing, regulating mitochondrial homeostasis, and dismantling adhesion complexes of parasitic protozoa. Although in no organism has the full complement of rhomboid function yet been elucidated, links to devastating human disease are emerging rapidly, including to Parkinson's disease, type II diabetes, cancer, and bacterial and malaria infection. Rhomboid proteases are unlike most proteolytic enzymes, because they are membrane-immersed; understanding how the membrane immersion affects their function remains a key challenge.

  7. Natural cysteine protease inhibitors in protozoa: Fifteen years of the chagasin family.

    PubMed

    Costa, Tatiana F R; Lima, Ana Paula C A

    2016-03-01

    Chagasin-type inhibitors comprise natural inhibitors of papain-like cysteine proteases that are distributed among Protist, Bacteria and Archaea. Chagasin was identified in the pathogenic protozoa Trypanosoma cruzi as an approximately 11 kDa protein that is a tight-binding and highly thermostable inhibitor of papain, cysteine cathepsins and endogenous parasite cysteine proteases. It displays an Imunoglobulin-like fold with three exposed loops to one side of the molecule, where amino acid residues present in conserved motifs at the tips of each loop contact target proteases. Differently from cystatins, the loop 2 of chagasin enters the active-site cleft, making direct contact with the catalytic residues, while loops 4 and 6 embrace the enzyme from the sides. Orthologues of chagasin are named Inhibitors of Cysteine Peptidases (ICP), and share conserved overall tri-dimensional structure and mode of binding to proteases. ICPs are tentatively distributed in three families: in family I42 are grouped chagasin-type inhibitors that share conserved residues at the exposed loops; family I71 contains Plasmodium ICPs, which are large proteins having a chagasin-like domain at the C-terminus, with lower similarity to chagasin in the conserved motif at loop 2; family I81 contains Toxoplasma ICP. Recombinant ICPs tested so far can inactivate protozoa cathepsin-like proteases and their mammalian counterparts. Studies on their biological roles were carried out in a few species, mainly using transgenic protozoa, and the conclusions vary. However, in all cases, alterations in the levels of expression of chagasin/ICPs led to substantial changes in one or more steps of parasite biology, with higher incidence in influencing their interaction with the hosts. We will cover most of the findings on chagasin/ICP structural and functional properties and overview the current knowledge on their roles in protozoa.

  8. Using the SUBcellular database for Arabidopsis proteins to localize the Deg protease family

    PubMed Central

    Tanz, Sandra K.; Castleden, Ian; Hooper, Cornelia M.; Small, Ian; Millar, A. Harvey

    2014-01-01

    Sub-functionalization during the expansion of gene families in eukaryotes has occurred in part through specific subcellular localization of different family members. To better understand this process in plants, compiled records of large-scale proteomic and fluorescent protein localization datasets can be explored and bioinformatic predictions for protein localization can be used to predict the gaps in experimental data. This process can be followed by targeted experiments to test predictions. The SUBA3 database is a free web-service at http://suba.plantenergy.uwa.edu.au that helps users to explore reported experimental data and predictions concerning proteins encoded by gene families and to define the experiments required to locate these homologous sets of proteins. Here we show how SUBA3 can be used to explore the subcellular location of the Deg protease family of ATP-independent serine endopeptidases (Deg1–Deg16). Combined data integration and new experiments refined location information for Deg1 and Deg9, confirmed Deg2, Deg5, and Deg8 in plastids and Deg 15 in peroxisomes and provide substantial experimental evidence for mitochondrial localized Deg proteases. Two of these, Deg3 and Deg10, additionally localized to the plastid, revealing novel dual-targeted Deg proteases in the plastid and the mitochondrion. SUBA3 is continually updated to ensure that researchers can use the latest published data when planning the experimental steps remaining to localize gene family functions. PMID:25161662

  9. Structures of a bi-functional Kunitz-type STI family inhibitor of serine and aspartic proteases: Could the aspartic protease inhibition have evolved from a canonical serine protease-binding loop?

    PubMed

    Guerra, Yasel; Valiente, Pedro A; Pons, Tirso; Berry, Colin; Rudiño-Piñera, Enrique

    2016-08-01

    Bi-functional inhibitors from the Kunitz-type soybean trypsin inhibitor (STI) family are glycosylated proteins able to inhibit serine and aspartic proteases. Here we report six crystal structures of the wild-type and a non-glycosylated mutant of the bifunctional inhibitor E3Ad obtained at different pH values and space groups. The crystal structures show that E3Ad adopts the typical β-trefoil fold of the STI family exhibiting some conformational changes due to pH variations and crystal packing. Despite the high sequence identity with a recently reported potato cathepsin D inhibitor (PDI), three-dimensional structures obtained in this work show a significant conformational change in the protease-binding loop proposed for aspartic protease inhibition. The E3Ad binding loop for serine protease inhibition is also proposed, based on structural similarity with a novel non-canonical conformation described for the double-headed inhibitor API-A from the Kunitz-type STI family. In addition, structural and sequence analyses suggest that bifunctional inhibitors of serine and aspartic proteases from the Kunitz-type STI family are more similar to double-headed inhibitor API-A than other inhibitors with a canonical protease-binding loop.

  10. A computational module assembled from different protease family motifs identifies PI PLC from Bacillus cereus as a putative prolyl peptidase with a serine protease scaffold.

    PubMed

    Rendón-Ramírez, Adela; Shukla, Manish; Oda, Masataka; Chakraborty, Sandeep; Minda, Renu; Dandekar, Abhaya M; Ásgeirsson, Bjarni; Goñi, Félix M; Rao, Basuthkar J

    2013-01-01

    Proteolytic enzymes have evolved several mechanisms to cleave peptide bonds. These distinct types have been systematically categorized in the MEROPS database. While a BLAST search on these proteases identifies homologous proteins, sequence alignment methods often fail to identify relationships arising from convergent evolution, exon shuffling, and modular reuse of catalytic units. We have previously established a computational method to detect functions in proteins based on the spatial and electrostatic properties of the catalytic residues (CLASP). CLASP identified a promiscuous serine protease scaffold in alkaline phosphatases (AP) and a scaffold recognizing a β-lactam (imipenem) in a cold-active Vibrio AP. Subsequently, we defined a methodology to quantify promiscuous activities in a wide range of proteins. Here, we assemble a module which encapsulates the multifarious motifs used by protease families listed in the MEROPS database. Since APs and proteases are an integral component of outer membrane vesicles (OMV), we sought to query other OMV proteins, like phospholipase C (PLC), using this search module. Our analysis indicated that phosphoinositide-specific PLC from Bacillus cereus is a serine protease. This was validated by protease assays, mass spectrometry and by inhibition of the native phospholipase activity of PI-PLC by the well-known serine protease inhibitor AEBSF (IC50 = 0.018 mM). Edman degradation analysis linked the specificity of the protease activity to a proline in the amino terminal, suggesting that the PI-PLC is a prolyl peptidase. Thus, we propose a computational method of extending protein families based on the spatial and electrostatic congruence of active site residues.

  11. Antigen receptor-induced B lymphocyte apoptosis mediated via a protease of the caspase family.

    PubMed

    Andjelic, S; Liou, H C

    1998-02-01

    An extensive body of data, in a variety of systems, denoted the caspase family of proteases as a key player in the execution of programmed cell death. This family consists of cysteine proteases that cleave after asparagine-containing motifs. It is well established that the caspases are essential for the apoptosis mediated by Fas (CD95) and TNF receptor p55, molecules that contain the "death domain" in the cytoplasmic tail. However, little is known about the mechanisms underlying the antigen receptor-mediated cell death in B lymphocytes, a process instrumental in negative selection of potentially autoreactive B cells. Here, we investigated the involvement of caspases in cell death triggered via the antigen receptor in B lymphocytes (BCR) by using specific inhibitors. Initially, we used a well-established cell line, CH31, which is a model of B cell tolerance, to demonstrate that these proteases indeed participate in the BCR-induced apoptotic pathway. Next, we confirmed the physiological relevance of the caspase-mediated cell death pathway in splenic B cell populations isolated ex vivo that were induced to undergo apoptosis by extensive cross-linking of their BCR. Most interestingly, our data demonstrated that caspases regulate not only the nuclear DNA fragmentation, but also the surface membrane phosphatidylserine translocation as well as the degradation of a specific nuclear substrate. Taken together, this report supports the hypothesis that regulation of the caspase family is crucial in controlling the life/death decision in B lymphocytes mediated by the antigen receptor signal transduction.

  12. Phylogeny and evolution of the aspartyl protease family from clinically relevant Candida species.

    PubMed

    Parra-Ortega, B; Cruz-Torres, H; Villa-Tanaca, L; Hernández-Rodríguez, C

    2009-05-01

    Aspartyl proteases are a class of enzymes that include the yeast aspartyl proteases and secreted aspartyl protease (Sap) superfamilies. Several Sap superfamily members have been demonstrated or suggested as virulence factors in opportunistic pathogens of the genus Candida. Candida albicans, Candida tropicalis, Candida dubliniensis and Candida parapsilosis harbour 10, four, eight and three SAP genes, respectively. In this work, genome mining and phylogenetic analyses revealed the presence of new members of the Sap superfamily in C. tropicalis (8), Candida guilliermondii (8), C. parapsilosis(11) and Candida lusitaniae (3). A total of 12 Sap families, containing proteins with at least 50% similarity, were discovered in opportunistic, pathogenic Candida spp. In several Sap families, at least two subfamilies or orthologous groups were identified, each defined by > 90% sequence similitude, functional similarity and synteny among its members. No new members of previously described Sap families were found in a Candida spp. clinical strain collection; however, the universality of SAPT gene distribution among C. tropicalis strains was demonstrated. In addition, several features of opportunistic pathogenic Candida species, such as gene duplications and inversions, similitude, synteny, putative transcription factor binding sites and genome traits of SAP gene superfamily were described in a molecular evolutionary context.

  13. Inhibition of outer membrane proteases of the omptin family by aprotinin.

    PubMed

    Brannon, John R; Burk, David L; Leclerc, Jean-Mathieu; Thomassin, Jenny-Lee; Portt, Andrea; Berghuis, Albert M; Gruenheid, Samantha; Le Moual, Hervé

    2015-06-01

    Bacterial proteases are important virulence factors that inactivate host defense proteins and contribute to tissue destruction and bacterial dissemination. Outer membrane proteases of the omptin family, exemplified by Escherichia coli OmpT, are found in some Gram-negative bacteria. Omptins cleave a variety of substrates at the host-pathogen interface, including plasminogen and antimicrobial peptides. Multiple omptin substrates relevant to infection have been identified; nonetheless, an effective omptin inhibitor remains to be found. Here, we purified native CroP, the OmpT ortholog in the murine pathogen Citrobacter rodentium. Purified CroP was found to readily cleave both a synthetic fluorescence resonance energy transfer substrate and the murine cathelicidin-related antimicrobial peptide. In contrast, CroP was found to poorly activate plasminogen into active plasmin. Although classical protease inhibitors were ineffective against CroP activity, we found that the serine protease inhibitor aprotinin displays inhibitory potency in the micromolar range. Aprotinin was shown to act as a competitive inhibitor of CroP activity and to interfere with the cleavage of the murine cathelicidin-related antimicrobial peptide. Importantly, aprotinin was able to inhibit not only CroP but also Yersinia pestis Pla and, to a lesser extent, E. coli OmpT. We propose a structural model of the aprotinin-omptin complex in which Lys15 of aprotinin forms salt bridges with conserved negatively charged residues of the omptin active site.

  14. Ligand heterogeneity of the cysteine protease binding protein family in the parasitic protist Entamoeba histolytica.

    PubMed

    Marumo, Konomi; Nakada-Tsukui, Kumiko; Tomii, Kentaro; Nozaki, Tomoyoshi

    2014-08-01

    Lysosomal soluble proteins are targeted to endosomes and lysosomes by specific receptors resident in the endoplasmic reticulum and/or the Golgi apparatus. The enteric protozoan parasite Entamoeba histolytica has a novel class of lysosomal targeting receptors, named the cysteine protease binding protein family (CPBF). Among 11 CPBFs (CPBF1-11), ligands for three members, CPBF1, CPBF6 and CPBF8, were previously shown to be cysteine proteases, α- and γ- amylases, and β-hexosaminidase and lysozymes, respectively. To further understand the heterogeneity of the ligands of CPBFs, we attempted to isolate and identify the ligands for other members of CPBFs, namely CPBF2, 3, 4, 5, 7, 9, 10 and 11, by immunoprecipitation and mass spectrometric analysis. We found that CPBF2 and CPBF10 bound to α-amylases while CPBF7 bound to β-hexosaminidases. It is intriguing that cysteine protease are exclusively recognised by CPBF1, whereas three α-amylases and β-hexosaminidases are redundantly recognised by three and two CPBFs, respectively. It was shown by bioinformatics analysis and phylogenetic reconstruction that each CPBF contains six prepeptidase carboxyl-terminal domains, and the domain configuration is evolutionarily conserved among CPBFs. Taken together, CPBFs with unique and conserved domain organisation have a remarkable ligand heterogeneity toward cysteine protease and carbohydrate degradation enzymes. Further structural studies are needed to elucidate the structural basis of the ligand specificity.

  15. Inhibition of Outer Membrane Proteases of the Omptin Family by Aprotinin

    PubMed Central

    Brannon, John R.; Burk, David L.; Leclerc, Jean-Mathieu; Thomassin, Jenny-Lee; Portt, Andrea; Berghuis, Albert M.; Gruenheid, Samantha

    2015-01-01

    Bacterial proteases are important virulence factors that inactivate host defense proteins and contribute to tissue destruction and bacterial dissemination. Outer membrane proteases of the omptin family, exemplified by Escherichia coli OmpT, are found in some Gram-negative bacteria. Omptins cleave a variety of substrates at the host-pathogen interface, including plasminogen and antimicrobial peptides. Multiple omptin substrates relevant to infection have been identified; nonetheless, an effective omptin inhibitor remains to be found. Here, we purified native CroP, the OmpT ortholog in the murine pathogen Citrobacter rodentium. Purified CroP was found to readily cleave both a synthetic fluorescence resonance energy transfer substrate and the murine cathelicidin-related antimicrobial peptide. In contrast, CroP was found to poorly activate plasminogen into active plasmin. Although classical protease inhibitors were ineffective against CroP activity, we found that the serine protease inhibitor aprotinin displays inhibitory potency in the micromolar range. Aprotinin was shown to act as a competitive inhibitor of CroP activity and to interfere with the cleavage of the murine cathelicidin-related antimicrobial peptide. Importantly, aprotinin was able to inhibit not only CroP but also Yersinia pestis Pla and, to a lesser extent, E. coli OmpT. We propose a structural model of the aprotinin-omptin complex in which Lys15 of aprotinin forms salt bridges with conserved negatively charged residues of the omptin active site. PMID:25824836

  16. Peroxisomal Proteostasis Involves a Lon Family Protein That Functions as Protease and Chaperone*

    PubMed Central

    Bartoszewska, Magdalena; Williams, Chris; Kikhney, Alexey; Opaliński, Łukasz; van Roermund, Carlo W. T.; de Boer, Rinse; Veenhuis, Marten; van der Klei, Ida J.

    2012-01-01

    Proteins are subject to continuous quality control for optimal proteostasis. The knowledge of peroxisome quality control systems is still in its infancy. Here we show that peroxisomes contain a member of the Lon family of proteases (Pln). We show that Pln is a heptameric protein and acts as an ATP-fueled protease and chaperone. Hence, Pln is the first chaperone identified in fungal peroxisomes. In cells of a PLN deletion strain peroxisomes contain protein aggregates, a major component of which is catalase-peroxidase. We show that this enzyme is sensitive to oxidative damage. The oxidatively damaged, but not the native protein, is a substrate of the Pln protease. Cells of the pln strain contain enhanced levels of catalase-peroxidase protein but reduced catalase-peroxidase enzyme activities. Together with the observation that Pln has chaperone activity in vitro, our data suggest that catalase-peroxidase aggregates accumulate in peroxisomes of pln cells due to the combined absence of Pln protease and chaperone activities. PMID:22733816

  17. Mining frequent patterns in protein structures: a study of protease families

    PubMed Central

    Chen, Shann-Ching; Bahar, Ivet

    2005-01-01

    Motivation Analysis of protein sequence and structure databases usually reveal frequent patterns (FP) associated with biological function. Data mining techniques generally consider the physicochemical and structural properties of amino acids and their microenvironment in the folded structures. Dynamics is not usually considered, although proteins are not static, and their function relates to conformational mobility in many cases. Results This work describes a novel unsupervised learning approach to discover FPs in the protein families, based on biochemical, geometric and dynamic features. Without any prior knowledge of functional motifs, the method discovers the FPs for each type of amino acid and identifies the conserved residues in three protease subfamilies; chymotrypsin and subtilisin subfamilies of serine proteases and papain subfamily of cysteine proteases. The catalytic triad residues are distinguished by their strong spatial coupling (high interconnectivity) to other conserved residues. Although the spatial arrangements of the catalytic residues in the two subfamilies of serine proteases are similar, their FPs are found to be quite different. The present approach appears to be a promising tool for detecting functional patterns in rapidly growing structure databases and providing insights in to the relationship among protein structure, dynamics and function. PMID:15262784

  18. Inactivation of the Deg protease family in the cyanobacterium Synechocystis sp. PCC 6803 has impact on the outer cell layers.

    PubMed

    Cheregi, Otilia; Miranda, Hélder; Gröbner, Gerhard; Funk, Christiane

    2015-11-01

    The serine type Deg/HtrA proteases are distributed in a wide range of organisms from Escherichia coli to humans. The cyanobacterium Synechocystis sp. PCC 6803 possesses three Deg protease orthologues: HtrA, HhoA and HhoB. Previously we compared Synechocystis 6803 wild type cells exposed to mild or severe stress conditions with a mutant lacking all three Deg proteases and demonstrated that stress had strong impact on the proteomes and metabolomes. To identify the biochemical processes, which this protease family is involved in, here we compared Synechocystis sp. PCC 6803 wild type cells with a mutant lacking all three Deg proteases grown under normal growth conditions (30°C and 40 μmol photons m(-2) s(-1)). Deletion of the Deg proteases lead to the down-regulation of proteins related to the biosynthesis of outer cell layers (e.g. the GDP mannose 4,6-dehydratase) and affected protein secretion. During the late growth phase of the culture Deg proteases were found to be secreted to the extracellular medium of the Synechocystis sp. PCC 6803 wild type strain. While cyanobacterial Deg proteases seem to act mainly in the periplasmic space, deletion of the three proteases influences the proteome and metabolome of the whole cell. Impairments in the outer cell layers of the triple mutant might explain the higher sensitivity toward light and oxidative stress, which was observed earlier by Barker and coworkers. Copyright © 2015 Elsevier B.V. All rights reserved.

  19. Serotype-Specific Structural Differences in the Protease-Cofactor Complexes of the Dengue Virus Family

    SciTech Connect

    Chandramouli, Sumana; Joseph, Jeremiah S.; Daudenarde, Sophie; Gatchalian, Jovylyn; Cornillez-Ty, Cromwell; Kuhn, Peter

    2010-03-04

    With an estimated 40% of the world population at risk, dengue poses a significant threat to human health, especially in tropical and subtropical regions. Preventative and curative efforts, such as vaccine development and drug discovery, face additional challenges due to the occurrence of four antigenically distinct serotypes of the causative dengue virus (DEN1 to -4). Complex immune responses resulting from repeat assaults by the different serotypes necessitate simultaneous targeting of all forms of the virus. One of the promising targets for drug development is the highly conserved two-component viral protease NS2B-NS3, which plays an essential role in viral replication by processing the viral precursor polyprotein into functional proteins. In this paper, we report the 2.1-{angstrom} crystal structure of the DEN1 NS2B hydrophilic core (residues 49 to 95) in complex with the NS3 protease domain (residues 1 to 186) carrying an internal deletion in the N terminus (residues 11 to 20). While the overall folds within the protease core are similar to those of DEN2 and DEN4 proteases, the conformation of the cofactor NS2B is dramatically different from those of other flaviviral apoprotease structures. The differences are especially apparent within its C-terminal region, implicated in substrate binding. The structure reveals for the first time serotype-specific structural elements in the dengue virus family, with the reported alternate conformation resulting from a unique metal-binding site within the DEN1 sequence. We also report the identification of a 10-residue stretch within NS3pro that separates the substrate-binding function from the catalytic turnover rate of the enzyme. Implications for broad-spectrum drug discovery are discussed.

  20. Human mast cell tryptase: Multiple cDNAs and genes reveal a multigene serine protease family

    SciTech Connect

    Vanderslice, P.; Ballinger, S.M., Tam, E.K.; Goldstein, S.M.; Craik, C.S.; Caughey, G.H. )

    1990-05-01

    Three different cDNAs and a gene encoding human skin mast cell tryptase have been cloned and sequenced in their entirety. The deduced amino acid sequences reveal a 30-amino acid prepropeptide followed by a 245-amino acid catalytic domain. The C-terminal undecapeptide of the human preprosequence is identical in dog tryptase and appears to be part of a prosequence unique among serine proteases. The differences among the three human tryptase catalytic domains include the loss of a consensus N-glycosylation site in one cDNA, which may explain some of the heterogeneity in size and susceptibility to deglycosylation seen in tryptase preparations. All three tryptase cDNAs are distinct from a recently reported cDNA obtained from a human lung mast cell library. A skin tryptase cDNA was used to isolate a human tryptase gene, the exons of which match one of the skin-derived cDNAs. The organization of the {approx}1.8-kilobase-pair tryptase gene is unique and is not closely related to that of any other mast cell or leukocyte serine protease. The 5{prime} regulatory regions of the gene share features with those of other serine proteases, including mast cell chymase, but are unusual in being separated from the protein-coding sequence by an intron. High-stringency hybridization of a human genomic DNA blot with a fragment of the tryptase gene confirms the presence of multiple tryptase genes. These findings provide genetic evidence that human mast cell tryptases are the products of a multigene family.

  1. Human mast cell tryptase: multiple cDNAs and genes reveal a multigene serine protease family.

    PubMed Central

    Vanderslice, P; Ballinger, S M; Tam, E K; Goldstein, S M; Craik, C S; Caughey, G H

    1990-01-01

    Three different cDNAs and a gene encoding human skin mast cell tryptase have been cloned and sequenced in their entirety. The deduced amino acid sequences reveal a 30-amino acid prepropeptide followed by a 245-amino acid catalytic domain. The C-terminal undecapeptide of the human preprosequence is identical in dog tryptase and appears to be part of a prosequence unique among serine proteases. The differences among the three human tryptase catalytic domains include the loss of a consensus N-glycosylation site in one cDNA, which may explain some of the heterogeneity in size and susceptibility to deglycosylation seen in tryptase preparations. All three tryptase cDNAs are distinct from a recently reported cDNA obtained from a human lung mast cell library. A skin tryptase cDNA was used to isolate a human tryptase gene, the exons of which match one of the skin-derived cDNAs. The organization of the approximately 1.8-kilobase-pair tryptase gene is unique and is not closely related to that of any other mast cell or leukocyte serine protease. The 5' regulatory regions of the gene share features with those of other serine proteases, including mast cell chymase, but are unusual in being separated from the protein-coding sequence by an intron. High-stringency hybridization of a human genomic DNA blot with a fragment of the tryptase gene confirms the presence of multiple tryptase genes. These findings provide genetic evidence that human mast cell tryptases are the products of a multigene family. Images PMID:2187193

  2. Untangling structure-function relationships in the rhomboid family of intramembrane proteases.

    PubMed

    Brooks, Cory L; Lemieux, M Joanne

    2013-12-01

    Rhomboid proteases are a family of integral membrane proteins that have been implicated in critical regulatory roles in a wide array of cellular processes and signaling events. The determination of crystal structures of the prokaryotic rhomboid GlpG from Escherichia coli and Haemophilus influenzae has ushered in an era of unprecedented understanding into molecular aspects of intramembrane proteolysis by this fascinating class of protein. A combination of structural studies by X-ray crystallography, and biophysical and spectroscopic analyses, combined with traditional enzymatic and functional analysis has revealed fundamental aspects of rhomboid structure, substrate recognition and the catalytic mechanism. This review summarizes these remarkable advances by examining evidence for the proposed catalytic mechanism derived from inhibitor co-crystal structures, conflicting models of rhomboid-substrate interaction, and recent work on the structure and function of rhomboid cytosolic domains. In addition to exploring progress on aspects of rhomboid structure, areas for future research and unaddressed questions are emphasized and highlighted. This article is part of a Special Issue entitled: Intramembrane Proteases.

  3. Non-erythroid alpha-spectrin breakdown by calpain and interleukin 1 beta-converting-enzyme-like protease(s) in apoptotic cells: contributory roles of both protease families in neuronal apoptosis.

    PubMed Central

    Nath, R; Raser, K J; Stafford, D; Hajimohammadreza, I; Posner, A; Allen, H; Talanian, R V; Yuen, P; Gilbertsen, R B; Wang, K K

    1996-01-01

    The cytoskeletal protein non-erythroid alpha-spectrin is well documented as an endogenous calpain substrate, especially under pathophysiological conditions. In cell necrosis (e.g. maitotoxin-treated neuroblastoma SH-SY5Y cells), alpha-spectrin breakdown products (SBDPs) of 150 kDa and 145 kDa were produced by cellular calpains. In contrast, in neuronal cells undergoing apoptosis (cerebellar granule neurons subjected to low potassium and SH-SY5Y cells treated with staurosporine), an additional SBDP of 120 kDa was also observed. The formation of the 120 kDa SBDP was insensitive to calpain inhibitors but was completely blocked by an interleukin 1 beta-converting-enzyme (ICE)-like protease inhibitor, Z-Asp-CH2OC(O)-2,6-dichlorobenzene. Autolytic activation of both calpain and the ICE homologue CPP32 was also observed in apoptotic cells. alpha-Spectrin can also be cleaved in vitro by purified calpains to produce the SBDP doublet of 150/145 kDa and by ICE and ICE homologues [ICH-1, ICH-2 and CPP32(beta)] to produce a 150 kDa SBDP. In addition, CPP32 and ICE also produced a 120 kDa SBDP. Furthermore inhibition of either ICE-like protease(s) or calpain protects both granule neurons and SH-SY5Y cells against apoptosis. Our results suggest that both protease families participate in the expression of neuronal apoptosis. PMID:8920967

  4. Chymotrypsin protease inhibitor gene family in rice: Genomic organization and evidence for the presence of a bidirectional promoter shared between two chymotrypsin protease inhibitor genes.

    PubMed

    Singh, Amanjot; Sahi, Chandan; Grover, Anil

    2009-01-01

    Protease inhibitors play important roles in stress and developmental responses of plants. Rice genome contains 17 putative members in chymotrypsin protease inhibitor (ranging in size from 7.21 to 11.9 kDa) gene family with different predicted localization sites. Full-length cDNA encoding for a putative subtilisin-chymotrypsin protease inhibitor (OCPI2) was obtained from Pusa basmati 1 (indica) rice seedlings. 620 bp-long OCPI2 cDNA contained 219 bp-long ORF, coding for 72 amino acid-long 7.7 kDa subtilisin-chymotrypsin protease inhibitor (CPI) cytoplasmic protein. Expression analysis by semi-quantitative RT-PCR analysis showed that OCPI2 transcript is induced by varied stresses including salt, ABA, low temperature and mechanical injury in both root and shoot tissues of the seedlings. Transgenic rice plants produced with OCPI2 promoter-gus reporter gene showed that this promoter directs high salt- and ABA-regulated expression of the GUS gene. Another CPI gene (OCPI1) upstream to OCPI2 (with 1126 bp distance between the transcription initiation sites of the two genes; transcription in the reverse orientation) was noted in genome sequence of rice genome. A vector that had GFP and GUS reporter genes in opposite orientations driven by 1881 bp intergenic sequence between the OCPI2 and OCPI1 (encompassing the region between the translation initiation sites of the two genes) was constructed and shot in onion epidermal cells by particle bombardment. Expression of both GFP and GUS from the same epidermal cell showed that this sequence represents a bidirectional promoter. Examples illustrating gene pairs showing co-expression of two divergent neighboring genes sharing a bidirectional promoter have recently been extensively worked out in yeast and human systems. We provide an example of a gene pair constituted of two homologous genes showing co-expression governed by a bidirectional promoter in rice.

  5. Identification of cysteine protease inhibitors that belong to cystatin family 1 in the cellular slime mold Dictyostelium discoideum.

    PubMed

    El-Halawany, Medhat S; Ohkouchi, Susumu; Shibata, Hideki; Hitomi, Kiyotaka; Maki, Masatoshi

    2004-06-01

    Family 1 cystatins are cytosolic inhibitors of cysteine proteases, and they are conserved in higher eukaryotes. We characterized two newly identified family 1 cystatins of the cellular slime mold Dictyostelium discoideum, cystatin A1 and A2. Their recombinant proteins showed specific inhibitory activity against papain and cathepsin B, respectively. Using specific polyclonal antibodies, we found that cystatin A1 is stably expressed throughout the life cycle of Dictyostelium, whereas cystatin A2 expression is up-regulated during the course of development.

  6. Inhibition of interleukin 1β converting enzyme family proteases reduces ischemic and excitotoxic neuronal damage

    PubMed Central

    Hara, Hideaki; Friedlander, Robert M.; Gagliardini, Valeria; Ayata, Cenk; Fink, Klaus; Huang, Zhihong; Shimizu-Sasamata, Masao; Yuan, Junying; Moskowitz, Michael A.

    1997-01-01

    The interleukin 1β converting enzyme (ICE) family plays a pivotal role in programmed cell death and has been implicated in stroke and neurodegenerative diseases. During reperfusion after filamentous middle cerebral artery occlusion, ICE-like cleavage products and tissue immunoreactive interleukin 1β (IL-1β) levels increased in ischemic mouse brain. Ischemic injury decreased after intracerebroventricular injections of ICE-like protease inhibitors, N-benzyloxycarbonyl-Val-Ala-Asp-fluoromethylketone (z-VAD.FMK), acetyl-Tyr-Val-Ala-Asp-chloromethylketone, or a relatively selective inhibitor of CPP32-like caspases, N-benzyloxycarbonyl-Asp-Glu-Val-Asp-fluoromethylketone, but not a cathepsin B inhibitor, N-benzyloxycarbonyl-Phe-Ala-fluoromethylketone. z-VAD.FMK decreased ICE-like cleavage products and tissue immunoreactive IL-1β levels in ischemic mouse brain and reduced tissue damage when administered to rats as well. Only z-VAD.FMK and acetyl-Tyr-Val-Ala-Asp-chloromethylketone reduced brain swelling, and N-benzyloxycarbonyl-Asp-Glu-Val-Asp-fluoromethylketone did not attenuate the ischemia-induced increase in tissue IL-1β levels. The three cysteine protease inhibitors significantly improved behavioral deficits, thereby showing that functional recovery of ischemic neuronal tissue can follow blockade of enzymes associated with apoptotic cell death. Finally, we examined the effect of z-VAD.FMK on excitotoxicity and found that it protected against α-amino-3-hydroxy-5-methyl-4-isoxazole propionate-induced or to a lesser extent N-methyl-d-aspartate-induced excitotoxic brain damage. Thus, ICE-like and CPP32-like caspases contribute to mechanisms of cell death in ischemic and excitotoxic brain injury and provide therapeutic targets for stroke and neurodegenerative brain damage. PMID:9050895

  7. Novel IgG-Degrading Enzymes of the IgdE Protease Family Link Substrate Specificity to Host Tropism of Streptococcus Species.

    PubMed

    Spoerry, Christian; Hessle, Pontus; Lewis, Melanie J; Paton, Lois; Woof, Jenny M; von Pawel-Rammingen, Ulrich

    2016-01-01

    Recently we have discovered an IgG degrading enzyme of the endemic pig pathogen S. suis designated IgdE that is highly specific for porcine IgG. This protease is the founding member of a novel cysteine protease family assigned C113 in the MEROPS peptidase database. Bioinformatical analyses revealed putative members of the IgdE protease family in eight other Streptococcus species. The genes of the putative IgdE family proteases of S. agalactiae, S. porcinus, S. pseudoporcinus and S. equi subsp. zooepidemicus were cloned for production of recombinant protein into expression vectors. Recombinant proteins of all four IgdE family proteases were proteolytically active against IgG of the respective Streptococcus species hosts, but not against IgG from other tested species or other classes of immunoglobulins, thereby linking the substrate specificity to the known host tropism. The novel IgdE family proteases of S. agalactiae, S. pseudoporcinus and S. equi showed IgG subtype specificity, i.e. IgdE from S. agalactiae and S. pseudoporcinus cleaved human IgG1, while IgdE from S. equi was subtype specific for equine IgG7. Porcine IgG subtype specificities of the IgdE family proteases of S. porcinus and S. pseudoporcinus remain to be determined. Cleavage of porcine IgG by IgdE of S. pseudoporcinus is suggested to be an evolutionary remaining activity reflecting ancestry of the human pathogen to the porcine pathogen S. porcinus. The IgG subtype specificity of bacterial proteases indicates the special importance of these IgG subtypes in counteracting infection or colonization and opportunistic streptococci neutralize such antibodies through expression of IgdE family proteases as putative immune evasion factors. We suggest that IgdE family proteases might be valid vaccine targets against streptococci of both human and veterinary medical concerns and could also be of therapeutic as well as biotechnological use.

  8. Aeromonas sobria serine protease (ASP): a subtilisin family endopeptidase with multiple virulence activities.

    PubMed

    Imamura, Takahisa; Murakami, Yoji; Nitta, Hidetoshi

    2017-09-26

    Aeromonas sobria serine protease (ASP) is secreted from Aeromonas sobria, a pathogen causing gastroenteritis and sepsis. ASP resembles Saccharomyces cerevisiae Kex2, a member of the subtilisin family, and preferentially cleaves peptide bonds at the C-terminal side of paired basic amino acid residues; also accepting unpaired arginine at the P1 site. Unlike Kex2, however, ASP lacks an intramolecular chaperone N-terminal propeptide, instead utilizes the external chaperone ORF2 for proper folding, therefore, ASP and its homologues constitute a new subfamily in the subtilisin family. Through activation of the kallikrein/kinin system, ASP induces vascular leakage, and presumably causes edema and septic shock. ASP accelerates plasma clotting by α-thrombin generation from prothrombin, whereas it impairs plasma clottability by fibrinogen degradation, together bringing about blood coagulation disorder that occurs in disseminated intravascular coagulation, a major complication of sepsis. From complement C5 ASP liberates C5a that induces neutrophil recruitment and superoxide release, and mast cell degranulation, which are associated with pus formation, tissue injury and diarrhea, respectively. Nicked two-chain ASP also secreted from A. sobria is more resistant to inactivation by α2-macroglobulin than single-chain ASP, thereby raising virulence activities. Thus, ASP is a potent virulence factor and may participate in the pathogenesis of A. sobria infection.

  9. Phylogenetic distribution of protease inhibitors of the Kazal-family within the Arthropoda.

    PubMed

    van Hoef, Vincent; Breugelmans, Bert; Spit, Jornt; Simonet, Gert; Zels, Sven; Vanden Broeck, Jozef

    2013-03-01

    In mammalian pancreatic cells, the pancreatic secretory trypsin inhibitor (PSTI) belonging to the Kazal-family prevents the premature activation of digestive enzymes and thus plays an important role in a protective mechanism against tissue destruction by autophagy. Although a similar protective mechanism exists in Arthropoda, the distribution of these inhibitors in this phylum remains obscure. A comprehensive in silico search of nucleotide databases, revealed the presence of members of the Kazal-family in the four major subphyla of the Arthropoda. Especially in the Hexapoda and the Crustacea these inhibitors are widespread, while in the Chelicerata and Myriapoda only a few Kazal-like protease inhibitors were found. A sequence alignment of inhibitors retrieved in the digestive system of insects revealed a conservation of the PSTI characteristics and strong resemblance to vertebrate PSTI. A phylogenetic analysis of these inhibitors showed that they generally cluster according to their order. The results of this data mining study provide new evidence for the existence of an ancient protective mechanism in metazoan digestive systems. Kazal-like inhibitors, which play an important protective role in the pancreas of vertebrates, also seem to be present in Arthropoda.

  10. Development of activity-based probes for trypsin-family serine proteases.

    PubMed

    Pan, Zhengying; Jeffery, Douglas A; Chehade, Kareem; Beltman, Jerlyn; Clark, James M; Grothaus, Paul; Bogyo, Matthew; Baruch, Amos

    2006-06-01

    A series of diphenylphosphonate-based probes were developed for the trypsin-like serine proteases. These probes selectively target serine proteases rather than general serine hydrolases that are targets for fluorophosphonate-based probes. This increased selectivity allows detection of low abundance serine proteases in complex proteomes using simple SDS-PAGE methods. We present here the application of multiple probes in enzyme activity profiling of intact mast cells, a type of inflammatory cell implicated in allergy and autoimmune diseases.

  11. Purification of human von Willebrand factor-cleaving protease and its identification as a new member of the metalloproteinase family.

    PubMed

    Fujikawa, K; Suzuki, H; McMullen, B; Chung, D

    2001-09-15

    von Willebrand factor (vWF) is synthesized in megakaryocytes and endothelial cells as a very large multimer, but circulates in plasma as a group of multimers ranging from 500 to 10 000 kd. An important mechanism for depolymerization of the large multimers is the limited proteolysis by a vWF-cleaving protease present in plasma. The absence or inactivation of the vWF-cleaving protease results in the accumulation of large multimers, which may cause thrombotic thrombocytopenic purpura. The vWF-cleaving protease was first described as a Ca(++)-dependent proteinase with an apparent molecular weight of approximately 300 kd. Thus far, however, it has not been isolated and characterized. In this study, the purification of human vWF-cleaving protease from a commercial preparation of factor VIII/vWF concentrate by means of several column chromatographic steps, including 2 steps of heparin-Sepharose column, is reported. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis analysis of the anion exchange and gel filtration column fractions showed that the vWF-cleaving protease activity corresponded to a protein band of 150 kd. After reduction, it migrated with an apparent weight of 190 kd. The amino terminal sequence of the 150-kd band was AAGGIL(H)LE(L)L(D)AXG(P)X(V)XQ (single-letter amino acid codes), with the tentative residues shown in parentheses. A search of the human genome sequence identified the vWF-cleaving protease as a new member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin type I motif) family of metalloproteinase. An active site sequence of HEIGHSFGLEHE (single-letter amino acid codes) was located at 150 residues from the N terminus of the protein.

  12. The ADAMs family of proteases: new biomarkers and therapeutic targets for cancer?

    PubMed Central

    2011-01-01

    The ADAMs are transmembrane proteins implicated in proteolysis and cell adhesion. Forty gene members of the family have been identified, of which 21 are believed to be functional in humans. As proteases, their main substrates are the ectodomains of other transmembrane proteins. These substrates include precursor forms of growth factors, cytokines, growth factor receptors, cytokine receptors and several different types of adhesion molecules. Although altered expression of specific ADAMs has been implicated in different diseases, their best-documented role is in cancer formation and progression. ADAMs shown to play a role in cancer include ADAM9, ADAM10, ADAM12, ADAM15 and ADAM17. Two of the ADAMs, i.e., ADAM10 and 17 appear to promote cancer progression by releasing HER/EGFR ligands. The released ligands activate HER/EGFR signalling that culminates in increased cell proliferation, migration and survival. Consistent with a causative role in cancer, several ADAMs are emerging as potential cancer biomarkers for aiding cancer diagnosis and predicting patient outcome. Furthermore, a number of selective ADAM inhibitors, especially against ADAM10 and ADAM17, have been shown to have anti-cancer effects. At least one of these inhibitors is now undergoing clinical trials in patients with breast cancer. PMID:21906355

  13. [Proprotein convertases - family of serine proteases with a broad spectrum of physiological functions].

    PubMed

    Małuch, Izabela; Walewska, Aleksandra; Sikorska, Emilia; Prahl, Adam

    2016-01-01

    A large group of secretory proteins involved in proper functioning of living organisms, is synthesized as inactive precursor molecules. Their biologically active forms are obtained as a result of numerous post-translational modifications. Some of these processes occur irreversibly, permanently changing the initial compound structure. An example of such modifications is catalytic treatment of proteins performed by proteolytic enzymes. Among five separate classes of these enzymes, the most numerous are serine proteases. Mammalian proprotein convertases (PCs), which include: furin, PC1/3, PC2, PACE4, PC4, PC5/6, PC7, PCSK9, SKI-1, represent serine endoproteases family. PCs play a key role in the activation of a number of precursor proteins causing formation of biologically active forms of enzymes, hormones, signaling molecules, transcription and growth factors. This article summarizes current state of knowledge on biosynthesis, structure and substrate specificity of PCs, identifies the relationship between location and intracellular activity of these enzymes, and their physiological functions in mammals.

  14. A repertoire of protease inhibitor families in Amblyomma americanum and other tick species: inter-species comparative analyses.

    PubMed

    Porter, Lindsay M; Radulović, Željko M; Mulenga, Albert

    2017-03-22

    Protease inhibitors (PIs) are important regulators of physiology and represent anti-parasitic druggable and vaccine targets. We conducted bioinformatic analyses of genome and transcriptome data to determine the protease inhibitor (PI) repertoire in Amblyomma americanum and in 25 other ixodid tick species. For A. americanum, we compared the PI repertoires in fed and unfed, male and female A. americanum ticks. We also analyzed PI repertoires of female 48, 96 and 120 h-fed midgut (MG) and salivary gland (SG) tissues. We found 1,595 putative non-redundant PI sequences across 26 ixodid tick species. Ticks express PIs from at least 18 different families: I1, I2, I4, I8, I21, I25, I29, I31, I32, I35, I39, I43, I51, I53, I63, I68, I72 and I74 (MEROPS). The largest PI families were I2, I4 and I8 and lowest in I21, I31, I32, I35 and I68. The majority (75%) of tick PIs putatively inhibit serine proteases, with ~11 and 9% putatively regulating cysteine or metalloprotease-mediated pathways, respectively, and ~4% putatively regulating multiple/mixed protease types. In A. americanum, we found 370 PIs in female and 354 in male ticks. In A. americanum we found 231 and 442 in unfed and fed ticks, respectively. In females, we found 206 and 164 PIs in SG and MG, respectively. The majority of highly cross-tick species conserved PIs were in families I1, I2, I8, I21, I25, I29, I39 and I43. Ticks appear to express large and diverse repertoires of PIs that primarily target serine protease-mediated pathways. We speculate that PI families with the highest repertoires may contain functionally redundant members while those with the lowest repertoires are functionally non-redundant PIs. We found some highly conserved PIs in the latter category, which we propose as potential candidates for broad-spectrum anti-tick vaccine candidates or druggable targets in tick control.

  15. Characterization of the entire cystatin gene family in barley and their target cathepsin L-like cysteine-proteases, partners in the hordein mobilization during seed germination.

    PubMed

    Martinez, Manuel; Cambra, Ines; Carrillo, Laura; Diaz-Mendoza, Mercedes; Diaz, Isabel

    2009-11-01

    Plant cystatins are inhibitors of cysteine-proteases of the papain C1A and legumain C13 families. Cystatin data from multiple plant species have suggested that these inhibitors act as defense proteins against pests and pathogens and as regulators of protein turnover. In this study, we characterize the entire cystatin gene family from barley (Hordeum vulgare), which contain 13 nonredundant genes, and identify and characterize their target enzymes, the barley cathepsin L-like proteases. Cystatins and proteases were expressed and purified from Escherichia coli cultures. Each cystatin was found to have different inhibitory capability against barley cysteine-proteases in in vitro inhibitory assays using specific substrates. Real-time reverse transcription-polymerase chain reaction revealed that inhibitors and enzymes present a wide variation in their messenger RNA expression patterns. Their transcripts were mainly detected in developing and germinating seeds, and some of them were also expressed in leaves and roots. Subcellular localization of cystatins and cathepsin L-like proteases fused to green fluorescent protein demonstrated the presence of both protein families throughout the endoplasmic reticulum and the Golgi complex. Proteases and cystatins not only colocalized but also interacted in vivo in the plant cell, as revealed by bimolecular fluorescence complementation. The functional relationship between cystatins and cathepsin L-like proteases was inferred from their common implication as counterparts of mobilization of storage proteins upon barley seed germination. The opposite pattern of transcription expression in gibberellin-treated aleurones presented by inhibitors and enzymes allowed proteases to specifically degrade B, C, and D hordeins stored in the endosperm of barley seeds.

  16. Structural definition and substrate specificity of the S28 protease family: the crystal structure of human prolylcarboxypeptidase.

    PubMed

    Soisson, Stephen M; Patel, Sangita B; Abeywickrema, Pravien D; Byrne, Noel J; Diehl, Ronald E; Hall, Dawn L; Ford, Rachael E; Reid, John C; Rickert, Keith W; Shipman, Jennifer M; Sharma, Sujata; Lumb, Kevin J

    2010-06-11

    The unique S28 family of proteases is comprised of the carboxypeptidase PRCP and the aminopeptidase DPP7. The structural basis of the different substrate specificities of the two enzymes is not understood nor has the structure of the S28 fold been described. The experimentally phased 2.8 A crystal structure is presented for human PRCP. PRCP contains an alpha/beta hydrolase domain harboring the catalytic Asp-His-Ser triad and a novel helical structural domain that caps the active site. Structural comparisons with prolylendopeptidase and DPP4 identify the S1 proline binding site of PRCP. A structure-based alignment with the previously undescribed structure of DPP7 illuminates the mechanism of orthogonal substrate specificity of PRCP and DPP7. PRCP has an extended active-site cleft that can accommodate proline substrates with multiple N-terminal residues. In contrast, the substrate binding groove of DPP7 is occluded by a short amino-acid insertion unique to DPP7 that creates a truncated active site selective for dipeptidyl proteolysis of N-terminal substrates. The results define the structure of the S28 family of proteases, provide the structural basis of PRCP and DPP7 substrate specificity and enable the rational design of selective PRCP modulators.

  17. Cysteine protease-binding protein family 6 mediates the trafficking of amylases to phagosomes in the enteric protozoan Entamoeba histolytica.

    PubMed

    Furukawa, Atsushi; Nakada-Tsukui, Kumiko; Nozaki, Tomoyoshi

    2013-05-01

    Phagocytosis plays a pivotal role in nutrient acquisition and evasion from the host defense systems in Entamoeba histolytica, the intestinal protozoan parasite that causes amoebiasis. We previously reported that E. histolytica possesses a unique class of a hydrolase receptor family, designated the cysteine protease-binding protein family (CPBF), that is involved in trafficking of hydrolases to lysosomes and phagosomes, and we have also reported that CPBF1 and CPBF8 bind to cysteine proteases or β-hexosaminidase α-subunit and lysozymes, respectively. In this study, we showed by immunoprecipitation that CPBF6, one of the most highly expressed CPBF proteins, specifically binds to α-amylase and γ-amylase. We also found that CPBF6 is localized in lysosomes, based on immunofluorescence imaging. Immunoblot and proteome analyses of the isolated phagosomes showed that CPBF6 mediates transport of amylases to phagosomes. We also demonstrated that the carboxyl-terminal cytosolic region of CPBF6 is engaged in the regulation of the trafficking of CPBF6 to phagosomes. Our proteome analysis of phagosomes also revealed new potential phagosomal proteins.

  18. Comparison of the activation peptide regions of protease-activated receptors (PAR) in members of the Family Felidae.

    PubMed

    Boudreaux, Mary K; Barnes, Sara Madison

    2016-09-01

    There is limited information regarding the nucleotides encoding or the predicted amino acid composition of protease-activated receptors (PAR) in cats. The purpose of the study was to determine the nucleotide sequence and predicted amino acid composition of the activation peptide regions of protease-activated receptors PAR1, PAR3, and PAR4 in Felidae family members. Genomic DNA isolated from whole blood samples collected from 10 domestic cats and 45 big cats representing 11 species was subjected to PCR using primers flanking the coding regions for the activation peptides of PAR1, PAR3, and PAR4. PCR products were isolated from agarose gels and submitted for sequencing. Nucleotide sequence data was used to predict the amino acid composition of the activation peptide and flanking regions of the 3 receptors. Predicted amino acid sequences were compared between Felidae members and to human beings. Variations in the predicted amino acid composition of the activation peptides and flanking regions of the various PAR were observed when comparing Felidae family members to each other and to human beings. While the activation peptide regions of the various PAR tend to be conserved, there are differences that may impact the ability of some agonists to mediate biased signaling events documented to occur in human platelets. © 2016 American Society for Veterinary Clinical Pathology.

  19. Cysteine Protease-Binding Protein Family 6 Mediates the Trafficking of Amylases to Phagosomes in the Enteric Protozoan Entamoeba histolytica

    PubMed Central

    Furukawa, Atsushi; Nakada-Tsukui, Kumiko

    2013-01-01

    Phagocytosis plays a pivotal role in nutrient acquisition and evasion from the host defense systems in Entamoeba histolytica, the intestinal protozoan parasite that causes amoebiasis. We previously reported that E. histolytica possesses a unique class of a hydrolase receptor family, designated the cysteine protease-binding protein family (CPBF), that is involved in trafficking of hydrolases to lysosomes and phagosomes, and we have also reported that CPBF1 and CPBF8 bind to cysteine proteases or β-hexosaminidase α-subunit and lysozymes, respectively. In this study, we showed by immunoprecipitation that CPBF6, one of the most highly expressed CPBF proteins, specifically binds to α-amylase and γ-amylase. We also found that CPBF6 is localized in lysosomes, based on immunofluorescence imaging. Immunoblot and proteome analyses of the isolated phagosomes showed that CPBF6 mediates transport of amylases to phagosomes. We also demonstrated that the carboxyl-terminal cytosolic region of CPBF6 is engaged in the regulation of the trafficking of CPBF6 to phagosomes. Our proteome analysis of phagosomes also revealed new potential phagosomal proteins. PMID:23509141

  20. Determinants of Affinity and Proteolytic Stability in Interactions of Kunitz Family Protease Inhibitors with Mesotrypsin

    SciTech Connect

    M Salameh; A Soares; D Navaneetham; D Sinha; P Walsh; E Radisky

    2011-12-31

    An important functional property of protein protease inhibitors is their stability to proteolysis. Mesotrypsin is a human trypsin that has been implicated in the proteolytic inactivation of several protein protease inhibitors. We have found that bovine pancreatic trypsin inhibitor (BPTI), a Kunitz protease inhibitor, inhibits mesotrypsin very weakly and is slowly proteolyzed, whereas, despite close sequence and structural homology, the Kunitz protease inhibitor domain of the amyloid precursor protein (APPI) binds to mesotrypsin 100 times more tightly and is cleaved 300 times more rapidly. To define features responsible for these differences, we have assessed the binding and cleavage by mesotrypsin of APPI and BPTI reciprocally mutated at two nonidentical residues that make direct contact with the enzyme. We find that Arg at P{sub 1} (versus Lys) favors both tighter binding and more rapid cleavage, whereas Met (versus Arg) at P'{sub 2} favors tighter binding but has minimal effect on cleavage. Surprisingly, we find that the APPI scaffold greatly enhances proteolytic cleavage rates, independently of the binding loop. We draw thermodynamic additivity cycles analyzing the interdependence of P{sub 1} and P'{sub 2} substitutions and scaffold differences, finding multiple instances in which the contributions of these features are nonadditive. We also report the crystal structure of the mesotrypsin-APPI complex, in which we find that the binding loop of APPI displays evidence of increased mobility compared with BPTI. Our data suggest that the enhanced vulnerability of APPI to mesotrypsin cleavage may derive from sequence differences in the scaffold that propagate increased flexibility and mobility to the binding loop.

  1. Determinants of Affinity and Proteolytic Stability in Interactions of Kunitz Family Protease Inhibitors with Mesotrypsin

    SciTech Connect

    Salameh, M.A.; Soares, A.; Navaneetham, D.; Sinha, D.; Walsh, P. N.; Radisky, E. S.

    2010-11-19

    An important functional property of protein protease inhibitors is their stability to proteolysis. Mesotrypsin is a human trypsin that has been implicated in the proteolytic inactivation of several protein protease inhibitors. We have found that bovine pancreatic trypsin inhibitor (BPTI), a Kunitz protease inhibitor, inhibits mesotrypsin very weakly and is slowly proteolyzed, whereas, despite close sequence and structural homology, the Kunitz protease inhibitor domain of the amyloid precursor protein (APPI) binds to mesotrypsin 100 times more tightly and is cleaved 300 times more rapidly. To define features responsible for these differences, we have assessed the binding and cleavage by mesotrypsin of APPI and BPTI reciprocally mutated at two nonidentical residues that make direct contact with the enzyme. We find that Arg at P{sub 1} (versus Lys) favors both tighter binding and more rapid cleavage, whereas Met (versus Arg) at P'{sub 2} favors tighter binding but has minimal effect on cleavage. Surprisingly, we find that the APPI scaffold greatly enhances proteolytic cleavage rates, independently of the binding loop. We draw thermodynamic additivity cycles analyzing the interdependence of P1 and P'{sub 2} substitutions and scaffold differences, finding multiple instances in which the contributions of these features are nonadditive. We also report the crystal structure of the mesotrypsin {center_dot} APPI complex, in which we find that the binding loop of APPI displays evidence of increased mobility compared with BPTI. Our data suggest that the enhanced vulnerability of APPI to mesotrypsin cleavage may derive from sequence differences in the scaffold that propagate increased flexibility and mobility to the binding loop.

  2. The HtrA/DegP family protease MamE is a bifunctional protein with roles in magnetosome protein localization and magnetite biomineralization

    PubMed Central

    Quinlan, Anna; Murat, Dorothée; Vali, Hojatollah; Komeili, Arash

    2011-01-01

    Summary Magnetotactic bacteria contain nanometer-sized, membrane-bound organelles, called magnetosomes, which are tasked with the biomineralization of small crystals of the iron oxide magnetite allowing the organism to use geomagnetic field lines for navigation. A key player in this process is the HtrA/DegP family protease MamE. In its absence, Magnetospirillum magneticum str AMB-1 is able to form magnetosome membranes but not magnetite crystals, a defect previously linked to the mislocalization of magnetosome proteins. In this work we use a directed genetic approach to find that MamE, and another predicted magnetosome-associated protease, MamO, likely function as proteases in vivo. However, as opposed to the complete loss of mamE where no biomineralization is observed, the protease-deficient variant of this protein still supports the initiation and formation of small, 20 nm-sized crystals of magnetite, too small to hold a permanent magnetic dipole moment. This analysis also reveals that MamE is a bifunctional protein with a protease-independent role in magnetosome protein localization and a protease-dependent role in maturation of small magnetite crystals. Together these results imply the existence of a previously unrecognized “checkpoint” in biomineralization where MamE moderates the completion of magnetite formation and thus committal to magneto-aerotaxis as the organism’s dominant mode of navigating the environment. PMID:21414040

  3. Crystallization and preliminary crystallographic studies of human kallikrein 7, a serine protease of the multigene kallikrein family

    PubMed Central

    Fernández, Israel S.; Ständker, Ludger; Forssmann, Wolf-Georg; Giménez-Gallego, Guillermo; Romero, Antonio

    2007-01-01

    Human kallikreins are a group of serine proteases of high sequence homology whose genes are grouped as a single cluster at chromosome 19. Although the physiological roles of kallikreins are generally still unknown, members of the kallikrein family have been clearly implicated in pathological situations such as cancer and psoriasis. Human kallikrein 7 (hK7) has been shown to be involved in pathological keratinization, psoriasis and ovarian cancer. In order to gain insight into the molecular structure of this protein, hK7 was crystallized after recombinant production in its folded and active form using a periplasmic secretion vector in Escherichia coli. The crystals belonged to the rhombohedral space group H32 and diffracted to 2.8 Å. The phase problem was solved by molecular replacement using the mouse kallikrein-related protein neuropsin. Completion of the model and structure refinement are under way. PMID:17671364

  4. Identification of cvSI-3 and evidence for the wide distribution and active evolution of the I84 family of protease inhibitors in mollusks.

    PubMed

    Xue, Qinggang; Beguel, Jean-Phillipe; Gauthier, Julie; La Peyre, Jerome

    2017-03-01

    Protease inhibitors are an extremely diverse group of proteins that control the proteolytic activities of proteases and play a crucial role in biological processes including host defenses. The I84 family of protease inhibitors in the MEROPS database currently consists of cvSI-1 and cvSI-2, two novel serine protease inhibitors purified and characterized from the eastern oyster Crassostrea virginica plasma and believed to play a role in host defense and disease resistance. In the present study, a third member of I84 family, named cvSI-3, was identified from C. virginica by cDNA cloning and sequencing. The full cvSI-3 cDNA was composed of 342 bp including a 255 bp open reading frame (ORF) that encodes an 84-amino acid peptide. The mature cvSI-3 molecule was predicted to have 68 amino acid residues after removal of a 16-amino acid signal peptide, with a calculated molecular mass of 7724.5 Da and a theoretical isoelectric point (pI) of 6.28. CvSI-3 amino acid sequence shared 41% identity with cvSI-2 and 37% identity with cvSI-1, which included 12 conserved cysteines. Quantitative real-time PCR determined that cvSI-3 gene expressed primarily in oyster digestive glands. Real-time PCR also detected that cvSI-1, cvSI-2 and cvSI-3 expression levels in digestive glands varied significantly, with cvSI-2 showing the highest expression level and cvSI-3 the lowest. Additionally, a significant correlation was detected between cvSI-2 and cvSI-3 mRNAs levels. Searches into sequence databases using cvSI-1, cvSI-2 and cvSI-3 as queries retrieved ESTs suggesting the possible existence of at least 9 more I84 family members in eastern oysters and of I84 family protease inhibitors in various bivalve and gastropod species. Moreover, orthologs of all C. virginica I84 family members or potential member genes were found to be present in the C. gigas genome, and their distributions among species provided important information about the evolution of the I84 family of protease inhibitors. It

  5. A Genomic Analysis of Rat Proteases and Protease Inhibitors

    PubMed Central

    Puente, Xose S.; López-Otín, Carlos

    2004-01-01

    Proteases perform important roles in multiple biological and pathological processes. The availability of the rat genome sequence has facilitated the analysis of the complete protease repertoire or degradome of this model organism. The rat degradome consists of at least 626 proteases and homologs, which are distributed into 24 aspartic, 160 cysteine, 192 metallo, 221 serine, and 29 threonine proteases. This distribution is similar to that of the mouse degradome but is more complex than that of the human degradome composed of 561 proteases and homologs. This increased complexity of rat proteases mainly derives from the expansion of several families, including placental cathepsins, testases, kallikreins, and hematopoietic serine proteases, involved in reproductive or immunological functions. These protease families have also evolved differently in rat and mouse and may contribute to explain some functional differences between these closely related species. Likewise, genomic analysis of rat protease inhibitors has shown some differences with mouse protease inhibitors and the expansion of families of cysteine and serine protease inhibitors in rodents with respect to human. These comparative analyses may provide new views on the functional diversity of proteases and inhibitors and contribute to the development of innovative strategies for treating proteolysis diseases. PMID:15060002

  6. Loss-of-function analyses defines vital and redundant functions of the Plasmodium rhomboid protease family.

    PubMed

    Lin, Jing-Wen; Meireles, Patrícia; Prudêncio, Miguel; Engelmann, Sabine; Annoura, Takeshi; Sajid, Mohammed; Chevalley-Maurel, Séverine; Ramesar, Jai; Nahar, Carolin; Avramut, Cristina M C; Koster, Abraham J; Matuschewski, Kai; Waters, Andrew P; Janse, Chris J; Mair, Gunnar R; Khan, Shahid M

    2013-04-01

    Rhomboid-like proteases cleave membrane-anchored proteins within their transmembrane domains. In apicomplexan parasites substrates include molecules that function in parasite motility and host cell invasion. While two Plasmodium rhomboids, ROM1 and ROM4, have been examined, the roles of the remaining six rhomboids during the malaria parasite's life cycle are unknown. We present systematic gene deletion analyses of all eight Plasmodium rhomboid-like proteins as a means to discover stage-specific phenotypes and potential functions in the rodent malaria model, P. berghei. Four rhomboids (ROM4, 6, 7 and 8) are refractory to gene deletion, suggesting an essential role during asexual blood stage development. In contrast ROM1, 3, 9 and 10 were dispensable for blood stage development and exhibited no, subtle or severe defects in mosquito or liver development. Parasites lacking ROM9 and ROM10 showed no major phenotypic defects. Parasites lacking ROM1 presented a delay in blood stage patency following liver infection, but in contrast to a previous study blood stage parasites had similar growth and virulence characteristics as wild type parasites. Parasites lacking ROM3 in mosquitoes readily established oocysts but failed to produce sporozoites. ROM3 is the first apicomplexan rhomboid identified to play a vital role in sporogony.

  7. Towards Delineating Functions within the Fasciola Secreted Cathepsin L Protease Family by Integrating In Vivo Based Sub-Proteomics and Phylogenetics

    PubMed Central

    Morphew, Russell M.; Wright, Hazel A.; LaCourse, E. James; Porter, Joanne; Barrett, John; Woods, Debra J.; Brophy, Peter M.

    2011-01-01

    Background Fasciola hepatica, along with Fasciola gigantica, is the causative agent of fasciolosis, a foodborne zoonotic disease affecting grazing animals and humans worldwide. Pathology is directly related to the release of parasite proteins that facilitate establishment within the host. The dominant components of these excretory-secretory (ES) products are also the most promising vaccine candidates, the cathepsin L (Cat L) protease family. Methodology/Principal Findings The sub-proteome of Cat L proteases from adult F. hepatica ES products derived from in vitro culture and in vivo from ovine host bile were compared by 2-DE. The individual Cat L proteases were identified by tandem mass spectrometry with the support of an in-house translated liver fluke EST database. The study reveals plasticity within the CL1 clade of Cat L proteases; highlighted by the identification of a novel isoform and CL1 sub-clade, resulting in a new Cat L phylogenetic analysis including representatives from other adult Cat L phylogenetic clades. Additionally, for the first time, mass spectrometry was shown to be sufficiently sensitive to reveal single amino acid polymorphisms in a resolved 2-DE protein spot derived from pooled population samples. Conclusions/Significance We have investigated the sub-proteome at the population level of a vaccine target family using the Cat L proteases from F. hepatica as a case study. We have confirmed that F. hepatica exhibits more plasticity in the expression of the secreted CL1 clade of Cat L proteases at the protein level than previously realised. We recommend that superfamily based vaccine discovery programmes should screen parasite populations from different host populations and, if required, different host species via sub-proteomic assay in order to confirm the relative expression at the protein level prior to the vaccine development phase. PMID:21245911

  8. The gene encoding DRAP (BACE2), a glycosylated transmembrane protein of the aspartic protease family, maps to the down critical region.

    PubMed

    Acquati, F; Accarino, M; Nucci, C; Fumagalli, P; Jovine, L; Ottolenghi, S; Taramelli, R

    2000-02-18

    We applied cDNA selection methods to a genomic clone (YAC 761B5) from chromosome 21 located in the so-called 'Down critical region' in 21q22.3. Starting from human fetal heart and brain mRNAs we obtained and sequenced several cDNA clones. One of these clones (Down region aspartic protease (DRAP), named also BACE2 according to the gene nomenclature) revealed a striking nucleotide and amino acid sequence identity with several motifs present in members of the aspartic protease family. In particular the amino acid sequences comprising the two catalytic sites found in all mammalian aspartic proteases are perfectly conserved. Interestingly, the predicted protein shows a typical membrane spanning region; this is at variance with most other known aspartic proteases, which are soluble molecules. We present preliminary evidence, on the basis of in vitro translation studies and cell transfection, that this gene encodes a glycosylated protein which localizes mainly intracellularly but to some extent also to the plasma membrane. Furthermore DRAP/BACE2 shares a high homology with a newly described beta-secretase enzyme (BACE-1) which is a transmembrane aspartic protease. The implications of this finding for Down syndrome are discussed.

  9. Antimicrobial peptide inhibition of fungalysin proteases that target plant type 19 Family IV defense chitinases

    USDA-ARS?s Scientific Manuscript database

    Cereal crops and other plants produce secreted seed chitinases that reduce pathogenic infection, most likely by targeting the fungal chitinous cell wall. We have shown that corn (Zea mays) produces three GH family 19, plant class IV chitinases, that help in protecting the plant against Fusarium and ...

  10. GlyGly-CTERM and Rhombosortase: A C-Terminal Protein Processing Signal in a Many-to-One Pairing with a Rhomboid Family Intramembrane Serine Protease

    PubMed Central

    Haft, Daniel H.; Varghese, Neha

    2011-01-01

    The rhomboid family of serine proteases occurs in all domains of life. Its members contain at least six hydrophobic membrane-spanning helices, with an active site serine located deep within the hydrophobic interior of the plasma membrane. The model member GlpG from Escherichia coli is heavily studied through engineered mutant forms, varied model substrates, and multiple X-ray crystal studies, yet its relationship to endogenous substrates is not well understood. Here we describe an apparent membrane anchoring C-terminal homology domain that appears in numerous genera including Shewanella, Vibrio, Acinetobacter, and Ralstonia, but excluding Escherichia and Haemophilus. Individual genomes encode up to thirteen members, usually homologous to each other only in this C-terminal region. The domain's tripartite architecture consists of motif, transmembrane helix, and cluster of basic residues at the protein C-terminus, as also seen with the LPXTG recognition sequence for sortase A and the PEP-CTERM recognition sequence for exosortase. Partial Phylogenetic Profiling identifies a distinctive rhomboid-like protease subfamily almost perfectly co-distributed with this recognition sequence. This protease subfamily and its putative target domain are hereby renamed rhombosortase and GlyGly-CTERM, respectively. The protease and target are encoded by consecutive genes in most genomes with just a single target, but far apart otherwise. The signature motif of the Rhombo-CTERM domain, often SGGS, only partially resembles known cleavage sites of rhomboid protease family model substrates. Some protein families that have several members with C-terminal GlyGly-CTERM domains also have additional members with LPXTG or PEP-CTERM domains instead, suggesting there may be common themes to the post-translational processing of these proteins by three different membrane protein superfamilies. PMID:22194940

  11. Crystallization and preliminary crystallographic studies of human kallikrein 7, a serine protease of the multigene kallikrein family

    SciTech Connect

    Fernández, Israel S.; Ständker, Ludger; Forssmann, Wolf-Georg; Giménez-Gallego, Guillermo; Romero, Antonio

    2007-08-01

    The cloning, expression, purification and crystallization of recombinant human kallikrein 7, directly synthesized in the active form in E. coli, is described. Diffraction data were collected to 2.8 Å resolution from native crystals. Human kallikreins are a group of serine proteases of high sequence homology whose genes are grouped as a single cluster at chromosome 19. Although the physiological roles of kallikreins are generally still unknown, members of the kallikrein family have been clearly implicated in pathological situations such as cancer and psoriasis. Human kallikrein 7 (hK7) has been shown to be involved in pathological keratinization, psoriasis and ovarian cancer. In order to gain insight into the molecular structure of this protein, hK7 was crystallized after recombinant production in its folded and active form using a periplasmic secretion vector in Escherichia coli. The crystals belonged to the rhombohedral space group H32 and diffracted to 2.8 Å. The phase problem was solved by molecular replacement using the mouse kallikrein-related protein neuropsin. Completion of the model and structure refinement are under way.

  12. Storage Protein Accumulation in the Absence of the Vacuolar Processing Enzyme Family of Cysteine ProteasesW⃞

    PubMed Central

    Gruis, Darren; Schulze, Jan; Jung, Rudolf

    2004-01-01

    The role(s) of specific proteases in seed protein processing is only vaguely understood; indeed, the overall role of processing in stable protein deposition has been the subject of more speculation than direct investigation. Seed-type members of the vacuolar processing enzyme (VPE) family were hypothesized to perform a unique function in seed protein processing, but we demonstrated previously that Asn-specific protein processing in developing Arabidopsis seeds occurs independently of this VPE activity. Here, we describe the unexpected expression of vegetative-type VPEs in developing seeds and test the role(s) of all VPEs in seed storage protein accumulation by systematically stacking knockout mutant alleles of all four members (αVPE, βVPE, γVPE, and δVPE) of the VPE gene family in Arabidopsis. The complete removal of VPE function in the αvpe βvpe γvpe δvpe quadruple mutant resulted in a total shift of storage protein accumulation from wild-type processed polypeptides to a finite number of prominent alternatively processed polypeptides cleaved at sites other than the conserved Asn residues targeted by VPE. Although alternatively proteolyzed legumin-type globulin polypeptides largely accumulated as intrasubunit disulfide-linked polypeptides with apparent molecular masses similar to those of VPE-processed legumin polypeptides, they showed markedly altered solubility and protein assembly characteristics. Instead of forming 11S hexamers, alternatively processed legumin polypeptides were deposited primarily as 9S complexes. However, despite the impact on seed protein processing, plants devoid of all known functional VPE genes appeared unchanged with regard to protein content in mature seeds, relative mobilization rates of protein reserves during germination, and vegetative growth. These findings indicate that VPE-mediated Asn-specific proteolytic processing, and the physiochemical property changes attributed to this specific processing step, are not required for

  13. The lone S41 family C-terminal processing protease in Staphylococcus aureus is localized to the cell wall and contributes to virulence.

    PubMed

    Carroll, Ronan K; Rivera, Frances E; Cavaco, Courtney K; Johnson, Grant M; Martin, David; Shaw, Lindsey N

    2014-08-01

    Staphylococcus aureus is a versatile pathogen of humans and a continued public health concern due to the rise and spread of multidrug-resistant strains. As part of an ongoing investigation into the pathogenic mechanisms of this organism we previously demonstrated that an intracellular N-terminal processing protease is required for S. aureus virulence. Following on from this, here we examine the role of CtpA, the lone C-terminal processing protease of S. aureus. CtpA, a member of the S41 family, is a serine protease whose homologues in Gram-negative bacteria have been implicated in a range of biological functions, including pathogenesis. We demonstrate that S. aureus CtpA is localized to the bacterial cell wall and expression of the ctpA gene is maximal upon exposure to conditions encountered during infection. Disruption of the ctpA gene leads to decreased heat tolerance and increased sensitivity when exposed to components of the host immune system. Finally we demonstrate that the ctpA(-) mutant strain is attenuated for virulence in a murine model of infection. Our results represent the first characterization of a C-terminal processing protease in a pathogenic Gram-positive bacterium and show that it plays a critical role during infection.

  14. The Coat Protein and NIa Protease of Two Potyviridae Family Members Independently Confer Superinfection Exclusion.

    PubMed

    Tatineni, Satyanarayana; French, Roy

    2016-12-01

    Superinfection exclusion (SIE) is an antagonistic virus-virus interaction whereby initial infection by one virus prevents subsequent infection by closely related viruses. Although SIE has been described in diverse viruses infecting plants, humans, and animals, its mechanisms, including involvement of specific viral determinants, are just beginning to be elucidated. In this study, SIE determinants encoded by two economically important wheat viruses, Wheat streak mosaic virus (WSMV; genus Tritimovirus, family Potyviridae) and Triticum mosaic virus (TriMV; genus Poacevirus, family Potyviridae), were identified in gain-of-function experiments that used heterologous viruses to express individual virus-encoded proteins in wheat. Wheat plants infected with TriMV expressing WSMV P1, HC-Pro, P3, 6K1, CI, 6K2, NIa-VPg, or NIb cistrons permitted efficient superinfection by WSMV expressing green fluorescent protein (WSMV-GFP). In contrast, wheat infected with TriMV expressing WSMV NIa-Pro or coat protein (CP) substantially excluded superinfection by WSMV-GFP, suggesting that both of these cistrons are SIE effectors encoded by WSMV. Importantly, SIE is due to functional WSMV NIa-Pro or CP rather than their encoding RNAs, as altering the coded protein products by minimally changing RNA sequences led to abolishment of SIE. Deletion mutagenesis further revealed that elicitation of SIE by NIa-Pro requires the entire protein while CP requires only a 200-amino-acid (aa) middle fragment (aa 101 to 300) of the 349 aa. Strikingly, reciprocal experiments with WSMV-mediated expression of TriMV proteins showed that TriMV CP, and TriMV NIa-Pro to a lesser extent, likewise excluded superinfection by TriMV-GFP. Collectively, these data demonstrate that WSMV- and TriMV-encoded CP and NIa-Pro proteins are effectors of SIE and that these two proteins trigger SIE independently of each other. Superinfection exclusion (SIE) is an antagonistic virus-virus interaction that prevents secondary

  15. The Coat Protein and NIa Protease of Two Potyviridae Family Members Independently Confer Superinfection Exclusion

    PubMed Central

    French, Roy

    2016-01-01

    ABSTRACT Superinfection exclusion (SIE) is an antagonistic virus-virus interaction whereby initial infection by one virus prevents subsequent infection by closely related viruses. Although SIE has been described in diverse viruses infecting plants, humans, and animals, its mechanisms, including involvement of specific viral determinants, are just beginning to be elucidated. In this study, SIE determinants encoded by two economically important wheat viruses, Wheat streak mosaic virus (WSMV; genus Tritimovirus, family Potyviridae) and Triticum mosaic virus (TriMV; genus Poacevirus, family Potyviridae), were identified in gain-of-function experiments that used heterologous viruses to express individual virus-encoded proteins in wheat. Wheat plants infected with TriMV expressing WSMV P1, HC-Pro, P3, 6K1, CI, 6K2, NIa-VPg, or NIb cistrons permitted efficient superinfection by WSMV expressing green fluorescent protein (WSMV-GFP). In contrast, wheat infected with TriMV expressing WSMV NIa-Pro or coat protein (CP) substantially excluded superinfection by WSMV-GFP, suggesting that both of these cistrons are SIE effectors encoded by WSMV. Importantly, SIE is due to functional WSMV NIa-Pro or CP rather than their encoding RNAs, as altering the coded protein products by minimally changing RNA sequences led to abolishment of SIE. Deletion mutagenesis further revealed that elicitation of SIE by NIa-Pro requires the entire protein while CP requires only a 200-amino-acid (aa) middle fragment (aa 101 to 300) of the 349 aa. Strikingly, reciprocal experiments with WSMV-mediated expression of TriMV proteins showed that TriMV CP, and TriMV NIa-Pro to a lesser extent, likewise excluded superinfection by TriMV-GFP. Collectively, these data demonstrate that WSMV- and TriMV-encoded CP and NIa-Pro proteins are effectors of SIE and that these two proteins trigger SIE independently of each other. IMPORTANCE Superinfection exclusion (SIE) is an antagonistic virus-virus interaction that

  16. Spink13, an Epididymis-specific Gene of the Kazal-type Serine Protease Inhibitor (SPINK) Family, Is Essential for the Acrosomal Integrity and Male Fertility*

    PubMed Central

    Ma, Li; Yu, Heguo; Ni, Zimei; Hu, Shuanggang; Ma, Wubin; Chu, Chen; Liu, Qiang; Zhang, Yonglian

    2013-01-01

    Sperm maturation involves numerous surface modifications by a variety of secreted proteins from epididymal epithelia. The sperm surface architecture depends on correct localization of its components and highlights the importance of the sequence of the proteolytic processing of the sperm surface in the epididymal duct. The presence of several protease inhibitors from different families is consistent with the hypothesis that correctly timed epididymal protein processing is essential for proper sperm maturation. Here we show that the rat (Rattus norvegicus) epididymis-specific gene Spink13, an androgen-responsive serine protease inhibitor, could bind to the sperm acrosome region. Furthermore, knockdown of Spink13 in vivo dramatically enhanced the acrosomal exocytosis during the process of capacitation and thus led to a significant reduction in male fertility, indicating that Spink13 was essential for sperm maturation. We conclude that blockade of SPINK13 may provide a new putative target for post-testicular male contraceptives. PMID:23430248

  17. Highly sensitive and adaptable fluorescence-quenched pair discloses the substrate specificity profiles in diverse protease families

    PubMed Central

    Poreba, Marcin; Szalek, Aleksandra; Rut, Wioletta; Kasperkiewicz, Paulina; Rutkowska-Wlodarczyk, Izabela; Snipas, Scott J.; Itoh, Yoshifumi; Turk, Dusan; Turk, Boris; Overall, Christopher M.; Kaczmarek, Leszek; Salvesen, Guy S.; Drag, Marcin

    2017-01-01

    Internally quenched fluorescent (IQF) peptide substrates originating from FRET (Förster Resonance Energy Transfer) are powerful tool for examining the activity and specificity of proteases, and a variety of donor/acceptor pairs are extensively used to design individual substrates and combinatorial libraries. We developed a highly sensitive and adaptable donor/acceptor pair that can be used to investigate the substrate specificity of cysteine proteases, serine proteases and metalloproteinases. This novel pair comprises 7-amino-4-carbamoylmethylcoumarin (ACC) as the fluorophore and 2,4-dinitrophenyl-lysine (Lys(DNP)) as the quencher. Using caspase-3, caspase-7, caspase-8, neutrophil elastase, legumain, and two matrix metalloproteinases (MMP2 and MMP9), we demonstrated that substrates containing ACC/Lys(DNP) exhibit 7 to 10 times higher sensitivity than conventional 7-methoxy-coumarin-4-yl acetic acid (MCA)/Lys(DNP) substrates; thus, substantially lower amounts of substrate and enzyme can be used for each assay. We therefore propose that the ACC/Lys(DNP) pair can be considered a novel and sensitive scaffold for designing substrates for any group of endopeptidases. We further demonstrate that IQF substrates containing unnatural amino acids can be used to investigate protease activities/specificities for peptides containing post-translationally modified amino acids. Finally, we used IQF substrates to re-investigate the P1-Asp characteristic of caspases, thus demonstrating that some human caspases can also hydrolyze substrates after glutamic acid. PMID:28230157

  18. Highly sensitive and adaptable fluorescence-quenched pair discloses the substrate specificity profiles in diverse protease families.

    PubMed

    Poreba, Marcin; Szalek, Aleksandra; Rut, Wioletta; Kasperkiewicz, Paulina; Rutkowska-Wlodarczyk, Izabela; Snipas, Scott J; Itoh, Yoshifumi; Turk, Dusan; Turk, Boris; Overall, Christopher M; Kaczmarek, Leszek; Salvesen, Guy S; Drag, Marcin

    2017-02-23

    Internally quenched fluorescent (IQF) peptide substrates originating from FRET (Förster Resonance Energy Transfer) are powerful tool for examining the activity and specificity of proteases, and a variety of donor/acceptor pairs are extensively used to design individual substrates and combinatorial libraries. We developed a highly sensitive and adaptable donor/acceptor pair that can be used to investigate the substrate specificity of cysteine proteases, serine proteases and metalloproteinases. This novel pair comprises 7-amino-4-carbamoylmethylcoumarin (ACC) as the fluorophore and 2,4-dinitrophenyl-lysine (Lys(DNP)) as the quencher. Using caspase-3, caspase-7, caspase-8, neutrophil elastase, legumain, and two matrix metalloproteinases (MMP2 and MMP9), we demonstrated that substrates containing ACC/Lys(DNP) exhibit 7 to 10 times higher sensitivity than conventional 7-methoxy-coumarin-4-yl acetic acid (MCA)/Lys(DNP) substrates; thus, substantially lower amounts of substrate and enzyme can be used for each assay. We therefore propose that the ACC/Lys(DNP) pair can be considered a novel and sensitive scaffold for designing substrates for any group of endopeptidases. We further demonstrate that IQF substrates containing unnatural amino acids can be used to investigate protease activities/specificities for peptides containing post-translationally modified amino acids. Finally, we used IQF substrates to re-investigate the P1-Asp characteristic of caspases, thus demonstrating that some human caspases can also hydrolyze substrates after glutamic acid.

  19. Proteases in Fas-mediated apoptosis.

    PubMed

    Zhivotovsky, B; Burgess, D H; Schlegel, J; Pörn, M I; Vanags, D; Orrenius, S

    1997-01-01

    Involvement of a unique family of cysteine proteases in the multistep apoptotic process has been documented. Cloning of several mammalian genes identifies some components of this cellular response. However, it is currently unclear which protease plays a role as a signal and/or effector of apoptosis. We summarize contributions to the data concerning proteases in Fas-mediated apoptosis.

  20. Proteomics and phylogenetic analysis of the cathepsin L protease family of the helminth pathogen Fasciola hepatica: expansion of a repertoire of virulence-associated factors.

    PubMed

    Robinson, Mark W; Tort, Jose F; Lowther, Jonathan; Donnelly, Sheila M; Wong, Emily; Xu, Weibo; Stack, Colin M; Padula, Matthew; Herbert, Ben; Dalton, John P

    2008-06-01

    Cathepsin L proteases secreted by the helminth pathogen Fasciola hepatica have functions in parasite virulence including tissue invasion and suppression of host immune responses. Using proteomics methods alongside phylogenetic studies we characterized the profile of cathepsin L proteases secreted by adult F. hepatica and hence identified those involved in host-pathogen interaction. Phylogenetic analyses showed that the Fasciola cathepsin L gene family expanded by a series of gene duplications followed by divergence that gave rise to three clades associated with mature adult worms (Clades 1, 2, and 5) and two clades specific to infective juvenile stages (Clades 3 and 4). Consistent with these observations our proteomics studies identified representatives from Clades 1, 2, and 5 but not from Clades 3 and 4 in adult F. hepatica secretory products. Clades 1 and 2 account for 67.39 and 27.63% of total secreted cathepsin Ls, respectively, suggesting that their expansion was positively driven and that these proteases are most critical for parasite survival and adaptation. Sequence comparison studies revealed that the expansion of cathepsin Ls by gene duplication was followed by residue changes in the S2 pocket of the active site. Our biochemical studies showed that these changes result in alterations in substrate binding and suggested that the divergence of the cathepsin L family produced a repertoire of enzymes with overlapping and complementary substrate specificities that could cleave host macromolecules more efficiently. Although the cathepsin Ls are produced as zymogens containing a prosegment and mature domain, all secreted enzymes identified by MS were processed to mature active enzymes. The prosegment region was highly conserved between the clades except at the boundary of prosegment and mature enzyme. Despite the lack of conservation at this section, sites for exogenous cleavage by asparaginyl endopeptidases and a Leu-Ser[downward arrow]His motif for

  1. Characterization of the Entire Cystatin Gene Family in Barley and Their Target Cathepsin L-Like Cysteine-Proteases, Partners in the Hordein Mobilization during Seed Germination1[W

    PubMed Central

    Martinez, Manuel; Cambra, Ines; Carrillo, Laura; Diaz-Mendoza, Mercedes; Diaz, Isabel

    2009-01-01

    Plant cystatins are inhibitors of cysteine-proteases of the papain C1A and legumain C13 families. Cystatin data from multiple plant species have suggested that these inhibitors act as defense proteins against pests and pathogens and as regulators of protein turnover. In this study, we characterize the entire cystatin gene family from barley (Hordeum vulgare), which contain 13 nonredundant genes, and identify and characterize their target enzymes, the barley cathepsin L-like proteases. Cystatins and proteases were expressed and purified from Escherichia coli cultures. Each cystatin was found to have different inhibitory capability against barley cysteine-proteases in in vitro inhibitory assays using specific substrates. Real-time reverse transcription-polymerase chain reaction revealed that inhibitors and enzymes present a wide variation in their messenger RNA expression patterns. Their transcripts were mainly detected in developing and germinating seeds, and some of them were also expressed in leaves and roots. Subcellular localization of cystatins and cathepsin L-like proteases fused to green fluorescent protein demonstrated the presence of both protein families throughout the endoplasmic reticulum and the Golgi complex. Proteases and cystatins not only colocalized but also interacted in vivo in the plant cell, as revealed by bimolecular fluorescence complementation. The functional relationship between cystatins and cathepsin L-like proteases was inferred from their common implication as counterparts of mobilization of storage proteins upon barley seed germination. The opposite pattern of transcription expression in gibberellin-treated aleurones presented by inhibitors and enzymes allowed proteases to specifically degrade B, C, and D hordeins stored in the endosperm of barley seeds. PMID:19759340

  2. Supermarket Proteases.

    ERIC Educational Resources Information Center

    Hagar, William G.; Bullerwell, Lornie D.

    2003-01-01

    Presents a laboratory activity on enzymes. Uses common items found in the supermarket that contain protease enzymes, such as contact lens cleaner and meat tenderizer. Demonstrates the digestion of gelatin proteins as part of enzymatic reactions. (Author/SOE)

  3. Supermarket Proteases.

    ERIC Educational Resources Information Center

    Hagar, William G.; Bullerwell, Lornie D.

    2003-01-01

    Presents a laboratory activity on enzymes. Uses common items found in the supermarket that contain protease enzymes, such as contact lens cleaner and meat tenderizer. Demonstrates the digestion of gelatin proteins as part of enzymatic reactions. (Author/SOE)

  4. Protein backbone flexibility pattern is evolutionarily conserved in the Flaviviridae family: A case of NS3 protease in Flavivirus and Hepacivirus.

    PubMed

    Palanisamy, Navaneethan; Akaberi, Dario; Lennerstrand, Johan

    2017-09-22

    Viruses belonging to the Flaviviridae family have been an important health concern for humans, animals and birds alike. No specific treatment is available yet for many of the viral infections caused by the members of this family. Lack of specific drugs against these viruses is mainly due to lack of protein structure information. It has been known that protein backbone fluctuation pattern is highly conserved in protein pairs with similar folds, in spite of the lack of sequence similarity. We hypothesized that this concept should also hold true for proteins (especially enzymes) of viruses included in different genera of the Flaviviridae family, as we know that the sequence similarity between them is low. Using available NS3 protease crystal structures of the Flaviviridae family, our preliminary results have shown that the Cα (i.e. backbone) fluctuation patterns are highly similar between Flaviviruses and a Hepacivirus (i.e. hepatitis C virus, HCV). This has to be validated further experimentally. Copyright © 2017 Elsevier Inc. All rights reserved.

  5. A Zinc-Dependent Protease AMZ-tk from a Thermophilic Archaeon is a New Member of the Archaemetzincin Protein Family

    PubMed Central

    Jia, Baolei; Li, Zhengqun; Liu, Jinliang; Sun, Ying; Jia, Xiaomeng; Xuan, Yuan Hu; Zhang, Jiayan; Jeon, Che Ok

    2015-01-01

    A putative zinc-dependent protease (TK0512) in Thermococcus kodakarensis KOD1 shares a conserved motif with archaemetzincins, which are metalloproteases found in archaea, bacteria, and eukarya. Phylogenetic and sequence analyses showed that TK0512 and its homologues in Thermococcaceae represent new members in the archaemetzincins family, which we named AMZ-tk. We further confirmed its proteolytic activity biochemically by overexpression of the recombinant AMZ-tk in Escherichia coli and characterization of the purified enzyme. In the presence of zinc, the purified enzyme degraded casein, while adding EDTA strongly inhibited the enzyme activity. AMZ-tk also exhibited self-cleavage activity that required Zn2+. These results demonstrated that AMZ-tk is a zinc-dependent protease within the archaemetzincin family. The enzyme displayed activity at alkaline pHs ranging from 7.0 to 10.0, with the optimal pH being 8.0. The optimum temperature for the catalytic activity of AMZ-tk was 55°C. Quantitative reverse transcription-PCR revealed that transcription of AMZ-tk was also up-regulated after exposing the cells to 55 and 65°C. Mutant analysis suggested that Zn2+ binding histidine and catalytic glutamate play key roles in proteolysis. AMZ-tk was thermostable on incubation for 4 h at 70°C in the presence of EDTA. AMZ-tk also retained >50% of its original activity in the presence of both laboratory surfactants and commercial laundry detergents. AMZ-tk further showed antibacterial activity against several bacteria. Therefore, AMZ-tk is of considerable interest for many purposes in view of its activity at alkaline pH, detergents, and thermostability. PMID:26733945

  6. An oocyte-specific astacin family protease, alveolin, is released from cortical granules to trigger egg envelope hardening during fertilization in medaka (Oryzias latipes).

    PubMed

    Shibata, Yasushi; Iwamatsu, Takashi; Suzuki, Norio; Young, Graham; Naruse, Kiyoshi; Nagahama, Yoshitaka; Yoshikuni, Michiyasu

    2012-12-15

    It has long been hypothesized that in fishes the contents of cortical granules are involved in the hardening of egg envelope following fertilization. We previously purified the egg envelope hardening initiation factor from the exudates released from activated medaka (Oryzias latipes) eggs and tentatively termed this protein alveolin. Alveolin is a member of the astacin metalloprotease family and was proposed to be a protease which hydrolyzes ZPB at one restricted position to allow starting cross-linking with ZPC. Here, we investigated the complete pathway from biosynthesis and accumulation to secretion of alveolin. A single alveolin transcript was detected only in ovarian preparations, confirming the specific expression of alveolin in the ovary. In situ hybridization indicated that the alveolin mRNA is already expressed in the very early previtellogenic oocytes. However, immunocytochemical studies revealed that the appearance of alveolin protein was delayed until the beginning of the vitellogenic stage. The cortical granules isolated from unfertilized eggs contained a high molecular weight form of glycosylated alveolin with a 50kDa relative molecular mass. Hypotonic treatment burst isolated granules in vitro and transformed alveolin to a 21.5kDa form, which is the same size as that of natural alveolin released from eggs upon fertilization. This transformation was inhibited in the presence of leupeptin and 4-(2-aminoethyl) benzenesulfonyl fluoride hydrochloride (AEBSF), suggesting that a serine protease is involved in alveolin activation upon fertilization. Furthermore, the phylogenetic relationship of alveolin with other vertebrate astacin family members was analyzed. The result shows that alveolin and its teleostean homologs make a new group which is separate from either the hatching enzyme, meprin and BMP1/tolloid groups.

  7. Identification and Characterization of a Novel Aspergillus fumigatus Rhomboid Family Putative Protease, RbdA, Involved in Hypoxia Sensing and Virulence

    PubMed Central

    Vaknin, Yakir; Hillmann, Falk; Iannitti, Rossana; Ben Baruch, Netali; Sandovsky-Losica, Hana; Shadkchan, Yona; Romani, Luigina; Brakhage, Axel

    2016-01-01

    Aspergillus fumigatus is the most common pathogenic mold infecting humans and a significant cause of morbidity and mortality in immunocompromised patients. In invasive pulmonary aspergillosis, A. fumigatus spores are inhaled into the lungs, undergoing germination and invasive hyphal growth. The fungus occludes and disrupts the blood vessels, leading to hypoxia and eventual tissue necrosis. The ability of this mold to adapt to hypoxia is regulated in part by the sterol regulatory element binding protein (SREBP) SrbA and the DscA to DscD Golgi E3 ligase complex critical for SREBP activation by proteolytic cleavage. Loss of the genes encoding these proteins results in avirulence. To identify novel regulators of hypoxia sensing, we screened the Neurospora crassa gene deletion library under hypoxia and identified a novel rhomboid family protease essential for hypoxic growth. Deletion of the A. fumigatus rhomboid homolog rbdA resulted in an inability to grow under hypoxia, hypersensitivity to CoCl2, nikkomycin Z, fluconazole, and ferrozine, abnormal swollen tip morphology, and transcriptional dysregulation—accurately phenocopying deletion of srbA. In vivo, rbdA deletion resulted in increased sensitivity to phagocytic killing, a reduced inflammatory Th1 and Th17 response, and strongly attenuated virulence. Phenotypic rescue of the ΔrbdA mutant was achieved by expression and nuclear localization of the N terminus of SrbA, including its HLH domain, further indicating that RbdA and SrbA act in the same signaling pathway. In summary, we have identified RbdA, a novel putative rhomboid family protease in A. fumigatus that mediates hypoxia adaptation and fungal virulence and that is likely linked to SrbA cleavage and activation. PMID:27068092

  8. Control of Entamoeba histolytica adherence involves metallosurface protease 1, an M8 family surface metalloprotease with homology to leishmanolysin.

    PubMed

    Teixeira, Jose E; Sateriale, Adam; Bessoff, Kovi E; Huston, Christopher D

    2012-06-01

    Invasive amebiasis due to Entamoeba histolytica infection is an important cause of morbidity in developing countries. The E. histolytica genome contains two homologues to the metalloprotease leishmanolysin gene, Entamoeba histolytica MSP-1 (EhMSP-1) and EhMSP-2, while the commensal ameba Entamoeba dispar has lost EhMSP-1. In this study, we sought to characterize E. histolytica metallosurface protease 1 (EhMSP-1). Using immunoprecipitation and a model substrate, we found that EhMSP-1 was a functional metalloprotease. Confocal microscopy and flow cytometry revealed that EhMSP-1 localized to the cell surface and revealed the existence of distinct, nonclonal trophozoite populations with high and low EhMSP-1 surface abundance that became synchronized following serum starvation. Phenotypic assays were performed after silencing EhMSP-1. Adherence of EhMSP-1-deficient trophozoites to tissue culture cell monolayers was more than five times greater than that of control amebas, but surface staining of several antigens, including the galactose adherence lectin, was unchanged. EhMSP-1 silencing similarly increased adherence to both viable and apoptotic Jurkat lymphocytes. Tissue culture cell monolayer destruction was reduced by EhMSP-1 silencing, although it was blocked almost completely by inhibiting cysteine proteases. Consistent with a primary defect in regulation of amebic adherence, EhMSP-1 silencing also resulted in reduced mobility on tissue culture cell monolayers and in increased phagocytosis. In conclusion, EhMSP-1 was shown to be a surface metalloprotease involved in regulation of amebic adherence, with additional effects on cell motility, cell monolayer destruction, and phagocytosis.

  9. SLC6 family transporter SNF-10 is required for protease-mediated activation of sperm motility in C. elegans

    PubMed Central

    Fenker, Kristin E.; Hansen, Angela A.; Chong, Conrad A.; Jud, Molly C.; Duffy, Brittany A.; Norton, J. Paul; Hansen, Jody M.; Stanfield, Gillian M.

    2014-01-01

    Summary Motility of sperm is crucial for their directed migration to the egg. The acquisition and modulation of motility are regulated to ensure that sperm move when and where needed, thereby promoting reproductive success. One specific example of this phenomenon occurs during differentiation of the amoeboid sperm of C. elegans as they activate from a round spermatid to a mature, crawling spermatozoon. Sperm activation is regulated by redundant pathways to occur at a specific time and place for each sex. Here, we report the identification of the solute carrier 6 (SLC6) transporter protein SNF-10 as a key regulator of C. elegans sperm activation in response to male protease activation signals. We find that SNF-10 is present in sperm and is required for activation by the male but not by the hermaphrodite. Loss of both snf-10 and a hermaphrodite activation factor render sperm completely insensitive to activation. Using in vitro assays, we find that snf-10 mutant sperm show a specific deficit in response to protease treatment but not to other activators. Prior to activation, SNF-10 is present in the plasma membrane, where it represents a strong candidate to receive signals that lead to subcellular morphogenesis. After activation, it shows polarized localization to the cell body region that is dependent on membrane fusions mediated by the dysferlin FER-1. Our discovery of snf-10 offers insight into the mechanisms differentially employed by the two sexes to accomplish the common goal of producing functional sperm, as well as how the physiology of nematode sperm may be regulated to control motility as it is in mammals. PMID:24929237

  10. Mutagenesis and crystallographic studies of the catalytic residues of the papain family protease bleomycin hydrolase: new insights into active-site structure

    PubMed Central

    O'Farrell, Paul A.; Joshua-Tor, Leemor

    2006-01-01

    Bleomycin hydrolase (BH) is a hexameric papain family cysteine protease which is involved in preparing peptides for antigen presentation and has been implicated in tumour cell resistance to bleomycin chemotherapy. Structures of active-site mutants of yeast BH yielded unexpected results. Replacement of the active-site asparagine with alanine, valine or leucine results in the destabilization of the histidine side chain, demonstrating unambiguously the role of the asparagine residue in correctly positioning the histidine for catalysis. Replacement of the histidine with alanine or leucine destabilizes the asparagine position, indicating a delicate arrangement of the active-site residues. In all of the mutants, the C-terminus of the protein, which lies in the active site, protrudes further into the active site. All mutants were compromised in their catalytic activity. The structures also revealed the importance of a tightly bound water molecule which stabilizes a loop near the active site and which is conserved throughout the papain family. It is displaced in a number of the mutants, causing destabilization of this loop and a nearby loop, resulting in a large movement of the active-site cysteine. The results imply that this water molecule plays a key structural role in this family of enzymes. PMID:17007609

  11. Cathepsin proteases in Toxoplasma gondii

    PubMed Central

    Dou, Zhicheng; Carruthers, Vern B.

    2014-01-01

    Cysteine proteases are important for the growth and survival of apicomplexan parasites that infect humans. The apicomplexan Toxoplasma gondii expresses five members of the C1 family of cysteine proteases, including one cathepsin L-like (TgCPL), one cathepsin B-like (TgCPB), and three cathepsin C-like (TgCPC1, 2 and 3) proteases. Recent genetic, biochemical and structural studies reveal that cathepsins function in microneme and rhoptry protein maturation, host cell invasion, replication, and nutrient acquisition.. Here, we review the key features and roles of T. gondii cathepsins and discuss the therapeutic potential for specific inhibitor development. PMID:21660658

  12. Allium sativum Protease Inhibitor: A Novel Kunitz Trypsin Inhibitor from Garlic Is a New Comrade of the Serpin Family

    PubMed Central

    Shamsi, Tooba Naz; Parveen, Romana; Amir, Mohd.; Baig, Mohd. Affan; Qureshi, M. Irfan; Ali, Sher; Fatima, Sadaf

    2016-01-01

    Purpose This study was aimed to purify and characterize the Protease inhibitor (PI) from a plant Allium sativum (garlic) with strong medicinal properties and to explore its phytodrug potentials. Methods Allium sativum Protease Inhibitor (ASPI) was purified using ammonium sulphate fractionation and Fast Protein Liquid Chromatography on anion exchanger Hi-Trap DEAE column. The purified protein was analyzed for its purity and molecular weight by SDS PAGE. The confirmation of presence of trypsin inhibiting PI was performed by MALDI TOF-TOF and analyzed by MASCOT database. The ASPI was further investigated for its kinetic properties and stability under extreme conditions of pH, temperature and chemical denaturants. Secondary structure was determined by Circular Dichorism (CD) spectroscopy. Results ASPI of ~15 kDa inhibited trypsin and matched "truncated kunitz Trypsin Inhibitor (Glycine max)" in MASCOT database. The purified ASPI showed 30376.1371 U/mg specific activity with a fold purity of 159.92 and yield ~93%. ASPI was quite stable in the range of pH 2–12 showing a decline in the activity around pH 4–5 suggesting that the pI value of the protein as ASPI aggregates in this range. ASPI showed stability to a broad range of temperature (10–80°C) but declined beyond 80°C. Further, detergents, oxidizing agents and reducing agents demonstrated change in ASPI activity under varying concentrations. The kinetic analysis revealed sigmoidal relationship of velocity with substrate concentration with Vmax 240.8 (μM/min) and Km value of 0.12 μM. ASPI showed uncompetitive inhibition with a Ki of 0.08±0.01 nM). The Far UV CD depicted 2.0% α -helices and 51% β -sheets at native pH. Conclusions To conclude, purified ~15 kDa ASPI exhibited fair stability in wide range of pH and temperature Overall, there was an increase in purification fold with remarkable yield. Chemical modification studies suggested the presence of lysine and tryptophan residues as lead amino acids

  13. Allium sativum Protease Inhibitor: A Novel Kunitz Trypsin Inhibitor from Garlic Is a New Comrade of the Serpin Family.

    PubMed

    Shamsi, Tooba Naz; Parveen, Romana; Amir, Mohd; Baig, Mohd Affan; Qureshi, M Irfan; Ali, Sher; Fatima, Sadaf

    2016-01-01

    This study was aimed to purify and characterize the Protease inhibitor (PI) from a plant Allium sativum (garlic) with strong medicinal properties and to explore its phytodrug potentials. Allium sativum Protease Inhibitor (ASPI) was purified using ammonium sulphate fractionation and Fast Protein Liquid Chromatography on anion exchanger Hi-Trap DEAE column. The purified protein was analyzed for its purity and molecular weight by SDS PAGE. The confirmation of presence of trypsin inhibiting PI was performed by MALDI TOF-TOF and analyzed by MASCOT database. The ASPI was further investigated for its kinetic properties and stability under extreme conditions of pH, temperature and chemical denaturants. Secondary structure was determined by Circular Dichorism (CD) spectroscopy. ASPI of ~15 kDa inhibited trypsin and matched "truncated kunitz Trypsin Inhibitor (Glycine max)" in MASCOT database. The purified ASPI showed 30376.1371 U/mg specific activity with a fold purity of 159.92 and yield ~93%. ASPI was quite stable in the range of pH 2-12 showing a decline in the activity around pH 4-5 suggesting that the pI value of the protein as ASPI aggregates in this range. ASPI showed stability to a broad range of temperature (10-80°C) but declined beyond 80°C. Further, detergents, oxidizing agents and reducing agents demonstrated change in ASPI activity under varying concentrations. The kinetic analysis revealed sigmoidal relationship of velocity with substrate concentration with Vmax 240.8 (μM/min) and Km value of 0.12 μM. ASPI showed uncompetitive inhibition with a Ki of 0.08±0.01 nM). The Far UV CD depicted 2.0% α -helices and 51% β -sheets at native pH. To conclude, purified ~15 kDa ASPI exhibited fair stability in wide range of pH and temperature Overall, there was an increase in purification fold with remarkable yield. Chemical modification studies suggested the presence of lysine and tryptophan residues as lead amino acids present in the reactive sites. Therefore, ASPI

  14. A mutation unique in serine protease inhibitors (serpins) identified in a family with type II hereditary angioneurotic edema.

    PubMed

    Ocejo-Vinyals, J G; Leyva-Cobián, F; Fernández-Luna, J L

    1995-09-01

    Hereditary angioneurotic edema (HANE) is an autosomal dominant disease due to genetic alterations at the C1 inhibitor gene. Mutations within the C1 inhibitor gene are responsible for the molecular defect in type II HANE. Most of the dysfunctional proteins result from mutations involving the Arg-444 (the P-1 site of the reactive center) or amino acids NH2-terminal to the reactive center. We have studied a Spanish family with type II HANE by using polymerase chain reaction (PCR) to amplify the exon eight of the C1 inhibitor gene. The purified 338-bp PCR product was subcloned and transformed into competent cells. After overnight cultures, we extracted the cloning vector from the positive colonies and sequenced both strands of the PCR product from each patient and healthy members of the family. We show that affected individuals in this family have a missense mutation, changing an adenine to cytosine in the codon 445. This substitution changes threonine at the P-1' site of the reactive center to a proline. This mutation generates a new restriction site, recognized by Bsi YI. To our knowledge, this is the first molecular defect characterized in a Spanish family with type II HANE, and to date, this is the first reported mutation at the P-1' site of the reactive center in individuals with type II HANE. This new mutation located at the reactive center emphasizes once more time the enormous heterogeneity of this gene.

  15. Serine Proteases of Parasitic Helminths

    PubMed Central

    Yang, Yong; Wen, Yun jun; Cai, Ya Nan; Vallée, Isabelle; Boireau, Pascal; Liu, Ming Yuan; Cheng, Shi Peng

    2015-01-01

    Serine proteases form one of the most important families of enzymes and perform significant functions in a broad range of biological processes, such as intra- and extracellular protein metabolism, digestion, blood coagulation, regulation of development, and fertilization. A number of serine proteases have been identified in parasitic helminths that have putative roles in parasite development and nutrition, host tissues and cell invasion, anticoagulation, and immune evasion. In this review, we described the serine proteases that have been identified in parasitic helminths, including nematodes (Trichinella spiralis, T. pseudospiralis, Trichuris muris, Anisakis simplex, Ascaris suum, Onchocerca volvulus, O. lienalis, Brugia malayi, Ancylostoma caninum, and Steinernema carpocapsae), cestodes (Spirometra mansoni, Echinococcus granulosus, and Schistocephalus solidus), and trematodes (Fasciola hepatica, F. gigantica, and Schistosoma mansoni). Moreover, the possible biological functions of these serine proteases in the endogenous biological phenomena of these parasites and in the host-parasite interaction were also discussed. PMID:25748703

  16. NMR characterization and conformational analysis of a potent papain-family cathepsin L-like cysteine protease inhibitor with different behaviour in polar and apolar media

    NASA Astrophysics Data System (ADS)

    Rotondo, Archimede; Ettari, Roberta; Zappalà, Maria; De Micheli, Carlo; Rotondo, Enrico

    2014-11-01

    We recently reported the synthesis, of a potent papain-family cathepsin L-like cysteine protease inhibitor, as new lead compound for the development of new drugs that can be used as antiprotozoal agents. The investigation of its conformational profile is crucial for the in-depth understanding of its biological behaviour. Our careful NMR analysis has been based on the complete and total assignment of 1H, 13C, 15N and 19F signals of the molecule in both CDCl3 and CD3OH, which could reproduce in some way a scenario of polar and not polar phases into the biological environment. In this way it has been unveiled a different behaviour of the molecule in polar and apolar media. In CDCl3 it is possible to define stable conformational arrangements on the basis of the detected through space contacts, whereas, in CD3OH a greater conformational freedom is envisaged: (a) by the overlap of any of the CH2 diastereotopic resonances (unable to distinguish asymmetric molecular sides because of the free rotation about the single bonded chains), (b) by the less definite measured vicinities not consistent with just one conformation and (c) by the evident loss or switching of key intramolecular hydrogen interactions.

  17. Structure and mechanism of rhomboid protease.

    PubMed

    Ha, Ya; Akiyama, Yoshinori; Xue, Yi

    2013-05-31

    Rhomboid protease was first discovered in Drosophila. Mutation of the fly gene interfered with growth factor signaling and produced a characteristic phenotype of a pointed head skeleton. The name rhomboid has since been widely used to describe a large family of related membrane proteins that have diverse biological functions but share a common catalytic core domain composed of six membrane-spanning segments. Most rhomboid proteases cleave membrane protein substrates near the N terminus of their transmembrane domains. How these proteases function within the confines of the membrane is not completely understood. Recent progress in crystallographic analysis of the Escherichia coli rhomboid protease GlpG in complex with inhibitors has provided new insights into the catalytic mechanism of the protease and its conformational change. Improved biochemical assays have also identified a substrate sequence motif that is specifically recognized by many rhomboid proteases.

  18. Structure and Mechanism of Rhomboid Protease*

    PubMed Central

    Ha, Ya; Akiyama, Yoshinori; Xue, Yi

    2013-01-01

    Rhomboid protease was first discovered in Drosophila. Mutation of the fly gene interfered with growth factor signaling and produced a characteristic phenotype of a pointed head skeleton. The name rhomboid has since been widely used to describe a large family of related membrane proteins that have diverse biological functions but share a common catalytic core domain composed of six membrane-spanning segments. Most rhomboid proteases cleave membrane protein substrates near the N terminus of their transmembrane domains. How these proteases function within the confines of the membrane is not completely understood. Recent progress in crystallographic analysis of the Escherichia coli rhomboid protease GlpG in complex with inhibitors has provided new insights into the catalytic mechanism of the protease and its conformational change. Improved biochemical assays have also identified a substrate sequence motif that is specifically recognized by many rhomboid proteases. PMID:23585569

  19. Proteases as Insecticidal Agents

    PubMed Central

    Harrison, Robert L.; Bonning, Bryony C.

    2010-01-01

    Proteases from a variety of sources (viruses, bacteria, fungi, plants, and insects) have toxicity towards insects. Some of these insecticidal proteases evolved as venom components, herbivore resistance factors, or microbial pathogenicity factors, while other proteases play roles in insect development or digestion, but exert an insecticidal effect when over-expressed from genetically engineered plants or microbial pathogens. Many of these proteases are cysteine proteases, although insect-toxic metalloproteases and serine proteases have also been examined. The sites of protease toxic activity range from the insect midgut to the hemocoel (body cavity) to the cuticle. This review discusses these insecticidal proteases along with their evaluation and use as potential pesticides. PMID:22069618

  20. Yeast extracellular proteases.

    PubMed

    Ogrydziak, D M

    1993-01-01

    Many species of yeast secrete significant amounts of protease(s). In this article, results of numerous surveys of yeast extracellular protease production have been compiled and inconsistencies in the data and limitations of the methodology have been examined. Regulation, purification, characterization, and processing of yeast extracellular proteases are reviewed. Results obtained from the sequences of cloned genes, especially the Saccharomyces cerevisiae Bar protease, the Candida albicans acid protease, and the Yarrowia lipolytica alkaline protease, have been emphasized. Biotechnological applications and the medical relevance of yeast extracellular proteases are covered. Yeast extracellular proteases have potential in beer and wine stabilization, and they probably contribute to pathogenicity of Candida spp. Yeast extracellular protease genes also provide secretion and processing signals for yeast expression systems designed for secretion of heterologous proteins. Coverage of the secretion of foreign proteases such as prochymosin, urokinase, and tissue plasminogen activator by yeast in included.

  1. Genotype-dependent expression of specific members of potato protease inhibitor gene families in different tissues and in response to wounding and nematode infection.

    PubMed

    Turrà, David; Bellin, Diana; Lorito, Matteo; Gebhardt, Christiane

    2009-05-01

    Protease inhibitors (PIs) are small ubiquitous proteins with a variety of biological functions in plants, including protein stabilization, modulation of apoptosis and defense against pathogens. Kunitz-like inhibitors (PKPIs) and proteinase inhibitors 1 (PI-1) are abundant in storage organs of potato plants and are up-regulated in other tissues in response to biotic and abiotic stress. However, little information is available on genotype-dependent regulation of individual PKPI group- and PI-1 genes. We isolated, sequenced and characterized four novel full-length PI-1 cDNAs (PPI3A2, PPI3A4, PPI2C4 and PPI2C1A) from Solanum tuberosum cv. Desirée. Specific primers were developed for PI-1 genes PPI3A2, PPI3B2 and PPI2C4 and the three PKPI homology groups A, B and C. Their expression profiles were studied by semi-quantitative RT-PCR in comparison with transcripts of the PI-1, Pin2 and PR1 gene families in various tissues, after wounding and Globodera rostochiensis infection of nematode-resistant genotypes P40 and LB7/4/c-I-7, and susceptible cv. Desirée. Individual PI-1 genes and PKPI homology groups were expressed in a tissue- and genotype-dependent manner after wounding and nematode infection. The differences in PI expression patterns were related to the intensity, type of inhibitors produced, and the kinetics of induction. Therefore, different genotype-environment combinations produce different sets of PI transcripts. Potato plants reacted to G. rostochiensis infection by modulating PKPI, PI-1 and Pin2, but not PR1 gene expression, suggesting that the jasmonic acid but not the salicylic acid defense signaling pathway is activated. PI expression profiles were not correlated with the resistance status of the potato genotype infected with G. rostochiensis.

  2. hpaR, a putative marR family transcriptional regulator, is positively controlled by HrpG and HrpX and involved in the pathogenesis, hypersensitive response, and extracellular protease production of Xanthomonas campestris pathovar campestris.

    PubMed

    Wei, Ke; Tang, Dong-Jie; He, Yong-Qiang; Feng, Jia-Xun; Jiang, Bo-Le; Lu, Guang-Tao; Chen, Baoshan; Tang, Ji-Liang

    2007-03-01

    The MarR family of transcriptional regulators of bacteria are involved in the regulation of many cellular processes, including pathogenesis. In this work, we have demonstrated genetically that hpaR (hpa, hrp associated), which encodes a putative MarR family regulator, is involved in the hypersensitive response (HR), pathogenicity, and extracellular protease production of the phytopathogenic bacterium Xanthomonas campestris pathovar campestris. A mutation in hpaR resulted in complete loss of virulence in the host plant cabbage, a delayed and weakened HR in the nonhost plant pepper ECW-10R, and an increase in extracellular protease production. Detection of the beta-glucuronidase activity of a plasmid-driven hpaR promoter-gusA reporter revealed that the expression of hpaR is positively controlled by HrpG and HrpX and is suppressed in rich medium while being strongly induced in minimal and hrp-inducing media and inside the host. These findings indicate that hpaR belongs to the hrpG and hrpX regulon and that HrpX regulates the extracellular protease production via hpaR in X. campestris pv. campestris.

  3. Serine proteases in rodent hippocampus.

    PubMed

    Davies, B J; Pickard, B S; Steel, M; Morris, R G; Lathe, R

    1998-09-04

    Brain serine proteases are implicated in developmental processes, synaptic plasticity, and in disorders including Alzheimer's disease. The spectrum of the major enzymes expressed in brain has not been established previously. We now present a systematic study of the serine proteases expressed in adult rat and mouse hippocampus. Using a combination of techniques including polymerase chain reaction amplification and Northern blotting we show that tissue-type plasminogen activator (t-PA) is the major species represented. Unexpectedly, the next most abundant species were RNK-Met-1, a lymphocyte protease not reported previously in brain, and two new family members, BSP1 (brain serine protease 1) and BSP2. We report full-length sequences of the two new proteases; homologies indicate that these are of tryptic specificity. Although BSP2 is expressed in several brain regions, BSP1 expression is strikingly restricted to hippocampus. Other enzymes represented, but at lower levels, included elastase IV, proteinase 3, complement C2, chymotrypsin B, chymotrypsin-like protein, and Hageman factor. Although thrombin and urokinase-type plasminogen activator were not detected in the primary screen, low level expression was confirmed using specific polymerase chain reaction primers. In contrast, and despite robust expression of t-PA, the usual t-PA substrate plasminogen was not expressed at detectable levels.

  4. Diversity, Structures, and Collagen-Degrading Mechanisms of Bacterial Collagenolytic Proteases.

    PubMed

    Zhang, Yu-Zhong; Ran, Li-Yuan; Li, Chun-Yang; Chen, Xiu-Lan

    2015-09-01

    Bacterial collagenolytic proteases are important because of their essential role in global collagen degradation and because of their virulence in some human bacterial infections. Bacterial collagenolytic proteases include some metalloproteases of the M9 family from Clostridium or Vibrio strains, some serine proteases distributed in the S1, S8, and S53 families, and members of the U32 family. In recent years, there has been remarkable progress in discovering new bacterial collagenolytic proteases and in investigating the collagen-degrading mechanisms of bacterial collagenolytic proteases. This review provides comprehensive insight into bacterial collagenolytic proteases, especially focusing on the structures and collagen-degrading mechanisms of representative bacterial collagenolytic proteases in each family. The roles of bacterial collagenolytic proteases in human diseases and global nitrogen cycling, together with the biotechnological and medical applications for these proteases, are also briefly discussed.

  5. Diversity, Structures, and Collagen-Degrading Mechanisms of Bacterial Collagenolytic Proteases

    PubMed Central

    Zhang, Yu-Zhong; Ran, Li-Yuan; Li, Chun-Yang

    2015-01-01

    Bacterial collagenolytic proteases are important because of their essential role in global collagen degradation and because of their virulence in some human bacterial infections. Bacterial collagenolytic proteases include some metalloproteases of the M9 family from Clostridium or Vibrio strains, some serine proteases distributed in the S1, S8, and S53 families, and members of the U32 family. In recent years, there has been remarkable progress in discovering new bacterial collagenolytic proteases and in investigating the collagen-degrading mechanisms of bacterial collagenolytic proteases. This review provides comprehensive insight into bacterial collagenolytic proteases, especially focusing on the structures and collagen-degrading mechanisms of representative bacterial collagenolytic proteases in each family. The roles of bacterial collagenolytic proteases in human diseases and global nitrogen cycling, together with the biotechnological and medical applications for these proteases, are also briefly discussed. PMID:26150451

  6. A Multifunctional Protease Inhibitor To Regulate Endolysosomal Function

    PubMed Central

    2011-01-01

    Proteases constitute a major class of drug targets. Endosomal compartments harbor several protease families whose attenuation may be beneficial to a number of biological processes, including inflammation, cancer metastasis, antigen presentation, and parasite clearance. As a step toward the goal of generalized but targeted protease inhibition in the endocytic pathway, we describe here the synthesis, characterization, and cellular application of a novel multifunctional protease inhibitor. We show that pepstatin A, a potent but virtually insoluble inhibitor of cathepsins D and E, can be conjugated to a single site on cystatin C, a potent inhibitor of the papain-like cysteine proteases (PLCP) and of asparagine endopeptidease (AEP), to create a highly soluble compound capable of suppressing the activity of all 3 principal protease families found in endosomes and lysosomes. We demonstrate that this cystatin–pepstatin inhibitor (CPI) can be taken up by cells to modulate protease activity and affect biological responses. PMID:21910425

  7. A multifunctional protease inhibitor to regulate endolysosomal function.

    PubMed

    van Kasteren, Sander I; Berlin, Ilana; Colbert, Jeff D; Keane, Doreen; Ovaa, Huib; Watts, Colin

    2011-11-18

    Proteases constitute a major class of drug targets. Endosomal compartments harbor several protease families whose attenuation may be beneficial to a number of biological processes, including inflammation, cancer metastasis, antigen presentation, and parasite clearance. As a step toward the goal of generalized but targeted protease inhibition in the endocytic pathway, we describe here the synthesis, characterization, and cellular application of a novel multifunctional protease inhibitor. We show that pepstatin A, a potent but virtually insoluble inhibitor of cathepsins D and E, can be conjugated to a single site on cystatin C, a potent inhibitor of the papain-like cysteine proteases (PLCP) and of asparagine endopeptidease (AEP), to create a highly soluble compound capable of suppressing the activity of all 3 principal protease families found in endosomes and lysosomes. We demonstrate that this cystatin-pepstatin inhibitor (CPI) can be taken up by cells to modulate protease activity and affect biological responses.

  8. Investigations with Protease.

    ERIC Educational Resources Information Center

    Yip, Din Yan

    1997-01-01

    Presents two simple and reliable ways for measuring protease activity that can be used for a variety of investigations in a range of biology class levels. The investigations use protease from a variety of sources. (DDR)

  9. Investigations with Protease.

    ERIC Educational Resources Information Center

    Yip, Din Yan

    1997-01-01

    Presents two simple and reliable ways for measuring protease activity that can be used for a variety of investigations in a range of biology class levels. The investigations use protease from a variety of sources. (DDR)

  10. CtpB assembles a gated protease tunnel regulating cell-cell signaling during spore formation in Bacillus subtilis.

    PubMed

    Mastny, Markus; Heuck, Alexander; Kurzbauer, Robert; Heiduk, Anja; Boisguerin, Prisca; Volkmer, Rudolf; Ehrmann, Michael; Rodrigues, Christopher D A; Rudner, David Z; Clausen, Tim

    2013-10-24

    Spore formation in Bacillus subtilis relies on a regulated intramembrane proteolysis (RIP) pathway that synchronizes mother-cell and forespore development. To address the molecular basis of this SpoIV transmembrane signaling, we carried out a structure-function analysis of the activating protease CtpB. Crystal structures reflecting distinct functional states show that CtpB constitutes a ring-like protein scaffold penetrated by two narrow tunnels. Access to the proteolytic sites sequestered within these tunnels is controlled by PDZ domains that rearrange upon substrate binding. Accordingly, CtpB resembles a minimal version of a self-compartmentalizing protease regulated by a unique allosteric mechanism. Moreover, biochemical analysis of the PDZ-gated channel combined with sporulation assays reveal that activation of the SpoIV RIP pathway is induced by the concerted activity of CtpB and a second signaling protease, SpoIVB. This proteolytic mechanism is of broad relevance for cell-cell communication, illustrating how distinct signaling pathways can be integrated into a single RIP module.

  11. CtpB Assembles a Gated Protease Tunnel Regulating Cell-Cell Signaling during Spore Formation in Bacillus subtilis

    PubMed Central

    Mastny, Markus; Heuck, Alexander; Kurzbauer, Robert; Heiduk, Anja; Boisguerin, Prisca; Volkmer, Rudolf; Ehrmann, Michael; Rodrigues, Christopher D.A.; Rudner, David Z.; Clausen, Tim

    2013-01-01

    Summary Spore formation in Bacillus subtilis relies on a regulated intramembrane proteolysis (RIP) pathway that synchronizes mother-cell and forespore development. To address the molecular basis of this SpoIV transmembrane signaling, we carried out a structure-function analysis of the activating protease CtpB. Crystal structures reflecting distinct functional states show that CtpB constitutes a ring-like protein scaffold penetrated by two narrow tunnels. Access to the proteolytic sites sequestered within these tunnels is controlled by PDZ domains that rearrange upon substrate binding. Accordingly, CtpB resembles a minimal version of a self-compartmentalizing protease regulated by a unique allosteric mechanism. Moreover, biochemical analysis of the PDZ-gated channel combined with sporulation assays reveal that activation of the SpoIV RIP pathway is induced by the concerted activity of CtpB and a second signaling protease, SpoIVB. This proteolytic mechanism is of broad relevance for cell-cell communication, illustrating how distinct signaling pathways can be integrated into a single RIP module. PMID:24243021

  12. A family of serine proteases of Clavibacter michiganensis subsp. michiganensis: chpC plays a role in colonization of the host plant tomato.

    PubMed

    Stork, Ines; Gartemann, Karl-Heinz; Burger, Annette; Eichenlaub, Rudolf

    2008-09-01

    Genes for seven putative serine proteases (ChpA-ChpG) belonging to the trypsin subfamily and homologous to the virulence factor pat-1 were identified on the chromosome of Clavibacter michiganensis subsp. michiganensis (Cmm) NCPPB382. All proteases have signal peptides indicating export of these proteins. Their putative function is suggested by two motifs and an aspartate residue typical for serine proteases. Furthermore, six cysteine residues are located at conserved positions. The genes are clustered in a chromosomal region of about 50 kb with a significantly lower G + C content than common for Cmm. The genes chpA, chpB and chpD are pseudogenes as they contain frame shifts and/or in-frame stop codons. The genes chpC and chpG were inactivated by the insertion of an antibiotic resistance cassette. The chpG mutant was not impaired in virulence. However, in planta the titre of the chpC mutant was drastically reduced and only weak disease symptoms were observed. Complementation of the chpC mutant by the wild-type allele restored full virulence. ChpC is the first chromosomal gene of Cmm identified so far that affects the interaction of the pathogen with the host plant.

  13. Proteases as therapeutics

    PubMed Central

    Craik, Charles S.; Page, Michael J.; Madison, Edwin L.

    2015-01-01

    Proteases are an expanding class of drugs that hold great promise. The U.S. FDA (Food and Drug Administration) has approved 12 protease therapies, and a number of next generation or completely new proteases are in clinical development. Although they are a well-recognized class of targets for inhibitors, proteases themselves have not typically been considered as a drug class despite their application in the clinic over the last several decades; initially as plasma fractions and later as purified products. Although the predominant use of proteases has been in treating cardiovascular disease, they are also emerging as useful agents in the treatment of sepsis, digestive disorders, inflammation, cystic fibrosis, retinal disorders, psoriasis and other diseases. In the present review, we outline the history of proteases as therapeutics, provide an overview of their current clinical application, and describe several approaches to improve and expand their clinical application. Undoubtedly, our ability to harness proteolysis for disease treatment will increase with our understanding of protease biology and the molecular mechanisms responsible. New technologies for rationally engineering proteases, as well as improved delivery options, will expand greatly the potential applications of these enzymes. The recognition that proteases are, in fact, an established class of safe and efficacious drugs will stimulate investigation of additional therapeutic applications for these enzymes. Proteases therefore have a bright future as a distinct therapeutic class with diverse clinical applications. PMID:21406063

  14. Secreted fungal aspartic proteases: A review.

    PubMed

    Mandujano-González, Virginia; Villa-Tanaca, Lourdes; Anducho-Reyes, Miguel Angel; Mercado-Flores, Yuridia

    2016-01-01

    The aspartic proteases, also called aspartyl and aspartate proteases or acid proteases (E.C.3.4.23), belong to the endopeptidase family and are characterized by the conserved sequence Asp-Gly-Thr at the active site. These enzymes are found in a wide variety of microorganisms in which they perform important functions related to nutrition and pathogenesis. In addition, their high activity and stability at acid pH make them attractive for industrial application in the food industry; specifically, they are used as milk-coagulating agents in cheese production or serve to improve the taste of some foods. This review presents an analysis of the characteristics and properties of secreted microbial aspartic proteases and their potential for commercial application. Copyright © 2016 Asociación Española de Micología. Published by Elsevier Espana. All rights reserved.

  15. Characterization of EspC, a 110-kilodalton protein secreted by enteropathogenic Escherichia coli which is homologous to members of the immunoglobulin A protease-like family of secreted proteins.

    PubMed Central

    Stein, M; Kenny, B; Stein, M A; Finlay, B B

    1996-01-01

    Enteropathogenic Escherichia coli (EPEC) secretes at least five proteins. Two of these proteins, EspA and EspB (previously called EaeB), activate signal transduction pathways in host epithelial cells. While the role of the other three proteins (39, 40, and 110 kDa) remains undetermined, secretion of all five proteins is under the control of perA, a known positive regulator of several EPEC virulence factors. On the basis of amino-terminal protein sequence data, we cloned and sequenced the gene which encodes the 110-kDa secreted protein and examined its possible role in EPEC signaling and interaction with epithelial cells. In accordance with the terminology used for espA and espB, we called this gene espC, for EPEC-secreted protein C. We found significant homology between the predicted EspC protein sequence and a family of immunoglobulin A (IgA) protease-like proteins which are widespread among pathogenic bacteria. Members of this protein family are found in avian pathogenic Escherichia coli (Tsh), Haemophilus influenzae (Hap), and Shigella flexneri (SepA). Although these proteins and EspC do not encode IgA protease activity, they have considerable homology with IgA protease from Neisseria gonorrhoeae and H. influenzae and appear to use a export system for secretion. We found that genes homologous to espC also exist in other pathogenic bacteria which cause attaching and effacing lesions, including Hafnia alvei biotype 19982, Citrobacter freundii biotype 4280, and rabbit diarrheagenic E. coli (RDEC-1). Although these strains secrete various proteins similar in molecular size to the proteins secreted by EPEC, we did not detect secretion of a 110-kDa protein by these strains. To examine the possible role of EspC in EPEC interactions with epithelial cells, we constructed a deletion mutant in espC by allelic exchange and characterized the mutant by standard tissue culture assays. We found that EspC is not necessary for mediating EPEC-induced signal transduction in He

  16. Serine proteases inhibiting cyanopeptides.

    PubMed

    Radau, G

    2000-08-01

    There are many compounds inhibiting serine proteases which play an important role in the human organism. This article reviews publications on the low-molecular weight, serine protease inhibitory cyanopeptides and reports on new developments in establishing structure-activity relationships.

  17. Detergent alkaline proteases: enzymatic properties, genes, and crystal structures.

    PubMed

    Saeki, Katsuhisa; Ozaki, Katsuya; Kobayashi, Tohru; Ito, Susumu

    2007-06-01

    Subtilisin-like serine proteases from bacilli have been used in various industrial fields worldwide, particularly in the production of laundry and automatic dishwashing detergents. They belong to family A of the subtilase superfamily, which is composed of three clans, namely, true subtilisins, high-alkaline proteases, and intracellular proteases. We succeeded in the large-scale production of a high-alkaline protease (M-protease) from alkaliphilic Bacillus clausii KSM-K16, and the enzyme has been introduced into compact heavy-duty laundry detergents. We have also succeeded in the industrial-scale production of a new alkaline protease, KP-43, which was originally resistant to chemical oxidants and to surfactants, produced by alkaliphilic Bacillus sp. strain KSM-KP43 and have incorporated it into laundry detergents. KP-43 and related proteases form a new clan, oxidatively stable proteases, in subtilase family A. In this review, we describe the enzymatic properties, gene sequences, and crystal structures of M-protease, KP-43, and related enzymes.

  18. Bacterial proteases, untapped antimicrobial drug targets.

    PubMed

    Culp, Elizabeth; Wright, Gerard D

    2017-04-01

    Bacterial proteases are an extensive collection of enzymes that have vital roles in cell viability, stress response and pathogenicity. Although their perturbation clearly offers the potential for antimicrobial drug development, both as traditional antibiotics and anti-virulence drugs, they are not yet the target of any clinically used therapeutics. Here we describe the potential for and recent progress in the development of compounds targeting bacterial proteases with a focus on AAA+ family proteolytic complexes and signal peptidases (SPs). Caseinolytic protease (ClpP) belongs to the AAA+ family of proteases, a group of multimeric barrel-shaped complexes whose activity is tightly regulated by associated AAA+ ATPases. The opportunity for chemical perturbation of these complexes is demonstrated by compounds targeting ClpP for inhibition, activation or perturbation of its associated ATPase. Meanwhile, SPs are also a proven antibiotic target. Responsible for the cleavage of targeting peptides during protein secretion, both type I and type II SPs have been successfully targeted by chemical inhibitors. As the threat of pan-antibiotic resistance continues to grow, these and other bacterial proteases offer an arsenal of novel antibiotic targets ripe for development.

  19. Structural determinants of tobacco vein mottling virus protease substrate specificity

    SciTech Connect

    Sun, Ping; Austin, Brian P.; Tozer, Jozsef; Waugh, David

    2010-10-28

    Tobacco vein mottling virus (TVMV) is a member of the Potyviridae, one of the largest families of plant viruses. The TVMV genome is translated into a single large polyprotein that is subsequently processed by three virally encoded proteases. Seven of the nine cleavage events are carried out by the NIa protease. Its homolog from the tobacco etch virus (TEV) is a widely used reagent for the removal of affinity tags from recombinant proteins. Although TVMV protease is a close relative of TEV protease, they exhibit distinct sequence specificities. We report here the crystal structure of a catalytically inactive mutant TVMV protease (K65A/K67A/C151A) in complex with a canonical peptide substrate (Ac-RETVRFQSD) at 1.7-{angstrom} resolution. As observed in several crystal structures of TEV protease, the C-terminus ({approx}20 residues) of TVMV protease is disordered. Unexpectedly, although deleting the disordered residues from TEV protease reduces its catalytic activity by {approx}10-fold, an analogous truncation mutant of TVMV protease is significantly more active. Comparison of the structures of TEV and TVMV protease in complex with their respective canonical substrate peptides reveals that the S3 and S4 pockets are mainly responsible for the differing substrate specificities. The structure of TVMV protease suggests that it is less tolerant of variation at the P1{prime} position than TEV protease. This conjecture was confirmed experimentally by determining kinetic parameters k{sub cat} and K{sub m} for a series of oligopeptide substrates. Also, as predicted by the cocrystal structure, we confirm that substitutions in the P6 position are more readily tolerated by TVMV than TEV protease.

  20. Structural determinants of tobacco vein mottling virus protease substrate specificity.

    PubMed

    Sun, Ping; Austin, Brian P; Tözsér, József; Waugh, David S

    2010-11-01

    Tobacco vein mottling virus (TVMV) is a member of the Potyviridae, one of the largest families of plant viruses. The TVMV genome is translated into a single large polyprotein that is subsequently processed by three virally encoded proteases. Seven of the nine cleavage events are carried out by the NIa protease. Its homolog from the tobacco etch virus (TEV) is a widely used reagent for the removal of affinity tags from recombinant proteins. Although TVMV protease is a close relative of TEV protease, they exhibit distinct sequence specificities. We report here the crystal structure of a catalytically inactive mutant TVMV protease (K65A/K67A/C151A) in complex with a canonical peptide substrate (Ac-RETVRFQSD) at 1.7-Å resolution. As observed in several crystal structures of TEV protease, the C-terminus (∼20 residues) of TVMV protease is disordered. Unexpectedly, although deleting the disordered residues from TEV protease reduces its catalytic activity by ∼10-fold, an analogous truncation mutant of TVMV protease is significantly more active. Comparison of the structures of TEV and TVMV protease in complex with their respective canonical substrate peptides reveals that the S3 and S4 pockets are mainly responsible for the differing substrate specificities. The structure of TVMV protease suggests that it is less tolerant of variation at the P1' position than TEV protease. This conjecture was confirmed experimentally by determining kinetic parameters k(cat) and K(m) for a series of oligopeptide substrates. Also, as predicted by the cocrystal structure, we confirm that substitutions in the P6 position are more readily tolerated by TVMV than TEV protease.

  1. Structural determinants of tobacco vein mottling virus protease substrate specificity

    PubMed Central

    Sun, Ping; Austin, Brian P; Tözsér, József; Waugh, David S

    2010-01-01

    Tobacco vein mottling virus (TVMV) is a member of the Potyviridae, one of the largest families of plant viruses. The TVMV genome is translated into a single large polyprotein that is subsequently processed by three virally encoded proteases. Seven of the nine cleavage events are carried out by the NIa protease. Its homolog from the tobacco etch virus (TEV) is a widely used reagent for the removal of affinity tags from recombinant proteins. Although TVMV protease is a close relative of TEV protease, they exhibit distinct sequence specificities. We report here the crystal structure of a catalytically inactive mutant TVMV protease (K65A/K67A/C151A) in complex with a canonical peptide substrate (Ac-RETVRFQSD) at 1.7-Å resolution. As observed in several crystal structures of TEV protease, the C-terminus (∼20 residues) of TVMV protease is disordered. Unexpectedly, although deleting the disordered residues from TEV protease reduces its catalytic activity by ∼10-fold, an analogous truncation mutant of TVMV protease is significantly more active. Comparison of the structures of TEV and TVMV protease in complex with their respective canonical substrate peptides reveals that the S3 and S4 pockets are mainly responsible for the differing substrate specificities. The structure of TVMV protease suggests that it is less tolerant of variation at the P1′ position than TEV protease. This conjecture was confirmed experimentally by determining kinetic parameters kcat and Km for a series of oligopeptide substrates. Also, as predicted by the cocrystal structure, we confirm that substitutions in the P6 position are more readily tolerated by TVMV than TEV protease. PMID:20862670

  2. Bacterial proteases and virulence.

    PubMed

    Frees, Dorte; Brøndsted, Lone; Ingmer, Hanne

    2013-01-01

    Bacterial pathogens rely on proteolysis for variety of purposes during the infection process. In the cytosol, the main proteolytic players are the conserved Clp and Lon proteases that directly contribute to virulence through the timely degradation of virulence regulators and indirectly by providing tolerance to adverse conditions such as those experienced in the host. In the membrane, HtrA performs similar functions whereas the extracellular proteases, in close contact with host components, pave the way for spreading infections by degrading host matrix components or interfering with host cell signalling to short-circuit host cell processes. Common to both intra- and extracellular proteases is the tight control of their proteolytic activities. In general, substrate recognition by the intracellular proteases is highly selective which is, in part, attributed to the chaperone activity associated with the proteases either encoded within the same polypeptide or on separate subunits. In contrast, substrate recognition by extracellular proteases is less selective and therefore these enzymes are generally expressed as zymogens to prevent premature proteolytic activity that would be detrimental to the cell. These extracellular proteases are activated in complex cascades involving auto-processing and proteolytic maturation. Thus, proteolysis has been adopted by bacterial pathogens at multiple levels to ensure the success of the pathogen in contact with the human host.

  3. Redefining the concept of protease-activated receptors: cathepsin S evokes itch via activation of Mrgprs

    PubMed Central

    Reddy, Vemuri B.; Sun, Shuohao; Azimi, Ehsan; Elmariah, Sarina B.; Dong, Xinzhong; Lerner, Ethan A.

    2015-01-01

    Sensory neurons expressing Mas-related G protein coupled receptors (Mrgprs) mediate histamine-independent itch. We show that the cysteine protease cathepsin S activates MrgprC11 and evokes receptor-dependent scratching in mice. In contrast to its activation of conventional protease-activated receptors, cathepsin S mediated activation of MrgprC11 did not involve the generation of a tethered ligand. We demonstrate further that different cysteine proteases selectively activate specific mouse and human Mrgpr family members. This expansion of our understanding by which proteases interact with GPCRs redefines the concept of what constitutes a protease-activated receptor. The findings also implicate proteases as ligands to members of this orphan receptor family while providing new insights into how cysteine proteases contribute to itch. PMID:26216096

  4. Functional Implications of Domain Organization Within Prokaryotic Rhomboid Proteases.

    PubMed

    Panigrahi, Rashmi; Lemieux, M Joanne

    2015-01-01

    Intramembrane proteases are membrane embedded enzymes that cleave transmembrane substrates. This interesting class of enzyme and its water mediated substrate cleavage mechanism occurring within the hydrophobic lipid bilayer has drawn the attention of researchers. Rhomboids are a family of ubiquitous serine intramembrane proteases. Bacterial forms of rhomboid proteases are mainly composed of six transmembrane helices that are preceded by a soluble N-terminal domain. Several crystal structures of the membrane domain of the E. coli rhomboid protease ecGlpG have been solved. Independently, the ecGlpG N-terminal cytoplasmic domain structure was solved using both NMR and protein crystallography. Despite these structures, we still do not know the structure of the full-length protein, nor do we know the functional role of these domains in the cell. This chapter will review the structural and functional roles of the different domains associated with prokaryotic rhomboid proteases. Lastly, we will address questions remaining in the field.

  5. The Degradome database: mammalian proteases and diseases of proteolysis.

    PubMed

    Quesada, Víctor; Ordóñez, Gonzalo R; Sánchez, Luis M; Puente, Xose S; López-Otín, Carlos

    2009-01-01

    The degradome is defined as the complete set of proteases present in an organism. The recent availability of whole genomic sequences from multiple organisms has led us to predict the contents of the degradomes of several mammalian species. To ensure the fidelity of these predictions, our methods have included manual curation of individual sequences and, when necessary, direct cloning and sequencing experiments. The results of these studies in human, chimpanzee, mouse and rat have been incorporated into the Degradome database, which can be accessed through a web interface at http://degradome.uniovi.es. The annotations about each individual protease can be retrieved by browsing catalytic classes and families or by searching specific terms. This web site also provides detailed information about genetic diseases of proteolysis, a growing field of great importance for multiple users. Finally, the user can find additional information about protease structures, protease inhibitors, ancillary domains of proteases and differences between mammalian degradomes.

  6. [Chloroplast Deg proteases].

    PubMed

    Grabsztunowicz, Magda; Luciński, Robert; Baranek, Małgorzata; Sikora, Bogna; Jackowski, Grzegorz

    2011-01-01

    For some chloroplast proteases ATP binding and hydrolysis is not necessary for their catalytic activity, most probably because even strongly unfolded substrates may penetrate their catalytic chamber. Deg1, 2, 5 and 8 are the best known of Arabidopsis thaliana ATP- independent chloroplast proteases, encoded by orthologues of genes coding for DegP, DegQ and DegS proteases of Escherichia coli. Current awareness in the area of structure and functions of chloroplast Degs is much more limited vs the one about their bacterial counterparts. Deg5 and Deg8 form a catalytic heterododecamer which is loosely attached to luminal side of thylakoid membrane. The complex catalyses--supported by Deg1 and one of FtsH proteases--the degradation of PsbA damaged due to plant exposition to elevated irradiance and thus these protease are of key importance for the plants' sensitivity to photoinhibition. Deg2 role in the disposal of damaged PsbA has not been elucidated. Recombinant Deg1 may degrade PsbO and plastocyanin in vitro but it is not clear whether this reaction is performed in vivo as well.

  7. Protease inhibitor studies enrolling.

    PubMed

    1995-01-01

    The protease enzyme is essential for HIV to make copies of itself. So far, research has failed to find a protease inhibitor that works against HIV. It is believed that, regardless of what type of protease inhibitor someone takes, it will need to be supplemented with other anti-HIV drugs. Three protease inhibitors have thus far been found to be safe, although long-term effects are unknown. These drugs are saquinavir, ABT-538, and L-735,524 produced by Hoffman-LaRoche, Abbott, and Merck respectively. Clinical trials of saquinavir are promising but it has not been shown to be the knock-out drug needed. ABT-538 has high bioavailability, but studies are showing it can cause liver and eye damage. L-735,524 studies are showing that resistance develops quite quickly. Future studies at higher doses are expected. To obtain information on protease studies currently looking for participants, contact The Network. Information on other approved, alternative, and experimental drugs is also available.

  8. The site-2 protease.

    PubMed

    Rawson, Robert B

    2013-12-01

    The site-2 protease (S2P) is an unusually-hydrophobic integral membrane protease. It cleaves its substrates, which are membrane-bound transcription factors, within membrane-spanning helices. Although structural information for S2P from animals is lacking, the available data suggest that cleavage may occur at or within the lipid bilayer. In mammalian cells, S2P is essential owing to its activation of the sterol regulatory element binding proteins (SREBPs); in the absence of exogenous lipid, cells lacking S2P cannot survive. S2P is also important in the endoplasmic reticulum (ER) stress response, activating several different membrane-bound transcription factors. Human patients harboring reduction-of-function mutations in S2P exhibit an array of pathologies ranging from skin defects to neurological abnormalities. Surprisingly, Drosophila melanogaster lacking S2P are viable and fertile. This article is part of a Special Issue entitled: Intramembrane Proteases.

  9. Characterization of the interleukin-1beta-converting enzyme/ced-3-family protease, caspase-3/CPP32, in Hodgkin's disease: lack of caspase-3 expression in nodular lymphocyte predominance Hodgkin's disease.

    PubMed

    Izban, K F; Wrone-Smith, T; Hsi, E D; Schnitzer, B; Quevedo, M E; Alkan, S

    1999-05-01

    Apoptosis (programmed cell death) serves an important role in the normal morphogenesis, immunoregulation, and homeostatic mechanisms in both normal and neoplastic cells. Caspase-3/CPP32, a member of the ICE/Ced-3-family of cysteine proteases, is an important downstream mediator of several complex proteolytic cascades that result in apoptosis in both hematopoietic and nonhematopoietic cells. Previous studies have demonstrated that caspase-3 is commonly expressed in classical Hodgkin's disease (CHD); however, the biological significance of its expression in Hodgkin's disease is unknown. In this report, the expression of caspase-3 in nodular lymphocyte predominance Hodgkin's disease (NLPHD) was evaluated by immunohistochemistry; in addition, we investigated the role of caspase-3 in CD95 (Fas)-mediated apoptosis in three CHD cell lines. Formalin-fixed, paraffin-embedded tissue sections from 11 cases of NLPHD were immunostained for caspase-3 using a polyclonal rabbit antibody that detects both the 32-kd zymogen and the 20-kd active subunit of the caspase-3 protease. Only 1/11 cases of NLPHD demonstrated caspase-3 immunopositivity in lymphocytic/histiocytic cells. Caspase-3 expression was also evaluated in three CHD cell lines, HS445, L428, and KMH2. Whereas caspase-3 expression was detected in HS445 and L428 cell lines, no expression was found in KMH2 cells by immunohistochemical staining. Treatment of HS445 and L428 cell lines for 72 hours with agonistic CD95 monoclonal antibody induced marked apoptosis that was significantly inhibited by pretreatment with the caspase-3 inhibitor, DEVD-FMK, as determined by terminal deoxynucleotidyl transferase-mediated dUTP nick end-labeling assay and flow cytometric analysis of 7-amino-actinomycin D staining. In addition, a significant increase in caspase-3 activity as determined by an enzyme colorimetric assay was detected in HS445 and L428 cells after 48 hours of CD95 stimulation. In marked contrast, treatment of caspase-3

  10. Cysteine Protease Inhibitors as Chemotherapy: Lessons from a Parasite Target

    NASA Astrophysics Data System (ADS)

    Selzer, Paul M.; Pingel, Sabine; Hsieh, Ivy; Ugele, Bernhard; Chan, Victor J.; Engel, Juan C.; Bogyo, Matthew; Russell, David G.; Sakanari, Judy A.; McKerrow, James H.

    1999-09-01

    Papain family cysteine proteases are key factors in the pathogenesis of cancer invasion, arthritis, osteoporosis, and microbial infections. Targeting this enzyme family is therefore one strategy in the development of new chemotherapy for a number of diseases. Little is known, however, about the efficacy, selectivity, and safety of cysteine protease inhibitors in cell culture or in vivo. We now report that specific cysteine protease inhibitors kill Leishmania parasites in vitro, at concentrations that do not overtly affect mammalian host cells. Inhibition of Leishmania cysteine protease activity was accompanied by defects in the parasite's lysosome/endosome compartment resembling those seen in lysosomal storage diseases. Colocalization of anti-protease antibodies with biotinylated surface proteins and accumulation of undigested debris and protease in the flagellar pocket of treated parasites were consistent with a pathway of protease trafficking from flagellar pocket to the lysosome/endosome compartment. The inhibitors were sufficiently absorbed and stable in vivo to ameliorate the pathology associated with a mouse model of Leishmania infection.

  11. Purification, characterization and identification of a senescence related serine protease in dark-induced senescent wheat leaves.

    PubMed

    Wang, Renxian; Liu, Shaowei; Wang, Jin; Dong, Qiang; Xu, Langlai; Rui, Qi

    2013-11-01

    Senescence-related proteases play important roles in leaf senescence by regulating protein degradation and nutrient recycling. A 98.9kDa senescence-related protease EP3 in wheat leaves was purified by ammonium sulfate precipitation, Q-Sepharose fast flow anion exchange chromatography and gel slicing after gel electrophoresis. Due to its relatively high thermal stability, its protease activity did not decrease after incubation at 40°C for 1-h. EP3 protease was suggested to be a metal-dependent serine protease, because its activity was inhibited by serine protease inhibitors PMSF and AEBSF and metal related protease inhibitor EGTA. It was identified as a subtilisin-like serine protease of the S8A family based on data from both mass spectrometry and the cloned cDNA sequence. Therefore, these data suggest that a serine protease of the S8A subfamily with specific biochemical properties is involved in senescence-associated protein degradation.

  12. Proteases in bacterial pathogenesis.

    PubMed

    Ingmer, Hanne; Brøndsted, Lone

    2009-11-01

    Bacterial pathogens rely on proteolysis for protein quality control under adverse conditions experienced in the host, as well as for the timely degradation of central virulence regulators. We have focused on the contribution of the conserved Lon, Clp, HtrA and FtsH proteases to pathogenesis and have highlighted common biological processes for which their activities are important for virulence.

  13. Specific and efficient cleavage of fusion proteins by recombinant plum pox virus NIa protease.

    PubMed

    Zheng, Nuoyan; Pérez, José de Jesús; Zhang, Zhonghui; Domínguez, Elvira; Garcia, Juan Antonio; Xie, Qi

    2008-02-01

    Site-specific proteases are the most popular kind of enzymes for removing the fusion tags from fused target proteins. Nuclear inclusion protein a (NIa) proteases obtained from the family Potyviridae have become promising due to their high activities and stringencies of sequences recognition. NIa proteases from tobacco etch virus (TEV) and tomato vein mottling virus (TVMV) have been shown to process recombinant proteins successfully in vitro. In this report, recombinant PPV (plum pox virus) NIa protease was employed to process fusion proteins with artificial cleavage site in vitro. Characteristics such as catalytic ability and affecting factors (salt, temperature, protease inhibitors, detergents, and denaturing reagents) were investigated. Recombinant PPV NIa protease expressed and purified from Escherichia coli demonstrated efficient and specific processing of recombinant GFP and SARS-CoV nucleocapsid protein, with site F (N V V V H Q black triangle down A) for PPV NIa protease artificially inserted between the fusion tags and the target proteins. Its catalytic capability is similar to those of TVMV and TEV NIa protease. Recombinant PPV NIa protease reached its maximal proteolytic activity at approximately 30 degrees C. Salt concentration and only one of the tested protease inhibitors had minor influences on the proteolytic activity of PPV NIa protease. Recombinant PPV NIa protease was resistant to self-lysis for at least five days.

  14. The Crystal Structure of GXGD Membrane Protease FlaK

    SciTech Connect

    J Hu; Y Xue; S Lee; Y Ha

    2011-12-31

    The GXGD proteases are polytopic membrane proteins with catalytic activities against membrane-spanning substrates that require a pair of aspartyl residues. Representative members of the family include preflagellin peptidase, type 4 prepilin peptidase, presenilin and signal peptide peptidase. Many GXGD proteases are important in medicine. For example, type 4 prepilin peptidase may contribute to bacterial pathogenesis, and mutations in presenilin are associated with Alzheimer's disease. As yet, there is no atomic-resolution structure in this protease family. Here we report the crystal structure of FlaK, a preflagellin peptidase from Methanococcus maripaludis, solved at 3.6 {angstrom} resolution. The structure contains six transmembrane helices. The GXGD motif and a short transmembrane helix, helix 4, are positioned at the centre, surrounded by other transmembrane helices. The crystal structure indicates that the protease must undergo conformational changes to bring the GXGD motif and a second essential aspartyl residue from transmembrane helix 1 into close proximity for catalysis. A comparison of the crystal structure with models of presenilin derived from biochemical analysis reveals three common transmembrane segments that are similarly arranged around the active site. This observation reinforces the idea that the prokaryotic and human proteases are evolutionarily related. The crystal structure presented here provides a framework for understanding the mechanism of the GXGD proteases, and may facilitate the rational design of inhibitors that target specific members of the family.

  15. The crystal structure of GXGD membrane protease FlaK

    SciTech Connect

    Hu, Jian; Xue, Yi; Lee, Sangwon; Ha, Ya

    2011-09-20

    The GXGD proteases are polytopic membrane proteins with catalytic activities against membrane-spanning substrates that require a pair of aspartyl residues. Representative members of the family include preflagellin peptidase, type 4 prepilin peptidase, presenilin and signal peptide peptidase. Many GXGD proteases are important in medicine. For example, type 4 prepilin peptidase may contribute to bacterial pathogenesis, and mutations in presenilin are associated with Alzheimer's disease. As yet, there is no atomic-resolution structure in this protease family. Here we report the crystal structure of FlaK, a preflagellin peptidase from Methanococcus maripaludis, solved at 3.6 {angstrom} resolution. The structure contains six transmembrane helices. The GXGD motif and a short transmembrane helix, helix 4, are positioned at the centre, surrounded by other transmembrane helices. The crystal structure indicates that the protease must undergo conformational changes to bring the GXGD motif and a second essential aspartyl residue from transmembrane helix 1 into close proximity for catalysis. A comparison of the crystal structure with models of presenilin derived from biochemical analysis reveals three common transmembrane segments that are similarly arranged around the active site. This observation reinforces the idea that the prokaryotic and human proteases are evolutionarily related. The crystal structure presented here provides a framework for understanding the mechanism of the GXGD proteases, and may facilitate the rational design of inhibitors that target specific members of the family.

  16. Bioinformatics perspective on rhomboid intramembrane protease evolution and function.

    PubMed

    Kinch, Lisa N; Grishin, Nick V

    2013-12-01

    Endopeptidase classification based on catalytic mechanism and evolutionary history has proven to be invaluable to the study of proteolytic enzymes. Such general mechanistic- and evolutionary- based groupings have launched experimental investigations, because knowledge gained for one family member tends to apply to the other closely related enzymes. The serine endopeptidases represent one of the most abundant and diverse groups, with their apparently successful proteolytic mechanism having arisen independently many times throughout evolution, giving rise to the well-studied soluble chemotrypsins and subtilisins, among many others. A large and diverse family of polytopic transmembrane proteins known as rhomboids has also evolved the serine protease mechanism. While the spatial structure, mechanism, and biochemical function of this family as intramembrane proteases has been established, the cellular roles of these enzymes as well as their natural substrates remain largely undetermined. While the evolutionary history of rhomboid proteases has been debated, sorting out the relationships among current day representatives should provide a solid basis for narrowing the knowledge gap between their biochemical and cellular functions. Indeed, some functional characteristics of rhomboid proteases can be gleaned from their evolutionary relationships. Finally, a specific case where phylogenetic profile analysis has identified proteins that contain a C-terminal processing motif (GlyGly-Cterm) as co-occurring with a set of bacterial rhomboid proteases provides an example of potential target identification through bioinformatics. This article is part of a Special Issue entitled: Intramembrane Proteases. © 2013.

  17. A primitive enzyme for a primitive cell: the protease required for excystation of Giardia.

    PubMed

    Ward, W; Alvarado, L; Rawlings, N D; Engel, J C; Franklin, C; McKerrow, J H

    1997-05-02

    Protozoan parasites of the genus Giardia are one of the earliest lineages of eukaryotic cells. To initiate infection, trophozoites emerge from a cyst in the host. Excystation is blocked by specific cysteine protease inhibitors. Using a biotinylated inhibitor, the target protease was identified and its corresponding gene cloned. The protease was localized to vesicles that release their contents just prior to excystation. The Giardia protease is the earliest known branch of the cathepsin B family. Its phylogeny confirms that the cathepsin B lineage evolved in primitive eukaryotic cells, prior to the divergence of plant and animal kingdoms, and underscores the diversity of cellular functions that this enzyme family facilitates.

  18. Rapid qualitative protease microassay (RPM).

    PubMed

    Mohan, S; Ma, P W K; Luthe, D S

    2005-09-30

    A rapid qualitative protease microassay (RPM) was developed as an alternative to conventional assays of cysteine protease activity in HPLC fractions. Using this technique protease activity in samples could be visually determined within 5 min. The method was sensitive to 3.3x10(-7) U/mL of papain and detected cysteine protease activity in dilute HPLC fractions with activity of 5.4x10(-5) U/mL. Because the method monitors the decolorization of Coomassie Brilliant Blue stained substrate, it can be modified to detect other classes of proteases.

  19. Rabbit endogenous retrovirus-H encodes a functional protease.

    PubMed

    Voisset, Cécile; Myers, Richard E; Carne, Alex; Kellam, Paul; Griffiths, David J

    2003-01-01

    Recent studies have revealed that 'human retrovirus-5' sequences found in human samples belong to a rabbit endogenous retrovirus family named RERV-H. A part of the gag-pro region of the RERV-H genome was amplified by PCR from DNA in human samples and several forms of RERV-H protease were expressed in bacteria. The RERV-H protease was able to cleave itself from a precursor protein and was also able to cleave the RERV-H Gag polyprotein precursor in vitro whereas a form of the protease with a mutation engineered into the active site was inactive. Potential N- and C-terminal autocleavage sites were characterized. The RERV-H protease was sensitive to pepstatin A, showing it to be an aspartic protease. Moreover, it was strongly inhibited by PYVPheStaAMT, a pseudopeptide inhibitor specific for Mason-Pfizer monkey virus and avian myeloblastosis-associated virus. A structural model of the RERV-H protease was constructed that, together with the activity data, confirms that this is a retroviral aspartic protease.

  20. From proteases to proteomics

    PubMed Central

    Neurath, Hans

    2001-01-01

    This personal and professional autobiography covers the 50-yr period of 1950–2000 and includes the following topics: History of the University of Washington School of Medicine and its Department of Biochemistry (Mount Rainier and the University of Washington, recruiting faculty, biology, research programs); scientific editing (publication, Biochemistry, Protein Science, electronic publication); Europe revisited (Heidelberg, approaching retirement, the German Research Center, reunion in Vienna); and 50 yr of research on proteolytic enzymes (trypsin, carboxypeptidases, mast cell proteases, future developments). PMID:11274481

  1. From proteases to proteomics.

    PubMed

    Neurath, H

    2001-04-01

    This personal and professional autobiography covers the 50-yr period of 1950-2000 and includes the following topics: History of the University of Washington School of Medicine and its Department of Biochemistry (Mount Rainier and the University of Washington, recruiting faculty, biology, research programs); scientific editing (publication, Biochemistry, Protein Science, electronic publication); Europe revisited (Heidelberg, approaching retirement, the German Research Center, reunion in Vienna); and 50 yr of research on proteolytic enzymes (trypsin, carboxypeptidases, mast cell proteases, future developments).

  2. Proteases in blood clotting.

    PubMed

    Walsh, Peter N; Ahmad, Syed S

    2002-01-01

    The serine proteases, cofactors and cell-receptor molecules that comprise the haemostatic mechanism are highly conserved modular proteins that have evolved to participate in biochemical reactions in blood coagulation, anticoagulation and fibrinolysis. Blood coagulation is initiated by exposure of tissue factor, which forms a complex with factor VIIa and factor X, which results in the generation of small quantities of thrombin and is rapidly shutdown by the tissue factor pathway inhibitor. The generation of these small quantities of thrombin then activates factor XI, resulting in a sequence of events that lead to the activation of factor IX, factor X and prothrombin. Sufficient thrombin is generated to effect normal haemostasis by converting fibrinogen into fibrin. The anticoagulant pathways that regulate blood coagulation include the protein C anticoagulant mechanism, the serine protease inhibitors in plasma, and the Kunitz-like inhibitors, tissue factor pathway inhibitor and protease nexin 2. Finally, the fibrinolytic mechanism that comprises the activation of plasminogen into plasmin prevents excessive fibrin accumulation by promoting local dissolution of thrombi and promoting wound healing by reestablishment of blood flow.

  3. Multifunctional Mitochondrial AAA Proteases

    PubMed Central

    Glynn, Steven E.

    2017-01-01

    Mitochondria perform numerous functions necessary for the survival of eukaryotic cells. These activities are coordinated by a diverse complement of proteins encoded in both the nuclear and mitochondrial genomes that must be properly organized and maintained. Misregulation of mitochondrial proteostasis impairs organellar function and can result in the development of severe human diseases. ATP-driven AAA+ proteins play crucial roles in preserving mitochondrial activity by removing and remodeling protein molecules in accordance with the needs of the cell. Two mitochondrial AAA proteases, i-AAA and m-AAA, are anchored to either face of the mitochondrial inner membrane, where they engage and process an array of substrates to impact protein biogenesis, quality control, and the regulation of key metabolic pathways. The functionality of these proteases is extended through multiple substrate-dependent modes of action, including complete degradation, partial processing, or dislocation from the membrane without proteolysis. This review discusses recent advances made toward elucidating the mechanisms of substrate recognition, handling, and degradation that allow these versatile proteases to control diverse activities in this multifunctional organelle. PMID:28589125

  4. Cloning, expression and activity analysis of a novel fibrinolytic serine protease from Arenicola cristata

    NASA Astrophysics Data System (ADS)

    Zhao, Chunling; Ju, Jiyu

    2015-06-01

    The full-length cDNA of a protease gene from a marine annelid Arenicola cristata was amplified through rapid amplification of cDNA ends technique and sequenced. The size of the cDNA was 936 bp in length, including an open reading frame encoding a polypeptide of 270 amino acid residues. The deduced amino acid sequnce consisted of pro- and mature sequences. The protease belonged to the serine protease family because it contained the highly conserved sequence GDSGGP. This protease was novel as it showed a low amino acid sequence similarity (< 40%) to other serine proteases. The gene encoding the active form of A. cristata serine protease was cloned and expressed in E. coli. Purified recombinant protease in a supernatant could dissolve an artificial fibrin plate with plasminogen-rich fibrin, whereas the plasminogen-free fibrin showed no clear zone caused by hydrolysis. This result suggested that the recombinant protease showed an indirect fibrinolytic activity of dissolving fibrin, and was probably a plasminogen activator. A rat model with venous thrombosis was established to demonstrate that the recombinant protease could also hydrolyze blood clot in vivo. Therefore, this recombinant protease may be used as a thrombolytic agent for thrombosis treatment. To our knowledge, this study is the first of reporting the fibrinolytic serine protease gene in A. cristata.

  5. Functional interplay between tetraspanins and proteases.

    PubMed

    Yáñez-Mó, María; Gutiérrez-López, Maria Dolores; Cabañas, Carlos

    2011-10-01

    Several recent publications have described examples of physical and functional interations between tetraspanins and specific membrane proteases belonging to the TM-MMP and α-(ADAMs) and γ-secretases families. Collectively, these examples constitute an emerging body of evidence supporting the notion that tetraspanin-enriched microdomains (TEMs) represent functional platforms for the regulation of key cellular processes including the release of surface protein ectodomains ("shedding"), regulated intramembrane proteolysis ("RIPing") and matrix degradation and assembly. These cellular processes in turn play a crucial role in an array of physiological and pathological phenomena. Thus, TEMs may represent new therapeutical targets that may simultaneously affect the proteolytic activity of different enzymes and their substrates. Agonistic or antagonistic antibodies and blocking soluble peptides corresponding to tetraspanin functional regions may offer new opportunities in the treatment of pathologies such as chronic inflammation, cancer, or Alzheimer's disease. In this review article, we will discuss all these aspects of functional regulation of protease activities by tetraspanins.

  6. Protease signalling: the cutting edge

    PubMed Central

    Turk, Boris; Turk, Dus̆an; Turk, Vito

    2012-01-01

    Protease research has undergone a major expansion in the last decade, largely due to the extremely rapid development of new technologies, such as quantitative proteomics and in-vivo imaging, as well as an extensive use of in-vivo models. These have led to identification of physiological substrates and resulted in a paradigm shift from the concept of proteases as protein-degrading enzymes to proteases as key signalling molecules. However, we are still at the beginning of an understanding of protease signalling pathways. We have only identified a minor subset of true physiological substrates for a limited number of proteases, and their physiological regulation is still not well understood. Similarly, links with other signalling systems are not well established. Herein, we will highlight current challenges in protease research. PMID:22367392

  7. Protease signalling: the cutting edge.

    PubMed

    Turk, Boris; Turk, Dušan; Turk, Vito

    2012-04-04

    Protease research has undergone a major expansion in the last decade, largely due to the extremely rapid development of new technologies, such as quantitative proteomics and in-vivo imaging, as well as an extensive use of in-vivo models. These have led to identification of physiological substrates and resulted in a paradigm shift from the concept of proteases as protein-degrading enzymes to proteases as key signalling molecules. However, we are still at the beginning of an understanding of protease signalling pathways. We have only identified a minor subset of true physiological substrates for a limited number of proteases, and their physiological regulation is still not well understood. Similarly, links with other signalling systems are not well established. Herein, we will highlight current challenges in protease research.

  8. Serine protease inhibitors suppress pancreatic endogenous proteases and modulate bacterial neutral proteases.

    PubMed

    Nduaguibe, Chikodili C; Bentsi-Barnes, Kwamina; Mullen, Yoko; Kandeel, Fouad; Al-Abdullah, Ismail

    2010-01-01

    Pefabloc, Trasylol and Urinary Trypsin Inhibitor (UTI) have been reported to be effective serine protease inhibitors that impair pancreatic endogenous proteases resulting in improved islet yield. Here we evaluated the effect of these inhibitors on endogenous proteases (trypsin, chymotrypsin and elastase), bacterial neutral proteases (thermolysin and neutral protease) and islet isolation digestion samples. Protease activity was measured using a fluorimetric assay and islet function was assessed by dynamic perifusion. Trypsin, chymotrypsin and elastase were significantly inhibited by Pefabloc and UTI. Trasylol showed strong inhibitory effects on trypsin and chymotrypsin but also decreased thermolysin activity. UTI was found to inhibit the activity of endogenous proteases and increase the activity of bacterial neutral proteases. Human islets exposed to Pefabloc had reduced insulin response, unlike Trasylol or UTI, which had no detrimental effect on insulin secretion. Although Trasylol was an effective inhibitor of endogenous proteases, FDA regulatory issues preclude its use in clinical application and thus in the isolation process. UTI has the greatest potential because it impairs endogenous pancreatic proteases and enhances digestion enzymes.

  9. Genome-wide identification and structure-function studies of proteases and protease inhibitors in Cicer arietinum (chickpea).

    PubMed

    Sharma, Ranu; Suresh, C G

    2015-01-01

    Proteases are a family of enzymes present in almost all living organisms. In plants they are involved in many biological processes requiring stress response in situations such as water deficiency, pathogen attack, maintaining protein content of the cell, programmed cell death, senescence, reproduction and many more. Similarly, protease inhibitors (PIs) are involved in various important functions like suppression of invasion by pathogenic nematodes, inhibition of spores-germination and mycelium growth of Alternaria alternata and response to wounding and fungal attack. As much as we know, no genome-wide study of proteases together with proteinaceous PIs is reported in any of the sequenced genomes till now. Phylogenetic studies and domain analysis of proteases were carried out to understand the molecular evolution as well as gene and protein features. Structural analysis was carried out to explore the binding mode and affinity of PIs for cognate proteases and prolyl oligopeptidase protease with inhibitor ligand. In the study reported here, a significant number of proteases and PIs were identified in chickpea genome. The gene expression profiles of proteases and PIs in five different plant tissues revealed a differential expression pattern in more than one plant tissue. Molecular dynamics studies revealed the formation of stable complex owing to increased number of protein-ligand and inter and intramolecular protein-protein hydrogen bonds. The genome-wide identification, characterization, evolutionary understanding, gene expression, and structural analysis of proteases and PIs provide a framework for future analysis when defining their roles in stress response and developing a more stress tolerant variety of chickpea. Copyright © 2014 Elsevier Ltd. All rights reserved.

  10. Protease-mediated drug delivery

    NASA Astrophysics Data System (ADS)

    Dickson, Eva F.; Goyan, Rebecca L.; Kennedy, James C.; Mackay, M.; Mendes, M. A. K.; Pottier, Roy H.

    2003-12-01

    Drugs used in disease treatment can cause damage to both malignant and normal tissue. This toxicity limits the maximum therapeutic dose. Drug targeting is of high interest to increase the therapeutic efficacy of the drug without increasing systemic toxicity. Certain tissue abnormalities, disease processes, cancers, and infections are characterized by high levels of activity of specific extracellular and/or intracellular proteases. Abnormally high activity levels of specific proteases are present at sites of physical or chemical trauma, blood clots, malignant tumors, rheumatoid arthritis, inflammatory bowel disease, gingival disease, glomerulonerphritis, and acute pancreatitis. Abnormal protease activity is suspected in development of liver thrombosis, pulmonary emphysema, atherosclerosis, and muscular dystrophy. Inactiviating disease-associated proteases by the administration of appropriate protease inhibitors has had limited success. Instead, one could use such proteases to target drugs to treat the condition. Protease mediated drug delivery offers such a possibility. Solubilizing groups are attached to insoluble drugs via a polypeptide chain which is specifically cleavable by certian proteases. When the solubilized drug enounters the protease, the solubilizing moieties are cleaved, and the drug precipitates at the disease location. Thus, a smaller systemic dosage could result in a therapeutic drug concentration at the treatment site with less systemic toxicity.

  11. Modeling and structural analysis of PA clan serine proteases

    PubMed Central

    2012-01-01

    Background Serine proteases account for over a third of all known proteolytic enzymes; they are involved in a variety of physiological processes and are classified into clans sharing structural homology. The PA clan of endopeptidases is the most abundant and over two thirds of this clan is comprised of the S1 family of serine proteases, which bear the archetypal trypsin fold and have a catalytic triad in the order Histidine, Aspartate, Serine. These proteases have been studied in depth and many three dimensional structures have been experimentally determined. However, these structures mostly consist of bacterial and animal proteases, with a small number of plant and fungal proteases and as yet no structures have been determined for protozoa or archaea. The core structure and active site geometry of these proteases is of interest for many applications. This study investigated the structural properties of different S1 family serine proteases from a diverse range of taxa using molecular modeling techniques. Results Our predicted models from protozoa, archaea, fungi and plants were combined with the experimentally determined structures of 16 S1 family members and used for analysis of the catalytic core. Amino acid sequences were submitted to SWISS-MODEL for homology-based structure prediction or the LOOPP server for threading-based structure prediction. Predicted models were refined using INSIGHT II and SCRWL and validated against experimental structures. Investigation of secondary structures and electrostatic surface potential was performed using MOLMOL. The structural geometry of the catalytic core shows clear deviations between taxa, but the relative positions of the catalytic triad residues were conserved. Some highly conserved residues potentially contributing to the stability of the structural core were identified. Evolutionary divergence was also exhibited by large variation in secondary structure features outside the core, differences in overall amino acid

  12. Role of rhomboid proteases in bacteria.

    PubMed

    Rather, Philip

    2013-12-01

    The first member of the rhomboid family of intramembrane serine proteases in bacteria was discovered almost 20years ago. It is now known that rhomboid proteins are widely distributed in bacteria, with some bacteria containing multiple rhomboids. At the present time, only a single rhomboid-dependent function in bacteria has been identified, which is the cleavage of TatA in Providencia stuartii. Mutational analysis has shown that loss of the GlpG rhomboid in Escherichia coli alters cefotaxime resistance, loss of the YqgP (GluP) rhomboid in Bacillus subtilis alters cell division and glucose uptake, and loss of the MSMEG_5036 and MSMEG_4904 genes in Mycobacterium smegmatis results in altered colony morphology, biofilm formation and antibiotic susceptibilities. However, the cellular substrates for these proteins have not been identified. In addition, analysis of the rhombosortases, together with their possible Gly-Gly CTERM substrates, may shed new light on the role of these proteases in bacteria. This article is part of a Special Issue entitled: Intramembrane Proteases.

  13. Protease inhibitors and proteolytic signalling cascades in insects.

    PubMed

    Gubb, David; Sanz-Parra, Arantza; Barcena, Laura; Troxler, Laurent; Fullaondo, Ane

    2010-12-01

    Proteolytic signalling cascades control a wide range of physiological responses. In order to respond rapidly, protease activity must be maintained at a basal level: the component zymogens must be sequentially activated and actively degraded. At the same time, signalling cascades must respond precisely: high target specificity is required. The insects have a wide range of trapping- and tight-binding protease inhibitors, which can regulate the activity of individual proteases. In addition, the interactions between component proteases of a signalling cascade can be modified by serine protease homologues. The suicide-inhibition mechanism of serpin family inhibitors gives rapid turnover of both protease and inhibitor, but target specificity is inherently broad. Similarly, the TEP/macroglobulins have extremely broad target specificity, which suits them for roles as hormone transport proteins and sensors of pathogenic virulence factors. The tight-binding inhibitors, on the other hand, have a lock-and-key mechanism capable of high target specificity. In addition, proteins containing multiple tight-binding inhibitory domains may act as scaffolds for the assembly of signalling complexes. Proteolytic cascades regulated by combinations of different types of inhibitor could combine the rapidity of suicide-inhibitors with the specificity lock-and-key inhibitors. This would allow precise control of physiological responses and may turn out to be a general rule.

  14. Phenotypic Analysis of Mice Lacking the Tmprss2-Encoded Protease

    PubMed Central

    Kim, Tom S.; Heinlein, Cynthia; Hackman, Robert C.; Nelson, Peter S.

    2006-01-01

    Tmprss2 encodes an androgen-regulated type II transmembrane serine protease (TTSP) expressed highly in normal prostate epithelium and has been implicated in prostate carcinogenesis. Although in vitro studies suggest protease-activated receptor 2 may be a substrate for TMPRSS2, the in vivo biological activities of TMPRSS2 remain unknown. We generated Tmprss2−/− mice by disrupting the serine protease domain through homologous recombination. Compared to wild-type littermates, Tmprss2−/− mice developed normally, survived to adulthood with no differences in protein levels of prostatic secretions, and exhibited no discernible abnormalities in organ histology or function. Loss of TMPRSS2 serine protease activity did not influence fertility, reduce survival, result in prostate hyperplasia or carcinoma, or alter prostatic luminal epithelial cell regrowth following castration and androgen replacement. Lack of an observable phenotype in Tmprss2−/− mice was not due to transcriptional compensation by closely related Tmprss2 homologs. We conclude that the lack of a discernible phenotype in Tmprss2−/− mice suggests functional redundancy involving one or more of the type II transmembrane serine protease family members or other serine proteases. Alternatively, TMPRSS2 may contribute a specialized but nonvital function that is apparent only in the context of stress, disease, or other systemic perturbation. PMID:16428450

  15. Pnserpin: A Novel Serine Protease Inhibitor from Extremophile Pyrobaculum neutrophilum

    PubMed Central

    Zhang, Huan; Fei, Rui; Xue, Baigong; Yu, Shanshan; Zhang, Zuoming; Zhong, Sheng; Gao, Yuanqi; Zhou, Xiaoli

    2017-01-01

    Serine protease inhibitors (serpins) are native inhibitors of serine proteases, constituting a large protein family with members spread over eukaryotes and prokaryotes. However, only very few prokaryotic serpins, especially from extremophiles, have been characterized to date. In this study, Pnserpin, a putative serine protease inhibitor from the thermophile Pyrobaculum neutrophilum, was overexpressed in Escherichia coli for purification and characterization. It irreversibly inhibits chymotrypsin-, trypsin-, elastase-, and subtilisin-like proteases in a temperature range from 20 to 100 °C in a concentration-dependent manner. The stoichiometry of inhibition (SI) of Pnserpin for proteases decreases as the temperature increases, indicating that the inhibitory activity of Pnserpin increases with the temperature. SDS-PAGE (sodium dodecyl sulfate polyacrylamide gel electrophoresis) showed that Pnserpin inhibits proteases by forming a SDS-resistant covalent complex. Homology modeling and molecular dynamic simulations predicted that Pnserpin can form a stable common serpin fold. Results of the present work will help in understanding the structural and functional characteristics of thermophilic serpin and will broaden the current knowledge about serpins from extremophiles. PMID:28067849

  16. Insights into the Cyanobacterial Deg/HtrA Proteases

    PubMed Central

    Cheregi, Otilia; Wagner, Raik; Funk, Christiane

    2016-01-01

    Proteins are the main machinery for all living processes in a cell; they provide structural elements, regulate biochemical reactions as enzymes, and are the interface to the outside as receptors and transporters. Like any other machinery proteins have to be assembled correctly and need maintenance after damage, e.g., caused by changes in environmental conditions, genetic mutations, and limitations in the availability of cofactors. Proteases and chaperones help in repair, assembly, and folding of damaged and misfolded protein complexes cost-effective, with low energy investment compared with neo-synthesis. Despite their importance for viability, the specific biological role of most proteases in vivo is largely unknown. Deg/HtrA proteases, a family of serine-type ATP-independent proteases, have been shown in higher plants to be involved in the degradation of the Photosystem II reaction center protein D1. The objective of this review is to highlight the structure and function of their cyanobacterial orthologs. Homology modeling was used to find specific features of the SynDeg/HtrA proteases of Synechocystis sp. PCC 6803. Based on the available data concerning their location and their physiological substrates we conclude that these Deg proteases not only have important housekeeping and chaperone functions within the cell, but also are needed for remodeling the cell exterior. PMID:27252714

  17. Cysteine Proteases: Modes of Activation and Future Prospects as Pharmacological Targets

    PubMed Central

    Verma, Sonia; Dixit, Rajnikant; Pandey, Kailash C.

    2016-01-01

    Proteolytic enzymes are crucial for a variety of biological processes in organisms ranging from lower (virus, bacteria, and parasite) to the higher organisms (mammals). Proteases cleave proteins into smaller fragments by catalyzing peptide bonds hydrolysis. Proteases are classified according to their catalytic site, and distributed into four major classes: cysteine proteases, serine proteases, aspartic proteases, and metalloproteases. This review will cover only cysteine proteases, papain family enzymes which are involved in multiple functions such as extracellular matrix turnover, antigen presentation, processing events, digestion, immune invasion, hemoglobin hydrolysis, parasite invasion, parasite egress, and processing surface proteins. Therefore, they are promising drug targets for various diseases. For preventing unwanted digestion, cysteine proteases are synthesized as zymogens, and contain a prodomain (regulatory) and a mature domain (catalytic). The prodomain acts as an endogenous inhibitor of the mature enzyme. For activation of the mature enzyme, removal of the prodomain is necessary and achieved by different modes. The pro-mature domain interaction can be categorized as protein–protein interactions (PPIs) and may be targeted in a range of diseases. Cysteine protease inhibitors are available that can block the active site but no such inhibitor available yet that can be targeted to block the pro-mature domain interactions and prevent it activation. This review specifically highlights the modes of activation (processing) of papain family enzymes, which involve auto-activation, trans-activation and also clarifies the future aspects of targeting PPIs to prevent the activation of cysteine proteases. PMID:27199750

  18. Purification and identification of a protease inhibitor from glassfish (Liparis tanakai) eggs.

    PubMed

    Ustadi, Ustadi; Kim, K Y; Kim, S M

    2005-10-05

    Two protease inhibitors of 67 and 18 kDa, respectively, were purified from glassfish, Liparis tanakai, eggs by affinity chromatography. The smaller protein was purified with a yield and purity of 0.25% and 49.69-fold, respectively, and was characterized for further study. The glassfish egg protease inhibitor exhibited stability between 50 and 65 degrees C in an alkaline environment (pH 8). It was shown to be a noncompetitive inhibitor against papain, with an inhibitor constant (Ki) of 4.44 nM. Potent glassfish protease inhibitor with N-Val-Gly Ser-Met-Thr-Gly-Gly-Phe-Thr-Asp-C amino acid residues was synthesized and its inhibitory activity was compared. Moreover, the 18-kDa protein inhibited cathepsin, a cysteine protease, more effectively than did egg white protease inhibitor, whereas the reverse was true for papain. Glassfish egg protease inhibitor is classified as a member of the family I cystatins.

  19. Proteomic Substrate Identification for Membrane Proteases in the Brain

    PubMed Central

    Müller, Stephan A.; Scilabra, Simone D.; Lichtenthaler, Stefan F.

    2016-01-01

    Cell-cell communication in the brain is controlled by multiple mechanisms, including proteolysis. Membrane-bound proteases generate signaling molecules from membrane-bound precursor proteins and control the length and function of cell surface membrane proteins. These proteases belong to different families, including members of the “a disintegrin and metalloprotease” (ADAM), the beta-site amyloid precursor protein cleaving enzymes (BACE), membrane-type matrix metalloproteases (MT-MMP) and rhomboids. Some of these proteases, in particular ADAM10 and BACE1 have been shown to be essential not only for the correct development of the mammalian brain, but also for myelination and maintaining neuronal connections in the adult nervous system. Additionally, these proteases are considered as drug targets for brain diseases, including Alzheimer’s disease (AD), schizophrenia and cancer. Despite their biomedical relevance, the molecular functions of these proteases in the brain have not been explored in much detail, as little was known about their substrates. This has changed with the recent development of novel proteomic methods which allow to identify substrates of membrane-bound proteases from cultured cells, primary neurons and other primary brain cells and even in vivo from minute amounts of mouse cerebrospinal fluid (CSF). This review summarizes the recent advances and highlights the strengths of the individual proteomic methods. Finally, using the example of the Alzheimer-related proteases BACE1, ADAM10 and γ-secretase, as well as ADAM17 and signal peptide peptidase like 3 (SPPL3), we illustrate how substrate identification with novel methods is instrumental in elucidating broad physiological functions of these proteases in the brain and other organs. PMID:27790089

  20. SjAPI, the first functionally characterized Ascaris-type protease inhibitor from animal venoms.

    PubMed

    Chen, Zongyun; Wang, Bin; Hu, Jun; Yang, Weishan; Cao, Zhijian; Zhuo, Renxi; Li, Wenxin; Wu, Yingliang

    2013-01-01

    Serine protease inhibitors act as modulators of serine proteases, playing important roles in protecting animal toxin peptides from degradation. However, all known serine protease inhibitors discovered thus far from animal venom belong to the Kunitz-type subfamily, and whether there are other novel types of protease inhibitors in animal venom remains unclear. Here, by screening scorpion venom gland cDNA libraries, we identified the first Ascaris-type animal toxin family, which contains four members: Scorpiops jendeki Ascaris-type protease inhibitor (SjAPI), Scorpiops jendeki Ascaris-type protease inhibitor 2 (SjAPI-2), Chaerilus tricostatus Ascaris-type protease inhibitor (CtAPI), and Buthus martensii Ascaris-type protease inhibitor (BmAPI). The detailed characterization of Ascaris-type peptide SjAPI from the venom gland of scorpion Scorpiops jendeki was carried out. The mature peptide of SjAPI contains 64 residues and possesses a classical Ascaris-type cysteine framework reticulated by five disulfide bridges, different from all known protease inhibitors from venomous animals. Enzyme and inhibitor reaction kinetics experiments showed that recombinant SjAPI was a dual function peptide with α-chymotrypsin- and elastase-inhibiting properties. Recombinant SjAPI inhibited α-chymotrypsin with a Ki of 97.1 nM and elastase with a Ki of 3.7 μM, respectively. Bioinformatics analyses and chimera experiments indicated that SjAPI contained the unique short side chain functional residues "AAV" and might be a useful template to produce new serine protease inhibitors. To our knowledge, SjAPI is the first functionally characterized animal toxin peptide with an Ascaris-type fold. The structural and functional diversity of animal toxins with protease-inhibiting properties suggested that bioactive peptides from animal venom glands might be a new source of protease inhibitors, which will accelerate the development of diagnostic and therapeutic agents for human diseases that target

  1. Cysteine proteases as therapeutic targets: does selectivity matter? A systematic review of calpain and cathepsin inhibitors

    PubMed Central

    Siklos, Marton; BenAissa, Manel; Thatcher, Gregory R.J.

    2015-01-01

    Cysteine proteases continue to provide validated targets for treatment of human diseases. In neurodegenerative disorders, multiple cysteine proteases provide targets for enzyme inhibitors, notably caspases, calpains, and cathepsins. The reactive, active-site cysteine provides specificity for many inhibitor designs over other families of proteases, such as aspartate and serine; however, a) inhibitor strategies often use covalent enzyme modification, and b) obtaining selectivity within families of cysteine proteases and their isozymes is problematic. This review provides a general update on strategies for cysteine protease inhibitor design and a focus on cathepsin B and calpain 1 as drug targets for neurodegenerative disorders; the latter focus providing an interesting query for the contemporary assumptions that irreversible, covalent protein modification and low selectivity are anathema to therapeutic safety and efficacy. PMID:26713267

  2. Proteases from psychrotrophs: an overview.

    PubMed

    Kasana, Ramesh Chand

    2010-05-01

    Proteases are hydrolytic enzymes which catalyze the total hydrolysis of proteins in to amino acids. Although proteolytic enzymes can be obtained from animals and plants but microorganisms are the preferred source for industrial applications in view of scientific and economical advantage. Among various groups of microbes, psychrotrophs are ideal candidates for enzymes production keeping in mind that enzymes active at low temperature and stable under alkaline condition, in presence of oxidants and detergents are in large demand as laundry additive. The proteases from psychrotrophs also find application in environmental bioremediation, food and molecular biology. During the previous two decades, proteases from psychrotrophs have received increased attention because of their wide range of applications, but the full potential of psychrotrophic proteases has not been exploited. This review focuses attention on the present status of knowledge on the production, optimization, molecular characteristics, applications, substrate specificity, and crystal structure of psychrotrophic proteases. The review will help in making strategies for exploitation of psychrotrophic protease resources and improvement of enzymes to obtain more robust proteases of industrial and biotechnological significance.

  3. Proteases in gastrointestinal neoplastic diseases.

    PubMed

    Herszényi, L; Plebani, M; Carraro, P; De Paoli, M; Roveroni, G; Cardin, R; Foschia, F; Tulassay, Z; Naccarato, R; Farinati, F

    2000-02-15

    Cysteine and serine proteases are involved in cancer invasion and metastasis. In the past few years we investigated the tissue levels of these proteases in gastric cancer (GC), gastric precancerous changes (CAG), colorectal cancer (CRC) and the plasma and serum levels of proteases in several gastrointestinal tumours, using ELISA methods. Significantly higher antigen levels were found not only in GC tissue but also in CAG with respect to the levels found normal tissue; with respect to CAG, patients with dysplasia had higher levels than patients without dysplasia. The same findings were obtained in CRC. In general protease levels correlated with the major histomorphological parameters, such as grading and histotype in GC as well as in CRC. Tissue protease levels had a strong prognostic impact in GC, in which UPA was singled out by multivariate analysis as the major prognostic factor, and CRC. The plasma levels of urokinase-type plasminogen activator (UPA) and the serum levels of cathepsin B were significantly increased in patients with gastrointestinal tumours. In conclusions, cysteine and serine proteases may have a part not only in GC and CRC invasion and metastasis, but also in the progression of gastric precancerous changes into cancer. They are strong prognostic factors in GC and CRC. These proteases may also have a role as tumour markers in the early diagnosis of gastrointestinal tract tumours.

  4. A lead discovery strategy driven by a comprehensive analysis of proteases in the peptide substrate space.

    PubMed

    Sukuru, Sai Chetan K; Nigsch, Florian; Quancard, Jean; Renatus, Martin; Chopra, Rajiv; Brooijmans, Natasja; Mikhailov, Dmitri; Deng, Zhan; Cornett, Allen; Jenkins, Jeremy L; Hommel, Ulrich; Davies, John W; Glick, Meir

    2010-11-01

    We present here a comprehensive analysis of proteases in the peptide substrate space and demonstrate its applicability for lead discovery. Aligned octapeptide substrates of 498 proteases taken from the MEROPS peptidase database were used for the in silico analysis. A multiple-category naïve Bayes model, trained on the two-dimensional chemical features of the substrates, was able to classify the substrates of 365 (73%) proteases and elucidate statistically significant chemical features for each of their specific substrate positions. The positional awareness of the method allows us to identify the most similar substrate positions between proteases. Our analysis reveals that proteases from different families, based on the traditional classification (aspartic, cysteine, serine, and metallo), could have substrates that differ at the cleavage site (P1-P1') but are similar away from it. Caspase-3 (cysteine protease) and granzyme B (serine protease) are previously known examples of cross-family neighbors identified by this method. To assess whether peptide substrate similarity between unrelated proteases could reliably translate into the discovery of low molecular weight synthetic inhibitors, a lead discovery strategy was tested on two other cross-family neighbors--namely cathepsin L2 and matrix metallo proteinase 9, and calpain 1 and pepsin A. For both these pairs, a naïve Bayes classifier model trained on inhibitors of one protease could successfully enrich those of its neighbor from a different family and vice versa, indicating that this approach could be prospectively applied to lead discovery for a novel protease target with no known synthetic inhibitors.

  5. A lead discovery strategy driven by a comprehensive analysis of proteases in the peptide substrate space

    PubMed Central

    Sukuru, Sai Chetan K; Nigsch, Florian; Quancard, Jean; Renatus, Martin; Chopra, Rajiv; Brooijmans, Natasja; Mikhailov, Dmitri; Deng, Zhan; Cornett, Allen; Jenkins, Jeremy L; Hommel, Ulrich; Davies, John W; Glick, Meir

    2010-01-01

    We present here a comprehensive analysis of proteases in the peptide substrate space and demonstrate its applicability for lead discovery. Aligned octapeptide substrates of 498 proteases taken from the MEROPS peptidase database were used for the in silico analysis. A multiple-category naïve Bayes model, trained on the two-dimensional chemical features of the substrates, was able to classify the substrates of 365 (73%) proteases and elucidate statistically significant chemical features for each of their specific substrate positions. The positional awareness of the method allows us to identify the most similar substrate positions between proteases. Our analysis reveals that proteases from different families, based on the traditional classification (aspartic, cysteine, serine, and metallo), could have substrates that differ at the cleavage site (P1–P1′) but are similar away from it. Caspase-3 (cysteine protease) and granzyme B (serine protease) are previously known examples of cross-family neighbors identified by this method. To assess whether peptide substrate similarity between unrelated proteases could reliably translate into the discovery of low molecular weight synthetic inhibitors, a lead discovery strategy was tested on two other cross-family neighbors—namely cathepsin L2 and matrix metallo proteinase 9, and calpain 1 and pepsin A. For both these pairs, a naïve Bayes classifier model trained on inhibitors of one protease could successfully enrich those of its neighbor from a different family and vice versa, indicating that this approach could be prospectively applied to lead discovery for a novel protease target with no known synthetic inhibitors. PMID:20799349

  6. A family of serine proteases expressed exclusively in myelo-monocytic cells specifically processes the nuclear factor-kappa B subunit p65 in vitro and may impair human immunodeficiency virus replication in these cells

    PubMed Central

    1994-01-01

    Two groups of U937 promonocytic cells were obtained by limiting dilution cloning which differed strikingly in their ability to support human immunodeficiency virus 1 (HIV-1) replication. "Plus" clones replicated the virus efficiently, whereas "minus" clones did not. We examined these clones for differences in nuclear factor (NF)-kappa B activity which might account for the observed phenomenon. Stimulation of plus clones liberated the classical p50-p65 complex from cytoplasmic pools, whereas minus clones produced an apparently novel, faster- migrating complex, as judged by electrophoretic mobility shift assays. It is surprising that the faster-migrating complex was composed also of p50 and p65. However, the p65 subunit was COOH-terminally truncated, as shown by immunoprecipitation. The truncation resulted from limited proteolysis of p65 during cellular extraction which released particular lysosomal serine proteases, such as elastase, cathepsin G, and proteinase 3. These specific proteases are coordinately expressed and were present exclusively in the minus U937 clones, but not in the plus clones, as demonstrated in the case of cathepsin G. In addition, these proteases were detected in certain subclones of THP-1 and HL-60 cells and in primary monocytes, in each case correlating with the truncated from of p65. We demonstrate in vitro cleavage of p65 by purified elastase and cathepsin G. It is possible that particular serine proteases may have inhibiting effects on the replication of HIV-1 in myelo-monocytic cells. The data also demonstrate that special precautions must be taken when making extracts from myelo-monocytic cells. PMID:7931077

  7. Exogenous proteases for meat tenderization.

    PubMed

    Bekhit, Alaa A; Hopkins, David L; Geesink, Geert; Bekhit, Adnan A; Franks, Philip

    2014-01-01

    The use of exogenous proteases to improve meat tenderness has attracted much interest recently, with a view to consistent production of tender meat and added value to lower grade meat cuts. This review discusses the sources, characteristics, and use of exogenous proteases in meat tenderization to highlight the specificity of the proteases toward meat proteins and their impact on meat quality. Plant enzymes (such as papain, bromelain, and ficin) have been extensively investigated as meat tenderizers. New plant proteases (actinidin and zingibain) and microbial enzyme preparations have been of recent interest due to controlled meat tenderization and other advantages. Successful use of these enzymes in fresh meat requires their enzymatic kinetics and characteristics to be determined, together with an understanding of the impact of the surrounding environmental conditions of the meat (pH, temperature) on enzyme function. This enables the optimal conditions for tenderizing fresh meat to be established, and the elimination or reduction of any negative impacts on other quality attributes.

  8. Visceral hypersensitivity in inflammatory bowel diseases and irritable bowel syndrome: The role of proteases.

    PubMed

    Ceuleers, Hannah; Van Spaendonk, Hanne; Hanning, Nikita; Heirbaut, Jelena; Lambeir, Anne-Marie; Joossens, Jurgen; Augustyns, Koen; De Man, Joris G; De Meester, Ingrid; De Winter, Benedicte Y

    2016-12-21

    Proteases, enzymes catalyzing the hydrolysis of peptide bonds, are present at high concentrations in the gastrointestinal tract. Besides their well-known role in the digestive process, they also function as signaling molecules through the activation of protease-activated receptors (PARs). Based on their chemical mechanism for catalysis, proteases can be classified into several classes: serine, cysteine, aspartic, metallo- and threonine proteases represent the mammalian protease families. In particular, the class of serine proteases will play a significant role in this review. In the last decades, proteases have been suggested to play a key role in the pathogenesis of visceral hypersensitivity, which is a major factor contributing to abdominal pain in patients with inflammatory bowel diseases and/or irritable bowel syndrome. So far, only a few preclinical animal studies have investigated the effect of protease inhibitors specifically on visceral sensitivity while their effect on inflammation is described in more detail. In our accompanying review we describe their effect on gastrointestinal permeability. On account of their promising results in the field of visceral hypersensitivity, further research is warranted. The aim of this review is to give an overview on the concept of visceral hypersensitivity as well as on the physiological and pathophysiological functions of proteases herein.

  9. Visceral hypersensitivity in inflammatory bowel diseases and irritable bowel syndrome: The role of proteases

    PubMed Central

    Ceuleers, Hannah; Van Spaendonk, Hanne; Hanning, Nikita; Heirbaut, Jelena; Lambeir, Anne-Marie; Joossens, Jurgen; Augustyns, Koen; De Man, Joris G; De Meester, Ingrid; De Winter, Benedicte Y

    2016-01-01

    Proteases, enzymes catalyzing the hydrolysis of peptide bonds, are present at high concentrations in the gastrointestinal tract. Besides their well-known role in the digestive process, they also function as signaling molecules through the activation of protease-activated receptors (PARs). Based on their chemical mechanism for catalysis, proteases can be classified into several classes: serine, cysteine, aspartic, metallo- and threonine proteases represent the mammalian protease families. In particular, the class of serine proteases will play a significant role in this review. In the last decades, proteases have been suggested to play a key role in the pathogenesis of visceral hypersensitivity, which is a major factor contributing to abdominal pain in patients with inflammatory bowel diseases and/or irritable bowel syndrome. So far, only a few preclinical animal studies have investigated the effect of protease inhibitors specifically on visceral sensitivity while their effect on inflammation is described in more detail. In our accompanying review we describe their effect on gastrointestinal permeability. On account of their promising results in the field of visceral hypersensitivity, further research is warranted. The aim of this review is to give an overview on the concept of visceral hypersensitivity as well as on the physiological and pathophysiological functions of proteases herein. PMID:28058009

  10. Purification and characterization of an alkaline protease from Micrococcus sp. isolated from the South China Sea

    NASA Astrophysics Data System (ADS)

    Hou, Enling; Xia, Tao; Zhang, Zhaohui; Mao, Xiangzhao

    2017-04-01

    Protease is wildly used in various fields, such as food, medicine, washing, leather, cosmetics and other industrial fields. In this study, an alkaline protease secreted by Micrococcus NH54PC02 isolated from the South China Sea was purified and characterized. The growth curve and enzyme activity curve indicated that the cell reached a maximum concentration at the 30th hour and the enzyme activity reached the maximum value at the 36th hour. The protease was purified with 3 steps involving ammonium sulfate precipitation, ion-exchange chromatography and hydrophobic chromatography with 8.22-fold increase in specific activity and 23.68% increase in the recovery. The molecular mass of the protease was estimated to be 25 kDa by SDS-PAGE analysis. The optimum temperature and pH for the protease activity were 50°C and pH 10.0, respectively. The protease showed a strong stability in a wide range of pH values ranging from 6.0-11.0, and maintained 90% enzyme activity in strong alkaline environment with pH 11.0. Inhibitor trials indicated that the protease might be serine protease. But it also possessed the characteristic of metalloprotease as it could be strongly inhibited by EDTA and strongly stimulated by Mn2+. Evaluation of matrix-assisted laser desorption ionization/time-of-flight MS (MALDI-TOF-TOF/MS) showed that the protease might belong to the peptidase S8 family.

  11. Application of Protease Technology in Dermatology

    PubMed Central

    Del Rosso, James Q.

    2013-01-01

    This article reviews background on proteases and their functions, their physiological significance in skin, and the potential implications of incorporating specific proteases and protease blends into dermatological products, including skin care formulations. The history of protease blend formulations used in wound model studies and for other disorders is reviewed. In vitro data with use of a specific 3-protease blend with evaluation of the impact on various skin proteins and peptides is also discussed in this article. PMID:23882305

  12. Membrane-anchored serine proteases in health and disease

    PubMed Central

    Bugge, Thomas; Wu, Qingyu

    2013-01-01

    Serine proteases of the trypsin-like family have long been recognized to be critical effectors of biological processes as diverse as digestion, blood coagulation, fibrinolysis, and immunity. In recent years, a subgroup of these enzymes has been identified that are anchored directly to plasma membranes, either by a carboxy-terminal transmembrane domain (Type I), an amino-terminal transmembrane domain with a cytoplasmic extension (Type II or TTSP), or through a glycosyl-phosphatidylinositol (GPI) linkage. Recent biochemical, cellular, and in vivo analyses have now established that membrane-anchored serine proteases are key pericellular contributors to processes vital for development and the maintenance of homeostasis. This chapter will review our current knowledge of the biological and physiological functions of these proteases, their molecular substrates, and their contributions to disease. PMID:21238933

  13. Emerging roles for diverse intramembrane proteases in plant biology.

    PubMed

    Adam, Zach

    2013-12-01

    Progress in the field of regulated intramembrane proteolysis (RIP) in recent years has made its impact on plant biology as well. Although this field within plant research is still in its infancy, some interesting observations have started to emerge. Gene encoding orthologs of rhomboid proteases, site-2 proteases (S2P), presenilin/γ-secretases, and signal peptide peptidases are found in plant genomes and some of these gene products were identified in different plant cell membranes. The lack of chloroplast-located rhomboid proteases was associated with reduced fertility and aberrations in flower morphology. Mutations in homologues of S2P resulted in chlorophyll deficiency and impaired chloroplast development. An S2P was also implicated in the response to ER stress through cleavage of ER-membrane bZIP transcription factors, allowing their migration to the nucleus and activation of the transcription of BiP chaperones. Other membrane-bound transcription factors of the NAC and PHD families were also demonstrated to undergo RIP and relocalization to the nucleus. These and other new data are expected to shed more light on the roles of intramembrane proteases in plant biology in the future. This article is part of a Special Issue entitled: Intramembrane Proteases. Copyright © 2013 Elsevier B.V. All rights reserved.

  14. Serine proteases, serine protease inhibitors, and protease-activated receptors: roles in synaptic function and behavior.

    PubMed

    Almonte, Antoine G; Sweatt, J David

    2011-08-17

    Serine proteases, serine protease inhibitors, and protease-activated receptors have been intensively investigated in the periphery and their roles in a wide range of processes-coagulation, inflammation, and digestion, for example-have been well characterized (see Coughlin, 2000; Macfarlane et al., 2001; Molinari et al., 2003; Wang et al., 2008; Di Cera, 2009 for reviews). A growing number of studies demonstrate that these protein systems are widely expressed in many cell types and regions in mammalian brains. Accumulating lines of evidence suggest that the brain has co-opted the activities of these interesting proteins to regulate various processes underlying synaptic activity and behavior. In this review, we discuss emerging roles for serine proteases in the regulation of mechanisms underlying synaptic plasticity and memory formation.

  15. Serine proteases, serine protease inhibitors, and protease-activated receptors: roles in synaptic function and behavior

    PubMed Central

    Almonte, Antoine G.; Sweatt, J. David

    2011-01-01

    Serine proteases, serine protease inhibitors, and protease-activated receptors have been intensively investigated in the periphery and their roles in a wide range of processes—coagulation, inflammation, and digestion, for example—have been well characterized (see Coughlin, 2000; Macfarlane et al., 2001; Molinari et al., 2003; Wang et al., 2008; Di Cera, 2009 for reviews). A growing number of studies demonstrate that these protein systems are widely expressed in many cell types and regions in mammalian brains. Accumulating lines of evidence suggest that the brain has co-opted the activities of these interesting proteins to regulate various processes underlying synaptic activity and behavior. In this review, we discuss emerging roles for serine proteases in the regulation of mechanisms underlying synaptic plasticity and memory formation. PMID:21782155

  16. The roles of cysteine proteases and phytocystatins in development and germination of cereal seeds.

    PubMed

    Szewińska, Joanna; Simińska, Joanna; Bielawski, Wiesław

    2016-12-01

    Proteolysis is an important process for development and germination of cereal seeds. Among the many types of proteases identified in plants are the cysteine proteases (CPs) of the papain and legumain families, which play a crucial role in hydrolysing storage proteins during seed germination as well as in processing the precursors of these proteins and the inactive forms of other proteases. Moreover, all of the tissues of cereal seeds undergo progressive degradation via programed cell death, which is integral to their growth. In view of the important roles played by proteases, their uncontrolled activity could be harmful to the development of seeds and young seedlings. Thus, the activities of these enzymes are regulated by intracellular inhibitors called phytocystatins (PhyCys). The phytocystatins inhibit the activity of proteases of the papain family, and the presence of an additional motif in their C-termini allows them to also regulate the activity of members of the legumain family. A balance between the levels of cysteine proteases and phytocystatins is necessary for proper cereal seed development, and this is maintained through the antagonistic activities of gibberellins (GAs) and abscisic acid (ABA), which regulate the expression of the corresponding genes. Transcriptional regulation of cysteine proteases and phytocystatins is determined by cis-acting elements located in the promoters of these genes and by the expression of their corresponding transcription factors (TFs) and the interactions between different TFs. Copyright © 2016 Elsevier GmbH. All rights reserved.

  17. A Phytophthora infestans Cystatin-Like Protein Targets a Novel Tomato Papain-Like Apoplastic Protease1[W][OA

    PubMed Central

    Tian, Miaoying; Win, Joe; Song, Jing; van der Hoorn, Renier; van der Knaap, Esther; Kamoun, Sophien

    2007-01-01

    There is emerging evidence that the proteolytic machinery of plants plays important roles in defense against pathogens. The oomycete pathogen Phytophthora infestans, the agent of the devastating late blight disease of tomato (Lycopersicon esculentum) and potato (Solanum tuberosum), has evolved an arsenal of protease inhibitors to overcome the action of host proteases. Previously, we described a family of 14 Kazal-like extracellular serine protease inhibitors from P. infestans. Among these, EPI1 and EPI10 bind and inhibit the pathogenesis-related (PR) P69B subtilisin-like serine protease of tomato. Here, we describe EPIC1 to EPIC4, a new family of P. infestans secreted proteins with similarity to cystatin-like protease inhibitor domains. Among these, the epiC1 and epiC2 genes lacked orthologs in Phytophthora sojae and Phytophthora ramorum, were relatively fast-evolving within P. infestans, and were up-regulated during infection of tomato, suggesting a role during P. infestans-host interactions. Biochemical functional analyses revealed that EPIC2B interacts with and inhibits a novel papain-like extracellular cysteine protease, termed Phytophthora Inhibited Protease 1 (PIP1). Characterization of PIP1 revealed that it is a PR protein closely related to Rcr3, a tomato apoplastic cysteine protease that functions in fungal resistance. Altogether, this and earlier studies suggest that interplay between host proteases of diverse catalytic families and pathogen inhibitors is a general defense-counterdefense process in plant-pathogen interactions. PMID:17085509

  18. The non-death role of metacaspase proteases.

    PubMed

    Shrestha, Amit; Megeney, Lynn A

    2012-01-01

    The activation of caspase proteases and the targeting of protein substrates act as key steps in the engagement and conduct of apoptosis/programmed cell death. However, the discovery of caspase involvement in diverse non-apoptotic cellular functions strongly suggests that these proteins may have evolved from a core behavior unrelated to the induction of cell death. The presence of similar proteases, termed metacaspases, in single cell organisms supports the contention that such proteins may have co-evolved or derived from a critical non-death function. Indeed, the benefit(s) for single cell life forms to retain proteins solely dedicated to self destruction would be countered by a strong selection pressure to curb or eliminate such processes. Examination of metacaspase biology provides evidence that these ancient protease forerunners of the caspase family also retain versatility in function, i.e., death and non-death cell functions. Here, we provide a critical review that highlights the non-death roles of metacaspases that have been described thus far, and the impact that these observations have for our understanding of the evolution and cellular utility of this protease family.

  19. Mast Cell Proteases and Inflammation

    PubMed Central

    Dai, Hongyan; Korthuis, Ronald J.

    2011-01-01

    Mast cells are best known for their role in allergic reactions but are also now recognized for their important contributions to a number of disparate inflammatory conditions through the release of inflammatory mediators, serglycin and other proteoglycans, and proteases. Because these tissue resident inflammatory cells express proteases in such great abundance and their enzymatic activity results in cleavage of a multitude of proteins and peptides, which in turn modify tissue function, their substrate specificity, tissue distribution, and mode of action have become the subjects of great interest. Although mast cell protease-dependent proteolysis is critical to host defense against invading pathogens, regulation of these hydrolytic enzymes is essential to limiting self-induced damage as well. Indeed, dysregulated release of mast cell proteases is now recognized to contribute to the pathogenesis of a number of inflammatory conditions including asthma, abdominal aortic aneurysm formation, vessel damage in atherosclerosis and hypertension, arthritis, and ischemia/reperfusion injury. Understanding how mast cell proteases contribute to inflammation will thus help unravel molecular mechanisms that underlie such immunologic disorders and will help identify new therapeutic targets for drug development. PMID:22125569

  20. The uncoupling of protease trans-cleavage and helicase activities in the pestivirus NS3.

    PubMed

    Zheng, Fengwei; Lu, Guoliang; Li, Ling; Gong, Peng; Pan, Zishu

    2017-08-23

    The nonstructural protein NS3 from the Flaviviridae family is a multi-functional protein that contains an N-terminal protease and a C-terminal helicase, playing essential roles in viral polyprotein processing and genome replication. Here we report a full-length crystal structure of the Classical swine fever virus (CSFV) NS3 in complex with its NS4A protease cofactor segment (PCS) at 2.35 Å resolution. The structure reveals a previously unidentified ∼2200-Å(2) intra-molecular protease-helicase interface comprising three clusters of interactions, representing a "closed" global conformation related to the NS3-NS4A cis-cleavage event. Although this conformation is incompatible with protease trans-cleavage, it appears to be functionally important and beneficial to the helicase activity, as the mutations designed to perturb this conformation impaired both the helicase activities in vitro and virus production in vivo Collectively, our work reveals important features of protease-helicase coordination in pestivirus NS3, and provides a key basis for how different conformational states may explicitly contribute to certain functions of this natural protease-helicase fusion protein.IMPORTANCE Many RNA viruses encode helicases to aid their RNA genome replication and transcription by unwinding structured RNA. Being naturally fused to a protease participating in viral polyprotein processing, the NS3 helicases encoded by the Flaviviridae family viruses are quite unique. Therefore, how these two enzyme modules coordinate in a single polypeptide is of particular interest. Here we report a previously unidentified conformation of pestivirus NS3 in complex with its NS4A protease cofactor segment (PCS). This conformational state is related to the protease cis-cleavage event and is optimal for the function of helicase. This work provides an important basis to understand how different enzymatic activities of NS3 may be achieved by the coordination between the protease and helicase

  1. Improving Production of Protease from Pseudoalteromonas sp. CSN423 by Random Mutagenesis.

    PubMed

    Wu, Cuiling; Liu, Dan; Yang, Xinghao; Wu, Ribang; Zhang, Jiang; Huang, Jiafeng; He, Hailun

    2016-10-01

    Pseudoalteromonas sp. CSN423, a marine strain, can express a major protease designated as E423 and it was secreted into the supernatant. To improve the protease E423 yield, Pseudoalteromonas sp. CSN423 was subjected to mutagenesis using UV irradiation. Mutant strain with 5.1-fold higher protease yield was isolated and named as Pseudoalteromonas sp. CSN423-M. Three protease bands were detected by zymography with casein as substrate, and results of mass spectrometry (MS) showed that two lower molecular weight protein bands were the same protease but with different mature forms. The entire protease operon was sequenced and no mutation was found. Mutant strain-associated changes of expression levels of protease synthesis and secretion-related genes were determined by quantitative real-time polymerase chain reaction (qRT-PCR). Mutant strain had higher expression of e423 than wild-type strain. Such result was consistent with protease activity profiles. Moreover, the mutant strain had higher transcriptional levels of citrate synthase (cs), α-ketoglutarate decarboxylase (kgd), cytochrome c oxidase subunit I (coxI), tolC, hlyD (membrane protein), luxR3, luxO, and luxT (transcriptional regulator). However, hexokinase (hk), pyruvate dehydrogenase E1 (pd-e1), epsD (membrane protein), and luxR1 remained unchanged, and luxR2 decreased sharply in the mutant. These results suggested that the redox pathway was promoted in the mutant strain, and LuxR family transcriptional regulators in Pseudoalteromonas spp. may play some role in regulating protease expression. Meanwhile, the secretion of extracellular protease was closely related to ABC transport system. These results may shed some light on the molecular mechanism underlying higher yield of protease E423 from Pseudoalteromonas sp. CSN423-M.

  2. A novel serine protease with caspase- and legumain-like activities from edible basidiomycete Flammulina velutipes.

    PubMed

    Iketani, Aya; Nakamura, Mayumi; Suzuki, Yuya; Awai, Koichiro; Shioi, Yuzo

    2013-03-01

    A serine protease with caspase- and legumain-like activities from basidiocarps of the edible basidiomycete Flammulina velutipes was characterized. The protease was purified to near homogeneity by three steps of chromatography using acetyl-Tyr-Val-Ala-Asp-4-methylcoumaryl-7-amide (Ac-YVAD-MCA) as a substrate. The enzyme was termed FvSerP (F. velutipes serine protease). This enzyme activity was completely inhibited by the caspase-specific inhibitor, Ac-YVAD-CHO, as well as moderately inhibited by serine protease inhibitors. Based on the N-terminal sequence, the cDNA of FvSerP was identified. The deduced protease sequence was a peptide composed of 325 amino acids with a molecular mass of 34.5 kDa. The amino acid sequence of FvSerP showed similarity to neither caspases nor to the plant subtilisin-like serine protease with caspase-like activity called saspase. FvSerP shared identity to the functionally unknown genes from class of Agaricomycetes, with similarity to the peptidase S41 domain of a serine protease. It was thus concluded that this enzyme is likely a novel serine protease with caspase- and legumain-like activities belonging to the peptidase S41 family and distributed in the class Agaricomycetes. This enzyme possibly functions in autolysis, a type of programmed cell death that occurs in the later stages of development of basidiocarps with reference to their enzymatic functions.

  3. Inhibition of viral proteases by Zingiberaceae extracts and flavones isolated from Kaempferia parviflora.

    PubMed

    Sookkongwaree, K; Geitmann, M; Roengsumran, S; Petsom, A; Danielson, U H

    2006-08-01

    In order to identify novel lead compounds with antiviral effect, methanol and aqueous extracts of eight medicinal plants in the Zingiberaceae family were screened for inhibition of proteases from human immunodeficiency virus type 1 (HIV-1), hepatitis C virus (HCV) and human cytomegalovirus (HCMV). In general, the methanol extracts inhibited the enzymes more effectively than the aqueous extracts. HIV-1 protease was strongly inhibited by the methanol extract of Alpinia galanga. This extract also inhibited HCV and HCMV proteases, but to a lower degree. HCV protease was most efficiently inhibited by the extracts from Zingiber officinale, with little difference between the aqueous and the methanol extracts. Many of the methanol extracts inhibited HCMV protease, but the aqueous extracts showed weak inhibition. In a first endeavor to identify the active constituents, eight flavones were isolated from the black rhizomes of Kaempferia parviflora. The most effective inhibitors, 5-hydroxy-7-methoxyflavone and 5,7-dimethoxyflavone, inhibited HIV-1 protease with IC50 values of 19 microM. Moreover, 5-hydroxy-3,7-dimethoxyflavone inhibited HCV protease and HCMV protease with IC50 values of 190 and 250 microM, respectively.

  4. Cytomegalovirus protease targeted prodrug development.

    PubMed

    Sabit, Hairat; Dahan, Arik; Sun, Jing; Provoda, Chester J; Lee, Kyung-Dall; Hilfinger, John H; Amidon, Gordon L

    2013-04-01

    Human cytomegalovirus (HCMV) is a prevalent virus that infects up to 90% of the population. The goal of this research is to determine if small molecular prodrug substrates can be developed for a specific HCMV encoded protease and thus achieve site-specific activation. HCMV encodes a 256 amino acid serine protease that is responsible for capsid assembly, an essential process for herpes virus production. The esterase activity of the more stable HCMV A143T/A144T protease mutant was evaluated with model p-nitrophenol (ONp) esters, Boc-Xaa-ONp (Ala, Leu, Ile, Val, Gln, Phe at the Xaa position). We demonstrate that the A143T/A144T mutant has esterase activity toward specific small ester compounds, e.g., Boc-L-Ala-ONp. Mono amino acid and dipeptide prodrugs of ganciclovir (GCV) were also synthesized and evaluated for hydrolysis by the A143T/A144T protease mutant in solution. Hydrolysis of these prodrugs was also evaluated in Caco-2 cell homogenates, human liver microsomes (HLMs), and rat and human plasma. For the selectivity potential of the prodrugs, the hydrolysis ratio was evaluated as a percentage of prodrug hydrolyzed by the HCMV protease over the percentages of prodrug hydrolyses by Caco-2 cell homogenates, HLMs, and human/rat plasma. A dipeptide prodrug of ganciclovir, Ac-l-Gln-l-Ala-GCV, emerged as a potential selective prodrug candidate. The results of this research demonstrate that targeting prodrugs for activation by a specific protease encoded by the infectious HCMV pathogen may be achievable.

  5. Evolutionary optimization of peptide substrates for proteases that exhibit rapid hydrolysis kinetics.

    PubMed

    Boulware, Kevin T; Jabaiah, Abeer; Daugherty, Patrick S

    2010-06-15

    Protease cleavage site recognition motifs can be identified using protease substrate discovery methodologies, but typically exhibit non-optimal specificity and activity. To enable evolutionary optimization of substrate cleavage kinetics, a two-color cellular library of peptide substrates (CLiPS) methodology was developed. Two-color CLiPS was applied to identify peptide substrates for the tobacco etch virus (TEV) protease from a random pentapeptide library, which were then optimized by screening of a focused, extended substrate library. Quantitative library screening yielded seven amino acid substrates exhibiting rapid hydrolysis by TEV protease and high sequence similarity to the native seven-amino-acid substrate, with a strong consensus of EXLYPhiQG. Comparison of hydrolysis rates for a family of closely related substrates indicates that the native seven-residue TEV substrate co-evolved with TEV protease to facilitate highly efficient hydrolysis. Consensus motifs revealed by screening enabled database identification of a family of related, putative viral protease substrates. More generally, our results suggest that substrate evolution using CLiPS may be useful for optimizing substrate selectivity and activity to enable the design of more effective protease activity probes, molecular imaging agents, and prodrugs.

  6. Identification of the recognition sequence and target proteins for DJ-1 protease.

    PubMed

    Mitsugi, Hitomi; Niki, Takeshi; Takahashi-Niki, Kazuko; Tanimura, Kyoko; Yoshizawa-Kumagaye, Kumiko; Tsunemi, Masahiko; Iguchi-Ariga, Sanae M M; Ariga, Hiroyoshi

    2013-08-19

    DJ-1, the product of familial Parkinson's disease gene and an oncogene, is a cysteine protease which plays a role in anti-oxidative stress reaction. In this study, we identified the recognition sequence for DJ-1 protease by using recombinant DJ-1 and a peptide library. Protease activity of DJ-1 lacking C-terminal α-helix (DJ-1ΔH9) was stronger than that of full-sized DJ-1, and the most susceptible sequence digested by DJ-1ΔH9 was valine-lysine-valine-alanine (VKVA) under the optimal conditions of pH 5.5 and 0 mM NaCl. Divalent ions, especially Cu²⁺, were inhibitory to DJ-1's protease activity. c-abl oncogene 1 product (ABL1) and kinesin family member 1B (KIF1B) containing VKVA were digested by DJ-1ΔH9.

  7. Discrimination of differentially inhibited cysteine proteases by activity-based profiling using cystatin variants with tailored specificities.

    PubMed

    Sainsbury, Frank; Rhéaume, Ann-Julie; Goulet, Marie-Claire; Vorster, Juan; Michaud, Dominique

    2012-12-07

    Recent research has shown the possibility of tailoring the inhibitory specificity of plant cystatins toward cysteine (Cys) proteases by single mutations at positively selected amino acid sites. Here we devised a cystatin activity-based profiling approach to assess the impact of such mutations at the proteome scale using single variants of tomato cystatin SlCYS8 and digestive Cys proteases of the herbivorous insect, Colorado potato beetle, as a model. Biotinylated forms of SlCYS8 and SlCYS8 variants were used to capture susceptible Cys proteases in insect midgut protein extracts by biotin immobilization on avidin-embedded beads. A quantitative LC-MS/MS analysis of the captured proteins was performed to compare the inhibitory profile of different SlCYS8 variants. The approach confirmed the relevance of phylogenetic inferences categorizing the insect digestive Cys proteases into six functionally distinct families. It also revealed significant variation in protease family profiles captured with N-terminal variants of SlCYS8, in line with in silico structural models for Cys protease-SlCYS8 interactions suggesting a functional role for the N-terminal region. Our data confirm overall the usefulness of cystatin activity-based protease profiling for the monitoring of Cys protease-inhibitor interactions in complex biological systems. They also illustrate the potential of biotinylated cystatins to identify recombinant cystatin candidates for the inactivation of specific Cys protease targets.

  8. Microbial proteases: detection, production, and genetic improvement.

    PubMed

    Kasana, Ramesh Chand; Salwan, Richa; Yadav, Sudesh Kumar

    2011-08-01

    Microbial proteases are one of the important groups of industrially and commercially produced enzymes contributing approximately 2/3 of all enzyme sales. Though proteases are produced by many microorganisms, emphasis is on the microorganisms producing proteases with desired characters. As demand for novel proteases is increasing day by day the initial screening methods and assays for protease detection are of utmost importance. This review focuses attention on present status of knowledge on the various methods and protocols available for protease screening, detection, and quantification starting from plate assays to spectrophotometric, fluorometric, and nanoparticles based assays. The review will help in making strategies for exploitation of protease resources and improvement of enzymes to obtain more robust proteases.

  9. Highly potent fibrinolytic serine protease from Streptomyces.

    PubMed

    Uesugi, Yoshiko; Usuki, Hirokazu; Iwabuchi, Masaki; Hatanaka, Tadashi

    2011-01-05

    We introduce a highly potent fibrinolytic serine protease from Streptomyces omiyaensis (SOT), which belongs to the trypsin family. The fibrinolytic activity of SOT was examined using in vitro assays and was compared with those of known fibrinolytic enzymes such as plasmin, tissue-type plasminogen activator (t-PA), urokinase, and nattokinase. Compared to other enzymes, SOT showed remarkably higher hydrolytic activity toward mimic peptides of fibrin and plasminogen. The fibrinolytic activity of SOT is about 18-fold higher than that of plasmin, and is comparable to that of t-PA by fibrin plate assays. Furthermore, SOT had some plasminogen activator-like activity. Results show that SOT and nattokinase have very different fibrinolytic and fibrinogenolytic modes, engendering significant synergetic effects of SOT and nattokinase on fibrinolysis. These results suggest that SOT presents important possibilities for application in the therapy of thrombosis.

  10. Synthesis of macrocyclic trypanosomal cysteine protease inhibitors.

    PubMed

    Chen, Yen Ting; Lira, Ricardo; Hansell, Elizabeth; McKerrow, James H; Roush, William R

    2008-11-15

    The importance of cysteine proteases in parasites, compounded with the lack of redundancy compared to their mammalian hosts makes proteases attractive targets for the development of new therapeutic agents. The binding mode of K11002 to cruzain, the major cysteine protease of Trypanosoma cruzi was used in the design of conformationally constrained inhibitors. Vinyl sulfone-containing macrocycles were synthesized via olefin ring-closing metathesis and evaluated against cruzain and the closely related cysteine protease, rhodesain.

  11. Plant cysteine proteases that evoke itch activate protease-activated receptors

    PubMed Central

    Reddy, V.B.; Lerner, E.A.

    2013-01-01

    Background Bromelain, ficin and papain are cysteine proteases from plants that produce itch upon injection into skin. Their mechanism of action has not been considered previously. Objectives To determine the mechanism by which these proteases function. Methods The ability of these proteases to activate protease-activated receptors was determined by ratiometric calcium imaging. Results We show here that bromelain, ficin and papain activate protease-activated receptors 2 and 4. Conclusions Bromelain, ficin and papain function as signalling molecules and activate protease-activated receptors. Activation of these receptors is the likely mechanism by which these proteases evoke itch. PMID:20491769

  12. Curcumin derivatives as HIV-1 protease inhibitors

    SciTech Connect

    Sui, Z.; Li, J.; Craik, C.S.; Ortiz de Montellano, P.R.

    1993-12-31

    Curcumin, a non-toxic natural compound from Curcuma longa, has been found to be an HIV-1 protease inhibitor. Some of its derivatives were synthesized and their inhibitory activity against the HIV-1 protease was tested. Curcumin analogues containing boron enhanced the inhibitory activity. At least of the the synthesized compounds irreversibly inhibits the HIV-1 protease.

  13. Design, Synthesis and Biological Evaluation of a Library of Thiocarbazates and their Activity as Cysteine Protease Inhibitors

    PubMed Central

    Liu, Zhuqing; Myers, Michael C.; Shah, Parag P.; Beavers, Mary Pat; Benedetti, Phillip A.; Diamond, Scott L.

    2010-01-01

    Recently, we identified a novel class of potent cathepsin L inhibitors, characterized by a thiocarbazate warhead. Given the potential of these compounds to inhibit other cysteine proteases, we designed and synthesized a library of thiocarbazates containing diversity elements at three positions. Biological characterization of this library for activity against a panel proteases indicated a significant preference for members of the papain family of cysteine proteases over serine, metallo-, and certain classes of cysteine proteases, such as caspases. Several very potent inhibitors of Cathepsin L and S were identified. The SAR data was employed in docking studies in an effort to understand the structural elements required for Cathepsin S inhibition. This study provides the basis for the design of highly potent and selective inhibitors of the papain family of cysteine proteases. PMID:20438448

  14. Proteases of Stored Product Insects and Their Inhibition by Specific Protease Inhibitors from Soybeans and Wheat Grain

    DTIC Science & Technology

    1989-12-15

    PROTEASES; PROTEASE INHIBITORS; STORED-PRODUCT INISECTS; TRIBOLIUM CASIANEUH; MIDGUT PROTEASES; TENEBRIO MOLITOR MIDGUT-PROTEASES; LOCUST CAECAL...separation and identification of numerous midgut proteases in Tenebrio and Tribolium . The PAGE-gelatin matrix revealed the inhibitory effect of BBI...the proteinaceous trypsin-chymotrypsin inhibitor from soybeans) on several Tribolium proteases - an effect which was not detectable in inhibition

  15. Purification, primary structures and evolution of coagulant proteases from Deinagkistrodon actus venom.

    PubMed

    Nikandrov, Nikolai N; Deshimaru, Masanobu; Tani, Ayako; Chijiwa, Takahito; Shibata, Hiroki; Chang, Chang-Chun; Fukumaki, Yasuyuki; Ito, Tatsumi; Ohno, Motonori

    2005-12-15

    Deinagkistrodon (formerly Agkistrodon) actus (Taiwan) snake venom was found to contain at least seven closely related coagulant proteases. One of them, named actibin, was purified to homogeneity by means of four chromatographic steps. Actibin acted on fibrinogen to form fibrin clots with extremely high specific activity of 1,630 NIH units/mg and preferentially released fibrinopeptide A. Actibin was an acidic glycoprotein (pI 3.4) with molecular weight of 41,000, which was reduced to 28,800 after deglycosylation with N-glycanase. The k(cat)/K(m) values of actibin for hydrolysis of tosyl-l-arginine methyl ester and benzoyl-l-arginine p-nitroanilide were one-third to a half those for thrombin, reflecting a high potency of actibin in fibrinogen clotting. The amidase activities of actibin and its family proteases were inhibited by 3,4-dichloroisocoumarin, a serine protease inhibitor, indicating that actibin and its family proteases are serine proteases. Four cDNAs, named DaP1 and DaP7-DaP9, encoding D. actus coagulant proteases were cloned. All cDNAs contain an open reading frame of 780 bp coding for 260 amino acid residues, including a signal peptide of 24 amino acid residues. Their amino acid sequences predicted are highly homologous to one another with one to five amino acid substitutions. When four D. actus protease cDNAs were compared with the cDNAs coding for Trimeresurus flavoviridis and T. gramineus venom serine proteases, accelerated evolution was clearly observed. Similarity of the nucleotide sequences of four D. actus protease cDNAs with no synonymous and one to five nonsynonymous substitutions seems not to be in direct conformity with accelerated evolution. This possibly suggests that they have evolved to a similar direction to enhance their clotting activity rather than to produce other physiological activities.

  16. Design of new potent HTLV-1 protease inhibitors: in silico study.

    PubMed

    Kheirabadi, Mitra; Maleki, Javad; Soufian, Safieh; Hosseini, Samaneh

    2016-03-01

    HTLV-1 and HIV-1 are two major causes for severe T-cell leukemia disease and acquired immune deficiency syndrome (AIDS). HTLV-1 protease, a member of aspartic acid protease family, plays important roles in maturation during virus replication cycle. The impairment of these proteases results in uninfectious HTLV-1virions.Similar to HIV-1protease deliberate mutations that confer drug resistance on HTLV-1 are frequently seen in this protease. Therefore, inhibition of HTLV-1 protease activity is expected to disrupt HTLV-1's ability to replicate and infect additional cells. In this study, we initially designed fifteen inhibitory compounds based on the conformations of a class of HIV-1 aspartyl protease inhibitors, sulfonamid-peptoid. Five compounds were chosen based on the goodness of their Drug-Likeness scoreusing "Lipinsk's rule of five". Here, using protein-ligand docking approach we compared the inhibitory constants of these compounds to those available in literatures and observed significantly higher inhibition for two compounds, SP-4 and SP-5. Our data suggest that the addition of two cyclic hydrocarbons to both ends of sulfonamide peptoids leads to the formation of new hydrophobic interactions due to the semi-circular form of these compounds, connecting the first chain of protease to the two ends of tested ligands via Hydrophobic interactions. We conclude that hydrophobic force plays an important role in suppressing protease activity especially for HTLV-1 protease, which in turn prevents the virus maturity. Therefore, designing and development of new ligands based on aromatic hydrocarbons in both ends of inhibitors is very promising for efficient treatment.

  17. Design of new potent HTLV-1 protease inhibitors: in silico study

    PubMed Central

    Kheirabadi, Mitra; Maleki, Javad; Soufian, Safieh; Hosseini, Samaneh

    2016-01-01

    HTLV-1 and HIV-1 are two major causes for severe T-cell leukemia disease and acquired immune deficiency syndrome (AIDS). HTLV-1 protease, a member of aspartic acid protease family, plays important roles in maturation during virus replication cycle. The impairment of these proteases results in uninfectious HTLV-1virions.Similar to HIV-1protease deliberate mutations that confer drug resistance on HTLV-1 are frequently seen in this protease. Therefore, inhibition of HTLV-1 protease activity is expected to disrupt HTLV-1’s ability to replicate and infect additional cells. In this study, we initially designed fifteen inhibitory compounds based on the conformations of a class of HIV-1 aspartyl protease inhibitors, sulfonamid-peptoid. Five compounds were chosen based on the goodness of their Drug-Likeness scoreusing “Lipinsk’s rule of five”. Here, using protein-ligand docking approach we compared the inhibitory constants of these compounds to those available in literatures and observed significantly higher inhibition for two compounds, SP-4 and SP-5. Our data suggest that the addition of two cyclic hydrocarbons to both ends of sulfonamide peptoids leads to the formation of new hydrophobic interactions due to the semi-circular form of these compounds, connecting the first chain of protease to the two ends of tested ligands via Hydrophobic interactions. We conclude that hydrophobic force plays an important role in suppressing protease activity especially for HTLV-1 protease, which in turn prevents the virus maturity. Therefore, designing and development of new ligands based on aromatic hydrocarbons in both ends of inhibitors is very promising for efficient treatment. PMID:27844017

  18. Function and Regulation of SUMO Proteases

    PubMed Central

    Hickey, Christopher M.; Wilson, Nicole R.; Hochstrasser, Mark

    2013-01-01

    Covalent attachment of small ubiquitin-like modifier (SUMO) to proteins is highly dynamic, and both SUMO-protein conjugation and cleavage can be regulated. Protein desumoylation is performed by SUMO proteases, which control cellular mechanisms ranging from transcription and cell division to ribosome biogenesis. Recent advances include the discovery of two novel classes of SUMO proteases, insights regarding SUMO protease specificity, and revelations of previously unappreciated SUMO protease functions in several key cellular pathways. These developments, together with new connections between SUMO proteases and the recently discovered SUMO-targeted ubiquitin ligases (STUbLs), make this an exciting period for the study of these enzymes. PMID:23175280

  19. Network Analyses Reveal Pervasive Functional Regulation Between Proteases in the Human Protease Web

    PubMed Central

    Fortelny, Nikolaus; Cox, Jennifer H.; Kappelhoff, Reinhild; Starr, Amanda E.; Lange, Philipp F.; Pavlidis, Paul; Overall, Christopher M.

    2014-01-01

    Proteolytic processing is an irreversible posttranslational modification affecting a large portion of the proteome. Protease-cleaved mediators frequently exhibit altered activity, and biological pathways are often regulated by proteolytic processing. Many of these mechanisms have not been appreciated as being protease-dependent, and the potential in unraveling a complex new dimension of biological control is increasingly recognized. Proteases are currently believed to act individually or in isolated cascades. However, conclusive but scattered biochemical evidence indicates broader regulation of proteases by protease and inhibitor interactions. Therefore, to systematically study such interactions, we assembled curated protease cleavage and inhibition data into a global, computational representation, termed the protease web. This revealed that proteases pervasively influence the activity of other proteases directly or by cleaving intermediate proteases or protease inhibitors. The protease web spans four classes of proteases and inhibitors and so links both recently and classically described protease groups and cascades, which can no longer be viewed as operating in isolation in vivo. We demonstrated that this observation, termed reachability, is robust to alterations in the data and will only increase in the future as additional data are added. We further show how subnetworks of the web are operational in 23 different tissues reflecting different phenotypes. We applied our network to develop novel insights into biologically relevant protease interactions using cell-specific proteases of the polymorphonuclear leukocyte as a system. Predictions from the protease web on the activity of matrix metalloproteinase 8 (MMP8) and neutrophil elastase being linked by an inactivating cleavage of serpinA1 by MMP8 were validated and explain perplexing Mmp8 −/− versus wild-type polymorphonuclear chemokine cleavages in vivo. Our findings supply systematically derived and

  20. Biotechnology of Cold-Active Proteases

    PubMed Central

    Joshi, Swati; Satyanarayana, Tulasi

    2013-01-01

    The bulk of Earth’s biosphere is cold (<5 °C) and inhabited by psychrophiles. Biocatalysts from psychrophilic organisms (psychrozymes) have attracted attention because of their application in the ongoing efforts to decrease energy consumption. Proteinases as a class represent the largest category of industrial enzymes. There has been an emphasis on employing cold-active proteases in detergents because this allows laundry operations at ambient temperatures. Proteases have been used in environmental bioremediation, food industry and molecular biology. In view of the present limited understanding and availability of cold-active proteases with diverse characteristics, it is essential to explore Earth’s surface more in search of an ideal cold-active protease. The understanding of molecular and mechanistic details of these proteases will open up new avenues to tailor proteases with the desired properties. A detailed account of the developments in the production and applications of cold-active proteases is presented in this review. PMID:24832807

  1. Bacterial proteases in IBD and IBS.

    PubMed

    Steck, Natalie; Mueller, Kerstin; Schemann, Michael; Haller, Dirk

    2012-11-01

    Proteases play a decisive role in health and disease. They fulfil diverse functions and have been associated with the pathology of gastrointestinal disorders such as inflammatory bowel disease (IBD) and irritable bowel syndrome (IBS). The current knowledge focuses on host-derived proteases including matrix metalloproteinases, various serine proteases and cathepsins. The possible contribution of bacterial proteases has been largely ignored in the pathogenesis of IBD and IBS, although there is increasing evidence, especially demonstrated for proteases from pathogenic bacteria. The underlying mechanisms extend to proteases from commensal bacteria which may be relevant for disease susceptibility. The intestinal microbiota and its proteolytic capacity exhibit the potential to contribute to the pathogenesis of IBD and IBS. This review highlights the relevance of host- and bacteria-derived proteases and their signalling mechanisms.

  2. Distinct contribution of Toxoplasma gondii rhomboid proteases 4 and 5 to micronemal protein protease 1 activity during invasion.

    PubMed

    Rugarabamu, George; Marq, Jean-Baptiste; Guérin, Amandine; Lebrun, Maryse; Soldati-Favre, Dominique

    2015-07-01

    Host cell entry by the Apicomplexa is associated with the sequential secretion of invasion factors from specialized apical organelles. Secretion of micronemal proteins (MICs) complexes by Toxoplasma gondii facilitates parasite gliding motility, host cell attachment and entry, as well as egress from infected cells. The shedding of MICs during these steps is mediated by micronemal protein proteases MPP1, MPP2 and MPP3. The constitutive activity of MPP1 leads to the cleavage of transmembrane MICs and is linked to the surface rhomboid protease 4 (ROM4) and possibly to rhomboid protease 5 (ROM5). To determine their importance and respective contribution to MPP1 activity, in this study ROM4 and ROM5 genes were abrogated using Cre-recombinase and CRISPR-Cas9 nuclease, respectively, and shown to be dispensable for parasite survival. Parasites lacking ROM4 predominantly engage in twirling motility and exhibit enhanced attachment and impaired invasion, whereas intracellular growth and egress is not affected. The substrates MIC2 and MIC6 are not cleaved in rom4-ko parasites, in contrast, intramembrane cleavage of AMA1 is reduced but not completely abolished. Shedding of MICs and invasion are not altered in the absence of ROM5; however, this protease responsible for the residual cleavage of AMA1 is able to cleave other AMA family members and exhibits a detectable contribution to invasion in the absence of ROM4.

  3. Proteases of germinating winged-bean (Psophocarpus tetragonolobus) seeds: purification and characterization of an acidic protease.

    PubMed

    Usha, R; Singh, M

    1996-01-15

    Two major classes of protease are shown to occur in germinating winged-bean (Psophocarpus tetragonolobus) seeds, by assaying extracts at pH 8.0 and pH 5.1 with [14C]gelatin as substrate. At pH 8.0, the activity profile of the enzyme shows a steady rise throughout the period of germination, whereas the activity at the acidic pH is very low up to day 5 and then increases sharply reaching a peak on day 11, followed by an equally sharp decline. The winged-bean acidic protease (WbAP) has been purified to apparent homogeneity, as attested by a single protein band on both PAGE and SDS/PAGE. WbAP is a monomeric enzyme with a molecular mass of 35 kDa and a pH optimum of 6.0. It is a thiol protease that does not belong to the papain family and it has tightly bound Ca2+ as shown by 45Ca(2+)-exchange studies. Besides gelatin and casein, it hydrolyses a 29 kDa winged-bean protein, indicating a prospective physiological role for it in storage-protein mobilization. Immunoblot analysis shows that it occurs only in the seeds and sprouting tubers of this plant and also that it is synthesized in developing seeds just before desiccation. It appears that the newly synthesized enzyme is inactive, and activation takes place around day 6 of germination. However, neither the mechanism of activation nor the signal that triggers it is clearly understood.

  4. The dissemination of C10 cysteine protease genes in Bacteroides fragilis by mobile genetic elements

    PubMed Central

    2010-01-01

    Background The C10 family of cysteine proteases includes enzymes that contribute to the virulence of bacterial pathogens, such as SpeB in Streptococcus pyogenes. The presence of homologues of cysteine protease genes in human commensal organisms has not been examined. Bacteroides fragilis is a member of the dominant Bacteroidetes phylum of the human intestinal microbiota, and is a significant opportunistic pathogen. Results Four homologues of the streptococcal virulence factor SpeB were identified in the B. fragilis genome. These four protease genes, two were directly contiguous to open reading frames predicted to encode staphostatin-like inhibitors, with which the protease genes were co-transcribed. Two of these protease genes are unique to B. fragilis 638R and are associated with two large genomic insertions. Gene annotation indicated that one of these insertions was a conjugative Tn-like element and the other was a prophage-like element, which was shown to be capable of excision. Homologues of the B. fragilis C10 protease genes were present in a panel of clinical isolates, and in DNA extracted from normal human faecal microbiota. Conclusions This study suggests a mechanism for the evolution and dissemination of an important class of protease in major members of the normal human microbiota. PMID:20416045

  5. Identification and biochemical characterization of vivapains, cysteine proteases of the malaria parasite Plasmodium vivax.

    PubMed Central

    Na, Byoung-Kuk; Shenai, Bhaskar R; Sijwali, Puran S; Choe, Youngchool; Pandey, Kailash C; Singh, Ajay; Craik, Charles S; Rosenthal, Philip J

    2004-01-01

    Cysteine proteases play important roles in the life cycles of malaria parasites. Cysteine protease inhibitors block haemoglobin hydrolysis and development in Plasmodium falciparum, suggesting that the cysteine proteases of this major human pathogen, termed falcipains, are appropriate therapeutic targets. To expand our understanding of plasmodial proteases to Plasmodium vivax, the other prevalent human malaria parasite, we identified and cloned genes encoding the P. vivax cysteine proteases, vivapain-2 and vivapain-3, and functionally expressed the proteases in Escherichia coli. The vivapain-2 and vivapain-3 genes predicted papain-family cysteine proteases, which shared a number of unusual features with falcipain-2 and falcipain-3, including large prodomains and short N-terminal extensions on the catalytic domain. Recombinant vivapain-2 and vivapain-3 shared properties with the falcipains, including acidic pH optima, requirements for reducing conditions for activity and hydrolysis of substrates with positively charged residues at P1 and Leu at P2. Both enzymes hydrolysed native haemoglobin at acidic pH and the erythrocyte cytoskeletal protein 4.1 at neutral pH, suggesting similar biological roles to the falcipains. Considering inhibitor profiles, the vivapains were inhibited by fluoromethylketone and vinyl sulphone inhibitors that also inhibited falcipains and have demonstrated potent antimalarial activity. PMID:14629194

  6. Modulation of the epithelial sodium channel (ENaC) by bacterial metalloproteases and protease inhibitors.

    PubMed

    Butterworth, Michael B; Zhang, Liang; Liu, Xiaoning; Shanks, Robert M; Thibodeau, Patrick H

    2014-01-01

    The serralysin family of metalloproteases is associated with the virulence of multiple gram-negative human pathogens, including Pseudomonas aeruginosa and Serratia marcescens. The serralysin proteases share highly conserved catalytic domains and show evolutionary similarity to the mammalian matrix metalloproteases. Our previous studies demonstrated that alkaline protease (AP) from Pseudomonas aeruginosa is capable of activating the epithelial sodium channel (ENaC), leading to an increase in sodium absorption in airway epithelia. The serralysin proteases are often co-expressed with endogenous, intracellular or periplasmic inhibitors, which putatively protect the bacterium from unwanted or unregulated protease activities. To evaluate the potential use of these small protein inhibitors in regulating the serralysin induced activation of ENaC, proteases from Pseudomonas aeruginosa and Serratia marcescens were purified for characterization along with a high affinity inhibitor from Pseudomonas. Both proteases showed activity against in vitro substrates and could be blocked by near stoichiometric concentrations of the inhibitor. In addition, both proteases were capable of activating ENaC when added to the apical surfaces of multiple epithelial cells with similar slow activation kinetics. The high-affinity periplasmic inhibitor from Pseudomonas effectively blocked this activation. These data suggest that multiple metalloproteases are capable of activating ENaC. Further, the endogenous, periplasmic bacterial inhibitors may be useful for modulating the downstream effects of the serralysin virulence factors under physiological conditions.

  7. Modulation of the Epithelial Sodium Channel (ENaC) by Bacterial Metalloproteases and Protease Inhibitors

    PubMed Central

    Butterworth, Michael B.; Zhang, Liang; Liu, Xiaoning; Shanks, Robert M.; Thibodeau, Patrick H.

    2014-01-01

    The serralysin family of metalloproteases is associated with the virulence of multiple gram-negative human pathogens, including Pseudomonas aeruginosa and Serratia marcescens. The serralysin proteases share highly conserved catalytic domains and show evolutionary similarity to the mammalian matrix metalloproteases. Our previous studies demonstrated that alkaline protease (AP) from Pseudomonas aeruginosa is capable of activating the epithelial sodium channel (ENaC), leading to an increase in sodium absorption in airway epithelia. The serralysin proteases are often co-expressed with endogenous, intracellular or periplasmic inhibitors, which putatively protect the bacterium from unwanted or unregulated protease activities. To evaluate the potential use of these small protein inhibitors in regulating the serralysin induced activation of ENaC, proteases from Pseudomonas aeruginosa and Serratia marcescens were purified for characterization along with a high affinity inhibitor from Pseudomonas. Both proteases showed activity against in vitro substrates and could be blocked by near stoichiometric concentrations of the inhibitor. In addition, both proteases were capable of activating ENaC when added to the apical surfaces of multiple epithelial cells with similar slow activation kinetics. The high-affinity periplasmic inhibitor from Pseudomonas effectively blocked this activation. These data suggest that multiple metalloproteases are capable of activating ENaC. Further, the endogenous, periplasmic bacterial inhibitors may be useful for modulating the downstream effects of the serralysin virulence factors under physiological conditions. PMID:24963801

  8. Nelfinavir: fourth protease inhibitor approved.

    PubMed

    1997-01-01

    The Food and Drug Administration (FDA) has granted accelerated approval to nelfinavir in both adult and pediatric formulations. Agouron, the manufacturer, used innovative computerized drug design techniques to discover, design, and refine the nelfinavir molecule. Nelfinavir is marketed under the trade name Viracept, and costs $5,000 per year. Early clinical trials find it to be as powerful as the other protease inhibitors, but with a different resistance profile. The drug has relatively few drug indications; however, several compounds have been contraindicated.

  9. Structural Mechanisms of Inactivation in Scabies Mite Serine Protease Paralogues

    SciTech Connect

    Fischer, Katja; Langendorf, Christopher G.; Irving, James A.; Reynolds, Simone; Willis, Charlene; Beckham, Simone; Law, Ruby H.P.; Yang, Sundy; Bashtannyk-Puhalovich, Tanya A.; McGowan, Sheena; Whisstock, James C.; Pike, Robert N.; Kemp, David J.; Buckle, Ashley M.

    2009-08-07

    The scabies mite (Sarcoptes scabiei) is a parasite responsible for major morbidity in disadvantaged communities and immuno-compromised patients worldwide. In addition to the physical discomfort caused by the disease, scabies infestations facilitate infection by Streptococcal species via skin lesions, resulting in a high prevalence of rheumatic fever/heart disease in affected communities. The scabies mite produces 33 proteins that are closely related to those in the dust mite group 3 allergen and belong to the S1-like protease family (chymotrypsin-like). However, all but one of these molecules contain mutations in the conserved active-site catalytic triad that are predicted to render them catalytically inactive. These molecules are thus termed scabies mite inactivated protease paralogues (SMIPPs). The precise function of SMIPPs is unclear; however, it has been suggested that these proteins might function by binding and protecting target substrates from cleavage by host immune proteases, thus preventing the host from mounting an effective immune challenge. In order to begin to understand the structural basis for SMIPP function, we solved the crystal structures of SMIPP-S-I1 and SMIPP-S-D1 at 1.85 {angstrom} and 2.0 {angstrom} resolution, respectively. Both structures adopt the characteristic serine protease fold, albeit with large structural variations over much of the molecule. In both structures, mutations in the catalytic triad together with occlusion of the S1 subsite by a conserved Tyr200 residue is predicted to block substrate ingress. Accordingly, we show that both proteases lack catalytic function. Attempts to restore function (via site-directed mutagenesis of catalytic residues as well as Tyr200) were unsuccessful. Taken together, these data suggest that SMIPPs have lost the ability to bind substrates in a classical 'canonical' fashion, and instead have evolved alternative functions in the lifecycle of the scabies mite.

  10. Serine Protease Activity of Calnuc

    PubMed Central

    Kanuru, Madhavi; Raman, Rajeev; Aradhyam, Gopala Krishna

    2013-01-01

    The functions of calnuc, a novel Ca2+-binding protein with multiple structural domains and diverse interacting partners, are yet unknown. We demonstrate unknown facets of calnuc, which is a serine protease in which Ser-378 of GXSXG motif, Asp-328 of DTG motif, and His-339 form the “catalytic triad,” locating the enzyme active site in the C-terminal region. Analogous to the active site of Zn2+ carboxypeptidases, calnuc has two high affinity (Kd ∼ 20 nm), well conserved Zn2+-binding sites near its N terminus, although it is inactive as a peptidase. Zn2+ binding allosterically and negatively regulates the serine protease activity of calnuc, inhibition being caused by an “open to close” change in its conformation not seen upon Ca2+ binding. Most strikingly, interaction with G protein α subunit completely inhibits the enzymatic activity of calnuc. We thus illustrate that G proteins and Zn2+ act as two “keys” that control enzymatic activity of calnuc, arresting it in “locked” state. Calnuc, therefore, exists dynamically in two different forms, (i) as a Ca2+-binding protein in Zn2+-bound form and (ii) as a protease in Zn2+-free form, commissioning it to perform multiple functions. PMID:23195954

  11. Molecular Imaging of Proteases in Cancer

    PubMed Central

    Yang, Yunan; Hong, Hao; Zhang, Yin; Cai, Weibo

    2010-01-01

    Proteases play important roles during tumor angiogenesis, invasion, and metastasis. Various molecular imaging techniques have been employed for protease imaging: optical (both fluorescence and bioluminescence), magnetic resonance imaging (MRI), single-photon emission computed tomography (SPECT), and positron emission tomography (PET). In this review, we will summarize the current status of imaging proteases in cancer with these techniques. Optical imaging of proteases, in particular with fluorescence, is the most intensively validated and many of the imaging probes are already commercially available. It is generally agreed that the use of activatable probes is the most accurate and appropriate means for measuring protease activity. Molecular imaging of proteases with other techniques (i.e. MRI, SPECT, and PET) has not been well-documented in the literature which certainly deserves much future effort. Optical imaging and molecular MRI of protease activity has very limited potential for clinical investigation. PET/SPECT imaging is suitable for clinical investigation; however the optimal probes for PET/SPECT imaging of proteases in cancer have yet to be developed. Successful development of protease imaging probes with optimal in vivo stability, tumor targeting efficacy, and desirable pharmacokinetics for clinical translation will eventually improve cancer patient management. Not limited to cancer, these protease-targeted imaging probes will also have broad applications in other diseases such as arthritis, atherosclerosis, and myocardial infarction. PMID:20234801

  12. Protease induced plasticity: matrix metalloproteinase-1 promotes neurostructural changes through activation of protease activated receptor 1

    PubMed Central

    Allen, Megan; Ghosh, Suhasini; Ahern, Gerard P.; Villapol, Sonia; Maguire-Zeiss, Kathleen A.; Conant, Katherine

    2016-01-01

    Matrix metalloproteinases (MMPs) are a family of secreted endopeptidases expressed by neurons and glia. Regulated MMP activity contributes to physiological synaptic plasticity, while dysregulated activity can stimulate injury. Disentangling the role individual MMPs play in synaptic plasticity is difficult due to overlapping structure and function as well as cell-type specific expression. Here, we develop a novel system to investigate the selective overexpression of a single MMP driven by GFAP expressing cells in vivo. We show that MMP-1 induces cellular and behavioral phenotypes consistent with enhanced signaling through the G-protein coupled protease activated receptor 1 (PAR1). Application of exogenous MMP-1, in vitro, stimulates PAR1 dependent increases in intracellular Ca2+ concentration and dendritic arborization. Overexpression of MMP-1, in vivo, increases dendritic complexity and induces biochemical and behavioral endpoints consistent with increased GPCR signaling. These data are exciting because we demonstrate that an astrocyte-derived protease can influence neuronal plasticity through an extracellular matrix independent mechanism. PMID:27762280

  13. Structural basis of ubiquitin recognition by the deubiquitinating protease USP2.

    PubMed

    Renatus, Martin; Parrado, Shirley Gil; D'Arcy, Allan; Eidhoff, Ulf; Gerhartz, Bernd; Hassiepen, Ulrich; Pierrat, Benoit; Riedl, Ralph; Vinzenz, Daniela; Worpenberg, Susanne; Kroemer, Markus

    2006-08-01

    Deubiquitinating proteases reverse protein ubiquitination and rescue their target proteins from destruction by the proteasome. USP2, a cysteine protease and a member of the ubiquitin specific protease family, is overexpressed in prostate cancer and stabilizes fatty acid synthase, which has been associated with the malignancy of some aggressive prostate cancers. Here, we report the structure of the human USP2 catalytic domain in complex with ubiquitin. Ubiquitin uses two major sites for the interaction with the protease. Both sites are required simultaneously, as shown by USP2 inhibition assays with peptides and ubiquitin mutants. In addition, a layer of ordered water molecules mediates key interactions between ubiquitin and USP2. As several of those molecules are found at identical positions in the previously solved USP7/ubiquitin-aldehyde complex structure, we suggest a general mechanism of water-mediated ubiquitin recognition by USPs.

  14. Evaluation on Potential Contributions of Protease Activated Receptors Related Mediators in Allergic Inflammation

    PubMed Central

    Zhang, Huiyun; Zeng, Xiaoning; He, Shaoheng

    2014-01-01

    Protease activated receptors (PARs) have been recognized as a distinctive four-member family of seven transmembrane G protein-coupled receptors (GPCRs) that can be cleaved by certain serine proteases. In recent years, there has been considerable interest in the role of PARs in allergic inflammation, the fundamental pathologic changes of allergy, but the potential roles of PARs in allergy remain obscure. Since many of these proteases are produced and actively involved in the pathologic process of inflammation including exudation of plasma components, inflammatory cell infiltration, and tissue damage and repair, PARs appear to make important contribution to allergy. The aim of the present review is to summarize the expression of PARs in inflammatory and structural cells, the influence of agonists or antagonists of PARs on cell behavior, and the involvement of PARs in allergic disorders, which will help us to better understand the roles of serine proteases and PARs in allergy. PMID:24876677

  15. Population-associated heterogeneity of the digestive Cys protease complement in Colorado potato beetle, Leptinotarsa decemlineata.

    PubMed

    Rasoolizadeh, Asieh; Goulet, Marie-Claire; Guay, Jean-Frédéric; Cloutier, Conrad; Michaud, Dominique

    2017-03-04

    Herbivorous insects use complex protease complements to process plant proteins, useful to adjust their digestive functions to the plant diet and to elude the antidigestive effects of dietary protease inhibitors. We here assessed whether basic profiles and diet-related adjustments of the midgut protease complement may vary among populations of the insect herbivore Colorado potato beetle (Leptinotarsa decemlineata). Two laboratory colonies of this insect were used as models, derived from insect samples collected in potato fields ∼1200km distant from each other in North America. Synchronized 4th-instar larvae reared on potato were kept on this plant, or switched to tomato or eggplant, to compare their midgut cathepsin activities and content of intestain Cys proteases under different diet regimes. Cathepsin D activity, cathepsin L activity, cathepsin B activity and total intestain content shortly after larval molting on potato leaves were about two times lower in one population compared to the other. By comparison, cathepsin D activity, cathepsin B activity, total intestain content and relative abundance of the most prominent intestain families were similar in the two populations after three days regardless of the plant diet, unlike cathepsin L activity and less prominent intestain families showing population-associated variability. Variation in Cys protease profiles translated into the differential efficiency of a Cys protease inhibitor, tomato cystatin SlCYS8, to inhibit cathepsin L activity in midgut extracts of the two insect groups. Despite quantitative differences, SlCYS8 single variants engineered to strongly inhibit Cys proteases showed improved potency against cathepsin L activity of either population. These data suggest the feasibility of designing cystatins to control L. decemlineata that are effective against different populations of this insect. They underline, on the other hand, the practical relevance of considering natural variability of the protease

  16. Advances in protease engineering for laundry detergents.

    PubMed

    Vojcic, Ljubica; Pitzler, Christian; Körfer, Georgette; Jakob, Felix; Ronny Martinez; Maurer, Karl-Heinz; Schwaneberg, Ulrich

    2015-12-25

    Proteases are essential ingredients in modern laundry detergents. Over the past 30 years, subtilisin proteases employed in the laundry detergent industry have been engineered by directed evolution and rational design to tailor their properties towards industrial demands. This comprehensive review discusses recent success stories in subtilisin protease engineering. Advances in protease engineering for laundry detergents comprise simultaneous improvement of thermal resistance and activity at low temperatures, a rational strategy to modulate pH profiles, and a general hypothesis for how to increase promiscuous activity towards the production of peroxycarboxylic acids as mild bleaching agents. The three protease engineering campaigns presented provide in-depth analysis of protease properties and have identified principles that can be applied to improve or generate enzyme variants for industrial applications beyond laundry detergents. Copyright © 2015 Elsevier B.V. All rights reserved.

  17. Secretion of proteases from Pasteurella multocida isolates.

    PubMed

    Negrete-Abascal, E; Tenorio, V R; de la Garza, M

    1999-01-01

    The capability of Pasteurella multocida to secrete proteases to the culture medium and their characterization were studied in five animal isolates (bovine, chicken, sheep, and two from pig). All the isolates produced proteases in a wide range of molecular mass. It is suggested that they are neutral metalloproteases, since they were optimally active between pH 6 and 7, inhibited by chelating agents but not by other protease inhibitors, and reactivated by calcium. Proteases from isolates were able to degrade IgG. Several proteins from supernatants of cultures precipitated with 70% (NH4)2SO4 of all the P. multocida isolates were recognized by a polyclonal antiserum raised against a purified protease from Actinobacillus pleuropneumoniae. Protease production might play an important role during tissue colonization and in P. multocida diseases.

  18. Biofluid proteases profiling in diabetes mellitus.

    PubMed

    Trindade, Fábio; Ferreira, Rita; Amado, Francisco; Vitorino, Rui

    2015-01-01

    The investigation of protease relevance in biologic systems beyond catabolism of proteins and peptides to amino acids has stimulated interest as to their role in the pathogenesis of several disorders including diabetes mellitus (DM). Evaluation of proteases and the assessment of their activity in biofluids are fundamental to elucidate these proteolytic systems in DM and its related complications. In contrast to traditional immunoassay or substrate based approaches that targeted specific proteases and their inhibitors, the field of degradomics has provided a comprehensive approach to study these enzymes. Although the degradome contains over 500 proteases, very few have been associated with DM and its micro- and macrovascular complications. In this paper, we review these proteases and their respective inhibitors with emphasis on DM. It is likely that future research will expand these initial studies and look to develop high throughput automated technologies to identify and characterize biofluid proteases of diagnostic and prognostic value in other pathologies.

  19. Bacterial proteases: targets for diagnostics and therapy.

    PubMed

    Kaman, W E; Hays, J P; Endtz, H P; Bikker, F J

    2014-07-01

    Proteases are essential for the proliferation and growth of bacteria, and are also known to contribute to bacterial virulence. This makes them interesting candidates as diagnostic and therapeutic targets for infectious diseases. In this review, the authors discuss the most recent developments and potential applications for bacterial proteases in the diagnosis and treatment of bacterial infections. Current and future bacterial protease targets are described and their limitations outlined.

  20. Nucleotide sequences encoding a thermostable alkaline protease

    DOEpatents

    Wilson, D.B.; Lao, G.

    1998-01-06

    Nucleotide sequences, derived from a thermophilic actinomycete microorganism, which encode a thermostable alkaline protease are disclosed. Also disclosed are variants of the nucleotide sequences which encode a polypeptide having thermostable alkaline proteolytic activity. Recombinant thermostable alkaline protease or recombinant polypeptide may be obtained by culturing in a medium a host cell genetically engineered to contain and express a nucleotide sequence according to the present invention, and recovering the recombinant thermostable alkaline protease or recombinant polypeptide from the culture medium. 3 figs.

  1. Nucleotide sequences encoding a thermostable alkaline protease

    DOEpatents

    Wilson, David B.; Lao, Guifang

    1998-01-01

    Nucleotide sequences, derived from a thermophilic actinomycete microorganism, which encode a thermostable alkaline protease are disclosed. Also disclosed are variants of the nucleotide sequences which encode a polypeptide having thermostable alkaline proteolytic activity. Recombinant thermostable alkaline protease or recombinant polypeptide may be obtained by culturing in a medium a host cell genetically engineered to contain and express a nucleotide sequence according to the present invention, and recovering the recombinant thermostable alkaline protease or recombinant polypeptide from the culture medium.

  2. Proteolytic crosstalk in multi-protease networks

    NASA Astrophysics Data System (ADS)

    Ogle, Curtis T.; Mather, William H.

    2016-04-01

    Processive proteases, such as ClpXP in E. coli, are conserved enzyme assemblies that can recognize and rapidly degrade proteins. These proteases are used for a number of purposes, including degrading mistranslated proteins and controlling cellular stress response. However, proteolytic machinery within the cell is limited in capacity and can lead to a bottleneck in protein degradation, whereby many proteins compete (‘queue’) for proteolytic resources. Previous work has demonstrated that such queueing can lead to pronounced statistical relationships between different protein counts when proteins compete for a single common protease. However, real cells contain many different proteases, e.g. ClpXP, ClpAP, and Lon in E. coli, and it is not clear how competition between proteins for multiple classes of protease would influence the dynamics of cellular networks. In the present work, we theoretically demonstrate that a multi-protease proteolytic bottleneck can substantially couple the dynamics for both simple and complex (oscillatory) networks, even between substrates with substantially different affinities for protease. For these networks, queueing often leads to strong positive correlations between protein counts, and these correlations are strongest near the queueing theoretic point of balance. Furthermore, we find that the qualitative behavior of these networks depends on the relative size of the absolute affinity of substrate to protease compared to the cross affinity of substrate to protease, leading in certain regimes to priority queue statistics.

  3. Bacterial proteases from the intracellular vacuole niche; protease conservation and adaptation for pathogenic advantage.

    PubMed

    Huston, Wilhelmina M

    2010-06-01

    Proteases with important roles for bacterial pathogens that specifically reside within intracellular vacuoles are frequently homologous to those that have important virulence functions for other bacteria. Research has identified that some of these conserved proteases have evolved specialized functions for intracellular vacuole-residing bacteria. Unique proteases with pathogenic functions have also been described from Chlamydia, Mycobacteria, and Legionella. These findings suggest that there are further novel functions for proteases from these bacteria that remain to be described. This review summarizes the recent findings of novel protease functions from the intracellular human pathogenic bacteria that reside exclusively in vacuoles.

  4. Proteases at work: cues for understanding neural development and degeneration

    PubMed Central

    Saftig, Paul; Bovolenta, Paola

    2015-01-01

    Proteolytical processing of membrane bound molecules is a fundamental mechanism for the degradation of these proteins as well as for controlling cell-to-cell communication, which is at the basis of tissue development and homeostasis. Members of families of metalloproteinases and intra-membrane proteases are major effectors of these events. A recent workshop in Baeza, Spain, was devoted to discuss how this mechanism coordinates brain development and how its dysfunction leads to brain pathologies. Herein we summarize the findings presented during this workshop, which illuminate the role of metalloproteinases, including matrix metalloproteinase, A Disintegrin and Metalloproteinase-proteases and intra-membrane proteases, in the regulation of neurogenesis, axon guidance, and synaptogenesis as well as in neurodegeneration. Indeed, there is increasing evidence that proteolysis at the membrane is directly linked to neuropathologies such as Alzheimer Disease and autism spectrum or prion disorders. These proteolytic events are tightly regulated and we are just at the beginning of understanding how these processes could be exploited to design therapeutic treatments aimed at alleviating psychiatric and neurodegenerative pathologies. PMID:25999813

  5. Protease-activated receptors in kidney disease progression.

    PubMed

    Palygin, Oleg; Ilatovskaya, Daria V; Staruschenko, Alexander

    2016-12-01

    Protease-activated receptors (PARs) are members of a well-known family of transmembrane G protein-coupled receptors (GPCRs). Four PARs have been identified to date, of which PAR1 and PAR2 are the most abundant receptors, and have been shown to be expressed in the kidney vascular and tubular cells. PAR signaling is mediated by an N-terminus tethered ligand that can be unmasked by serine protease cleavage. The receptors are activated by endogenous serine proteases, such as thrombin (acts on PARs 1, 3, and 4) and trypsin (PAR2). PARs can be involved in glomerular, microvascular, and inflammatory regulation of renal function in both normal and pathological conditions. As an example, it was shown that human glomerular epithelial and mesangial cells express PARs, and these receptors are involved in the pathogenesis of crescentic glomerulonephritis, glomerular fibrin deposition, and macrophage infiltration. Activation of these receptors in the kidney also modulates renal hemodynamics and glomerular filtration rate. Clinical studies further demonstrated that the concentration of urinary thrombin is associated with glomerulonephritis and type 2 diabetic nephropathy; thus, molecular and functional mechanisms of PARs activation can be directly involved in renal disease progression. We briefly discuss here the recent literature related to activation of PAR signaling in glomeruli and the kidney in general and provide some examples of PAR1 signaling in glomeruli podocytes. Copyright © 2016 the American Physiological Society.

  6. Tissue Dissociation Enzyme Neutral Protease Assessment

    PubMed Central

    Breite, A.G.; Dwulet, F.E.; McCarthy, R.C.

    2010-01-01

    Neutral proteases, essential components of purified tissue dissociation enzymes required for successful human islet isolation, show variable activities and effects of substrate on their activities. Initially we used a spectrophotometric endpoint assay with azocasein substrate to measure neutral protease activity. After critical review of the results, we observed these data to be inconsistent and not correlating expected differences in specific activities between thermolysin and Bacillus polymyxa proteases. This observation led to the development of a fluorescent microplate assay using fluorescein isothyocyanate–conjugated bovine serum albumin (FITC-BSA) as the substrate. This simpler, more flexible method offered a homogeneous, kinetic enzyme assay allowing determination of steady state reaction rates of sample replicates at various dilutions. The assay had a linear range of 4- to 8-fold and interassay coefficients of variation for B polymyxa protease and thermolysin of <9% and <15%, respectively, which were lower than those using the spectrophotometric endpoint assay, namely, 54% and 36%, respectively. This format allowed for incorporation of enzyme inhibitors, as illustrated by addition of sulfhydryl protease inhibitors, which, consistent with earlier reports, strongly indicated that the main contaminant in purified collagenase preparations was clostripain. Determination of the specific activities for several purified neutral proteases showed that the B polymyxa and Clostridium histolyticum proteases had approximately 40% and 15% specific activities, respectively, of those obtained with purified thermolysin, indicating the different characteristics of neutral protease enzymes for cell isolation procedures. PMID:20692405

  7. Purification and characterization of a prothrombin-activating protease from Nephila clavata.

    PubMed

    Joo, Han-Seung; Park, Gun-Chun; Cho, Woo Ri; Tak, Eunsik; Paik, Seung R; Chang, Chung-Soon

    2002-03-01

    We report upon the purification and characterization of a novel prothrombin-activating enzyme from the body fluid (total homogenates of isolated digestive tract without eggs, spinnerets and silk glands) of the spider, Nephila clavata by a combination of acetone fractionation, ion exchange, and Soybean trypsin inhibitor-Sepharose chromatography. Analysis of the purified enzyme with SDS-PAGE and gel filtration revealed a single polypeptide chain with an apparent molecular weight of 24kDa. The proteolytic activity of the enzyme was stable up to 50 degrees C, however, it became unstable over 55 degrees C. The enzyme had an optimum pH of 8, and Ca(2+) was not required for the enzyme activity. According to inhibition profiles obtained with several serine protease inhibitors such as PMSF and benzamidine, the purified protease is a member of the serine proteases. Bz-Ile-Glu(gamma-OR)- Gly-Arg-pNA and Z-Arg-Gly-Arg-pNA which are known as substrates for factor Xa, were hydrolyzed favorably by the enzyme. And the Nephila protease could produce thrombin from prothrombin at nM range, and form the turbid ring using fibrinogen-agarose plate. The results obtained confirmed that the purified protease is a potent prothrombin-activating activity belonging to the family of serine protease.

  8. Purification, Characterization, and Functional Role of a Novel Extracellular Protease from Pleurotus ostreatus

    PubMed Central

    Palmieri, Gianna; Bianco, Carmen; Cennamo, Giovanna; Giardina, Paola; Marino, Gennaro; Monti, Maria; Sannia, Giovanni

    2001-01-01

    A new extracellular protease (PoSl; Pleurotus ostreatus subtilisin-like protease) from P. ostreatus culture broth has been purified and characterized. PoSl is a monomeric glycoprotein with a molecular mass of 75 kDa, a pI of 4.5, and an optimum pH in the alkaline range. The inhibitory profile indicates that PoSl is a serine protease. The N-terminal and three tryptic peptide sequences of PoSl have been determined. The homology of one internal peptide with conserved sequence around the Asp residue of the catalytic triad in the subtilase family suggests that PoSl is a subtilisin-like protease. This hypothesis is further supported by the finding that PoSl hydrolysis sites of the insulin B chain match those of subtilisin. PoSl activity is positively affected by calcium. A 10-fold decrease in the Km value in the presence of calcium ions can reflect an induced structural change in the substrate recognition site region. Furthermore, Ca2+ binding slows PoSl autolysis, triggering the protein to form a more compact structure. These effects have already been observed for subtilisin and other serine proteases. Moreover, PoSl protease seems to play a key role in the regulation of P. ostreatus laccase activity by degrading and/or activating different isoenzymes. PMID:11375191

  9. The Degradome database: expanding roles of mammalian proteases in life and disease.

    PubMed

    Pérez-Silva, José G; Español, Yaiza; Velasco, Gloria; Quesada, Víctor

    2016-01-04

    Since the definition of the degradome as the complete repertoire of proteases in a given organism, the combined effort of numerous laboratories has greatly expanded our knowledge of its roles in biology and pathology. Once the genomic sequences of several important model organisms were made available, we presented the Degradome database containing the curated sets of known protease genes in human, chimpanzee, mouse and rat. Here, we describe the updated Degradome database, featuring 81 new protease genes and 7 new protease families. Notably, in this short time span, the number of known hereditary diseases caused by mutations in protease genes has increased from 77 to 119. This increase reflects the growing interest on the roles of the degradome in multiple diseases, including cancer and ageing. Finally, we have leveraged the widespread adoption of new webtools to provide interactive graphic views that show information about proteases in the global context of the degradome. The Degradome database can be accessed through its web interface at http://degradome.uniovi.es.

  10. Protease Inhibitors from Marine Venomous Animals and Their Counterparts in Terrestrial Venomous Animals

    PubMed Central

    Mourão, Caroline B.F.; Schwartz, Elisabeth F.

    2013-01-01

    The Kunitz-type protease inhibitors are the best-characterized family of serine protease inhibitors, probably due to their abundance in several organisms. These inhibitors consist of a chain of ~60 amino acid residues stabilized by three disulfide bridges, and was first observed in the bovine pancreatic trypsin inhibitor (BPTI)-like protease inhibitors, which strongly inhibit trypsin and chymotrypsin. In this review we present the protease inhibitors (PIs) described to date from marine venomous animals, such as from sea anemone extracts and Conus venom, as well as their counterparts in terrestrial venomous animals, such as snakes, scorpions, spiders, Anurans, and Hymenopterans. More emphasis was given to the Kunitz-type inhibitors, once they are found in all these organisms. Their biological sources, specificity against different proteases, and other molecular blanks (being also K+ channel blockers) are presented, followed by their molecular diversity. Whereas sea anemone, snakes and other venomous animals present mainly Kunitz-type inhibitors, PIs from Anurans present the major variety in structure length and number of Cys residues, with at least six distinguishable classes. A representative alignment of PIs from these venomous animals shows that, despite eventual differences in Cys assignment, the key-residues for the protease inhibitory activity in all of them occupy similar positions in primary sequence. The key-residues for the K+ channel blocking activity was also compared. PMID:23771044

  11. The Degradome database: expanding roles of mammalian proteases in life and disease

    PubMed Central

    Pérez-Silva, José G.; Español, Yaiza; Velasco, Gloria; Quesada, Víctor

    2016-01-01

    Since the definition of the degradome as the complete repertoire of proteases in a given organism, the combined effort of numerous laboratories has greatly expanded our knowledge of its roles in biology and pathology. Once the genomic sequences of several important model organisms were made available, we presented the Degradome database containing the curated sets of known protease genes in human, chimpanzee, mouse and rat. Here, we describe the updated Degradome database, featuring 81 new protease genes and 7 new protease families. Notably, in this short time span, the number of known hereditary diseases caused by mutations in protease genes has increased from 77 to 119. This increase reflects the growing interest on the roles of the degradome in multiple diseases, including cancer and ageing. Finally, we have leveraged the widespread adoption of new webtools to provide interactive graphic views that show information about proteases in the global context of the degradome. The Degradome database can be accessed through its web interface at http://degradome.uniovi.es. PMID:26553809

  12. Purification and characterization of a novel extracellular alkaline protease from Cellulomonas bogoriensis.

    PubMed

    Li, Fan; Yang, Liyuan; Lv, Xue; Liu, Dongbo; Xia, Hongmei; Chen, Shan

    2016-05-01

    An extracellular alkaline protease produced by the alkali-tolerant Cellulomonas bogoriensis was purified by a combination of ammonium sulfate precipitation and cation exchange chromatography. The purity of the protease was detected by sodium dodecyl sulfate-polyacrylamide gel electrophoresis, and its molecular weight was confirmed to be 18.3 kDa. The enzyme showed optimum activity at 60 °C and pH 11. The stability of the protease was maintained at a wide temperature range of 4-60 °C and pH range of 3-12. Irreversible inhibition of the enzyme activity by phenylmethylsulfonyl fluoride and tosyl-l-phenylalanine chloromethyl ketone demonstrated that the purified enzyme is a chymotrypsin of the serine protease family. The Km and Vmax of the protease activity on casein were 19.2 mg/mL and 25000 μg/min/mg, respectively. The broad substrate specificity and remarkable stability in the presence of organic solvents, salt, and commercial detergents, as well as its excellent stain removal and dehairing capability, make the purified alkaline protease a promising candidate for industrial applications.

  13. Procerain, a stable cysteine protease from the latex of Calotropis procera.

    PubMed

    Dubey, Vikash Kumar; Jagannadham, M V

    2003-04-01

    A protease was purified to homogeneity from the latex of medicinal plant Calotropis procera (Family-Asclepiadaceae). The molecular mass and isoelectric point of the enzyme are 28.8 kDa and 9.32, respectively. Hydrolysis of azoalbumin by the enzyme was optimal in the range of pH 7.0-9.0 and temperature 55-60 degree C. The enzyme hydrolyses denatured natural substrates like casein, azoalbumin, and azocasein with high specific activity. Proteolytic and amidolytic activities of the enzyme were activated by thiol protease activators and inhibited by thiol protease inhibitors, indicating the enzyme to be a cysteine protease. The enzyme named as procerain, cleaves N-succinyl-Ala-Ala-Ala-p-nitroanilide but not -Ala-Ala-p-nitroanilide, -Ala p-nitroanilide and N-d-Benzoyl--Arg-p-nitroanilide and appears to be peptide length dependent. The extinction coefficient (epsilon 1% 280 nm) of the enzyme was 24.9 and it had no detectable carbohydrate moiety. Procerain contains eight tryptophan, 20 tyrosine and seven cysteine residues forming three disulfide bridges, and the remaining one being free. Procerain retains full activity over a broad range of pH 3.0-12.0 and temperatures up to 70 degree C, besides being stable at very high concentrations of chemical denaturants and organic solvents. Polyclonal antibodies against procerain do not cross-react with other related proteases. Procerain unlike most of the plant cysteine proteases has blocked N-terminal residue.

  14. Modeling of protease I collagenolytic enzyme from the fiddler crab Uca pugilator

    NASA Astrophysics Data System (ADS)

    Arnoux, B.; Lecroisey, A.; Ducruix, A.

    1990-06-01

    Collagenolytic protease I from the fiddler crab Uca pugilator belongs to the serine proteases of the trypsin family. A graphic molecular model was built using information from sequences and X-ray structures of four homologous proteins which were superimposed to define structurally conserved regions. Protease I sequence was aligned, with sequences of the model proteins, without permitting any deletion or insertion in these regions. Elastase α-carbon chain was selected as a template molecule. For the structurally variable regions, fragments of the four homologous proteins which were `closest' in sequence were selected. Intramolecular steric hindrance, that resulted from the substitution of the residues of the templates by protease I residues, was corrected by adjustment of the side-chain conformational angles. The model was then optimized by energy minimization. The primary specificity pocket in the model of collagenolytic protease I predicts a substrate preference for both P1 hydrophobic and positively charged residues which is in agreement with the biochemical observations. As soybean trypsin inhibitor (STI) is known to inhibit collagenolytic protease I, a tentative model of the complex was constructed and possibilities of interaction examined.

  15. Development and binding characteristics of phosphonate inhibitors of SplA protease from Staphylococcus aureus

    PubMed Central

    Burchacka, Ewa; Zdzalik, Michal; Niemczyk, Justyna-Stec; Pustelny, Katarzyna; Popowicz, Grzegorz; Wladyka, Benedykt; Dubin, Adam; Potempa, Jan; Sienczyk, Marcin; Dubin, Grzegorz; Oleksyszyn, Jozef

    2014-01-01

    Staphylococcus aureus is responsible for a variety of human infections, including life-threatening, systemic conditions. Secreted proteome, including a range of proteases, constitutes the major virulence factor of the bacterium. However, the functions of individual enzymes, in particular SplA protease, remain poorly characterized. Here, we report development of specific inhibitors of SplA protease. The design, synthesis, and activity of a series of α-aminoalkylphosphonate diaryl esters and their peptidyl derivatives are described. Potent inhibitors of SplA are reported, which may facilitate future investigation of physiological function of the protease. The binding modes of the high-affinity compounds Cbz-PheP-(OC6H4−4-SO2CH3)2 and Suc-Val-Pro-PheP-(OC6H5)2 are revealed by high-resolution crystal structures of complexes with the protease. Surprisingly, the binding mode of both compounds deviates from previously characterized canonical interaction of α-aminoalkylphosphonate peptidyl derivatives and family S1 serine proteases. PMID:24375505

  16. Protease-degradable electrospun fibrous hydrogels

    NASA Astrophysics Data System (ADS)

    Wade, Ryan J.; Bassin, Ethan J.; Rodell, Christopher B.; Burdick, Jason A.

    2015-03-01

    Electrospun nanofibres are promising in biomedical applications to replicate features of the natural extracellular matrix (ECM). However, nearly all electrospun scaffolds are either non-degradable or degrade hydrolytically, whereas natural ECM degrades proteolytically, often through matrix metalloproteinases. Here we synthesize reactive macromers that contain protease-cleavable and fluorescent peptides and are able to form both isotropic hydrogels and electrospun fibrous hydrogels through a photoinitiated polymerization. These biomimetic scaffolds are susceptible to protease-mediated cleavage in vitro in a protease dose-dependent manner and in vivo in a subcutaneous mouse model using transdermal fluorescent imaging to monitor degradation. Importantly, materials containing an alternate and non-protease-cleavable peptide sequence are stable in both in vitro and in vivo settings. To illustrate the specificity in degradation, scaffolds with mixed fibre populations support selective fibre degradation based on individual fibre degradability. Overall, this represents a novel biomimetic approach to generate protease-sensitive fibrous scaffolds for biomedical applications.

  17. The membrane-anchored serine protease, TMPRSS2, activates PAR-2 in prostate cancer cells

    PubMed Central

    2004-01-01

    TMPRSS2 is a type II transmembrane-bound serine protease that has gained interest owing to its highly localized expression in the prostate and its overexpression in neoplastic prostate epithelium. Once activated, the serine protease domain of TMPRSS2 is released from the cell surface into the extracellular space. PAR (protease-activated receptor)-2 belongs to a family of G-protein-coupled receptors (PAR-1–4) that are activated by specific serine proteases, which are expressed in many normal and malignant cell types. Previous in vitro studies on prostate cancer cells suggest a role for PAR-2 in prostate cancer metastasis. A polyclonal anti-human TMPRSS2 antibody was generated against the TMPRSS2 serine protease domain. The antibody showed specific reactivity with recombinant expressed TMPRSS2, and so was used to extract and purify the cleaved active TMPRSS2 protease from prostate cancer cells. Reverse transcriptase PCR and Western blot analysis were used to show the expression of both TMPRSS2 and PAR-2 in the androgen-dependent LNCaP prostate cancer cell line. Treatment of LNCaP cells with the cellular immunopurified TMPRSS2 protease induced a transient increase in intracellular calcium, which is indicative of G-protein-coupled-receptor activation. This calcium mobilization was inhibited by cellular pre-treatment with a specific PAR-2 antagonist, but not with a PAR-1 antagonist; inhibition of the protease activity also failed to mobilize calcium, suggesting that TMPRSS2 is capable of cleaving and thereby activating the PAR-2 receptor. The calcium mobilization was also inhibited by cellular pre-treatment with suramin or 2-APB (2-aminoethoxydiphenyl borate), indicating that a G-protein pathway is involved and that subsequent calcium release is mainly from intracellular stores. The present study describes how TMPRSS2 may contribute to prostate tumour metastasis via the activation of PAR-2. PMID:15537383

  18. The membrane-anchored serine protease, TMPRSS2, activates PAR-2 in prostate cancer cells.

    PubMed

    Wilson, Susan; Greer, Brett; Hooper, John; Zijlstra, Andries; Walker, Brian; Quigley, James; Hawthorne, Susan

    2005-06-15

    TMPRSS2 is a type II transmembrane-bound serine protease that has gained interest owing to its highly localized expression in the prostate and its overexpression in neoplastic prostate epithelium. Once activated, the serine protease domain of TMPRSS2 is released from the cell surface into the extracellular space. PAR (protease-activated receptor)-2 belongs to a family of G-protein-coupled receptors (PAR-1-4) that are activated by specific serine proteases, which are expressed in many normal and malignant cell types. Previous in vitro studies on prostate cancer cells suggest a role for PAR-2 in prostate cancer metastasis. A polyclonal anti-human TMPRSS2 antibody was generated against the TMPRSS2 serine protease domain. The antibody showed specific reactivity with recombinant expressed TMPRSS2, and so was used to extract and purify the cleaved active TMPRSS2 protease from prostate cancer cells. Reverse transcriptase PCR and Western blot analysis were used to show the expression of both TMPRSS2 and PAR-2 in the androgen-dependent LNCaP prostate cancer cell line. Treatment of LNCaP cells with the cellular immunopurified TMPRSS2 protease induced a transient increase in intracellular calcium, which is indicative of G-protein-coupled-receptor activation. This calcium mobilization was inhibited by cellular pre-treatment with a specific PAR-2 antagonist, but not with a PAR-1 antagonist; inhibition of the protease activity also failed to mobilize calcium, suggesting that TMPRSS2 is capable of cleaving and thereby activating the PAR-2 receptor. The calcium mobilization was also inhibited by cellular pre-treatment with suramin or 2-APB (2-aminoethoxydiphenyl borate), indicating that a G-protein pathway is involved and that subsequent calcium release is mainly from intracellular stores. The present study describes how TMPRSS2 may contribute to prostate tumour metastasis via the activation of PAR-2.

  19. Lysosomal cysteine proteases: structure, function and inhibition of cathepsins.

    PubMed

    Roberts, Rebecca

    2005-12-01

    Lysosomal cysteine proteases, a subgroup of the cathepsin family, are critical for normal cellular functions such as general protein turnover, antigen processing and bone remodeling. In the past decade, the number of identified human cathepsins has more than doubled and their known role in several pathologies has expanded rapidly. Increased understanding of the structure and mechanism of this class of enzymes has brought on a new fervor in the design of small molecule inhibitors with the hope of producing specific, therapeutic drugs for diseases such as arthritis, allergy, multiple sclerosis, atherosclerosis, Alzheimer's disease and cancer.

  20. Structure of the Autocatalytic Cysteine Protease Domain of Potyvirus Helper-component Proteinase*

    PubMed Central

    Guo, Bihong; Lin, Jinzhong; Ye, Keqiong

    2011-01-01

    The helper-component proteinase (HC-Pro) of potyvirus is involved in polyprotein processing, aphid transmission, and suppression of antiviral RNA silencing. There is no high resolution structure reported for any part of HC-Pro, hindering mechanistic understanding of its multiple functions. We have determined the crystal structure of the cysteine protease domain of HC-Pro from turnip mosaic virus at 2.0 Å resolution. As a protease, HC-Pro only cleaves a Gly-Gly dipeptide at its own C terminus. The structure represents a postcleavage state in which the cleaved C terminus remains tightly bound at the active site cleft to prevent trans activity. The structure adopts a compact α/β-fold, which differs from papain-like cysteine proteases and shows weak similarity to nsP2 protease from Venezuelan equine encephalitis alphavirus. Nevertheless, the catalytic cysteine and histidine residues constitute an active site that is highly similar to these in papain-like and nsP2 proteases. HC-Pro recognizes a consensus sequence YXVGG around the cleavage site between the two glycine residues. The structure delineates the sequence specificity at sites P1–P4. Structural modeling and covariation analysis across the Potyviridae family suggest a tryptophan residue accounting for the glycine specificity at site P1′. Moreover, a surface of the protease domain is conserved in potyvirus but not in other genera of the Potyviridae family, likely due to extra functional constrain. The structure provides insight into the catalysis mechanism, cis-acting mode, cleavage site specificity, and other functions of the HC-Pro protease domain. PMID:21543324

  1. Propeptides of eukaryotic proteases encode histidines to exploit organelle pH for regulation.

    PubMed

    Elferich, Johannes; Williamson, Danielle M; Krishnamoorthy, Bala; Shinde, Ujwal

    2013-08-01

    Eukaryotic cells maintain strict control over protein secretion, in part by using the pH gradient maintained within their secretory pathway. How eukaryotic proteins evolved from prokaryotic orthologs to exploit the pH gradient for biological functions remains a fundamental question in cell biology. Our laboratory previously demonstrated that protein domains located within precursor proteins, propeptides, encode histidine-driven pH sensors to regulate organelle-specific activation of the eukaryotic proteases furin and proprotein convertase-1/3. Similar findings have been reported in other unrelated protease families. By analyzing >10,000 unique proteases within evolutionarily unrelated families, we show that eukaryotic propeptides are enriched in histidines compared with prokaryotic orthologs. On this basis, we hypothesize that eukaryotic proteins evolved to enrich histidines within their propeptides to exploit the tightly controlled pH gradient of the secretory pathway, thereby regulating activation within specific organelles. Enrichment of histidines in propeptides may therefore be used to predict the presence of pH sensors in other proteases or even protease substrates.

  2. Production, characterization, gene cloning, and nematocidal activity of the extracellular protease from Stenotrophomonas maltophilia N4.

    PubMed

    Jankiewicz, Urszula; Larkowska, Ewa; Swiontek Brzezinska, Maria

    2016-06-01

    A rhizosphere strain of the bacterium Stenotrophomonas maltophilia N4 secretes the serine protease PN4, whose molecular mass is approximately 42 kDa. The optimal temperature for the enzyme activity of the 11-fold purified protein was 50°C and the optimal pH was 10.5. The activity of the enzyme was strongly inhibited by specific serine protease inhibitors, which allowed for its classification as an alkaline serine protease family. Ca(2+) ions stimulated the activity of the protease PN4, while Mg(2+) ions stabilized its activity, and Zn(2+) and Cd(2+) ions strongly inhibited its activity. The enzyme has broad substrate specificity. For example, it is able to hydrolyse casein, keratin, albumin, haemoglobin, and gelatin, as well as the insoluble modified substrates azure keratin and azocoll. The gene that encodes the 1740 bp precursor form of the enzyme (accession number: LC031815) was cloned. We then deduced that its amino acid sequence includes the region of the conserved domain of the S8 family of peptidases as well as the catalytic triad Asp/His/Ser. The bacterial culture fluid as well as the purified protease PN4 demonstrated biocidal activity with regard to the nematodes Caenorhabditis elegans and Panagrellus spp. Copyright © 2016 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

  3. Vibrio cholerae hemagglutinin(HA)/protease: an extracellular metalloprotease with multiple pathogenic activities

    PubMed Central

    Benitez, Jorge A.; Silva, Anisia J.

    2016-01-01

    Vibrio cholerae of serogroup O1 and O139, the etiological agent of the diarrheal disease cholera, expresses the extracellular Zn-dependent metalloprotease hemagglutinin (HA)/protease also reported as vibriolysin. This enzyme is also produced by non-O1/O139 (non-cholera) strains that cause mild, sporadic illness (i.e. gastroenteritis, wound or ear infections). Orthologs of HA/protease are present in other members of the Vibrionaceae family pathogenic to humans and fish. HA/protease belongs to the M4 neutral peptidase family and displays significant amino acid sequence homology to Pseudomonas aeruginosa elastase (LasB) and Bacillus thermoproteolyticus thermolysin. It exhibits a broad range of potentially pathogenic activities in cell culture and animal models. These activities range from the covalent modification of other toxins, the degradation of the protective mucus barrier and disruption of intestinal tight junctions. Here we review (i) the structure and regulation of HA/protease expression, (ii) its interaction with other toxins and the intestinal mucosa and (iii) discuss the possible role(s) of HA/protease in the pathogenesis of cholera. PMID:26952544

  4. Genome-wide identification, evolutuionary and expression analysis of aspartic proteases gene superfamily in grape

    USDA-ARS?s Scientific Manuscript database

    Aspartic proteases (APs) are a large family of proteolytic enzymes in vertebrates, plants, yeast, nematodes, parasites, fungi, and viruses. In plants, they are involved in many biological processes, such as plant senescence, stress response, programmed cell death, and reproduction. Prior to the pr...

  5. Gene expression and activity of digestive proteases in Daphnia: effects of cyanobacterial protease inhibitors

    PubMed Central

    2010-01-01

    Background The frequency of cyanobacterial blooms has increased worldwide, and these blooms have been claimed to be a major factor leading to the decline of the most important freshwater herbivores, i.e. representatives of the genus Daphnia. This suppression of Daphnia is partly attributed to the presence of biologically active secondary metabolites in cyanobacteria. Among these metabolites, protease inhibitors are found in almost every natural cyanobacterial bloom and have been shown to specifically inhibit Daphnia's digestive proteases in vitro, but to date no physiological responses of these serine proteases to cyanobacterial protease inhibitors in Daphnia have been reported in situ at the protein and genetic levels. Results Nine digestive proteases were detected in D. magna using activity-stained SDS-PAGE. Subsequent analyses by LC-MS/MS and database search led to the identification of respective protease genes. D. magna responded to dietary protease inhibitors by up-regulation of the expression of these respective proteases at the RNA-level and by the induction of new and less sensitive protease isoforms at the protein level. The up-regulation in response to dietary trypsin- and chymotrypsin-inhibitors ranged from 1.4-fold to 25.6-fold. These physiological responses of Daphnia, i.e. up-regulation of protease expression and the induction of isoforms, took place even after feeding on 20% cyanobacterial food for only 24 h. These physiological responses proved to be independent from microcystin effects. Conclusion Here for the first time it was shown in situ that a D. magna clone responds physiologically to dietary cyanobacterial protease inhibitors by phenotypic plasticity of the targets of these specific inhibitors, i.e. Daphnia gut proteases. These regulatory responses are adaptive for D. magna, as they increase the capacity for protein digestion in the presence of dietary protease inhibitors. The type and extent of these responses in protease expression might

  6. Protease and protease-activated receptor-2 signaling in the pathogenesis of atopic dermatitis.

    PubMed

    Lee, Sang Eun; Jeong, Se Kyoo; Lee, Seung Hun

    2010-11-01

    Proteases in the skin are essential to epidermal permeability barrier homeostasis. In addition to their direct proteolytic effects, certain proteases signal to cells by activating protease-activated receptors (PARs), the G-protein-coupled receptors. The expression of functional PAR-2 on human skin and its role in inflammation, pruritus, and skin barrier homeostasis have been demonstrated. Atopic dermatitis (AD) is a multifactorial inflammatory skin disease characterized by genetic barrier defects and allergic inflammation, which is sustained by gene-environmental interactions. Recent studies have revealed aberrant expression and activation of serine proteases and PAR-2 in the lesional skin of AD patients. The imbalance between proteases and protease inhibitors associated with genetic defects in the protease/protease inhibitor encoding genes, increase in skin surface pH, and exposure to proteolytically active allergens contribute to this aberrant protease/ PAR-2 signaling in AD. The increased protease activity in AD leads to abnormal desquamation, degradation of lipid-processing enzymes and antimicrobial peptides, and activation of primary cytokines, thereby leading to permeability barrier dysfunction, inflammation, and defects in the antimicrobial barrier. Moreover, up-regulated proteases stimulate PAR-2 in lesional skin of AD and lead to the production of cytokines and chemokines involved in inflammation and immune responses, itching sensation, and sustained epidermal barrier perturbation with easier allergen penetration. In addition, PAR-2 is an important sensor for exogenous danger molecules, such as exogenous proteases from various allergens, and plays an important role in AD pathogenesis. Together, these findings suggest that protease activity or PAR-2 may be a future target for therapeutic intervention for the treatment of AD.

  7. Protease and Protease-Activated Receptor-2 Signaling in the Pathogenesis of Atopic Dermatitis

    PubMed Central

    Lee, Sang Eun; Jeong, Se Kyoo

    2010-01-01

    Proteases in the skin are essential to epidermal permeability barrier homeostasis. In addition to their direct proteolytic effects, certain proteases signal to cells by activating protease-activated receptors (PARs), the G-protein-coupled receptors. The expression of functional PAR-2 on human skin and its role in inflammation, pruritus, and skin barrier homeostasis have been demonstrated. Atopic dermatitis (AD) is a multifactorial inflammatory skin disease characterized by genetic barrier defects and allergic inflammation, which is sustained by gene-environmental interactions. Recent studies have revealed aberrant expression and activation of serine proteases and PAR-2 in the lesional skin of AD patients. The imbalance between proteases and protease inhibitors associated with genetic defects in the protease/protease inhibitor encoding genes, increase in skin surface pH, and exposure to proteolytically active allergens contribute to this aberrant protease/PAR-2 signaling in AD. The increased protease activity in AD leads to abnormal desquamation, degradation of lipid-processing enzymes and antimicrobial peptides, and activation of primary cytokines, thereby leading to permeability barrier dysfunction, inflammation, and defects in the antimicrobial barrier. Moreover, up-regulated proteases stimulate PAR-2 in lesional skin of AD and lead to the production of cytokines and chemokines involved in inflammation and immune responses, itching sensation, and sustained epidermal barrier perturbation with easier allergen penetration. In addition, PAR-2 is an important sensor for exogenous danger molecules, such as exogenous proteases from various allergens, and plays an important role in AD pathogenesis. Together, these findings suggest that protease activity or PAR-2 may be a future target for therapeutic intervention for the treatment of AD. PMID:20879045

  8. Regulation of protease production in Clostridium sporogenes.

    PubMed Central

    Allison, C; Macfarlane, G T

    1990-01-01

    The physiological and nutritional factors that regulate protease synthesis in Clostridium sporogenes C25 were studied in batch and continuous cultures. Formation of extracellular proteases occurred at the end of active growth and during the stationary phase in batch cultures. Protease production was inversely related to growth rate in glucose-excess and glucose-limited chemostats over the range D = 0.05 to 0.70 h-1. In pulse experiments, glucose, ammonia, phosphate, and some amino acids (tryptophan, proline, tyrosine, and isoleucine) strongly repressed protease synthesis. This repression was not relieved by addition of 4 mM cyclic AMP, cyclic GMP, or dibutyryl cyclic AMP. Protease formation was markedly inhibited by 4 mM ATP and ADP, but GTP and GDP had little effect on the process. It is concluded that protease production by C. sporogenes is strongly influenced by the amount of energy available to the cells, with the highest levels of protease synthesis occurring under energy-limiting conditions. PMID:2268158

  9. A biotechnology perspective of fungal proteases

    PubMed Central

    de Souza, Paula Monteiro; Bittencourt, Mona Lisa de Assis; Caprara, Carolina Canielles; de Freitas, Marcela; de Almeida, Renata Paula Coppini; Silveira, Dâmaris; Fonseca, Yris Maria; Ferreira, Edivaldo Ximenes; Pessoa, Adalberto; Magalhães, Pérola Oliveira

    2015-01-01

    Proteases hydrolyze the peptide bonds of proteins into peptides and amino acids, being found in all living organisms, and are essential for cell growth and differentiation. Proteolytic enzymes have potential application in a wide number of industrial processes such as food, laundry detergent and pharmaceutical. Proteases from microbial sources have dominated applications in industrial sectors. Fungal proteases are used for hydrolyzing protein and other components of soy beans and wheat in soy sauce production. Proteases can be produced in large quantities in a short time by established methods of fermentation. The parameters such as variation in C/N ratio, presence of some sugars, besides several other physical factors are important in the development of fermentation process. Proteases of fungal origin can be produced cost effectively, have an advantage faster production, the ease with which the enzymes can be modified and mycelium can be easily removed by filtration. The production of proteases has been carried out using submerged fermentation, but conditions in solid state fermentation lead to several potential advantages for the production of fungal enzymes. This review focuses on the production of fungal proteases, their distribution, structural-functional aspects, physical and chemical parameters, and the use of these enzymes in industrial applications. PMID:26273247

  10. Cysteine Proteases from Bloodfeeding Arthropod Ectoparasites

    PubMed Central

    Sojka, Daniel; Francischetti, Ivo M. B.; Calvo, Eric; Kotsyfakis, Michalis

    2012-01-01

    Cysteine proteases have been discovered in various bloodfeeding ectoparasites. Here, we assemble the available information about the function of these peptidases and reveal their role in hematophagy and parasite development. While most of the data shed light on key proteolytic events that play a role in arthropod physiology, we also report on the association of cysteine proteases with arthropod vectorial capacity. With emphasis on ticks, specifically Ixodes ricinus, we finally propose a model about the contribution of cysteine peptidases to blood digestion, and how their concerted action with other tick midgut proteases leads to the absorbance of nutrients by the midgut epithelial cells. PMID:21660665

  11. HIV-1 Protease: Structure, Dynamics and Inhibition

    SciTech Connect

    Louis, John M.; Ishima, R.; Torchia, D.A.; Weber, Irene T.

    2008-06-03

    The HIV-1 protease is synthesized as part of a large Gag-Pol precursor protein. It is responsible for its own release from the precursor and the processing of the Gag and Gag-Pol polyproteins into the mature structural and functional proteins required for virus maturation. Because of its indispensable role, the mature HIV-1 protease dimer has proven to be a successful target for the development of antiviral agents. In the last 5 years, a major emphasis in protease research has been to improve inhibitor design and treatment regimens.

  12. Protease and protease inhibitory activity in pregnant and postpartum involuting uterus

    SciTech Connect

    Milwidsky, A.; Beller, U.; Palti, Z.; Mayer, M.

    1982-08-15

    The presence of two distinct proteolytic activities in the rat uterus was confirmed with /sup 14/C-labeled globin used as a sensitive protein substrate and following release of label into the trichloroacetic acid-soluble supernatant fraction. Protease I is a cytoplasmic acid protease while protease II is associated with the pellet fraction, can be extracted by 0.6 M sodium chloride, and is active at pH 7.0. Protease I activity is low during pregnancy and markedly increases at term achieving maximal activity at day 3 post partum with a subsequent decline to preterm activity values. Lactation did not affect the uterine protease I activity. Protease II activity is not significantly different during pregnancy, at term, and post partum. The presence of an inhibitor of protease I was suggested by a decrease in enzyme activity with an increased cytosolic protein concentration. The inhibitor also lessened bovine trypsin activity but had no effect on protease II. Although its inhibitory potency on trypsin fluctuated during the various uterine physiologic stages, these changes appeared to be statistically insignificant. Human uterine samples were also found to contain the two protease activities with similar changes in protease I post partum. It is suggested that, both in the rat and in man, uterine involution post partum is associated with a marked increase in activity of acid cytosolic protease, while a particulate neutral protease and a soluble inhibitor of trypsin, which are also present in uterine cells, do not appear to play a significant role in the dissolution of uterine tissues after parturition.

  13. An Alkaline Protease from Bacillus pumilus MP 27: Functional Analysis of Its Binding Model toward Its Applications As Detergent Additive

    PubMed Central

    Baweja, Mehak; Tiwari, Rameshwar; Singh, Puneet K.; Nain, Lata; Shukla, Pratyoosh

    2016-01-01

    A proteolytic strain of Bacillus pumilus MP 27 was isolated from water samples of Southern ocean produced alkaline protease. Since protease production need expensive ingredients, an economically viable process was developed by using low cost carbon source, wheat straw, supplemented with peptone. This protease was active within temperature ranges 10–70°C at pH 9. This process was optimized by response surface methodology using a Box Bekhman design by Design Expert 7.0 software that increased the protease activity to 776.5 U/ml. Moreover, the enzyme was extremely stable at a broad range of temperature and pH retaining 69% of its activity at 50°C and 70% at pH 11. The enzyme exhibited excellent compatibility with surfactants and commercial detergents, showing 87% stability with triton X-100 and 100% stability with Tide commercial detergent. The results of the wash performance analysis demonstrated considerably good de-staining at 50 and 4°C with low supplementation (109 U/ml). Molecular modeling of the protease revealed the presence of serine proteases, subtilase family and serine active site and further docking supported the association of catalytic site with the various substrates. Certainly, such protease can be considered as a good detergent additive in detergent industry with a possibility to remove the stains effectively even in a cold wash. PMID:27536284

  14. Isolation and characterization of two serine proteases from metagenomic libraries of the Gobi and Death Valley deserts.

    PubMed

    Neveu, Julie; Regeard, Christophe; DuBow, Michael S

    2011-08-01

    The screening of environmental DNA metagenome libraries for functional activities can provide an important source of new molecules and enzymes. In this study, we identified 17 potential protease-producing clones from two metagenomic libraries derived from samples of surface sand from the Gobi and Death Valley deserts. Two of the proteases, DV1 and M30, were purified and biochemically examined. These two proteases displayed a molecular mass of 41.5 kDa and 45.7 kDa, respectively, on SDS polyacrylamide gels. Alignments with known protease sequences showed less than 55% amino acid sequence identity. These two serine proteases appear to belong to the subtilisin (S8A) family and displayed several unique biochemical properties. Protease DV1 had an optimum pH of 8 and an optimal activity at 55°C, while protease M30 had an optimum pH >11 and optimal activity at 40°C. The properties of these enzymes make them potentially useful for biotechnological applications and again demonstrate that metagenomic approaches can be useful, especially when coupled with the study of novel environments such as deserts.

  15. Role of cockroach proteases in allergic disease.

    PubMed

    Page, Kristen

    2012-10-01

    Allergic asthma is on the rise in developed countries, and cockroach exposure is a major risk factor for the development of asthma. In recent years, a number of studies have investigated the importance of allergen-associated proteases in modulating allergic airway inflammation. Many of the studies have suggested the importance of allergen-associated proteases as having a direct role on airway epithelial cells and dendritic cells. In most cases, activation of the protease activated receptor (PAR)-2 has been implicated as a mechanism behind the potent allergenicity associated with cockroaches. In this review, we focus on recent evidence linking cockroach proteases to activation of a variety of cells important in allergic airway inflammation and the role of PAR-2 in this process. We will highlight recent data exploring the potential mechanisms involved in the biological effects of the allergen.

  16. Regulatory Characteristics of Bacillus pumilus Protease Promoters.

    PubMed

    Toymentseva, Anna A; Mascher, Thorsten; Sharipova, Margarita R

    2017-05-01

    Expression of extracellular protease genes of Bacilli is subject to regulation by many positive and negative regulators. Here we analyzed 5' regulatory regions of genes encoding proteolytic proteases AprBp, GseBp, and MprBp from Bacillus pumilus strain 3-19. Gfp fusion constructs with upstream genomic regions of different lengths were created for all three genes to identify their natural promoters (regulatory regions). Our results suggest that the aprBp gene, encoding the major subtilisin-like protease, has the most extensive promoter region of approximately 445 bp, while the minor protease genes encoding glutamyl endopeptidase (gseBp) and metalloproteinase (mprBp) are preceded by promoters of 150 and 250 bp in length, respectively. Promoter analysis of P aprBp -gfpmu3 and P gseBp -gfpmu3 reporter fusion constructs in degU and spo0A mutants indicates a positive regulatory effect of DegU and Spo0A on protease expression, while the disruption of abrB, sinR, and scoC repressor genes did not significantly affect promoter activities of all protease genes. On the other hand, the expression of P aprBp -gfpmu3 and P gseBp -gfpmu3 reporters increased 1.6- and 3.0-fold, respectively, in sigD-deficient cells, indicating that the prevention of motility gene expression promotes protease expression. Our results indicate that all examined regulators regulated serine proteases production in B. subtilis.

  17. Protease Mediated Anti-Cancer Therapy

    DTIC Science & Technology

    2006-08-01

    anticancer therapy and focal light illumination is expected to be an effective treatment with reduced phototoxicity given the quenched state of the...to months following photodynamic therapy (PDT). Herein, we report a novel design of protease-mediated photosensitization by which phototoxicity can...W81XWH-05-1-0515 TITLE: Protease Mediated Anti-Cancer Therapy PRINCIPAL INVESTIGATOR: Ching-Hsuan Tung CONTRACTING ORGANIZATION

  18. Structural and Functional Characterization of Cleavage and Inactivation of Human Serine Protease Inhibitors by the Bacterial SPATE Protease EspPα from Enterohemorrhagic E. coli

    PubMed Central

    Weiss, André; Joerss, Hanna; Brockmeyer, Jens

    2014-01-01

    EspPα and EspI are serine protease autotransporters found in enterohemorrhagic Escherichia coli. They both belong to the SPATE autotransporter family and are believed to contribute to pathogenicity via proteolytic cleavage and inactivation of different key host proteins during infection. Here, we describe the specific cleavage and functional inactivation of serine protease inhibitors (serpins) by EspPα and compare this activity with the related SPATE EspI. Serpins are structurally related proteins that regulate vital protease cascades, such as blood coagulation and inflammatory host response. For the rapid determination of serpin cleavage sites, we applied direct MALDI-TOF-MS or ESI-FTMS analysis of coincubations of serpins and SPATE proteases and confirmed observed cleavage positions using in-gel-digest of SDS-PAGE-separated degradation products. Activities of both serpin and SPATE protease were assessed in a newly developed photometrical assay using chromogenic peptide substrates. EspPα cleaved the serpins α1-protease inhibitor (α1-PI), α1-antichymotrypsin, angiotensinogen, and α2-antiplasmin. Serpin cleavage led to loss of inhibitory function as demonstrated for α1-PI while EspPα activity was not affected. Notably, EspPα showed pronounced specificity and cleaved procoagulatory serpins such as α2-antiplasmin while the anticoagulatory antithrombin III was not affected. Together with recently published research, this underlines the interference of EspPα with hemostasis or inflammatory responses during infection, while the observed interaction of EspI with serpins is likely to be not physiologically relevant. EspPα-mediated serpin cleavage occurred always in flexible loops, indicating that this structural motif might be required for substrate recognition. PMID:25347319

  19. A cysteine protease isolated from the latex of Ficus microcarpa: purification and biochemical characterization.

    PubMed

    Mnif, Ibtissem Hamza; Siala, Rayda; Nasri, Rim; Mhamdi, Samiha; Nasri, Moncef; Kamoun, Alya Sellami

    2015-02-01

    A plant protease named microcarpain was purified from the latex of Ficus microcarpa by acetonic (20-40 % saturation) precipitation, Sephadex G-75 filtration, and Mono Q-Sefinose FF chromatography. The protease was purified with a yield of 9.25 % and a purification factor of 8. The molecular weight of the microcarpain was estimated to be 20 kDa by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE). The purified enzyme showed maximum activity at pH 8.0 and at a temperature of 70 °C. Proteolytic activity was strongly inhibited by dithio-bis-nitrobenzoic acid (DTNB), Hg(2+), and Cu(2+). The N-terminal amino acid sequence of the purified microcarpain "VPETVDWRSKGAV" showed high homology with a protease from Arabidopsis thaliana. Inhibition studies and N-terminal sequence classified the enzyme as a member of the cysteine peptidases family.

  20. Immune evasion by pathogenic Leptospira strains: the secretion of proteases that directly cleave complement proteins.

    PubMed

    Fraga, Tatiana Rodrigues; Courrol, Daniella Dos Santos; Castiblanco-Valencia, Mónica Marcela; Hirata, Izaura Yoshico; Vasconcellos, Sílvio Arruda; Juliano, Luiz; Barbosa, Angela Silva; Isaac, Lourdes

    2014-03-01

    Leptospirosis is an infectious disease of public health importance. To successfully colonize the host, pathogens have evolved multiple strategies to escape the complement system. Here we demonstrate that the culture supernatant of pathogenic but not saprophytic Leptospira inhibit the three complement pathways. We showed that the proteolytic activity in the supernatants of pathogenic strains targets the central complement molecule C3 and specific proteins from each pathway, such as factor B, C2, and C4b. The proteases cleaved α and β chains of C3 and work in synergy with host regulators to inactivate C3b. Proteolytic activity was inhibited by 1,10-phenanthroline, suggesting the participation of metalloproteases. A recombinant leptospiral metalloprotease from the thermolysin family cleaved C3 in serum and could be one of the proteases responsible for the supernatant activity. We conclude that pathogenic leptospiral proteases can deactivate immune effector molecules and represent potential targets to the development of new therapies in leptospirosis.

  1. The function of the DegP (HtrA) protein: Protease versus chaperone.

    PubMed

    Chang, Zengyi

    2016-11-01

    The DegP (or HtrA) is a highly conserved family of proteins functioning in all living organisms. It was initially identified as a protease functioning in the periplasmic space of the Gram-negative bacterial cells. It was later reported to also exhibit chaperone activity and thus has been designated as a bifunctional protein. However, recent studies demonstrated that in living cells it more likely functions only as a protease with hardly detectable chaperone activities. In this review, I will summarize the evidences clarifying that DegP more likely only functions as a protease rather than as a chaperone in cells. © 2016 IUBMB Life, 68(11):904-907, 2016. © 2016 International Union of Biochemistry and Molecular Biology.

  2. Acid protease production in fungal root endophytes.

    PubMed

    Mayerhofer, Michael S; Fraser, Erica; Kernaghan, Gavin

    2015-01-01

    Fungal endophytes are ubiquitous in healthy root tissue, but little is known about their ecosystem functions, including their ability to utilize organic nutrient sources such as proteins. Root-associated fungi may secrete proteases to access the carbon and mineral nutrients within proteins in the soil or in the cells of their plant host. We compared the protein utilization patterns of multiple isolates of the root endophytes Phialocephala fortinii s.l., Meliniomyces variabilis and Umbelopsis isabellina with those of two ectomycorrhizal (ECM) fungi, Hebeloma incarnatulum and Laccaria bicolor, and the wood-decay fungus Irpex lacteus at pH values of 2-9 on liquid BSA media. We also assessed protease activity using a fluorescently labeled casein assay and gelatin zymography and characterized proteases using specific protease inhibitors. I. lacteus and U. isabellina utilized protein efficiently, while the ECM fungi exhibited poor protein utilization. ECM fungi secreted metallo-proteases and had pH optima above 4, while other fungi produced aspartic proteases with lower pH optima. The ascomycetous root endophytes M. variabilis and P. fortinii exhibited intermediate levels of protein utilization and M. variabilis exhibited a very low pH optimum. Comparing proteolytic profiles between fungal root endophytes and fungi with well defined ecological roles provides insight into the ecology of these cryptic root associates.

  3. Cysteine protease antigens cleave CD123, the α subunit of murine IL-3 receptor, on basophils and suppress IL-3-mediated basophil expansion

    SciTech Connect

    Nishikado, Hideto; Fujimura, Tsutomu; Taka, Hikari; Mineki, Reiko; Ogawa, Hideoki; Okumura, Ko; Takai, Toshiro

    2015-05-01

    Th2 type immune responses are essential for protective immunity against parasites and play crucial roles in allergic disorders. Helminth parasites secrete a variety of proteases for their infectious cycles including for host entry, tissue migration, and suppression of host immune effector cell function. Furthermore, a number of pathogen-derived antigens, as well as allergens such as papain, belong to the family of cysteine proteases. Although the link between protease activity and Th2 type immunity is well documented, the mechanisms by which proteases regulate host immune responses are largely unknown. Here, we demonstrate that the cysteine proteases papain and bromelain selectively cleave the α subunit of the IL-3 receptor (IL-3Rα/CD123) on the surface of murine basophils. The decrease in CD123 expression on the cell surface, and the degradation of the extracellular domain of recombinant CD123 were dependent on the protease activity of papain and bromelain. Pre-treatment of murine basophils with papain resulted in inhibition of IL-3-IL-3R signaling and suppressed IL-3- but not thymic stromal lymphopoietin-induced expansion of basophils in vitro. Our unexpected findings illuminate a novel mechanism for the regulation of basophil functions by protease antigens. Because IL-3 plays pivotal roles in the activation and proliferation of basophils and in protective immunity against helminth parasites, pathogen-derived proteases might contribute to the pathogenesis of infections by regulating IL-3-mediated functions in basophils. - Highlights: • We identified the murine IL3R as a novel target of papain-family cysteine proteases. • Papain-family cysteine proteases cleaved IL3Rα/CD123 on murine basophils. • Papain suppressed IL3- but not TSLP-induced expansion of murine basophils. • The inactivation of IL3R might be a strategy for pathogens to suppress host immunity.

  4. How proteases regulate bone morphogenesis.

    PubMed

    Ortega, Nathalie; Behonick, Danielle; Stickens, Dominique; Werb, Zena

    2003-05-01

    Matrix metalloproteinases (MMPs) degrade most components of the extracellular matrix (ECM), as well as many non-ECM molecules. MMPs participate in (1). degradation of ECM to allow cell migration; (2). alteration of the ECM microenvironment resulting in alteration in cellular behavior; (3). modulation of biologically active molecules by direct cleavage or release from ECM stores; (4). regulation of the activity of other proteases; and (5). cell attachment, proliferation, differentiation, and apoptosis. We have sought to understand the role of MMPs during development and tissue repair in transgenic mice. Endochondral bone formation presents a particularly interesting developmental challenge. During this process, an avascular tissue (cartilage) is converted into one of the most highly vascularized tissues (bone) in the vertebrate body. Ossification begins with invasion of the calcified hypertrophic cartilage by capillaries. Apoptosis of the terminal hypertrophic chondrocytes, degradation of the cartilage matrix, and deposition of bone matrix by osteoblasts accompanies neovascularization of the growth plate. Remodeling of ECM results in a cavity filled with vascular channels containing hematopoietic cells. Our results reveal that MMP9, MMP13, and vascular endothelial growth factor are key regulators for the remodeling of the skeletal tissues. They coordinate not only matrix degradation, but also the recruitment and differentiation of endothelial cells, osteoclasts, chondroclasts, and osteoprogenitors.

  5. PCSK9: an enigmatic protease.

    PubMed

    Lopez, Dayami

    2008-04-01

    Proprotein convertase subtilisin/kexin type 9 (PCSK9) plays a critical role in cholesterol metabolism by controlling the levels of low density lipoprotein (LDL) particles that circulate in the bloodstream. Several gain-of-function and loss-of-function mutations in the PCSK9 gene, that occur naturally, have been identified and linked to hypercholesterolemia and hypocholesterolemia, respectively. PCSK9 expression has been shown to be regulated by sterol regulatory element binding proteins (SREBPs) and statins similar to other genes involved in cholesterol homeostasis. The most critical finding concerning PCSK9 is that this protease is able to influence the number of LDL receptor molecules expressed on the cell surface. Studies have demonstrated that PCSK9 acts mainly by enhancing degradation of LDL receptor protein in the liver. Inactivation of PCSK9 in mice reduces plasma cholesterol levels primarily by increasing hepatic expression of LDL receptor protein and thereby accelerating clearance of circulating LDL cholesterol. The objective of this review is to summarize the current information related to the regulation and function of PCSK9 and to identify gaps in our present knowledge.

  6. Carbohydrate protease conjugates: Stabilized proteases for peptide synthesis

    SciTech Connect

    Wartchow, C.A.; Wang, Peng; Bednarski, M.D.; Callstrom, M.R. |

    1995-12-31

    The synthesis of oligopeptides using stable carbohydrate protease conjugates (CPCs) was examined in acetonitrile solvent systems. CPC[{alpha}-chymotrypsin] was used for the preparation of peptides containing histidine, phenylalanine, tryptophan in the P{sub 1} position in 60-93% yield. The CPC[{alpha}-chymotrypsin]-catalyzed synthesis of octamer Z-Gly-Gly-Phe-Gly-Gly-Phe-Gly-Gly-OEt from Z-Gly-Gly-Phe-Gly-Gly-Phe-OMe was achieved in 71% yield demonstrating that synthesis peptides containing both hydrophylic and hydrophobic amino acids. The P{sub 2} specificity of papain for aromatic residues was utilized for the 2 + 3 coupling of Z-Tyr-Gly-OMe to H{sub 2}N-Gly-Phe-Leu-OH to generate the leucine enkephalin derivative in 79% yield. Although papain is nonspecific for the hydrolysis of N-benzyloxycarbonyl amino acid methyl esters in aqueous solution, the rates of synthesis for these derivitives with nucleophile leucine tert-butyl ester differed by nearly 2 orders of magnitude. CPC[thermolysin] was used to prepare the aspartame precursor Z-Asp-Phe-OMe in 90% yield. The increased stability of CPCs prepared from periodate-modified poly(2-methacryl- amido-2-deoxy-D-glucose), poly(2-methacrylamido-2-deoxy-D-galactose), and poly(5-methacryl-amido-5-deoxy-D-ribose), carbohydrate materials designed to increase the aldehyde concentration in aqueous solution, suggests that the stability of CPCs is directly related to the aldehyde concentration of the carbohydrate material. Periodate oxidation of poly(2-methacrylamido-2-deoxy-D-glucose) followed by covalent attachment to {alpha}-chymotrypsin gave a CPC with catalytic activity in potassium phosphate buffer at 90{degrees}C for 2 h. 1 fig., 1 tab., 40 refs.

  7. Molecular Cloning and Immunochemical Characterization of a New Japanese Cedar Pollen Allergen Homologous to Plant Subtilisin-Like Serine Protease

    PubMed Central

    2010-01-01

    Protease activities in allergen sources are thought to be involved in triggering allergic inflammation through the disruption of epithelial barrier or the induction of proinflammatory cytokines. Protease allergens may also work as type 2 helper T cell (TH2) adjuvants through the cleavage of cell surface receptors. Here, we report molecular cloning and immunochemical characterization of a new Japanese cedar (Cryptomeria japonica) pollen allergen (CPA9) homologous to serine protease, which is initially found as a high IgE-binding spot on our two-dimensional (2-D) IgE immunoblotting map. The cpa9 cDNA encoded a 757 amino acid polypeptide showing a significant sequence identity with plant subtilisin-like serine protease family members including melon major allergen Cuc m 1. We found that native CPA9 purified from C. japonica pollen showed a high IgE-binding frequency and IgE cross-reactivity with melon extract. PMID:23282945

  8. The serine protease domain of MASP-3: enzymatic properties and crystal structure in complex with ecotin.

    PubMed

    Gaboriaud, Christine; Gupta, Rajesh Kumar; Martin, Lydie; Lacroix, Monique; Serre, Laurence; Teillet, Florence; Arlaud, Gérard J; Rossi, Véronique; Thielens, Nicole M

    2013-01-01

    Mannan-binding lectin (MBL), ficolins and collectin-11 are known to associate with three homologous modular proteases, the MBL-Associated Serine Proteases (MASPs). The crystal structures of the catalytic domains of MASP-1 and MASP-2 have been solved, but the structure of the corresponding domain of MASP-3 remains unknown. A link between mutations in the MASP1/3 gene and the rare autosomal recessive 3MC (Mingarelli, Malpuech, Michels and Carnevale,) syndrome, characterized by various developmental disorders, was discovered recently, revealing an unexpected important role of MASP-3 in early developmental processes. To gain a first insight into the enzymatic and structural properties of MASP-3, a recombinant form of its serine protease (SP) domain was produced and characterized. The amidolytic activity of this domain on fluorescent peptidyl-aminomethylcoumarin substrates was shown to be considerably lower than that of other members of the C1r/C1s/MASP family. The E. coli protease inhibitor ecotin bound to the SP domains of MASP-3 and MASP-2, whereas no significant interaction was detected with MASP-1, C1r and C1s. A tetrameric complex comprising an ecotin dimer and two MASP-3 SP domains was isolated and its crystal structure was solved and refined to 3.2 Å. Analysis of the ecotin/MASP-3 interfaces allows a better understanding of the differential reactivity of the C1r/C1s/MASP protease family members towards ecotin, and comparison of the MASP-3 SP domain structure with those of other trypsin-like proteases yields novel hypotheses accounting for its zymogen-like properties in vitro.

  9. The Serine Protease Domain of MASP-3: Enzymatic Properties and Crystal Structure in Complex with Ecotin

    PubMed Central

    Gaboriaud, Christine; Gupta, Rajesh Kumar; Martin, Lydie; Lacroix, Monique; Serre, Laurence; Teillet, Florence; Arlaud, Gérard J.; Rossi, Véronique; Thielens, Nicole M.

    2013-01-01

    Mannan-binding lectin (MBL), ficolins and collectin-11 are known to associate with three homologous modular proteases, the MBL-Associated Serine Proteases (MASPs). The crystal structures of the catalytic domains of MASP-1 and MASP-2 have been solved, but the structure of the corresponding domain of MASP-3 remains unknown. A link between mutations in the MASP1/3 gene and the rare autosomal recessive 3MC (Mingarelli, Malpuech, Michels and Carnevale,) syndrome, characterized by various developmental disorders, was discovered recently, revealing an unexpected important role of MASP-3 in early developmental processes. To gain a first insight into the enzymatic and structural properties of MASP-3, a recombinant form of its serine protease (SP) domain was produced and characterized. The amidolytic activity of this domain on fluorescent peptidyl-aminomethylcoumarin substrates was shown to be considerably lower than that of other members of the C1r/C1s/MASP family. The E. coli protease inhibitor ecotin bound to the SP domains of MASP-3 and MASP-2, whereas no significant interaction was detected with MASP-1, C1r and C1s. A tetrameric complex comprising an ecotin dimer and two MASP-3 SP domains was isolated and its crystal structure was solved and refined to 3.2 Å. Analysis of the ecotin/MASP-3 interfaces allows a better understanding of the differential reactivity of the C1r/C1s/MASP protease family members towards ecotin, and comparison of the MASP-3 SP domain structure with those of other trypsin-like proteases yields novel hypotheses accounting for its zymogen-like properties in vitro. PMID:23861840

  10. Structure, Mechanism and Inhibition of γ-Secretase and Presenilin-Like Proteases

    PubMed Central

    Wolfe, Michael S.

    2010-01-01

    Presenilin is the catalytic component of γ-secretase, a complex aspartyl protease and a founding member of intramembrane-cleaving proteases. γ-Secretase is involved in the pathogenesis of Alzheimer’s disease and a top target for therapeutic intervention. However, the protease complex processes a variety of transmembrane substrates, including the Notch receptor, raising concerns about toxicity. Nevertheless, γ-secretase inhibitors and modulators have been identified that allow Notch processing and signalling to continue, and promising compounds are entering clinical trials. Molecular and biochemical studies offer a model for how this protease hydrolyzes transmembrane domains in the confines of the lipid bilayer. Progress has also been made toward structure elucidation of presenilin and the γ-secretase complex by electron microscopy as well as by studying cysteine-mutant presenilins. The signal peptide peptidase (SPP) family of proteases are distantly related to presenilins. However, the SPPs work as single polypeptides without the need for cofactors and otherwise appear to be simple model systems for presenilin in the γ-secretase complex. SPP biology, structure, and inhibition will also be discussed. PMID:20482315

  11. MALT1 Protease Activity Controls the Expression of Inflammatory Genes in Keratinocytes upon Zymosan Stimulation.

    PubMed

    Schmitt, Anja; Grondona, Paula; Maier, Tabea; Brändle, Marc; Schönfeld, Caroline; Jäger, Günter; Kosnopfel, Corinna; Eberle, Franziska C; Schittek, Birgit; Schulze-Osthoff, Klaus; Yazdi, Amir S; Hailfinger, Stephan

    2016-04-01

    The protease activity of the paracaspase mucosa-associated lymphoid tissue lymphoma translocation gene 1 (MALT1) plays an important role in antigen receptor-mediated lymphocyte activation by controlling the activity of the transcription factor nuclear factor-κB and is thus essential for the expression of inflammatory target genes. MALT1 is not only present in cells of the hematopoietic lineage, but is ubiquitously expressed. Here we report that stimulation with zymosan or Staphylococcus aureus induced MALT1 protease activity in human primary keratinocytes. Inhibition of the Src family of kinases or novel protein kinase C isoforms as well as silencing of CARMA2 or BCL10 interfered with activation of MALT1 protease. Silencing or inhibition of MALT1 protease strongly decreased the expression of important inflammatory genes such as TNFα, IL-17C, CXCL8 and HBD-2. MALT1-inhibited cells were unable to mount an antimicrobial response upon zymosan stimulation or phorbolester/ionomycin treatment, demonstrating a central role of MALT1 protease activity in keratinocyte immunity and suggesting MALT1 as a potential target in inflammatory skin diseases.

  12. Structural Evidence for Regulation and Specificity of Flaviviral Proteases and Evolution of the Flaviviridae Fold

    SciTech Connect

    Aleshin,A.; Shiryaev, S.; Strongin, A.; Liddington, R.

    2007-01-01

    Pathogenic members of the flavivirus family, including West Nile Virus (WNV) and Dengue Virus (DV), are growing global threats for which there are no specific treatments. The two-component flaviviral enzyme NS2B-NS3 cleaves the viral polyprotein precursor within the host cell, a process that is required for viral replication. Here, we report the crystal structure of WNV NS2B-NS3pro both in a substrate-free form and in complex with the trypsin inhibitor aprotinin/BPTI. We show that aprotinin binds in a substrate-mimetic fashion in which the productive conformation of the protease is fully formed, providing evidence for an 'induced fit' mechanism of catalysis and allowing us to rationalize the distinct substrate specificities of WNV and DV proteases. We also show that the NS2B cofactor of WNV can adopt two very distinct conformations and that this is likely to be a general feature of flaviviral proteases, providing further opportunities for regulation. Finally, by comparing the flaviviral proteases with the more distantly related Hepatitis C virus, we provide insights into the evolution of the Flaviviridae fold. Our work should expedite the design of protease inhibitors to treat a range of flaviviral infections.

  13. Biochemical characterization of a detergent-stable serine alkaline protease from Caldicoprobacter guelmensis.

    PubMed

    Bouacem, Khelifa; Bouanane-Darenfed, Amel; Laribi-Habchi, Hassiba; Elhoul, Mouna Ben; Hmida-Sayari, Aïda; Hacene, Hocine; Ollivier, Bernard; Fardeau, Marie-Laure; Jaouadi, Bassem; Bejar, Samir

    2015-11-01

    Caldicoprobacter guelmensis isolated from the hydrothermal hot spring of Guelma (Algeria) produced high amounts of extracellular thermostable serine alkaline protease (called SAPCG) (23,000U/mL). The latter was purified by ammonium sulphate precipitation, UNO Q-6 FPLC and Zorbex PSM 300 HPLC, and submitted to biochemical characterization assays. Matrix assisted laser desorption ionization-time of flight mass spectrometry (MALDI-TOF/MS) analysis revealed that the purified enzyme was a monomer, with a molecular mass of 55,824.19Da. The 19 N-terminal residue sequence of SAPCG showed high homology with those of microbial proteases. The enzyme was completely inhibited by phenylmethanesulfonyl fluoride (PMSF) and diiodopropyl fluorophosphates (DFP), which suggested its belonging to the serine protease family. It showed optimum protease activity at pH 10 and 70°C with casein as a substrate. The thermoactivity and thermostability of SAPCG were enhanced in the presence of 2mM Ca(2+). Its half-life times at 80 and 90°C were 180 and 60min, respectively. Interestingly, the SAPCG protease exhibited significant compatibility with iSiS and Persil, and wash performance analysis revealed that it could remove blood-stains effectively. Overall, SAPCG displayed a number of attractive properties that make it a promising candidate for future applications as an additive in detergent formulations.

  14. Activation of Bacteroides fragilis toxin by a novel bacterial protease contributes to anaerobic sepsis

    PubMed Central

    Choi, Vivian M.; Herrou, Julien; Hecht, Aaron L.; Teoh, Wei Ping; Turner, Jerrold R.; Crosson, Sean; Wardenburg, Juliane Bubeck

    2016-01-01

    Bacteroides fragilis is the leading cause of anaerobic bacteremia and sepsis 1. Enterotoxigenic strains producing B. fragilis toxin (BFT, fragilysin) contribute to colitis 2 and intestinal malignancy 3, yet are also isolated in bloodstream infection 4,5. It is not known whether these strains harbor unique genetic determinants that confer virulence in extra-intestinal disease. We demonstrate that BFT contributes to sepsis and identify a B. fragilis protease, fragipain (Fpn), which is required for endogenous activation of BFT through removal of its auto-inhibitory prodomain. Structural analysis of Fpn reveals a His-Cys catalytic dyad characteristic of C11 family cysteine proteases that are conserved in multiple pathogenic Bacteroides spp and Clostridium spp. Fpn-deficient enterotoxigenic B. fragilis is attenuated in its ability to induce sepsis, however Fpn is dispensable in B. fragilis colitis wherein host proteases mediate BFT activation. Our findings define a role for B. fragilis enterotoxin and its activating protease in the pathogenesis of bloodstream infection, indicating a greater complexity of cellular targeting and action of BFT than previously appreciated. The expression of fpn by both toxigenic and non-toxigenic strains suggests this protease may contribute to anaerobic sepsis beyond its role in toxin activation, potentially serving as a target for disease modification. PMID:27089515

  15. Comprehensive Analysis of a Vibrio parahaemolyticus Strain Extracellular Serine Protease VpSP37

    PubMed Central

    Bennici, Carmelo; Quatrini, Paola; Catania, Valentina; Mazzola, Salvatore; Ghersi, Giulio; Cuttitta, Angela

    2015-01-01

    Proteases play an important role in the field of tissue dissociation combined with regenerative medicine. During the years new sources of proteolytic enzymes have been studied including proteases from different marine organisms both eukaryotic and prokaryotic. Herein we have purified a secreted component of an isolate of Vibrio parahaemolyticus, with electrophoretic mobilities corresponding to 36 kDa, belonging to the serine proteases family. Sequencing of the N-terminus enabled the in silico identification of the whole primary structure consisting of 345 amino acid residues with a calculated molecular mass of 37.4 KDa. The purified enzyme, named VpSP37, contains a Serine protease domain between residues 35 and 276 and a canonical Trypsin/Chimotrypsin 3D structure. Functional assays were performed to evaluate protease activity of purified enzyme. Additionally the performance of VpSP37 was evaluated in tissue dissociations experiments and the use of such enzyme as a component of enzyme blend for tissue dissociation procedures is strongly recommended. PMID:26162075

  16. Protease Inhibitors Targeting Coronavirus and Filovirus Entry

    PubMed Central

    Zhou, Yanchen; Vedantham, Punitha; Lu, Kai; Agudelo, Juliet; Carrion, Ricardo; Nunneley, Jerritt W.; Barnard, Dale; Pöhlmann, Stefan; McKerrow, James H.; Renslo, Adam R.; Simmons, Graham

    2016-01-01

    In order to gain entry into cells, diverse viruses, including Ebola virus, SARS-coronavirus and the emerging MERS-coronavirus, depend on activation of their envelope glycoproteins by host cell proteases. The respective enzymes are thus excellent targets for antiviral intervention. In cell culture, activation of Ebola virus, as well as SARS- and MERS-coronavirus can be accomplished by the endosomal cysteine proteases, cathepsin L (CTSL) and cathepsin B (CTSB). In addition, SARS- and MERS-coronavirus can use serine proteases localized at the cell surface, for their activation. However, it is currently unclear which protease(s) facilitate viral spread in the infected host. We report here that the cysteine protease inhibitor K11777, ((2S)-N-[(1E,3S)-1-(benzenesulfonyl)-5-phenylpent-1-en-3-yl]-2-{[(E)-4-methylpiperazine-1-carbonyl]amino}-3-phenylpropanamide) and closely-related vinylsulfones act as broad-spectrum antivirals by targeting cathepsin-mediated cell entry. K11777 is already in advanced stages of development for a number of parasitic diseases, such as Chagas disease, and has proven to be safe and effective in a range of animal models. K11777 inhibition of SARS-CoV and Ebola virus entry was observed in the sub-nanomolar range. In order to assess, whether cysteine or serine proteases promote viral spread in the host, we compared the antiviral activity of an optimized K11777-derivative with that of camostat, an inhibitor of TMPRSS2 and related serine proteases. Employing a pathogenic animal model of SARS-CoV infection, we demonstrated that viral spread and pathogenesis of SARS-CoV is driven by serine rather than cysteine proteases and can be effectively prevented by camostat. Camostat has been clinically used to treat chronic pancreatitis, and thus represents an exciting potential therapeutic for respiratory coronavirus infections. Our results indicate that camostat, or similar serine protease inhibitors, might be an effective option for treatment of SARS and

  17. The serpin MNEI inhibits elastase-like and chymotrypsin-like serine proteases through efficient reactions at two active sites.

    PubMed

    Cooley, J; Takayama, T K; Shapiro, S D; Schechter, N M; Remold-O'Donnell, E

    2001-12-25

    MNEI (monocyte/neutrophil elastase inhibitor) is a 42 kDa serpin superfamily protein characterized initially as a fast-acting inhibitor of neutrophil elastase. Here we show that MNEI has a broader specificity, efficiently inhibiting proteases with elastase- and chymotrypsin-like specificities. Reaction of MNEI with neutrophil proteinase-3, an elastase-like protease, and porcine pancreatic elastase demonstrated rapid inhibition rate constants >10(7) M(-1) s(-1), similar to that observed for neutrophil elastase. Reactions of MNEI with chymotrypsin-like proteases were also rapid: cathepsin G from neutrophils (>10(6) M(-1) s(-1)), mast cell chymase (>10(5) M(-1) s(-1)), chymotrypsin (>10(6) M(-1) s(-1)), and prostate-specific antigen (PSA), which had the slowest rate constant at approximately 10(4) M(-1) s(-1). Inhibition of trypsin-like (plasmin, granzyme A, and thrombin) and caspase-like (granzyme B) serine proteases was not observed or highly inefficient (trypsin), nor was inhibition of proteases from the cysteine (caspase-1 and caspase-3) and metalloprotease (macrophage elastase, MMP-12) families. The stoichiometry of inhibition for all inhibitory reactions was near 1, and inhibitory complexes were resistant to dissociation by SDS, further indicating the specificity of MNEI for elastase- and chymotrypsin-like proteases. Determination of the reactive site of MNEI by N-terminal sequencing and mass analysis of reaction products identified two reactive sites, each with a different specificity. Cys(344), which corresponds to Met(358), the P(1) site of alpha1-antitrypsin, was the inhibitory site for elastase-like proteases and PSA, while the preceding residue, Phe(343), was the inhibitory site for chymotrypsin-like proteases. This study demonstrates that MNEI has two functional reactive sites corresponding to the predicted P(1) and P(2) positions of the reactive center loop. The data suggest that MNEI plays a regulatory role at extravascular sites to limit inflammatory

  18. Evaluation of proteases and protease inhibitors in Heterodera glycines cysts obtained from laboratory and field populations

    USDA-ARS?s Scientific Manuscript database

    Proteases and proteases inhibitors were evaluated in a number of preparations of Heterodera glycines cysts obtained from glasshouse cultures (GH) and field (LR) populations. Using a FRET-peptide library comprising 512 peptide substrate pools that detect 4 endoprotease types (aspartic, cysteine, meta...

  19. Intervention for hyperlipidemia associated with protease inhibitors.

    PubMed

    Melroe, N H; Kopaczewski, J; Henry, K; Huebsch, J

    1999-01-01

    In the past 3 years, treatment for HIV infection has significantly improved the prognosis for HIV-infected persons. The administration of protease inhibitors for the treatment of HIV infection has had a significant role in the reduction of AIDS-related complications. Recent findings have indicated that protease inhibitors may significantly increase lipids to levels that pose a health risk that may be greater than the illness itself. This article reviews the initial findings of a study that investigated the impact of interventions for the treatment of protease inhibitor-related hyperlipidemia. The purpose of the study was to determine if initiation of interventions based on the National Cholesterol Education Program Guidelines would be effective in lowering protease inhibitor-related hyperlipidemia without disrupting the effectiveness of the HIV therapy. A total of 45 HIV-infected individuals who were taking a protease inhibitor and had abnormally elevated lipids were enrolled into this study. Mean serum cholesterol level prior to initiation of a protease inhibitor regimen was 170 mg/dl as compared to a mean cholesterol at time of enrollment of 289 mg/dl and triglycerides of 879 mg/dl. Interventions included diet and exercise and the prescription of gemfibrozil alone or in combination with atorvatstatin. During the course of the study, overall intervention significantly reduced serum cholesterol level to 201 mg/dl (p. 01) over a study period of ten months. Case studies of five medical events related to hyperlipidemia are included. Currently, 26 participants continue in the study. Sixteen participants discontinued protease inhibitor therapy during the course of the study and thus ended their participation.

  20. The Multifaceted Poliovirus 2A Protease: Regulation of Gene Expression by Picornavirus Proteases

    PubMed Central

    Castelló, Alfredo; Álvarez, Enrique; Carrasco, Luis

    2011-01-01

    After entry into animal cells, most viruses hijack essential components involved in gene expression. This is the case of poliovirus, which abrogates cellular translation soon after virus internalization. Abrogation is achieved by cleavage of both eIF4GI and eIF4GII by the viral protease 2A. Apart from the interference of poliovirus with cellular protein synthesis, other gene expression steps such as RNA and protein trafficking between nucleus and cytoplasm are also altered. Poliovirus 2Apro is capable of hydrolyzing components of the nuclear pore, thus preventing an efficient antiviral response by the host cell. Here, we compare in detail poliovirus 2Apro with other viral proteins (from picornaviruses and unrelated families) as regard to their activity on key host factors that control gene expression. It is possible that future analyses to determine the cellular proteins targeted by 2Apro will uncover other cellular functions ablated by poliovirus infection. Further understanding of the cellular proteins hydrolyzed by 2Apro will add further insight into the molecular mechanism by which poliovirus and other viruses interact with the host cell. PMID:21541224

  1. The dimer interfaces of protease and extra-protease domains influence the activation of protease and the specificity of GagPol cleavage.

    PubMed

    Pettit, Steven C; Gulnik, Sergei; Everitt, Lori; Kaplan, Andrew H

    2003-01-01

    Activation of the human immunodeficiency virus type 1 (HIV-1) protease is an essential step in viral replication. As is the case for all retroviral proteases, enzyme activation requires the formation of protease homodimers. However, little is known about the mechanisms by which retroviral proteases become active within their precursors. Using an in vitro expression system, we have examined the determinants of activation efficiency and the order of cleavage site processing for the protease of HIV-1 within the full-length GagPol precursor. Following activation, initial cleavage occurs between the viral p2 and nucleocapsid proteins. This is followed by cleavage of a novel site located in the transframe domain. Mutational analysis of the dimer interface of the protease produced differential effects on activation and specificity. A subset of mutations produced enhanced cleavage at the amino terminus of the protease, suggesting that, in the wild-type precursor, cleavages that liberate the protease are a relatively late event. Replacement of the proline residue at position 1 of the protease dimer interface resulted in altered cleavage of distal sites and suggests that this residue functions as a cis-directed specificity determinant. In summary, our studies indicate that interactions within the protease dimer interface help determine the order of precursor cleavage and contribute to the formation of extended-protease intermediates. Assembly domains within GagPol outside the protease domain also influence enzyme activation.

  2. Site-Directed Mutagenesis and Structural Studies Suggest that the Germination Protease, GPR, in Spores of Bacillus Species Is an Atypical Aspartic Acid Protease

    PubMed Central

    Carroll, Thomas M.; Setlow, Peter

    2005-01-01

    Germination protease (GPR) initiates the degradation of small, acid-soluble spore proteins (SASP) during germination of spores of Bacillus and Clostridium species. The GPR amino acid sequence is not homologous to members of the major protease families, and previous work has not identified residues involved in GPR catalysis. The current work has focused on identifying catalytically essential amino acids by mutagenesis of Bacillus megaterium gpr. A residue was selected for alteration if it (i) was conserved among spore-forming bacteria, (ii) was a potential nucleophile, and (iii) had not been ruled out as inessential for catalysis. GPR variants were overexpressed in Escherichia coli, and the active form (P41) was assayed for activity against SASP and the zymogen form (P46) was assayed for the ability to autoprocess to P41. Variants inactive against SASP and unable to autoprocess were analyzed by circular dichroism spectroscopy and multiangle laser light scattering to determine whether the variant's inactivity was due to loss of secondary or quaternary structure, respectively. Variation of D127 and D193, but no other residues, resulted in inactive P46 and P41, while variants of each form were well structured and tetrameric, suggesting that D127 and D193 are essential for activity and autoprocessing. Mapping these two aspartate residues and a highly conserved lysine onto the B. megaterium P46 crystal structure revealed a striking similarity to the catalytic residues and propeptide lysine of aspartic acid proteases. These data indicate that GPR is an atypical aspartic acid protease. PMID:16199582

  3. Essential role of nuclear localization for yeast Ulp2 SUMO protease function.

    PubMed

    Kroetz, Mary B; Su, Dan; Hochstrasser, Mark

    2009-04-01

    The SUMO protein is covalently attached to many different substrates throughout the cell. This modification is rapidly reversed by SUMO proteases. The Saccharomyces cerevisiae SUMO protease Ulp2 is a nuclear protein required for chromosome stability and cell cycle restart after checkpoint arrest. Ulp2 is related to the human SENP6 protease, also a nuclear protein. All members of the Ulp2/SENP6 family of SUMO proteases have large but poorly conserved N-terminal domains (NTDs) adjacent to the catalytic domain. Ulp2 also has a long C-terminal domain (CTD). We show that CTD deletion has modest effects on yeast growth, but poly-SUMO conjugates accumulate. In contrast, the NTD is essential for Ulp2 function and is required for nuclear targeting. Two short, widely separated sequences within the NTD confer nuclear localization. Efficient Ulp2 import into the nucleus requires the beta-importin Kap95, which functions on classical nuclear-localization signal (NLS)-bearing substrates. Remarkably, replacement of the entire >400-residue NTD by a heterologous NLS results in near-normal Ulp2 function. These data demonstrate that nuclear localization of Ulp2 is crucial in vivo, yet only small segments of the NTD provide the key functional elements, explaining the minimal sequence conservation of the NTDs in the Ulp2/SENP6 family of enzymes.

  4. Identification of covalent active site inhibitors of dengue virus protease

    PubMed Central

    Koh-Stenta, Xiaoying; Joy, Joma; Wang, Si Fang; Kwek, Perlyn Zekui; Wee, John Liang Kuan; Wan, Kah Fei; Gayen, Shovanlal; Chen, Angela Shuyi; Kang, CongBao; Lee, May Ann; Poulsen, Anders; Vasudevan, Subhash G; Hill, Jeffrey; Nacro, Kassoum

    2015-01-01

    Dengue virus (DENV) protease is an attractive target for drug development; however, no compounds have reached clinical development to date. In this study, we utilized a potent West Nile virus protease inhibitor of the pyrazole ester derivative class as a chemical starting point for DENV protease drug development. Compound potency and selectivity for DENV protease were improved through structure-guided small molecule optimization, and protease-inhibitor binding interactions were validated biophysically using nuclear magnetic resonance. Our work strongly suggests that this class of compounds inhibits flavivirus protease through targeted covalent modification of active site serine, contrary to an allosteric binding mechanism as previously described. PMID:26677315

  5. Production of alkaline protease from Cellulosimicrobium cellulans

    PubMed Central

    Ferracini-Santos, Luciana; Sato, Hélia H

    2009-01-01

    Cellulosimicrobium cellulans is one of the microorganisms that produces a wide variety of yeast cell wall-degrading enzymes, β-1,3-glucanase, protease and chitinase. Dried cells of Saccharomyces cerevisiae were used as carbon and nitrogen source for cell growth and protease production. The medium components KH2PO4, KOH and dried yeast cells showed a significant effect (p<0.05) on the factorial fractional design. A second design was prepared using two factors: pH and percentage of dried yeast cells. The results showed that the culture medium for the maximum production of protease was 0.2 g/l of MgSO4.7H2O, 2.0 g/l of (NH4)2SO4 and 8% of dried yeast cells in 0.15M phosphate buffer at pH 8.0. The maximum alkaline protease production was 7.0 ± 0.27 U/ml over the center point. Crude protease showed best activity at 50ºC and pH 7.0-8.0, and was stable at 50ºC. PMID:24031317

  6. Lysosomal protease expression in mature enamel.

    PubMed

    Tye, Coralee E; Lorenz, Rachel L; Bartlett, John D

    2009-01-01

    The enamel matrix proteins (amelogenin, enamelin and ameloblastin) are degraded by matrix metalloproteinase-20 and kallikrein-4 during enamel development and mature enamel is virtually protein free. The precise mechanism of removal and degradation of the enamel protein cleavage products from the matrix, however, remains poorly understood. It has been proposed that receptor-mediated endocytosis allows for the cleaved proteins to be removed from the matrix during enamel formation and then transported to the lysosome for further degradation. This study aims to identify lysosomal proteases that are present in maturation-stage enamel organ. RNA from first molars of 11-day-old mice was collected and expression was initially assessed by RT-PCR and then quantified by qPCR. The pattern of expression of selected proteases was assessed by immunohistochemical staining of demineralized mouse incisors. With the exception of cathepsin G, all lysosomal proteases assessed were expressed in maturation-stage enamel organ. Identified proteases included cathepsins B, D, F, H, K, L, O, S and Z. Tripeptidyl peptidases I and II as well as dipeptidyl peptidases I, II, III and IV were also found to be expressed. Immunohistochemical staining confirmed that the maturation-stage ameloblasts express cathepsins L and S and tripeptidyl peptidase II. Our results suggest that the ameloblasts are enriched by a large number of lysosomal proteases at maturation that are likely involved in the degradation of the organic matrix.

  7. Molecular models of NS3 protease variants of the Hepatitis C virus

    PubMed Central

    da Silveira, Nelson JF; Arcuri, Helen A; Bonalumi, Carlos E; de Souza, Fátima P; Mello, Isabel MVGC; Rahal, Paula; Pinho, João RR; de Azevedo, Walter F

    2005-01-01

    Background Hepatitis C virus (HCV) currently infects approximately three percent of the world population. In view of the lack of vaccines against HCV, there is an urgent need for an efficient treatment of the disease by an effective antiviral drug. Rational drug design has not been the primary way for discovering major therapeutics. Nevertheless, there are reports of success in the development of inhibitor using a structure-based approach. One of the possible targets for drug development against HCV is the NS3 protease variants. Based on the three-dimensional structure of these variants we expect to identify new NS3 protease inhibitors. In order to speed up the modeling process all NS3 protease variant models were generated in a Beowulf cluster. The potential of the structural bioinformatics for development of new antiviral drugs is discussed. Results The atomic coordinates of crystallographic structure 1CU1 and 1DY9 were used as starting model for modeling of the NS3 protease variant structures. The NS3 protease variant structures are composed of six subdomains, which occur in sequence along the polypeptide chain. The protease domain exhibits the dual beta-barrel fold that is common among members of the chymotrypsin serine protease family. The helicase domain contains two structurally related beta-alpha-beta subdomains and a third subdomain of seven helices and three short beta strands. The latter domain is usually referred to as the helicase alpha-helical subdomain. The rmsd value of bond lengths and bond angles, the average G-factor and Verify 3D values are presented for NS3 protease variant structures. Conclusions This project increases the certainty that homology modeling is an useful tool in structural biology and that it can be very valuable in annotating genome sequence information and contributing to structural and functional genomics from virus. The structural models will be used to guide future efforts in the structure-based drug design of a new

  8. Molecular models of NS3 protease variants of the Hepatitis C virus.

    PubMed

    da Silveira, Nelson J F; Arcuri, Helen A; Bonalumi, Carlos E; de Souza, Fátima P; Mello, Isabel M V G C; Rahal, Paula; Pinho, João R R; de Azevedo, Walter F

    2005-01-21

    Hepatitis C virus (HCV) currently infects approximately three percent of the world population. In view of the lack of vaccines against HCV, there is an urgent need for an efficient treatment of the disease by an effective antiviral drug. Rational drug design has not been the primary way for discovering major therapeutics. Nevertheless, there are reports of success in the development of inhibitor using a structure-based approach. One of the possible targets for drug development against HCV is the NS3 protease variants. Based on the three-dimensional structure of these variants we expect to identify new NS3 protease inhibitors. In order to speed up the modeling process all NS3 protease variant models were generated in a Beowulf cluster. The potential of the structural bioinformatics for development of new antiviral drugs is discussed. The atomic coordinates of crystallographic structure 1CU1 and 1DY9 were used as starting model for modeling of the NS3 protease variant structures. The NS3 protease variant structures are composed of six subdomains, which occur in sequence along the polypeptide chain. The protease domain exhibits the dual beta-barrel fold that is common among members of the chymotrypsin serine protease family. The helicase domain contains two structurally related beta-alpha-beta subdomains and a third subdomain of seven helices and three short beta strands. The latter domain is usually referred to as the helicase alpha-helical subdomain. The rmsd value of bond lengths and bond angles, the average G-factor and Verify 3D values are presented for NS3 protease variant structures. This project increases the certainty that homology modeling is an useful tool in structural biology and that it can be very valuable in annotating genome sequence information and contributing to structural and functional genomics from virus. The structural models will be used to guide future efforts in the structure-based drug design of a new generation of NS3 protease variants

  9. Intramolecular Interactions between the Protease and Structural Domains Are Important for the Functions of Serine Protease Autotransporters▿ †

    PubMed Central

    Tsang, Casey; Malik, Huma; Nassman, Deana; Huang, Antony; Tariq, Fayha; Oelschlaeger, Peter; Stathopoulos, Christos

    2010-01-01

    Autotransporter (AT) is a protein secretion pathway found in Gram-negative bacteria featuring a multidomain polypeptide with a signal sequence, a passenger domain, and a translocator domain. An AT subfamily named serine protease ATs of the family Enterobacteriaceae (SPATEs) is characterized by the presence of a conserved serine protease motif in the passenger domain which contributes to bacterial pathogenesis. The goal of the current study is to determine the importance of the passenger domain conserved residues in the SPATE proteolytic and adhesive functions using the temperature-sensitive hemagglutinin (Tsh) protein as our model. To begin, mutations of 21 fully conserved residues in the four passenger domain conserved motifs were constructed by PCR-based site-directed mutagenesis. Seventeen mutants exhibited a wild-type secretion level; among these mutants, eight displayed reduced proteolytic activities in Tsh-specific oligopeptide and mucin cleavage assays. These eight mutants also demonstrated lower affinities to extracellular matrix proteins, collagen IV, and fibronectin. These eight conserved residues were analyzed by molecular graphics modeling to demonstrate their intramolecular interactions with the catalytic triad and other key residues. Additional mutations were made to confirm the above interactions in order to demonstrate their significance to the SPATE functions. Altogether our data suggest that certain conserved residues in the SPATE passenger domain are important for both the proteolytic and adhesive activities of SPATE by maintaining the proper protein structure via intramolecular interactions between the protease and β-helical domains. Here, we provide new insight into the structure-function relationship of the SPATEs and the functional roles of their conserved residues. PMID:20479079

  10. 3C-like protease of rabbit hemorrhagic disease virus: identification of cleavage sites in the ORF1 polyprotein and analysis of cleavage specificity.

    PubMed Central

    Wirblich, C; Sibilia, M; Boniotti, M B; Rossi, C; Thiel, H J; Meyers, G

    1995-01-01

    Rabbit hemorrhagic disease virus, a positive-stranded RNA virus of the family Caliciviridae, encodes a trypsin-like cysteine protease as part of a large polyprotein. Upon expression in Escherichia coli, the protease releases itself from larger precursors by proteolytic cleavages at its N and C termini. Both cleavage sites were determined by N-terminal sequence analysis of the cleavage products. Cleavage at the N terminus of the protease occurred with high efficiency at an EG dipeptide at positions 1108 and 1109. Cleavage at the C terminus of the protease occurred with low efficiency at an ET dipeptide at positions 1251 and 1252. To study the cleavage specificity of the protease, amino acid substitutions were introduced at the P2, P1, and P1' positions at the cleavage site at the N-terminal boundary of the protease. This analysis showed that the amino acid at the P1 position is the most important determinant for substrate recognition. Only glutamic acid, glutamine, and aspartic acid were tolerated at this position. At the P1' position, glycine, serine, and alanine were the preferred substrates of the protease, but a number of amino acids with larger side chains were also tolerated. Substitutions at the P2 position had only little effect on the cleavage efficiency. Cell-free expression of the C-terminal half of the ORF1 polyprotein showed that the protease catalyzes cleavage at the junction of the RNA polymerase and the capsid protein. An EG dipeptide at positions 1767 and 1768 was identified as the putative cleavage site. Our data show that rabbit hemorrhagic disease virus encodes a trypsin-like cysteine protease that is similar to 3C proteases with regard to function and specificity but is more similar to 2A proteases with regard to size. PMID:7474137

  11. Cleavage entropy as quantitative measure of protease specificity.

    PubMed

    Fuchs, Julian E; von Grafenstein, Susanne; Huber, Roland G; Margreiter, Michael A; Spitzer, Gudrun M; Wallnoefer, Hannes G; Liedl, Klaus R

    2013-04-01

    A purely information theory-guided approach to quantitatively characterize protease specificity is established. We calculate an entropy value for each protease subpocket based on sequences of cleaved substrates extracted from the MEROPS database. We compare our results with known subpocket specificity profiles for individual proteases and protease groups (e.g. serine proteases, metallo proteases) and reflect them quantitatively. Summation of subpocket-wise cleavage entropy contributions yields a measure for overall protease substrate specificity. This total cleavage entropy allows ranking of different proteases with respect to their specificity, separating unspecific digestive enzymes showing high total cleavage entropy from specific proteases involved in signaling cascades. The development of a quantitative cleavage entropy score allows an unbiased comparison of subpocket-wise and overall protease specificity. Thus, it enables assessment of relative importance of physicochemical and structural descriptors in protease recognition. We present an exemplary application of cleavage entropy in tracing substrate specificity in protease evolution. This highlights the wide range of substrate promiscuity within homologue proteases and hence the heavy impact of a limited number of mutations on individual substrate specificity.

  12. Cleavage Entropy as Quantitative Measure of Protease Specificity

    PubMed Central

    Fuchs, Julian E.; von Grafenstein, Susanne; Huber, Roland G.; Margreiter, Michael A.; Spitzer, Gudrun M.; Wallnoefer, Hannes G.; Liedl, Klaus R.

    2013-01-01

    A purely information theory-guided approach to quantitatively characterize protease specificity is established. We calculate an entropy value for each protease subpocket based on sequences of cleaved substrates extracted from the MEROPS database. We compare our results with known subpocket specificity profiles for individual proteases and protease groups (e.g. serine proteases, metallo proteases) and reflect them quantitatively. Summation of subpocket-wise cleavage entropy contributions yields a measure for overall protease substrate specificity. This total cleavage entropy allows ranking of different proteases with respect to their specificity, separating unspecific digestive enzymes showing high total cleavage entropy from specific proteases involved in signaling cascades. The development of a quantitative cleavage entropy score allows an unbiased comparison of subpocket-wise and overall protease specificity. Thus, it enables assessment of relative importance of physicochemical and structural descriptors in protease recognition. We present an exemplary application of cleavage entropy in tracing substrate specificity in protease evolution. This highlights the wide range of substrate promiscuity within homologue proteases and hence the heavy impact of a limited number of mutations on individual substrate specificity. PMID:23637583

  13. Neutrophil serine proteases in antibacterial defense.

    PubMed

    Stapels, Daphne A C; Geisbrecht, Brian V; Rooijakkers, Suzan H M

    2015-02-01

    Neutrophil serine proteases (NSPs) are critical for the effective functioning of neutrophils and greatly contribute to immune protection against bacterial infections. Thanks to their broad substrate specificity, these chymotrypsin-like proteases trigger multiple reactions that are detrimental to bacterial survival such as direct bacterial killing, generation of antimicrobial peptides, inactivation of bacterial virulence factors and formation of neutrophil extracellular traps. Recently, the importance of NSPs in antibacterial defenses has been further underscored by discoveries of unique bacterial evasion strategies to combat these proteases. Bacteria can indirectly disarm NSPs by protecting bacterial substrates against NSP cleavage, but also produce inhibitory molecules that potently block NSPs. Here we review recent insights in the functional contribution of NSPs in host protection against bacterial infections and the elegant strategies that bacteria use to counteract these responses. Copyright © 2014 Elsevier Ltd. All rights reserved.

  14. Insect response to plant defensive protease inhibitors.

    PubMed

    Zhu-Salzman, Keyan; Zeng, Rensen

    2015-01-07

    Plant protease inhibitors (PIs) are natural plant defense proteins that inhibit proteases of invading insect herbivores. However, their anti-insect efficacy is determined not only by their potency toward a vulnerable insect system but also by the response of the insect to such a challenge. Through the long history of coevolution with their host plants, insects have developed sophisticated mechanisms to circumvent antinutritional effects of dietary challenges. Their response takes the form of changes in gene expression and the protein repertoire in cells lining the alimentary tract, the first line of defense. Research in insect digestive proteases has revealed the crucial roles they play in insect adaptation to plant PIs and has brought about a new appreciation of how phytophagous insects employ this group of molecules in both protein digestion and counterdefense. This review provides researchers in related fields an up-to-date summary of recent advances.

  15. A cysteine protease of Dieffenbachia maculata.

    PubMed

    Chitre, A; Padmanabhan, S; Shastri, N V

    1998-12-01

    Plants of the genus Dieffenbachia, very popular as indoor ornamental plants, are known for their toxic as well as therapeutic properties. Their toxic manifestations have been partly attributed to their proteolytic activity. The work described in the present paper shows that stem leaves and petiole of Dieffenbachia maculata Schott, a commonly grown species, contain significant proteolytic activity, different parts showing different types of protease activities. Stem showed the highest enzyme activity and this protease was purified about 55 fold by solvent precipitation, gel filtration and ion exchange chromatography. The enzyme has a relative molecular mass of 61 kDa as determined by SDS-PAGE and has an optimum pH of 8.0 and optimum temperature of 50 degrees C. Effects of various substrates, inhibitors and activators indicate that the enzyme is a cysteine protease with leucylpeptidase activity.

  16. Large lateral movement of transmembrane helix S5 is not required for substrate access to the active site of rhomboid intramembrane protease.

    PubMed

    Xue, Yi; Ha, Ya

    2013-06-07

    Rhomboids represent an evolutionarily ancient protease family. Unlike most other proteases, they are polytopic membrane proteins and specialize in cleaving transmembrane protein substrates. The polar active site of rhomboid protease is embedded in the membrane and normally closed. For the bacterial rhomboid GlpG, it has been proposed that one of the transmembrane helices (S5) of the protease can rotate to open a lateral gate, enabling substrate to enter the protease from inside the membrane. Here, we studied the conformational change in GlpG by solving the cocrystal structure of the protease with a mechanism-based inhibitor. We also examined the lateral gating model by cross-linking S5 to a neighboring helix (S2). The crystal structure shows that inhibitor binding displaces a capping loop (L5) from the active site but causes only minor shifts in the transmembrane helices. Cross-linking S5 and S2, which not only restricts the lateral movement of S5 but also prevents substrate from passing between the two helices, does not hinder the ability of the protease to cleave a membrane protein substrate in detergent solution and in reconstituted membrane vesicles. Taken together, these data suggest that a large lateral movement of the S5 helix is not required for substrate access to the active site of rhomboid protease.

  17. Large Lateral Movement of Transmembrane Helix S5 Is Not Required for Substrate Access to the Active Site of Rhomboid Intramembrane Protease*

    PubMed Central

    Xue, Yi; Ha, Ya

    2013-01-01

    Rhomboids represent an evolutionarily ancient protease family. Unlike most other proteases, they are polytopic membrane proteins and specialize in cleaving transmembrane protein substrates. The polar active site of rhomboid protease is embedded in the membrane and normally closed. For the bacterial rhomboid GlpG, it has been proposed that one of the transmembrane helices (S5) of the protease can rotate to open a lateral gate, enabling substrate to enter the protease from inside the membrane. Here, we studied the conformational change in GlpG by solving the cocrystal structure of the protease with a mechanism-based inhibitor. We also examined the lateral gating model by cross-linking S5 to a neighboring helix (S2). The crystal structure shows that inhibitor binding displaces a capping loop (L5) from the active site but causes only minor shifts in the transmembrane helices. Cross-linking S5 and S2, which not only restricts the lateral movement of S5 but also prevents substrate from passing between the two helices, does not hinder the ability of the protease to cleave a membrane protein substrate in detergent solution and in reconstituted membrane vesicles. Taken together, these data suggest that a large lateral movement of the S5 helix is not required for substrate access to the active site of rhomboid protease. PMID:23609444

  18. Serine Protease(s) Secreted by the Nematode Trichuris muris Degrade the Mucus Barrier

    PubMed Central

    Hasnain, Sumaira Z.; McGuckin, Michael A.; Grencis, Richard K.; Thornton, David J.

    2012-01-01

    The polymeric mucin component of the intestinal mucus barrier changes during nematode infection to provide not only physical protection but also to directly affect pathogenic nematodes and aid expulsion. Despite this, the direct interaction of the nematodes with the mucins and the mucus barrier has not previously been addressed. We used the well-established Trichuris muris nematode model to investigate the effect on mucins of the complex mixture of immunogenic proteins secreted by the nematode called excretory/secretory products (ESPs). Different regimes of T. muris infection were used to simulate chronic (low dose) or acute (high dose) infection. Mucus/mucins isolated from mice and from the human intestinal cell line, LS174T, were treated with ESPs. We demonstrate that serine protease(s) secreted by the nematode have the ability to change the properties of the mucus barrier, making it more porous by degrading the mucin component of the mucus gel. Specifically, the serine protease(s) acted on the N-terminal polymerising domain of the major intestinal mucin Muc2, resulting in depolymerisation of Muc2 polymers. Importantly, the respiratory/gastric mucin Muc5ac, which is induced in the intestine and is critical for worm expulsion, was protected from the depolymerising effect exerted by ESPs. Furthermore, serine protease inhibitors (Serpins) which may protect the mucins, in particular Muc2, from depolymerisation, were highly expressed in mice resistant to chronic infection. Thus, we demonstrate that nematodes secrete serine protease(s) to degrade mucins within the mucus barrier, which may modify the niche of the parasite to prevent clearance from the host or facilitate efficient mating and egg laying from the posterior end of the parasite that is in intimate contact with the mucus barrier. However, during a TH2-mediated worm expulsion response, serpins, Muc5ac and increased levels of Muc2 protect the barrier from degradation by the nematode secreted protease(s). PMID

  19. Seminal and colostral protease inhibitors on leukocytes.

    PubMed

    Veselský, L; Cechová, D; Hruban, V; Klaudy, J

    1982-01-01

    For detection of protease inhibitors from cow colostrum (CTI) and bull seminal plasma (BUSI I and BUSI II) on the surface of leukocytes, immunological methods were used. An agglutination and an immunofluorescence test demonstrated components on the surface of bovine, porcine and ovine granulocytes and lymphocytes which were immunologically identical with the protease inhibitors isolated from cow colostrum and bull seminal plasma. When antisera against (CTI, BUSI and BUSI II were absorbed by bovine and porcine liver, kidney and spleen homogenate or by bovine and porcine granulocytes or lymphocytes, the immunological tests were negative.

  20. Saquinavir, the pioneer antiretroviral protease inhibitor.

    PubMed

    la Porte, Charles J L

    2009-10-01

    The treatment of HIV infection underwent a major change in 1995 when saquinavir was the first protease inhibitor introduced into the market. This drug made the use of combination therapy in the treatment of HIV possible and increased the success rate of treatment. This article will review recent literature on saquinavir to define its current role in HIV treatment, among the newer antiretroviral drugs. Scientific literature and conference presentations were evaluated for relevant information pertaining to saquinavir. Although underused, saquinavir has good efficacy and tolerability when compared to other protease inhibitors. The film-coated tablet formulation improved pill burden. Saquinavir still has potential in the treatment of adults, children and pregnant women.

  1. Current and Novel Inhibitors of HIV Protease

    PubMed Central

    Pokorná, Jana; Machala, Ladislav; Řezáčová, Pavlína; Konvalinka, Jan

    2009-01-01

    The design, development and clinical success of HIV protease inhibitors represent one of the most remarkable achievements of molecular medicine. This review describes all nine currently available FDA-approved protease inhibitors, discusses their pharmacokinetic properties, off-target activities, side-effects, and resistance profiles. The compounds in the various stages of clinical development are also introduced, as well as alternative approaches, aiming at other functional domains of HIV PR. The potential of these novel compounds to open new way to the rational drug design of human viruses is critically assessed. PMID:21994591

  2. Serine proteases and metalloproteases associated with pathogenesis but not host specificity in the Entomophthoralean fungus Zoophthora radicans.

    PubMed

    Xu, J; Baldwin, D; Kindrachuk, C; Hegedus, D D

    2006-06-01

    The protease activity of a Zoophthora radicans strain that was highly infective toward Pieris brassicae (cabbage butterfly) larvae was compared with that of isogenic strains that were adapted to Plutella xylostella (diamondback moth) larvae through serial passage. All strains produced three distinct serine proteases ranging in size from 25 to 37 kDa; however, the original strain from P. brassicae also produced large amounts of an approximately 46 kDa metalloprotease. Subsequently, a cDNA encoding a 43 kDa (mature enzyme) zinc-dependent metalloprotease, ZrMEP1, was isolated from the original fungal strain and most likely corresponds to the 46 kDa protease observed with in-gel assays. ZrMEP1 possessed characteristics of both the fungalysin and thermolysin metalloprotease families found in some pulmonary and dermal pathogens. This is the first report of this type of metalloprotease from an entomo pathogenic fungus. A cDNA encoding a trypsin-like serine protease, ZrSP1, was also identified and was most similar to a serine protease from the plant pathogen Verticillium dahliae. In artificial media, ZrMEP1 and ZrSP1 were found to be differentially responsive to gelatin and catabolite repression in the fungal strains adapted to P. brassicae and P. xylostella, but their expression patterns within infected larvae were the same. It appears that while these proteases likely play a role in the infection process, they may not be major host specificity determinants.

  3. A novel detergent-stable solvent-tolerant serine thiol alkaline protease from Streptomyces koyangensis TN650.

    PubMed

    Ben Elhoul, Mouna; Zaraî Jaouadi, Nadia; Rekik, Hatem; Bejar, Wacim; Boulkour Touioui, Souraya; Hmidi, Maher; Badis, Abdelmalek; Bejar, Samir; Jaouadi, Bassem

    2015-08-01

    An alkaline proteinase (STAP) was produced from strain TN650 isolated from a Tunisian off-shore oil field and assigned as Streptomyces koyangensis strain TN650 based on physiological and biochemical properties and 16S rRNA gene sequencing. Matrix assisted laser desorption ionization-time of flight mass spectrometry (MALDI-TOF/MS) analysis revealed that the purified enzyme was a monomer with a molecular mass of 45125.17-Da. The enzyme had an NH2-terminal sequence of TQSNPPSWGLDRIDQTTAFTKACSIKY, thus sharing high homology with those of Streptomyces proteases. The results showed that this protease was completely inhibited by phenylmethanesulfonyl fluoride (PMSF), diiodopropyl fluorophosphates (DFP), and partially inhibited by 5,5-dithio-bis-(2-nitro benzoic acid) (DTNB), which strongly suggested its belonging to the serine thiol protease family. Using casein as a substrate, the optimum pH and temperature values for protease activity were pH 10 and 70 °C, respectively. The protease was stable at pH 7-10 and 30-60 °C for 24 h. STAP exhibited high catalytic efficiency, significant detergent stability, and elevated organic solvent resistance compared to the SG-XIV proteases from S. griseus and KERAB from Streptomyces sp. AB1. The stap gene encoding STAP was isolated, and its DNA sequence was determined. These properties make STAP a potential candidate for future application in detergent formulations and non-aqueous peptide biocatalysis.

  4. Paracoccidioides brasiliensis induces cytokine secretion in epithelial cells in a protease-activated receptor-dependent (PAR) manner.

    PubMed

    de Oliveira, Priscila; Juliano, Maria Aparecida; Tanaka, Aparecida Sadae; Carmona, Adriana Karaoglanovic; Dos Santos, Saara Maria Batista; de Barros, Bianca Carla Silva Campitelli; Maza, Paloma Korehisa; Puccia, Rosana; Suzuki, Erika

    2017-04-01

    Paracoccidioides brasiliensis is one of the etiological agents of the human systemic mycosis paracoccidioidomycosis. Protease-activated receptors (PARs) are expressed in many cell types and comprise a family of G protein-coupled receptors (PAR-1, PAR-2, and PAR-4), which may be activated by proteases secreted by several pathogens. In the present study, we showed that the pathogenic fungus P. brasiliensis secretes components that promote interleukin (IL)-6 and IL-8 secretion by the lung epithelial cell line A549. Cytokine secretion was reduced by antagonistic peptides for PAR-1 and PAR-2, but not for PAR-4. P. brasiliensis proteases were isolated from fungal culture supernatants in a p-aminomethylbenzamidine-Sepharose column. The obtained fractions were tested for enzymatic activity against fluorescence resonance energy transfer (FRET) peptides derived from sequences that spanned the activation sites of human PARs. The eluted fraction, termed PbP, contained protease activities that were able to hydrolyze the FRET peptides. PbP also induced IL-6 and IL-8 secretion in A549 epithelial cells, which was reduced upon heat inactivation of PbP, incubation with antagonistic peptides for PAR-1 and PAR-2, and the protease inhibitors aprotinin, leupeptin, and E-64. Together, these results show for the first time that P. brasiliensis yeasts secrete proteases that activate PARs in lung epithelial cells, leading to cytokine secretion.

  5. Detection of protease and protease activity using a single nanocrescent SERS probe

    DOEpatents

    Liu, Gang L.; Ellman, Jonathan A.; Lee, Luke P.; Chen, Fanqing Frank

    2015-09-29

    This invention pertains to the in vitro detection of proteases using a single peptide-conjugate nanocrescent surface enhanced Raman scattering (SERS) probes with at least nanomolar sensitivity. The probe enables detection of proteolytic activity in extremely small volume and at low concentration. In certain embodiments the probes comprise an indicator for the detection of an active protease, where the indicator comprises a nanocrescent attached to a peptide, where said peptide comprises a recognition site for the protease and a Raman tag attached to the peptide.

  6. Detection of protease and protease activity using a single nanoscrescent SERS probe

    DOEpatents

    Liu, Gang L.; Ellman, Jonathan A.; Lee, Luke P.; Chen, Fanqing Frank

    2013-01-29

    This invention pertains to the in vitro detection of proteases using a single peptide-conjugate nanocrescent surface enhanced Raman scattering (SERS) probes with at least nanomolar sensitivity. The probe enables detection of proteolytic activity in extremely small volume and at low concentration. In certain embodiments the probes comprise an indicator for the detection of an active protease, where the indicator comprises a nanocrescent attached to a peptide, where said peptide comprises a recognition site for the protease and a Raman tag attached to the peptide.

  7. The Occurrence of Type S1A Serine Proteases in Sponge and Jellyfish

    NASA Technical Reports Server (NTRS)

    Rojas, Ana; Doolittle, Russell F.

    2003-01-01

    Although serine proteases are found in all kinds of cellular organisms and many viruses, the classic "chymotrypsin family" (Group S1A by th e 1998 Barrett nomenclature) has an unusual phylogenetic distribution , being especially common in animals, entirely absent from plants and protists, and rare among fungi. The distribution in Bacteria is larg ely restricted to the genus Streptomyces, although a few isolated occ urrences in other bacteria have been reported. The family may be enti rely absent from Archaea. Although more than a thousand sequences have been reported for enzymes of this type from animals, none of them ha ve been from early diverging phyla like Porifera or Cnidaria, We now report the existence of Group SlA serine proteases in a sponge (phylu m Porifera) and a jellyfish (phylum Cnidaria), making it safe to conc lude that all animal groups possess these enzymes.

  8. Calcium-induced Folding and Stabilization of the Pseudomonas aeruginosa Alkaline Protease*

    PubMed Central

    Zhang, Liang; Conway, James F.; Thibodeau, Patrick H.

    2012-01-01

    Pseudomonas aeruginosa is an opportunistic pathogen that contributes to the mortality of immunocompromised individuals and patients with cystic fibrosis. Pseudomonas infection presents clinical challenges due to its ability to form biofilms and modulate host-pathogen interactions through the secretion of virulence factors. The calcium-regulated alkaline protease (AP), a member of the repeats in toxin (RTX) family of proteins, is implicated in multiple modes of infection. A series of full-length and truncation mutants were purified for structural and functional studies to evaluate the role of Ca2+ in AP folding and activation. We find that Ca2+ binding induces RTX folding, which serves to chaperone the folding of the protease domain. Subsequent association of the RTX domain with an N-terminal α-helix stabilizes AP. These results provide a basis for the Ca2+-mediated regulation of AP and suggest mechanisms by which Ca2+ regulates the RTX family of virulence factors. PMID:22170064

  9. Subtilases: the superfamily of subtilisin-like serine proteases.

    PubMed Central

    Siezen, R. J.; Leunissen, J. A.

    1997-01-01

    Subtilases are members of the clan (or superfamily) of subtilisin-like serine proteases. Over 200 subtilases are presently known, more than 170 of which with their complete amino acid sequence. In this update of our previous overview (Siezen RJ, de Vos WM, Leunissen JAM, Dijkstra BW, 1991, Protein Eng 4:719-731), details of more than 100 new subtilases discovered in the past five years are summarized, and amino acid sequences of their catalytic domains are compared in a multiple sequence alignment. Based on sequence homology, a subdivision into six families is proposed. Highly conserved residues of the catalytic domain are identified, as are large or unusual deletions and insertions. Predictions have been updated for Ca(2+)-binding sites, disulfide bonds, and substrate specificity, based on both sequence alignment and three-dimensional homology modeling. PMID:9070434

  10. Expression pattern of protease activated receptors in lymphoid cells.

    PubMed

    López, Mercedes L; Soriano-Sarabia, Natalia; Bruges, Gustavo; Marquez, María Elena; Preissner, Klaus T; Schmitz, M Lienhard; Hackstein, Holger

    2014-01-01

    Protease-activated receptors (PARs) are a subfamily of four G-protein-coupled receptors mediating multiple functions. PARs expression was studied in subpopulations of human lymphocytes. Our results indicate that natural killer cells expressed mRNA for PAR₁, PAR₂ and PAR₃, CD4+ T cells expressed PAR₁ and PAR₂, while γδ and CD8+ T cells only expressed PAR₁. PAR₄ was absent at mRNA level and B cells did not express any PAR. Analyses of the cell surface PARs expression by flow cytometry were consistent with the mRNA data and also between different donors. PAR₁ is the most abundant member of the PAR family present in lymphocytes. Copyright © 2014 Elsevier Inc. All rights reserved.

  11. Tissue Factor, Protease Activated Receptors and Pathologic Heart Remodeling

    PubMed Central

    Antoniak, Silvio; Sparkenbaugh, Erica; Pawlinski, Rafal

    2015-01-01

    Tissue factor is the primary initiator of coagulation cascade and plays an essential role in hemostasis and thrombosis. In addition, tissue factor and coagulation proteases contribute to the many cellular responses via activation of protease activated receptors. Heart is the organ demonstrating high levels of constitutive tissue factor expression. This review focuses on the role of tissue factor, coagulation proteases and protease activated receptors in heart hemostasis and the pathological heart remodeling associated with myocardial infarction, viral myocarditis and hypertension. PMID:25104210

  12. ADAM-9 is an insulin-like growth factor binding protein-5 protease produced and secreted by human osteoblasts.

    PubMed

    Mohan, Subburaman; Thompson, Garrett R; Amaar, Yousef G; Hathaway, Gary; Tschesche, Harald; Baylink, David J

    2002-12-24

    IGF binding protein-5 (BP-5) is an important bone formation regulator. Therefore, elucidation of the identity of IGF binding protein-5 (BP-5) protease produced by osteoblasts is important for our understanding of the molecular pathways that control the action of BP-5. In this regard, BP-5 protease purified by various chromatographic steps from a conditioned medium of U2 human osteosarcoma cells migrated as a single major band, which comigrated with the protease activity in native PAGE and yielded multiple bands in SDS-PAGE under reducing conditions. N-Terminal sequencing of these bands revealed that three of the bands yielded amino acid sequences that were identical to that of alpha2 macroglobulin (alpha2M). Although alpha2M was produced by human osteoblasts (OBs), it was not found to be a BP-5 protease. Because alpha2M had been shown to complex with ADAM proteases and because ADAM-12 was found to cleave BP-3 and BP-5, we evaluated if one of the members of ADAM family was the BP-5 protease. On the basis of the findings that (1) purified preparations of BP-5 protease from U2 cell CM contained ADAM-9, (2) ADAM-9 is produced and secreted in high abundance by various human OB cell types, (3) purified ADAM-9 cleaved BP-5 effectively while it did not cleave other IGFBPs or did so with less potency, and (4) purified ADAM-9 bound to alpha2M, we conclude that ADAM-9 is a BP-5 protease produced by human OBs.

  13. Chromosomal mapping of cell death proteases CPP32, MCH2, and MCH3

    SciTech Connect

    Bullrich, F.; Fernandes-Alnemri, T.; Litwack, G.

    1996-09-01

    Apoptosis may involve a specialized proteolytic cascade catalyzed by interleukin-1{beta}-converting enzyme-like proteases. We have recently identified three new members of this family (CPP32, MCH2, MCH3) and shown that they play an important role in promoting cell death. Here we report the chromosomal mapping of CPP32 to 4q34, MCH2 to 4q25, and MCH3 to 10q25. 16 refs., 2 figs., 1 tab.

  14. Structural and Functional Determinants of γ-Secretase, an Intramembrane Protease Implicated in Alzheimer’s Disease

    PubMed Central

    Fraering, Patrick C

    2007-01-01

    Alzheimer’s disease is the most common form of neurodegenerative diseases in humans, characterized by the progressive accumulation and aggregation of amyloid-β peptides (Aβ) in brain regions subserving memory and cognition. These 39-43 amino acids long peptides are generated by the sequential proteolytic cleavages of the amyloid-β precursor protein (APP) by β- and γ-secretases, with the latter being the founding member of a new class of intramembrane-cleaving proteases (I-CliPs) characterized by their intramembranous catalytic residues hydrolyzing the peptide bonds within the transmembrane regions of their respective substrates. These proteases include the S2P family of metalloproteases, the Rhomboid family of serine proteases, and two aspartyl proteases: the signal peptide peptidase (SPP) and γ-secretase. In sharp contrast to Rhomboid and SPP that function as a single component, γ-secretase is a multi-component protease with complex assembly, maturation and activation processes. Recently, two low-resolution three-dimensional structures of γ-secretase and three high-resolution structures of the GlpG rhomboid protease have been obtained almost simultaneously by different laboratories. Although these proteases are unrelated by sequence or evolution, they seem to share common functional and structural mechanisms explaining how they catalyze intramembrane proteolysis. Indeed, a water-containing chamber in the catalytic cores of both γ-secretase and GlpG rhomboid provides the hydrophilic environment required for proteolysis and a lateral gating mechanism controls substrate access to the active site. The studies that have identified and characterized the structural determinants critical for the assembly and activity of the γ-secretase complex are reviewed here. PMID:19415127

  15. RC1339/APRc from Rickettsia conorii Is a Novel Aspartic Protease with Properties of Retropepsin-Like Enzymes

    PubMed Central

    Cruz, Rui; Huesgen, Pitter; Riley, Sean P.; Wlodawer, Alexander; Faro, Carlos; Overall, Christopher M.; Martinez, Juan J.; Simões, Isaura

    2014-01-01

    Members of the species Rickettsia are obligate intracellular, gram-negative, arthropod-borne pathogens of humans and other mammals. The life-threatening character of diseases caused by many Rickettsia species and the lack of reliable protective vaccine against rickettsioses strengthens the importance of identifying new protein factors for the potential development of innovative therapeutic tools. Herein, we report the identification and characterization of a novel membrane-embedded retropepsin-like homologue, highly conserved in 55 Rickettsia genomes. Using R. conorii gene homologue RC1339 as our working model, we demonstrate that, despite the low overall sequence similarity to retropepsins, the gene product of rc1339 APRc (for Aspartic Protease from Rickettsia conorii) is an active enzyme with features highly reminiscent of this family of aspartic proteases, such as autolytic activity impaired by mutation of the catalytic aspartate, accumulation in the dimeric form, optimal activity at pH 6, and inhibition by specific HIV-1 protease inhibitors. Moreover, specificity preferences determined by a high-throughput profiling approach confirmed common preferences between this novel rickettsial enzyme and other aspartic proteases, both retropepsins and pepsin-like. This is the first report on a retropepsin-like protease in gram-negative intracellular bacteria such as Rickettsia, contributing to the analysis of the evolutionary relationships between the two types of aspartic proteases. Additionally, we have also shown that APRc is transcribed and translated in R. conorii and R. rickettsii and is integrated into the outer membrane of both species. Finally, we demonstrated that APRc is sufficient to catalyze the in vitro processing of two conserved high molecular weight autotransporter adhesin/invasion proteins, Sca5/OmpB and Sca0/OmpA, thereby suggesting the participation of this enzyme in a relevant proteolytic pathway in rickettsial life-cycle. As a novel bona fide member

  16. A tandem Kunitz protease inhibitor (KPI106)-serine carboxypeptidase (SCP1) controls mycorrhiza establishment and arbuscule development in Medicago truncatula.

    PubMed

    Rech, Stefanie S; Heidt, Sven; Requena, Natalia

    2013-09-01

    Plant proteases and protease inhibitors are involved in plant developmental processes including those involving interactions with microbes. Here we show that a tandem between a Kunitz protease inhibitor (KPI106) and a serine carboxypeptidase (SCP1) controls arbuscular mycorrhiza development in the root cortex of Medicago truncatula. Both proteins are only induced during mycorrhiza formation and belong to large families whose members are also mycorrhiza-specific. Furthermore, the interaction between KPI106 and SCP1 analysed using the yeast two-hybrid system is specific, indicating that each family member might have a defined counterpart. In silico docking analysis predicted a putative P1 residue in KPI106 (Lys173) that fits into the catalytic pocket of SCP1, suggesting that KPI106 might inhibit the enzyme activity by mimicking the protease substrate. In vitro mutagenesis of the Lys173 showed that this residue is important in determining the strength and specificity of the interaction. The RNA interference (RNAi) inactivation of the serine carboxypeptidase SCP1 produces aberrant mycorrhizal development with an increased number of septated hyphae and degenerate arbuscules, a phenotype also observed when overexpressing KPI106. Protease and inhibitor are both secreted as observed when expressed in Nicotiana benthamiana epidermal cells. Taken together we envisage a model in which the protease SCP1 is secreted in the apoplast where it produces a peptide signal critical for proper fungal development within the root. KPI106 also at the apoplast would modulate the spatial and/or temporal activity of SCP1 by competing with the protease substrate. © 2013 The Authors The Plant Journal © 2013 John Wiley & Sons Ltd.

  17. Discovery and characterization of a novel plant pathogen protease

    USDA-ARS?s Scientific Manuscript database

    Chitinase modifying proteins are fungal proteases that attack specific plant defense chitinases. At least three unrelated types of proteases have evolved to have this function. They all truncate the targeted chitinases by cleaving near their amino termini, but each protease type targets a different ...

  18. Proteolytic Activation of the Essential Parasitophorous Vacuole Cysteine Protease SERA6 Accompanies Malaria Parasite Egress from Its Host Erythrocyte*

    PubMed Central

    Ruecker, Andrea; Shea, Michael; Hackett, Fiona; Suarez, Catherine; Hirst, Elizabeth M. A.; Milutinovic, Katarina; Withers-Martinez, Chrislaine; Blackman, Michael J.

    2012-01-01

    The malaria parasite replicates within an intraerythrocytic parasitophorous vacuole (PV). The PV and host cell membranes eventually rupture, releasing merozoites in a process called egress. Certain inhibitors of serine and cysteine proteases block egress, indicating a crucial role for proteases. The Plasmodium falciparum genome encodes nine serine-repeat antigens (SERAs), each of which contains a central domain homologous to the papain-like (clan CA, family C1) protease family. SERA5 and SERA6 are indispensable in blood-stage parasites, but the function of neither is known. Here we show that SERA6 localizes to the PV where it is precisely cleaved just prior to egress by an essential serine protease called PfSUB1. Mutations that replace the predicted catalytic Cys of SERA6, or that block SERA6 processing by PfSUB1, could not be stably introduced into the parasite genomic sera6 locus, indicating that SERA6 is an essential enzyme and that processing is important for its function. We demonstrate that cleavage of SERA6 by PfSUB1 converts it to an active cysteine protease. Our observations reveal a proteolytic activation step in the malarial PV that may be required for release of the parasite from its host erythrocyte. PMID:22984267

  19. [Peptide hydrolases with catalytic dyad Ser-Lys. Similarity and distinctions of the active centers of ATP-dependent Lon proteases, LexA repressors, signal peptidases and C-terminal processing proteases].

    PubMed

    Rotanova, T V

    2002-01-01

    It is established that ATP-dependent protease Lon family belongs to the serine-lysine peptide hydrolases clan. Significant similarity of amino acid sequences of proteases Lon and repressors LexA in the regions including the catalytic serine and lysine residues is revealed by comparing primary structures of different families of the enzymes with Ser-Lys catalytic dyad. The both Lon and LexA families are shown to be divided into two subfamilies in accordance with the nature of amino acids in the catalytically active serine environment. Putative DNA binding sites are revealed in proteolytic domains of Lon A subfamily. Similarities and distinctions of the all families peptide hydrolases of the clan in the regions of their active centers are discussed.

  20. Molecular markers of serine protease evolution

    PubMed Central

    Krem, Maxwell M.; Di Cera, Enrico

    2001-01-01

    The evolutionary history of serine proteases can be accounted for by highly conserved amino acids that form crucial structural and chemical elements of the catalytic apparatus. These residues display non- random dichotomies in either amino acid choice or serine codon usage and serve as discrete markers for tracking changes in the active site environment and supporting structures. These markers categorize serine proteases of the chymotrypsin-like, subtilisin-like and α/β-hydrolase fold clans according to phylogenetic lineages, and indicate the relative ages and order of appearance of those lineages. A common theme among these three unrelated clans of serine proteases is the development or maintenance of a catalytic tetrad, the fourth member of which is a Ser or Cys whose side chain helps stabilize other residues of the standard catalytic triad. A genetic mechanism for mutation of conserved markers, domain duplication followed by gene splitting, is suggested by analysis of evolutionary markers from newly sequenced genes with multiple protease domains. PMID:11406580

  1. Zika Virus Protease: An Antiviral Drug Target.

    PubMed

    Kang, CongBao; Keller, Thomas H; Luo, Dahai

    2017-10-01

    The recent outbreak of Zika virus (ZIKV) infection has caused global concern due to its link to severe damage to the brain development of foetuses and neuronal complications in adult patients. A worldwide research effort has been undertaken to identify effective and safe treatment and vaccination options. Among the proposed viral and host components, the viral NS2B-NS3 protease represents an attractive drug target due to its essential role in the virus life cycle. Here, we outline recent progress in studies on the Zika protease. Biochemical, biophysical, and structural studies on different protease constructs provide new insight into the structure and activity of the protease. The unlinked construct displays higher enzymatic activity and better mimics the native state of the enzyme and therefore is better suited for drug discovery. Furthermore, the structure of the free enzyme adopts a closed conformation and a preformed active site. The availability of a lead fragment hit and peptide inhibitors, as well as the attainability of soakable crystals, suggest that the unlinked construct is a promising tool for drug discovery. Copyright © 2017 Elsevier Ltd. All rights reserved.

  2. Transient ECM protease activity promotes synaptic plasticity

    PubMed Central

    Magnowska, Marta; Gorkiewicz, Tomasz; Suska, Anna; Wawrzyniak, Marcin; Rutkowska-Wlodarczyk, Izabela; Kaczmarek, Leszek; Wlodarczyk, Jakub

    2016-01-01

    Activity-dependent proteolysis at a synapse has been recognized as a pivotal factor in controlling dynamic changes in dendritic spine shape and function; however, excessive proteolytic activity is detrimental to the cells. The exact mechanism of control of these seemingly contradictory outcomes of protease activity remains unknown. Here, we reveal that dendritic spine maturation is strictly controlled by the proteolytic activity, and its inhibition by the endogenous inhibitor (Tissue inhibitor of matrix metalloproteinases-1 – TIMP-1). Excessive proteolytic activity impairs long-term potentiation of the synaptic efficacy (LTP), and this impairment could be rescued by inhibition of protease activity. Moreover LTP is altered persistently when the ability of TIMP-1 to inhibit protease activity is abrogated, further demonstrating the role of such inhibition in the promotion of synaptic plasticity under well-defined conditions. We also show that dendritic spine maturation involves an intermediate formation of elongated spines, followed by their conversion into mushroom shape. The formation of mushroom-shaped spines is accompanied by increase in AMPA/NMDA ratio of glutamate receptors. Altogether, our results identify inhibition of protease activity as a critical regulatory mechanism for dendritic spines maturation. PMID:27282248

  3. Investigational protease inhibitors as antiretroviral therapies

    PubMed Central

    Midde, Narasimha M.; Patters, Benjamin J.; Rao, PSS; Cory, Theodore J.; Kumar, Santosh

    2017-01-01

    Introduction Highly Active Antiretroviral Therapy (HAART) has tremendously improved the life expectancy of the HIV-infected population over the past three decades. Protease inhibitors have been one of the major classes of drugs in HAART regimens that are effective in treating HIV. However, the emergence of resistance and cross-resistance against protease inhibitors encourages researchers to develop new PIs with broad-spectrum activity, as well as novel means of enhancing the efficacy of existing PIs. Areas covered In this article we discuss recent advances in HIV protease inhibitor (PI) development, focusing on both investigational and experimental agents. We also include a section on pharmacokinetic booster drugs for improved bioavailability of protease inhibitors. Further, we discuss novel drug delivery systems using a variety of nanocarriers for the delivery of PIs across the blood-brain barrier to treat the HIV in the brain. Expert opinion We discuss our opinion on the promises and challenges on the development of novel investigational and experimental PIs that are less toxic and more effective in combating drug-resistance. Further, we discuss the future of novel nanocarriers that have been developed to deliver PIs to the brain cells. Although these are promising findings, many challenges need to be overcome prior to making them a viable option. PMID:27415449

  4. trans-Protease Activity and Structural Insights into the Active Form of the Alphavirus Capsid Protease

    PubMed Central

    Aggarwal, Megha; Dhindwal, Sonali; Kumar, Pravindra; Kuhn, Richard J.

    2014-01-01

    ABSTRACT The alphavirus capsid protein (CP) is a serine protease that possesses cis-proteolytic activity essential for its release from the nascent structural polyprotein. The released CP further participates in viral genome encapsidation and nucleocapsid core formation, followed by its attachment to glycoproteins and virus budding. Thus, protease activity of the alphavirus capsid is a potential antialphaviral target to arrest capsid release, maturation, and structural polyprotein processing. However, the discovery of capsid protease inhibitors has been hampered due to the lack of a suitable screening assay and of the crystal structure in its active form. Here, we report the development of a trans-proteolytic activity assay for Aura virus capsid protease (AVCP) based on fluorescence resonance energy transfer (FRET) for screening protease inhibitors. Kinetic parameters using fluorogenic peptide substrates were estimated, and the Km value was found to be 2.63 ± 0.62 μM while the kcat/Km value was 4.97 × 104 M−1 min−1. Also, the crystal structure of the trans-active form of AVCP has been determined to 1.81-Å resolution. Structural comparisons of the active form with the crystal structures of available substrate-bound mutant and inactive blocked forms of the capsid protease identify conformational changes in the active site, the oxyanion hole, and the substrate specificity pocket residues, which could be critical for rational drug design. IMPORTANCE The alphavirus capsid protease is an attractive antiviral therapeutic target. In this study, we have described the formerly unappreciated trans-proteolytic activity of the enzyme and for the first time have developed a FRET-based protease assay for screening capsid protease inhibitors. Our structural studies unveil the structural features of the trans-active protease, which has been previously proposed to exist in the natively unfolded form (M. Morillas, H. Eberl, F. H. Allain, R. Glockshuber, and E. Kuennemann, J

  5. Phosphorylation of the type II transmembrane serine protease, TMPRSS13, in hepatocyte growth factor activator inhibitor-1 and -2-mediated cell-surface localization.

    PubMed

    Murray, Andrew S; Varela, Fausto A; Hyland, Thomas E; Schoenbeck, Andrew J; White, Jordan M; Tanabe, Lauren M; Todi, Sokol V; List, Karin

    2017-09-08

    TMPRSS13 is a member of the type II transmembrane serine protease (TTSP) family. Although various TTSPs have been characterized in detail biochemically and functionally, the basic properties of TMPRSS13 remain unclear. Here, we investigate the activation, inhibition, post-translational modification, and localization of TMPRSS13. We show that TMPRSS13 is a glycosylated, active protease and that its own proteolytic activity mediates zymogen cleavage. Full-length, active TMPRSS13 exhibits impaired cell-surface expression in the absence of the cognate Kunitz-type serine protease inhibitors, hepatocyte growth factor activator inhibitor (HAI)-1 or HAI-2. Concomitant presence of TMPRSS13 with either HAI-1 or -2 mediates phosphorylation of residues in the intracellular domain of the protease, and it coincides with efficient transport of the protease to the cell surface and its subsequent shedding. Cell-surface labeling experiments indicate that the dominant form of TMPRSS13 on the cell surface is phosphorylated, whereas intracellular TMPRSS13 is predominantly non-phosphorylated. These data provide novel insight into the cellular properties of TMPRSS13 and highlight phosphorylation of TMPRSS13 as a novel post-translational modification of this TTSP family member and potentially other members of this family of proteases. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  6. Trypanosomatid cysteine protease activity may be enhanced by a kininogen-like moiety from host serum.

    PubMed Central

    Lonsdale-Eccles, J D; Mpimbaza, G W; Nkhungulu, Z R; Olobo, J; Smith, L; Tosomba, O M; Grab, D J

    1995-01-01

    African trypanosomes contain cysteine proteases (trypanopains) the activity of which can be measured by in vitro digestion of fibrinogen, after electrophoresis in fibrinogen-containing SDS/polyacrylamide gels. When assessed by this procedure, trypanopain from Trypanosoma brucei (trypanopain-Tb) is estimated to have a molecular mass of 28 kDa. However, two additional bands of trypanopain activity (87 kDa and 105 kDa) are observed if serum is added to the trypanopain before electrophoresis. Formation of the 87 and 105 kDa bands is frequently accompanied by a reduction in the intensity of the 28 kDa activity which suggests that the extra bands are complexes of the 28 kDa trypanopain-Tb and a molecule from rat serum called rat trypanopain moledulator (rTM). The rTM-induced activation of cysteine proteases is not restricted to T. brucei as it is also observed with proteases from other protozoan parasites such as bloodstream forms of Trypanosoma congolense and the mammalian-infective in vitro-derived promastigote forms of Leishmania donovani and Leishmania major. The physical properties of rTM resemble those of the kininogen family of cysteine protease inhibitors. rTM is an acidic (pI 4.7) heat-stable 68 kDa glycoprotein with 15 kDa protease-susceptible domains. This resemblance between rTM and kininogens was confirmed by the positive, albeit weak, immunoreactivity between anti-(human low-molecular-mass kininogen) antibody and rTM as well as anti-rTM antibody and human low-molecular-mass kininogen. Furthermore, commercial preparations of human-low-molecular-mass kininogen and chicken egg white cystatin mimicked rTM by forming extra bands of proteolytic activity in the presence of trypanopain-Tb. In some instances, low-molecular-mass kininogen was also observed to increase the rate of hydrolysis of 7-(benzyloxycarbonyl-phenylalanyl-arginyl-amido)-4- methylcoumarin by live T. brucei. Although this effect was rather erratic, in no instance was significant inhibition

  7. Proteases and Protease Inhibitors of Urinary Extracellular Vesicles in Diabetic Nephropathy

    PubMed Central

    Tataruch, Dorota; Gu, Dongfeng; Liu, Xinyu; Forsblom, Carol; Groop, Per-Henrik; Holthofer, Harry

    2015-01-01

    Diabetic nephropathy (DN) is one of the major complications of diabetes mellitus (DM), leads to chronic kidney disease (CKD), and, ultimately, is the main cause for end-stage kidney disease (ESKD). Beyond urinary albumin, no reliable biomarkers are available for accurate early diagnostics. Urinary extracellular vesicles (UEVs) have recently emerged as an interesting source of diagnostic and prognostic disease biomarkers. Here we used a protease and respective protease inhibitor array to profile urines of type 1 diabetes patients at different stages of kidney involvement. Urine samples were divided into groups based on the level of albuminuria and UEVs isolated by hydrostatic dialysis and screened for relative changes of 34 different proteases and 32 protease inhibitors, respectively. Interestingly, myeloblastin and its natural inhibitor elafin showed an increase in the normo- and microalbuminuric groups. Similarly, a characteristic pattern was observed in the array of protease inhibitors, with a marked increase of cystatin B, natural inhibitor of cathepsins L, H, and B as well as of neutrophil gelatinase-associated Lipocalin (NGAL) in the normoalbuminuric group. This study shows for the first time the distinctive alterations in comprehensive protease profiles of UEVs in diabetic nephropathy and uncovers intriguing mechanistic, prognostic, and diagnostic features of kidney damage in diabetes. PMID:25874235

  8. A novel protease activity assay using a protease-responsive chaperone protein

    SciTech Connect

    Sao, Kentaro; Murata, Masaharu; Fujisaki, Yuri; Umezaki, Kaori; Mori, Takeshi; Niidome, Takuro; Katayama, Yoshiki; Hashizume, Makoto

    2009-06-05

    Protease activity assays are important for elucidating protease function and for developing new therapeutic agents. In this study, a novel turbidimetric method for determining the protease activity using a protease-responsive chaperone protein is described. For this purpose, a recombinant small heat-shock protein (sHSP) with an introduced Factor Xa protease recognition site was synthesized in bacteria. This recombinant mutant, FXa-HSP, exhibited chaperone-like activity at high temperatures in cell lysates. However, the chaperone-like activity of FXa-HSP decreased dramatically following treatment with Factor Xa. Protein precipitation was subsequently observed in the cell lysates. The reaction was Factor Xa concentration-dependent and was quantitatively suppressed by a specific inhibitor for Factor Xa. Protein aggregation was detected by a simple method based on turbidimetry. The results clearly demonstrate that this assay is an effective, easy-to-use method for determining protease activities without the requirement of labeling procedures and the use of radioisotopes.

  9. Mirolase, a novel subtilisin-like serine protease from the periodontopathogen Tannerella forsythia

    PubMed Central

    Ksiazek, Miroslaw; Karim, Abdulkarim Y.; Bryzek, Danuta; Enghild, Jan J.; Thøgersen, Ida B.; Koziel, Joanna; Potempa, Jan

    2015-01-01

    The genome of Tannerella forsythia, an etiologic factor of chronic periodontitis, contains several genes encoding putative proteases. Here, we characterized a subtilisin-like serine protease of T. forsythia referred to as mirolase. Recombinant full-length latent promirolase (85 kDa, without its signal peptide) processed itself through sequential autoproteolytic cleavages into a mature enzyme of 40 kDa. Mirolase latency was driven by the N-terminal prodomain (NTP). In stark contrast to almost all known subtilases, the cleaved NTP remained non-covalently associated with mirolase, inhibiting its proteolytic, but not amidolytic, activity. Full activity was observed only after the NTP was gradually, and fully, degraded. Both activity and processing was absolutely dependent on calcium ions, which were also essential for enzyme stability. As a consequence, both serine protease inhibitors and calcium ions chelators inhibited mirolase activity. Activity assays using an array of chromogenic substrates revealed that mirolase specificity is driven not only by the substrate-binding subsite S1, but also by other subsites. Taken together mirolase is a calcium-dependent serine protease of the S8 family with the unique mechanism of activation that may contribute to T. forsythia pathogenicity by degradation of fibrinogen, hemoglobin and the antimicrobial peptide LL-37. PMID:25391881

  10. Crystal structure of a novel cysteinless plant Kunitz-type protease inhibitor

    SciTech Connect

    Hansen, Daiane; Macedo-Ribeiro, Sandra; Verissimo, Paula; Yoo Im, Sonia; Sampaio, Misako Uemura; Oliva, Maria Luiza Vilela . E-mail: olivaml.bioq@epm.br

    2007-09-07

    Bauhinia bauhinioides Cruzipain Inhibitor (BbCI) is a cysteine protease inhibitor highly homologous to plant Kunitz-type inhibitors. However, in contrast to classical Kunitz family inhibitors it lacks cysteine residues and therefore disulfide bridges. BbCI is also distinct in the ability to inactivate enzymes belonging to two different classes, cysteine and serine proteases. Besides inhibiting the cysteine protease cruzipain, BbCI also inhibits cathepsin L and the serine proteases HNE (human neutrophil elastase) and PPE (porcine pancreatic elastase). Monoclinic crystals of the recombinant inhibitor that diffract to 1.7 A resolution were obtained using hanging drop method by vapor diffusion at 18 {sup o}C. The refined structure shows the conservative {beta}-trefoil fold features of the Kunitz inhibitors. In BbCI, one of the two characteristic S-S bonds is replaced by the water-mediated interaction between Tyr125 and Gly132. In this work we explore the structural differences between Kunitz-type inhibitors and analyze the essential interactions that maintain the protein structural stability preserving its biological function.

  11. Mirolase, a novel subtilisin-like serine protease from the periodontopathogen Tannerella forsythia.

    PubMed

    Ksiazek, Miroslaw; Karim, Abdulkarim Y; Bryzek, Danuta; Enghild, Jan J; Thøgersen, Ida B; Koziel, Joanna; Potempa, Jan

    2015-03-01

    The genome of Tannerella forsythia, an etiological factor of chronic periodontitis, contains several genes encoding putative proteases. Here, we characterized a subtilisin-like serine protease of T. forsythia referred to as mirolase. Recombinant full-length latent promirolase [85 kDa, without its signal peptide (SP)] processed itself through sequential autoproteolytic cleavages into a mature enzyme of 40 kDa. Mirolase latency was driven by the N-terminal prodomain (NTP). In stark contrast to almost all known subtilases, the cleaved NTP remained non-covalently associated with mirolase, inhibiting its proteolytic, but not amidolytic, activity. Full activity was observed only after the NTP was gradually, and fully, degraded. Both activity and processing was absolutely dependent on calcium ions, which were also essential for enzyme stability. As a consequence, both serine protease inhibitors and calcium ions chelators inhibited mirolase activity. Activity assays using an array of chromogenic substrates revealed that mirolase specificity is driven not only by the substrate-binding subsite S1, but also by other subsites. Taken together, mirolase is a calcium-dependent serine protease of the S8 family with the unique mechanism of activation that may contribute to T. forsythia pathogenicity by degradation of fibrinogen, hemoglobin, and the antimicrobial peptide LL-37.

  12. Roles of proteases during invasion and egress by Plasmodium and Toxoplasma.

    PubMed

    Dowse, Timothy J; Koussis, Konstantinos; Blackman, Michael J; Soldati-Favre, Dominique

    2008-01-01

    Apicomplexan pathogens replicate exclusively within the confines of a host cell. Entry into (invasion) and exit from (egress) these cells requires an array of specialized parasite molecules, many of which have long been considered to have potential as targets of drug or vaccine-based therapies. In this chapter the authors discuss the current state of knowledge regarding the role of parasite proteolytic enzymes in these critical steps in the life cycle of two clinically important apicomplexan genera, Plasmodium and Toxoplasma. At least three distinct proteases of the cysteine mechanistic class have been implicated in egress of the malaria parasite from cells of its vertebrate and insect host. In contrast, the bulk of the evidence indicates a prime role for serine proteases of the subtilisin and rhomboid families in invasion by both parasites. Whereas proteases involved in egress may function predominantly to degrade host cell structures, proteases involved in invasion probably act primarily as maturases and 'sheddases', required to activate and ultimately remove ligands involved in interactions with the host cell.

  13. Identification of inhibitors of the transmembrane protease FlaK of Methanococcus maripaludis.

    PubMed

    Coburger, Ina; Schaub, Yvonne; Roeser, Dirk; Hardes, Kornelia; Maeder, Patrick; Klee, Nina; Steinmetzer, Torsten; Imhof, Diana; Diederich, Wibke E; Than, Manuel E

    2016-08-01

    GxGD-type intramembrane cleaving proteases (I-CLiPs) form a family of proteolytic enzymes that feature an aspartate-based catalytic mechanism. Yet, they structurally and functionally largely differ from the classical pepsin-like aspartic proteases. Among them are the archaeal enzyme FlaK, processing its substrate FlaB2 during the formation of flagella and γ-secretase, which is centrally involved in the etiology of the neurodegenerative Alzheimer's disease. We developed an optimized activity assay for FlaK and based on screening of a small in-house library and chemical synthesis, we identified compound 9 as the first inhibitor of this enzyme. Our results show that this intramembrane protease differs from classical pepsin-like aspartic proteases and give insights into the substrate recognition of this enzyme. By providing the needed tools to further study the enzymatic cycle of FlaK, our results also enable further studies towards a functional understanding of other GxGD-type I-CLiPs. © 2016 The Authors. MicrobiologyOpen published by John Wiley & Sons Ltd.

  14. Two Membrane-Anchored Aspartic Proteases Contribute to Pollen and Ovule Development1[OPEN

    PubMed Central

    Gao, Hui; Zhang, Yinghui; Wang, Wanlei; Zhao, Keke; Liu, Chunmei; Bai, Lin; Li, Rui

    2017-01-01

    Aspartic proteases are a class of proteolytic enzymes with conserved aspartate residues, which are implicated in protein processing, maturation, and degradation. Compared with yeast and animals, plants possess a larger aspartic protease family. However, little is known about most of these enzymes. Here, we characterized two Arabidopsis (Arabidopsis thaliana) putative glycosylphosphatidylinositol (GPI)-anchored aspartic protease genes, A36 and A39, which are highly expressed in pollen and pollen tubes. a36 and a36 a39 mutants display significantly reduced pollen activity. Transmission electron microscopy and terminal-deoxynucleotidyl transferase-mediated nick end labeling assays further revealed that the unviable pollen in a36 a39 may undergo unanticipated apoptosis-like programmed cell death. The degeneration of female gametes also occurred in a36 a39. Aniline Blue staining, scanning electron microscopy, and semi in vitro guidance assays indicated that the micropylar guidance of pollen tubes is significantly compromised in a36 a39. A36 and A39 that were fused with green fluorescent protein are localized to the plasma membrane and display punctate cytosolic localization and colocalize with the GPI-anchored protein COBRA-LIKE10. Furthermore, in a36 a39, the abundance of highly methylesterified homogalacturonans and xyloglucans was increased significantly in the apical pollen tube wall. These results indicate that A36 and A39, two putative GPI-anchored aspartic proteases, play important roles in plant reproduction in Arabidopsis. PMID:27872247

  15. Cleavage Specificity Analysis of Six Type II Transmembrane Serine Proteases (TTSPs) Using PICS with Proteome-Derived Peptide Libraries

    PubMed Central

    Béliveau, François; Leduc, Richard; Overall, Christopher M.

    2014-01-01

    Background Type II transmembrane serine proteases (TTSPs) are a family of cell membrane tethered serine proteases with unclear roles as their cleavage site specificities and substrate degradomes have not been fully elucidated. Indeed just 52 cleavage sites are annotated in MEROPS, the database of proteases, their substrates and inhibitors. Methodology/Principal Finding To profile the active site specificities of the TTSPs, we applied Proteomic Identification of protease Cleavage Sites (PICS). Human proteome-derived database searchable peptide libraries were assayed with six human TTSPs (matriptase, matriptase-2, matriptase-3, HAT, DESC and hepsin) to simultaneously determine sequence preferences on the N-terminal non-prime (P) and C-terminal prime (P’) sides of the scissile bond. Prime-side cleavage products were isolated following biotinylation and identified by tandem mass spectrometry. The corresponding non-prime side sequences were derived from human proteome databases using bioinformatics. Sequencing of 2,405 individual cleaved peptides allowed for the development of the family consensus protease cleavage site specificity revealing a strong specificity for arginine in the P1 position and surprisingly a lysine in P1′ position. TTSP cleavage between R↓K was confirmed using synthetic peptides. By parsing through known substrates and known structures of TTSP catalytic domains, and by modeling the remainder, structural explanations for this strong specificity were derived. Conclusions Degradomics analysis of 2,405 cleavage sites revealed a similar and characteristic TTSP family specificity at the P1 and P1′ positions for arginine and lysine in unfolded peptides. The prime side is important for cleavage specificity, thus making these proteases unusual within the tryptic-enzyme class that generally has overriding non-prime side specificity. PMID:25211023

  16. Comparative study on the protease inhibitors from fish eggs

    NASA Astrophysics Data System (ADS)

    Ustadi; Kim, K. Y.; Kim, S. M.

    2005-07-01

    The protease inhibitor was purified from five different fish eggs. The molecular weights of Pacific herring, chum salmon, pond smelt, glassfish, and Alaska pollock egg protease inhibitors were 120, 89, 84.5, 17, and l6.8kDa, respectively. The specific inhibitory activity of glassfish egg protease inhibitor was the highest followed by those of Pacific herring and Alaska pollock in order. The specific inhibitory activity and purity of glassfish egg protease inhibitor were 19.70 Umg-1 protein and 164.70 folds of purification, respectively. Glassfish egg protease inhibitor was reasonably stable at 50-65°C and pH 8, which was more stable at high temperature and pH than protease inhibitors from the other fish species. Glassfish egg protease inhibitor was noncompetitive with inhibitor constant ( K i) of 4.44 nmolL-1.

  17. Characterization of a Casuarina glauca nodule-specific subtilisin-like protease gene, a homolog of Alnus glutinosa ag12.

    PubMed

    Laplaze, L; Ribeiro, A; Franche, C; Duhoux, E; Auguy, F; Bogusz, D; Pawlowski, K

    2000-01-01

    In search of plant genes expressed during early interactions between Casuarina glauca and Frankia, we have isolated and characterized a C. glauca gene that has strong homology to subtilisin-like protease gene families of several plants including the actinorhizal nodulin gene ag12 of another actinorhizal plant, Alnus glutinosa. Based on the expression pattern of cg12 in the course of nodule development, it represents an early actinorhizal nodulin gene. Our results suggest that subtilisin-like proteases may be a common element in the process of infection of plant cells by Frankia in both Betulaceae (Alnus glutinosa) and Casuarinaceae (Casuarina glauca) symbioses.

  18. Management of protease inhibitor-associated hyperlipidemia.

    PubMed

    Penzak, Scott R; Chuck, Susan K

    2002-01-01

    Dyslipidemia, characterized by elevated serum levels of triglycerides and reduced levels of total cholesterol, low-density lipoprotein-cholesterol (LDL-C) and high-density lipoprotein-cholesterol, has been recognized in patients with human immunodeficiency virus (HIV) infection. It is thought that elevated levels of circulating cytokines, such as tumor necrosis factor-alpha and interferon-alpha, may alter lipid metabolism in patients with HIV infection. Protease inhibitors, such as saquinavir, indinavir and ritonavir, have been found to decrease mortality and improve quality of life in patients with HIV infection. However, these drugs have been associated with a syndrome of fat redistribution, insulin resistance, and hyperlipidemia. Elevations in serum total cholesterol and triglyceride levels, along with dyslipidemia that typically occurs in patients with HIV infection, may predispose patients to complications such as premature atherosclerosis and pancreatitis. It has been estimated that hypercholesterolemia and hypertriglyceridemia occur in greater than 50% of protease inhibitor recipients after 2 years of therapy, and that the risk of developing hyperlipidemia increases with the duration of treatment with protease inhibitors. In general, treatment of hyperlipidemia should follow National Cholesterol Education Program guidelines; efforts should be made to modify/control coronary heart disease risk factors (i.e. smoking; hypertension; diabetes mellitus) and maximize lifestyle modifications, primarily dietary intervention and exercise, in these patients. Where indicated, treatment usually consists of either pravastatin or atorvastatin for patients with elevated serum levels of LDL-C and/or total cholesterol. Atorvastatin is more potent in lowering serum total cholesterol and triglycerides compared with other hydroxymethylglutaryl coenzyme A (HMG-CoA) reductase inhibitors, but it is also associated with more drug interactions compared with pravastatin. Simvastatin

  19. Structure of protease-cleaved Escherichia coli α-2-macroglobulin reveals a putative mechanism of conformational activation for protease entrapment

    PubMed Central

    Fyfe, Cameron D.; Grinter, Rhys; Josts, Inokentijs; Mosbahi, Khedidja; Roszak, Aleksander W.; Cogdell, Richard J.; Wall, Daniel M.; Burchmore, Richard J. S.; Byron, Olwyn; Walker, Daniel

    2015-01-01

    Bacterial α-2-macroglobulins have been suggested to function in defence as broad-spectrum inhibitors of host proteases that breach the outer membrane. Here, the X-ray structure of protease-cleaved Escherichia coli α-2-macroglobulin is described, which reveals a putative mechanism of activation and conformational change essential for protease inhibition. In this competitive mechanism, protease cleavage of the bait-region domain results in the untethering of an intrinsically disordered region of this domain which disrupts native interdomain interactions that maintain E. coli α-2-macroglobulin in the inactivated form. The resulting global conformational change results in entrapment of the protease and activation of the thioester bond that covalently links to the attacking protease. Owing to the similarity in structure and domain architecture of Escherichia coli α-2-macroglobulin and human α-2-macro­globulin, this protease-activation mechanism is likely to operate across the diverse members of this group. PMID:26143919

  20. Orally administered proteases in aesthetic surgery.

    PubMed

    Dusková, M; Wald, M

    1999-01-01

    Increasing demand for shortening the sequel period after aesthetic surgery has led to comparative testing of optional approaches. Systemic enzyme therapy with its pharmacological effects represents a preventive and curative option for inflammatory process including healing. Excellent results were presented, namely, in the treatment of secondary lymphoedema. The incidence of hematoma, edema, and pain was followed, and the results were compared in a randomized group of 20 patients with upper eyelid blepharoplasty treated with proteases (Wobenzym drg) and in a similar group treated with systemic antiedema and hemostyptic therapy (Dicynone drg and Reparil drg). No undesirable side effects were observed. In addition, proteases apparently have no limitation for patients with the risk of concurrent cardiovascular, hepatic, or renal diseases.

  1. Enteropeptidase, a type II transmembrane serine protease.

    PubMed

    Zheng, X Long; Kitamoto, Yasunori; Sadler, J Evan

    2009-06-01

    Enteropeptidase, a type II transmembrane serine protease, is localized to the brush border of the duodenal and jejunal mucosa. It is synthesized as a zymogen (proenteropeptidase) that requires activation by another protease, either trypsin or possibly duodenase. Active enteropeptidase then converts the pancreatic precursor, trypsinogen, to trypsin by cleavage of the specific trypsinogen activation peptide, Asp-Asp-Asp-Asp-Lys- Ile that is highly conserved in vertebrates. Trypsin, in turn, activates other digestive zymogens such as chymotrypsinogen, proelastase, procarboxypeptidase and prolipase in the lumen of the gut. The important biological function of enteropeptidase is highlighted by the manifestation of severe diarrhea, failure to thrive, hypoproteinemia and edema as a result of congenital deficiency of enteropeptidase activity in the gut. Conversely, duodenopancreatic reflux of proteolytically active enteropeptidase may cause acute and chronic pancreatitis.

  2. Mycobacterial Caseinolytic Protease Gene Regulator ClgR Is a Substrate of Caseinolytic Protease

    PubMed Central

    Yamada, Yoshiyuki

    2017-01-01

    ABSTRACT The mycobacterial caseinolytic protease ClpP1P2 is a degradative protease that recently gained interest as a genetically and pharmacologically validated drug target for tuberculosis. The first whole-cell active ClpP1P2 inhibitor, the human proteasome inhibitor bortezomib, is currently undergoing lead optimization to introduce selectivity for the bacterial target. How inhibition of ClpP1P2 translates into whole-cell antimicrobial activity is little understood. Previous work has shown that the caseinolytic protease gene regulator ClgR is an activator of the clpP1P2 genes and also suggested that this transcription factor may be a substrate of the protease. Here, we employ promoter activity reporters and direct mRNA level measurements showing that bortezomib treatment of Mycobacterium bovis BCG increased transcription of clpP1P2 and other ClgR-dependent promoters, suggesting that inhibition of ClpP1P2 increases cellular ClgR levels. Then, we carried out red fluorescent protein-ClgR fusion analyses to show that ClgR is indeed a substrate of ClpP1P2 and to identify ClgR’s C-terminal nonapeptide APVVSLAVA as the signal sufficient for recognition and efficient protein degradation by ClpP1P2. Interestingly, accumulation of ClgR appears to be toxic for bacilli, suggesting a mechanism for how pharmacological inhibition of ClpP1P2 protease activity by bortezomib translates into whole-cell antibacterial activity. IMPORTANCE With 9 million new cases and more than 1 million deaths per year, tuberculosis, caused by Mycobacterium tuberculosis, is the biggest infectious disease killer globally. New drugs for the treatment of the drug-resistant forms of the disease are needed. Recently, a new target-lead couple, the mycobacterial protease ClpP1P2 and the human anticancer drug bortezomib, was identified. However, we know little about how expression of this protease is regulated, which proteins in the bacterium it degrades, how the protease recognizes its target proteins

  3. Tyrosine Phosphorylation of Botulinum Neurotoxin Protease Domains

    DTIC Science & Technology

    2012-06-01

    terminus in the enzyme’s substrate or product binding. Keywords: botulinum neurotoxin, tyrosine phosphorylation, zinc endoporotease, protease, clostridium ...associated membrane protein. These 150 kDa exotoxins are produced by strains of Clostridium botulinum as sevendistinct serotypes,designatedBoNT/A-G.After...A) anti-phosphotyrosine antibody Western blot (B). (A) Relative abundance of the m/z species representing phosphorylated LcB was plotted as a% of

  4. Dysregulation of Protease and Protease Inhibitors in a Mouse Model of Human Pelvic Organ Prolapse

    PubMed Central

    Budatha, Madhusudhan; Silva, Simone; Montoya, Teodoro Ignacio; Suzuki, Ayako; Shah-Simpson, Sheena; Wieslander, Cecilia Karin; Yanagisawa, Masashi; Word, Ruth Ann; Yanagisawa, Hiromi

    2013-01-01

    Mice deficient for the fibulin-5 gene (Fbln5−/−) develop pelvic organ prolapse (POP) due to compromised elastic fibers and upregulation of matrix metalloprotease (MMP)-9. Here, we used casein zymography, inhibitor profiling, affinity pull-down, and mass spectrometry to discover additional protease upregulated in the vaginal wall of Fbln5−/− mice, herein named V1 (25 kDa). V1 was a serine protease with trypsin-like activity similar to protease, serine (PRSS) 3, a major extrapancreatic trypsinogen, was optimum at pH 8.0, and predominantly detected in estrogenized vaginal epithelium of Fbln5−/− mice. PRSS3 was (a) localized in epithelial secretions, (b) detected in media of vaginal organ culture from both Fbln5−/− and wild type mice, and (c) cleaved fibulin-5 in vitro. Expression of two serine protease inhibitors [Serpina1a (α1-antitrypsin) and Elafin] was dysregulated in Fbln5−/− epithelium. Finally, we confirmed that PRSS3 was expressed in human vaginal epithelium and that SERPINA1 and Elafin were downregulated in vaginal tissues from women with POP. These data collectively suggest that the balance between proteases and their inhibitors contributes to support of the pelvic organs in humans and mice. PMID:23437119

  5. Acanthamoeba protease activity promotes allergic airway inflammation via protease-activated receptor 2.

    PubMed

    Park, Mi Kyung; Cho, Min Kyoung; Kang, Shin Ae; Park, Hye-Kyung; Kim, Dong-Hee; Yu, Hak Sun

    2014-01-01

    Acanthamoeba is a free-living amoeba commonly present in the environment and often found in human airway cavities. Acanthamoeba possesses strong proteases that can elicit allergic airway inflammation. To our knowledge, the aeroallergenicity of Acanthamoeba has not been reported. We repeatedly inoculated mice with Acanthamoeba trophozoites or excretory-secretory (ES) proteins intra-nasally and evaluated symptoms and airway immune responses. Acanthamoeba trophozoites or ES proteins elicited immune responses in mice that resembled allergic airway inflammation. ES proteins had strong protease activity and activated the expression of several chemokine genes (CCL11, CCL17, CCL22, TSLP, and IL-25) in mouse lung epithelial cells. The serine protease inhibitor phenyl-methane-sulfonyl fluoride (PMSF) inhibited ES protein activity. ES proteins also stimulated dendritic cells and enhanced the differentiation of naive T cells into IL-4-secreting T cells. After repeated inoculation of the protease-activated receptor 2 knockout mouse with ES proteins, airway inflammation and Th2 immune responses were markedly reduced, but not to basal levels. Furthermore, asthma patients had higher Acanthamoeba-specific IgE titers than healthy controls and we found Acanthamoeba specific antigen from house dust in typical living room. Our findings suggest that Acanthamoeba elicits allergic airway symptoms in mice via a protease allergen. In addition, it is possible that Acanthamoeba may be one of the triggers human airway allergic disease.

  6. Luteoloside Acts as 3C Protease Inhibitor of Enterovirus 71 In Vitro

    PubMed Central

    Cao, Zeyu; Ding, Yue; Ke, Zhipeng; Cao, Liang; Li, Na; Ding, Gang; Wang, Zhenzhong; Xiao, Wei

    2016-01-01

    Luteoloside is a member of the flavonoids family that exhibits several bioactivities including anti-microbial and anti-cancer activities. However, the antiviral activity of luteoloside against enterovirus 71 (EV71) and the potential mechanism(s) responsible for this effect remain unknown. In this study, the antiviral potency of luteoloside against EV71 and its inhibitory effects on 3C protease activity were evaluated. First, we investigated the cytotoxicity of luteoloside against rhabdomyosarcoma (RD) cells, which was the cell line selected for an in vitro infection model. In a subsequent antiviral assay, the cytopathic effect of EV71 was significantly and dose-dependently relieved by the administration of luteoloside (EC50 = 0.43 mM, selection index = 5.3). Using a plaque reduction assay, we administered luteoloside at various time points and found that the compound reduced EV71 viability in RD cells rather than increasing defensive mobilization or viral absorption. Moreover, biochemical studies focused on VP1 (a key structural protein of EV71) mRNA transcript and protein levels also revealed the inhibitory effects of luteoloside on the EV71 viral yield. Finally, we performed inhibition assays using luteoloside to evaluate its effect on recombinant 3C protease activity. Our results demonstrated that luteoloside blocked 3C protease enzymatic activity in a dose-dependent manner (IC50 = 0.36 mM) that was similar to the effect of rutin, which is a well-known C3 protease inhibitor. Collectively, the results from this study indicate that luteoloside can block 3C protease activity and subsequently inhibit EV71 production in vitro. PMID:26870944

  7. Expression and characterization of alkaline protease from the metagenomic library of tannery activated sludge.

    PubMed

    Devi, Selvaraju Gayathri; Fathima, Anwar Aliya; Sanitha, Mary; Iyappan, Sellamuthu; Curtis, Wayne R; Ramya, Mohandass

    2016-12-01

    Metagenomics has the potential to facilitate the discovery of novel enzymes; however, to date, only a few alkaline proteases have been characterized from environmentally-sourced DNA. We report the identification and characterization of an alkaline serine protease designated as Prt1A from the metagenomic library of tannery activated sludge. Sequence analysis revealed that Prt1A is closely related to S8A family subtilisins with a catalytic triad of Asp143, His173, and Ser326. The putative protease gene (prt-1A) was subcloned in pET 28a (+) vector and overexpressed in Escherichia coli BL21(DE3)pLysS cells. This 38.8 KDa recombinant protease was purified to homogeneity by nickel affinity chromatography and exhibited optimal enzyme activity at elevated pH (11.0) and temperature (55°C). The enzyme activity was enhanced by the addition of 5 mM Ca(2+) ions, and was stable in the presence of anionic detergent, oxidizing agent and various organic solvents. The enzyme displayed high affinity and catalytic efficiency for casein under standard assay conditions (Vmax = 279 U/mg/min, Km = 1.70 mg/mL) and was also compatible with commercial detergents. These results suggest that Prt1A protease could act as an efficient enzyme in various industrial applications. Copyright © 2016 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

  8. Purification and characterization of secretory serine protease from necrotrophic oomycete, Pythium myriotylum Dreschler.

    PubMed

    Aswati Nair, Ravindranathan; Geethu, Chellappan

    2015-01-01

    Progressive increase in extracellular proteolytic activity with respect to growth was detected in cultures of necrotrophic oomycete Pythium myriotylum Dreschler with maximum activity detected at stationary phase of growth. The secretory protease from P. myriotylum designated, spPm1 was purified to homogeneity giving a single band of 47 kDa molecular mass on non-reducing SDS-PAGE and exhibiting caseinolytic activity in the zymogram. Under reducing conditions, an additional band of 27.0 kDa molecular size observed was subjected to matrix-assisted laser desorption/ionization-time-of-flight mass spectrometry (MALDI-TOF-MS) analysis. Resulting peptide identified as an autolytic product and generated under reducing conditions on SDS-PAGE, showed homology to domains of oomycete effector molecules. spPm1 retained proteolytic activity over broad pH (5.0-12.0) and temperature (10-80 °C) ranges with optimal pH and temperature at 8.0 and 60 °C respectively. spPm1 was identified as a serine protease following experiments with inhibitors specific to various protease groups. spPm1 displayed high stability to surfactants, organic solvents, oxidizing agents and to metal-ion chelator, EDTA. Kinetic parameters, Km and Vmax were determined as 0.04 mM and 7.52 U min(-1) mg(-1) respectively. Preferential hydrolysis of synthetic fluorogenic substrate, SAAPPPA (N-succinyl-L-alanyl-alanyl-proline-phenylalanine-p-nitroanilide) confirmed spPm1 as belonging to subtilisin serine protease family. The excellent stability of spPm1 protease characterized from P. myriotylum is discussed with respect to its potential industrial applications.

  9. A novel human protease similar to the interleukin-1 beta converting enzyme induces apoptosis in transfected cells.

    PubMed Central

    Faucheu, C; Diu, A; Chan, A W; Blanchet, A M; Miossec, C; Hervé, F; Collard-Dutilleul, V; Gu, Y; Aldape, R A; Lippke, J A

    1995-01-01

    We have identified a novel cDNA encoding a protein (named TX) with > 50% overall sequence identity with the interleukin-1 beta converting enzyme (ICE) and approximately 30% sequence identity with the ICE homologs NEDD-2/ICH-1L and CED-3. A computer homology model of TX was constructed based on the X-ray coordinates of the ICE crystal recently published. This model suggests that TX is a cysteine protease, with the P1 aspartic acid substrate specificity retained. Transfection experiments demonstrate that TX is a protease which is able to cleave itself and the p30 ICE precursor, but not to generate mature IL-1 beta from pro-IL-1 beta. In addition, this protein induces apoptosis in transfected COS cells. TX therefore delineates a new member of the growing Ice/ced-3 gene family coding for proteases with cytokine processing activity or involved in programmed cell death. Images PMID:7743998

  10. A novel human protease similar to the interleukin-1 beta converting enzyme induces apoptosis in transfected cells.

    PubMed

    Faucheu, C; Diu, A; Chan, A W; Blanchet, A M; Miossec, C; Hervé, F; Collard-Dutilleul, V; Gu, Y; Aldape, R A; Lippke, J A

    1995-05-01

    We have identified a novel cDNA encoding a protein (named TX) with > 50% overall sequence identity with the interleukin-1 beta converting enzyme (ICE) and approximately 30% sequence identity with the ICE homologs NEDD-2/ICH-1L and CED-3. A computer homology model of TX was constructed based on the X-ray coordinates of the ICE crystal recently published. This model suggests that TX is a cysteine protease, with the P1 aspartic acid substrate specificity retained. Transfection experiments demonstrate that TX is a protease which is able to cleave itself and the p30 ICE precursor, but not to generate mature IL-1 beta from pro-IL-1 beta. In addition, this protein induces apoptosis in transfected COS cells. TX therefore delineates a new member of the growing Ice/ced-3 gene family coding for proteases with cytokine processing activity or involved in programmed cell death.

  11. Crimean-Congo Hemorrhagic Fever Virus Suppresses Innate Immune Responses via a Ubiquitin and ISG15 Specific Protease.

    PubMed

    Scholte, Florine E M; Zivcec, Marko; Dzimianski, John V; Deaton, Michelle K; Spengler, Jessica R; Welch, Stephen R; Nichol, Stuart T; Pegan, Scott D; Spiropoulou, Christina F; Bergeron, Éric

    2017-09-05

    Antiviral responses are regulated by conjugation of ubiquitin (Ub) and interferon-stimulated gene 15 (ISG15) to proteins. Certain classes of viruses encode Ub- or ISG15-specific proteases belonging to the ovarian tumor (OTU) superfamily. Their activity is thought to suppress cellular immune responses, but studies demonstrating the function of viral OTU proteases during infection are lacking. Crimean-Congo hemorrhagic fever virus (CCHFV, family Nairoviridae) is a highly pathogenic human virus that encodes an OTU with both deubiquitinase and deISGylase activity as part of the viral RNA polymerase. We investigated CCHFV OTU function by inactivating protease catalytic activity or by selectively disrupting its deubiquitinase and deISGylase activity using reverse genetics. CCHFV OTU inactivation blocked viral replication independently of its RNA polymerase activity, while deubiquitinase activity proved critical for suppressing the interferon responses. Our findings provide insights into viral OTU functions and support the development of therapeutics and vaccines. Published by Elsevier Inc.

  12. Protease-activated receptors and prostaglandins in inflammatory lung disease

    PubMed Central

    Peters, Terence; Henry, Peter J

    2009-01-01

    Protease-activated receptors (PARs) are a novel family of G protein-coupled receptors. Signalling through PARs typically involves the cleavage of an extracellular region of the receptor by endogenous or exogenous proteases, which reveals a tethered ligand sequence capable of auto-activating the receptor. A considerable body of evidence has emerged over the past 20 years supporting a prominent role for PARs in a variety of human physiological and pathophysiological processes, and thus substantial attention has been directed towards developing drug-like molecules that activate or block PARs via non-proteolytic pathways. PARs are widely expressed within the respiratory tract, and their activation appears to exert significant modulatory influences on the level of bronchomotor tone, as well as on the inflammatory processes associated with a range of respiratory tract disorders. Nevertheless, there is debate as to whether the principal response to PAR activation is an augmentation or attenuation of airways inflammation. In this context, an important action of PAR activators may be to promote the generation and release of prostanoids, such as prostglandin E2, which have well-established anti-inflammatory effects in the lung. In this review, we primarily focus on the relationship between PARs, prostaglandins and inflammatory processes in the lung, and highlight their potential role in selected respiratory tract disorders, including pulmonary fibrosis, asthma and chronic obstructive pulmonary disease. This article is part of a themed issue on Mediators and Receptors in the Resolution of Inflammation. To view this issue visit http://www3.interscience.wiley.com/journal/121548564/issueyear?year=2009 PMID:19845685

  13. Bcl-2 inhibits the mitochondrial release of an apoptogenic protease

    PubMed Central

    1996-01-01

    Bcl-2 belongs to a family of apoptosis-regulatory proteins which incorporate into the outer mitochondrial as well as nuclear membranes. The mechanism by which the proto-oncogene product Bcl-2 inhibits apoptosis is thus far elusive. We and others have shown previously that the first biochemical alteration detectable in cells undergoing apoptosis, well before nuclear changes become manifest, is a collapse of the mitochondrial inner membrane potential (delta psi m), suggesting the involvement of mitochondrial products in the apoptotic cascade. Here we show that mitochondria contain a pre-formed approximately 50-kD protein which is released upon delta psi m disruption and which, in a cell-free in vitro system, causes isolated nuclei to undergo apoptotic changes such as chromatin condensation and internucleosomal DNA fragmentation. This apoptosis-inducing factor (AIF) is blocked by N- benzyloxycarbonyl-Val-Ala-Asp.fluoromethylketone (Z-VAD.fmk), an antagonist of interleukin-1 beta-converting enzyme (ICE)-like proteases that is also an efficient inhibitor of apoptosis in cells. We have tested the effect of Bcl-2 on the formation, release, and action of AIF. When preventing mitochondrial permeability transition (which accounts for the pre-apoptotic delta psi m disruption in cells), Bcl-2 hyperexpressed in the outer mitochondrial membrane also impedes the release of AIF from isolated mitochondria in vitro. In contrast, Bcl-2 does not affect the formation of AIF, which is contained in comparable quantities in control mitochondria and in mitochondria from Bcl-2- hyperexpressing cells. Furthermore, the presence of Bcl-2 in the nuclear membrane does not interfere with the action of AIF on the nucleus, nor does Bcl-2 hyperexpression protect cells against AIF. It thus appears that Bcl-2 prevents apoptosis by favoring the retention of an apoptogenic protease in mitochondria. PMID:8879205

  14. Isolation and Identification of an Extracellular Subtilisin-Like Serine Protease Secreted by the Bat Pathogen Pseudogymnoascus destructans

    PubMed Central

    Pannkuk, Evan L.; Risch, Thomas S.; Savary, Brett J.

    2015-01-01

    White nose syndrome (WNS) is a cutaneous fungal disease of bats. WNS is responsible for unprecedented mortalities in North American cave bat populations. There have been few descriptions of enzyme activities that may function in WNS host/pathogen interactions, while no study has isolated and described secreted proteases. To address the hypothesis that Pseudogymnoascus destructans secretes extracellular proteases that function in wing necrosis during WNS infection, the object of this study was to culture P. destructans on various media, then isolate and structurally identify those proteases accumulated stably in the culture medium. We found a single dominant protease activity on minimal nutrient broth enriched with protein substrates, which was strongly inhibited by phenylmethylsulfonyl fluoride. This P. destructans serine protease (PdSP1) was isolated by preparative isoelectric focusing and concanavalin A lectin affinity chromatography. PdSP1 showed a molecular weight 27,900 (estimated by SDS-PAGE), broad pH optimum 6-8, and temperature optimum 60°C. Structural characterization of PdSP1 by MALDI-TOF MS, Orbitrap MS/MS, and Edman amino-terminal peptide sequencing matched it directly to a hypothetical protein accession from the sequenced P. destructans genome that is further identified as a MEROPS family S8A subtilisin-like serine peptidase. Two additional isoforms, PdSP2 and PdSP3, were identified in the P. destructans genome with 90% and 53% homology, respectively. P. destructans S8A serine proteases showed closer sequence conservation to P. pannorum and plant pathogenic fungi than to human pathogenic dermatophytes. Peptide-specific polyclonal antibodies developed from the PdSP1 sequence detected the protein in western blots. These subtilisin-like serine proteases are candidates for further functional studies in WNS host-pathogen interaction. PMID:25785714

  15. Isolation and identification of an extracellular subtilisin-like serine protease secreted by the bat pathogen Pseudogymnoascus destructans.

    PubMed

    Pannkuk, Evan L; Risch, Thomas S; Savary, Brett J

    2015-01-01

    White nose syndrome (WNS) is a cutaneous fungal disease of bats. WNS is responsible for unprecedented mortalities in North American cave bat populations. There have been few descriptions of enzyme activities that may function in WNS host/pathogen interactions, while no study has isolated and described secreted proteases. To address the hypothesis that Pseudogymnoascus destructans secretes extracellular proteases that function in wing necrosis during WNS infection, the object of this study was to culture P. destructans on various media, then isolate and structurally identify those proteases accumulated stably in the culture medium. We found a single dominant protease activity on minimal nutrient broth enriched with protein substrates, which was strongly inhibited by phenylmethylsulfonyl fluoride. This P. destructans serine protease (PdSP1) was isolated by preparative isoelectric focusing and concanavalin A lectin affinity chromatography. PdSP1 showed a molecular weight 27,900 (estimated by SDS-PAGE), broad pH optimum 6-8, and temperature optimum 60°C. Structural characterization of PdSP1 by MALDI-TOF MS, Orbitrap MS/MS, and Edman amino-terminal peptide sequencing matched it directly to a hypothetical protein accession from the sequenced P. destructans genome that is further identified as a MEROPS family S8A subtilisin-like serine peptidase. Two additional isoforms, PdSP2 and PdSP3, were identified in the P. destructans genome with 90% and 53% homology, respectively. P. destructans S8A serine proteases showed closer sequence conservation to P. pannorum and plant pathogenic fungi than to human pathogenic dermatophytes. Peptide-specific polyclonal antibodies developed from the PdSP1 sequence detected the protein in western blots. These subtilisin-like serine proteases are candidates for further functional studies in WNS host-pathogen interaction.

  16. Antibacterial cysteine protease from Cissus quadrangularis L.

    PubMed

    Muthu, Sakthivel; Gopal, Venkatesh Babu; Karthik S, Narayan; Sivaji, Prabu; Malairaj, Sathuvan; Lakshmikanthan, Mythileeswari; Subramani, Nagaraj; Perumal, Palani

    2017-10-01

    An antibacterial Cp was extracted from the stem of Cissus quadrangularis and purified with a 5.39 fold increase in specific activity and 8.67% recovery. The molecular weight of the purified enzyme was estimated to be 39kDa by SDS-PAGE. The purified enzyme appeared as a single band on Native-PAGE. The optimum pH and temperature for protease activity were around 6.0 and 50°C respectively. The Cp showed pH stability from 3 to 10 and retained more than 90% of its relative protease activity. The addition of metal ions such as Mg(2+) and Ca(2+) also exhibited relative protease activity. Cp showed a potent antibacterial activity against pathogenic bacteria. About 4.74Uml(-1) of Cp from C. quadrangularis was tested for antibacterial activity against Bacillus cereus and Bacillus megaterium which subsequently showed zone of inhibition of 21 and 20mm respectively. Cp from C. quadrangularis degraded the peptidoglycan layer of bacteria by Cp was confirmed by transmission electron microscopic analysis. Copyright © 2017 Elsevier B.V. All rights reserved.

  17. Effect of lanthanides on Porphyromonas gingivalis proteases.

    PubMed

    Sunkara, Sasi K; Ciancio, Sebastian G; Sojar, Hakimuddin T

    2010-01-01

    Host and bacterial proteases play a vital role in periodontitis. Inhibitors of these proteases are necessary for control of this disease. The purpose of this study was to evaluate the effect of lanthanides on proteins from Porphyromonas gingivalis, a major pathogen in periodontitis. Benzoyl-L-Arg-p-nitroanilide (BAPNA); H-Gly-Pro-pNA x HCl and gelatin were used to evaluate the activity of P. gingivalis proteins in the presence of lanthanides. Proteins extracted from cell surfaces and culture media of P. gingivalis were assessed for activity in the presence of different lanthanides by BAPNA assay. Only gadolinium chloride was used for H-Gly-Pro-pNA x HCl assay and gelatin-zymography. Concentration-dependent reduction of absorbance was observed in the presence of lanthanides with BAPNA and a similar observation was made with gadolinium chloride using H-Gly-Pro-pNa. Collagenolytic activity in cell surface extracts and culture media-precipitated proteins was absent in the presence of gadolinium chloride. These results suggest that the lanthanide gadolinium can be a potential inhibitor of P. gingivalis proteases.

  18. Corruption of innate immunity by bacterial proteases.

    PubMed

    Potempa, Jan; Pike, Robert N

    2009-01-01

    The innate immune system of the human body has developed numerous mechanisms to control endogenous and exogenous bacteria and thus prevent infections by these microorganisms. These mechanisms range from physical barriers such as the skin or mucosal epithelium to a sophisticated array of molecules and cells that function to suppress or prevent bacterial infection. Many bacteria express a variety of proteases, ranging from non-specific and powerful enzymes that degrade many proteins involved in innate immunity to proteases that are extremely precise and specific in their mode of action. Here we have assembled a comprehensive picture of how bacterial proteases affect the host's innate immune system to gain advantage and cause infection. This picture is far from being complete since the numbers of mechanisms utilized are as astonishing as they are diverse, ranging from degradation of molecules vital to innate immune mechanisms to subversion of the mechanisms to allow the bacterium to hide from the system or take advantage of it. It is vital that such mechanisms are elucidated to allow strategies to be developed to aid the innate immune system in controlling bacterial infections.

  19. Extracellular proteases from eight psychrotolerant Antarctic strains.

    PubMed

    Vazquez, Susana C; Coria, Silvia H; MacCormack, Walter P

    2004-01-01

    Extracellular proteases from 8 Antarctic psychrotolerant Pseudomonas sp. strains were purified and characterised. All of them are neutral metalloproteases, have an apparent molecular mass of 45kDa, optimal activity at 40 degrees C and pH 7-9, retaining significant activity at pH 5-11. With the exception of P96-18, which is less stable, all retain more than 50% activity after 3 h of incubation at pH 5-9 and show low thermal stability (their half-life times range from 20 to 60 min at 40 degrees C and less than 5 min at 50 degrees C). These proteases can be used in commercial processes carried out at neutral pH and moderate temperatures, and are of special interest for their application in mixtures of enzymes where final thermal selective inactivation is needed. Results also highlight the relevance of Antarctic biotopes for the isolation of protease-producing enzymes active at low temperatures.

  20. Corruption of Innate Immunity by Bacterial Proteases

    PubMed Central

    Potempa, Jan; Pike, Robert N.

    2009-01-01

    The innate immune system of the human body has developed numerous mechanisms to control endogenous and exogenous bacteria and thus prevent infections by these microorganisms. These mechanisms range from physical barriers such as the skin or mucosal epithelium to a sophisticated array of molecules and cells that function to suppress or prevent bacterial infection. Many bacteria express a variety of proteases, ranging from non-specific and powerful enzymes that degrade many proteins involved in innate immunity to proteases that are extremely precise and specific in their mode of action. Here we have assembled a comprehensive picture of how bacterial proteases affect the host’s innate immune system to gain advantage and cause infection. This picture is far from being complete since the numbers of mechanisms utilized are as astonishing as they are diverse, ranging from degradation of molecules vital to innate immune mechanisms to subversion of the mechanisms to allow the bacterium to hide from the system or take advantage of it. It is vital that such mechanisms are elucidated to allow strategies to be developed to aid the innate immune system in controlling bacterial infections. PMID:19756242

  1. Development of a Gaussia Luciferase-Based Human Norovirus Protease Reporter System: Cell Type-Specific Profile of Norwalk Virus Protease Precursors and Evaluation of Inhibitors

    PubMed Central

    Qu, Lin; Vongpunsawad, Sompong; Atmar, Robert L.; Prasad, B. V. Venkataram

    2014-01-01

    ABSTRACT Norwalk virus (NV) is the prototype strain of human noroviruses (HuNoVs), a group of positive-strand RNA viruses in the Caliciviridae family and the leading cause of epidemic gastroenteritis worldwide. Investigation of HuNoV replication and development of antiviral therapeutics in cell culture remain challenging tasks. Here, we present NoroGLuc, a HuNoV protease reporter system based on a fusion of NV p41 protein with a naturally secreted Gaussia luciferase (GLuc), linked by the p41/p22 cleavage site for NV protease (Pro). trans cleavage of NoroGLuc by NV Pro or Pro precursors results in release and secretion of an active GLuc. Using this system, we observed a cell type-specific activity profile of NV Pro and Pro precursors, suggesting that the activity of NV Pro is modulated by other viral proteins in the precursor forms and strongly influenced by cellular factors. NoroGLuc was also cleaved by Pro and Pro precursors generated from replication of NV stool RNA in transfected cells, resulting in a measurable increase of secreted GLuc. Truncation analysis revealed that the N-terminal membrane association domain of NV p41 is critical for NoroGLuc activity. Although designed for NV, a genogroup GI.1 norovirus, NoroGLuc also efficiently detects Pro activities from GII.3 and GII.4 noroviruses. At noncytotoxic concentrations, protease inhibitors ZnCl2 and Nα-p-tosyl-l-lysine chloromethyl ketone (TLCK) exhibited dose-dependent inhibitory effects on a GII.4 Pro by NoroGLuc assay. These results establish NoroGLuc as a pan-genogroup HuNoV protease reporter system that can be used for the study of HuNoV proteases and precursors, monitoring of viral RNA replication, and evaluation of antiviral agents. IMPORTANCE Human noroviruses are the leading cause of epidemic gastroenteritis worldwide. Currently, there are no vaccines or antiviral drugs available to counter these highly contagious viruses. These viruses are currently noncultivatable in cell culture. Here, we report

  2. A functional proteomics screen of proteases in colorectal carcinoma.

    PubMed Central

    McKerrow, J. H.; Bhargava, V.; Hansell, E.; Huling, S.; Kuwahara, T.; Matley, M.; Coussens, L.; Warren, R.

    2000-01-01

    BACKGROUND: Proteases facilitate several steps in cancer progression. To identify proteases most suitable for drug targeting, actual enzyme activity and not messenger RNA levels or immunoassay of protein is the ideal assay readout. MATERIALS AND METHODS: An automated microtiter plate assay format was modified to allow detection of all four major classes of proteases in tissue samples. Fifteen sets of colorectal carcinoma biopsies representing primary tumor, adjacent normal colon, and liver metastases were screened for protease activity. RESULTS: The major proteases detected were matrix metalloproteases (MMP9, MMP2, and MMP1), cathepsin B, cathepsin D, and the mast cell serine proteases, tryptase and chymase. Matrix metalloproteases were expressed at higher levels in the primary tumor than in adjacent normal tissue. The mast cell proteases, in contrast, were at very high levels in adjacent normal tissue, and not detectable in the metastases. Cathepsin B activity was significantly higher in the primary tumor, and highest in the metastases. The major proteases detected by activity assays were then localized in biopsy sections by immunohistochemistry. Mast cell proteases were abundant in adjacent normal tissue, because of infiltration of the lamina propria by mast cells. Matrix metalloproteases were localized to the tumor cells themselves; whereas, cathepsin B was predominantly expressed by macrophages at the leading edge of invading tumors. Although only low levels of urinary plasminogen activator were detected by direct enzyme assay, immunohistochemistry showed abundant protein within the tumor. CONCLUSIONS: This analysis, surveying all major classes of proteases by assays of activity rather than immunolocalization or in situ hybridization alone, serves to identify proteases whose activity is not completely balanced by endogenous inhibitors and which may be essential for tumor progression. These proteases are logical targets for initial efforts to produce low

  3. Serine protease activity in developmental stages of Eimeria tenella.

    PubMed

    Fetterer, R H; Miska, K B; Lillehoj, H; Barfield, R C

    2007-04-01

    A number of complex processes are involved in Eimeria spp. survival, including control of sporulation, intracellular invasion, evasion of host immune responses, successful reproduction, and nutrition. Proteases have been implicated in many of these processes, but the occurrence and functions of serine proteases have not been characterized. Bioinformatic analysis suggests that the Eimeria tenella genome contains several serine proteases that lack homology to trypsin. Using RT-PCR, a gene encoding a subtilisin-like and a rhomboid protease-like serine protease was shown to be developmentally regulated, both being poorly expressed in sporozoites (SZ) and merozoites (MZ). Casein substrate gel electrophoresis of oocyst extracts during sporulation demonstrated bands of proteolytic activity with relative molecular weights (Mr) of 18, 25, and 45 kDa that were eliminated by coincubation with serine protease inhibitors. A protease with Mr of 25 kDa was purified from extracts of unsporulated oocysts by a combination of affinity and anion exchange chromatography. Extracts of SZ contained only a single band of inhibitor-sensitive proteolytic activity at 25 kDa, while the pattern of proteases from extracts of MZ was similar to that of oocysts except for the occurrence of a 90 kDa protease, resistant to protease inhibitors. Excretory-secretory products (ESP) from MZ contained AEBSF (4-[2-Aminoethyl] benzenesulphonyl fluoride)-sensitive protease activity with a specific activity about 10 times greater than that observed in MZ extracts. No protease activity was observed in the ESP from SZ. Pretreatment of SZ with AEBSF significantly reduced SZ invasion and the release of the microneme protein, MIC2. The current results suggest that serine proteases are present in all the developmental stages examined.

  4. HIV-protease inhibitors block the replication of both vesicular stomatitis and influenza viruses at an early post-entry replication step

    SciTech Connect

    Federico, Maurizio

    2011-08-15

    The inhibitors of HIV-1 protease (PIs) have been designed to block the activity of the viral aspartyl-protease. However, it is now accepted that this family of inhibitors can also affect the activity of cell proteases. Since the replication of many virus species requires the activity of host cell proteases, investigating the effects of PIs on the life cycle of viruses other than HIV would be of interest. Here, the potent inhibition induced by saquinavir and nelfinavir on the replication of both vesicular stomatitis and influenza viruses is described. These are unrelated enveloped RNA viruses infecting target cells upon endocytosis and intracellular fusion. The PI-induced inhibition was apparently a consequence of a block at the level of the fusion between viral envelope and endosomal membranes. These findings would open the way towards the therapeutic use of PIs against enveloped RNA viruses other than HIV.

  5. Using in silico techniques: Isolation and characterization of an insect cuticle-degrading-protease gene from Beauveria bassiana.

    PubMed

    Khan, Sehroon; Nadir, Sadia; Wang, Xuewen; Khan, Afsar; Xu, Jianchu; Li, Meng; Tao, Lihong; Khan, Siraj; Karunarathna, Samantha C

    2016-08-01

    Cuticle-degrading-proteases (CDPs) secreted by Beauveria spp. are pivotal biocontrol substances, possessing commercial potential for developing bio-pesticides. Therefore, a thoughtful and contemplative understanding and assessment of the structural and functional features of these proteases would markedly assist the development of biogenic pesticides. Computational molecular biology is a new facile alternative approach to the tedious experimental molecular biology; therefore, by using bioinformatics tools, we isolated and characterized an insect CDP gene from Beauveria bassiana 70 s.l. genomic DNA. The CDP gene (1240 bp with GeneBank accession no. KT804651.1) consisted of three introns and four CDS exons, and shared 74-100% sequence identity to the reference CDP genes. Its phylogenetic tree results showed a unique evolution pattern, and the predicted amino acid peptide (PAAP) consisted of 344 amino acid residues with pI, molecular weight, instability index, grand average hydropathicity value and aliphatic index of 7.2, 35.4 kDa, 24.45, -0.149, and 76.63, respectively. The gene possessed 74-89% amino acid sequence similarity to the 12 reference strains. Three motifs (Peptidase_S8 subtilase family) were detected in the PAAP, and the computed 3D structure possessed 79.09% structural identity to alkaline serine proteases. The PAAP had four (three serine proteases and one Pyridoxal-dependent decarboxylase) conserved domains, a disulfide bridge, two calcium binding sites, MY domain, and three predicted active sites in the serine family domains. These results will set the groundwork for further exploitation of proteases and understanding the mechanism of disease caused by cuticle-degrading-serine-proteases from entomopathogenic fungi.

  6. Diverse enzymatic specificities of digestive proteases, 'intestains', enable Colorado potato beetle larvae to counteract the potato defence mechanism.

    PubMed

    Gruden, Kristina; Popovic, Tatjana; Cimerman, Nina; Krizaj, Igor; Strukelj, Borut

    2003-02-01

    In response to insect attack, high levels of proteinase inhibitors are synthesised in potato leaves. This can cause inefficient protein digestion in insects, leading to reduced growth, delayed development and lower fecundity. It has been suggested that Colorado potato beetle overcomes this defence mechanism by inducing the production of a set of cysteine proteases that are resistant to potato proteinase inhibitors. Experiments with gut extracts showed that these proteases have unusual inhibition profiles as they are not inhibited by most of the cystatins but are strongly inhibited by thyropins. In this study we have isolated three cysteine proteases from adapted guts of Colorado potato beetle larvae, named intestains 1, 2 and 3, the first cysteine proteases known to be involved in extracellular protein digestion. The N-terminal sequences suggest their classification into the papain family. Intestains differ in substrate specificities and inhibitory profiles. Their substrate specificities suggest that intestains 1 and 2 are general digestive enzymes, while intestain 3 has a more specific function. The inhibitory profile of intestain 1 is similar to that of proteases of the papain family. However, the Ki values for the interaction of intestain 2 with the same set of inhibitors are several hundred fold higher, which would enable the enzyme to circumvent the potato defence mechanism characterised by high concentrations of protease inhibitors in attacked potato leaves. A further, different strategy of the Colorado potato beetle to avoid potato defence is exhibited by intestain 3, which is able to cleave off the N-terminus of model cystatin and thus inactivate the inhibitor. These results suggest that the Colorado potato beetle combines different strategies to counteract plant defence mechanisms.

  7. Enzymatic characterization of germination-specific cysteine protease-1 expressed transiently in cotyledons during the early phase of germination.

    PubMed

    Tsuji, Akihiko; Tsukamoto, Kana; Iwamoto, Keiko; Ito, Yuka; Yuasa, Keizo

    2013-01-01

    Papain-like cysteine protease activity that shows a unique transient expression profile in cotyledons of daikon radish during germination was detected. The enzyme showed a distinct elution pattern on DEAE-cellulose compared with cathepsin B-like and Responsive to dessication-21 cysteine protease. Although this activity was not detected in seed prior to imbibition, the activity increased markedly and reached a maximum at 2 days after imbibition and then decreased rapidly and completely disappeared after 5 days. Using cystatin-Sepharose, the 26 kDa cysteine protease (DRCP26) was isolated from cotyledons at 2 days after imbibition. The deduced amino acid sequence from the cDNA nucleotide sequence indicated that DRCP26 is an orthologue of Arabidopsis unidentified protein, germination-specific cysteine protease-1, belonging to the C1 family of cysteine protease predicted from genetic information. In an effort to characterize the enzymatic properties of DRCP26, the enzyme was purified to homogeneity from cotyledons at 48 h after imbibition. The best synthetic substrate for the enzyme was carbobenzoxy-Phe-Arg-4-methylcoumaryl-7-amide. All model peptides were digested to small peptides by the enzyme, suggesting that DRCP26 possesses broad cleavage specificity. These results indicated that DRCP26 plays a role in the mobilization of storage proteins in the early phase of seed germination.

  8. Enzymatic characterization of germination-specific cysteine protease-1 expressed transiently in cotyledons during the early phase of germination*

    PubMed Central

    Tsuji, Akihiko; Tsukamoto, Kana; Iwamoto, Keiko; Ito, Yuka; Yuasa, Keizo

    2013-01-01

    Papain-like cysteine protease activity that shows a unique transient expression profile in cotyledons of daikon radish during germination was detected. The enzyme showed a distinct elution pattern on DEAE-cellulose compared with cathepsin B-like and Responsive to dessication-21 cysteine protease. Although this activity was not detected in seed prior to imbibition, the activity increased markedly and reached a maximum at 2 days after imbibition and then decreased rapidly and completely disappeared after 5 days. Using cystatin-Sepharose, the 26 kDa cysteine protease (DRCP26) was isolated from cotyledons at 2 days after imbibition. The deduced amino acid sequence from the cDNA nucleotide sequence indicated that DRCP26 is an orthologue of Arabidopsis unidentified protein, germination-specific cysteine protease-1, belonging to the C1 family of cysteine protease predicted from genetic information. In an effort to characterize the enzymatic properties of DRCP26, the enzyme was purified to homogeneity from cotyledons at 48 h after imbibition. The best synthetic substrate for the enzyme was carbobenzoxy-Phe-Arg-4-methylcoumaryl-7-amide. All model peptides were digested to small peptides by the enzyme, suggesting that DRCP26 possesses broad cleavage specificity. These results indicated that DRCP26 plays a role in the mobilization of storage proteins in the early phase of seed germination. PMID:23112094

  9. Structural Insight into Serine Protease Rv3671c that Protects M. tuberculosis from Oxidative and Acidic Stress

    SciTech Connect

    Biswas, Tapan; Small, Jennifer; Vandal, Omar; Odaira, Toshiko; Deng, Haiteng; Ehrt, Sabine; Tsodikov, Oleg V.

    2010-11-15

    Rv3671c, a putative serine protease, is crucial for persistence of Mycobacterium tuberculosis in the hostile environment of the phagosome. We show that Rv3671c is required for M. tuberculosis resistance to oxidative stress in addition to its role in protection from acidification. Structural and biochemical analyses demonstrate that the periplasmic domain of Rv3671c is a functional serine protease of the chymotrypsin family and, remarkably, that its activity increases on oxidation. High-resolution crystal structures of this protease in an active strained state and in an inactive relaxed state reveal that a solvent-exposed disulfide bond controls the protease activity by constraining two distant regions of Rv3671c and stabilizing it in the catalytically active conformation. In vitro biochemical studies confirm that activation of the protease in an oxidative environment is dependent on this reversible disulfide bond. These results suggest that the disulfide bond modulates activity of Rv3671c depending on the oxidative environment in vivo.

  10. Purification, characterization, and properties of an alkaline protease produced by Serratia marcescens S3-R1 inhabiting Korean ginseng rhizosphere.

    PubMed

    Nam, Myoung Soo; Whang, Kyung Sook; Choi, Seong Hyun; Bae, Hyoung Churl; Kim, Yoo Kyeong; Park, Young W

    2013-12-01

    An alkaline protease produced by the Serratia marcescens S3-R1 which inhabits in the Korean ginseng rhizosphere was investigated. The purposes of this study were to characterize and purify the bacterial enzyme by four different purification steps: precipitation of enzyme fraction by ammonium sulfate, loading the enzyme pellets on a DEAE-Sepharose anion-exchange chromatograph, separation of the fraction containing enzyme activity by fast protein liquid Mono Q chromatography and identification of the single-band fraction by sodium dodecyl sulfate-polyacrylamide gel electrophoresis, and then quantification of the single-band fraction by reverse-phase high-performance liquid chromatography. The molecular weight of the purified protease was estimated as 50 308 Da by matrix-assisted laser desorption ionization time-of-flight analysis. The N-terminal amino acid sequence of the protease was identified as Ala-Val-Thr-Ile-Glu-Asp-Ala-Val-Asp-Asp, and the enzyme belongs to the metalloprotease family. The optimal activities of the protease occurred at pH 7-9 and a temperature 40 °C. The ranges of pH and thermal stability of the enzyme were at 7-10 and 30-40 °C, respectively. The alkaline protease was successfully purified and characterized from the bacterium Serratia marcescens S3-R1, which has potential for industrial application, including milk protein hydrolysates. © 2013 Society of Chemical Industry.

  11. Cloning, expression and characterisation of an HtrA-like serine protease produced in vivo by Mycobacterium leprae.

    PubMed

    Ribeiro-Guimarães, Michelle Lopes; Marengo, Eliana Blini; Tempone, Antonio Jorge; Amaral, Julio Jablonski; Klitzke, Clécio F; Silveira, Erika K Xavier da; Portaro, Fernanda Calheta Vieira; Pessolani, Maria Cristina Vidal

    2009-12-01

    Members of the high temperature requirement A (HtrA) family of chaperone proteases have been shown to play a role in bacterial pathogenesis. In a recent report, we demonstrated that the gene ML0176, which codes for a predicted HtrA-like protease, a gene conserved in other species of mycobacteria, is transcribed by Mycobacterium leprae in human leprosy lesions. In the present study, the recombinant ML0176 protein was produced and its enzymatic properties investigated. M. lepraerecombinant ML0176 was able to hydrolyse a variety of synthetic and natural peptides. Similar to other HtrA proteins, this enzyme displayed maximum proteolytic activity at temperatures above 40 degrees C and was completely inactivated by aprotinin, a protease inhibitor with high selectivity for serine proteases. Finally, analysis of M. leprae ML0176 specificity suggested a broader cleavage preference than that of previously described HtrAs homologues. In summary, we have identified an HtrA-like protease in M. lepraethat may constitute a potential new target for the development of novel prophylactic and/or therapeutic strategies against mycobacterial infections.

  12. A potential Kazal-type serine protease inhibitor involves in kinetics of protease inhibition and bacteriostatic activity.

    PubMed

    Kumaresan, Venkatesh; Harikrishnan, Ramaswamy; Arockiaraj, Jesu

    2015-02-01

    Kazal-type serine protease inhibitor (KSPI) is a pancreatic secretary trypsin inhibitor which involves in various cellular component regulations including development and defense process. In this study, we have characterized a KSPI cDNA sequence of freshwater striped murrel fish Channa striatus (Cs) at molecular level. Cellular location analysis predicted that the CsKSPI was an extracellular protein. The domain analysis showed that the CsKSPI contains a Kazal domain at 47-103 along with its family signature between 61 and 83. Phylogenetically, CsKSPI is closely related to KSPI from Maylandia zebra and formed a sister group with mammals. The 2D structure of CsKSPI showed three α-helical regions which are connected with random coils, one helix at signal sequence and two at the Kazal domain region. The relative gene expression showed that the CsKSPI was highly expressed in gills and its expression was induced upon fungus (Aphanomyces invadans), bacteria (Aeromonas hydrophila) and poly I:C (a viral analogue) challenge. The CsKSPI recombinant protein was produced to characterize and study the CsKSPI gene specific functions. The recombinant CsKSPI strongly inhibited trypsin compared to other tested proteases. The results of the kinetic activity of CsKSPI against trypsin was V(max)s = 1.62 nmol/min, K(M)s = 0.21 mM and K(i)s = 15.37 nM. Moreover, the recombinant CsKSPI inhibited the growth of Gram-negative bacteria A. hydrophila at 20 μM and Gram-positive bacteria Bacillus subtilis at the MIC50 of 15 μM. Overall, the study indicated that the CsKSPI was a potential trypsin inhibitor which involves in antimicrobial activity.

  13. Sequence conservation, phylogenetic relationships, and expression profiles of nondigestive serine proteases and serine protease homologs in Manduca sexta

    PubMed Central

    Cao, Xiaolong; He, Yan; Hu, Yingxia; Zhang, Xiufeng; Wang, Yang; Zou, Zhen; Chen, Yunru; Blissard, Gary W.; Kanost, Michael R.; Jiang, Haobo

    2015-01-01

    Serine protease (SP) and serine protease homolog (SPH) genes in insects encode a large family of proteins involved in digestion, development, immunity, and other processes. While 68 digestive SPs and their close homologs are reported in a companion paper (Kuwar et al., 2015), we have identified 125 other SPs/SPHs in Manduca sexta and studied their structure, evolution, and expression. Fifty-two of them contain cystine-stabilized structures for molecular recognition, including clip, LDLa, Sushi, Wonton, TSP, CUB, Frizzle, and SR domains. There are nineteen groups of genes evolved from relatively recent gene duplication and sequence divergence. Thirty-five SPs and seven SPHs contain 1, 2 or 5 clip domains. Multiple sequence alignment and molecular modeling of the 54 clip domains have revealed structural diversity of these regulatory modules. Sequence comparison with their homologs in Drosophila melanogaster, Anopheles gambiae and Tribolium castaneum allows us to classify them into five subfamilies: A are SPHs with 1 or 5 group-3 clip domains, B are SPs with 1 or 2 group-2 clip domains, C, D1 and D2 are SPs with a single clip domain in group-1a, 1b and 1c, respectively. We have classified into six categories the 125 expression profiles of SP-related proteins in fat body, brain, midgut, Malpighian tubule, testis, and ovary at different stages, suggesting that they participate in various physiological processes. Through RNA-Seq-based gene annotation and expression profiling, as well as intragenomic sequence comparisons, we have established a framework of information for future biochemical research of nondigestive SPs and SPHs in this model species. PMID:25530503

  14. Reaching the melting point: Degradative enzymes and protease inhibitors involved in baculovirus infection and dissemination.

    PubMed

    Ishimwe, Egide; Hodgson, Jeffrey J; Clem, Rollie J; Passarelli, A Lorena

    2015-05-01

    Baculovirus infection of a host insect involves several steps, beginning with initiation of virus infection in the midgut, followed by dissemination of infection from the midgut to other tissues in the insect, and finally culminating in "melting" or liquefaction of the host, which allows for horizontal spread of infection to other insects. While all of the viral gene products are involved in ultimately reaching this dramatic infection endpoint, this review focuses on two particular types of baculovirus-encoded proteins: degradative enzymes and protease inhibitors. Neither of these types of proteins is commonly found in other virus families, but they both play important roles in baculovirus infection. The types of degradative enzymes and protease inhibitors encoded by baculoviruses are discussed, as are the roles of these proteins in the infection process. Copyright © 2015 Elsevier Inc. All rights reserved.

  15. Granulosain I, a cysteine protease isolated from ripe fruits of Solanum granuloso-leprosum (Solanaceae).

    PubMed

    Vallés, Diego; Bruno, Mariela; López, Laura M I; Caffini, Néstor O; Cantera, Ana María B

    2008-08-01

    A new cysteine peptidase (Granulosain I) was isolated from ripe fruits of Solanum granuloso-leprosum Dunal (Solanaceae) by means of precipitation with organic solvent and cation exchange chromatography. The enzyme showed a single band by SDS-PAGE, its molecular mass was 24,746 Da (MALDI-TOF/MS) and its isoelectric point was higher than 9.3. It showed maximum activity (more than 90%) in the pH range 7-8.6. Granulosain I was completely inhibited by E-64 and activated by the addition of cysteine or 2-mercaptoethanol, confirming its cysteinic nature. The kinetic studies carried out with PFLNA as substrate, showed an affinity (Km 0.6 mM) slightly lower than those of other known plant cysteine proteases (papain and bromelain). The N-terminal sequence of granulosain I (DRLPASVDWRGKGVLVLVKNQGQC) exhibited a close homology with other cysteine proteases belonging to the C1A family.

  16. Type II transmembrane serine proteases as potential targets for cancer therapy

    PubMed Central

    Murray, Andrew S.; Varela, Fausto A.

    2016-01-01

    Carcinogenesis is accompanied by increased protein and activity levels of extracellular cell-surface proteases that are capable of modifying the tumor micro-environment by directly cleaving the extracellular matrix, as well as activating growth factors and proinflammatory mediators involved in proliferation and invasion of cancer cells, and recruitment of inflammatory cells. These complex processes ultimately potentiate neoplastic progression leading to local tumor cell invasion, entry into the vasculature, and metastasis to distal sites. Several members of the type II transmembrane serine protease (TTSP) family have been shown to play critical roles in cancer progression. In this review the knowledge collected over the past two decades about the molecular mechanisms underlying the pro-cancerous properties of selected TTSPs will be summarized. Furthermore, we will discuss how these insights may facilitate the translation into clinical settings in the future by specifically targeting TTSPs as part of novel cancer treatment regimens. PMID:27078673

  17. Entomotoxic and nematotoxic lectins and protease inhibitors from fungal fruiting bodies.

    PubMed

    Sabotič, Jerica; Ohm, Robin A; Künzler, Markus

    2016-01-01

    Fruiting bodies or sporocarps of dikaryotic (ascomycetous and basidiomycetous) fungi, commonly referred to as mushrooms, are often rich in entomotoxic and nematotoxic proteins that include lectins and protease inhibitors. These protein toxins are thought to act as effectors of an innate defense system of mushrooms against animal predators including fungivorous insects and nematodes. In this review, we summarize current knowledge about the structures, target molecules, and regulation of the biosynthesis of the best characterized representatives of these fungal defense proteins, including galectins, beta-trefoil-type lectins, actinoporin-type lectins, beta-propeller-type lectins and beta-trefoil-type chimerolectins, as well as mycospin and mycocypin families of protease inhibitors. We also present an overview of the phylogenetic distribution of these proteins among a selection of fungal genomes and draw some conclusions about their evolution and physiological function. Finally, we present an outlook for future research directions in this field and their potential applications in medicine and crop protection.

  18. Reaching the Melting Point: Degradative Enzymes and Protease Inhibitors Involved in Baculovirus Infection and Dissemination

    PubMed Central

    Ishimwe, Egide; Hodgson, Jeffrey J.; Clem, Rollie J.; Passarelli, A. Lorena

    2015-01-01

    Baculovirus infection of a host insect involves several steps, beginning with initiation of virus infection in the midgut, followed by dissemination of infection from the midgut to other tissues in the insect, and finally culminating in “melting” or liquefaction of the host, which allows for horizontal spread of infection to other insects. While all of the viral gene products are involved in ultimately reaching this dramatic infection endpoint, this review focuses on two particular types of baculovirus-encoded proteins: degradative enzymes and protease inhibitors. Neither of these types of proteins is commonly found in other virus families, but they both play important roles in baculovirus infection. The types of degradative enzymes and protease inhibitors encoded by baculoviruses are discussed, as are the roles of these proteins in the infection process. PMID:25724418

  19. Arabidopsis AtSerpin1, Crystal Structure and in Vivo Interaction with Its Target Protease RESPONSIVE TO DESICCATION-21 (RD21)

    SciTech Connect

    Lampl, Nardy; Budai-Hadrian, Ofra; Davydov, Olga; Joss, Tom V.; Harrop, Stephen J.; Curmi, Paul M.G.; Roberts, Thomas H.; Fluhr, Robert

    2010-05-25

    In animals, protease inhibitors of the serpin family are associated with many physiological processes, including blood coagulation and innate immunity. Serpins feature a reactive center loop (RCL), which displays a protease target sequence as a bait. RCL cleavage results in an irreversible, covalent serpin-protease complex. AtSerpin1 is an Arabidopsis protease inhibitor that is expressed ubiquitously throughout the plant. The x-ray crystal structure of recombinant AtSerpin1 in its native stressed conformation was determined at 2.2 {angstrom}. The electrostatic surface potential below the RCL was found to be highly positive, whereas the breach region critical for RCL insertion is an unusually open structure. AtSerpin1 accumulates in plants as a full-length and a cleaved form. Fractionation of seedling extracts by nonreducing SDS-PAGE revealed the presence of an additional slower migrating complex that was absent when leaves were treated with the specific cysteine protease inhibitor l-trans-epoxysuccinyl-l-leucylamido (4-guanidino)butane. Significantly, RESPONSIVE TO DESICCATION-21 (RD21) was the major protease labeled with the l-trans-epoxysuccinyl-l-leucylamido (4-guanidino)butane derivative DCG-04 in wild type extracts but not in extracts of mutant plants constitutively overexpressing AtSerpin1, indicating competition. Fractionation by nonreducing SDS-PAGE followed by immunoblotting with RD21-specific antibody revealed that the protease accumulated both as a free enzyme and in a complex with AtSerpin1. Importantly, both RD21 and AtSerpin1 knock-out mutants lacked the serpin-protease complex. The results establish that the major Arabidopsis plant serpin interacts with RD21. This is the first report of the structure and in vivo interaction of a plant serpin with its target protease.

  20. Proteolytic Activity Matrix Analysis (PrAMA) for Simultaneous Determination of Multiple Protease Activities

    PubMed Central

    Miller, Miles A.; Barkal, Layla; Jeng, Karen; Herrlich, Andreas; Griffith, Linda G.; Lauffenburger, Douglas A.

    2011-01-01

    Matrix metalloproteinases (MMPs) and A Disintegrin and Metalloproteinases (ADAMs) are two related protease families that play key roles in matrix remodeling and growth factor ligand shedding. Directly ascertaining the proteolytic activities of particular MMPs and ADAMs in physiological environments in a non-invasive, real-time, multiplex manner remains a challenge. This work describes Proteolytic Activity Matrix Analysis (PrAMA), an integrated experimental measurement and mathematical analysis framework for simultaneously determining the activities of particular enzymes in complex mixtures of MMPs and ADAMs. The PrAMA method interprets dynamic signals from panels of moderately specific FRET-based polypeptide protease substrates to deduce a profile of specific MMP and ADAM proteolytic activities. Deconvolution of signals from complex mixtures of proteases is accomplished using prior data on individual MMP/ADAM cleavage signatures for the substrate panel measured with purified enzymes. We first validate PrAMA inference using a compendium of roughly 4000 measurements involving known mixtures of purified enzymes and substrates, and then demonstrate application to the live-cell response of wildtype, ADAM10−/−, and ADAM17−/− fibroblasts to phorbol ester stimulation. Results indicate PrAMA can distinguish closely related enzymes from each other with high accuracy, even in the presence of unknown background proteolytic activity. PrAMA offers a valuable tool for applications ranging from live-cell in vitro assays to high-throughput inhibitor screening with complex enzyme mixtures. Moreover, our approach may extend to other families of proteases, such as caspases and cathepsins, that also can lack highly-specific substrates. PMID:21180771

  1. Diversity of both the cultivable protease-producing bacteria and bacterial extracellular proteases in the coastal sediments of King George Island, Antarctica.

    PubMed

    Zhou, Ming-Yang; Wang, Guang-Long; Li, Dan; Zhao, Dian-Li; Qin, Qi-Long; Chen, Xiu-Lan; Chen, Bo; Zhou, Bai-Cheng; Zhang, Xi-Ying; Zhang, Yu-Zhong

    2013-01-01

    Protease-producing bacteria play a vital role in degrading sedimentary organic nitrogen. However, the diversity of these bacteria and their extracellular proteases in most regions remain unknown. In this paper, the diversity of the cultivable protease-producing bacteria and of bacterial extracellular proteases in the sediments of Maxwell Bay, King George Island, Antarctica was investigated. The cultivable protease-producing bacteria reached 10(5) cells/g in all 8 sediment samples. The cultivated protease-producing bacteria were mainly affiliated with the phyla Actinobacteria, Firmicutes, Bacteroidetes, and Proteobacteria, and the predominant genera were Bacillus (22.9%), Flavobacterium (21.0%) and Lacinutrix (16.2%). Among these strains, Pseudoalteromonas and Flavobacteria showed relatively high protease production. Inhibitor analysis showed that nearly all the extracellular proteases from the bacteria were serine proteases or metalloproteases. These results begin to address the diversity of protease-producing bacteria and bacterial extracellular proteases in the sediments of the Antarctic Sea.

  2. Economic Methods of Ginger Protease'sextraction and Purification

    NASA Astrophysics Data System (ADS)

    Qiao, Yuanyuan; Tong, Junfeng; Wei, Siqing; Du, Xinyong; Tang, Xiaozhen

    This article reports the ginger protease extraction and purification methods from fresh ginger rhizome. As to ginger protease extraction, we adapt the steps of organic solvent dissolving, ammonium sulfate depositing and freeze-drying, and this method can attain crude enzyme powder 0.6% weight of fresh ginger rhizome. The purification part in this study includes two steps: cellulose ion exchange (DEAE-52) and SP-Sephadex 50 chromatography, which can purify crude ginger protease through ion and molecular weight differences respectively.

  3. A preliminary neutron diffraction analysis of Achromobacter protease I

    NASA Astrophysics Data System (ADS)

    Ohnishi, Yuki; Masaki, Takeharu; Yamada, Taro; Kurihara, Kazuo; Tanaka, Ichiro; Niimura, Nobuo

    2010-11-01

    Achromobacter protease I (API, E.C. 3.4.21.50) is one of the serine proteases produced by Achromobacter lyticus M497-1. API is distinct from the other tripsin type protease in its lysine specificity. The neutron structure analysis of catalytic triad with Trp169 and His210 was presented. His57 was double protonated and formed hydrogen bonds to Ser194Oγ and Asp113Oδ1, Oδ2.

  4. Fibrin(ogen)olytic activity of bumblebee venom serine protease

    SciTech Connect

    Qiu Yuling; Choo, Young Moo; Yoon, Hyung Joo; Jia Jingming; Cui Zheng; Wang Dong; Kim, Doh Hoon; Sohn, Hung Dae; Jin, Byung Rae

    2011-09-01

    Bee venom is a rich source of pharmacologically active components; it has been used as an immunotherapy to treat bee venom hypersensitivity, and venom therapy has been applied as an alternative medicine. Here, we present evidence that the serine protease found in bumblebee venom exhibits fibrin(ogen)olytic activity. Compared to honeybee venom, bumblebee venom contains a higher content of serine protease, which is one of its major components. Venom serine proteases from bumblebees did not cross-react with antibodies against the honeybee venom serine protease. We provide functional evidence indicating that bumblebee (Bombus terrestris) venom serine protease (Bt-VSP) acts as a fibrin(ogen)olytic enzyme. Bt-VSP activates prothrombin and directly degrades fibrinogen into fibrin degradation products. However, Bt-VSP is not a plasminogen activator, and its fibrinolytic activity is less than that of plasmin. Taken together, our results define roles for Bt-VSP as a prothrombin activator, a thrombin-like protease, and a plasmin-like protease. These findings offer significant insight into the allergic reaction sequence that is initiated by bee venom serine protease and its potential usefulness as a clinical agent in the field of hemostasis and thrombosis. - Graphical abstract: Display Omitted Highlights: > Bumblebee venom serine protease (Bt-VSP) is a fibrin(ogen)olytic enzyme. > Bt-VSP activates prothrombin. > Bt-VSP directly degrades fibrinogen into fibrin degradation products. > Bt-VSP is a hemostatically active protein that is a potent clinical agent.

  5. Extracellular Bacterial Proteases in Chronic Wounds: A Potential Therapeutic Target?

    PubMed

    Suleman, Louise

    2016-10-01

    Significance: Bacterial biofilms are considered to be responsible for over 80% of persistent infections, including chronic lung infections, osteomyelitis, periodontitis, endocarditis, and chronic wounds. Over 60% of chronic wounds are colonized with bacteria that reside within a biofilm. The exaggerated proteolytic environment of chronic wounds, more specifically elevated matrix metalloproteinases, is thought to be one of the possible reasons as to why chronic wounds fail to heal. However, the role of bacterial proteases within chronic wounds is not fully understood. Recent Advances: Recent research has shown that bacterial proteases can enable colonization and facilitate bacterial immune evasion. The inhibition of bacterial proteases such as Pseudomonas aeruginosa elastase B (LasB) has resulted in the disruption of the bacterial biofilm in vitro. P. aeruginosa is thought to be a key pathogen in chronic wound infection, and therefore, the disruption of these biofilms, potentially through the targeting of P. aeruginosa bacterial proteases, is an attractive therapeutic endeavor. Critical Issues: Disrupting biofilm formation through the inhibition of bacterial proteases may lead to the dissemination of bacteria from the biofilm, allowing planktonic cells to colonize new sites within the wound. Future Directions: Despite a plethora of evidence supporting the role of bacterial proteases as virulence factors in infection, there remains a distinct lack of research into the effect of bacterial proteases in chronic wounds. To assess the viability of targeting bacterial proteases, future research should aim to understand the role of these proteases in a variety of chronic wound subtypes.

  6. Crystal structure of the cysteine protease inhibitor 2 from Entamoeba histolytica: Functional convergence of a common protein fold

    SciTech Connect

    Casados-Vázquez, Luz E.; Lara-González, Samuel; Brieb, Luis G.

    2012-04-18

    Cysteine proteases (CP) are key pathogenesis and virulence determinants of protozoan parasites. Entamoeba histolytica contains at least 50 cysteine proteases; however, only three (EhCP1, EhCP2 and EhCP5) are responsible for approximately 90% of the cysteine protease activity in this parasite. CPs are expressed as inactive zymogens. Because the processed proteases are potentially cytotoxic, protozoan parasites have developed mechanisms to regulate their activity. Inhibitors of cysteine proteases (ICP) of the chagasin-like inhibitor family (MEROPS family I42) were recently identified in bacteria and protozoan parasites. E. histolytica contains two ICP-encoding genes of the chagasin-like inhibitor family. EhICP1 localizes to the cytosol, whereas EhICP2 is targeted to phagosomes. Herein, we report two crystal structures of EhICP2. The overall structure of EhICP2 consists of eight {beta}-strands and closely resembles the immunoglobulin fold. A comparison between the two crystal forms of EhICP2 indicates that the conserved BC, DE and FG loops form a flexible wedge that may block the active site of CPs. The positively charged surface of the wedge-forming loops in EhICP2 contrasts with the neutral surface of the wedge-forming loops in chagasin. We postulate that the flexibility and positive charge observed in the DE and FG loops of EhICP2 may be important to facilitate the initial binding of this inhibitor to the battery of CPs present in E. histolytica.

  7. Cloning and analysis of WF146 protease, a novel thermophilic subtilisin-like protease with four inserted surface loops.

    PubMed

    Wu, Jiang; Bian, Yan; Tang, Bing; Chen, Xiangdong; Shen, Ping; Peng, Zhenrong

    2004-01-30

    Cloning and sequencing of the gene encoding WF146 protease, an extracellular subtilisin-like protease from the thermophile Bacillus sp. WF146, revealed that the WF146 protease was translated as a 416-amino acid precursor consisting of a putative 18-amino acid signal peptide, a 10-kDa N-terminal propeptide and a 32-kDa mature protease region. The mature WF146 protease shares a high degree of amino acid sequence identity with two psychrophilic subtilisins, S41 (68.2%) and S39 (65.4%), and a mesophilic subtilisin, SSII (67.1%). Significantly, these closely related proteases adapted to different temperatures all had four inserted surface loops not found in other subtilisins. However, unlike those of S41, S39 and SSII, the inserted loops of the WF146 protease possessed stabilizing features, such as the introduction of Pro residues into the loop regions. Interestingly, the WF146 protease contained five of the seven mutations previously found in a hyperstable variant of subtilisin S41 obtained by directed evolution. The proform of WF146 protease (pro-WF146 protease) was overexpressed in Escherichia coli in an inactive soluble form. After heat treatment, the 42-kDa pro-WF146 protease converted to a 32-kDa active mature form by processing the N-terminal propeptide. The purified mature WF146 protease hydrolyzed casein with an optimum temperature of 85 degrees C, and lost activity with a half-life of 30 min at 80 degrees C in the presence of 10 mM CaCl2.

  8. Reversible Unfolding of Rhomboid Intramembrane Proteases

    PubMed Central

    Panigrahi, Rashmi; Arutyunova, Elena; Panwar, Pankaj; Gimpl, Katharina; Keller, Sandro; Lemieux, M. Joanne

    2016-01-01

    Denaturant-induced unfolding of helical membrane proteins provides insights into their mechanism of folding and domain organization, which take place in the chemically heterogeneous, anisotropic environment of a lipid membrane. Rhomboid proteases are intramembrane proteases that play key roles in various diseases. Crystal structures have revealed a compact helical bundle with a buried active site, which requires conformational changes for the cleavage of transmembrane substrates. A dimeric form of the rhomboid protease has been shown to be important for activity. In this study, we examine the mechanism of refolding for two distinct rhomboids to gain insight into their secondary structure-activity relationships. Although helicity is largely abolished in the unfolded states of both proteins, unfolding is completely reversible for HiGlpG but only partially reversible for PsAarA. Refolding of both proteins results in reassociation of the dimer, with a 90% regain of catalytic activity for HiGlpG but only a 70% regain for PsAarA. For both proteins, a broad, gradual transition from the native, folded state to the denatured, partly unfolded state was revealed with the aid of circular dichroism spectroscopy as a function of denaturant concentration, thus arguing against a classical two-state model as found for many globular soluble proteins. Thermal denaturation has irreversible destabilizing effects on both proteins, yet reveals important functional details regarding substrate accessibility to the buried active site. This concerted biophysical and functional analysis demonstrates that HiGlpG, with a simple six-transmembrane-segment organization, is more robust than PsAarA, which has seven predicted transmembrane segments, thus rendering HiGlpG amenable to in vitro studies of membrane-protein folding. PMID:27028647

  9. Purification of Pseudomonas aeruginosa proteases and microscopic characterization of pseudomonal protease-induced rabbit corneal damage.

    PubMed Central

    Kreger, A S; Gray, L D

    1978-01-01

    Extracellular proteases of three cornea-virulent strains of Pseudomonas aeruginosa were isolated by sequential ammonium sulfate precipitation, Ultrogel AcA 54 gel filtration, and flat-bed isoelectric focusing. The purity of the preparations was determined by sodium dodecyl sulfate-polyacrylamide gel electrophoresis , thin-layer isoelectric focusing in polyacrylamide gel, immunodiffusion and immunoelectrophoretic procedures, and tests for the presence of other known pseudomonal products. Light and electron microscopic examination of rabbit corneal lesions observed 4 to 6 h after the intracorneal injection of submicrogram amounts of the proteases revealed: (i) degeneration and necrosis of epithelium, endothelium, and keratocytes, (ii) infiltration, degeneration, and necrosis of polymorphonuclear leukocytes, (iii) loss of the characteristic weblike pattern, colloidal iron staining, and ruthenium red staining of the stromal proteoglycan ground substance, (iv) dispersal of strucutrally normal appearing collagen fibrils, ground substance, (iv) dispersal of structurally normal appearing collagen fibrils, and (v) accumulation of plasma proteins and fibrin in the necrotic corneas. These structural alterations are very similar to those observed previously during experimental P. aeruginosa keratitis, and this similarity supports the idea that pseudomonal proteases are responsible, at least in part, for the rapid and extensive liquefaction necrosis characteristic of pseudomonal-induced keratitis. In addition, the results support the idea that pseudomonal proteases elicit severe corneal damage by causing the loss of the corneal proteoglycan ground substance, thus resulting in dispersal of undamaged collagen fibrils, weakening of the corneal stroma, and subsequent descemetocele formation and corneal perforation by the anterior chamber pressure. Images PMID:415981

  10. Multiple Proteases to Localize Oxidation Sites

    PubMed Central

    Gu, Liqing; Robinson, Renã A. S.

    2015-01-01

    Proteins present in cellular environments with high levels of reactive oxygen and nitrogen species and/or low levels of antioxidants are highly susceptible to oxidative post-translational modification (PTM). Irreversible oxidative PTMs can generate a complex distribution of modified protein molecules, recently termed as proteoforms. Using ubiquitin as a model system, we mapped oxidative modification sites using trypsin, Lys-C, and Glu-C peptides. Several M+16 Da proteoforms were detected as well as proteoforms that include other previously unidentified oxidative modifications. This work highlights the use of multiple protease digestions to give insights to the complexity of oxidative modifications possible in bottom-up analyses. PMID:25775238

  11. Protease sensing using nontoxic silicon quantum dots

    NASA Astrophysics Data System (ADS)

    Cheng, Xiaoyu; McVey, Benjamin F. P.; Robinson, Andrew B.; Longatte, Guillaume; O'Mara, Peter B.; Tan, Vincent T. G.; Thordarson, Pall; Tilley, Richard D.; Gaus, Katharina; Justin Gooding, John

    2017-08-01

    Herein is presented a proof-of-concept study of protease sensing that combines nontoxic silicon quantum dots (SiQDs) with Förster resonance energy transfer (FRET). The SiQDs serve as the donor and an organic dye as the acceptor. The dye is covalently attached to the SiQDs using a peptide linker. Enzymatic cleavage of the peptide leads to changes in FRET efficiency. The combination of interfacial design and optical imaging presented in this work opens opportunities for use of nontoxic SiQDs relevant to intracellular sensing and imaging.

  12. Rapid Release of Protease Inhibitors from Soybeans

    PubMed Central

    Hwang, David L.; Yang, Wen-Kuang; Foard, Donald E.; Lin, K.-T. -Davis

    1978-01-01

    Specific antisera were prepared against the Bowman-Birk trypsin inhibitor and four other trypsin inhibitors of low molecular weight isolated from soybeans (Glycine max L. cv. Tracy). These antisera were used to detect the presence and amount of the inhibitors in: (a) seeds and protein extracts of soybean meal; (b) seedlings; and (c) the water surrounding the seeds and roots of seedlings. Lectin activities in seeds, seedlings, and water were also determined at the same time as the protease inhibitor activities. By competitive inhibition of immunoprecipitation, the combined five low molecular weight protease inhibitors were found to constitute the following percentages of proteins (w/w): 6.3% in defatted soybean meal; 8.1% of the protein extracted from the meal by a buffer of pH 8.6; 8.3, 14.7, 15.2, 16.1, 17.2, and 18.9% of the protein in a lyophilisate of water in which seeds were incubated for 4, 8, 12, 16, 20, and 24 hours, respectively; 8.2% in a lyophilisate of water in which roots of seedlings grew for 20 days; 1.5% in cotyledons; and less than 0.1% in epicotyls, hypocotyls, and roots of 12-day-old seedlings. Hemagglutination activities, expressed as the lowest amount of protein required to give a positive agglutination of 0.2 ml of 2% rabbit red blood cells, were as follows: purified soybean lectin, 0.08 μg; lyophilisate of water in which seeds were incubated for 4, 8, 12, 16, 20, and 24 hours, 10, 2.5, 5, 5, and 2.5 μg, respectively; lyophilisate of water in which roots grew for 20 days, 5 μg; 12-day-old cotyledons, roots, epicotyls, and hypocotyls, 12.5, 100, >1,000, and >500 μg, respectively. The results indicate that a large amount of protease inhibitors as well as lectins are released from seeds during the first 8 hours of imbibition. Neither lima bean trypsin inhibitor (mol wt, 10,000) nor Kunitz soybean trypsin inhibitor (mol wt, 21,500) showed competitive inhibition in tests with antisera against low molecular weight soybean protease inhibitors

  13. Increased activity of unlinked Zika virus NS2B/NS3 protease compared to linked Zika virus protease.

    PubMed

    Kuiper, Benjamin D; Slater, Kristin; Spellmon, Nicholas; Holcomb, Joshua; Medapureddy, Prasanna; Muzzarelli, Kendall M; Yang, Zhe; Ovadia, Reuben; Amblard, Franck; Kovari, Iulia A; Schinazi, Raymond F; Kovari, Ladislau C

    2017-03-22

    Zika virus (ZIKV) is a flavivirus spread by daytime-active Aedes spp. mosquitoes such as A. aegypti and A. albopictus. Previously thought to be a mild infection, the latest ZIKV outbreak in the Americas is causally associated with more severe symptoms as well as severe birth defects, such as microcephaly. Currently no vaccine or antiviral exists. However, recent progress has demonstrated the viral NS2B/NS3 protease may be a suitable target for the development of small-molecule antiviral agents. To better understand the ZIKV protease, we expressed, purified, and characterized unlinked and linked NS2B/NS3 protease corresponding to an isolate from the recent outbreak in Puerto Rico. Unlinked ZIKV protease is more active and binds substrate with greater affinity than linked ZIKV protease. Therefore, we propose that unlinked ZIKV protease be used when evaluating or designing ZIKV protease inhibitors. Additionally, potent inhibitors of related viral proteases, like West Nile Virus and Dengue virus, may serve as advanced starting points to identify and develop ZIKV protease inhibitors.

  14. Structure of protease-cleaved Escherichia coli α-2-macroglobulin reveals a putative mechanism of conformational activation for protease entrapment

    SciTech Connect

    Fyfe, Cameron D.; Grinter, Rhys; Josts, Inokentijs; Mosbahi, Khedidja; Roszak, Aleksander W.; Cogdell, Richard J.; Wall, Daniel M.; Burchmore, Richard J. S.; Byron, Olwyn; Walker, Daniel

    2015-06-30

    The X-ray structure of protease-cleaved E. coli α-2-macroglobulin is described, which reveals a putative mechanism of activation and conformational change essential for protease inhibition. Bacterial α-2-macroglobulins have been suggested to function in defence as broad-spectrum inhibitors of host proteases that breach the outer membrane. Here, the X-ray structure of protease-cleaved Escherichia coli α-2-macroglobulin is described, which reveals a putative mechanism of activation and conformational change essential for protease inhibition. In this competitive mechanism, protease cleavage of the bait-region domain results in the untethering of an intrinsically disordered region of this domain which disrupts native interdomain interactions that maintain E. coli α-2-macroglobulin in the inactivated form. The resulting global conformational change results in entrapment of the protease and activation of the thioester bond that covalently links to the attacking protease. Owing to the similarity in structure and domain architecture of Escherichia coli α-2-macroglobulin and human α-2-macroglobulin, this protease-activation mechanism is likely to operate across the diverse members of this group.

  15. HIV-1 protease-substrate coevolution in nelfinavir resistance.

    PubMed

    Kolli, Madhavi; Ozen, Ayşegül; Kurt-Yilmaz, Nese; Schiffer, Celia A

    2014-07-01

    Resistance to various human immunodeficiency virus type 1 (HIV-1) protease inhibitors (PIs) challenges the effectiveness of therapies in treating HIV-1-infected individuals and AIDS patients. The virus accumulates mutations within the protease (PR) that render the PIs less potent. Occasionally, Gag sequences also coevolve with mutations at PR cleavage sites contributing to drug resistance. In this study, we investigated the structural basis of coevolution of the p1-p6 cleavage site with the nelfinavir (NFV) resistance D30N/N88D protease mutations by determining crystal structures of wild-type and NFV-resistant HIV-1 protease in complex with p1-p6 substrate peptide variants with L449F and/or S451N. Alterations of residue 30's interaction with the substrate are compensated by the coevolving L449F and S451N cleavage site mutations. This interdependency in the PR-p1-p6 interactions enhances intermolecular contacts and reinforces the overall fit of the substrate within the substrate envelope, likely enabling coevolution to sustain substrate recognition and cleavage in the presence of PR resistance mutations. Resistance to human immunodeficiency virus type 1 (HIV-1) protease inhibitors challenges the effectiveness of therapies in treating HIV-1-infected individuals and AIDS patients. Mutations in HIV-1 protease selected under the pressure of protease inhibitors render the inhibitors less potent. Occasionally, Gag sequences also mutate and coevolve with protease, contributing to maintenance of viral fitness and to drug resistance. In this study, we investigated the structural basis of coevolution at the Gag p1-p6 cleavage site with the nelfinavir (NFV) resistance D30N/N88D protease mutations. Our structural analysis reveals the interdependency of protease-substrate interactions and how coevolution may restore substrate recognition and cleavage in the presence of protease drug resistance mutations. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

  16. Secretion of Proteases by an Opportunistic Fungal Pathogen Scedosporium aurantiacum

    PubMed Central

    Kautto, Liisa; Nevalainen, Helena

    2017-01-01

    Scedosporium aurantiacum is an opportunistic filamentous fungus increasingly isolated from the sputum of cystic fibrosis patients, and is especially prevalent in Australia. At the moment, very little is known about the infection mechanism of this fungus. Secreted proteases have been shown to contribute to fungal virulence in several studies with other fungi. Here we have compared the profiles of proteases secreted by a clinical isolate Scedosporium aurantiacum (WM 06.482) and an environmental strain (WM 10.136) grown on a synthetic cystic fibrosis sputum medium supplemented with casein or mucin. Protease activity was assessed using class-specific substrates and inhibitors. Subtilisin-like and trypsin-like serine protease activity was detected in all cultures. The greatest difference in the secretion of proteases between the two strains occurred in mucin-supplemented medium, where the activities of the elastase-like, trypsin-like and aspartic proteases were, overall, 2.5–75 fold higher in the clinical strain compared to the environmental strain. Proteases secreted by the two strains in the mucin-supplemented medium were further analyzed by mass spectrometry. Six homologs of fungal proteases were identified from the clinical strain and five from the environmental strain. Of these, three were common for both strains including a subtilisin peptidase, a putative leucine aminopeptidase and a PA-SaNapH-like protease. Trypsin-like protease was identified by mass spectrometry only in the clinical isolate even though trypsin-like activity was present in all cultures. In contrast, high elastase-like activity was measured in the culture supernatant of the clinical strain but could not be identified by mass spectrometry searching against other fungi in the NCBI database. Future availability of an annotated genome will help finalise identification of the S. aurantiacum proteases. PMID:28060882

  17. Regulated proteolysis by cortical granule serine protease 1 at fertilization.

    PubMed

    Haley, Sheila A; Wessel, Gary M

    2004-05-01

    Cortical granules are specialized organelles whose contents interact with the extracellular matrix of the fertilized egg to form the block to polyspermy. In sea urchins, the granule contents form a fertilization envelope (FE), and this construction is critically dependent upon protease activity. An autocatalytic serine protease, cortical granule serine protease 1 (CGSP1), has been identified in the cortical granules of Strongylocentrotus purpuratus eggs, and here we examined the regulation of the protease activity and tested potential target substrates of CGSP1. We found that CGSP1 is stored in its full-length, enzymatically quiescent form in the granule, and is inactive at pH 6.5 or below. We determined the pH of the cortical granule by fluorescent indicators and micro-pH probe measurements and found the granules to be pH 5.5, a condition inhibitory to CGSP1 activity. Exposure of the protease to the pH of seawater (pH 8.0) at exocytosis immediately activates the protease. Activation of eggs at pH 6.5 or lower blocks activation of the protease and the resultant FE phenotypes are indistinguishable from a protease-null phenotype. We find that native cortical granule targets of the protease are beta-1,3 glucanase, ovoperoxidase, and the protease itself, but the structural proteins of the granule are not proteolyzed by CGSP1. Whole mount immunolocalization experiments demonstrate that inhibition of CGSP1 activity affects the localization of ovoperoxidase but does not alter targeting of structural proteins to the FE. The mistargeting of ovoperoxidase may lead to spurious peroxidative cross-linking activity and contribute to the lethality observed in protease-null cells. Thus, CGSP1 is proteolytically active only when secreted, due to the low pH of the cortical granules, and it has a small population of targets for cleavage within the cortical granules.

  18. Secretion of Proteases by an Opportunistic Fungal Pathogen Scedosporium aurantiacum.

    PubMed

    Han, Zhiping; Kautto, Liisa; Nevalainen, Helena

    2017-01-01

    Scedosporium aurantiacum is an opportunistic filamentous fungus increasingly isolated from the sputum of cystic fibrosis patients, and is especially prevalent in Australia. At the moment, very little is known about the infection mechanism of this fungus. Secreted proteases have been shown to contribute to fungal virulence in several studies with other fungi. Here we have compared the profiles of proteases secreted by a clinical isolate Scedosporium aurantiacum (WM 06.482) and an environmental strain (WM 10.136) grown on a synthetic cystic fibrosis sputum medium supplemented with casein or mucin. Protease activity was assessed using class-specific substrates and inhibitors. Subtilisin-like and trypsin-like serine protease activity was detected in all cultures. The greatest difference in the secretion of proteases between the two strains occurred in mucin-supplemented medium, where the activities of the elastase-like, trypsin-like and aspartic proteases were, overall, 2.5-75 fold higher in the clinical strain compared to the environmental strain. Proteases secreted by the two strains in the mucin-supplemented medium were further analyzed by mass spectrometry. Six homologs of fungal proteases were identified from the clinical strain and five from the environmental strain. Of these, three were common for both strains including a subtilisin peptidase, a putative leucine aminopeptidase and a PA-SaNapH-like protease. Trypsin-like protease was identified by mass spectrometry only in the clinical isolate even though trypsin-like activity was present in all cultures. In contrast, high elastase-like activity was measured in the culture supernatant of the clinical strain but could not be identified by mass spectrometry searching against other fungi in the NCBI database. Future availability of an annotated genome will help finalise identification of the S. aurantiacum proteases.

  19. Structural determinants of MALT1 protease activity.

    PubMed

    Wiesmann, Christian; Leder, Lukas; Blank, Jutta; Bernardi, Anna; Melkko, Samu; Decock, Arnaud; D'Arcy, Allan; Villard, Frederic; Erbel, Paulus; Hughes, Nicola; Freuler, Felix; Nikolay, Rainer; Alves, Juliano; Bornancin, Frederic; Renatus, Martin

    2012-05-25

    The formation of the CBM (CARD11-BCL10-MALT1) complex is pivotal for antigen-receptor-mediated activation of the transcription factor NF-κB. Signaling is dependent on MALT1 (mucosa-associated lymphoid tissue lymphoma translocation protein 1), which not only acts as a scaffolding protein but also possesses proteolytic activity mediated by its caspase-like domain. It remained unclear how the CBM activates MALT1. Here, we provide biochemical and structural evidence that MALT1 activation is dependent on its dimerization and show that mutations at the dimer interface abrogate activity in cells. The unliganded protease presents itself in a dimeric yet inactive state and undergoes substantial conformational changes upon substrate binding. These structural changes also affect the conformation of the C-terminal Ig-like domain, a domain that is required for MALT1 activity. Binding to the active site is coupled to a relative movement of caspase and Ig-like domains. MALT1 binding partners thus may have the potential of tuning MALT1 protease activity without binding directly to the caspase domain.

  20. Hemostatic, milk clotting and blood stain removal potential of cysteine proteases from Calotropis gigantea (L.) R. Br. Latex.

    PubMed

    Bindhu, Omana Sukumaran; Singh, Maheshwari Kumari

    2014-04-01

    Plant latex is a natural source of biologically active compounds and several hydrolytic enzymes responsible for their diverse health benefits. Recent past has witnessed substantial progress in understanding their supplementary industrial and pharmaceutical utility. Calotropis gigantea is one of the important latex producing plants belonging to asclepediaceae family with wide ethnopharmacological applications and is rich in proteolytic enzymes. Present study investigates hemostatic, milk clotting and blood stain removal potential of C. gigantea latex proteases. The protease activity of crude enzyme (CE), obtained by centrifugation followed by ammonium sulphate precipitation and dialysis, was assayed using casein as the substrate. Effect of pH, temperature and specific inhibitors on protease activity was determined. Native PAGE and in gel protease activity of CE was performed. Hemostatic (Fibrinogen polymerization, fibrinogen agarose plate and blood clot lysis assays), milk clotting and blood stain removal efficacies of CE were determined. CE exhibited high caseinolytic activity. Enzyme activity was optimum at 37-50ºC and pH 8.0. Fibrinogen polymerization assay showed concentration dependent increase in turbidity indicating thrombin like activity which was further confirmed by fibrinogen agarose plate assays. Clot lysis assay indicated 92.41% thrombolysis by CE in 90 min. CE also revealed significantly high ratio of milk clotting to protease activity (Milk Clotting Index, MCI = 827.59 ± 1.52). Complete destaining of blood stained fabric was observed when incubated with 1% detergent incorporated with 0.1mg/ml CE. The study highlights and validates the compound application potential of latex cysteine proteases from C. gigantea.

  1. Hemostatic, milk clotting and blood stain removal potential of cysteine proteases from Calotropis gigantea (L.) R. Br. Latex

    PubMed Central

    Bindhu, Omana Sukumaran; Singh, Maheshwari Kumari

    2014-01-01

    Introduction: Plant latex is a natural source of biologically active compounds and several hydrolytic enzymes responsible for their diverse health benefits. Recent past has witnessed substantial progress in understanding their supplementary industrial and pharmaceutical utility. Calotropis gigantea is one of the important latex producing plants belonging to asclepediaceae family with wide ethnopharmacological applications and is rich in proteolytic enzymes. Present study investigates hemostatic, milk clotting and blood stain removal potential of C. gigantea latex proteases. Materials and Methods: The protease activity of crude enzyme (CE), obtained by centrifugation followed by ammonium sulphate precipitation and dialysis, was assayed using casein as the substrate. Effect of pH, temperature and specific inhibitors on protease activity was determined. Native PAGE and in gel protease activity of CE was performed. Hemostatic (Fibrinogen polymerization, fibrinogen agarose plate and blood clot lysis assays), milk clotting and blood stain removal efficacies of CE were determined. Results: CE exhibited high caseinolytic activity. Enzyme activity was optimum at 37-50ºC and pH 8.0. Fibrinogen polymerization assay showed concentration dependent increase in turbidity indicating thrombin like activity which was further confirmed by fibrinogen agarose plate assays. Clot lysis assay indicated 92.41% thrombolysis by CE in 90 min. CE also revealed significantly high ratio of milk clotting to protease activity (Milk Clotting Index, MCI = 827.59 ± 1.52). Complete destaining of blood stained fabric was observed when incubated with 1% detergent incorporated with 0.1mg/ml CE. The study highlights and validates the compound application potential of latex cysteine proteases from C. gigantea. PMID:24991114

  2. Proteomic approaches to identify substrates of the three Deg/HtrA proteases of the cyanobacterium Synechocystis sp. PCC 6803.

    PubMed

    Tam, Lam X; Aigner, Harald; Timmerman, Evy; Gevaert, Kris; Funk, Christiane

    2015-06-15

    The family of Deg/HtrA proteases plays an important role in quality control of cellular proteins in a wide range of organisms. In the genome of the cyanobacterium Synechocystis sp. PCC 6803, a model organism for photosynthetic research and renewable energy products, three Deg proteases are encoded, termed HhoA, HhoB and HtrA. In the present study, we compared wild-type (WT) Synechocystis cells with the single insertion mutants ΔhhoA, ΔhhoB and ΔhtrA. Protein expression of the remaining Deg/HtrA proteases was strongly affected in the single insertion mutants. Detailed proteomic studies using DIGE (difference gel electrophoresis) and N-terminal COFRADIC (N-terminal combined fractional diagonal chromatography) revealed that inactivation of a single Deg protease has similar impact on the proteomes of the three mutants; differences to WT were observed in enzymes involved in the major metabolic pathways. Changes in the amount of phosphate permease system Pst-1 were observed only in the insertion mutant ΔhhoB. N-terminal COFRADIC analyses on cell lysates of ΔhhoB confirmed changed amounts of many cell envelope proteins, including the phosphate permease systems, compared with WT. In vitro COFRADIC studies were performed to identify the specificity profiles of the recombinant proteases rHhoA, rHhoB or rHtrA added to the Synechocystis WT proteome. The combined in vivo and in vitro N-terminal COFRADIC datasets propose RbcS as a natural substrate for HhoA, PsbO for HhoB and HtrA and Pbp8 for HtrA. We therefore suggest that each Synechocystis Deg protease protects the cell through different, but connected mechanisms. © The Authors Journal compilation © 2015 Biochemical Society.

  3. The HhoA protease from Synechocystis sp. PCC 6803 - Novel insights into structure and activity regulation.

    PubMed

    Hall, Michael; Wagner, Raik; Lam, Xuan Tam; Funk, Christiane; Persson, Karina

    2017-06-01

    Proteases play a vital role in the removal of proteins, which become damaged due to temperature or oxidative stress. Important to this process in the cyanobacterium Synechocystis sp. PCC6803 is the family of Deg/HtrA proteases; HhoA (sll1679), HhoB (sll1427) and HtrA (slr1204). While previous studies have elucidated the structures of Deg/HtrA proteases from Escherichia coli and from the chloroplast of the higher plant Arabidopsis thaliana, no structural data have been available for any Deg/HtrA protease from cyanobacteria, the evolutionary ancestor of the chloroplast. To gain a deeper insight into the molecular mechanisms and regulation of these proteins we have solved the structure of the Synechocystis HhoA protease in complex with a co-purified peptide by X-ray crystallography. HhoA assembles into stable trimers, mediated by its protease domain and further into a cage-like hexamer by a novel interaction between the PDZ domains of opposing trimers. Each PDZ domain contains two loops for PDZ-PDZ formation: interaction clamp one and two (IC1, IC2). IC1 interacts with IC2 on the opposing PDZ domain and vice versa. Our structure shows a peptide bound to a conserved groove on the PDZ domain and the properties of this pocket suggest that it binds substrate proteins as well as the neo C-termini of cleaved substrates. In agreement with previous studies showing the proteolytic activity of HhoA to be activated by Ca(2+) or Mg(2+), binding of divalent metal ions to the central channel of the trimer by the L1 activation loop was observed. Copyright © 2016. Published by Elsevier Inc.

  4. Midgut serine proteases and alternative host plant utilization in Pieris brassicae L.

    PubMed Central

    Kumar, Rakesh; Bhardwaj, Usha; Kumar, Pawan; Mazumdar-Leighton, Sudeshna

    2015-01-01

    Pieris brassicae L. is a serious pest of cultivated crucifers in several parts of the world. Larvae of P. brassicae also feed prolifically on garden nasturtium (Tropaeolum majus L., of the family Tropaeolaceae). Proteolytic digestion was studied in larvae feeding on multiple hosts. Fourth instars were collected from cauliflower fields before transfer onto detached, aerial tissues of selected host plants in the lab. Variable levels of midgut proteases were detected in larvae fed on different hosts using protein substrates (casein and recombinant RBCL cloned from cauliflower) and diagnostic, synthetic substrates. Qualitative changes in midgut trypsin activities and quantitative changes in midgut chymotrypsin activities were implicated in physiological adaptation of larvae transferred to T. majus. Midgut proteolytic activities were inhibited to different extents by serine protease inhibitors, including putative trypsin inhibitors isolated from herbivore-attacked and herbivore-free leaves of cauliflower (CfTI) and T. majus (TpTI). Transfer of larvae to T. majus significantly influenced feeding parameters but not necessarily when transferred to different tissues of the same host. Results obtained are relevant for devising sustainable pest management strategies, including transgenic approaches using genes encoding plant protease inhibitors. PMID:25873901

  5. Cysteine proteases from the Asclepiadaceae plants latex exhibited thrombin and plasmin like activities.

    PubMed

    Shivaprasad, H V; Riyaz, M; Venkatesh Kumar, R; Dharmappa, K K; Tarannum, Shaista; Siddesha, J M; Rajesh, R; Vishwanath, B S

    2009-10-01

    In the present study we evaluated the presence of cysteine protease from the latex of four plants Asclepias curassavica L., Calotropis gigantea R.Br., Pergularia extensa R.Br. and Cynanchum puciflorum R.Br. belongs to the family Asclepiadaceae. Cysteine proteases from these plants latex exhibited both thrombin and plasmin like activities. Latex enzyme fraction in a concentration dependent manner induced the formation of clot in citrated blood plasma. Direct incubation of fibrinogen with latex enzyme fraction resulted in the formation of fibrin clot similar to thrombin enzyme. However prolonged incubation resulted in degradation of the formed fibrin clot suggesting plasmin like activity. Latex enzyme fraction preferentially hydrolyzed Aalpha and Bbeta chains of fibrinogen to form fibrin clot. Latex enzyme fraction also hydrolyzed the subunits of fully cross linked fibrin efficiently, the order of hydrolysis was alpha-polymer > alpha-chains > beta-chain and gamma-gamma dimer. Cysteine proteases from all the four Asclepiadaceae plants latex exhibited similar action on fibrinogen and fibrin. This study scientifically validate the use of plant latex in stop bleeding and wound healing by traditional healers all over the world.

  6. The Catalytic Machinery of Rhomboid Proteases: Combined MD and QM Simulations.

    PubMed

    Uritsky, Neta; Shokhen, Michael; Albeck, Amnon

    2012-11-13

    Rhomboid proteases are a ubiquitous family of intramembrane serine proteases in prokaryotic and eukaryotic organisms that cleave membrane proteins in their transmembrane region. Their catalytic activity is centered at a His-Ser catalytic dyad. We applied molecular dynamics and quantum mechanics calculations in order to clarify the protonation state of the catalytic residues of E. coli GlpG rhomboid protease and how it is affected by the immersion of the enzyme in the membrane. We identified (Nε)H150(dpr)_H254(dpr)_S201(pr) as the protonation (and H150 tautomeric) state of free GlpG in both lipid-solubilized and membrane environments. We used our MD-QM/SCRF(VS) computational protocol to rationalize and predict the trend of pKa change caused by the decrease of water exposure of the active site of GlpG due to ligand binding. The catalytic diad of lipid-solubilized GlpG exists as an H254(+)_S201(-) ion pair at the Michaelis complex stage, with Ser201 ready for nucleophilic attack on the substrate. Therefore, deprotonation of S201 does not contribute to the activation barrier of covalent tetrahedral complex formation. In contrast, both catalytic residues, H254 and S201, are neutral in the Michaelis complex of GlpG in the membrane. Therefore, S201 deprotonation by H254 general base catalysis should contribute to the activation barrier of the covalent tetrahedral complex formation.

  7. Staphylococcus aureus secretes a unique class of neutrophil serine protease inhibitors

    PubMed Central

    Stapels, Daphne A. C.; Ramyar, Kasra X.; Bischoff, Markus; von Köckritz-Blickwede, Maren; Milder, Fin J.; Ruyken, Maartje; Eisenbeis, Janina; McWhorter, William J.; Herrmann, Mathias; van Kessel, Kok P. M.; Geisbrecht, Brian V.; Rooijakkers, Suzan H. M.

    2014-01-01

    Neutrophils are indispensable for clearing infections with the prominent human pathogen Staphylococcus aureus. Here, we report that S. aureus secretes a family of proteins that potently inhibits the activity of neutrophil serine proteases (NSPs): neutrophil elastase (NE), proteinase 3, and cathepsin G. The NSPs, but not related serine proteases, are specifically blocked by the extracellular adherence protein (Eap) and the functionally orphan Eap homologs EapH1 and EapH2, with inhibitory-constant values in the low-nanomolar range. Eap proteins are together essential for NSP inhibition by S. aureus in vitro and promote staphylococcal infection in vivo. The crystal structure of the EapH1/NE complex showed that Eap molecules constitute a unique class of noncovalent protease inhibitors that occlude the catalytic cleft of NSPs. These findings increase our insights into the complex pathogenesis of S. aureus infections and create opportunities to design novel treatment strategies for inflammatory conditions related to excessive NSP activity. PMID:25161283

  8. Characterization of a novel otubain-like protease with deubiquitination activity from Nosema bombycis (Microsporidia).

    PubMed

    Wang, Ying; Dang, Xiaoqun; Luo, Bo; Li, Chunfeng; Long, Mengxian; Li, Tian; Li, Zhi; Pan, Guoqing; Zhou, Zeyang

    2015-10-01

    Otubains are a recently identified family of deubiquitinating enzymes (DUBs). They are involved in diverse biological processes including protein degradation, signal transduction, and cell immune response. Several microsporidian genomes have been published in the last decade; however, little is known about the otubain-like protease in these widely-spread obligate intracellular parasites. Here, we characterized a 25 kDa otubain-like protease (NbOTU1) from the microsporidian Nosema bombycis, the pathogen causing pebrine disease in the economically important insect Bombyx mori. Sequence analysis showed that this protein contained a conserved catalytic triad of otubains composed of aspartate, cysteine, and histidine residues. The expression of Nbotu1 began on day 3 postinfection as determined by the RT-PCR method. Immunofluorescence analysis indicated that NbOTU1 is localized on the spore wall of N. bombycis. The subcellular localization of the NbOTU1 was further detected with immunoelectron microscopy, which showed that NbOTU1 is localized at the regions around endospore wall and plasma membrane. Deubiquitination analysis confirmed that the recombinant NbOTU1 possessed deubiquitination activity in vitro. Taken together, a novel microsporidian otubain-like protease NbOTU1 was partially characterized in N. bombycis, demonstrating its subcellular location and deubiquitination activity. This study provided a basic reference for further dissecting the function of otubains in microsporidia.

  9. Mutation Patterns and Structural Correlates in Human Immunodeficiency Virus Type 1 Protease following Different Protease Inhibitor Treatments

    PubMed Central

    Wu, Thomas D.; Schiffer, Celia A.; Gonzales, Matthew J.; Taylor, Jonathan; Kantor, Rami; Chou, Sunwen; Israelski, Dennis; Zolopa, Andrew R.; Fessel, W. Jeffrey; Shafer, Robert W.

    2003-01-01

    Although many human immunodeficiency virus type 1 (HIV-1)-infected persons are treated with multiple protease inhibitors in combination or in succession, mutation patterns of protease isolates from these persons have not been characterized. We collected and analyzed 2,244 subtype B HIV-1 isolates from 1,919 persons with different protease inhibitor experiences: 1,004 isolates from untreated persons, 637 isolates from persons who received one protease inhibitor, and 603 isolates from persons receiving two or more protease inhibitors. The median number of protease mutations per isolate increased from 4 in untreated persons to 12 in persons who had received four or more protease inhibitors. Mutations at 45 of the 99 amino acid positions in the protease—including 22 not previously associated with drug resistance—were significantly associated with protease inhibitor treatment. Mutations at 17 of the remaining 99 positions were polymorphic but not associated with drug treatment. Pairs and clusters of correlated (covarying) mutations were significantly more likely to occur in treated than in untreated persons: 115 versus 23 pairs and 30 versus 2 clusters, respectively. Of the 115 statistically significant pairs of covarying residues in the treated isolates, 59 were within 8 Å of each other—many more than would be expected by chance. In summary, nearly one-half of HIV-1 protease positions are under selective drug pressure, including many residues not previously associated with drug resistance. Structural factors appear to be responsible for the high frequency of covariation among many of the protease residues. The presence of mutational clusters provides insight into the complex mutational patterns required for HIV-1 protease inhibitor resistance. PMID:12663790

  10. Effect of proteases on the. beta. -thromboglobulin radioimmunoassay

    SciTech Connect

    Donlon, J.A.; Helgeson, E.A.; Donlon, M.A.

    1985-02-11

    Rat peritoneal mast cells and mast cell granules were evaluated by radioimmunoassay for the presence of ..beta..-thromboglobulin and platelet factor 4. The initial assays indicated that a ..beta..-thromboglobulin cross reacting material was released from mast cells by compound 48/80 in a similar dose-dependent manner as histamine release. The material was also found to be associated with purified granules. However, the use of protease inhibitors in the buffers completely abolished the positive assays. Further evaluation of the effects of various proteases on the ..beta..-thromboglobulin assay indicated that elastase would also generate a false positive assay which could then be neutralized by the use of ..cap alpha../sub 1/-antitrypsin as a protease inhibitor. There was no protease effect on the platelet factor 4 radioimmunoassay which always showed no detectable amounts with mast cells, granules or proteases. These results clearly indicate the artifactual positive assays which can arise when using certain radioimmunoassay tests in the presence of cell proteases. The use of protease inhibitors is a necessary control when applying a radioimmunoassay to a system with potentially active proteases. 24 references, 2 figures, 4 tables.

  11. Serine protease activities in Leishmania (Leishmania) chagasi promastigotes.

    PubMed

    da Silva-López, Raquel Elisa; dos Santos, Tatiana Resende; Morgado-Díaz, José Andrés; Tanaka, Marcelo Neves; de Simone, Salvatore Giovanni

    2010-10-01

    The present work reports the isolation, biochemical characterization, and subcellular location of serine proteases from aqueous, detergent soluble, and culture supernatant of Leishmania chagasi promastigote extracts, respectively, LCSII, LCSI, and LCSIII. The active enzyme molecular masses of LCSII were about 105, 66, and 60 kDa; of LCSI, 60 and 58 kDa; and of LCSIII, approximately 76 and 68 kDa. Optimal pH for the enzymes was 7.0 for LCSI and LCSIII and 8.5 for LCSII, and the optimal temperature for all enzymes was 37°C, using α-N-ρ-tosyl-L: -arginine methyl ester as substrate. Assay of thermal stability indicated that LCSIII is the more stable enzyme. Hemoglobin, bovine serum albumin, and ovalbumin were hydrolyzed by LCSII and LCSI but not by LCSIII. Inhibition studies suggested that enzymes belong to the serine protease class modulated by divalent cations. Rabbit antiserum against 56-kDa serine protease of Leishmania amazonensis identified proteins in all extracts of L. chagasi. Furthermore, immunocytochemistry demonstrated that serine proteases are located in flagellar pocket region and cytoplasmic vesicles of L. chagasi promastigotes. These findings indicate that L. chagasi serine proteases differ from L. amazonensis proteases and all known flagellate proteases, but display some similarities with serine proteases from other Leishmania species, suggesting a conservation of this enzymatic activity in the genus.

  12. Expression and characterization of Coprothermobacter proteolyticus alkaline serine protease

    USDA-ARS?s Scientific Manuscript database

    TECHNICAL ABSTRACT A putative protease gene (aprE) from the thermophilic bacterium Coprothermobacter proteolyticus was cloned and expressed in Bacillus subtilis. The enzyme was determined to be a serine protease based on inhibition by PMSF. Biochemical characterization demonstrated the enzyme had...

  13. Gene cloning, molecular modeling, and phylogenetics of serine protease P32 and serine carboxypeptidase SCP1 from nematophagous fungi Pochonia rubescens and Pochonia chlamydosporia.

    PubMed

    Larriba, Eduardo; Martín-Nieto, José; Lopez-Llorca, Luis Vicente

    2012-07-01

    The fungi Pochonia chlamydosporia and Pochonia rubescens are parasites of nematode eggs and thus are biocontrol agents of nematodes. Proteolytic enzymes such as the S8 proteases VCP1 and P32, secreted during the pathogenesis of nematode eggs, are major virulence factors in these fungi. Recently, expression of these enzymes and of SCP1, a new putative S10 carboxypeptidase, was detected during endophytic colonization of barley roots by these fungi. In our study, we cloned the genomic and mRNA sequences encoding P32 from P. rubescens and SCP1 from P. chlamydosporia. P32 showed a high homology with the serine proteases Pr1A from the entomopathogenic fungus Metarhizium anisopliae and VCP1 from P. chlamydosporia (86% and 76% identity, respectively). However, the catalytic pocket of P32 showed differences in the amino acids of the substrate-recognition sites compared with the catalytic pockets of Pr1A and VCP1 proteases. Phylogenetic analysis of P32 suggests a common ancestor with protease Pr1A. SCP1 displays the characteristic features of a member of the S10 family of serine proteases. Phylogenetic comparisons show that SCP1 and other carboxypeptidases from filamentous fungi have an origin different from that of yeast vacuolar serine carboxypeptidases. Understanding protease genes from nematophagous fungi is crucial for enhancing the biocontrol potential of these organisms.

  14. Drosophila melanogaster clip-domain serine proteases: Structure, function and regulation.

    PubMed

    Veillard, Florian; Troxler, Laurent; Reichhart, Jean-Marc

    2016-03-01

    Mammalian chymotrypsin-like serine proteases (SPs) are one of the best-studied family of enzymes with roles in a wide range of physiological processes, including digestion, blood coagulation, fibrinolysis and humoral immunity. Extracellular SPs can form cascades, in which one protease activates the zymogen of the next protease in the chain, to amplify physiological or pathological signals. These extracellular SPs are generally multi-domain proteins, with pro-domains that are involved in protein-protein interactions critical for the sequential organization of the cascades, the control of their intensity and their proper localization. Far less is known about invertebrate SPs than their mammalian counterparts. In insect genomes, SPs and their proteolytically inactive homologs (SPHs) constitute large protein families. In addition to the chymotrypsin fold, many of these proteins contain additional structural domains, often with conserved mammalian orthologues. However, the largest group of arthropod SP regulatory modules is the clip domains family, which has only been identified in arthropods. The clip-domain SPs are extracellular and have roles in the immune response and embryonic development. The powerful reverse-genetics tools in Drosophila melanogaster have been essential to identify the functions of clip-SPs and their organization in sequential cascades. This review focuses on the current knowledge of Drosophila clip-SPs and presents, when necessary, data obtained in other insect models. We will first cover the biochemical and structural features of clip domain SPs and SPHs. Clip-SPs are implicated in three main biological processes: the control of the dorso-ventral patterning during embryonic development; the activation of the Toll-mediated response to microbial infections and the prophenoloxydase cascade, which triggers melanization. Finally, we review the regulation of SPs and SPHs, from specificity of activation to inhibition by endogenous or pathogen

  15. Prions in Variably Protease-Sensitive Prionopathy: An Update

    PubMed Central

    Zou, Wen-Quan; Gambetti, Pierluigi; Xiao, Xiangzhu; Yuan, Jue; Langeveld, Jan; Pirisinu, Laura

    2013-01-01

    Human prion diseases, including sporadic, familial, and acquired forms such as Creutzfeldt-Jakob disease (CJD), are caused by prions in which an abnormal prion protein (PrPSc) derived from its normal cellular isoform (PrPC) is the only known component. The recently-identified variably protease-sensitive prionopathy (VPSPr) is characterized not only by an atypical clinical phenotype and neuropathology but also by the deposition in the brain of a peculiar PrPSc. Like other forms of human prion disease, the pathogenesis of VPSPr also currently remains unclear. However, the findings of the peculiar features of prions from VPSPr and of the possible association of VPSPr with a known genetic prion disease linked with a valine to isoleucine mutation at residue 180 of PrP reported recently, may be of great importance in enhancing our understanding of not only this atypical human prion disease in particular, but also other prion diseases in general. In this review, we highlight the physicochemical and biological properties of prions from VPSPr and discuss the pathogenesis of VPSPr including the origin and formation of the peculiar prions. PMID:25437202

  16. Alkaline protease production by a strain of marine yeasts

    NASA Astrophysics Data System (ADS)

    Ping, Wang; Zhenming, Chi; Chunling, Ma

    2006-07-01

    Yeast strain 10 with high yield of protease was isolated from sediments of saltern near Qingdao, China. The protease had the highest activity at pH 9.0 and 45°C. The optimal medium for the maximum alkaline protease production of strain 10 was 2.5g soluble starch and 2.0g NaNO3 in 100mL seawater with initial pH 6.0. The optimal cultivation conditions for the maximum protease production were temperature 24.5°C, aeration rate 8.0L min-1 and agitation speed 150r min-1 Under the optimal conditions, 623.1 U mg-1 protein of alkaline protease was reached in the culture within 30h of fermentation.

  17. Protease-activated nanomaterials for targeted cancer theranostics.

    PubMed

    Chan, Yung-Chieh; Hsiao, Michael

    2017-09-01

    Cancer metastasis accompanies irreversible proteolysis. Malignant cells that abnormally express extracellular proteases usually lead to a poor outcome during cancer progression. The development of protease-activated drugs is an important goal. Moreover, the specific proteolytic mechanism can be used as a diagnostic strategy. Currently, nanotechnology for use in medication has been extensively developed to exploit the physical and chemical properties of nanoparticles. For example, to improve the efficacy of cancer therapy drugs, targeted delivery has been attempted by combining a targeting ligand with a nanoparticle. Multifunctional nanoparticles have been prepared for cancer therapy and diagnosis because of their advantages such as stable physical properties, drug carrying ability and potential specific targeting ability. In this review, we present reports on protease-activated nanoparticle design for cancer theranostics. We further describe recent protease-activated metalloprotease-based and cathepsin-based nanomaterials used in cancer nanotheranostics. Innovative protease-activated nanomaterials have significant potential for designing personalized treatment.

  18. Poliovirus protease 3C(pro) kills cells by apoptosis.

    PubMed

    Barco, A; Feduchi, E; Carrasco, L

    2000-01-20

    The tetracycline-based Tet-Off expression system has been used to analyze the effects of poliovirus protease 3C(pro) on human cells. Stable HeLa cell clones that express this poliovirus protease under the control of an inducible, tightly regulated promoter were obtained. Tetracycline removal induces synthesis of 3C protease, followed by drastic morphological alterations and cellular death. Degradation of cellular DNA in nucleosomes and generation of apoptotic bodies are observed from the second day after 3C(pro) induction. The cleavage of poly(ADP-ribose) polymerase, an enzyme involved in DNA repair, occurs after induction of 3C(pro), indicating caspase activation by this poliovirus protease. The 3C(pro)-induced apoptosis is blocked by the caspase inhibitor z-VAD-fmk. Our findings suggest that the protease 3C is responsible for triggering apoptosis in poliovirus-infected cells by a mechanism that involves caspase activation. Copyright 2000 Academic Press.

  19. Purification and characterization of an alkaline protease from Acetes chinensis

    NASA Astrophysics Data System (ADS)

    Xu, Jiachao; Liu, Xin; Li, Zhaojie; Xu, Jie; Xue, Changhu; Gao, Xin

    2005-07-01

    An alkaline protease from Acetes chinensis was purified and characterized in this study. The steps of purification include ammonium sulfate precipitation, ion-exchange chromatography with Q-sepharose Fast Flow, gel filtration chromatography with S300 and the second ion-exchange chromatography with Q-sepharose Fast Flow. The protease was isolated and purified, which was present and active on protein substrates (azocasein and casein). The specific protease activity was 17.15 folds and the recovery was 4.67. The molecular weight of the protease was estimated at 23.2 kD by SDS-PAGE. With azocasein as the susbstrate, the optimal temperature was 55°C and the optimal pH value was 5.5. Ion Ca2+ could enhance the proteolytic activity of the protease, while Cu2+, EDTA and PMSF could inhibit its activity.

  20. Identification of a cysteine protease closely related to interleukin-1 beta-converting enzyme.

    PubMed

    Faucheu, C; Blanchet, A M; Collard-Dutilleul, V; Lalanne, J L; Diu-Hercend, A

    1996-02-15

    The present study describes the identification and molecular cloning of a new member of the interleukin-1 beta-converting enzyme (ICE) family denoted transcript Y (TY). TY is very closely related to both ICE (51% amino acid identity) and a protein named transcript X (TX) (75% amino acid identity) that we recently identified [Faucheu, C., Diu, A., Chan, A.W.E., Blanchet, A.-M., Miossec, C., Hervé, F.,Collard-Dutilleul, V., Gu, Y., Aldape, R., Lippke, J., Rocher, C., Su, M.S.-S., Livingston, D.J., Hercend, T. & Lalanne, J.-L. (1995) EMBO J. 14, 1914-1922]. The amino acids that are implicated in both the ICE catalytic site and in the PI aspartate-binding pocket are conserved in TY. Within the ICE gene family, TY belongs to a subfamily of proteins closely related to the prototype ICE protein. Using transfection experiments into mammalian cells, we demonstrate that TY has protease activity on its own precursor and that this activity is dependent on the presence of a cysteine residue at position 245. However, despite the close similarity between TY and ICE active sites, TY fails to process the interleukin-1 beta precursor. In addition, as already observed for ICE and TX, TY is able to induce apoptosis when overexpressed in COS cells. TY therefore represents a new member of the growing family of apoptosis-inducing ICE-related cysteine proteases.

  1. Comparative genomic analysis of aspartic proteases in eight parasitic platyhelminths: insights into functions and evolution.

    PubMed

    Wang, Shuai; Wei, Wei; Luo, Xuenong; Wang, Sen; Hu, Songnian; Cai, Xuepeng

    2015-03-15

    We performed genome-wide identifications and comparative genomic analyses of the predicted aspartic proteases (APs) from eight parasitic flatworms, focusing on their evolution, potentials as drug targets and expression patterns. The results revealed that: i) More members of family A01 were identified from the schistosomes than from the cestodes; some evidence implied gene loss events along the class Cestoda, which may be related to the different ways to ingest host nutrition; ii) members in family A22 were evolutionarily highly conserved among all the parasites; iii) one retroviral-like AP in family A28 shared a highly similar predicted 3D structure with the HIV protease, implying its potential to be inhibited by HIV inhibitor-like molecules; and iiii) retrotransposon-associated APs were extensively expanded among these parasites. These results implied that the evolutionary histories of some APs in these parasites might relate to adaptations to their parasitism and some APs might have potential serving as intervention targets. Copyright © 2015 Elsevier B.V. All rights reserved.

  2. Cytokeratin 8 is an epithelial cell receptor for Pet, a cytotoxic serine protease autotransporter of Enterobacteriaceae.

    PubMed

    Nava-Acosta, Raul; Navarro-Garcia, Fernando

    2013-12-10

    The group of proteins known as serine protease autotransporters of Enterobacteriaceae (SPATE) is a growing family of serine proteases secreted to the external milieu by the type V secretion system. Pet toxin and some other SPATE belong to the class 1 cytotoxic SPATE, which have comparable protease strength on fodrin. Pet is internalized and is directed to its intracellular substrate by retrograde transport. However, the epithelial cell receptor for Pet has yet to be identified. We show that Pet has affinity for the epithelial cell surface until the saturation of the binding sites at 100 nM Pet. Affinity column assays and matrix-assisted laser desorption ionization-time of flight (MALDI-TOF) analysis identified a cytokeratin (CK8) which directly binds to Pet, and both proteins colocalized on the cell surface. Interestingly, CK8 is not present in kidney cell lines, which are not susceptible to Pet. Inhibition experiments by using anti-CK8 and ck8 small interfering RNA (siRNA) blocked the cytotoxic effect induced by Pet, while exogenous CK8 expression in kidney cells made them susceptible to Pet intoxication. Recombinant CK8 showed a Pet-binding pattern similar to that seen by using fixed cells. Remarkably, Pet colocalized with CK8 and clathrin at early times (receptor-mediated endocytosis), and subsequently, Pet colocalized with CK8 and Rab5b in the early endosomes. These data support the idea that CK8 is an important receptor for Pet on epithelial cells for starting its cytotoxic effects. These data suggest that therapeutics that block Pet-CK8 interaction may improve outcome of diseases caused by Pet-secreting Enterobacteriaceae such as enteroaggregative Escherichia coli. Receptor-ligand binding is one mechanism by which cells sense and respond to external cues. Receptors may also be utilized by toxins to mediate their own internalization. Pet toxin is secreted by enteroaggregative Escherichia coli, an organism that causes persistent diarrhea in children, traveler

  3. The crystal structure of the cysteine protease Xylellain from Xylella fastidiosa reveals an intriguing activation mechanism.

    PubMed

    Leite, Ney Ribeiro; Faro, Aline Regis; Dotta, Maria Amélia Oliva; Faim, Livia Maria; Gianotti, Andreia; Silva, Flavio Henrique; Oliva, Glaucius; Thiemann, Otavio Henrique

    2013-02-14

    Xylella fastidiosa is responsible for a wide range of economically important plant diseases. We report here the crystal structure and kinetic data of Xylellain, the first cysteine protease characterized from the genome of the pathogenic X. fastidiosa strain 9a5c. Xylellain has a papain-family fold, and part of the N-terminal sequence blocks the enzyme active site, thereby mediating protein activity. One novel feature identified in the structure is the presence of a ribonucleotide bound outside the active site. We show that this ribonucleotide plays an important regulatory role in Xylellain enzyme kinetics, possibly functioning as a physiological mediator.

  4. Proteomic protease specificity profiling of clostridial collagenases reveals their intrinsic nature as dedicated degraders of collagen.

    PubMed

    Eckhard, Ulrich; Huesgen, Pitter F; Brandstetter, Hans; Overall, Christopher M

    2014-04-04

    Clostridial collagenases are among the most efficient degraders of collagen. Most clostridia are saprophytes and secrete proteases to utilize proteins in their environment as carbon sources; during anaerobic infections, collagenases play a crucial role in host colonization. Several medical and biotechnological applications have emerged utilizing their high collagenolytic efficiency. However, the contribution of the functionally most important peptidase domain to substrate specificity remains unresolved. We investigated the active site sequence specificity of the peptidase domains of collagenase G and H from Clostridium histolyticum and collagenase T from Clostridium tetani. Both prime and non-prime cleavage site specificity were simultaneously profiled using Proteomic Identification of protease Cleavage Sites (PICS), a mass spectrometry-based method utilizing database searchable proteome-derived peptide libraries. For each enzyme we identified >100 unique-cleaved peptides, resulting in robust cleavage logos revealing collagen-like specificity patterns: a strong preference for glycine in P3 and P1', proline at P2 and P2', and a slightly looser specificity at P1, which in collagen is typically occupied by hydroxyproline. This specificity for the classic collagen motifs Gly-Pro-X and Gly-X-Hyp represents a remarkable adaptation considering the complex requirements for substrate unfolding and presentation that need to be fulfilled before a single collagen strand becomes accessible for cleavage. We demonstrate the striking sequence specificity of a family of clostridial collagenases using proteome derived peptide libraries and PICS, Proteomic Identification of protease Cleavage Sites. In combination with the previously published crystal structures of these proteases, our results represent an important piece of the puzzle in understanding the complex mechanism underlying collagen hydrolysis, and pave the way for the rational design of specific test substrates and

  5. Biochemical Characterization of an Extracellular Heat-Stable Protease from Serratia liquefaciens Isolated from Raw Milk.

    PubMed

    Baglinière, François; Salgado, Rafael Locatelli; Salgado, Cleonice Aparecida; Vanetti, Maria Cristina Dantas

    2017-04-01

    The protease Ser2 secreted by the psychrotrophic strain Serratia liquefaciens L53, a highly proteolytic strain isolated from Brazilian raw milk was purified and characterized. Using azocasein as substrate, Ser2 exhibited activity in a wide range of pH (5 to 10) and temperature (4 to 60 °C). The optimal activity was detected at pH 8.0 and at a temperature of 37 °C. This protease, still active at 4, 7, and 10 °C, was strongly inhibited by chelating agents and by dithiothreitol, a reducing agent. These results confirmed that Ser2 belongs to the peptidase family M10 and requires Ca(2+) , Zn(2+) , and disulfide bridges for stability. This protease is able to hydrolyze three kinds of casein in the preferential order of κ→ β→ α-casein. Highly heat-stable in skimmed, semi-skimmed, and whole milk at 140°C with D-values of 2.8, 3.9, and 4.5 min, respectively, Ser2 showed a residual activity between 87 and 100 percent after heat-treatment of 65 °C for 30 min, 72 °C for 20 s, and 140 °C for 4 s that are commonly used in dairy industries. As the protease AprX that is mainly secreted by Pseudomonas genus, Ser2 could be one of the main causes of UHT milk destabilization during storage. © 2017 Institute of Food Technologists®.

  6. Molecular adaptation of a plant-bacterium outer membrane protease towards plague virulence factor Pla

    PubMed Central

    2011-01-01

    Background Omptins are a family of outer membrane proteases that have spread by horizontal gene transfer in Gram-negative bacteria that infect vertebrates or plants. Despite structural similarity, the molecular functions of omptins differ in a manner that reflects the life style of their host bacteria. To simulate the molecular adaptation of omptins, we applied site-specific mutagenesis to make Epo of the plant pathogenic Erwinia pyrifoliae exhibit virulence-associated functions of its close homolog, the plasminogen activator Pla of Yersinia pestis. We addressed three virulence-associated functions exhibited by Pla, i.e., proteolytic activation of plasminogen, proteolytic degradation of serine protease inhibitors, and invasion into human cells. Results Pla and Epo expressed in Escherichia coli are both functional endopeptidases and cleave human serine protease inhibitors, but Epo failed to activate plasminogen and to mediate invasion into a human endothelial-like cell line. Swapping of ten amino acid residues at two surface loops of Pla and Epo introduced plasminogen activation capacity in Epo and inactivated the function in Pla. We also compared the structure of Pla and the modeled structure of Epo to analyze the structural variations that could rationalize the different proteolytic activities. Epo-expressing bacteria managed to invade human cells only after all extramembranous residues that differ between Pla and Epo and the first transmembrane β-strand had been changed. Conclusions We describe molecular adaptation of a protease from an environmental setting towards a virulence factor detrimental for humans. Our results stress the evolvability of bacterial β-barrel surface structures and the environment as a source of progenitor virulence molecules of human pathogens. PMID:21310089

  7. Proteases of Stored Product Insects and Their Inhibition by Specific Protease Inhibitors from Soybeans and Wheat Grain

    DTIC Science & Technology

    1988-10-16

    Tenebria molitor MIDGUT PROTEASES; LOCUST CAECAL PROTEASES; BOWMAN-BIRK TRYPSIN-CHMOTRYPSIN INHIBITOR (SOYBEANS) CHICKPEAS TRYPSIN-CHYMOTRYPSIN...and Kunitz (STI) from soybeans, CI from chickpeas , chicken ovomucoid and turkey ovomucoid. It was Jnactivated by phenylemthvsulfonyl fluoride (PMSF...soybeans and Cl from chickpeas , by chicken ovomucoid and turkey overmucoid, as well as by the Kunitz (STI) soybean trypsin inhibitor that hardly

  8. The Serine Protease HhoA from Synechocystis sp. Strain PCC 6803: Substrate Specificity and Formation of a Hexameric Complex Are Regulated by the PDZ Domain▿

    PubMed Central

    Huesgen, Pitter F.; Scholz, Philipp; Adamska, Iwona

    2007-01-01

    Enzymes of the ATP-independent Deg serine endopeptidase family are very flexible with regard to their substrate specificity. Some family members cleave only one substrate, while others act as general proteases on unfolded substrates. The proteolytic activity of Deg proteases is regulated by PDZ protein interaction domains. Here we characterized the HhoA protease from Synechocystis sp. strain PCC 6803 in vitro using several recombinant protein constructs. The proteolytic activity of HhoA was found to increase with temperature and basic pH and was stimulated by the addition of Mg2+ or Ca2+. We found that the single PDZ domain of HhoA played a critical role in regulating protease activity and in the assembly of a hexameric complex. Deletion of the PDZ domain strongly reduced proteolysis of a sterically challenging resorufin-labeled casein substrate, but unlabeled β-casein was still degraded. Reconstitution of the purified HhoA with total membrane proteins isolated from Synechocystis sp. wild-type strain PCC 6803 and a ΔhhoA mutant resulted in specific degradation of selected proteins at elevated temperatures. We concluded that a single PDZ domain of HhoA plays a critical role in defining the protease activity and oligomerization state, combining the functions that are attributed to two PDZ domains in the homologous DegP protease from Escherichia coli. Based on this first enzymatic study of a Deg protease from cyanobacteria, we propose a general role for HhoA in the quality control of extracytoplasmic proteins, including membrane proteins, in Synechocystis sp. strain PCC 6803. PMID:17616590

  9. Identification and Characterization of IgdE, a Novel IgG-degrading Protease of Streptococcus suis with Unique Specificity for Porcine IgG*

    PubMed Central

    Spoerry, Christian; Seele, Jana; Valentin-Weigand, Peter; Baums, Christoph G.; von Pawel-Rammingen, Ulrich

    2016-01-01

    Streptococcus suis is a major endemic pathogen of pigs causing meningitis, arthritis, and other diseases. Zoonotic S. suis infections are emerging in humans causing similar pathologies as well as severe conditions such as toxic shock-like syndrome. Recently, we discovered an IdeS family protease of S. suis that exclusively cleaves porcine IgM and represents the first virulence factor described, linking S. suis to pigs as their natural host. Here we report the identification and characterization of a novel, unrelated protease of S. suis that exclusively targets porcine IgG. This enzyme, designated IgdE for immunoglobulin G-degrading enzyme of S. suis, is a cysteine protease distinct from previous characterized streptococcal immunoglobulin degrading proteases of the IdeS family and mediates efficient cleavage of the hinge region of porcine IgG with a high degree of specificity. The findings that all S. suis strains investigated possess the IgG proteolytic activity and that piglet serum samples contain specific antibodies against IgdE strongly indicate that the protease is expressed in vivo during infection and represents a novel and putative important bacterial virulence/colonization determinant, and a thus potential therapeutic target. PMID:26861873

  10. Identification of a new soybean Kunitz trypsin inhibitor mutation and its effect on Bowman-Birk protease inhibitor content in soybean seed

    USDA-ARS?s Scientific Manuscript database

    Soybean seeds possess anti-nutritional compounds which inactivate digestive proteases, principally corresponding to two families: Kunitz Trypsin Inhibitors (KTi) and Bowman-Birk Inhibitors (BBI). High levels of raw soybeans/soybean meal in feed mixtures can cause poor weight gain and pancreatic abno...

  11. Active Site Characterization of Proteases Sequences from Different Species of Aspergillus.

    PubMed

    Morya, V K; Yadav, Virendra K; Yadav, Sangeeta; Yadav, Dinesh

    2016-09-01

    A total of 129 proteases sequences comprising 43 serine proteases, 36 aspartic proteases, 24 cysteine protease, 21 metalloproteases, and 05 neutral proteases from different Aspergillus species were analyzed for the catalytically active site residues using MEROPS database and various bioinformatics tools. Different proteases have predominance of variable active site residues. In case of 24 cysteine proteases of Aspergilli, the predominant active site residues observed were Gln193, Cys199, His364, Asn384 while for 43 serine proteases, the active site residues namely Asp164, His193, Asn284, Ser349 and Asp325, His357, Asn454, Ser519 were frequently observed. The analysis of 21 metalloproteases of Aspergilli revealed Glu298 and Glu388, Tyr476 as predominant active site residues. In general, Aspergilli species-specific active site residues were observed for different types of protease sequences analyzed. The phylogenetic analysis of these 129 proteases sequences revealed 14 different clans representing different types of proteases with diverse active site residues.

  12. Crystallization and preliminary X-ray diffraction studies of the cysteine protease ervatamin A from Ervatamia coronaria

    SciTech Connect

    Chakraborty, Sibani; Biswas, Sampa; Chakrabarti, Chandana; Dattagupta, Jiban K.

    2005-06-01

    Ervatamin A is a papain-family cysteine protease with high activity and stability. It has been isolated and purified from the latex of the medicinal flowering plant E. coronaria and crystallized by the vapour-diffusion technique. Crystals diffracted to 2.1 Å and the structure was solved by molecular replacement. The ervatamins are highly stable cysteine proteases that are present in the latex of the medicinal plant Ervatamia coronaria and belong to the papain family, members of which share similar amino-acid sequences and also a similar fold comprising two domains. Ervatamin A from this family, a highly active protease compared with others from the same source, has been purified to homogeneity by ion-exchange chromatography and crystallized by the vapour-diffusion method. Needle-shaped crystals of ervatamin A diffract to 2.1 Å resolution and belong to space group C222{sub 1}, with unit-cell parameters a = 31.10, b = 144.17, c = 108.61 Å. The solvent content using an ervatamin A molecular weight of 27.6 kDa is 43.9%, with a V{sub M} value of 2.19 Å{sup 3} Da{sup −1} assuming one protein molecule in the asymmetric unit. A molecular-replacement solution has been found using the structure of ervatamin C as a search model.

  13. PEGylated substrates of NSP4 protease: A tool to study protease specificity

    NASA Astrophysics Data System (ADS)

    Wysocka, Magdalena; Gruba, Natalia; Grzywa, Renata; Giełdoń, Artur; Bąchor, Remigiusz; Brzozowski, Krzysztof; Sieńczyk, Marcin; Dieter, Jenne; Szewczuk, Zbigniew; Rolka, Krzysztof; Lesner, Adam

    2016-03-01

    Herein we present the synthesis of a novel type of peptidomimetics composed of repeating diaminopropionic acid residues modified with structurally diverse heterobifunctional polyethylene glycol chains (abbreviated as DAPEG). Based on the developed compounds, a library of fluorogenic substrates was synthesized. Further library deconvolution towards human neutrophil serine protease 4 (NSP4) yielded highly sensitive and selective internally quenched peptidomimetic substrates. In silico analysis of the obtained peptidomimetics revealed the presence of an interaction network with distant subsites located on the enzyme surface.

  14. Novel pseudosymmetric inhibitors of HIV-1 protease

    SciTech Connect

    Faessler, A.; Roesel, J.; Gruetter, M.; Tintelnot-Blomley, M.; Alteri, E.; Bold, G.; Lang, M.

    1993-12-31

    Taking into account the unique C-2 symmetric nature of the HIV-1 protease homodimer, the authors have designed and synthesized novel inhibitors featuring an almost symmetric structure. Compounds containing the easily accessible Phe[CH(OH)CH{sub 2}N(NH)]Cha dipeptide isostere as a nonhydrolyzable replacement of the scissile amide bond of the natural substrate are potent inhibitors in vitro with IC{sub 50} values of 9 to 50 nM. The antiviral activity depends mainly on the nature of the anylated valine residues linked to the dipeptide mimic. In this series, CGP 53820 combines both high potency and excellent specificity. Its predicted symmetric binding pattern is illustrated by the X-ray structure analysis performed with the corresponding enzyme-inhibitor complex.

  15. HIV-1 protease inhibitors in development.

    PubMed

    Rusconi, Stefano; La Seta Catamancio, Simona

    2002-03-01

    Several pharmaceutical companies have developed an increasing number of second generation protease inhibitors (PI) during the last few years. Many of these compounds have been in preclinical trials and some are now in clinical use. All drugs in this category have been designed to be well absorbed and overcome the crucial problem of cross-resistance within this class of compounds. Taking into account the rapid occurrence of PI cross-resistance, clinicians who are treating patients with the HIV-1 infection will need new active PIs in the near future. The clinical and antiviral efficacy of the new molecules versus the older PIs will be investigated through comparative trials that are likely to be completed over the next 12 months. These third-generation PIs currently in development will be the subject of our review.

  16. Identification of two new keratinolytic proteases from a Bacillus pumilus strain using protein analysis and gene sequencing.

    PubMed

    Fellahi, Soltana; Chibani, Abdelwaheb; Feuk-Lagerstedt, Elisabeth; Taherzadeh, Mohammad J

    2016-12-01

    The Bacillus strain (CCUG 66887) has a high capacity to excrete keratinase with the ability to degrade both alpha- and beta keratin. In this study we aimed to show the characteristics of the keratinolytic protease and to identify its gene by using liquid chromatography-electrospray ionization tandem mass spectrometry methods (nanoHPLC-ESI-MS/MS) followed by Mascot data base search. The results showed that the enzyme in fact consists of two different keratinases, both with a molecular mass of 38 kDa. Further, DNA sequencing generated the open reading frame (ORF) of one of the genes (Ker1), and de novo genome sequencing identified the ORF of the second gene (Ker2). The two keratinase genes contain 1153 base pairs each and have a gene similarity of 67 %. In addition, the Bacillus strain was classified as Bacillus pumilus and its genes were annotated in the GeneBank at NCBI (accession: CP011109.1). Amino acid sequences alignment with known B. pumilus proteases indicated that the two keratinases of B. pumilus strain C4 are subtilisin-like serine proteases belonging to the Protease S8 family. Taken together, these result suggest the two keratinases as promising candidates for enzymatic processing of keratinous wastes in waste refinery.

  17. Cloning, expression, and characterization of a milk-clotting aspartic protease gene (Po-Asp) from Pleurotus ostreatus.

    PubMed

    Yin, Chaomin; Zheng, Liesheng; Chen, Liguo; Tan, Qi; Shang, Xiaodong; Ma, Aimin

    2014-02-01

    An aspartic protease gene from Pleurotus ostreatus (Po-Asp) had been cloned based on the 3' portion of cDNA in our previous work. The Po-Asp cDNA contained 1,324 nucleotides with an open reading frame (ORF) of 1,212 bp encoding 403 amino acid residues. The putative amino acid sequence included a signal peptide, an activation peptide, two most possible N-glycosylation sites and two conserved catalytic active site. The mature polypeptide with 327 amino acid residues had a calculated molecular mass of 35.3 kDa and a theoretical isoelectric point of 4.57. Basic Local Alignment Search Tool analysis showed 68-80 % amino acid sequence identical to other basidiomycetous aspartic proteases. Sequence comparison and evolutionary analysis revealed that Po-Asp is a member of fungal aspartic protease family. The DNA sequence of Po-Asp is 1,525 bp in length without untranslated region, consisting of seven exons and six introns. The Po-Asp cDNA without signal sequence was expressed in Pichia pastoris and sodium dodecyl sulfate-polyacrylamide gel electrophoresis demonstrated the molecular mass of recombinant Po-Asp was about 43 kDa. The crude recombinant aspartic protease had milk-clotting activity.

  18. Cathepsin L-like protease can regulate the process of metamorphosis and fat body dissociation in Antheraea pernyi.

    PubMed

    Sun, Yu-Xuan; Tang, Lin; Wang, Pei; Abbas, Muhammad Nadeem; Tian, Ji-Wu; Zhu, Bao-Jian; Liu, Chao-Liang

    2017-09-27

    Cathepsins are a group of protease, located in lysosome and play a vital role in physiological process. Here, we reported cathepsin L-like protease (Ap-cathL), which contained an open reading frame of 1155 bp and encoding 385 amino acid residues protein. The I29 inhibitor domain and peptidase C1A (clan CA of cysteine proteases, papain family C1 subfamily) putative conserved domains were detected in Ap-cathL. Quantitative real-time PCR (qRT-PCR) analysis revealed that Ap-cathL highly expressed in the fat body and midgut. The high expression during the molting stage, pupal stage and following 20E (20-hydroxyecdysone) treatment indicated that it maybe involved in the process of molting and metamorphosis. In addition, depletion of Ap-cathL influenced the expression of apoptosis pathway related genes. The protease inhibitor and RNA interference experiments showed that Ap-cathL was involved in the fat body dissociation of A. pernyi. These results suggest that Ap-cathL may involve in the process of metamorphosis and fat body dissociation of A. pernyi. Copyright © 2017 Elsevier Ltd. All rights reserved.

  19. Crystal structure of a complex between Serratia marcescens metallo-protease and an inhibitor from Erwinia chrysanthemi.

    PubMed

    Baumann, U; Bauer, M; Létoffé, S; Delepelaire, P; Wandersman, C

    1995-05-05

    The crystal structure of the complex between the 50 kDa metallo-endoproteinase from Serratia marcescens (SMP), a member of the metzincin superfamily, and an inhibitor from Erwinia chrysanthemi (Inh) was solved by molecular replacement using the known structure of SMP, and refined at 2.30 A resolution to a crystallographic R-factor of 0.195. The E. chrysanthemi inhibitor folds into a compact eight-stranded antiparallel beta-barrel of simple up-down topology such as is found for members of the retinol binding protein family. It mainly interacts with the protease via its five N-terminal residues, which insert into the active site cleft, occupying the S' sites. The first N-terminal residue, SerI1, is partially cleaved off by the protease, while SerI2 makes a hydrogen bond with the catalytically active glutamic acid, Glu177, of the protease. Further interactions are made between one face of the inhibitor formed by the strands s3, s4 and s5 and the protease segment 218 to 228, which is located immediately after the characteristic "Met-turn" of the metzincins.

  20. Human DESC1 serine protease confers tumorigenic properties to MDCK cells and it is upregulated in tumours of different origin

    PubMed Central

    Viloria, C G; Peinado, J R; Astudillo, A; García-Suárez, O; González, M V; Suárez, C; Cal, S

    2007-01-01

    Proteolysis of the extracellular matrix components plays a crucial role in the regulation of the cellular and physiological processes, and different pathologies have been associated with the loss or gain of function of proteolytic enzymes. DESC1 (differentially expressed in squamous cell carcinoma gene 1), a member of the TTSP (type II transmembrane serine protease) family of serine proteases, is an epithelial-specific enzyme that has been found downregulated in squamous cell carcinoma of the head and neck region. We describe new properties of DESC1 suggesting that this protease may be involved in the progression of some type of tumours. Thus, this enzyme hydrolyses some extracellular matrix components, such as fibronectin, gelatin or fibrinogen. Moreover, Madin–Darby canine kidney (MDCK) cells expressing exogenous human DESC1 acquire properties associated with tumour growth such as enhanced motility and an increase of tubular forms in a 3D collagen lattice following HGF treatment. Finally, we generated polyclonal anti-DESC1 antibodies and immunohistochemical analysis in tissues different from head and neck region indicated that this protease was overexpressed in tumours of diverse origins. Taken together, our results suggest that DESC1 could be considered as a potential therapeutic target in some type of tumours. PMID:17579619

  1. Active-site gating regulates substrate selectivity in a chymotrypsin-like serine protease the structure of haemophilus influenzae immunoglobulin A1 protease.

    PubMed

    Johnson, Troy A; Qiu, Jiazhou; Plaut, Andrew G; Holyoak, Todd

    2009-06-12

    We report here the first structure of a member of the immunoglobulin A protease (IgAP) family at 1.75-A resolution. This protease is a founding member of the type V (autotransporter) secretion system and is considered a virulence determinant among the bacteria expressing the enzyme. The structure of the enzyme fits that of a classic autotransporter in which several unique domains necessary for protein function are appended to a central, 100-A-long beta-helical domain. The N-terminal domain of the IgAP is found to possess a chymotrypsin-like fold. However, this catalytic domain contains a unique loop D that extends over the active site acting as a lid, gating substrate access. The data presented provide a structural basis for the known ability of IgAPs to cleave only the proline/serine/threonine-rich hinge peptide unique to IgA1 (isotype 1) in the context of the intact fold of the immunoglobulin. Based upon the structural data, as well as molecular modeling, a model suggesting that the unique extended loop D in this IgAP sterically occludes the active-site binding cleft in the absence of immunoglobulin binding is presented. Only in the context of binding of the IgA1-Fc domain in a valley formed between the N-terminal protease domain and another domain appended to the beta-helix spine (domain 2) is the lid stabilized in an open conformation. The stabilization of this open conformation through Fc association subsequently allows access of the hinge peptide to the active site, resulting in recognition and cleavage of the substrate.

  2. Salt stress represses production of extracellular proteases in Bacillus pumilus.

    PubMed

    Liu, R F; Huang, C L; Feng, H

    2015-05-11

    Bacillus pumilus is able to secrete subtilisin-like prote-ases, one of which has been purified and characterized biochemically, demonstrating great potential for use in industrial applications. In the current study, the biosynthesis and transcription of extracellular pro-teases in B. pumilus (BA06) under salt stress were investigated using various methods, including a proteolytic assay, zymogram analysis, and real-time PCR. Our results showed that total extracellular proteolytic activity, both in fermentation broth and on milk-containing agar plates, was considerably repressed by salt in a dosage-dependent manner. As Bacillus species usually secret multiple extracellular proteases, a vari-ety of individual extracellular protease encoding genes were selected for real-time PCR analysis. It was shown that proteases encoded by the aprE and aprX genes were the major proteases in the fermentation broth in terms of their transcripts in B. pumilus. Further, transcription of aprE, aprX, and epr genes was indeed repressed by salt stress. In con-trast, transcription of other genes (e.g., vpr and wprA) was not repressed or significantly affected by the salt. Conclusively, salt stress represses total extracellular proteolytic activity in B. pumilus, which can largely be ascribed to suppression of the major protease-encoding genes (aprE, aprX) at the transcriptional level. In contrast, transcription of other pro-tease-encoding genes (e.g., vpr, wprA) was not repressed by salt stress.

  3. Screening and characterization of protease producing actinomycetes from marine saltern.

    PubMed

    Suthindhiran, Krish; Jayasri, Mangalam Achuthananda; Dipali, Dipa; Prasar, Apurva

    2014-10-01

    In the course of systematic screening program for bioactive actinomycetes, an alkaline protease producing halophilic strain Actinopolyspora sp. VITSDK2 was isolated from marine saltern, Southern India. The strain was identified as Actinopolyspora based on its phenotypic and phylogenetic characters. The protease was partially purified using ammonium sulfate precipitation and subsequently by DEAE cellulose column chromatography. The enzyme was further purified using HPLC and the molecular weight was found to be 22 kDa as determined by SDS-PAGE analysis. The purified protease exhibited pH stability in a wide range of 4-12 with optimum at 10.0. The enzyme was found to be stable between 25 and 80 °C and displayed a maximum activity at 60 °C. The enzyme activity was increased marginally in presence of Mn(2+) , Mg(2+) , and Ca(2+) and decreased in presence of Cu(2+) . PMSF and DFP completely inhibited the activity suggesting it belongs to serine protease. Further, the proteolytic activity was abolished in presence of N-tosyl-L-lysine chloromethyl ketone suggesting this might be chymotrypsin-like serine protease. The protease was 96% active when kept for 10 days at room temperature. The results indicate that the enzyme belong to chymotrypsin-like serine protease exhibiting both pH and thermostability, which can be used for various applications in industries. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  4. Staphylococcal proteases aid in evasion of the human complement system

    PubMed Central

    Jusko, Monika; Potempa, Jan; Kantyka, Tomasz; Bielecka, Ewa; Miller, Halie K.; Kalinska, Magdalena; Dubin, Grzegorz; Garred, Peter; Shaw, Lindsey N.; Blom, Anna M.

    2014-01-01

    Staphylococcus aureus is an opportunistic pathogen that presents severe healthcare concerns due to the prevalence of multiple antibiotic resistant strains. New treatment strategies are urgently needed, which requires an understanding of disease causation mechanisms. Complement is one of the first lines of defense against bacterial pathogens, and S. aureus expresses several specific complement inhibitors. The effect of extracellular proteases from this bacterium on complement, however, has been the subject of limited investigation, except for a recent report regarding cleavage of the C3 component by aureolysin. We demonstrate here that four major extracellular proteases of S. aureus are potent complement inhibitors. Incubation of human serum with the cysteine proteases staphopain A and staphopain B, the serine protease V8, and the metalloproteinase aureolysin resulted in a drastic decrease in the haemolytic activity of serum; whereas two serine-protease like enzymes, SplD and SplE, had no effect. These four proteases were found to inhibit all pathways of complement due to the efficient degradation of several crucial components. Furthermore, S. aureus mutants lacking proteolytic enzymes were found to be more efficiently killed in human blood. Taken together, the major proteases of S. aureus appear to be important for pathogen-mediated evasion of the human complement system. PMID:23838186

  5. Exploring a new serine protease from Cucumis sativus L.

    PubMed

    Nafeesa, Zohara; Shivalingu, B R; Vivek, H K; Priya, B S; Swamy, S Nanjunda

    2015-03-01

    Coagulation is an important physiological process in hemostasis which is activated by sequential action of proteases. This study aims to understand the involvement of aqueous fruit extract of Cucumis sativus L. (AqFEC) European burp less variety in blood coagulation cascade. AqFEC hydrolyzed casein in a dose-dependent manner. The presence of protease activity was further confirmed by casein zymography which revealed the possible presence of two high molecular weight protease(s). The proteolytic activity was inhibited only by phenyl methyl sulphonyl fluoride suggesting the presence of serine protease(s). In a dose-dependent manner, AqFEC also hydrolysed Aα and Bβ subunits of fibrinogen, whereas it failed to degrade the γ subunit of fibrinogen even at a concentration as high as 100 μg and incubation time up to 4 h. AqFEC reduced the clotting time of citrated plasma by 87.65%. The protease and fibrinogenolytic activity of AqFEC suggests its possible role in stopping the bleeding and ensuing wound healing process.

  6. German cockroach frass proteases cleave pro-matrix metalloproteinase-9.

    PubMed

    Hughes, Valerie S; Page, Kristen

    2007-01-01

    Matrix metalloproteinase (MMP)-9, secreted as pro-MMP-9, is cleaved by serine proteases at the N-terminus to generate active MMP-9. Pro-MMP-9 has been found in the bronchoalveolar lavage fluid of patients with asthma. Because many inhaled aeroallergens contain active proteases, the authors sought to determine whether German cockroach (GC) fecal remnants (frass) and house dust mite (HDM) were able to cleave pro-MMP-9. Treatment of recombinant human (rh) pro-MMP-9 with GC frass resulted in a dose- and time-dependent cleavage. This was abrogated by pretreating frass with an inhibitor of serine, but not cysteine protease activity. GC frass also induced cleavage of pro-MMP-9 from primary human neutrophils dependent on the active serine proteases in GC frass. HDM was less potent at cleaving pro-MMP-9. Alpha1-antitrypsin (A1AT), a naturally occurring protease inhibitor, attenuated GC frass-induced cleavage of pro-MMP-9. A1AT partially inactivated the serine protease activity in GC frass, while GC frass cleaved A1AT in a dose- and time-dependent manner. These data suggest that GC frass-derived serine proteases could regulate the activity of MMP-9 and that A1AT may play an important role in modulating GC frass activity in vivo. These data suggest a mechanism by which inhalation of GC frass could regulate airway remodeling through the activation of pro-MMP-9.

  7. Effects of detergents on the West Nile virus protease activity.

    PubMed

    Ezgimen, Manolya D; Mueller, Niklaus H; Teramoto, Tadahisa; Padmanabhan, R

    2009-05-01

    Detergents such as Triton X-100 are often used in drug discovery research to weed out small molecule promiscuous and non-specific inhibitors which act by aggregation in solution and undesirable precipitation in aqueous assay buffers. We evaluated the effects of commonly used detergents, Triton X-100, Tween-20, Nonidet-40 (NP-40), Brij-35, and CHAPS, on the enzymatic activity of West Nile virus (WNV) protease. Unexpectedly, Triton X-100, Tween-20, and NP-40 showed an enhancement of in vitro WNV protease activity from 2 to 2.5-fold depending on the detergent and its concentration. On the other hand, Brij-35, at 0.001% enhanced the protease activity by 1.5-fold and CHAPS had the least enhancing effect. The kinetic analysis showed that the increase in protease activity by Triton X-100 was dose-dependent. Furthermore, at Triton X-100 and Tween-20 concentrations higher than 0.001%, the inhibition of compound B, one of the lead compounds against WNV protease identified in a high throughput screen (IC(50) value of 5.7+/-2.5 microM), was reversed. However, in the presence of CHAPS, compound B still showed good inhibition of WNV protease. Our results, taken together, indicate that nonionic detergents, Triton X-100, Tween, and NP-40 are unsuitable for the purpose of discrimination of true versus promiscuous inhibitors of WNV protease in high throughput assays.

  8. Cold-adapted proteases as an emerging class of therapeutics.

    PubMed

    Fornbacke, Marcus; Clarsund, Mats

    2013-06-01

    Proteases have been used in medicine for several decades and are an established and well tolerated class of therapeutic agent. These proteases were sourced from mammals or bacteria that exist or have adapted to moderate temperatures (mesophilic organisms); however, proteases derived from organisms from cold environments-cold-adapted or psychrophilic proteases-generally have high specific activity, low substrate affinity, and high catalytic rates at low and moderate temperatures. Made possible by greater flexibility, psychrophilic enzymes interact with and transform the substrate at lower energy costs. Cold-adapted proteases have been used in a wide range of applications, including industrial functions, textiles, cleaning/hygiene products, molecular biology, environmental bioremediations, consumer food products, cosmetics, and pharmaceutical production. In addition to these applications, they have also shown promise as therapeutic modalities for cosmeceutical applications (by reducing glabellar [frown] lines) and a number of disease conditions, including bacterial infections (by disrupting biofilms to prevent bacterial infection), topical wound management (when used as a debridement agent to remove necrotic tissue and fibrin clots), oral/dental health management (by removing plaque and preventing periodontal disease), and in viral infections (by reducing the infectivity of viruses, such as human rhinovirus 16 and herpes simplex virus). Psychrophilic proteases with greater activity and stability (than the original organism-derived variant) have been developed; this coupled with available manufacturing recombinant production techniques suggests that cold-adapted proteases have a promising future as a distinct therapeutic class with diverse clinical applications.

  9. Expression and functions of proteases in vascular tissues.

    PubMed

    Petzold, H Earl; Zhao, Mingzhe; Beers, Eric P

    2012-05-01

    With the emergence of new models for wood formation and the increasing emphasis on improving the efficiency of cellulosic biofuel production, research on vascular tissue biology has intensified in recent years. Some of the most active areas of research focus on manipulating activity of enzymes in the cellulose, hemicellulose, pectin and lignin pathways. In addition, great strides have been made in the characterization of transcriptional networks controlling genes that affect differentiation, secondary cell wall synthesis and programmed cell death in xylem. Less attention has been devoted to the characterization of proteases that may be important regulators of post-translational events that affect vascular cell differentiation and function and cell wall composition. Several genes for proteases and components of the ubiquitin/26S proteasome pathway are upregulated in xylem and phloem and in cell culture systems for studying the differentiation of xylem tracheary elements (TEs). Although small molecule protease inhibitors have been used to explore the roles of proteases during the differentiation of cultured TEs, only a small number of vascular tissue-associated protease genes have been directly tested to determine whether they play roles in vascular tissue biology. In this report, we review roles for proteases in vascular cell differentiation and function as determined through the use of protease inhibitors and genetic analyses and conclude by identifying opportunities for future research in this area. Copyright © Physiologia Plantarum 2011.

  10. A proteomic approach for the discovery of protease substrates.

    PubMed

    Bredemeyer, Andrew J; Lewis, Renate M; Malone, James P; Davis, Alan E; Gross, Julia; Townsend, R Reid; Ley, Timothy J

    2004-08-10

    Standardized, comprehensive platforms for the discovery of protease substrates have been extremely difficult to create. Screens for protease specificity are now frequently based on the cleavage patterns of peptide substrates, which contain small recognition motifs that are required for the cleavage of the scissile bond within an active site. However, these studies do not identify in vivo substrates, nor can they lead to the definition of the macromolecular features that account for the biological specificity of proteases. To use properly folded proteins in a proteomic screen for protease substrates, we used 2D difference gel electrophoresis and tandem MS to identify substrates of an apoptosis-inducing protease, granzyme B. We confirmed the cleavage of procaspase-3, one of the key substrates of this enzyme, and identified several substrates that were previously unknown, as well as the cleavage site for one of these substrates. We were also able to observe the kinetics of substrate cleavage and cleavage product accumulation by using the 2D difference gel electrophoresis methodology. "Protease proteomics" may therefore represent an important tool for the discovery of the native substrates of a variety of proteases.

  11. Laundry detergent compatibility of the alkaline protease from Bacillus cereus.

    PubMed

    Banik, Rathindra Mohan; Prakash, Monika

    2004-01-01

    The endogenous protease activity in various commercially available laundry detergents of international companies was studied. The maximum protease activity was found at 50 degrees C in pH range 10.5-11.0 in all the tested laundry detergents. The endogenous protease activity in the tested detergents retained up to 70% on incubation at 40 degrees C for 1 h, whereas less than 30% activity was only found on incubation at 50 degrees C for 1 h. The alkaline protease from an alkalophilic strain of Bacillus cereus was studied for its compatibility in commercial detergents. The cell free fermented broth from shake flask culture of the organism showed maximum activity at pH 10.5 and 50 degrees C. The protease from B. cereus showed much higher residual activity (more than 80%) on incubation with laundry detergents at 50 degrees C for 1 h or longer. The protease enzyme from B. cereus was found to be superior over the endogenous proteases present in the tested commercial laundry detergents in comparison to the enzyme stability during the washing at higher temperature, e.g., 40-50 degrees C.

  12. The emerging role of coagulation proteases in kidney disease

    PubMed Central

    Madhusudhan, Thati; Kerlin, Bryce A.; Isermann, Berend

    2016-01-01

    A role of coagulation proteases in kidney disease beyond their function in normal haemostasis and thrombosis has long been suspected, and studies performed in the past 15 years have provided novel insights into the mechanisms involved. The expression of protease-activated receptors (PARs) in renal cells provides a molecular link between coagulation proteases and renal cell function and revitalizes research evaluating the role of haemostasis regulators in renal disease. Renal cell-specific expression and activity of coagulation proteases, their regulators and their receptors are dynamically altered during disease processes. Furthermore, renal inflammation and tissue remodelling are not only associated, but are causally linked with altered coagulation activation and protease-dependent signalling. Intriguingly, coagulation proteases signal through more than one receptor or induce formation of receptor complexes in a cell-specific manner, emphasizing context specificity. Understanding these cell-specific signalosomes and their regulation in kidney disease is crucial to unravelling the pathophysiological relevance of coagulation regulators in renal disease. In addition, the clinical availability of small molecule targeted anticoagulants as well as the development of PAR antagonists increases the need for in-depth knowledge of the mechanisms through which coagulation proteases might regulate renal physiology. PMID:26592189

  13. Protease activity, localization and inhibition in the human hair follicle.

    PubMed

    Bhogal, R K; Mouser, P E; Higgins, C A; Turner, G A

    2014-02-01

    In humans, the process of hair shedding, referred to as exogen, is believed to occur independently of the other hair cycle phases. Although the actual mechanisms involved in hair shedding are not fully known, it has been hypothesized that the processes leading to the final step of hair shedding may be driven by proteases and/or protease inhibitor activity. In this study, we investigated the presence of proteases and protease activity in naturally shed human hairs and assessed enzyme inhibition activity of test materials. We measured enzyme activity using a fluorescence-based assay and protein localization by indirect immunohistochemistry (IHC). We also developed an ex vivo skin model for measuring the force required to pull hair fibres from skin. Our data demonstrate the presence of protease activity in the tissue material surrounding club roots. We also demonstrated the localization of specific serine protease protein expression in human hair follicle by IHC. These data provide evidence demonstrating the presence of proteases around the hair club roots, which may play a role during exogen. We further tested the hypothesis that a novel protease inhibitor system (combination of Trichogen) and climbazole) could inhibit protease activity in hair fibre club root extracts collected from a range of ethnic groups (U.K., Brazil, China, first-generation Mexicans in the U.S.A., Thailand and Turkey) in both males and females. Furthermore, we demonstrated that this combination is capable of increasing the force required to remove hair in an ex vivo skin model system. These studies indicate the presence of proteolytic activity in the tissue surrounding the human hair club root and show that it is possible to inhibit this activity with a combination of Trichogen and climbazole. This technology may have potential to reduce excessive hair shedding. © 2013 Society of Cosmetic Scientists and the Société Française de Cosmétologie.

  14. IrSPI, a Tick Serine Protease Inhibitor Involved in Tick Feeding and Bartonella henselae Infection

    PubMed Central

    Liu, Xiang Ye; de la Fuente, Jose; Cote, Martine; Galindo, Ruth C.; Moutailler, Sara; Vayssier-Taussat, Muriel; Bonnet, Sarah I.

    2014-01-01

    Ixodes ricinus is the most widespread and abundant tick in Europe, frequently bites humans, and is the vector of several pathogens including those responsible for Lyme disease, Tick-Borne Encephalitis, anaplasmosis, babesiosis and bartonellosis. These tick-borne pathogens are transmitted to vertebrate hosts via tick saliva during blood feeding, and tick salivary gland (SG) factors are likely implicated in transmission. In order to identify such tick factors, we characterized the transcriptome of female I. ricinus SGs using next generation sequencing techniques, and compared transcriptomes between Bartonella henselae-infected and non-infected ticks. High-throughput sequencing of I. ricinus SG transcriptomes led to the generation of 24,539 isotigs. Among them, 829 and 517 transcripts were either significantly up- or down-regulated respectively, in response to bacterial infection. Searches based on sequence identity showed that among the differentially expressed transcripts, 161 transcripts corresponded to nine groups of previously annotated tick SG gene families, while the others corresponded to genes of unknown function. Expression patterns of five selected genes belonging to the BPTI/Kunitz family of serine protease inhibitors, the tick salivary peptide group 1 protein, the salp15 super-family, and the arthropod defensin family, were validated by qRT-PCR. IrSPI, a member of the BPTI/Kunitz family of serine protease inhibitors, showed the highest up-regulation in SGs in response to Bartonella infection. IrSPI silencing impaired tick feeding, as well as resulted in reduced bacterial load in tick SGs. This study provides a comprehensive analysis of I. ricinus SG transcriptome and contributes significant genomic information about this important disease vector. This in-depth knowledge will enable a better understanding of the molecular interactions between ticks and tick-borne pathogens, and identifies IrSPI, a candidate to study now in detail to estimate its

  15. A genetic locus closely linked to a protease inhibitor gene complex controls the level of multiple RNA transcripts.

    PubMed Central

    Hill, R E; Shaw, P H; Barth, R K; Hastie, N D

    1985-01-01

    The two major protease inhibitors in mouse plasma are alpha 1-protease inhibitor (alpha 1-PI), putative inhibitor of neutrophil elastase, and contrapsin, an inhibitor in vitro of trypsinlike proteases. We have shown by nucleotide sequence analysis that these two inhibitors are related (R. E. Hill, P. H. Shaw, P. A. Boyd, H. Baumann, and N. D. Hastie, Nature (London) 311:175-177, 1984). Here, we show that the contrapsin and alpha 1-PI genes are members of two different multigene families, each containing at least three genes in mice and rats. We established the chromosomal locations of these genes by analyzing the segregation of restriction fragment length polymorphisms in recombinant inbred mouse strains. These experiments show that the multiple genes in each family are clustered and that the two gene families are closely linked on chromosome 12. Thus the genes for contrapsin and alpha 1-PI are likely to have evolved by duplication of a common ancestral gene. The contrapsin multigene family codes for multiple mRNA transcripts in the liver. There is a genetic difference among inbred mouse strains in the regulation of two of these transcripts. In some inbred strains the transcripts are synthesized constitutively; in others they are induced by inflammation. We mapped in recombinant inbred strains the regulatory locus responsible for this genetic variation and found it is linked to the contrapsin multigene family, which suggests a cis-acting regulatory element. We also found that the contrapsin and the alpha 1-PI multigene families have acquired very different regulatory responses since the time of the gene duplication event. Images PMID:2427931

  16. Spatially dependent activation of the patterning protease, Easter.

    PubMed

    LeMosy, Ellen K

    2006-04-17

    The dorsoventral axis of the Drosophila embryo is established by the activating cleavage of a signaling ligand by a serine protease, Easter, only on the ventral side of the embryo. Easter is the final protease in a serine protease cascade in which initial reaction steps appear not to be ventrally restricted, but where Easter activity is promoted ventrally through the action of a spatial cue at an unknown step in the pathway. Here, biochemical studies demonstrate that this spatial control occurs at or above the level of Easter zymogen activation, rather than through direct promotion of Easter's catalytic activity against the signaling ligand.

  17. [The extracellular proteases of the phytopathogenic bacterium Xanthomonas campestris].

    PubMed

    Kalashnikova, E E; Chernyshova, M P; Ignatov, V V

    2003-01-01

    The culture liquids of three Xanthomonas campestris pv. campestris strains were found to possess proteolytic activity. The culture liquid of strain B-611 with the highest proteolytic activity was fractionated by salting-out with ammonium sulfate, gel filtration, and ion-exchange chromatography. The electrophoretic analysis of active fractions showed the presence of two proteases in the culture liquid of strain B-611, the major of which being serine protease. The treatment of cabbage seedlings with the proteases augmented the activity of peroxidase in the cabbage roots by 28%.

  18. Characterization of the protease activity of detergents: laboratory practicals for studying the protease profile and activity of various commercial detergents.

    PubMed

    Valls, Cristina; Pujadas, Gerard; Garcia-Vallve, Santi; Mulero, Miquel

    2011-07-01

    Detergent enzymes account for about 30% of the total worldwide production of enzymes and are one of the largest and most successful applications of modern industrial biotechnology. Proteases can improve the wash performance of household, industrial, and institutional laundry detergents used to remove protein-based stains such as blood, grass, body fluids, and food soils. This article describes two easy and cheap laboratory exercises to study the presence, profile, and basic enzymology of detergent proteases. These laboratory practicals are based on the determination of the detergent protease activity of various commercial detergents using the N-succinyl-L-alanyl-L-alanyl-L-prolyl-L-phenylalanine p-nitroanilide method and the bovine serum albumin degradation capacity. Students are also required to elucidate the enzymatic subtype of detergent proteases by studying the inhibitory potential of several types of protease inhibitors revealed by the same experimental methodology. Additionally, the results of the exercises can be used to provide additional insights on elementary enzymology by studying the influence of several important parameters on protease activity such as temperature (in this article) and the influence of pH and effects of surfactants and oxidizers (proposed). Students also develop laboratory skills, problem-solving capacities, and the ability to write a laboratory report. The exercises are mainly designed for an advanced undergraduate project in the biochemistry and biotechnology sciences. Globally, these laboratory practicals show students the biotechnological applications of proteases in the detergent industry and also reinforce important enzymology concepts.

  19. Amino-acid sequence and glycan structures of cysteine proteases with proline specificity from ginger rhizome Zingiber officinale.

    PubMed

    Choi, K H; Laursen, R A

    2000-03-01

    The ginger proteases (GP-I and GP-II), isolated from the ginger rhizome Zingiber officinale, have an unusual substrate specificity preference for cleaving peptides with a proline residue at the P2 position. The complete amino-acid sequence of GP-II, a glycoprotein containing 221 amino acids, and about 98% that of GP-I have been determined. Both proteases, which are 82% similar, have cysteine residues at positions 27 and histidines at position 161, corresponding to the essential cysteine-histidine diads found in the papain family of cysteine proteases, and six corresponding cysteine residues that form the three invariant disulfide linkages seen in this family of proteins. The sequence homology with other members (papain, bromelain, actinidin, protease omega, etc.) of this family is approximately 50%. GP-II has two predicted glycosylation sites at Asn99 and Asn156. Analyisis by electrospray and collision-induced dissociation MS showed that both sites were occupied by the glycans (Man)3(Xyl)1(Fuc)1(GlcNAc)2 and (Man)3(Xyl)1(Fuc)1(GlcNAc)3, in a ratio of approximately 7 : 1. Both glycans are xylose containing biantennary complex types that share the common core structural unit, Man1-->6(Man1-->3) (Xyl1-->2)Man1-->4GlcNAc1-->4(Fuc1-->3)GlcNAc for the major form, with an additional N-acetylglucosamine residue being linked, in the minor form, to one of the terminal mannose units of the core structure.

  20. Detection of Legume Protease Inhibitors by the Gel-X-ray Film Contact Print Technique

    ERIC Educational Resources Information Center

    Mulimani, Veerappa H.; Sudheendra, Kulkarni; Giri, Ashok P.

    2002-01-01

    Redgram (Cajanus cajan L.) extracts have been analyzed for the protease inhibitors using a new, sensitive, simple, and rapid method for detection of electrophoretically separated protease inhibitors. The detection involves equilibrating the gel successively in the protease assay buffer and protease solution, rinsing the gel in assay buffer, and…

  1. Detection of Legume Protease Inhibitors by the Gel-X-ray Film Contact Print Technique

    ERIC Educational Resources Information Center

    Mulimani, Veerappa H.; Sudheendra, Kulkarni; Giri, Ashok P.

    2002-01-01

    Redgram (Cajanus cajan L.) extracts have been analyzed for the protease inhibitors using a new, sensitive, simple, and rapid method for detection of electrophoretically separated protease inhibitors. The detection involves equilibrating the gel successively in the protease assay buffer and protease solution, rinsing the gel in assay buffer, and…

  2. Aspergillus protein degradation pathways with different secreted protease sets at neutral and acidic pH.

    PubMed

    Sriranganadane, Dev; Waridel, Patrice; Salamin, Karine; Reichard, Utz; Grouzmann, Eric; Neuhaus, Jean-Marc; Quadroni, Manfredo; Monod, Michel

    2010-07-02

    Aspergillus fumigatus grows well at neutral and acidic pH in a medium containing protein as the sole nitrogen source by secreting two different sets of proteases. Neutral pH favors the secretion of neutral and alkaline endoproteases, leucine aminopeptidases (Laps) which are nonspecific monoaminopeptidases, and an X-prolyl dipeptidase (DppIV). Acidic pH environment promotes the secretion of an aspartic endoprotease of pepsin family (Pep1) and tripeptidyl-peptidases of the sedolisin family (SedB and SedD). A novel prolyl peptidase, AfuS28, was found to be secreted in both alkaline and acidic conditions. In previous studies, Laps were shown to degrade peptides from their N-terminus until an X-Pro sequence acts as a stop signal. X-Pro sequences can be then removed by DppIV, which allows Laps access to the following residues. We have shown that at acidic pH Seds degrade large peptides from their N-terminus into tripeptides until Pro in P1 or P'1 position acts as a stop for these exopeptidases. However, X-X-Pro and X-X-X-Pro sequences can be removed by AfuS28 thus allowing Seds further sequential proteolysis. In conclusion, both alkaline and acidic sets of proteases contain exoprotease activity capable of cleaving after proline residues that cannot be removed during sequential digestion by nonspecific exopeptidases.

  3. A protease-independent function for SPPL3 in NFAT activation.

    PubMed

    Makowski, Stefanie L; Wang, Zhaoquan; Pomerantz, Joel L

    2015-01-01

    The signal peptide peptidase (SPP)-related intramembrane aspartyl proteases are a homologous group of polytopic membrane proteins, some of which function in innate or adaptive immunity by cleaving proteins involved in antigen presentation or intracellular signaling. Signal peptide peptidase-like 3 (SPPL3) is a poorly characterized endoplasmic reticulum (ER)-localized member of this family, with no validated cellular substrates. We report here the isolation of SPPL3 in a screen for activators of NFAT, a transcription factor that controls lymphocyte development and function. We find that SPPL3 is required downstream of T cell receptor engagement for maximal Ca(2+) influx and NFAT activation. Surprisingly, the proteolytic activity of SPPL3 is not required for its role in this pathway. SPPL3 enhances the signal-induced association of stromal interaction molecule 1 (STIM1) and Orai1 and is even required for the full activity of constitutively active STIM1 variants that bind Orai1 independently of ER Ca(2+) release. SPPL3 associates with STIM1 through at least two independent domains, the transmembrane region and the CRAC activation domain (CAD), and can promote the association of the STIM1 CAD with Orai1. Our results assign a function in lymphocyte signaling to SPPL3 and highlight the emerging importance of nonproteolytic functions for members of the intramembrane aspartyl protease family. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  4. Role of protease-activated receptors 2 (PAR2) in ocular infections and inflammation

    PubMed Central

    Tripathi, Trivendra; Alizadeh, Hassan

    2015-01-01

    Protease-activated receptors (PARs) belong to a unique family of G protein-coupled receptors (GPCRs) that are cleaved at an activation site within the N-terminal exodomain by a variety of proteinases, essentially of the serine (Ser) proteinase family. After cleavage, the new N-terminal sequence functions as a tethered ligand, which binds intramolecularly to activate the receptor and initiate signaling. Cell signals induced through the activation of PARs appear to play a significant role in innate and adoptive immune responses of the cornea, which is constantly exposed to proteinases under physiological or pathophysiological conditions. Activation of PARs interferes with all aspects of the corneal physiology such as barrier function, transports, innate and adoptive immune responses, and functions of corneal nerves. It is not known whether the proteinase released from the microorganism can activate PARs and triggers the inflammatory responses. The role of PAR2 expressed by the corneal epithelial cells and activation by serine protease released from microorganism is discussed here. Recent evidences suggest that activation of PAR2, by the serine proteinases, play an important role in innate and inflammatory responses of the corneal infection. PMID:26078987

  5. Zebra chip disease decreases tuber (Solanum tuberosum L.) protein content by attenuating protease inhibitor levels and increasing protease activities.

    PubMed

    Kumar, G N Mohan; Knowles, Lisa O; Knowles, N Richard

    2015-11-01

    Zebra chip disease of potato decreases protease inhibitor levels resulting in enhanced serine-type protease activity, decreased protein content and altered protein profiles of fully mature tubers. Zebra-chip (ZC), caused by Candidatus Liberibacter solanacearum (CLso), is a relatively new disease of potato that negatively affects growth, yield, propagation potential, and fresh and process qualities of tubers. Diseased plants produce tubers with characteristic brown discoloration of vascular tissue accompanied by elevated levels of free amino acids and reducing sugars. Here we demonstrate that ZC disease induces selective protein catabolism in tubers through modulating protease inhibitor levels. Soluble protein content of tubers from CLso-infected plants was 33% lower than from non-infected plants and electrophoretic analyses revealed substantial reductions in major tuber proteins. Patatin (~40 kDa) and ser-, asp- (22 kDa) and cys-type (85 kDa) protease inhibitors were either absent or greatly reduced in ZC-afflicted tubers. In contrast to healthy (non-infected) tubers, the proteolytic activity in CLso infected tubers was high and the ability of extracts from infected tubers to inhibit trypsin (ser-type) and papain (cys-type) proteases greatly attenuated. Moreover, extracts from CLso-infected tubers rapidly catabolized proteins purified from healthy tubers (40 kDa patatin, 22 kDa protease inhibitors, 85 kDa potato multicystatin) when subjected to proteolysis individually. In contrast, crude extracts from non-infected tubers effectively inhibited the proteolytic activity from ZC-afflicted tubers. These results suggest that the altered protein profile of ZC afflicted tubers is largely due to loss of ser- and cys-type protease inhibitors. Further analysis revealed a novel PMSF-sensitive (ser) protease (ca. 80-120 kDa) in CLso infected tubers. PMSF abolished the proteolytic activities responsible for degrading patatin, the 22 kDa protease inhibitor(s) and potato

  6. Purification, characterization, and gene cloning of thermopsin, a thermostable acid protease from Sulfolobus acidocaldarius.

    PubMed

    Lin, X; Tang, J

    1990-01-25

    A thermostable, acid proteolytic activity has been found to be associated with the cells and in the culture medium of Sulfolobus acidocaldarius, an archaebacterium. This acid protease, which has been named thermopsin, was purified to homogeneity from the culture medium by a five-step procedure including column chromatographies on DEAE-Sepharose CL-6B, phenyl-Sepharose CL-4B, Sephadex G-100, monoQ (fast protein liquid chromatography), and gel filtration (high pressure liquid chromatography). The purified thermopsin produced a single band on sodium dodecyl sulfate-polyacrylamide gel electrophoresis and the proteolytic activity was associated with the band. Thermopsin is a single-chain protein as indicated by gel electrophoresis and by a single NH2-terminal sequence. It has maximal proteolytic activity at pH 2 and 90 degrees C. A genomic library of S. acidocaldarius was prepared and screened by an oligonucleotide probe designed from the NH2-terminal sequence of thermopsin. Five positive clones were isolated. From these clones the thermopsin gene was mapped and sequenced. The nucleotide sequence showed that the thermopsin structure is encoded in 1020 bases. In the deduced protein sequence, there are 41 amino acid residues (including the initiation Met) preceding the NH2-terminal position of thermopsin. Most of these residues appear to be characteristic of a leader sequence. However, the presence in this region of a short pro sequence cannot be ruled out. Thermopsin contains a single cysteine at residue 237 that is not essential for activity (Fusek, M., Lin, X.-L., Tang, J. (1990) J. Biol. Chem. 265, 1496-1501. Thermopsin has no apparent sequence similarity to aspartic proteases of the pepsin family nor to pepstatin-insensitive acid protease (Maita, T., Nagata, S., Matsuda, G., Murata, S., Oda, K., Murao, S., and Tsura, D. (1984) J. Biochem. 95, 465-475) and thus may represent a new class of acid proteases. Also absent is the characteristic active site aspartyl sequence

  7. Improving Viral Protease Inhibitors to Counter Drug Resistance

    PubMed Central

    Yilmaz, Nese Kurt; Swanstrom, Ronald; Schiffer, Celia A.

    2016-01-01

    Drug resistance is a major problem in health care, undermining therapy outcomes and necessitating novel approaches to drug design. Extensive studies on resistance to viral protease inhibitors, particularly those of HIV-1 and hepatitis C virus (HCV) protease, revealed a plethora of information on the structural and molecular mechanisms underlying resistance. These insights led to several strategies to improve viral protease inhibitors to counter resistance, such as exploiting the essential biological function and leveraging evolutionary constraints. Incorporation of these strategies into structure-based drug design can minimize vulnerability to resistance, not only for viral proteases but for other quickly evolving drug targets as well, toward designing inhibitors one step ahead of evolution to counter resistance with more intelligent and rational design. PMID:27090931

  8. Synergism of Selective Tumor Vascular Thrombosis and Protease Activated Prodrug

    DTIC Science & Technology

    2008-05-01

    Such a cytotoxin can be aldesleukin, 5- aminolevulinic acid, bleomycin sulfate, camptothecin, carboplatin, carmustine, cisplatin, cladribine, lyophilized... aminolevulinic acid, protoporphyrin IX, taxol or paclitaxel. In one embodiment, the prodrug is activated by asparaginyl proteases (e.g., legumain) and

  9. Inhibition of activity of the protease from bovine leukemia virus.

    PubMed

    Ménard, A; Leonard, R; Llido, S; Geoffre, S; Picard, P; Berteau, F; Precigoux, G; Hospital, M; Guillemain, B

    1994-06-13

    In view of the close similarity between bovine leukemia virus (BLV) and human T-cell leukemia virus type I (HTLV-I) we investigated the possibility of developing specific inhibitors of the proteases of these retroviruses using the purified enzyme from BLV. We tested the ability of this protease to specifically cleave various short oligopeptide substrates containing cleavage sites of BLV and HTLV-I proteases, as well as a recombinant BLV Gag precursor. The best substrate, a synthetic decapeptide bearing the natural cleavage site between the matrix and the capsid proteins of BLV Gag precursor polyprotein, was used to develop an inhibition assay. We determined the relative inhibitory effect of synthetic Gag precursor-like peptides in which the cleavable site was replaced by a non-hydrolyzable moiety. The encouraging inhibitory effect of these compounds indicates that potent non-peptidic inhibitors for retroviral proteases are not unattainable.

  10. The role of proteases in regulating Eph/ephrin signaling

    PubMed Central

    Atapattu, Lakmali; Lackmann, Martin; Janes, Peter W

    2014-01-01

    Proteases regulate a myriad of cell functions, both in normal and disease states. In addition to protein turnover, they regulate a range of signaling processes, including those mediated by Eph receptors and their ephrin ligands. A variety of proteases is reported to directly cleave Ephs and/or ephrins under different conditions, to promote receptor and/or ligand shedding, and regulate receptor/ligand internalisation and signaling. They also cleave other adhesion proteins in response to Eph-ephrin interactions, to indirectly facilitate Eph-mediated functions. Proteases thus contribute to Eph/ephrin mediated changes in cell-cell and cell-matrix interactions, in cell morphology and in cell migration and invasion, in a manner which appears to be tightly regulated by, and co-ordinated with, Eph signaling. This review summarizes the current literature describing the function and regulation of protease activities during Eph/ephrin-mediated cell signaling. PMID:25482632

  11. Crystal Structure of Human Taspase1, a Crucial Protease Regulating the Function of MLL

    SciTech Connect

    Khan,J.; Dunn, B.; Tong, L.

    2005-01-01

    Taspase1 catalyzes the proteolytic processing of the mixed lineage leukemia (MLL) nuclear protein, which is required for maintaining Hox gene expression patterns. Chromosomal translocations of the MLL gene are associated with leukemia in infants. Taspase1, a threonine aspartase, is a member of the type 2 asparaginase family, but is the only protease in this family. We report here the crystal structures of human activated Taspase1 and its proenzyme, as well as the characterization of the effects of mutations in the active site region using a newly developed fluorogenic assay. The structure of Taspase1 has significant differences from other asparaginases, especially near the active site. Mutation of the catalytic nucleophile, Thr234, abolishes autocatalytic processing in cis but does not completely block proteolysis in trans. The structure unexpectedly showed the binding of a chloride ion in the active site, and our kinetic studies confirm that chlorides ions are inhibitors of this enzyme at physiologically relevant concentrations.

  12. Proteases in cardiometabolic diseases: Pathophysiology, molecular mechanisms and clinical applications

    PubMed Central

    Hua, Yinan; Nair, Sreejayan

    2014-01-01

    Cardiovascular disease is the leading cause of death in the U.S. and other developed country. Metabolic syndrome, including obesity, diabetes/insulin resistance, hypertension and dyslipidemia is major threat for public health in the modern society. It is well established that metabolic syndrome contributes to the development of cardiovascular disease collective called as cardiometabolic disease. Despite documented studies in the research field of cardiometabolic disease, the underlying mechanisms are far from clear. Proteases are enzymes that break down proteins, many of which have been implicated in various diseases including cardiac disease. Matrix metalloproteinase (MMP), calpain, cathepsin and caspase are among the major proteases involved in cardiac remodeling. Recent studies have also implicated proteases in the pathogenesis of cardiometabolic disease. Elevated expression and activities of proteases in atherosclerosis, coronary heart disease, obesity/insulin-associated heart disease as well as hypertensive heart disease have been documented. Furthermore, transgenic animals that are deficient in or overexpress proteases allow scientists to understand the causal relationship between proteases and cardiometabolic disease. Mechanistically, MMPs and cathepsins exert their effect on cardiometabolic diseases mainly through modifying the extracellular matrix. However, MMP and cathepsin are also reported to affect intracellular proteins, by which they contribute to the development of cardiometabolic diseases. On the other hand, activation of calpain and caspases has been shown to influence intracellular signaling cascade including the NF-κB and apoptosis pathways. Clinically, proteases are reported to function as biomarkers of cardiometabolic diseases. More importantly, the inhibitors of proteases are credited with beneficial cardiometabolic profile, although the exact molecular mechanisms underlying these salutary effects are still under investigation. A better

  13. Engineering Environmentally-Stable Proteases to Specifically Neutralize Protein Toxins

    DTIC Science & Technology

    2013-10-01

    2-0128 TITLE: ENGINEERING ENVIRONMENTALLY-STABLE PROTEASES TO SPECIFICALLY NEUTRALIZE PROTEIN TOXINS PRINCIPAL INVESTIGATOR: Philip N...Bryan CONTRACTING ORGANIZATION: Potomac Affinity Proteins , LLC NORTH POTOMAC MD 20878-2566 REPORT DATE: October 2013 TYPE OF REPORT...CONTRACT NUMBER ENGINEERING ENVIRONMENTALLY-STABLE PROTEASES TO SPECIFICALLY NEUTRALIZE PROTEIN TOXINS 5b. GRANT NUMBER W81XWH-10-2-0128 5c

  14. Photoactivated Spatiotemporally-Responsive Nanosensors of in Vivo Protease Activity.

    PubMed

    Dudani, Jaideep S; Jain, Piyush K; Kwong, Gabriel A; Stevens, Kelly R; Bhatia, Sangeeta N

    2015-12-22

    Proteases play diverse and important roles in physiology and disease, including influencing critical processes in development, immune responses, and malignancies. Both the abundance and activity of these enzymes are tightly regulated and highly contextual; thus, in order to elucidate their specific impact on disease progression, better tools are needed to precisely monitor in situ protease activity. Current strategies for detecting protease activity are focused on functionalizing synthetic peptide substrates with reporters that emit detection signals following peptide cleavage. However, these activity-based probes lack the capacity to be turned on at sites of interest and, therefore, are subject to off-target activation. Here we report a strategy that uses light to precisely control both the location and time of activity-based sensing. We develop photocaged activity-based sensors by conjugating photolabile molecules directly onto peptide substrates, thereby blocking protease cleavage by steric hindrance. At sites of disease, exposure to ultraviolet light unveils the nanosensors to allow proteases to cleave and release a reporter fragment that can be detected remotely. We apply this spatiotemporally controlled system to probe secreted protease activity in vitro and tumor protease activity in vivo. In vitro, we demonstrate the ability to dynamically and spatially measure metalloproteinase activity in a 3D model of colorectal cancer. In vivo, veiled nanosensors are selectively activated at the primary tumor site in colorectal cancer xenografts to capture the tumor microenvironment-enriched protease activity. The ability to remotely control activity-based sensors may offer a valuable complement to existing tools for measuring biological activity.

  15. Effects of cultural conditions on protease production by Aeromonas hydrophila.

    PubMed Central

    O'Reilly, T; Day, D F

    1983-01-01

    Production of extracellular proteolytic activity by Aeromonas hydrophila was influenced by temperature, pH, and aeration. Conditions which produced maximal growth also resulted in maximal protease production. Enzyme production appeared to be modulated by an inducer catabolite repression system whereby NH4+ and glucose repressed enzyme production and complex nitrogen and nonglucose, carbon energy sources promoted it. Under nutritional stress, protease production was high, despite poor growth. PMID:6342534

  16. Antiviral Potential of a Novel Compound CW-33 against Enterovirus A71 via Inhibition of Viral 2A Protease

    PubMed Central

    Wang, Ching-Ying; Huang, An-Cheng; Hour, Mann-Jen; Huang, Su-Hua; Kung, Szu-Hao; Chen, Chao-Hsien; Chen, I-Chieh; Chang, Yuan-Shiun; Lien, Jin-Cherng; Lin, Cheng-Wen

    2015-01-01

    Enterovirus A71 (EV-A71) in the Picornaviridae family causes hand-foot-and-mouth disease, aseptic meningitis, severe central nervous system disease, even death. EV-A71 2A protease cleaves Type I interferon (IFN)-α/β receptor 1 (IFNAR1) to block IFN-induced Jak/STAT signaling. This study investigated anti-EV-A7l activity and synergistic mechanism(s) of a novel furoquinoline alkaloid compound CW-33 alone and in combination with IFN-β. Anti-EV-A71 activities of CW-33 alone and in combination with IFN-β were evaluated by inhibitory assays of virus-induced apoptosis, plaque formation, and virus yield. CW-33 showed antiviral activities with an IC50 of near 200 μM in EV-A71 plaque reduction and virus yield inhibition assays. While, anti-EV-A71 activities of CW-33 combined with 100 U/mL IFN-β exhibited a synergistic potency with an IC50 of approximate 1 μM in plaque reduction and virus yield inhibition assays. Molecular docking revealed CW-33 binding to EV-A71 2A protease active sites, correlating with an inhibitory effect of CW33 on in vitro enzymatic activity of recombinant 2A protease (IC50 = 53.1 μM). Western blotting demonstrated CW-33 specifically inhibiting 2A protease-mediated cleavage of IFNAR1. CW-33 also recovered Type I IFN-induced Tyk2 and STAT1 phosphorylation as well as 2′,5′-OAS upregulation in EV-A71 infected cells. The results demonstrated CW-33 inhibiting viral 2A protease activity to reduce Type I IFN antagonism of EV-A71. Therefore, CW-33 combined with a low-dose of Type I IFN could be applied in developing alternative approaches to treat EV-A71 infection. PMID:26090728

  17. A novel organic solvent- and detergent-stable serine alkaline protease from Trametes cingulata strain CTM10101.

    PubMed

    Omrane Benmrad, Maroua; Moujehed, Emna; Ben Elhoul, Mouna; Zaraî Jaouadi, Nadia; Mechri, Sondes; Rekik, Hatem; Kourdali, Sidali; El Hattab, Mohamed; Badis, Abdelmalek; Sayadi, Sami; Bejar, Samir; Jaouadi, Bassem

    2016-10-01

    A protease-producing fungus was isolated from an alkaline wastewater of chemical industries and identified as Trametes cingulata strain CTM10101 on the basis of the ITS rDNA gene-sequencing. It was observed that the fungus strongly produce extracellular protease grown at 30°C in potato-dextrose-broth (PDB) optimized media (13500U/ml). The pure serine protease isolated by Trametes cingulata (designated SPTC) was purified by ammonium sulfate precipitation-dialysis followed by heat-treatment and UNO S-1 FPLC cation-exchange chromatography. The chemical characterization carried on include phisico-chemical determination and spectroscopie analysis. The MALDI-TOF/MS analysis revealed that the purified enzyme was a monomer with a molecular mass of 31405.16-Da. The enzyme had an NH2-terminal sequence of ALTTQTEAPWALGTVSHKGQAST, thus sharing high homology with those of fungal-proteases. The optimum pH and temperature values of its proteolytic activity were pH 9 and 60°C, respectively, and its half-life times at 60 and 70°C were 9 and 5-h, respectively. It was completely inhibited by PMSF and DFP, which strongly suggested its belonging to the serine protease family. Compared to Flavourzyme(®)500L from Aspergillus oryzae and Thermolysin typeX from Geobacillus stearothermophilus, SPTC displayed higher levels of hydrolysis, substrate specificity, and catalytic efficiency as well as elevated organic solvent tolerance and considerable detergent stability. Finally, SPTC could potentially be used in peptide synthesis and detergent formulations.

  18. The structures of Arabidopsis Deg5 and Deg8 reveal new insights into HtrA proteases

    SciTech Connect

    Sun, Wei; Gao, Feng; Fan, Haitian; Shan, Xiaoyue; Sun, Renhua; Liu, Lin; Gong, Weimin

    2013-05-01

    The crystal structures of Arabidopsis Deg5 and Deg8 have been determined to resolutions of 2.6 and 2.0 Å, respectively, revealing novel structural features of HtrA proteases. Plant Deg5 and Deg8 are two members of the HtrA proteases, a family of oligomeric serine endopeptidases that are involved in a variety of protein quality-control processes. These two HtrA proteases are located in the thylakoid lumen and participate in high-light stress responses by collaborating with other chloroplast proteins. Deg5 and Deg8 degrade photodamaged D1 protein of the photosystem II reaction centre, allowing its in situ replacement. Here, the crystal structures of Arabidopsis thaliana Deg5 (S266A) and Deg8 (S292A) are reported at 2.6 and 2.0 Å resolution, respectively. The Deg5 trimer contains two calcium ions in a central channel, suggesting a link between photodamage control and calcium ions in chloroplasts. Previous structures of HtrA proteases have indicated that their regulation usually requires C-terminal PDZ domain(s). Deg5 is unique in that it contains no PDZ domain and the trimeric structure of Deg5 (S266A) reveals a novel catalytic triad conformation. A similar triad conformation is observed in the hexameric structure of the single PDZ-domain-containing Deg8 (S292A). These findings suggest a novel activation mechanism for plant HtrA proteases and provide structural clues to their function in light-stress response.

  19. Identification of two components of the Serratia marcescens metalloprotease transporter: protease SM secretion in Escherichia coli is TolC dependent.

    PubMed

    Létoffé, S; Ghigo, J M; Wandersman, C

    1993-11-01

    The Serratia marcescens metalloprotease (protease SM) belongs to a family of proteins secreted from gram-negative bacteria by a signal peptide-independent pathway which requires a specific transporter consisting of three proteins: two in the inner membrane and one in the outer membrane. The prtDSM and prtESM genes encoding the two S. marcescens inner membrane components were cloned and expressed in Escherichia coli. Their nucleotide sequence revealed high overall homology with the two analogous inner membrane components of the Erwinia chrysanthemi protease secretion apparatus and lower, but still significant, homology with the two analogous inner membrane components of the E. coli hemolysin transporter. When expressed in E. coli, these two proteins, PrtDSM and PrtESM, allowed the secretion of protease SM only in the presence of TolC protein, the outer membrane component of the hemolysin transporter.

  20. Proteases for Cell Suicide: Functions and Regulation of Caspases

    PubMed Central

    Chang, Howard Y.; Yang, Xiaolu

    2000-01-01

    Caspases are a large family of evolutionarily conserved proteases found from Caenorhabditis elegans to humans. Although the first caspase was identified as a processing enzyme for interleukin-1β, genetic and biochemical data have converged to reveal that many caspases are key mediators of apoptosis, the intrinsic cell suicide program essential for development and tissue homeostasis. Each caspase is a cysteine aspartase; it employs a nucleophilic cysteine in its active site to cleave aspartic acid peptide bonds within proteins. Caspases are synthesized as inactive precursors termed procaspases; proteolytic processing of procaspase generates the tetrameric active caspase enzyme, composed of two repeating heterotypic subunits. Based on kinetic data, substrate specificity, and procaspase structure, caspases have been conceptually divided into initiators and effectors. Initiator caspases activate effector caspases in response to specific cell death signals, and effector caspases cleave various cellular proteins to trigger apoptosis. Adapter protein-mediated oligomerization of procaspases is now recognized as a universal mechanism of initiator caspase activation and underlies the control of both cell surface death receptor and mitochondrial cytochrome c-Apaf-1 apoptosis pathways. Caspase substrates have bene identified that induce each of the classic features of apoptosis, including membrane blebbing, cell body shrinkage, and DNA fragmentation. Mice deficient for caspase genes have highlighted tissue- and signal-specific pathways for apoptosis and demonstrated an independent function for caspase-1 and -11 in cytokine processing. Dysregulation of caspases features prominently in many human diseases, including cancer, autoimmunity, and neurodegenerative disorders, and increasing evidence shows that altering caspase activity can confer therapeutic benefits. PMID:11104820

  1. The roles of intramembrane proteases in protozoan parasites.

    PubMed

    Sibley, L David

    2013-12-01

    Intramembrane proteolysis is widely conserved throughout different forms of life, with three major types of proteases being known for their ability to cleave peptide bonds directly within the transmembrane domains of their substrates. Although intramembrane proteases have been extensively studied in humans and model organisms, they have only more recently been investigated in protozoan parasites, where they turn out to play important and sometimes unexpected roles. Signal peptide peptidases are involved in endoplasmic reticulum (ER) quality control and signal peptide degradation from exported proteins. Recent studies suggest that repurposing inhibitors developed for blocking presenilins may be useful for inhibiting the growth of Plasmodium, and possibly other protozoan parasites, by blocking signal peptide peptidases. Rhomboid proteases, originally described in the fly, are also widespread in parasites, and are especially expanded in apicomplexans. Their study in parasites has revealed novel roles that expand our understanding of how these proteases function. Within this diverse group of parasites, rhomboid proteases contribute to processing of adhesins involved in attachment, invasion, intracellular replication, phagocytosis, and immune evasion, placing them at the vertex of host-parasite interactions. This article is part of a Special Issue entitled: Intramembrane Proteases. Copyright © 2013 Elsevier B.V. All rights reserved.

  2. Temporal dependence of cysteine protease activation following excitotoxic hippocampal injury.

    PubMed

    Berry, J N; Sharrett-Field, L J; Butler, T R; Prendergast, M A

    2012-10-11

    Excitotoxic insults can lead to intracellular signaling cascades that contribute to cell death, in part by activation of proteases, phospholipases, and endonucleases. Cysteine proteases, such as calpains, are calcium (Ca(2+))-activated enzymes which degrade cytoskeletal proteins, including microtubule-associated proteins, tubulin, and spectrin, among others. The current study used the organotypic hippocampal slice culture model to examine whether pharmacologic inhibition of cysteine protease activity inhibits N-methyl-D-aspartate- (NMDA-) induced excitotoxic (20 μM NMDA) cell death and changes in synaptophysin immunoreactivity. Significant NMDA-induced cytotoxicity (as measured by propidium iodide [PI] uptake) was found in the CA1 region of the hippocampus at all timepoints examined (24, 72, 120 h), an effect significantly attenuated by co-exposure to the selective NMDA receptor antagonist DL-2-Amino-5-phosphonopentanoic acid (APV), but not MDL-28170, a potent cysteine protease inhibitor. Results indicated sparing of NMDA-induced loss of the synaptic vesicular protein synaptophysin in all regions of the hippocampus by MDL-28170, though only at early timepoints after injury. These results suggest Ca(2+)-dependent recruitment of cysteine proteases within 24h of excitotoxic insult, but activation of alternative cellular degrading mechanisms after 24h. Further, these data suggest that synaptophysin may be a substrate for calpains and related proteases.

  3. The Inflammatory Actions of Coagulant and Fibrinolytic Proteases in Disease

    PubMed Central

    Schuliga, Michael

    2015-01-01

    Aside from their role in hemostasis, coagulant and fibrinolytic proteases are important mediators of inflammation in diseases such as asthma, atherosclerosis, rheumatoid arthritis, and cancer. The blood circulating zymogens of these proteases enter damaged tissue as a consequence of vascular leak or rupture to become activated and contribute to extravascular coagulation or fibrinolysis. The coagulants, factor Xa (FXa), factor VIIa (FVIIa), tissue factor, and thrombin, also evoke cell-mediated actions on structural cells (e.g., fibroblasts and smooth muscle cells) or inflammatory cells (e.g., macrophages) via the proteolytic activation of protease-activated receptors (PARs). Plasmin, the principle enzymatic mediator of fibrinolysis, also forms toll-like receptor-4 (TLR-4) activating fibrin degradation products (FDPs) and can release latent-matrix bound growth factors such as transforming growth factor-β (TGF-β). Furthermore, the proteases that convert plasminogen into plasmin (e.g., urokinase plasminogen activator) evoke plasmin-independent proinflammatory actions involving coreceptor activation. Selectively targeting the receptor-mediated actions of hemostatic proteases is a strategy that may be used to treat inflammatory disease without the bleeding complications of conventional anticoagulant therapies. The mechanisms by which proteases of the coagulant and fibrinolytic systems contribute to extravascular inflammation in disease will be considered in this review. PMID:25878399

  4. Phage display as a powerful tool to engineer protease inhibitors.

    PubMed

    Zani, Marie-Louise; Moreau, Thierry

    2010-11-01

    Since its introduction by Georges Smith some 25 years ago, phage display has proved to be a powerful molecular technique for selecting proteins with desired biological properties from huge libraries. Early on, various protease inhibitor scaffolds were displayed at the surface of filamentous phages to select new inhibitors with shifted specificities and enhanced affinities towards one or more target protease(s). The past two decades have seen a number of natural protease inhibitors subjected to phage display, mostly to shift and increase their inhibitory specificity, but also to explore the molecular mechanisms by which they interact with their cognate enzymes with low or very high selectivity. This review focuses on the major uses of phage display in the field of protein protease inhibitors. The exquisite molecular mechanisms by which natural protease inhibitors prevent unwanted or excessive proteolysis in cells and tissues are also examined along with some of the general principles underlying the way phage display is applied to these molecules. Copyright © 2010 Elsevier Masson SAS. All rights reserved.

  5. Regulation of intestinal permeability: The role of proteases

    PubMed Central

    Van Spaendonk, Hanne; Ceuleers, Hannah; Witters, Leonie; Patteet, Eveline; Joossens, Jurgen; Augustyns, Koen; Lambeir, Anne-Marie; De Meester, Ingrid; De Man, Joris G; De Winter, Benedicte Y

    2017-01-01

    The gastrointestinal barrier is - with approximately 400 m2 - the human body’s largest surface separating the external environment from the internal milieu. This barrier serves a dual function: permitting the absorption of nutrients, water and electrolytes on the one hand, while limiting host contact with noxious luminal antigens on the other hand. To maintain this selective barrier, junction protein complexes seal the intercellular space between adjacent epithelial cells and regulate the paracellular transport. Increased intestinal permeability is associated with and suggested as a player in the pathophysiology of various gastrointestinal and extra-intestinal diseases such as inflammatory bowel disease, celiac disease and type 1 diabetes. The gastrointestinal tract is exposed to high levels of endogenous and exogenous proteases, both in the lumen and in the mucosa. There is increasing evidence to suggest that a dysregulation of the protease/antiprotease balance in the gut contributes to epithelial damage and increased permeability. Excessive proteolysis leads to direct cleavage of intercellular junction proteins, or to opening of the junction proteins via activation of protease activated receptors. In addition, proteases regulate the activity and availability of cytokines and growth factors, which are also known modulators of intestinal permeability. This review aims at outlining the mechanisms by which proteases alter the intestinal permeability. More knowledge on the role of proteases in mucosal homeostasis and gastrointestinal barrier function will definitely contribute to the identification of new therapeutic targets for permeability-related diseases. PMID:28405139

  6. Characterizing Protease Specificity: How Many Substrates Do We Need?

    PubMed

    Schauperl, Michael; Fuchs, Julian E; Waldner, Birgit J; Huber, Roland G; Kramer, Christian; Liedl, Klaus R

    2015-01-01

    Calculation of cleavage entropies allows to quantify, map and compare protease substrate specificity by an information entropy based approach. The metric intrinsically depends on the number of experimentally determined substrates (data points). Thus a statistical analysis of its numerical stability is crucial to estimate the systematic error made by estimating specificity based on a limited number of substrates. In this contribution, we show the mathematical basis for estimating the uncertainty in cleavage entropies. Sets of cleavage entropies are calculated using experimental cleavage data and modeled extreme cases. By analyzing the underlying mathematics and applying statistical tools, a linear dependence of the metric in respect to 1/n was found. This allows us to extrapolate the values to an infinite number of samples and to estimate the errors. Analyzing the errors, a minimum number of 30 substrates was found to be necessary to characterize substrate specificity, in terms of amino acid variability, for a protease (S4-S4') with an uncertainty of 5 percent. Therefore, we encourage experimental researchers in the protease field to record specificity profiles of novel proteases aiming to identify at least 30 peptide substrates of maximum sequence diversity. We expect a full characterization of protease specificity helpful to rationalize biological functions of proteases and to assist rational drug design.

  7. Mixture-based peptide libraries for identifying protease cleavage motifs.

    PubMed

    Turk, Benjamin E

    2009-01-01

    All proteases and peptidases are to some extent sequence-specific, in that one or more residues are preferred at particular positions surrounding the cleavage site in substrates. I describe here a general protocol for determining protease cleavage site preferences using mixture-based peptide libraries. Initially a completely random, amino-terminally capped peptide mixture is digested with the protease of interest, and the cleavage products are analyzed by automated Edman sequencing. The distribution of amino acids found in each sequencing cycle indicates which residues are preferred by the protease at positions downstream of the cleav