Sample records for sequence homologies interaction

  1. Evidence of protein-free homology recognition in magnetic bead force-extension experiments

    NASA Astrophysics Data System (ADS)

    O'Lee, D. J.; Danilowicz, C.; Rochester, C.; Kornyshev, A. A.; Prentiss, M.

    2016-07-01

    Earlier theoretical studies have proposed that the homology-dependent pairing of large tracts of dsDNA may be due to physical interactions between homologous regions. Such interactions could contribute to the sequence-dependent pairing of chromosome regions that may occur in the presence or the absence of double-strand breaks. Several experiments have indicated the recognition of homologous sequences in pure electrolytic solutions without proteins. Here, we report single-molecule force experiments with a designed 60 kb long dsDNA construct; one end attached to a solid surface and the other end to a magnetic bead. The 60 kb constructs contain two 10 kb long homologous tracts oriented head to head, so that their sequences match if the two tracts fold on each other. The distance between the bead and the surface is measured as a function of the force applied to the bead. At low forces, the construct molecules extend substantially less than normal, control dsDNA, indicating the existence of preferential interaction between the homologous regions. The force increase causes no abrupt but continuous unfolding of the paired homologous regions. Simple semi-phenomenological models of the unfolding mechanics are proposed, and their predictions are compared with the data.

  2. Evidence of protein-free homology recognition in magnetic bead force–extension experiments

    PubMed Central

    (O’) Lee, D. J.; Danilowicz, C.; Rochester, C.; Prentiss, M.

    2016-01-01

    Earlier theoretical studies have proposed that the homology-dependent pairing of large tracts of dsDNA may be due to physical interactions between homologous regions. Such interactions could contribute to the sequence-dependent pairing of chromosome regions that may occur in the presence or the absence of double-strand breaks. Several experiments have indicated the recognition of homologous sequences in pure electrolytic solutions without proteins. Here, we report single-molecule force experiments with a designed 60 kb long dsDNA construct; one end attached to a solid surface and the other end to a magnetic bead. The 60 kb constructs contain two 10 kb long homologous tracts oriented head to head, so that their sequences match if the two tracts fold on each other. The distance between the bead and the surface is measured as a function of the force applied to the bead. At low forces, the construct molecules extend substantially less than normal, control dsDNA, indicating the existence of preferential interaction between the homologous regions. The force increase causes no abrupt but continuous unfolding of the paired homologous regions. Simple semi-phenomenological models of the unfolding mechanics are proposed, and their predictions are compared with the data. PMID:27493568

  3. Conservation of coevolving protein interfaces bridges prokaryote–eukaryote homologies in the twilight zone

    PubMed Central

    Rodriguez-Rivas, Juan; Marsili, Simone; Juan, David; Valencia, Alfonso

    2016-01-01

    Protein–protein interactions are fundamental for the proper functioning of the cell. As a result, protein interaction surfaces are subject to strong evolutionary constraints. Recent developments have shown that residue coevolution provides accurate predictions of heterodimeric protein interfaces from sequence information. So far these approaches have been limited to the analysis of families of prokaryotic complexes for which large multiple sequence alignments of homologous sequences can be compiled. We explore the hypothesis that coevolution points to structurally conserved contacts at protein–protein interfaces, which can be reliably projected to homologous complexes with distantly related sequences. We introduce a domain-centered protocol to study the interplay between residue coevolution and structural conservation of protein–protein interfaces. We show that sequence-based coevolutionary analysis systematically identifies residue contacts at prokaryotic interfaces that are structurally conserved at the interface of their eukaryotic counterparts. In turn, this allows the prediction of conserved contacts at eukaryotic protein–protein interfaces with high confidence using solely mutational patterns extracted from prokaryotic genomes. Even in the context of high divergence in sequence (the twilight zone), where standard homology modeling of protein complexes is unreliable, our approach provides sequence-based accurate information about specific details of protein interactions at the residue level. Selected examples of the application of prokaryotic coevolutionary analysis to the prediction of eukaryotic interfaces further illustrate the potential of this approach. PMID:27965389

  4. Conservation of coevolving protein interfaces bridges prokaryote-eukaryote homologies in the twilight zone.

    PubMed

    Rodriguez-Rivas, Juan; Marsili, Simone; Juan, David; Valencia, Alfonso

    2016-12-27

    Protein-protein interactions are fundamental for the proper functioning of the cell. As a result, protein interaction surfaces are subject to strong evolutionary constraints. Recent developments have shown that residue coevolution provides accurate predictions of heterodimeric protein interfaces from sequence information. So far these approaches have been limited to the analysis of families of prokaryotic complexes for which large multiple sequence alignments of homologous sequences can be compiled. We explore the hypothesis that coevolution points to structurally conserved contacts at protein-protein interfaces, which can be reliably projected to homologous complexes with distantly related sequences. We introduce a domain-centered protocol to study the interplay between residue coevolution and structural conservation of protein-protein interfaces. We show that sequence-based coevolutionary analysis systematically identifies residue contacts at prokaryotic interfaces that are structurally conserved at the interface of their eukaryotic counterparts. In turn, this allows the prediction of conserved contacts at eukaryotic protein-protein interfaces with high confidence using solely mutational patterns extracted from prokaryotic genomes. Even in the context of high divergence in sequence (the twilight zone), where standard homology modeling of protein complexes is unreliable, our approach provides sequence-based accurate information about specific details of protein interactions at the residue level. Selected examples of the application of prokaryotic coevolutionary analysis to the prediction of eukaryotic interfaces further illustrate the potential of this approach.

  5. HomPPI: a class of sequence homology based protein-protein interface prediction methods

    PubMed Central

    2011-01-01

    Background Although homology-based methods are among the most widely used methods for predicting the structure and function of proteins, the question as to whether interface sequence conservation can be effectively exploited in predicting protein-protein interfaces has been a subject of debate. Results We studied more than 300,000 pair-wise alignments of protein sequences from structurally characterized protein complexes, including both obligate and transient complexes. We identified sequence similarity criteria required for accurate homology-based inference of interface residues in a query protein sequence. Based on these analyses, we developed HomPPI, a class of sequence homology-based methods for predicting protein-protein interface residues. We present two variants of HomPPI: (i) NPS-HomPPI (Non partner-specific HomPPI), which can be used to predict interface residues of a query protein in the absence of knowledge of the interaction partner; and (ii) PS-HomPPI (Partner-specific HomPPI), which can be used to predict the interface residues of a query protein with a specific target protein. Our experiments on a benchmark dataset of obligate homodimeric complexes show that NPS-HomPPI can reliably predict protein-protein interface residues in a given protein, with an average correlation coefficient (CC) of 0.76, sensitivity of 0.83, and specificity of 0.78, when sequence homologs of the query protein can be reliably identified. NPS-HomPPI also reliably predicts the interface residues of intrinsically disordered proteins. Our experiments suggest that NPS-HomPPI is competitive with several state-of-the-art interface prediction servers including those that exploit the structure of the query proteins. The partner-specific classifier, PS-HomPPI can, on a large dataset of transient complexes, predict the interface residues of a query protein with a specific target, with a CC of 0.65, sensitivity of 0.69, and specificity of 0.70, when homologs of both the query and the target can be reliably identified. The HomPPI web server is available at http://homppi.cs.iastate.edu/. Conclusions Sequence homology-based methods offer a class of computationally efficient and reliable approaches for predicting the protein-protein interface residues that participate in either obligate or transient interactions. For query proteins involved in transient interactions, the reliability of interface residue prediction can be improved by exploiting knowledge of putative interaction partners. PMID:21682895

  6. MollDE: a homology modeling framework you can click with.

    PubMed

    Canutescu, Adrian A; Dunbrack, Roland L

    2005-06-15

    Molecular Integrated Development Environment (MolIDE) is an integrated application designed to provide homology modeling tools and protocols under a uniform, user-friendly graphical interface. Its main purpose is to combine the most frequent modeling steps in a semi-automatic, interactive way, guiding the user from the target protein sequence to the final three-dimensional protein structure. The typical basic homology modeling process is composed of building sequence profiles of the target sequence family, secondary structure prediction, sequence alignment with PDB structures, assisted alignment editing, side-chain prediction and loop building. All of these steps are available through a graphical user interface. MolIDE's user-friendly and streamlined interactive modeling protocol allows the user to focus on the important modeling questions, hiding from the user the raw data generation and conversion steps. MolIDE was designed from the ground up as an open-source, cross-platform, extensible framework. This allows developers to integrate additional third-party programs to MolIDE. http://dunbrack.fccc.edu/molide/molide.php rl_dunbrack@fccc.edu.

  7. SANSparallel: interactive homology search against Uniprot

    PubMed Central

    Somervuo, Panu; Holm, Liisa

    2015-01-01

    Proteins evolve by mutations and natural selection. The network of sequence similarities is a rich source for mining homologous relationships that inform on protein structure and function. There are many servers available to browse the network of homology relationships but one has to wait up to a minute for results. The SANSparallel webserver provides protein sequence database searches with immediate response and professional alignment visualization by third-party software. The output is a list, pairwise alignment or stacked alignment of sequence-similar proteins from Uniprot, UniRef90/50, Swissprot or Protein Data Bank. The stacked alignments are viewed in Jalview or as sequence logos. The database search uses the suffix array neighborhood search (SANS) method, which has been re-implemented as a client-server, improved and parallelized. The method is extremely fast and as sensitive as BLAST above 50% sequence identity. Benchmarks show that the method is highly competitive compared to previously published fast database search programs: UBLAST, DIAMOND, LAST, LAMBDA, RAPSEARCH2 and BLAT. The web server can be accessed interactively or programmatically at http://ekhidna2.biocenter.helsinki.fi/cgi-bin/sans/sans.cgi. It can be used to make protein functional annotation pipelines more efficient, and it is useful in interactive exploration of the detailed evidence supporting the annotation of particular proteins of interest. PMID:25855811

  8. Structure and DNA-Binding Sites of the SWI1 AT-rich Interaction Domain (ARID) Suggest Determinants for Sequence-Specific DNA Recognition

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kim, Suhkmann; Zhang, Ziming; Upchurch, Sean

    2004-04-16

    2 ARID is a homologous family of DNA-binding domains that occur in DNA binding proteins from a wide variety of species, ranging from yeast to nematodes, insects, mammals and plants. SWI1, a member of the SWI/SNF protein complex that is involved in chromatin remodeling during transcription, contains the ARID motif. The ARID domain of human SWI1 (also known as p270) does not select for a specific DNA sequence from a random sequence pool. The lack of sequence specificity shown by the SWI1 ARID domain stands in contrast to the other characterized ARID domains, which recognize specific AT-rich sequences. We havemore » solved the three-dimensional structure of human SWI1 ARID using solution NMR methods. In addition, we have characterized non-specific DNA-binding by the SWI1 ARID domain. Results from this study indicate that a flexible long internal loop in ARID motif is likely to be important for sequence specific DNA-recognition. The structure of human SWI1 ARID domain also represents a distinct structural subfamily. Studies of ARID indicate that boundary of the DNA binding structural and functional domains can extend beyond the sequence homologous region in a homologous family of proteins. Structural studies of homologous domains such as ARID family of DNA-binding domains should provide information to better predict the boundary of structural and functional domains in structural genomic studies. Key Words: ARID, SWI1, NMR, structural genomics, protein-DNA interaction.« less

  9. SANSparallel: interactive homology search against Uniprot.

    PubMed

    Somervuo, Panu; Holm, Liisa

    2015-07-01

    Proteins evolve by mutations and natural selection. The network of sequence similarities is a rich source for mining homologous relationships that inform on protein structure and function. There are many servers available to browse the network of homology relationships but one has to wait up to a minute for results. The SANSparallel webserver provides protein sequence database searches with immediate response and professional alignment visualization by third-party software. The output is a list, pairwise alignment or stacked alignment of sequence-similar proteins from Uniprot, UniRef90/50, Swissprot or Protein Data Bank. The stacked alignments are viewed in Jalview or as sequence logos. The database search uses the suffix array neighborhood search (SANS) method, which has been re-implemented as a client-server, improved and parallelized. The method is extremely fast and as sensitive as BLAST above 50% sequence identity. Benchmarks show that the method is highly competitive compared to previously published fast database search programs: UBLAST, DIAMOND, LAST, LAMBDA, RAPSEARCH2 and BLAT. The web server can be accessed interactively or programmatically at http://ekhidna2.biocenter.helsinki.fi/cgi-bin/sans/sans.cgi. It can be used to make protein functional annotation pipelines more efficient, and it is useful in interactive exploration of the detailed evidence supporting the annotation of particular proteins of interest. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  10. MetaGO: Predicting Gene Ontology of Non-homologous Proteins Through Low-Resolution Protein Structure Prediction and Protein-Protein Network Mapping.

    PubMed

    Zhang, Chengxin; Zheng, Wei; Freddolino, Peter L; Zhang, Yang

    2018-03-10

    Homology-based transferal remains the major approach to computational protein function annotations, but it becomes increasingly unreliable when the sequence identity between query and template decreases below 30%. We propose a novel pipeline, MetaGO, to deduce Gene Ontology attributes of proteins by combining sequence homology-based annotation with low-resolution structure prediction and comparison, and partner's homology-based protein-protein network mapping. The pipeline was tested on a large-scale set of 1000 non-redundant proteins from the CAFA3 experiment. Under the stringent benchmark conditions where templates with >30% sequence identity to the query are excluded, MetaGO achieves average F-measures of 0.487, 0.408, and 0.598, for Molecular Function, Biological Process, and Cellular Component, respectively, which are significantly higher than those achieved by other state-of-the-art function annotations methods. Detailed data analysis shows that the major advantage of the MetaGO lies in the new functional homolog detections from partner's homology-based network mapping and structure-based local and global structure alignments, the confidence scores of which can be optimally combined through logistic regression. These data demonstrate the power of using a hybrid model incorporating protein structure and interaction networks to deduce new functional insights beyond traditional sequence homology-based referrals, especially for proteins that lack homologous function templates. The MetaGO pipeline is available at http://zhanglab.ccmb.med.umich.edu/MetaGO/. Copyright © 2018. Published by Elsevier Ltd.

  11. Heterochromatic self-association, a determinant of nuclear organization, does not require sequence homology in Drosophila.

    PubMed Central

    Sage, Brian T; Csink, Amy K

    2003-01-01

    Chromosomes of higher eukaryotes contain blocks of heterochromatin that can associate with each other in the interphase nucleus. A well-studied example of heterochromatic interaction is the brown(Dominant) (bwD) chromosome of D. melanogaster, which contains an approximately 1.6-Mbp insertion of AAGAG repeats near the distal tip of chromosome 2. This insertion causes association of the tip with the centric heterochromatin of chromosome 2 (2h), which contains megabases of AAGAG repeats. Here we describe an example, other than bwD, in which distally translocated heterochromatin associates with centric heterochromatin. Additionally, we show that when a translocation places bwD on a different chromosome, bwD tends to associate with the centric heterochromatin of this chromosome, even when the chromosome contains a small fraction of the sequence homology present elsewhere. To further test the importance of sequence homology in these interactions, we used interspecific mating to introgress the bwD allele from D. melanogaster into D. simulans, which lacks the AAGAG on the autosomes. We find that D. simulans bwD associates with 2h, which lacks the AAGAG sequence, while it does not associate with the AAGAG containing X chromosome heterochromatin. Our results show that intranuclear association of separate heterochromatic blocks does not require that they contain the same sequence. PMID:14668374

  12. DNA-DNA interaction beyond the ground state

    NASA Astrophysics Data System (ADS)

    Lee, D. J.; Wynveen, A.; Kornyshev, A. A.

    2004-11-01

    The electrostatic interaction potential between DNA duplexes in solution is a basis for the statistical mechanics of columnar DNA assemblies. It may also play an important role in recombination of homologous genes. We develop a theory of this interaction that includes thermal torsional fluctuations of DNA using field-theoretical methods and Monte Carlo simulations. The theory extends and rationalizes the earlier suggested variational approach which was developed in the context of a ground state theory of interaction of nonhomologous duplexes. It shows that the heuristic variational theory is equivalent to the Hartree self-consistent field approximation. By comparison of the Hartree approximation with an exact solution based on the QM analogy of path integrals, as well as Monte Carlo simulations, we show that this easily analytically-tractable approximation works very well in most cases. Thermal fluctuations do not remove the ability of DNA molecules to attract each other at favorable azimuthal conformations, neither do they wash out the possibility of electrostatic “snap-shot” recognition of homologous sequences, considered earlier on the basis of ground state calculations. At short distances DNA molecules undergo a “torsional alignment transition,” which is first order for nonhomologous DNA and weaker order for homologous sequences.

  13. Prediction of Ras-effector interactions using position energy matrices.

    PubMed

    Kiel, Christina; Serrano, Luis

    2007-09-01

    One of the more challenging problems in biology is to determine the cellular protein interaction network. Progress has been made to predict protein-protein interactions based on structural information, assuming that structural similar proteins interact in a similar way. In a previous publication, we have determined a genome-wide Ras-effector interaction network based on homology models, with a high accuracy of predicting binding and non-binding domains. However, for a prediction on a genome-wide scale, homology modelling is a time-consuming process. Therefore, we here successfully developed a faster method using position energy matrices, where based on different Ras-effector X-ray template structures, all amino acids in the effector binding domain are sequentially mutated to all other amino acid residues and the effect on binding energy is calculated. Those pre-calculated matrices can then be used to score for binding any Ras or effector sequences. Based on position energy matrices, the sequences of putative Ras-binding domains can be scanned quickly to calculate an energy sum value. By calibrating energy sum values using quantitative experimental binding data, thresholds can be defined and thus non-binding domains can be excluded quickly. Sequences which have energy sum values above this threshold are considered to be potential binding domains, and could be further analysed using homology modelling. This prediction method could be applied to other protein families sharing conserved interaction types, in order to determine in a fast way large scale cellular protein interaction networks. Thus, it could have an important impact on future in silico structural genomics approaches, in particular with regard to increasing structural proteomics efforts, aiming to determine all possible domain folds and interaction types. All matrices are deposited in the ADAN database (http://adan-embl.ibmc.umh.es/). Supplementary data are available at Bioinformatics online.

  14. Structure and function of ameloblastin as an extracellular matrix protein: adhesion, calcium binding, and CD63 interaction in human and mouse.

    PubMed

    Zhang, Xu; Diekwisch, Thomas G H; Luan, Xianghong

    2011-12-01

    The functional significance of extracellular matrix proteins in the life of vertebrates is underscored by a high level of sequence variability in tandem with a substantial degree of conservation in terms of cell-cell and cell-matrix adhesion interactions. Many extracellular matrix proteins feature multiple adhesion domains for successful attachment to substrates, such as integrin, CD63, and heparin. Here we have used homology and ab initio modeling algorithms to compare mouse ameloblastin (mAMBN) and human ameloblastin (hABMN) isoforms and to analyze their potential for cell adhesion and interaction with other matrix molecules as well as calcium binding. Sequence comparison between mAMBN and hAMBN revealed a 26-amino-acid deletion in mAMBN, corresponding to a helix-loop-helix frameshift. The human AMBN domain (174Q-201G), homologous to the mAMBN 157E-178I helix-loop-helix region, formed a helix-loop motif with an extended loop, suggesting a higher degree of flexibility of hAMBN compared with mAMBN, as confirmed by molecular dynamics simulation. Heparin-binding domains, CD63-interaction domains, and calcium-binding sites in both hAMBN and mAMBN support the concept of AMBN as an extracellular matrix protein. The high level of conservation between AMBN functional domains related to adhesion and differentiation was remarkable when compared with only 61% amino acid sequence homology. © 2011 Eur J Oral Sci.

  15. Phylo-mLogo: an interactive and hierarchical multiple-logo visualization tool for alignment of many sequences

    PubMed Central

    Shih, Arthur Chun-Chieh; Lee, DT; Peng, Chin-Lin; Wu, Yu-Wei

    2007-01-01

    Background When aligning several hundreds or thousands of sequences, such as epidemic virus sequences or homologous/orthologous sequences of some big gene families, to reconstruct the epidemiological history or their phylogenies, how to analyze and visualize the alignment results of many sequences has become a new challenge for computational biologists. Although there are several tools available for visualization of very long sequence alignments, few of them are applicable to the alignments of many sequences. Results A multiple-logo alignment visualization tool, called Phylo-mLogo, is presented in this paper. Phylo-mLogo calculates the variabilities and homogeneities of alignment sequences by base frequencies or entropies. Different from the traditional representations of sequence logos, Phylo-mLogo not only displays the global logo patterns of the whole alignment of multiple sequences, but also demonstrates their local homologous logos for each clade hierarchically. In addition, Phylo-mLogo also allows the user to focus only on the analysis of some important, structurally or functionally constrained sites in the alignment selected by the user or by built-in automatic calculation. Conclusion With Phylo-mLogo, the user can symbolically and hierarchically visualize hundreds of aligned sequences simultaneously and easily check the changes of their amino acid sites when analyzing many homologous/orthologous or influenza virus sequences. More information of Phylo-mLogo can be found at URL . PMID:17319966

  16. Comparative analysis of ribosomal protein L5 sequences from bacteria of the genus Thermus.

    PubMed

    Jahn, O; Hartmann, R K; Boeckh, T; Erdmann, V A

    1991-06-01

    The genes for the ribosomal 5S rRNA binding protein L5 have been cloned from three extremely thermophilic eubacteria, Thermus flavus, Thermus thermophilus HB8 and Thermus aquaticus (Jahn et al, submitted). Genes for protein L5 from the three Thermus strains display 95% G/C in third positions of codons. Amino acid sequences deduced from the DNA sequence were shown to be identical for T flavus and T thermophilus, although the corresponding DNA sequences differed by two T to C transitions in the T thermophilus gene. Protein L5 sequences from T flavus and T thermophilus are 95% homologous to L5 from T aquaticus and 56.5% homologous to the corresponding E coli sequence. The lowest degrees of homology were found between the T flavus/T thermophilus L5 proteins and those of yeast L16 (27.5%), Halobacterium marismortui (34.0%) and Methanococcus vannielii (36.6%). From sequence comparison it becomes clear that thermostability of Thermus L5 proteins is achieved by an increase in hydrophobic interactions and/or by restriction of steric flexibility due to the introduction of amino acids with branched aliphatic side chains such as leucine. Alignment of the nine protein sequences equivalent to Thermus L5 proteins led to identification of a conserved internal segment, rich in acidic amino acids, which shows homology to subsequences of E coli L18 and L25. The occurrence of conserved sequence elements in 5S rRNA binding proteins and ribosomal proteins in general is discussed in terms of evolution and function.

  17. Trans-Homolog Interactions Facilitating Paramutation in Maize

    PubMed Central

    2015-01-01

    Paramutations represent locus-specific trans-homolog interactions affecting the heritable silencing properties of endogenous alleles. Although examples of paramutation are well studied in maize (Zea mays), the responsible mechanisms remain unclear. Genetic analyses indicate roles for plant-specific DNA-dependent RNA polymerases that generate small RNAs, and current working models hypothesize that these small RNAs direct heritable changes at sequences often acting as transcriptional enhancers. Several studies have defined specific sequences that mediate paramutation behaviors, and recent results identify a diversity of DNA-dependent RNA polymerase complexes operating in maize. Other reports ascribe broader roles for some of these complexes in normal genome function. This review highlights recent research to understand the molecular mechanisms of paramutation and examines evidence relevant to small RNA-based modes of transgenerational epigenetic inheritance. PMID:26149572

  18. Intramolecular interactions regulate SAP97 binding to GKAP

    PubMed Central

    Wu, Hongju; Reissner, Carsten; Kuhlendahl, Sven; Coblentz, Blake; Reuver, Susanne; Kindler, Stefan; Gundelfinger, Eckart D.; Garner, Craig C.

    2000-01-01

    Membrane-associated guanylate kinase homologs (MAGUKs) are multidomain proteins found to be central organizers of cellular junctions. In this study, we examined the molecular mechanisms that regulate the interaction of the MAGUK SAP97 with its GUK domain binding partner GKAP (GUK-associated protein). The GKAP–GUK interaction is regulated by a series of intramolecular interactions. Specifically, the association of the Src homology 3 (SH3) domain and sequences situated between the SH3 and GUK domains with the GUK domain was found to interfere with GKAP binding. In contrast, N-terminal sequences that precede the first PDZ domain in SAP97, facilitated GKAP binding via its association with the SH3 domain. Utilizing crystal structure data available for PDZ, SH3 and GUK domains, molecular models of SAP97 were generated. These models revealed that SAP97 can exist in a compact U-shaped conformation in which the N-terminal domain folds back and interacts with the SH3 and GUK domains. These models support the biochemical data and provide new insights into how intramolecular interactions may regulate the association of SAP97 with its binding partners. PMID:11060025

  19. The colocalization transition of homologous chromosomes at meiosis

    NASA Astrophysics Data System (ADS)

    Nicodemi, Mario; Panning, Barbara; Prisco, Antonella

    2008-06-01

    Meiosis is the specialized cell division required in sexual reproduction. During its early stages, in the mother cell nucleus, homologous chromosomes recognize each other and colocalize in a crucial step that remains one of the most mysterious of meiosis. Starting from recent discoveries on the system molecular components and interactions, we discuss a statistical mechanics model of chromosome early pairing. Binding molecules mediate long-distance interaction of special DNA recognition sequences and, if their concentration exceeds a critical threshold, they induce a spontaneous colocalization transition of chromosomes, otherwise independently diffusing.

  20. Interactive computer programs for the graphic analysis of nucleotide sequence data.

    PubMed Central

    Luckow, V A; Littlewood, R K; Rownd, R H

    1984-01-01

    A group of interactive computer programs have been developed which aid in the collection and graphical analysis of nucleotide and protein sequence data. The programs perform the following basic functions: a) enter, edit, list, and rearrange sequence data; b) permit automatic entry of nucleotide sequence data directly from an autoradiograph into the computer; c) search for restriction sites or other specified patterns and plot a linear or circular restriction map, or print their locations; d) plot base composition; e) analyze homology between sequences by plotting a two-dimensional graphic matrix; and f) aid in plotting predicted secondary structures of RNA molecules. PMID:6546437

  1. Msh2 Blocks an Alternative Mechanism for Non-Homologous Tail Removal during Single-Strand Annealing in Saccharomyces cerevisiae

    PubMed Central

    Manthey, Glenn M.; Naik, Nilan; Bailis, Adam M.

    2009-01-01

    Chromosomal translocations are frequently observed in cells exposed to agents that cause DNA double-strand breaks (DSBs), such as ionizing radiation and chemotherapeutic drugs, and are often associated with tumors in mammals. Recently, translocation formation in the budding yeast, Saccharomyces cerevisiae, has been found to occur at high frequencies following the creation of multiple DSBs adjacent to repetitive sequences on non-homologous chromosomes. The genetic control of translocation formation and the chromosome complements of the clones that contain translocations suggest that translocation formation occurs by single-strand annealing (SSA). Among the factors important for translocation formation by SSA is the central mismatch repair (MMR) and homologous recombination (HR) factor, Msh2. Here we describe the effects of several msh2 missense mutations on translocation formation that suggest that Msh2 has separable functions in stabilizing annealed single strands, and removing non-homologous sequences from their ends. Additionally, interactions between the msh2 alleles and a null allele of RAD1, which encodes a subunit of a nuclease critical for the removal of non-homologous tails suggest that Msh2 blocks an alternative mechanism for removing these sequences. These results suggest that Msh2 plays multiple roles in the formation of chromosomal translocations following acute levels of DNA damage. PMID:19834615

  2. An ectromelia virus profilin homolog interacts with cellular tropomyosin and viral A-type inclusion protein.

    PubMed

    Butler-Cole, Christine; Wagner, Mary J; Da Silva, Melissa; Brown, Gordon D; Burke, Robert D; Upton, Chris

    2007-07-24

    Profilins are critical to cytoskeletal dynamics in eukaryotes; however, little is known about their viral counterparts. In this study, a poxviral profilin homolog, ectromelia virus strain Moscow gene 141 (ECTV-PH), was investigated by a variety of experimental and bioinformatics techniques to characterize its interactions with cellular and viral proteins. Profilin-like proteins are encoded by all orthopoxviruses sequenced to date, and share over 90% amino acid (aa) identity. Sequence comparisons show highest similarity to mammalian type 1 profilins; however, a conserved 3 aa deletion in mammalian type 3 and poxviral profilins suggests that these homologs may be more closely related. Structural analysis shows that ECTV-PH can be successfully modelled onto both the profilin 1 crystal structure and profilin 3 homology model, though few of the surface residues thought to be required for binding actin, poly(L-proline), and PIP2 are conserved. Immunoprecipitation and mass spectrometry identified two proteins that interact with ECTV-PH within infected cells: alpha-tropomyosin, a 38 kDa cellular actin-binding protein, and the 84 kDa product of vaccinia virus strain Western Reserve (VACV-WR) 148, which is the truncated VACV counterpart of the orthopoxvirus A-type inclusion (ATI) protein. Western and far-western blots demonstrated that the interaction with alpha-tropomyosin is direct, and immunofluorescence experiments suggest that ECTV-PH and alpha-tropomyosin may colocalize to structures that resemble actin tails and cellular protrusions. Sequence comparisons of the poxviral ATI proteins show that although full-length orthologs are only present in cowpox and ectromelia viruses, an ~ 700 aa truncated ATI protein is conserved in over 90% of sequenced orthopoxviruses. Immunofluorescence studies indicate that ECTV-PH localizes to cytoplasmic inclusion bodies formed by both truncated and full-length versions of the viral ATI protein. Furthermore, colocalization of ECTV-PH and truncated ATI protein to protrusions from the cell surface was observed. These results suggest a role for ECTV-PH in intracellular transport of viral proteins or intercellular spread of the virus. Broader implications include better understanding of the virus-host relationship and mechanisms by which cells organize and control the actin cytoskeleton.

  3. Enhanced Prediction of Src Homology 2 (SH2) Domain Binding Potentials Using a Fluorescence Polarization-derived c-Met, c-Kit, ErbB, and Androgen Receptor Interactome*

    PubMed Central

    Leung, Kin K.; Hause, Ronald J.; Barkinge, John L.; Ciaccio, Mark F.; Chuu, Chih-Pin; Jones, Richard B.

    2014-01-01

    Many human diseases are associated with aberrant regulation of phosphoprotein signaling networks. Src homology 2 (SH2) domains represent the major class of protein domains in metazoans that interact with proteins phosphorylated on the amino acid residue tyrosine. Although current SH2 domain prediction algorithms perform well at predicting the sequences of phosphorylated peptides that are likely to result in the highest possible interaction affinity in the context of random peptide library screens, these algorithms do poorly at predicting the interaction potential of SH2 domains with physiologically derived protein sequences. We employed a high throughput interaction assay system to empirically determine the affinity between 93 human SH2 domains and phosphopeptides abstracted from several receptor tyrosine kinases and signaling proteins. The resulting interaction experiments revealed over 1000 novel peptide-protein interactions and provided a glimpse into the common and specific interaction potentials of c-Met, c-Kit, GAB1, and the human androgen receptor. We used these data to build a permutation-based logistic regression classifier that performed considerably better than existing algorithms for predicting the interaction potential of several SH2 domains. PMID:24728074

  4. An evolutionarily conserved motif in the TAB1 C-terminal region is necessary for interaction with and activation of TAK1 MAPKKK.

    PubMed

    Ono, K; Ohtomo, T; Sato, S; Sugamata, Y; Suzuki, M; Hisamoto, N; Ninomiya-Tsuji, J; Tsuchiya, M; Matsumoto, K

    2001-06-29

    TAK1, a member of the MAPKKK family, is involved in the intracellular signaling pathways mediated by transforming growth factor beta, interleukin 1, and Wnt. TAK1 kinase activity is specifically activated by the TAK1-binding protein TAB1. The C-terminal 68-amino acid sequence of TAB1 (TAB1-C68) is sufficient for TAK1 interaction and activation. Analysis of various truncated versions of TAB1-C68 defined a C-terminal 30-amino acid sequence (TAB1-C30) necessary for TAK1 binding and activation. NMR studies revealed that the TAB1-C30 region has a unique alpha-helical structure. We identified a conserved sequence motif, PYVDXA/TXF, in the C-terminal domain of mammalian TAB1, Xenopus TAB1, and its Caenorhabditis elegans homolog TAP-1, suggesting that this motif constitutes a specific TAK1 docking site. Alanine substitution mutagenesis showed that TAB1 Phe-484, located in the conserved motif, is crucial for TAK1 binding and activation. The C. elegans homolog of TAB1, TAP-1, was able to interact with and activate the C. elegans homolog of TAK1, MOM-4. However, the site in TAP-1 corresponding to Phe-484 of TAB1 is an alanine residue (Ala-364), and changing this residue to Phe abrogates the ability of TAP-1 to interact with and activate MOM-4. These results suggest that the Phe or Ala residue within the conserved motif of the TAB1-related proteins is important for interaction with and activation of specific TAK1 MAPKKK family members in vivo.

  5. Comparative analysis of the prion protein gene sequences in African lion.

    PubMed

    Wu, Chang-De; Pang, Wan-Yong; Zhao, De-Ming

    2006-10-01

    The prion protein gene of African lion (Panthera Leo) was first cloned and polymorphisms screened. The results suggest that the prion protein gene of eight African lions is highly homogenous. The amino acid sequences of the prion protein (PrP) of all samples tested were identical. Four single nucleotide polymorphisms (C42T, C81A, C420T, T600C) in the prion protein gene (Prnp) of African lion were found, but no amino acid substitutions. Sequence analysis showed that the higher homology is observed to felis catus AF003087 (96.7%) and to sheep number M31313.1 (96.2%) Genbank accessed. With respect to all the mammalian prion protein sequences compared, the African lion prion protein sequence has three amino acid substitutions. The homology might in turn affect the potential intermolecular interactions critical for cross species transmission of prion disease.

  6. Even with nonnative interactions, the updated folding transition states of the homologs Proteins G & L are extensive and similar

    PubMed Central

    Baxa, Michael C.; Yu, Wookyung; Adhikari, Aashish N.; Ge, Liang; Xia, Zhen; Zhou, Ruhong; Freed, Karl F.; Sosnick, Tobin R.

    2015-01-01

    Experimental and computational folding studies of Proteins L & G and NuG2 typically find that sequence differences determine which of the two hairpins is formed in the transition state ensemble (TSE). However, our recent work on Protein L finds that its TSE contains both hairpins, compelling a reassessment of the influence of sequence on the folding behavior of the other two homologs. We characterize the TSEs for Protein G and NuG2b, a triple mutant of NuG2, using ψ analysis, a method for identifying contacts in the TSE. All three homologs are found to share a common and near-native TSE topology with interactions between all four strands. However, the helical content varies in the TSE, being largely absent in Proteins G & L but partially present in NuG2b. The variability likely arises from competing propensities for the formation of nonnative β turns in the naturally occurring proteins, as observed in our TerItFix folding algorithm. All-atom folding simulations of NuG2b recapitulate the observed TSEs with four strands for 5 of 27 transition paths [Lindorff-Larsen K, Piana S, Dror RO, Shaw DE (2011) Science 334(6055):517–520]. Our data support the view that homologous proteins have similar folding mechanisms, even when nonnative interactions are present in the transition state. These findings emphasize the ongoing challenge of accurately characterizing and predicting TSEs, even for relatively simple proteins. PMID:26100906

  7. Restriction and Sequence Alterations Affect DNA Uptake Sequence-Dependent Transformation in Neisseria meningitidis

    PubMed Central

    Ambur, Ole Herman; Frye, Stephan A.; Nilsen, Mariann; Hovland, Eirik; Tønjum, Tone

    2012-01-01

    Transformation is a complex process that involves several interactions from the binding and uptake of naked DNA to homologous recombination. Some actions affect transformation favourably whereas others act to limit it. Here, meticulous manipulation of a single type of transforming DNA allowed for quantifying the impact of three different mediators of meningococcal transformation: NlaIV restriction, homologous recombination and the DNA Uptake Sequence (DUS). In the wildtype, an inverse relationship between the transformation frequency and the number of NlaIV restriction sites in DNA was observed when the transforming DNA harboured a heterologous region for selection (ermC) but not when the transforming DNA was homologous with only a single nucleotide heterology. The influence of homologous sequence in transforming DNA was further studied using plasmids with a small interruption or larger deletions in the recombinogenic region and these alterations were found to impair transformation frequency. In contrast, a particularly potent positive driver of DNA uptake in Neisseria sp. are short DUS in the transforming DNA. However, the molecular mechanism(s) responsible for DUS specificity remains unknown. Increasing the number of DUS in the transforming DNA was here shown to exert a positive effect on transformation. Furthermore, an influence of variable placement of DUS relative to the homologous region in the donor DNA was documented for the first time. No effect of altering the orientation of DUS was observed. These observations suggest that DUS is important at an early stage in the recognition of DNA, but does not exclude the existence of more than one level of DUS specificity in the sequence of events that constitute transformation. New knowledge on the positive and negative drivers of transformation may in a larger perspective illuminate both the mechanisms and the evolutionary role(s) of one of the most conserved mechanisms in nature: homologous recombination. PMID:22768309

  8. Colonization of heterochromatic genes by transposable elements in Drosophila.

    PubMed

    Dimitri, Patrizio; Junakovic, Nikolaj; Arcà, Bruno

    2003-04-01

    As a further step toward understanding transposable element-host genome interactions, we investigated the molecular anatomy of introns from five heterochromatic and 22 euchromatic protein-coding genes of Drosophila melanogaster. A total of 79 kb of intronic sequences from heterochromatic genes and 355 kb of intronic sequences from euchromatic genes have been used in Blast searches against Drosophila transposable elements (TEs). The results show that TE-homologous sequences belonging to 19 different families represent about 50% of intronic DNA from heterochromatic genes. In contrast, only 0.1% of the euchromatic intron DNA exhibits homology to known TEs. Intraspecific and interspecific size polymorphisms of introns were found, which are likely to be associated with changes in TE-related sequences. Together, the enrichment in TEs and the apparent dynamic state of heterochromatic introns suggest that TEs contribute significantly to the evolution of genes located in heterochromatin.

  9. RNABindRPlus: a predictor that combines machine learning and sequence homology-based methods to improve the reliability of predicted RNA-binding residues in proteins.

    PubMed

    Walia, Rasna R; Xue, Li C; Wilkins, Katherine; El-Manzalawy, Yasser; Dobbs, Drena; Honavar, Vasant

    2014-01-01

    Protein-RNA interactions are central to essential cellular processes such as protein synthesis and regulation of gene expression and play roles in human infectious and genetic diseases. Reliable identification of protein-RNA interfaces is critical for understanding the structural bases and functional implications of such interactions and for developing effective approaches to rational drug design. Sequence-based computational methods offer a viable, cost-effective way to identify putative RNA-binding residues in RNA-binding proteins. Here we report two novel approaches: (i) HomPRIP, a sequence homology-based method for predicting RNA-binding sites in proteins; (ii) RNABindRPlus, a new method that combines predictions from HomPRIP with those from an optimized Support Vector Machine (SVM) classifier trained on a benchmark dataset of 198 RNA-binding proteins. Although highly reliable, HomPRIP cannot make predictions for the unaligned parts of query proteins and its coverage is limited by the availability of close sequence homologs of the query protein with experimentally determined RNA-binding sites. RNABindRPlus overcomes these limitations. We compared the performance of HomPRIP and RNABindRPlus with that of several state-of-the-art predictors on two test sets, RB44 and RB111. On a subset of proteins for which homologs with experimentally determined interfaces could be reliably identified, HomPRIP outperformed all other methods achieving an MCC of 0.63 on RB44 and 0.83 on RB111. RNABindRPlus was able to predict RNA-binding residues of all proteins in both test sets, achieving an MCC of 0.55 and 0.37, respectively, and outperforming all other methods, including those that make use of structure-derived features of proteins. More importantly, RNABindRPlus outperforms all other methods for any choice of tradeoff between precision and recall. An important advantage of both HomPRIP and RNABindRPlus is that they rely on readily available sequence and sequence-derived features of RNA-binding proteins. A webserver implementation of both methods is freely available at http://einstein.cs.iastate.edu/RNABindRPlus/.

  10. Preservation of protein clefts in comparative models.

    PubMed

    Piedra, David; Lois, Sergi; de la Cruz, Xavier

    2008-01-16

    Comparative, or homology, modelling of protein structures is the most widely used prediction method when the target protein has homologues of known structure. Given that the quality of a model may vary greatly, several studies have been devoted to identifying the factors that influence modelling results. These studies usually consider the protein as a whole, and only a few provide a separate discussion of the behaviour of biologically relevant features of the protein. Given the value of the latter for many applications, here we extended previous work by analysing the preservation of native protein clefts in homology models. We chose to examine clefts because of their role in protein function/structure, as they are usually the locus of protein-protein interactions, host the enzymes' active site, or, in the case of protein domains, can also be the locus of domain-domain interactions that lead to the structure of the whole protein. We studied how the largest cleft of a protein varies in comparative models. To this end, we analysed a set of 53507 homology models that cover the whole sequence identity range, with a special emphasis on medium and low similarities. More precisely we examined how cleft quality - measured using six complementary parameters related to both global shape and local atomic environment, depends on the sequence identity between target and template proteins. In addition to this general analysis, we also explored the impact of a number of factors on cleft quality, and found that the relationship between quality and sequence identity varies depending on cleft rank amongst the set of protein clefts (when ordered according to size), and number of aligned residues. We have examined cleft quality in homology models at a range of seq.id. levels. Our results provide a detailed view of how quality is affected by distinct parameters and thus may help the user of comparative modelling to determine the final quality and applicability of his/her cleft models. In addition, the large variability in model quality that we observed within each sequence bin, with good models present even at low sequence identities (between 20% and 30%), indicates that properly developed identification methods could be used to recover good cleft models in this sequence range.

  11. Determining protein function and interaction from genome analysis

    DOEpatents

    Eisenberg, David; Marcotte, Edward M.; Thompson, Michael J.; Pellegrini, Matteo; Yeates, Todd O.

    2004-08-03

    A computational method system, and computer program are provided for inferring functional links from genome sequences. One method is based on the observation that some pairs of proteins A' and B' have homologs in another organism fused into a single protein chain AB. A trans-genome comparison of sequences can reveal these AB sequences, which are Rosetta Stone sequences because they decipher an interaction between A' and B. Another method compares the genomic sequence of two or more organisms to create a phylogenetic profile for each protein indicating its presence or absence across all the genomes. The profile provides information regarding functional links between different families of proteins. In yet another method a combination of the above two methods is used to predict functional links.

  12. A retroviral oncogene, akt, encoding a serine-threonine kinase containing an SH2-like region.

    PubMed

    Bellacosa, A; Testa, J R; Staal, S P; Tsichlis, P N

    1991-10-11

    The v-akt oncogene codes for a 105-kilodalton fusion phosphoprotein containing Gag sequences at its amino terminus. Sequence analysis of v-akt and biochemical characterization of its product revealed that it codes for a protein kinase C-related serine-threonine kinase whose cellular homolog is expressed in most tissues, with the highest amount found in thymus. Although Akt is a serine-threonine kinase, part of its regulatory region is similar to the Src homology-2 domain, a structural motif characteristic of cytoplasmic tyrosine kinases that functions in protein-protein interactions. This suggests that Akt may form a functional link between tyrosine and serine-threonine phosphorylation pathways.

  13. Rosetta stone method for detecting protein function and protein-protein interactions from genome sequences

    DOEpatents

    Eisenberg, David; Marcotte, Edward M.; Pellegrini, Matteo; Thompson, Michael J.; Yeates, Todd O.

    2002-10-15

    A computational method system, and computer program are provided for inferring functional links from genome sequences. One method is based on the observation that some pairs of proteins A' and B' have homologs in another organism fused into a single protein chain AB. A trans-genome comparison of sequences can reveal these AB sequences, which are Rosetta Stone sequences because they decipher an interaction between A' and B. Another method compares the genomic sequence of two or more organisms to create a phylogenetic profile for each protein indicating its presence or absence across all the genomes. The profile provides information regarding functional links between different families of proteins. In yet another method a combination of the above two methods is used to predict functional links.

  14. PNMA family: Protein interaction network and cell signalling pathways implicated in cancer and apoptosis.

    PubMed

    Pang, Siew Wai; Lahiri, Chandrajit; Poh, Chit Laa; Tan, Kuan Onn

    2018-05-01

    Paraneoplastic Ma Family (PNMA) comprises a growing number of family members which share relatively conserved protein sequences encoded by the human genome and is localized to several human chromosomes, including the X-chromosome. Based on sequence analysis, PNMA family members share sequence homology to the Gag protein of LTR retrotransposon, and several family members with aberrant protein expressions have been reported to be closely associated with the human Paraneoplastic Disorder (PND). In addition, gene mutations of specific members of PNMA family are known to be associated with human mental retardation or 3-M syndrome consisting of restrictive post-natal growth or dwarfism, and development of skeletal abnormalities. Other than sequence homology, the physiological function of many members in this family remains unclear. However, several members of this family have been characterized, including cell signalling events mediated by these proteins that are associated with apoptosis, and cancer in different cell types. Furthermore, while certain PNMA family members show restricted gene expression in the human brain and testis, other PNMA family members exhibit broader gene expression or preferential and selective protein interaction profiles, suggesting functional divergence within the family. Functional analysis of some members of this family have identified protein domains that are required for subcellular localization, protein-protein interactions, and cell signalling events which are the focus of this review paper. Copyright © 2018 Elsevier Inc. All rights reserved.

  15. ECOD: An Evolutionary Classification of Protein Domains

    PubMed Central

    Kinch, Lisa N.; Pei, Jimin; Shi, Shuoyong; Kim, Bong-Hyun; Grishin, Nick V.

    2014-01-01

    Understanding the evolution of a protein, including both close and distant relationships, often reveals insight into its structure and function. Fast and easy access to such up-to-date information facilitates research. We have developed a hierarchical evolutionary classification of all proteins with experimentally determined spatial structures, and presented it as an interactive and updatable online database. ECOD (Evolutionary Classification of protein Domains) is distinct from other structural classifications in that it groups domains primarily by evolutionary relationships (homology), rather than topology (or “fold”). This distinction highlights cases of homology between domains of differing topology to aid in understanding of protein structure evolution. ECOD uniquely emphasizes distantly related homologs that are difficult to detect, and thus catalogs the largest number of evolutionary links among structural domain classifications. Placing distant homologs together underscores the ancestral similarities of these proteins and draws attention to the most important regions of sequence and structure, as well as conserved functional sites. ECOD also recognizes closer sequence-based relationships between protein domains. Currently, approximately 100,000 protein structures are classified in ECOD into 9,000 sequence families clustered into close to 2,000 evolutionary groups. The classification is assisted by an automated pipeline that quickly and consistently classifies weekly releases of PDB structures and allows for continual updates. This synchronization with PDB uniquely distinguishes ECOD among all protein classifications. Finally, we present several case studies of homologous proteins not recorded in other classifications, illustrating the potential of how ECOD can be used to further biological and evolutionary studies. PMID:25474468

  16. ECOD: an evolutionary classification of protein domains.

    PubMed

    Cheng, Hua; Schaeffer, R Dustin; Liao, Yuxing; Kinch, Lisa N; Pei, Jimin; Shi, Shuoyong; Kim, Bong-Hyun; Grishin, Nick V

    2014-12-01

    Understanding the evolution of a protein, including both close and distant relationships, often reveals insight into its structure and function. Fast and easy access to such up-to-date information facilitates research. We have developed a hierarchical evolutionary classification of all proteins with experimentally determined spatial structures, and presented it as an interactive and updatable online database. ECOD (Evolutionary Classification of protein Domains) is distinct from other structural classifications in that it groups domains primarily by evolutionary relationships (homology), rather than topology (or "fold"). This distinction highlights cases of homology between domains of differing topology to aid in understanding of protein structure evolution. ECOD uniquely emphasizes distantly related homologs that are difficult to detect, and thus catalogs the largest number of evolutionary links among structural domain classifications. Placing distant homologs together underscores the ancestral similarities of these proteins and draws attention to the most important regions of sequence and structure, as well as conserved functional sites. ECOD also recognizes closer sequence-based relationships between protein domains. Currently, approximately 100,000 protein structures are classified in ECOD into 9,000 sequence families clustered into close to 2,000 evolutionary groups. The classification is assisted by an automated pipeline that quickly and consistently classifies weekly releases of PDB structures and allows for continual updates. This synchronization with PDB uniquely distinguishes ECOD among all protein classifications. Finally, we present several case studies of homologous proteins not recorded in other classifications, illustrating the potential of how ECOD can be used to further biological and evolutionary studies.

  17. Freiburg RNA tools: a central online resource for RNA-focused research and teaching.

    PubMed

    Raden, Martin; Ali, Syed M; Alkhnbashi, Omer S; Busch, Anke; Costa, Fabrizio; Davis, Jason A; Eggenhofer, Florian; Gelhausen, Rick; Georg, Jens; Heyne, Steffen; Hiller, Michael; Kundu, Kousik; Kleinkauf, Robert; Lott, Steffen C; Mohamed, Mostafa M; Mattheis, Alexander; Miladi, Milad; Richter, Andreas S; Will, Sebastian; Wolff, Joachim; Wright, Patrick R; Backofen, Rolf

    2018-05-21

    The Freiburg RNA tools webserver is a well established online resource for RNA-focused research. It provides a unified user interface and comprehensive result visualization for efficient command line tools. The webserver includes RNA-RNA interaction prediction (IntaRNA, CopraRNA, metaMIR), sRNA homology search (GLASSgo), sequence-structure alignments (LocARNA, MARNA, CARNA, ExpaRNA), CRISPR repeat classification (CRISPRmap), sequence design (antaRNA, INFO-RNA, SECISDesign), structure aberration evaluation of point mutations (RaSE), and RNA/protein-family models visualization (CMV), and other methods. Open education resources offer interactive visualizations of RNA structure and RNA-RNA interaction prediction as well as basic and advanced sequence alignment algorithms. The services are freely available at http://rna.informatik.uni-freiburg.de.

  18. Improving homology modeling of G-protein coupled receptors through multiple-template derived conserved inter-residue interactions

    NASA Astrophysics Data System (ADS)

    Chaudhari, Rajan; Heim, Andrew J.; Li, Zhijun

    2015-05-01

    Evidenced by the three-rounds of G-protein coupled receptors (GPCR) Dock competitions, improving homology modeling methods of helical transmembrane proteins including the GPCRs, based on templates of low sequence identity, remains an eminent challenge. Current approaches addressing this challenge adopt the philosophy of "modeling first, refinement next". In the present work, we developed an alternative modeling approach through the novel application of available multiple templates. First, conserved inter-residue interactions are derived from each additional template through conservation analysis of each template-target pairwise alignment. Then, these interactions are converted into distance restraints and incorporated in the homology modeling process. This approach was applied to modeling of the human β2 adrenergic receptor using the bovin rhodopsin and the human protease-activated receptor 1 as templates and improved model quality was demonstrated compared to the homology model generated by standard single-template and multiple-template methods. This method of "refined restraints first, modeling next", provides a fast and complementary way to the current modeling approaches. It allows rational identification and implementation of additional conserved distance restraints extracted from multiple templates and/or experimental data, and has the potential to be applicable to modeling of all helical transmembrane proteins.

  19. Network-based function prediction and interactomics: the case for metabolic enzymes.

    PubMed

    Janga, S C; Díaz-Mejía, J Javier; Moreno-Hagelsieb, G

    2011-01-01

    As sequencing technologies increase in power, determining the functions of unknown proteins encoded by the DNA sequences so produced becomes a major challenge. Functional annotation is commonly done on the basis of amino-acid sequence similarity alone. Long after sequence similarity becomes undetectable by pair-wise comparison, profile-based identification of homologs can often succeed due to the conservation of position-specific patterns, important for a protein's three dimensional folding and function. Nevertheless, prediction of protein function from homology-driven approaches is not without problems. Homologous proteins might evolve different functions and the power of homology detection has already started to reach its maximum. Computational methods for inferring protein function, which exploit the context of a protein in cellular networks, have come to be built on top of homology-based approaches. These network-based functional inference techniques provide both a first hand hint into a proteins' functional role and offer complementary insights to traditional methods for understanding the function of uncharacterized proteins. Most recent network-based approaches aim to integrate diverse kinds of functional interactions to boost both coverage and confidence level. These techniques not only promise to solve the moonlighting aspect of proteins by annotating proteins with multiple functions, but also increase our understanding on the interplay between different functional classes in a cell. In this article we review the state of the art in network-based function prediction and describe some of the underlying difficulties and successes. Given the volume of high-throughput data that is being reported the time is ripe to employ these network-based approaches, which can be used to unravel the functions of the uncharacterized proteins accumulating in the genomic databases. © 2010 Elsevier Inc. All rights reserved.

  20. Direct Single-Molecule Observation of Mode and Geometry of RecA-Mediated Homology Search.

    PubMed

    Lee, Andrew J; Endo, Masayuki; Hobbs, Jamie K; Wälti, Christoph

    2018-01-23

    Genomic integrity, when compromised by accrued DNA lesions, is maintained through efficient repair via homologous recombination. For this process the ubiquitous recombinase A (RecA), and its homologues such as the human Rad51, are of central importance, able to align and exchange homologous sequences within single-stranded and double-stranded DNA in order to swap out defective regions. Here, we directly observe the widely debated mechanism of RecA homology searching at a single-molecule level using high-speed atomic force microscopy (HS-AFM) in combination with tailored DNA origami frames to present the reaction targets in a way suitable for AFM-imaging. We show that RecA nucleoprotein filaments move along DNA substrates via short-distance facilitated diffusions, or slides, interspersed with longer-distance random moves, or hops. Importantly, from the specific interaction geometry, we find that the double-stranded substrate DNA resides in the secondary DNA binding-site within the RecA nucleoprotein filament helical groove during the homology search. This work demonstrates that tailored DNA origami, in conjunction with HS-AFM, can be employed to reveal directly conformational and geometrical information on dynamic protein-DNA interactions which was previously inaccessible at an individual single-molecule level.

  1. Mitochondrial Genome Sequence of the Legume Vicia faba

    PubMed Central

    Negruk, Valentine

    2013-01-01

    The number of plant mitochondrial genomes sequenced exceeds two dozen. However, for a detailed comparative study of different phylogenetic branches more plant mitochondrial genomes should be sequenced. This article presents sequencing data and comparative analysis of mitochondrial DNA (mtDNA) of the legume Vicia faba. The size of the V. faba circular mitochondrial master chromosome of cultivar Broad Windsor was estimated as 588,000 bp with a genome complexity of 387,745 bp and 52 conservative mitochondrial genes; 32 of them encoding proteins, 3 rRNA, and 17 tRNA genes. Six tRNA genes were highly homologous to chloroplast genome sequences. In addition to the 52 conservative genes, 114 unique open reading frames (ORFs) were found, 36 without significant homology to any known proteins and 29 with homology to the Medicago truncatula nuclear genome and to other plant mitochondrial ORFs, 49 ORFs were not homologous to M. truncatula but possessed sequences with significant homology to other plant mitochondrial or nuclear ORFs. In general, the unique ORFs revealed very low homology to known closely related legumes, but several sequence homologies were found between V. faba, Beta vulgaris, Nicotiana tabacum, Vitis vinifera, and even the monocots Oryza sativa and Zea mays. Most likely these ORFs arose independently during angiosperm evolution (Kubo and Mikami, 2007; Kubo and Newton, 2008). Computational analysis revealed in total about 45% of V. faba mtDNA sequence being homologous to the Medicago truncatula nuclear genome (more than to any sequenced plant mitochondrial genome), and 35% of this homology ranging from a few dozen to 12,806 bp are located on chromosome 1. Apparently, mitochondrial rrn5, rrn18, rps10, ATP synthase subunit alpha, cox2, and tRNA sequences are part of transcribed nuclear mosaic ORFs. PMID:23675376

  2. Next-Generation Sequence Analysis of the Genome of RFHVMn, the Macaque Homolog of Kaposi's Sarcoma (KS)-Associated Herpesvirus, from a KS-Like Tumor of a Pig-Tailed Macaque

    PubMed Central

    Bruce, A. Gregory; Ryan, Jonathan T.; Thomas, Mathew J.; Peng, Xinxia; Grundhoff, Adam; Tsai, Che-Chung

    2013-01-01

    The complete sequence of retroperitoneal fibromatosis-associated herpesvirus Macaca nemestrina (RFHVMn), the pig-tailed macaque homolog of Kaposi's sarcoma-associated herpesvirus (KSHV), was determined by next-generation sequence analysis of a Kaposi's sarcoma (KS)-like macaque tumor. Colinearity of genes was observed with the KSHV genome, and the core herpesvirus genes had strong sequence homology to the corresponding KSHV genes. RFHVMn lacked homologs of open reading frame 11 (ORF11) and KSHV ORFs K5 and K6, which appear to have been generated by duplication of ORFs K3 and K4 after the divergence of KSHV and RFHV. RFHVMn contained positional homologs of all other unique KSHV genes, although some showed limited sequence similarity. RFHVMn contained a number of candidate microRNA genes. Although there was little sequence similarity with KSHV microRNAs, one candidate contained the same seed sequence as the positional homolog, kshv-miR-K12-10a, suggesting functional overlap. RNA transcript splicing was highly conserved between RFHVMn and KSHV, and strong sequence conservation was noted in specific promoters and putative origins of replication, predicting important functional similarities. Sequence comparisons indicated that RFHVMn and KSHV developed in long-term synchrony with the evolution of their hosts, and both viruses phylogenetically group within the RV1 lineage of Old World primate rhadinoviruses. RFHVMn is the closest homolog of KSHV to be completely sequenced and the first sequenced RV1 rhadinovirus homolog of KSHV from a nonhuman Old World primate. The strong genetic and sequence similarity between RFHVMn and KSHV, coupled with similarities in biology and pathology, demonstrate that RFHVMn infection in macaques offers an important and relevant model for the study of KSHV in humans. PMID:24109218

  3. Direct evidence for sequence-dependent attraction between double-stranded DNA controlled by methylation.

    PubMed

    Yoo, Jejoong; Kim, Hajin; Aksimentiev, Aleksei; Ha, Taekjip

    2016-03-22

    Although proteins mediate highly ordered DNA organization in vivo, theoretical studies suggest that homologous DNA duplexes can preferentially associate with one another even in the absence of proteins. Here we combine molecular dynamics simulations with single-molecule fluorescence resonance energy transfer experiments to examine the interactions between duplex DNA in the presence of spermine, a biological polycation. We find that AT-rich DNA duplexes associate more strongly than GC-rich duplexes, regardless of the sequence homology. Methyl groups of thymine acts as a steric block, relocating spermine from major grooves to interhelical regions, thereby increasing DNA-DNA attraction. Indeed, methylation of cytosines makes attraction between GC-rich DNA as strong as that between AT-rich DNA. Recent genome-wide chromosome organization studies showed that remote contact frequencies are higher for AT-rich and methylated DNA, suggesting that direct DNA-DNA interactions that we report here may play a role in the chromosome organization and gene regulation.

  4. Direct evidence for sequence-dependent attraction between double-stranded DNA controlled by methylation

    NASA Astrophysics Data System (ADS)

    Yoo, Jejoong; Kim, Hajin; Aksimentiev, Aleksei; Ha, Taekjip

    2016-03-01

    Although proteins mediate highly ordered DNA organization in vivo, theoretical studies suggest that homologous DNA duplexes can preferentially associate with one another even in the absence of proteins. Here we combine molecular dynamics simulations with single-molecule fluorescence resonance energy transfer experiments to examine the interactions between duplex DNA in the presence of spermine, a biological polycation. We find that AT-rich DNA duplexes associate more strongly than GC-rich duplexes, regardless of the sequence homology. Methyl groups of thymine acts as a steric block, relocating spermine from major grooves to interhelical regions, thereby increasing DNA-DNA attraction. Indeed, methylation of cytosines makes attraction between GC-rich DNA as strong as that between AT-rich DNA. Recent genome-wide chromosome organization studies showed that remote contact frequencies are higher for AT-rich and methylated DNA, suggesting that direct DNA-DNA interactions that we report here may play a role in the chromosome organization and gene regulation.

  5. Structural and Functional Insights into WRKY3 and WRKY4 Transcription Factors to Unravel the WRKY–DNA (W-Box) Complex Interaction in Tomato (Solanum lycopersicum L.). A Computational Approach

    PubMed Central

    Aamir, Mohd; Singh, Vinay K.; Meena, Mukesh; Upadhyay, Ram S.; Gupta, Vijai K.; Singh, Surendra

    2017-01-01

    The WRKY transcription factors (TFs), play crucial role in plant defense response against various abiotic and biotic stresses. The role of WRKY3 and WRKY4 genes in plant defense response against necrotrophic pathogens is well-reported. However, their functional annotation in tomato is largely unknown. In the present work, we have characterized the structural and functional attributes of the two identified tomato WRKY transcription factors, WRKY3 (SlWRKY3), and WRKY4 (SlWRKY4) using computational approaches. Arabidopsis WRKY3 (AtWRKY3: NP_178433) and WRKY4 (AtWRKY4: NP_172849) protein sequences were retrieved from TAIR database and protein BLAST was done for finding their sequential homologs in tomato. Sequence alignment, phylogenetic classification, and motif composition analysis revealed the remarkable sequential variation between, these two WRKYs. The tomato WRKY3 and WRKY4 clusters with Solanum pennellii showing the monophyletic origin and evolution from their wild homolog. The functional domain region responsible for sequence specific DNA-binding occupied in both proteins were modeled [using AtWRKY4 (PDB ID:1WJ2) and AtWRKY1 (PDBID:2AYD) as template protein structures] through homology modeling using Discovery Studio 3.0. The generated models were further evaluated for their accuracy and reliability based on qualitative and quantitative parameters. The modeled proteins were found to satisfy all the crucial energy parameters and showed acceptable Ramachandran statistics when compared to the experimentally resolved NMR solution structures and/or X-Ray diffracted crystal structures (templates). The superimposition of the functional WRKY domains from SlWRKY3 and SlWRKY4 revealed remarkable structural similarity. The sequence specific DNA binding for two WRKYs was explored through DNA-protein interaction using Hex Docking server. The interaction studies found that SlWRKY4 binds with the W-box DNA through WRKYGQK with Tyr408, Arg409, and Lys419 with the initial flanking sequences also get involved in binding. In contrast, the SlWRKY3 made interaction with RKYGQK along with the residues from zinc finger motifs. Protein-protein interactions studies were done using STRING version 10.0 to explore all the possible protein partners involved in associative functional interaction networks. The Gene ontology enrichment analysis revealed the functional dimension and characterized the identified WRKYs based on their functional annotation. PMID:28611792

  6. Detecting false positive sequence homology: a machine learning approach.

    PubMed

    Fujimoto, M Stanley; Suvorov, Anton; Jensen, Nicholas O; Clement, Mark J; Bybee, Seth M

    2016-02-24

    Accurate detection of homologous relationships of biological sequences (DNA or amino acid) amongst organisms is an important and often difficult task that is essential to various evolutionary studies, ranging from building phylogenies to predicting functional gene annotations. There are many existing heuristic tools, most commonly based on bidirectional BLAST searches that are used to identify homologous genes and combine them into two fundamentally distinct classes: orthologs and paralogs. Due to only using heuristic filtering based on significance score cutoffs and having no cluster post-processing tools available, these methods can often produce multiple clusters constituting unrelated (non-homologous) sequences. Therefore sequencing data extracted from incomplete genome/transcriptome assemblies originated from low coverage sequencing or produced by de novo processes without a reference genome are susceptible to high false positive rates of homology detection. In this paper we develop biologically informative features that can be extracted from multiple sequence alignments of putative homologous genes (orthologs and paralogs) and further utilized in context of guided experimentation to verify false positive outcomes. We demonstrate that our machine learning method trained on both known homology clusters obtained from OrthoDB and randomly generated sequence alignments (non-homologs), successfully determines apparent false positives inferred by heuristic algorithms especially among proteomes recovered from low-coverage RNA-seq data. Almost ~42 % and ~25 % of predicted putative homologies by InParanoid and HaMStR respectively were classified as false positives on experimental data set. Our process increases the quality of output from other clustering algorithms by providing a novel post-processing method that is both fast and efficient at removing low quality clusters of putative homologous genes recovered by heuristic-based approaches.

  7. Analysis of Homologs of Cry-toxin Receptor-Related Proteins in the Midgut of a Non-Bt Target, Nilaparvata lugens (Stål) (Hemiptera: Delphacidae)

    PubMed Central

    Shao, Ensi; Lin, Li; Liu, Sijun; Zhang, Jiao; Chen, Xuelin; Sha, Li; Huang, Zhipeng; Huang, Biwang; Guan, Xiong

    2018-01-01

    Abstract The brown planthopper (BPH) Nilaparvata lugens is one of the most destructive insect pests in the rice fields of Asia. Like other hemipteran insects, BPH is not susceptible to Cry toxins of Bacillus thuringiensis (Bt) or transgenic rice carrying Bt cry genes. Lack of Cry receptors in the midgut is one of the main reasons that BPH is not susceptible to the Cry toxins. The main Cry-binding proteins (CBPs) of the susceptible insects are cadherin, aminopeptidase N (APN), and alkaline phosphatase (ALP). In this study, we analyzed and validated de novo assembled transcripts from transcriptome sequencing data of BPH to identify and characterize homologs of cadherin, APN, and ALP. We then compared the cadherin-, APN-, and ALP-like proteins of BPH to previously reported CBPs to identify their homologs in BPH. The sequence analysis revealed that at least one cadherin, one APN, and two ALPs of BPH contained homologous functional domains identified from the Cry-binding cadherin, APN, and ALP, respectively. Quantitative real-time polymerase chain reaction used to verify the expression level of each putative Cry receptor homolog in the BPH midgut indicated that the CBPs homologous APN and ALP were expressed at high or medium-high levels while the cadherin was expressed at a low level. These results suggest that homologs of CBPs exist in the midgut of BPH. However, differences in key motifs of CBPs, which are functional in interacting with Cry toxins, may be responsible for insusceptibility of BPH to Cry toxins. PMID:29415259

  8. dbSWEET: An Integrated Resource for SWEET Superfamily to Understand, Analyze and Predict the Function of Sugar Transporters in Prokaryotes and Eukaryotes.

    PubMed

    Gupta, Ankita; Sankararamakrishnan, Ramasubbu

    2018-04-14

    SWEET (Sweet Will Eventually be Exported Transporter) proteins have been recently discovered and form one of the three major families of sugar transporters. Homologs of SWEET are found in both prokaryotes and eukaryotes. Bacterial SWEET homologs have three transmembrane segments forming a triple-helical bundle and the functional form is dimers. Eukaryotic SWEETs have seven transmembrane helical segments forming two triple-helical bundles with a linker helix. Members of SWEET homologs have been shown to be involved in several important physiological processes in plants. However, not much is known regarding the biological significance of SWEET homologs in prokaryotes and in mammals. We have collected more than 2000 SWEET homologs from both prokaryotes and eukaryotes. For each homolog, we have modeled three different conformational states representing outward open, inward open and occluded states. We have provided details regarding substrate-interacting residues and residues forming the selectivity filter for each SWEET homolog. Several search and analysis options are available. The users can generate a phylogenetic tree and structure-based sequence alignment for selected set of sequences. With no metazoan SWEETs functionally characterized, the features observed in the selectivity filter residues can be used to predict the potential substrates that are likely to be transported across the metazoan SWEETs. We believe that this database will help the researchers to design mutational experiments and simulation studies that will aid to advance our understanding of the physiological role of SWEET homologs. This database is freely available to the scientific community at http://bioinfo.iitk.ac.in/bioinfo/dbSWEET/Home. Copyright © 2018 Elsevier Ltd. All rights reserved.

  9. De-novo assembly and characterization of the transcriptome of Metschnikowia fructicola reveals differences in gene expression following interaction with Penicillium digitatum and grapefruit peel

    PubMed Central

    2013-01-01

    Background The yeast Metschnikowia fructicola is an antagonist with biological control activity against postharvest diseases of several fruits. We performed a transcriptome analysis, using RNA-Seq technology, to examine the response of M. fructicola with citrus fruit and with the postharvest pathogen, Penicillium digitatum. Results More than 26 million sequencing reads were assembled into 9,674 unigenes. Approximately 50% of the unigenes could be annotated based on homology matches in the NCBI database. Based on homology, sequences were annotated with a gene description, gene ontology (GO term), and clustered into functional groups. An analysis of differential expression when the yeast was interacting with the fruit vs. the pathogen revealed more than 250 genes with specific expression responses. In the antagonist-pathogen interaction, genes related to transmembrane, multidrug transport and to amino acid metabolism were induced. In the antagonist-fruit interaction, expression of genes involved in oxidative stress, iron homeostasis, zinc homeostasis, and lipid metabolism were induced. Patterns of gene expression in the two interactions were examined at the individual transcript level by quantitative real-time PCR analysis (RT-qPCR). Conclusion This study provides new insight into the biology of the tritrophic interactions that occur in a biocontrol system such as the use of the yeast, M. fructicola for the control of green mold on citrus caused by P. digitatum. PMID:23496978

  10. Process of labeling specific chromosomes using recombinant repetitive DNA

    DOEpatents

    Moyzis, R.K.; Meyne, J.

    1988-02-12

    Chromosome preferential nucleotide sequences are first determined from a library of recombinant DNA clones having families of repetitive sequences. Library clones are identified with a low homology with a sequence of repetitive DNA families to which the first clones respectively belong and variant sequences are then identified by selecting clones having a pattern of hybridization with genomic DNA dissimilar to the hybridization pattern shown by the respective families. In another embodiment, variant sequences are selected from a sequence of a known repetitive DNA family. The selected variant sequence is classified as chromosome specific, chromosome preferential, or chromosome nonspecific. Sequences which are classified as chromosome preferential are further sequenced and regions are identified having a low homology with other regions of the chromosome preferential sequence or with known sequences of other family members and consensus sequences of the repetitive DNA families for the chromosome preferential sequences. The selected low homology regions are then hybridized with chromosomes to determine those low homology regions hybridized with a specific chromosome under normal stringency conditions.

  11. Micropathogen Community Analysis in Hyalomma rufipes via High-Throughput Sequencing of Small RNAs

    PubMed Central

    Luo, Jin; Liu, Min-Xuan; Ren, Qiao-Yun; Chen, Ze; Tian, Zhan-Cheng; Hao, Jia-Wei; Wu, Feng; Liu, Xiao-Cui; Luo, Jian-Xun; Yin, Hong; Wang, Hui; Liu, Guang-Yuan

    2017-01-01

    Ticks are important vectors in the transmission of a broad range of micropathogens to vertebrates, including humans. Because of the role of ticks in disease transmission, identifying and characterizing the micropathogen profiles of tick populations have become increasingly important. The objective of this study was to survey the micropathogens of Hyalomma rufipes ticks. Illumina HiSeq2000 technology was utilized to perform deep sequencing of small RNAs (sRNAs) extracted from field-collected H. rufipes ticks in Gansu Province, China. The resultant sRNA library data revealed that the surveyed tick populations produced reads that were homologous to St. Croix River Virus (SCRV) sequences. We also observed many reads that were homologous to microbial and/or pathogenic isolates, including bacteria, protozoa, and fungi. As part of this analysis, a phylogenetic tree was constructed to display the relationships among the homologous sequences that were identified. The study offered a unique opportunity to gain insight into the micropathogens of H. rufipes ticks. The effective control of arthropod vectors in the future will require knowledge of the micropathogen composition of vectors harboring infectious agents. Understanding the ecological factors that regulate vector propagation in association with the prevalence and persistence of micropathogen lineages is also imperative. These interactions may affect the evolution of micropathogen lineages, especially if the micropathogens rely on the vector or host for dispersal. The sRNA deep-sequencing approach used in this analysis provides an intuitive method to survey micropathogen prevalence in ticks and other vector species. PMID:28861401

  12. Evaluating the efficacy of a structure-derived amino acid substitution matrix in detecting protein homologs by BLAST and PSI-BLAST.

    PubMed

    Goonesekere, Nalin Cw

    2009-01-01

    The large numbers of protein sequences generated by whole genome sequencing projects require rapid and accurate methods of annotation. The detection of homology through computational sequence analysis is a powerful tool in determining the complex evolutionary and functional relationships that exist between proteins. Homology search algorithms employ amino acid substitution matrices to detect similarity between proteins sequences. The substitution matrices in common use today are constructed using sequences aligned without reference to protein structure. Here we present amino acid substitution matrices constructed from the alignment of a large number of protein domain structures from the structural classification of proteins (SCOP) database. We show that when incorporated into the homology search algorithms BLAST and PSI-blast, the structure-based substitution matrices enhance the efficacy of detecting remote homologs.

  13. BCL2 oncogene translocation is mediated by a chi-like consensus

    PubMed Central

    1992-01-01

    Examination of 64 translocations involving the major breakpoint region (mbr) of the BCL2 oncogene and the immunoglobulin heavy chain locus identified three short (14, 16, and 18 bp) segments within the mbr at which translocations occurred with very high frequency. Each of these clusters was associated with a 15-bp region of sequence homology, the principal one containing an octamer related to chi, the procaryotic activator of recombination. The presence of short deletions and N nucleotide additions at the breakpoints, as well as involvement of JH and DH coding regions, suggested that these sequences served as signals capable of interacting with the VDJ recombinase complex, even though no homology with the traditional heptamer/spacer/nonamer (IgRSS) existed. Furthermore, the BCL2 signal sequences were employed in a bidirectional fashion and could mediate recombination of one mbr region with another. Segments homologous to the BCL2 signal sequences flanked individual members of the XP family of diversity gene segments, which were themselves highly overrepresented in the reciprocal products (18q-) of BCL2 translocation. We propose that the chi-like signal sequences of BCL2 represent a distinct class of recognition sites for the recombinase complex, responsible for initiating interactions between regions of DNA separated by great distances, and that BCL2 translocation begins by a recombination event between mbr and DXP chi signals. Since recombinant joints containing chi, not IgRSS, occur in brain cells expressing RAG-1 (Matsuoka, M., F. Nagawa, K. Okazaki, L. Kingsbury, K. Yoshida, U. Muller, D. T. Larue, J. A. Winer, and H. Sakano. 1991. Science [Wash. DC]. 254:81; reference 1), we further suggest that the product of this gene could mediate both BCL2 translocation and the first step of normal DJ assembly through the creation of chi joints, rather than signal or coding joints. PMID:1588282

  14. From microbial communities to cells

    NASA Technical Reports Server (NTRS)

    Margulis, L.

    1985-01-01

    The eukraotic cell, the unit of structure of protoctists, plants, fungi, and animals, is not at all homologous to prokaryotic cells. Instead the eukaryotic cell is homologous to communities of microorganisms such as those of the sulfuretum. This research is based on the hypothesis that at least four different interacting community members entered the original associations that, when stabilized, led to the emergence of eukaryotic cells. These are: (1) host nucleocytoplasm (thermoplasma like archaebacteria); (2) mitochrondria (paracoccus or bdellovibryo like respiring bacteria; and (3) plastids (cyanobacteria) and undulipodia. Tubulin like protein was found in the free living spirochete Spirochaeta bajacaliforniensis and in several other spirochetes. The amino acid sequence was to see if the spirochete protein is homologous to the tubulin of undulipodial and mitotic spindle microtubules.

  15. MIPS: a database for protein sequences, homology data and yeast genome information.

    PubMed Central

    Mewes, H W; Albermann, K; Heumann, K; Liebl, S; Pfeiffer, F

    1997-01-01

    The MIPS group (Martinsried Institute for Protein Sequences) at the Max-Planck-Institute for Biochemistry, Martinsried near Munich, Germany, collects, processes and distributes protein sequence data within the framework of the tripartite association of the PIR-International Protein Sequence Database (,). MIPS contributes nearly 50% of the data input to the PIR-International Protein Sequence Database. The database is distributed on CD-ROM together with PATCHX, an exhaustive supplement of unique, unverified protein sequences from external sources compiled by MIPS. Through its WWW server (http://www.mips.biochem.mpg.de/ ) MIPS permits internet access to sequence databases, homology data and to yeast genome information. (i) Sequence similarity results from the FASTA program () are stored in the FASTA database for all proteins from PIR-International and PATCHX. The database is dynamically maintained and permits instant access to FASTA results. (ii) Starting with FASTA database queries, proteins have been classified into families and superfamilies (PROT-FAM). (iii) The HPT (hashed position tree) data structure () developed at MIPS is a new approach for rapid sequence and pattern searching. (iv) MIPS provides access to the sequence and annotation of the complete yeast genome (), the functional classification of yeast genes (FunCat) and its graphical display, the 'Genome Browser' (). A CD-ROM based on the JAVA programming language providing dynamic interactive access to the yeast genome and the related protein sequences has been compiled and is available on request. PMID:9016498

  16. DNA typing of ancient parasite eggs from environmental samples identifies human and animal worm infections in Viking-age settlement.

    PubMed

    Søe, Martin Jensen; Nejsum, Peter; Fredensborg, Brian Lund; Kapel, Christian Moliin Outzen

    2015-02-01

    Ancient parasite eggs were recovered from environmental samples collected at a Viking-age settlement in Viborg, Denmark, dated 1018-1030 A.D. Morphological examination identified Ascaris sp., Trichuris sp., and Fasciola sp. eggs, but size and shape did not allow species identification. By carefully selecting genetic markers, PCR amplification and sequencing of ancient DNA (aDNA) isolates resulted in identification of: the human whipworm, Trichuris trichiura , using SSUrRNA sequence homology; Ascaris sp. with 100% homology to cox1 haplotype 07; and Fasciola hepatica using ITS1 sequence homology. The identification of T. trichiura eggs indicates that human fecal material is present and, hence, that the Ascaris sp. haplotype 07 was most likely a human variant in Viking-age Denmark. The location of the F. hepatica finding suggests that sheep or cattle are the most likely hosts. Further, we sequenced the Ascaris sp. 18S rRNA gene in recent isolates from humans and pigs of global distribution and show that this is not a suited marker for species-specific identification. Finally, we discuss ancient parasitism in Denmark and the implementation of aDNA analysis methods in paleoparasitological studies. We argue that when employing species-specific identification, soil samples offer excellent opportunities for studies of human parasite infections and of human and animal interactions of the past.

  17. Annotating Protein Functional Residues by Coupling High-Throughput Fitness Profile and Homologous-Structure Analysis

    PubMed Central

    Du, Yushen; Wu, Nicholas C.; Jiang, Lin; Zhang, Tianhao; Gong, Danyang; Shu, Sara; Wu, Ting-Ting

    2016-01-01

    ABSTRACT Identification and annotation of functional residues are fundamental questions in protein sequence analysis. Sequence and structure conservation provides valuable information to tackle these questions. It is, however, limited by the incomplete sampling of sequence space in natural evolution. Moreover, proteins often have multiple functions, with overlapping sequences that present challenges to accurate annotation of the exact functions of individual residues by conservation-based methods. Using the influenza A virus PB1 protein as an example, we developed a method to systematically identify and annotate functional residues. We used saturation mutagenesis and high-throughput sequencing to measure the replication capacity of single nucleotide mutations across the entire PB1 protein. After predicting protein stability upon mutations, we identified functional PB1 residues that are essential for viral replication. To further annotate the functional residues important to the canonical or noncanonical functions of viral RNA-dependent RNA polymerase (vRdRp), we performed a homologous-structure analysis with 16 different vRdRp structures. We achieved high sensitivity in annotating the known canonical polymerase functional residues. Moreover, we identified a cluster of noncanonical functional residues located in the loop region of the PB1 β-ribbon. We further demonstrated that these residues were important for PB1 protein nuclear import through the interaction with Ran-binding protein 5. In summary, we developed a systematic and sensitive method to identify and annotate functional residues that are not restrained by sequence conservation. Importantly, this method is generally applicable to other proteins about which homologous-structure information is available. PMID:27803181

  18. Functional region prediction with a set of appropriate homologous sequences-an index for sequence selection by integrating structure and sequence information with spatial statistics

    PubMed Central

    2012-01-01

    Background The detection of conserved residue clusters on a protein structure is one of the effective strategies for the prediction of functional protein regions. Various methods, such as Evolutionary Trace, have been developed based on this strategy. In such approaches, the conserved residues are identified through comparisons of homologous amino acid sequences. Therefore, the selection of homologous sequences is a critical step. It is empirically known that a certain degree of sequence divergence in the set of homologous sequences is required for the identification of conserved residues. However, the development of a method to select homologous sequences appropriate for the identification of conserved residues has not been sufficiently addressed. An objective and general method to select appropriate homologous sequences is desired for the efficient prediction of functional regions. Results We have developed a novel index to select the sequences appropriate for the identification of conserved residues, and implemented the index within our method to predict the functional regions of a protein. The implementation of the index improved the performance of the functional region prediction. The index represents the degree of conserved residue clustering on the tertiary structure of the protein. For this purpose, the structure and sequence information were integrated within the index by the application of spatial statistics. Spatial statistics is a field of statistics in which not only the attributes but also the geometrical coordinates of the data are considered simultaneously. Higher degrees of clustering generate larger index scores. We adopted the set of homologous sequences with the highest index score, under the assumption that the best prediction accuracy is obtained when the degree of clustering is the maximum. The set of sequences selected by the index led to higher functional region prediction performance than the sets of sequences selected by other sequence-based methods. Conclusions Appropriate homologous sequences are selected automatically and objectively by the index. Such sequence selection improved the performance of functional region prediction. As far as we know, this is the first approach in which spatial statistics have been applied to protein analyses. Such integration of structure and sequence information would be useful for other bioinformatics problems. PMID:22643026

  19. Identification of SHIP-1 and SHIP-2 homologs in channel catfish, Ictalurus punctatus

    USDA-ARS?s Scientific Manuscript database

    Src homology domain 2 (SH2) domain-containing inositol 5’-phosphatases (SHIP) proteins have diverse roles in signal transduction. SHIP-1 and SHIP-2 homologs were identified in channel catfish, Ictalurus punctatus, based on sequence homology to murine and human SHIP sequences. Full-length cDNAs for ...

  20. GeneBuilder: interactive in silico prediction of gene structure.

    PubMed

    Milanesi, L; D'Angelo, D; Rogozin, I B

    1999-01-01

    Prediction of gene structure in newly sequenced DNA becomes very important in large genome sequencing projects. This problem is complicated due to the exon-intron structure of eukaryotic genes and because gene expression is regulated by many different short nucleotide domains. In order to be able to analyse the full gene structure in different organisms, it is necessary to combine information about potential functional signals (promoter region, splice sites, start and stop codons, 3' untranslated region) together with the statistical properties of coding sequences (coding potential), information about homologous proteins, ESTs and repeated elements. We have developed the GeneBuilder system which is based on prediction of functional signals and coding regions by different approaches in combination with similarity searches in proteins and EST databases. The potential gene structure models are obtained by using a dynamic programming method. The program permits the use of several parameters for gene structure prediction and refinement. During gene model construction, selecting different exon homology levels with a protein sequence selected from a list of homologous proteins can improve the accuracy of the gene structure prediction. In the case of low homology, GeneBuilder is still able to predict the gene structure. The GeneBuilder system has been tested by using the standard set (Burset and Guigo, Genomics, 34, 353-367, 1996) and the performances are: 0.89 sensitivity and 0.91 specificity at the nucleotide level. The total correlation coefficient is 0.88. The GeneBuilder system is implemented as a part of the WebGene a the URL: http://www.itba.mi. cnr.it/webgene and TRADAT (TRAncription Database and Analysis Tools) launcher URL: http://www.itba.mi.cnr.it/tradat.

  1. GeneBee-net: Internet-based server for analyzing biopolymers

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Brodsky, L.I.; Ivanov, V.V.; Nikolaev, V.K.

    This work describes a network server for searching databanks of biopolymer structures and performing other biocomputing procedures; it is available via direct Internet connection. Basic server procedures are dedicated to homology (similarity) search of sequence and 3D structure of proteins. The homologies found could be used to build multiple alignments, predict protein and RNA secondary structure, and construct phylogenetic trees. In addition to traditional methods of sequence similarity search, the authors propose {open_quotes}non-matrix{close_quotes} (correlational) search. An analogous approach is used to identify regions of similar tertiary structure of proteins. Algorithm concepts and usage examples are presented for new methods. Servicemore » logic is based upon interaction of a client program and server procedures. The client program allows the compilation of queries and the processing of results of an analysis.« less

  2. [Study on the genetic difference of SEO type Hantaviruses].

    PubMed

    Zhang, X; Zhou, S; Wang, H; Hu, J; Guan, Z; Liu, H

    2000-10-01

    To understand the genetic type of Hantaviruses and the difference between them caused by rodents in Beijing and to furhter explore the source of the infectious factors. Hantavirus RNA, isolated from lungs of rodents captured in Beijing and positive with Hantavirus antigens with frozen sectioning and Immunofluorescent assay, were reverse-transcribed and amplified with PCR with Hantavirus-specific primers. Five of the PCR amplifications were discovered and sequenced with 300 bp sequence data of M segments (from 2003 - 2302nt according cDNA of seoul 8039 strain). Nucleotide sequence homology showed that they were sequences of SEO-type Hantavirus. Compared with SEO type Hantavirus, the nucleotide sequence homology of these samples was more than 94% while the homology of amonia acid sequence was more than 98%. When compared with HNT type Hantavirus, the homology of nucleotide sequence became less than 72% with the homology of amonia acid sequence less than 81%. Similar to other Hantavirus of SEO type, their nucleotide sequences and deduced amino acid sequences were highly preserved. Phylogenetic tree analysis showed that the five viruses could be divided into at least 4 branches. It was quite likely that there were at least two sub-type SEO viruses with 4 branches that were circulating in Beijing.

  3. Protein 3D Structure Computed from Evolutionary Sequence Variation

    PubMed Central

    Sheridan, Robert; Hopf, Thomas A.; Pagnani, Andrea; Zecchina, Riccardo; Sander, Chris

    2011-01-01

    The evolutionary trajectory of a protein through sequence space is constrained by its function. Collections of sequence homologs record the outcomes of millions of evolutionary experiments in which the protein evolves according to these constraints. Deciphering the evolutionary record held in these sequences and exploiting it for predictive and engineering purposes presents a formidable challenge. The potential benefit of solving this challenge is amplified by the advent of inexpensive high-throughput genomic sequencing. In this paper we ask whether we can infer evolutionary constraints from a set of sequence homologs of a protein. The challenge is to distinguish true co-evolution couplings from the noisy set of observed correlations. We address this challenge using a maximum entropy model of the protein sequence, constrained by the statistics of the multiple sequence alignment, to infer residue pair couplings. Surprisingly, we find that the strength of these inferred couplings is an excellent predictor of residue-residue proximity in folded structures. Indeed, the top-scoring residue couplings are sufficiently accurate and well-distributed to define the 3D protein fold with remarkable accuracy. We quantify this observation by computing, from sequence alone, all-atom 3D structures of fifteen test proteins from different fold classes, ranging in size from 50 to 260 residues., including a G-protein coupled receptor. These blinded inferences are de novo, i.e., they do not use homology modeling or sequence-similar fragments from known structures. The co-evolution signals provide sufficient information to determine accurate 3D protein structure to 2.7–4.8 Å Cα-RMSD error relative to the observed structure, over at least two-thirds of the protein (method called EVfold, details at http://EVfold.org). This discovery provides insight into essential interactions constraining protein evolution and will facilitate a comprehensive survey of the universe of protein structures, new strategies in protein and drug design, and the identification of functional genetic variants in normal and disease genomes. PMID:22163331

  4. Structural changes in the BH3 domain of SOUL protein upon interaction with the anti-apoptotic protein Bcl-xL

    PubMed Central

    Ambrosi, Emmanuele; Capaldi, Stefano; Bovi, Michele; Saccomani, Gianmaria; Perduca, Massimiliano; Monaco, Hugo L.

    2011-01-01

    The SOUL protein is known to induce apoptosis by provoking the mitochondrial permeability transition, and a sequence homologous with the BH3 (Bcl-2 homology 3) domains has recently been identified in the protein, thus making it a potential new member of the BH3-only protein family. In the present study, we provide NMR, SPR (surface plasmon resonance) and crystallographic evidence that a peptide spanning residues 147–172 in SOUL interacts with the anti-apoptotic protein Bcl-xL. We have crystallized SOUL alone and the complex of its BH3 domain peptide with Bcl-xL, and solved their three-dimensional structures. The SOUL monomer is a single domain organized as a distorted β-barrel with eight anti-parallel strands and two α-helices. The BH3 domain extends across 15 residues at the end of the second helix and eight amino acids in the chain following it. There are important structural differences in the BH3 domain in the intact SOUL molecule and the same sequence bound to Bcl-xL. PMID:21639858

  5. Solution NMR Structures of Pyrenophora tritici-repentis ToxB and Its Inactive Homolog Reveal Potential Determinants of Toxin Activity*

    PubMed Central

    Nyarko, Afua; Singarapu, Kiran K.; Figueroa, Melania; Manning, Viola A.; Pandelova, Iovanna; Wolpert, Thomas J.; Ciuffetti, Lynda M.; Barbar, Elisar

    2014-01-01

    Pyrenophora tritici-repentis Ptr ToxB (ToxB) is a proteinaceous host-selective toxin produced by Pyrenophora tritici-repentis (P. tritici-repentis), a plant pathogenic fungus that causes the disease tan spot of wheat. One feature that distinguishes ToxB from other host-selective toxins is that it has naturally occurring homologs in non-pathogenic P. tritici-repentis isolates that lack toxic activity. There are no high-resolution structures for any of the ToxB homologs, or for any protein with >30% sequence identity, and therefore what underlies activity remains an open question. Here, we present the NMR structures of ToxB and its inactive homolog Ptr toxb. Both proteins adopt a β-sandwich fold comprising three strands in each half that are bridged together by two disulfide bonds. The inactive toxb, however, shows higher flexibility localized to the sequence-divergent β-sandwich half. The absence of toxic activity is attributed to a more open structure in the vicinity of one disulfide bond, higher flexibility, and residue differences in an exposed loop that likely impacts interaction with putative targets. We propose that activity is regulated by perturbations in a putative active site loop and changes in dynamics distant from the site of activity. Interestingly, the new structures identify AvrPiz-t, a secreted avirulence protein produced by the rice blast fungus, as a structural homolog to ToxB. This homology suggests that fungal proteins involved in either disease susceptibility such as ToxB or resistance such as AvrPiz-t may have a common evolutionary origin. PMID:25063993

  6. Central region component1, a novel synaptonemal complex component, is essential for meiotic recombination initiation in rice.

    PubMed

    Miao, Chunbo; Tang, Ding; Zhang, Honggen; Wang, Mo; Li, Yafei; Tang, Shuzhu; Yu, Hengxiu; Gu, Minghong; Cheng, Zhukuan

    2013-08-01

    In meiosis, homologous recombination entails programmed DNA double-strand break (DSB) formation and synaptonemal complex (SC) assembly coupled with the DSB repair. Although SCs display extensive structural conservation among species, their components identified are poorly conserved at the sequence level. Here, we identified a novel SC component, designated central region component1 (CRC1), in rice (Oryza sativa). CRC1 colocalizes with ZEP1, the rice SC transverse filament protein, to the central region of SCs in a mutually dependent fashion. Consistent with this colocalization, CRC1 interacts with ZEP1 in yeast two-hybrid assays. CRC1 is orthologous to Saccharomyces cerevisiae pachytene checkpoint2 (Pch2) and Mus musculus THYROID receptor-interacting protein13 (TRIP13) and may be a conserved SC component. Additionally, we provide evidence that CRC1 is essential for meiotic DSB formation. CRC1 interacts with homologous pairing aberration in rice meiosis1 (PAIR1) in vitro, suggesting that these proteins act as a complex to promote DSB formation. PAIR2, the rice ortholog of budding yeast homolog pairing1, is required for homologous chromosome pairing. We found that CRC1 is also essential for the recruitment of PAIR2 onto meiotic chromosomes. The roles of CRC1 identified here have not been reported for Pch2 or TRIP13.

  7. CENTRAL REGION COMPONENT1, a Novel Synaptonemal Complex Component, Is Essential for Meiotic Recombination Initiation in Rice[C][W

    PubMed Central

    Miao, Chunbo; Tang, Ding; Zhang, Honggen; Wang, Mo; Li, Yafei; Tang, Shuzhu; Yu, Hengxiu; Gu, Minghong; Cheng, Zhukuan

    2013-01-01

    In meiosis, homologous recombination entails programmed DNA double-strand break (DSB) formation and synaptonemal complex (SC) assembly coupled with the DSB repair. Although SCs display extensive structural conservation among species, their components identified are poorly conserved at the sequence level. Here, we identified a novel SC component, designated CENTRAL REGION COMPONENT1 (CRC1), in rice (Oryza sativa). CRC1 colocalizes with ZEP1, the rice SC transverse filament protein, to the central region of SCs in a mutually dependent fashion. Consistent with this colocalization, CRC1 interacts with ZEP1 in yeast two-hybrid assays. CRC1 is orthologous to Saccharomyces cerevisiae pachytene checkpoint2 (Pch2) and Mus musculus THYROID RECEPTOR-INTERACTING PROTEIN13 (TRIP13) and may be a conserved SC component. Additionally, we provide evidence that CRC1 is essential for meiotic DSB formation. CRC1 interacts with HOMOLOGOUS PAIRING ABERRATION IN RICE MEIOSIS1 (PAIR1) in vitro, suggesting that these proteins act as a complex to promote DSB formation. PAIR2, the rice ortholog of budding yeast homolog pairing1, is required for homologous chromosome pairing. We found that CRC1 is also essential for the recruitment of PAIR2 onto meiotic chromosomes. The roles of CRC1 identified here have not been reported for Pch2 or TRIP13. PMID:23943860

  8. [Sequence analysis of LEAFY homologous gene from Dendrobium moniliforme and application for identification of medicinal Dendrobium].

    PubMed

    Xing, Wen-Rui; Hou, Bei-Wei; Guan, Jing-Jiao; Luo, Jing; Ding, Xiao-Yu

    2013-04-01

    The LEAFY (LFY) homologous gene of Dendrobium moniliforme (L.) Sw. was cloned by new primers which were designed based on the conservative region of known sequences of orchid LEAFY gene. Partial LFY homologous gene was cloned by common PCR, then we got the complete LFY homologous gene Den LFY by Tail-PCR. The complete sequence of DenLFY gene was 3 575 bp which contained three exons and two introns. Using BLAST method, comparison analysis among the exon of LFY homologous gene indicted that the DenLFY gene had high identity with orchids LFY homologous, including the related fragment of PhalLFY (84%) in Phalaenopsis hybrid cultivar, LFY homologous gene in Oncidium (90%) and in other orchid (over 80%). Using MP analysis, Dendrobium is found to be the sister to Oncidium and Phalaenopsis. Homologous analysis demonstrated that the C-terminal amino acids were highly conserved. When the exons and introns were separately considered, exons and the sequence of amino acid were good markers for the function research of DenLFY gene. The second intron can be used in authentication research of Dendrobium based on the length polymorphism between Dendrobium moniliforme and Dendrobium officinale.

  9. Annotating Protein Functional Residues by Coupling High-Throughput Fitness Profile and Homologous-Structure Analysis.

    PubMed

    Du, Yushen; Wu, Nicholas C; Jiang, Lin; Zhang, Tianhao; Gong, Danyang; Shu, Sara; Wu, Ting-Ting; Sun, Ren

    2016-11-01

    Identification and annotation of functional residues are fundamental questions in protein sequence analysis. Sequence and structure conservation provides valuable information to tackle these questions. It is, however, limited by the incomplete sampling of sequence space in natural evolution. Moreover, proteins often have multiple functions, with overlapping sequences that present challenges to accurate annotation of the exact functions of individual residues by conservation-based methods. Using the influenza A virus PB1 protein as an example, we developed a method to systematically identify and annotate functional residues. We used saturation mutagenesis and high-throughput sequencing to measure the replication capacity of single nucleotide mutations across the entire PB1 protein. After predicting protein stability upon mutations, we identified functional PB1 residues that are essential for viral replication. To further annotate the functional residues important to the canonical or noncanonical functions of viral RNA-dependent RNA polymerase (vRdRp), we performed a homologous-structure analysis with 16 different vRdRp structures. We achieved high sensitivity in annotating the known canonical polymerase functional residues. Moreover, we identified a cluster of noncanonical functional residues located in the loop region of the PB1 β-ribbon. We further demonstrated that these residues were important for PB1 protein nuclear import through the interaction with Ran-binding protein 5. In summary, we developed a systematic and sensitive method to identify and annotate functional residues that are not restrained by sequence conservation. Importantly, this method is generally applicable to other proteins about which homologous-structure information is available. To fully comprehend the diverse functions of a protein, it is essential to understand the functionality of individual residues. Current methods are highly dependent on evolutionary sequence conservation, which is usually limited by sampling size. Sequence conservation-based methods are further confounded by structural constraints and multifunctionality of proteins. Here we present a method that can systematically identify and annotate functional residues of a given protein. We used a high-throughput functional profiling platform to identify essential residues. Coupling it with homologous-structure comparison, we were able to annotate multiple functions of proteins. We demonstrated the method with the PB1 protein of influenza A virus and identified novel functional residues in addition to its canonical function as an RNA-dependent RNA polymerase. Not limited to virology, this method is generally applicable to other proteins that can be functionally selected and about which homologous-structure information is available. Copyright © 2016 Du et al.

  10. Manipulation of Karyotype in Caenorhabditis elegans Reveals Multiple Inputs Driving Pairwise Chromosome Synapsis During Meiosis

    PubMed Central

    Roelens, Baptiste; Schvarzstein, Mara; Villeneuve, Anne M.

    2015-01-01

    Meiotic chromosome segregation requires pairwise association between homologs, stabilized by the synaptonemal complex (SC). Here, we investigate factors contributing to pairwise synapsis by investigating meiosis in polyploid worms. We devised a strategy, based on transient inhibition of cohesin function, to generate polyploid derivatives of virtually any Caenorhabditis elegans strain. We exploited this strategy to investigate the contribution of recombination to pairwise synapsis in tetraploid and triploid worms. In otherwise wild-type polyploids, chromosomes first sort into homolog groups, then multipartner interactions mature into exclusive pairwise associations. Pairwise synapsis associations still form in recombination-deficient tetraploids, confirming a propensity for synapsis to occur in a strictly pairwise manner. However, the transition from multipartner to pairwise association was perturbed in recombination-deficient triploids, implying a role for recombination in promoting this transition when three partners compete for synapsis. To evaluate the basis of synapsis partner preference, we generated polyploid worms heterozygous for normal sequence and rearranged chromosomes sharing the same pairing center (PC). Tetraploid worms had no detectable preference for identical partners, indicating that PC-adjacent homology drives partner choice in this context. In contrast, triploid worms exhibited a clear preference for identical partners, indicating that homology outside the PC region can influence partner choice. Together, our findings, suggest a two-phase model for C. elegans synapsis: an early phase, in which initial synapsis interactions are driven primarily by recombination-independent assessment of homology near PCs and by a propensity for pairwise SC assembly, and a later phase in which mature synaptic interactions are promoted by recombination. PMID:26500263

  11. Gentle Masking of Low-Complexity Sequences Improves Homology Search

    PubMed Central

    Frith, Martin C.

    2011-01-01

    Detection of sequences that are homologous, i.e. descended from a common ancestor, is a fundamental task in computational biology. This task is confounded by low-complexity tracts (such as atatatatatat), which arise frequently and independently, causing strong similarities that are not homologies. There has been much research on identifying low-complexity tracts, but little research on how to treat them during homology search. We propose to find homologies by aligning sequences with “gentle” masking of low-complexity tracts. Gentle masking means that the match score involving a masked letter is , where is the unmasked score. Gentle masking slightly but noticeably improves the sensitivity of homology search (compared to “harsh” masking), without harming specificity. We show examples in three useful homology search problems: detection of NUMTs (nuclear copies of mitochondrial DNA), recruitment of metagenomic DNA reads to reference genomes, and pseudogene detection. Gentle masking is currently the best way to treat low-complexity tracts during homology search. PMID:22205972

  12. Sequence divergence of the red and green visual pigments in great apes and humans.

    PubMed Central

    Deeb, S S; Jorgensen, A L; Battisti, L; Iwasaki, L; Motulsky, A G

    1994-01-01

    We have determined the coding sequences of red and green visual pigment genes of the chimpanzee, gorilla, and orangutan. The deduced amino acid sequences of these pigments are highly homologous to the equivalent human pigments. None of the amino acid differences occurred at sites that were previously shown to influence pigment absorption characteristics. Therefore, we predict the spectra of red and green pigments of the apes to have wavelengths of maximum absorption that differ by < 2 nm from the equivalent human pigments and that color vision in these nonhuman primates will be very similar, if not identical, to that in humans. A total of 14 within-species polymorphisms (6 involving silent substitutions) were observed in the coding sequences of the red and green pigment genes of the great apes. Remarkably, the polymorphisms at 6 of these sites had been observed in human populations, suggesting that they predated the evolution of higher primates. Alleles at polymorphic sites were often shared between the red and green pigment genes. The average synonymous rate of divergence of red from green sequences was approximately 1/10th that estimated for other proteins of higher primates, indicating the involvement of gene conversion in generating these polymorphisms. The high degree of homology and juxtaposition of these two genes on the X chromosome has promoted unequal recombination and/or gene conversion that led to sequence homogenization. However, natural selection operated to maintain the degree of separation in peak absorbance between the red and green pigments that resulted in optimal chromatic discrimination. This represents a unique case of molecular coevolution between two homologous genes that functionally interact at the behavioral level. PMID:8041777

  13. Contribution of the first K-homology domain of poly(C)-binding protein 1 to its affinity and specificity for C-rich oligonucleotides

    PubMed Central

    Yoga, Yano M. K.; Traore, Daouda A. K.; Sidiqi, Mahjooba; Szeto, Chris; Pendini, Nicole R.; Barker, Andrew; Leedman, Peter J.; Wilce, Jacqueline A.; Wilce, Matthew C. J.

    2012-01-01

    Poly-C-binding proteins are triple KH (hnRNP K homology) domain proteins with specificity for single stranded C-rich RNA and DNA. They play diverse roles in the regulation of protein expression at both transcriptional and translational levels. Here, we analyse the contributions of individual αCP1 KH domains to binding C-rich oligonucleotides using biophysical and structural methods. Using surface plasmon resonance (SPR), we demonstrate that KH1 makes the most stable interactions with both RNA and DNA, KH3 binds with intermediate affinity and KH2 only interacts detectibly with DNA. The crystal structure of KH1 bound to a 5′-CCCTCCCT-3′ DNA sequence shows a 2:1 protein:DNA stoichiometry and demonstrates a molecular arrangement of KH domains bound to immediately adjacent oligonucleotide target sites. SPR experiments, with a series of poly-C-sequences reveals that cytosine is preferred at all four positions in the oligonucleotide binding cleft and that a C-tetrad binds KH1 with 10 times higher affinity than a C-triplet. The basis for this high affinity interaction is finally detailed with the structure determination of a KH1.W.C54S mutant bound to 5′-ACCCCA-3′ DNA sequence. Together, these data establish the lead role of KH1 in oligonucleotide binding by αCP1 and reveal the molecular basis of its specificity for a C-rich tetrad. PMID:22344691

  14. Contribution of the first K-homology domain of poly(C)-binding protein 1 to its affinity and specificity for C-rich oligonucleotides.

    PubMed

    Yoga, Yano M K; Traore, Daouda A K; Sidiqi, Mahjooba; Szeto, Chris; Pendini, Nicole R; Barker, Andrew; Leedman, Peter J; Wilce, Jacqueline A; Wilce, Matthew C J

    2012-06-01

    Poly-C-binding proteins are triple KH (hnRNP K homology) domain proteins with specificity for single stranded C-rich RNA and DNA. They play diverse roles in the regulation of protein expression at both transcriptional and translational levels. Here, we analyse the contributions of individual αCP1 KH domains to binding C-rich oligonucleotides using biophysical and structural methods. Using surface plasmon resonance (SPR), we demonstrate that KH1 makes the most stable interactions with both RNA and DNA, KH3 binds with intermediate affinity and KH2 only interacts detectibly with DNA. The crystal structure of KH1 bound to a 5'-CCCTCCCT-3' DNA sequence shows a 2:1 protein:DNA stoichiometry and demonstrates a molecular arrangement of KH domains bound to immediately adjacent oligonucleotide target sites. SPR experiments, with a series of poly-C-sequences reveals that cytosine is preferred at all four positions in the oligonucleotide binding cleft and that a C-tetrad binds KH1 with 10 times higher affinity than a C-triplet. The basis for this high affinity interaction is finally detailed with the structure determination of a KH1.W.C54S mutant bound to 5'-ACCCCA-3' DNA sequence. Together, these data establish the lead role of KH1 in oligonucleotide binding by αCP1 and reveal the molecular basis of its specificity for a C-rich tetrad.

  15. Locating herpesvirus Bcl-2 homologs in the specificity landscape of anti-apoptotic Bcl-2 proteins

    PubMed Central

    Foight, Glenna Wink; Keating, Amy E.

    2015-01-01

    Viral homologs of the anti-apoptotic Bcl-2 proteins are highly diverged from their mammalian counterparts, yet they perform overlapping functions by binding and inhibiting BH3 motif-containing proteins. We investigated the BH3 binding properties of the herpesvirus Bcl-2 homologs KSBcl-2, BHRF1, and M11, as they relate to those of the human Bcl-2 homologs Mcl-1, Bfl-1, Bcl-w, Bcl-xL, and Bcl-2. Analysis of the sequence and structure of the BH3 binding grooves showed that, despite low sequence identity, M11 has structural similarities to Bcl-xL, Bcl-2, and Bcl-w. BHRF1 and KSBcl-2 are more structurally similar to Mcl-1 than to the other human proteins. Binding to human BH3-like peptides showed that KSBcl-2 has similar specificity to Mcl-1, and BHRF1 has a restricted binding profile; M11 binding preferences are distinct from those of Bcl-xL, Bcl-2 and Bcl-w. Because KSBcl-2 and BHRF1 are from human herpesviruses associated with malignancies, we screened computationally designed BH3 peptide libraries using bacterial surface display to identify selective binders of KSBcl-2 or BHRF1. The resulting peptides bound to KSBcl-2 and BHRF1 in preference to Bfl-1, Bcl-w, Bcl-xL, and Bcl-2, but showed only modest specificity over Mcl-1. Rational mutagenesis increased specificity against Mcl-1, resulting in a peptide with a dissociation constant of 2.9 nM for binding to KSBcl-2 and >1000-fold specificity over human Bcl-2 proteins, and a peptide with >70-fold specificity for BHRF1. In addition to providing new insights into viral Bcl-2 binding specificity, this study will inform future work analyzing the interaction properties of homologous binding domains and designing specific protein interaction partners. PMID:26009469

  16. Isolation and characterization of rhamnose-binding lectins from eggs of steelhead trout (Oncorhynchus mykiss) homologous to low density lipoprotein receptor superfamily.

    PubMed

    Tateno, H; Saneyoshi, A; Ogawa, T; Muramoto, K; Kamiya, H; Saneyoshi, M

    1998-07-24

    Two L-rhamnose-binding lectins named STL1 and STL2 were isolated from eggs of steelhead trout (Oncorhynchus mykiss) by affinity chromatography and ion exchange chromatography. The apparent molecular masses of purified STL1 and STL2 were estimated to be 84 and 68 kDa, respectively, by gel filtration chromatography. Sodium dodecyl sulfate polyacrylamide gel electrophoresis and matrix-assisted laser desorption ionization time of flight mass spectrometry of these lectins revealed that STL1 was composed of noncovalently linked trimer of 31.4-kDa subunits, and STL2 was noncovalently linked trimer of 21.5-kDa subunits. The minimum concentrations of STL1, a major component, and STL2, a minor component, needed to agglutinate rabbit erythrocytes were 9 and 0.2 microg/ml, respectively. The most effective saccharide in the hemagglutination inhibition assay for both STL1 and STL2 was L-rhamnose. Saccharides possessing the same configuration of hydroxyl groups at C2 and C4 as that in L-rhamnose, such as L-arabinose and D-galactose, also inhibited. The amino acid sequence of STL2 was determined by analysis of peptides generated by digestion of the S-carboxamidomethylated protein with Achromobacter protease I or Staphylococcus aureus V8 protease. The STL2 subunit of 195 amino acid residues proved to have a unique polypeptide architecture; that is, it was composed of two tandemly repeated homologous domains (STL2-N and STL2-C) with 52% internal homology. These two domains showed a sequence homology to the subunit (105 amino acid residues) of D-galactoside-specific sea urchin (Anthocidaris crassispina) egg lectin (37% for STL2-N and 46% for STL2-C, respectively). The N terminus of the STL1 subunit was blocked with an acetyl group. However, a partial amino acid sequence of the subunit showed a sequence similarity to STL2. Moreover, STL2 also showed a sequence homology to the ligand binding domain of the vitellogenin receptor. We have also employed surface plasmon resonance biosensor methodology to investigate the interactions between STL2 and major egg yolk proteins from steelhead trout, lipovitellin, and beta'-component, which are known as vitellogenin digests. Interestingly, STL2 showed distinct interactions with both egg yolk proteins. The estimated values for the affinity constant (Ka) of STL2 to lipovitellin and beta' component were 3.44 x 10(6) and 4.99 x 10(6), respectively. These results suggest that the fish egg lectins belong to a new family of animal lectin structurally related to the low density lipoprotein receptor super- family.

  17. Interaction between focal adhesion kinase and Crk-associated tyrosine kinase substrate p130Cas.

    PubMed

    Polte, T R; Hanks, S K

    1995-11-07

    The focal adhesion kinase (FAK) has been implicated in integrin-mediated signaling events and in the mechanism of cell transformation by the v-Src and v-Crk oncoproteins. To gain further insight into FAK signaling pathways, we used a two-hybrid screen to identify proteins that interact with mouse FAK. The screen identified two proteins that interact with FAK via their Src homology 3 (SH3) domains: a v-Crk-associated tyrosine kinase substrate (Cas), p130Cas, and a still uncharacterized protein, FIPSH3-2, which contains an SH3 domain closely related to that of p130Cas. These SH3 domains bind to the same proline-rich region of FAK (APPKPSR) encompassing residues 711-717. The mouse p130Cas amino acid sequence was deduced from cDNA clones, revealing an overall high degree of similarity to the recently reported rat sequence. Coimmunoprecipitation experiments confirmed that p130Cas and FAK are associated in mouse fibroblasts. The stable interaction between p130Cas and FAK emerges as a likely key element in integrin-mediated signal transduction and further represents a direct molecular link between the v-Src and v-Crk oncoproteins. The Src family kinase Fyn, whose Src homology 2 (SH2) domain binds to the major FAK autophosphorylation site (tyrosine 397), was also identified in the two-hybrid screen.

  18. Cloning of Giardia lamblia heat shock protein HSP70 homologs: implications regarding origin of eukaryotic cells and of endoplasmic reticulum.

    PubMed Central

    Gupta, R S; Aitken, K; Falah, M; Singh, B

    1994-01-01

    The genes for two different 70-kDa heat shock protein (HSP70) homologs have been cloned and sequenced from the protozoan Giardia lamblia. On the basis of their sequence features, one of these genes corresponds to the cytoplasmic form of HSP70. The second gene, on the basis of its characteristic N-terminal hydrophobic signal sequence and C-terminal endoplasmic reticulum (ER) retention sequence (Lys-Asp-Glu-Leu), is the equivalent of ER-resident GRP78 or the Bip family of proteins. Phylogenetic trees based on HSP70 sequences show that G. lamblia homologs show the deepest divergence among eukaryotic species. The identification of a GRP78 or Bip homolog in G. lamblia strongly suggests the existence of ER in this ancient eukaryote. Detailed phylogenetic analyses of HSP70 sequences by boot-strap neighbor-joining and maximum-parsimony methods show that the cytoplasmic and ER homologs form distinct subfamilies that evolved from a common eukaryotic ancestor by gene duplication that occurred very early in the evolution of eukaryotic cells. It is postulated that because of the essential "molecular chaperone" function of these proteins in translocation of other proteins across membranes, duplication of their genes accompanied the evolution of ER or nucleus in the eukaryotic cell ancestor. The presence in all eukaryotic cytoplasmic HSP70 homologs (including the cognate, heat-induced, and ER forms) of a number of autapomorphic sequence signatures that are not present in any prokaryotic or organellar homologs provides strong evidence regarding the monophyletic nature of eukaryotic lineage. Further, all eukaryotic HSP70 homologs share in common with the Gram-negative group of eubacteria a number of sequence features that are not present in any archaebacterium or Gram-positive bacterium, indicating their evolution from this group of organisms. Some implications of these findings regarding the evolution of eukaryotic cells and ER are discussed. Images PMID:8159675

  19. Versatility and Invariance in the Evolution of Homologous Heteromeric Interfaces

    PubMed Central

    Andreani, Jessica; Faure, Guilhem; Guerois, Raphaël

    2012-01-01

    Evolutionary pressures act on protein complex interfaces so that they preserve their complementarity. Nonetheless, the elementary interactions which compose the interface are highly versatile throughout evolution. Understanding and characterizing interface plasticity across evolution is a fundamental issue which could provide new insights into protein-protein interaction prediction. Using a database of 1,024 couples of close and remote heteromeric structural interologs, we studied protein-protein interactions from a structural and evolutionary point of view. We systematically and quantitatively analyzed the conservation of different types of interface contacts. Our study highlights astonishing plasticity regarding polar contacts at complex interfaces. It also reveals that up to a quarter of the residues switch out of the interface when comparing two homologous complexes. Despite such versatility, we identify two important interface descriptors which correlate with an increased conservation in the evolution of interfaces: apolar patches and contacts surrounding anchor residues. These observations hold true even when restricting the dataset to transiently formed complexes. We show that a combination of six features related either to sequence or to geometric properties of interfaces can be used to rank positions likely to share similar contacts between two interologs. Altogether, our analysis provides important tracks for extracting meaningful information from multiple sequence alignments of conserved binding partners and for discriminating near-native interfaces using evolutionary information. PMID:22952442

  20. Navigating highly homologous genes in a molecular diagnostic setting: a resource for clinical next-generation sequencing.

    PubMed

    Mandelker, Diana; Schmidt, Ryan J; Ankala, Arunkanth; McDonald Gibson, Kristin; Bowser, Mark; Sharma, Himanshu; Duffy, Elizabeth; Hegde, Madhuri; Santani, Avni; Lebo, Matthew; Funke, Birgit

    2016-12-01

    Next-generation sequencing (NGS) is now routinely used to interrogate large sets of genes in a diagnostic setting. Regions of high sequence homology continue to be a major challenge for short-read technologies and can lead to false-positive and false-negative diagnostic errors. At the scale of whole-exome sequencing (WES), laboratories may be limited in their knowledge of genes and regions that pose technical hurdles due to high homology. We have created an exome-wide resource that catalogs highly homologous regions that is tailored toward diagnostic applications. This resource was developed using a mappability-based approach tailored to current Sanger and NGS protocols. Gene-level and exon-level lists delineate regions that are difficult or impossible to analyze via standard NGS. These regions are ranked by degree of affectedness, annotated for medical relevance, and classified by the type of homology (within-gene, different functional gene, known pseudogene, uncharacterized noncoding region). Additionally, we provide a list of exons that cannot be analyzed by short-amplicon Sanger sequencing. This resource can help guide clinical test design, supplemental assay implementation, and results interpretation in the context of high homology.Genet Med 18 12, 1282-1289.

  1. Caught in the act: the lifetime of synaptic intermediates during the search for homology on DNA

    PubMed Central

    Mani, Adam; Braslavsky, Ido; Arbel-Goren, Rinat; Stavans, Joel

    2010-01-01

    Homologous recombination plays pivotal roles in DNA repair and in the generation of genetic diversity. To locate homologous target sequences at which strand exchange can occur within a timescale that a cell’s biology demands, a single-stranded DNA-recombinase complex must search among a large number of sequences on a genome by forming synapses with chromosomal segments of DNA. A key element in the search is the time it takes for the two sequences of DNA to be compared, i.e. the synapse lifetime. Here, we visualize for the first time fluorescently tagged individual synapses formed by RecA, a prokaryotic recombinase, and measure their lifetime as a function of synapse length and differences in sequence between the participating DNAs. Surprisingly, lifetimes can be ∼10 s long when the DNAs are fully heterologous, and much longer for partial homology, consistently with ensemble FRET measurements. Synapse lifetime increases rapidly as the length of a region of full homology at either the 3′- or 5′-ends of the invading single-stranded DNA increases above 30 bases. A few mismatches can reduce dramatically the lifetime of synapses formed with nearly homologous DNAs. These results suggest the need for facilitated homology search mechanisms to locate homology successfully within the timescales observed in vivo. PMID:20044347

  2. Amino acid sequences of ribosomal proteins S11 from Bacillus stearothermophilus and S19 from Halobacterium marismortui. Comparison of the ribosomal protein S11 family.

    PubMed

    Kimura, M; Kimura, J; Hatakeyama, T

    1988-11-21

    The complete amino acid sequences of ribosomal proteins S11 from the Gram-positive eubacterium Bacillus stearothermophilus and of S19 from the archaebacterium Halobacterium marismortui have been determined. A search for homologous sequences of these proteins revealed that they belong to the ribosomal protein S11 family. Homologous proteins have previously been sequenced from Escherichia coli as well as from chloroplast, yeast and mammalian ribosomes. A pairwise comparison of the amino acid sequences showed that Bacillus protein S11 shares 68% identical residues with S11 from Escherichia coli and a slightly lower homology (52%) with the homologous chloroplast protein. The halophilic protein S19 is more related to the eukaryotic (45-49%) than to the eubacterial counterparts (35%).

  3. CMsearch: simultaneous exploration of protein sequence space and structure space improves not only protein homology detection but also protein structure prediction.

    PubMed

    Cui, Xuefeng; Lu, Zhiwu; Wang, Sheng; Jing-Yan Wang, Jim; Gao, Xin

    2016-06-15

    Protein homology detection, a fundamental problem in computational biology, is an indispensable step toward predicting protein structures and understanding protein functions. Despite the advances in recent decades on sequence alignment, threading and alignment-free methods, protein homology detection remains a challenging open problem. Recently, network methods that try to find transitive paths in the protein structure space demonstrate the importance of incorporating network information of the structure space. Yet, current methods merge the sequence space and the structure space into a single space, and thus introduce inconsistency in combining different sources of information. We present a novel network-based protein homology detection method, CMsearch, based on cross-modal learning. Instead of exploring a single network built from the mixture of sequence and structure space information, CMsearch builds two separate networks to represent the sequence space and the structure space. It then learns sequence-structure correlation by simultaneously taking sequence information, structure information, sequence space information and structure space information into consideration. We tested CMsearch on two challenging tasks, protein homology detection and protein structure prediction, by querying all 8332 PDB40 proteins. Our results demonstrate that CMsearch is insensitive to the similarity metrics used to define the sequence and the structure spaces. By using HMM-HMM alignment as the sequence similarity metric, CMsearch clearly outperforms state-of-the-art homology detection methods and the CASP-winning template-based protein structure prediction methods. Our program is freely available for download from http://sfb.kaust.edu.sa/Pages/Software.aspx : xin.gao@kaust.edu.sa Supplementary data are available at Bioinformatics online. © The Author 2016. Published by Oxford University Press.

  4. Crystal structure of AFV3-109, a highly conserved protein from crenarchaeal viruses

    PubMed Central

    Keller, Jenny; Leulliot, Nicolas; Cambillau, Christian; Campanacci, Valérie; Porciero, Stéphanie; Prangishvili, David; Forterre, Patrick; Cortez, Diego; Quevillon-Cheruel, Sophie; van Tilbeurgh, Herman

    2007-01-01

    The extraordinary morphologies of viruses infecting hyperthermophilic archaea clearly distinguish them from bacterial and eukaryotic viruses. Moreover, their genomes code for proteins that to a large extend have no related sequences in the extent databases. However, a small pool of genes is shared by overlapping subsets of these viruses, and the most conserved gene, exemplified by the ORF109 of the Acidianus Filamentous Virus 3, AFV3, is present on genomes of members of three viral familes, the Lipothrixviridae, Rudiviridae, and "Bicaudaviridae", as well as of the unclassified Sulfolobus Turreted Icosahedral Virus, STIV. We present here the crystal structure of the protein (Mr = 13.1 kD, 109 residues) encoded by the AFV3 ORF 109 in two different crystal forms at 1.5 and 1.3 Å resolution. The structure of AFV3-109 is a five stranded β-sheet with loops on one side and three helices on the other. It forms a dimer adopting the shape of a cradle that encompasses the best conserved regions of the sequence. No protein with a related fold could be identified except for the ortholog from STIV1, whose structure was deposited at the Protein Data Bank. We could clearly identify a well bound glycerol inside the cradle, contacting exclusively totally conserved residues. This interaction was confirmed in solution by fluorescence titration. Although the function of AFV3-109 cannot be deduced directly from its structure, structural homology with the STIV1 protein, and the size and charge distribution of the cavity suggested it could interact with nucleic acids. Fluorescence quenching titrations also showed that AFV3-109 interacts with dsDNA. Genomic sequence analysis revealed bacterial homologs of AFV3-109 as a part of a putative previously unidentified prophage sequences in some Firmicutes. PMID:17241456

  5. Computational Approaches for Decoding Select Odorant-Olfactory Receptor Interactions Using Mini-Virtual Screening

    PubMed Central

    Harini, K.; Sowdhamini, Ramanathan

    2015-01-01

    Olfactory receptors (ORs) belong to the class A G-Protein Coupled Receptor superfamily of proteins. Unlike G-Protein Coupled Receptors, ORs exhibit a combinatorial response to odors/ligands. ORs display an affinity towards a range of odor molecules rather than binding to a specific set of ligands and conversely a single odorant molecule may bind to a number of olfactory receptors with varying affinities. The diversity in odor recognition is linked to the highly variable transmembrane domains of these receptors. The purpose of this study is to decode the odor-olfactory receptor interactions using in silico docking studies. In this study, a ligand (odor molecules) dataset of 125 molecules was used to carry out in silico docking using the GLIDE docking tool (SCHRODINGER Inc Pvt LTD). Previous studies, with smaller datasets of ligands, have shown that orthologous olfactory receptors respond to similarly-tuned ligands, but are dramatically different in their efficacy and potency. Ligand docking results were applied on homologous pairs (with varying sequence identity) of ORs from human and mouse genomes and ligand binding residues and the ligand profile differed among such related olfactory receptor sequences. This study revealed that homologous sequences with high sequence identity need not bind to the same/ similar ligand with a given affinity. A ligand profile has been obtained for each of the 20 receptors in this analysis which will be useful for expression and mutation studies on these receptors. PMID:26221959

  6. SH2-catalytic domain linker heterogeneity influences allosteric coupling across the SFK family.

    PubMed

    Register, A C; Leonard, Stephen E; Maly, Dustin J

    2014-11-11

    Src-family kinases (SFKs) make up a family of nine homologous multidomain tyrosine kinases whose misregulation is responsible for human disease (cancer, diabetes, inflammation, etc.). Despite overall sequence homology and identical domain architecture, differences in SH3 and SH2 regulatory domain accessibility and ability to allosterically autoinhibit the ATP-binding site have been observed for the prototypical SFKs Src and Hck. Biochemical and structural studies indicate that the SH2-catalytic domain (SH2-CD) linker, the intramolecular binding epitope for SFK SH3 domains, is responsible for allosterically coupling SH3 domain engagement to autoinhibition of the ATP-binding site through the conformation of the αC helix. As a relatively unconserved region between SFK family members, SH2-CD linker sequence variability across the SFK family is likely a source of nonredundant cellular functions between individual SFKs via its effect on the availability of SH3 and SH2 domains for intermolecular interactions and post-translational modification. Using a combination of SFKs engineered with enhanced or weakened regulatory domain intramolecular interactions and conformation-selective inhibitors that report αC helix conformation, this study explores how SH2-CD sequence heterogeneity affects allosteric coupling across the SFK family by examining Lyn, Fyn1, and Fyn2. Analyses of Fyn1 and Fyn2, isoforms that are identical but for a 50-residue sequence spanning the SH2-CD linker, demonstrate that SH2-CD linker sequence differences can have profound effects on allosteric coupling between otherwise identical kinases. Most notably, a dampened allosteric connection between the SH3 domain and αC helix leads to greater autoinhibitory phosphorylation by Csk, illustrating the complex effects of SH2-CD linker sequence on cellular function.

  7. Defining and predicting structurally conserved regions in protein superfamilies

    PubMed Central

    Huang, Ivan K.; Grishin, Nick V.

    2013-01-01

    Motivation: The structures of homologous proteins are generally better conserved than their sequences. This phenomenon is demonstrated by the prevalence of structurally conserved regions (SCRs) even in highly divergent protein families. Defining SCRs requires the comparison of two or more homologous structures and is affected by their availability and divergence, and our ability to deduce structurally equivalent positions among them. In the absence of multiple homologous structures, it is necessary to predict SCRs of a protein using information from only a set of homologous sequences and (if available) a single structure. Accurate SCR predictions can benefit homology modelling and sequence alignment. Results: Using pairwise DaliLite alignments among a set of homologous structures, we devised a simple measure of structural conservation, termed structural conservation index (SCI). SCI was used to distinguish SCRs from non-SCRs. A database of SCRs was compiled from 386 SCOP superfamilies containing 6489 protein domains. Artificial neural networks were then trained to predict SCRs with various features deduced from a single structure and homologous sequences. Assessment of the predictions via a 5-fold cross-validation method revealed that predictions based on features derived from a single structure perform similarly to ones based on homologous sequences, while combining sequence and structural features was optimal in terms of accuracy (0.755) and Matthews correlation coefficient (0.476). These results suggest that even without information from multiple structures, it is still possible to effectively predict SCRs for a protein. Finally, inspection of the structures with the worst predictions pinpoints difficulties in SCR definitions. Availability: The SCR database and the prediction server can be found at http://prodata.swmed.edu/SCR. Contact: 91huangi@gmail.com or grishin@chop.swmed.edu Supplementary information: Supplementary data are available at Bioinformatics Online PMID:23193223

  8. Assigning protein functions by comparative genome analysis protein phylogenetic profiles

    DOEpatents

    Pellegrini, Matteo; Marcotte, Edward M.; Thompson, Michael J.; Eisenberg, David; Grothe, Robert; Yeates, Todd O.

    2003-05-13

    A computational method system, and computer program are provided for inferring functional links from genome sequences. One method is based on the observation that some pairs of proteins A' and B' have homologs in another organism fused into a single protein chain AB. A trans-genome comparison of sequences can reveal these AB sequences, which are Rosetta Stone sequences because they decipher an interaction between A' and B. Another method compares the genomic sequence of two or more organisms to create a phylogenetic profile for each protein indicating its presence or absence across all the genomes. The profile provides information regarding functional links between different families of proteins. In yet another method a combination of the above two methods is used to predict functional links.

  9. Evidence from molecular dynamics simulations of conformational preorganization in the ribonuclease H active site

    PubMed Central

    Stafford, Kate A.; Palmer III, Arthur G.

    2014-01-01

    Ribonuclease H1 (RNase H) enzymes are well-conserved endonucleases that are present in all domains of life and are particularly important in the life cycle of retroviruses as domains within reverse transcriptase. Despite extensive study, especially of the E. coli homolog, the interaction of the highly negatively charged active site with catalytically required magnesium ions remains poorly understood. In this work, we describe molecular dynamics simulations of the E. coli homolog in complex with magnesium ions, as well as simulations of other homologs in their apo states. Collectively, these results suggest that the active site is highly rigid in the apo state of all homologs studied and is conformationally preorganized to favor the binding of a magnesium ion. Notably, representatives of bacterial, eukaryotic, and retroviral RNases H all exhibit similar active-site rigidity, suggesting that this dynamic feature is only subtly modulated by amino acid sequence and is primarily imposed by the distinctive RNase H protein fold. PMID:25075292

  10. Overcoming Sequence Misalignments with Weighted Structural Superposition

    PubMed Central

    Khazanov, Nickolay A.; Damm-Ganamet, Kelly L.; Quang, Daniel X.; Carlson, Heather A.

    2012-01-01

    An appropriate structural superposition identifies similarities and differences between homologous proteins that are not evident from sequence alignments alone. We have coupled our Gaussian-weighted RMSD (wRMSD) tool with a sequence aligner and seed extension (SE) algorithm to create a robust technique for overlaying structures and aligning sequences of homologous proteins (HwRMSD). HwRMSD overcomes errors in the initial sequence alignment that would normally propagate into a standard RMSD overlay. SE can generate a corrected sequence alignment from the improved structural superposition obtained by wRMSD. HwRMSD’s robust performance and its superiority over standard RMSD are demonstrated over a range of homologous proteins. Its better overlay results in corrected sequence alignments with good agreement to HOMSTRAD. Finally, HwRMSD is compared to established structural alignment methods: FATCAT, SSM, CE, and Dalilite. Most methods are comparable at placing residue pairs within 2 Å, but HwRMSD places many more residue pairs within 1 Å, providing a clear advantage. Such high accuracy is essential in drug design, where small distances can have a large impact on computational predictions. This level of accuracy is also needed to correct sequence alignments in an automated fashion, especially for omics-scale analysis. HwRMSD can align homologs with low sequence identity and large conformational differences, cases where both sequence-based and structural-based methods may fail. The HwRMSD pipeline overcomes the dependency of structural overlays on initial sequence pairing and removes the need to determine the best sequence-alignment method, substitution matrix, and gap parameters for each unique pair of homologs. PMID:22733542

  11. Structural Insights into the Unusually Strong ATPase Activity of the AAA Domain of the Caenorhabditis elegans Fidgetin-like 1 (FIGL-1) Protein*

    PubMed Central

    Peng, Wentao; Lin, Zhijie; Li, Weirong; Lu, Jing; Shen, Yuequan; Wang, Chunguang

    2013-01-01

    The FIGL-1 (fidgetin like-1) protein is a homolog of fidgetin, a protein whose mutation leads to multiple developmental defects. The FIGL-1 protein contains an AAA (ATPase associated with various activities) domain and belongs to the AAA superfamily. However, the biological functions and developmental implications of this protein remain unknown. Here, we show that the AAA domain of the Caenorhabditis elegans FIGL-1 protein (CeFIGL-1-AAA), in clear contrast to homologous AAA domains, has an unusually high ATPase activity and forms a hexamer in solution. By determining the crystal structure of CeFIGL-1-AAA, we found that the loop linking helices α9 and α10 folds into the short helix α9a, which has an acidic surface and interacts with a positively charged surface of the neighboring subunit. Disruption of this charge interaction by mutagenesis diminishes both the ATPase activity and oligomerization capacity of the protein. Interestingly, the acidic residues in helix α9a of CeFIGL-1-AAA are not conserved in other homologous AAA domains that have relatively low ATPase activities. These results demonstrate that the sequence of CeFIGL-1-AAA has adapted to establish an intersubunit charge interaction, which contributes to its strong oligomerization and ATPase activity. These unique properties of CeFIGL-1-AAA distinguish it from other homologous proteins, suggesting that CeFIGL-1 may have a distinct biological function. PMID:23979136

  12. Structural insights into the unusually strong ATPase activity of the AAA domain of the Caenorhabditis elegans fidgetin-like 1 (FIGL-1) protein.

    PubMed

    Peng, Wentao; Lin, Zhijie; Li, Weirong; Lu, Jing; Shen, Yuequan; Wang, Chunguang

    2013-10-11

    The FIGL-1 (fidgetin like-1) protein is a homolog of fidgetin, a protein whose mutation leads to multiple developmental defects. The FIGL-1 protein contains an AAA (ATPase associated with various activities) domain and belongs to the AAA superfamily. However, the biological functions and developmental implications of this protein remain unknown. Here, we show that the AAA domain of the Caenorhabditis elegans FIGL-1 protein (CeFIGL-1-AAA), in clear contrast to homologous AAA domains, has an unusually high ATPase activity and forms a hexamer in solution. By determining the crystal structure of CeFIGL-1-AAA, we found that the loop linking helices α9 and α10 folds into the short helix α9a, which has an acidic surface and interacts with a positively charged surface of the neighboring subunit. Disruption of this charge interaction by mutagenesis diminishes both the ATPase activity and oligomerization capacity of the protein. Interestingly, the acidic residues in helix α9a of CeFIGL-1-AAA are not conserved in other homologous AAA domains that have relatively low ATPase activities. These results demonstrate that the sequence of CeFIGL-1-AAA has adapted to establish an intersubunit charge interaction, which contributes to its strong oligomerization and ATPase activity. These unique properties of CeFIGL-1-AAA distinguish it from other homologous proteins, suggesting that CeFIGL-1 may have a distinct biological function.

  13. Hydroquinone: O-glucosyltransferase from cultivated Rauvolfia cells: enrichment and partial amino acid sequences.

    PubMed

    Arend, J; Warzecha, H; Stöckigt, J

    2000-01-01

    Plant cell suspension cultures of Rauvolfia are able to produce a high amount of arbutin by glucosylation of exogenously added hydroquinone. A four step purification procedure using anion exchange, hydrophobic interaction, hydroxyapatite-chromatography and chromatofocusing delivered in a yield of 0.5%, an approximately 390 fold enrichment of the involved glucosyltransferase. SDS-PAGE showed a M(r) for the enzyme of 52 kDa. Proteolysis of the pure enzyme with endoproteinase LysC revealed six peptide fragments with 9-23 amino acids which were sequenced. Sequence alignment of the six peptides showed high homologies to glycosyltransferases from other higher plants.

  14. Prediction of TF target sites based on atomistic models of protein-DNA complexes

    PubMed Central

    Angarica, Vladimir Espinosa; Pérez, Abel González; Vasconcelos, Ana T; Collado-Vides, Julio; Contreras-Moreira, Bruno

    2008-01-01

    Background The specific recognition of genomic cis-regulatory elements by transcription factors (TFs) plays an essential role in the regulation of coordinated gene expression. Studying the mechanisms determining binding specificity in protein-DNA interactions is thus an important goal. Most current approaches for modeling TF specific recognition rely on the knowledge of large sets of cognate target sites and consider only the information contained in their primary sequence. Results Here we describe a structure-based methodology for predicting sequence motifs starting from the coordinates of a TF-DNA complex. Our algorithm combines information regarding the direct and indirect readout of DNA into an atomistic statistical model, which is used to estimate the interaction potential. We first measure the ability of our method to correctly estimate the binding specificities of eight prokaryotic and eukaryotic TFs that belong to different structural superfamilies. Secondly, the method is applied to two homology models, finding that sampling of interface side-chain rotamers remarkably improves the results. Thirdly, the algorithm is compared with a reference structural method based on contact counts, obtaining comparable predictions for the experimental complexes and more accurate sequence motifs for the homology models. Conclusion Our results demonstrate that atomic-detail structural information can be feasibly used to predict TF binding sites. The computational method presented here is universal and might be applied to other systems involving protein-DNA recognition. PMID:18922190

  15. Classification and Lineage Tracing of SH2 Domains Throughout Eukaryotes.

    PubMed

    Liu, Bernard A

    2017-01-01

    Today there exists a rapidly expanding number of sequenced genomes. Cataloging protein interaction domains such as the Src Homology 2 (SH2) domain across these various genomes can be accomplished with ease due to existing algorithms and predictions models. An evolutionary analysis of SH2 domains provides a step towards understanding how SH2 proteins integrated with existing signaling networks to position phosphotyrosine signaling as a crucial driver of robust cellular communication networks in metazoans. However organizing and tracing SH2 domain across organisms and understanding their evolutionary trajectory remains a challenge. This chapter describes several methodologies towards analyzing the evolutionary trajectory of SH2 domains including a global SH2 domain classification system, which facilitates annotation of new SH2 sequences essential for tracing the lineage of SH2 domains throughout eukaryote evolution. This classification utilizes a combination of sequence homology, protein domain architecture and the boundary positions between introns and exons within the SH2 domain or genes encoding these domains. Discrete SH2 families can then be traced across various genomes to provide insight into its origins. Furthermore, additional methods for examining potential mechanisms for divergence of SH2 domains from structural changes to alterations in the protein domain content and genome duplication will be discussed. Therefore a better understanding of SH2 domain evolution may enhance our insight into the emergence of phosphotyrosine signaling and the expansion of protein interaction domains.

  16. Isolation and sequence of partial cDNA clones of human L1: homology of human and rodent L1 in the cytoplasmic region.

    PubMed

    Harper, J R; Prince, J T; Healy, P A; Stuart, J K; Nauman, S J; Stallcup, W B

    1991-03-01

    We have isolated cDNA clones coding for the human homologue of the neuronal cell adhesion molecule L1. The nucleotide sequence of the cDNA clones and the deduced primary amino acid sequence of the carboxy terminal portion of the human L1 are homologous to the corresponding sequences of mouse L1 and rat NILE glycoprotein, with an especially high sequences identity in the cytoplasmic regions of the proteins. There is also protein sequence homology with the cytoplasmic region of the Drosophila cell adhesion molecule, neuroglian. The conservation of the cytoplasmic domain argues for an important functional role for this portion of the molecule.

  17. New approaches to high-throughput structure characterization of SH3 complexes: the example of Myosin-3 and Myosin-5 SH3 domains from S. cerevisiae.

    PubMed

    Musi, Valeria; Birdsall, Berry; Fernandez-Ballester, Gregorio; Guerrini, Remo; Salvatori, Severo; Serrano, Luis; Pastore, Annalisa

    2006-04-01

    SH3 domains are small protein modules that are involved in protein-protein interactions in several essential metabolic pathways. The availability of the complete genome and the limited number of clearly identifiable SH3 domains make the yeast Saccharomyces cerevisae an ideal proteomic-based model system to investigate the structural rules dictating the SH3-mediated protein interactions and to develop new tools to assist these studies. In the present work, we have determined the solution structure of the SH3 domain from Myo3 and modeled by homology that of the highly homologous Myo5, two myosins implicated in actin polymerization. We have then implemented an integrated approach that makes use of experimental and computational methods to characterize their binding properties. While accommodating their targets in the classical groove, the two domains have selectivity in both orientation and sequence specificity of the target peptides. From our study, we propose a consensus sequence that may provide a useful guideline to identify new natural partners and suggest a strategy of more general applicability that may be of use in other structural proteomic studies.

  18. The use of coded PCR primers enables high-throughput sequencing of multiple homolog amplification products by 454 parallel sequencing.

    PubMed

    Binladen, Jonas; Gilbert, M Thomas P; Bollback, Jonathan P; Panitz, Frank; Bendixen, Christian; Nielsen, Rasmus; Willerslev, Eske

    2007-02-14

    The invention of the Genome Sequence 20 DNA Sequencing System (454 parallel sequencing platform) has enabled the rapid and high-volume production of sequence data. Until now, however, individual emulsion PCR (emPCR) reactions and subsequent sequencing runs have been unable to combine template DNA from multiple individuals, as homologous sequences cannot be subsequently assigned to their original sources. We use conventional PCR with 5'-nucleotide tagged primers to generate homologous DNA amplification products from multiple specimens, followed by sequencing through the high-throughput Genome Sequence 20 DNA Sequencing System (GS20, Roche/454 Life Sciences). Each DNA sequence is subsequently traced back to its individual source through 5'tag-analysis. We demonstrate that this new approach enables the assignment of virtually all the generated DNA sequences to the correct source once sequencing anomalies are accounted for (miss-assignment rate<0.4%). Therefore, the method enables accurate sequencing and assignment of homologous DNA sequences from multiple sources in single high-throughput GS20 run. We observe a bias in the distribution of the differently tagged primers that is dependent on the 5' nucleotide of the tag. In particular, primers 5' labelled with a cytosine are heavily overrepresented among the final sequences, while those 5' labelled with a thymine are strongly underrepresented. A weaker bias also exists with regards to the distribution of the sequences as sorted by the second nucleotide of the dinucleotide tags. As the results are based on a single GS20 run, the general applicability of the approach requires confirmation. However, our experiments demonstrate that 5'primer tagging is a useful method in which the sequencing power of the GS20 can be applied to PCR-based assays of multiple homologous PCR products. The new approach will be of value to a broad range of research areas, such as those of comparative genomics, complete mitochondrial analyses, population genetics, and phylogenetics.

  19. Identification of plant genes regulated in resistant potato Solanum sparsipilum during the early stages of infection by Globodera pallida.

    PubMed

    Jolivet, Katell; Grenier, Eric; Bouchet, Jean-Paul; Esquibet, Magali; Kerlan, Marie-Claire; Caromel, Bernard; Mugniéry, Didier; Lefebvre, Véronique

    2007-04-01

    Using a complementary (c)DNA-amplified fragment length polymorphism (AFLP) approach, we investigated differential gene expression linked to resistance mechanisms during the incompatible potato - Globodera pallida interaction. Expression was compared between a resistant and a susceptible potato clone, inoculated or not inoculated with G. pallida. These clones were issued from a cross between the resistant Solanum sparsipilum spl329.18 accession and the susceptible dihaploid S. tuberosum Caspar H3, and carried, respectively, resistant and susceptible alleles at the resistance quantitative trait loci (QTLs). Analysis was done on root fragments picked up at 4 time points, during a period of 6 days after infection, from penetration of the nematode in the root to degradation of the feeding site in resistant plants. A total of 2560 transcript-derived fragments (TDFs) were analyzed, resulting in the detection of 46 TDFs that were up- or downregulated. The number of TDFs that were up- or downregulated increased with time after inoculation. The majority of TDFs were upregulated at only 1 or 2 time points in response to infection. After isolation and sequencing of the TDFs of interest, a subset of 36 sequences were identified, among which 22 matched plant sequences and 2 matched nematode sequences. Some of the TDFs that matched plant genes showed clear homologies to genes involved in cell-cycle regulation, transcription regulation, resistance downstream signalling pathways, and defense mechanisms. Other sequences with homologies to plant genes of unknown function or without any significant similarity to known proteins were also found. Although not exhaustive, these results represent the most extensive list of genes with altered RNA levels after the incompatible G. pallida-potato interaction that has been published to date. The function of these genes could provide insight into resistance or plant defense mechanisms during incompatible potato-cyst nematode interactions.

  20. Resolution of model Holliday junctions by yeast endonuclease: effect of DNA structure and sequence.

    PubMed Central

    Parsons, C A; Murchie, A I; Lilley, D M; West, S C

    1989-01-01

    The resolution of Holliday junctions in DNA involves specific cleavage at or close to the site of the junction. A nuclease from Saccharomyces cerevisiae cleaves model Holliday junctions in vitro by the introduction of nicks in regions of duplex DNA adjacent to the crossover point. In previous studies [Parsons and West (1988) Cell, 52, 621-629] it was shown that cleavage occurred within homologous arm sequences with precise symmetry across the junction. In contrast, junctions with heterologous arm sequences were cleaved asymmetrically. In this work, we have studied the effect of sequence changes and base modification upon the site of cleavage. It is shown that the specificity of cleavage is unchanged providing that perfect homology is maintained between opposing arm sequences. However, in the absence of homology, cleavage depends upon sequence context and is affected by minor changes such as base modification. These data support the proposed mechanism for cleavage of a Holliday junction, which requires homologous alignment of arm sequences in an enzyme--DNA complex as a prerequisite for symmetrical cleavage by the yeast endonuclease. Images PMID:2653810

  1. On the necessity of dissecting sequence similarity scores into segment-specific contributions for inferring protein homology, function prediction and annotation

    PubMed Central

    2014-01-01

    Background Protein sequence similarities to any types of non-globular segments (coiled coils, low complexity regions, transmembrane regions, long loops, etc. where either positional sequence conservation is the result of a very simple, physically induced pattern or rather integral sequence properties are critical) are pertinent sources for mistaken homologies. Regretfully, these considerations regularly escape attention in large-scale annotation studies since, often, there is no substitute to manual handling of these cases. Quantitative criteria are required to suppress events of function annotation transfer as a result of false homology assignments. Results The sequence homology concept is based on the similarity comparison between the structural elements, the basic building blocks for conferring the overall fold of a protein. We propose to dissect the total similarity score into fold-critical and other, remaining contributions and suggest that, for a valid homology statement, the fold-relevant score contribution should at least be significant on its own. As part of the article, we provide the DissectHMMER software program for dissecting HMMER2/3 scores into segment-specific contributions. We show that DissectHMMER reproduces HMMER2/3 scores with sufficient accuracy and that it is useful in automated decisions about homology for instructive sequence examples. To generalize the dissection concept for cases without 3D structural information, we find that a dissection based on alignment quality is an appropriate surrogate. The approach was applied to a large-scale study of SMART and PFAM domains in the space of seed sequences and in the space of UniProt/SwissProt. Conclusions Sequence similarity core dissection with regard to fold-critical and other contributions systematically suppresses false hits and, additionally, recovers previously obscured homology relationships such as the one between aquaporins and formate/nitrite transporters that, so far, was only supported by structure comparison. PMID:24890864

  2. Predictive Bcl-2 Family Binding Models Rooted in Experiment or Structure

    PubMed Central

    DeBartolo, Joe; Dutta, Sanjib; Reich, Lothar; Keating, Amy E.

    2013-01-01

    Proteins of the Bcl-2 family either enhance or suppress programmed cell death and are centrally involved in cancer development and resistance to chemotherapy. BH3 (Bcl-2 homology 3)-only Bcl-2 proteins promote cell death by docking an α-helix into a hydrophobic groove on the surface of one or more of five pro-survival Bcl-2 receptor proteins. There is high structural homology within the pro-death and pro-survival families, yet a high degree of interaction specificity is nevertheless encoded, posing an interesting and important molecular recognition problem. Understanding protein features that dictate Bcl-2 interaction specificity is critical for designing peptide-based cancer therapeutics and diagnostics. In this study, we present peptide SPOT arrays and deep sequencing data from yeast display screening experiments that significantly expand the BH3 sequence space that has been experimentally tested for interaction with five human anti-apoptotic receptors. These data provide rich information about the determinants of Bcl-2 family specificity. To interpret and use the information, we constructed two simple data-based models that can predict affinity and specificity when evaluated on independent data sets within a limited sequence space. We also constructed a novel structure-based statistical potential, called STATIUM, which is remarkably good at predicting Bcl-2 affinity and specificity, especially considering it is not trained on experimental data. We compare the performance of our three models to each other and to alternative structure-based methods and discuss how such tools can guide prediction and design of new Bcl-2 family complexes. PMID:22617328

  3. DNA Repair: The Search for Homology.

    PubMed

    Haber, James E

    2018-05-01

    The repair of chromosomal double-strand breaks (DSBs) by homologous recombination is essential to maintain genome integrity. The key step in DSB repair is the RecA/Rad51-mediated process to match sequences at the broken end to homologous donor sequences that can be used as a template to repair the lesion. Here, in reviewing research about DSB repair, I consider the many factors that appear to play important roles in the successful search for homology by several homologous recombination mechanisms. See also the video abstract here: https://youtu.be/vm7-X5uIzS8. © 2018 WILEY Periodicals, Inc.

  4. The limits of protein sequence comparison?

    PubMed Central

    Pearson, William R; Sierk, Michael L

    2010-01-01

    Modern sequence alignment algorithms are used routinely to identify homologous proteins, proteins that share a common ancestor. Homologous proteins always share similar structures and often have similar functions. Over the past 20 years, sequence comparison has become both more sensitive, largely because of profile-based methods, and more reliable, because of more accurate statistical estimates. As sequence and structure databases become larger, and comparison methods become more powerful, reliable statistical estimates will become even more important for distinguishing similarities that are due to homology from those that are due to analogy (convergence). The newest sequence alignment methods are more sensitive than older methods, but more accurate statistical estimates are needed for their full power to be realized. PMID:15919194

  5. PSAT: A web tool to compare genomic neighborhoods of multiple prokaryotic genomes

    PubMed Central

    Fong, Christine; Rohmer, Laurence; Radey, Matthew; Wasnick, Michael; Brittnacher, Mitchell J

    2008-01-01

    Background The conservation of gene order among prokaryotic genomes can provide valuable insight into gene function, protein interactions, or events by which genomes have evolved. Although some tools are available for visualizing and comparing the order of genes between genomes of study, few support an efficient and organized analysis between large numbers of genomes. The Prokaryotic Sequence homology Analysis Tool (PSAT) is a web tool for comparing gene neighborhoods among multiple prokaryotic genomes. Results PSAT utilizes a database that is preloaded with gene annotation, BLAST hit results, and gene-clustering scores designed to help identify regions of conserved gene order. Researchers use the PSAT web interface to find a gene of interest in a reference genome and efficiently retrieve the sequence homologs found in other bacterial genomes. The tool generates a graphic of the genomic neighborhood surrounding the selected gene and the corresponding regions for its homologs in each comparison genome. Homologs in each region are color coded to assist users with analyzing gene order among various genomes. In contrast to common comparative analysis methods that filter sequence homolog data based on alignment score cutoffs, PSAT leverages gene context information for homologs, including those with weak alignment scores, enabling a more sensitive analysis. Features for constraining or ordering results are designed to help researchers browse results from large numbers of comparison genomes in an organized manner. PSAT has been demonstrated to be useful for helping to identify gene orthologs and potential functional gene clusters, and detecting genome modifications that may result in loss of function. Conclusion PSAT allows researchers to investigate the order of genes within local genomic neighborhoods of multiple genomes. A PSAT web server for public use is available for performing analyses on a growing set of reference genomes through any web browser with no client side software setup or installation required. Source code is freely available to researchers interested in setting up a local version of PSAT for analysis of genomes not available through the public server. Access to the public web server and instructions for obtaining source code can be found at . PMID:18366802

  6. Stringent homology-based prediction of H. sapiens-M. tuberculosis H37Rv protein-protein interactions.

    PubMed

    Zhou, Hufeng; Gao, Shangzhi; Nguyen, Nam Ninh; Fan, Mengyuan; Jin, Jingjing; Liu, Bing; Zhao, Liang; Xiong, Geng; Tan, Min; Li, Shijun; Wong, Limsoon

    2014-04-08

    H. sapiens-M. tuberculosis H37Rv protein-protein interaction (PPI) data are essential for understanding the infection mechanism of the formidable pathogen M. tuberculosis H37Rv. Computational prediction is an important strategy to fill the gap in experimental H. sapiens-M. tuberculosis H37Rv PPI data. Homology-based prediction is frequently used in predicting both intra-species and inter-species PPIs. However, some limitations are not properly resolved in several published works that predict eukaryote-prokaryote inter-species PPIs using intra-species template PPIs. We develop a stringent homology-based prediction approach by taking into account (i) differences between eukaryotic and prokaryotic proteins and (ii) differences between inter-species and intra-species PPI interfaces. We compare our stringent homology-based approach to a conventional homology-based approach for predicting host-pathogen PPIs, based on cellular compartment distribution analysis, disease gene list enrichment analysis, pathway enrichment analysis and functional category enrichment analysis. These analyses support the validity of our prediction result, and clearly show that our approach has better performance in predicting H. sapiens-M. tuberculosis H37Rv PPIs. Using our stringent homology-based approach, we have predicted a set of highly plausible H. sapiens-M. tuberculosis H37Rv PPIs which might be useful for many of related studies. Based on our analysis of the H. sapiens-M. tuberculosis H37Rv PPI network predicted by our stringent homology-based approach, we have discovered several interesting properties which are reported here for the first time. We find that both host proteins and pathogen proteins involved in the host-pathogen PPIs tend to be hubs in their own intra-species PPI network. Also, both host and pathogen proteins involved in host-pathogen PPIs tend to have longer primary sequence, tend to have more domains, tend to be more hydrophilic, etc. And the protein domains from both host and pathogen proteins involved in host-pathogen PPIs tend to have lower charge, and tend to be more hydrophilic. Our stringent homology-based prediction approach provides a better strategy in predicting PPIs between eukaryotic hosts and prokaryotic pathogens than a conventional homology-based approach. The properties we have observed from the predicted H. sapiens-M. tuberculosis H37Rv PPI network are useful for understanding inter-species host-pathogen PPI networks and provide novel insights for host-pathogen interaction studies.

  7. Structure and Protein-Protein Interaction Studies on Chlamydia trachomatis Protein CT670 (YscO Homolog)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lorenzini, Emily; Singer, Alexander; Singh, Bhag

    2010-07-28

    Comparative genomic studies have identified many proteins that are found only in various Chlamydiae species and exhibit no significant sequence similarity to any protein in organisms that do not belong to this group. The CT670 protein of Chlamydia trachomatis is one of the proteins whose genes are in one of the type III secretion gene clusters but whose cellular functions are not known. CT670 shares several characteristics with the YscO protein of Yersinia pestis, including the neighboring genes, size, charge, and secondary structure, but the structures and/or functions of these proteins remain to be determined. Although a BLAST search withmore » CT670 did not identify YscO as a related protein, our analysis indicated that these two proteins exhibit significant sequence similarity. In this paper, we report that the CT670 crystal, solved at a resolution of 2 {angstrom}, consists of a single coiled coil containing just two long helices. Gel filtration and analytical ultracentrifugation studies showed that in solution CT670 exists in both monomeric and dimeric forms and that the monomer predominates at lower protein concentrations. We examined the interaction of CT670 with many type III secretion system-related proteins (viz., CT091, CT665, CT666, CT667, CT668, CT669, CT671, CT672, and CT673) by performing bacterial two-hybrid assays. In these experiments, CT670 was found to interact only with the CT671 protein (YscP homolog), whose gene is immediately downstream of ct670. A specific interaction between CT670 and CT671 was also observed when affinity chromatography pull-down experiments were performed. These results suggest that CT670 and CT671 are putative homologs of the YcoO and YscP proteins, respectively, and that they likely form a chaperone-effector pair.« less

  8. In vivo binding of PRDM9 reveals interactions with noncanonical genomic sites

    PubMed Central

    Grey, Corinne; Clément, Julie A.J.; Buard, Jérôme; Leblanc, Benjamin; Gut, Ivo; Gut, Marta; Duret, Laurent

    2017-01-01

    In mouse and human meiosis, DNA double-strand breaks (DSBs) initiate homologous recombination and occur at specific sites called hotspots. The localization of these sites is determined by the sequence-specific DNA binding domain of the PRDM9 histone methyl transferase. Here, we performed an extensive analysis of PRDM9 binding in mouse spermatocytes. Unexpectedly, we identified a noncanonical recruitment of PRDM9 to sites that lack recombination activity and the PRDM9 binding consensus motif. These sites include gene promoters, where PRDM9 is recruited in a DSB-dependent manner. Another subset reveals DSB-independent interactions between PRDM9 and genomic sites, such as the binding sites for the insulator protein CTCF. We propose that these DSB-independent sites result from interactions between hotspot-bound PRDM9 and genomic sequences located on the chromosome axis. PMID:28336543

  9. Amino acid sequence of the human fibronectin receptor

    PubMed Central

    1987-01-01

    The amino acid sequence deduced from cDNA of the human placental fibronectin receptor is reported. The receptor is composed of two subunits: an alpha subunit of 1,008 amino acids which is processed into two polypeptides disulfide bonded to one another, and a beta subunit of 778 amino acids. Each subunit has near its COOH terminus a hydrophobic segment. This and other sequence features suggest a structure for the receptor in which the hydrophobic segments serve as transmembrane domains anchoring each subunit to the membrane and dividing each into a large ectodomain and a short cytoplasmic domain. The alpha subunit ectodomain has five sequence elements homologous to consensus Ca2+- binding sites of several calcium-binding proteins, and the beta subunit contains a fourfold repeat strikingly rich in cysteine. The alpha subunit sequence is 46% homologous to the alpha subunit of the vitronectin receptor. The beta subunit is 44% homologous to the human platelet adhesion receptor subunit IIIa and 47% homologous to a leukocyte adhesion receptor beta subunit. The high degree of homology (85%) of the beta subunit with one of the polypeptides of a chicken adhesion receptor complex referred to as integrin complex strongly suggests that the latter polypeptide is the chicken homologue of the fibronectin receptor beta subunit. These receptor subunit homologies define a superfamily of adhesion receptors. The availability of the entire protein sequence for the fibronectin receptor will facilitate studies on the functions of these receptors. PMID:2958481

  10. Using structure to explore the sequence alignment space of remote homologs.

    PubMed

    Kuziemko, Andrew; Honig, Barry; Petrey, Donald

    2011-10-01

    Protein structure modeling by homology requires an accurate sequence alignment between the query protein and its structural template. However, sequence alignment methods based on dynamic programming (DP) are typically unable to generate accurate alignments for remote sequence homologs, thus limiting the applicability of modeling methods. A central problem is that the alignment that is "optimal" in terms of the DP score does not necessarily correspond to the alignment that produces the most accurate structural model. That is, the correct alignment based on structural superposition will generally have a lower score than the optimal alignment obtained from sequence. Variations of the DP algorithm have been developed that generate alternative alignments that are "suboptimal" in terms of the DP score, but these still encounter difficulties in detecting the correct structural alignment. We present here a new alternative sequence alignment method that relies heavily on the structure of the template. By initially aligning the query sequence to individual fragments in secondary structure elements and combining high-scoring fragments that pass basic tests for "modelability", we can generate accurate alignments within a small ensemble. Our results suggest that the set of sequences that can currently be modeled by homology can be greatly extended.

  11. DNA sequence alignment by microhomology sampling during homologous recombination

    PubMed Central

    Qi, Zhi; Redding, Sy; Lee, Ja Yil; Gibb, Bryan; Kwon, YoungHo; Niu, Hengyao; Gaines, William A.; Sung, Patrick

    2015-01-01

    Summary Homologous recombination (HR) mediates the exchange of genetic information between sister or homologous chromatids. During HR, members of the RecA/Rad51 family of recombinases must somehow search through vast quantities of DNA sequence to align and pair ssDNA with a homologous dsDNA template. Here we use single-molecule imaging to visualize Rad51 as it aligns and pairs homologous DNA sequences in real-time. We show that Rad51 uses a length-based recognition mechanism while interrogating dsDNA, enabling robust kinetic selection of 8-nucleotide (nt) tracts of microhomology, which kinetically confines the search to sites with a high probability of being a homologous target. Successful pairing with a 9th nucleotide coincides with an additional reduction in binding free energy and subsequent strand exchange occurs in precise 3-nt steps, reflecting the base triplet organization of the presynaptic complex. These findings provide crucial new insights into the physical and evolutionary underpinnings of DNA recombination. PMID:25684365

  12. The OGCleaner: filtering false-positive homology clusters.

    PubMed

    Fujimoto, M Stanley; Suvorov, Anton; Jensen, Nicholas O; Clement, Mark J; Snell, Quinn; Bybee, Seth M

    2017-01-01

    Detecting homologous sequences in organisms is an essential step in protein structure and function prediction, gene annotation and phylogenetic tree construction. Heuristic methods are often employed for quality control of putative homology clusters. These heuristics, however, usually only apply to pairwise sequence comparison and do not examine clusters as a whole. We present the Orthology Group Cleaner (the OGCleaner), a tool designed for filtering putative orthology groups as homology or non-homology clusters by considering all sequences in a cluster. The OGCleaner relies on high-quality orthologous groups identified in OrthoDB to train machine learning algorithms that are able to distinguish between true-positive and false-positive homology groups. This package aims to improve the quality of phylogenetic tree construction especially in instances of lower-quality transcriptome assemblies. https://github.com/byucsl/ogcleaner CONTACT: sfujimoto@gmail.comSupplementary information: Supplementary data are available at Bioinformatics online. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  13. Phage display selection of peptides that target calcium-binding proteins.

    PubMed

    Vetter, Stefan W

    2013-01-01

    Phage display allows to rapidly identify peptide sequences with binding affinity towards target proteins, for example, calcium-binding proteins (CBPs). Phage technology allows screening of 10(9) or more independent peptide sequences and can identify CBP binding peptides within 2 weeks. Adjusting of screening conditions allows selecting CBPs binding peptides that are either calcium-dependent or independent. Obtained peptide sequences can be used to identify CBP target proteins based on sequence homology or to quickly obtain peptide-based CBP inhibitors to modulate CBP-target interactions. The protocol described here uses a commercially available phage display library, in which random 12-mer peptides are displayed on filamentous M13 phages. The library was screened against the calcium-binding protein S100B.

  14. Template-based structure modeling of protein-protein interactions

    PubMed Central

    Szilagyi, Andras; Zhang, Yang

    2014-01-01

    The structure of protein-protein complexes can be constructed by using the known structure of other protein complexes as a template. The complex structure templates are generally detected either by homology-based sequence alignments or, given the structure of monomer components, by structure-based comparisons. Critical improvements have been made in recent years by utilizing interface recognition and by recombining monomer and complex template libraries. Encouraging progress has also been witnessed in genome-wide applications of template-based modeling, with modeling accuracy comparable to high-throughput experimental data. Nevertheless, bottlenecks exist due to the incompleteness of the proteinprotein complex structure library and the lack of methods for distant homologous template identification and full-length complex structure refinement. PMID:24721449

  15. Homology analyses of the protein sequences of fatty acid synthases from chicken liver, rat mammary gland, and yeast

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Chang, Soo-Ik; Hammes, G.G.

    1989-11-01

    Homology analyses of the protein sequences of chicken liver and rat mammary gland fatty acid synthases were carried out. The amino acid sequences of the chicken and rat enzymes are 67% identical. If conservative substitutions are allowed, 78% of the amino acids are matched. A region of low homologies exists between the functional domains, in particular around amino acid residues 1059-1264 of the chicken enzyme. Homologies between the active sites of chicken and rat and of chicken and yeast enzymes have been analyzed by an alignment method. A high degree of homology exists between the active sites of the chickenmore » and rat enzymes. However, the chicken and yeast enzymes show a lower degree of homology. The DADPH-binding dinucleotide folds of the {beta}-ketoacyl reductase and the enoyl reductase sites were identified by comparison with a known consensus sequence for the DADP- and FAD-binding dinucleotide folds. The active sites of all of the enzymes are primarily in hydrophobic regions of the protein. This study suggests that the genes for the functional domains of fatty acid synthase were originally separated, and these genes were connected to each other by using different connecting nucleotide sequences in different species. An alternative explanation for the differences in rat and chicken is a common ancestry and mutations in the joining regions during evolution.« less

  16. Faster sequence homology searches by clustering subsequences.

    PubMed

    Suzuki, Shuji; Kakuta, Masanori; Ishida, Takashi; Akiyama, Yutaka

    2015-04-15

    Sequence homology searches are used in various fields. New sequencing technologies produce huge amounts of sequence data, which continuously increase the size of sequence databases. As a result, homology searches require large amounts of computational time, especially for metagenomic analysis. We developed a fast homology search method based on database subsequence clustering, and implemented it as GHOSTZ. This method clusters similar subsequences from a database to perform an efficient seed search and ungapped extension by reducing alignment candidates based on triangle inequality. The database subsequence clustering technique achieved an ∼2-fold increase in speed without a large decrease in search sensitivity. When we measured with metagenomic data, GHOSTZ is ∼2.2-2.8 times faster than RAPSearch and is ∼185-261 times faster than BLASTX. The source code is freely available for download at http://www.bi.cs.titech.ac.jp/ghostz/ akiyama@cs.titech.ac.jp Supplementary data are available at Bioinformatics online. © The Author 2014. Published by Oxford University Press.

  17. Sequence-structure relationships in RNA loops: establishing the basis for loop homology modeling.

    PubMed

    Schudoma, Christian; May, Patrick; Nikiforova, Viktoria; Walther, Dirk

    2010-01-01

    The specific function of RNA molecules frequently resides in their seemingly unstructured loop regions. We performed a systematic analysis of RNA loops extracted from experimentally determined three-dimensional structures of RNA molecules. A comprehensive loop-structure data set was created and organized into distinct clusters based on structural and sequence similarity. We detected clear evidence of the hallmark of homology present in the sequence-structure relationships in loops. Loops differing by <25% in sequence identity fold into very similar structures. Thus, our results support the application of homology modeling for RNA loop model building. We established a threshold that may guide the sequence divergence-based selection of template structures for RNA loop homology modeling. Of all possible sequences that are, under the assumption of isosteric relationships, theoretically compatible with actual sequences observed in RNA structures, only a small fraction is contained in the Rfam database of RNA sequences and classes implying that the actual RNA loop space may consist of a limited number of unique loop structures and conserved sequences. The loop-structure data sets are made available via an online database, RLooM. RLooM also offers functionalities for the modeling of RNA loop structures in support of RNA engineering and design efforts.

  18. Homology modeling reveals the structural background of the striking difference in thermal stability between two related [NiFe]hydrogenases.

    PubMed

    Szilágyi, András; Kovács, Kornél L; Rákhely, Gábor; Závodszky, Péter

    2002-02-01

    Hydrogenases are redox metalloenzymes in bacteria that catalyze the uptake or production of molecular hydrogen. Two homologous nickel-iron hydrogenases, HupSL and HydSL from the photosynthetic purple sulfur bacterium Thiocapsa roseopersicina, differ substantially in their thermal stabilities despite the high sequence similarity between them. The optimum temperature of HydSL activity is estimated to be at least 50 degrees C higher than that of HupSL. In this work, homology models of both proteins were constructed and analyzed for a number of structural properties. The comparison of the models reveals that the higher stability of HydSL can be attributed to increased inter-subunit electrostatic interactions: the homology models reliably predict that HydSL contains at least five more inter-subunit ion pairs than HupSL. The subunit interface of HydSL is more polar than that of HupSL, and it contains a few extra inter-subunit hydrogen bonds. A more optimized cavity system and amino acid replacements resulting in increased conformational rigidity may also contribute to the higher stability of HydSL. The results are in accord with the general observation that with increasing temperature, the role of electrostatic interactions in protein stability increases. Electronic supplementary material to this paper can be obtained by using the Springer Link server located at http://dx.doi.org/10.1007/s00894-001-0071-8.

  19. Solution structure of the DNA-binding domain of RPA from Saccharomyces cerevisiae and its interaction with single-stranded DNA and SV40 T antigen

    PubMed Central

    Park, Chin-Ju; Lee, Joon-Hwa; Choi, Byong-Seok

    2005-01-01

    Replication protein A (RPA) is a three-subunit complex with multiple roles in DNA metabolism. DNA-binding domain A in the large subunit of human RPA (hRPA70A) binds to single-stranded DNA (ssDNA) and is responsible for the species-specific RPA–T antigen (T-ag) interaction required for Simian virus 40 replication. Although Saccharomyces cerevisiae RPA70A (scRPA70A) shares high sequence homology with hRPA70A, the two are not functionally equivalent. To elucidate the similarities and differences between these two homologous proteins, we determined the solution structure of scRPA70A, which closely resembled the structure of hRPA70A. The structure of ssDNA-bound scRPA70A, as simulated by residual dipolar coupling-based homology modeling, suggested that the positioning of the ssDNA is the same for scRPA70A and hRPA70A, although the conformational changes that occur in the two proteins upon ssDNA binding are not identical. NMR titrations of hRPA70A with T-ag showed that the T-ag binding surface is separate from the ssDNA-binding region and is more neutral than the corresponding part of scRPA70A. These differences might account for the species-specific nature of the hRPA70A–T-ag interaction. Our results provide insight into how these two homologous RPA proteins can exhibit functional differences, but still both retain their ability to bind ssDNA. PMID:16043636

  20. Structural and functional homology between the RNAPI subunits A14/A43 and the archaeal RNAP subunits E/F

    PubMed Central

    Meka, Hedije; Daoust, Gregoire; Bourke Arnvig, Kristine; Werner, Finn; Brick, Peter; Onesti, Silvia

    2003-01-01

    In the archaeal RNA polymerase and the eukaryotic RNA polymerase II, two subunits (E/F and RPB4/RPB7, respectively) form a heterodimer that reversibly associates with the core of the enzyme. Recently it has emerged that this heterodimer also has a counterpart in the other eukaryotic RNA polymerases: in particular two subunits of RNA polymerase I (A14 and A43) display genetic and biochemical characteristics that are similar to those of the RPB4 and RPB7 subunits, despite the fact that only A43 shows some sequence homology to RPB7. We demonstrate that the sequence of A14 strongly suggests the presence of a HRDC domain, a motif that is found at the C-terminus of a number of helicases and RNases. The same motif is also seen in the structure of the F subunit, suggesting a structural link between A14 and the RPB4/C17/subunit F family, even in the absence of direct sequence homology. We show that it is possible to co-express and co-purify large amounts of the recombinant A14/A43 heterodimer, indicating a tight and specific interaction between the two subunits. To shed light on the function of the heterodimer, we performed gel mobility shift assays and showed that the A14/A43 heterodimer binds single-stranded RNA in a similar way to the archaeal E/F complex. PMID:12888498

  1. Small tandemly repeated DNA sequences of higher plants likely originate from a tRNA gene ancestor.

    PubMed Central

    Benslimane, A A; Dron, M; Hartmann, C; Rode, A

    1986-01-01

    Several monomers (177 bp) of a tandemly arranged repetitive nuclear DNA sequence of Brassica oleracea have been cloned and sequenced. They share up to 95% homology between one another and up to 80% with other satellite DNA sequences of Cruciferae, suggesting a common ancestor. Both strands of these monomers show more than 50% homology with many tRNA genes; the best homologies have been obtained with Lys and His yeast mitochondrial tRNA genes (respectively 64% and 60%). These results suggest that small tandemly repeated DNA sequences of plants may have evolved from a tRNA gene ancestor. These tandem repeats have probably arisen via a process involving reverse transcription of polymerase III RNA intermediates, as is the case for interspersed DNA sequences of mammalians. A model is proposed to explain the formation of such small tandemly repeated DNA sequences. Images PMID:3774553

  2. A Guide to the PLAZA 3.0 Plant Comparative Genomic Database.

    PubMed

    Vandepoele, Klaas

    2017-01-01

    PLAZA 3.0 is an online resource for comparative genomics and offers a versatile platform to study gene functions and gene families or to analyze genome organization and evolution in the green plant lineage. Starting from genome sequence information for over 35 plant species, precomputed comparative genomic data sets cover homologous gene families, multiple sequence alignments, phylogenetic trees, and genomic colinearity information within and between species. Complementary functional data sets, a Workbench, and interactive visualization tools are available through a user-friendly web interface, making PLAZA an excellent starting point to translate sequence or omics data sets into biological knowledge. PLAZA is available at http://bioinformatics.psb.ugent.be/plaza/ .

  3. DNA sequence homology induces cytosine-to-thymine mutation by a heterochromatin-related pathway in Neurospora

    PubMed Central

    Gladyshev, Eugene; Kleckner, Nancy

    2017-01-01

    Eukaryotic genomes contain substantial amounts of repetitive DNA organized in the form of constitutive heterochromatin and associated with repressive epigenetic modifications, such as H3K9me3 and C5-cytosine methylation (5mC). In the fungus Neurospora crassa, H3K9me3 and 5mC are catalyzed, respectively, by a conserved SUV39 histone methyltransferase DIM-5 and a DNMT1-like cytosine methyltransferase DIM-2. Here we show that DIM-2 can also mediate Repeat-Induced Point mutation (RIP) of repetitive DNA in N. crassa. We further show that DIM-2-dependent RIP requires DIM-5, HP1, and other known heterochromatin factors, implying the role of a repeat-induced heterochromatin-related process. Our previous findings suggest that the mechanism of repeat recognition for RIP involves direct interactions between homologous double-stranded (ds) DNA segments. We thus now propose that, in somatic cells, homologous dsDNA/dsDNA interactions between a small number of repeat copies can nucleate a transient heterochromatic state, which, on longer repeat arrays, may lead to the formation of constitutive heterochromatin. PMID:28459455

  4. Origin and spread of photosynthesis based upon conserved sequence features in key bacteriochlorophyll biosynthesis proteins.

    PubMed

    Gupta, Radhey S

    2012-11-01

    The origin of photosynthesis and how this capability has spread to other bacterial phyla remain important unresolved questions. I describe here a number of conserved signature indels (CSIs) in key proteins involved in bacteriochlorophyll (Bchl) biosynthesis that provide important insights in these regards. The proteins BchL and BchX, which are essential for Bchl biosynthesis, are derived by gene duplication in a common ancestor of all phototrophs. More ancient gene duplication gave rise to the BchX-BchL proteins and the NifH protein of the nitrogenase complex. The sequence alignment of NifH-BchX-BchL proteins contain two CSIs that are uniquely shared by all NifH and BchX homologs, but not by any BchL homologs. These CSIs and phylogenetic analysis of NifH-BchX-BchL protein sequences strongly suggest that the BchX homologs are ancestral to BchL and that the Bchl-based anoxygenic photosynthesis originated prior to the chlorophyll (Chl)-based photosynthesis in cyanobacteria. Another CSI in the BchX-BchL sequence alignment that is uniquely shared by all BchX homologs and the BchL sequences from Heliobacteriaceae, but absent in all other BchL homologs, suggests that the BchL homologs from Heliobacteriaceae are primitive in comparison to all other photosynthetic lineages. Several other identified CSIs in the BchN homologs are commonly shared by all proteobacterial homologs and a clade consisting of the marine unicellular Cyanobacteria (Clade C). These CSIs in conjunction with the results of phylogenetic analyses and pair-wise sequence similarity on the BchL, BchN, and BchB proteins, where the homologs from Clade C Cyanobacteria and Proteobacteria exhibited close relationship, provide strong evidence that these two groups have incurred lateral gene transfers. Additionally, phylogenetic analyses and several CSIs in the BchL-N-B proteins that are uniquely shared by all Chlorobi and Chloroflexi homologs provide evidence that the genes for these proteins have also been laterally transferred between these groups. Other results and observations reported here indicate that the genes for the BchL-N-B proteins in Proteobacteria are derived from the Clade C Cyanobacteria, whereas those in Chlorobi were acquired from Chloroflexus or related bacteria by means of LGTs. Some implications of these observations regarding the origin and spread of photosynthesis are discussed.

  5. Lipopolysaccharide-induced innate immune factors in the bottlenose dolphin (Tursiops truncatus) detected in expression sequence tag analysis.

    PubMed

    Ohishi, Kazue; Shishido, Reiko; Iwata, Yasunao; Saitoh, Masafumi; Takenaka, Ryota; Ohtsu, Dai; Okutsu, Kenji; Maruyama, Tadashi

    2011-11-01

    EST analysis based on the megaclone-megasorting method was performed using leukocytes from the bottlenose dolphin (Tursiops truncatus) with or without LPS stimulation. A total of 849 upregulated and 384 downregulated EST clones were sequenced, annotated, and functionally classified. Ferritin heavy peptide I was the most abundant upregulated transcript, suggesting that LPS stimulation induced high production of reactive oxygen species, which were sequestered in ferritin. Among the immune factors, the transcripts coding for an IL-1Ra, homologs to bovine serum amyloid A3, and canine intercellular adhesion molecule-1 were highly expressed. Markedly downregulated transcripts of immune factors were those for homologs of calcium-binding proteins belonging to the S100 family, S100A12, S100A8, and S100A6. Time-course experiments on the expression of some immune factors including IL-1Ra suggested that these factors interact and control cetacean innate immunity. © 2011 The Societies and Blackwell Publishing Asia Pty Ltd.

  6. Twin-arginine translocase may have a role in the chaperone function of NarJ from Escherichia coli

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Chan, Catherine S.; Howell, Jenika M.; Workentine, Matthew L.

    2006-04-28

    NarJ is a chaperone involved in folding, maturation, and molybdenum cofactor insertion of nitrate reductase A from Escherichia coli. It has also been shown that NarJ exhibits sequence homology to a family of chaperones involved in maturation and cofactor insertion of E. coli redox enzymes that are mediated by twin-arginine translocase (Tat) dependent translocation. In this study, we show that NarJ binds the N-terminal region of NarG through Far Western studies and isothermal titration calorimetry, and the binding event occurs towards a short peptide sequence that contains a homologous twin-arginine motif. Fractionation experiments also show that the interaction of NarJmore » to the cytoplasmic membrane exhibits Tat-dependence. Upon further investigation through Far Western blots, the interactome of NarJ also exhibits Tat-dependence. Together the data suggest that the Tat system may play a role in the maturation pathway of nitrate reductase A.« less

  7. Whole genome analysis of CRISPR Cas9 sgRNA off-target homologies via an efficient computational algorithm.

    PubMed

    Zhou, Hong; Zhou, Michael; Li, Daisy; Manthey, Joseph; Lioutikova, Ekaterina; Wang, Hong; Zeng, Xiao

    2017-11-17

    The beauty and power of the genome editing mechanism, CRISPR Cas9 endonuclease system, lies in the fact that it is RNA-programmable such that Cas9 can be guided to any genomic loci complementary to a 20-nt RNA, single guide RNA (sgRNA), to cleave double stranded DNA, allowing the introduction of wanted mutations. Unfortunately, it has been reported repeatedly that the sgRNA can also guide Cas9 to off-target sites where the DNA sequence is homologous to sgRNA. Using human genome and Streptococcus pyogenes Cas9 (SpCas9) as an example, this article mathematically analyzed the probabilities of off-target homologies of sgRNAs and discovered that for large genome size such as human genome, potential off-target homologies are inevitable for sgRNA selection. A highly efficient computationl algorithm was developed for whole genome sgRNA design and off-target homology searches. By means of a dynamically constructed sequence-indexed database and a simplified sequence alignment method, this algorithm achieves very high efficiency while guaranteeing the identification of all existing potential off-target homologies. Via this algorithm, 1,876,775 sgRNAs were designed for the 19,153 human mRNA genes and only two sgRNAs were found to be free of off-target homology. By means of the novel and efficient sgRNA homology search algorithm introduced in this article, genome wide sgRNA design and off-target analysis were conducted and the results confirmed the mathematical analysis that for a sgRNA sequence, it is almost impossible to escape potential off-target homologies. Future innovations on the CRISPR Cas9 gene editing technology need to focus on how to eliminate the Cas9 off-target activity.

  8. Insights into the fold organization of TIM barrel from interaction energy based structure networks.

    PubMed

    Vijayabaskar, M S; Vishveshwara, Saraswathi

    2012-01-01

    There are many well-known examples of proteins with low sequence similarity, adopting the same structural fold. This aspect of sequence-structure relationship has been extensively studied both experimentally and theoretically, however with limited success. Most of the studies consider remote homology or "sequence conservation" as the basis for their understanding. Recently "interaction energy" based network formalism (Protein Energy Networks (PENs)) was developed to understand the determinants of protein structures. In this paper we have used these PENs to investigate the common non-covalent interactions and their collective features which stabilize the TIM barrel fold. We have also developed a method of aligning PENs in order to understand the spatial conservation of interactions in the fold. We have identified key common interactions responsible for the conservation of the TIM fold, despite high sequence dissimilarity. For instance, the central beta barrel of the TIM fold is stabilized by long-range high energy electrostatic interactions and low-energy contiguous vdW interactions in certain families. The other interfaces like the helix-sheet or the helix-helix seem to be devoid of any high energy conserved interactions. Conserved interactions in the loop regions around the catalytic site of the TIM fold have also been identified, pointing out their significance in both structural and functional evolution. Based on these investigations, we have developed a novel network based phylogenetic analysis for remote homologues, which can perform better than sequence based phylogeny. Such an analysis is more meaningful from both structural and functional evolutionary perspective. We believe that the information obtained through the "interaction conservation" viewpoint and the subsequently developed method of structure network alignment, can shed new light in the fields of fold organization and de novo computational protein design.

  9. Mechanism of action of chromogranin A on catecholamine release: molecular modeling of the catestatin region reveals a β-strand/loop/β-strand structure secured by hydrophobic interactions and predictive of activity

    PubMed Central

    Tsigelny, Igor; Mahata, Sushil K.; Taupenot, Laurent; Preece, Nicholas E.; Mahata, Manjula; Khan, Imran; Parmer, Robert J.; O’Connor, Daniel T.

    2009-01-01

    A novel fragment of chromogranin A, known as ‘catestatin’ (bovine chromogranin A344–364), inhibits catecholamine release from chromaffin cells and noradrenergic neurons by acting as a non-competitive nicotinic cholinergic antagonist, and may therefore constitute an endogenous autocrine feedback regulator of sympathoadrenal activity. To characterize how this activity depends on the peptide’s structure, we searched for common 3-dimensional motifs for this primary structure or its homologs. Catestatin’s primary structure bore significant (29–35.5% identity, general alignment score 44–57) sequence homology to fragment sequences within three homologs of known 3-dimensional structures, based on solved X-ray crystals: 8FAB, 1PKM, and 2IG2. Each of these sequences exists in nature as a β-strand/loop/β-strand structure, stabilized by hydrophobic interactions between the β-strands. The catestatin structure was stable during molecular dynamics simulations. The catestatin loop contains three Arg residues, whose electropositive side chains form the terminus of the structure, and give rise to substantial uncompensated charge asymmetry in the molecule. A hydrophobic moment plot revealed that catestatin is the only segment of chromogranin A predicted to contain amphiphilic β-strand. Circular dichroism in the far ultraviolet showed substantial (63%) β-sheet structure, especially in a hydrophobic environment. Alanine-substitution mutants of catestatin established a crucial role for the three central arginine residues in the loop (Arg351, Arg353, and Arg358), though not for two arginine residues in the strand region toward the amino-terminus. [125I]Catestatin bound to Torpedo membranes at a site other than the nicotinic agonist binding site. When the catestatin structure was ‘docked’ with the extracellular domain of the Torpedo nicotinic cholinergic receptor, it interacted principally with the β and δ subunits, in a relatively hydrophobic region of the cation pore extracellular orifice, and the complex of ligand and receptor largely occluded the cation pore, providing a structural basis for the non-competitive nicotinic cholinergic antagonist properties of the peptide. We conclude that a homology model of catestatin correctly predicts actual features of the peptide, both physical and biological. The model suggests particular spatial and charge features of the peptide which may serve as starting points in the development of non-peptide mimetics of this endogenous nicotinic cholinergic antagonist. PMID:9809795

  10. Synthetic oligonucleotide probes deduced from amino acid sequence data. Theoretical and practical considerations.

    PubMed

    Lathe, R

    1985-05-05

    Synthetic probes deduced from amino acid sequence data are widely used to detect cognate coding sequences in libraries of cloned DNA segments. The redundancy of the genetic code dictates that a choice must be made between (1) a mixture of probes reflecting all codon combinations, and (2) a single longer "optimal" probe. The second strategy is examined in detail. The frequency of sequences matching a given probe by chance alone can be determined and also the frequency of sequences closely resembling the probe and contributing to the hybridization background. Gene banks cannot be treated as random associations of the four nucleotides, and probe sequences deduced from amino acid sequence data occur more often than predicted by chance alone. Probe lengths must be increased to confer the necessary specificity. Examination of hybrids formed between unique homologous probes and their cognate targets reveals that short stretches of perfect homology occurring by chance make a significant contribution to the hybridization background. Statistical methods for improving homology are examined, taking human coding sequences as an example, and considerations of codon utilization and dinucleotide frequencies yield an overall homology of greater than 82%. Recommendations for probe design and hybridization are presented, and the choice between using multiple probes reflecting all codon possibilities and a unique optimal probe is discussed.

  11. Comparative genomic survey, exon-intron annotation and phylogenetic analysis of NAT-homologous sequences in archaea, protists, fungi, viruses, and invertebrates

    USDA-ARS?s Scientific Manuscript database

    We have previously published extensive genomic surveys [1-3], reporting NAT-homologous sequences in hundreds of sequenced bacterial, fungal and vertebrate genomes. We present here the results of our latest search of 2445 genomes, representing 1532 (70 archaeal, 1210 bacterial, 43 protist, 97 fungal,...

  12. Drosophila homologues of adenomatous polyposis coli (APC) and the formin diaphanous collaborate by a conserved mechanism to stimulate actin filament assembly.

    PubMed

    Jaiswal, Richa; Stepanik, Vince; Rankova, Aneliya; Molinar, Olivia; Goode, Bruce L; McCartney, Brooke M

    2013-05-10

    Vertebrate APC collaborates with Dia through its Basic domain to assemble actin filaments. Despite limited sequence homology between the vertebrate and Drosophila APC Basic domains, Drosophila APC1 collaborates with Dia to stimulate actin assembly in vitro. The mechanism of actin assembly is highly conserved over evolution. APC-Dia collaborations may be crucial in a wide range of animal cells. Adenomatous polyposis coli (APC) is a large multidomain protein that regulates the cytoskeleton. Recently, it was shown that vertebrate APC through its Basic domain directly collaborates with the formin mDia1 to stimulate actin filament assembly in the presence of nucleation barriers. However, it has been unclear whether these activities extend to homologues of APC and Dia in other organisms. Drosophila APC and Dia are each required to promote actin furrow formation in the syncytial embryo, suggesting a potential collaboration in actin assembly, but low sequence homology between the Basic domains of Drosophila and vertebrate APC has left their functional and mechanistic parallels uncertain. To address this question, we purified Drosophila APC1 and Dia and determined their individual and combined effects on actin assembly using both bulk fluorescence assays and total internal reflection fluorescence microscopy. Our data show that APC1, similar to its vertebrate homologue, bound to actin monomers and nucleated and bundled filaments. Further, Drosophila Dia nucleated actin assembly and protected growing filament barbed ends from capping protein. Drosophila APC1 and Dia directly interacted and collaborated to promote actin assembly in the combined presence of profilin and capping protein. Thus, despite limited sequence homology, Drosophila and vertebrate APCs exhibit highly related activities and mechanisms and directly collaborate with formins. These results suggest that APC-Dia interactions in actin assembly are conserved and may underlie important in vivo functions in a broad range of animal phyla.

  13. A draft sequence of the rice genome (Oryza sativa L. ssp. indica).

    PubMed

    Yu, Jun; Hu, Songnian; Wang, Jun; Wong, Gane Ka-Shu; Li, Songgang; Liu, Bin; Deng, Yajun; Dai, Li; Zhou, Yan; Zhang, Xiuqing; Cao, Mengliang; Liu, Jing; Sun, Jiandong; Tang, Jiabin; Chen, Yanjiong; Huang, Xiaobing; Lin, Wei; Ye, Chen; Tong, Wei; Cong, Lijuan; Geng, Jianing; Han, Yujun; Li, Lin; Li, Wei; Hu, Guangqiang; Huang, Xiangang; Li, Wenjie; Li, Jian; Liu, Zhanwei; Li, Long; Liu, Jianping; Qi, Qiuhui; Liu, Jinsong; Li, Li; Li, Tao; Wang, Xuegang; Lu, Hong; Wu, Tingting; Zhu, Miao; Ni, Peixiang; Han, Hua; Dong, Wei; Ren, Xiaoyu; Feng, Xiaoli; Cui, Peng; Li, Xianran; Wang, Hao; Xu, Xin; Zhai, Wenxue; Xu, Zhao; Zhang, Jinsong; He, Sijie; Zhang, Jianguo; Xu, Jichen; Zhang, Kunlin; Zheng, Xianwu; Dong, Jianhai; Zeng, Wanyong; Tao, Lin; Ye, Jia; Tan, Jun; Ren, Xide; Chen, Xuewei; He, Jun; Liu, Daofeng; Tian, Wei; Tian, Chaoguang; Xia, Hongai; Bao, Qiyu; Li, Gang; Gao, Hui; Cao, Ting; Wang, Juan; Zhao, Wenming; Li, Ping; Chen, Wei; Wang, Xudong; Zhang, Yong; Hu, Jianfei; Wang, Jing; Liu, Song; Yang, Jian; Zhang, Guangyu; Xiong, Yuqing; Li, Zhijie; Mao, Long; Zhou, Chengshu; Zhu, Zhen; Chen, Runsheng; Hao, Bailin; Zheng, Weimou; Chen, Shouyi; Guo, Wei; Li, Guojie; Liu, Siqi; Tao, Ming; Wang, Jian; Zhu, Lihuang; Yuan, Longping; Yang, Huanming

    2002-04-05

    We have produced a draft sequence of the rice genome for the most widely cultivated subspecies in China, Oryza sativa L. ssp. indica, by whole-genome shotgun sequencing. The genome was 466 megabases in size, with an estimated 46,022 to 55,615 genes. Functional coverage in the assembled sequences was 92.0%. About 42.2% of the genome was in exact 20-nucleotide oligomer repeats, and most of the transposons were in the intergenic regions between genes. Although 80.6% of predicted Arabidopsis thaliana genes had a homolog in rice, only 49.4% of predicted rice genes had a homolog in A. thaliana. The large proportion of rice genes with no recognizable homologs is due to a gradient in the GC content of rice coding sequences.

  14. Genome Sequence, Assembly and Characterization of Two Metschnikowia fructicola Strains Used as Biocontrol Agents of Postharvest Diseases

    PubMed Central

    Piombo, Edoardo; Sela, Noa; Wisniewski, Michael; Hoffmann, Maria; Gullino, Maria L.; Allard, Marc W.; Levin, Elena; Spadaro, Davide; Droby, Samir

    2018-01-01

    The yeast Metschnikowia fructicola was reported as an efficient biological control agent of postharvest diseases of fruits and vegetables, and it is the bases of the commercial formulated product “Shemer.” Several mechanisms of action by which M. fructicola inhibits postharvest pathogens were suggested including iron-binding compounds, induction of defense signaling genes, production of fungal cell wall degrading enzymes and relatively high amounts of superoxide anions. We assembled the whole genome sequence of two strains of M. fructicola using PacBio and Illumina shotgun sequencing technologies. Using the PacBio, a high-quality draft genome consisting of 93 contigs, with an estimated genome size of approximately 26 Mb, was obtained. Comparative analysis of M. fructicola proteins with the other three available closely related genomes revealed a shared core of homologous proteins coded by 5,776 genes. Comparing the genomes of the two M. fructicola strains using a SNP calling approach resulted in the identification of 564,302 homologous SNPs with 2,004 predicted high impact mutations. The size of the genome is exceptionally high when compared with those of available closely related organisms, and the high rate of homology among M. fructicola genes points toward a recent whole-genome duplication event as the cause of this large genome. Based on the assembled genome, sequences were annotated with a gene description and gene ontology (GO term) and clustered in functional groups. Analysis of CAZymes family genes revealed 1,145 putative genes, and transcriptomic analysis of CAZyme expression levels in M. fructicola during its interaction with either grapefruit peel tissue or Penicillium digitatum revealed a high level of CAZyme gene expression when the yeast was placed in wounded fruit tissue. PMID:29666611

  15. Improve homology search sensitivity of PacBio data by correcting frameshifts.

    PubMed

    Du, Nan; Sun, Yanni

    2016-09-01

    Single-molecule, real-time sequencing (SMRT) developed by Pacific BioSciences produces longer reads than secondary generation sequencing technologies such as Illumina. The long read length enables PacBio sequencing to close gaps in genome assembly, reveal structural variations, and identify gene isoforms with higher accuracy in transcriptomic sequencing. However, PacBio data has high sequencing error rate and most of the errors are insertion or deletion errors. During alignment-based homology search, insertion or deletion errors in genes will cause frameshifts and may only lead to marginal alignment scores and short alignments. As a result, it is hard to distinguish true alignments from random alignments and the ambiguity will incur errors in structural and functional annotation. Existing frameshift correction tools are designed for data with much lower error rate and are not optimized for PacBio data. As an increasing number of groups are using SMRT, there is an urgent need for dedicated homology search tools for PacBio data. In this work, we introduce Frame-Pro, a profile homology search tool for PacBio reads. Our tool corrects sequencing errors and also outputs the profile alignments of the corrected sequences against characterized protein families. We applied our tool to both simulated and real PacBio data. The results showed that our method enables more sensitive homology search, especially for PacBio data sets of low sequencing coverage. In addition, we can correct more errors when comparing with a popular error correction tool that does not rely on hybrid sequencing. The source code is freely available at https://sourceforge.net/projects/frame-pro/ yannisun@msu.edu. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  16. A generalized global alignment algorithm.

    PubMed

    Huang, Xiaoqiu; Chao, Kun-Mao

    2003-01-22

    Homologous sequences are sometimes similar over some regions but different over other regions. Homologous sequences have a much lower global similarity if the different regions are much longer than the similar regions. We present a generalized global alignment algorithm for comparing sequences with intermittent similarities, an ordered list of similar regions separated by different regions. A generalized global alignment model is defined to handle sequences with intermittent similarities. A dynamic programming algorithm is designed to compute an optimal general alignment in time proportional to the product of sequence lengths and in space proportional to the sum of sequence lengths. The algorithm is implemented as a computer program named GAP3 (Global Alignment Program Version 3). The generalized global alignment model is validated by experimental results produced with GAP3 on both DNA and protein sequences. The GAP3 program extends the ability of standard global alignment programs to recognize homologous sequences of lower similarity. The GAP3 program is freely available for academic use at http://bioinformatics.iastate.edu/aat/align/align.html.

  17. The sequence, and its evolutionary implications, of a Thermococcus celer protein associated with transcription

    NASA Technical Reports Server (NTRS)

    Kaine, B. P.; Mehr, I. J.; Woese, C. R.

    1994-01-01

    Through random search, a gene from Thermococcus celer has been identified and sequenced that appears to encode a transcription-associated protein (110 amino acid residues). The sequence has clear homology to approximately the last half of an open reading frame reported previously for Sulfolobus acidocaldarius [Langer, D. & Zillig, W. (1993) Nucleic Acids Res. 21, 2251]. The protein translations of these two archaeal genes in turn are homologs of a small subunit found in eukaryotic RNA polymerase I (A12.2) and the counterpart of this from RNA polymerase II (B12.6). Homology is also seen with the eukaryotic transcription factor TFIIS, but it involves only the terminal 45 amino acids of the archaeal proteins. Evolutionary implications of these homologies are discussed.

  18. BLAST and FASTA similarity searching for multiple sequence alignment.

    PubMed

    Pearson, William R

    2014-01-01

    BLAST, FASTA, and other similarity searching programs seek to identify homologous proteins and DNA sequences based on excess sequence similarity. If two sequences share much more similarity than expected by chance, the simplest explanation for the excess similarity is common ancestry-homology. The most effective similarity searches compare protein sequences, rather than DNA sequences, for sequences that encode proteins, and use expectation values, rather than percent identity, to infer homology. The BLAST and FASTA packages of sequence comparison programs provide programs for comparing protein and DNA sequences to protein databases (the most sensitive searches). Protein and translated-DNA comparisons to protein databases routinely allow evolutionary look back times from 1 to 2 billion years; DNA:DNA searches are 5-10-fold less sensitive. BLAST and FASTA can be run on popular web sites, but can also be downloaded and installed on local computers. With local installation, target databases can be customized for the sequence data being characterized. With today's very large protein databases, search sensitivity can also be improved by searching smaller comprehensive databases, for example, a complete protein set from an evolutionarily neighboring model organism. By default, BLAST and FASTA use scoring strategies target for distant evolutionary relationships; for comparisons involving short domains or queries, or searches that seek relatively close homologs (e.g. mouse-human), shallower scoring matrices will be more effective. Both BLAST and FASTA provide very accurate statistical estimates, which can be used to reliably identify protein sequences that diverged more than 2 billion years ago.

  19. The primary structures of two yeast enolase genes. Homology between the 5' noncoding flanking regions of yeast enolase and glyceraldehyde-3-phosphate dehydrogenase genes.

    PubMed

    Holland, M J; Holland, J P; Thill, G P; Jackson, K A

    1981-02-10

    Segments of yeast genomic DNA containing two enolase structural genes have been isolated by subculture cloning procedures using a cDNA hybridization probe synthesized from purified yeast enolase mRNA. Based on restriction endonuclease and transcriptional maps of these two segments of yeast DNA, each hybrid plasmid contains a region of extensive nucleotide sequence homology which forms hybrids with the cDNA probe. The DNA sequences which flank this homologous region in the two hybrid plasmids are nonhomologous indicating that these sequences are nontandemly repeated in the yeast genome. The complete nucleotide sequence of the coding as well as the flanking noncoding regions of these genes has been determined. The amino acid sequence predicted from one reading frame of both structural genes is extremely similar to that determined for yeast enolase (Chin, C. C. Q., Brewer, J. M., Eckard, E., and Wold, F. (1981) J. Biol. Chem. 256, 1370-1376), confirming that these isolated structural genes encode yeast enolase. The nucleotide sequences of the coding regions of the genes are approximately 95% homologous, and neither gene contains an intervening sequence. Codon utilization in the enolase genes follows the same biased pattern previously described for two yeast glyceraldehyde-3-phosphate dehydrogenase structural genes (Holland, J. P., and Holland, M. J. (1980) J. Biol. Chem. 255, 2596-2605). DNA blotting analysis confirmed that the isolated segments of yeast DNA are colinear with yeast genomic DNA and that there are two nontandemly repeated enolase genes per haploid yeast genome. The noncoding portions of the two enolase genes adjacent to the initiation and termination codons are approximately 70% homologous and contain sequences thought to be involved in the synthesis and processing messenger RNA. Finally there are regions of extensive homology between the two enolase structural genes and two yeast glyceraldehyde-3-phosphate dehydrogenase structural genes within the 5- noncoding portions of these glycolytic genes.

  20. The light gene of Drosophila melanogaster encodes a homologue of VPS41, a yeast gene involved in cellular-protein trafficking.

    PubMed

    Warner, T S; Sinclair, D A; Fitzpatrick, K A; Singh, M; Devlin, R H; Honda, B M

    1998-04-01

    Mutations in a number of genes affect eye colour in Drosophila melanogaster; some of these "eye-colour" genes have been shown to be involved in various aspects of cellular transport processes. In addition, combinations of viable mutant alleles of some of these genes, such as carnation (car) combined with either light (lt) or deep-orange (dor) mutants, show lethal interactions. Recently, dor was shown to be homologous to the yeast gene PEP3 (VPS18), which is known to be involved in intracellular trafficking. We have undertaken to extend our earlier work on the lt gene, in order to examine in more detail its expression pattern and to characterize its gene product via sequencing of a cloned cDNA. The gene appears to be expressed at relatively high levels in all stages and tissues examined, and shows strong homology to VPS41, a gene involved in cellular-protein trafficking in yeast and higher eukaryotes. Further genetic experiments also point to a role for lt in transport processes: we describe lethal interactions between viable alleles of lt and dor, as well as phenotypic interactions (reductions in eye pigment) between allels of lt and another eye-colour gene, garnet (g), whose gene product has close homology to a subunit of the human adaptor complex, AP-3.

  1. Evolutionary profiles from the QR factorization of multiple sequence alignments

    PubMed Central

    Sethi, Anurag; O'Donoghue, Patrick; Luthey-Schulten, Zaida

    2005-01-01

    We present an algorithm to generate complete evolutionary profiles that represent the topology of the molecular phylogenetic tree of the homologous group. The method, based on the multidimensional QR factorization of numerically encoded multiple sequence alignments, removes redundancy from the alignments and orders the protein sequences by increasing linear dependence, resulting in the identification of a minimal basis set of sequences that spans the evolutionary space of the homologous group of proteins. We observe a general trend that these smaller, more evolutionarily balanced profiles have comparable and, in many cases, better performance in database searches than conventional profiles containing hundreds of sequences, constructed in an iterative and computationally intensive procedure. For more diverse families or superfamilies, with sequence identity <30%, structural alignments, based purely on the geometry of the protein structures, provide better alignments than pure sequence-based methods. Merging the structure and sequence information allows the construction of accurate profiles for distantly related groups. These structure-based profiles outperformed other sequence-based methods for finding distant homologs and were used to identify a putative class II cysteinyl-tRNA synthetase (CysRS) in several archaea that eluded previous annotation studies. Phylogenetic analysis showed the putative class II CysRSs to be a monophyletic group and homology modeling revealed a constellation of active site residues similar to that in the known class I CysRS. PMID:15741270

  2. Replication protein A 32 interacts through a similar binding interface with TIPIN, XPA, and UNG2.

    PubMed

    Ali, Seikh Imtiaz; Shin, Jae-Sun; Bae, Sung-Hun; Kim, Byoungkook; Choi, Byong-Seok

    2010-07-01

    The 32kDa subunit of replication protein A (RPA32) is involved in various DNA repair systems such as nucleotide excision repair, base excision repair, and homologous recombination. In these processes, RPA32 interacts with different binding partners via its C-terminal domain (RPA32C; residues 172-270). It has been reported recently that RPA32C also interacts with TIPIN during the intra-S checkpoint. To determine the significance of the interaction of RPA32C with TIPIN, we have examined the interaction mode using NMR spectroscopy and an in silico modeling approach. Here, we show that TIPIN(185-218), which shares high sequence similarity with XPA(10-43) and UNG2(56-89), is less ordered in the free state and then forms a longer alpha-helix upon binding to RPA32C. The binding interface between TIPIN(185-218) and RPA32C is similar to those of XPA and UNG2, but its mode of interaction is different. The results suggest that RPA32 is an exchange point for multiple proteins involved in DNA repair, homologous recombination, and checkpoint processes and that it binds to different partners with comparable binding affinity using a single site. Copyright 2010 Elsevier Ltd. All rights reserved.

  3. Global investigation of protein-protein interactions in yeast Saccharomyces cerevisiae using re-occurring short polypeptide sequences.

    PubMed

    Pitre, S; North, C; Alamgir, M; Jessulat, M; Chan, A; Luo, X; Green, J R; Dumontier, M; Dehne, F; Golshani, A

    2008-08-01

    Protein-protein interaction (PPI) maps provide insight into cellular biology and have received considerable attention in the post-genomic era. While large-scale experimental approaches have generated large collections of experimentally determined PPIs, technical limitations preclude certain PPIs from detection. Recently, we demonstrated that yeast PPIs can be computationally predicted using re-occurring short polypeptide sequences between known interacting protein pairs. However, the computational requirements and low specificity made this method unsuitable for large-scale investigations. Here, we report an improved approach, which exhibits a specificity of approximately 99.95% and executes 16,000 times faster. Importantly, we report the first all-to-all sequence-based computational screen of PPIs in yeast, Saccharomyces cerevisiae in which we identify 29,589 high confidence interactions of approximately 2 x 10(7) possible pairs. Of these, 14,438 PPIs have not been previously reported and may represent novel interactions. In particular, these results reveal a richer set of membrane protein interactions, not readily amenable to experimental investigations. From the novel PPIs, a novel putative protein complex comprised largely of membrane proteins was revealed. In addition, two novel gene functions were predicted and experimentally confirmed to affect the efficiency of non-homologous end-joining, providing further support for the usefulness of the identified PPIs in biological investigations.

  4. ProfileGrids: a sequence alignment visualization paradigm that avoids the limitations of Sequence Logos.

    PubMed

    Roca, Alberto I

    2014-01-01

    The 2013 BioVis Contest provided an opportunity to evaluate different paradigms for visualizing protein multiple sequence alignments. Such data sets are becoming extremely large and thus taxing current visualization paradigms. Sequence Logos represent consensus sequences but have limitations for protein alignments. As an alternative, ProfileGrids are a new protein sequence alignment visualization paradigm that represents an alignment as a color-coded matrix of the residue frequency occurring at every homologous position in the aligned protein family. The JProfileGrid software program was used to analyze the BioVis contest data sets to generate figures for comparison with the Sequence Logo reference images. The ProfileGrid representation allows for the clear and effective analysis of protein multiple sequence alignments. This includes both a general overview of the conservation and diversity sequence patterns as well as the interactive ability to query the details of the protein residue distributions in the alignment. The JProfileGrid software is free and available from http://www.ProfileGrid.org.

  5. [Identification of proteins interacting with the circadian clock protein PER1 in tumors using bacterial two-hybrid system technique].

    PubMed

    Zhang, Yu; Yao, Youlin; Jiang, Siyuan; Lu, Yilu; Liu, Yunqiang; Tao, Dachang; Zhang, Sizhong; Ma, Yongxin

    2015-04-01

    To identify protein-protein interaction partners of PER1 (period circadian protein homolog 1), key component of the molecular oscillation system of the circadian rhythm in tumors using bacterial two-hybrid system technique. Human cervical carcinoma cell Hela library was adopted. Recombinant bait plasmid pBT-PER1 and pTRG cDNA plasmid library were cotransformed into the two-hybrid system reporter strain cultured in a special selective medium. Target clones were screened. After isolating the positive clones, the target clones were sequenced and analyzed. Fourteen protein coding genes were identified, 4 of which were found to contain whole coding regions of genes, which included optic atrophy 3 protein (OPA3) associated with mitochondrial dynamics and homo sapiens cutA divalent cation tolerance homolog of E. coli (CUTA) associated with copper metabolism. There were also cellular events related proteins and proteins which are involved in biochemical reaction and signal transduction-related proteins. Identification of potential interacting proteins with PER1 in tumors may provide us new insights into the functions of the circadian clock protein PER1 during tumorigenesis.

  6. Electrostatic Interactions between Elongated Monomers Drive Filamentation of Drosophila Shrub, a Metazoan ESCRT-III Protein.

    PubMed

    McMillan, Brian J; Tibbe, Christine; Jeon, Hyesung; Drabek, Andrew A; Klein, Thomas; Blacklow, Stephen C

    2016-08-02

    The endosomal sorting complex required for transport (ESCRT) is a conserved protein complex that facilitates budding and fission of membranes. It executes a key step in many cellular events, including cytokinesis and multi-vesicular body formation. The ESCRT-III protein Shrub in flies, or its homologs in yeast (Snf7) or humans (CHMP4B), is a critical polymerizing component of ESCRT-III needed to effect membrane fission. We report the structural basis for polymerization of Shrub and define a minimal region required for filament formation. The X-ray structure of the Shrub core shows that individual monomers in the lattice interact in a staggered arrangement using complementary electrostatic surfaces. Mutations that disrupt interface salt bridges interfere with Shrub polymerization and function. Despite substantial sequence divergence and differences in packing interactions, the arrangement of Shrub subunits in the polymer resembles that of Snf7 and other family homologs, suggesting that this intermolecular packing mechanism is shared among ESCRT-III proteins. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

  7. Exploring representations of protein structure for automated remote homology detection and mapping of protein structure space

    PubMed Central

    2014-01-01

    Background Due to rapid sequencing of genomes, there are now millions of deposited protein sequences with no known function. Fast sequence-based comparisons allow detecting close homologs for a protein of interest to transfer functional information from the homologs to the given protein. Sequence-based comparison cannot detect remote homologs, in which evolution has adjusted the sequence while largely preserving structure. Structure-based comparisons can detect remote homologs but most methods for doing so are too expensive to apply at a large scale over structural databases of proteins. Recently, fragment-based structural representations have been proposed that allow fast detection of remote homologs with reasonable accuracy. These representations have also been used to obtain linearly-reducible maps of protein structure space. It has been shown, as additionally supported from analysis in this paper that such maps preserve functional co-localization of the protein structure space. Methods Inspired by a recent application of the Latent Dirichlet Allocation (LDA) model for conducting structural comparisons of proteins, we propose higher-order LDA-obtained topic-based representations of protein structures to provide an alternative route for remote homology detection and organization of the protein structure space in few dimensions. Various techniques based on natural language processing are proposed and employed to aid the analysis of topics in the protein structure domain. Results We show that a topic-based representation is just as effective as a fragment-based one at automated detection of remote homologs and organization of protein structure space. We conduct a detailed analysis of the information content in the topic-based representation, showing that topics have semantic meaning. The fragment-based and topic-based representations are also shown to allow prediction of superfamily membership. Conclusions This work opens exciting venues in designing novel representations to extract information about protein structures, as well as organizing and mining protein structure space with mature text mining tools. PMID:25080993

  8. Stringent homology-based prediction of H. sapiens-M. tuberculosis H37Rv protein-protein interactions

    PubMed Central

    2014-01-01

    Background H. sapiens-M. tuberculosis H37Rv protein-protein interaction (PPI) data are essential for understanding the infection mechanism of the formidable pathogen M. tuberculosis H37Rv. Computational prediction is an important strategy to fill the gap in experimental H. sapiens-M. tuberculosis H37Rv PPI data. Homology-based prediction is frequently used in predicting both intra-species and inter-species PPIs. However, some limitations are not properly resolved in several published works that predict eukaryote-prokaryote inter-species PPIs using intra-species template PPIs. Results We develop a stringent homology-based prediction approach by taking into account (i) differences between eukaryotic and prokaryotic proteins and (ii) differences between inter-species and intra-species PPI interfaces. We compare our stringent homology-based approach to a conventional homology-based approach for predicting host-pathogen PPIs, based on cellular compartment distribution analysis, disease gene list enrichment analysis, pathway enrichment analysis and functional category enrichment analysis. These analyses support the validity of our prediction result, and clearly show that our approach has better performance in predicting H. sapiens-M. tuberculosis H37Rv PPIs. Using our stringent homology-based approach, we have predicted a set of highly plausible H. sapiens-M. tuberculosis H37Rv PPIs which might be useful for many of related studies. Based on our analysis of the H. sapiens-M. tuberculosis H37Rv PPI network predicted by our stringent homology-based approach, we have discovered several interesting properties which are reported here for the first time. We find that both host proteins and pathogen proteins involved in the host-pathogen PPIs tend to be hubs in their own intra-species PPI network. Also, both host and pathogen proteins involved in host-pathogen PPIs tend to have longer primary sequence, tend to have more domains, tend to be more hydrophilic, etc. And the protein domains from both host and pathogen proteins involved in host-pathogen PPIs tend to have lower charge, and tend to be more hydrophilic. Conclusions Our stringent homology-based prediction approach provides a better strategy in predicting PPIs between eukaryotic hosts and prokaryotic pathogens than a conventional homology-based approach. The properties we have observed from the predicted H. sapiens-M. tuberculosis H37Rv PPI network are useful for understanding inter-species host-pathogen PPI networks and provide novel insights for host-pathogen interaction studies. Reviewers This article was reviewed by Michael Gromiha, Narayanaswamy Srinivasan and Thomas Dandekar. PMID:24708540

  9. The molecular dynamics of long noncoding RNA control of transcription in PTEN and its pseudogene

    PubMed Central

    Lister, Nicholas; Shevchenko, Galina; Walshe, James L.; Groen, Jessica; Johnsson, Per; Vidarsdóttir, Linda; Grander, Dan; Ataide, Sandro F.; Morris, Kevin V.

    2017-01-01

    RNA has been found to interact with chromatin and modulate gene transcription. In human cells, little is known about how long noncoding RNAs (lncRNAs) interact with target loci in the context of chromatin. We find here, using the phosphatase and tensin homolog (PTEN) pseudogene as a model system, that antisense lncRNAs interact first with a 5′ UTR-containing promoter-spanning transcript, which is then followed by the recruitment of DNA methyltransferase 3a (DNMT3a), ultimately resulting in the transcriptional and epigenetic control of gene expression. Moreover, we find that the lncRNA and promoter-spanning transcript interaction are based on a combination of structural and sequence components of the antisense lncRNA. These observations suggest, on the basis of this one example, that evolutionary pressures may be placed on RNA structure more so than sequence conservation. Collectively, the observations presented here suggest a much more complex and vibrant RNA regulatory world may be operative in the regulation of gene expression. PMID:28847966

  10. Generation and Analysis of Expressed Sequence Tags from Olea europaea L.

    PubMed Central

    Ozdemir Ozgenturk, Nehir; Oruç, Fatma; Sezerman, Ugur; Kuçukural, Alper; Vural Korkut, Senay; Toksoz, Feriha; Un, Cemal

    2010-01-01

    Olive (Olea europaea L.) is an important source of edible oil which was originated in Near-East region. In this study, two cDNA libraries were constructed from young olive leaves and immature olive fruits for generation of ESTs to discover the novel genes and search the function of unknown genes of olive. The randomly selected 3840 colonies were sequenced for EST collection from both libraries. Readable 2228 sequences for olive leaf and 1506 sequences for olive fruit were assembled into 205 and 69 contigs, respectively, whereas 2478 were singletons. Putative functions of all 2752 differentially expressed unique sequences were designated by gene homology based on BLAST and annotated using BLAST2GO. While 1339 ESTs show no homology to the database, 2024 ESTs have homology (under 80%) with hypothetical proteins, putative proteins, expressed proteins, and unknown proteins in NCBI-GenBank. 635 EST's unique genes sequence have been identified by over 80% homology to known function in other species which were not previously described in Olea family. Only 3.1% of total EST's was shown similarity with olive database existing in NCBI. This generated EST's data and consensus sequences were submitted to NCBI as valuable source for functional genome studies of olive. PMID:21197085

  11. FBI-1 enhances transcription of the nuclear factor-kappaB (NF-kappaB)-responsive E-selectin gene by nuclear localization of the p65 subunit of NF-kappaB.

    PubMed

    Lee, Dong-Kee; Kang, Jae-Eun; Park, Hye-Jin; Kim, Myung-Hwa; Yim, Tae-Hee; Kim, Jung-Min; Heo, Min-Kyu; Kim, Kyu-Yeun; Kwon, Ho Jeong; Hur, Man-Wook

    2005-07-29

    The POZ domain is a highly conserved protein-protein interaction motif found in many regulatory proteins. Nuclear factor-kappaB (NF-kappaB) plays a key role in the expression of a variety of genes in response to infection, inflammation, and stressful conditions. We found that the POZ domain of FBI-1 (factor that binds to the inducer of short transcripts of human immunodeficiency virus-1) interacted with the Rel homology domain of the p65 subunit of NF-kappaB in both in vivo and in vitro protein-protein interaction assays. FBI-1 enhanced NF-kappaB-mediated transcription of E-selectin genes in HeLa cells upon phorbol 12-myristate 13-acetate stimulation and overcame gene repression by IkappaB alpha or IkappaB beta. In contrast, the POZ domain of FBI-1, which is a dominant-negative form of FBI-1, repressed NF-kappaB-mediated transcription, and the repression was cooperative with IkappaB alpha or IkappaB beta. In contrast, the POZ domain tagged with a nuclear localization sequence polypeptide of FBI-1 enhanced NF-kappaB-responsive gene transcription, suggesting that the molecular interaction between the POZ domain and the Rel homology domain of p65 and the nuclear localization by the nuclear localization sequence are important in the transcription enhancement mediated by FBI-1. Confocal microscopy showed that FBI-1 increased NF-kappaB movement into the nucleus and increased the stability of NF-kappaB in the nucleus, which enhanced NF-kappaB-mediated transcription of the E-selectin gene. FBI-1 also interacted with IkappaB alpha and IkappaB beta.

  12. Genomewide Function Conservation and Phylogeny in the Herpesviridae

    PubMed Central

    Albà, M. Mar; Das, Rhiju; Orengo, Christine A.; Kellam, Paul

    2001-01-01

    The Herpesviridae are a large group of well-characterized double-stranded DNA viruses for which many complete genome sequences have been determined. We have extracted protein sequences from all predicted open reading frames of 19 herpesvirus genomes. Sequence comparison and protein sequence clustering methods have been used to construct herpesvirus protein homologous families. This resulted in 1692 proteins being clustered into 243 multiprotein families and 196 singleton proteins. Predicted functions were assigned to each homologous family based on genome annotation and published data and each family classified into seven broad functional groups. Phylogenetic profiles were constructed for each herpesvirus from the homologous protein families and used to determine conserved functions and genomewide phylogenetic trees. These trees agreed with molecular-sequence-derived trees and allowed greater insight into the phylogeny of ungulate and murine gammaherpesviruses. PMID:11156614

  13. Epitopes of human testis-specific lactate dehydrogenase deduced from a cDNA sequence

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Millan, J.L.; Driscoll, C.E.; LeVan, K.M.

    The sequence and structure of human testis-specific L-lactate dehydrogenase (LDHC/sub 4/, LDHX; (L)-lactate:NAD/sup +/ oxidoreductase, EC 1.1.1.27) has been derived from analysis of a complementary DNA (cDNA) clone comprising the complete protein coding region of the enzyme. From the deduced amino acid sequence, human LDHC/sub 4/ is as different from rodent LDHC/sub 4/ (73% homology) as it is from human LDHA/sub 4/ (76% homology) and porcine LDHB/sub 4/ (68% homology). Subunit homologies are consistent with the conclusion that the LDHC gene arose by at least two independent duplication events. Furthermore, the lower degree of homology between mouse and human LDHC/submore » 4/ and the appearance of this isozyme late in evolution suggests a higher rate of mutation in the mammalian LDHC genes than in the LDHA and -B genes. Comparison of exposed amino acid residues of discrete anti-genic determinants of mouse and human LDHC/sub 4/ reveals significant differences. Knowledge of the human LDHC/sub 4/ sequence will help design human-specific peptides useful in the development of a contraceptive vaccine.« less

  14. The ubiquitin-homology protein, DAP-1, associates with tumor necrosis factor receptor (p60) death domain and induces apoptosis.

    PubMed

    Liou, M L; Liou, H C

    1999-04-09

    The tumor necrosis factor receptor, p60 (TNF-R1), transduces death signals via the association of its cytoplasmic domain with several intracellular proteins. By screening a mammalian cDNA library using the yeast two-hybrid cloning technique, we isolated a ubiquitin-homology protein, DAP-1, which specifically interacts with the cytoplasmic death domain of TNF-R1. Sequence analysis reveals that DAP-1 shares striking sequence homology with the yeast SMT3 protein that is essential for the maintenance of chromosome integrity during mitosis (Meluh, P. B., and Koshland, D. (1995) Mol. Biol. Cell 6, 793-807). DAP-1 is nearly identical to PIC1, a protein that interacts with the PML tumor suppressor implicated in acute promyelocytic leukemia (Boddy, M. N., Howe, K., Etkin, L. D., Solomon, E., and Freemont, P. S. (1996) Oncogene 13, 971-982), and the sentrin protein, which associates with the Fas death receptor (Okura, T., Gong, L., Kamitani, T., Wada, T., Okura, I., Wei, C. F., Chang, H. M., and Yeh, E. T. (1996) J. Immunol. 157, 4277-4281). The in vivo interaction between DAP-1 and TNF-R1 was further confirmed in mammalian cells. In transient transfection assays, overexpression of DAP-1 suppresses NF-kappaB/Rel activity in 293T cells, a human kidney embryonic carcinoma cell line. Overexpression of either DAP-1 or sentrin causes apoptosis of TNF-sensitive L929 fibroblast cell line, as well as TNF-resistant osteosarcoma cell line, U2OS. Furthermore, the dominant negative Fas-associated death domain protein (FADD) protein blocks the cell death induced by either DAP-1 or FADD. Collectively, these observations highly suggest a role for DAP-1 in mediating TNF-induced cell death signaling pathways, presumably through the recruitment of FADD death effector.

  15. Genomic DNA sequence and cytosine methylation changes of adult rice leaves after seeds space flight

    NASA Astrophysics Data System (ADS)

    Shi, Jinming

    In this study, cytosine methylation on CCGG site and genomic DNA sequence changes of adult leaves of rice after seeds space flight were detected by methylation-sensitive amplification polymorphism (MSAP) and Amplified fragment length polymorphism (AFLP) technique respectively. Rice seeds were planted in the trial field after 4 days space flight on the shenzhou-6 Spaceship of China. Adult leaves of space-treated rice including 8 plants chosen randomly and 2 plants with phenotypic mutation were used for AFLP and MSAP analysis. Polymorphism of both DNA sequence and cytosine methylation were detected. For MSAP analysis, the average polymorphic frequency of the on-ground controls, space-treated plants and mutants are 1.3%, 3.1% and 11% respectively. For AFLP analysis, the average polymorphic frequencies are 1.4%, 2.9%and 8%respectively. Total 27 and 22 polymorphic fragments were cloned sequenced from MSAP and AFLP analysis respectively. Nine of the 27 fragments from MSAP analysis show homology to coding sequence. For the 22 polymorphic fragments from AFLP analysis, no one shows homology to mRNA sequence and eight fragments show homology to repeat region or retrotransposon sequence. These results suggest that although both genomic DNA sequence and cytosine methylation status can be effected by space flight, the genomic region homology to the fragments from genome DNA and cytosine methylation analysis were different.

  16. GeneWiz browser: An Interactive Tool for Visualizing Sequenced Chromosomes.

    PubMed

    Hallin, Peter F; Stærfeldt, Hans-Henrik; Rotenberg, Eva; Binnewies, Tim T; Benham, Craig J; Ussery, David W

    2009-09-25

    We present an interactive web application for visualizing genomic data of prokaryotic chromosomes. The tool (GeneWiz browser) allows users to carry out various analyses such as mapping alignments of homologous genes to other genomes, mapping of short sequencing reads to a reference chromosome, and calculating DNA properties such as curvature or stacking energy along the chromosome. The GeneWiz browser produces an interactive graphic that enables zooming from a global scale down to single nucleotides, without changing the size of the plot. Its ability to disproportionally zoom provides optimal readability and increased functionality compared to other browsers. The tool allows the user to select the display of various genomic features, color setting and data ranges. Custom numerical data can be added to the plot allowing, for example, visualization of gene expression and regulation data. Further, standard atlases are pre-generated for all prokaryotic genomes available in GenBank, providing a fast overview of all available genomes, including recently deposited genome sequences. The tool is available online from http://www.cbs.dtu.dk/services/gwBrowser. Supplemental material including interactive atlases is available online at http://www.cbs.dtu.dk/services/gwBrowser/suppl/.

  17. Chimeric mitochondrial minichromosomes of the human body louse, Pediculus humanus: evidence for homologous and non-homologous recombination.

    PubMed

    Shao, Renfu; Barker, Stephen C

    2011-02-15

    The mitochondrial (mt) genome of the human body louse, Pediculus humanus, consists of 18 minichromosomes. Each minichromosome is 3 to 4 kb long and has 1 to 3 genes. There is unequivocal evidence for recombination between different mt minichromosomes in P. humanus. It is not known, however, how these minichromosomes recombine. Here, we report the discovery of eight chimeric mt minichromosomes in P. humanus. We classify these chimeric mt minichromosomes into two groups: Group I and Group II. Group I chimeric minichromosomes contain parts of two different protein-coding genes that are from different minichromosomes. The two parts of protein-coding genes in each Group I chimeric minichromosome are joined at a microhomologous nucleotide sequence; microhomologous nucleotide sequences are hallmarks of non-homologous recombination. Group II chimeric minichromosomes contain all of the genes and the non-coding regions of two different minichromosomes. The conserved sequence blocks in the non-coding regions of Group II chimeric minichromosomes resemble the "recombination repeats" in the non-coding regions of the mt genomes of higher plants. These repeats are essential to homologous recombination in higher plants. Our analyses of the nucleotide sequences of chimeric mt minichromosomes indicate both homologous and non-homologous recombination between minichromosomes in the mitochondria of the human body louse. Copyright © 2010 Elsevier B.V. All rights reserved.

  18. Designing a Bioengine for Detection and Analysis of Base String on an Affected Sequence in High-Concentration Regions

    PubMed Central

    Mandal, Bijoy Kumar; Kim, Tai-hoon

    2013-01-01

    We design an Algorithm for bioengine. As a program are enable optimal alignments searching between two sequences, the host sequence (normal plant) as well as query sequence (virus). Searching for homologues has become a routine operation of biological sequences in 4 × 4 combination with different subsequence (word size). This program takes the advantage of the high degree of homology between such sequences to construct an alignment of the matching regions. There is a main aim which is to detect the overlapping reading frames. This program also enables to find out the highly infected colones selection highest matching region with minimum gap or mismatch zones and unique virus colones matches. This is a small, portable, interactive, front-end program intended to be used to find out the regions of matching between host sequence and query subsequences. All the operations are carried out in fraction of seconds, depending on the required task and on the sequence length. PMID:24000321

  19. Not all transmembrane helices are born equal: Towards the extension of the sequence homology concept to membrane proteins

    PubMed Central

    2011-01-01

    Background Sequence homology considerations widely used to transfer functional annotation to uncharacterized protein sequences require special precautions in the case of non-globular sequence segments including membrane-spanning stretches composed of non-polar residues. Simple, quantitative criteria are desirable for identifying transmembrane helices (TMs) that must be included into or should be excluded from start sequence segments in similarity searches aimed at finding distant homologues. Results We found that there are two types of TMs in membrane-associated proteins. On the one hand, there are so-called simple TMs with elevated hydrophobicity, low sequence complexity and extraordinary enrichment in long aliphatic residues. They merely serve as membrane-anchoring device. In contrast, so-called complex TMs have lower hydrophobicity, higher sequence complexity and some functional residues. These TMs have additional roles besides membrane anchoring such as intra-membrane complex formation, ligand binding or a catalytic role. Simple and complex TMs can occur both in single- and multi-membrane-spanning proteins essentially in any type of topology. Whereas simple TMs have the potential to confuse searches for sequence homologues and to generate unrelated hits with seemingly convincing statistical significance, complex TMs contain essential evolutionary information. Conclusion For extending the homology concept onto membrane proteins, we provide a necessary quantitative criterion to distinguish simple TMs (and a sufficient criterion for complex TMs) in query sequences prior to their usage in homology searches based on assessment of hydrophobicity and sequence complexity of the TM sequence segments. Reviewers This article was reviewed by Shamil Sunyaev, L. Aravind and Arcady Mushegian. PMID:22024092

  20. MitoNuc: a database of nuclear genes coding for mitochondrial proteins. Update 2002.

    PubMed

    Attimonelli, Marcella; Catalano, Domenico; Gissi, Carmela; Grillo, Giorgio; Licciulli, Flavio; Liuni, Sabino; Santamaria, Monica; Pesole, Graziano; Saccone, Cecilia

    2002-01-01

    Mitochondria, besides their central role in energy metabolism, have recently been found to be involved in a number of basic processes of cell life and to contribute to the pathogenesis of many degenerative diseases. All functions of mitochondria depend on the interaction of nuclear and organelle genomes. Mitochondrial genomes have been extensively sequenced and analysed and data have been collected in several specialised databases. In order to collect information on nuclear coded mitochondrial proteins we developed MitoNuc, a database containing detailed information on sequenced nuclear genes coding for mitochondrial proteins in Metazoa. The MitoNuc database can be retrieved through SRS and is available via the web site http://bighost.area.ba.cnr.it/mitochondriome where other mitochondrial databases developed by our group, the complete list of the sequenced mitochondrial genomes, links to other mitochondrial sites and related information, are available. The MitoAln database, related to MitoNuc in the previous release, reporting the multiple alignments of the relevant homologous protein coding regions, is no longer supported in the present release. In order to keep the links among entries in MitoNuc from homologous proteins, a new field in the database has been defined: the cluster identifier, an alpha numeric code used to identify each cluster of homologous proteins. A comment field derived from the corresponding SWISS-PROT entry has been introduced; this reports clinical data related to dysfunction of the protein. The logic scheme of MitoNuc database has been implemented in the ORACLE DBMS. This will allow the end-users to retrieve data through a friendly interface that will be soon implemented.

  1. Site directed recombination

    DOEpatents

    Jurka, Jerzy W.

    1997-01-01

    Enhanced homologous recombination is obtained by employing a consensus sequence which has been found to be associated with integration of repeat sequences, such as Alu and ID. The consensus sequence or sequence having a single transition mutation determines one site of a double break which allows for high efficiency of integration at the site. By introducing single or double stranded DNA having the consensus sequence flanking region joined to a sequence of interest, one can reproducibly direct integration of the sequence of interest at one or a limited number of sites. In this way, specific sites can be identified and homologous recombination achieved at the site by employing a second flanking sequence associated with a sequence proximal to the 3'-nick.

  2. Analysis of Structural MtrC Models Based on Homology with the Crystal Structure of MtrF

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Edwards, Marcus; Fredrickson, Jim K.; Zachara, John M.

    2012-12-01

    The outer-membrane decahaem cytochrome MtrC is part of the transmembrane MtrCAB complex required for mineral respiration by Shewanella oneidensis. MtrC has significant sequence similarity to the paralogous decahaem cytochrome MtrF, which has been structurally solved through X-ray crystallography. This now allows for homology-based models of MtrC to be generated. The structure of these MtrC homology models contain ten bis-histidine-co-ordinated c-type haems arranged in a staggered cross through a four-domain structure. This model is consistent with current spectroscopic data and shows that the areas around haem 5 and haem 10, at the termini of an octahaem chain, are likely to havemore » functions similar to those of the corresponding haems in MtrF. The electrostatic surfaces around haem 7, close to the β-barrels, are different in MtrF and MtrC, indicating that these haems may have different potentials and interact with substrates differently.« less

  3. Scalable Parallel Methods for Analyzing Metagenomics Data at Extreme Scale

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Daily, Jeffrey A.

    2015-05-01

    The field of bioinformatics and computational biology is currently experiencing a data revolution. The exciting prospect of making fundamental biological discoveries is fueling the rapid development and deployment of numerous cost-effective, high-throughput next-generation sequencing technologies. The result is that the DNA and protein sequence repositories are being bombarded with new sequence information. Databases are continuing to report a Moore’s law-like growth trajectory in their database sizes, roughly doubling every 18 months. In what seems to be a paradigm-shift, individual projects are now capable of generating billions of raw sequence data that need to be analyzed in the presence of alreadymore » annotated sequence information. While it is clear that data-driven methods, such as sequencing homology detection, are becoming the mainstay in the field of computational life sciences, the algorithmic advancements essential for implementing complex data analytics at scale have mostly lagged behind. Sequence homology detection is central to a number of bioinformatics applications including genome sequencing and protein family characterization. Given millions of sequences, the goal is to identify all pairs of sequences that are highly similar (or “homologous”) on the basis of alignment criteria. While there are optimal alignment algorithms to compute pairwise homology, their deployment for large-scale is currently not feasible; instead, heuristic methods are used at the expense of quality. In this dissertation, we present the design and evaluation of a parallel implementation for conducting optimal homology detection on distributed memory supercomputers. Our approach uses a combination of techniques from asynchronous load balancing (viz. work stealing, dynamic task counters), data replication, and exact-matching filters to achieve homology detection at scale. Results for a collection of 2.56M sequences show parallel efficiencies of ~75-100% on up to 8K cores, representing a time-to-solution of 33 seconds. We extend this work with a detailed analysis of single-node sequence alignment performance using the latest CPU vector instruction set extensions. Preliminary results reveal that current sequence alignment algorithms are unable to fully utilize widening vector registers.« less

  4. Comparative structural analysis of Bru1 region homeologs in Saccharum spontaneum and S. officinarum

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhang, Jisen; Sharma, Anupma; Yu, Qingyi

    Here, sugarcane is a major sugar and biofuel crop, but genomic research and molecular breeding have lagged behind other major crops due to the complexity of auto-allopolyploid genomes. Sugarcane cultivars are frequently aneuploid with chromosome number ranging from 100 to 130, consisting of 70-80 % S. officinarum, 10-20 % S. spontaneum, and 10 % recombinants between these two species. Analysis of a genomic region in the progenitor autoploid genomes of sugarcane hybrid cultivars will reveal the nature and divergence of homologous chromosomes. As a result, to investigate the origin and evolution of haplotypes in the Bru1 genomic regions in sugarcanemore » cultivars, we identified two BAC clones from S. spontaneum and four from S. officinarum and compared to seven haplotype sequences from sugarcane hybrid R570. The results clarified the origin of seven homologous haplotypes in R570, four haplotypes originated from S. officinarum, two from S. spontaneum and one recombinant.. Retrotransposon insertions and sequences variations among the homologous haplotypes sequence divergence ranged from 18.2 % to 60.5 % with an average of 33. 7 %. Gene content and gene structure were relatively well conserved among the homologous haplotypes. Exon splitting occurred in haplotypes of the hybrid genome but not in its progenitor genomes. Tajima's D analysis revealed that S. spontaneum hapotypes in the Bru1 genomic regions were under strong directional selection. Numerous inversions, deletions, insertions and translocations were found between haplotypes within each genome. In conclusion, this is the first comparison among haplotypes of a modern sugarcane hybrid and its two progenitors. Tajima's D results emphasized the crucial role of this fungal disease resistance gene for enhancing the fitness of this species and indicating that the brown rust resistance gene in R570 is from S. spontaneum. Species-specific InDel, sequences similarity and phylogenetic analysis of homologous genes can be used for identifying the origin of S. spontaneum and S. officinarum haplotype in Saccharum hybrids. Comparison of exon splitting among the homologous haplotypes suggested that the genome rearrangements in Saccharum hybrids S. officinarum would be sufficient for proper genome assembly of this autopolyploid genome. Retrotransposon insertions and sequences variations among the homologous haplotypes sequence divergence may allow sequencing and assembling the autopolyploid Saccharum genomes and the auto-allopolyploid hybrid genomes using whole genome shotgun sequencing.« less

  5. Comparative structural analysis of Bru1 region homeologs in Saccharum spontaneum and S. officinarum

    DOE PAGES

    Zhang, Jisen; Sharma, Anupma; Yu, Qingyi; ...

    2016-06-10

    Here, sugarcane is a major sugar and biofuel crop, but genomic research and molecular breeding have lagged behind other major crops due to the complexity of auto-allopolyploid genomes. Sugarcane cultivars are frequently aneuploid with chromosome number ranging from 100 to 130, consisting of 70-80 % S. officinarum, 10-20 % S. spontaneum, and 10 % recombinants between these two species. Analysis of a genomic region in the progenitor autoploid genomes of sugarcane hybrid cultivars will reveal the nature and divergence of homologous chromosomes. As a result, to investigate the origin and evolution of haplotypes in the Bru1 genomic regions in sugarcanemore » cultivars, we identified two BAC clones from S. spontaneum and four from S. officinarum and compared to seven haplotype sequences from sugarcane hybrid R570. The results clarified the origin of seven homologous haplotypes in R570, four haplotypes originated from S. officinarum, two from S. spontaneum and one recombinant.. Retrotransposon insertions and sequences variations among the homologous haplotypes sequence divergence ranged from 18.2 % to 60.5 % with an average of 33. 7 %. Gene content and gene structure were relatively well conserved among the homologous haplotypes. Exon splitting occurred in haplotypes of the hybrid genome but not in its progenitor genomes. Tajima's D analysis revealed that S. spontaneum hapotypes in the Bru1 genomic regions were under strong directional selection. Numerous inversions, deletions, insertions and translocations were found between haplotypes within each genome. In conclusion, this is the first comparison among haplotypes of a modern sugarcane hybrid and its two progenitors. Tajima's D results emphasized the crucial role of this fungal disease resistance gene for enhancing the fitness of this species and indicating that the brown rust resistance gene in R570 is from S. spontaneum. Species-specific InDel, sequences similarity and phylogenetic analysis of homologous genes can be used for identifying the origin of S. spontaneum and S. officinarum haplotype in Saccharum hybrids. Comparison of exon splitting among the homologous haplotypes suggested that the genome rearrangements in Saccharum hybrids S. officinarum would be sufficient for proper genome assembly of this autopolyploid genome. Retrotransposon insertions and sequences variations among the homologous haplotypes sequence divergence may allow sequencing and assembling the autopolyploid Saccharum genomes and the auto-allopolyploid hybrid genomes using whole genome shotgun sequencing.« less

  6. Preliminary X-ray diffraction analysis of YqjH from Escherichia coli: a putative cytoplasmic ferri-siderophore reductase.

    PubMed

    Bamford, Vicki A; Armour, Maria; Mitchell, Sue A; Cartron, Michaël; Andrews, Simon C; Watson, Kimberly A

    2008-09-01

    YqjH is a cytoplasmic FAD-containing protein from Escherichia coli; based on homology to ViuB of Vibrio cholerae, it potentially acts as a ferri-siderophore reductase. This work describes its overexpression, purification, crystallization and structure solution at 3.0 A resolution. YqjH shares high sequence similarity with a number of known siderophore-interacting proteins and its structure was solved by molecular replacement using the siderophore-interacting protein from Shewanella putrefaciens as the search model. The YqjH structure resembles those of other members of the NAD(P)H:flavin oxidoreductase superfamily.

  7. Predicted secondary structure similarity in the absence of primary amino acid sequence homology: hepatitis B virus open reading frames.

    PubMed Central

    Schaeffer, E; Sninsky, J J

    1984-01-01

    Proteins that are related evolutionarily may have diverged at the level of primary amino acid sequence while maintaining similar secondary structures. Computer analysis has been used to compare the open reading frames of the hepatitis B virus to those of the woodchuck hepatitis virus at the level of amino acid sequence, and to predict the relative hydrophilic character and the secondary structure of putative polypeptides. Similarity is seen at the levels of relative hydrophilicity and secondary structure, in the absence of sequence homology. These data reinforce the proposal that these open reading frames encode viral proteins. Computer analysis of this type can be more generally used to establish structural similarities between proteins that do not share obvious sequence homology as well as to assess whether an open reading frame is fortuitous or codes for a protein. PMID:6585835

  8. Nucleotide sequence of the gene encoding the nitrogenase iron protein of Thiobacillus ferrooxidans

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Pretorius, I.M.; Rawlings, D.E.; O'Neill, E.G.

    1987-01-01

    The DNA sequence was determined for the cloned Thiobacillus ferrooxidans nifH and part of the nifD genes. The DNA chains were radiolabeled with (..cap alpha..-/sup 32/P)dCTP (3000 Ci/mmol) or (..cap alpha..-/sup 35/S)dCTP (400 Ci/mmol). A putative T. ferrooxidans nifH promoter was identified whose sequences showed perfect consensus with those of the Klebsiella pneumoniae nif promoter. Two putative consensus upstream activator sequences were also identified. The amino acid sequence was deduced from the DNA sequence. In a comparison of nifH DNA sequences from T. ferrooxidans and eight other nitrogen-fixing microbes, a Rhizobium sp. isolated from Parasponia andersonii showed the greatest homologymore » (74%) and Clostridium pasteurianum (nifH1) showed the least homology (54%). In the comparison of the amino acid sequences of the Fe proteins, the Rhizobium sp. and Rhizobium japonicum showed the greatest homology (both 86%) and C. pasteurianum (nifH1 gene product) demonstrated the least homology (56%) to the T. ferrooxidans Fe protein.« less

  9. Using peptide array to identify binding motifs and interaction networks for modular domains.

    PubMed

    Li, Shawn S-C; Wu, Chenggang

    2009-01-01

    Specific protein-protein interactions underlie all essential biological processes and form the basis of cellular signal transduction. The recognition of a short, linear peptide sequence in one protein by a modular domain in another represents a common theme of macromolecular recognition in cells, and the importance of this mode of protein-protein interaction is highlighted by the large number of peptide-binding domains encoded by the human genome. This phenomenon also provides a unique opportunity to identify protein-protein binding events using peptide arrays and complementary biochemical assays. Accordingly, high-density peptide array has emerged as a useful tool by which to map domain-mediated protein-protein interaction networks at the proteome level. Using the Src-homology 2 (SH2) and 3 (SH3) domains as examples, we describe the application of oriented peptide array libraries in uncovering specific motifs recognized by an SH2 domain and the use of high-density peptide arrays in identifying interaction networks mediated by the SH3 domain. Methods reviewed here could also be applied to other modular domains, including catalytic domains, that recognize linear peptide sequences.

  10. Detection and localisation of protein-protein interactions in Saccharomyces cerevisiae using a split-GFP method.

    PubMed

    Barnard, Emma; McFerran, Neil V; Trudgett, Alan; Nelson, John; Timson, David J

    2008-05-01

    An alternative method for monitoring protein-protein interactions in Saccharomyces cerevisiae has been developed. It relies on the ability of two fragments of enhanced green fluorescent protein (EGFP) to reassemble and fluoresce when fused to interacting proteins. Since this fluorescence can be detected in living cells, simultaneous detection and localisation of interacting pairs is possible. DNA sequences encoding N- and C-terminal EGFP fragments flanked by sequences from the genes of interest were transformed into S. cerevisiae JPY5 cells and homologous recombination into the genome verified by PCR. The system was evaluated by testing known interacting proteins: labelling of the phosphofructokinase subunits, Pfk1p and Pfk2p, with N- and C-terminal EGFP fragments, respectively, resulted in green fluorescence in the cytoplasm. The system works in other cellular compartments: labelling of Idh1p and Idh2p (mitochondrial matrix), Sdh3p and Sdh4p (mitochondrial membrane) and Pap2p and Mtr4p (nucleus) all resulted in fluorescence in the appropriate cellular compartment.

  11. Bacterial RecA Protein Promotes Adenoviral Recombination during In Vitro Infection

    PubMed Central

    Lee, Jeong Yoon; Lee, Ji Sun; Materne, Emma C.; Rajala, Rahul; Ismail, Ashrafali M.; Seto, Donald; Dyer, David W.

    2018-01-01

    ABSTRACT Adenovirus infections in humans are common and sometimes lethal. Adenovirus-derived vectors are also commonly chosen for gene therapy in human clinical trials. We have shown in previous work that homologous recombination between adenoviral genomes of human adenovirus species D (HAdV-D), the largest and fastest growing HAdV species, is responsible for the rapid evolution of this species. Because adenovirus infection initiates in mucosal epithelia, particularly at the gastrointestinal, respiratory, genitourinary, and ocular surfaces, we sought to determine a possible role for mucosal microbiota in adenovirus genome diversity. By analysis of known recombination hot spots across 38 human adenovirus genomes in species D (HAdV-D), we identified nucleotide sequence motifs similar to bacterial Chi sequences, which facilitate homologous recombination in the presence of bacterial Rec enzymes. These motifs, referred to here as ChiAD, were identified immediately 5′ to the sequence encoding penton base hypervariable loop 2, which expresses the arginine-glycine-aspartate moiety critical to adenoviral cellular entry. Coinfection with two HAdV-Ds in the presence of an Escherichia coli lysate increased recombination; this was blocked in a RecA mutant strain, E. coli DH5α, or upon RecA depletion. Recombination increased in the presence of E. coli lysate despite a general reduction in viral replication. RecA colocalized with viral DNA in HAdV-D-infected cell nuclei and was shown to bind specifically to ChiAD sequences. These results indicate that adenoviruses may repurpose bacterial recombination machinery, a sharing of evolutionary mechanisms across a diverse microbiota, and unique example of viral commensalism. IMPORTANCE Adenoviruses are common human mucosal pathogens of the gastrointestinal, respiratory, and genitourinary tracts and ocular surface. Here, we report finding Chi-like sequences in adenovirus recombination hot spots. Adenovirus coinfection in the presence of bacterial RecA protein facilitated homologous recombination between viruses. Genetic recombination led to evolution of an important external feature on the adenoviral capsid, namely, the penton base protein hypervariable loop 2, which contains the arginine-glycine-aspartic acid motif critical to viral internalization. We speculate that free Rec proteins present in gastrointestinal secretions upon bacterial cell death facilitate the evolution of human adenoviruses through homologous recombination, an example of viral commensalism and the complexity of virus-host interactions, including regional microbiota. PMID:29925671

  12. ComplexContact: a web server for inter-protein contact prediction using deep learning.

    PubMed

    Zeng, Hong; Wang, Sheng; Zhou, Tianming; Zhao, Feifeng; Li, Xiufeng; Wu, Qing; Xu, Jinbo

    2018-05-22

    ComplexContact (http://raptorx2.uchicago.edu/ComplexContact/) is a web server for sequence-based interfacial residue-residue contact prediction of a putative protein complex. Interfacial residue-residue contacts are critical for understanding how proteins form complex and interact at residue level. When receiving a pair of protein sequences, ComplexContact first searches for their sequence homologs and builds two paired multiple sequence alignments (MSA), then it applies co-evolution analysis and a CASP-winning deep learning (DL) method to predict interfacial contacts from paired MSAs and visualizes the prediction as an image. The DL method was originally developed for intra-protein contact prediction and performed the best in CASP12. Our large-scale experimental test further shows that ComplexContact greatly outperforms pure co-evolution methods for inter-protein contact prediction, regardless of the species.

  13. Interactions among Trypanosoma brucei RAD51 paralogues in DNA repair and antigenic variation

    PubMed Central

    Dobson, Rachel; Stockdale, Christopher; Lapsley, Craig; Wilkes, Jonathan; McCulloch, Richard

    2011-01-01

    Homologous recombination in Trypanosoma brucei is used for moving variant surface glycoprotein (VSG) genes into expression sites during immune evasion by antigenic variation. A major route for such VSG switching is gene conversion reactions in which RAD51, a universally conserved recombinase, catalyses homology-directed strand exchange. In any eukaryote, RAD51-directed strand exchange in vivo is mediated by further factors, including RAD51-related proteins termed Rad51 paralogues. These appear to be ubiquitously conserved, although their detailed roles in recombination remain unclear. In T. brucei, four putative RAD51 paralogue genes have been identified by sequence homology. Here we show that all four RAD51 paralogues act in DNA repair, recombination and RAD51 subnuclear dynamics, though not equivalently, while mutation of only one RAD51 paralogue gene significantly impedes VSG switching. We also show that the T. brucei RAD51 paralogues interact, and that the complexes they form may explain the distinct phenotypes of the mutants as well as observed expression interdependency. Finally, we document the Rad51 paralogues that are encoded by a wide range of protists, demonstrating that the Rad51 paralogue repertoire in T. brucei is unusually large among microbial eukaryotes and that one member of the protein family corresponds with a key, conserved eukaryotic Rad51 paralogue. PMID:21615552

  14. HIP1, a human homologue of S. cerevisiae Sla2p, interacts with membrane-associated huntingtin in the brain.

    PubMed

    Kalchman, M A; Koide, H B; McCutcheon, K; Graham, R K; Nichol, K; Nishiyama, K; Kazemi-Esfarjani, P; Lynn, F C; Wellington, C; Metzler, M; Goldberg, Y P; Kanazawa, I; Gietz, R D; Hayden, M R

    1997-05-01

    Huntington disease (HD) is associated with the expansion of a polyglutamine tract, greater than 35 repeats, in the HD gene product, huntingtin. Here we describe a novel huntingtin interacting protein, HIP1, which co-localizes with huntingtin and shares sequence homology and biochemical characteristics with Sla2p, a protein essential for function of the cytoskeleton in Saccharomyces cerevisiae. The huntingtin-HIP1 interaction is restricted to the brain and is inversely correlated to the polyglutamine length in huntingtin. This provides the first molecular link between huntingtin and the neuronal cytoskeleton and suggests that, in HD, loss of normal huntingtin-HIP1 interaction may contribute to a defect in membrane-cytoskeletal integrity in the brain.

  15. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ryan, Q.C.

    There are two nonallelic human {gamma} globin genes located on the short arm of chromosome No. 11 in the order 5{prime}-{sup G}{sub {gamma}}-{sup A}{sub {gamma}}-3{prime}. Various modifications of the two {gamma} genes have been reported and include: deletions, triplications, quadruplications and recently a quintuplication. These are generally created by one or more unequal crossovers in the {gamma} globin gene regions on adjacent chromosomes. During the course of looking for a {gamma}{sup {degree}} thalassemia, which might be due to a crossover of looking for a {gamma} genes, two cases were found in the family W. Bgl II mapping studies showed amore » 5 kb deletion at the {gamma} gene loci in these individuals. The Bgl II fragment from the {gamma} gene loci of R.W. was cloned into the phage vector QR1. Phage mapping showed that two out of the three Pst I sites within the Bgl II fragment were missing which suggested that the crossover might have occurred within the {gamma} gene, possibly within the {gamma}IVS II region. Sequence analysis of the cloned fragment revealed an unusual sequence which had no sequence homology with the {gamma} gene region except for a small 264 bp region near the 3{prime} end. The orientation of the 264 bp fragment is inverted relative to homologous sequences in the {sup G}{sub {gamma}} and {sup A}{sub {gamma}} IVS II. The unusual sequence was computer analyzed for homology with every DNA sequence file in the EMBL database and GenBank and did not show any significant homologies to all the available DNA sequences except for the 264 bp {gamma}IVS II homology.« less

  16. [Bioinformatics Analysis of Clustered Regularly Interspaced Short Palindromic Repeats in the Genomes of Shigella].

    PubMed

    Wang, Pengfei; Wang, Yingfang; Duan, Guangcai; Xue, Zerun; Wang, Linlin; Guo, Xiangjiao; Yang, Haiyan; Xi, Yuanlin

    2015-04-01

    This study was aimed to explore the features of clustered regularly interspaced short palindromic repeats (CRISPR) structures in Shigella by using bioinformatics. We used bioinformatics methods, including BLAST, alignment and RNA structure prediction, to analyze the CRISPR structures of Shigella genomes. The results showed that the CRISPRs existed in the four groups of Shigella, and the flanking sequences of upstream CRISPRs could be classified into the same group with those of the downstream. We also found some relatively conserved palindromic motifs in the leader sequences. Repeat sequences had the same group with corresponding flanking sequences, and could be classified into two different types by their RNA secondary structures, which contain "stem" and "ring". Some spacers were found to homologize with part sequences of plasmids or phages. The study indicated that there were correlations between repeat sequences and flanking sequences, and the repeats might act as a kind of recognition mechanism to mediate the interaction between foreign genetic elements and Cas proteins.

  17. GCView: the genomic context viewer for protein homology searches

    PubMed Central

    Grin, Iwan; Linke, Dirk

    2011-01-01

    Genomic neighborhood can provide important insights into evolution and function of a protein or gene. When looking at operons, changes in operon structure and composition can only be revealed by looking at the operon as a whole. To facilitate the analysis of the genomic context of a query in multiple organisms we have developed Genomic Context Viewer (GCView). GCView accepts results from one or multiple protein homology searches such as BLASTp as input. For each hit, the neighboring protein-coding genes are extracted, the regions of homology are labeled for each input and the results are presented as a clear, interactive graphical output. It is also possible to add more searches to iteratively refine the output. GCView groups outputs by the hits for different proteins. This allows for easy comparison of different operon compositions and structures. The tool is embedded in the framework of the Bioinformatics Toolkit of the Max-Planck Institute for Developmental Biology (MPI Toolkit). Job results from the homology search tools inside the MPI Toolkit can be forwarded to GCView and results can be subsequently analyzed by sequence analysis tools. Results are stored online, allowing for later reinspection. GCView is freely available at http://toolkit.tuebingen.mpg.de/gcview. PMID:21609955

  18. HIV-1 Nef binds with human GCC185 protein and regulates mannose 6 phosphate receptor recycling

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kumar, Manjeet; Kaur, Supinder; Nazir, Aamir

    HIV-1 Nef modulates cellular function that enhances viral replication in vivo which culminate into AIDS pathogenesis. With no enzymatic activity, Nef regulates cellular function through host protein interaction. Interestingly, trans-cellular introduction of recombinant Nef protein in Caenorhabditis elegans results in AIDS like pathogenesis which might share common pathophysiology because the gene sequence of C. elegans and humans share considerable homology. Therefore employing C. elegans based initial screen complemented with sequence based homology search we identified GCC185 as novel host protein interacting with HIV-1 Nef. The detailed molecular characterization revealed N-terminal EEEE{sub 65} acidic domain of Nef as key region for interaction. GCC185 ismore » a tethering protein that binds with Rab9 transport vesicles. Our results show that Nef-GCC185 interaction disrupts Rab9 interaction resulting in delocalization of CI-MPR (cation independent Mannose 6 phosphate receptor) resulting in elevated secretion of hexosaminidase. In agreement with this, our studies identified novel host GCC185 protein that interacts with Nef EEEE65 acidic domain interfering GCC185-Rab9 vesicle membrane fusion responsible for retrograde vesicular transport of CI-MPR from late endosomes to TGN. In light of existing report suggesting critical role of Nef-GCC185 interaction reveals valuable mechanistic insights affecting specific protein transport pathway in docking of late endosome derived Rab9 bearing transport vesicle at TGN elucidating role of Nef during viral pathogenesis. -- Highlights: •Nef, an accessory protein of HIV-1 interacts with host factor and culminates into AIDS pathogenesis. •Using Caenorhabditis elegans based screen system, novel Nef interacting cellular protein GCC185 was identified. •Molecular characterization of Nef and human protein GCC185 revealed Nef EEEE{sub 65} key region interacted with full length GCC185. •Nef impeded the GCC185-Rab 9 interaction and perturb the mannose 6 phosphate receptor recycling. •Our study identified novel Nef interacting human GCC185 protein and their role regulation of M6P receptor recycling.« less

  19. Historical perspectives on tumor necrosis factor and its superfamily: 25 years later, a golden journey

    PubMed Central

    Gupta, Subash C.; Kim, Ji Hye

    2012-01-01

    Although activity that induced tumor regression was observed and termed tumor necrosis factor (TNF) as early as the 1960s, the true identity of TNF was not clear until 1984, when Aggarwal and coworkers reported, for the first time, the isolation of 2 cytotoxic factors: one, derived from macrophages (molecular mass 17 kDa), was named TNF, and the second, derived from lymphocytes (20 kDa), was named lymphotoxin. Because the 2 cytotoxic factors exhibited 50% amino acid sequence homology and bound to the same receptor, they came to be called TNF-α and TNF-β. Identification of the protein sequences led to cloning of their cDNA. Based on sequence homology to TNF-α, now a total of 19 members of the TNF superfamily have been identified, along with 29 interacting receptors, and several molecules that interact with the cytoplasmic domain of these receptors. The roles of the TNF superfamily in inflammation, apoptosis, proliferation, invasion, angiogenesis, metastasis, and morphogenesis have been documented. Their roles in immunologic, cardiovascular, neurologic, pulmonary, and metabolic diseases are becoming apparent. TNF superfamily members are active targets for drug development, as indicated by the recent approval and expanding market of TNF blockers used to treat rheumatoid arthritis, psoriasis, Crohns disease, and osteoporosis, with a total market of more than US $20 billion. As we learn more about this family, more therapeutics will probably emerge. In this review, we summarize the initial discovery of TNF-α, and the insights gained regarding the roles of this molecule and its related family members in normal physiology and disease. PMID:22053109

  20. Single-cell template strand sequencing by Strand-seq enables the characterization of individual homologs.

    PubMed

    Sanders, Ashley D; Falconer, Ester; Hills, Mark; Spierings, Diana C J; Lansdorp, Peter M

    2017-06-01

    The ability to distinguish between genome sequences of homologous chromosomes in single cells is important for studies of copy-neutral genomic rearrangements (such as inversions and translocations), building chromosome-length haplotypes, refining genome assemblies, mapping sister chromatid exchange events and exploring cellular heterogeneity. Strand-seq is a single-cell sequencing technology that resolves the individual homologs within a cell by restricting sequence analysis to the DNA template strands used during DNA replication. This protocol, which takes up to 4 d to complete, relies on the directionality of DNA, in which each single strand of a DNA molecule is distinguished based on its 5'-3' orientation. Culturing cells in a thymidine analog for one round of cell division labels nascent DNA strands, allowing for their selective removal during genomic library construction. To preserve directionality of template strands, genomic preamplification is bypassed and labeled nascent strands are nicked and not amplified during library preparation. Each single-cell library is multiplexed for pooling and sequencing, and the resulting sequence data are aligned, mapping to either the minus or plus strand of the reference genome, to assign template strand states for each chromosome in the cell. The major adaptations to conventional single-cell sequencing protocols include harvesting of daughter cells after a single round of BrdU incorporation, bypassing of whole-genome amplification, and removal of the BrdU + strand during Strand-seq library preparation. By sequencing just template strands, the structure and identity of each homolog are preserved.

  1. Phospholipase Cβ1 induces membrane tubulation and is involved in caveolae formation

    PubMed Central

    Inaba, Takehiko; Kishimoto, Takuma; Murate, Motohide; Tajima, Takuya; Sakai, Shota; Abe, Mitsuhiro; Makino, Asami; Tomishige, Nario; Ishitsuka, Reiko; Ikeda, Yasuo; Takeoka, Shinji; Kobayashi, Toshihide

    2016-01-01

    Lipid membrane curvature plays important roles in various physiological phenomena. Curvature-regulated dynamic membrane remodeling is achieved by the interaction between lipids and proteins. So far, several membrane sensing/sculpting proteins, such as Bin/amphiphysin/Rvs (BAR) proteins, are reported, but there remains the possibility of the existence of unidentified membrane-deforming proteins that have not been uncovered by sequence homology. To identify new lipid membrane deformation proteins, we applied liposome-based microscopic screening, using unbiased-darkfield microscopy. Using this method, we identified phospholipase Cβ1 (PLCβ1) as a new candidate. PLCβ1 is well characterized as an enzyme catalyzing the hydrolysis of phosphatidylinositol-4,5-bisphosphate (PIP2). In addition to lipase activity, our results indicate that PLCβ1 possessed the ability of membrane tubulation. Lipase domains and inositol phospholipids binding the pleckstrin homology (PH) domain of PLCβ1 were not involved, but the C-terminal sequence was responsible for this tubulation activity. Computational modeling revealed that the C terminus displays the structural homology to the BAR domains, which is well known as a membrane sensing/sculpting domain. Overexpression of PLCβ1 caused plasma membrane tubulation, whereas knockdown of the protein reduced the number of caveolae and induced the evagination of caveolin-rich membrane domains. Taken together, our results suggest a new function of PLCβ1: plasma membrane remodeling, and in particular, caveolae formation. PMID:27342861

  2. Sequence basis of Barnacle Cement Nanostructure is Defined by Proteins with Silk Homology

    NASA Astrophysics Data System (ADS)

    So, Christopher R.; Fears, Kenan P.; Leary, Dagmar H.; Scancella, Jenifer M.; Wang, Zheng; Liu, Jinny L.; Orihuela, Beatriz; Rittschof, Dan; Spillmann, Christopher M.; Wahl, Kathryn J.

    2016-11-01

    Barnacles adhere by producing a mixture of cement proteins (CPs) that organize into a permanently bonded layer displayed as nanoscale fibers. These cement proteins share no homology with any other marine adhesives, and a common sequence-basis that defines how nanostructures function as adhesives remains undiscovered. Here we demonstrate that a significant unidentified portion of acorn barnacle cement is comprised of low complexity proteins; they are organized into repetitive sequence blocks and found to maintain homology to silk motifs. Proteomic analysis of aggregate bands from PAGE gels reveal an abundance of Gly/Ala/Ser/Thr repeats exemplified by a prominent, previously unidentified, 43 kDa protein in the solubilized adhesive. Low complexity regions found throughout the cement proteome, as well as multiple lysyl oxidases and peroxidases, establish homology with silk-associated materials such as fibroin, silk gum sericin, and pyriform spidroins from spider silk. Distinct primary structures defined by homologous domains shed light on how barnacles use low complexity in nanofibers to enable adhesion, and serves as a starting point for unraveling the molecular architecture of a robust and unique class of adhesive nanostructures.

  3. Chemical property based sequence characterization of PpcA and its homolog proteins PpcB-E: A mathematical approach

    PubMed Central

    Pal Choudhury, Pabitra

    2017-01-01

    Periplasmic c7 type cytochrome A (PpcA) protein is determined in Geobacter sulfurreducens along with its other four homologs (PpcB-E). From the crystal structure viewpoint the observation emerges that PpcA protein can bind with Deoxycholate (DXCA), while its other homologs do not. But it is yet to be established with certainty the reason behind this from primary protein sequence information. This study is primarily based on primary protein sequence analysis through the chemical basis of embedded amino acids. Firstly, we look for the chemical group specific score of amino acids. Along with this, we have developed a new methodology for the phylogenetic analysis based on chemical group dissimilarities of amino acids. This new methodology is applied to the cytochrome c7 family members and pinpoint how a particular sequence is differing with others. Secondly, we build a graph theoretic model on using amino acid sequences which is also applied to the cytochrome c7 family members and some unique characteristics and their domains are highlighted. Thirdly, we search for unique patterns as subsequences which are common among the group or specific individual member. In all the cases, we are able to show some distinct features of PpcA that emerges PpcA as an outstanding protein compared to its other homologs, resulting towards its binding with deoxycholate. Similarly, some notable features for the structurally dissimilar protein PpcD compared to the other homologs are also brought out. Further, the five members of cytochrome family being homolog proteins, they must have some common significant features which are also enumerated in this study. PMID:28362850

  4. The impact of CRISPR repeat sequence on structures of a Cas6 protein-RNA complex

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wang, Ruiying; Zheng, Han; Preamplume, Gan

    The repeat-associated mysterious proteins (RAMPs) comprise the most abundant family of proteins involved in prokaryotic immunity against invading genetic elements conferred by the clustered regularly interspaced short palindromic repeat (CRISPR) system. Cas6 is one of the first characterized RAMP proteins and is a key enzyme required for CRISPR RNA maturation. Despite a strong structural homology with other RAMP proteins that bind hairpin RNA, Cas6 distinctly recognizes single-stranded RNA. Previous structural and biochemical studies show that Cas6 captures the 5' end while cleaving the 3' end of the CRISPR RNA. Here, we describe three structures and complementary biochemical analysis of amore » noncatalytic Cas6 homolog from Pyrococcus horikoshii bound to CRISPR repeat RNA of different sequences. Our study confirms the specificity of the Cas6 protein for single-stranded RNA and further reveals the importance of the bases at Positions 5-7 in Cas6-RNA interactions. Substitutions of these bases result in structural changes in the protein-RNA complex including its oligomerization state.« less

  5. Homologous recombination within the capsid gene of porcine circovirus type 2 subgroup viruses via natural co-infection

    USDA-ARS?s Scientific Manuscript database

    Several studies had reported homologous recombination between porcine circovirus type 2 (PCV2)-group 1 (Gp1) and -group 2 (Gp2) viruses. Interestingly, the recombination events described thus far mapped either within the Rep gene sequences or the sequences flanking the Rep gene region. Previously, ...

  6. Homology and the optimization of DNA sequence data

    NASA Technical Reports Server (NTRS)

    Wheeler, W.

    2001-01-01

    Three methods of nucleotide character analysis are discussed. Their implications for molecular sequence homology and phylogenetic analysis are compared. The criterion of inter-data set congruence, both character based and topological, are applied to two data sets to elucidate and potentially discriminate among these parsimony-based ideas. c2001 The Willi Hennig Society.

  7. Establishing homologies in protein sequences

    NASA Technical Reports Server (NTRS)

    Dayhoff, M. O.; Barker, W. C.; Hunt, L. T.

    1983-01-01

    Computer-based statistical techniques used to determine homologies between proteins occurring in different species are reviewed. The technique is based on comparison of two protein sequences, either by relating all segments of a given length in one sequence to all segments of the second or by finding the best alignment of the two sequences. Approaches discussed include selection using printed tabulations, identification of very similar sequences, and computer searches of a database. The use of the SEARCH, RELATE, and ALIGN programs (Dayhoff, 1979) is explained; sample data are presented in graphs, diagrams, and tables and the construction of scoring matrices is considered.

  8. Complete genome sequence analysis of a duck circovirus from Guangxi pockmark ducks.

    PubMed

    Xie, Liji; Xie, Zhixun; Zhao, Guangyuan; Liu, Jiabo; Pang, Yaoshan; Deng, Xianwen; Xie, Zhiqin; Fan, Qing

    2012-12-01

    We report here the complete genomic sequence of a novel duck circovirus (DuCV) strain, GX1104, isolated from Guangxi pockmark ducks in Guangxi, China. The whole nucleotide sequence had the highest homology (97.2%) with the sequence of strain TC/2002 (GenBank accession number AY394721.1) and had a low homology (76.8% to 78.6%) with the sequences of other strains isolated from China, Germany, and the United States. This report will help to understand the epidemiology and molecular characteristics of Guangxi pockmark duck circovirus in southern China.

  9. Invariant glycines and prolines flanking in loops the strand beta 2 of various (alpha/beta)8-barrel enzymes: a hidden homology?

    PubMed Central

    Janecek, S.

    1996-01-01

    The question of parallel (alpha/beta)8-barrel fold evolution remains unclear, owing mainly to the lack of sequence homology throughout the amino acid sequences of (alpha/beta)8-barrel enzymes. The "classical" approaches used in the search for homologies among (alpha/beta)8-barrels (e.g., production of structurally based alignments) have yielded alignments perfect from the structural point of view, but the approaches have been unable to reveal the homologies. These are proposed to be "hidden" in (alpha/beta)8-barrel enzymes. The term "hidden homology" means that the alignment of sequence stretches proposed to be homologous need not be structurally fully satisfactory. This is due to the very long evolutionary history of all (alpha/beta)8-barrels. This work identifies so-called hidden homology around the strand beta 2 that is flanked by loops containing invariant glycines and prolines in 17 different (alpha/beta)8-barrel enzymes, i.e., roughly in half of all currently known (alpha/beta)8-barrel proteins. The search was based on the idea that a conserved sequence region of an (alpha/beta)8-barrel enzyme should be more or less conserved also in the equivalent part of the structure of the other enzymes with this folding motif, given their mutual evolutionary relatedness. For this purpose, the sequence region around the well-conserved second beta-strand of alpha-amylase flanked by the invariant glycine and proline (56_GFTAIWITP, Aspergillus oryzae alpha-amylase numbering), was used as the sequence-structural template. The proposal that the second beta-strand of (alpha/beta)8-barrel fold is important from the evolutionary point of view is strongly supported by the increasing trend of the observed beta 2-strand structural similarity for the pairs of (alpha/beta)8-barrel enzymes: alpha-amylase and the alpha-subunit of tryptophan synthase, alpha-amylase and mandelate racemase, and alpha-amylase and cyclodextrin glycosyltransferase. This trend is also in agreement with the existing evolutionary division of the entire family of (alpha/beta)8-barrel proteins. PMID:8762144

  10. Invariant glycines and prolines flanking in loops the strand beta 2 of various (alpha/beta)8-barrel enzymes: a hidden homology?

    PubMed

    Janecek, S

    1996-06-01

    The question of parallel (alpha/beta)8-barrel fold evolution remains unclear, owing mainly to the lack of sequence homology throughout the amino acid sequences of (alpha/beta)8-barrel enzymes. The "classical" approaches used in the search for homologies among (alpha/beta)8-barrels (e.g., production of structurally based alignments) have yielded alignments perfect from the structural point of view, but the approaches have been unable to reveal the homologies. These are proposed to be "hidden" in (alpha/beta)8-barrel enzymes. The term "hidden homology" means that the alignment of sequence stretches proposed to be homologous need not be structurally fully satisfactory. This is due to the very long evolutionary history of all (alpha/beta)8-barrels. This work identifies so-called hidden homology around the strand beta 2 that is flanked by loops containing invariant glycines and prolines in 17 different (alpha/beta)8-barrel enzymes, i.e., roughly in half of all currently known (alpha/beta)8-barrel proteins. The search was based on the idea that a conserved sequence region of an (alpha/beta)8-barrel enzyme should be more or less conserved also in the equivalent part of the structure of the other enzymes with this folding motif, given their mutual evolutionary relatedness. For this purpose, the sequence region around the well-conserved second beta-strand of alpha-amylase flanked by the invariant glycine and proline (56_GFTAIWITP, Aspergillus oryzae alpha-amylase numbering), was used as the sequence-structural template. The proposal that the second beta-strand of (alpha/beta)8-barrel fold is important from the evolutionary point of view is strongly supported by the increasing trend of the observed beta 2-strand structural similarity for the pairs of (alpha/beta)8-barrel enzymes: alpha-amylase and the alpha-subunit of tryptophan synthase, alpha-amylase and mandelate racemase, and alpha-amylase and cyclodextrin glycosyltransferase. This trend is also in agreement with the existing evolutionary division of the entire family of (alpha/beta)8-barrel proteins.

  11. Reassociation and hybridization properties of DNAs from several species of fish

    USGS Publications Warehouse

    Gharrett, A.J.; Simon, R.C.; McIntyre, J.D.

    1977-01-01

    Reassociation and hybridization properties from spectrophotometric studies of DNAs from 10 species of fish indicate:1. Great diversity in the amounts of repeated sequences in the genomes of different species - more specialized fish had less redundancy.2. Large differences in the complexities of the DNAs - more specialized fish had less information.3. Little homology between sequences of remotely related species but substantial homology between sequences of closely related species.

  12. A Symplectic Instanton Homology via Traceless Character Varieties

    NASA Astrophysics Data System (ADS)

    Horton, Henry T.

    Since its inception, Floer homology has been an important tool in low-dimensional topology. Floer theoretic invariants of 3-manifolds tend to be either gauge theoretic or symplecto-geometric in nature, and there is a general philosophy that each gauge theoretic Floer homology should have a corresponding symplectic Floer homology and vice-versa. In this thesis, we construct a Lagrangian Floer invariant for any closed, oriented 3-manifold Y (called the symplectic instanton homology of Y and denoted SI(Y)) which is conjecturally equivalent to a Floer homology defined using a certain variant of Yang-Mills gauge theory. The crucial ingredient for defining SI( Y) is the use of traceless character varieties in the symplectic setting, which allow us to avoid the debilitating technical hurdles present when one attempts to define a symplectic version of instanton Floer homologies. Floer theories are also expected to roughly satisfy the axioms of a topological quantum field theory (TQFT), and furthermore Dehn surgeries on knots should induce exact triangles of Floer homologies. Following a strategy used by Ozsvath and Szabo in the context of Heegaard Floer homology, we prove that our theory is functorial with respect to connected 4-dimensional cobordisms, so that cobordisms induce homomorphisms between symplectic instanton homologies. By studying the effect of Dehn surgeries on traceless character varieties, we establish a surgery exact triangle using work of Seidel that relates the geometry of Lefschetz fibrations with exact triangles in Lagrangian Floer theory. We further prove that Dehn surgeries on a link L in a 3-manifold Y induce a spectral sequence of symplectic instanton homologies - the E2-page is isomorphic to a direct sum of symplectic instanton homologies of all possible combinations of 0- and 1-surgeries on the components of L, and the spectral sequence converges to SI(Y). For the branched double cover Sigma(L) of a link L in S3, we show there is a link surgery spectral sequence whose E 2-page is isomorphic to the reduced Khovanov homology of L and which converges to the symplectic instanton homology of Sigma( L).

  13. Evidence for the presence of key chlorophyll-biosynthesis-related proteins in the genus Rubrobacter (Phylum Actinobacteria) and its implications for the evolution and origin of photosynthesis.

    PubMed

    Gupta, Radhey S; Khadka, Bijendra

    2016-02-01

    Homologs showing high degree of sequence similarity to the three subunits of the protochlorophyllide oxidoreductase enzyme complex (viz. BchL, BchN, and BchB), which carries out a central role in chlorophyll-bacteriochlorophyll (Bchl) biosynthesis, are uniquely found in photosynthetic organisms. The results of BLAST searches and homology modeling presented here show that proteins exhibiting a high degree of sequence and structural similarity to the BchB and BchN proteins are also present in organisms from the high G+C Gram-positive phylum of Actinobacteria, specifically in members of the genus Rubrobacter (R. x ylanophilus and R. r adiotolerans). The results presented exclude the possibility that the observed BLAST hits are for subunits of the nitrogenase complex or the chlorin reductase complex. The branching in phylogenetic trees and the sequence characteristics of the Rubrobacter BchB/BchN homologs indicate that these homologs are distinct from those found in other photosynthetic bacteria and that they may represent ancestral forms of the BchB/BchN proteins. Although a homolog showing high degree of sequence similarity to the BchL protein was not detected in Rubrobacter, another protein, belonging to the ParA/Soj/MinD family, present in these bacteria, exhibits high degree of structural similarity to the BchL. In addition to the BchB/BchN homologs, Rubrobacter species also contain homologs showing high degree of sequence similarity to different subunits of magnesium chelatase (BchD, BchH, and BchI) as well as proteins showing significant similarity to the BchP and BchG proteins. Interestingly, no homologs corresponding to the BchX, BchY, and BchZ proteins were detected in the Rubrobacter species. These results provide the first suggestive evidence that some form of photosynthesis either exists or was anciently present within the phylum Actinobacteria (high G+C Gram-positive) in members of the genus Rubrobacter. The significance of these results concerning the origin of the Bchl-based photosynthesis is also discussed.

  14. Gene Discovery through Genomic Sequencing of Brucella abortus

    PubMed Central

    Sánchez, Daniel O.; Zandomeni, Ruben O.; Cravero, Silvio; Verdún, Ramiro E.; Pierrou, Ester; Faccio, Paula; Diaz, Gabriela; Lanzavecchia, Silvia; Agüero, Fernán; Frasch, Alberto C. C.; Andersson, Siv G. E.; Rossetti, Osvaldo L.; Grau, Oscar; Ugalde, Rodolfo A.

    2001-01-01

    Brucella abortus is the etiological agent of brucellosis, a disease that affects bovines and human. We generated DNA random sequences from the genome of B. abortus strain 2308 in order to characterize molecular targets that might be useful for developing immunological or chemotherapeutic strategies against this pathogen. The partial sequencing of 1,899 clones allowed the identification of 1,199 genomic sequence surveys (GSSs) with high homology (BLAST expect value < 10−5) to sequences deposited in the GenBank databases. Among them, 925 represent putative novel genes for the Brucella genus. Out of 925 nonredundant GSSs, 470 were classified in 15 categories based on cellular function. Seven hundred GSSs showed no significant database matches and remain available for further studies in order to identify their function. A high number of GSSs with homology to Agrobacterium tumefaciens and Rhizobium meliloti proteins were observed, thus confirming their close phylogenetic relationship. Among them, several GSSs showed high similarity with genes related to nodule nitrogen fixation, synthesis of nod factors, nodulation protein symbiotic plasmid, and nodule bacteroid differentiation. We have also identified several B. abortus homologs of virulence and pathogenesis genes from other pathogens, including a homolog to both the Shda gene from Salmonella enterica serovar Typhimurium and the AidA-1 gene from Escherichia coli. Other GSSs displayed significant homologies to genes encoding components of the type III and type IV secretion machineries, suggesting that Brucella might also have an active type III secretion machinery. PMID:11159979

  15. Combined sequence and structure analysis of the fungal laccase family.

    PubMed

    Kumar, S V Suresh; Phale, Prashant S; Durani, S; Wangikar, Pramod P

    2003-08-20

    Plant and fungal laccases belong to the family of multi-copper oxidases and show much broader substrate specificity than other members of the family. Laccases have consequently been of interest for potential industrial applications. We have analyzed the essential sequence features of fungal laccases based on multiple sequence alignments of more than 100 laccases. This has resulted in identification of a set of four ungapped sequence regions, L1-L4, as the overall signature sequences that can be used to identify the laccases, distinguishing them within the broader class of multi-copper oxidases. The 12 amino acid residues in the enzymes serving as the copper ligands are housed within these four identified conserved regions, of which L2 and L4 conform to the earlier reported copper signature sequences of multi-copper oxidases while L1 and L3 are distinctive to the laccases. The mapping of regions L1-L4 on to the three-dimensional structure of the Coprinus cinerius laccase indicates that many of the non-copper-ligating residues of the conserved regions could be critical in maintaining a specific, more or less C-2 symmetric, protein conformational motif characterizing the active site apparatus of the enzymes. The observed intraprotein homologies between L1 and L3 and between L2 and L4 at both the structure and the sequence levels suggest that the quasi C-2 symmetric active site conformational motif may have arisen from a structural duplication event that neither the sequence homology analysis nor the structure homology analysis alone would have unraveled. Although the sequence and structure homology is not detectable in the rest of the protein, the relative orientation of region L1 with L2 is similar to that of L3 with L4. The structure duplication of first-shell and second-shell residues has become cryptic because the intraprotein sequence homology noticeable for a given laccase becomes significant only after comparing the conservation pattern in several fungal laccases. The identified motifs, L1-L4, can be useful in searching the newly sequenced genomes for putative laccase enzymes. Copyright 2003 Wiley Periodicals, Inc. Biotechnol Bioeng 83: 386-394, 2003.

  16. Homology modeling a fast tool for drug discovery: current perspectives.

    PubMed

    Vyas, V K; Ukawala, R D; Ghate, M; Chintha, C

    2012-01-01

    Major goal of structural biology involve formation of protein-ligand complexes; in which the protein molecules act energetically in the course of binding. Therefore, perceptive of protein-ligand interaction will be very important for structure based drug design. Lack of knowledge of 3D structures has hindered efforts to understand the binding specificities of ligands with protein. With increasing in modeling software and the growing number of known protein structures, homology modeling is rapidly becoming the method of choice for obtaining 3D coordinates of proteins. Homology modeling is a representation of the similarity of environmental residues at topologically corresponding positions in the reference proteins. In the absence of experimental data, model building on the basis of a known 3D structure of a homologous protein is at present the only reliable method to obtain the structural information. Knowledge of the 3D structures of proteins provides invaluable insights into the molecular basis of their functions. The recent advances in homology modeling, particularly in detecting and aligning sequences with template structures, distant homologues, modeling of loops and side chains as well as detecting errors in a model contributed to consistent prediction of protein structure, which was not possible even several years ago. This review focused on the features and a role of homology modeling in predicting protein structure and described current developments in this field with victorious applications at the different stages of the drug design and discovery.

  17. Homology Modeling a Fast Tool for Drug Discovery: Current Perspectives

    PubMed Central

    Vyas, V. K.; Ukawala, R. D.; Ghate, M.; Chintha, C.

    2012-01-01

    Major goal of structural biology involve formation of protein-ligand complexes; in which the protein molecules act energetically in the course of binding. Therefore, perceptive of protein-ligand interaction will be very important for structure based drug design. Lack of knowledge of 3D structures has hindered efforts to understand the binding specificities of ligands with protein. With increasing in modeling software and the growing number of known protein structures, homology modeling is rapidly becoming the method of choice for obtaining 3D coordinates of proteins. Homology modeling is a representation of the similarity of environmental residues at topologically corresponding positions in the reference proteins. In the absence of experimental data, model building on the basis of a known 3D structure of a homologous protein is at present the only reliable method to obtain the structural information. Knowledge of the 3D structures of proteins provides invaluable insights into the molecular basis of their functions. The recent advances in homology modeling, particularly in detecting and aligning sequences with template structures, distant homologues, modeling of loops and side chains as well as detecting errors in a model contributed to consistent prediction of protein structure, which was not possible even several years ago. This review focused on the features and a role of homology modeling in predicting protein structure and described current developments in this field with victorious applications at the different stages of the drug design and discovery. PMID:23204616

  18. RNAi triggered by symmetrically transcribed transgenes in Drosophila melanogaster.

    PubMed Central

    Giordano, Ennio; Rendina, Rosaria; Peluso, Ivana; Furia, Maria

    2002-01-01

    Specific silencing of target genes can be induced in a variety of organisms by providing homologous double-stranded RNA molecules. In vivo, these molecules can be generated either by transcription of sequences having an inverted-repeat (IR) configuration or by simultaneous transcription of sense-antisense strands. Since IR constructs are difficult to prepare and can stimulate genomic rearrangements, we investigated the silencing potential of symmetrically transcribed sequences. We report that Drosophila transgenes whose sense-antisense transcription was driven by two convergent arrays of Gal4-dependent UAS sequences can induce specific, dominant, and heritable repression of target genes. This effect is not dependent on a mechanism based on homology-dependent DNA/DNA interactions, but is directly triggered by transcriptional activation and is accompanied by specific depletion of the endogenous target RNA. Tissue-specific induction of these transgenes restricts the target gene silencing to selected body domains, and spreading phenomena described in other cases of post-transcriptional gene silencing (PTGS) were not observed. In addition to providing an additional tool useful for Drosophila functional genomic analysis, these results add further strength to the view that events of sense-antisense transcription may readily account for some, if not all, PTGS-cosuppression phenomena and can potentially play a relevant role in gene regulation. PMID:11861567

  19. A proteomic map of the unsequenced kala-azar vector Phlebotomus papatasi using cell line.

    PubMed

    Pawar, Harsh; Chavan, Sandip; Mahale, Kiran; Khobragade, Sweta; Kulkarni, Aditi; Patil, Arun; Chaphekar, Deepa; Varriar, Pratyasha; Sudeep, Anakkathil; Pai, Kalpana; Prasad, T S K; Gowda, Harsha; Patole, Milind S

    2015-12-01

    The debilitating disease kala-azar or visceral leishmaniasis is caused by the kinetoplastid protozoan parasite Leishmania donovani. The parasite is transmitted by the hematophagous sand fly vector of the genus Phlebotomus in the old world and Lutzomyia in the new world. The predominant Phlebotomine species associated with the transmission of kala-azar are Phlebotomus papatasi and Phlebotomus argentipes. Understanding the molecular interaction of the sand fly and Leishmania, during the development of parasite within the sand fly gut is crucial to the understanding of the parasite life cycle. The complete genome sequences of sand flies (Phlebotomus and Lutzomyia) are currently not available and this hinders identification of proteins in the sand fly vector. The current study utilizes a three frame translated transcriptomic data of P. papatasi in the absence of genomic sequences to analyze the mass spectrometry data of P. papatasi cell line using a proteogenomic approach. Additionally, we have carried out the proteogenomic analysis of P. papatasi by comparative homology-based searches using related sequenced dipteran protein data. This study resulted in the identification of 1313 proteins from P. papatasi based on homology. Our study demonstrates the power of proteogenomic approaches in mapping the proteomes of unsequenced organisms. Copyright © 2015 Elsevier B.V. All rights reserved.

  20. The PYRIN domain: A member of the death domain-fold superfamily

    PubMed Central

    Fairbrother, Wayne J.; Gordon, Nathaniel C.; Humke, Eric W.; O'Rourke, Karen M.; Starovasnik, Melissa A.; Yin, Jian-Ping; Dixit, Vishva M.

    2001-01-01

    PYRIN domains were identified recently as putative protein–protein interaction domains at the N-termini of several proteins thought to function in apoptotic and inflammatory signaling pathways. The ∼95 residue PYRIN domains have no statistically significant sequence homology to proteins with known three-dimensional structure. Using secondary structure prediction and potential-based fold recognition methods, however, the PYRIN domain is predicted to be a member of the six-helix bundle death domain-fold superfamily that includes death domains (DDs), death effector domains (DEDs), and caspase recruitment domains (CARDs). Members of the death domain-fold superfamily are well established mediators of protein–protein interactions found in many proteins involved in apoptosis and inflammation, indicating further that the PYRIN domains serve a similar function. An homology model of the PYRIN domain of CARD7/DEFCAP/NAC/NALP1, a member of the Apaf-1/Ced-4 family of proteins, was constructed using the three-dimensional structures of the FADD and p75 neurotrophin receptor DDs, and of the Apaf-1 and caspase-9 CARDs, as templates. Validation of the model using a variety of computational techniques indicates that the fold prediction is consistent with the sequence. Comparison of a circular dichroism spectrum of the PYRIN domain of CARD7/DEFCAP/NAC/NALP1 with spectra of several proteins known to adopt the death domain-fold provides experimental support for the structure prediction. PMID:11514682

  1. Restricted N-glycan conformational space in the PDB and its implication in glycan structure modeling.

    PubMed

    Jo, Sunhwan; Lee, Hui Sun; Skolnick, Jeffrey; Im, Wonpil

    2013-01-01

    Understanding glycan structure and dynamics is central to understanding protein-carbohydrate recognition and its role in protein-protein interactions. Given the difficulties in obtaining the glycan's crystal structure in glycoconjugates due to its flexibility and heterogeneity, computational modeling could play an important role in providing glycosylated protein structure models. To address if glycan structures available in the PDB can be used as templates or fragments for glycan modeling, we present a survey of the N-glycan structures of 35 different sequences in the PDB. Our statistical analysis shows that the N-glycan structures found on homologous glycoproteins are significantly conserved compared to the random background, suggesting that N-glycan chains can be confidently modeled with template glycan structures whose parent glycoproteins share sequence similarity. On the other hand, N-glycan structures found on non-homologous glycoproteins do not show significant global structural similarity. Nonetheless, the internal substructures of these N-glycans, particularly, the substructures that are closer to the protein, show significantly similar structures, suggesting that such substructures can be used as fragments in glycan modeling. Increased interactions with protein might be responsible for the restricted conformational space of N-glycan chains. Our results suggest that structure prediction/modeling of N-glycans of glycoconjugates using structure database could be effective and different modeling approaches would be needed depending on the availability of template structures.

  2. Restricted N-glycan Conformational Space in the PDB and Its Implication in Glycan Structure Modeling

    PubMed Central

    Jo, Sunhwan; Lee, Hui Sun; Skolnick, Jeffrey; Im, Wonpil

    2013-01-01

    Understanding glycan structure and dynamics is central to understanding protein-carbohydrate recognition and its role in protein-protein interactions. Given the difficulties in obtaining the glycan's crystal structure in glycoconjugates due to its flexibility and heterogeneity, computational modeling could play an important role in providing glycosylated protein structure models. To address if glycan structures available in the PDB can be used as templates or fragments for glycan modeling, we present a survey of the N-glycan structures of 35 different sequences in the PDB. Our statistical analysis shows that the N-glycan structures found on homologous glycoproteins are significantly conserved compared to the random background, suggesting that N-glycan chains can be confidently modeled with template glycan structures whose parent glycoproteins share sequence similarity. On the other hand, N-glycan structures found on non-homologous glycoproteins do not show significant global structural similarity. Nonetheless, the internal substructures of these N-glycans, particularly, the substructures that are closer to the protein, show significantly similar structures, suggesting that such substructures can be used as fragments in glycan modeling. Increased interactions with protein might be responsible for the restricted conformational space of N-glycan chains. Our results suggest that structure prediction/modeling of N-glycans of glycoconjugates using structure database could be effective and different modeling approaches would be needed depending on the availability of template structures. PMID:23516343

  3. A conserved role for L1 as a transmembrane link between neuronal adhesion and membrane cytoskeleton assembly.

    PubMed

    Hortsch, M; O'Shea, K S; Zhao, G; Kim, F; Vallejo, Y; Dubreuil, R R

    1998-01-01

    The L1-family of cell adhesion molecules is involved in many important aspects of nervous system development. Mutations in the human L1-CAM gene cause a complicated array of neurological phenotypes; however, the molecular basis of these effects cannot be explained by a simple loss of adhesive function. Human L1-CAM and its Drosophila homolog neuroglian are rather divergent in sequence, with the highest degree of amino acid sequence conservation between segments of their cytoplasmic domains. In an attempt to elucidate the fundamental functions shared between these distantly related members of the L1-family, we demonstrate here that the extracellular domains of mammalian L1-CAMs and Drosophila neuroglian are both able to induce the aggregation of transfected Drosophila S2 cells in vitro. To a limited degree they even interact with each other in cell adhesion and neurite outgrowth assays. The cytoplasmic domains of human L1-CAM and neuroglian are both able to interact with the Drosophila homolog of the cytoskeletal linker protein ankyrin. Moreover the recruitment of ankyrin to cell-cell contacts is completely dependent on L1-mediated cell adhesion. These findings support a model of L1 function in which the phenotypes of human L1-CAM mutations results from a disruption of the link between the extracellular environment and the neuronal cytoskeleton.

  4. Identification of tissue-specific targeting peptide

    NASA Astrophysics Data System (ADS)

    Jung, Eunkyoung; Lee, Nam Kyung; Kang, Sang-Kee; Choi, Seung-Hoon; Kim, Daejin; Park, Kisoo; Choi, Kihang; Choi, Yun-Jaie; Jung, Dong Hyun

    2012-11-01

    Using phage display technique, we identified tissue-targeting peptide sets that recognize specific tissues (bone-marrow dendritic cell, kidney, liver, lung, spleen and visceral adipose tissue). In order to rapidly evaluate tissue-specific targeting peptides, we performed machine learning studies for predicting the tissue-specific targeting activity of peptides on the basis of peptide sequence information using four machine learning models and isolated the groups of peptides capable of mediating selective targeting to specific tissues. As a representative liver-specific targeting sequence, the peptide "DKNLQLH" was selected by the sequence similarity analysis. This peptide has a high degree of homology with protein ligands which can interact with corresponding membrane counterparts. We anticipate that our models will be applicable to the prediction of tissue-specific targeting peptides which can recognize the endothelial markers of target tissues.

  5. ProfileGrids: a sequence alignment visualization paradigm that avoids the limitations of Sequence Logos

    PubMed Central

    2014-01-01

    Background The 2013 BioVis Contest provided an opportunity to evaluate different paradigms for visualizing protein multiple sequence alignments. Such data sets are becoming extremely large and thus taxing current visualization paradigms. Sequence Logos represent consensus sequences but have limitations for protein alignments. As an alternative, ProfileGrids are a new protein sequence alignment visualization paradigm that represents an alignment as a color-coded matrix of the residue frequency occurring at every homologous position in the aligned protein family. Results The JProfileGrid software program was used to analyze the BioVis contest data sets to generate figures for comparison with the Sequence Logo reference images. Conclusions The ProfileGrid representation allows for the clear and effective analysis of protein multiple sequence alignments. This includes both a general overview of the conservation and diversity sequence patterns as well as the interactive ability to query the details of the protein residue distributions in the alignment. The JProfileGrid software is free and available from http://www.ProfileGrid.org. PMID:25237393

  6. Characterization of a novel human sperm-associated antigen 9 (SPAG9) having structural homology with c-Jun N-terminal kinase-interacting protein

    PubMed Central

    Jagadish, Nirmala; Rana, Ritu; Selvi, Ramasamy; Mishra, Deepshikha; Garg, Manoj; Yadav, Shikha; Herr, John C.; Okumura, Katsuzumi; Hasegawa, Akiko; Koyama, Koji; Suri, Anil

    2005-01-01

    We report a novel SPAG9 (sperm-associated antigen 9) protein having structural homology with JNK (c-Jun N-terminal kinase)-interacting protein 3. SPAG9, a single copy gene mapped to the human chromosome 17q21.33 syntenic with location of mouse chromosome 11, was earlier shown to be expressed exclusively in testis [Shankar, Mohapatra and Suri (1998) Biochem. Biophys. Res. Commun. 243, 561–565]. The SPAG9 amino acid sequence analysis revealed identity with the JNK-binding domain and predicted coiled-coil, leucine zipper and transmembrane domains. The secondary structure analysis predicted an α-helical structure for SPAG9 that was confirmed by CD spectra. Microsequencing of higher-order aggregates of recombinant SPAG9 by tandem MS confirmed the amino acid sequence and mono atomic mass of 83.9 kDa. Transient expression of SPAG9 and its deletion mutants revealed that both leucine zipper with extended coiled-coil domains and transmembrane domain of SPAG9 were essential for dimerization and proper localization. Studies of MAPK (mitogenactivated protein kinase) interactions demonstrated that SPAG9 interacted with higher binding affinity to JNK3 and JNK2 compared with JNK1. No interaction was observed with p38α or extracellular-signal-regulated kinase pathways. Polyclonal antibodies raised against recombinant SPAG9 recognized native protein in human sperm extracts and localized specifically on the acrosomal compartment of intact human spermatozoa. Acrosome-reacted spermatozoa demonstrated SPAG9 immunofluorescence, indicating its retention on the equatorial segment after the acrosome reaction. Further, anti-SPAG9 antibodies inhibited the binding of human spermatozoa to intact human oocytes as well as to matched hemizona. This is the first report of sperm-associated JNK-binding protein that may have a role in spermatozoa–egg interaction. PMID:15693750

  7. Characterization of a novel human sperm-associated antigen 9 (SPAG9) having structural homology with c-Jun N-terminal kinase-interacting protein.

    PubMed

    Jagadish, Nirmala; Rana, Ritu; Selvi, Ramasamy; Mishra, Deepshikha; Garg, Manoj; Yadav, Shikha; Herr, John C; Okumura, Katsuzumi; Hasegawa, Akiko; Koyama, Koji; Suri, Anil

    2005-07-01

    We report a novel SPAG9 (sperm-associated antigen 9) protein having structural homology with JNK (c-Jun N-terminal kinase)-interacting protein 3. SPAG9, a single copy gene mapped to the human chromosome 17q21.33 syntenic with location of mouse chromosome 11, was earlier shown to be expressed exclusively in testis [Shankar, Mohapatra and Suri (1998) Biochem. Biophys. Res. Commun. 243, 561-565]. The SPAG9 amino acid sequence analysis revealed identity with the JNK-binding domain and predicted coiled-coil, leucine zipper and transmembrane domains. The secondary structure analysis predicted an alpha-helical structure for SPAG9 that was confirmed by CD spectra. Microsequencing of higher-order aggregates of recombinant SPAG9 by tandem MS confirmed the amino acid sequence and mono atomic mass of 83.9 kDa. Transient expression of SPAG9 and its deletion mutants revealed that both leucine zipper with extended coiled-coil domains and transmembrane domain of SPAG9 were essential for dimerization and proper localization. Studies of MAPK (mitogenactivated protein kinase) interactions demonstrated that SPAG9 interacted with higher binding affinity to JNK3 and JNK2 compared with JNK1. No interaction was observed with p38alpha or extracellular-signal-regulated kinase pathways. Polyclonal antibodies raised against recombinant SPAG9 recognized native protein in human sperm extracts and localized specifically on the acrosomal compartment of intact human spermatozoa. Acrosome-reacted spermatozoa demonstrated SPAG9 immunofluorescence, indicating its retention on the equatorial segment after the acrosome reaction. Further, anti-SPAG9 antibodies inhibited the binding of human spermatozoa to intact human oocytes as well as to matched hemizona. This is the first report of sperm-associated JNK-binding protein that may have a role in spermatozoa-egg interaction.

  8. The VP35 and VP40 proteins of filoviruses. Homology between Marburg and Ebola viruses.

    PubMed

    Bukreyev, A A; Volchkov, V E; Blinov, V M; Netesov, S V

    1993-05-03

    The fragments of genomic RNA sequences of Marburg (MBG) and Ebola (EBO) viruses are reported. These fragments were found to encode the VP35 and VP40 proteins. The canonic sequences were revealed before and after each open reading frame. It is suggested that these sequences are mRNA extremities and at the same time the regulatory elements for mRNA transcription. Homology between the MBG and EBO proteins was discovered.

  9. HIP12 is a non-proapoptotic member of a gene family including HIP1, an interacting protein with huntingtin.

    PubMed

    Chopra, V S; Metzler, M; Rasper, D M; Engqvist-Goldstein, A E; Singaraja, R; Gan, L; Fichter, K M; McCutcheon, K; Drubin, D; Nicholson, D W; Hayden, M R

    2000-11-01

    Huntingtin-interacting protein I (HIP1) is a membrane-associated protein that interacts with huntingtin, the protein altered in Huntington disease. HIP1 shows homology to Sla2p, a protein essential for the assembly and function of the cytoskeleton and endocytosis in Saccharomyces cerevisiae. We have determined that the HIP1 gene comprises 32 exons spanning approximately 215 kb of genomic DNA and gives rise to two alternate splice forms termed HIP1-1 and HIP1-2. Additionally, we have identified a novel protein termed HIP12 with significant sequence and biochemical similarities to HIP1 and high sequence similarity to Sla2p. HIP12 differs from HIP1 in its pattern of expression both at the mRNA and protein level. However, HIP1 and HIP12 are both found within the brain and show a similar subcellular distribution pattern. In contrast to HIP1, which is toxic in cell culture, HIP12 does not confer toxicity in the same assay systems. Interestingly, HIP12 does not interact with huntingtin but can interact with HIP1. suggesting a potential interaction in vivo that may influence the function of each respective protein.

  10. Bhageerath-H: A homology/ab initio hybrid server for predicting tertiary structures of monomeric soluble proteins

    PubMed Central

    2014-01-01

    Background The advent of human genome sequencing project has led to a spurt in the number of protein sequences in the databanks. Success of structure based drug discovery severely hinges on the availability of structures. Despite significant progresses in the area of experimental protein structure determination, the sequence-structure gap is continually widening. Data driven homology based computational methods have proved successful in predicting tertiary structures for sequences sharing medium to high sequence similarities. With dwindling similarities of query sequences, advanced homology/ ab initio hybrid approaches are being explored to solve structure prediction problem. Here we describe Bhageerath-H, a homology/ ab initio hybrid software/server for predicting protein tertiary structures with advancing drug design attempts as one of the goals. Results Bhageerath-H web-server was validated on 75 CASP10 targets which showed TM-scores ≥0.5 in 91% of the cases and Cα RMSDs ≤5Å from the native in 58% of the targets, which is well above the CASP10 water mark. Comparison with some leading servers demonstrated the uniqueness of the hybrid methodology in effectively sampling conformational space, scoring best decoys and refining low resolution models to high and medium resolution. Conclusion Bhageerath-H methodology is web enabled for the scientific community as a freely accessible web server. The methodology is fielded in the on-going CASP11 experiment. PMID:25521245

  11. [Preparation of monoclonal antibody against 4-amylphenol and homology modeling of its Fv fragment].

    PubMed

    Cheng, Lei; Wu, Haizhen; Fei, Jing; Zhang, Lujia; Ye, Jiang; Zhang, Huizhan

    2017-03-01

    Objective To prepare and characterize a monoclonal antibody (mAb) against 4-amylphenol (4-AP), clone its cDNA sequence and make homology modeling for its Fv fragment. Methods A high-affinity anti-4-AP mAb was generated from a hybridoma cell line F10 using electrofusion between splenocytes from APA-BSA-immunized mouse and Sp2/0 myeloma cells. Then we extracted the mRNA of F10 cells and cloned the cDNA of mAb. The homology modeling and molecular docking of its Fv fragment was conducted with biological software. Results Under the optimum conditions, the ic-ELISA equation was y=A 2 +(A 1 -A 2 )/(1+(x/x 0 ) p ) (A 1 =1.28; A 2 =-0.066; x 0 =12560.75; p=0.74) with a correlation coefficient (R 2 ) of 0.997. The lowest detectable limit was 0.65 μg/mL. The heavy and light chains of mAb respectively belonged to IgG1 and Kappa. The homology modeling and molecular docking studies revealed that the binding of 4-Ap and mAb was attributed to the hydrogen bond and hydrophobic interactions. Conclusion The study successfully established a stable 4-AP mAb-secreting hybridoma cell line. The study on spatial structure of Fv fragment using homology modeling provided a reference for the development and design of single chain variable fragments.

  12. Partial mapping and sequencing of a fish iridovirus genome reveals genes homologous to the frog virus 3 p31, p40 and human eIF2alpha.

    PubMed

    Yu, Y X; Béarzotti, M; Vende, P; Ahne, W; Brémont, M

    1999-09-01

    Iridovirus-like pathogens have been recognized as a cause of serious systemic diseases among feral, cultured and ornamental fish in the recent years. Mortalities of fish due to systemic iridovirus infection reaching 30-100% were observed in Europe, Australia, Japan and Thailand. Up to now, the molecular biology of these important pathogens has been poorly documented. To get better insights on the genomic organization of these piscine iridoviruses, we have constructed a cosmid viral DNA library from the epizootic hematopoietic necrosis virus (EHNV). Two recombinant cosmids (Cos7 and Cos12) have been selected for systematic sequencing. Cos7 and 12 are localized side by side along the genome and cover the 2/3 part of the total EHNV genome which has been estimated to be approximately 101.47 kb in length. Thirty five kilobase pairs (kbps) from Cos7 and 10 kbps from Cos12 have been determined. Sequence analysis revealed open reading frames (ORF) sharing homologies with sequences from the Frog virus 3 such as the p31 and p40 proteins. Among the others identified ORFs, some of them presented homologies with known protein sequences, such as the human eIF2alpha protein, and some did not show any significant homologies with sequences available in the databases. But, none were related to Lymphocystis virus, a member of the Iridoviridae family, for which the full genome nucleotide sequence has been determined.

  13. Incorrectly predicted genes in rice?

    PubMed

    Cruveiller, Stéphane; Jabbari, Kamel; Clay, Oliver; Bernardi, Giorgio

    2004-05-26

    Between one third and one half of the proposed rice genes appear to have no homologs in other species, including Arabidopsis. Compositional considerations, and a comparison of curated rice sequences with ex novo predictions, suggest that many or most of the putative genes without homologs may be false positive predictions, i.e., sequences that are never translated into functional proteins in vivo.

  14. A Drosophila protein-tyrosine phosphatase associates with an adapter protein required for axonal guidance.

    PubMed

    Clemens, J C; Ursuliak, Z; Clemens, K K; Price, J V; Dixon, J E

    1996-07-19

    We have used the yeast two-hybrid system to isolate a novel Drosophila adapter protein, which interacts with the Drosophila protein-tyrosine phosphatase (PTP) dPTP61F. Absence of this protein in Drosophila causes the mutant photoreceptor axon phenotype dreadlocks (dock) (Garrity, P. A., Rao, Y., Salecker, I., and Zipursky, S. L.(1996) Cell 85, 639-650). Dock is similar to the mammalian oncoprotein Nck and contains three Src homology 3 (SH3) domains and one Src homology 2 (SH2) domain. The interaction of dPTP61F with Dock was confirmed in vivo by immune precipitation experiments. A sequence containing five PXXP motifs from the non-catalytic domain of the PTP is sufficient for interaction with Dock. This suggests that binding to the PTP is mediated by one or more of the SH3 domains of Dock. Immune precipitations of Dock also co-precipitate two tyrosine-phosphorylated proteins having molecular masses of 190 and 145 kDa. Interactions between Dock and these tyrosine-phosphorylated proteins are likely mediated by the Dock SH2 domain. These findings identify potential signal-transducing partners of Dock and propose a role for dPTP61F and the unidentified phosphoproteins in axonal guidance.

  15. Homology and phylogeny and their automated inference

    NASA Astrophysics Data System (ADS)

    Fuellen, Georg

    2008-06-01

    The analysis of the ever-increasing amount of biological and biomedical data can be pushed forward by comparing the data within and among species. For example, an integrative analysis of data from the genome sequencing projects for various species traces the evolution of the genomes and identifies conserved and innovative parts. Here, I review the foundations and advantages of this “historical” approach and evaluate recent attempts at automating such analyses. Biological data is comparable if a common origin exists (homology), as is the case for members of a gene family originating via duplication of an ancestral gene. If the family has relatives in other species, we can assume that the ancestral gene was present in the ancestral species from which all the other species evolved. In particular, describing the relationships among the duplicated biological sequences found in the various species is often possible by a phylogeny, which is more informative than homology statements. Detecting and elaborating on common origins may answer how certain biological sequences developed, and predict what sequences are in a particular species and what their function is. Such knowledge transfer from sequences in one species to the homologous sequences of the other is based on the principle of ‘my closest relative looks and behaves like I do’, often referred to as ‘guilt by association’. To enable knowledge transfer on a large scale, several automated ‘phylogenomics pipelines’ have been developed in recent years, and seven of these will be described and compared. Overall, the examples in this review demonstrate that homology and phylogeny analyses, done on a large (and automated) scale, can give insights into function in biology and biomedicine.

  16. Methods and statistics for combining motif match scores.

    PubMed

    Bailey, T L; Gribskov, M

    1998-01-01

    Position-specific scoring matrices are useful for representing and searching for protein sequence motifs. A sequence family can often be described by a group of one or more motifs, and an effective search must combine the scores for matching a sequence to each of the motifs in the group. We describe three methods for combining match scores and estimating the statistical significance of the combined scores and evaluate the search quality (classification accuracy) and the accuracy of the estimate of statistical significance of each. The three methods are: 1) sum of scores, 2) sum of reduced variates, 3) product of score p-values. We show that method 3) is superior to the other two methods in both regards, and that combining motif scores indeed gives better search accuracy. The MAST sequence homology search algorithm utilizing the product of p-values scoring method is available for interactive use and downloading at URL http:/(/)www.sdsc.edu/MEME.

  17. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kennedy, M.A.; Morris, C.M.; Fitzgerald, P.H.

    The human kappa deleting element (Kde) mediates loss of CK and JK genes in B cells. A probe for Kde detects two genomic sequences on Southern blots. The Kde is located 24kb 3{prime} to CK, but the position of the homologous sequence is unknown. The authors in situ hybridized m141-2 to metaphase cells of JC11, a B-cell line bearing a t(2;14)(p11;q32) in which the chromosome 2 breakpoint is within JK or the VK-JK intron. Three peaks of labelled sites were obtained. Southern analysis of BamH1 digested DNA showed that Kde (14kb) and the homologous sequence (3kb) were both intact. Kdemore » accounts for hybridization to 14q+ and the 2p- signal presumably derives from the related sequence. This locates the sequence homologous to Kde upstream from JK, possibly within the VK cluster, and may reflect transposition or some other duplicative event as proposed for the evolution of other regions of the kappa locus.« less

  18. Identification of genes from pattern formation, tyrosine kinase, and potassium channel families by DNA amplification

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kamb, A.; Weir, M.; Rudy, B.

    1989-06-01

    The study of gene family members has been aided by the isolation of related genes on the basis of DNA homology. The authors have adapted the polymerase chain reaction to screen animal genomes very rapidly and reliably for likely gene family members. Using conserved amino acid sequences to design degenerate oligonucleotide primers, they have shown that the genome of the nematode Caenorhabditis elegans contains sequences homologous to many Drosophila genes involved in pattern formation, including the segment polarity gene wingless (vertebrate int-1), and homeobox sequences characteristic of the Antennapedia, engrailed, and paired families. In addition, they have used this methodmore » to show that C. elegans contains at least five different sequences homologous to genes in the tyrosine kinase family. Lastly, they have isolated six potassium channel sequences from humans, a result that validates the utility of the method with large genomes and suggests that human potassium channel gene diversity may be extensive.« less

  19. Cytomegalovirus Basic Phosphoprotein (pUL32) Binds to Capsids In Vitro through Its Amino One-Third

    PubMed Central

    Baxter, Michael K.; Gibson, Wade

    2001-01-01

    The cytomegalovirus (CMV) basic phosphoprotein (BPP) is a component of the tegument. It remains with the nucleocapsid fraction under conditions that remove most other tegument proteins from the virion, suggesting a direct and perhaps tight interaction with the capsid. As a step toward localizing this protein within the molecular structure of the virion and understanding its function during infection, we have investigated the BPP-capsid interaction. In this report we present evidence that the BPP interacts selectively, through its amino one-third, with CMV capsids. Radiolabeled simian CMV (SCMV) BPP, synthesized in vitro, bound to SCMV B-capsids, and C-capsids to a lesser extent, following incubation with either isolated capsids or lysates of infected cells. Human CMV (HCMV) BPP (pUL32) also bound to SCMV capsids, and SCMV BPP likewise bound to HCMV capsids, indicating that the sequence(s) involved is conserved between the two proteins. Analysis of SCMV BPP truncation mutants localized the capsid-binding region to the amino one-third of the molecule—the portion of BPP showing the greatest sequence conservation between the SCMV and HCMV homologs. This general approach may have utility in studying the interactions of other proteins with conformation-dependent binding sites. PMID:11435566

  20. The General Definition of the p97/Valosin-containing Protein (VCP)-interacting Motif (VIM) Delineates a New Family of p97 Cofactors*

    PubMed Central

    Stapf, Christopher; Cartwright, Edward; Bycroft, Mark; Hofmann, Kay; Buchberger, Alexander

    2011-01-01

    Cellular functions of the essential, ubiquitin-selective AAA ATPase p97/valosin-containing protein (VCP) are controlled by regulatory cofactors determining substrate specificity and fate. Most cofactors bind p97 through a ubiquitin regulatory X (UBX) or UBX-like domain or linear sequence motifs, including the hitherto ill defined p97/VCP-interacting motif (VIM). Here, we present the new, minimal consensus sequence RX5AAX2R as a general definition of the VIM that unites a novel family of known and putative p97 cofactors, among them UBXD1 and ZNF744/ANKZF1. We demonstrate that this minimal VIM consensus sequence is necessary and sufficient for p97 binding. Using NMR chemical shift mapping, we identified several residues of the p97 N-terminal domain (N domain) that are critical for VIM binding. Importantly, we show that cellular stress resistance conferred by the yeast VIM-containing cofactor Vms1 depends on the physical interaction between its VIM and the critical N domain residues of the yeast p97 homolog, Cdc48. Thus, the VIM-N domain interaction characterized in this study is required for the physiological function of Vms1 and most likely other members of the newly defined VIM family of cofactors. PMID:21896481

  1. Protein-protein interaction network-based detection of functionally similar proteins within species.

    PubMed

    Song, Baoxing; Wang, Fen; Guo, Yang; Sang, Qing; Liu, Min; Li, Dengyun; Fang, Wei; Zhang, Deli

    2012-07-01

    Although functionally similar proteins across species have been widely studied, functionally similar proteins within species showing low sequence similarity have not been examined in detail. Identification of these proteins is of significant importance for understanding biological functions, evolution of protein families, progression of co-evolution, and convergent evolution and others which cannot be obtained by detection of functionally similar proteins across species. Here, we explored a method of detecting functionally similar proteins within species based on graph theory. After denoting protein-protein interaction networks using graphs, we split the graphs into subgraphs using the 1-hop method. Proteins with functional similarities in a species were detected using a method of modified shortest path to compare these subgraphs and to find the eligible optimal results. Using seven protein-protein interaction networks and this method, some functionally similar proteins with low sequence similarity that cannot detected by sequence alignment were identified. By analyzing the results, we found that, sometimes, it is difficult to separate homologous from convergent evolution. Evaluation of the performance of our method by gene ontology term overlap showed that the precision of our method was excellent. Copyright © 2012 Wiley Periodicals, Inc.

  2. Preliminary X-ray diffraction analysis of YqjH from Escherichia coli: a putative cytoplasmic ferri-siderophore reductase

    PubMed Central

    Bamford, Vicki A.; Armour, Maria; Mitchell, Sue A.; Cartron, Michaël; Andrews, Simon C.; Watson, Kimberly A.

    2008-01-01

    YqjH is a cytoplasmic FAD-containing protein from Escherichia coli; based on homology to ViuB of Vibrio cholerae, it potentially acts as a ferri-siderophore reductase. This work describes its overexpression, purification, crystallization and structure solution at 3.0 Å resolution. YqjH shares high sequence similarity with a number of known siderophore-interacting proteins and its structure was solved by molecular replacement using the siderophore-interacting protein from Shewanella putrefaciens as the search model. The YqjH structure resembles those of other members of the NAD(P)H:flavin oxidoreductase superfamily. PMID:18765906

  3. Metagenomic gene annotation by a homology-independent approach

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Froula, Jeff; Zhang, Tao; Salmeen, Annette

    2011-06-02

    Fully understanding the genetic potential of a microbial community requires functional annotation of all the genes it encodes. The recently developed deep metagenome sequencing approach has enabled rapid identification of millions of genes from a complex microbial community without cultivation. Current homology-based gene annotation fails to detect distantly-related or structural homologs. Furthermore, homology searches with millions of genes are very computational intensive. To overcome these limitations, we developed rhModeller, a homology-independent software pipeline to efficiently annotate genes from metagenomic sequencing projects. Using cellulases and carbonic anhydrases as two independent test cases, we demonstrated that rhModeller is much faster than HMMERmore » but with comparable accuracy, at 94.5percent and 99.9percent accuracy, respectively. More importantly, rhModeller has the ability to detect novel proteins that do not share significant homology to any known protein families. As {approx}50percent of the 2 million genes derived from the cow rumen metagenome failed to be annotated based on sequence homology, we tested whether rhModeller could be used to annotate these genes. Preliminary results suggest that rhModeller is robust in the presence of missense and frameshift mutations, two common errors in metagenomic genes. Applying the pipeline to the cow rumen genes identified 4,990 novel cellulases candidates and 8,196 novel carbonic anhydrase candidates.In summary, we expect rhModeller to dramatically increase the speed and quality of metagnomic gene annotation.« less

  4. Oligo/Polynucleotide-Based Gene Modification: Strategies and Therapeutic Potential

    PubMed Central

    Sargent, R. Geoffrey; Kim, Soya

    2011-01-01

    Oligonucleotide- and polynucleotide-based gene modification strategies were developed as an alternative to transgene-based and classical gene targeting-based gene therapy approaches for treatment of genetic disorders. Unlike the transgene-based strategies, oligo/polynucleotide gene targeting approaches maintain gene integrity and the relationship between the protein coding and gene-specific regulatory sequences. Oligo/polynucleotide-based gene modification also has several advantages over classical vector-based homologous recombination approaches. These include essentially complete homology to the target sequence and the potential to rapidly engineer patient-specific oligo/polynucleotide gene modification reagents. Several oligo/polynucleotide-based approaches have been shown to successfully mediate sequence-specific modification of genomic DNA in mammalian cells. The strategies involve the use of polynucleotide small DNA fragments, triplex-forming oligonucleotides, and single-stranded oligodeoxynucleotides to mediate homologous exchange. The primary focus of this review will be on the mechanistic aspects of the small fragment homologous replacement, triplex-forming oligonucleotide-mediated, and single-stranded oligodeoxynucleotide-mediated gene modification strategies as it relates to their therapeutic potential. PMID:21417933

  5. A Sand Fly Salivary Protein Vaccine Shows Efficacy Against Vector-Transmitted Cutaneous Leishmaniasis in Nonhuman Primates

    DTIC Science & Technology

    2015-06-03

    demonstrating its immunogenicity in humans. PdSP15 sequence and structure show no homol- ogy to mammalian proteins, further demonstrating its potential...sequence or structure homology to known human proteins The protective salivary antigen PdSP15 shares sequence homology only to the small odorant binding...salivary proteins PpSP15 and PsSP15, respectively (Fig. 4B). To exclude any structural similarities to human pro teins, the crystal structure of PdPS15

  6. The C Terminus of Formin FMNL3 Accelerates Actin Polymerization and Contains a WH2 Domain-like Sequence That Binds Both Monomers and Filament Barbed Ends*

    PubMed Central

    Heimsath, Ernest G.; Higgs, Henry N.

    2012-01-01

    Formin proteins are actin assembly factors that accelerate filament nucleation then remain on the elongating barbed end and modulate filament elongation. The formin homology 2 (FH2) domain is central to these activities, but recent work has suggested that additional sequences enhance FH2 domain function. Here we show that the C-terminal 76 amino acids of the formin FMNL3 have a dramatic effect on the ability of the FH2 domain to accelerate actin assembly. This C-terminal region contains a WASp homology 2 (WH2)-like sequence that binds actin monomers in a manner that is competitive with other WH2 domains and with profilin. In addition, the C terminus binds filament barbed ends. As a monomer, the FMNL3 C terminus inhibits actin polymerization and slows barbed end elongation with moderate affinity. As a dimer, the C terminus accelerates actin polymerization from monomers and displays high affinity inhibition of barbed end elongation. These properties are not common to all formin C termini, as those of mDia1 and INF2 do not behave similarly. Interestingly, mutation of two aliphatic residues, which blocks high affinity actin binding by the WH2-like sequence, has no effect on the ability of the C terminus to enhance FH2-mediated polymerization. However, mutation of three successive basic residues at the C terminus of the WH2-like sequence compromises polymerization enhancement. These results illustrate that the C termini of formins are highly diverse in their interactions with actin. PMID:22094460

  7. Prunus necrotic ringspot ilarvirus: nucleotide sequence of RNA3 and the relationship to other ilarviruses based on coat protein comparison.

    PubMed

    Guo, D; Maiss, E; Adam, G; Casper, R

    1995-05-01

    The RNA3 of prunus necrotic ringspot ilarvirus (PNRSV) has been cloned and its entire sequence determined. The RNA3 consists of 1943 nucleotides (nt) and possesses two large open reading frames (ORFs) separated by an intergenic region of 74 nt. The 5' proximal ORF is 855 nt in length and codes for a protein of molecular mass 31.4 kDa which has homologies with the putative movement protein of other members of the Bromoviridae. The 3' proximal ORF of 675 nt is the cistron for the coat protein (CP) and has a predicted molecular mass of 24.9 kDa. The sequence of the 3' non-coding region (NCR) of PNRSV RNA3 showed a high degree of similarity with those of tobacco streak virus (TSV), prune dwarf virus (PDV), apple mosaic virus (ApMV) and also alfalfa mosaic virus (AIMV). In addition it contained potential stem-loop structures with interspersed AUGC motifs characteristic for ilar- and alfamoviruses. This conserved primary and secondary structure in all 3' NCRs may be responsible for the interaction with homologous and heterologous CPs and subsequent activation of genome replication. The CP gene of an ApMV isolate (ApMV-G) of 657 nt has also been cloned and sequenced. Although ApMV and PNRSV have a distant serological relationship, the deduced amino acid sequences of their CPs have an identity of only 51.8%. The N termini of PNRSV and ApMV CPs have in common a zinc-finger motif and the potential to form an amphipathic helix.

  8. Epstein-Barr virus nuclear protein 3C binds to the N-terminal (NTD) and beta trefoil domains (BTD) of RBP/CSL; Only the NTD interaction is essential for lymphoblastoid cell growth

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Calderwood, Michael A.; Lee, Sungwook; Holthaus, Amy M.

    Association of EBV nuclear proteins EBNA2, EBNA3A and EBNA3C with RBP/CSL, is essential for lymphoblastoid cell line (LCL) proliferation. Conserved residues in the EBNA3 homology domain, required for RBP/CSL interaction, lack the W{Phi}P motif that mediates EBNA2 and Notch binding to the RBP/CSL beta-trefoil domain (BTD). We map RBP/CSL interacting residues within EBNA3A(aa128-204) and EBNA3C(aa211-233). The EBNA3A results are consistent with an earlier report (aa125-222), but the EBNA3C domain is unexpectedly small and includes a 'WTP' sequence. This EBNA3C WTP motif confers RBP/CSL binding in vitro, in yeast, and in mammalian cells. Further, an EBNA3C WTP {yields} STP(W227S) mutation impairedmore » BTD binding whereas EBNA3 homology domain mutations disrupted RBP/CSL N-terminal domain (NTD) binding. WTP was not essential for EBNA3C repression of EBNA2 in reporter assays or for maintenance of LCL growth. Our results indicate that EBNA3 proteins interact with multiple RBP/CSL domains, but only NTD interactions are required for LCL growth.« less

  9. Exploration of new perspectives and limitations in Agrobacterium-mediated gene transfer technology. Final report, June 1, 1992--May 31, 1995

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Marton, L.

    1996-02-01

    Genetic manipulation of plants often involves the introduction of homologous or partly homologous genes. Ectropic introduction of homologous sequences into plant genomes may trigger epigenetic changes, making expression of the genes unpredictable. The main project objective was to examine the feasibility of using Agrobacterium-mediated gene transfer for homologous gene targeting in plants.

  10. EUGENE'HOM: A generic similarity-based gene finder using multiple homologous sequences.

    PubMed

    Foissac, Sylvain; Bardou, Philippe; Moisan, Annick; Cros, Marie-Josée; Schiex, Thomas

    2003-07-01

    EUGENE'HOM is a gene prediction software for eukaryotic organisms based on comparative analysis. EUGENE'HOM is able to take into account multiple homologous sequences from more or less closely related organisms. It integrates the results of TBLASTX analysis, splice site and start codon prediction and a robust coding/non-coding probabilistic model which allows EUGENE'HOM to handle sequences from a variety of organisms. The current target of EUGENE'HOM is plant sequences. The EUGENE'HOM web site is available at http://genopole.toulouse.inra.fr/bioinfo/eugene/EuGeneHom/cgi-bin/EuGeneHom.pl.

  11. Editing Transgenic DNA Components by Inducible Gene Replacement in Drosophila melanogaster

    PubMed Central

    Lin, Chun-Chieh; Potter, Christopher J.

    2016-01-01

    Gene conversions occur when genomic double-strand DNA breaks (DSBs) trigger unidirectional transfer of genetic material from a homologous template sequence. Exogenous or mutated sequence can be introduced through this homology-directed repair (HDR). We leveraged gene conversion to develop a method for genomic editing of existing transgenic insertions in Drosophila melanogaster. The clustered regularly-interspaced palindromic repeats (CRISPR)/Cas9 system is used in the homology assisted CRISPR knock-in (HACK) method to induce DSBs in a GAL4 transgene, which is repaired by a single-genomic transgenic construct containing GAL4 homologous sequences flanking a T2A-QF2 cassette. With two crosses, this technique converts existing GAL4 lines, including enhancer traps, into functional QF2 expressing lines. We used HACK to convert the most commonly-used GAL4 lines (labeling tissues such as neurons, fat, glia, muscle, and hemocytes) to QF2 lines. We also identified regions of the genome that exhibited differential efficiencies of HDR. The HACK technique is robust and readily adaptable for targeting and replacement of other genomic sequences, and could be a useful approach to repurpose existing transgenes as new genetic reagents become available. PMID:27334272

  12. Compartmentalization of the yeast meiotic nucleus revealed by analysis of ectopic recombination.

    PubMed

    Schlecht, Hélène B; Lichten, Michael; Goldman, Alastair S H

    2004-11-01

    As yeast cells enter meiosis, chromosomes move from a centromere-clustered (Rabl) to a telomere-clustered (bouquet) configuration and then to states of progressive homolog pairing where telomeres are more dispersed. It is uncertain at which stage of this process sequences commit to recombine with each other. Previous analyses using recombination between dispersed homologous sequences (ectopic recombination) support the view that, on average, homologs are aligned end to end by the time of commitment to recombination. We have undertaken further analyses incorporating new inserts, chromosome rearrangements, an alternate mode of recombination initiation, and mutants that disrupt nuclear structure or telomere metabolism. Our findings support previous conclusions and reveal that distance from the nearest telomere is an important parameter influencing recombination between dispersed sequences. In general, the farther dispersed sequences are from their nearest telomere, the less likely they are to engage in ectopic recombination. Neither the mode of initiating recombination nor the formation of the bouquet appears to affect this relationship. We suggest that aspects of telomere localization and behavior influence the organization and mobility of chromosomes along their entire length, during a critical period of meiosis I prophase that encompasses the homology search.

  13. Prefiltering Model for Homology Detection Algorithms on GPU.

    PubMed

    Retamosa, Germán; de Pedro, Luis; González, Ivan; Tamames, Javier

    2016-01-01

    Homology detection has evolved over the time from heavy algorithms based on dynamic programming approaches to lightweight alternatives based on different heuristic models. However, the main problem with these algorithms is that they use complex statistical models, which makes it difficult to achieve a relevant speedup and find exact matches with the original results. Thus, their acceleration is essential. The aim of this article was to prefilter a sequence database. To make this work, we have implemented a groundbreaking heuristic model based on NVIDIA's graphics processing units (GPUs) and multicore processors. Depending on the sensitivity settings, this makes it possible to quickly reduce the sequence database by factors between 50% and 95%, while rejecting no significant sequences. Furthermore, this prefiltering application can be used together with multiple homology detection algorithms as a part of a next-generation sequencing system. Extensive performance and accuracy tests have been carried out in the Spanish National Centre for Biotechnology (NCB). The results show that GPU hardware can accelerate the execution times of former homology detection applications, such as National Centre for Biotechnology Information (NCBI), Basic Local Alignment Search Tool for Proteins (BLASTP), up to a factor of 4.

  14. The barley EST DNA Replication and Repair Database (bEST-DRRD) as a tool for the identification of the genes involved in DNA replication and repair.

    PubMed

    Gruszka, Damian; Marzec, Marek; Szarejko, Iwona

    2012-06-14

    The high level of conservation of genes that regulate DNA replication and repair indicates that they may serve as a source of information on the origin and evolution of the species and makes them a reliable system for the identification of cross-species homologs. Studies that had been conducted to date shed light on the processes of DNA replication and repair in bacteria, yeast and mammals. However, there is still much to be learned about the process of DNA damage repair in plants. These studies, which were conducted mainly using bioinformatics tools, enabled the list of genes that participate in various pathways of DNA repair in Arabidopsis thaliana (L.) Heynh to be outlined; however, information regarding these mechanisms in crop plants is still very limited. A similar, functional approach is particularly difficult for a species whose complete genomic sequences are still unavailable. One of the solutions is to apply ESTs (Expressed Sequence Tags) as the basis for gene identification. For the construction of the barley EST DNA Replication and Repair Database (bEST-DRRD), presented here, the Arabidopsis nucleotide and protein sequences involved in DNA replication and repair were used to browse for and retrieve the deposited sequences, derived from four barley (Hordeum vulgare L.) sequence databases, including the "Barley Genome version 0.05" database (encompassing ca. 90% of barley coding sequences) and from two databases covering the complete genomes of two monocot models: Oryza sativa L. and Brachypodium distachyon L. in order to identify homologous genes. Sequences of the categorised Arabidopsis queries are used for browsing the repositories, which are located on the ViroBLAST platform. The bEST-DRRD is currently used in our project during the identification and validation of the barley genes involved in DNA repair. The presented database provides information about the Arabidopsis genes involved in DNA replication and repair, their expression patterns and models of protein interactions. It was designed and established to provide an open-access tool for the identification of monocot homologs of known Arabidopsis genes that are responsible for DNA-related processes. The barley genes identified in the project are currently being analysed to validate their function.

  15. The effector candidate repertoire of the arbuscular mycorrhizal fungus Rhizophagus clarus.

    PubMed

    Sędzielewska Toro, Kinga; Brachmann, Andreas

    2016-02-09

    Arbuscular mycorrhizal fungi (AMF) form an ecologically important symbiosis with more than two thirds of studied land plants. Recent studies of plant-pathogen interactions showed that effector proteins play a key role in host colonization by controlling the plant immune system. We hypothesise that also for symbiotic-plant interactions the secreted effectome of the fungus is a major component of communication and the conservation level of effector proteins between AMF species may be indicative whether they play a fundamental role. In this study, we used a bioinformatics pipeline to predict and compare the effector candidate repertoire of the two AMF species, Rhizophagus irregularis and Rhizophagus clarus. Our in silico pipeline revealed a list of 220 R. irregularis candidate effector genes that create a valuable information source to elucidate the mechanism of plant infection and colonization by fungi during AMF symbiotic interaction. While most of the candidate effectors show no homologies to known domains or proteins, the candidates with homologies point to potential roles in signal transduction, cell wall modification or transcription regulation. A remarkable aspect of our work is presence of a large portion of the effector proteins involved in symbiosis, which are not unique to each fungi or plant species, but shared along the Glomeromycota phylum. For 95% of R. irregularis candidates we found homologs in a R. clarus genome draft generated by Illumina high-throughput sequencing. Interestingly, 9% of the predicted effectors are at least as conserved between the two Rhizophagus species as proteins with housekeeping functions (similarity > 90%). Therefore, we state that this group of highly conserved effector proteins between AMF species may play a fundamental role during fungus-plant interaction. We hypothesise that in symbiotic interactions the secreted effectome of the fungus might be an important component of communication. Identification and functional characterization of the primary AMF effectors that regulate symbiotic development will help in understanding the mechanisms of fungus-plant interaction.

  16. CoryneBase: Corynebacterium Genomic Resources and Analysis Tools at Your Fingertips

    PubMed Central

    Tan, Mui Fern; Jakubovics, Nick S.; Wee, Wei Yee; Mutha, Naresh V. R.; Wong, Guat Jah; Ang, Mia Yang; Yazdi, Amir Hessam; Choo, Siew Woh

    2014-01-01

    Corynebacteria are used for a wide variety of industrial purposes but some species are associated with human diseases. With increasing number of corynebacterial genomes having been sequenced, comparative analysis of these strains may provide better understanding of their biology, phylogeny, virulence and taxonomy that may lead to the discoveries of beneficial industrial strains or contribute to better management of diseases. To facilitate the ongoing research of corynebacteria, a specialized central repository and analysis platform for the corynebacterial research community is needed to host the fast-growing amount of genomic data and facilitate the analysis of these data. Here we present CoryneBase, a genomic database for Corynebacterium with diverse functionality for the analysis of genomes aimed to provide: (1) annotated genome sequences of Corynebacterium where 165,918 coding sequences and 4,180 RNAs can be found in 27 species; (2) access to comprehensive Corynebacterium data through the use of advanced web technologies for interactive web interfaces; and (3) advanced bioinformatic analysis tools consisting of standard BLAST for homology search, VFDB BLAST for sequence homology search against the Virulence Factor Database (VFDB), Pairwise Genome Comparison (PGC) tool for comparative genomic analysis, and a newly designed Pathogenomics Profiling Tool (PathoProT) for comparative pathogenomic analysis. CoryneBase offers the access of a range of Corynebacterium genomic resources as well as analysis tools for comparative genomics and pathogenomics. It is publicly available at http://corynebacterium.um.edu.my/. PMID:24466021

  17. Zinc-binding Domain of the Bacteriophage T7 DNA Primase Modulates Binding to the DNA Template*

    PubMed Central

    Lee, Seung-Joo; Zhu, Bin; Akabayov, Barak; Richardson, Charles C.

    2012-01-01

    The zinc-binding domain (ZBD) of prokaryotic DNA primases has been postulated to be crucial for recognition of specific sequences in the single-stranded DNA template. To determine the molecular basis for this role in recognition, we carried out homolog-scanning mutagenesis of the zinc-binding domain of DNA primase of bacteriophage T7 using a bacterial homolog from Geobacillus stearothermophilus. The ability of T7 DNA primase to catalyze template-directed oligoribonucleotide synthesis is eliminated by substitution of any five-amino acid residue-long segment within the ZBD. The most significant defect occurs upon substitution of a region (Pro-16 to Cys-20) spanning two cysteines that coordinate the zinc ion. The role of this region in primase function was further investigated by generating a protein library composed of multiple amino acid substitutions for Pro-16, Asp-18, and Asn-19 followed by genetic screening for functional proteins. Examination of proteins selected from the screening reveals no change in sequence-specific recognition. However, the more positively charged residues in the region facilitate DNA binding, leading to more efficient oligoribonucleotide synthesis on short templates. The results suggest that the zinc-binding mode alone is not responsible for sequence recognition, but rather its interaction with the RNA polymerase domain is critical for DNA binding and for sequence recognition. Consequently, any alteration in the ZBD that disturbs its conformation leads to loss of DNA-dependent oligoribonucleotide synthesis. PMID:23024359

  18. The Drosophila hnRNP F/H Homolog Glorund Uses Two Distinct RNA-Binding Modes to Diversify Target Recognition.

    PubMed

    Tamayo, Joel V; Teramoto, Takamasa; Chatterjee, Seema; Hall, Traci M Tanaka; Gavis, Elizabeth R

    2017-04-04

    The Drosophila hnRNP F/H homolog, Glorund (Glo), regulates nanos mRNA translation by interacting with a structured UA-rich motif in the nanos 3' untranslated region. Glo regulates additional RNAs, however, and mammalian homologs bind G-tract sequences to regulate alternative splicing, suggesting that Glo also recognizes G-tract RNA. To gain insight into how Glo recognizes both structured UA-rich and G-tract RNAs, we used mutational analysis guided by crystal structures of Glo's RNA-binding domains and identified two discrete RNA-binding surfaces that allow Glo to recognize both RNA motifs. By engineering Glo variants that favor a single RNA-binding mode, we show that a subset of Glo's functions in vivo is mediated solely by the G-tract binding mode, whereas regulation of nanos requires both recognition modes. Our findings suggest a molecular mechanism for the evolution of dual RNA motif recognition in Glo that may be applied to understanding the functional diversity of other RNA-binding proteins. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.

  19. The Drosophila hnRNP F/H homolog glorund uses two distinct RNA-binding modes to diversify target recognition

    DOE PAGES

    Tamayo, Joel V.; Teramoto, Takamasa; Chatterjee, Seema; ...

    2017-04-04

    The Drosophila hnRNP F/H homolog, Glorund (Glo), regulates nanos mRNA translation by interacting with a structured UA-rich motif in the nanos 3' untranslated region. Glo regulates additional RNAs, however, and mammalian homologs bind G-tract sequences to regulate alternative splicing, suggesting that Glo also recognizes G-tract RNA. To gain insight into how Glo recognizes both structured UA-rich and G-tract RNAs, we used mutational analysis guided by crystal structures of Glo’s RNA-binding domains and identified two discrete RNA-binding surfaces that allow Glo to recognize both RNA motifs. By engineering Glo variants that favor a single RNA-binding mode, we show that a subsetmore » of Glo’s functions in vivo is mediated solely by the G-tract binding mode, whereas regulation of nanos requires both recognition modes. Lastly, our findings suggest a molecular mechanism for the evolution of dual RNA motif recognition in Glo that may be applied to understanding the functional diversity of other RNA-binding proteins.« less

  20. The Drosophila hnRNP F/H Homolog Glorund Uses Two Distinct RNA-Binding Modes to Diversify Target Recognition

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tamayo, Joel V.; Teramoto, Takamasa; Chatterjee, Seema

    The Drosophila hnRNP F/H homolog, Glorund (Glo), regulates nanos mRNA translation by interacting with a structured UA-rich motif in the nanos 3' untranslated region. Glo regulates additional RNAs, however, and mammalian homologs bind G-tract sequences to regulate alternative splicing, suggesting that Glo also recognizes G-tract RNA. To gain insight into how Glo recognizes both structured UA-rich and G-tract RNAs, we used mutational analysis guided by crystal structures of Glo’s RNA-binding domains and identified two discrete RNA-binding surfaces that allow Glo to recognize both RNA motifs. By engineering Glo variants that favor a single RNA-binding mode, we show that a subsetmore » of Glo’s functions in vivo is mediated solely by the G-tract binding mode, whereas regulation of nanos requires both recognition modes. Our findings suggest a molecular mechanism for the evolution of dual RNA motif recognition in Glo that may be applied to understanding the functional diversity of other RNA-binding proteins.« less

  1. The Drosophila hnRNP F/H homolog glorund uses two distinct RNA-binding modes to diversify target recognition

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tamayo, Joel V.; Teramoto, Takamasa; Chatterjee, Seema

    The Drosophila hnRNP F/H homolog, Glorund (Glo), regulates nanos mRNA translation by interacting with a structured UA-rich motif in the nanos 3' untranslated region. Glo regulates additional RNAs, however, and mammalian homologs bind G-tract sequences to regulate alternative splicing, suggesting that Glo also recognizes G-tract RNA. To gain insight into how Glo recognizes both structured UA-rich and G-tract RNAs, we used mutational analysis guided by crystal structures of Glo’s RNA-binding domains and identified two discrete RNA-binding surfaces that allow Glo to recognize both RNA motifs. By engineering Glo variants that favor a single RNA-binding mode, we show that a subsetmore » of Glo’s functions in vivo is mediated solely by the G-tract binding mode, whereas regulation of nanos requires both recognition modes. Lastly, our findings suggest a molecular mechanism for the evolution of dual RNA motif recognition in Glo that may be applied to understanding the functional diversity of other RNA-binding proteins.« less

  2. The crystal structure of NADPH:ferredoxin reductase from Azotobacter vinelandii.

    PubMed Central

    Sridhar Prasad, G.; Kresge, N.; Muhlberg, A. B.; Shaw, A.; Jung, Y. S.; Burgess, B. K.; Stout, C. D.

    1998-01-01

    NADPH:ferredoxin reductase (AvFPR) is involved in the response to oxidative stress in Azotobacter vinelandii. The crystal structure of AvFPR has been determined at 2.0 A resolution. The polypeptide fold is homologous with six other oxidoreductases whose structures have been solved including Escherichia coli flavodoxin reductase (EcFldR) and spinach, and Anabaena ferredoxin:NADP+ reductases (FNR). AvFPR is overall most homologous to EcFldR. The structure is comprised of a N-terminal six-stranded antiparallel beta-barrel domain, which binds FAD, and a C-terminal five-stranded parallel beta-sheet domain, which binds NADPH/NADP+ and has a classical nucleotide binding fold. The two domains associate to form a deep cleft where the NADPH and FAD binding sites are juxtaposed. The structure displays sequence conserved motifs in the region surrounding the two dinucleotide binding sites, which are characteristic of the homologous enzymes. The folded over conformation of FAD in AvFPR is similar to that in EcFldR due to stacking of Phe255 on the adenine ring of FAD, but it differs from that in the FNR enzymes, which lack a homologous aromatic residue. The structure of AvFPR displays three unique features in the environment of the bound FAD. Two features may affect the rate of reduction of FAD: the absence of an aromatic residue stacked on the isoalloxazine ring in the NADPH binding site; and the interaction of a carbonyl group with N10 of the flavin. Both of these features are due to the substitution of a conserved C-terminal tyrosine residue with alanine (Ala254) in AvFPR. An additional unique feature may affect the interaction of AvFPR with its redox partner ferredoxin I (FdI). This is the extension of the C-terminus by three residues relative to EcFldR and by four residues relative to FNR. The C-terminal residue, Lys258, interacts with the AMP phosphate of FAD. Consequently, both phosphate groups are paired with a basic group due to the simultaneous interaction of the FMN phosphate with Arg51 in a conserved FAD binding motif. The fourth feature, common to homologous oxidoreductases, is a concentration of 10 basic residues on the face of the protein surrounding the active site, in addition to Arg51 and Lys258. PMID:9865948

  3. Gene: a gene-centered information resource at NCBI.

    PubMed

    Brown, Garth R; Hem, Vichet; Katz, Kenneth S; Ovetsky, Michael; Wallin, Craig; Ermolaeva, Olga; Tolstoy, Igor; Tatusova, Tatiana; Pruitt, Kim D; Maglott, Donna R; Murphy, Terence D

    2015-01-01

    The National Center for Biotechnology Information's (NCBI) Gene database (www.ncbi.nlm.nih.gov/gene) integrates gene-specific information from multiple data sources. NCBI Reference Sequence (RefSeq) genomes for viruses, prokaryotes and eukaryotes are the primary foundation for Gene records in that they form the critical association between sequence and a tracked gene upon which additional functional and descriptive content is anchored. Additional content is integrated based on the genomic location and RefSeq transcript and protein sequence data. The content of a Gene record represents the integration of curation and automated processing from RefSeq, collaborating model organism databases, consortia such as Gene Ontology, and other databases within NCBI. Records in Gene are assigned unique, tracked integers as identifiers. The content (citations, nomenclature, genomic location, gene products and their attributes, phenotypes, sequences, interactions, variation details, maps, expression, homologs, protein domains and external databases) is available via interactive browsing through NCBI's Entrez system, via NCBI's Entrez programming utilities (E-Utilities and Entrez Direct) and for bulk transfer by FTP. Published by Oxford University Press on behalf of Nucleic Acids Research 2014. This work is written by (a) US Government employee(s) and is in the public domain in the US.

  4. Finding similar nucleotide sequences using network BLAST searches.

    PubMed

    Ladunga, Istvan

    2009-06-01

    The Basic Local Alignment Search Tool (BLAST) is a keystone of bioinformatics due to its performance and user-friendliness. Beginner and intermediate users will learn how to design and submit blastn and Megablast searches on the Web pages at the National Center for Biotechnology Information. We map nucleic acid sequences to genomes, find identical or similar mRNA, expressed sequence tag, and noncoding RNA sequences, and run Megablast searches, which are much faster than blastn. Understanding results is assisted by taxonomy reports, genomic views, and multiple alignments. We interpret expected frequency thresholds, biological significance, and statistical significance. Weak hits provide no evidence, but hints for further analyses. We find genes that may code for homologous proteins by translated BLAST. We reduce false positives by filtering out low-complexity regions. Parsed BLAST results can be integrated into analysis pipelines. Links in the output connect to Entrez, PUBMED, structural, sequence, interaction, and expression databases. This facilitates integration with a wide spectrum of biological knowledge.

  5. Membrane and Protein Interactions of the Pleckstrin Homology Domain Superfamily

    PubMed Central

    Lenoir, Marc; Kufareva, Irina; Abagyan, Ruben; Overduin, Michael

    2015-01-01

    The human genome encodes about 285 proteins that contain at least one annotated pleckstrin homology (PH) domain. As the first phosphoinositide binding module domain to be discovered, the PH domain recruits diverse protein architectures to cellular membranes. PH domains constitute one of the largest protein superfamilies, and have diverged to regulate many different signaling proteins and modules such as Dbl homology (DH) and Tec homology (TH) domains. The ligands of approximately 70 PH domains have been validated by binding assays and complexed structures, allowing meaningful extrapolation across the entire superfamily. Here the Membrane Optimal Docking Area (MODA) program is used at a genome-wide level to identify all membrane docking PH structures and map their lipid-binding determinants. In addition to the linear sequence motifs which are employed for phosphoinositide recognition, the three dimensional structural features that allow peripheral membrane domains to approach and insert into the bilayer are pinpointed and can be predicted ab initio. The analysis shows that conserved structural surfaces distinguish which PH domains associate with membrane from those that do not. Moreover, the results indicate that lipid-binding PH domains can be classified into different functional subgroups based on the type of membrane insertion elements they project towards the bilayer. PMID:26512702

  6. A Comprehensive Strategy for Accurate Mutation Detection of the Highly Homologous PMS2.

    PubMed

    Li, Jianli; Dai, Hongzheng; Feng, Yanming; Tang, Jia; Chen, Stella; Tian, Xia; Gorman, Elizabeth; Schmitt, Eric S; Hansen, Terah A A; Wang, Jing; Plon, Sharon E; Zhang, Victor Wei; Wong, Lee-Jun C

    2015-09-01

    Germline mutations in the DNA mismatch repair gene PMS2 underlie the cancer susceptibility syndrome, Lynch syndrome. However, accurate molecular testing of PMS2 is complicated by a large number of highly homologous sequences. To establish a comprehensive approach for mutation detection of PMS2, we have designed a strategy combining targeted capture next-generation sequencing (NGS), multiplex ligation-dependent probe amplification, and long-range PCR followed by NGS to simultaneously detect point mutations and copy number changes of PMS2. Exonic deletions (E2 to E9, E5 to E9, E8, E10, E14, and E1 to E15), duplications (E11 to E12), and a nonsense mutation, p.S22*, were identified. Traditional multiplex ligation-dependent probe amplification and Sanger sequencing approaches cannot differentiate the origin of the exonic deletions in the 3' region when PMS2 and PMS2CL share identical sequences as a result of gene conversion. Our approach allows unambiguous identification of mutations in the active gene with a straightforward long-range-PCR/NGS method. Breakpoint analysis of multiple samples revealed that recurrent exon 14 deletions are mediated by homologous Alu sequences. Our comprehensive approach provides a reliable tool for accurate molecular analysis of genes containing multiple copies of highly homologous sequences and should improve PMS2 molecular analysis for patients with Lynch syndrome. Copyright © 2015 American Society for Investigative Pathology and the Association for Molecular Pathology. Published by Elsevier Inc. All rights reserved.

  7. Targeting Neuroblastoma Cell Surface Proteins: Recommendations for Homology Modeling of hNET, ALK, and TrkB.

    PubMed

    Haddad, Yazan; Heger, Zbyněk; Adam, Vojtech

    2017-01-01

    Targeted therapy is a promising approach for treatment of neuroblastoma as evident from the large number of targeting agents employed in clinical practice today. In the absence of known crystal structures, researchers rely on homology modeling to construct template-based theoretical structures for drug design and testing. Here, we discuss three candidate cell surface proteins that are suitable for homology modeling: human norepinephrine transporter (hNET), anaplastic lymphoma kinase (ALK), and neurotrophic tyrosine kinase receptor 2 (NTRK2 or TrkB). When choosing templates, both sequence identity and structure quality are important for homology modeling and pose the first of many challenges in the modeling process. Homology modeling of hNET can be improved using template models of dopamine and serotonin transporters instead of the leucine transporter (LeuT). The extracellular domains of ALK and TrkB are yet to be exploited by homology modeling. There are several idiosyncrasies that require direct attention throughout the process of model construction, evaluation and refinement. Shifts/gaps in the alignment between the template and target, backbone outliers and side-chain rotamer outliers are among the main sources of physical errors in the structures. Low-conserved regions can be refined with loop modeling method. Residue hydrophobicity, accessibility to bound metals or glycosylation can aid in model refinement. We recommend resolving these idiosyncrasies as part of "good modeling practice" to obtain highest quality model. Decreasing physical errors in protein structures plays major role in the development of targeting agents and understanding of chemical interactions at the molecular level.

  8. RNA regulators responding to ribosomal protein S15 are frequent in sequence space

    PubMed Central

    Slinger, Betty L.; Meyer, Michelle M.

    2016-01-01

    There are several natural examples of distinct RNA structures that interact with the same ligand to regulate the expression of homologous genes in different organisms. One essential question regarding this phenomenon is whether such RNA regulators are the result of convergent or divergent evolution. Are the RNAs derived from some common ancestor and diverged to the point where we cannot identify the similarity, or have multiple solutions to the same biological problem arisen independently? A key variable in assessing these alternatives is how frequently such regulators arise within sequence space. Ribosomal protein S15 is autogenously regulated via an RNA regulator in many bacterial species; four apparently distinct regulators have been functionally validated in different bacterial phyla. Here, we explore how frequently such regulators arise within a partially randomized sequence population. We find many RNAs that interact specifically with ribosomal protein S15 from Geobacillus kaustophilus with biologically relevant dissociation constants. Furthermore, of the six sequences we characterize, four show regulatory activity in an Escherichia coli reporter assay. Subsequent footprinting and mutagenesis analysis indicates that protein binding proximal to regulatory features such as the Shine–Dalgarno sequence is sufficient to enable regulation, suggesting that regulation in response to S15 is relatively easily acquired. PMID:27580716

  9. Domain architecture conservation in orthologs

    PubMed Central

    2011-01-01

    Background As orthologous proteins are expected to retain function more often than other homologs, they are often used for functional annotation transfer between species. However, ortholog identification methods do not take into account changes in domain architecture, which are likely to modify a protein's function. By domain architecture we refer to the sequential arrangement of domains along a protein sequence. To assess the level of domain architecture conservation among orthologs, we carried out a large-scale study of such events between human and 40 other species spanning the entire evolutionary range. We designed a score to measure domain architecture similarity and used it to analyze differences in domain architecture conservation between orthologs and paralogs relative to the conservation of primary sequence. We also statistically characterized the extents of different types of domain swapping events across pairs of orthologs and paralogs. Results The analysis shows that orthologs exhibit greater domain architecture conservation than paralogous homologs, even when differences in average sequence divergence are compensated for, for homologs that have diverged beyond a certain threshold. We interpret this as an indication of a stronger selective pressure on orthologs than paralogs to retain the domain architecture required for the proteins to perform a specific function. In general, orthologs as well as the closest paralogous homologs have very similar domain architectures, even at large evolutionary separation. The most common domain architecture changes observed in both ortholog and paralog pairs involved insertion/deletion of new domains, while domain shuffling and segment duplication/deletion were very infrequent. Conclusions On the whole, our results support the hypothesis that function conservation between orthologs demands higher domain architecture conservation than other types of homologs, relative to primary sequence conservation. This supports the notion that orthologs are functionally more similar than other types of homologs at the same evolutionary distance. PMID:21819573

  10. Highly divergent ancient gene families in metagenomic samples are compatible with additional divisions of life.

    PubMed

    Lopez, Philippe; Halary, Sébastien; Bapteste, Eric

    2015-10-26

    Microbial genetic diversity is often investigated via the comparison of relatively similar 16S molecules through multiple alignments between reference sequences and novel environmental samples using phylogenetic trees, direct BLAST matches, or phylotypes counts. However, are we missing novel lineages in the microbial dark universe by relying on standard phylogenetic and BLAST methods? If so, how can we probe that universe using alternative approaches? We performed a novel type of multi-marker analysis of genetic diversity exploiting the topology of inclusive sequence similarity networks. Our protocol identified 86 ancient gene families, well distributed and rarely transferred across the 3 domains of life, and retrieved their environmental homologs among 10 million predicted ORFs from human gut samples and other metagenomic projects. Numerous highly divergent environmental homologs were observed in gut samples, although the most divergent genes were over-represented in non-gut environments. In our networks, most divergent environmental genes grouped exclusively with uncultured relatives, in maximal cliques. Sequences within these groups were under strong purifying selection and presented a range of genetic variation comparable to that of a prokaryotic domain. Many genes families included environmental homologs that were highly divergent from cultured homologs: in 79 gene families (including 18 ribosomal proteins), Bacteria and Archaea were less divergent than some groups of environmental sequences were to any cultured or viral homologs. Moreover, some groups of environmental homologs branched very deeply in phylogenetic trees of life, when they were not too divergent to be aligned. These results underline how limited our understanding of the most diverse elements of the microbial world remains, and encourage a deeper exploration of natural communities and their genetic resources, hinting at the possibility that still unknown yet major divisions of life have yet to be discovered.

  11. A trait stacking system via intra-genomic homologous recombination.

    PubMed

    Kumar, Sandeep; Worden, Andrew; Novak, Stephen; Lee, Ryan; Petolino, Joseph F

    2016-11-01

    A gene targeting method has been developed, which allows the conversion of 'breeding stacks', containing unlinked transgenes into a 'molecular stack' and thereby circumventing the breeding challenges associated with transgene segregation. A gene targeting method has been developed for converting two unlinked trait loci into a single locus transgene stack. The method utilizes intra-genomic homologous recombination (IGHR) between stably integrated target and donor loci which share sequence homology and nuclease cleavage sites whereby the donor contains a promoterless herbicide resistance transgene. Upon crossing with a zinc finger nuclease (ZFN)-expressing plant, double-strand breaks (DSB) are created in both the stably integrated target and donor loci. DSBs flanking the donor locus result in intra-genomic mobilization of a promoterless selectable marker-containing donor sequence, which can be utilized as a template for homology-directed repair of a concomitant DSB at the target locus resulting in a functional selectable marker via nuclease-mediated cassette exchange (NMCE). The method was successfully demonstrated in maize using a glyphosate tolerance gene as a donor whereby up to 3.3 % of the resulting progeny embryos cultured on selection medium regenerated plants with the donor sequence integrated into the target locus. The process could be extended to multiple cycles of trait stacking by virtue of a unique intron sequence homology for NMCE between the target and the donor loci. This is the first report that describes NMCE via IGHR, thereby enabling trait stacking using conventional crossing.

  12. Better Understanding of Homologous Recombination through a 12-Week Laboratory Course for Undergraduates Majoring in Biotechnology

    ERIC Educational Resources Information Center

    Li, Ming; Shen, Xiaodong; Zhao, Yan; Hu, Xiaomei; Hu, Fuquan; Rao, Xiancai

    2017-01-01

    Homologous recombination, a central concept in biology, is defined as the exchange of DNA strands between two similar or identical nucleotide sequences. Unfortunately, undergraduate students majoring in biotechnology often experience difficulties in understanding the molecular basis of homologous recombination. In this study, we developed and…

  13. Bloom DNA Helicase Facilitates Homologous Recombination between Diverged Homologous Sequences*

    PubMed Central

    Kikuchi, Koji; Abdel-Aziz, H. Ismail; Taniguchi, Yoshihito; Yamazoe, Mitsuyoshi; Takeda, Shunichi; Hirota, Kouji

    2009-01-01

    Bloom syndrome caused by inactivation of the Bloom DNA helicase (Blm) is characterized by increases in the level of sister chromatid exchange, homologous recombination (HR) associated with cross-over. It is therefore believed that Blm works as an anti-recombinase. Meanwhile, in Drosophila, DmBlm is required specifically to promote the synthesis-dependent strand anneal (SDSA), a type of HR not associating with cross-over. However, conservation of Blm function in SDSA through higher eukaryotes has been a matter of debate. Here, we demonstrate the function of Blm in SDSA type HR in chicken DT40 B lymphocyte line, where Ig gene conversion diversifies the immunoglobulin V gene through intragenic HR between diverged homologous segments. This reaction is initiated by the activation-induced cytidine deaminase enzyme-mediated uracil formation at the V gene, which in turn converts into abasic site, presumably leading to a single strand gap. Ig gene conversion frequency was drastically reduced in BLM−/− cells. In addition, BLM−/− cells used limited donor segments harboring higher identity compared with other segments in Ig gene conversion event, suggesting that Blm can promote HR between diverged sequences. To further understand the role of Blm in HR between diverged homologous sequences, we measured the frequency of gene targeting induced by an I-SceI-endonuclease-mediated double-strand break. BLM−/− cells showed a severer defect in the gene targeting frequency as the number of heterologous sequences increased at the double-strand break site. Conversely, the overexpression of Blm, even an ATPase-defective mutant, strongly stimulated gene targeting. In summary, Blm promotes HR between diverged sequences through a novel ATPase-independent mechanism. PMID:19661064

  14. Comparative analyses of putative toxin gene homologs from an Old World viper, Daboia russelii

    PubMed Central

    Krishnan, Neeraja M.

    2017-01-01

    Availability of snake genome sequences has opened up exciting areas of research on comparative genomics and gene diversity. One of the challenges in studying snake genomes is the acquisition of biological material from live animals, especially from the venomous ones, making the process cumbersome and time-consuming. Here, we report comparative sequence analyses of putative toxin gene homologs from Russell’s viper (Daboia russelii) using whole-genome sequencing data obtained from shed skin. When compared with the major venom proteins in Russell’s viper studied previously, we found 45–100% sequence similarity between the venom proteins and their putative homologs in the skin. Additionally, comparative analyses of 20 putative toxin gene family homologs provided evidence of unique sequence motifs in nerve growth factor (NGF), platelet derived growth factor (PDGF), Kunitz/Bovine pancreatic trypsin inhibitor (Kunitz BPTI), cysteine-rich secretory proteins, antigen 5, andpathogenesis-related1 proteins (CAP) and cysteine-rich secretory protein (CRISP). In those derived proteins, we identified V11 and T35 in the NGF domain; F23 and A29 in the PDGF domain; N69, K2 and A5 in the CAP domain; and Q17 in the CRISP domain to be responsible for differences in the largest pockets across the protein domain structures in crotalines, viperines and elapids from the in silico structure-based analysis. Similarly, residues F10, Y11 and E20 appear to play an important role in the protein structures across the kunitz protein domain of viperids and elapids. Our study highlights the usefulness of shed skin in obtaining good quality high-molecular weight DNA for comparative genomic studies, and provides evidence towards the unique features and evolution of putative venom gene homologs in vipers. PMID:29230357

  15. The site-specific ribosomal insertion element type II of Bombyx mori (R2Bm) contains the coding sequence for a reverse transcriptase-like enzyme.

    PubMed Central

    Burke, W D; Calalang, C C; Eickbush, T H

    1987-01-01

    Two classes of DNA elements interrupt a fraction of the rRNA repeats of Bombyx mori. We have analyzed by genomic blotting and sequence analysis one class of these elements which we have named R2. These elements occupy approximately 9% of the rDNA units of B. mori and appear to be homologous to the type II rDNA insertions detected in Drosophila melanogaster. Approximately 25 copies of R2 exist within the B. mori genome, of which at least 20 are located at a precise location within otherwise typical rDNA units. Nucleotide sequence analysis has revealed that the 4.2-kilobase-pair R2 element has a single large open reading frame, occupying over 82% of the total length of the element. The central region of this 1,151-amino-acid open reading frame shows homology to the reverse transcriptase enzymes found in retroviruses and certain transposable elements. Amino acid homology of this region is highest to the mobile line 1 elements of mammals, followed by the mitochondrial type II introns of fungi, and the pol gene of retroviruses. Less homology exists with transposable elements of D. melanogaster and Saccharomyces cerevisiae. Two additional regions of sequence homology between L1 and R2 elements were also found outside the reverse transcriptase region. We suggest that the R2 elements are retrotransposons that are site specific in their insertion into the genome. Such mobility would enable these elements to occupy a small fraction of the rDNA units of B. mori despite their continual elimination from the rDNA locus by sequence turnover. Images PMID:2439905

  16. Feedback Regulation of ABA Signaling and Biosynthesis by a bZIP Transcription Factor Targets Drought-Resistance-Related Genes1[OPEN

    PubMed Central

    Tang, Ning; Yang, Jun; Peng, Lei; Ma, Siqi; Xu, Yan; Li, Guoliang

    2016-01-01

    The OsbZIP23 transcription factor has been characterized for its essential role in drought resistance in rice (Oryza sativa), but the mechanism is unknown. In this study, we first investigated the transcriptional activation of OsbZIP23. A homolog of SnRK2 protein kinase (SAPK2) was found to interact with and phosphorylate OsbZIP23 for its transcriptional activation. SAPK2 also interacted with OsPP2C49, an ABI1 homolog, which deactivated the SAPK2 to inhibit the transcriptional activation activity of OsbZIP23. Next, we performed genome-wide identification of OsbZIP23 targets by immunoprecipitation sequencing and RNA sequencing analyses in the OsbZIP23-overexpression, osbzip23 mutant, and wild-type rice under normal and drought stress conditions. OsbZIP23 directly regulates a large number of reported genes that function in stress response, hormone signaling, and developmental processes. Among these targets, we found that OsbZIP23 could positively regulate OsPP2C49, and overexpression of OsPP2C49 in rice resulted in significantly decreased sensitivity of the abscisic acid (ABA) response and rapid dehydration. Moreover, OsNCED4 (9-cis-epoxycarotenoid dioxygenase4), a key gene in ABA biosynthesis, was also positively regulated by OsbZIP23. Together, our results suggest that OsbZIP23 acts as a central regulator in ABA signaling and biosynthesis, and drought resistance in rice. PMID:27325665

  17. Molecular cloning and nucleotide sequence of a transforming gene detected by transfection of chicken B-cell lymphoma DNA

    NASA Astrophysics Data System (ADS)

    Goubin, Gerard; Goldman, Debra S.; Luce, Judith; Neiman, Paul E.; Cooper, Geoffrey M.

    1983-03-01

    A transforming gene detected by transfection of chicken B-cell lymphoma DNA has been isolated by molecular cloning. It is homologous to a conserved family of sequences present in normal chicken and human DNAs but is not related to transforming genes of acutely transforming retroviruses. The nucleotide sequence of the cloned transforming gene suggests that it encodes a protein that is partially homologous to the amino terminus of transferrin and related proteins although only about one tenth the size of transferrin.

  18. Structural insights into the anti-HIV activity of the Oscillatoria agardhii agglutinin homolog lectin family.

    PubMed

    Koharudin, Leonardus M I; Kollipara, Sireesha; Aiken, Christopher; Gronenborn, Angela M

    2012-09-28

    Oscillatoria agardhii agglutinin homolog (OAAH) proteins belong to a recently discovered lectin family. All members contain a sequence repeat of ~66 amino acids, with the number of repeats varying among different family members. Apart from data for the founding member OAA, neither three-dimensional structures, information about carbohydrate binding specificities, nor antiviral activity data have been available up to now for any other members of the OAAH family. To elucidate the structural basis for the antiviral mechanism of OAAHs, we determined the crystal structures of Pseudomonas fluorescens and Myxococcus xanthus lectins. Both proteins exhibit the same fold, resembling the founding family member, OAA, with minor differences in loop conformations. Carbohydrate binding studies by NMR and x-ray structures of glycan-lectin complexes reveal that the number of sugar binding sites corresponds to the number of sequence repeats in each protein. As for OAA, tight and specific binding to α3,α6-mannopentaose was observed. All the OAAH proteins described here exhibit potent anti-HIV activity at comparable levels. Altogether, our results provide structural details of the protein-carbohydrate interaction for this novel lectin family and insights into the molecular basis of their HIV inactivation properties.

  19. EUGÈNE'HOM: a generic similarity-based gene finder using multiple homologous sequences

    PubMed Central

    Foissac, Sylvain; Bardou, Philippe; Moisan, Annick; Cros, Marie-Josée; Schiex, Thomas

    2003-01-01

    EUGÈNE'HOM is a gene prediction software for eukaryotic organisms based on comparative analysis. EUGÈNE'HOM is able to take into account multiple homologous sequences from more or less closely related organisms. It integrates the results of TBLASTX analysis, splice site and start codon prediction and a robust coding/non-coding probabilistic model which allows EUGÈNE'HOM to handle sequences from a variety of organisms. The current target of EUGÈNE'HOM is plant sequences. The EUGÈNE'HOM web site is available at http://genopole.toulouse.inra.fr/bioinfo/eugene/EuGeneHom/cgi-bin/EuGeneHom.pl. PMID:12824408

  20. Exploring the Interaction of SV2A with Racetams Using Homology Modelling, Molecular Dynamics and Site-Directed Mutagenesis

    PubMed Central

    Lee, Joanna; Daniels, Veronique; Sands, Zara A.; Lebon, Florence; Shi, Jiye; Biggin, Philip C.

    2015-01-01

    The putative Major Facilitator Superfamily (MFS) transporter, SV2A, is the target for levetiracetam (LEV), which is a successful anti-epileptic drug. Furthermore, SV2A knock out mice display a severe seizure phenotype and die after a few weeks. Despite this, the mode of action of LEV is not known at the molecular level. It would be extremely desirable to understand this more fully in order to aid the design of improved anti-epileptic compounds. Since there is no structure for SV2A, homology modelling can provide insight into the ligand-binding site. However, it is not a trivial process to build such models, since SV2A has low sequence identity to those MFS transporters whose structures are known. A further level of complexity is added by the fact that it is not known which conformational state of the receptor LEV binds to, as multiple conformational states have been inferred by tomography and ligand binding assays or indeed, if binding is exclusive to a single state. Here, we explore models of both the inward and outward facing conformational states of SV2A (according to the alternating access mechanism for MFS transporters). We use a sequence conservation analysis to help guide the homology modelling process and generate the models, which we assess further with Molecular Dynamics (MD). By comparing the MD results in conjunction with docking and simulation of a LEV-analogue used in radioligand binding assays, we were able to suggest further residues that line the binding pocket. These were confirmed experimentally. In particular, mutation of D670 leads to a complete loss of binding. The results shed light on the way LEV analogues may interact with SV2A and may help with the on-going design of improved anti-epileptic compounds. PMID:25692762

  1. Genomic and Transcriptomic Analyses of Indole-3-Acetic Acid Biosynthesis in Diatoms

    NASA Astrophysics Data System (ADS)

    Lim, R.; Armbrust, V.

    2016-02-01

    Indole-3-acetic acid (IAA) is a major plant growth hormone and a common mediator of plant-bacterial interactions. Recently, IAA has also been found to play a role in interactions between diatoms and bacteria, with IAA production by an associated Sulfitobacter leading to increased growth rates in the marine diatom Pseudo-nitzschia multiseries. It is unclear, however, if diatoms themselves are able to synthesize IAA and whether this capability is widespread throughout Bacillariophyta. Four major tryptophan-dependent IAA biosynthesis pathways have been identified in plants and bacteria, each denoted by the first intermediate downstream of tryptophan: the indole-3-pyruvate (IPyA), tryptamine (TAM), indole-3-acetaldoxime (IAOx) and indole-3-acetamide (IAM) pathways. To investigate the possibility of IAA biosynthesis in diatoms, we first analyzed publicly available genomes of raphid pennates P. multiseries, Phaeodactylum tricornutum, Fragilariopsis cylindrus and centric Thalassiosira pseudonana for potential homologs to plant and bacterial IAA biosynthesis genes. The P. multiseries, F. cylindrus and P. tricornutum genomes encode downstream enzymes for bacterial TAM and IAM and plant IPyA pathways. The more evolutionarily ancient T. pseudonana encodes one TAM enzyme in its genome. To investigate the potential distribution of these pathways more broadly, we surveyed the transcriptomes of 11 diatom species that include representatives from all four Bacillariophyta classes. Datasets used were sequenced as part of the Marine Microbial Eukaryote Transcriptome Sequencing Project (MMETSP) and obtained from cultures maintained axenically. Transcripts associated with the TAM pathway were most frequently detected, with potential homologs to required enzymes identified in 10 of the 11 species examined. Transcripts homologous to rate-limiting IPyA enzymes were detected in six species. Only two centric and araphid pennate species expressed transcripts associated with enzymes in the IAM and IAOx pathways. This pattern suggests multiple events of gene loss as the phylum expanded and diversified. Mass spectrometry analyses will be conducted to confirm the production of IAA in axenic cultures of P. pungens, P. multistriata, Skeletonema marinoi and F. cylindrus.

  2. Developmental rearrangement of cyanobacterial nif genes: nucleotide sequence, open reading frames, and cytochrome P-450 homology of the Anabaena sp. strain PCC 7120 nifD element.

    PubMed Central

    Lammers, P J; McLaughlin, S; Papin, S; Trujillo-Provencio, C; Ryncarz, A J

    1990-01-01

    An 11-kbp DNA element of unknown function interrupts the nifD gene in vegetative cells of Anabaena sp. strain PCC 7120. In developing heterocysts the nifD element excises from the chromosome via site-specific recombination between short repeat sequences that flank the element. The nucleotide sequence of the nifH-proximal half of the element was determined to elucidate the genetic potential of the element. Four open reading frames with the same relative orientation as the nifD element-encoded xisA gene were identified in the sequenced region. Each of the open reading frames was preceded by a reasonable ribosome-binding site and had biased codon utilization preferences consistent with low levels of expression. Open reading frame 3 was highly homologous with three cytochrome P-450 omega-hydroxylase proteins and showed regional homology to functionally significant domains common to the cytochrome P-450 superfamily. The sequence encoding open reading frame 2 was the most highly conserved portion of the sequenced region based on heterologous hybridization experiments with three genera of heterocystous cyanobacteria. Images PMID:2123860

  3. Characterization and mapping of cDNA encoding aspartate aminotransferase in rice, Oryza sativa L.

    PubMed

    Song, J; Yamamoto, K; Shomura, A; Yano, M; Minobe, Y; Sasaki, T

    1996-10-31

    Fifteen cDNA clones, putatively identified as encoding aspartate aminotransferase (AST, EC 2.6.1.1.), were isolated and partially sequenced. Together with six previously isolated clones putatively identified to encode ASTs (Sasaki, et al. 1994, Plant Journal 6, 615-624), their sequences were characterized and classified into 4 cDNA species. Two of the isolated clones, C60213 and C2079, were full-length cDNAs, and their complete nucleotide sequences were determined. C60213 was 1612 bp long and its deduced amino acid sequence showed 88% homology with that of Panicum miliaceum L. mitochondrial AST. The C60213-encoded protein had an N-terminal amino acid sequence that was characteristic of a mitochondrial transit peptide. On the other hand, C2079 was 1546 bp long and had 91% amino acid sequence homology with P. miliaceum L. cytosolic AST but lacked in the transit peptide sequence. The homologies of nucleotide sequences and deduced amino acid sequences of C2079 and C60213 were 54% and 52%, respectively. C2079 and C60213 were mapped on chromosomes 1 and 6, respectively, by restriction fragment length polymorphism linkage analysis. Northern blot analysis using C2079 as a probe revealed much higher transcript levels in callus and root than in green and etiolated shoots, suggesting tissue-specific variations of AST gene expression.

  4. Echinococcus granulosus Sensu Stricto in Dogs and Jackals from Caspian Sea Region, Northern Iran

    PubMed Central

    GHOLAMI, Shirzad; JAHANDAR, Hefzallah; ABASTABAR, Mahdi; PAGHEH, Abdolsatar; MOBEDI, Iraj; SHARBATKHORI, Mitra

    2016-01-01

    Background: The aim of the present study was genotyping of Echinococcus granulosus isolates from dogs and jackals in Mazandaran Province, northern Iran, and using partial sequence of the mitochondrial cytochrome c oxidase subunit 1 gene (cox1). Methods: E. granulosus isolates (n = 15) were collected from 42 stray dogs and 16 jackals found in south of the Caspian Sea in northern Iran. After morphological study, the isolates were genetically characterized using consensus sequences (366bp) of the cox1 gene. Phylogenetic analysis of cox1 nucleotide sequence data was performed using a Bayesian Inference approach. Results: Four different sequences were observed among the isolates. Two genotypes [G1 (66.7%) and G3 (33.3%)] were identified among the isolates. The G1 sequences indicated three sequence profiles. One profile (Maz1) had 100% homology with reference sequence (AN: KP339045). Two other profiles, designated Maz2 and Maz3, had 99% homology with the G1 genotype (ANs: KP339046 and KP339047). A G3 sequence designated Maz4 showed 100% homology with a G3 reference sequence (AN: KP339048). Conclusion: The occurrence of the G1 genotype of E. granulosus sensu stricto as a frequent genotype in dogs is emphasized. This study established the first molecular characterization of E. granulosus in the province. PMID:28096852

  5. Gene Unprediction with Spurio: A tool to identify spurious protein sequences.

    PubMed

    Höps, Wolfram; Jeffryes, Matt; Bateman, Alex

    2018-01-01

    We now have access to the sequences of tens of millions of proteins. These protein sequences are essential for modern molecular biology and computational biology. The vast majority of protein sequences are derived from gene prediction tools and have no experimental supporting evidence for their translation.  Despite the increasing accuracy of gene prediction tools there likely exists a large number of spurious protein predictions in the sequence databases.  We have developed the Spurio tool to help identify spurious protein predictions in prokaryotes.  Spurio searches the query protein sequence against a prokaryotic nucleotide database using tblastn and identifies homologous sequences. The tblastn matches are used to score the query sequence's likelihood of being a spurious protein prediction using a Gaussian process model. The most informative feature is the appearance of stop codons within the presumed translation of homologous DNA sequences. Benchmarking shows that the Spurio tool is able to distinguish spurious from true proteins. However, transposon proteins are prone to be predicted as spurious because of the frequency of degraded homologs found in the DNA sequence databases. Our initial experiments suggest that less than 1% of the proteins in the UniProtKB sequence database are likely to be spurious and that Spurio is able to identify over 60 times more spurious proteins than the AntiFam resource. The Spurio software and source code is available under an MIT license at the following URL: https://bitbucket.org/bateman-group/spurio.

  6. The LINE-1 DNA sequences in four mammalian orders predict proteins that conserve homologies to retrovirus proteins.

    PubMed Central

    Fanning, T; Singer, M

    1987-01-01

    Recent work suggests that one or more members of the highly repeated LINE-1 (L1) DNA family found in all mammals may encode one or more proteins. Here we report the sequence of a portion of an L1 cloned from the domestic cat (Felis catus). These data permit comparison of the L1 sequences in four mammalian orders (Carnivore, Lagomorph, Rodent and Primate) and the comparison supports the suggested coding potential. In two separate, noncontiguous regions in the carboxy terminal half of the proteins predicted from the DNA sequences, there are several strongly conserved segments. In one region, these share homology with known or suspected reverse transcriptases, as described by others in rodents and primates. In the second region, closer to the carboxy terminus, the strongly conserved segments are over 90% homologous among the four orders. One of the latter segments is cysteine rich and resembles the putative metal binding domains of nucleic acid binding proteins, including those of TFIIIA and retroviruses. PMID:3562227

  7. The N-terminal sequence of ribosomal protein L10 from the archaebacterium Halobacterium marismortui and its relationship to eubacterial protein L6 and other ribosomal proteins.

    PubMed

    Dijk, J; van den Broek, R; Nasiulas, G; Beck, A; Reinhardt, R; Wittmann-Liebold, B

    1987-08-01

    The amino-terminal sequence of ribosomal protein L10 from Halobacterium marismortui has been determined up to residue 54, using both a liquid- and a gas-phase sequenator. The two sequences are in good agreement. The protein is clearly homologous to protein HcuL10 from the related strain Halobacterium cutirubrum. Furthermore, a weaker but distinct homology to ribosomal protein L6 from Escherichia coli and Bacillus stearothermophilus can be detected. In addition to 7 identical amino acids in the first 36 residues in all four sequences a number of conservative replacements occurs, of mainly hydrophobic amino acids. In this common region the pattern of conserved amino acids suggests the presence of a beta-alpha fold as it occurs in ribosomal proteins L12 and L30. Furthermore, several potential cases of homology to other ribosomal components of the three ur-kingdoms have been found.

  8. Molecular characterization of chikungunya virus from Andhra Pradesh, India & phylogenetic relationship with Central African isolates.

    PubMed

    M Naresh Kumar, C V; Anthony Johnson, A M; R Sai Gopal, D V

    2007-12-01

    Chikungunya virus has caused numerous large outbreaks in India. Suspected blood samples from the epidemic were collected and characterized for the identification of the responsible causative from Rayalaseema region of Andhra Pradesh. RT-PCR was used for screening of suspected blood samples. Primers were designed to amplify partial E1 gene and the amplified fragment was cloned and sequenced. The sequence was analyzed and compared with other geographical isolates to find the phylogenetic relationship. The sequence was submitted to the Gen bank DNA database (accession DQ888620). Comparative nucleotide homology analysis of the AP Ra-CTR isolate with the other isolates revealed 94.7+/-3.6 per cent of homology of CHIKAPRa-CTR with other isolates of Chikungunya virus at nucleotide level and 96.8+/-3.2 per cent of homology at amino acid level. The current epidemic was caused by the Central African genotype of CHIKV, grouped in Central Africa cluster in phylogenetic trees generated based on nucleotide and amino acid sequences.

  9. DNA sequences of three beta-1,4-endoglucanase genes from Thermomonospora fusca.

    PubMed Central

    Lao, G; Ghangas, G S; Jung, E D; Wilson, D B

    1991-01-01

    The DNA sequences of the Thermomonospora fusca genes encoding cellulases E2 and E5 and the N-terminal end of E4 were determined. Each sequence contains an identical 14-bp inverted repeat upstream of the initiation codon. There were no significant homologies between the coding regions of the three genes. The E2 gene is 73% identical to the celA gene from Microbispora bispora, but this was the only homology found with other cellulase genes. E2 belongs to a family of cellulases that includes celA from M. bispora, cenA from Cellulomonas fimi, casA from an alkalophilic Streptomyces strain, and cellobiohydrolase II from Trichoderma reesei. E4 shows 44% identity to an avocado cellulase, while E5 belongs to the Bacillus cellulase family. There were strong similarities between the amino acid sequences of the E2 and E5 cellulose binding domains, and these regions also showed homology with C. fimi and Pseudomonas fluorescens cellulose binding domains. PMID:1904434

  10. Rapid Hypothesis Testing with Candida albicans through Gene Disruption with Short Homology Regions

    PubMed Central

    Wilson, R. Bryce; Davis, Dana; Mitchell, Aaron P.

    1999-01-01

    Disruption of newly identified genes in the pathogen Candida albicans is a vital step in determination of gene function. Several gene disruption methods described previously employ long regions of homology flanking a selectable marker. Here, we describe disruption of C. albicans genes with PCR products that have 50 to 60 bp of homology to a genomic sequence on each end of a selectable marker. We used the method to disrupt two known genes, ARG5 and ADE2, and two sequences newly identified through the Candida genome project, HRM101 and ENX3. HRM101 and ENX3 are homologous to genes in the conserved RIM101 (previously called RIM1) and PacC pathways of Saccharomyces cerevisiae and Aspergillus nidulans. We show that three independent hrm101/hrm101 mutants and two independent enx3/enx3 mutants are defective in filamentation on Spider medium. These observations argue that HRM101 and ENX3 sequences are indeed portions of genes and that the respective gene products have related functions. PMID:10074081

  11. Conservation of the glycoprotein B homologs of the Kaposi’s sarcoma-associated herpesvirus (KSHV/HHV8) and Old World primate rhadinoviruses of chimpanzees and macaques

    PubMed Central

    Bruce, A. Gregory; Horst, Jeremy A.; Rose, Timothy M.

    2016-01-01

    The envelope-associated glycoprotein B (gB) is highly conserved within the Herpesviridae and plays a critical role in viral entry. We analyzed the evolutionary conservation of sequence and structural motifs within the Kaposi’s sarcoma-associated herpesvirus (KSHV) gB and homologs of Old World primate rhadinoviruses belonging to the distinct RV1 and RV2 rhadinovirus lineages. In addition to gB homologs of rhadinoviruses infecting the pig-tailed and rhesus macaques, we cloned and sequenced gB homologs of RV1 and RV2 rhadinoviruses infecting chimpanzees. A structural model of the KSHV gB was determined, and functional motifs and sequence variants were mapped to the model structure. Conserved domains and motifs were identified, including an “RGD” motif that plays a critical role in KSHV binding and entry through the cellular integrin αVβ3. The RGD motif was only detected in RV1 rhadinoviruses suggesting an important difference in cell tropism between the two rhadinovirus lineages. PMID:27070755

  12. Advances in Homology Protein Structure Modeling

    PubMed Central

    Xiang, Zhexin

    2007-01-01

    Homology modeling plays a central role in determining protein structure in the structural genomics project. The importance of homology modeling has been steadily increasing because of the large gap that exists between the overwhelming number of available protein sequences and experimentally solved protein structures, and also, more importantly, because of the increasing reliability and accuracy of the method. In fact, a protein sequence with over 30% identity to a known structure can often be predicted with an accuracy equivalent to a low-resolution X-ray structure. The recent advances in homology modeling, especially in detecting distant homologues, aligning sequences with template structures, modeling of loops and side chains, as well as detecting errors in a model, have contributed to reliable prediction of protein structure, which was not possible even several years ago. The ongoing efforts in solving protein structures, which can be time-consuming and often difficult, will continue to spur the development of a host of new computational methods that can fill in the gap and further contribute to understanding the relationship between protein structure and function. PMID:16787261

  13. PSI/TM-Coffee: a web server for fast and accurate multiple sequence alignments of regular and transmembrane proteins using homology extension on reduced databases.

    PubMed

    Floden, Evan W; Tommaso, Paolo D; Chatzou, Maria; Magis, Cedrik; Notredame, Cedric; Chang, Jia-Ming

    2016-07-08

    The PSI/TM-Coffee web server performs multiple sequence alignment (MSA) of proteins by combining homology extension with a consistency based alignment approach. Homology extension is performed with Position Specific Iterative (PSI) BLAST searches against a choice of redundant and non-redundant databases. The main novelty of this server is to allow databases of reduced complexity to rapidly perform homology extension. This server also gives the possibility to use transmembrane proteins (TMPs) reference databases to allow even faster homology extension on this important category of proteins. Aside from an MSA, the server also outputs topological prediction of TMPs using the HMMTOP algorithm. Previous benchmarking of the method has shown this approach outperforms the most accurate alignment methods such as MSAProbs, Kalign, PROMALS, MAFFT, ProbCons and PRALINE™. The web server is available at http://tcoffee.crg.cat/tmcoffee. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  14. Acid sphingomyelinase possesses a domain homologous to its activator proteins: saposins B and D.

    PubMed Central

    Ponting, C. P.

    1994-01-01

    An N-terminal region of the acid sphingomyelinase sequence (residues 89-165) is shown to be homologous to saposin-type sequences. By analogy with the known functions of saposins, this sphingomyelinase saposin-type domain may possess lipid-binding and/or sphingomyelinase-activator properties. This finding may prove to be important in the understanding of Niemann-Pick disease, which results from sphingomyelinase deficiency. PMID:8003971

  15. Molecular Phylogenetics of Trichostrongylus Species (Nematoda: Trichostrongylidae) from Humans of Mazandaran Province, Iran.

    PubMed

    Sharifdini, Meysam; Heidari, Zahra; Hesari, Zahra; Vatandoost, Sajad; Kia, Eshrat Beigom

    2017-06-01

    The present study was performed to analyze molecularly the phylogenetic positions of human-infecting Trichostrongylus species in Mazandaran Province, Iran, which is an endemic area for trichostrongyliasis. DNA from 7 Trichostrongylus infected stool samples were extracted by using in-house (IH) method. PCR amplification of ITS2-rDNA region was performed, and products were sequenced. Phylogenetic analysis of the nucleotide sequence data was performed using MEGA 5.0 software. Six out of 7 isolates had high similarity with Trichostrongylus colubriformis , while the other one showed high homology with Trichostrongylus axei registered in GenBank reference sequences. Intra-specific variations within isolates of T. colubriformis and T. axei amounted to 0-1.8% and 0-0.6%, respectively. Trichostrongylus species obtained in the present study were in a cluster with the relevant reference sequences from previous studies. BLAST analysis indicated that there was 100% homology among all 6 ITS2 sequences of T. colubriformis in the present study and most previously registered sequences of T. colubriformis from human, sheep, and goat isolates from Iran and also human isolates from Laos, Thailand, and France. The ITS2 sequence of T. axei exhibited 99.4% homology with the human isolate of T. axei from Thailand, sheep isolates from New Zealand and Iran, and cattle isolate from USA.

  16. Transitive homology-guided structural studies lead to discovery of Cro proteins with 40% sequence identity but different folds

    PubMed Central

    Roessler, Christian G.; Hall, Branwen M.; Anderson, William J.; Ingram, Wendy M.; Roberts, Sue A.; Montfort, William R.; Cordes, Matthew H. J.

    2008-01-01

    Proteins that share common ancestry may differ in structure and function because of divergent evolution of their amino acid sequences. For a typical diverse protein superfamily, the properties of a few scattered members are known from experiment. A satisfying picture of functional and structural evolution in relation to sequence changes, however, may require characterization of a larger, well chosen subset. Here, we employ a “stepping-stone” method, based on transitive homology, to target sequences intermediate between two related proteins with known divergent properties. We apply the approach to the question of how new protein folds can evolve from preexisting folds and, in particular, to an evolutionary change in secondary structure and oligomeric state in the Cro family of bacteriophage transcription factors, initially identified by sequence-structure comparison of distant homologs from phages P22 and λ. We report crystal structures of two Cro proteins, Xfaso 1 and Pfl 6, with sequences intermediate between those of P22 and λ. The domains show 40% sequence identity but differ by switching of α-helix to β-sheet in a C-terminal region spanning ≈25 residues. Sedimentation analysis also suggests a correlation between helix-to-sheet conversion and strengthened dimerization. PMID:18227506

  17. The cytochrome oxidase subunit I and subunit III genes in Oenothera mitochondria are transcribed from identical promoter sequences

    PubMed Central

    Hiesel, Rudolf; Schobel, Werner; Schuster, Wolfgang; Brennicke, Axel

    1987-01-01

    Two loci encoding subunit III of the cytochrome oxidase (COX) in Oenothera mitochondria have been identified from a cDNA library of mitochondrial transcripts. A 657-bp sequence block upstream from the open reading frame is also present in the two copies of the COX subunit I gene and is presumably involved in homologous sequence rearrangement. The proximal points of sequence rearrangements are located 3 bp upstream from the COX I and 1139 bp upstream from the COX III initiation codons. The 5'-termini of both COX I and COX III mRNAs have been mapped in this common sequence confining the promoter region for the Oenothera mitochondrial COX I and COX III genes to the homologous sequence block. ImagesFig. 5. PMID:15981332

  18. Computational allergenicity prediction of transgenic proteins expressed in genetically modified crops.

    PubMed

    Verma, Alok Kumar; Misra, Amita; Subash, Swarna; Das, Mukul; Dwivedi, Premendra D

    2011-09-01

    Development of genetically modified (GM) crops is on increase to improve food quality, increase harvest yields, and reduce the dependency on chemical pesticides. Before their release in marketplace, they should be scrutinized for their safety. Several guidelines of different regulatory agencies like ILSI, WHO Codex, OECD, and so on for allergenicity evaluation of transgenics are available and sequence homology analysis is the first test to determine the allergenic potential of inserted proteins. Therefore, to test and validate, 312 allergenic, 100 non-allergenic, and 48 inserted proteins were assessed for sequence similarity using 8-mer, 80-mer, and full FASTA search. On performing sequence homology studies, ~94% the allergenic proteins gave exact matches for 8-mer and 80-mer homology. However, 20 allergenic proteins showed non-allergenic behavior. Out of 100 non-allergenic proteins, seven qualified as allergens. None of the inserted proteins demonstrated allergenic behavior. In order to improve the predictability, proteins showing anomalous behavior were tested by Algpred and ADFS separately. Use of Algpred and ADFS softwares reduced the tendency of false prediction to a great extent (74-78%). In conclusion, routine sequence homology needs to be coupled with some other bioinformatic method like ADFS/Algpred to reduce false allergenicity prediction of novel proteins.

  19. Differential display RT PCR of total RNA from human foreskin fibroblasts for investigation of androgen-dependent gene expression

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Nitsche, E.M.; Moquin, A.; Adams, P.S.

    1996-05-03

    Male sexual differentiation is a process that involves androgen action via the androgen receptor. Defects in the androgen receptor, many resulting from point mutations in the androgen receptor gene, lead to varying degrees of impaired masculinization in chromosomally male individuals. To date no specific androgen regulated morphogens involved in this process have been identified and no marker genes are known that would help to predict further virilization in infants with partial androgen insensitivity. In the present study we first show data on androgen regulated gene expression investigated by differential display reverse transcription PCR (dd RT PCR) on total RNA frommore » human neonatal genital skin fibroblasts cultured in the presence or absence of 100 nM testosterone. Using three different primer combinations, 54 cDNAs appeared to be regulated by androgens. Most of these sequences show the characteristics of expressed mRNAs but showed no homology to sequences in the database. However 15 clones with significant homology to previously cloned sequences were identified. Seven cDNAs appear to be induced by androgen withdrawal. Of these, five are similar to ETS (expression tagged sequences) from unknown genes; the other two show significant homology to the cDNAs of ubiquitin and human guanylate binding protein 2 (GBP-2). In addition, we have identified 8 cDNA clones which show homologies to other sequences in the database and appear to be upregulated in the presence of testosterone. Three differential expressed sequences show significant homology to the cDNAs of L-plastin and one to the cDNA of testican. This latter gene codes for a proteoglycan involved in cell social behavior and therefore of special interest in this context. The results of this study are of interest in further investigation of normal and disturbed androgen-dependent gene expression. 49 refs., 2 figs., 5 tabs.« less

  20. orthoFind Facilitates the Discovery of Homologous and Orthologous Proteins.

    PubMed

    Mier, Pablo; Andrade-Navarro, Miguel A; Pérez-Pulido, Antonio J

    2015-01-01

    Finding homologous and orthologous protein sequences is often the first step in evolutionary studies, annotation projects, and experiments of functional complementation. Despite all currently available computational tools, there is a requirement for easy-to-use tools that provide functional information. Here, a new web application called orthoFind is presented, which allows a quick search for homologous and orthologous proteins given one or more query sequences, allowing a recurrent and exhaustive search against reference proteomes, and being able to include user databases. It addresses the protein multidomain problem, searching for homologs with the same domain architecture, and gives a simple functional analysis of the results to help in the annotation process. orthoFind is easy to use and has been proven to provide accurate results with different datasets. Availability: http://www.bioinfocabd.upo.es/orthofind/.

  1. Functional conservation of the yeast and Arabidopsis RAD54-like genes.

    PubMed

    Klutstein, Michael; Shaked, Hezi; Sherman, Amir; Avivi-Ragolsky, Naomi; Shema, Efrat; Zenvirth, Drora; Levy, Avraham A; Simchen, Giora

    2008-04-01

    The Saccharomyces cerevisiae RAD54 gene has critical roles in DNA double-strand break repair, homologous recombination, and gene targeting. Previous results show that the yeast gene enhances gene targeting when expressed in Arabidopsis thaliana. In this work we address the trans-species compatibility of Rad54 functions. We show that overexpression of yeast RAD54 in Arabidopsis enhances DNA damage resistance severalfold. Thus, the yeast gene is active in the Arabidopsis homologous-recombination repair system. Moreover, we have identified an A. thaliana ortholog of yeast RAD54, named AtRAD54. This gene, with close sequence similarity to RAD54, complements methylmethane sulfonate (MMS) sensitivity but not UV sensitivity or gene targeting defects of rad54Delta mutant yeast cells. Overexpression of AtRAD54 in Arabidopsis leads to enhanced resistance to DNA damage. This gene's assignment as a RAD54 ortholog is further supported by the interaction of AtRad54 with AtRad51 and the interactions between alien proteins (i.e., yeast Rad54 with AtRAD51 and yeast Rad51 with AtRad54) in a yeast two-hybrid experiment. These interactions hint at the molecular nature of this interkingdom complementation, although the stronger effect of the yeast Rad54 in plants than AtRad54 in yeast might be explained by an ability of the Rad54 protein to act alone, independently of its interaction with Rad51.

  2. Endophyte Microbiome Diversity in Micropropagated Atriplex canescens and Atriplex torreyi var griffithsii

    PubMed Central

    Lucero, Mary E.; Unc, Adrian; Cooke, Peter; Dowd, Scot; Sun, Shulei

    2011-01-01

    Microbial diversity associated with micropropagated Atriplex species was assessed using microscopy, isolate culturing, and sequencing. Light, electron, and confocal microscopy revealed microbial cells in aseptically regenerated leaves and roots. Clone libraries and tag-encoded FLX amplicon pyrosequencing (TEFAP) analysis amplified sequences from callus homologous to diverse fungal and bacterial taxa. Culturing isolated some seed borne endophyte taxa which could be readily propagated apart from the host. Microbial cells were observed within biofilm-like residues associated with plant cell surfaces and intercellular spaces. Various universal primers amplified both plant and microbial sequences, with different primers revealing different patterns of fungal diversity. Bacterial and fungal TEFAP followed by alignment with sequences from curated databases revealed 7 bacterial and 17 ascomycete taxa in A. canescens, and 5 bacterial taxa in A. torreyi. Additional diversity was observed among isolates and clone libraries. Micropropagated Atriplex retains a complex, intimately associated microbiome which includes diverse strains well poised to interact in manners that influence host physiology. Microbiome analysis was facilitated by high throughput sequencing methods, but primer biases continue to limit recovery of diverse sequences from even moderately complex communities. PMID:21437280

  3. Identification and analysis of multigene families by comparison of exon fingerprints.

    PubMed

    Brown, N P; Whittaker, A J; Newell, W R; Rawlings, C J; Beck, S

    1995-06-02

    Gene families are often recognised by sequence homology using similarity searching to find relationships, however, genomic sequence data provides gene architectural information not used by conventional search methods. In particular, intron positions and phases are expected to be relatively conserved features, because mis-splicing and reading frame shifts should be selected against. A fast search technique capable of detecting possible weak sequence homologies apparent at the intron/exon level of gene organization is presented for comparing spliceosomal genes and gene fragments. FINEX compares strings of exons delimited by intron/exon boundary positions and intron phases (exon fingerprint) using a global dynamic programming algorithm with a combined intron phase identity and exon size dissimilarity score. Exon fingerprints are typically two orders of magnitude smaller than their nucleic acid sequence counterparts giving rise to fast search times: a ranked search against a library of 6755 fingerprints for a typical three exon fingerprint completes in under 30 seconds on an ordinary workstation, while a worst case largest fingerprint of 52 exons completes in just over one minute. The short "sequence" length of exon fingerprints in comparisons is compensated for by the large exon alphabet compounded of intron phase types and a wide range of exon sizes, the latter contributing the most information to alignments. FINEX performs better in some searches than conventional methods, finding matches with similar exon organization, but low sequence homology. A search using a human serum albumin finds all members of the multigene family in the FINEX database at the top of the search ranking, despite very low amino acid percentage identities between family members. The method should complement conventional sequence searching and alignment techniques, offering a means of identifying otherwise hard to detect homologies where genomic data are available.

  4. Purification of FKBP-70, a novel immunophilin from Saccharomyces cerevisiae, and cloning of its structural gene, FPR3.

    PubMed

    Manning-Krieg, U C; Henríquez, R; Cammas, F; Graff, P; Gavériaux, S; Movva, N R

    1994-09-19

    A novel protein, belonging to the yeast family of FKBPs (FK-binding proteins), FKBP-70, was isolated from Saccharomyces cerevisiae by its interaction with the immunosuppressive agent FK-520. Its structural gene, FPR3, was cloned and the protein expressed and purified from Escherichia coli. This third member of the FKBP family in yeast is homologous to the other FKBPs at its carboxy terminus, showing conserved ligand binding and proline isomerase regions. It is, however, a longer acidic protein with several potential nuclear targeting sequences and a region of homology to nucleolins. Yeast strains deleted for FPR3, as well as a triple deletion mutant of this family of genes, FPR1, FPR2 and FPR3, are viable under normal conditions of growth, indicating that the FPR genes are not essential for life.

  5. Nmf9 Encodes a Highly Conserved Protein Important to Neurological Function in Mice and Flies.

    PubMed

    Zhang, Shuxiao; Ross, Kevin D; Seidner, Glen A; Gorman, Michael R; Poon, Tiffany H; Wang, Xiaobo; Keithley, Elizabeth M; Lee, Patricia N; Martindale, Mark Q; Joiner, William J; Hamilton, Bruce A

    2015-07-01

    Many protein-coding genes identified by genome sequencing remain without functional annotation or biological context. Here we define a novel protein-coding gene, Nmf9, based on a forward genetic screen for neurological function. ENU-induced and genome-edited null mutations in mice produce deficits in vestibular function, fear learning and circadian behavior, which correlated with Nmf9 expression in inner ear, amygdala, and suprachiasmatic nuclei. Homologous genes from unicellular organisms and invertebrate animals predict interactions with small GTPases, but the corresponding domains are absent in mammalian Nmf9. Intriguingly, homozygotes for null mutations in the Drosophila homolog, CG45058, show profound locomotor defects and premature death, while heterozygotes show striking effects on sleep and activity phenotypes. These results link a novel gene orthology group to discrete neurological functions, and show conserved requirement across wide phylogenetic distance and domain level structural changes.

  6. Metagenomic ventures into outer sequence space.

    PubMed

    Dutilh, Bas E

    Sequencing DNA or RNA directly from the environment often results in many sequencing reads that have no homologs in the database. These are referred to as "unknowns," and reflect the vast unexplored microbial sequence space of our biosphere, also known as "biological dark matter." However, unknowns also exist because metagenomic datasets are not optimally mined. There is a pressure on researchers to publish and move on, and the unknown sequences are often left for what they are, and conclusions drawn based on reads with annotated homologs. This can cause abundant and widespread genomes to be overlooked, such as the recently discovered human gut bacteriophage crAssphage. The unknowns may be enriched for bacteriophage sequences, the most abundant and genetically diverse component of the biosphere and of sequence space. However, it remains an open question, what is the actual size of biological sequence space? The de novo assembly of shotgun metagenomes is the most powerful tool to address this question.

  7. The challenge of annotating protein sequences: The tale of eight domains of unknown function in Pfam.

    PubMed

    Goonesekere, Nalin C W; Shipely, Krysten; O'Connor, Kevin

    2010-06-01

    The Pfam database is an important tool in genome annotation, since it provides a collection of curated protein families. However, a subset of these families, known as domains of unknown function (DUFs), remains poorly characterized. We have related sequences from DUF404, DUF407, DUF482, DUF608, DUF810, DUF853, DUF976 and DUF1111 to homologs in PDB, within the midnight zone (9-20%) of sequence identity. These relationships were extended to provide functional annotation by sequence analysis and model building. Also described are examples of residue plasticity within enzyme active sites, and change of function within homologous sequences of a DUF. Copyright 2010 Elsevier Ltd. All rights reserved.

  8. Homology modeling and in silico site directed mutagenesis of pyruvate ferredoxin oxidoreductase from Clostridium thermocellum.

    PubMed

    Saranyah, Kannuchamy; Kalva, Sukesh; Mukund, Nisha; Singh, Sanjeev Kumar; Saleena, Lilly M

    2015-01-01

    Pyruvate ferredoxin oxidoreductase is the crucial enzyme that involves in bioethanol synthesis pathway of Clostridium thermocellum. It is an ethanologenic organism but has been investigated less on its enzyme structure. The amino acid sequence of Pyruvate ferredoxin oxidoreductase was derived from UNIPROT and the screened crystal structure was taken as the template for homology modeling using MODELLER 9V11. The model was loop refined and was validated using RMSD, ProSA and PROCHECK. The docking and per residue interaction studies were carried out to elucidate the interaction energies of amino acid residues with pyruvate. To enhance the binding of pyruvate with the enzyme, mutation studies were carried out by replacing Thr31 as it had a less interaction energy. Out of 10 mutants, T31N, T31Q and T31G were selected using potential energy and the residual energy calculations. Five nanoseconds explicit MD simulations were run for apo, wild type and mutants T31N, T31Q and T31G using Desmond. RMSD, RMSF, distance plots and H-bonds analysis proved T31G to be a favorable mutant for binding of pyruvate. Thus, modeling PFOR would help in profound understanding of its structural clefts and mutation studies would aid in improving the enzyme efficiency.

  9. Tolerance of DNA Mismatches in Dmc1 Recombinase-mediated DNA Strand Exchange.

    PubMed

    Borgogno, María V; Monti, Mariela R; Zhao, Weixing; Sung, Patrick; Argaraña, Carlos E; Pezza, Roberto J

    2016-03-04

    Recombination between homologous chromosomes is required for the faithful meiotic segregation of chromosomes and leads to the generation of genetic diversity. The conserved meiosis-specific Dmc1 recombinase catalyzes homologous recombination triggered by DNA double strand breaks through the exchange of parental DNA sequences. Although providing an efficient rate of DNA strand exchange between polymorphic alleles, Dmc1 must also guard against recombination between divergent sequences. How DNA mismatches affect Dmc1-mediated DNA strand exchange is not understood. We have used fluorescence resonance energy transfer to study the mechanism of Dmc1-mediated strand exchange between DNA oligonucleotides with different degrees of heterology. The efficiency of strand exchange is highly sensitive to the location, type, and distribution of mismatches. Mismatches near the 3' end of the initiating DNA strand have a small effect, whereas most mismatches near the 5' end impede strand exchange dramatically. The Hop2-Mnd1 protein complex stimulates Dmc1-catalyzed strand exchange on homologous DNA or containing a single mismatch. We observed that Dmc1 can reject divergent DNA sequences while bypassing a few mismatches in the DNA sequence. Our findings have important implications in understanding meiotic recombination. First, Dmc1 acts as an initial barrier for heterologous recombination, with the mismatch repair system providing a second level of proofreading, to ensure that ectopic sequences are not recombined. Second, Dmc1 stepping over infrequent mismatches is likely critical for allowing recombination between the polymorphic sequences of homologous chromosomes, thus contributing to gene conversion and genetic diversity. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  10. Tolerance of DNA Mismatches in Dmc1 Recombinase-mediated DNA Strand Exchange*

    PubMed Central

    Borgogno, María V.; Monti, Mariela R.; Zhao, Weixing; Sung, Patrick; Argaraña, Carlos E.; Pezza, Roberto J.

    2016-01-01

    Recombination between homologous chromosomes is required for the faithful meiotic segregation of chromosomes and leads to the generation of genetic diversity. The conserved meiosis-specific Dmc1 recombinase catalyzes homologous recombination triggered by DNA double strand breaks through the exchange of parental DNA sequences. Although providing an efficient rate of DNA strand exchange between polymorphic alleles, Dmc1 must also guard against recombination between divergent sequences. How DNA mismatches affect Dmc1-mediated DNA strand exchange is not understood. We have used fluorescence resonance energy transfer to study the mechanism of Dmc1-mediated strand exchange between DNA oligonucleotides with different degrees of heterology. The efficiency of strand exchange is highly sensitive to the location, type, and distribution of mismatches. Mismatches near the 3′ end of the initiating DNA strand have a small effect, whereas most mismatches near the 5′ end impede strand exchange dramatically. The Hop2-Mnd1 protein complex stimulates Dmc1-catalyzed strand exchange on homologous DNA or containing a single mismatch. We observed that Dmc1 can reject divergent DNA sequences while bypassing a few mismatches in the DNA sequence. Our findings have important implications in understanding meiotic recombination. First, Dmc1 acts as an initial barrier for heterologous recombination, with the mismatch repair system providing a second level of proofreading, to ensure that ectopic sequences are not recombined. Second, Dmc1 stepping over infrequent mismatches is likely critical for allowing recombination between the polymorphic sequences of homologous chromosomes, thus contributing to gene conversion and genetic diversity. PMID:26709229

  11. Analysis of eight out genes in a cluster required for pectic enzyme secretion by Erwinia chrysanthemi: sequence comparison with secretion genes from other gram-negative bacteria.

    PubMed Central

    Lindeberg, M; Collmer, A

    1992-01-01

    Many extracellular proteins produced by Erwinia chrysanthemi require the out gene products for transport across the outer membrane. In a previous report (S. Y. He, M. Lindeberg, A. K. Chatterjee, and A. Collmer, Proc. Natl. Acad. Sci. USA 88:1079-1083, 1991) cosmid pCPP2006, sufficient for secretion of Erwinia chrysanthemi extracellular proteins by Escherichia coli, was partially sequenced, revealing four out genes sharing high homology with pulH through pulK from Klebsiella oxytoca. The nucleotide sequence of eight additional out genes reveals homology with pulC through pulG, pulL, pulM, pulO, and other genes involved in secretion by various gram-negative bacteria. Although signal sequences and hydrophobic regions are generally conserved between Pul and Out proteins, four out genes contain unique inserts, a pulN homolog is not present, and outO appears to be transcribed separately from outC through outM. The sequenced region was subcloned, and an additional 7.6-kb region upstream was identified as being required for secretion in E. coli. out gene homologs were found on Erwinia carotovora cosmid clone pAKC651 but were not detected in E. coli. The outC-through-outM operon is weakly induced by polygalacturonic acid and strongly expressed in the early stationary phase. The out and pul genes are highly similar in sequence, hydropathic properties, and overall arrangement but differ in both transcriptional organization and the nature of their induction. Images PMID:1429461

  12. Characterization of constitutive and putative differentially expressed mRNAs by means of expressed sequence tags, differential display reverse transcriptase-PCR and randomly amplified polymorphic DNA-PCR from the sand fly vector Lutzomyia longipalpis.

    PubMed

    Ramalho-Ortigão, J M; Temporal, P; de Oliveira , S M; Barbosa, A F; Vilela, M L; Rangel, E F; Brazil, R P; Traub-Cseko, Y M

    2001-01-01

    Molecular studies of insect disease vectors are of paramount importance for understanding parasite-vector relationship. Advances in this area have led to important findings regarding changes in vectors' physiology upon blood feeding and parasite infection. Mechanisms for interfering with the vectorial capacity of insects responsible for the transmission of diseases such as malaria, Chagas disease and dengue fever are being devised with the ultimate goal of developing transgenic insects. A primary necessity for this goal is information on gene expression and control in the target insect. Our group is investigating molecular aspects of the interaction between Leishmania parasites and Lutzomyia sand flies. As an initial step in our studies we have used random sequencing of cDNA clones from two expression libraries made from head/thorax and abdomen of sugar fed L. longipalpis for the identification of expressed sequence tags (EST). We applied differential display reverse transcriptase-PCR and randomly amplified polymorphic DNA-PCR to characterize differentially expressed mRNA from sugar and blood fed insects, and, in one case, from a L. (V.) braziliensis-infected L. longipalpis. We identified 37 cDNAs that have shown homology to known sequences from GeneBank. Of these, 32 cDNAs code for constitutive proteins such as zinc finger protein, glutamine synthetase, G binding protein, ubiquitin conjugating enzyme. Three are putative differentially expressed cDNAs from blood fed and Leishmania-infected midgut, a chitinase, a V-ATPase and a MAP kinase. Finally, two sequences are homologous to Drosophila melanogaster gene products recently discovered through the Drosophila genome initiative.

  13. Molecular analysis of the glucocerebrosidase gene locus

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Winfield, S.L.; Martin, B.M.; Fandino, A.

    1994-09-01

    Gaucher disease is due to a deficiency in the activity of the lysosomal enzyme glucocerebrosidase. Both the functional gene for this enzyme and a pseudogene are located in close proximity on chromosome 1q21. Analysis of the mutations present in patient samples has suggested interaction between the functional gene and the pseudogene in the origin of mutant genotypes. To investigate the involvement of regions flanking the functional gene and pseudogene in the origin of mutations found in Gaucher disease, a YAC clone containing DNA from this locus has been subcloned and characterized. The original YAC containing {approximately}360 kb was truncated withmore » the use of fragmentation plasmids to about 85 kb. A lambda library derived from this YAC was screened to obtain clones containing glucocerebrosidase sequences. PCR amplification was used to identify subclones containing 5{prime}, central, or 3{prime} sequences of the functional gene or of the pseudogene. Clones spanning the entire distance from the last exon of the functional gene to intron 1 of the pseudogene, the 5{prime} end of the functional gene and 16 kb of 5{prime} flanking region and approximately 15 kb of 3{prime} flanking region of the pseudogene were sequenced. Sequence data from 48 kb of intergenic and flanking regions of the glucocerebrosidase gene and its pseudogene has been generated. A large number of Alu sequences and several simple repeats have been found. Two of these repeats exhibit fragment length polymorphism. There is almost 100% homology between the 3{prime} flanking regions of the functional gene and the pseudogene, extending to about 4 kb past the termination codons. A much lower degree of homology is observed in the 5{prime} flanking region. Patient samples are currently being screened for polymorphisms in these flanking regions.« less

  14. Global transformation of erythrocyte properties via engagement of an SH2-like sequence in band 3

    PubMed Central

    Turrini, Francesco M.; Li, Yen-Hsing; Low, Philip S.

    2016-01-01

    Src homology 2 (SH2) domains are composed of weakly conserved sequences of ∼100 aa that bind phosphotyrosines in signaling proteins and thereby mediate intra- and intermolecular protein–protein interactions. In exploring the mechanism whereby tyrosine phosphorylation of the erythrocyte anion transporter, band 3, triggers membrane destabilization, vesiculation, and fragmentation, we discovered a SH2 signature motif positioned between membrane-spanning helices 4 and 5. Evidence that this exposed cytoplasmic sequence contributes to a functional SH2-like domain is provided by observations that: (i) it contains the most conserved sequence of SH2 domains, GSFLVR; (ii) it binds the tyrosine phosphorylated cytoplasmic domain of band 3 (cdb3-PO4) with Kd = 14 nM; (iii) binding of cdb3-PO4 to erythrocyte membranes is inhibited both by antibodies against the SH2 signature sequence and dephosphorylation of cdb3-PO4; (iv) label transfer experiments demonstrate the covalent transfer of photoactivatable biotin from isolated cdb3-PO4 (but not cdb3) to band 3 in erythrocyte membranes; and (v) phosphorylation-induced binding of cdb3-PO4 to the membrane-spanning domain of band 3 in intact cells causes global changes in membrane properties, including (i) displacement of a glycolytic enzyme complex from the membrane, (ii) inhibition of anion transport, and (iii) rupture of the band 3–ankyrin bridge connecting the spectrin-based cytoskeleton to the membrane. Because SH2-like motifs are not retrieved by normal homology searches for SH2 domains, but can be found in many tyrosine kinase-regulated transport proteins using modified search programs, we suggest that related cases of membrane transport proteins containing similar motifs are widespread in nature where they participate in regulation of cell properties. PMID:27856737

  15. Global transformation of erythrocyte properties via engagement of an SH2-like sequence in band 3.

    PubMed

    Puchulu-Campanella, Estela; Turrini, Francesco M; Li, Yen-Hsing; Low, Philip S

    2016-11-29

    Src homology 2 (SH2) domains are composed of weakly conserved sequences of ∼100 aa that bind phosphotyrosines in signaling proteins and thereby mediate intra- and intermolecular protein-protein interactions. In exploring the mechanism whereby tyrosine phosphorylation of the erythrocyte anion transporter, band 3, triggers membrane destabilization, vesiculation, and fragmentation, we discovered a SH2 signature motif positioned between membrane-spanning helices 4 and 5. Evidence that this exposed cytoplasmic sequence contributes to a functional SH2-like domain is provided by observations that: (i) it contains the most conserved sequence of SH2 domains, GSFLVR; (ii) it binds the tyrosine phosphorylated cytoplasmic domain of band 3 (cdb3-PO 4 ) with K d = 14 nM; (iii) binding of cdb3-PO 4 to erythrocyte membranes is inhibited both by antibodies against the SH2 signature sequence and dephosphorylation of cdb3-PO 4 ; (iv) label transfer experiments demonstrate the covalent transfer of photoactivatable biotin from isolated cdb3-PO 4 (but not cdb3) to band 3 in erythrocyte membranes; and (v) phosphorylation-induced binding of cdb3-PO 4 to the membrane-spanning domain of band 3 in intact cells causes global changes in membrane properties, including (i) displacement of a glycolytic enzyme complex from the membrane, (ii) inhibition of anion transport, and (iii) rupture of the band 3-ankyrin bridge connecting the spectrin-based cytoskeleton to the membrane. Because SH2-like motifs are not retrieved by normal homology searches for SH2 domains, but can be found in many tyrosine kinase-regulated transport proteins using modified search programs, we suggest that related cases of membrane transport proteins containing similar motifs are widespread in nature where they participate in regulation of cell properties.

  16. 3'-terminal sequence of a small round structured virus (SRSV) in Japan.

    PubMed

    Utagawa, E T; Takeda, N; Inouye, S; Kasuga, K; Yamazaki, S

    1994-01-01

    We determined the nucleotide sequence of about 1,000 bases from the 3'-terminus of a small round structured virus (SRSV), which caused a gastroenteritis outbreak in Chiba Prefecture, Japan, in 1987. The sequence was compared with the corresponding sequence region of Norwalk virus; it consisted of a part of the open reading frame 2 (ORF2), whole ORF3, and 3'-noncoding region (NCR). The 624-base-long ORF3 had sequence homology of 68% with the corresponding region of Norwalk virus. (The amino acid sequence homology was 74%.) The 94-base-long NCR had 65% homology with Norwalk virus. We then selected two consensus-sequence portions in the above sequence between Chiba and Norwalk viruses for primers in the reverse transcriptase-polymerase chain reaction (RT-PCR). Using this primer set, we detected 669-bp bands in agarose gel electrophoresis of RT-PCR products from feces containing Chiba or Norwalk viruses. Furthermore, in Southern hybridization with Chiba probes which were labeled with digoxigenin-dUTP in PCR, the bands of the two viruses were clearly stained under a low stringency condition. Since both Chiba and Norwalk viruses were detected by the above primer set although they are geographically and chronologically different viruses, our primer-pair may be useful for detection of a broad range of SRSVs which cause gastroenteritis in different areas.

  17. Genetic stability of gene targeted immunoglobulin loci. I. Heavy chain isotype exchange induced by a universal gene replacement vector.

    PubMed Central

    Kardinal, C; Selmayr, M; Mocikat, R

    1996-01-01

    Gene targeting at the immunoglobulin loci of B cells is an efficient tool for studying immunoglobulin expression or generating chimeric antibodies. We have shown that vector integration induced by human immunoglobulin G1 (IgG1) insertion vectors results in subsequent vector excision mediated by the duplicated target sequence, whereas replacement events which could be induced by the same constructs remain stable. We could demonstrate that the distribution of the vector homology strongly influences the genetic stability obtained. To this end we developed a novel type of a heavy chain replacement vector making use of the heavy chain class switch recombination sequence. Despite the presence of a two-sided homology this construct is universally applicable irrespective of the constant gene region utilized by the B cell. In comparison to an integration vector the frequency of stable incorporation was strongly increased, but we still observed vector excision, although at a markedly reduced rate. The latter events even occurred with circular constructs. Linearization of the construct at various sites and the comparison with an integration vector that carries the identical homology sequence, but differs in the distribution of homology, revealed the following features of homologous recombination of immunoglobulin genes: (i) the integration frequency is only determined by the length of the homology flank where the cross-over takes place; (ii) a 5' flank that does not meet the minimum requirement of homology length cannot be complemented by a sufficient 3' flank; (iii) free vector ends play a role for integration as well as for replacement targeting; (iv) truncating recombination events are suppressed in the presence of two flanks. Furthermore, we show that the switch region that was used as 3' flank is non-functional in an inverted orientation. Images Figure 2 PMID:8958041

  18. Genetic stability of gene targeted immunoglobulin loci. I. Heavy chain isotype exchange induced by a universal gene replacement vector.

    PubMed

    Kardinal, C; Selmayr, M; Mocikat, R

    1996-11-01

    Gene targeting at the immunoglobulin loci of B cells is an efficient tool for studying immunoglobulin expression or generating chimeric antibodies. We have shown that vector integration induced by human immunoglobulin G1 (IgG1) insertion vectors results in subsequent vector excision mediated by the duplicated target sequence, whereas replacement events which could be induced by the same constructs remain stable. We could demonstrate that the distribution of the vector homology strongly influences the genetic stability obtained. To this end we developed a novel type of a heavy chain replacement vector making use of the heavy chain class switch recombination sequence. Despite the presence of a two-sided homology this construct is universally applicable irrespective of the constant gene region utilized by the B cell. In comparison to an integration vector the frequency of stable incorporation was strongly increased, but we still observed vector excision, although at a markedly reduced rate. The latter events even occurred with circular constructs. Linearization of the construct at various sites and the comparison with an integration vector that carries the identical homology sequence, but differs in the distribution of homology, revealed the following features of homologous recombination of immunoglobulin genes: (i) the integration frequency is only determined by the length of the homology flank where the cross-over takes place; (ii) a 5' flank that does not meet the minimum requirement of homology length cannot be complemented by a sufficient 3' flank; (iii) free vector ends play a role for integration as well as for replacement targeting; (iv) truncating recombination events are suppressed in the presence of two flanks. Furthermore, we show that the switch region that was used as 3' flank is non-functional in an inverted orientation.

  19. Identification and Characterization of Putative Integron-Like Elements of the Heavy-Metal-Hypertolerant Strains of Pseudomonas spp.

    PubMed

    Ciok, Anna; Adamczuk, Marcin; Bartosik, Dariusz; Dziewit, Lukasz

    2016-11-28

    Pseudomonas strains isolated from the heavily contaminated Lubin copper mine and Zelazny Most post-flotation waste reservoir in Poland were screened for the presence of integrons. This analysis revealed that two strains carried homologous DNA regions composed of a gene encoding a DNA_BRE_C domain-containing tyrosine recombinase (with no significant sequence similarity to other integrases of integrons) plus a three-component array of putative integron gene cassettes. The predicted gene cassettes encode three putative polypeptides with homology to (i) transmembrane proteins, (ii) GCN5 family acetyltransferases, and (iii) hypothetical proteins of unknown function (homologous proteins are encoded by the gene cassettes of several class 1 integrons). Comparative sequence analyses identified three structural variants of these novel integron-like elements within the sequenced bacterial genomes. Analysis of their distribution revealed that they are found exclusively in strains of the genus Pseudomonas .

  20. GPU-Acceleration of Sequence Homology Searches with Database Subsequence Clustering.

    PubMed

    Suzuki, Shuji; Kakuta, Masanori; Ishida, Takashi; Akiyama, Yutaka

    2016-01-01

    Sequence homology searches are used in various fields and require large amounts of computation time, especially for metagenomic analysis, owing to the large number of queries and the database size. To accelerate computing analyses, graphics processing units (GPUs) are widely used as a low-cost, high-performance computing platform. Therefore, we mapped the time-consuming steps involved in GHOSTZ, which is a state-of-the-art homology search algorithm for protein sequences, onto a GPU and implemented it as GHOSTZ-GPU. In addition, we optimized memory access for GPU calculations and for communication between the CPU and GPU. As per results of the evaluation test involving metagenomic data, GHOSTZ-GPU with 12 CPU threads and 1 GPU was approximately 3.0- to 4.1-fold faster than GHOSTZ with 12 CPU threads. Moreover, GHOSTZ-GPU with 12 CPU threads and 3 GPUs was approximately 5.8- to 7.7-fold faster than GHOSTZ with 12 CPU threads.

  1. Cloning and nucleotide sequence of the Pseudomonas aeruginosa glucose-selective OprB porin gene and distribution of OprB within the family Pseudomonadaceae.

    PubMed

    Wylie, J L; Worobec, E A

    1994-03-01

    OprB is a glucose-selective porin known to be produced by Pseudomonas aeruginosa and Pseudomonas putida. We have cloned and sequenced the oprB gene of P. aeruginosa and obtained expression of OprB in Escherichia coli. The mature protein consists of 423 amino acid residues with a deduced molecular mass of 47597 Da. Several clusters of amino acid residues, potentially involved in the structure or function of the protein, were identified. An area of regional homology with E. coli LamB was also identified. Carbohydrate-inducible proteins, potentially homologous to OprB, were identified in several rRNA homology-group-I pseudomonads by sodium dodecyl sulfate/polyacrylamide gel electrophoresis analysis, Western immunoblotting and N-terminal amino acid sequencing. These species also contained DNA that hybridized to a P. aeruginosa oprB gene probe.

  2. ProtDec-LTR2.0: an improved method for protein remote homology detection by combining pseudo protein and supervised Learning to Rank.

    PubMed

    Chen, Junjie; Guo, Mingyue; Li, Shumin; Liu, Bin

    2017-11-01

    As one of the most important tasks in protein sequence analysis, protein remote homology detection is critical for both basic research and practical applications. Here, we present an effective web server for protein remote homology detection called ProtDec-LTR2.0 by combining ProtDec-Learning to Rank (LTR) and pseudo protein representation. Experimental results showed that the detection performance is obviously improved. The web server provides a user-friendly interface to explore the sequence and structure information of candidate proteins and find their conserved domains by launching a multiple sequence alignment tool. The web server is free and open to all users with no login requirement at http://bioinformatics.hitsz.edu.cn/ProtDec-LTR2.0/. bliu@hit.edu.cn. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com

  3. Spiroplasma species share common DNA sequences among their viruses, plasmids and genomes.

    PubMed

    Ranhand, J M; Nur, I; Rose, D L; Tully, J G

    1987-01-01

    Alkaline-Southern-blot analyses showed that a spiroplasma plasmid, pRA1, obtained from Spiroplasma citri (Maroc-R8A2), contained DNA sequences that were homologous to spiroplasma type 3 viruses (SV3) obtained from S. citri (Maroc-R8A2), S. citri (608) and S. mirum (SMCA). In addition, pRA1 and SV3(608) DNA shared common, but not necessarily related, sequences with extrachromosomal DNA derived from 11 Spiroplasma species or strains. Furthermore, SV3(608) had DNA homology with the chromosome from 6 distinct spiroplasmas but not with chromosomal DNA from eight other Spiroplasma species or strains. The biological function of these common sequences is unknown.

  4. Escherichia coli promoter sequences predict in vitro RNA polymerase selectivity.

    PubMed

    Mulligan, M E; Hawley, D K; Entriken, R; McClure, W R

    1984-01-11

    We describe a simple algorithm for computing a homology score for Escherichia coli promoters based on DNA sequence alone. The homology score was related to 31 values, measured in vitro, of RNA polymerase selectivity, which we define as the product KBk2, the apparent second order rate constant for open complex formation. We found that promoter strength could be predicted to within a factor of +/-4.1 in KBk2 over a range of 10(4) in the same parameter. The quantitative evaluation was linked to an automated (Apple II) procedure for searching and evaluating possible promoters in DNA sequence files.

  5. CBH1 homologs and varian CBH1 cellulase

    DOEpatents

    Goedegebuur, Frits; Gualfetti, Peter; Mitchinson, Colin; Neefe, Paulien

    2014-07-01

    Disclosed are a number of homologs and variants of Hypocrea jecorina Cel7A (formerly Trichoderma reesei cellobiohydrolase I or CBH1), nucleic acids encoding the same and methods for producing the same. The homologs and variant cellulases have the amino acid sequence of a glycosyl hydrolase of family 7A wherein one or more amino acid residues are substituted and/or deleted.

  6. CBH1 homologs and variant CBH1 cellulases

    DOEpatents

    Goedegebuur, Frits [Rozenlaan, NL; Gualfetti, Peter [San Francisco, CA; Mitchinson, Colin [Half Moon Bay, CA; Neefe, Paulien [Zoetermeer, NL

    2011-05-31

    Disclosed are a number of homologs and variants of Hypocrea jecorina Cel7A (formerly Trichoderma reesei cellobiohydrolase I or CBH1), nucleic acids encoding the same and methods for producing the same. The homologs and variant cellulases have the amino acid sequence of a glycosyl hydrolase of family 7A wherein one or more amino acid residues are substituted and/or deleted.

  7. Evolutionarily Conserved Linkage between Enzyme Fold, Flexibility, and Catalysis

    PubMed Central

    Ramanathan, Arvind; Agarwal, Pratul K.

    2011-01-01

    Proteins are intrinsically flexible molecules. The role of internal motions in a protein's designated function is widely debated. The role of protein structure in enzyme catalysis is well established, and conservation of structural features provides vital clues to their role in function. Recently, it has been proposed that the protein function may involve multiple conformations: the observed deviations are not random thermodynamic fluctuations; rather, flexibility may be closely linked to protein function, including enzyme catalysis. We hypothesize that the argument of conservation of important structural features can also be extended to identification of protein flexibility in interconnection with enzyme function. Three classes of enzymes (prolyl-peptidyl isomerase, oxidoreductase, and nuclease) that catalyze diverse chemical reactions have been examined using detailed computational modeling. For each class, the identification and characterization of the internal protein motions coupled to the chemical step in enzyme mechanisms in multiple species show identical enzyme conformational fluctuations. In addition to the active-site residues, motions of protein surface loop regions (>10 Å away) are observed to be identical across species, and networks of conserved interactions/residues connect these highly flexible surface regions to the active-site residues that make direct contact with substrates. More interestingly, examination of reaction-coupled motions in non-homologous enzyme systems (with no structural or sequence similarity) that catalyze the same biochemical reaction shows motions that induce remarkably similar changes in the enzyme–substrate interactions during catalysis. The results indicate that the reaction-coupled flexibility is a conserved aspect of the enzyme molecular architecture. Protein motions in distal areas of homologous and non-homologous enzyme systems mediate similar changes in the active-site enzyme–substrate interactions, thereby impacting the mechanism of catalyzed chemistry. These results have implications for understanding the mechanism of allostery, and for protein engineering and drug design. PMID:22087074

  8. Evolutionarily conserved linkage between enzyme fold, flexibility, and catalysis.

    PubMed

    Ramanathan, Arvind; Agarwal, Pratul K

    2011-11-01

    Proteins are intrinsically flexible molecules. The role of internal motions in a protein's designated function is widely debated. The role of protein structure in enzyme catalysis is well established, and conservation of structural features provides vital clues to their role in function. Recently, it has been proposed that the protein function may involve multiple conformations: the observed deviations are not random thermodynamic fluctuations; rather, flexibility may be closely linked to protein function, including enzyme catalysis. We hypothesize that the argument of conservation of important structural features can also be extended to identification of protein flexibility in interconnection with enzyme function. Three classes of enzymes (prolyl-peptidyl isomerase, oxidoreductase, and nuclease) that catalyze diverse chemical reactions have been examined using detailed computational modeling. For each class, the identification and characterization of the internal protein motions coupled to the chemical step in enzyme mechanisms in multiple species show identical enzyme conformational fluctuations. In addition to the active-site residues, motions of protein surface loop regions (>10 Å away) are observed to be identical across species, and networks of conserved interactions/residues connect these highly flexible surface regions to the active-site residues that make direct contact with substrates. More interestingly, examination of reaction-coupled motions in non-homologous enzyme systems (with no structural or sequence similarity) that catalyze the same biochemical reaction shows motions that induce remarkably similar changes in the enzyme-substrate interactions during catalysis. The results indicate that the reaction-coupled flexibility is a conserved aspect of the enzyme molecular architecture. Protein motions in distal areas of homologous and non-homologous enzyme systems mediate similar changes in the active-site enzyme-substrate interactions, thereby impacting the mechanism of catalyzed chemistry. These results have implications for understanding the mechanism of allostery, and for protein engineering and drug design.

  9. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ramanathan, Arvind; Agarwal, Pratul K

    Proteins are intrinsically flexible molecules. The role of internal motions in a protein's designated function is widely debated. The role of protein structure in enzyme catalysis is well established, and conservation of structural features provides vital clues to their role in function. Recently, it has been proposed that the protein function may involve multiple conformations: the observed deviations are not random thermodynamic fluctuations; rather, flexibility may be closely linked to protein function, including enzyme catalysis. We hypothesize that the argument of conservation of important structural features can also be extended to identification of protein flexibility in interconnection with enzyme function.more » Three classes of enzymes (prolyl-peptidyl isomerase, oxidoreductase, and nuclease) that catalyze diverse chemical reactions have been examined using detailed computational modeling. For each class, the identification and characterization of the internal protein motions coupled to the chemical step in enzyme mechanisms in multiple species show identical enzyme conformational fluctuations. In addition to the active-site residues, motions of protein surface loop regions (>10 away) are observed to be identical across species, and networks of conserved interactions/residues connect these highly flexible surface regions to the active-site residues that make direct contact with substrates. More interestingly, examination of reaction-coupled motions in non-homologous enzyme systems (with no structural or sequence similarity) that catalyze the same biochemical reaction shows motions that induce remarkably similar changes in the enzyme substrate interactions during catalysis. The results indicate that the reaction-coupled flexibility is a conserved aspect of the enzyme molecular architecture. Protein motions in distal areas of homologous and non-homologous enzyme systems mediate similar changes in the active-site enzyme substrate interactions, thereby impacting the mechanism of catalyzed chemistry. These results have implications for understanding the mechanism of allostery, and for protein engineering and drug design.« less

  10. Structural basis for antagonism of human interleukin 18 by poxvirus interleukin 18-binding protein

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Krumm, Brian; Meng, Xiangzhi; Li, Yongchao

    2009-07-10

    Human interleukin-18 (hIL-18) is a cytokine that plays an important role in inflammation and host defense against microbes. Its activity is regulated in vivo by a naturally occurring antagonist, the human IL-18-binding protein (IL-18BP). Functional homologs of human IL-18BP are encoded by all orthopoxviruses, including variola virus, the causative agent of smallpox. They contribute to virulence by suppressing IL-18-mediated immune responses. Here, we describe the 2.0-{angstrom} resolution crystal structure of an orthopoxvirus IL-18BP, ectromelia virus IL-18BP (ectvIL-18BP), in complex with hIL-18. The hIL-18 structure in the complex shows significant conformational change at the binding interface compared with the structure ofmore » ligand-free hIL-18, indicating that the binding is mediated by an induced-fit mechanism. EctvIL-18BP adopts a canonical Ig fold and interacts via one edge of its {beta}-sandwich with 3 cavities on the hIL-18 surface through extensive hydrophobic and hydrogen bonding interactions. Most of the ectvIL-18BP residues that participate in these interactions are conserved in both human and viral homologs, explaining their functional equivalence despite limited sequence homology. EctvIL-18BP blocks a putative receptor-binding site on IL-18, thus preventing IL-18 from engaging its receptor. Our structure provides insights into how IL-18BPs modulate hIL-18 activity. The revealed binding interface provides the basis for rational design of inhibitors against orthopoxvirus IL-18BP (for treating orthopoxvirus infection) or hIL-18 (for treating certain inflammatory and autoimmune diseases).« less

  11. Occurrence and expression of gene transfer agent genes in marine bacterioplankton.

    PubMed

    Biers, Erin J; Wang, Kui; Pennington, Catherine; Belas, Robert; Chen, Feng; Moran, Mary Ann

    2008-05-01

    Genes with homology to the transduction-like gene transfer agent (GTA) were observed in genome sequences of three cultured members of the marine Roseobacter clade. A broader search for homologs for this host-controlled virus-like gene transfer system identified likely GTA systems in cultured Alphaproteobacteria, and particularly in marine bacterioplankton representatives. Expression of GTA genes and extracellular release of GTA particles ( approximately 50 to 70 nm) was demonstrated experimentally for the Roseobacter clade member Silicibacter pomeroyi DSS-3, and intraspecific gene transfer was documented. GTA homologs are surprisingly infrequent in marine metagenomic sequence data, however, and the role of this lateral gene transfer mechanism in ocean bacterioplankton communities remains unclear.

  12. Occurrence and Expression of Gene Transfer Agent Genes in Marine Bacterioplankton▿

    PubMed Central

    Biers, Erin J.; Wang, Kui; Pennington, Catherine; Belas, Robert; Chen, Feng; Moran, Mary Ann

    2008-01-01

    Genes with homology to the transduction-like gene transfer agent (GTA) were observed in genome sequences of three cultured members of the marine Roseobacter clade. A broader search for homologs for this host-controlled virus-like gene transfer system identified likely GTA systems in cultured Alphaproteobacteria, and particularly in marine bacterioplankton representatives. Expression of GTA genes and extracellular release of GTA particles (∼50 to 70 nm) was demonstrated experimentally for the Roseobacter clade member Silicibacter pomeroyi DSS-3, and intraspecific gene transfer was documented. GTA homologs are surprisingly infrequent in marine metagenomic sequence data, however, and the role of this lateral gene transfer mechanism in ocean bacterioplankton communities remains unclear. PMID:18359833

  13. Nucleotide sequence of the ribosomal RNA gene of Physarum polycephalum: intron 2 and its flanking regions of the 26S rRNA gene.

    PubMed Central

    Nomiyama, H; Kuhara, S; Kukita, T; Otsuka, T; Sakaki, Y

    1981-01-01

    The 26S ribosomal RNA gene of Physarum polycephalum is interrupted by two introns, and we have previously determined the sequence of one of them (intron 1) (Nomiyama et al. Proc.Natl.Acad.Sci.USA 78, 1376-1380, 1981). In this study we sequenced the second intron (intron 2) of about 0.5 kb length and its flanking regions, and found that one nucleotide at each junction is identical in intron 1 and intron 2, though the junction regions share no other sequence homology. Comparison of the flanking exon sequences to E. coli 23S rRNA sequences shows that conserved sequences are interspersed with tracts having little homology. In particular, the region encompassing the intron 2 interruption site is highly conserved. The E. coli ribosomal protein L1 binding region is also conserved. Images PMID:6171776

  14. Cloning and Sequencing of Defective Particles Derived from the Autonomous Parvovirus Minute Virus of Mice for the Construction of Vectors with Minimal cis-Acting Sequences

    PubMed Central

    Clément, Nathalie; Avalosse, Bernard; El Bakkouri, Karim; Velu, Thierry; Brandenburger, Annick

    2001-01-01

    The production of wild-type-free stocks of recombinant parvovirus minute virus of mice [MVM(p)] is difficult due to the presence of homologous sequences in vector and helper genomes that cannot easily be eliminated from the overlapping coding sequences. We have therefore cloned and sequenced spontaneously occurring defective particles of MVM(p) with very small genomes to identify the minimal cis-acting sequences required for DNA amplification and virus production. One of them has lost all capsid-coding sequences but is still able to replicate in permissive cells when nonstructural proteins are provided in trans by a helper plasmid. Vectors derived from this particle produce stocks with no detectable wild-type MVM after cotransfection with new, matched, helper plasmids that present no homology downstream from the transgene. PMID:11152501

  15. Cloning and sequence analysis of complementary DNA encoding an aberrantly rearranged human T-cell gamma chain.

    PubMed Central

    Dialynas, D P; Murre, C; Quertermous, T; Boss, J M; Leiden, J M; Seidman, J G; Strominger, J L

    1986-01-01

    Complementary DNA (cDNA) encoding a human T-cell gamma chain has been cloned and sequenced. At the junction of the variable and joining regions, there is an apparent deletion of two nucleotides in the human cDNA sequence relative to the murine gamma-chain cDNA sequence, resulting simultaneously in the generation of an in-frame stop codon and in a translational frameshift. For this reason, the sequence presented here encodes an aberrantly rearranged human T-cell gamma chain. There are several surprising differences between the deduced human and murine gamma-chain amino acid sequences. These include poor homology in the variable region, poor homology in a discrete segment of the constant region precisely bounded by the expected junctions of exon CII, and the presence in the human sequence of five potential sites for N-linked glycosylation. Images PMID:3458221

  16. Nucleotide sequence determination of guinea-pig casein B mRNA reveals homology with bovine and rat alpha s1 caseins and conservation of the non-coding regions of the mRNA.

    PubMed Central

    Hall, L; Laird, J E; Craig, R K

    1984-01-01

    Nucleotide sequence analysis of cloned guinea-pig casein B cDNA sequences has identified two casein B variants related to the bovine and rat alpha s1 caseins. Amino acid homology was largely confined to the known bovine or predicted rat phosphorylation sites and within the 'signal' precursor sequence. Comparison of the deduced nucleotide sequence of the guinea-pig and rat alpha s1 casein mRNA species showed greater sequence conservation in the non-coding than in the coding regions, suggesting a functional and possibly regulatory role for the non-coding regions of casein mRNA. The results provide insight into the evolution of the casein genes, and raise questions as to the role of conserved nucleotide sequences within the non-coding regions of mRNA species. Images Fig. 1. PMID:6548375

  17. Multiple Pairwise Analysis of Non-homologous Centromere Coupling Reveals Preferential Chromosome Size-Dependent Interactions and a Role for Bouquet Formation in Establishing the Interaction Pattern

    PubMed Central

    Lefrançois, Philippe; Rockmill, Beth; Xie, Pingxing; Roeder, G. Shirleen; Snyder, Michael

    2016-01-01

    During meiosis, chromosomes undergo a homology search in order to locate their homolog to form stable pairs and exchange genetic material. Early in prophase, chromosomes associate in mostly non-homologous pairs, tethered only at their centromeres. This phenomenon, conserved through higher eukaryotes, is termed centromere coupling in budding yeast. Both initiation of recombination and the presence of homologs are dispensable for centromere coupling (occurring in spo11 mutants and haploids induced to undergo meiosis) but the presence of the synaptonemal complex (SC) protein Zip1 is required. The nature and mechanism of coupling have yet to be elucidated. Here we present the first pairwise analysis of centromere coupling in an effort to uncover underlying rules that may exist within these non-homologous interactions. We designed a novel chromosome conformation capture (3C)-based assay to detect all possible interactions between non-homologous yeast centromeres during early meiosis. Using this variant of 3C-qPCR, we found a size-dependent interaction pattern, in which chromosomes assort preferentially with chromosomes of similar sizes, in haploid and diploid spo11 cells, but not in a coupling-defective mutant (spo11 zip1 haploid and diploid yeast). This pattern is also observed in wild-type diploids early in meiosis but disappears as meiosis progresses and homologous chromosomes pair. We found no evidence to support the notion that ancestral centromere homology plays a role in pattern establishment in S. cerevisiae post-genome duplication. Moreover, we found a role for the meiotic bouquet in establishing the size dependence of centromere coupling, as abolishing bouquet (using the bouquet-defective spo11 ndj1 mutant) reduces it. Coupling in spo11 ndj1 rather follows telomere clustering preferences. We propose that a chromosome size preference for centromere coupling helps establish efficient homolog recognition. PMID:27768699

  18. Detection of Helicobacter and Campylobacter spp. from the aquatic environment of marine mammals.

    PubMed

    Goldman, C G; Matteo, M J; Loureiro, J D; Degrossi, J; Teves, S; Heredia, S Rodriguez; Alvarez, K; González, A Beltrán; Catalano, M; Boccio, J; Cremaschi, G; Solnick, J V; Zubillaga, M B

    2009-01-13

    The mechanism by which Helicobacter species are transmitted remains unclear. To examine the possible role of environmental transmission in marine mammals, we sought the presence of Helicobacter spp. and non-Helicobacter bacteria within the order Campylobacterales in water from the aquatic environment of marine mammals, and in fish otoliths regurgitated by dolphins. Water was collected from six pools, two inhabited by dolphins and four inhabited by seals. Regurgitated otoliths were collected from the bottom of dolphins' pools. Samples were evaluated by culture, PCR and DNA sequence analysis. Sequences from dolphins' water and from regurgitated otoliths clustered with 99.8-100% homology with sequences from gastric fluids, dental plaque and saliva from dolphins living in those pools, and with 99.5% homology with H. cetorum. Sequences from seals' water clustered with 99.5% homology with a sequence amplified from a Northern sea lion (AY203900). Control PCR on source water for the pools and from otoliths dissected from feeder fish were negative. The findings of Helicobacter spp. DNA in the aquatic environment suggests that contaminated water from regurgitated fish otoliths and perhaps other tissues may play a role in Helicobacter transmission among marine mammals.

  19. Isolation and characterization of a cDNA clone for the complete protein coding region of the delta subunit of the mouse acetylcholine receptor.

    PubMed Central

    LaPolla, R J; Mayne, K M; Davidson, N

    1984-01-01

    A mouse cDNA clone has been isolated that contains the complete coding region of a protein highly homologous to the delta subunit of the Torpedo acetylcholine receptor (AcChoR). The cDNA library was constructed in the vector lambda 10 from membrane-associated poly(A)+ RNA from BC3H-1 mouse cells. Surprisingly, the delta clone was selected by hybridization with cDNA encoding the gamma subunit of the Torpedo AcChoR. The nucleotide sequence of the mouse cDNA clone contains an open reading frame of 520 amino acids. This amino acid sequence exhibits 59% and 50% sequence homology to the Torpedo AcChoR delta and gamma subunits, respectively. However, the mouse nucleotide sequence has several stretches of high homology with the Torpedo gamma subunit cDNA, but not with delta. The mouse protein has the same general structural features as do the Torpedo subunits. It is encoded by a 3.3-kilobase mRNA. There is probably only one, but at most two, chromosomal genes coding for this or closely related sequences. Images PMID:6096870

  20. Chromosome specific repetitive DNA sequences

    DOEpatents

    Moyzis, Robert K.; Meyne, Julianne

    1991-01-01

    A method is provided for determining specific nucleotide sequences useful in forming a probe which can identify specific chromosomes, preferably through in situ hybridization within the cell itself. In one embodiment, chromosome preferential nucleotide sequences are first determined from a library of recombinant DNA clones having families of repetitive sequences. Library clones are identified with a low homology with a sequence of repetitive DNA families to which the first clones respectively belong and variant sequences are then identified by selecting clones having a pattern of hybridization with genomic DNA dissimilar to the hybridization pattern shown by the respective families. In another embodiment, variant sequences are selected from a sequence of a known repetitive DNA family. The selected variant sequence is classified as chromosome specific, chromosome preferential, or chromosome nonspecific. Sequences which are classified as chromosome preferential are further sequenced and regions are identified having a low homology with other regions of the chromosome preferential sequence or with known sequences of other family me This invention is the result of a contract with the Department of Energy (Contract No. W-7405-ENG-36).

  1. Recombination–deletion between homologous cassettes in retrovirus is suppressed via a strategy of degenerate codon substitution

    PubMed Central

    Im, Eung Jun; Bais, Anthony J; Yang, Wen; Ma, Qiangzhong; Guo, Xiuyang; Sepe, Steven M; Junghans, Richard P

    2014-01-01

    Transduction and expression procedures in gene therapy protocols may optimally transfer more than a single gene to correct a defect and/or transmit new functions to recipient cells or organisms. This may be accomplished by transduction with two (or more) vectors, or, more efficiently, in a single vector. Occasionally, it may be useful to coexpress homologous genes or chimeric proteins with regions of shared homology. Retroviridae include the dominant vector systems for gene transfer (e.g., gamma-retro and lentiviruses) and are capable of such multigene expression. However, these same viruses are known for efficient recombination–deletion when domains are duplicated within the viral genome. This problem can be averted by resorting to two-vector strategies (two-chain two-vector), but at a penalty to cost, convenience, and efficiency. Employing a chimeric antigen receptor system as an example, we confirm that coexpression of two genes with homologous domains in a single gamma-retroviral vector (two-chain single-vector) leads to recombination–deletion between repeated sequences, excising the equivalent of one of the chimeric antigen receptors. Here, we show that a degenerate codon substitution strategy in the two-chain single-vector format efficiently suppressed intravector deletional loss with rescue of balanced gene coexpression by minimizing sequence homology between repeated domains and preserving the final protein sequence. PMID:25419532

  2. Sequence alignment visualization in HTML5 without Java.

    PubMed

    Gille, Christoph; Birgit, Weyand; Gille, Andreas

    2014-01-01

    Java has been extensively used for the visualization of biological data in the web. However, the Java runtime environment is an additional layer of software with an own set of technical problems and security risks. HTML in its new version 5 provides features that for some tasks may render Java unnecessary. Alignment-To-HTML is the first HTML-based interactive visualization for annotated multiple sequence alignments. The server side script interpreter can perform all tasks like (i) sequence retrieval, (ii) alignment computation, (iii) rendering, (iv) identification of a homologous structural models and (v) communication with BioDAS-servers. The rendered alignment can be included in web pages and is displayed in all browsers on all platforms including touch screen tablets. The functionality of the user interface is similar to legacy Java applets and includes color schemes, highlighting of conserved and variable alignment positions, row reordering by drag and drop, interlinked 3D visualization and sequence groups. Novel features are (i) support for multiple overlapping residue annotations, such as chemical modifications, single nucleotide polymorphisms and mutations, (ii) mechanisms to quickly hide residue annotations, (iii) export to MS-Word and (iv) sequence icons. Alignment-To-HTML, the first interactive alignment visualization that runs in web browsers without additional software, confirms that to some extend HTML5 is already sufficient to display complex biological data. The low speed at which programs are executed in browsers is still the main obstacle. Nevertheless, we envision an increased use of HTML and JavaScript for interactive biological software. Under GPL at: http://www.bioinformatics.org/strap/toHTML/.

  3. Distribution of a Nocardia brasiliensis catalase gene fragment in members of the genera Nocardia, Gordona, and Rhodococcus.

    PubMed

    Vera-Cabrera, L; Johnson, W M; Welsh, O; Resendiz-Uresti, F L; Salinas-Carmona, M C

    1999-06-01

    An immunodominant protein from Nocardia brasiliensis, P61, was subjected to amino-terminal and internal sequence analysis. Three sequences of 22, 17, and 38 residues, respectively, were obtained and compared with the protein database from GenBank by using the BLAST system. The sequences showed homology to some eukaryotic catalases and to a bromoperoxidase-catalase from Streptomyces violaceus. Its identity as a catalase was confirmed by analysis of its enzymatic activity on H2O2 and by a double-staining method on a nondenaturing polyacrylamide gel with 3,3'-diaminobenzidine and ferricyanide; the result showed only catalase activity, but no peroxidase. By using one of the internal amino acid sequences and a consensus catalase motif (VGNNTP), we were able to design a PCR assay that generated a 500-bp PCR product. The amplicon was analyzed, and the nucleotide sequence was compared to the GenBank database with the observation of high homology to other bacterial and eukaryotic catalases. A PCR assay based on this target sequence was performed with primers NB10 and NB11 to confirm the presence of the NB10-NB11 gene fragment in several N. brasiliensis strains isolated from mycetoma. The same assay was used to determine whether there were homologous sequences in several type strains from the genera Nocardia, Rhodococcus, Gordona, and Streptomyces. All of the N. brasiliensis strains presented a positive result but only some of the actinomycetes species tested were positive in the PCR assay. In order to confirm these findings, genomic DNA was subjected to Southern blot analysis. A 1.7-kbp band was observed in the N. brasiliensis strains, and bands of different molecular weight were observed in cross-reacting actinomycetes. Sequence analysis of the amplicons of selected actinomycetes showed high homology in this catalase fragment, thus demonstrating that this protein is highly conserved in this group of bacteria.

  4. A discriminative method for family-based protein remote homology detection that combines inductive logic programming and propositional models

    PubMed Central

    2011-01-01

    Background Remote homology detection is a hard computational problem. Most approaches have trained computational models by using either full protein sequences or multiple sequence alignments (MSA), including all positions. However, when we deal with proteins in the "twilight zone" we can observe that only some segments of sequences (motifs) are conserved. We introduce a novel logical representation that allows us to represent physico-chemical properties of sequences, conserved amino acid positions and conserved physico-chemical positions in the MSA. From this, Inductive Logic Programming (ILP) finds the most frequent patterns (motifs) and uses them to train propositional models, such as decision trees and support vector machines (SVM). Results We use the SCOP database to perform our experiments by evaluating protein recognition within the same superfamily. Our results show that our methodology when using SVM performs significantly better than some of the state of the art methods, and comparable to other. However, our method provides a comprehensible set of logical rules that can help to understand what determines a protein function. Conclusions The strategy of selecting only the most frequent patterns is effective for the remote homology detection. This is possible through a suitable first-order logical representation of homologous properties, and through a set of frequent patterns, found by an ILP system, that summarizes essential features of protein functions. PMID:21429187

  5. A discriminative method for family-based protein remote homology detection that combines inductive logic programming and propositional models.

    PubMed

    Bernardes, Juliana S; Carbone, Alessandra; Zaverucha, Gerson

    2011-03-23

    Remote homology detection is a hard computational problem. Most approaches have trained computational models by using either full protein sequences or multiple sequence alignments (MSA), including all positions. However, when we deal with proteins in the "twilight zone" we can observe that only some segments of sequences (motifs) are conserved. We introduce a novel logical representation that allows us to represent physico-chemical properties of sequences, conserved amino acid positions and conserved physico-chemical positions in the MSA. From this, Inductive Logic Programming (ILP) finds the most frequent patterns (motifs) and uses them to train propositional models, such as decision trees and support vector machines (SVM). We use the SCOP database to perform our experiments by evaluating protein recognition within the same superfamily. Our results show that our methodology when using SVM performs significantly better than some of the state of the art methods, and comparable to other. However, our method provides a comprehensible set of logical rules that can help to understand what determines a protein function. The strategy of selecting only the most frequent patterns is effective for the remote homology detection. This is possible through a suitable first-order logical representation of homologous properties, and through a set of frequent patterns, found by an ILP system, that summarizes essential features of protein functions.

  6. Contribution of energy values to the analysis of global searching molecular dynamics simulations of transmembrane helical bundles.

    PubMed Central

    Torres, Jaume; Briggs, John A G; Arkin, Isaiah T

    2002-01-01

    Molecular interactions between transmembrane alpha-helices can be explored using global searching molecular dynamics simulations (GSMDS), a method that produces a group of probable low energy structures. We have shown previously that the correct model in various homooligomers is always located at the bottom of one of various possible energy basins. Unfortunately, the correct model is not necessarily the one with the lowest energy according to the computational protocol, which has resulted in overlooking of this parameter in favor of experimental data. In an attempt to use energetic considerations in the aforementioned analysis, we used global searching molecular dynamics simulations on three homooligomers of different sizes, the structures of which are known. As expected, our results show that even when the conformational space searched includes the correct structure, taking together simulations using both left and right handedness, the correct model does not necessarily have the lowest energy. However, for the models derived from the simulation that uses the correct handedness, the lowest energy model is always at, or very close to, the correct orientation. We hypothesize that this should also be true when simulations are performed using homologous sequences, and consequently lowest energy models with the right handedness should produce a cluster around a certain orientation. In contrast, using the wrong handedness the lowest energy structures for each sequence should appear at many different orientations. The rationale behind this is that, although more than one energy basin may exist, basins that do not contain the correct model will shift or disappear because they will be destabilized by at least one conservative (i.e. silent) mutation, whereas the basin containing the correct model will remain. This not only allows one to point to the possible handedness of the bundle, but can be used to overcome ambiguities arising from the use of homologous sequences in the analysis of global searching molecular dynamics simulations. In addition, because clustering of lowest energy models arising from homologous sequences only happens when the estimation of the helix tilt is correct, it may provide a validation for the helix tilt estimate. PMID:12023229

  7. The organisation and interviral homologies of genes at the 3' end of tobacco rattle virus RNA1

    PubMed Central

    Boccara, Martine; Hamilton, William D. O.; Baulcombe, David C.

    1986-01-01

    The RNA1 of tobacco rattle virus (TRV) has been cloned as cDNA and the nucleotide sequence determined of 2 kb from the 3'-terminal region. The sequence contains three long open reading frames. One of these starts 5' of the cDNA and probably corresponds to the carboxy-terminal sequence of a 170-K protein encoded on RNA1. The deduced protein sequence from this reading frame shows homology with the putative replicases of tobacco mosaic virus (TMV) and tricornaviruses. The location of the second open reading frame, which encodes a 29-K polypeptide, was shown by Northern blot analysis to coincide with a 1.6-kb subgenomic RNA. The validity of this reading frame was confirmed by showing that the cDNA extending over this region could be transcribed and translated in vitro to produce a polypeptide of the predicted size which co-migrates in electrophoresis with a translation product of authentic viral RNA. The sequence of this 29-K polypeptide showed homology with two regions in the 30-K protein of TMV. This homology includes positions in the TMV 30-K protein where mutations have been identified which affect the transport of virus between cells. The third open reading frame encodes a potential 16-K protein and was shown by Northern blot hybridisation to be contained within the region of a 0.7-kb subgenomic RNA which is found in cellular RNA of infected cells but not virus particles. The many similarities between TRV and TMV in viral morphology, gene organisation and sequence suggest that these two viral groups may share a common viral ancestor. ImagesFig. 2.Fig. 3. PMID:16453668

  8. Microbes in mercury-enriched geothermal springs in western North America.

    PubMed

    Geesey, Gill G; Barkay, Tamar; King, Sue

    2016-11-01

    Because geothermal environments contain mercury (Hg) from natural sources, microorganisms that evolved in these systems have likely adapted to this element. Knowledge of the interactions between microorganisms and Hg in geothermal systems may assist in understanding the long-term evolution of microbial adaptation to Hg with relevance to other environments where Hg is introduced from anthropogenic sources. A number of microbiological studies with supporting geochemistry have been conducted in geothermal systems across western North America. Approximately 1 in 5 study sites include measurements of Hg. Of all prokaryotic taxa reported across sites with microbiological and accompanying physicochemical data, 42% have been detected at sites in which Hg was measured. Genes specifying Hg reduction and detoxification by microorganisms were detected in a number of hot springs across the region. Archaeal-like sequences, representing two crenarchaeal orders and one order each of the Euryarchaeota and Thaumarchaeota, dominated in metagenomes' MerA (the mercuric reductase protein) inventories, while bacterial homologs were mostly found in one deeply sequenced metagenome. MerA homologs were more frequently found in metagenomes of microbial communities in acidic springs than in circumneutral or high pH geothermal systems, possibly reflecting higher bioavailability of Hg under acidic conditions. MerA homologs were found in hot springs prokaryotic isolates affiliated with Bacteria and Archaea taxa. Acidic sites with high Hg concentrations contain more of Archaea than Bacteria taxa, while the reverse appears to be the case in circumneutral and high pH sites with high Hg concentrations. However, MerA was detected in only a small fraction of the Archaea and Bacteria taxa inhabiting sites containing Hg. Nevertheless, the presence of MerA homologs and their distribution patterns in systems, in which Hg has yet to be measured, demonstrates the potential for detoxification by Hg reduction in these geothermal systems, particularly the low pH springs that are dominated by Archaea. Copyright © 2016 Elsevier B.V. All rights reserved.

  9. Nucleotide sequencing and serological evidence that the recently recognized deer tick virus is a genotype of Powassan virus.

    PubMed

    Beasley, D W; Suderman, M T; Holbrook, M R; Barrett, A D

    2001-11-05

    Deer tick virus (DTV) is a recently recognized North American virus isolated from Ixodes dammini ticks. Nucleotide sequencing of fragments of structural and non-structural protein genes suggested that this virus was most closely related to the tick-borne flavivirus Powassan (POW), which causes potentially fatal encephalitis in humans. To determine whether DTV represents a new and distinct member of the Flavivirus genus of the family Flaviviridae, we sequenced the structural protein genes and 5' and 3' non-coding regions of this virus. In addition, we compared the reactivity of DTV and POW in hemagglutination inhibition tests with a panel of polyclonal and monoclonal antisera, and performed cross-neutralization experiments using anti-DTV antisera. Nucleotide sequencing revealed a high degree of homology between DTV and POW at both nucleotide (>80% homology) and amino acid (>90% homology) levels, and the two viruses were indistinguishable in serological assays and mouse neuroinvasiveness. On the basis of these results, we suggest that DTV should be classified as a genotype of POW virus.

  10. Principles of long noncoding RNA evolution derived from direct comparison of transcriptomes in 17 species.

    PubMed

    Hezroni, Hadas; Koppstein, David; Schwartz, Matthew G; Avrutin, Alexandra; Bartel, David P; Ulitsky, Igor

    2015-05-19

    The inability to predict long noncoding RNAs from genomic sequence has impeded the use of comparative genomics for studying their biology. Here, we develop methods that use RNA sequencing (RNA-seq) data to annotate the transcriptomes of 16 vertebrates and the echinoid sea urchin, uncovering thousands of previously unannotated genes, most of which produce long intervening noncoding RNAs (lincRNAs). Although in each species, >70% of lincRNAs cannot be traced to homologs in species that diverged >50 million years ago, thousands of human lincRNAs have homologs with similar expression patterns in other species. These homologs share short, 5'-biased patches of sequence conservation nested in exonic architectures that have been extensively rewired, in part by transposable element exonization. Thus, over a thousand human lincRNAs are likely to have conserved functions in mammals, and hundreds beyond mammals, but those functions require only short patches of specific sequences and can tolerate major changes in gene architecture. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.

  11. AlloRep: A Repository of Sequence, Structural and Mutagenesis Data for the LacI/GalR Transcription Regulators.

    PubMed

    Sousa, Filipa L; Parente, Daniel J; Shis, David L; Hessman, Jacob A; Chazelle, Allen; Bennett, Matthew R; Teichmann, Sarah A; Swint-Kruse, Liskin

    2016-02-22

    Protein families evolve functional variation by accumulating point mutations at functionally important amino acid positions. Homologs in the LacI/GalR family of transcription regulators have evolved to bind diverse DNA sequences and allosteric regulatory molecules. In addition to playing key roles in bacterial metabolism, these proteins have been widely used as a model family for benchmarking structural and functional prediction algorithms. We have collected manually curated sequence alignments for >3000 sequences, in vivo phenotypic and biochemical data for >5750 LacI/GalR mutational variants, and noncovalent residue contact networks for 65 LacI/GalR homolog structures. Using this rich data resource, we compared the noncovalent residue contact networks of the LacI/GalR subfamilies to design and experimentally validate an allosteric mutant of a synthetic LacI/GalR repressor for use in biotechnology. The AlloRep database (freely available at www.AlloRep.org) is a key resource for future evolutionary studies of LacI/GalR homologs and for benchmarking computational predictions of functional change. Copyright © 2015 Elsevier Ltd. All rights reserved.

  12. Transmembrane insertion of twin-arginine signal peptides is driven by TatC and regulated by TatB

    PubMed Central

    Fröbel, Julia; Rose, Patrick; Lausberg, Frank; Blümmel, Anne-Sophie; Freudl, Roland; Müller, Matthias

    2012-01-01

    The twin-arginine translocation (Tat) pathway of bacteria and plant chloroplasts mediates the transmembrane transport of folded proteins, which harbour signal sequences with a conserved twin-arginine motif. Many Tat translocases comprise the three membrane proteins TatA, TatB and TatC. TatC was previously shown to be involved in recognizing twin-arginine signal peptides. Here we show that beyond recognition, TatC mediates the transmembrane insertion of a twin-arginine signal sequence, thereby translocating the signal sequence cleavage site across the bilayer. In the absence of TatB, this can lead to the removal of the signal sequence even from a translocation-incompetent substrate. Hence interaction of twin-arginine signal peptides with TatB counteracts their premature cleavage uncoupled from translocation. This capacity of TatB is not shared by the homologous TatA protein. Collectively our results suggest that TatC is an insertase for twin-arginine signal peptides and that translocation-proficient signal sequence recognition requires the concerted action of TatC and TatB. PMID:23250441

  13. Transmembrane insertion of twin-arginine signal peptides is driven by TatC and regulated by TatB.

    PubMed

    Fröbel, Julia; Rose, Patrick; Lausberg, Frank; Blümmel, Anne-Sophie; Freudl, Roland; Müller, Matthias

    2012-01-01

    The twin-arginine translocation (Tat) pathway of bacteria and plant chloroplasts mediates the transmembrane transport of folded proteins, which harbour signal sequences with a conserved twin-arginine motif. Many Tat translocases comprise the three membrane proteins TatA, TatB and TatC. TatC was previously shown to be involved in recognizing twin-arginine signal peptides. Here we show that beyond recognition, TatC mediates the transmembrane insertion of a twin-arginine signal sequence, thereby translocating the signal sequence cleavage site across the bilayer. In the absence of TatB, this can lead to the removal of the signal sequence even from a translocation-incompetent substrate. Hence interaction of twin-arginine signal peptides with TatB counteracts their premature cleavage uncoupled from translocation. This capacity of TatB is not shared by the homologous TatA protein. Collectively our results suggest that TatC is an insertase for twin-arginine signal peptides and that translocation-proficient signal sequence recognition requires the concerted action of TatC and TatB.

  14. Aromatic interactions impact ligand binding and function at serotonin 5-HT2C G protein-coupled receptors: receptor homology modelling, ligand docking, and molecular dynamics results validated by experimental studies

    NASA Astrophysics Data System (ADS)

    Córdova-Sintjago, Tania; Villa, Nancy; Fang, Lijuan; Booth, Raymond G.

    2014-02-01

    The serotonin (5-hydroxytryptamine, 5-HT) 5-HT2 G protein-coupled receptor (GPCR) family consists of types 2A, 2B, and 2C that share ∼75% transmembrane (TM) sequence identity. Agonists for 5-HT2C receptors are under development for psychoses; whereas, at 5-HT2A receptors, antipsychotic effects are associated with antagonists - in fact, 5-HT2A agonists can cause hallucinations and 5-HT2B agonists cause cardiotoxicity. It is known that 5-HT2A TM6 residues W6.48, F6.51, and F6.52 impact ligand binding and function; however, ligand interactions with these residues at the 5-HT2C receptor have not been reported. To predict and validate molecular determinants for 5-HT2C-specific activation, results from receptor homology modelling, ligand docking, and molecular dynamics simulation studies were compared with experimental results for ligand binding and function at wild type and W6.48A, F6.51A, and F6.52A point-mutated 5-HT2C receptors.

  15. Different domains of the murine RNA polymerase I-specific termination factor mTTF-I serve distinct functions in transcription termination.

    PubMed

    Evers, R; Smid, A; Rudloff, U; Lottspeich, F; Grummt, I

    1995-03-15

    Termination of mouse ribosomal gene transcription by RNA polymerase I (Pol I) requires the specific interaction of a DNA binding protein, mTTF-I, with an 18 bp sequence element located downstream of the rRNA coding region. Here we describe the molecular cloning and functional characterization of the cDNA encoding this transcription termination factor. Recombinant mTTF-I binds specifically to the murine terminator elements and terminates Pol I transcription in a reconstituted in vitro system. Deletion analysis has defined a modular structure of mTTF-I comprising a dispensable N-terminal half, a large C-terminal DNA binding region and an internal domain which is required for transcription termination. Significantly, the C-terminal region of mTTF-I reveals striking homology to the DNA binding domains of the proto-oncogene c-Myb and the yeast transcription factor Reb1p. Site-directed mutagenesis of one of the tryptophan residues that is conserved in the homology region of c-Myb, Reb1p and mTTF-I abolishes specific DNA binding, a finding which underscores the functional relevance of these residues in DNA-protein interactions.

  16. Different domains of the murine RNA polymerase I-specific termination factor mTTF-I serve distinct functions in transcription termination.

    PubMed Central

    Evers, R; Smid, A; Rudloff, U; Lottspeich, F; Grummt, I

    1995-01-01

    Termination of mouse ribosomal gene transcription by RNA polymerase I (Pol I) requires the specific interaction of a DNA binding protein, mTTF-I, with an 18 bp sequence element located downstream of the rRNA coding region. Here we describe the molecular cloning and functional characterization of the cDNA encoding this transcription termination factor. Recombinant mTTF-I binds specifically to the murine terminator elements and terminates Pol I transcription in a reconstituted in vitro system. Deletion analysis has defined a modular structure of mTTF-I comprising a dispensable N-terminal half, a large C-terminal DNA binding region and an internal domain which is required for transcription termination. Significantly, the C-terminal region of mTTF-I reveals striking homology to the DNA binding domains of the proto-oncogene c-Myb and the yeast transcription factor Reb1p. Site-directed mutagenesis of one of the tryptophan residues that is conserved in the homology region of c-Myb, Reb1p and mTTF-I abolishes specific DNA binding, a finding which underscores the functional relevance of these residues in DNA-protein interactions. Images PMID:7720715

  17. The evolution of function within the Nudix homology clan

    PubMed Central

    Srouji, John R.; Xu, Anting; Park, Annsea; Kirsch, Jack F.

    2017-01-01

    ABSTRACT The Nudix homology clan encompasses over 80,000 protein domains from all three domains of life, defined by homology to each other. Proteins with a domain from this clan fall into four general functional classes: pyrophosphohydrolases, isopentenyl diphosphate isomerases (IDIs), adenine/guanine mismatch‐specific adenine glycosylases (A/G‐specific adenine glycosylases), and nonenzymatic activities such as protein/protein interaction and transcriptional regulation. The largest group, pyrophosphohydrolases, encompasses more than 100 distinct hydrolase specificities. To understand the evolution of this vast number of activities, we assembled and analyzed experimental and structural data for 205 Nudix proteins collected from the literature. We corrected erroneous functions or provided more appropriate descriptions for 53 annotations described in the Gene Ontology Annotation database in this family, and propose 275 new experimentally‐based annotations. We manually constructed a structure‐guided sequence alignment of 78 Nudix proteins. Using the structural alignment as a seed, we then made an alignment of 347 “select” Nudix homology domains, curated from structurally determined, functionally characterized, or phylogenetically important Nudix domains. Based on our review of Nudix pyrophosphohydrolase structures and specificities, we further analyzed a loop region downstream of the Nudix hydrolase motif previously shown to contact the substrate molecule and possess known functional motifs. This loop region provides a potential structural basis for the functional radiation and evolution of substrate specificity within the hydrolase family. Finally, phylogenetic analyses of the 347 select protein domains and of the complete Nudix homology clan revealed general monophyly with regard to function and a few instances of probable homoplasy. Proteins 2017; 85:775–811. © 2016 Wiley Periodicals, Inc. PMID:27936487

  18. Weak conservation of structural features in the interfaces of homologous transient protein–protein complexes

    PubMed Central

    Sudha, Govindarajan; Singh, Prashant; Swapna, Lakshmipuram S; Srinivasan, Narayanaswamy

    2015-01-01

    Residue types at the interface of protein–protein complexes (PPCs) are known to be reasonably well conserved. However, we show, using a dataset of known 3-D structures of homologous transient PPCs, that the 3-D location of interfacial residues and their interaction patterns are only moderately and poorly conserved, respectively. Another surprising observation is that a residue at the interface that is conserved is not necessarily in the interface in the homolog. Such differences in homologous complexes are manifested by substitution of the residues that are spatially proximal to the conserved residue and structural differences at the interfaces as well as differences in spatial orientations of the interacting proteins. Conservation of interface location and the interaction pattern at the core of the interfaces is higher than at the periphery of the interface patch. Extents of variability of various structural features reported here for homologous transient PPCs are higher than the variation in homologous permanent homomers. Our findings suggest that straightforward extrapolation of interfacial nature and inter-residue interaction patterns from template to target could lead to serious errors in the modeled complex structure. Understanding the evolution of interfaces provides insights to improve comparative modeling of PPC structures. PMID:26311309

  19. Graph pyramids for protein function prediction

    PubMed Central

    2015-01-01

    Background Uncovering the hidden organizational characteristics and regularities among biological sequences is the key issue for detailed understanding of an underlying biological phenomenon. Thus pattern recognition from nucleic acid sequences is an important affair for protein function prediction. As proteins from the same family exhibit similar characteristics, homology based approaches predict protein functions via protein classification. But conventional classification approaches mostly rely on the global features by considering only strong protein similarity matches. This leads to significant loss of prediction accuracy. Methods Here we construct the Protein-Protein Similarity (PPS) network, which captures the subtle properties of protein families. The proposed method considers the local as well as the global features, by examining the interactions among 'weakly interacting proteins' in the PPS network and by using hierarchical graph analysis via the graph pyramid. Different underlying properties of the protein families are uncovered by operating the proposed graph based features at various pyramid levels. Results Experimental results on benchmark data sets show that the proposed hierarchical voting algorithm using graph pyramid helps to improve computational efficiency as well the protein classification accuracy. Quantitatively, among 14,086 test sequences, on an average the proposed method misclassified only 21.1 sequences whereas baseline BLAST score based global feature matching method misclassified 362.9 sequences. With each correctly classified test sequence, the fast incremental learning ability of the proposed method further enhances the training model. Thus it has achieved more than 96% protein classification accuracy using only 20% per class training data. PMID:26044522

  20. Graph pyramids for protein function prediction.

    PubMed

    Sandhan, Tushar; Yoo, Youngjun; Choi, Jin; Kim, Sun

    2015-01-01

    Uncovering the hidden organizational characteristics and regularities among biological sequences is the key issue for detailed understanding of an underlying biological phenomenon. Thus pattern recognition from nucleic acid sequences is an important affair for protein function prediction. As proteins from the same family exhibit similar characteristics, homology based approaches predict protein functions via protein classification. But conventional classification approaches mostly rely on the global features by considering only strong protein similarity matches. This leads to significant loss of prediction accuracy. Here we construct the Protein-Protein Similarity (PPS) network, which captures the subtle properties of protein families. The proposed method considers the local as well as the global features, by examining the interactions among 'weakly interacting proteins' in the PPS network and by using hierarchical graph analysis via the graph pyramid. Different underlying properties of the protein families are uncovered by operating the proposed graph based features at various pyramid levels. Experimental results on benchmark data sets show that the proposed hierarchical voting algorithm using graph pyramid helps to improve computational efficiency as well the protein classification accuracy. Quantitatively, among 14,086 test sequences, on an average the proposed method misclassified only 21.1 sequences whereas baseline BLAST score based global feature matching method misclassified 362.9 sequences. With each correctly classified test sequence, the fast incremental learning ability of the proposed method further enhances the training model. Thus it has achieved more than 96% protein classification accuracy using only 20% per class training data.

  1. Genome-wide comparative analysis reveals human-mouse regulatory landscape and evolution.

    PubMed

    Denas, Olgert; Sandstrom, Richard; Cheng, Yong; Beal, Kathryn; Herrero, Javier; Hardison, Ross C; Taylor, James

    2015-02-14

    Because species-specific gene expression is driven by species-specific regulation, understanding the relationship between sequence and function of the regulatory regions in different species will help elucidate how differences among species arise. Despite active experimental and computational research, relationships among sequence, conservation, and function are still poorly understood. We compared transcription factor occupied segments (TFos) for 116 human and 35 mouse TFs in 546 human and 125 mouse cell types and tissues from the Human and the Mouse ENCODE projects. We based the map between human and mouse TFos on a one-to-one nucleotide cross-species mapper, bnMapper, that utilizes whole genome alignments (WGA). Our analysis shows that TFos are under evolutionary constraint, but a substantial portion (25.1% of mouse and 25.85% of human on average) of the TFos does not have a homologous sequence on the other species; this portion varies among cell types and TFs. Furthermore, 47.67% and 57.01% of the homologous TFos sequence shows binding activity on the other species for human and mouse respectively. However, 79.87% and 69.22% is repurposed such that it binds the same TF in different cells or different TFs in the same cells. Remarkably, within the set of repurposed TFos, the corresponding genome regions in the other species are preferred locations of novel TFos. These events suggest exaptation of some functional regulatory sequences into new function. Despite TFos repurposing, we did not find substantial changes in their predicted target genes, suggesting that CRMs buffer evolutionary events allowing little or no change in the TFos - target gene associations. Thus, the small portion of TFos with strictly conserved occupancy underestimates the degree of conservation of regulatory interactions. We mapped regulatory sequences from an extensive number of TFs and cell types between human and mouse using WGA. A comparative analysis of this correspondence unveiled the extent of the shared regulatory sequence across TFs and cell types under study. Importantly, a large part of the shared regulatory sequence is repurposed on the other species. This sequence, fueled by turnover events, provides a strong case for exaptation in regulatory elements.

  2. Computational approaches to predict bacteriophage–host relationships

    PubMed Central

    Edwards, Robert A.; McNair, Katelyn; Faust, Karoline; Raes, Jeroen; Dutilh, Bas E.

    2015-01-01

    Metagenomics has changed the face of virus discovery by enabling the accurate identification of viral genome sequences without requiring isolation of the viruses. As a result, metagenomic virus discovery leaves the first and most fundamental question about any novel virus unanswered: What host does the virus infect? The diversity of the global virosphere and the volumes of data obtained in metagenomic sequencing projects demand computational tools for virus–host prediction. We focus on bacteriophages (phages, viruses that infect bacteria), the most abundant and diverse group of viruses found in environmental metagenomes. By analyzing 820 phages with annotated hosts, we review and assess the predictive power of in silico phage–host signals. Sequence homology approaches are the most effective at identifying known phage–host pairs. Compositional and abundance-based methods contain significant signal for phage–host classification, providing opportunities for analyzing the unknowns in viral metagenomes. Together, these computational approaches further our knowledge of the interactions between phages and their hosts. Importantly, we find that all reviewed signals significantly link phages to their hosts, illustrating how current knowledge and insights about the interaction mechanisms and ecology of coevolving phages and bacteria can be exploited to predict phage–host relationships, with potential relevance for medical and industrial applications. PMID:26657537

  3. Amastin Knockdown in Leishmania braziliensis Affects Parasite-Macrophage Interaction and Results in Impaired Viability of Intracellular Amastigotes.

    PubMed

    de Paiva, Rita Marcia Cardoso; Grazielle-Silva, Viviane; Cardoso, Mariana Santos; Nakagaki, Brenda Naemi; Mendonça-Neto, Rondon Pessoa; Canavaci, Adriana Monte Cassiano; Souza Melo, Normanda; Martinelli, Patrícia Massara; Fernandes, Ana Paula; daRocha, Wanderson Duarte; Teixeira, Santuza M R

    2015-12-01

    Leishmaniasis, a human parasitic disease with manifestations ranging from cutaneous ulcerations to fatal visceral infection, is caused by several Leishmania species. These protozoan parasites replicate as extracellular, flagellated promastigotes in the gut of a sandfly vector and as amastigotes inside the parasitophorous vacuole of vertebrate host macrophages. Amastins are surface glycoproteins encoded by large gene families present in the genomes of several trypanosomatids and highly expressed in the intracellular amastigote stages of Trypanosoma cruzi and Leishmania spp. Here, we showed that the genome of L. braziliensis contains 52 amastin genes belonging to all four previously described amastin subfamilies and that the expression of members of all subfamilies is upregulated in L. braziliensis amastigotes. Although primary sequence alignments showed no homology to any known protein sequence, homology searches based on secondary structure predictions indicate that amastins are related to claudins, a group of proteins that are components of eukaryotic tight junction complexes. By knocking-down the expression of δ-amastins in L. braziliensis, their essential role during infection became evident. δ-amastin knockdown parasites showed impaired growth after in vitro infection of mouse macrophages and completely failed to produce infection when inoculated in BALB/c mice, an attenuated phenotype that was reverted by the re-expression of an RNAi-resistant amastin gene. Further highlighting their essential role in host-parasite interactions, electron microscopy analyses of macrophages infected with amastin knockdown parasites showed significant alterations in the tight contact that is normally observed between the surface of wild type amastigotes and the membrane of the parasitophorous vacuole.

  4. Research resource: Update and extension of a glycoprotein hormone receptors web application.

    PubMed

    Kreuchwig, Annika; Kleinau, Gunnar; Kreuchwig, Franziska; Worth, Catherine L; Krause, Gerd

    2011-04-01

    The SSFA-GPHR (Sequence-Structure-Function-Analysis of Glycoprotein Hormone Receptors) database provides a comprehensive set of mutation data for the glycoprotein hormone receptors (covering the lutropin, the FSH, and the TSH receptors). Moreover, it provides a platform for comparison and investigation of these homologous receptors and helps in understanding protein malfunctions associated with several diseases. Besides extending the data set (> 1100 mutations), the database has been completely redesigned and several novel features and analysis tools have been added to the web site. These tools allow the focused extraction of semiquantitative mutant data from the GPHR subtypes and different experimental approaches. Functional and structural data of the GPHRs are now linked interactively at the web interface, and new tools for data visualization (on three-dimensional protein structures) are provided. The interpretation of functional findings is supported by receptor morphings simulating intramolecular changes during the activation process, which thus help to trace the potential function of each amino acid and provide clues to the local structural environment, including potentially relocated spatial counterpart residues. Furthermore, double and triple mutations are newly included to allow the analysis of their functional effects related to their spatial interrelationship in structures or homology models. A new important feature is the search option and data visualization by interactive and user-defined snake-plots. These new tools allow fast and easy searches for specific functional data and thereby give deeper insights in the mechanisms of hormone binding, signal transduction, and signaling regulation. The web application "Sequence-Structure-Function-Analysis of GPHRs" is accessible on the internet at http://www.ssfa-gphr.de/.

  5. Productive Homologous and Non-homologous Recombination of Hepatitis C Virus in Cell Culture

    PubMed Central

    Li, Yi-Ping; Mikkelsen, Lotte S.; Gottwein, Judith M.; Bukh, Jens

    2013-01-01

    Genetic recombination is an important mechanism for increasing diversity of RNA viruses, and constitutes a viral escape mechanism to host immune responses and to treatment with antiviral compounds. Although rare, epidemiologically important hepatitis C virus (HCV) recombinants have been reported. In addition, recombination is an important regulatory mechanism of cytopathogenicity for the related pestiviruses. Here we describe recombination of HCV RNA in cell culture leading to production of infectious virus. Initially, hepatoma cells were co-transfected with a replicating JFH1ΔE1E2 genome (genotype 2a) lacking functional envelope genes and strain J6 (2a), which has functional envelope genes but does not replicate in culture. After an initial decrease in the number of HCV positive cells, infection spread after 13–36 days. Sequencing of recovered viruses revealed non-homologous recombinants with J6 sequence from the 5′ end to the NS2–NS3 region followed by JFH1 sequence from Core to the 3′ end. These recombinants carried duplicated sequence of up to 2400 nucleotides. HCV replication was not required for recombination, as recombinants were observed in most experiments even when two replication incompetent genomes were co-transfected. Reverse genetic studies verified the viability of representative recombinants. After serial passage, subsequent recombination events reducing or eliminating the duplicated region were observed for some but not all recombinants. Furthermore, we found that inter-genotypic recombination could occur, but at a lower frequency than intra-genotypic recombination. Productive recombination of attenuated HCV genomes depended on expression of all HCV proteins and tolerated duplicated sequence. In general, no strong site specificity was observed. Non-homologous recombination was observed in most cases, while few homologous events were identified. A better understanding of HCV recombination could help identification of natural recombinants and thereby lead to improved therapy. Our findings suggest mechanisms for occurrence of recombinants observed in patients. PMID:23555245

  6. Biological intuition in alignment-free methods: response to Posada.

    PubMed

    Ragan, Mark A; Chan, Cheong Xin

    2013-08-01

    A recent editorial in Journal of Molecular Evolution highlights opportunities and challenges facing molecular evolution in the era of next-generation sequencing. Abundant sequence data should allow more-complex models to be fit at higher confidence, making phylogenetic inference more reliable and improving our understanding of evolution at the molecular level. However, concern that approaches based on multiple sequence alignment may be computationally infeasible for large datasets is driving the development of so-called alignment-free methods for sequence comparison and phylogenetic inference. The recent editorial characterized these approaches as model-free, not based on the concept of homology, and lacking in biological intuition. We argue here that alignment-free methods have not abandoned models or homology, and can be biologically intuitive.

  7. [Interconnection between architecture of protein globule and disposition of conformational conservative oligopeptides in proteins from one protein family].

    PubMed

    Batianovskiĭ, A V; Filatov, I V; Namiot, V A; Esipova, N G; Volotovskiĭ, I D

    2012-01-01

    It was shown that selective interactions between helical segments of macromolecules can realize in globular proteins in the segments characterized by the same periodicities of charge distribution i.e. between conformationally conservative oligopeptides. It was found that in the macromolecules of alpha-helical proteins conformationally conservative oligopeptides are disposed at a distance being characteristic of direct interactions. For representatives of many structural families of alpha-type proteins specific disposition of conformationally conservative segments is observed. This disposition is inherent to a particular structural family. Disposition of conformationally conservative segments is not related to homology of the amino acid sequence but reflects peculiarities of native 3D-architectures of protein globules.

  8. The Complete Genome Sequence of Herpesvirus Papio 2 (Cercopithecine Herpesvirus 16) Shows Evidence of Recombination Events among Various Progenitor Herpesviruses†

    PubMed Central

    Tyler, Shaun D.; Severini, Alberto

    2006-01-01

    We have sequenced the entire genome of herpesvirus papio 2 (HVP-2; Cercopithecine herpesvirus 16) strain X313, a baboon herpesvirus with close homology to other primate alphaherpesviruses, such as SA8, monkey B virus, and herpes simplex virus (HSV) type 1 and type 2. The genome of HVP-2 is 156,487 bp in length, with an overall GC content of 76.5%. The genome organization is identical to that of the other members of the genus Simplexvirus, with a long and a short unique region, each bordered by inverted repeats which end with an “a” sequence. All of the open reading frames detected in this genome were homologous and colinear with those of SA8 and B virus. The HSV gene RL1 (γ134.5; neurovirulence factor) is not present in HVP-2, as is the case for SA8 and B virus. The HVP-2 genome is 85% homologous to its closest relative, SA8. However, segment-by-segment bootstrap analysis of the genome revealed at least two regions that display closer homology to the corresponding sequences of B virus. The first region comprises the UL41 to UL44 genes, and the second region is located within the UL36 gene. We hypothesize that this localized and defined shift in homology is due to recombination events between an SA8-like progenitor of HVP-2 and a herpesvirus species more closely related to the B virus. Since some of the genes involved in these putative recombination events are determinants of virulence, a comparative analysis of their function may provide insight into the pathogenic mechanism of simplexviruses. PMID:16414998

  9. The complete genome sequence of herpesvirus papio 2 (Cercopithecine herpesvirus 16) shows evidence of recombination events among various progenitor herpesviruses.

    PubMed

    Tyler, Shaun D; Severini, Alberto

    2006-02-01

    We have sequenced the entire genome of herpesvirus papio 2 (HVP-2; Cercopithecine herpesvirus 16) strain X313, a baboon herpesvirus with close homology to other primate alphaherpesviruses, such as SA8, monkey B virus, and herpes simplex virus (HSV) type 1 and type 2. The genome of HVP-2 is 156,487 bp in length, with an overall GC content of 76.5%. The genome organization is identical to that of the other members of the genus Simplexvirus, with a long and a short unique region, each bordered by inverted repeats which end with an "a" sequence. All of the open reading frames detected in this genome were homologous and colinear with those of SA8 and B virus. The HSV gene RL1 (gamma(1)34.5; neurovirulence factor) is not present in HVP-2, as is the case for SA8 and B virus. The HVP-2 genome is 85% homologous to its closest relative, SA8. However, segment-by-segment bootstrap analysis of the genome revealed at least two regions that display closer homology to the corresponding sequences of B virus. The first region comprises the UL41 to UL44 genes, and the second region is located within the UL36 gene. We hypothesize that this localized and defined shift in homology is due to recombination events between an SA8-like progenitor of HVP-2 and a herpesvirus species more closely related to the B virus. Since some of the genes involved in these putative recombination events are determinants of virulence, a comparative analysis of their function may provide insight into the pathogenic mechanism of simplexviruses.

  10. The molecular mechanism for interaction of ceruloplasmin and myeloperoxidase

    NASA Astrophysics Data System (ADS)

    Bakhautdin, Bakytzhan; Bakhautdin, Esen Göksöy

    2016-04-01

    Ceruloplasmin (Cp) is a copper-containing ferroxidase with potent antioxidant activity. Cp is expressed by hepatocytes and activated macrophages and has been known as physiologic inhibitor of myeloperoxidase (MPO). Enzymatic activity of MPO produces anti-microbial agents and strong prooxidants such as hypochlorous acid and has a potential to damage host tissue at the sites of inflammation and infection. Thus Cp-MPO interaction and inhibition of MPO has previously been suggested as an important control mechanism of excessive MPO activity. Our aim in this study was to identify minimal Cp domain or peptide that interacts with MPO. We first confirmed Cp-MPO interaction by ELISA and surface plasmon resonance (SPR). SPR analysis of the interaction yielded 30 nM affinity between Cp and MPO. We then designed and synthesized 87 overlapping peptides spanning the entire amino acid sequence of Cp. Each of the peptides was tested whether it binds to MPO by direct binding ELISA. Two of the 87 peptides, P18 and P76 strongly interacted with MPO. Amino acid sequence analysis of identified peptides revealed high sequence and structural homology between them. Further structural analysis of Cp's crystal structure by PyMOL software unfolded that both peptides represent surface-exposed sites of Cp and face nearly the same direction. To confirm our finding we raised anti-P18 antisera in rabbit and demonstrated that this antisera disrupts Cp-MPO binding and rescues MPO activity. Collectively, our results confirm Cp-MPO interaction and identify two nearly identical sites on Cp that specifically bind MPO. We propose that inhibition of MPO by Cp requires two nearly identical sites on Cp to bind homodimeric MPO simultaneously and at an angle of at least 120 degrees, which, in turn, exerts tension on MPO and results in conformational change.

  11. SINE sequences detect DNA fingerprints in salmonid fishes.

    PubMed

    Spruell, P; Thorgaard, G H

    1996-04-01

    DNA probes homologous to two previously described salmonid short interspersed nuclear elements (SINEs) detected DNA fingerprint patterns in 14 species of salmonid fishes. The probes showed more homology to some species than to others and little homology to three nonsalmonid fishes. The DNA fingerprint patterns derived from the SINE probes are individual-specific and inherited in a Mendelian manner. Probes derived from different regions of the same SINE detect only partially overlapping banding patterns, reflecting a more complex SINE structure than has been previously reported. Like the human Alu sequence, the SINEs found in salmonids could provide useful genetic markers and primer sites for PCR-based techniques. These elements may be more desirable for some applications than traditional DNA fingerprinting probes that detect tandemly repeated arrays.

  12. Gene-for-genes interactions between cotton R genes and Xanthomonas campestris pv. malvacearum avr genes.

    PubMed

    De Feyter, R; Yang, Y; Gabriel, D W

    1993-01-01

    Six plasmid-borne avirulence (avr) genes were previously cloned from strain XcmH of the cotton pathogen, Xanthomonas campestris pv. malvacearum. We have now localized all six avr genes on the cloned fragments by subcloning and Tn5-gusA insertional mutagenesis. None of these avr genes appeared to exhibit exclusively gene-for-gene patterns of interactions with cotton R genes, and avrB4 was demonstrated to confer avr gene-for-R genes (plural) avirulence to X. c. pv. malvacearum on congenic cotton lines carrying either of two different resistance loci, B1 or B4. Furthermore, the B1 locus appeared to confer R gene-for-avr genes resistance to cotton against isogenic X. c. pv. malvacearum strains carrying any one of three avr genes: avrB4, avrb6, or avrB102. Restriction enzyme, Southern blot hybridization, and DNA sequence analyses showed that the XcmH avr genes are all highly similar to each other, to avrBs3 and avrBsP from the pepper pathogen X. c. pv. vesicatoria, and to the host-specific virulence gene pthA from the citrus pathogen X. citri. The XcmH avr genes differed primarily in the multiplicity of a tandemly repeated 102-base pair motif within the central portions of the genes, repeated from 14 to 23 times in members of this gene family. The complete nucleotide sequence of avrb6 revealed that it is 97% identical in DNA sequence to avrB4, avrBs3, avrBsP, and pthA and that 62-bp inverted terminal repeats mark the boundaries of homology between avrb6 and all members of this Xanthomonas virulence/avirulence gene family sequenced to date. The terminal 38 bp of both inverted repeats are highly similar to the 38-bp consensus terminal sequence of the Tn3 family of transposons. Up to 11 members of the avr gene family appear to be present in North American strains of X. c. pv. malvacearum, including XcmH. The high level of homology observed among these avr genes and their presence in multiple copies may explain the gene-for-genes interactions and also the observed high frequencies (10(-3) to 10(-4) per locus) of X. c. pv. malvacearum race change mutations. Five spontaneous race change mutants of XcmH suffered avr locus deletions, strongly indicating intergenic recombination as the primary mechanism for generating new races in X. c. pv. malvacearum.

  13. Complete Genome Sequence of Pig-Tailed Macaque Rhadinovirus 2 and Its Evolutionary Relationship with Rhesus Macaque Rhadinovirus and Human Herpesvirus 8/Kaposi's Sarcoma-Associated Herpesvirus

    PubMed Central

    Bruce, A. Gregory; Thouless, Margaret E.; Haines, Anthony S.; Pallen, Mark J.; Grundhoff, Adam

    2015-01-01

    ABSTRACT Two rhadinovirus lineages have been identified in Old World primates. The rhadinovirus 1 (RV1) lineage consists of human herpesvirus 8, Kaposi's sarcoma-associated herpesvirus (KSHV), and closely related rhadinoviruses of chimpanzees, gorillas, macaques and other Old World primates. The RV2 rhadinovirus lineage is distinct and consists of closely related viruses from the same Old World primate species. Rhesus macaque rhadinovirus (RRV) is the RV2 prototype, and two RRV isolates, 26-95 and 17577, were sequenced. We determined that the pig-tailed macaque RV2 rhadinovirus, MneRV2, is highly associated with lymphomas in macaques with simian AIDS. To further study the role of rhadinoviruses in the development of lymphoma, we sequenced the complete genome of MneRV2 and identified 87 protein coding genes and 17 candidate microRNAs (miRNAs). A strong genome colinearity and sequence homology were observed between MneRV2 and RRV26-95, although the open reading frame (ORF) encoding the KSHV ORFK15 homolog was disrupted in RRV26-95. Comparison with MneRV2 revealed several genomic anomalies in RRV17577 that were not present in other rhadinovirus genomes, including an N-terminal duplication in ORF4 and a recombinative exchange of more distantly related homologs of the ORF22/ORF47 interacting glycoprotein genes. The comparison with MneRV2 has revealed novel genes and important conservation of protein coding domains and transcription initiation, termination, and splicing signals, which have added to our knowledge of RV2 rhadinovirus genetics. Further comparisons with KSHV and other RV1 rhadinoviruses will provide important avenues for dissecting the biology, evolution, and pathology of these closely related tumor-inducing viruses in humans and other Old World primates. IMPORTANCE This work provides the sequence characterization of MneRV2, the pig-tailed macaque homolog of rhesus rhadinovirus (RRV). MneRV2 and RRV belong to the rhadinovirus 2 (RV2) rhadinovirus lineage of Old World primates and are distinct but related to Kaposi's sarcoma-associated herpesvirus (KSHV), the etiologic agent of Kaposi's sarcoma. Pig-tailed macaques provide important models of human disease, and our previous studies have indicated that MneRV2 plays a causal role in AIDS-related lymphomas in macaques. Delineation of the MneRV2 sequence has allowed a detailed characterization of the genome structure, and evolutionary comparisons with RRV and KSHV have identified conserved promoters, splice junctions, and novel genes. This comparison provides insight into RV2 rhadinovirus biology and sets the groundwork for more intensive next-generation (Next-Gen) transcript and genetic analysis of this class of tumor-inducing herpesvirus. This study supports the use of MneRV2 in pig-tailed macaques as an important model for studying rhadinovirus biology, transmission and pathology. PMID:25609822

  14. Structures of Bacterial Biosynthetic Arginine Decarboxylases

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    F Forouhar; S Lew; J Seetharaman

    2011-12-31

    Biosynthetic arginine decarboxylase (ADC; also known as SpeA) plays an important role in the biosynthesis of polyamines from arginine in bacteria and plants. SpeA is a pyridoxal-5'-phosphate (PLP)-dependent enzyme and shares weak sequence homology with several other PLP-dependent decarboxylases. Here, the crystal structure of PLP-bound SpeA from Campylobacter jejuni is reported at 3.0 {angstrom} resolution and that of Escherichia coli SpeA in complex with a sulfate ion is reported at 3.1 {angstrom} resolution. The structure of the SpeA monomer contains two large domains, an N-terminal TIM-barrel domain followed by a {beta}-sandwich domain, as well as two smaller helical domains. Themore » TIM-barrel and {beta}-sandwich domains share structural homology with several other PLP-dependent decarboxylases, even though the sequence conservation among these enzymes is less than 25%. A similar tetramer is observed for both C. jejuni and E. coli SpeA, composed of two dimers of tightly associated monomers. The active site of SpeA is located at the interface of this dimer and is formed by residues from the TIM-barrel domain of one monomer and a highly conserved loop in the {beta}-sandwich domain of the other monomer. The PLP cofactor is recognized by hydrogen-bonding, {pi}-stacking and van der Waals interactions.« less

  15. Direct visualization reveals kinetics of meiotic chromosome synapsis

    DOE PAGES

    Rog, Ofer; Dernburg, Abby  F.

    2015-03-17

    The synaptonemal complex (SC) is a conserved protein complex that stabilizes interactions along homologous chromosomes (homologs) during meiosis. The SC regulates genetic exchanges between homologs, thereby enabling reductional division and the production of haploid gametes. Here, we directly observe SC assembly (synapsis) by optimizing methods for long-term fluorescence recording in C. elegans. We report that synapsis initiates independently on each chromosome pair at or near pairing centers—specialized regions required for homolog associations. Once initiated, the SC extends rapidly and mostly irreversibly to chromosome ends. Quantitation of SC initiation frequencies and extension rates reveals that initiation is a rate-limiting step inmore » homolog interactions. Eliminating the dynein-driven chromosome movements that accompany synapsis severely retards SC extension, revealing a new role for these conserved motions. This work provides the first opportunity to directly observe and quantify key aspects of meiotic chromosome interactions and will enable future in vivo analysis of germline processes.« less

  16. Estrogen Receptor Folding Modulates cSrc Kinase SH2 Interaction via a Helical Binding Mode.

    PubMed

    Nieto, Lidia; Tharun, Inga M; Balk, Mark; Wienk, Hans; Boelens, Rolf; Ottmann, Christian; Milroy, Lech-Gustav; Brunsveld, Luc

    2015-11-20

    The estrogen receptors (ERs) feature, next to their transcriptional role, important nongenomic signaling actions, with emerging clinical relevance. The Src Homology 2 (SH2) domain mediated interaction between cSrc kinase and ER plays a key role in this; however the molecular determinants of this interaction have not been elucidated. Here, we used phosphorylated ER peptide and semisynthetic protein constructs in a combined biochemical and structural study to, for the first time, provide a quantitative and structural characterization of the cSrc SH2-ER interaction. Fluorescence polarization experiments delineated the SH2 binding motif in the ER sequence. Chemical shift perturbation analysis by nuclear magnetic resonance (NMR) together with molecular dynamics (MD) simulations allowed us to put forward a 3D model of the ER-SH2 interaction. The structural basis of this protein-protein interaction has been compared with that of the high affinity SH2 binding sequence GpYEEI. The ER features a different binding mode from that of the "two-pronged plug two-hole socket" model in the so-called specificity determining region. This alternative binding mode is modulated via the folding of ER helix 12, a structural element directly C-terminal of the key phosphorylated tyrosine. The present findings provide novel molecular entries for understanding nongenomic ER signaling and targeting the corresponding disease states.

  17. Mapping neurofibromatosis 1 homologous loci by fluorescence in situ hybridization

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Viskochil, D.; Breidenbach, H.H.; Cawthon, R.

    Neurofibromatosis 1 maps to chromosome band 17q11.2 and the NF1 gene is comprised of 59 exons that span approximately 335 kb of genomic DNA. In order to further analyze the structure of NF1 from exons 2 through 27b, we isolated a number of cosmid and bacteriophage P-1 genomic clones using NF1-exon probes under high-stringency hybridization conditions. Using tagged, intron-based primers and DNA from various clones as a template, we PCR-amplified and sequenced individual NF1 exons. The exon sequences in PCR products from several genomic clones differed from the exon sequence derived from cloned NF1 cDNAs. Clones with variant sequences weremore » mapped by fluorescence in situ hybridization under high-stringency conditions. Three clones mapped to chromosome band 15q11.2, one mapped to 14q11.2, one mapped to both 2q14.1-14.3 and 14q11.2, one mapped to 2q33-34, and one mapped to both 18q11.2 and 21q21. Even though some PCR-product sequences retained proper splice junctions and open reading frames, we have yet to identify cDNAs that correspond to the variant exon sequences. We are now sequencing clones that map to NF1-homologous loci in order to develop discriminating primer pairs for the exclusive amplification of NF1-specific sequences in our efforts to develop a comprehensive NF1 mutation screen using genomic DNA as template. The role of NF1-homologous sequences may play in neurofibromatosis 1 is not clear.« less

  18. Chlamydia trachomatis protein CT009 is a structural and functional homolog to the key morphogenesis component RodZ and interacts with division septal plane localized MreB

    DOE PAGES

    Kemege, Kyle E.; Hickey, John M.; Barta, Michael L.; ...

    2014-11-10

    Cell division in Chlamydiae is poorly understood as apparent homologs to most conserved bacterial cell division proteins are lacking and presence of elongation (rod shape) associated proteins indicate non-canonical mechanisms may be employed. The rod-shape determining protein MreB has been proposed as playing a unique role in chlamydial cell division. In other organisms, MreB is part of an elongation complex that requires RodZ for proper function. A recent study reported that the protein encoded by ORF CT009 interacts with MreB despite low sequence similarity to RodZ. The studies in this paper expand on those observations through protein structure, mutagenesis andmore » cellular localization analyses. Structural analysis indicated that CT009 shares high level of structural similarity to RodZ, revealing the conserved orientation of two residues critical for MreB interaction. Substitutions eliminated MreB protein interaction and partial complementation provided by CT009 in RodZ deficient Escherichia coli. Cellular localization analysis of CT009 showed uniform membrane staining in Chlamydia. This was in contrast to the localization of MreB, which was restricted to predicted septal planes. Finally, MreB localization to septal planes provides direct experimental observation for the role of MreB in cell division and supports the hypothesis that it serves as a functional replacement for FtsZ in Chlamydia.« less

  19. Chlamydia trachomatis protein CT009 is a structural and functional homolog to the key morphogenesis component RodZ and interacts with division septal plane localized MreB

    PubMed Central

    Kemege, Kyle E.; Hickey, John M.; Barta, Michael L.; Wickstrum, Jason; Balwalli, Namita; Lovell, Scott; Battaile, Kevin P.; Hefty, P. Scott

    2015-01-01

    Summary Cell division in Chlamydiae is poorly understood as apparent homologs to most conserved bacterial cell division proteins are lacking and presence of elongation (rod shape) associated proteins indicate non-canonical mechanisms may be employed. The rod-shape determining protein MreB has been proposed as playing a unique role in chlamydial cell division. In other organisms, MreB is part of an elongation complex that requires RodZ for proper function. A recent study reported that the protein encoded by ORF CT009 interacts with MreB despite low sequence similarity to RodZ. The studies herein expand on those observations through protein structure, mutagenesis, and cellular localization analyses. Structural analysis indicated that CT009 shares high level of structural similarity to RodZ, revealing the conserved orientation of two residues critical for MreB interaction. Substitutions eliminated MreB protein interaction and partial complementation provided by CT009 in RodZ deficient E. coli. Cellular localization analysis of CT009 showed uniform membrane staining in Chlamydia. This was in contrast to the localization of MreB, which was restricted to predicted septal planes. MreB localization to septal planes provides direct experimental observation for the role of MreB in cell division and supports the hypothesis that it serves as a functional replacement for FtsZ in Chlamydia. PMID:25382739

  20. Chlamydia trachomatis protein CT009 is a structural and functional homolog to the key morphogenesis component RodZ and interacts with division septal plane localized MreB.

    PubMed

    Kemege, Kyle E; Hickey, John M; Barta, Michael L; Wickstrum, Jason; Balwalli, Namita; Lovell, Scott; Battaile, Kevin P; Hefty, P Scott

    2015-02-01

    Cell division in Chlamydiae is poorly understood as apparent homologs to most conserved bacterial cell division proteins are lacking and presence of elongation (rod shape) associated proteins indicate non-canonical mechanisms may be employed. The rod-shape determining protein MreB has been proposed as playing a unique role in chlamydial cell division. In other organisms, MreB is part of an elongation complex that requires RodZ for proper function. A recent study reported that the protein encoded by ORF CT009 interacts with MreB despite low sequence similarity to RodZ. The studies herein expand on those observations through protein structure, mutagenesis and cellular localization analyses. Structural analysis indicated that CT009 shares high level of structural similarity to RodZ, revealing the conserved orientation of two residues critical for MreB interaction. Substitutions eliminated MreB protein interaction and partial complementation provided by CT009 in RodZ deficient Escherichia coli. Cellular localization analysis of CT009 showed uniform membrane staining in Chlamydia. This was in contrast to the localization of MreB, which was restricted to predicted septal planes. MreB localization to septal planes provides direct experimental observation for the role of MreB in cell division and supports the hypothesis that it serves as a functional replacement for FtsZ in Chlamydia. © 2014 John Wiley & Sons Ltd.

  1. Molecular characterization of DnaJ 5 homologs in silkworm Bombyx mori and its expression during egg diapause.

    PubMed

    Sirigineedi, Sasibhushan; Vijayagowri, Esvaran; Murthy, Geetha N; Rao, Guruprasada; Ponnuvel, Kangayam M

    2014-12-01

    A comparison of the cDNA sequences (1 056 bp) of Bombyx mori DnaJ 5 homolog with B. mori genome revealed that unlike in other Hsps, it has an intron of 234 bp. The DnaJ 5 homolog contains 351 amino acids, of which 70 contain the conserved DnaJ domain at the N-terminal end. This homolog of B. mori has all desirable functional domains similar to other insects, and the 13 different DnaJ homologs identified in B. mori genome were distributed on different chromosomes. The expressed sequence tag database analysis of Hsp40 gene expression revealed higher expression in wing disc followed by diapause-induced eggs. Microarray analysis revealed higher expression of DnaJ 5 homolog at 18th h after oviposition in diapause-induced eggs. Further validation of DnaJ 5 expression through qPCR in diapause-induced and nondiapause eggs at different time intervals revealed higher expression in diapause eggs at 18 and 24 h after oviposition, which coincided with the expression of Hsp70 as the Hsp 40 is its co-chaperone. This study thus provides an outline of the genome organization of Hsp40 gene, and its role in egg diapause induction in B. mori. © 2013 Institute of Zoology, Chinese Academy of Sciences.

  2. Mutation of Hip’s Carboxy-Terminal Region Inhibits a Transitional Stage of Progesterone Receptor Assembly

    PubMed Central

    Prapapanich, Viravan; Chen, Shiying; Smith, David F.

    1998-01-01

    Steroid receptor complexes are assembled through an ordered, multistep pathway involving multiple components of the cytoplasmic chaperone machinery. Two of these components are Hsp70-binding proteins, Hip and Hop, that have some limited homology in their C-terminal regions, outside the sequences mapped for Hsp70 binding. Within this region of Hip is a DPEV sequence that occurs twice; in Hop, one DPEV sequence plus a partial second sequence occurs. In an effort to better understand Hip function as it relates to assembly of progesterone receptor complexes, the DPEV region of Hip was targeted for mutations. Each DPEV sequence was mutated to an APAV sequence, singly or in combination. The combined mutation, APAV2, was further combined with a deletion of Hip’s tetratricopeptide repeat region that is required for Hsp70 binding or with a deletion of Hip’s GGMP repeat. An additional mutant was prepared by truncation of Hip’s DPEV-containing C terminus. By comparing interactions of various Hip forms with Hsp70, it was determined that mutation of the DPEV sequences created a dominant inhibitory form of Hip. The mutant Hip-Hsp70 complex was not prevented from interacting with progesterone receptor, but the mutant caused a dose-dependent inhibition of receptor assembly with Hsp90. The behavior of the Hip mutant is consistent with a model in which Hip and Hop are required to facilitate the transition from an early receptor complex with Hsp70 into later complexes containing Hsp90. PMID:9447991

  3. In-Field Spatial Variability in the Degradation of the Phenyl-Urea Herbicide Isoproturon Is the Result of Interactions between Degradative Sphingomonas spp. and Soil pH

    PubMed Central

    Bending, Gary D.; Lincoln, Suzanne D.; Sørensen, Sebastian R.; Morgan, J. Alun W.; Aamand, Jens; Walker, Allan

    2003-01-01

    Substantial spatial variability in the degradation rate of the phenyl-urea herbicide isoproturon (IPU) [3-(4-isopropylphenyl)-1,1-dimethylurea] has been shown to occur within agricultural fields, with implications for the longevity of the compound in the soil, and its movement to ground- and surface water. The microbial mechanisms underlying such spatial variability in degradation rate were investigated at Deep Slade field in Warwickshire, United Kingdom. Most-probable-number analysis showed that rapid degradation of IPU was associated with proliferation of IPU-degrading organisms. Slow degradation of IPU was linked to either a delay in the proliferation of IPU-degrading organisms or apparent cometabolic degradation. Using enrichment techniques, an IPU-degrading bacterial culture (designated strain F35) was isolated from fast-degrading soil, and partial 16S rRNA sequencing placed it within the Sphingomonas group. Denaturing gradient gel electrophoresis (DGGE) of PCR-amplified bacterial community 16S rRNA revealed two bands that increased in intensity in soil during growth-linked metabolism of IPU, and sequencing of the excised bands showed high sequence homology to the Sphingomonas group. However, while F35 was not closely related to either DGGE band, one of the DGGE bands showed 100% partial 16S rRNA sequence homology to an IPU-degrading Sphingomonas sp. (strain SRS2) isolated from Deep Slade field in an earlier study. Experiments with strains SRS2 and F35 in soil and liquid culture showed that the isolates had a narrow pH optimum (7 to 7.5) for metabolism of IPU. The pH requirements of IPU-degrading strains of Sphingomonas spp. could largely account for the spatial variation of IPU degradation rates across the field. PMID:12571001

  4. Mutational landscape of gastric adenocarcinoma in Chinese: implications for prognosis and therapy.

    PubMed

    Chen, Kexin; Yang, Da; Li, Xiangchun; Sun, Baocun; Song, Fengju; Cao, Wenfeng; Brat, Daniel J; Gao, Zhibo; Li, Haixin; Liang, Han; Zhao, Yanrui; Zheng, Hong; Li, Miao; Buckner, Jan; Patterson, Scott D; Ye, Xiang; Reinhard, Christoph; Bhathena, Anahita; Joshi, Deepa; Mischel, Paul S; Croce, Carlo M; Wang, Yi Michael; Raghavakaimal, Sreekumar; Li, Hui; Lu, Xin; Pan, Yang; Chang, Han; Ba, Sujuan; Luo, Longhai; Cavenee, Webster K; Zhang, Wei; Hao, Xishan

    2015-01-27

    Gastric cancer (GC) is a highly heterogeneous disease. To identify potential clinically actionable therapeutic targets that may inform individualized treatment strategies, we performed whole-exome sequencing on 78 GCs of differing histologies and anatomic locations, as well as whole-genome sequencing on two GC cases, each with three primary tumors and two matching lymph node metastases. The data showed two distinct GC subtypes with either high-clonality (HiC) or low-clonality (LoC). The HiC subtype of intratumoral heterogeneity was associated with older age, TP53 (tumor protein P53) mutation, enriched C > G transition, and significantly shorter survival, whereas the LoC subtype was associated with younger age, ARID1A (AT rich interactive domain 1A) mutation, and significantly longer survival. Phylogenetic tree analysis of whole-genome sequencing data from multiple samples of two patients supported the clonal evolution of GC metastasis and revealed the accumulation of genetic defects that necessitate combination therapeutics. The most recurrently mutated genes, which were validated in a separate cohort of 216 cases by targeted sequencing, were members of the homologous recombination DNA repair, Wnt, and PI3K-ERBB pathways. Notably, the drugable NRG1 (neuregulin-1) and ERBB4 (V-Erb-B2 avian erythroblastic leukemia viral oncogene homolog 4) ligand-receptor pair were mutated in 10% of GC cases. Mutations of the BRCA2 (breast cancer 2, early onset) gene, found in 8% of our cohort and validated in The Cancer Genome Atlas GC cohort, were associated with significantly longer survivals. These data define distinct clinicogenetic forms of GC in the Chinese population that are characterized by specific mutation sets that can be investigated for efficacy of single and combination therapies.

  5. Structural diversity of domain superfamilies in the CATH database.

    PubMed

    Reeves, Gabrielle A; Dallman, Timothy J; Redfern, Oliver C; Akpor, Adrian; Orengo, Christine A

    2006-07-14

    The CATH database of domain structures has been used to explore the structural variation of homologous domains in 294 well populated domain structure superfamilies, each containing at least three sequence diverse relatives. Our analyses confirm some previously detected trends relating sequence divergence to structural variation but for a much larger dataset and in some superfamilies the new data reveal exceptional structural variation. Use of a new algorithm (2DSEC) to analyse variability in secondary structure compositions across a superfamily sheds new light on how structures evolve. 2DSEC detects inserted secondary structures that embellish the core of conserved secondary structures found throughout the superfamily. Analysis showed that for 56% of highly populated superfamilies (>9 sequence diverse relatives), there are twofold or more increases in the numbers of secondary structures in some relatives. In some families fivefold increases occur, sometimes modifying the fold of the domain. Manual inspection of secondary structure insertions or embellishments in 48 particularly variable superfamilies revealed that although these insertions were usually discontiguous in the sequence they were often co-located in 3D resulting in a larger structural motif that often modified the geometry of the active site or the surface conformation promoting diverse domain partnerships and protein interactions. These observations, supported by automatic analysis of all well populated CATH families, suggest that accretion of small secondary structure insertions may provide a simple mechanism for evolving new functions in diverse relatives. Some layered domain architectures (e.g. mainly-beta and alpha-beta sandwiches) that recur highly in the genomes more frequently exploit these types of embellishments to modify function. In these architectures, aggregation occurs most often at the edges, top or bottom of the beta-sheets. Information on structural variability across domain superfamilies has been made available through the CATH Dictionary of Homologous Structures (DHS).

  6. Transcription activation mediated by a cyclic AMP receptor protein from Thermus thermophilus HB8.

    PubMed

    Shinkai, Akeo; Kira, Satoshi; Nakagawa, Noriko; Kashihara, Aiko; Kuramitsu, Seiki; Yokoyama, Shigeyuki

    2007-05-01

    The extremely thermophilic bacterium Thermus thermophilus HB8, which belongs to the phylum Deinococcus-Thermus, has an open reading frame encoding a protein belonging to the cyclic AMP (cAMP) receptor protein (CRP) family present in many bacteria. The protein named T. thermophilus CRP is highly homologous to the CRP family proteins from the phyla Firmicutes, Actinobacteria, and Cyanobacteria, and it forms a homodimer and interacts with cAMP. CRP mRNA and intracellular cAMP were detected in this strain, which did not drastically fluctuate during cultivation in a rich medium. The expression of several genes was altered upon disruption of the T. thermophilus CRP gene. We found six CRP-cAMP-dependent promoters in in vitro transcription assays involving DNA fragments containing the upstream regions of the genes exhibiting decreased expression in the CRP disruptant, indicating that the CRP is a transcriptional activator. The consensus T. thermophilus CRP-binding site predicted upon nucleotide sequence alignment is 5'-(C/T)NNG(G/T)(G/T)C(A/C)N(A/T)NNTCACAN(G/C)(G/C)-3'. This sequence is unique compared with the known consensus binding sequences of CRP family proteins. A putative -10 hexamer sequence resides at 18 to 19 bp downstream of the predicted T. thermophilus CRP-binding site. The CRP-regulated genes found in this study comprise clustered regularly interspaced short palindromic repeat (CRISPR)-associated (cas) ones, and the genes of a putative transcriptional regulator, a protein containing the exonuclease III-like domain of DNA polymerase, a GCN5-related acetyltransferase homolog, and T. thermophilus-specific proteins of unknown function. These results suggest a role for cAMP signal transduction in T. thermophilus and imply the T. thermophilus CRP is a cAMP-responsive regulator.

  7. Evolutionary distance from human homologs reflects allergenicity of animal food proteins.

    PubMed

    Jenkins, John A; Breiteneder, Heimo; Mills, E N Clare

    2007-12-01

    In silico analysis of allergens can identify putative relationships among protein sequence, structure, and allergenic properties. Such systematic analysis reveals that most plant food allergens belong to a restricted number of protein superfamilies, with pollen allergens behaving similarly. We have investigated the structural relationships of animal food allergens and their evolutionary relatedness to human homologs to define how closely a protein must resemble a human counterpart to lose its allergenic potential. Profile-based sequence homology methods were used to classify animal food allergens into Pfam families, and in silico analyses of their evolutionary and structural relationships were performed. Animal food allergens could be classified into 3 main families--tropomyosins, EF-hand proteins, and caseins--along with 14 minor families each composed of 1 to 3 allergens. The evolutionary relationships of each of these allergen superfamilies showed that in general, proteins with a sequence identity to a human homolog above approximately 62% were rarely allergenic. Single substitutions in otherwise highly conserved regions containing IgE epitopes in EF-hand parvalbumins may modulate allergenicity. These data support the premise that certain protein structures are more allergenic than others. Contrasting with plant food allergens, animal allergens, such as the highly conserved tropomyosins, challenge the capability of the human immune system to discriminate between foreign and self-proteins. Such immune responses run close to becoming autoimmune responses. Exploiting the closeness between animal allergens and their human homologs in the development of recombinant allergens for immunotherapy will need to consider the potential for developing unanticipated autoimmune responses.

  8. Cloning and characterization of the ddc homolog encoding L-2,4-diaminobutyrate decarboxylase in Enterobacter aerogenes.

    PubMed

    Yamamoto, S; Mutoh, N; Tsuzuki, D; Ikai, H; Nakao, H; Shinoda, S; Narimatsu, S; Miyoshi, S I

    2000-05-01

    L-2,4-diaminobutyrate decarboxylase (DABA DC) catalyzes the formation of 1,3-diaminopropane (DAP) from DABA. In the present study, the ddc gene encoding DABA DC from Enterobacter aerogenes ATCC 13048 was cloned and characterized. Determination of the nucleotide sequence revealed an open reading frame of 1470 bp encoding a 53659-Da protein of 490 amino acids, whose deduced NH2-terminal sequence was identical to that of purified DABA DC from E. aerogenes. The deduced amino acid sequence was highly similar to those of Acinetobacter baumannii and Haemophilus influenzae DABA DCs encoded by the ddc genes. The lysine-307 of the E. aerogenes DABA DC was identified as the pyridoxal 5'-phosphate binding residue by site-directed mutagenesis. Furthermore, PCR analysis revealed the distribution of E. aerogenes ddc homologs in some other species of Enterobacteriaceae. Such a relatively wide occurrence of the ddc homologs implies biological significance of DABA DC and its product DAP.

  9. GPU-Acceleration of Sequence Homology Searches with Database Subsequence Clustering

    PubMed Central

    Suzuki, Shuji; Kakuta, Masanori; Ishida, Takashi; Akiyama, Yutaka

    2016-01-01

    Sequence homology searches are used in various fields and require large amounts of computation time, especially for metagenomic analysis, owing to the large number of queries and the database size. To accelerate computing analyses, graphics processing units (GPUs) are widely used as a low-cost, high-performance computing platform. Therefore, we mapped the time-consuming steps involved in GHOSTZ, which is a state-of-the-art homology search algorithm for protein sequences, onto a GPU and implemented it as GHOSTZ-GPU. In addition, we optimized memory access for GPU calculations and for communication between the CPU and GPU. As per results of the evaluation test involving metagenomic data, GHOSTZ-GPU with 12 CPU threads and 1 GPU was approximately 3.0- to 4.1-fold faster than GHOSTZ with 12 CPU threads. Moreover, GHOSTZ-GPU with 12 CPU threads and 3 GPUs was approximately 5.8- to 7.7-fold faster than GHOSTZ with 12 CPU threads. PMID:27482905

  10. Saccharomyces cerevisiae SSB1 protein and its relationship to nucleolar RNA-binding proteins.

    PubMed

    Jong, A Y; Clark, M W; Gilbert, M; Oehm, A; Campbell, J L

    1987-08-01

    To better define the function of Saccharomyces cerevisiae SSB1, an abundant single-stranded nucleic acid-binding protein, we determined the nucleotide sequence of the SSB1 gene and compared it with those of other proteins of known function. The amino acid sequence contains 293 amino acid residues and has an Mr of 32,853. There are several stretches of sequence characteristic of other eucaryotic single-stranded nucleic acid-binding proteins. At the amino terminus, residues 39 to 54 are highly homologous to a peptide in calf thymus UP1 and UP2 and a human heterogeneous nuclear ribonucleoprotein. Residues 125 to 162 constitute a fivefold tandem repeat of the sequence RGGFRG, the composition of which suggests a nucleic acid-binding site. Near the C terminus, residues 233 to 245 are homologous to several RNA-binding proteins. Of 18 C-terminal residues, 10 are acidic, a characteristic of the procaryotic single-stranded DNA-binding proteins and eucaryotic DNA- and RNA-binding proteins. In addition, examination of the subcellular distribution of SSB1 by immunofluorescence microscopy indicated that SSB1 is a nuclear protein, predominantly located in the nucleolus. Sequence homologies and the nucleolar localization make it likely that SSB1 functions in RNA metabolism in vivo, although an additional role in DNA metabolism cannot be excluded.

  11. Microsporidia, amitochondrial protists, possess a 70-kDa heat shock protein gene of mitochondrial evolutionary origin.

    PubMed

    Peyretaillade, E; Broussolle, V; Peyret, P; Méténier, G; Gouy, M; Vivarès, C P

    1998-06-01

    An intronless gene encoding a protein of 592 amino acid residues with similarity to 70-kDa heat shock proteins (HSP70s) has been cloned and sequenced from the amitochondrial protist Encephalitozoon cuniculi (phylum Microsporidia). Southern blot analyses show the presence of a single gene copy located on chromosome XI. The encoded protein exhibits an N-terminal hydrophobic leader sequence and two motifs shared by proteobacterial and mitochondrially expressed HSP70 homologs. Phylogenetic analysis using maximum likelihood and evolutionary distances place the E. cuniculi sequence in the cluster of mitochondrially expressed HSP70s, with a higher evolutionary rate than those of homologous sequences. Similar results were obtained after cloning a fragment of the homologous gene in the closely related species E. hellem. The presence of a nuclear targeting signal-like sequence supports a role of the Encephalitozoon HSP70 as a molecular chaperone of nuclear proteins. No evidence for cytosolic or endoplasmic reticulum forms of HSP70 was obtained through PCR amplification. These data suggest that Encephalitozoon species have evolved from an ancestor bearing mitochondria, which is in disagreement with the postulated presymbiotic origin of Microsporidia. The specific role and intracellular localization of the mitochondrial HSP70-like protein remain to be elucidated.

  12. Comparative sequence analysis of a region on human chromosome 13q14, frequently deleted in B-cell chronic lymphocytic leukemia, and its homologous region on mouse chromosome 14.

    PubMed

    Kapanadze, B; Makeeva, N; Corcoran, M; Jareborg, N; Hammarsund, M; Baranova, A; Zabarovsky, E; Vorontsova, O; Merup, M; Gahrton, G; Jansson, M; Yankovsky, N; Einhorn, S; Oscier, D; Grandér, D; Sangfelt, O

    2000-12-15

    Previous studies have indicated the presence of a putative tumor suppressor gene on human chromosome 13q14, commonly deleted in patients with B-cell chronic lymphocytic leukemia (B-CLL). We have recently identified a minimally deleted region encompassing parts of two adjacent genes, termed LEU1 and LEU2 (leukemia-associated genes 1 and 2), and several additional transcripts. In addition, 50 kb centromeric to this region we have identified another gene, LEU5/RFP2. To elucidate further the complex genomic organization of this region, we have identified, mapped, and sequenced the homologous region in the mouse. Fluorescence in situ hybridization analysis demonstrated that the region maps to mouse chromosome 14. The overall organization and gene order in this region were found to be highly conserved in the mouse. Sequence comparison between the human deletion hotspot region and its homologous mouse region revealed a high degree of sequence conservation with an overall score of 74%. However, our data also show that in terms of transcribed sequences, only two of those, human LEU2 and LEU5/RFP2, are clearly conserved, strengthening the case for these genes as putative candidate B-CLL tumor suppressor genes.

  13. Using relational databases for improved sequence similarity searching and large-scale genomic analyses.

    PubMed

    Mackey, Aaron J; Pearson, William R

    2004-10-01

    Relational databases are designed to integrate diverse types of information and manage large sets of search results, greatly simplifying genome-scale analyses. Relational databases are essential for management and analysis of large-scale sequence analyses, and can also be used to improve the statistical significance of similarity searches by focusing on subsets of sequence libraries most likely to contain homologs. This unit describes using relational databases to improve the efficiency of sequence similarity searching and to demonstrate various large-scale genomic analyses of homology-related data. This unit describes the installation and use of a simple protein sequence database, seqdb_demo, which is used as a basis for the other protocols. These include basic use of the database to generate a novel sequence library subset, how to extend and use seqdb_demo for the storage of sequence similarity search results and making use of various kinds of stored search results to address aspects of comparative genomic analysis.

  14. Top-Down-Assisted Bottom-Up Method for Homologous Protein Sequencing: Hemoglobin from 33 Bird Species

    NASA Astrophysics Data System (ADS)

    Song, Yang; Laskay, Ünige A.; Vilcins, Inger-Marie E.; Barbour, Alan G.; Wysocki, Vicki H.

    2015-11-01

    Ticks are vectors for disease transmission because they are indiscriminant in their feeding on multiple vertebrate hosts, transmitting pathogens between their hosts. Identifying the hosts on which ticks have fed is important for disease prevention and intervention. We have previously shown that hemoglobin (Hb) remnants from a host on which a tick fed can be used to reveal the host's identity. For the present research, blood was collected from 33 bird species that are common in the U.S. as hosts for ticks but that have unknown Hb sequences. A top-down-assisted bottom-up mass spectrometry approach with a customized searching database, based on variability in known bird hemoglobin sequences, has been devised to facilitate fast and complete sequencing of hemoglobin from birds with unknown sequences. These hemoglobin sequences will be added to a hemoglobin database and used for tick host identification. The general approach has the potential to sequence any set of homologous proteins completely in a rapid manner.

  15. The HMMER Web Server for Protein Sequence Similarity Search.

    PubMed

    Prakash, Ananth; Jeffryes, Matt; Bateman, Alex; Finn, Robert D

    2017-12-08

    Protein sequence similarity search is one of the most commonly used bioinformatics methods for identifying evolutionarily related proteins. In general, sequences that are evolutionarily related share some degree of similarity, and sequence-search algorithms use this principle to identify homologs. The requirement for a fast and sensitive sequence search method led to the development of the HMMER software, which in the latest version (v3.1) uses a combination of sophisticated acceleration heuristics and mathematical and computational optimizations to enable the use of profile hidden Markov models (HMMs) for sequence analysis. The HMMER Web server provides a common platform by linking the HMMER algorithms to databases, thereby enabling the search for homologs, as well as providing sequence and functional annotation by linking external databases. This unit describes three basic protocols and two alternate protocols that explain how to use the HMMER Web server using various input formats and user defined parameters. © 2017 by John Wiley & Sons, Inc. Copyright © 2017 John Wiley & Sons, Inc.

  16. Molecular characterization of a novel Luteovirus from peach identified by high-throughput sequencing

    USDA-ARS?s Scientific Manuscript database

    Contigs with sequence homologies to Cherry-associated luteovirus were identified by high-throughput sequencing analysis of two peach accessions undergoing quarantine testing. The complete genomic sequences of the two isolates of this virus are 5,819 and 5,814 nucleotides. Their genome organization i...

  17. Differential protein expression in alligator leukocytes in response to bacterial lipopolysaccharide injection.

    PubMed

    Merchant, Mark; Kinney, Clint; Sanders, Paige

    2009-12-01

    Blood was collected from three juvenile alligators (Alligator mississippiensis) before, and again 24h after, injection with bacterial lipopolysaccharide (LPS). The leukocytes were collected from both samples, and the proteins were extracted. Each group of proteins was labeled with a different fluorescent dye and the differences in protein expression were analyzed by two dimensional differential in-gel expressions (2D-DIGE). The proteins which appeared to be increased or decreased by treatment with LPS were selected and analyzed by MALDI-TOF to determine mass and LC-MS/MS to acquire the partial protein sequences. The peptide sequences were compared to the NCBI protein sequence database to determine homology with other sequences from other species. Several proteins of interest appeared to be increased upon LPS stimulation. Proteins with homology to human transgelin-2, fish glucose-6-phosphate dehydrogenase, amphibian α-enolase, alligator lactate dehydrogenase, fish ubiquitin-activating enzyme, and fungal β-tubulin were also increased after LPS injection. Proteins with homology to fish vimentin 4, murine heterogeneous nuclear ribonucleoprotein A3, and avian calreticulin were found to be decreased in response to LPS. In addition, five proteins, four of which were up-regulated (827, 560, 512, and 650%) and one that exhibited repressed expression (307%), did not show homology to any protein in the database, and thus may represent newly discovered proteins. We are using this biochemical approach to isolate and characterize alligator proteins with potential relevant immune function.

  18. Molecular identification of aiiA homologous gene from endophytic Enterobacter species and in silico analysis of putative tertiary structure of AHL-lactonase.

    PubMed

    Rajesh, P S; Rai, V Ravishankar

    2014-01-03

    The aiiA homologous gene known to encode AHL- lactonase enzyme which hydrolyze the N-acylhomoserine lactone (AHL) quorum sensing signaling molecules produced by Gram negative bacteria. In this study, the degradation of AHL molecules was determined by cell-free lysate of endophytic Enterobacter species. The percentage of quorum quenching was confirmed and quantified by HPLC method (p<0.0001). Amplification and sequence BLAST analysis showed the presence of aiiA homologous gene in endophytic Enterobacter asburiae VT65, Enterobacter aerogenes VT66 and Enterobacter ludwigii VT70 strains. Sequence alignment analysis revealed the presence of two zinc binding sites, "HXHXDH" motif as well as tyrosine residue at the position 194. Based on known template available at Swiss-Model, putative tertiary structure of AHL-lactonase was constructed. The result showed that novel endophytic strains of Enterobacter genera encode the novel aiiA homologous gene and its structural importance for future study. Copyright © 2013 Elsevier Inc. All rights reserved.

  19. Using the underlying biological organization of the Mycobacterium tuberculosis functional network for protein function prediction.

    PubMed

    Mazandu, Gaston K; Mulder, Nicola J

    2012-07-01

    Despite ever-increasing amounts of sequence and functional genomics data, there is still a deficiency of functional annotation for many newly sequenced proteins. For Mycobacterium tuberculosis (MTB), more than half of its genome is still uncharacterized, which hampers the search for new drug targets within the bacterial pathogen and limits our understanding of its pathogenicity. As for many other genomes, the annotations of proteins in the MTB proteome were generally inferred from sequence homology, which is effective but its applicability has limitations. We have carried out large-scale biological data integration to produce an MTB protein functional interaction network. Protein functional relationships were extracted from the Search Tool for the Retrieval of Interacting Genes/Proteins (STRING) database, and additional functional interactions from microarray, sequence and protein signature data. The confidence level of protein relationships in the additional functional interaction data was evaluated using a dynamic data-driven scoring system. This functional network has been used to predict functions of uncharacterized proteins using Gene Ontology (GO) terms, and the semantic similarity between these terms measured using a state-of-the-art GO similarity metric. To achieve better trade-off between improvement of quality, genomic coverage and scalability, this prediction is done by observing the key principles driving the biological organization of the functional network. This study yields a new functionally characterized MTB strain CDC1551 proteome, consisting of 3804 and 3698 proteins out of 4195 with annotations in terms of the biological process and molecular function ontologies, respectively. These data can contribute to research into the Development of effective anti-tubercular drugs with novel biological mechanisms of action. Copyright © 2011 Elsevier B.V. All rights reserved.

  20. Light intermediate chain 1 defines a functional subfraction of cytoplasmic dynein which binds to pericentrin.

    PubMed

    Tynan, S H; Purohit, A; Doxsey, S J; Vallee, R B

    2000-10-20

    The light intermediate chains (LICs) of cytoplasmic dynein consist of multiple isoforms, which undergo post-translational modification to produce a large number of species separable by two-dimensional electrophoresis and which we have proposed to represent at least two gene products. Recently, we demonstrated the first known function for the LICs: binding to the centrosomal protein, pericentrin, which represents a novel, non-dynactin-based cargo-binding mechanism. Here we report the cloning of rat LIC1, which is approximately 75% homologous to rat LIC2 and also contains a P-loop consensus sequence. We compared LIC1 and LIC2 for the ability to interact with pericentrin, and found that only LIC1 will bind. A functional P-loop sequence is not required for this interaction. We have mapped the interaction to the central region of both LIC1 and pericentrin. Using recombinant LICs, we found that they form homooligomers, but not heterooligomers, and exhibit mutually exclusive binding to the heavy chain. Additionally, overexpressed pericentrin is seen to interact with endogenous LIC1 exclusively. Together these results demonstrate the existence of two subclasses of cytoplasmic dynein: LIC1-containing dynein, and LIC2-containing dynein, only the former of which is involved in pericentrin association with dynein.

  1. SNBRFinder: A Sequence-Based Hybrid Algorithm for Enhanced Prediction of Nucleic Acid-Binding Residues.

    PubMed

    Yang, Xiaoxia; Wang, Jia; Sun, Jun; Liu, Rong

    2015-01-01

    Protein-nucleic acid interactions are central to various fundamental biological processes. Automated methods capable of reliably identifying DNA- and RNA-binding residues in protein sequence are assuming ever-increasing importance. The majority of current algorithms rely on feature-based prediction, but their accuracy remains to be further improved. Here we propose a sequence-based hybrid algorithm SNBRFinder (Sequence-based Nucleic acid-Binding Residue Finder) by merging a feature predictor SNBRFinderF and a template predictor SNBRFinderT. SNBRFinderF was established using the support vector machine whose inputs include sequence profile and other complementary sequence descriptors, while SNBRFinderT was implemented with the sequence alignment algorithm based on profile hidden Markov models to capture the weakly homologous template of query sequence. Experimental results show that SNBRFinderF was clearly superior to the commonly used sequence profile-based predictor and SNBRFinderT can achieve comparable performance to the structure-based template methods. Leveraging the complementary relationship between these two predictors, SNBRFinder reasonably improved the performance of both DNA- and RNA-binding residue predictions. More importantly, the sequence-based hybrid prediction reached competitive performance relative to our previous structure-based counterpart. Our extensive and stringent comparisons show that SNBRFinder has obvious advantages over the existing sequence-based prediction algorithms. The value of our algorithm is highlighted by establishing an easy-to-use web server that is freely accessible at http://ibi.hzau.edu.cn/SNBRFinder.

  2. Porcine MYF6 gene: sequence, homology analysis, and variation in the promoter region.

    PubMed

    Wyszyńska-Koko, J; Kurył, J

    2004-01-01

    MYF6 gene codes for the bHLH transcription factor belonging to MyoD family. Its expression accompanies the processes of differentiation and maturation of myotubes during embriogenesis and continues on a relatively high level after birth, affecting the muscle phenotype. The porcine MYF6 gene was amplified and sequenced and compared with MYF6 gene sequences of other species. The amino acid sequence was deduced and an interspecies homology analysis was performed. Myf-6 protein shows a high conservation among species of 99 and 97% identity when comparing pig with cow and human, respectively, and of 93% when comparing pig with mouse and rat. The single nucleotide polymorphism (SNP) was revealed within the promoter region, which appeared to be T --> C transition recognized by a MspI restriction enzyme.

  3. Regions of conservation and divergence in the 3' untranslated sequences of genomic RNA from Ross River virus isolates.

    PubMed

    Faragher, S G; Dalgarno, L

    1986-07-20

    The 3' untranslated (UT) sequences of the genomic RNAs of five geographic variants of the alphavirus Ross River virus (RRV) were determined and compared with the 3' UT sequence of RRV T48, the prototype strain. Part of the 3' UT region of Getah virus, a close serological relative of RRV, was also sequenced. The RRV 3' UT region varies markedly in length between variants. Large deletions or insertions, sequence rearrangements and single nucleotide substitutions are observed. A sequence tract of 49 to 58 nucleotides, which is repeated as four blocks in the RRV T48 3' UT region, occurs only once in the 3' UT region of one RRV strain (NB5092), indicating that the existence of repeat sequence blocks is not essential for RRV replication. However, the precise sequence of the 3' proximal copy of the repeat block and its position relative to the poly(A) tail were identical in all RRV isolates examined, suggesting that it has an important role in RRV replication. Nucleotide substitutions between RRV variants are distributed non-randomly along the length of the 3' UT region. The sequence of 120 to 130 nucleotides adjacent to the poly(A) tail is strongly conserved. Getah virus RNA contains three repeat sequence blocks in the 3' UT region. These are similar in sequence to those in RRV RNA but differ in their arrangement. Homology between the RRV and Getah 3' UT sequences is greatest in the 3' proximal repeat sequence block that shows three differences in 49 nucleotides. The 3' proximal repeat in Getah RNA occurs at the same position, relative to the poly(A) tail, as in all RRV variants. The RRV and Getah virus 3' UT sequences show extensive homology in the region between the 3' proximal repeat and the poly(A) tail but, apart from the repeat blocks themselves, they show no significant homology elsewhere.

  4. Molecular Dynamics Simulations of the Human Glucose Transporter GLUT1

    PubMed Central

    Park, Min-Sun

    2015-01-01

    Glucose transporters (GLUTs) provide a pathway for glucose transport across membranes. Human GLUTs are implicated in devastating diseases such as heart disease, hyper- and hypo-glycemia, type 2 diabetes and caner. The human GLUT1 has been recently crystalized in the inward-facing open conformation. However, there is no other structural information for other conformations. The X-ray structures of E. coli Xylose permease (XylE), a glucose transporter homolog, are available in multiple conformations with and without the substrates D-xylose and D-glucose. XylE has high sequence homology to human GLUT1 and key residues in the sugar-binding pocket are conserved. Here we construct a homology model for human GLUT1 based on the available XylE crystal structure in the partially occluded outward-facing conformation. A long unbiased all atom molecular dynamics simulation starting from the model can capture a new fully opened outward-facing conformation. Our investigation of molecular interactions at the interface between the transmembrane (TM) domains and the intracellular helices (ICH) domain in the outward- and inward-facing conformation supports that the ICH domain likely stabilizes the outward-facing conformation in GLUT1. Furthermore, inducing a conformational transition, our simulations manifest a global asymmetric rocker switch motion and detailed molecular interactions between the substrate and residues through the water-filled selective pore along a pathway from the extracellular to the intracellular side. The results presented here are consistent with previously published biochemical, mutagenesis and functional studies. Together, this study shed light on the structure and functional relationships of GLUT1 in multiple conformational states. PMID:25919356

  5. H3K9me2/3 Binding of the MBT Domain Protein LIN-61 Is Essential for Caenorhabditis elegans Vulva Development

    PubMed Central

    Koester-Eiserfunke, Nora; Fischle, Wolfgang

    2011-01-01

    MBT domain proteins are involved in developmental processes and tumorigenesis. In vitro binding and mutagenesis studies have shown that individual MBT domains within clustered MBT repeat regions bind mono- and dimethylated histone lysine residues with little to no sequence specificity but discriminate against the tri- and unmethylated states. However, the exact function of promiscuous histone methyl-lysine binding in the biology of MBT domain proteins has not been elucidated. Here, we show that the Caenorhabditis elegans four MBT domain protein LIN-61, in contrast to other MBT repeat factors, specifically interacts with histone H3 when methylated on lysine 9, displaying a strong preference for di- and trimethylated states (H3K9me2/3). Although the fourth MBT repeat is implicated in this interaction, H3K9me2/3 binding minimally requires MBT repeats two to four. Further, mutagenesis of residues conserved with other methyl-lysine binding MBT regions in the fourth MBT repeat does not abolish interaction, implicating a distinct binding mode. In vivo, H3K9me2/3 interaction of LIN-61 is required for C. elegans vulva development within the synMuvB pathway. Mutant LIN-61 proteins deficient in H3K9me2/3 binding fail to rescue lin-61 synMuvB function. Also, previously identified point mutant synMuvB alleles are deficient in H3K9me2/3 interaction although these target residues that are outside of the fourth MBT repeat. Interestingly, lin-61 genetically interacts with two other synMuvB genes, hpl-2, an HP1 homologous H3K9me2/3 binding factor, and met-2, a SETDB1 homologous H3K9 methyl transferase (H3K9MT), in determining C. elegans vulva development and fertility. Besides identifying the first sequence specific and di-/trimethylation binding MBT domain protein, our studies imply complex multi-domain regulation of ligand interaction of MBT domains. Our results also introduce a mechanistic link between LIN-61 function and biology, and they establish interplay of the H3K9me2/3 binding proteins, LIN-61 and HPL-2, as well as the H3K9MT MET-2 in distinct developmental pathways. PMID:21437264

  6. Ocellatin peptides from the skin secretion of the South American frog Leptodactylus labyrinthicus (Leptodactylidae): characterization, antimicrobial activities and membrane interactions.

    PubMed

    Gusmão, Karla A G; Dos Santos, Daniel M; Santos, Virgílio M; Cortés, María Esperanza; Reis, Pablo V M; Santos, Vera L; Piló-Veloso, Dorila; Verly, Rodrigo M; de Lima, Maria Elena; Resende, Jarbas M

    2017-01-01

    The availability of antimicrobial peptides from several different natural sources has opened an avenue for the discovery of new biologically active molecules. To the best of our knowledge, only two peptides isolated from the frog Leptodactylus labyrinthicus , namely pentadactylin and ocellatin-F1, have shown antimicrobial activities. Therefore, in order to explore the antimicrobial potential of this species, we have investigated the biological activities and membrane interactions of three peptides isolated from the anuran skin secretion. Three peptide primary structures were determined by automated Edman degradation. These sequences were prepared by solid-phase synthesis and submitted to activity assays against gram-positive and gram-negative bacteria and against two fungal strains. The hemolytic properties of the peptides were also investigated in assays with rabbit blood erythrocytes. The conformational preferences of the peptides and their membrane interactions have been investigated by circular dichroism spectroscopy and liposome dye release assays. The amino acid compositions of three ocellatins were determined and the sequences exhibit 100% homology for the first 22 residues (ocellatin-LB1 sequence). Ocellatin-LB2 carries an extra Asn residue and ocellatin-F1 extra Asn-Lys-Leu residues at C-terminus. Ocellatin-F1 presents a stronger antibiotic potential and a broader spectrum of activities compared to the other peptides. The membrane interactions and pore formation capacities of the peptides correlate directly with their antimicrobial activities, i.e., ocellatin-F1 > ocellatin-LB1 > ocellatin-LB2. All peptides acquire high helical contents in membrane environments. However, ocellatin-F1 shows in average stronger helical propensities. The obtained results indicate that the three extra amino acid residues at the ocellatin-F1 C-terminus play an important role in promoting stronger peptide-membrane interactions and antimicrobial properties. The extra Asn-23 residue present in ocellatin-LB2 sequence seems to decrease its antimicrobial potential and the strength of the peptide-membrane interactions.

  7. Development of a Reporter System to Explore MMEJ in the Context of Replacing Large Genomic Fragments.

    PubMed

    Yanik, Mert; Ponnam, Surya Prakash Goud; Wimmer, Tobias; Trimborn, Lennart; Müller, Carina; Gambert, Isabel; Ginsberg, Johanna; Janise, Annabella; Domicke, Janina; Wende, Wolfgang; Lorenz, Birgit; Stieger, Knut

    2018-06-01

    Common genome-editing strategies are either based on non-homologous end joining (NHEJ) or, in the presence of a template DNA, based on homologous recombination with long (homology-directed repair [HDR]) or short (microhomology-mediated end joining [MMEJ]) homologous sequences. In the current study, we aim to develop a model system to test the activity of MMEJ after CRISPR/Cas9-mediated cleavage in cell culture. Following successful proof of concept in an episomally based reporter system, we tested template plasmids containing a promoter-less luciferase gene flanked by microhomologous sequences (mhs) of different length (5, 10, 15, 20, 30, and 50 bp) that are complementary to the mouse retinitis pigmentosa GTPase regulator (RPGR)-ORF15, which is under the control of a CMV promoter stably integrated into a HEK293 cell line. Luciferase signal appearance represented successful recombination events and was highest when the mhs were 5 bp long, while longer mhs revealed lower luciferase signal. In addition, presence of Csy4 RNase was shown to increase luciferase signaling. The luciferase reporter system is a valuable tool to study the input of the different DNA repair mechanisms in the replacement of large DNA sequences by mhs. Copyright © 2018 The Authors. Published by Elsevier Inc. All rights reserved.

  8. AlphaII-spectrin interacts with Tes and EVL, two actin-binding proteins located at cell contacts.

    PubMed

    Rotter, Björn; Bournier, Odile; Nicolas, Gael; Dhermy, Didier; Lecomte, Marie-Christine

    2005-06-01

    The spectrin-based membrane skeleton, a multi-protein scaffold attached to diverse cellular membranes, is presumed to be involved in the stabilization of membranes, the establishment of membrane domains as well as in vesicle trafficking and nuclear functions. Spectrin tetramers made of alpha- and beta-subunits are linked to actin microfilaments, forming a network that binds a multitude of proteins. The most prevalent alpha-spectrin subunit in non-erythroid cells, alphaII-spectrin, contains two particular spectrin repeats in its central region, alpha9 and alpha10, which host an Src homology 3 domain, a tissue-specific spliced sequence of 20 residues, a calmodulin-binding site and major cleavage sites for caspases and calpains. Using yeast two-hybrid screening of kidney libraries, we identified two partners of the alpha9-alpha10 repeats: the potential tumour suppressor Tes, an actin-binding protein mainly located at focal adhesions; and EVL (Ena/vasodilator-stimulated phosphoprotein-like protein), another actin-binding protein, equally recruited at focal adhesions. Interactions between spectrin and overexpressed Tes and EVL were confirmed by co-immunoprecipitation. In vitro studies showed that the interaction between Tes and spectrin is mediated by a LIM (Lin-11, Isl-1 and Mec3) domain of Tes and by the alpha10 repeat of alphaII-spectrin whereas EVL interacts with the Src homology 3 domain located within the alpha9 repeat. Moreover, we describe an in vitro interaction between Tes and EVL, and a co-localization of these two proteins at focal adhesions. These interactions between alphaII-spectrin, Tes and EVL indicate new functions for spectrin in actin dynamics and focal adhesions.

  9. Nucleotide sequences of two genomic DNAs encoding peroxidase of Arabidopsis thaliana.

    PubMed

    Intapruk, C; Higashimura, N; Yamamoto, K; Okada, N; Shinmyo, A; Takano, M

    1991-02-15

    The peroxidase (EC 1.11.1.7)-encoding gene of Arabidopsis thaliana was screened from a genomic library using a cDNA encoding a neutral isozyme of horseradish, Armoracia rusticana, peroxidase (HRP) as a probe, and two positive clones were isolated. From the comparison with the sequences of the HRP-encoding genes, we concluded that two clones contained peroxidase-encoding genes, and they were named prxCa and prxEa. Both genes consisted of four exons and three introns; the introns had consensus nucleotides, GT and AG, at the 5' and 3' ends, respectively. The lengths of each putative exon of the prxEa gene were the same as those of the HRP-basic-isozyme-encoding gene, prxC3, and coded for 349 amino acids (aa) with a sequence homology of 89% to that encoded by prxC3. The prxCa gene was very close to the HRP-neutral-isozyme-encoding gene, prxC1b, and coded for 354 aa with 91% homology to that encoded by prxC1b. The aa sequence homology was 64% between the two peroxidases encoded by prxCa and prxEa.

  10. Protein structure recognition: From eigenvector analysis to structural threading method

    NASA Astrophysics Data System (ADS)

    Cao, Haibo

    In this work, we try to understand the protein folding problem using pair-wise hydrophobic interaction as the dominant interaction for the protein folding process. We found a strong correlation between amino acid sequence and the corresponding native structure of the protein. Some applications of this correlation were discussed in this dissertation include the domain partition and a new structural threading method as well as the performance of this method in the CASP5 competition. In the first part, we give a brief introduction to the protein folding problem. Some essential knowledge and progress from other research groups was discussed. This part include discussions of interactions among amino acids residues, lattice HP model, and the designablity principle. In the second part, we try to establish the correlation between amino acid sequence and the corresponding native structure of the protein. This correlation was observed in our eigenvector study of protein contact matrix. We believe the correlation is universal, thus it can be used in automatic partition of protein structures into folding domains. In the third part, we discuss a threading method based on the correlation between amino acid sequence and ominant eigenvector of the structure contact-matrix. A mathematically straightforward iteration scheme provides a self-consistent optimum global sequence-structure alignment. The computational efficiency of this method makes it possible to search whole protein structure databases for structural homology without relying on sequence similarity. The sensitivity and specificity of this method is discussed, along with a case of blind test prediction. In the appendix, we list the overall performance of this threading method in CASP5 blind test in comparison with other existing approaches.

  11. SNP-VISTA: An interactive SNP visualization tool

    PubMed Central

    Shah, Nameeta; Teplitsky, Michael V; Minovitsky, Simon; Pennacchio, Len A; Hugenholtz, Philip; Hamann, Bernd; Dubchak, Inna L

    2005-01-01

    Background Recent advances in sequencing technologies promise to provide a better understanding of the genetics of human disease as well as the evolution of microbial populations. Single Nucleotide Polymorphisms (SNPs) are established genetic markers that aid in the identification of loci affecting quantitative traits and/or disease in a wide variety of eukaryotic species. With today's technological capabilities, it has become possible to re-sequence a large set of appropriate candidate genes in individuals with a given disease in an attempt to identify causative mutations. In addition, SNPs have been used extensively in efforts to study the evolution of microbial populations, and the recent application of random shotgun sequencing to environmental samples enables more extensive SNP analysis of co-occurring and co-evolving microbial populations. The program is available at [1]. Results We have developed and present two modifications of an interactive visualization tool, SNP-VISTA, to aid in the analyses of the following types of data: A. Large-scale re-sequence data of disease-related genes for discovery of associated and/or causative alleles (GeneSNP-VISTA). B. Massive amounts of ecogenomics data for studying homologous recombination in microbial populations (EcoSNP-VISTA). The main features and capabilities of SNP-VISTA are: 1) mapping of SNPs to gene structure; 2) classification of SNPs, based on their location in the gene, frequency of occurrence in samples and allele composition; 3) clustering, based on user-defined subsets of SNPs, highlighting haplotypes as well as recombinant sequences; 4) integration of protein evolutionary conservation visualization; and 5) display of automatically calculated recombination points that are user-editable. Conclusion The main strength of SNP-VISTA is its graphical interface and use of visual representations, which support interactive exploration and hence better understanding of large-scale SNP data by the user. PMID:16336665

  12. Evidence that a sequence similar to TAR is important for induction of the JC virus late promoter by human immunodeficiency virus type 1 Tat.

    PubMed Central

    Chowdhury, M; Taylor, J P; Chang, C F; Rappaport, J; Khalili, K

    1992-01-01

    A specific RNA sequence located in the leader of all human immunodeficiency virus type 1 (HIV-1) mRNAs termed the transactivation response element, or TAR, is a primary target for induction of HIV-1 long terminal repeat activity by the HIV-1-derived trans-regulatory protein, Tat. Human neurotropic virus, JC virus (JCV), a causative agent of the degenerative demyelinating disease progressive multifocal leukoencephalopathy, contains sequences in the 5' end of the late RNA species with an extensive homology to HIV-1 TAR. In this study, we examined the possible role of the JCV-derived TAR-homologous sequence in Tat-mediated activation of the JCV late promoter (Tada et al., Proc. Natl. Acad. Sci. USA 87:3479-3483, 1990). Results from site-directed mutagenesis revealed that critical G residues required for the function of HIV-1 TAR that are conserved in the JCV TAR homolog play an important role in Tat activation of the JCV promoter. In addition, in vivo competition studies suggest that shared regulatory components mediate Tat activation of the JCV late and HIV-1 long terminal repeat promoters. Furthermore, we showed that the JCV-derived TAR sequence behaves in the same way as HIV-1 TAR in response to two distinct Tat mutants, one of which that has no ability to bind to HIV-1 TAR and another that lacks transcriptional activity on a responsive promoter. These results suggest that the TAR homolog of the JCV late promoter is responsive to HIV-1 Tat induction and thus may participate in the overall activation of the JCV late promoter mediated by this transactivation. Images PMID:1331525

  13. Expression of an Atriplex nummularia gene encoding a protein homologous to the bacterial molecular chaperone DnaJ.

    PubMed

    Zhu, J K; Shi, J; Bressan, R A; Hasegawa, P M

    1993-03-01

    DnaJ is a 36-kD heat shock protein that functions together with Dnak (Hsp70) as a molecular chaperone in Escherichia coli. We have obtained a cDNA clone from the higher plant Atriplex nummularia that encodes a 46.6-kD polypeptide (ANJ1) with an overall 35.2% amino acid sequence identity with the E. coli DnaJ. ANJ1 has 43.4% overall sequence identity with the Saccharomyces cerevisiae cytoplasmic DnaJ homolog YDJ1/MAS5. Complementation of the yeast mas5 mutation indicated that ANJ1 is a functional homolog of YDJ1/MAS5. The presence of other DnaJ homologs in A. nummularia was demonstrated by the detection of proteins that are antigenically related to the yeast mitochondrial DnaJ homolog SCJ1 and the yeast DnaJ-related protein Sec63. Expression of the ANJ1 gene was compared with that of an A. nummularia Hsp70 gene. Expression of both ANJ1 and Hsp70 transcripts was coordinately induced by heat shock. However, noncoordinate accumulation of ANJ1 and Hsp70 mRNAs occurred during the cell growth cycle and in response to NaCl stress.

  14. In trans paired nicking triggers seamless genome editing without double-stranded DNA cutting.

    PubMed

    Chen, Xiaoyu; Janssen, Josephine M; Liu, Jin; Maggio, Ignazio; 't Jong, Anke E J; Mikkers, Harald M M; Gonçalves, Manuel A F V

    2017-09-22

    Precise genome editing involves homologous recombination between donor DNA and chromosomal sequences subjected to double-stranded DNA breaks made by programmable nucleases. Ideally, genome editing should be efficient, specific, and accurate. However, besides constituting potential translocation-initiating lesions, double-stranded DNA breaks (targeted or otherwise) are mostly repaired through unpredictable and mutagenic non-homologous recombination processes. Here, we report that the coordinated formation of paired single-stranded DNA breaks, or nicks, at donor plasmids and chromosomal target sites by RNA-guided nucleases based on CRISPR-Cas9 components, triggers seamless homology-directed gene targeting of large genetic payloads in human cells, including pluripotent stem cells. Importantly, in addition to significantly reducing the mutagenicity of the genome modification procedure, this in trans paired nicking strategy achieves multiplexed, single-step, gene targeting, and yields higher frequencies of accurately edited cells when compared to the standard double-stranded DNA break-dependent approach.CRISPR-Cas9-based gene editing involves double-strand breaks at target sequences, which are often repaired by mutagenic non-homologous end-joining. Here the authors use Cas9 nickases to generate coordinated single-strand breaks in donor and target DNA for precise homology-directed gene editing.

  15. Analysis of the DNA sequence of a 15,500 bp fragment near the left telomere of chromosome XV from Saccharomyces cerevisiae reveals a putative sugar transporter, a carboxypeptidase homologue and two new open reading frames.

    PubMed

    Gamo, F J; Lafuente, M J; Casamayor, A; Ariño, J; Aldea, M; Casas, C; Herrero, E; Gancedo, C

    1996-06-15

    We report the sequence of a 15.5 kb DNA segment located near the left telomere of chromosome XV of Saccharomyces cerevisiae. The sequence contains nine open reading frames (ORFs) longer than 300 bp. Three of them are internal to other ones. One corresponds to the gene LGT3 that encodes a putative sugar transporter. Three adjacent ORFs were separated by two stop codons in frame. These ORFs presented homology with the gene CPS1 that encodes carboxypeptidase S. The stop codons were not found in the same sequence derived from another yeast strain. Two other ORFs without significant homology in databases were also found. One of them, O0420, is very rich in serine and threonine and presents a series of repeated or similar amino acid stretches along the sequence.

  16. Nucleotide sequence analysis of the L gene of Newcastle disease virus: homologies with Sendai and vesicular stomatitis viruses.

    PubMed Central

    Yusoff, K; Millar, N S; Chambers, P; Emmerson, P T

    1987-01-01

    The nucleotide sequence of the L gene of the Beaudette C strain of Newcastle disease virus (NDV) has been determined. The L gene is 6704 nucleotides long and encodes a protein of 2204 amino acids with a calculated molecular weight of 248822. Mung bean nuclease mapping of the 5' terminus of the L gene mRNA indicates that the transcription of the L gene is initiated 11 nucleotides upstream of the translational start site. Comparison with the amino acid sequences of the L genes of Sendai virus and vesicular stomatitis virus (VSV) suggests that there are several regions of homology between the sequences. These data provide further evidence for an evolutionary relationship between the Paramyxoviridae and the Rhabdoviridae. A non-coding sequence of 46 nucleotides downstream of the presumed polyadenylation site of the L gene may be part of a negative strand leader RNA. Images PMID:3035486

  17. Sequence and analysis of chromosome 4 of the plant Arabidopsis thaliana.

    PubMed

    Mayer, K; Schüller, C; Wambutt, R; Murphy, G; Volckaert, G; Pohl, T; Düsterhöft, A; Stiekema, W; Entian, K D; Terryn, N; Harris, B; Ansorge, W; Brandt, P; Grivell, L; Rieger, M; Weichselgartner, M; de Simone, V; Obermaier, B; Mache, R; Müller, M; Kreis, M; Delseny, M; Puigdomenech, P; Watson, M; Schmidtheini, T; Reichert, B; Portatelle, D; Perez-Alonso, M; Boutry, M; Bancroft, I; Vos, P; Hoheisel, J; Zimmermann, W; Wedler, H; Ridley, P; Langham, S A; McCullagh, B; Bilham, L; Robben, J; Van der Schueren, J; Grymonprez, B; Chuang, Y J; Vandenbussche, F; Braeken, M; Weltjens, I; Voet, M; Bastiaens, I; Aert, R; Defoor, E; Weitzenegger, T; Bothe, G; Ramsperger, U; Hilbert, H; Braun, M; Holzer, E; Brandt, A; Peters, S; van Staveren, M; Dirske, W; Mooijman, P; Klein Lankhorst, R; Rose, M; Hauf, J; Kötter, P; Berneiser, S; Hempel, S; Feldpausch, M; Lamberth, S; Van den Daele, H; De Keyser, A; Buysshaert, C; Gielen, J; Villarroel, R; De Clercq, R; Van Montagu, M; Rogers, J; Cronin, A; Quail, M; Bray-Allen, S; Clark, L; Doggett, J; Hall, S; Kay, M; Lennard, N; McLay, K; Mayes, R; Pettett, A; Rajandream, M A; Lyne, M; Benes, V; Rechmann, S; Borkova, D; Blöcker, H; Scharfe, M; Grimm, M; Löhnert, T H; Dose, S; de Haan, M; Maarse, A; Schäfer, M; Müller-Auer, S; Gabel, C; Fuchs, M; Fartmann, B; Granderath, K; Dauner, D; Herzl, A; Neumann, S; Argiriou, A; Vitale, D; Liguori, R; Piravandi, E; Massenet, O; Quigley, F; Clabauld, G; Mündlein, A; Felber, R; Schnabl, S; Hiller, R; Schmidt, W; Lecharny, A; Aubourg, S; Chefdor, F; Cooke, R; Berger, C; Montfort, A; Casacuberta, E; Gibbons, T; Weber, N; Vandenbol, M; Bargues, M; Terol, J; Torres, A; Perez-Perez, A; Purnelle, B; Bent, E; Johnson, S; Tacon, D; Jesse, T; Heijnen, L; Schwarz, S; Scholler, P; Heber, S; Francs, P; Bielke, C; Frishman, D; Haase, D; Lemcke, K; Mewes, H W; Stocker, S; Zaccaria, P; Bevan, M; Wilson, R K; de la Bastide, M; Habermann, K; Parnell, L; Dedhia, N; Gnoj, L; Schutz, K; Huang, E; Spiegel, L; Sehkon, M; Murray, J; Sheet, P; Cordes, M; Abu-Threideh, J; Stoneking, T; Kalicki, J; Graves, T; Harmon, G; Edwards, J; Latreille, P; Courtney, L; Cloud, J; Abbott, A; Scott, K; Johnson, D; Minx, P; Bentley, D; Fulton, B; Miller, N; Greco, T; Kemp, K; Kramer, J; Fulton, L; Mardis, E; Dante, M; Pepin, K; Hillier, L; Nelson, J; Spieth, J; Ryan, E; Andrews, S; Geisel, C; Layman, D; Du, H; Ali, J; Berghoff, A; Jones, K; Drone, K; Cotton, M; Joshu, C; Antonoiu, B; Zidanic, M; Strong, C; Sun, H; Lamar, B; Yordan, C; Ma, P; Zhong, J; Preston, R; Vil, D; Shekher, M; Matero, A; Shah, R; Swaby, I K; O'Shaughnessy, A; Rodriguez, M; Hoffmann, J; Till, S; Granat, S; Shohdy, N; Hasegawa, A; Hameed, A; Lodhi, M; Johnson, A; Chen, E; Marra, M; Martienssen, R; McCombie, W R

    1999-12-16

    The higher plant Arabidopsis thaliana (Arabidopsis) is an important model for identifying plant genes and determining their function. To assist biological investigations and to define chromosome structure, a coordinated effort to sequence the Arabidopsis genome was initiated in late 1996. Here we report one of the first milestones of this project, the sequence of chromosome 4. Analysis of 17.38 megabases of unique sequence, representing about 17% of the genome, reveals 3,744 protein coding genes, 81 transfer RNAs and numerous repeat elements. Heterochromatic regions surrounding the putative centromere, which has not yet been completely sequenced, are characterized by an increased frequency of a variety of repeats, new repeats, reduced recombination, lowered gene density and lowered gene expression. Roughly 60% of the predicted protein-coding genes have been functionally characterized on the basis of their homology to known genes. Many genes encode predicted proteins that are homologous to human and Caenorhabditis elegans proteins.

  18. Cloning and functional characterization of the Xenopus orthologue of the Treacher Collins syndrome (TCOF1) gene product.

    PubMed

    Gonzales, Bianca; Yang, Hushan; Henning, Dale; Valdez, Benigno C

    2005-10-10

    Treacher Collins syndrome (TCS) is an autosomal dominant disorder of craniofacial development caused by mutations in the TCOF1 gene, which encodes the nucleolar phosphoprotein treacle. We previously reported a function for mammalian treacle in ribosomal DNA gene transcription by its interaction with upstream binding factor. As an initial step in the development of a TCS model for frog the cDNA that encodes the Xenopus laevis treacle was cloned. Although the derived amino acid sequence shows a poor homology with its mammalian orthologues, Xenopus treacle has 11 highly homologous direct repeats near the center of the protein molecule similar to those present in its human, dog and mouse orthologues. Comparison of their amino acid compositions indicates conservation of predominant specific amino acid residues. Antisense-mediated down-regulation of treacle expression in X. laevis oocytes resulted in inhibition of rDNA gene transcription. The results suggest evolutionary conservation of the function of treacle in ribosomal RNA biogenesis in higher eukaryotes.

  19. Parallels between UNUSUAL FLORAL ORGANS and FIMBRIATA, genes controlling flower development in Arabidopsis and Antirrhinum.

    PubMed

    Ingram, G C; Goodrich, J; Wilkinson, M D; Simon, R; Haughn, G W; Coen, E S

    1995-09-01

    The unusual floral organs (ufo) mutant of Arabidopsis has flowers with variable homeotic organ transformations and inflorescence-like characteristics. To determine the relationship between UFO and previously characterized meristem and organ identity genes, we cloned UFO and determined its expression pattern. The UFO gene shows extensive homology with FIMBRIATA (FIM), a gene mediating between meristem and organ identity genes in Antirrhinum. All three UFO mutant alleles that we sequenced are predicted to produce truncated proteins. UFO transcripts were first detected in early floral meristems, before organ identity genes had been activated. At later developmental stages, UFO expression is restricted to the junction between sepal and petal primordia. Phenotypic, genetic, and expression pattern comparisons between UFO and FIM suggest that they are cognate homologs and play a similar role in mediating between meristem and organ identity genes. However, some differences in the functions and genetic interactions of UFO and FIM were apparent, indicating that changes in partially redundant pathways have occurred during the evolutionary divergence of Arabidopsis and Antirrhinum.

  20. Characterization of a highly conserved human homolog to the chicken neural cell surface protein Bravo/Nr-CAM that maps to chromosome band 7q31

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lane, R.P.; Vielmetter, J.; Dreyer, W.J.

    1996-08-01

    The neuronal cell adhesion molecule Bravo/Nr-CAM is a cell surface protein of the immunoglobulin (Ig) superfamily and is closely related to the L1/NgCAM and neurofascin molecules, all of which contain six immunoglobulin domains, five fibronectin repeats, a transmembrane region, and an intracellular domain. Chicken Bravo/Nr-CAM has been shown to interact with other cell surface molecules of the Ig superfamily and has been implicated in specific pathfinding roles of axonal growth cones in the developing nervous system. We now report the characterization of cDNA clones encoding the human Bravo/Nr-CAM protein, which, like its chicken homolog, is composed of six V-like Igmore » domains and five fibronectin type III repeats. The human Bravo/Nr-CAM homolog also contains a transmembrane and intracellular domain, both of which are 100% conserved at the amino acid level compared to its chicken homolog. Overall, the human Bravo/Nr-CAM homolog is 82% identical to the chicken Bravo/Nr-CAM amino acid sequence. Independent cDNAs encoding four different isoforms were also identified, all of which contain alternatively spliced variants around the fifth fibronectin type III repeat, including one isoform that had been previously identified for chicken Bravo/Nr-CAM. Northern blot analysis reveals one mRNA species of approximately 7.0 kb in adult human brain tissue. Fluorescence in situ hybridization maps the gene for human Bravo/Nr-CAM to human chromosome 7q31.1-q31.2. This chromosomal locus has been previously identified as containing a tumore suppressor candidate gene commonly deleted in certain human cancer tissues. 38 refs., 5 figs.« less

  1. Jaw1/LRMP has a role in maintaining nuclear shape via interaction with SUN proteins.

    PubMed

    Kozono, Takuma; Tadahira, Kazuko; Okumura, Wataru; Itai, Nao; Tamura-Nakano, Miwa; Dohi, Taeko; Tonozuka, Takashi; Nishikawa, Atsushi

    2018-06-06

    Jaw1/LRMP is characterized as a type II integral membrane protein that is localized to endoplasmic reticulum (ER), however, its physiological functions have been poorly understood. An alignment of amino acid sequence of Jaw1 with KASH proteins, outer nuclear membrane proteins, revealed that Jaw1 has a partial homology to the KASH domain. Here, we show that the function of Jaw1 is to maintain nuclear shape in mouse melanoma cell line. The siRNA-mediated knockdown of Jaw1 caused a severe defect in nuclear shape, and the defect was rescued by ectopic expression of siRNA-resistant Jaw1. Since co-immunoprecipitation assay indicates that Jaw1 interacts with SUN proteins that are inner nuclear proteins and microtubules, this study suggests that Jaw1 has a role in maintaining nuclear shape via interactions with SUN proteins and microtubules.

  2. New acute transforming feline retovirus with fms homology specifies a C-terminally truncated version of the c-fms protein that is different from SM-feline sarcoma virus v-fms protein

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Besmer, P.; Lader, E.; George, P.C.

    1986-10-01

    The HZ5-feline sarcoma virus (FeSV) is a new acute transforming feline retrovirus which was isolated from a multicentric fibrosarcoma of a domestic cat. The HZ5-FeSV transforms fibroblasts in vitro and is replication defective. A biologically active integrated HZ5-FeSV provirus was molecularly cloned from cellular DNA of HZ5-FeSV-infected FRE-3A rat cells. The HZ5-FeSV has oncogene homology with the fms sequences of the SM-FeSV. The genome organization of the 8.6-kilobase HZ5-FeSV provirus is 5' ..delta..gag-fms-..delta..pol-..delta..env 3'. The HZ5- and SM-FeSVs display indistinguishable in vitro transformation characteristics, and the structures of the gag-fms transforming genes in the two viruses are very similar. Inmore » the HZ5-FeSV and the SM-FeSV, identical c-fms and feline leukemia virus p10 sequences form the 5' gag-fms junction. With regard to v-fms the two viruses are homologous up to 11 amino acids before the C terminus of the SM-FeSV v-fms protein. In HZ5-FeSV a segment of 362 nucleotides then follows before the 3' recombination site with feline leukemia virus pol. The new 3' v-fms sequence encodes 27 amino acids before reaching a TGA termination signal. The relationship of this sequence with the recently characterized human c-fms sequence has been examined. The 3' HZ5-FeSV v-fms sequence is homologous with 3' c-fms sequences. A frameshift mutation (11-base-pair deletion) was found in the C-terminal fms coding sequence of the HZ5-FeSV. As a result, the HZ5-FeSV v-fms protein is predicted to be a C-terminally truncated version of c-fms. This frameshift mutation may determine the oncogenic properties of v-fms in the HZ5-FeSV.« less

  3. A new acute transforming feline retrovirus with fms homology specifies a C-terminally truncated version of the c-fms protein that is different from SM-feline sarcoma virus v-fms protein.

    PubMed Central

    Besmer, P; Lader, E; George, P C; Bergold, P J; Qiu, F H; Zuckerman, E E; Hardy, W D

    1986-01-01

    The HZ5-feline sarcoma virus (FeSV) is a new acute transforming feline retrovirus which was isolated from a multicentric fibrosarcoma of a domestic cat. The HZ5-FeSV transforms fibroblasts in vitro and is replication defective. A biologically active integrated HZ5-FeSV provirus was molecularly cloned from cellular DNA of HZ5-FeSV-infected FRE-3A rat cells. The HZ5-FeSV has oncogene homology with the fms sequences of the SM-FeSV. The genome organization of the 8.6-kilobase HZ5-FeSV provirus is 5' delta gag-fms-delta pol-delta env 3'. The HZ5-and SM-FeSVs display indistinguishable in vitro transformation characteristics, and the structures of the gag-fms transforming genes in the two viruses are very similar. In the HZ5-FeSV and the SM-FeSV, identical c-fms and feline leukemia virus p10 sequences form the 5' gag-fms junction. With regard to v-fms the two viruses are homologous up to 11 amino acids before the C terminus of the SM-FeSV v-fms protein. In HZ5-FeSV a segment of 362 nucleotides then follows before the 3' recombination site with feline leukemia virus pol. The new 3' v-fms sequence encodes 27 amino acids before reaching a TGA termination signal. The relationship of this sequence with the recently characterized human c-fms sequence has been examined. The 3' HZ5-FeSV v-fms sequence is homologous with 3' c-fms sequences. A frameshift mutation (11-base-pair deletion) was found in the C-terminal fms coding sequence of the HZ5-FeSV. As a result, the HZ5-FeSV v-fms protein is predicted to be a C-terminally truncated version of c-fms. This frameshift mutation may determine the oncogenic properties of v-fms in the HZ5-FeSV. Images PMID:3018286

  4. Exploiting three kinds of interface propensities to identify protein binding sites.

    PubMed

    Liu, Bin; Wang, Xiaolong; Lin, Lei; Dong, Qiwen; Wang, Xuan

    2009-08-01

    Predicting the binding sites between two interacting proteins provides important clues to the function of a protein. In this study, we present a building block of proteins called order profiles to use the evolutionary information of the protein sequence frequency profiles and apply this building block to produce a class of propensities called order profile interface propensities. For comparisons, we revisit the usage of residue interface propensities and binary profile interface propensities for protein binding site prediction. Each kind of propensities combined with sequence profiles and accessible surface areas are inputted into SVM. When tested on four types of complexes (hetero-permanent complexes, hetero-transient complexes, homo-permanent complexes and homo-transient complexes), experimental results show that the order profile interface propensities are better than residue interface propensities and binary profile interface propensities. Therefore, order profile is a suitable profile-level building block of the protein sequences and can be widely used in many tasks of computational biology, such as the sequence alignment, the prediction of domain boundary, the designation of knowledge-based potentials and the protein remote homology detection.

  5. Sequence of the bchG gene from Chloroflexus aurantiacus: relationship between chlorophyll synthase and other polyprenyltransferases

    NASA Technical Reports Server (NTRS)

    Lopez, J. C.; Ryan, S.; Blankenship, R. E.

    1996-01-01

    The sequence of the Chloroflexus aurantiacus open reading frame thought to be the C. aurantiacus homolog of the Rhodobacter capsulatus bchG gene is reported. The BchG gene product catalyzes esterification of bacteriochlorophyllide a by geranylgeraniol-PPi during bacteriochlorophyll a biosynthesis. Homologs from Arabidopsis thaliana, Synechocystis sp. strain PCC6803, and C. aurantiacus were identified in database searches. Profile analysis identified three related polyprenyltransferase enzymes which attach an aliphatic alcohol PPi to an aromatic substrate. This suggests a broader relationship between chlorophyll synthases and other polyprenyltransferases.

  6. PredictProtein—an open resource for online prediction of protein structural and functional features

    PubMed Central

    Yachdav, Guy; Kloppmann, Edda; Kajan, Laszlo; Hecht, Maximilian; Goldberg, Tatyana; Hamp, Tobias; Hönigschmid, Peter; Schafferhans, Andrea; Roos, Manfred; Bernhofer, Michael; Richter, Lothar; Ashkenazy, Haim; Punta, Marco; Schlessinger, Avner; Bromberg, Yana; Schneider, Reinhard; Vriend, Gerrit; Sander, Chris; Ben-Tal, Nir; Rost, Burkhard

    2014-01-01

    PredictProtein is a meta-service for sequence analysis that has been predicting structural and functional features of proteins since 1992. Queried with a protein sequence it returns: multiple sequence alignments, predicted aspects of structure (secondary structure, solvent accessibility, transmembrane helices (TMSEG) and strands, coiled-coil regions, disulfide bonds and disordered regions) and function. The service incorporates analysis methods for the identification of functional regions (ConSurf), homology-based inference of Gene Ontology terms (metastudent), comprehensive subcellular localization prediction (LocTree3), protein–protein binding sites (ISIS2), protein–polynucleotide binding sites (SomeNA) and predictions of the effect of point mutations (non-synonymous SNPs) on protein function (SNAP2). Our goal has always been to develop a system optimized to meet the demands of experimentalists not highly experienced in bioinformatics. To this end, the PredictProtein results are presented as both text and a series of intuitive, interactive and visually appealing figures. The web server and sources are available at http://ppopen.rostlab.org. PMID:24799431

  7. Identification of the WBSCR9 gene, encoding a novel transcriptional regulator, in the Williams-Beuren syndrome deletion at 7q11.23.

    PubMed

    Peoples, R J; Cisco, M J; Kaplan, P; Francke, U

    1998-01-01

    We have identified a novel gene (WBSCR9) within the common Williams-Beuren syndrome (WBS) deletion by interspecies sequence conservation. The WBSCR9 gene encodes a roughly 7-kb transcript with an open reading frame of 1483 amino acids and a predicted protein product size of 170.8 kDa. WBSCR9 is comprised of at least 20 exons extending over 60 kb. The transcript is expressed ubiquitously throughout development and is subject to alternative splicing. Functional motifs identified by sequence homology searches include a bromodomain; a PHD, or C4HC3, finger; several putative nuclear localization signals; four nuclear receptor binding motifs; a polyglutamate stretch and two PEST sequences. Bromodomains, PHD motifs and nuclear receptor binding motifs are cardinal features of proteins that are involved in chromatin remodeling and modulation of transcription. Haploinsufficiency for WBSCR9 gene products may contribute to the complex phenotype of WBS by interacting with tissue-specific regulatory factors during development.

  8. PROFESS: a PROtein Function, Evolution, Structure and Sequence database

    PubMed Central

    Triplet, Thomas; Shortridge, Matthew D.; Griep, Mark A.; Stark, Jaime L.; Powers, Robert; Revesz, Peter

    2010-01-01

    The proliferation of biological databases and the easy access enabled by the Internet is having a beneficial impact on biological sciences and transforming the way research is conducted. There are ∼1100 molecular biology databases dispersed throughout the Internet. To assist in the functional, structural and evolutionary analysis of the abundant number of novel proteins continually identified from whole-genome sequencing, we introduce the PROFESS (PROtein Function, Evolution, Structure and Sequence) database. Our database is designed to be versatile and expandable and will not confine analysis to a pre-existing set of data relationships. A fundamental component of this approach is the development of an intuitive query system that incorporates a variety of similarity functions capable of generating data relationships not conceived during the creation of the database. The utility of PROFESS is demonstrated by the analysis of the structural drift of homologous proteins and the identification of potential pancreatic cancer therapeutic targets based on the observation of protein–protein interaction networks. Database URL: http://cse.unl.edu/∼profess/ PMID:20624718

  9. Nucleotide Sequence and Genetic Structure of a Novel Carbaryl Hydrolase Gene (cehA) from Rhizobium sp. Strain AC100

    PubMed Central

    Hashimoto, Masayuki; Fukui, Mitsuru; Hayano, Kouichi; Hayatsu, Masahito

    2002-01-01

    Rhizobium sp. strain AC100, which is capable of degrading carbaryl (1-naphthyl-N-methylcarbamate), was isolated from soil treated with carbaryl. This bacterium hydrolyzed carbaryl to 1-naphthol and methylamine. Carbaryl hydrolase from the strain was purified to homogeneity, and its N-terminal sequence, molecular mass (82 kDa), and enzymatic properties were determined. The purified enzyme hydrolyzed 1-naphthyl acetate and 4-nitrophenyl acetate indicating that the enzyme is an esterase. We then cloned the carbaryl hydrolase gene (cehA) from the plasmid DNA of the strain and determined the nucleotide sequence of the 10-kb region containing cehA. No homologous sequences were found by a database homology search using the nucleotide and deduced amino acid sequences of the cehA gene. Six open reading frames including the cehA gene were found in the 10-kb region, and sequencing analysis shows that the cehA gene is flanked by two copies of insertion sequence-like sequence, suggesting that it makes part of a composite transposon. PMID:11872471

  10. In vivo gene correction with targeted sequence substitution through microhomology-mediated end joining.

    PubMed

    Shin, Jeong Hong; Jung, Soobin; Ramakrishna, Suresh; Kim, Hyongbum Henry; Lee, Junwon

    2018-07-07

    Genome editing technology using programmable nucleases has rapidly evolved in recent years. The primary mechanism to achieve precise integration of a transgene is mainly based on homology-directed repair (HDR). However, an HDR-based genome-editing approach is less efficient than non-homologous end-joining (NHEJ). Recently, a microhomology-mediated end-joining (MMEJ)-based transgene integration approach was developed, showing feasibility both in vitro and in vivo. We expanded this method to achieve targeted sequence substitution (TSS) of mutated sequences with normal sequences using double-guide RNAs (gRNAs), and a donor template flanking the microhomologies and target sequence of the gRNAs in vitro and in vivo. Our method could realize more efficient sequence substitution than the HDR-based method in vitro using a reporter cell line, and led to the survival of a hereditary tyrosinemia mouse model in vivo. The proposed MMEJ-based TSS approach could provide a novel therapeutic strategy, in addition to HDR, to achieve gene correction from a mutated sequence to a normal sequence. Copyright © 2018 Elsevier Inc. All rights reserved.

  11. A ribosomal orphon sequence from Xenopus laevis flanked by novel low copy number repetitive elements.

    PubMed

    Guimond, A; Moss, T

    1999-02-01

    We have used a differential cloning approach to isolate ribosomal/non-ribosomal frontier sequences from Xenopus laevis. A ribosomal intergenic spacer sequence (IGS) was cloned and shown not to be physically linked with the ribosomal locus. This ribosomal orphon contained the IGS sequences found immediately downstream of the 28S gene and included an array of enhancer repetitions and a non-functional spacer promoter. The orphon sequence was flanked by a member of the novel 'Frt' low copy repetitive element family. Three individual Frt repeats were sequenced and all members of this family were shown to lie clustered at two chromosomal sites, one of which contained the ribosomal orphon. One of the Frt elements contained an insertion of 297 bp that showed extensive homology to sequences within at least three other Xenopus genes. Each homology region was flanked by members of the T2 family of short interspersed repetitive elements, (SINEs), and by its target insertion sequence, suggesting multiple translocation events. The data are discussed in terms of the evolution of the ribosomal gene locus.

  12. The first genome sequence of a metatherian herpesvirus: Macropodid herpesvirus 1.

    PubMed

    Vaz, Paola K; Mahony, Timothy J; Hartley, Carol A; Fowler, Elizabeth V; Ficorilli, Nino; Lee, Sang W; Gilkerson, James R; Browning, Glenn F; Devlin, Joanne M

    2016-01-22

    While many placental herpesvirus genomes have been fully sequenced, the complete genome of a marsupial herpesvirus has not been described. Here we present the first genome sequence of a metatherian herpesvirus, Macropodid herpesvirus 1 (MaHV-1). The MaHV-1 viral genome was sequenced using an Illumina MiSeq sequencer, de novo assembly was performed and the genome was annotated. The MaHV-1 genome was 140 kbp in length and clustered phylogenetically with the primate simplexviruses, sharing 67% nucleotide sequence identity with Human herpesviruses 1 and 2. The MaHV-1 genome contained 66 predicted open reading frames (ORFs) homologous to those in other herpesvirus genomes, but lacked homologues of UL3, UL4, UL56 and glycoprotein J. This is the first alphaherpesvirus genome that has been found to lack the UL3 and UL4 homologues. We identified six novel ORFs and confirmed their transcription by RT-PCR. This is the first genome sequence of a herpesvirus that infects metatherians, a taxonomically unique mammalian clade. Members of the Simplexvirus genus are remarkably conserved, so the absence of ORFs otherwise retained in eutherian and avian alphaherpesviruses contributes to our understanding of the Alphaherpesvirinae. Further study of metatherian herpesvirus genetics and pathogenesis provides a unique approach to understanding herpesvirus-mammalian interactions.

  13. A computational study of the chemokine receptor CXCR1 bound with interleukin-8

    NASA Astrophysics Data System (ADS)

    Wang, Yang; Severin Lupala, Cecylia; Wang, Ting; Li, Xuanxuan; Yun, Ji-Hye; Park, Jae-hyun; Jin, Zeyu; Lee, Weontae; Tan, Leihan; Liu, Haiguang

    2018-03-01

    CXCR1 is a G-protein coupled receptor, transducing signals from chemokines, in particular the interleukin-8 (IL8) molecules. This study combines homology modeling and molecular dynamics simulation methods to study the structure of CXCR1-IL8 complex. By using CXCR4-vMIP-II crystallography structure as the homologous template, CXCR1-IL8 complex structure was constructed, and then refined using all-atom molecular dynamics simulations. Through extensive simulations, CXCR1-IL8 binding poses were investigated in detail. Furthermore, the role of the N-terminal of CXCR1 receptor was studied by comparing four complex models differing in the N-terminal sequences. The results indicate that the receptor N-terminal affects the binding of IL8 significantly. With a shorter N-terminal domain, the binding of IL8 to CXCR1 becomes unstable. The homology modeling and simulations also reveal the key receptor-ligand residues involved in the electrostatic interactions known to be vital for complex formation. Project supported by the National Natural Science Foundation of China (Grant Nos. 11575021, U1530401, and U1430237) and the National Research Foundation of Korea (Grant Nos. NRF-2017R1A2B2008483 and NRF-2016R1A6A3A04010213).

  14. Bacteriophage T5 encodes a homolog of the eukaryotic transcription coactivator PC4 implicated in recombination-dependent DNA replication.

    PubMed

    Steigemann, Birthe; Schulz, Annina; Werten, Sebastiaan

    2013-11-15

    The RNA polymerase II cofactor PC4 globally regulates transcription of protein-encoding genes through interactions with unwinding DNA, the basal transcription machinery and transcription activators. Here, we report the surprising identification of PC4 homologs in all sequenced representatives of the T5 family of bacteriophages, as well as in an archaeon and seven phyla of eubacteria. We have solved the crystal structure of the full-length T5 protein at 1.9Å, revealing a striking resemblance to the characteristic single-stranded DNA (ssDNA)-binding core domain of PC4. Intriguing novel structural features include a potential regulatory region at the N-terminus and a C-terminal extension of the homodimerisation interface. The genome organisation of T5-related bacteriophages points at involvement of the PC4 homolog in recombination-dependent DNA replication, strongly suggesting that the protein corresponds to the hitherto elusive replicative ssDNA-binding protein of the T5 family. Our findings imply that PC4-like factors intervene in multiple unwinding-related processes by acting as versatile modifiers of nucleic acid conformation and raise the possibility that the eukaryotic transcription coactivator derives from ancestral DNA replication, recombination and repair factors. © 2013.

  15. ATP hydrolysis provides functions that promote rejection of pairings between different copies of long repeated sequences

    PubMed Central

    Danilowicz, Claudia; Hermans, Laura; Coljee, Vincent; Prévost, Chantal

    2017-01-01

    Abstract During DNA recombination and repair, RecA family proteins must promote rapid joining of homologous DNA. Repeated sequences with >100 base pair lengths occupy more than 1% of bacterial genomes; however, commitment to strand exchange was believed to occur after testing ∼20–30 bp. If that were true, pairings between different copies of long repeated sequences would usually become irreversible. Our experiments reveal that in the presence of ATP hydrolysis even 75 bp sequence-matched strand exchange products remain quite reversible. Experiments also indicate that when ATP hydrolysis is present, flanking heterologous dsDNA regions increase the reversibility of sequence matched strand exchange products with lengths up to ∼75 bp. Results of molecular dynamics simulations provide insight into how ATP hydrolysis destabilizes strand exchange products. These results inspired a model that shows how pairings between long repeated sequences could be efficiently rejected even though most homologous pairings form irreversible products. PMID:28854739

  16. Isolation and characterization of an AGAMOUS homolog from Fraxinus pennsylvanica

    Treesearch

    Ningxia Du; Paula M. Pijut

    2010-01-01

    An AGAMOUS homolog (FpAG) was isolated from green ash (Fraxinus pennsylvanica) using a reverse transcriptase polymerase chain reaction method. Southern blot analysis indicated that FpAG was present as a single-copy sequence in the genome of green ash. RNA accumulated in the reproductive tissues (female...

  17. Repertoire, genealogy and genomic organization of cruzipain and homologous genes in Trypanosoma cruzi, T. cruzi-like and other trypanosome species.

    PubMed

    Lima, Luciana; Ortiz, Paola A; da Silva, Flávia Maia; Alves, João Marcelo P; Serrano, Myrna G; Cortez, Alane P; Alfieri, Silvia C; Buck, Gregory A; Teixeira, Marta M G

    2012-01-01

    Trypanosoma cruzi, the agent of Chagas disease, is a complex of genetically diverse isolates highly phylogenetically related to T. cruzi-like species, Trypanosoma cruzi marinkellei and Trypanosoma dionisii, all sharing morphology of blood and culture forms and development within cells. However, they differ in hosts, vectors and pathogenicity: T. cruzi is a human pathogen infective to virtually all mammals whilst the other two species are non-pathogenic and bat restricted. Previous studies suggest that variations in expression levels and genetic diversity of cruzipain, the major isoform of cathepsin L-like (CATL) enzymes of T. cruzi, correlate with levels of cellular invasion, differentiation, virulence and pathogenicity of distinct strains. In this study, we compared 80 sequences of genes encoding cruzipain from 25 T. cruzi isolates representative of all discrete typing units (DTUs TcI-TcVI) and the new genotype Tcbat and 10 sequences of homologous genes from other species. The catalytic domain repertoires diverged according to DTUs and trypanosome species. Relatively homogeneous sequences are found within and among isolates of the same DTU except TcV and TcVI, which displayed sequences unique or identical to those of TcII and TcIII, supporting their origin from the hybridization between these two DTUs. In network genealogies, sequences from T. cruzi clustered tightly together and closer to T. c. marinkellei than to T. dionisii and largely differed from homologues of T. rangeli and T. b. brucei. Here, analysis of isolates representative of the overall biological and genetic diversity of T. cruzi and closest T. cruzi-like species evidenced DTU- and species-specific polymorphisms corroborating phylogenetic relationships inferred with other genes. Comparison of both phylogenetically close and distant trypanosomes is valuable to understand host-parasite interactions, virulence and pathogenicity. Our findings corroborate cruzipain as valuable target for drugs, vaccine, diagnostic and genotyping approaches.

  18. Structural Characterization and Oligomerization of the TssL Protein, a Component Shared by Bacterial Type VI and Type IVb Secretion Systems*

    PubMed Central

    Durand, Eric; Zoued, Abdelrahim; Spinelli, Silvia; Watson, Paul J. H.; Aschtgen, Marie-Stéphanie; Journet, Laure; Cambillau, Christian; Cascales, Eric

    2012-01-01

    The Type VI secretion system (T6SS) is a macromolecular system distributed in Gram-negative bacteria, responsible for the secretion of effector proteins into target cells. The T6SS has a broad versatility as it can target both eukaryotic and prokaryotic cells. It is therefore involved in host pathogenesis or killing neighboring bacterial cells to colonize a new niche. At the architecture level, the T6SS core apparatus is composed of 13 proteins, which assemble in two subcomplexes. One of these subcomplexes, composed of subunits that share structural similarities with bacteriophage tail and baseplate components, is anchored to the cell envelope by the membrane subcomplex. This latter is constituted of at least three proteins, TssL, TssM, and TssJ. The crystal structure of the TssJ outer membrane lipoprotein and its interaction with the inner membrane TssM protein have been recently reported. TssL and TssM share sequence homology and characteristics with two components of the Type IVb secretion system (T4bSS), IcmH/DotU and IcmF, respectively. In this study, we report the crystal structure of the cytoplasmic domain of the TssL inner membrane protein from the enteroaggregative Escherichia coli Sci-1 T6SS. It folds as a hook-like structure composed of two three-helix bundles. Two TssL molecules associate to form a functional complex. Although the TssL trans-membrane segment is the main determinant of self-interaction, contacts between the cytoplasmic domains are required for TssL function. Based on sequence homology and secondary structure prediction, we propose that the TssL structure is the prototype for the members of the TssL and IcmH/DotU families. PMID:22371492

  19. Template Dimerization Promotes an Acceptor Invasion-Induced Transfer Mechanism during Human Immunodeficiency Virus Type 1 Minus-Strand Synthesis

    PubMed Central

    Balakrishnan, Mini; Roques, Bernard P.; Fay, Philip J.; Bambara, Robert A.

    2003-01-01

    The biochemical mechanism of template switching by human immunodeficiency virus type 1 (HIV-1) reverse transcriptase and the role of template dimerization were examined. Homologous donor-acceptor template pairs derived from the HIV-1 untranslated leader region and containing the wild-type and mutant dimerization initiation sequences (DIS) were used to examine the efficiency and distribution of transfers. Inhibiting donor-acceptor interaction was sufficient to reduce transfers in DIS-containing template pairs, indicating that template dimerization, and not the mere presence of the DIS, promotes efficient transfers. Additionally, we show evidence that the overall transfer process spans an extended region of the template and proceeds through a two-step mechanism. Transfer is initiated through an RNase H-facilitated acceptor invasion step, while synthesis continues on the donor template. The invasion then propagates towards the primer terminus by branch migration. Transfer is completed with the translocation of the primer terminus at a site distant from the invasion point. In our system, most invasions initiated before synthesis reached the DIS. However, transfer of the primer terminus predominantly occurred after synthesis through the DIS. The two steps were separated by 60 to 80 nucleotides. Sequence markers revealed the position of primer terminus switch, whereas DNA oligomers designed to block acceptor-cDNA interactions defined sites of invasion. Within the region of homology, certain positions on the template were inherently more favorable for invasion than others. In templates with DIS, the proximity of the acceptor facilitates invasion, thereby enhancing transfer efficiency. Nucleocapsid protein enhanced the overall efficiency of transfers but did not alter the mechanism. PMID:12663778

  20. A proposed architecture for lecithin cholesterol acyl transferase (LCAT): identification of the catalytic triad and molecular modeling.

    PubMed Central

    Peelman, F.; Vinaimont, N.; Verhee, A.; Vanloo, B.; Verschelde, J. L.; Labeur, C.; Seguret-Mace, S.; Duverger, N.; Hutchinson, G.; Vandekerckhove, J.; Tavernier, J.; Rosseneu, M.

    1998-01-01

    The enzyme cholesterol lecithin acyl transferase (LCAT) shares the Ser/Asp-Glu/His triad with lipases, esterases and proteases, but the low level of sequence homology between LCAT and these enzymes did not allow for the LCAT fold to be identified yet. We, therefore, relied upon structural homology calculations using threading methods based on alignment of the sequence against a library of solved three-dimensional protein structures, for prediction of the LCAT fold. We propose that LCAT, like lipases, belongs to the alpha/beta hydrolase fold family, and that the central domain of LCAT consists of seven conserved parallel beta-strands connected by four alpha-helices and separated by loops. We used the conserved features of this protein fold for the prediction of functional domains in LCAT, and carried out site-directed mutagenesis for the localization of the active site residues. The wild-type enzyme and mutants were expressed in Cos-1 cells. LCAT mass was measured by ELISA, and enzymatic activity was measured on recombinant HDL, on LDL and on a monomeric substrate. We identified D345 and H377 as the catalytic residues of LCAT, together with F103 and L182 as the oxyanion hole residues. In analogy with lipases, we further propose that a potential "lid" domain at residues 50-74 of LCAT might be involved in the enzyme-substrate interaction. Molecular modeling of human LCAT was carried out using human pancreatic and Candida antarctica lipases as templates. The three-dimensional model proposed here is compatible with the position of natural mutants for either LCAT deficiency or Fish-eye disease. It enables moreover prediction of the LCAT domains involved in the interaction with the phospholipid and cholesterol substrates. PMID:9541390

  1. Two amino acid residues confer different binding affinities of Abelson family kinase SRC homology 2 domains for phosphorylated cortactin.

    PubMed

    Gifford, Stacey M; Liu, Weizhi; Mader, Christopher C; Halo, Tiffany L; Machida, Kazuya; Boggon, Titus J; Koleske, Anthony J

    2014-07-11

    The closely related Abl family kinases, Arg and Abl, play important non-redundant roles in the regulation of cell morphogenesis and motility. Despite similar N-terminal sequences, Arg and Abl interact with different substrates and binding partners with varying affinities. This selectivity may be due to slight differences in amino acid sequence leading to differential interactions with target proteins. We report that the Arg Src homology (SH) 2 domain binds two specific phosphotyrosines on cortactin, a known Abl/Arg substrate, with over 10-fold higher affinity than the Abl SH2 domain. We show that this significant affinity difference is due to the substitution of arginine 161 and serine 187 in Abl to leucine 207 and threonine 233 in Arg, respectively. We constructed Abl SH2 domains with R161L and S187T mutations alone and in combination and find that these substitutions are sufficient to convert the low affinity Abl SH2 domain to a higher affinity "Arg-like" SH2 domain in binding to a phospho-cortactin peptide. We crystallized the Arg SH2 domain for structural comparison to existing crystal structures of the Abl SH2 domain. We show that these two residues are important determinants of Arg and Abl SH2 domain binding specificity. Finally, we expressed Arg containing an "Abl-like" low affinity mutant Arg SH2 domain (L207R/T233S) and find that this mutant, although properly localized to the cell periphery, does not support wild type levels of cell edge protrusion. Together, these observations indicate that these two amino acid positions confer different binding affinities and cellular functions on the distinct Abl family kinases. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

  2. Structural basis of toxicity and immunity in contact-dependent growth inhibition (CDI) systems.

    PubMed

    Morse, Robert P; Nikolakakis, Kiel C; Willett, Julia L E; Gerrick, Elias; Low, David A; Hayes, Christopher S; Goulding, Celia W

    2012-12-26

    Contact-dependent growth inhibition (CDI) systems encode polymorphic toxin/immunity proteins that mediate competition between neighboring bacterial cells. We present crystal structures of CDI toxin/immunity complexes from Escherichia coli EC869 and Burkholderia pseudomallei 1026b. Despite sharing little sequence identity, the toxin domains are structurally similar and have homology to endonucleases. The EC869 toxin is a Zn(2+)-dependent DNase capable of completely degrading the genomes of target cells, whereas the Bp1026b toxin cleaves the aminoacyl acceptor stems of tRNA molecules. Each immunity protein binds and inactivates its cognate toxin in a unique manner. The EC869 toxin/immunity complex is stabilized through an unusual β-augmentation interaction. In contrast, the Bp1026b immunity protein exploits shape and charge complementarity to occlude the toxin active site. These structures represent the initial glimpse into the CDI toxin/immunity network, illustrating how sequence-diverse toxins adopt convergent folds yet retain distinct binding interactions with cognate immunity proteins. Moreover, we present visual demonstration of CDI toxin delivery into a target cell.

  3. Peptidoglycan-Sensing Receptors Trigger the Formation of Functional Amyloids of the Adaptor Protein Imd to Initiate Drosophila NF-κB Signaling.

    PubMed

    Kleino, Anni; Ramia, Nancy F; Bozkurt, Gunes; Shen, Yanfang; Nailwal, Himani; Huang, Jing; Napetschnig, Johanna; Gangloff, Monique; Chan, Francis Ka-Ming; Wu, Hao; Li, Jixi; Silverman, Neal

    2017-10-17

    In the Drosophila immune response, bacterial derived diaminopimelic acid-type peptidoglycan binds the receptors PGRP-LC and PGRP-LE, which through interaction with the adaptor protein Imd leads to activation of the NF-κB homolog Relish and robust antimicrobial peptide gene expression. PGRP-LC, PGRP-LE, and Imd each contain a motif with some resemblance to the RIP Homotypic Interaction Motif (RHIM), a domain found in mammalian RIPK proteins forming functional amyloids during necroptosis. Here we found that despite sequence divergence, these Drosophila cryptic RHIMs formed amyloid fibrils in vitro and in cells. Amyloid formation was required for signaling downstream of Imd, and in contrast to the mammalian RHIMs, was not associated with cell death. Furthermore, amyloid formation constituted a regulatable step and could be inhibited by Pirk, an endogenous feedback regulator of this pathway. Thus, diverse sequence motifs are capable of forming amyloidal signaling platforms, and the formation of these platforms may present a regulatory point in multiple biological processes. Copyright © 2017 Elsevier Inc. All rights reserved.

  4. Nucleotide sequence of the L1 ribosomal protein gene of Xenopus laevis: remarkable sequence homology among introns.

    PubMed Central

    Loreni, F; Ruberti, I; Bozzoni, I; Pierandrei-Amaldi, P; Amaldi, F

    1985-01-01

    Ribosomal protein L1 is encoded by two genes in Xenopus laevis. The comparison of two cDNA sequences shows that the two L1 gene copies (L1a and L1b) have diverged in many silent sites and very few substitution sites; moreover a small duplication occurred at the very end of the coding region of the L1b gene which thus codes for a product five amino acids longer than that coded by L1a. Quantitatively the divergence between the two L1 genes confirms that a whole genome duplication took place in Xenopus laevis approximately 30 million years ago. A genomic fragment containing one of the two L1 gene copies (L1a), with its nine introns and flanking regions, has been completely sequenced. The 5' end of this gene has been mapped within a 20-pyridimine stretch as already found for other vertebrate ribosomal protein genes. Four of the nine introns have a 60-nucleotide sequence with 80% homology; within this region some boxes, one of which is 16 nucleotides long, are 100% homologous among the four introns. This feature of L1a gene introns is interesting since we have previously shown that the activity of this gene is regulated at a post-transcriptional level and it involves the block of the normal splicing of some intron sequences. Images Fig. 3. Fig. 5. PMID:3841512

  5. MIPS: analysis and annotation of proteins from whole genomes

    PubMed Central

    Mewes, H. W.; Amid, C.; Arnold, R.; Frishman, D.; Güldener, U.; Mannhaupt, G.; Münsterkötter, M.; Pagel, P.; Strack, N.; Stümpflen, V.; Warfsmann, J.; Ruepp, A.

    2004-01-01

    The Munich Information Center for Protein Sequences (MIPS-GSF), Neuherberg, Germany, provides protein sequence-related information based on whole-genome analysis. The main focus of the work is directed toward the systematic organization of sequence-related attributes as gathered by a variety of algorithms, primary information from experimental data together with information compiled from the scientific literature. MIPS maintains automatically generated and manually annotated genome-specific databases, develops systematic classification schemes for the functional annotation of protein sequences and provides tools for the comprehensive analysis of protein sequences. This report updates the information on the yeast genome (CYGD), the Neurospora crassa genome (MNCDB), the database of complete cDNAs (German Human Genome Project, NGFN), the database of mammalian protein–protein interactions (MPPI), the database of FASTA homologies (SIMAP), and the interface for the fast retrieval of protein-associated information (QUIPOS). The Arabidopsis thaliana database, the rice database, the plant EST databases (MATDB, MOsDB, SPUTNIK), as well as the databases for the comprehensive set of genomes (PEDANT genomes) are described elsewhere in the 2003 and 2004 NAR database issues, respectively. All databases described, and the detailed descriptions of our projects can be accessed through the MIPS web server (http://mips.gsf.de). PMID:14681354

  6. MIPS: analysis and annotation of proteins from whole genomes.

    PubMed

    Mewes, H W; Amid, C; Arnold, R; Frishman, D; Güldener, U; Mannhaupt, G; Münsterkötter, M; Pagel, P; Strack, N; Stümpflen, V; Warfsmann, J; Ruepp, A

    2004-01-01

    The Munich Information Center for Protein Sequences (MIPS-GSF), Neuherberg, Germany, provides protein sequence-related information based on whole-genome analysis. The main focus of the work is directed toward the systematic organization of sequence-related attributes as gathered by a variety of algorithms, primary information from experimental data together with information compiled from the scientific literature. MIPS maintains automatically generated and manually annotated genome-specific databases, develops systematic classification schemes for the functional annotation of protein sequences and provides tools for the comprehensive analysis of protein sequences. This report updates the information on the yeast genome (CYGD), the Neurospora crassa genome (MNCDB), the database of complete cDNAs (German Human Genome Project, NGFN), the database of mammalian protein-protein interactions (MPPI), the database of FASTA homologies (SIMAP), and the interface for the fast retrieval of protein-associated information (QUIPOS). The Arabidopsis thaliana database, the rice database, the plant EST databases (MATDB, MOsDB, SPUTNIK), as well as the databases for the comprehensive set of genomes (PEDANT genomes) are described elsewhere in the 2003 and 2004 NAR database issues, respectively. All databases described, and the detailed descriptions of our projects can be accessed through the MIPS web server (http://mips.gsf.de).

  7. Homologous prominence non-radial eruptions: A case study

    NASA Astrophysics Data System (ADS)

    Duchlev, P.; Koleva, K.; Madjarska, M. S.; Dechev, M.

    2016-10-01

    The present study provides important details on homologous eruptions of a solar prominence that occurred in active region NOAA 10904 on 2006 August 22. We report on the pre-eruptive phase of the homologous feature as well as the kinematics and the morphology of a forth from a series of prominence eruptions that is critical in defining the nature of the previous consecutive eruptions. The evolution of the overlying coronal field during homologous eruptions is discussed and a new observational criterion for homologous eruptions is provided. We find a distinctive sequence of three activation periods each of them containing pre-eruptive precursors such as a brightening and enlarging of the prominence body followed by small surge-like ejections from its southern end observed in the radio 17 GHz. We analyse a fourth eruption that clearly indicates a full reformation of the prominence after the third eruption. The fourth eruption although occurring 11 h later has an identical morphology, the same angle of propagation with respect to the radial direction, as well as similar kinematic evolution as the previous three eruptions. We find an important feature of the homologous eruptive prominence sequence that is the maximum height increase of each consecutive eruption. The present analysis establishes that all four eruptions observed in Hα are of confined type with the third eruption undergoing a thermal disappearance during its eruptive phase. We suggest that the observation of the same direction of the magnetic flux rope (MFR) ejections can be consider as an additional observational criterion for MFR homology. This observational indication for homologous eruptions is important, especially in the case of events of typical or poorly distinguishable morphology of eruptive solar phenomena.

  8. Simultaneous Binding of Two Peptidyl Ligands by a Src Homology 2 Domain

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhang, Yanyan; Zhang, Jinjin; Yuan, Chunhua

    Src homology 2 (SH2) domains mediate protein-protein interactions by recognizing phosphotyrosine (pY)-containing sequences of target proteins. In all of the SH2 domain-pY peptide interactions described to date, the SH2 domain binds to a single pY peptide. Here, determination of the cocrystal structure of the N-terminal SH2 domain of phosphatase SHP-2 bound to a class IV peptide (VIpYFVP) revealed a noncanonical 1:2 (protein-peptide) complex. The first peptide binds in a canonical manner with its pY side chain inserted in the usual binding pocket, while the second pairs up with the first to form two antiparallel {beta}-strands that extend the central {beta}-sheetmore » of the SH2 domain. This unprecedented binding mode was confirmed in the solution phase by NMR experiments and shown to be adopted by pY peptides derived from cellular proteins. Site-directed mutagenesis and surface plasmon resonance studies revealed that the binding of the first peptide is pY-dependent, but phosphorylation is not required for the second peptide. Our findings suggest a potential new function for the SH2 domain as a molecular clamp to promote dimerization of signaling proteins.« less

  9. cDNA cloning of the human peroxisomal enoyl-CoA hydratase: 3-Hydroxyacyl-CoA dehydrogenase bifunctional enzyme and localization to chromosome 3q26. 3-3q28: A free left Alu arm is inserted in the 3[prime] noncoding region

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hoefler, G.; Forstner, M.; Hulla, W.

    1994-01-01

    Enoyl-CoA hydratase:3-hydroxyacyl-CoA dehydrogenase bifunctional enzyme is one of the four enzymes of the peroxisomal, [beta]-oxidation pathway. Here, the authors report the full-length human cDNA sequence and the localization of the corresponding gene on chromosome 3q26.3-3q28. The cDNA sequence spans 3779 nucleotides with an open reading frame of 2169 nucleotides. The tripeptide SKL at the carboxy terminus, known to serve as a peroxisomal targeting signal, is present. DNA sequence comparison of the coding region showed an 80% homology between human and rat bifunctional enzyme cDNA. The 3[prime] noncoding sequence contains 117 nucleotides homologous to an Alu repeat. Based on sequence comparison,more » they propose that these nucleotides are a free left Alu arm with 86% homology to the Alu-J family. RNA analysis shows one band with highest intensity in liver and kidney. This cDNA will allow in-depth studies of molecular defects in patients with defective peroxisomal bifunctional enzyme. Moreover, it will also provide a means for studying the regulation of peroxisomal [beta]-oxidation in humans. 33 refs., 5 figs.« less

  10. Osteoblast-specific factor 2: cloning of a putative bone adhesion protein with homology with the insect protein fasciclin I.

    PubMed Central

    Takeshita, S; Kikuno, R; Tezuka, K; Amann, E

    1993-01-01

    A cDNA library prepared from the mouse osteoblastic cell line MC3T3-E1 was screened for the presence of specifically expressed genes by employing a combined subtraction hybridization/differential screening approach. A cDNA was identified and sequenced which encodes a protein designated osteoblast-specific factor 2 (OSF-2) comprising 811 amino acids. OSF-2 has a typical signal sequence, followed by a cysteine-rich domain, a fourfold repeated domain and a C-terminal domain. The protein lacks a typical transmembrane region. The fourfold repeated domain of OSF-2 shows homology with the insect protein fasciclin I. RNA analyses revealed that OSF-2 is expressed in bone and to a lesser extent in lung, but not in other tissues. Mouse OSF-2 cDNA was subsequently used as a probe to clone the human counterpart. Mouse and human OSF-2 show a high amino acid sequence conservation except for the signal sequence and two regions in the C-terminal domain in which 'in-frame' insertions or deletions are observed, implying alternative splicing events. On the basis of the amino acid sequence homology with fasciclin I, we suggest that OSF-2 functions as a homophilic adhesion molecule in bone formation. Images Figure 3 Figure 4 Figure 5 Figure 6 PMID:8363580

  11. Construction and production of oncotropic vectors, derived from MVM(p), that share reduced sequence homology with helper plasmids.

    PubMed

    Clément, Nathalie; Velu, Thierry; Brandenburger, Annick

    2002-09-01

    The production of currently available vectors derived from autonomous parvoviruses requires the expression of capsid proteins in trans, from helper sequences. Cotransfection of a helper plasmid always generates significant amounts of replication-competent virus (RCV) that can be reduced by the integration of helper sequences into a packaging cell line. Although stocks of minute virus of mice (MVM)-based vectors with no detectable RCV could be produced by transfection into packaging cells; the latter appear after one or two rounds of replication, precluding further amplification of the vector stock. Indeed, once RCVs become detectable, they are efficiently amplified and rapidly take over the culture. Theoretically RCV-free vector stocks could be produced if all homology between vector and helper DNA is eliminated, thus preventing homologous recombination. We constructed new vectors based on the structure of spontaneously occurring defective particles of MVM. Based on published observations related to the size of vectors and the sequence of the viral origin of replication, these vectors were modified by the insertion of foreign DNA sequences downstream of the transgene and by the introduction of a consensus NS-1 nick site near the origin of replication to optimize their production. In one of the vectors the inserted fragment of mouse genomic DNA had a synergistic effect with the modified origin of replication in increasing vector production.

  12. Assignment of the human caltractin gene (CALT) to Xq28 by fluorescence in situ hybridization

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tanaka, Tanaka; Okui, Keiko; Nakamura, Yusuke

    1994-12-01

    The centrosome is the major microtubule-organizing center of interphase eukaryotic cells, an its duplication is essential to eukaryotic cell division. Caltractin, a structural component of centrosomes, is highly homologous in amino acid sequence to the product of the CDC31 gene of Saccharomyces cerevisiae. In S. cerevisiae, an important role for CDC31 in duplication of the spindle pole body (SPB), a kind of microtubule-organizing center, has been demonstrated by an experiment in which mutant CDC31 prevented SPB duplication and led to formation of a monopolar spindle. In view of the localization of human caltractin in centrosomes and the sequence homology itmore » bears to yeast CDC31, it is reasonable to assume that caltractin functions in humans as CDC31 does in yeast. As a part of the Human Genome Project, we have been determining nucleotide sequences of DNA clones randomly selected from a directionally cloned cDNA library constructed from fetal brain mRNA obtained from Clontech (La Jolla, CA). By comparing 5{prime} partial DNA sequences of these cDNA clones with known DNA sequences in the database, we found one clone that was highly homologous to the caltractin gene of Chlamydomonas, which turned out to be the same as a human gene identified recently. 4 refs., 1 fig.« less

  13. Structural analysis of key gap junction domains--Lessons from genome data and disease-linked mutants.

    PubMed

    Bai, Donglin

    2016-02-01

    A gap junction (GJ) channel is formed by docking of two GJ hemichannels and each of these hemichannels is a hexamer of connexins. All connexin genes have been identified in human, mouse, and rat genomes and their homologous genes in many other vertebrates are available in public databases. The protein sequences of these connexins align well with high sequence identity in the same connexin across different species. Domains in closely related connexins and several residues in all known connexins are also well-conserved. These conserved residues form signatures (also known as sequence logos) in these domains and are likely to play important biological functions. In this review, the sequence logos of individual connexins, groups of connexins with common ancestors, and all connexins are analyzed to visualize natural evolutionary variations and the hot spots for human disease-linked mutations. Several gap junction domains are homologous, likely forming similar structures essential for their function. The availability of a high resolution Cx26 GJ structure and the subsequently-derived homology structure models for other connexin GJ channels elevated our understanding of sequence logos at the three-dimensional GJ structure level, thus facilitating the understanding of how disease-linked connexin mutants might impair GJ structure and function. This knowledge will enable the design of complementary variants to rescue disease-linked mutants. Copyright © 2015 Elsevier Ltd. All rights reserved.

  14. Saccharomyces cerevisiae SSB1 protein and its relationship to nucleolar RNA-binding proteins.

    PubMed Central

    Jong, A Y; Clark, M W; Gilbert, M; Oehm, A; Campbell, J L

    1987-01-01

    To better define the function of Saccharomyces cerevisiae SSB1, an abundant single-stranded nucleic acid-binding protein, we determined the nucleotide sequence of the SSB1 gene and compared it with those of other proteins of known function. The amino acid sequence contains 293 amino acid residues and has an Mr of 32,853. There are several stretches of sequence characteristic of other eucaryotic single-stranded nucleic acid-binding proteins. At the amino terminus, residues 39 to 54 are highly homologous to a peptide in calf thymus UP1 and UP2 and a human heterogeneous nuclear ribonucleoprotein. Residues 125 to 162 constitute a fivefold tandem repeat of the sequence RGGFRG, the composition of which suggests a nucleic acid-binding site. Near the C terminus, residues 233 to 245 are homologous to several RNA-binding proteins. Of 18 C-terminal residues, 10 are acidic, a characteristic of the procaryotic single-stranded DNA-binding proteins and eucaryotic DNA- and RNA-binding proteins. In addition, examination of the subcellular distribution of SSB1 by immunofluorescence microscopy indicated that SSB1 is a nuclear protein, predominantly located in the nucleolus. Sequence homologies and the nucleolar localization make it likely that SSB1 functions in RNA metabolism in vivo, although an additional role in DNA metabolism cannot be excluded. Images PMID:2823109

  15. Phylogenetic distribution of plant snoRNA families.

    PubMed

    Patra Bhattacharya, Deblina; Canzler, Sebastian; Kehr, Stephanie; Hertel, Jana; Grosse, Ivo; Stadler, Peter F

    2016-11-24

    Small nucleolar RNAs (snoRNAs) are one of the most ancient families amongst non-protein-coding RNAs. They are ubiquitous in Archaea and Eukarya but absent in bacteria. Their main function is to target chemical modifications of ribosomal RNAs. They fall into two classes, box C/D snoRNAs and box H/ACA snoRNAs, which are clearly distinguished by conserved sequence motifs and the type of chemical modification that they govern. Similarly to microRNAs, snoRNAs appear in distinct families of homologs that affect homologous targets. In animals, snoRNAs and their evolution have been studied in much detail. In plants, however, their evolution has attracted comparably little attention. In order to chart the phylogenetic distribution of individual snoRNA families in plants, we applied a sophisticated approach for identifying homologs of known plant snoRNAs across the plant kingdom. In response to the relatively fast evolution of snoRNAs, information on conserved sequence boxes, target sequences, and secondary structure is combined to identify additional snoRNAs. We identified 296 families of snoRNAs in 24 species and traced their evolution throughout the plant kingdom. Many of the plant snoRNA families comprise paralogs. We also found that targets are well-conserved for most snoRNA families. The sequence conservation of snoRNAs is sufficient to establish homologies between phyla. The degree of this conservation tapers off, however, between land plants and algae. Plant snoRNAs are frequently organized in highly conserved spatial clusters. As a resource for further investigations we provide carefully curated and annotated alignments for each snoRNA family under investigation.

  16. Divergence and evolution of homologous regions of Bombyx mori nuclear polyhedrosis virus.

    PubMed Central

    Majima, K; Kobara, R; Maeda, S

    1993-01-01

    Homologous regions (hrs) (hr1,hr2-left,hr2-right,hr3,hr4-left,hr 4-right, and hr5) similar to those found in the Autographa californica nuclear polyhedrosis virus (AcNPV) genome were found in the Bombyx mori NPV (BmNPV) genome. The BmNPV hrs contained two to eight repeats of a homologous nucleotide sequence which were on average about 75 bp long. All of these homologous sequence repeats contained a 26-bp-long palindrome motif with an EcoRI or EcoRI-like site at its core. The consensus sequence of the BmNPV hrs showed 95% conservation with respect to those found in AcNPV. Nucleotide sequence analysis indicated that hr2-left and hr2-right of BmNPV evolved from an ancestor similar to hr2 of AcNPV by inversion, cleavage, and ligation. The polarities of the BmNPV and AcNPV hrs were conserved except for that of hr4-left. Within hr4-right of BmNPV, four repeats of a previously underscribed palindrome motif were found. Bmhr5D, a BmNPV mutant which lacked hr5, replicated at a rate similar to that of wild-type BmNPV in BmN cells and silkworm larvae, indicating that hr5 was not essential for viral replication. After ten passages of Bmhr5D in BmN cells, no detectable changes in its genome were observed by restriction endonuclease analysis. The evolution and divergence of the BmNPV genome are also discussed. Images PMID:8230471

  17. The roles of WRN and BLM RecQ helicases in the Alternative Lengthening of Telomeres

    PubMed Central

    Mendez-Bermudez, Aaron; Hidalgo-Bravo, Alberto; Cotton, Victoria E.; Gravani, Athanasia; Jeyapalan, Jennie N.; Royle, Nicola J.

    2012-01-01

    Approximately 10% of all cancers, but a higher proportion of sarcomas, use the recombination-based alternative lengthening of telomeres (ALT) to maintain telomeres. Two RecQ helicase genes, BLM and WRN, play important roles in homologous recombination repair and they have been implicated in telomeric recombination activity, but their precise roles in ALT are unclear. Using analysis of sequence variation present in human telomeres, we found that a WRN– ALT+ cell line lacks the class of complex telomere mutations attributed to inter-telomeric recombination in other ALT+ cell lines. This suggests that WRN facilitates inter-telomeric recombination when there are sequence differences between the donor and recipient molecules or that sister-telomere interactions are suppressed in the presence of WRN and this promotes inter-telomeric recombination. Depleting BLM in the WRN– ALT+ cell line increased the mutation frequency at telomeres and at the MS32 minisatellite, which is a marker of ALT. The absence of complex telomere mutations persisted in BLM-depleted clones, and there was a clear increase in sequence homogenization across the telomere and MS32 repeat arrays. These data indicate that BLM suppresses unequal sister chromatid interactions that result in excessive homogenization at MS32 and at telomeres in ALT+ cells. PMID:22989712

  18. The roles of WRN and BLM RecQ helicases in the Alternative Lengthening of Telomeres.

    PubMed

    Mendez-Bermudez, Aaron; Hidalgo-Bravo, Alberto; Cotton, Victoria E; Gravani, Athanasia; Jeyapalan, Jennie N; Royle, Nicola J

    2012-11-01

    Approximately 10% of all cancers, but a higher proportion of sarcomas, use the recombination-based alternative lengthening of telomeres (ALT) to maintain telomeres. Two RecQ helicase genes, BLM and WRN, play important roles in homologous recombination repair and they have been implicated in telomeric recombination activity, but their precise roles in ALT are unclear. Using analysis of sequence variation present in human telomeres, we found that a WRN- ALT+ cell line lacks the class of complex telomere mutations attributed to inter-telomeric recombination in other ALT+ cell lines. This suggests that WRN facilitates inter-telomeric recombination when there are sequence differences between the donor and recipient molecules or that sister-telomere interactions are suppressed in the presence of WRN and this promotes inter-telomeric recombination. Depleting BLM in the WRN- ALT+ cell line increased the mutation frequency at telomeres and at the MS32 minisatellite, which is a marker of ALT. The absence of complex telomere mutations persisted in BLM-depleted clones, and there was a clear increase in sequence homogenization across the telomere and MS32 repeat arrays. These data indicate that BLM suppresses unequal sister chromatid interactions that result in excessive homogenization at MS32 and at telomeres in ALT+ cells.

  19. A discriminative method for protein remote homology detection and fold recognition combining Top-n-grams and latent semantic analysis.

    PubMed

    Liu, Bin; Wang, Xiaolong; Lin, Lei; Dong, Qiwen; Wang, Xuan

    2008-12-01

    Protein remote homology detection and fold recognition are central problems in bioinformatics. Currently, discriminative methods based on support vector machine (SVM) are the most effective and accurate methods for solving these problems. A key step to improve the performance of the SVM-based methods is to find a suitable representation of protein sequences. In this paper, a novel building block of proteins called Top-n-grams is presented, which contains the evolutionary information extracted from the protein sequence frequency profiles. The protein sequence frequency profiles are calculated from the multiple sequence alignments outputted by PSI-BLAST and converted into Top-n-grams. The protein sequences are transformed into fixed-dimension feature vectors by the occurrence times of each Top-n-gram. The training vectors are evaluated by SVM to train classifiers which are then used to classify the test protein sequences. We demonstrate that the prediction performance of remote homology detection and fold recognition can be improved by combining Top-n-grams and latent semantic analysis (LSA), which is an efficient feature extraction technique from natural language processing. When tested on superfamily and fold benchmarks, the method combining Top-n-grams and LSA gives significantly better results compared to related methods. The method based on Top-n-grams significantly outperforms the methods based on many other building blocks including N-grams, patterns, motifs and binary profiles. Therefore, Top-n-gram is a good building block of the protein sequences and can be widely used in many tasks of the computational biology, such as the sequence alignment, the prediction of domain boundary, the designation of knowledge-based potentials and the prediction of protein binding sites.

  20. Exploiting rice-sorghum synteny for targeted development of EST-SSRs to enrich the sorghum genetic linkage map.

    PubMed

    Ramu, P; Kassahun, B; Senthilvel, S; Ashok Kumar, C; Jayashree, B; Folkertsma, R T; Reddy, L Ananda; Kuruvinashetti, M S; Haussmann, B I G; Hash, C T

    2009-11-01

    The sequencing and detailed comparative functional analysis of genomes of a number of select botanical models open new doors into comparative genomics among the angiosperms, with potential benefits for improvement of many orphan crops that feed large populations. In this study, a set of simple sequence repeat (SSR) markers was developed by mining the expressed sequence tag (EST) database of sorghum. Among the SSR-containing sequences, only those sharing considerable homology with rice genomic sequences across the lengths of the 12 rice chromosomes were selected. Thus, 600 SSR-containing sorghum EST sequences (50 homologous sequences on each of the 12 rice chromosomes) were selected, with the intention of providing coverage for corresponding homologous regions of the sorghum genome. Primer pairs were designed and polymorphism detection ability was assessed using parental pairs of two existing sorghum mapping populations. About 28% of these new markers detected polymorphism in this 4-entry panel. A subset of 55 polymorphic EST-derived SSR markers were mapped onto the existing skeleton map of a recombinant inbred population derived from cross N13 x E 36-1, which is segregating for Striga resistance and the stay-green component of terminal drought tolerance. These new EST-derived SSR markers mapped across all 10 sorghum linkage groups, mostly to regions expected based on prior knowledge of rice-sorghum synteny. The ESTs from which these markers were derived were then mapped in silico onto the aligned sorghum genome sequence, and 88% of the best hits corresponded to linkage-based positions. This study demonstrates the utility of comparative genomic information in targeted development of markers to fill gaps in linkage maps of related crop species for which sufficient genomic tools are not available.

  1. The Janus Kinase (JAK) FERM and SH2 Domains: Bringing Specificity to JAK-Receptor Interactions.

    PubMed

    Ferrao, Ryan; Lupardus, Patrick J

    2017-01-01

    The Janus kinases (JAKs) are non-receptor tyrosine kinases essential for signaling in response to cytokines and interferons and thereby control many essential functions in growth, development, and immune regulation. JAKs are unique among tyrosine kinases for their constitutive yet non-covalent association with class I and II cytokine receptors, which upon cytokine binding bring together two JAKs to create an active signaling complex. JAK association with cytokine receptors is facilitated by N-terminal FERM and SH2 domains, both of which are classical mediators of peptide interactions. Together, the JAK FERM and SH2 domains mediate a bipartite interaction with two distinct receptor peptide motifs, the proline-rich "Box1" and hydrophobic "Box2," which are present in the intracellular domain of cytokine receptors. While the general sidechain chemistry of Box1 and Box2 peptides is conserved between receptors, they share very weak primary sequence homology, making it impossible to posit why certain JAKs preferentially interact with and signal through specific subsets of cytokine receptors. Here, we review the structure and function of the JAK FERM and SH2 domains in light of several recent studies that reveal their atomic structure and elucidate interaction mechanisms with both the Box1 and Box2 receptor motifs. These crystal structures demonstrate how evolution has repurposed the JAK FERM and SH2 domains into a receptor-binding module that facilitates interactions with multiple receptors possessing diverse primary sequences.

  2. Three genes in the human MHC class III region near the junction with the class II: Gene for receptor of advanced glycosylation end products, PBX2 homeobox gene and a notch homolog, human counterpart of mouse mammary tumor gene int-3

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sugaya, K.; Fukagawa, T.; Matsumoto, K.

    Cosmid walking of about 250 kb from MHC class III gene CYP21 to class II was conducted. The gene for receptor of advanced glycosylation end products of proteins (RAGE, a member of immunoglobulin super-family molecules), the PBX2 homeobox gene designated HOX12, and the human counterpart of the mouse mammary tumor gene int-3 were found. The contiguous RAGE and HOX12 genes were completely sequenced, and the human int-3 counterpart was partially sequenced and assigned to a Notch homolog. This human Notch homolog, designated NOTCH3, showed both the intracellular portion present in the mouse int-3 sequence and the extracellular portion absent inmore » the int-3. It thus corresponds to the intact form of a Notch-type transmembrane protein. About 20 kb of dense Alu clustering was found just centromeric to the NOTCH3. 48 refs., 9 figs., 2 tabs.« less

  3. Quantifying the relationship between sequence and three-dimensional structure conservation in RNA

    PubMed Central

    2010-01-01

    Background In recent years, the number of available RNA structures has rapidly grown reflecting the increased interest on RNA biology. Similarly to the studies carried out two decades ago for proteins, which gave the fundamental grounds for developing comparative protein structure prediction methods, we are now able to quantify the relationship between sequence and structure conservation in RNA. Results Here we introduce an all-against-all sequence- and three-dimensional (3D) structure-based comparison of a representative set of RNA structures, which have allowed us to quantitatively confirm that: (i) there is a measurable relationship between sequence and structure conservation that weakens for alignments resulting in below 60% sequence identity, (ii) evolution tends to conserve more RNA structure than sequence, and (iii) there is a twilight zone for RNA homology detection. Discussion The computational analysis here presented quantitatively describes the relationship between sequence and structure for RNA molecules and defines a twilight zone region for detecting RNA homology. Our work could represent the theoretical basis and limitations for future developments in comparative RNA 3D structure prediction. PMID:20550657

  4. Non-homologous isofunctional enzymes: a systematic analysis of alternative solutions in enzyme evolution.

    PubMed

    Omelchenko, Marina V; Galperin, Michael Y; Wolf, Yuri I; Koonin, Eugene V

    2010-04-30

    Evolutionarily unrelated proteins that catalyze the same biochemical reactions are often referred to as analogous - as opposed to homologous - enzymes. The existence of numerous alternative, non-homologous enzyme isoforms presents an interesting evolutionary problem; it also complicates genome-based reconstruction of the metabolic pathways in a variety of organisms. In 1998, a systematic search for analogous enzymes resulted in the identification of 105 Enzyme Commission (EC) numbers that included two or more proteins without detectable sequence similarity to each other, including 34 EC nodes where proteins were known (or predicted) to have distinct structural folds, indicating independent evolutionary origins. In the past 12 years, many putative non-homologous isofunctional enzymes were identified in newly sequenced genomes. In addition, efforts in structural genomics resulted in a vastly improved structural coverage of proteomes, providing for definitive assessment of (non)homologous relationships between proteins. We report the results of a comprehensive search for non-homologous isofunctional enzymes (NISE) that yielded 185 EC nodes with two or more experimentally characterized - or predicted - structurally unrelated proteins. Of these NISE sets, only 74 were from the original 1998 list. Structural assignments of the NISE show over-representation of proteins with the TIM barrel fold and the nucleotide-binding Rossmann fold. From the functional perspective, the set of NISE is enriched in hydrolases, particularly carbohydrate hydrolases, and in enzymes involved in defense against oxidative stress. These results indicate that at least some of the non-homologous isofunctional enzymes were recruited relatively recently from enzyme families that are active against related substrates and are sufficiently flexible to accommodate changes in substrate specificity.

  5. Identification of N-methyl-D-aspartic acid (NMDA) receptor subtype-specific binding sites that mediate direct interactions with scaffold protein PSD-95.

    PubMed

    Cousins, Sarah L; Stephenson, F Anne

    2012-04-13

    N-methyl-D-aspartate (NMDA) neurotransmitter receptors and the postsynaptic density-95 (PSD-95) membrane-associated guanylate kinase (MAGUK) family of scaffolding proteins are integral components of post-synaptic macromolecular signaling complexes that serve to propagate glutamate responses intracellularly. Classically, NMDA receptor NR2 subunits associate with PSD-95 MAGUKs via a conserved ES(E/D)V amino acid sequence located at their C termini. We previously challenged this dogma to demonstrate a second non-ES(E/D)V PSD-95-binding site in both NMDA receptor NR2A and NR2B subunits. Here, using a combination of co-immunoprecipitations from transfected mammalian cells, yeast two-hybrid interaction assays, and glutathione S-transferase (GST) pulldown assays, we show that NR2A subunits interact directly with PSD-95 via the C-terminal ESDV motif and additionally via an Src homology 3 domain-binding motif that associates with the Src homology 3 domain of PSD-95. Peptide inhibition of co-immunoprecipitations of NR2A and PSD-95 demonstrates that both the ESDV and non-ESDV sites are required for association in native brain tissue. Furthermore, we refine the non-ESDV site within NR2B to residues 1149-1157. These findings provide a molecular basis for the differential association of NMDA receptor subtypes with PSD-95 MAGUK scaffold proteins. These selective interactions may contribute to the organization, lateral mobility, and ultimately the function of NMDA receptor subtypes at synapses. Furthermore, they provide a more general molecular mechanism by which the scaffold, PSD-95, may discriminate between potential interacting partner proteins.

  6. Identification of N-Methyl-d-aspartic Acid (NMDA) Receptor Subtype-specific Binding Sites That Mediate Direct Interactions with Scaffold Protein PSD-95*

    PubMed Central

    Cousins, Sarah L.; Stephenson, F. Anne

    2012-01-01

    N-methyl-d-aspartate (NMDA) neurotransmitter receptors and the postsynaptic density-95 (PSD-95) membrane-associated guanylate kinase (MAGUK) family of scaffolding proteins are integral components of post-synaptic macromolecular signaling complexes that serve to propagate glutamate responses intracellularly. Classically, NMDA receptor NR2 subunits associate with PSD-95 MAGUKs via a conserved ES(E/D)V amino acid sequence located at their C termini. We previously challenged this dogma to demonstrate a second non-ES(E/D)V PSD-95-binding site in both NMDA receptor NR2A and NR2B subunits. Here, using a combination of co-immunoprecipitations from transfected mammalian cells, yeast two-hybrid interaction assays, and glutathione S-transferase (GST) pulldown assays, we show that NR2A subunits interact directly with PSD-95 via the C-terminal ESDV motif and additionally via an Src homology 3 domain-binding motif that associates with the Src homology 3 domain of PSD-95. Peptide inhibition of co-immunoprecipitations of NR2A and PSD-95 demonstrates that both the ESDV and non-ESDV sites are required for association in native brain tissue. Furthermore, we refine the non-ESDV site within NR2B to residues 1149–1157. These findings provide a molecular basis for the differential association of NMDA receptor subtypes with PSD-95 MAGUK scaffold proteins. These selective interactions may contribute to the organization, lateral mobility, and ultimately the function of NMDA receptor subtypes at synapses. Furthermore, they provide a more general molecular mechanism by which the scaffold, PSD-95, may discriminate between potential interacting partner proteins. PMID:22375001

  7. Molecular analysis of the split cox1 gene from the Basidiomycota Agrocybe aegerita: relationship of its introns with homologous Ascomycota introns and divergence levels from common ancestral copies.

    PubMed

    Gonzalez, P; Barroso, G; Labarère, J

    1998-10-05

    The Basidiomycota Agrocybe aegerita (Aa) mitochondrial cox1 gene (6790 nucleotides), encoding a protein of 527aa (58377Da), is split by four large subgroup IB introns possessing site-specific endonucleases assumed to be involved in intron mobility. When compared to other fungal COX1 proteins, the Aa protein is closely related to the COX1 one of the Basidiomycota Schizophyllum commune (Sc). This clade reveals a relationship with the studied Ascomycota ones, with the exception of Schizosaccharomyces pombe (Sp) which ranges in an out-group position compared with both higher fungi divisions. When comparison is extended to other kingdoms, fungal COX1 sequences are found to be more related to algae and plant ones (more than 57.5% aa similarity) than to animal sequences (53.6% aa similarity), contrasting with the previously established close relationship between fungi and animals, based on comparisons of nuclear genes. The four Aa cox1 introns are homologous to Ascomycota or algae cox1 introns sharing the same location within the exonic sequences. The percentages of identity of the intronic nucleotide sequences suggest a possible acquisition by lateral transfers of ancestral copies or of their derived sequences. These identities extend over the whole intronic sequences, arguing in favor of a transfer of the complete intron rather than a transfer limited to the encoded ORF. The intron i4 shares 74% of identity, at the nucleotidic level, with the Podospora anserina (Pa) intron i14, and up to 90.5% of aa similarity between the encoded proteins, i.e. the highest values reported to date between introns of two phylogenetically distant species. This low divergence argues for a recent lateral transfer between the two species. On the contrary, the low sequence identities (below 36%) observed between Aa i1 and the homologous Sp i1 or Prototheca wickeramii (Pw) i1 suggest a long evolution time after the separation of these sequences. The introns i2 and i3 possessed intermediate percentages of identity with their homologous Ascomycota introns. This is the first report of the complete nucleotide sequence and molecular organization of a mitochondrial cox1 gene of any member of the Basidiomycota division.

  8. Functionality of intrinsic disorder in tumor necrosis factor-α and its receptors.

    PubMed

    Uversky, Vladimir N; El-Baky, Nawal Abd; El-Fakharany, Esmail M; Sabry, Amira; Mattar, Ehab H; Uversky, Alexey V; Redwan, Elrashdy M

    2017-11-01

    Tumor necrosis factor-α (TNF-α) is a pleiotropic inflammatory cytokine that exerts potent cytotoxic effects on solid tumor cells, while not affecting their normal counterparts. It is also known that TNF-α exerts many of its biological functions via interaction with specific receptors. To understand the potential roles of intrinsic disorder in the functioning of this important cytokine, we explored the peculiarities of intrinsic disorder distribution in human TNF-α and its homologs from various species, ranging from zebrafish to chimpanzee. We also studied the peculiarities of intrinsic disorder distribution in human TNF-α receptors, TNFR1 and TNFR2. Analysis revealed that cytoplasmic domains of TNF-α and its receptors are expected to be highly disordered. Furthermore, although the sequence identities of analyzed TNF-α homologs range from 99.57% (between human and chimpanzee proteins) to 22.33% (between frog and fish proteins), their intrinsic disorder profiles are characterized by a remarkable similarity. These observations indicate that the peculiarities of distribution of the intrinsic disorder propensity within the amino acid sequences are evolutionary conserved, and therefore could be of functional importance for this family of proteins. We also show that disordered and flexible regions of human TNF-α and its TNFR1 and TNFR2 receptors are crucial for some of their biological activities. © 2017 Federation of European Biochemical Societies.

  9. Microbial population index and community structure in saline-alkaline soil using gene targeted metagenomics.

    PubMed

    Keshri, Jitendra; Mishra, Avinash; Jha, Bhavanath

    2013-03-30

    Population indices of bacteria and archaea were investigated from saline-alkaline soil and a possible microbe-environment pattern was established using gene targeted metagenomics. Clone libraries were constructed using 16S rRNA and functional gene(s) involved in carbon fixation (cbbL), nitrogen fixation (nifH), ammonia oxidation (amoA) and sulfur metabolism (apsA). Molecular phylogeny revealed the dominance of Actinobacteria, Firmicutes and Proteobacteria along with archaeal members of Halobacteraceae. The library consisted of novel bacterial (20%) and archaeal (38%) genera showing ≤95% similarity to previously retrieved sequences. Phylogenetic analysis indicated ability of inhabitant to survive in stress condition. The 16S rRNA gene libraries contained novel gene sequences and were distantly homologous with cultured bacteria. Functional gene libraries were found unique and most of the clones were distantly related to Proteobacteria, while clones of nifH gene library also showed homology with Cyanobacteria and Firmicutes. Quantitative real-time PCR exhibited that bacterial abundance was two orders of magnitude higher than archaeal. The gene(s) quantification indicated the size of the functional guilds harboring relevant key genes. The study provides insights on microbial ecology and different metabolic interactions occurring in saline-alkaline soil, possessing phylogenetically diverse groups of bacteria and archaea, which may be explored further for gene cataloging and metabolic profiling. Copyright © 2012 Elsevier GmbH. All rights reserved.

  10. Structural and transcription analysis of two homologous genes for the P700 chlorophyll a-apoproteins in Chlamydomonas reinhardii: evidence for in vivo trans-splicing

    PubMed Central

    Kück, Ulrich; Choquet, Yves; Schneider, Michel; Dron, Michel; Bennoun, Pierre

    1987-01-01

    The two homologous genes for the P700 chlorophyll a-apoproteins (ps1A1 and ps1A2) are encoded by the plastom in the green alga Chlamydomonas reinhardii. The structure and organization of the two genes were determined by comparison with the homologous genes from maize using data from heterologous hybridizations as well as from DNA and RNA sequencing. While the ps1A2 (736 codons) gene shows a continuous gene organization, the ps1A1 (754 codons) gene possesses some unusual features. The discontinuous gene is split into three separate exons which are scattered around the circular chloroplast genome. Exon 1 (86 bp) is separated by ∼50 kb from exon 2 (198 bp), which is located ∼ 90 kb apart from exon 3 (1984 bp). All exons are flanked by intronic sequences of group II. Transcription analysis reveals that the ps1A2 gene hybridizes with a 2.8-kb transcript, while all exon regions of the ps1A1 gene are homologous to a mature mRNA of 2.7 kb. From our data we conclude that the three distantly separated exonic sequences of the ps1A1 gene constitute a functional gene which probably operates by a trans-splicing mechanism. ImagesFig. 3.Fig. 5.Fig. 6. PMID:16453785

  11. Molecular cloning, sequence analysis and homology modeling of the first caudata amphibian antifreeze-like protein in axolotl (Ambystoma mexicanum).

    PubMed

    Zhang, Songyan; Gao, Jiuxiang; Lu, Yiling; Cai, Shasha; Qiao, Xue; Wang, Yipeng; Yu, Haining

    2013-08-01

    Antifreeze proteins (AFPs) refer to a class of polypeptides that are produced by certain vertebrates, plants, fungi, and bacteria and which permit their survival in subzero environments. In this study, we report the molecular cloning, sequence analysis and three-dimensional structure of the axolotl antifreeze-like protein (AFLP) by homology modeling of the first caudate amphibian AFLP. We constructed a full-length spleen cDNA library of axolotl (Ambystoma mexicanum). An EST having highest similarity (∼42%) with freeze-responsive liver protein Li16 from Rana sylvatica was identified, and the full-length cDNA was subsequently obtained by RACE-PCR. The axolotl antifreeze-like protein sequence represents an open reading frame for a putative signal peptide and the mature protein composed of 93 amino acids. The calculated molecular mass and the theoretical isoelectric point (pl) of this mature protein were 10128.6 Da and 8.97, respectively. The molecular characterization of this gene and its deduced protein were further performed by detailed bioinformatics analysis. The three-dimensional structure of current AFLP was predicted by homology modeling, and the conserved residues required for functionality were identified. The homology model constructed could be of use for effective drug design. This is the first report of an antifreeze-like protein identified from a caudate amphibian.

  12. Primary structure of rat cardiac beta-adrenergic and muscarinic cholinergic receptors obtained by automated DNA sequence analysis: further evidence for a multigene family.

    PubMed

    Gocayne, J; Robinson, D A; FitzGerald, M G; Chung, F Z; Kerlavage, A R; Lentes, K U; Lai, J; Wang, C D; Fraser, C M; Venter, J C

    1987-12-01

    Two cDNA clones, lambda RHM-MF and lambda RHB-DAR, encoding the muscarinic cholinergic receptor and the beta-adrenergic receptor, respectively, have been isolated from a rat heart cDNA library. The cDNA clones were characterized by restriction mapping and automated DNA sequence analysis utilizing fluorescent dye primers. The rat heart muscarinic receptor consists of 466 amino acids and has a calculated molecular weight of 51,543. The rat heart beta-adrenergic receptor consists of 418 amino acids and has a calculated molecular weight of 46,890. The two cardiac receptors have substantial amino acid homology (27.2% identity, 50.6% with favored substitutions). The rat cardiac beta receptor has 88.0% homology (92.5% with favored substitutions) with the human brain beta receptor and the rat cardiac muscarinic receptor has 94.6% homology (97.6% with favored substitutions) with the porcine cardiac muscarinic receptor. The muscarinic cholinergic and beta-adrenergic receptors appear to be as conserved as hemoglobin and cytochrome c but less conserved than histones and are clearly members of a multigene family. These data support our hypothesis, based upon biochemical and immunological evidence, that suggests considerable structural homology and evolutionary conservation between adrenergic and muscarinic cholinergic receptors. To our knowledge, this is the first report utilizing automated DNA sequence analysis to determine the structure of a gene.

  13. Therapeutic Potential of a Scorpion Venom-Derived Antimicrobial Peptide and Its Homologs Against Antibiotic-Resistant Gram-Positive Bacteria.

    PubMed

    Liu, Gaomin; Yang, Fan; Li, Fangfang; Li, Zhongjie; Lang, Yange; Shen, Bingzheng; Wu, Yingliang; Li, Wenxin; Harrison, Patrick L; Strong, Peter N; Xie, Yingqiu; Miller, Keith; Cao, Zhijian

    2018-01-01

    The alarming rise in the prevalence of antibiotic resistance among pathogenic bacteria poses a unique challenge for the development of effective therapeutic agents. Antimicrobial peptides (AMPs) have attracted a great deal of attention as a possible solution to the increasing problem of antibiotic-resistant bacteria. Marcin-18 was identified from the scorpion Mesobuthus martensii at both DNA and protein levels. The genomic sequence revealed that the marcin-18 coding gene contains a phase-I intron with a GT-AG splice junction located in the DNA region encoding the N -terminal part of signal peptide. The peptide marcin-18 was also isolated from scorpion venom. A protein sequence homology search revealed that marcin-18 shares extremely high sequence identity to the AMPs meucin-18 and megicin-18. In vitro , chemically synthetic marcin-18 and its homologs (meucin-18 and megicin-18) showed highly potent inhibitory activity against Gram-positive bacteria, including some clinical antibiotic-resistant strains. Importantly, in a mouse acute peritonitis model, these peptides significantly decreased the bacterial load in ascites and rescued nearly all mice heavily infected with clinical methicillin-resistant Staphylococcus aureus from lethal bacteremia. Peptides exerted antimicrobial activity via a bactericidal mechanism and killed bacteria through membrane disruption. Taken together, marcin-18 and its homologs have potential for development as therapeutic agents for treating antibiotic-resistant, Gram-positive bacterial infections.

  14. Analysis of the binding sites of vitamin D 1α-hydroxylase (CYP27B1) and vitamin D 24-hydroxylase (CYP24A1) for the design of selective CYP24A1 inhibitors: Homology modelling, molecular dynamics simulations and identification of key binding requirements.

    PubMed

    Taban, Ismail M; Zhu, Jinge; DeLuca, Hector F; Simons, Claire

    2017-10-15

    A homology model of human CYP27B1 was built using MOE and was further optimised by molecular dynamics simulations of the hCYP27B1 homology model and a hCYP27B1-SDZ-88357 complex. Docking results from the hCYP27B1-SDZ-88357 complex showed amino acids Arg107, Asn387 and Asp320 have an important role in binding interaction, with Asp320 part of the important acid-alcohol pair situated in the I-helix with the conserved sequence (A/G) GX (E/D) (T/S), which assumes an essential role in the binding of an oxygen molecule for catalysis. Additional docking experiments with selective hCYP27B1 or hCYP24A1 inhibitors using both the hCYP27B1 model and a triple mutant hCYP24A1 model provided further support for the importance of H-bonding interactions with the three identified active site amino acids. To confirm the role of Arg107, Asn387 and Asp320 in the active site of hCYP27B1 compounds were designed that would form H-bonding interactions, as determined from docking experiments with the hCYP27B1 model. Subsequent synthesis and CYP24A1 and CYP27B1 enzyme assays of the designed compounds 1a and 1b showed a∼5-fold selectivity for CYP27B1 confirming the importance of Asp320 in particular and also Asn387 and Arg107 as important amino acids for CYP27B1 inhibitory activity. Copyright © 2017 Elsevier Ltd. All rights reserved.

  15. An aureobasidin A resistance gene isolated from Aspergillus is a homolog of yeast AUR1, a gene responsible for inositol phosphorylceramide (IPC) synthase activity.

    PubMed

    Kuroda, M; Hashida-Okado, T; Yasumoto, R; Gomi, K; Kato, I; Takesako, K

    1999-03-01

    The AUR1 gene of Saccharomyces cerevisiae, mutations in which confer resistance to the antibiotic aureobasidin A, is necessary for inositol phosphorylceramide (IPC) synthase activity. We report the molecular cloning and characterization of the Aspergillus nidulans aurA gene, which is homologous to AUR1. A single point mutation in the aurA gene of A. nidulans confers a high level of resistance to aureobasidin A. The A. nidulans aurA gene was used to identify its homologs in other Aspergillus species, including A. fumigatus, A. niger, and A. oryzae. The deduced amino acid sequence of an aurA homolog from the pathogenic fungus A. fumigatus showed 87% identity to that of A. nidulans. The AurA proteins of A. nidulans and A. fumigatus shared common characteristics in primary structure, including sequence, hydropathy profile, and N-glycosylation sites, with their S. cerevisiae, Schizosaccharomyces pombe, and Candida albicans counterparts. These results suggest that the aureobasidin resistance gene is conserved evolutionarily in various fungi.

  16. Identification of Histone Deacetylase (HDAC) as a drug target against MRSA via interolog method of protein-protein interaction prediction.

    PubMed

    Uddin, Reaz; Tariq, Syeda Sumayya; Azam, Syed Sikander; Wadood, Abdul; Moin, Syed Tarique

    2017-08-30

    Patently, Protein-Protein Interactions (PPIs) lie at the core of significant biological functions and make the foundation of host-pathogen relationships. Hence, the current study is aimed to use computational biology techniques to predict host-pathogen Protein-Protein Interactions (HP-PPIs) between MRSA and Humans as potential drug targets ultimately proposing new possible inhibitors against them. As a matter of fact this study is based on the Interolog method which implies that homologous proteins retain their ability to interact. A distant homolog approach based on Interolog method was employed to speculate MRSA protein homologs in Humans using PSI-BLAST. In addition the protein interaction partners of these homologs as listed in Database of Interacting Proteins (DIP) were predicted to interact with MRSA as well. Moreover, a direct approach using BLAST was also applied so as to attain further confidence in the strategy. Consequently, the common HP-PPIs predicted by both approaches are suggested as potential drug targets (22%) whereas, the unique HP-PPIs estimated only through distant homolog approach are presented as novel drug targets (12%). Furthermore, the most repeated entry in our results was found to be MRSA Histone Deacetylase (HDAC) which was then modeled using SWISS-MODEL. Eventually, small molecules from ZINC, selected randomly, were docked against HDAC using Auto Dock and are suggested as potential binders (inhibitors) based on their energetic profiles. Thus the current study provides basis for further in-depth analysis of such data which not only include MRSA but other deadly pathogens as well. Copyright © 2017 Elsevier B.V. All rights reserved.

  17. Expression of an Atriplex nummularia gene encoding a protein homologous to the bacterial molecular chaperone DnaJ.

    PubMed Central

    Zhu, J K; Shi, J; Bressan, R A; Hasegawa, P M

    1993-01-01

    DnaJ is a 36-kD heat shock protein that functions together with Dnak (Hsp70) as a molecular chaperone in Escherichia coli. We have obtained a cDNA clone from the higher plant Atriplex nummularia that encodes a 46.6-kD polypeptide (ANJ1) with an overall 35.2% amino acid sequence identity with the E. coli DnaJ. ANJ1 has 43.4% overall sequence identity with the Saccharomyces cerevisiae cytoplasmic DnaJ homolog YDJ1/MAS5. Complementation of the yeast mas5 mutation indicated that ANJ1 is a functional homolog of YDJ1/MAS5. The presence of other DnaJ homologs in A. nummularia was demonstrated by the detection of proteins that are antigenically related to the yeast mitochondrial DnaJ homolog SCJ1 and the yeast DnaJ-related protein Sec63. Expression of the ANJ1 gene was compared with that of an A. nummularia Hsp70 gene. Expression of both ANJ1 and Hsp70 transcripts was coordinately induced by heat shock. However, noncoordinate accumulation of ANJ1 and Hsp70 mRNAs occurred during the cell growth cycle and in response to NaCl stress. PMID:8467224

  18. CPHmodels-3.0--remote homology modeling using structure-guided sequence profiles.

    PubMed

    Nielsen, Morten; Lundegaard, Claus; Lund, Ole; Petersen, Thomas Nordahl

    2010-07-01

    CPHmodels-3.0 is a web server predicting protein 3D structure by use of single template homology modeling. The server employs a hybrid of the scoring functions of CPHmodels-2.0 and a novel remote homology-modeling algorithm. A query sequence is first attempted modeled using the fast CPHmodels-2.0 profile-profile scoring function suitable for close homology modeling. The new computational costly remote homology-modeling algorithm is only engaged provided that no suitable PDB template is identified in the initial search. CPHmodels-3.0 was benchmarked in the CASP8 competition and produced models for 94% of the targets (117 out of 128), 74% were predicted as high reliability models (87 out of 117). These achieved an average RMSD of 4.6 A when superimposed to the 3D structure. The remaining 26% low reliably models (30 out of 117) could superimpose to the true 3D structure with an average RMSD of 9.3 A. These performance values place the CPHmodels-3.0 method in the group of high performing 3D prediction tools. Beside its accuracy, one of the important features of the method is its speed. For most queries, the response time of the server is <20 min. The web server is available at http://www.cbs.dtu.dk/services/CPHmodels/.

  19. [The genetical evolution of the full length genes of 5 EV 71 strains from 5 Shenzhen patients with hand-food-mouth disease associated with EV71 infection].

    PubMed

    Liu, Wei-long; Yang, Gui-lin; Wei, Qing; Zhang, Ming-xia; Chen, Xin-chun; Liu, Ying-xia; Gao, Yang; Zhou, Bo-ping

    2011-02-01

    To investigate the characteristics of molecular epidemiology and molecular evolution of 5 EV 71 (enterovirus 71, EV71) strains from 5 Shenzhen patients with hand-food-mouth disease associated with EV 71 infection. 5 EV 71 strains were isolated, and sequenced to analyzed the full length gene sequences in order to compare nucleotide and amino acid homology with other EV71 strains from other regions and countries as well as previous strains across the world through bioinformatics software. 5 strains of EV 71 belonged to sub-genotype C4 by analysis of nucleotide sequences of VP1 and VP4 of EV 71. The differences of nucleotide and amino acid sequences were much small with nucleotide homology of 93% and amino acid homology of 98% among these 5 strains. A phylogenetic tree analysis indicated that 2008 Shenzhen epidemic strains were the most close to 2004 Shenzhen circulating strains, and also much close to 1998 Shenzhen epidemic strains and 2008 Fuyang Anhui strains. The dead strain was very close to 2008 Fuyang Anhui epidemic strains. It can be speculated that this epidemic strains of EV 71 probably originate from the same ancient strain in the history, may from 1998 Shenzhen strain.

  20. Sequencing BPS spectra

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Gukov, Sergei; Nawata, Satoshi; Saberi, Ingmar

    In this article, we provide both a detailed study of color-dependence of link homologies, as realized in physics as certain spaces of BPS states, and a broad study of the behavior of BPS states in general. We consider how the spectrum of BPS states varies as continuous parameters of a theory are perturbed. This question can be posed in a wide variety of physical contexts, and we answer it by proposing that the relationship between unperturbed and perturbed BPS spectra is described by a spectral sequence. These general considerations unify previous applications of spectral sequence techniques to physics, and explainmore » from a physical standpoint the appearance of many spectral sequences relating various link homology theories to one another. We also study structural properties of colored HOMFLY homology for links and evaluate Poincar e polynomials in numerous examples. Among these structural properties is a novel "sliding" property, which can be explained by using (re fined) modular S-matrix. This leads to the identi fication of modular transformations in Chern-Simons theory and 3d N = 2 theory via the 3d/3d correspondence. In conclusion, we introduce the notion of associated varieties as classical limits of recursion relations of colored superpolynomials of links, and study their properties.« less

  1. Sequencing BPS spectra

    DOE PAGES

    Gukov, Sergei; Nawata, Satoshi; Saberi, Ingmar; ...

    2016-03-02

    In this article, we provide both a detailed study of color-dependence of link homologies, as realized in physics as certain spaces of BPS states, and a broad study of the behavior of BPS states in general. We consider how the spectrum of BPS states varies as continuous parameters of a theory are perturbed. This question can be posed in a wide variety of physical contexts, and we answer it by proposing that the relationship between unperturbed and perturbed BPS spectra is described by a spectral sequence. These general considerations unify previous applications of spectral sequence techniques to physics, and explainmore » from a physical standpoint the appearance of many spectral sequences relating various link homology theories to one another. We also study structural properties of colored HOMFLY homology for links and evaluate Poincar e polynomials in numerous examples. Among these structural properties is a novel "sliding" property, which can be explained by using (re fined) modular S-matrix. This leads to the identi fication of modular transformations in Chern-Simons theory and 3d N = 2 theory via the 3d/3d correspondence. In conclusion, we introduce the notion of associated varieties as classical limits of recursion relations of colored superpolynomials of links, and study their properties.« less

  2. A Global Comparison of the Human and T. brucei Degradomes Gives Insights about Possible Parasite Drug Targets

    PubMed Central

    Mashiyama, Susan T.; Koupparis, Kyriacos; Caffrey, Conor R.; McKerrow, James H.; Babbitt, Patricia C.

    2012-01-01

    We performed a genome-level computational study of sequence and structure similarity, the latter using crystal structures and models, of the proteases of Homo sapiens and the human parasite Trypanosoma brucei. Using sequence and structure similarity networks to summarize the results, we constructed global views that show visually the relative abundance and variety of proteases in the degradome landscapes of these two species, and provide insights into evolutionary relationships between proteases. The results also indicate how broadly these sequence sets are covered by three-dimensional structures. These views facilitate cross-species comparisons and offer clues for drug design from knowledge about the sequences and structures of potential drug targets and their homologs. Two protease groups (“M32” and “C51”) that are very different in sequence from human proteases are examined in structural detail, illustrating the application of this global approach in mining new pathogen genomes for potential drug targets. Based on our analyses, a human ACE2 inhibitor was selected for experimental testing on one of these parasite proteases, TbM32, and was shown to inhibit it. These sequence and structure data, along with interactive versions of the protein similarity networks generated in this study, are available at http://babbittlab.ucsf.edu/resources.html. PMID:23236535

  3. Definition of Cis-Acting Elements Regulating Expression of the Drosophila Melanogaster Ninae Opsin Gene by Oligonucleotide-Directed Mutagenesis

    PubMed Central

    Mismer, D.; Rubin, G. M.

    1989-01-01

    We have analyzed the cis-acting regulatory sequences of the Rh1 (ninaE) gene in Drosophila melanogaster by P-element-mediated germline transformation of indicator genes transcribed from mutant ninaE promoter sequences. We have previously shown that a 200-bp region extending from -120 to +67 relative to the transcription start site is sufficient to obtain eye-specific expression from the ninaE promoter. In the present study, 22 different 4-13-bp sequences in the -120/+67 promoter region were altered by oligonucleotide-directed mutagenesis. Several of these sequences were found to be required for proper promoter function; two of these are conserved in the promoter of the homologous gene isolated from the related species Drosophila virilis. Alteration of a conserved 9-bp sequence results in aberrant, low level expression in the body. Alteration of a separate 11-bp sequence, found in the promoter regions of several photoreceptor-specific genes of Drosophila, results in an approximately 15-fold reduction in promoter efficiency but without apparent alteration of tissue-specificity. A protein factor capable of interacting with this 11-bp sequence has been detected by DNaseI footprinting in embryonic nuclear extracts. Finally, we have further characterized two separable enhancer sequences previously shown to be required for normal levels of expression from this promoter. PMID:2521839

  4. Analysis of expressed sequence tags for Frankliniella occidentalis, the western flower thrips.

    PubMed

    Rotenberg, D; Whitfield, A E

    2010-08-01

    Thrips are members of the insect order Thysanoptera and Frankliniella occidentalis (the western flower thrips) is the most economically important pest within this order. F. occidentalis is both a direct pest of crops and an efficient vector of plant viruses, including Tomato spotted wilt virus (TSWV). Despite the world-wide importance of thrips in agriculture, there is little knowledge of the F. occidentalis genome or gene functions at this time. A normalized cDNA library was constructed from first instar thrips and 13 839 expressed sequence tags (ESTs) were obtained. Our EST data assembled into 894 contigs and 11 806 singletons (12 700 nonredundant sequences). We found that 31% of these sequences had significant similarity (E< or = 10(-10)) to protein sequences in the National Center for Biotechnology Information nonredundant (nr) protein database, and 25% were functionally annotated using Blast 2GO. We identified 74 sequences with putative homology to proteins associated with insect innate immunity. Sixteen sequences had significant similarity to proteins associated with small RNA-mediated gene silencing pathways (RNA interference; RNAi), including the antiviral pathway (short interfering RNA-mediated pathway). Our EST collection provides new sequence resources for characterizing gene functions in F. occidentalis and other thrips species with regards to vital biological processes, studying the mechanism of interactions with the viruses harboured and transmitted by the vector, and identifying new insect gene-centred targets for plant disease and insect control.

  5. Amino acid sequences of the ribosomal proteins HL30 and HmaL5 from the archaebacterium Halobacterium marismortui.

    PubMed

    Hatakeyama, T; Hatakeyama, T

    1990-07-06

    The complete amino acid sequences of the ribosomal proteins HL30 and HmaL5 from the archaebacterium Halobacterium marismortui were determined. Protein HL30 was found to be acetylated at its N-terminal amino acid and shows homology to the eukaryotic ribosomal proteins YL34 from yeast and RL31 from rat. Protein HmaL5 was homologous to the protein L5 from Escherichia coli and Bacillus stearothermophilus as well as to YL16 from yeast. HmaL5 shows more similarities to its eukaryotic counterpart than to eubacterial ones.

  6. Super elongation complex contains a TFIIF-related subcomplex

    PubMed Central

    Knutson, Bruce A.; Smith, Marissa L.; Walker-Kopp, Nancy; Xu, Xia

    2016-01-01

    ABSTRACT Super elongation complex (SEC) belongs to a family of RNA polymerase II (Pol II) elongation factors that has similar properties as TFIIF, a general transcription factor that increases the transcription elongation rate by reducing pausing. Although SEC has TFIIF-like functional properties, it apparently lacks sequence and structural homology. Using HHpred, we find that SEC contains an evolutionarily related TFIIF-like subcomplex. We show that the SEC subunit ELL interacts with the Pol II Rbp2 subunit, as expected for a TFIIF-like factor. These findings suggest a new model for how SEC functions as a Pol II elongation factor and how it suppresses Pol II pausing. PMID:27223670

  7. Cloning, overexpression and interaction of recombinant Fur from the cyanobacterium Anabaena PCC 7119 with isiB and its own promoter.

    PubMed

    Bes, M T; Hernández, J A; Peleato, M L; Fillat, M F

    2001-01-15

    A gene coding for a Fur (ferric uptake regulation) protein from the cyanobacterium Anabaena PCC 7119 has been cloned and overexpressed in Escherichia coli. DNA sequence analysis confirmed the presence of a 151-amino-acid open reading frame that showed homology with the Fur proteins reported for the unicellular cyanobacteria Synechococcus 7942 and Synechocystis PCC 6803. Two putative Fur-binding sites were detected in the promoter regions of the fur gene from Anabaena. Partially purified recombinant Fur binds to the flavodoxin promoter as well as its own promoter. This suggests that the Fur gene is autoregulated in Anabaena.

  8. Identifying Bacterial Immune Evasion Proteins Using Phage Display.

    PubMed

    Fevre, Cindy; Scheepmaker, Lisette; Haas, Pieter-Jan

    2017-01-01

    Methods aimed at identification of immune evasion proteins are mainly rely on in silico prediction of sequence, structural homology to known evasion proteins or use a proteomics driven approach. Although proven successful these methods are limited by a low efficiency and or lack of functional identification. Here we describe a high-throughput genomic strategy to functionally identify bacterial immune evasion proteins using phage display technology. Genomic bacterial DNA is randomly fragmented and ligated into a phage display vector that is used to create a phage display library expressing bacterial secreted and membrane bound proteins. This library is used to select displayed bacterial secretome proteins that interact with host immune components.

  9. Transcriptome deep-sequencing and clustering of expressed isoforms from Favia corals

    PubMed Central

    2013-01-01

    Background Genomic and transcriptomic sequence data are essential tools for tackling ecological problems. Using an approach that combines next-generation sequencing, de novo transcriptome assembly, gene annotation and synthetic gene construction, we identify and cluster the protein families from Favia corals from the northern Red Sea. Results We obtained 80 million 75 bp paired-end cDNA reads from two Favia adult samples collected at 65 m (Fav1, Fav2) on the Illumina GA platform, and generated two de novo assemblies using ABySS and CAP3. After removing redundancy and filtering out low quality reads, our transcriptome datasets contained 58,268 (Fav1) and 62,469 (Fav2) contigs longer than 100 bp, with N50 values of 1,665 bp and 1,439 bp, respectively. Using the proteome of the sea anemone Nematostella vectensis as a reference, we were able to annotate almost 20% of each dataset using reciprocal homology searches. Homologous clustering of these annotated transcripts allowed us to divide them into 7,186 (Fav1) and 6,862 (Fav2) homologous transcript clusters (E-value ≤ 2e-30). Functional annotation categories were assigned to homologous clusters using the functional annotation of Nematostella vectensis. General annotation of the assembled transcripts was improved 1-3% using the Acropora digitifera proteome. In addition, we screened these transcript isoform clusters for fluorescent proteins (FPs) homologs and identified seven potential FP homologs in Fav1, and four in Fav2. These transcripts were validated as bona fide FP transcripts via robust fluorescence heterologous expression. Annotation of the assembled contigs revealed that 1.34% and 1.61% (in Fav1 and Fav2, respectively) of the total assembled contigs likely originated from the corals’ algal symbiont, Symbiodinium spp. Conclusions Here we present a study to identify the homologous transcript isoform clusters from the transcriptome of Favia corals using a far-related reference proteome. Furthermore, the symbiont-derived transcripts were isolated from the datasets and their contribution quantified. This is the first annotated transcriptome of the genus Favia, a major increase in genomics resources available in this important family of corals. PMID:23937070

  10. The Inner Membrane Complex Sub-compartment Proteins Critical for Replication of the Apicomplexan Parasite Toxoplasma gondii Adopt a Pleckstrin Homology Fold*

    PubMed Central

    Tonkin, Michelle L.; Beck, Josh R.; Bradley, Peter J.; Boulanger, Martin J.

    2014-01-01

    Toxoplasma gondii, an apicomplexan parasite prevalent in developed nations, infects up to one-third of the human population. The success of this parasite depends on several unique structures including an inner membrane complex (IMC) that lines the interior of the plasma membrane and contains proteins important for gliding motility and replication. Of these proteins, the IMC sub-compartment proteins (ISPs) have recently been shown to play a role in asexual T. gondii daughter cell formation, yet the mechanism is unknown. Complicating mechanistic characterization of the ISPs is a lack of sequence identity with proteins of known structure or function. In support of elucidating the function of ISPs, we first determined the crystal structures of representative members TgISP1 and TgISP3 to a resolution of 2.10 and 2.32 Å, respectively. Structural analysis revealed that both ISPs adopt a pleckstrin homology fold often associated with phospholipid binding or protein-protein interactions. Substitution of basic for hydrophobic residues in the region that overlays with phospholipid binding in related pleckstrin homology domains, however, suggests that ISPs do not retain phospholipid binding activity. Consistent with this observation, biochemical assays revealed no phospholipid binding activity. Interestingly, mapping of conserved surface residues combined with crystal packing analysis indicates that TgISPs have functionally repurposed the phospholipid-binding site likely to coordinate protein partners. Recruitment of larger protein complexes may also be aided through avidity-enhanced interactions resulting from multimerization of the ISPs. Overall, we propose a model where TgISPs recruit protein partners to the IMC to ensure correct progression of daughter cell formation. PMID:24675080

  11. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Leong, JoAnn Ching

    The nucleotide sequence of the IHNV glycoprotein gene has been determined from a cDNA clone containing the entire coding region. The glycoprotein cDNA clone contained a leader sequence of 48 bases, a coding region of 1524 nucleotides, and 39 bases at the 3 foot end. The entire cDNA clone contains 1609 nucleodites and encodes a protein of 508 amino acids. The deduced amino acid sequence gave a translated molecular weight of 56,795 daltons. A hydropathicity profile of the deduced amino acid sequence indicated that there were two major hydrophobic domains: one,at the N-terminus,delineating a signal peptide of 18 amino acidsmore » and the other, at the C-terminus,delineating the region of the transmembrane. Five possible sites of N-linked glyscoylation were identified. Although no nucleic acid homology existed between the IHNV glycoprotein gene and the glycoprotein genes of rabies and VSV, there was significant homology at the amino acid level between all three rhabdovirus glycoproteins.« less

  12. The Porcelain Crab Transcriptome and PCAD, the Porcelain Crab Microarray and Sequence Database

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tagmount, Abderrahmane; Wang, Mei; Lindquist, Erika

    2010-01-27

    Background: With the emergence of a completed genome sequence of the freshwater crustacean Daphnia pulex, construction of genomic-scale sequence databases for additional crustacean sequences are important for comparative genomics and annotation. Porcelain crabs, genus Petrolisthes, have been powerful crustacean models for environmental and evolutionary physiology with respect to thermal adaptation and understanding responses of marine organisms to climate change. Here, we present a large-scale EST sequencing and cDNA microarray database project for the porcelain crab Petrolisthes cinctipes. Methodology/Principal Findings: A set of ~;;30K unique sequences (UniSeqs) representing ~;;19K clusters were generated from ~;;98K high quality ESTs from a set ofmore » tissue specific non-normalized and mixed-tissue normalized cDNA libraries from the porcelain crab Petrolisthes cinctipes. Homology for each UniSeq was assessed using BLAST, InterProScan, GO and KEGG database searches. Approximately 66percent of the UniSeqs had homology in at least one of the databases. All EST and UniSeq sequences along with annotation results and coordinated cDNA microarray datasets have been made publicly accessible at the Porcelain Crab Array Database (PCAD), a feature-enriched version of the Stanford and Longhorn Array Databases.Conclusions/Significance: The EST project presented here represents the third largest sequencing effort for any crustacean, and the largest effort for any crab species. Our assembly and clustering results suggest that our porcelain crab EST data set is equally diverse to the much larger EST set generated in the Daphnia pulex genome sequencing project, and thus will be an important resource to the Daphnia research community. Our homology results support the pancrustacea hypothesis and suggest that Malacostraca may be ancestral to Branchiopoda and Hexapoda. Our results also suggest that our cDNA microarrays cover as much of the transcriptome as can reasonably be captured in EST library sequencing approaches, and thus represent a rich resource for studies of environmental genomics.« less

  13. [Sequencing and analysis of the complete genome of a rabies virus isolate from Sika deer].

    PubMed

    Zhao, Yun-Jiao; Guo, Li; Huang, Ying; Zhang, Li-Shi; Qian, Ai-Dong

    2008-05-01

    One DRV strain was isolated from Sika Deer brain and sequenced. Nine overlapped gene fragments were amplified by RT-PCR through 3'-RACE and 5'-RACE method, and the complete DRV genome sequence was assembled. The length of the complete genome is 11863bp. The DRV genome organization was similar to other rabies viruses which were composed of five genes and the initiation sites and termination sites were highly conservative. There were mutated amino acids in important antigen sites of nucleoprotein and glycoprotein. The nucleotide and amino acid homologies of gene N, P, M, G, L in strains with completed genomie sequencing were compared. Compared with N gene sequence of other typical rabies viruses, a phylogenetic tree was established . These results indicated that DRV belonged to gene type 1. The highest homology compared with Chinese vaccine strain 3aG was 94%, and the lowest was 71% compared with WCBV. These findings provided theoretical reference for further research in rabies virus.

  14. Bacillus amyloliquefaciens ssp. plantarum F11 isolated from Algerian salty lake as a source of biosurfactants and bioactive lipopeptides.

    PubMed

    Daas, Mohamed Seghir; Acedo, Jeella Z; Rosana, Albert Remus R; Orata, Fabini D; Reiz, Béla; Zheng, Jing; Nateche, Farida; Case, Rebecca J; Kebbouche-Gana, Salima; Vederas, John C

    2018-01-01

    In this study, we identified a new Bacillus strain isolated from an Algerian salty lake that produces metabolites that are active against Gram-positive and Gram-negative bacteria, as well as fungal pathogens. The draft genome sequence of the strain is presented herein. Genome sequence analysis identified the strain to be B. amyloliquefaciens subspecies plantarum F11, and showed that the strain carries the gene clusters for the production of a number of bioactive and surface-active compounds. These include the lipopeptides surfactin and fengycin, antibacterial polyketides macrolactin and bacillaene, and a putative novel lanthipeptide, among others. Through an activity-guided purification method using hydrophobic interaction chromatographic techniques, we confirmed the ability of the strain to produce fengycin lipopeptides. The identities of the isolated fengycin homologs were ascertained through tandem mass spectrometry. © FEMS 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  15. Unexpected features of the dark proteome.

    PubMed

    Perdigão, Nelson; Heinrich, Julian; Stolte, Christian; Sabir, Kenneth S; Buckley, Michael J; Tabor, Bruce; Signal, Beth; Gloss, Brian S; Hammang, Christopher J; Rost, Burkhard; Schafferhans, Andrea; O'Donoghue, Seán I

    2015-12-29

    We surveyed the "dark" proteome-that is, regions of proteins never observed by experimental structure determination and inaccessible to homology modeling. For 546,000 Swiss-Prot proteins, we found that 44-54% of the proteome in eukaryotes and viruses was dark, compared with only ∼14% in archaea and bacteria. Surprisingly, most of the dark proteome could not be accounted for by conventional explanations, such as intrinsic disorder or transmembrane regions. Nearly half of the dark proteome comprised dark proteins, in which the entire sequence lacked similarity to any known structure. Dark proteins fulfill a wide variety of functions, but a subset showed distinct and largely unexpected features, such as association with secretion, specific tissues, the endoplasmic reticulum, disulfide bonding, and proteolytic cleavage. Dark proteins also had short sequence length, low evolutionary reuse, and few known interactions with other proteins. These results suggest new research directions in structural and computational biology.

  16. Unexpected features of the dark proteome

    PubMed Central

    Perdigão, Nelson; Heinrich, Julian; Stolte, Christian; Sabir, Kenneth S.; Buckley, Michael J.; Tabor, Bruce; Signal, Beth; Gloss, Brian S.; Hammang, Christopher J.; Rost, Burkhard; Schafferhans, Andrea

    2015-01-01

    We surveyed the “dark” proteome–that is, regions of proteins never observed by experimental structure determination and inaccessible to homology modeling. For 546,000 Swiss-Prot proteins, we found that 44–54% of the proteome in eukaryotes and viruses was dark, compared with only ∼14% in archaea and bacteria. Surprisingly, most of the dark proteome could not be accounted for by conventional explanations, such as intrinsic disorder or transmembrane regions. Nearly half of the dark proteome comprised dark proteins, in which the entire sequence lacked similarity to any known structure. Dark proteins fulfill a wide variety of functions, but a subset showed distinct and largely unexpected features, such as association with secretion, specific tissues, the endoplasmic reticulum, disulfide bonding, and proteolytic cleavage. Dark proteins also had short sequence length, low evolutionary reuse, and few known interactions with other proteins. These results suggest new research directions in structural and computational biology. PMID:26578815

  17. Analysis of a four generation family reveals the widespread sequence-dependent maintenance of allelic DNA methylation in somatic and germ cells

    PubMed Central

    Tang, Aifa; Huang, Yi; Li, Zesong; Wan, Shengqing; Mou, Lisha; Yin, Guangliang; Li, Ning; Xie, Jun; Xia, Yudong; Li, Xianxin; Luo, Liya; Zhang, Junwen; Chen, Shen; Wu, Song; Sun, Jihua; Sun, Xiaojuan; Jiang, Zhimao; Chen, Jing; Li, Yingrui; Wang, Jian; Wang, Jun; Cai, Zhiming; Gui, Yaoting

    2016-01-01

    Differential methylation of the homologous chromosomes, a well-known mechanism leading to genomic imprinting and X-chromosome inactivation, is widely reported at the non-imprinted regions on autosomes. To evaluate the transgenerational DNA methylation patterns in human, we analyzed the DNA methylomes of somatic and germ cells in a four-generation family. We found that allelic asymmetry of DNA methylation was pervasive at the non-imprinted loci and was likely regulated by cis-acting genetic variants. We also observed that the allelic methylation patterns for the vast majority of the cis-regulated loci were shared between the somatic and germ cells from the same individual. These results demonstrated the interaction between genetic and epigenetic variations and suggested the possibility of widespread sequence-dependent transmission of DNA methylation during spermatogenesis. PMID:26758766

  18. DNA homology among diverse spiroplasma strains representing several serological groups.

    PubMed

    Lee, I M; Davis, R E

    1980-11-01

    Deoxyribonucleic acid (DNA) homology among 10 strains of spiroplasma associated with plants and insects was assessed by analysis of DNA-DNA hybrids with single strand specific S1 nuclease. Based on DNA homology, the spiroplasmas could be divided into three genetically distinct groups (designated I, II, and III), corresponding to three separate serogroups described previously. DNA sequence homology between the three groups was less than or equal to 5%. Based on DNA homology, group I could be divided into three subgroups (A, B, and C) that corresponded to three serological subgroups of serogroup I. Subgroup A contained Spiroplasma citri strains Maroc R8A2 and C 189; subgroup B contained strains AS 576 from honey bee and G 1 from flowers; subgroup C contained corn stunt spiroplasma strains I-747 and PU 8-17. There was 27-54% DNA sequence homology among these three subgroups. Group II contained strains 23-6 and 27-31 isolated from flowers of tulip tree (Liriodendron tulipifera L.). Group III contained strains SR 3 and SR 9, other isolates from flowers of tulip tree. Based on thermal denaturation, guanine plus cytosine contents of DNA from five type strains representing all groups and subgroups were estimated to be close to 26 mol% for group I strains, close to 25 mol% for group II strains, and close to 29 mol% for group III strains. The genome molecular weights of these five type strains were all estimated to bae about 10(9).

  19. Comparative analysis of expressed sequence tags of conifers and angiosperms reveals sequences specifically conserved in conifers.

    PubMed

    Ujino-Ihara, Tokuko; Kanamori, Hiroyuki; Yamane, Hiroko; Taguchi, Yuriko; Namiki, Nobukazu; Mukai, Yuzuru; Yoshimura, Kensuke; Tsumura, Yoshihiko

    2005-12-01

    To identify and characterize lineage-specific genes of conifers, two sets of ESTs (with 12791 and 5902 ESTs, representing 5373 and 3018 gene transcripts, respectively) were generated from the Cupressaceae species Cryptomeria japonica and Chamaecyparis obtusa. These transcripts were compared with non-redundant sets of genes generated from Pinaceae species, other gymnosperms and angiosperms. About 6% of tentative unique genes (Unigenes) of C. japonica and C. obtusa had homologs in other conifers but not angiosperms, and about 70% had apparent homologs in angiosperms. The calculated GC contents of orthologous genes showed that GC contents of coniferous genes are likely to be lower than those of angiosperms. Comparisons of the numbers of homologous genes in each species suggest that copy numbers of genes may be correlated between diverse seed plants. This correlation suggests that the multiplicity of such genes may have arisen before the divergence of gymnosperms and angiosperms.

  20. Camelid Ig V genes reveal significant human homology not seen in therapeutic target genes, providing for a powerful therapeutic antibody platform

    PubMed Central

    Klarenbeek, Alex; Mazouari, Khalil El; Desmyter, Aline; Blanchetot, Christophe; Hultberg, Anna; de Jonge, Natalie; Roovers, Rob C; Cambillau, Christian; Spinelli, Sylvia; Del-Favero, Jurgen; Verrips, Theo; de Haard, Hans J; Achour, Ikbel

    2015-01-01

    Camelid immunoglobulin variable (IGV) regions were found homologous to their human counterparts; however, the germline V repertoires of camelid heavy and light chains are still incomplete and their therapeutic potential is only beginning to be appreciated. We therefore leveraged the publicly available HTG and WGS databases of Lama pacos and Camelus ferus to retrieve the germline repertoire of V genes using human IGV genes as reference. In addition, we amplified IGKV and IGLV genes to uncover the V germline repertoire of Lama glama and sequenced BAC clones covering part of the Lama pacos IGK and IGL loci. Our in silico analysis showed that camelid counterparts of all human IGKV and IGLV families and most IGHV families could be identified, based on canonical structure and sequence homology. Interestingly, this sequence homology seemed largely restricted to the Ig V genes and was far less apparent in other genes: 6 therapeutically relevant target genes differed significantly from their human orthologs. This contributed to efficient immunization of llamas with the human proteins CD70, MET, interleukin (IL)-1β and IL-6, resulting in large panels of functional antibodies. The in silico predicted human-homologous canonical folds of camelid-derived antibodies were confirmed by X-ray crystallography solving the structure of 2 selected camelid anti-CD70 and anti-MET antibodies. These antibodies showed identical fold combinations as found in the corresponding human germline V families, yielding binding site structures closely similar to those occurring in human antibodies. In conclusion, our results indicate that active immunization of camelids can be a powerful therapeutic antibody platform. PMID:26018625

  1. Microarray analysis of gene expression profiles in ripening pineapple fruits.

    PubMed

    Koia, Jonni H; Moyle, Richard L; Botella, Jose R

    2012-12-18

    Pineapple (Ananas comosus) is a tropical fruit crop of significant commercial importance. Although the physiological changes that occur during pineapple fruit development have been well characterized, little is known about the molecular events that occur during the fruit ripening process. Understanding the molecular basis of pineapple fruit ripening will aid the development of new varieties via molecular breeding or genetic modification. In this study we developed a 9277 element pineapple microarray and used it to profile gene expression changes that occur during pineapple fruit ripening. Microarray analyses identified 271 unique cDNAs differentially expressed at least 1.5-fold between the mature green and mature yellow stages of pineapple fruit ripening. Among these 271 sequences, 184 share significant homology with genes encoding proteins of known function, 53 share homology with genes encoding proteins of unknown function and 34 share no significant homology with any database accession. Of the 237 pineapple sequences with homologs, 160 were up-regulated and 77 were down-regulated during pineapple fruit ripening. DAVID Functional Annotation Cluster (FAC) analysis of all 237 sequences with homologs revealed confident enrichment scores for redox activity, organic acid metabolism, metalloenzyme activity, glycolysis, vitamin C biosynthesis, antioxidant activity and cysteine peptidase activity, indicating the functional significance and importance of these processes and pathways during pineapple fruit development. Quantitative real-time PCR analysis validated the microarray expression results for nine out of ten genes tested. This is the first report of a microarray based gene expression study undertaken in pineapple. Our bioinformatic analyses of the transcript profiles have identified a number of genes, processes and pathways with putative involvement in the pineapple fruit ripening process. This study extends our knowledge of the molecular basis of pineapple fruit ripening and non-climacteric fruit ripening in general.

  2. Microarray analysis of gene expression profiles in ripening pineapple fruits

    PubMed Central

    2012-01-01

    Background Pineapple (Ananas comosus) is a tropical fruit crop of significant commercial importance. Although the physiological changes that occur during pineapple fruit development have been well characterized, little is known about the molecular events that occur during the fruit ripening process. Understanding the molecular basis of pineapple fruit ripening will aid the development of new varieties via molecular breeding or genetic modification. In this study we developed a 9277 element pineapple microarray and used it to profile gene expression changes that occur during pineapple fruit ripening. Results Microarray analyses identified 271 unique cDNAs differentially expressed at least 1.5-fold between the mature green and mature yellow stages of pineapple fruit ripening. Among these 271 sequences, 184 share significant homology with genes encoding proteins of known function, 53 share homology with genes encoding proteins of unknown function and 34 share no significant homology with any database accession. Of the 237 pineapple sequences with homologs, 160 were up-regulated and 77 were down-regulated during pineapple fruit ripening. DAVID Functional Annotation Cluster (FAC) analysis of all 237 sequences with homologs revealed confident enrichment scores for redox activity, organic acid metabolism, metalloenzyme activity, glycolysis, vitamin C biosynthesis, antioxidant activity and cysteine peptidase activity, indicating the functional significance and importance of these processes and pathways during pineapple fruit development. Quantitative real-time PCR analysis validated the microarray expression results for nine out of ten genes tested. Conclusions This is the first report of a microarray based gene expression study undertaken in pineapple. Our bioinformatic analyses of the transcript profiles have identified a number of genes, processes and pathways with putative involvement in the pineapple fruit ripening process. This study extends our knowledge of the molecular basis of pineapple fruit ripening and non-climacteric fruit ripening in general. PMID:23245313

  3. Natural non-homologous recombination led to the emergence of a duplicated V3-NS5A region in HCV-1b strains associated with hepatocellular carcinoma.

    PubMed

    Le Guillou-Guillemette, Hélène; Pivert, Adeline; Bouthry, Elise; Henquell, Cécile; Petsaris, Odile; Ducancelle, Alexandra; Veillon, Pascal; Vallet, Sophie; Alain, Sophie; Thibault, Vincent; Abravanel, Florence; Rosenberg, Arielle A; André-Garnier, Elisabeth; Bour, Jean-Baptiste; Baazia, Yazid; Trimoulet, Pascale; André, Patrice; Gaudy-Graffin, Catherine; Bettinger, Dominique; Larrat, Sylvie; Signori-Schmuck, Anne; Saoudin, Hénia; Pozzetto, Bruno; Lagathu, Gisèle; Minjolle-Cha, Sophie; Stoll-Keller, Françoise; Pawlotsky, Jean-Michel; Izopet, Jacques; Payan, Christopher; Lunel-Fabiani, Françoise; Lemaire, Christophe

    2017-01-01

    The emergence of new strains in RNA viruses is mainly due to mutations or intra and inter-genotype homologous recombination. Non-homologous recombinations may be deleterious and are rarely detected. In previous studies, we identified HCV-1b strains bearing two tandemly repeated V3 regions in the NS5A gene without ORF disruption. This polymorphism may be associated with an unfavorable course of liver disease and possibly involved in liver carcinogenesis. Here we aimed at characterizing the origin of these mutant strains and identifying the evolutionary mechanism on which the V3 duplication relies. Direct sequencing of the entire NS5A and E1 genes was performed on 27 mutant strains. Quasispecies analyses in consecutive samples were also performed by cloning and sequencing the NS5A gene for all mutant and wild strains. We analyzed the mutant and wild-type sequence polymorphisms using Bayesian methods to infer the evolutionary history of and the molecular mechanism leading to the duplication-like event. Quasispecies were entirely composed of exclusively mutant or wild-type strains respectively. Mutant quasispecies were found to have been present since contamination and had persisted for at least 10 years. This V3 duplication-like event appears to have resulted from non-homologous recombination between HCV-1b wild-type strains around 100 years ago. The association between increased liver disease severity and these HCV-1b mutants may explain their persistence in chronically infected patients. These results emphasize the possible consequences of non-homologous recombination in the emergence and severity of new viral diseases.

  4. Determinants of Chromosome Architecture: Insulator Pairing in cis and in trans

    PubMed Central

    Fujioka, Miki; Mistry, Hemlata; Schedl, Paul; Jaynes, James B.

    2016-01-01

    The chromosomes of multicellular animals are organized into a series of topologically independent looped domains. This domain organization is critical for the proper utilization and propagation of the genetic information encoded by the chromosome. A special set of architectural elements, called boundaries or insulators, are responsible both for subdividing the chromatin into discrete domains and for determining the topological organization of these domains. Central to the architectural functions of insulators are homologous and heterologous insulator:insulator pairing interactions. The former (pairing between copies of the same insulator) dictates the process of homolog alignment and pairing in trans, while the latter (pairing between different insulators) defines the topology of looped domains in cis. To elucidate the principles governing these architectural functions, we use two insulators, Homie and Nhomie, that flank the Drosophila even skipped locus. We show that homologous insulator interactions in trans, between Homie on one homolog and Homie on the other, or between Nhomie on one homolog and Nhomie on the other, mediate transvection. Critically, these homologous insulator:insulator interactions are orientation-dependent. Consistent with a role in the alignment and pairing of homologs, self-pairing in trans is head-to-head. Head-to-head self-interactions in cis have been reported for other fly insulators, suggesting that this is a general principle of self-pairing. Homie and Nhomie not only pair with themselves, but with each other. Heterologous Homie-Nhomie interactions occur in cis, and we show that they serve to delimit a looped chromosomal domain that contains the even skipped transcription unit and its associated enhancers. The topology of this loop is defined by the heterologous pairing properties of Homie and Nhomie. Instead of being head-to-head, which would generate a circular loop, Homie-Nhomie pairing is head-to-tail. Head-to-tail pairing in cis generates a stem-loop, a configuration much like that observed in classical lampbrush chromosomes. These pairing principles provide a mechanistic underpinning for the observed topologies within and between chromosomes. PMID:26910731

  5. Clustering evolving proteins into homologous families.

    PubMed

    Chan, Cheong Xin; Mahbob, Maisarah; Ragan, Mark A

    2013-04-08

    Clustering sequences into groups of putative homologs (families) is a critical first step in many areas of comparative biology and bioinformatics. The performance of clustering approaches in delineating biologically meaningful families depends strongly on characteristics of the data, including content bias and degree of divergence. New, highly scalable methods have recently been introduced to cluster the very large datasets being generated by next-generation sequencing technologies. However, there has been little systematic investigation of how characteristics of the data impact the performance of these approaches. Using clusters from a manually curated dataset as reference, we examined the performance of a widely used graph-based Markov clustering algorithm (MCL) and a greedy heuristic approach (UCLUST) in delineating protein families coded by three sets of bacterial genomes of different G+C content. Both MCL and UCLUST generated clusters that are comparable to the reference sets at specific parameter settings, although UCLUST tends to under-cluster compositionally biased sequences (G+C content 33% and 66%). Using simulated data, we sought to assess the individual effects of sequence divergence, rate heterogeneity, and underlying G+C content. Performance decreased with increasing sequence divergence, decreasing among-site rate variation, and increasing G+C bias. Two MCL-based methods recovered the simulated families more accurately than did UCLUST. MCL using local alignment distances is more robust across the investigated range of sequence features than are greedy heuristics using distances based on global alignment. Our results demonstrate that sequence divergence, rate heterogeneity and content bias can individually and in combination affect the accuracy with which MCL and UCLUST can recover homologous protein families. For application to data that are more divergent, and exhibit higher among-site rate variation and/or content bias, MCL may often be the better choice, especially if computational resources are not limiting.

  6. Noncytopathogenic Pestivirus Strains Generated by Nonhomologous RNA Recombination: Alterations in the NS4A/NS4B Coding Region

    PubMed Central

    Gallei, Andreas; Orlich, Michaela; Thiel, Heinz-Juergen; Becher, Paul

    2005-01-01

    Several studies have demonstrated that cytopathogenic (cp) pestivirus strains evolve from noncytopathogenic (noncp) viruses by nonhomologous RNA recombination. In addition, two recent reports showed the rapid emergence of noncp Bovine viral diarrhea virus (BVDV) after a few cell culture passages of cp BVDV strains by homologous recombination between identical duplicated viral sequences. To allow the identification of recombination sites from noncp BVDV strains that evolve from cp viruses, we constructed the cp BVDV strains CP442 and CP552. Both harbor duplicated viral sequences of different origin flanking the cellular insertion Nedd8*; the latter is a prerequisite for their cytopathogenicity. In contrast to the previous studies, isolation of noncp strains was possible only after extensive cell culture passages of CP442 and CP552. Sequence analysis of 15 isolated noncp BVDVs confirmed that all recombinant strains lack at least most of Nedd8*. Interestingly, only one strain resulted from homologous recombination while the other 14 strains were generated by nonhomologous recombination. Accordingly, our data suggest that the extent of sequence identity between participating sequences influences both frequency and mode (homologous versus nonhomologous) of RNA recombination in pestiviruses. Further analyses of the noncp recombinant strains revealed that a duplication of 14 codons in the BVDV nonstructural protein 4B (NS4B) gene does not interfere with efficient viral replication. Moreover, an insertion of viral sequences between the NS4A and NS4B genes was well tolerated. These findings thus led to the identification of two genomic loci which appear to be suited for the insertion of heterologous sequences into the genomes of pestiviruses and related viruses. PMID:16254361

  7. Isolation of a novel Orientia species (O. chuto sp. nov.) from a patient infected in Dubai.

    PubMed

    Izzard, Leonard; Fuller, Andrew; Blacksell, Stuart D; Paris, Daniel H; Richards, Allen L; Aukkanit, Nuntipa; Nguyen, Chelsea; Jiang, Ju; Fenwick, Stan; Day, Nicholas P J; Graves, Stephen; Stenos, John

    2010-12-01

    In July 2006, an Australian tourist returning from Dubai, in the United Arab Emirates (UAE), developed acute scrub typhus. Her signs and symptoms included fever, myalgia, headache, rash, and eschar. Orientia tsutsugamushi serology demonstrated a 4-fold rise in antibody titers in paired serum collections (1:512 to 1:8,192), with the sera reacting strongest against the Gilliam strain antigen. An Orientia species was isolated by the in vitro culture of the patient's acute blood taken prior to antibiotic treatment. The gene sequencing of the 16S rRNA gene (rrs), partial 56-kDa gene, and the full open reading frame 47-kDa gene was performed, and comparisons of this new Orientia sp. isolate to previously characterized strains demonstrated significant sequence diversity. The closest homology to the rrs sequence of the new Orientia sp. isolate was with three strains of O. tsutsugamushi (Ikeda, Kato, and Karp), with a nucleotide sequence similarity of 98.5%. The closest homology to the 47-kDa gene sequence was with O. tsutsugamushi strain Gilliam, with a nucleotide similarity of 82.3%, while the closest homology to the 56-kDa gene sequence was with O. tsutsugamushi strain TA686, with a nucleotide similarity of 53.1%. The molecular divergence and geographically unique origin lead us to believe that this organism should be considered a novel species. Therefore, we have proposed the name "Orientia chuto," and the prototype strain of this species is strain Dubai, named after the location in which the patient was infected.

  8. Isolation of a Novel Orientia Species (O. chuto sp. nov.) from a Patient Infected in Dubai ▿

    PubMed Central

    Izzard, Leonard; Fuller, Andrew; Blacksell, Stuart D.; Paris, Daniel H.; Richards, Allen L.; Aukkanit, Nuntipa; Nguyen, Chelsea; Jiang, Ju; Fenwick, Stan; Day, Nicholas P. J.; Graves, Stephen; Stenos, John

    2010-01-01

    In July 2006, an Australian tourist returning from Dubai, in the United Arab Emirates (UAE), developed acute scrub typhus. Her signs and symptoms included fever, myalgia, headache, rash, and eschar. Orientia tsutsugamushi serology demonstrated a 4-fold rise in antibody titers in paired serum collections (1:512 to 1:8,192), with the sera reacting strongest against the Gilliam strain antigen. An Orientia species was isolated by the in vitro culture of the patient's acute blood taken prior to antibiotic treatment. The gene sequencing of the 16S rRNA gene (rrs), partial 56-kDa gene, and the full open reading frame 47-kDa gene was performed, and comparisons of this new Orientia sp. isolate to previously characterized strains demonstrated significant sequence diversity. The closest homology to the rrs sequence of the new Orientia sp. isolate was with three strains of O. tsutsugamushi (Ikeda, Kato, and Karp), with a nucleotide sequence similarity of 98.5%. The closest homology to the 47-kDa gene sequence was with O. tsutsugamushi strain Gilliam, with a nucleotide similarity of 82.3%, while the closest homology to the 56-kDa gene sequence was with O. tsutsugamushi strain TA686, with a nucleotide similarity of 53.1%. The molecular divergence and geographically unique origin lead us to believe that this organism should be considered a novel species. Therefore, we have proposed the name “Orientia chuto,” and the prototype strain of this species is strain Dubai, named after the location in which the patient was infected. PMID:20926708

  9. Extensive characterization of Tupaia belangeri neuropeptidome using an integrated mass spectrometric approach.

    PubMed

    Petruzziello, Filomena; Fouillen, Laetitia; Wadensten, Henrik; Kretz, Robert; Andren, Per E; Rainer, Gregor; Zhang, Xiaozhe

    2012-02-03

    Neuropeptidomics is used to characterize endogenous peptides in the brain of tree shrews (Tupaia belangeri). Tree shrews are small animals similar to rodents in size but close relatives of primates, and are excellent models for brain research. Currently, tree shrews have no complete proteome information available on which direct database search can be allowed for neuropeptide identification. To increase the capability in the identification of neuropeptides in tree shrews, we developed an integrated mass spectrometry (MS)-based approach that combines methods including data-dependent, directed, and targeted liquid chromatography (LC)-Fourier transform (FT)-tandem MS (MS/MS) analysis, database construction, de novo sequencing, precursor protein search, and homology analysis. Using this integrated approach, we identified 107 endogenous peptides that have sequences identical or similar to those from other mammalian species. High accuracy MS and tandem MS information, with BLAST analysis and chromatographic characteristics were used to confirm the sequences of all the identified peptides. Interestingly, further sequence homology analysis demonstrated that tree shrew peptides have a significantly higher degree of homology to equivalent sequences in humans than those in mice or rats, consistent with the close phylogenetic relationship between tree shrews and primates. Our results provide the first extensive characterization of the peptidome in tree shrews, which now permits characterization of their function in nervous and endocrine system. As the approach developed fully used the conservative properties of neuropeptides in evolution and the advantage of high accuracy MS, it can be portable for identification of neuropeptides in other species for which the fully sequenced genomes or proteomes are not available.

  10. Characterization and Nucleotide Sequence of CARB-6, a New Carbenicillin-Hydrolyzing β-Lactamase from Vibrio cholerae

    PubMed Central

    Choury, Danièle; Aubert, Gérald; Szajnert, Marie-France; Azibi, Kemal; Delpech, Marc; Paul, Gérard

    1999-01-01

    A clinical strain of Vibrio cholerae non-O1 non-O139 isolated in France produced a new β-lactamase with a pI of 5.35. The purified enzyme, with a molecular mass of 33,000 Da, was characterized. Its kinetic constants show it to be a carbenicillin-hydrolyzing enzyme comparable to the five previously reported CARB β-lactamases and to SAR-1, another carbenicillin-hydrolyzing β-lactamase that has a pI of 4.9 and that is produced by a V. cholerae strain from Tanzania. This β-lactamase is designated CARB-6, and the gene for CARB-6 could not be transferred to Escherichia coli K-12 by conjugation. The nucleotide sequence of the structural gene was determined by direct sequencing of PCR-generated fragments from plasmid DNA with four pairs of primers covering the whole sequence of the reference CARB-3 gene. The gene encodes a 288-amino-acid protein that shares 94% homology with the CARB-1, CARB-2, and CARB-3 enzymes, 93% homology with the Proteus mirabilis N29 enzyme, and 86.5% homology with the CARB-4 enzyme. The sequence of CARB-6 differs from those of CARB-3, CARB-2, CARB-1, N29, and CARB-4 at 15, 16, 17, 19, and 37 amino acid positions, respectively. All these mutations are located in the C-terminal region of the sequence and at the surface of the molecule, according to the crystal structure of the Staphylococcus aureus PC-1 β-lactamase. PMID:9925522

  11. Genomic organization, sequence characterization and expression analysis of Tenebrio molitor apolipophorin-III in response to an intracellular pathogen, Listeria monocytogenes.

    PubMed

    Noh, Ju Young; Patnaik, Bharat Bhusan; Tindwa, Hamisi; Seo, Gi Won; Kim, Dong Hyun; Patnaik, Hongray Howrelia; Jo, Yong Hun; Lee, Yong Seok; Lee, Bok Luel; Kim, Nam Jung; Han, Yeon Soo

    2014-01-25

    Apolipophorin III (apoLp-III) is a well-known hemolymph protein having a functional role in lipid transport and immune response of insects. We cloned full-length cDNA encoding putative apoLp-III from larvae of the coleopteran beetle, Tenebrio molitor (TmapoLp-III), by identification of clones corresponding to the partial sequence of TmapoLp-III, subsequently followed with full length sequencing by a clone-by-clone primer walking method. The complete cDNA consists of 890 nucleotides, including an ORF encoding 196 amino acid residues. Excluding a putative signal peptide of the first 20 amino acid residues, the 176-residue mature apoLp-III has a calculated molecular mass of 19,146Da. Genomic sequence analysis with respect to its cDNA showed that TmapoLp-III was organized into four exons interrupted by three introns. Several immune-related transcription factor binding sites were discovered in the putative 5'-flanking region. BLAST and phylogenetic analyses reveal that TmapoLp-III has high sequence identity (88%) with Tribolium castaneum apoLp-III but shares little sequence homologies (<26%) with other apoLp-IIIs. Homology modeling of Tm apoLp-III shows a bundle of five amphipathic alpha helices, including a short helix 3'. The 'helix-short helix-helix' motif was predicted to be implicated in lipid binding interactions, through reversible conformational changes and accommodating the hydrophobic residues to the exterior for stability. Highest level of TmapoLp-III mRNA was detected at late pupal stages, albeit it is expressed in the larval and adult stages at lower levels. The tissue specific expression of the transcripts showed significantly higher numbers in larval fat body and adult integument. In addition, TmapoLp-III mRNA was found to be highly upregulated in late stages of L. monocytogenes or E. coli challenge. These results indicate that TmapoLp-III may play an important role in innate immune responses against bacterial pathogens in T. molitor. Copyright © 2013 Elsevier B.V. All rights reserved.

  12. A Delicate Balance Between Repair and Replication Factors Regulates Recombination Between Divergent DNA Sequences in Saccharomyces cerevisiae

    PubMed Central

    Chakraborty, Ujani; George, Carolyn M.; Lyndaker, Amy M.; Alani, Eric

    2016-01-01

    Single-strand annealing (SSA) is an important homologous recombination mechanism that repairs DNA double strand breaks (DSBs) occurring between closely spaced repeat sequences. During SSA, the DSB is acted upon by exonucleases to reveal complementary sequences that anneal and are then repaired through tail clipping, DNA synthesis, and ligation steps. In baker’s yeast, the Msh DNA mismatch recognition complex and the Sgs1 helicase act to suppress SSA between divergent sequences by binding to mismatches present in heteroduplex DNA intermediates and triggering a DNA unwinding mechanism known as heteroduplex rejection. Using baker’s yeast as a model, we have identified new factors and regulatory steps in heteroduplex rejection during SSA. First we showed that Top3-Rmi1, a topoisomerase complex that interacts with Sgs1, is required for heteroduplex rejection. Second, we found that the replication processivity clamp proliferating cell nuclear antigen (PCNA) is dispensable for heteroduplex rejection, but is important for repairing mismatches formed during SSA. Third, we showed that modest overexpression of Msh6 results in a significant increase in heteroduplex rejection; this increase is due to a compromise in Msh2-Msh3 function required for the clipping of 3′ tails. Thus 3′ tail clipping during SSA is a critical regulatory step in the repair vs. rejection decision; rejection is favored before the 3′ tails are clipped. Unexpectedly, Msh6 overexpression, through interactions with PCNA, disrupted heteroduplex rejection between divergent sequences in another recombination substrate. These observations illustrate the delicate balance that exists between repair and replication factors to optimize genome stability. PMID:26680658

  13. Functionally conserved enhancers with divergent sequences in distant vertebrates

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Yang, Song; Oksenberg, Nir; Takayama, Sachiko

    To examine the contributions of sequence and function conservation in the evolution of enhancers, we systematically identified enhancers whose sequences are not conserved among distant groups of vertebrate species, but have homologous function and are likely to be derived from a common ancestral sequence. In conclusion, our approach combined comparative genomics and epigenomics to identify potential enhancer sequences in the genomes of three groups of distantly related vertebrate species.

  14. Functionally conserved enhancers with divergent sequences in distant vertebrates

    DOE PAGES

    Yang, Song; Oksenberg, Nir; Takayama, Sachiko; ...

    2015-10-30

    To examine the contributions of sequence and function conservation in the evolution of enhancers, we systematically identified enhancers whose sequences are not conserved among distant groups of vertebrate species, but have homologous function and are likely to be derived from a common ancestral sequence. In conclusion, our approach combined comparative genomics and epigenomics to identify potential enhancer sequences in the genomes of three groups of distantly related vertebrate species.

  15. DSAP: deep-sequencing small RNA analysis pipeline.

    PubMed

    Huang, Po-Jung; Liu, Yi-Chung; Lee, Chi-Ching; Lin, Wei-Chen; Gan, Richie Ruei-Chi; Lyu, Ping-Chiang; Tang, Petrus

    2010-07-01

    DSAP is an automated multiple-task web service designed to provide a total solution to analyzing deep-sequencing small RNA datasets generated by next-generation sequencing technology. DSAP uses a tab-delimited file as an input format, which holds the unique sequence reads (tags) and their corresponding number of copies generated by the Solexa sequencing platform. The input data will go through four analysis steps in DSAP: (i) cleanup: removal of adaptors and poly-A/T/C/G/N nucleotides; (ii) clustering: grouping of cleaned sequence tags into unique sequence clusters; (iii) non-coding RNA (ncRNA) matching: sequence homology mapping against a transcribed sequence library from the ncRNA database Rfam (http://rfam.sanger.ac.uk/); and (iv) known miRNA matching: detection of known miRNAs in miRBase (http://www.mirbase.org/) based on sequence homology. The expression levels corresponding to matched ncRNAs and miRNAs are summarized in multi-color clickable bar charts linked to external databases. DSAP is also capable of displaying miRNA expression levels from different jobs using a log(2)-scaled color matrix. Furthermore, a cross-species comparative function is also provided to show the distribution of identified miRNAs in different species as deposited in miRBase. DSAP is available at http://dsap.cgu.edu.tw.

  16. Identification of a novel MLPK homologous gene MLPKn1 and its expression analysis in Brassica oleracea.

    PubMed

    Gao, Qiguo; Shi, Songmei; Liu, Yudong; Pu, Quanming; Liu, Xiaohuan; Zhang, Ying; Zhu, Liquan

    2016-09-01

    M locus protein kinase, one of the SRK-interacting proteins, is a necessary positive regulator for the self-incompatibility response in Brassica. In B. rapa, MLPK is expressed as two different transcripts, MLPKf1 and MLPKf2, and either isoform can complement the mlpk/mlpk mutation. The AtAPK1B gene has been considered to be the ortholog of BrMLPK, and AtAPK1B has no role in self-incompatibility (SI) response in A. thaliana SRK-SCR plants. Until now, what causes the MLPK and APK1B function difference during SI response in Brassica and A. thaliana SRKb-SCRb plants has remained unknown. Here, in addition to the reported MLPKf1/2, we identified the new MLPKf1 homologous gene MLPKn1 from B. oleracea. BoMLPKn1 and BoMLPKf1 shared nucleotide sequence identity as high as 84.3 %, and the most striking difference consisted in two fragment insertions in BoMLPKn1. BoMLPKn1 and BoMLPKf1 had a similar gene structure; both their deduced amino acid sequences contained a typical plant myristoylation consensus sequence and a Ser/Thr protein kinase domain. BoMLPKn1 was widely expressed in petal, sepal, anther, stigma and leaf. Genome-wide survey revealed that the B. oleracea genome contained three MLPK homologous genes: BoMLPKf1/2, BoMLPKn1 and Bol008343n. The B. rapa genome also contained three MLPK homologous genes, BrMLPKf1/2, BraMLPKn1 and Bra040929. Phylogenetic analysis revealed that BoMLPKf1/2 and BrMLPKf1/2 were phylogenetically more distant from AtAPK1A than Bol008343n, Bra040929, BraMLPKn1 and BoMLPKn1, Synteny analysis revealed that the B. oleracea chromosomal region containing BoMLPKn1 displayed high synteny with the A. thaliana chromosomal region containing APK1B, whereas the B. rapa chromosomal region containing BraMLPKn1 showed high synteny with the A. thaliana chromosomal region containing APK1B. Together, these results revealed that BoMLPKn1/BraMLPKn1, and not the formerly reported BoMLPKf1/2 (BrMLPKf1/2), was the orthologous genes of AtAPK1B, and no ortholog of BoMLPKf1/2 (BrMLPKf1/2) was found in the A. thaliana genome. We speculated that Brassica MLPKf1/2 might have emerged after speciation of Brassica and A. thailiana, and that it was recruited to the SRK-triggered SI signaling cascade in Brassica.

  17. Sequencing, Analysis, and Annotation of Expressed Sequence Tags for Camelus dromedarius

    PubMed Central

    Al-Swailem, Abdulaziz M.; Shehata, Maher M.; Abu-Duhier, Faisel M.; Al-Yamani, Essam J.; Al-Busadah, Khalid A.; Al-Arawi, Mohammed S.; Al-Khider, Ali Y.; Al-Muhaimeed, Abdullah N.; Al-Qahtani, Fahad H.; Manee, Manee M.; Al-Shomrani, Badr M.; Al-Qhtani, Saad M.; Al-Harthi, Amer S.; Akdemir, Kadir C.; Otu, Hasan H.

    2010-01-01

    Despite its economical, cultural, and biological importance, there has not been a large scale sequencing project to date for Camelus dromedarius. With the goal of sequencing complete DNA of the organism, we first established and sequenced camel EST libraries, generating 70,272 reads. Following trimming, chimera check, repeat masking, cluster and assembly, we obtained 23,602 putative gene sequences, out of which over 4,500 potentially novel or fast evolving gene sequences do not carry any homology to other available genomes. Functional annotation of sequences with similarities in nucleotide and protein databases has been obtained using Gene Ontology classification. Comparison to available full length cDNA sequences and Open Reading Frame (ORF) analysis of camel sequences that exhibit homology to known genes show more than 80% of the contigs with an ORF>300 bp and ∼40% hits extending to the start codons of full length cDNAs suggesting successful characterization of camel genes. Similarity analyses are done separately for different organisms including human, mouse, bovine, and rat. Accompanying web portal, CAGBASE (http://camel.kacst.edu.sa/), hosts a relational database containing annotated EST sequences and analysis tools with possibility to add sequences from public domain. We anticipate our results to provide a home base for genomic studies of camel and other comparative studies enabling a starting point for whole genome sequencing of the organism. PMID:20502665

  18. Recently published protein sequences. I.

    NASA Technical Reports Server (NTRS)

    Jukes, T. H.; Holmquist, R.

    1972-01-01

    Some polypeptide sequences that have been published in the 1972 scientific literature are listed. Only selected sequences are included. The compilation has two objectives. Current information between periods when more comprehensive compilations are published is to be assembled and the use of data that do not include arrangements of unsequenced peptides for 'maximum homology' is to be encouraged.

  19. The nucleotide sequence of 5S ribosomal RNA from Micrococcus lysodeikticus.

    PubMed Central

    Hori, H; Osawa, S; Murao, K; Ishikura, H

    1980-01-01

    The nucleotide sequence of ribosomal 5S RNA from Micrococcus lysodeikticus is pGUUACGGCGGCUAUAGCGUGGGGGAAACGCCCGGCCGUAUAUCGAACCCGGAAGCUAAGCCCCAUAGCGCCGAUGGUUACUGUAACCGGGAGGUUGUGGGAGAGUAGGUCGCCGCCGUGAOH. When compared to other 5S RNAs, the sequence homology is greatest with Thermus aquaticus, and these two 5S RNAs reveal several features intermediate between those of typical gram-positive bacteria and gram-negative bacteria. PMID:6780979

  20. Molecular evolution of an Avirulence Homolog (Avh) gene subfamily in Phytophthora ramorum

    Treesearch

    GossErica M.; Caroline M. Press; Niklaus J. Grünwald

    2008-01-01

    Pathogen effectors can serve a virulence function on behalf of the pathogen or trigger a rapid defense response in resistant hosts. Sequencing of the Phytophthora ramorum genome and subsequent analysis identified a diverse superfamily of approximately 350 genes that are homologous to the four known avirulence genes in plant pathogenic oomycetes and...

Top