The aquaporin TcAQP1 of the desert truffle Terfezia claveryi is a membrane pore for water and CO(2) transport.

PubMed

Navarro-Ródenas, Alfonso; Ruíz-Lozano, Juan Manuel; Kaldenhoff, Ralf; Morte, Asunción

2012-02-01

Terfezia claveryi is a hypogeous mycorrhizal fungus belonging to the so-called "desert truffles," with a good record as an edible fungus and of considerable economic importance. T. claveryi improves the tolerance to water stress of the host plant Helianthemum almeriense, for which, in field conditions, symbiosis with T. claveryi is valuable for its survival. We have characterized cDNAs from T. claveryi and identified a sequence related to the aquaporin gene family. The full-length sequence was obtained by rapid amplification of cDNA ends and was named TcAQP1. This aquaporin gene encoded a functional water-channel protein, as demonstrated by heterologous expression assays in Saccharomyces cerevisiae. The mycorrhizal fungal aquaporin increased both water and CO(2) conductivity in the heterologous expression system. The expression patterns of the TcAQP1 gene in mycelium, under different water potentials, and in mycorrhizal plants are discussed. The high levels of water conductivity of TcAQP1 could be related to the adaptation of this mycorrhizal fungus to semiarid areas. The CO(2) permeability of TcAQP1 could be involved in the regulation of T. claveryi growth during presymbiotic phases, making it a good candidate to be considered a novel molecular signaling channel in mycorrhizal fungi.

Molecular Diversity of Trypanosoma cruzi Detected in the Vector Triatoma protracta from California, USA

PubMed Central

Shender, Lisa A.; Lewis, Michael D.; Rejmanek, Daniel; Mazet, Jonna A. K.

2016-01-01

Background Trypanosoma cruzi, causative agent of Chagas disease in humans and dogs, is a vector-borne zoonotic protozoan parasite that can cause fatal cardiac disease. While recognized as the most economically important parasitic infection in Latin America, the incidence of Chagas disease in the United States of America (US) may be underreported and even increasing. The extensive genetic diversity of T. cruzi in Latin America is well-documented and likely influences disease progression, severity and treatment efficacy; however, little is known regarding T. cruzi strains endemic to the US. It is therefore important to expand our knowledge on US T. cruzi strains, to improve upon the recognition of and response to locally acquired infections. Methodology/Principle Findings We conducted a study of T. cruzi molecular diversity in California, augmenting sparse genetic data from southern California and for the first time investigating genetic sequences from northern California. The vector Triatoma protracta was collected from southern (Escondido and Los Angeles) and northern (Vallecito) California regions. Samples were initially screened via sensitive nuclear repetitive DNA and kinetoplast minicircle DNA PCR assays, yielding an overall prevalence of approximately 28% and 55% for southern and northern California regions, respectively. Positive samples were further processed to identify discrete typing units (DTUs), revealing both TcI and TcIV lineages in southern California, but only TcI in northern California. Phylogenetic analyses (targeting COII-ND1, TR and RB19 genes) were performed on a subset of positive samples to compare Californian T. cruzi samples to strains from other US regions and Latin America. Results indicated that within the TcI DTU, California sequences were similar to those from the southeastern US, as well as to several isolates from Latin America responsible for causing Chagas disease in humans. Conclusions/Significance Triatoma protracta populations in California are frequently infected with T. cruzi. Our data extend the northern limits of the range of TcI and identify a novel genetic exchange event between TcI and TcIV. High similarity between sequences from California and specific Latin American strains indicates US strains may be equally capable of causing human disease. Additional genetic characterization of Californian and other US T. cruzi strains is recommended. PMID:26797311

The genome sequence of the most widely cultivated cacao type and its use to identify candidate genes regulating pod color.

PubMed

Motamayor, Juan C; Mockaitis, Keithanne; Schmutz, Jeremy; Haiminen, Niina; Livingstone, Donald; Cornejo, Omar; Findley, Seth D; Zheng, Ping; Utro, Filippo; Royaert, Stefan; Saski, Christopher; Jenkins, Jerry; Podicheti, Ram; Zhao, Meixia; Scheffler, Brian E; Stack, Joseph C; Feltus, Frank A; Mustiga, Guiliana M; Amores, Freddy; Phillips, Wilbert; Marelli, Jean Philippe; May, Gregory D; Shapiro, Howard; Ma, Jianxin; Bustamante, Carlos D; Schnell, Raymond J; Main, Dorrie; Gilbert, Don; Parida, Laxmi; Kuhn, David N

2013-06-03

Theobroma cacao L. cultivar Matina 1-6 belongs to the most cultivated cacao type. The availability of its genome sequence and methods for identifying genes responsible for important cacao traits will aid cacao researchers and breeders. We describe the sequencing and assembly of the genome of Theobroma cacao L. cultivar Matina 1-6. The genome of the Matina 1-6 cultivar is 445 Mbp, which is significantly larger than a sequenced Criollo cultivar, and more typical of other cultivars. The chromosome-scale assembly, version 1.1, contains 711 scaffolds covering 346.0 Mbp, with a contig N50 of 84.4 kbp, a scaffold N50 of 34.4 Mbp, and an evidence-based gene set of 29,408 loci. Version 1.1 has 10x the scaffold N50 and 4x the contig N50 as Criollo, and includes 111 Mb more anchored sequence. The version 1.1 assembly has 4.4% gap sequence, while Criollo has 10.9%. Through a combination of haplotype, association mapping and gene expression analyses, we leverage this robust reference genome to identify a promising candidate gene responsible for pod color variation. We demonstrate that green/red pod color in cacao is likely regulated by the R2R3 MYB transcription factor TcMYB113, homologs of which determine pigmentation in Rosaceae, Solanaceae, and Brassicaceae. One SNP within the target site for a highly conserved trans-acting siRNA in dicots, found within TcMYB113, seems to affect transcript levels of this gene and therefore pod color variation. We report a high-quality sequence and annotation of Theobroma cacao L. and demonstrate its utility in identifying candidate genes regulating traits.

The genome sequence of the most widely cultivated cacao type and its use to identify candidate genes regulating pod color

PubMed Central

2013-01-01

Background Theobroma cacao L. cultivar Matina 1-6 belongs to the most cultivated cacao type. The availability of its genome sequence and methods for identifying genes responsible for important cacao traits will aid cacao researchers and breeders. Results We describe the sequencing and assembly of the genome of Theobroma cacao L. cultivar Matina 1-6. The genome of the Matina 1-6 cultivar is 445 Mbp, which is significantly larger than a sequenced Criollo cultivar, and more typical of other cultivars. The chromosome-scale assembly, version 1.1, contains 711 scaffolds covering 346.0 Mbp, with a contig N50 of 84.4 kbp, a scaffold N50 of 34.4 Mbp, and an evidence-based gene set of 29,408 loci. Version 1.1 has 10x the scaffold N50 and 4x the contig N50 as Criollo, and includes 111 Mb more anchored sequence. The version 1.1 assembly has 4.4% gap sequence, while Criollo has 10.9%. Through a combination of haplotype, association mapping and gene expression analyses, we leverage this robust reference genome to identify a promising candidate gene responsible for pod color variation. We demonstrate that green/red pod color in cacao is likely regulated by the R2R3 MYB transcription factor TcMYB113, homologs of which determine pigmentation in Rosaceae, Solanaceae, and Brassicaceae. One SNP within the target site for a highly conserved trans-acting siRNA in dicots, found within TcMYB113, seems to affect transcript levels of this gene and therefore pod color variation. Conclusions We report a high-quality sequence and annotation of Theobroma cacao L. and demonstrate its utility in identifying candidate genes regulating traits. PMID:23731509

Trypanosoma cruzi I genotypes in different geographic regions and transmission cycles based on a microsatellite motif of the intergenic spacer of spliced leader genes✯

PubMed Central

Cura, Carolina I.; Mejía-Jaramillo, Ana M.; Duffy, Tomás; Burgos, Juan M.; Rodriguero, Marcela; Cardinal, Marta V.; Kjos, Sonia; Gurgel-Gonçalves, Rodrigo; Blanchet, Denis; De Pablos, Luis M.; Tomasini, Nicolás; Silva, Alex Da; Russomando, Graciela; Cuba Cuba, Cesar A.; Aznar, Christine; Abate, Teresa; Levin, Mariano J.; Osuna, Antonio; Gürtler, Ricardo E.; Diosque, Patricio; Solari, Aldo; Triana-Chávez, Omar; Schijman, Alejandro G.

2011-01-01

The intergenic region of spliced-leader (SL-IR) genes from 105 Trypanosoma cruzi I (Tc I) infected biological samples, culture isolates and stocks from 11 endemic countries, from Argentina to the USA were characterised, allowing identification of 76 genotypes with 54 polymorphic sites from 123 aligned sequences. On the basis of the microsatellite motif proposed by Herrera et al. (2007) to define four haplotypes in Colombia, we could classify these genotypes into four distinct Tc I SL-IR groups, three corresponding to the former haplotypes Ia (11 genotypes), Ib (11 genotypes) and Id (35 genotypes); and one novel group, Ie (19 genotypes). Genotypes harboring the Tc Ic motif were not detected in our study. Tc Ia was associated with domestic cycles in southern and northern South America and sylvatic cycles in Central and North America. Tc Ib was found in all transmission cycles from Colombia. Tc Id was identified in all transmission cycles from Argentina and Colombia, including Chagas cardiomyopathy patients, sylvatic Brazilian samples and human cases from French Guiana, Panama and Venezuela. Tc Ie gathered five samples from domestic Triatoma infestans from northern Argentina, nine samples from wild Mepraia spinolai and Mepraia gajardoi and two chagasic patients from Chile and one from a Bolivian patient with chagasic reactivation. Mixed infections by Tc Ia + Tc Id, Tc Ia + Tc Ie and Tc Id + Tc Ie were detected in vector faeces and isolates from human and vector samples. In addition, Tc Ia and Tc Id were identified in different tissues from a heart transplanted Chagas cardiomyopathy patient with reactivation, denoting histotropism. Trypanosoma cruzi I SL-IR genotypes from parasites infecting Triatoma gerstaeckeri and Didelphis virginiana from USA, T. infestans from Paraguay, Rhodnius nasutus and Rhodnius neglectus from Brazil and M. spinolai and M. gajardoi from Chile are to our knowledge described for the first time. PMID:20670628

Reconsideration of the seven discrete typing units within the species Trypanosoma cruzi, a new proposal of three reliable mitochondrial clades.

PubMed

Barnabé, Christian; Mobarec, Hugo Ignacio; Jurado, Marcelo Roman; Cortez, Jacqueline Andrea; Brenière, Simone Frédérique

2016-04-01

It is generally acknowledged that Trypanosoma cruzi, responsible for Chagas disease, is structured into six or seven distinct discrete typing units (DTUs), and termed TcI through TcVI and TcBat for the seventh, by a collective of researchers. However, such structuring can be validated only when the species is analyzed over its entire distribution area with the same genetic markers. Many works have dealt with several DTUs in limited areas, generally one country, others have dealt with only one DTU over the endemic area, but no work has reported data of all DTUs over the entire endemic area. Hence, the aim of this minireview was to analyze three gene sequences, already deposited in GenBank by others, over the entire geographical distribution of Chagas disease. Two mitochondrial (CytB and COII) and one nuclear gene (Gpi) were selected (i) among those most widely used in the field, (ii) of single copy for the nuclear one, and (iii) presenting common sequences of sufficient size for applying phylogenetic tools. They were analyzed using maximum likelihood trees and phylogenetic networks. Remarkably, only three significant clusters instead of seven were found with the mitochondrial genes. With the nuclear gene, surprisingly, all seven expected clusters did not have significant bootstrap values. Moreover, DTUs TcV and TcVI were indistinguishable as were TcIII and TcIV. Additionally, we have undertaken a minireview of seventy-five publications presenting phylogenetic trees with identifiable DTUs that allowed us, together with our own results, to seriously question the structuring of T. cruzi into six or seven separated DTUs. We propose that mitochondrial typing in three clusters currently named mtTcI, mtTcII, and mtTcIII is robust whereas nuclear typing may lead to a questionable clustering but it is valuable for detecting mitochondrial introgression, heterozygous states and allelic composition. Copyright © 2016 Elsevier B.V. All rights reserved.

Genome sequencing and transposon mutagenesis of Burkholderia seminalis TC3.4.2R3 identify genes contributing to suppression of orchid necrosis caused by B. gladioli

USDA-ARS?s Scientific Manuscript database

Thirty six strains of Burkholderia spp. isolated from sugarcane were evaluated for biological control of leaf and pseudobulb necrosis of orchid caused by B. gladioli. Twenty nine of the sugarcane strains suppressed the disease in greenhouse assays. We generated a draft genomic sequence of one suppr...

De Novo Paternal FBN1 Mutation Detected in Embryos Before Implantation.

PubMed

Wang, Shuling; Niu, Ziru; Wang, Hui; Ma, Minyue; Zhang, Wei; Fang Wang, Shu; Wang, Jun; Yan, Hong; Liu, Yifan; Duan, Na; Zhang, Xiandong; Yao, Yuanqing

2017-06-26

BACKGROUND Marfan syndrome (MFS) is an autosomal dominant disease caused by mutations in the Fibrillin (FBN)1 gene and characterized by disorders in the cardiovascular, skeletal, and visual systems. The diversity of mutations and phenotypic heterogeneity of MFS make prenatal molecular diagnoses difficult. In this study, we used pre-implantation genetic diagnosis (PGD) to identify the pathogenic mutation in a male patient with MFS and to determine whether his offspring would be free of the disease. MATERIAL AND METHODS The history and pedigree of the proband were analyzed. Mutation analysis was performed on the couple and immediate family members. The couple chose IVF treatment and 4 blastocysts were biopsied. PGD was carried out by targeted high-throughput sequencing of the FBN1 gene in the embryos, along with single-nucleotide polymorphism haplotyping. Sanger sequencing was used to confirm the causative mutation. RESULTS c.2647T>C (p.Trp883Arg) was identified as the de novo likely pathogenic mutation in the proband. Whole-genome amplification and sequencing of the 3 embryos revealed that they did not carry the mutation, and 1 blastocyst was transferred back to the uterus. The amniocentesis test result analyzed by Sanger sequencing confirmed the PGD. A premature but healthy infant free of heart malformations was born. CONCLUSIONS The de novo mutation c.2647T>C (p.Trp883Arg) in FBN1 was identified in a Chinese patient with MFS. Embryos without the mutation were identified by PGD and resulted in a successful pregnancy.

A mutant screening method by critical annealing temperature-PCR for site-directed mutagenesis.

PubMed

Liu, Ying; Wu, Ting; Song, Jian; Chen, Xuelian; Zhang, Yu; Wan, Yu

2013-03-11

Distinguishing desired mutants from parental templates and undesired mutants is a problem not well solved in Quikchange™ mutagenesis. Although Dpn I digestion can eliminate methylated parental (WT) DNA, the efficiency is not satisfying due to the existence of hemi-methylated DNA in the PCR products, which is resistant to Dpn I. The present study designed a novel critical annealing temperature (T(c))-PCR to replace Dpn I digestion for more perfect mutant distinguishing, in which part-overlapping primers containing mutation(s) were used to reduce initial concentration of template DNA in mutagenic PCR. A T(c)-PCR with the same mutagenic primers was performed without Dpn I digestion. The T(c) for each pair of the primers was identified by gradient PCR. The relationship between PCR-identified T(c) and T(m) of the primers was analyzed and modeled with correlation and regression. Gradient PCR identified a T(c) for each of 14 tested mutagenic primers, which could discriminate mismatched parental molecules and undesired mutants from desired mutants. The PCR-identified T(c) was correlated to the primer's T(m) (r = 0.804, P<0.0001). Thus, in practical applications, the T(c) can be easily calculated with a regression equation, T(c)= 48.81 + 0.253*T(m). The new protocol introduced a novel T(c)-PCR method for mutant screening which can more efficiently and accurately select against parental molecules and undesired mutations in mutagenic sequence segments.

Predominance of hybrid discrete typing units of Trypanosoma cruzi in domestic Triatoma infestans from the Bolivian Gran Chaco region.

PubMed

Perez, Esdenka; Monje, Marcelo; Chang, Boris; Buitrago, Rosio; Parrado, Rudy; Barnabé, Christian; Noireau, François; Brenière, Simone Frédérique

2013-01-01

In the Gran Chaco region the reinfestation by Triatoma infestans remains a major problem for control of Chagas disease. Trypanosoma cruzi the agent of the illness presents a broad genetic intraspecific variability which is poorly documented in the Bolivian Gran Chaco. This work presents the identification of the discrete typing units (DTUs) currently recognized for T. cruzi in T. infestans populations collected before and after residual insecticide spraying in four villages in this region. Before spraying, of 84 samples, the frequencies of the DTUs identified by using the multiplex PCR based on the non transcribed spacer of the mini-exon gene (MMPCR) were 0.21 for TcI, 0.70 for TcII/TcV/TcVI, and 0.17 for TcIII/TcIV and no significant difference was observed after spraying (76 samples). Moreover 13% of the total sample corresponds to T. infestans specimens with mixed infection of DTUs of which three were TcII/TcV/TcVI with TcIII/TcIV. The partial sequences of T. cruzi Gpi gene obtained from 14 PCR products agree the MMPCR DTU identification and allowed to precise the occurrence of TcIII, TcII and hybrid TcV/TcVI stocks which were not discriminated by the MMPCR. Given the high prevalence of hybrid stocks, the authors ask whether the recombination event at the origin of hybrids would have taken place in the Gran Chaco where the putative parents are also present. Copyright © 2012 Elsevier B.V. All rights reserved.

Large diversity of the piggyBac-like elements in the genome of Tribolium castaneum

PubMed Central

Wang, Jianjun; Du, Yuzhou; Wang, Suzhi; Brown, Sue; Park, Yoonseong

2011-01-01

The piggyBac transposable element, originally discovered in the cabbage looper, Trichoplusia ni, has been widely used in insect transgenesis including the red flour beetle Tribolium castaneum. We surveyed piggyBac-like (PLE) sequences in the genome of Tribolium castaneum by homology searches using as queries the diverse PLE sequences that have been described previously. The search yielded a total of 32 piggyBac-like elements (TcPLEs) which were classified into 14 distinct groups. Most of the TcPLEs contain defective functional motifs in that they are lacking inverted terminal repeats or have disrupted open reading frames. Only one single copy of TcPLE1 appears to be intact with imperfect 16 bp inverted terminal repeats flanking an open reading frame encoding a transposase of 571 amino acid residues. Many copies of TcPLEs were found to be inserted into or close to other transposon-like sequences. This large diversity of TcPLEs with generally low copy numbers suggests multiple invasions of the TcPLEs over a long evolutionary time without extensive multiplications or occurrence of rapid loss of TcPLEs copies. PMID:18342253

Multilocus sequence typing (MLST) for lineage assignment and high resolution diversity studies in Trypanosoma cruzi.

PubMed

Yeo, Matthew; Mauricio, Isabel L; Messenger, Louisa A; Lewis, Michael D; Llewellyn, Martin S; Acosta, Nidia; Bhattacharyya, Tapan; Diosque, Patricio; Carrasco, Hernan J; Miles, Michael A

2011-06-01

Multilocus sequence typing (MLST) is a powerful and highly discriminatory method for analysing pathogen population structure and epidemiology. Trypanosoma cruzi, the protozoan agent of American trypanosomiasis (Chagas disease), has remarkable genetic and ecological diversity. A standardised MLST protocol that is suitable for assignment of T. cruzi isolates to genetic lineage and for higher resolution diversity studies has not been developed. We have sequenced and diplotyped nine single copy housekeeping genes and assessed their value as part of a systematic MLST scheme for T. cruzi. A minimum panel of four MLST targets (Met-III, RB19, TcGPXII, and DHFR-TS) was shown to provide unambiguous assignment of isolates to the six known T. cruzi lineages (Discrete Typing Units, DTUs TcI-TcVI). In addition, we recommend six MLST targets (Met-II, Met-III, RB19, TcMPX, DHFR-TS, and TR) for more in depth diversity studies on the basis that diploid sequence typing (DST) with this expanded panel distinguished 38 out of 39 reference isolates. Phylogenetic analysis implies a subdivision between North and South American TcIV isolates. Single Nucleotide Polymorphism (SNP) data revealed high levels of heterozygosity among DTUs TcI, TcIII, TcIV and, for three targets, putative corresponding homozygous and heterozygous loci within DTUs TcI and TcIII. Furthermore, individual gene trees gave incongruent topologies at inter- and intra-DTU levels, inconsistent with a model of strict clonality. We demonstrate the value of systematic MLST diplotyping for describing inter-DTU relationships and for higher resolution diversity studies of T. cruzi, including presence of recombination events. The high levels of heterozygosity will facilitate future population genetics analysis based on MLST haplotypes.

A genomic scale map of genetic diversity in Trypanosoma cruzi

PubMed Central

2012-01-01

Background Trypanosoma cruzi, the causal agent of Chagas Disease, affects more than 16 million people in Latin America. The clinical outcome of the disease results from a complex interplay between environmental factors and the genetic background of both the human host and the parasite. However, knowledge of the genetic diversity of the parasite, is currently limited to a number of highly studied loci. The availability of a number of genomes from different evolutionary lineages of T. cruzi provides an unprecedented opportunity to look at the genetic diversity of the parasite at a genomic scale. Results Using a bioinformatic strategy, we have clustered T. cruzi sequence data available in the public domain and obtained multiple sequence alignments in which one or two alleles from the reference CL-Brener were included. These data covers 4 major evolutionary lineages (DTUs): TcI, TcII, TcIII, and the hybrid TcVI. Using these set of alignments we have identified 288,957 high quality single nucleotide polymorphisms and 1,480 indels. In a reduced re-sequencing study we were able to validate ~ 97% of high-quality SNPs identified in 47 loci. Analysis of how these changes affect encoded protein products showed a 0.77 ratio of synonymous to non-synonymous changes in the T. cruzi genome. We observed 113 changes that introduce or remove a stop codon, some causing significant functional changes, and a number of tri-allelic and tetra-allelic SNPs that could be exploited in strain typing assays. Based on an analysis of the observed nucleotide diversity we show that the T. cruzi genome contains a core set of genes that are under apparent purifying selection. Interestingly, orthologs of known druggable targets show statistically significant lower nucleotide diversity values. Conclusions This study provides the first look at the genetic diversity of T. cruzi at a genomic scale. The analysis covers an estimated ~ 60% of the genetic diversity present in the population, providing an essential resource for future studies on the development of new drugs and diagnostics, for Chagas Disease. These data is available through the TcSNP database (http://snps.tcruzi.org). PMID:23270511

THAP1/DYT6 sequence variants in non-DYT1 early-onset primary dystonia in China and their effects on RNA expression.

PubMed

Cheng, Fu Bo; Ozelius, Laurie J; Wan, Xin Hua; Feng, Jia Chun; Ma, Ling Yan; Yang, Ying Mai; Wang, Lin

2012-02-01

Mutations in the THAP1 gene were recently identified as the cause of DYT6 primary dystonia. More than 40 mutations in this gene have been described in different populations. However, no previous report has identified sequence variations that affect the transcript process of the THAP1 gene. In addition, the mutation frequency in Chinese early-onset primary dystonia has not been well characterized. One hundred and two unrelated patients with non-DYT1 early-onset primary dystonia (age at onset <26 years), family members of participants with mutations, and 200 neurologically normal controls were screened for THAP1 gene mutations. The effects of the identified mutations on RNA expression were analyzed using semi-quantitative real-time PCR. Seven sequence variants (c.63_66del TTTC, c.161G>T, c.224A>T, c.267G>A, c.339T>C, c.449A>C, and c.539T>C) were identified in this group of patients (6.9%). In this cohort, 15 subjects (seven unrelated patients and eight family members) were detected to have THAP1 sequence variants. Among these 15 subjects, 11 were manifested (penetrance of DYT6 was 73.3%) and seven presented with craniocervical involvement (63.6%). However, one patient manifested paroxysmal headshake, and one presented with essential hand tremor. Semi-quantitative real-time PCR indicated that a novel silent mutation (c.267G>A) decreased the expression of THAP1 in human lymphocytes. Our findings indicated that THAP1 sequence variants are not common in non-DYT1 early-onset primary dystonia in China and that the clinical manifestation may vary. One silent mutation (c.267G>A) was shown to affect THAP1 expression.

Selected exonic sequencing of the AGXT gene provides a genetic diagnosis in 50% of patients with primary hyperoxaluria type 1.

PubMed

Williams, Emma; Rumsby, Gill

2007-07-01

Definitive diagnosis of primary hyperoxaluria type 1 (PH1) requires analysis of alanine:glyoxylate aminotransferase (AGT) activity in the liver. We have previously shown that targeted screening for the 3 most common mutations in the AGXT gene (c.33_34insC, c.508G>A, and c.731T>C) can provide a molecular diagnosis in 34.5% of PH1 patients, eliminating the need for a liver biopsy. Having reviewed the distribution of all AGXT mutations, we have evaluated a diagnostic strategy that uses selected exon sequencing for the molecular diagnosis of PH1. We sequenced exons 1, 4, and 7 for 300 biopsy-confirmed PH1 patients and expressed the identified missense mutations in vitro. Our identification of at least 1 mutation in 224 patients (75%) and 2 mutations in 149 patients increased the diagnostic sensitivity to 50%. We detected 29 kinds of sequence changes, 15 of which were novel. Four of these mutations were in exon 1 (c.2_3delinsAT, c.30_32delCC, c.122G>A, c.126delG), 7 were in exon 4 (c.447_454delGCTGCTGT, c.449T>C, c.473C>T, c.481G>A, c.481G>T, c.497T>C, c.424-2A>G), and 4 were in exon 7 (c.725insT, c.737G>A, c.757T>C, c.776 + 1G>A). The missense changes were associated with severely decreased AGT catalytic activity and negative immunoreactivity when expressed in vitro. Missense mutation c.26C>A, previously described as a pathological mutation, had activity similar to that of the wild-type enzyme. Selective exon sequencing can allow a definitive diagnosis in 50% of PH1 patients. The test offers a rapid turnaround time (15 days) with minimal risk to the patient. Demonstration of the expression of missense changes is essential to demonstrate pathogenicity.

Coexpression Analysis Identifies Two Oxidoreductases Involved in the Biosynthesis of the Monoterpene Acid Moiety of Natural Pyrethrin Insecticides in Tanacetum cinerariifolium1[OPEN

PubMed Central

Moghe, Gaurav D.

2018-01-01

Flowers of Tanacetum cinerariifolium produce a set of compounds known collectively as pyrethrins, which are commercially important pesticides that are strongly toxic to flying insects but not to most vertebrates. A pyrethrin molecule is an ester consisting of either trans-chrysanthemic acid or its modified form, pyrethric acid, and one of three alcohols, jasmolone, pyrethrolone, and cinerolone, that appear to be derived from jasmonic acid. Chrysanthemyl diphosphate synthase (CDS), the first enzyme involved in the synthesis of trans-chrysanthemic acid, was characterized previously and its gene isolated. TcCDS produces free trans-chrysanthemol in addition to trans-chrysanthemyl diphosphate, but the enzymes responsible for the conversion of trans-chrysanthemol to the corresponding aldehyde and then to the acid have not been reported. We used an RNA sequencing-based approach and coexpression correlation analysis to identify several candidate genes encoding putative trans-chrysanthemol and trans-chrysanthemal dehydrogenases. We functionally characterized the proteins encoded by these genes using a combination of in vitro biochemical assays and heterologous expression in planta to demonstrate that TcADH2 encodes an enzyme that oxidizes trans-chrysanthemol to trans-chrysanthemal, while TcALDH1 encodes an enzyme that oxidizes trans-chrysanthemal into trans-chrysanthemic acid. Transient coexpression of TcADH2 and TcALDH1 together with TcCDS in Nicotiana benthamiana leaves results in the production of trans-chrysanthemic acid as well as several other side products. The majority (58%) of trans-chrysanthemic acid was glycosylated or otherwise modified. Overall, these data identify key steps in the biosynthesis of pyrethrins and demonstrate the feasibility of metabolic engineering to produce components of these defense compounds in a heterologous host. PMID:29122986

Tubulocystic Carcinoma of the Kidney with Poorly Differentiated Foci: A Frequent Morphologic Pattern of Fumarate Hydratase-Deficient Renal Cell Carcinoma

PubMed Central

Smith, Steven C; Trpkov, Kiril; Chen, Ying-Bei; Mehra, Rohit; Sirohi, Deepika; Ohe, Chisato; Cani, Andi K; Hovelson, Daniel H; Omata, Kei; McHugh, Jonathan B; Jochum, Wolfram; Colecchia, Maurizio; Amin, Mitual; Divatia, Mukul K; Hes, Ondřej; Menon, Santosh; da Cunha, Isabela Werneck; Tripodi, Sergio; Brimo, Fadi; Gill, Anthony J; Osunkoya, Adeboye O; Magi-Galluzzi, Cristina; Sibony, Mathilde; Williamson, Sean R; Nesi, Gabriella; Picken, Maria M; Maclean, Fiona; Agaimy, Abbas; Cheng, Liang; Epstein, Jonathan I; Reuter, Victor E; Tickoo, Satish K; Tomlins, Scott A; Amin, Mahul B

2017-01-01

An emerging group of high grade renal cell carcinomas (RCCs), particularly carcinomas arising in the hereditary leiomyomatosis renal cell carcinoma syndrome (HLRCC), show fumarate hydratase (FH) gene mutation and loss of function. Based on similar cytomorphology and clinicopathologic features between these tumors and cases described as tubulocystic carcinomas with poorly differentiated foci of infiltrative adenocarcinoma (TC-PD), we hypothesized a relationship between these entities. First, 29 RCCs with morphology of TC-PD were identified retrospectively and assessed for FH expression and aberrant succination (2SC) by immunohistochemistry (IHC), with targeted next generation sequencing (NGS) of 409 genes—including FH—performed on a subset. The 29 TC-PD RCCs included 21 males and 8 females, aged 16-86 years (median 46), with tumors measuring 3-21 cm (median 9) arising in the right (n=16) and left (n=13) kidneys. Family history or stigmata of HLRCC were identified in only 3 (12%). These tumors were aggressive, with 79% showing perinephric extension, nodal involvement in 41%, and metastasis in 86%. Of these, 16 (55%) demonstrated loss of FH by IHC (14/14 with positive 2SC). In contrast, 5 (17%) showed a wild type immunoprofile of FH+/2SC-. An intriguing group of 8 (28%) showed variable FH± positivity, but with strong/diffuse 2SC+. NGS revealed 8 cases with FH mutations, including 5 FH-/2SC+ and 3 FH±/2SC+ cases, but none in FH+/2SC- cases. Secondly, we retrospectively reviewed the morphology of two well-characterized cohorts of RCCs with FH-deficiency determined by IHC or sequencing (n=23 and n=9), unselected for TC-PD pattern, identifying the TC-PD morphology in 10 (31%). We conclude that RCCs with TC-PD morphology are enriched for FH deficiency, and we recommend additional work up, including referral to genetic counseling, for prospective cases. Additionally, based on these and other observations, we propose the term “FH-deficient RCC” as a provisional term for tumors with a combination of suggestive morphology and immunophenotype but where genetic confirmation is unavailable upon diagnosis. This term will serve as a provisional nomenclature that will enable triage of individual cases for genetic counseling and testing, while designating these cases for prospective studies of their relationship to HLRCC. PMID:27635946

High-affinity copper transport and Snq2 export permease of saccharomyces cerevisiae modulate cytotoxicity of PR-10 from Theobroma cacao.

PubMed

Pungartnik, Cristina; da Silva, Aline Clara; de Melo, Sarah Alves; Gramacho, Karina Peres; de Mattos Cascardo, Júlio Cézar; Brendel, Martin; Micheli, Fabienne; da Silva Gesteira, Abelmon

2009-01-01

A pathogenesis-related (PR) protein from Theobroma cacao (TcPR-10) was identified from a cacao-Moniliophthora perniciosa interaction cDNA library. Nucleotide and amino acid sequences showed homology with other PR-10 proteins having P loop motif and Betv1 domain. Recombinant TcPR-10 showed in vitro and in vivo ribonuclease activity, and antifungal activity against the basidiomycete cacao pathogen M. perniciosa and the yeast Saccharomyces cerevisiae. Fluorescein isothiocyanate-labeled TcPR-10 was internalized by M. perniciosa hyphae and S. cerevisiae cells and inhibited growth of both fungi. Energy and temperature-dependent internalization of the TcPR-10 suggested an active importation into the fungal cells. Chronical exposure to TcPR-10 of 29 yeast mutants with single gene defects in DNA repair, general membrane transport, metal transport, and antioxidant defenses was tested. Two yeast mutants were hyperresistant compared with their respective isogenic wild type: ctr3Delta mutant, lacking the high-affinity plasma membrane copper transporter and mac1Delta, the copper-sensing transcription factor involved in regulation of high-affinity copper transport. Acute exposure of exponentially growing yeast cells revealed that TcPR-10 resistance is also enhanced in the Snq2 export permease-lacking mutant which has reduced intracellular presence of TcPR-10.

Diagnostic accuracy of 3T magnetic resonance imaging in the preoperative localisation of parathyroid adenomas: comparison with ultrasound and 99mTc-sestamibi scans.

PubMed

Argirò, Renato; Diacinti, Daniele; Sacconi, Beatrice; Iannarelli, Angelo; Diacinti, Davide; Cipriani, Cristiana; Pisani, Daniela; Romagnoli, Elisabetta; Biffoni, Marco; Di Gioia, Cira; Pepe, Jessica; Bezzi, Mario; Letizia, Claudio; Minisola, Salvatore; Catalano, Carlo

2018-05-07

To evaluate the diagnostic performance of 3TMRI in comparison with ultrasound (US) and 99mTc-sestamibi scan for presurgical localisation of parathyroid adenomas (PTAs) in patients with primary hyperparathyroidism (PHPT). Fifty-seven patients affected by PHPT were prospectively enrolled and underwent US, 99mTc-sestamibi and 3TMRI. T2-weighted and post-contrast T1-weighted Iterative decomposition of water and fat with Echo Asymmetry and Least squares estimation (IDEAL) sequences were acquired. Diagnostic performance of US, 99mTc-sestamibi and MRI in localising PTAs to correct quadrant were compared according to surgical and pathological findings. According to surgical findings, US correctly localised 41/46 PTAs (sensitivity of 89.1%; specificity 97.5%; PPV 93.1% and NPV 95.6%); 99mTc-sestamibi correctly localised 38/46 PTAs (sensitivity 83.6%, specificity 98.3%, PPV 95% and NPV 93.7%). US and 99mTc-sestamibi combined had a sensitivity of 93.4% (43/46 PTAs), specificity of 98.3%, PPV 95% and NPV 98.3%. MRI correctly localised 45/46 PTAs (sensitivity 97.8%; specificity 97.5%; PPV 93.7% and NPV 99.2%). MRI was able to detect six adenomas missed by 99mTc-sestamibi and two adenomas missed by US. MRI and US were able to detect all enlarged parathyroid glands in patients with multiglandular disease. MRI identified six of seven ectopic adenomas. Our study demonstrated high diagnostic performance of 3T MRI in the preoperative PTAs quadrant localisation, as well as in patients with multiglandular disease and ectopic PTAs. MRI may be preferred to adequately select patient candidates for minimally invasive parathyroidectomy (MIP). • PTA(s) quadrant localisation by 3TMRI was more accurate than US+99mTc-sestamibi. • MRI identified all enlarged glands in multiglandular disease similarly to US. • MRI identified 6/7 ectopic PTAs similarly to 99mTc-sestamibi. • Presurgical PTA(s) localisation by 3TMRI select the optimal candidates for MIP.

Exome sequencing is an efficient tool for variant late-infantile neuronal ceroid lipofuscinosis molecular diagnosis.

PubMed

Patiño, Liliana Catherine; Battu, Rajani; Ortega-Recalde, Oscar; Nallathambi, Jeyabalan; Anandula, Venkata Ramana; Renukaradhya, Umashankar; Laissue, Paul

2014-01-01

The neuronal ceroid-lipofuscinoses (NCL) is a group of neurodegenerative disorders characterized by epilepsy, visual failure, progressive mental and motor deterioration, myoclonus, dementia and reduced life expectancy. Classically, NCL-affected individuals have been classified into six categories, which have been mainly defined regarding the clinical onset of symptoms. However, some patients cannot be easily included in a specific group because of significant variation in the age of onset and disease progression. Molecular genetics has emerged in recent years as a useful tool for enhancing NCL subtype classification. Fourteen NCL genetic forms (CLN1 to CLN14) have been described to date. The variant late-infantile form of the disease has been linked to CLN5, CLN6, CLN7 (MFSD8) and CLN8 mutations. Despite advances in the diagnosis of neurodegenerative disorders mutations in these genes may cause similar phenotypes, which rends difficult accurate candidate gene selection for direct sequencing. Three siblings who were affected by variant late-infantile NCL are reported in the present study. We used whole-exome sequencing, direct sequencing and in silico approaches to identify the molecular basis of the disease. We identified the novel c.1219T>C (p.Trp407Arg) and c.1361T>C (p.Met454Thr) MFSD8 pathogenic mutations. Our results highlighted next generation sequencing as a novel and powerful methodological approach for the rapid determination of the molecular diagnosis of NCL. They also provide information regarding the phenotypic and molecular spectrum of CLN7 disease.

Study of infectious diseases in archaeological bone material - A dataset.

PubMed

Pucu, Elisa; Cascardo, Paula; Chame, Marcia; Felice, Gisele; Guidon, Niéde; Cleonice Vergne, Maria; Campos, Guadalupe; Roberto Machado-Silva, José; Leles, Daniela

2017-08-01

Bones of human and ground sloth remains were analyzed for presence of Trypanosoma cruzi by conventional PCR using primers TC, TC1 and TC2. Sequence results amplified a fragment with the same product size as the primers (300 and 350pb). Amplified PCR product was sequenced and analyzed on GenBank, using Blast. Although these sequences did not match with these parasites they showed high amplification with species of bacteria. This article presents the methodology used and the alignment of the sequences. The display of this dataset will allow further analysis of our results and discussion presented in the manuscript "Finding the unexpected: a critical view on molecular diagnosis of infectious diseases in archaeological samples" (Pucu et al. 2017) [1].

Single nucleotide polymorphisms and haplotype frequencies of CYP3A5 in a Japanese population.

PubMed

Saeki, Mayumi; Saito, Yoshiro; Nakamura, Takahiro; Murayama, Norie; Kim, Su-Ryang; Ozawa, Shogo; Komamura, Kazuo; Ueno, Kazuyuki; Kamakura, Shiro; Nakajima, Toshiharu; Saito, Hirohisa; Kitamura, Yutaka; Kamatani, Naoyuki; Sawada, Jun-ichi

2003-06-01

In order to identify single nucleotide polymorphisms (SNPs) and haplotype frequencies of CYP3A5 in a Japanese population, we sequenced the proximal promoter region, all exons, and the surrounding intronic regions using genomic DNA from 187 Japanese subjects. Thirteen SNPs, including seven novel ones: 13108T>C, 16025A>G, 16903A>G, 16993C>G, 27448C>A, 29782A>G, and 31551T>C (A of the translational start codon of GenBank Accession # NG_000004.2 is numbered 1 according to the CYP Allele Nomenclature), were identified. The most common SNP was 6986A>G (key SNP for CYP3A5*3), with a 0.759 frequency. Two novel SNPs, 29782A>G (I456V) and 31551T>C (I488T), as well as 12952T>C (*5 marker) were found, but these alterations were always associated with the *3A marker SNPs, 6986A>G and 31611C>T. Using these 13 SNPs, haplotype analysis was performed and five novel *1 haplotypes (subtypes) (*1e to *1i) and six novel *3 haplotypes (subtypes) (*3d to *3i) were identified. Our findings suggest that CYP3A5*3 is the major defective allele and that other functional exonic SNPs are rare in the Japanese. Copyright 2003 Wiley-Liss, Inc.

Structural Basis of the Interaction of a Trypanosoma cruzi Surface Molecule Implicated in Oral Infection with Host Cells and Gastric Mucin

PubMed Central

Cortez, Cristian; Yoshida, Nobuko; Bahia, Diana; Sobreira, Tiago J.P.

2012-01-01

Host cell invasion and dissemination within the host are hallmarks of virulence for many pathogenic microorganisms. As concerns Trypanosoma cruzi, which causes Chagas disease, the insect vector-derived metacyclic trypomastigotes (MT) initiate infection by invading host cells, and later blood trypomastigotes disseminate to diverse organs and tissues. Studies with MT generated in vitro and tissue culture-derived trypomastigotes (TCT), as counterparts of insect-borne and bloodstream parasites, have implicated members of the gp85/trans-sialidase superfamily, MT gp82 and TCT Tc85-11, in cell invasion and interaction with host factors. Here we analyzed the gp82 structure/function characteristics and compared them with those previously reported for Tc85-11. One of the gp82 sequences identified as a cell binding site consisted of an α-helix, which connects the N-terminal β-propeller domain to the C-terminal β-sandwich domain where the second binding site is nested. In the gp82 structure model, both sites were exposed at the surface. Unlike gp82, the Tc85-11 cell adhesion sites are located in the N-terminal β-propeller region. The gp82 sequence corresponding to the epitope for a monoclonal antibody that inhibits MT entry into target cells was exposed on the surface, upstream and contiguous to the α-helix. Located downstream and close to the α-helix was the gp82 gastric mucin binding site, which plays a central role in oral T. cruzi infection. The sequences equivalent to Tc85-11 laminin-binding sites, which have been associated with the parasite ability to overcome extracellular matrices and basal laminae, was poorly conserved in gp82, compatible with its reduced capacity to bind laminin. Our study indicates that gp82 is structurally suited for MT to initiate infection by the oral route, whereas Tc85-11, with its affinity for laminin, would facilitate the parasite dissemination through diverse organs and tissues. PMID:22860068

Identification, cloning, and expression of a GHF9 cellulase from Tribolium castaneum (Coleoptera: Tenebrionidae)

USDA-ARS?s Scientific Manuscript database

The availability of sequenced insect genomes has allowed for discovery and functional characterization of novel genes and proteins. We report use of the Tribolium castaneum (Herbst) (red flour beetle) genome to identify, clone, express, and characterize a novel endo-ß-1,4-glucanase we named TcEG1 (...

Codon 62 (GTG>GCG, Val→Ala) (α1) (HBA1: c.188T>C) causing nondeletional α-thalassemia in a Chinese family.

PubMed

Liao, Can; Tang, Hai-Shen; Li, Ru; Li, Dong-Zhi

2013-01-01

We report a novel α-globin gene point mutation detected during newborn screening for hemoglobinopathies. Sequence analyses identified a GTG>GCG substitution at codon 62 of the α1-globin gene. This mutation causes a silent α-thalassemia (α-thal).

Probable Diagnosis of a Patient with Niemann-Pick Disease Type C: Managing Pitfalls of Exome Sequencing.

PubMed

Zeiger, William A; Jamal, Nasheed I; Scheuner, Maren T; Pittman, Patricia; Raymond, Kimiyo M; Morra, Massimo; Mishra, Shri K

2018-02-17

Here, we present a case of a 31-year-old man with progressive cognitive decline, ataxia, and dystonia. Extensive laboratory, radiographic, and targeted genetic studies over the course of several years failed to yield a diagnosis. Initial whole exome sequencing through a commercial laboratory identified several variants of uncertain significance; however, follow-up clinical examination and testing ruled each of these out. Eventually, repeat whole exome sequencing identified a known pathogenic intronic variant in the NPC1 gene (NM_000271.4, c.1554-1009G>A) and an additional heterozygous exonic variant of uncertain significance in the NPC1 gene (NM_000271.4, c.2524T>C). Follow-up biochemical testing was consistent with a diagnosis of probable Niemann-Pick disease Type C (NP-C). This case illustrates the potential of whole exome sequencing for diagnosing rare complex neurologic diseases. It also identifies several potential common pitfalls that must be navigated by clinicians when interpreting commercial whole exome sequencing results.

Natural and emergent Trypanosoma cruzi I genotypes revealed by mitochondrial (Cytb) and nuclear (SSU rDNA) genetic markers.

PubMed

Ramírez, Juan David; Duque, María Clara; Montilla, Marleny; Cucunubá, Zulma; Guhl, Felipe

2012-12-01

Chagas disease is a tropical and systemic disease caused by the parasite Trypanosoma cruzi. This parasite has been divided into six Discrete Typing Units (DTU's) due to its high genetic diversity. T. cruzi I (TcI) is the most prevalent DTU in Colombia and recently associated to cardiomyopathies. The aim of this study was to unravel the genetic variability among a set of 70 cell-single TcI clones from different geographical regions and hosts using the sequences of Cytb and SSU rDNA. The results showed two genotypes associated to transmission cycles of Chagas disease in Colombia and supports the previous descriptions using SL-IR. Phylogenetic networks were developed detecting recombination events within TcI. We also tested the phylogenetic relationships beneath TcI clones and TcIII/TcIV sequences observing the high relatedness of TcI clones from sylvatic cycle with TcIII/TcIV. We corroborate the high genetic diversity displayed by TcI, the plausible recombination within this DTU supporting the previous model of genetic exchange proposed in T. cruzi populations. We conclude inquiring the need to pursue new studies to elucidate the genetic structure of TcI across Chagas disease endemic countries. Copyright © 2012 Elsevier Inc. All rights reserved.

North American import? Charting the origins of an enigmatic Trypanosoma cruzi domestic genotype.

PubMed

Zumaya-Estrada, Federico A; Messenger, Louisa A; Lopez-Ordonez, Teresa; Lewis, Michael D; Flores-Lopez, Carlos A; Martínez-Ibarra, Alejandro J; Pennington, Pamela M; Cordon-Rosales, Celia; Carrasco, Hernan V; Segovia, Maikel; Miles, Michael A; Llewellyn, Martin S

2012-10-10

Trypanosoma cruzi, the agent of Chagas disease, is currently recognized as a complex of six lineages or Discrete Typing Units (DTU): TcI-TcVI. Recent studies have identified a divergent group within TcI - TcI(DOM). TcI(DOM). is associated with a significant proportion of human TcI infections in South America, largely absent from local wild mammals and vectors, yet closely related to sylvatic strains in North/Central America. Our aim was to examine hypotheses describing the origin of the TcI(DOM) genotype. We propose two possible scenarios: an emergence of TcI(DOM) in northern South America as a sister group of North American strain progenitors and dispersal among domestic transmission cycles, or an origin in North America, prior to dispersal back into South American domestic cycles. To provide further insight we undertook high resolution nuclear and mitochondrial genotyping of multiple Central American strains (from areas of México and Guatemala) and included them in an analysis with other published data. Mitochondrial sequence and nuclear microsatellite data revealed a cline in genetic diversity across isolates grouped into three populations: South America, North/Central America and TcI(DOM). As such, greatest diversity was observed in South America (A(r) = 4.851, π = 0.00712) and lowest in TcI(DOM) (Ar = 1.813, π = 0.00071). Nuclear genetic clustering (genetic distance based) analyses suggest that TcI(DOM) is nested within the North/Central American clade. Declining genetic diversity across the populations, and corresponding hierarchical clustering suggest that emergence of this important human genotype most likely occurred in North/Central America before moving southwards. These data are consistent with early patterns of human dispersal into South America.

Bovine exome sequence analysis and targeted SNP genotyping of recessive fertility defects BH1, HH2, and HH3 reveal a putative causative mutation in SMC2 for HH3.

PubMed

McClure, Matthew C; Bickhart, Derek; Null, Dan; Vanraden, Paul; Xu, Lingyang; Wiggans, George; Liu, George; Schroeder, Steve; Glasscock, Jarret; Armstrong, Jon; Cole, John B; Van Tassell, Curtis P; Sonstegard, Tad S

2014-01-01

The recent discovery of bovine haplotypes with negative effects on fertility in the Brown Swiss, Holstein, and Jersey breeds has allowed producers to identify carrier animals using commercial single nucleotide polymorphism (SNP) genotyping assays. This study was devised to identify the causative mutations underlying defective bovine embryo development contained within three of these haplotypes (Brown Swiss haplotype 1 and Holstein haplotypes 2 and 3) by combining exome capture with next generation sequencing. Of the 68,476,640 sequence variations (SV) identified, only 1,311 genome-wide SNP were concordant with the haplotype status of 21 sequenced carriers. Validation genotyping of 36 candidate SNP identified only 1 variant that was concordant to Holstein haplotype 3 (HH3), while no variants located within the refined intervals for HH2 or BH1 were concordant. The variant strictly associated with HH3 is a non-synonymous SNP (T/C) within exon 24 of the Structural Maintenance of Chromosomes 2 (SMC2) on Chromosome 8 at position 95,410,507 (UMD3.1). This polymorphism changes amino acid 1135 from phenylalanine to serine and causes a non-neutral, non-tolerated, and evolutionarily unlikely substitution within the NTPase domain of the encoded protein. Because only exome capture sequencing was used, we could not rule out the possibility that the true causative mutation for HH3 might lie in a non-exonic genomic location. Given the essential role of SMC2 in DNA repair, chromosome condensation and segregation during cell division, our findings strongly support the non-synonymous SNP (T/C) in SMC2 as the likely causative mutation. The absence of concordant variations for HH2 or BH1 suggests either the underlying causative mutations lie within a non-exomic region or in exome regions not covered by the capture array.

Bovine Exome Sequence Analysis and Targeted SNP Genotyping of Recessive Fertility Defects BH1, HH2, and HH3 Reveal a Putative Causative Mutation in SMC2 for HH3

PubMed Central

McClure, Matthew C.; Bickhart, Derek; Null, Dan; VanRaden, Paul; Xu, Lingyang; Wiggans, George; Liu, George; Schroeder, Steve; Glasscock, Jarret; Armstrong, Jon; Cole, John B.; Van Tassell, Curtis P.; Sonstegard, Tad S.

2014-01-01

The recent discovery of bovine haplotypes with negative effects on fertility in the Brown Swiss, Holstein, and Jersey breeds has allowed producers to identify carrier animals using commercial single nucleotide polymorphism (SNP) genotyping assays. This study was devised to identify the causative mutations underlying defective bovine embryo development contained within three of these haplotypes (Brown Swiss haplotype 1 and Holstein haplotypes 2 and 3) by combining exome capture with next generation sequencing. Of the 68,476,640 sequence variations (SV) identified, only 1,311 genome-wide SNP were concordant with the haplotype status of 21 sequenced carriers. Validation genotyping of 36 candidate SNP identified only 1 variant that was concordant to Holstein haplotype 3 (HH3), while no variants located within the refined intervals for HH2 or BH1 were concordant. The variant strictly associated with HH3 is a non-synonymous SNP (T/C) within exon 24 of the Structural Maintenance of Chromosomes 2 (SMC2) on Chromosome 8 at position 95,410,507 (UMD3.1). This polymorphism changes amino acid 1135 from phenylalanine to serine and causes a non-neutral, non-tolerated, and evolutionarily unlikely substitution within the NTPase domain of the encoded protein. Because only exome capture sequencing was used, we could not rule out the possibility that the true causative mutation for HH3 might lie in a non-exonic genomic location. Given the essential role of SMC2 in DNA repair, chromosome condensation and segregation during cell division, our findings strongly support the non-synonymous SNP (T/C) in SMC2 as the likely causative mutation. The absence of concordant variations for HH2 or BH1 suggests either the underlying causative mutations lie within a non-exomic region or in exome regions not covered by the capture array. PMID:24667746

Exome Sequencing Is an Efficient Tool for Variant Late-Infantile Neuronal Ceroid Lipofuscinosis Molecular Diagnosis

PubMed Central

Ortega-Recalde, Oscar; Nallathambi, Jeyabalan; Anandula, Venkata Ramana; Renukaradhya, Umashankar; Laissue, Paul

2014-01-01

The neuronal ceroid-lipofuscinoses (NCL) is a group of neurodegenerative disorders characterized by epilepsy, visual failure, progressive mental and motor deterioration, myoclonus, dementia and reduced life expectancy. Classically, NCL-affected individuals have been classified into six categories, which have been mainly defined regarding the clinical onset of symptoms. However, some patients cannot be easily included in a specific group because of significant variation in the age of onset and disease progression. Molecular genetics has emerged in recent years as a useful tool for enhancing NCL subtype classification. Fourteen NCL genetic forms (CLN1 to CLN14) have been described to date. The variant late-infantile form of the disease has been linked to CLN5, CLN6, CLN7 (MFSD8) and CLN8 mutations. Despite advances in the diagnosis of neurodegenerative disorders mutations in these genes may cause similar phenotypes, which rends difficult accurate candidate gene selection for direct sequencing. Three siblings who were affected by variant late-infantile NCL are reported in the present study. We used whole-exome sequencing, direct sequencing and in silico approaches to identify the molecular basis of the disease. We identified the novel c.1219T>C (p.Trp407Arg) and c.1361T>C (p.Met454Thr) MFSD8 pathogenic mutations. Our results highlighted next generation sequencing as a novel and powerful methodological approach for the rapid determination of the molecular diagnosis of NCL. They also provide information regarding the phenotypic and molecular spectrum of CLN7 disease. PMID:25333361

Polymorphisms in the Myostatin-1 gene and their association with growth traits in Ancherythroculter nigrocauda

NASA Astrophysics Data System (ADS)

Sun, Yanhong; Li, Qing; Wang, Guiying; Zhu, Dongmei; Chen, Jian; Li, Pei; Tong, Jingou

2017-05-01

Myostatin ( MSTN) is a member of the transforming growth factor-β gene superfamily that negatively regulates skeletal muscle development and growth. In the present study, partial genomic fragments of Myostatin-1 ( MSTN-1) in two commercial hatchery populations of Ancherythroculter nigrocauda, an economically important freshwater fish, were screened for single nucleotide polymorphisms (SNPs) and then genotyped by direct sequencing of PCR products. Five SNPs were identified in intron 1 and exon 2, including a non-synonymous mutation causing an amino acid change (Val to Ile) at position 180. Association analyses based on 300 individuals revealed that the g.1129T>C SNP locus was significantly associated with total length (TL), body length (BL), body height (BH) and body weight (BW) in 6- and 18-month-old populations, while the g.1289G>A locus was significantly associated with BH and BW in the 6-month-old population. Haplotype analyses revealed that fish with the genotype combinations TC/TC or TC/GA showed better growth performance. Our results suggest that g.1129T>C and g.1289G>A have positive effects on growth traits and may be candidate gene markers for marker-assisted selection in A. nigrocauda.

Identification of novel and conserved microRNAs related to drought stress in potato by deep sequencing.

PubMed

Zhang, Ning; Yang, Jiangwei; Wang, Zemin; Wen, Yikai; Wang, Jie; He, Wenhui; Liu, Bailin; Si, Huaijun; Wang, Di

2014-01-01

MicroRNAs (miRNAs) are a group of small, non-coding RNAs that play important roles in plant growth, development and stress response. There have been an increasing number of investigations aimed at discovering miRNAs and analyzing their functions in model plants (such as Arabidopsis thaliana and rice). In this research, we constructed small RNA libraries from both polyethylene glycol (PEG 6,000) treated and control potato samples, and a large number of known and novel miRNAs were identified. Differential expression analysis showed that 100 of the known miRNAs were down-regulated and 99 were up-regulated as a result of PEG stress, while 119 of the novel miRNAs were up-regulated and 151 were down-regulated. Based on target prediction, annotation and expression analysis of the miRNAs and their putative target genes, 4 miRNAs were identified as regulating drought-related genes (miR811, miR814, miR835, miR4398). Their target genes were MYB transcription factor (CV431094), hydroxyproline-rich glycoprotein (TC225721), quaporin (TC223412) and WRKY transcription factor (TC199112), respectively. Relative expression trends of those miRNAs were the same as that predicted by Solexa sequencing and they showed a negative correlation with the expression of the target genes. The results provide molecular evidence for the possible involvement of miRNAs in the process of drought response and/or tolerance in the potato plant.

Identification of Bari Transposons in 23 Sequenced Drosophila Genomes Reveals Novel Structural Variants, MITEs and Horizontal Transfer

PubMed Central

D’Addabbo, Pietro; Caizzi, Ruggiero

2016-01-01

Bari elements are members of the Tc1-mariner superfamily of DNA transposons, originally discovered in Drosophila melanogaster, and subsequently identified in silico in 11 sequenced Drosophila genomes and as experimentally isolated in four non-sequenced Drosophila species. Bari-like elements have been also studied for their mobility both in vivo and in vitro. We analyzed 23 Drosophila genomes and carried out a detailed characterization of the Bari elements identified, including those from the heterochromatic Bari1 cluster in D. melanogaster. We have annotated 401 copies of Bari elements classified either as putatively autonomous or inactive according to the structure of the terminal sequences and the presence of a complete transposase-coding region. Analyses of the integration sites revealed that Bari transposase prefers AT-rich sequences in which the TA target is cleaved and duplicated. Furthermore evaluation of transposon’s co-occurrence near the integration sites of Bari elements showed a non-random distribution of other transposable elements. We also unveil the existence of a putatively autonomous Bari1 variant characterized by two identical long Terminal Inverted Repeats, in D. rhopaloa. In addition, we detected MITEs related to Bari transposons in 9 species. Phylogenetic analyses based on transposase gene and the terminal sequences confirmed that Bari-like elements are distributed into three subfamilies. A few inconsistencies in Bari phylogenetic tree with respect to the Drosophila species tree could be explained by the occurrence of horizontal transfer events as also suggested by the results of dS analyses. This study further clarifies the Bari transposon’s evolutionary dynamics and increases our understanding on the Tc1-mariner elements’ biology. PMID:27213270

Identification of Bari Transposons in 23 Sequenced Drosophila Genomes Reveals Novel Structural Variants, MITEs and Horizontal Transfer.

PubMed

Palazzo, Antonio; Lovero, Domenica; D'Addabbo, Pietro; Caizzi, Ruggiero; Marsano, René Massimiliano

2016-01-01

Bari elements are members of the Tc1-mariner superfamily of DNA transposons, originally discovered in Drosophila melanogaster, and subsequently identified in silico in 11 sequenced Drosophila genomes and as experimentally isolated in four non-sequenced Drosophila species. Bari-like elements have been also studied for their mobility both in vivo and in vitro. We analyzed 23 Drosophila genomes and carried out a detailed characterization of the Bari elements identified, including those from the heterochromatic Bari1 cluster in D. melanogaster. We have annotated 401 copies of Bari elements classified either as putatively autonomous or inactive according to the structure of the terminal sequences and the presence of a complete transposase-coding region. Analyses of the integration sites revealed that Bari transposase prefers AT-rich sequences in which the TA target is cleaved and duplicated. Furthermore evaluation of transposon's co-occurrence near the integration sites of Bari elements showed a non-random distribution of other transposable elements. We also unveil the existence of a putatively autonomous Bari1 variant characterized by two identical long Terminal Inverted Repeats, in D. rhopaloa. In addition, we detected MITEs related to Bari transposons in 9 species. Phylogenetic analyses based on transposase gene and the terminal sequences confirmed that Bari-like elements are distributed into three subfamilies. A few inconsistencies in Bari phylogenetic tree with respect to the Drosophila species tree could be explained by the occurrence of horizontal transfer events as also suggested by the results of dS analyses. This study further clarifies the Bari transposon's evolutionary dynamics and increases our understanding on the Tc1-mariner elements' biology.

Tracking global changes induced in the CD4 T-cell receptor repertoire by immunization with a complex antigen using short stretches of CDR3 protein sequence.

PubMed

Thomas, Niclas; Best, Katharine; Cinelli, Mattia; Reich-Zeliger, Shlomit; Gal, Hilah; Shifrut, Eric; Madi, Asaf; Friedman, Nir; Shawe-Taylor, John; Chain, Benny

2014-11-15

The clonal theory of adaptive immunity proposes that immunological responses are encoded by increases in the frequency of lymphocytes carrying antigen-specific receptors. In this study, we measure the frequency of different T-cell receptors (TcR) in CD4 + T cell populations of mice immunized with a complex antigen, killed Mycobacterium tuberculosis, using high throughput parallel sequencing of the TcRβ chain. Our initial hypothesis that immunization would induce repertoire convergence proved to be incorrect, and therefore an alternative approach was developed that allows accurate stratification of TcR repertoires and provides novel insights into the nature of CD4 + T-cell receptor recognition. To track the changes induced by immunization within this heterogeneous repertoire, the sequence data were classified by counting the frequency of different clusters of short (3 or 4) continuous stretches of amino acids within the antigen binding complementarity determining region 3 (CDR3) repertoire of different mice. Both unsupervised (hierarchical clustering) and supervised (support vector machine) analyses of these different distributions of sequence clusters differentiated between immunized and unimmunized mice with 100% efficiency. The CD4 + TcR repertoires of mice 5 and 14 days postimmunization were clearly different from that of unimmunized mice but were not distinguishable from each other. However, the repertoires of mice 60 days postimmunization were distinct both from naive mice and the day 5/14 animals. Our results reinforce the remarkable diversity of the TcR repertoire, resulting in many diverse private TcRs contributing to the T-cell response even in genetically identical mice responding to the same antigen. However, specific motifs defined by short stretches of amino acids within the CDR3 region may determine TcR specificity and define a new approach to TcR sequence classification. The analysis was implemented in R and Python, and source code can be found in Supplementary Data. b.chain@ucl.ac.uk Supplementary data are available at Bioinformatics online. © The Author 2014. Published by Oxford University Press.

A Thiazole Coumarin (TC) Turn-On Fluorescence Probe for AT-Base Pair Detection and Multipurpose Applications in Different Biological Systems

NASA Astrophysics Data System (ADS)

Narayanaswamy, Nagarjun; Kumar, Manoj; Das, Sadhan; Sharma, Rahul; Samanta, Pralok K.; Pati, Swapan K.; Dhar, Suman K.; Kundu, Tapas K.; Govindaraju, T.

2014-09-01

Sequence-specific recognition of DNA by small turn-on fluorescence probes is a promising tool for bioimaging, bioanalytical and biomedical applications. Here, the authors report a novel cell-permeable and red fluorescent hemicyanine-based thiazole coumarin (TC) probe for DNA recognition, nuclear staining and cell cycle analysis. TC exhibited strong fluorescence enhancement in the presence of DNA containing AT-base pairs, but did not fluoresce with GC sequences, single-stranded DNA, RNA and proteins. The fluorescence staining of HeLa S3 and HEK 293 cells by TC followed by DNase and RNase digestion studies depicted the selective staining of DNA in the nucleus over the cytoplasmic region. Fluorescence-activated cell sorting (FACS) analysis by flow cytometry demonstrated the potential application of TC in cell cycle analysis in HEK 293 cells. Metaphase chromosome and malaria parasite DNA imaging studies further confirmed the in vivo diagnostic and therapeutic applications of probe TC. Probe TC may find multiple applications in fluorescence spectroscopy, diagnostics, bioimaging and molecular and cell biology.

A Thiazole Coumarin (TC) Turn-On Fluorescence Probe for AT-Base Pair Detection and Multipurpose Applications in Different Biological Systems

PubMed Central

Narayanaswamy, Nagarjun; Kumar, Manoj; Das, Sadhan; Sharma, Rahul; Samanta, Pralok K.; Pati, Swapan K.; Dhar, Suman K.; Kundu, Tapas K.; Govindaraju, T.

2014-01-01

Sequence-specific recognition of DNA by small turn-on fluorescence probes is a promising tool for bioimaging, bioanalytical and biomedical applications. Here, the authors report a novel cell-permeable and red fluorescent hemicyanine-based thiazole coumarin (TC) probe for DNA recognition, nuclear staining and cell cycle analysis. TC exhibited strong fluorescence enhancement in the presence of DNA containing AT-base pairs, but did not fluoresce with GC sequences, single-stranded DNA, RNA and proteins. The fluorescence staining of HeLa S3 and HEK 293 cells by TC followed by DNase and RNase digestion studies depicted the selective staining of DNA in the nucleus over the cytoplasmic region. Fluorescence-activated cell sorting (FACS) analysis by flow cytometry demonstrated the potential application of TC in cell cycle analysis in HEK 293 cells. Metaphase chromosome and malaria parasite DNA imaging studies further confirmed the in vivo diagnostic and therapeutic applications of probe TC. Probe TC may find multiple applications in fluorescence spectroscopy, diagnostics, bioimaging and molecular and cell biology. PMID:25252596

Software for rapid time dependent ChIP-sequencing analysis (TDCA).

PubMed

Myschyshyn, Mike; Farren-Dai, Marco; Chuang, Tien-Jui; Vocadlo, David

2017-11-25

Chromatin immunoprecipitation followed by DNA sequencing (ChIP-seq) and associated methods are widely used to define the genome wide distribution of chromatin associated proteins, post-translational epigenetic marks, and modifications found on DNA bases. An area of emerging interest is to study time dependent changes in the distribution of such proteins and marks by using serial ChIP-seq experiments performed in a time resolved manner. Despite such time resolved studies becoming increasingly common, software to facilitate analysis of such data in a robust automated manner is limited. We have designed software called Time-Dependent ChIP-Sequencing Analyser (TDCA), which is the first program to automate analysis of time-dependent ChIP-seq data by fitting to sigmoidal curves. We provide users with guidance for experimental design of TDCA for modeling of time course (TC) ChIP-seq data using two simulated data sets. Furthermore, we demonstrate that this fitting strategy is widely applicable by showing that automated analysis of three previously published TC data sets accurately recapitulates key findings reported in these studies. Using each of these data sets, we highlight how biologically relevant findings can be readily obtained by exploiting TDCA to yield intuitive parameters that describe behavior at either a single locus or sets of loci. TDCA enables customizable analysis of user input aligned DNA sequencing data, coupled with graphical outputs in the form of publication-ready figures that describe behavior at either individual loci or sets of loci sharing common traits defined by the user. TDCA accepts sequencing data as standard binary alignment map (BAM) files and loci of interest in browser extensible data (BED) file format. TDCA accurately models the number of sequencing reads, or coverage, at loci from TC ChIP-seq studies or conceptually related TC sequencing experiments. TC experiments are reduced to intuitive parametric values that facilitate biologically relevant data analysis, and the uncovering of variations in the time-dependent behavior of chromatin. TDCA automates the analysis of TC ChIP-seq experiments, permitting researchers to easily obtain raw and modeled data for specific loci or groups of loci with similar behavior while also enhancing consistency of data analysis of TC data within the genomics field.

Genome-wide identification and characterization of cacao WRKY transcription factors and analysis of their expression in response to witches' broom disease

PubMed Central

Silva Monteiro de Almeida, Dayanne; Oliveira Jordão do Amaral, Daniel; Del-Bem, Luiz-Eduardo; Bronze dos Santos, Emily; Santana Silva, Raner José; Peres Gramacho, Karina; Vincentz, Michel

2017-01-01

Transcriptional regulation, led by transcription factors (TFs) such as those of the WRKY family, is a mechanism used by the organism to enhance or repress gene expression in response to stimuli. Here, we report on the genome-wide analysis of the Theobroma cacao WRKY TF family and also investigate the expression of WRKY genes in cacao infected by the fungus Moniliophthora perniciosa. In the cacao genome, 61 non-redundant WRKY sequences were found and classified in three groups (I to III) according to the WRKY and zinc-finger motif types. The 61 putative WRKY sequences were distributed on the 10 cacao chromosomes and 24 of them came from duplication events. The sequences were phylogenetically organized according to the general WRKY groups. The phylogenetic analysis revealed that subgroups IIa and IIb are sister groups and share a common ancestor, as well as subgroups IId and IIe. The most divergent groups according to the plant origin were IIc and III. According to the phylogenetic analysis, 7 TcWRKY genes were selected and analyzed by RT-qPCR in susceptible and resistant cacao plants infected (or not) with M. perniciosa. Some TcWRKY genes presented interesting responses to M. perniciosa such as Tc01_p014750/Tc06_p013130/AtWRKY28, Tc09_p001530/Tc06_p004420/AtWRKY40, Tc04_p016130/AtWRKY54 and Tc10_p016570/ AtWRKY70. Our results can help to select appropriate candidate genes for further characterization in cacao or in other Theobroma species. PMID:29084273

Genome-wide identification and characterization of cacao WRKY transcription factors and analysis of their expression in response to witches' broom disease.

PubMed

Silva Monteiro de Almeida, Dayanne; Oliveira Jordão do Amaral, Daniel; Del-Bem, Luiz-Eduardo; Bronze Dos Santos, Emily; Santana Silva, Raner José; Peres Gramacho, Karina; Vincentz, Michel; Micheli, Fabienne

2017-01-01

Transcriptional regulation, led by transcription factors (TFs) such as those of the WRKY family, is a mechanism used by the organism to enhance or repress gene expression in response to stimuli. Here, we report on the genome-wide analysis of the Theobroma cacao WRKY TF family and also investigate the expression of WRKY genes in cacao infected by the fungus Moniliophthora perniciosa. In the cacao genome, 61 non-redundant WRKY sequences were found and classified in three groups (I to III) according to the WRKY and zinc-finger motif types. The 61 putative WRKY sequences were distributed on the 10 cacao chromosomes and 24 of them came from duplication events. The sequences were phylogenetically organized according to the general WRKY groups. The phylogenetic analysis revealed that subgroups IIa and IIb are sister groups and share a common ancestor, as well as subgroups IId and IIe. The most divergent groups according to the plant origin were IIc and III. According to the phylogenetic analysis, 7 TcWRKY genes were selected and analyzed by RT-qPCR in susceptible and resistant cacao plants infected (or not) with M. perniciosa. Some TcWRKY genes presented interesting responses to M. perniciosa such as Tc01_p014750/Tc06_p013130/AtWRKY28, Tc09_p001530/Tc06_p004420/AtWRKY40, Tc04_p016130/AtWRKY54 and Tc10_p016570/ AtWRKY70. Our results can help to select appropriate candidate genes for further characterization in cacao or in other Theobroma species.

Simple methodology to directly genotype Trypanosoma cruzi discrete typing units in single and mixed infections from human blood samples.

PubMed

Bontempi, Iván A; Bizai, María L; Ortiz, Sylvia; Manattini, Silvia; Fabbro, Diana; Solari, Aldo; Diez, Cristina

2016-09-01

Different DNA markers to genotype Trypanosoma cruzi are now available. However, due to the low quantity of parasites present in biological samples, DNA markers with high copy number like kinetoplast minicircles are needed. The aim of this study was to complete a DNA assay called minicircle lineage specific-PCR (MLS-PCR) previously developed to genotype the T. cruzi DTUs TcV and TcVI, in order to genotype DTUs TcI and TcII and to improve TcVI detection. We screened kinetoplast minicircle hypervariable sequences from cloned PCR products from reference strains belonging to the mentioned DTUs using specific kDNA probes. With the four highly specific sequences selected, we designed primers to be used in the MLS-PCR to directly genotype T. cruzi from biological samples. High specificity and sensitivity were obtained when we evaluated the new approach for TcI, TcII, TcV and TcVI genotyping in twenty two T. cruzi reference strains. Afterward, we compared it with hybridization tests using specific kDNA probes in 32 blood samples from chronic chagasic patients from North Eastern Argentina. With both tests we were able to genotype 94% of the samples and the concordance between them was very good (kappa=0.855). The most frequent T. cruzi DTUs detected were TcV and TcVI, followed by TcII and much lower TcI. A unique T. cruzi DTU was detected in 18 samples meantime more than one in the remaining; being TcV and TcVI the most frequent association. A high percentage of mixed detections were obtained with both assays and its impact was discussed. Copyright © 2016 Elsevier B.V. All rights reserved.

Applicability of plasmid calibrant pTC1507 in quantification of TC1507 maize: an interlaboratory study.

PubMed

Meng, Yanan; Liu, Xin; Wang, Shu; Zhang, Dabing; Yang, Litao

2012-01-11

To enforce the labeling regulations of genetically modified organisms (GMOs), the application of DNA plasmids as calibrants is becoming essential for the practical quantification of GMOs. This study reports the construction of plasmid pTC1507 for a quantification assay of genetically modified (GM) maize TC1507 and the collaborative ring trial in international validation of its applicability as a plasmid calibrant. pTC1507 includes one event-specific sequence of TC1507 maize and one unique sequence of maize endogenous gene zSSIIb. A total of eight GMO detection laboratories worldwide were invited to join the validation process, and test results were returned from all eight participants. Statistical analysis of the returned results showed that real-time PCR assays using pTC1507 as calibrant in both GM event-specific and endogenous gene quantifications had high PCR efficiency (ranging from 0.80 to 1.15) and good linearity (ranging from 0.9921 to 0.9998). In a quantification assay of five blind samples, the bias between the test values and true values ranged from 2.6 to 24.9%. All results indicated that the developed pTC1507 plasmid is applicable for the quantitative analysis of TC1507 maize and can be used as a suitable substitute for dried powder certified reference materials (CRMs).

Molecular characterization and transcriptional analysis of the female-enriched chondroitin proteoglycan 2 of Toxocara canis.

PubMed

Ma, G X; Zhou, R Q; Hu, L; Luo, Y L; Luo, Y F; Zhu, H H

2018-03-01

Toxocara canis is an important but neglected zoonotic parasite, and is the causative agent of human toxocariasis. Chondroitin proteoglycans are biological macromolecules, widely distributed in extracellular matrices, with a great diversity of functions in mammals. However, there is limited information regarding chondroitin proteoglycans in nematode parasites. In the present study, a female-enriched chondroitin proteoglycan 2 gene of T. canis (Tc-cpg-2) was cloned and characterized. Quantitative real-time polymerase chain reaction (qRT-PCR) was employed to measure the transcription levels of Tc-cpg-2 among tissues of male and female adult worms. A 485-amino-acid (aa) polypeptide was predicted from a continuous 1458-nuleotide open reading frame and designated as TcCPG2, which contains a 21-aa signal peptide. Conserved domain searching indicated three chitin-binding peritrophin-A (CBM_14) domains in the amino acid sequence of TcCPG2. Multiple alignment with the inferred amino acid sequences of Caenorhabditis elegans and Ascaris suum showed that CBM_14 domains were well conserved among these species. Phylogenetic analysis suggested that TcCPG2 was closely related to the sequence of chondroitin proteoglycan 2 of A. suum. Interestingly, a high level of Tc-cpg-2 was detected in female germline tissues, particularly in the oviduct, suggesting potential roles of this gene in reproduction (e.g. oogenesis and embryogenesis) of adult T. canis. The functional roles of Tc-cpg-2 in reproduction and development in this parasite and related parasitic nematodes warrant further functional studies.

The diversity of the Chagas parasite, Trypanosoma cruzi, infecting the main Central American vector, Triatoma dimidiata, from Mexico to Colombia

PubMed Central

Waleckx, Etienne; Woods, Adrienne S.; Monroy, Maria Carlota; Stevens, Lori

2017-01-01

Little is known about the strains of Trypanosoma cruzi circulating in Central America and specifically in the most important vector in this region, Triatoma dimidiata. Approximately six million people are infected with T. cruzi, the causative agent of Chagas disease, which has the greatest negative economic impact and is responsible for ~12,000 deaths annually in Latin America. By international consensus, strains of T. cruzi are divided into six monophyletic clades called discrete typing units (DTUs TcI-VI) and a seventh DTU first identified in bats called TcBat. TcI shows the greatest geographic range and diversity. Identifying strains present and diversity within these strains is important as different strains and their genotypes may cause different pathologies and may circulate in different localities and transmission cycles, thus impacting control efforts, treatment and vaccine development. To determine parasite strains present in T. dimidiata across its geographic range from Mexico to Colombia, we isolated abdominal DNA from T. dimidiata and determined which specimens were infected with T. cruzi by PCR. Strains from infected insects were determined by comparing the sequence of the 18S rDNA and the spliced-leader intergenic region to typed strains in GenBank. Two DTUs were found: 94% of infected T. dimidiata contained TcI and 6% contained TcIV. TcI exhibited high genetic diversity. Geographic structure of TcI haplotypes was evident by Principal Component and Median-Joining Network analyses as well as a significant result in the Mantel test, indicating isolation by distance. There was little evidence of association with TcI haplotypes and host/vector or ecotope. This study provides new information about the strains circulating in the most important Chagas vector in Central America and reveals considerable variability within TcI as well as geographic structuring at this large geographic scale. The lack of association with particular vectors/hosts or ecotopes suggests the parasites are moving among vectors/hosts and ecotopes therefore a comprehensive approach, such as the Ecohealth approach that makes houses refractory to the vectors will be needed to successfully halt transmission of Chagas disease. PMID:28957315

Development of a Trypanosoma cruzi strain typing assay using MS2 peptide spectral libraries (Tc-STAMS2)

PubMed Central

de Oliveira, Gilberto Santos; Kawahara, Rebeca; Rosa-Fernandes, Livia; Avila, Carla Cristi; Teixeira, Marta M. G.; Larsen, Martin R.

2018-01-01

Background Chagas disease also known as American trypanosomiasis is caused by the protozoan Trypanosoma cruzi. Over the last 30 years, Chagas disease has expanded from a neglected parasitic infection of the rural population to an urbanized chronic disease, becoming a potentially emergent global health problem. T. cruzi strains were assigned to seven genetic groups (TcI-TcVI and TcBat), named discrete typing units (DTUs), which represent a set of isolates that differ in virulence, pathogenicity and immunological features. Indeed, diverse clinical manifestations (from asymptomatic to highly severe disease) have been attempted to be related to T.cruzi genetic variability. Due to that, several DTU typing methods have been introduced. Each method has its own advantages and drawbacks such as high complexity and analysis time and all of them are based on genetic signatures. Recently, a novel method discriminated bacterial strains using a peptide identification-free, genome sequence-independent shotgun proteomics workflow. Here, we aimed to develop a Trypanosoma cruzi Strain Typing Assay using MS/MS peptide spectral libraries, named Tc-STAMS2. Methods/Principal findings The Tc-STAMS2 method uses shotgun proteomics combined with spectral library search to assign and discriminate T. cruzi strains independently on the genome knowledge. The method is based on the construction of a library of MS/MS peptide spectra built using genotyped T. cruzi reference strains. For identification, the MS/MS peptide spectra of unknown T. cruzi cells are identified using the spectral matching algorithm SpectraST. The Tc-STAMS2 method allowed correct identification of all DTUs with high confidence. The method was robust towards different sample preparations, length of chromatographic gradients and fragmentation techniques. Moreover, a pilot inter-laboratory study showed the applicability to different MS platforms. Conclusions and significance This is the first study that develops a MS-based platform for T. cruzi strain typing. Indeed, the Tc-STAMS2 method allows T. cruzi strain typing using MS/MS spectra as discriminatory features and allows the differentiation of TcI-TcVI DTUs. Similar to genomic-based strategies, the Tc-STAMS2 method allows identification of strains within DTUs. Its robustness towards different experimental and biological variables makes it a valuable complementary strategy to the current T. cruzi genotyping assays. Moreover, this method can be used to identify DTU-specific features correlated with the strain phenotype. PMID:29608573

Development of a Trypanosoma cruzi strain typing assay using MS2 peptide spectral libraries (Tc-STAMS2).

PubMed

de Oliveira, Gilberto Santos; Kawahara, Rebeca; Rosa-Fernandes, Livia; Mule, Simon Ngao; Avila, Carla Cristi; Teixeira, Marta M G; Larsen, Martin R; Palmisano, Giuseppe

2018-04-01

Chagas disease also known as American trypanosomiasis is caused by the protozoan Trypanosoma cruzi. Over the last 30 years, Chagas disease has expanded from a neglected parasitic infection of the rural population to an urbanized chronic disease, becoming a potentially emergent global health problem. T. cruzi strains were assigned to seven genetic groups (TcI-TcVI and TcBat), named discrete typing units (DTUs), which represent a set of isolates that differ in virulence, pathogenicity and immunological features. Indeed, diverse clinical manifestations (from asymptomatic to highly severe disease) have been attempted to be related to T.cruzi genetic variability. Due to that, several DTU typing methods have been introduced. Each method has its own advantages and drawbacks such as high complexity and analysis time and all of them are based on genetic signatures. Recently, a novel method discriminated bacterial strains using a peptide identification-free, genome sequence-independent shotgun proteomics workflow. Here, we aimed to develop a Trypanosoma cruzi Strain Typing Assay using MS/MS peptide spectral libraries, named Tc-STAMS2. The Tc-STAMS2 method uses shotgun proteomics combined with spectral library search to assign and discriminate T. cruzi strains independently on the genome knowledge. The method is based on the construction of a library of MS/MS peptide spectra built using genotyped T. cruzi reference strains. For identification, the MS/MS peptide spectra of unknown T. cruzi cells are identified using the spectral matching algorithm SpectraST. The Tc-STAMS2 method allowed correct identification of all DTUs with high confidence. The method was robust towards different sample preparations, length of chromatographic gradients and fragmentation techniques. Moreover, a pilot inter-laboratory study showed the applicability to different MS platforms. This is the first study that develops a MS-based platform for T. cruzi strain typing. Indeed, the Tc-STAMS2 method allows T. cruzi strain typing using MS/MS spectra as discriminatory features and allows the differentiation of TcI-TcVI DTUs. Similar to genomic-based strategies, the Tc-STAMS2 method allows identification of strains within DTUs. Its robustness towards different experimental and biological variables makes it a valuable complementary strategy to the current T. cruzi genotyping assays. Moreover, this method can be used to identify DTU-specific features correlated with the strain phenotype.

Single-nucleotide polymorphisms g.151435C>T and g.173057T>C in PRLR gene regulated by bta-miR-302a are associated with litter size in goats.

PubMed

An, Xiaopeng; Hou, Jinxing; Gao, Teyang; Lei, Yingnan; Li, Guang; Song, Yuxuan; Wang, Jiangang; Cao, Binyun

2015-06-01

Single-nucleotide polymorphisms (SNPs) located at microRNA-binding sites (miR-SNPs) can affect the expression of genes. This study aimed to identify the miR-SNPs associated with litter size. Guanzhong (n = 321) and Boer (n = 191) goat breeds were used to detect SNPs in the caprine prolactin receptor (PRLR) gene by DNA sequencing, primer-introduced restriction analysis-polymerase chain reaction, and polymerase chain reaction-restriction fragment length polymorphism. Three novel SNPs (g.151435C>T, g.151454A>G, and g.173057T>C) were identified in the caprine PRLR gene. Statistical results indicated that the g.151435C>T and g.173057T>C SNPs were significantly associated with litter size in Guanzhong and Boer goat breeds. Further analysis revealed that combinative genotype C6 (TTAACC) was better than the others for litter size in both goat breeds. Furthermore, the PRLR g.173057T>C polymorphism was predicted to regulate the binding activity of bta-miR-302a. Luciferase reporter gene assay confirmed that 173057C to T substitution disrupted the binding site for bta-miR-302a, resulting in the reduced levels of luciferase. Taken together, these findings suggested that bta-miR-302a can influence the expression of PRLR protein by binding with 3'untranslated region, resulting in that the g.173057T>C SNP had significant effects on litter size. Copyright © 2015 Elsevier Inc. All rights reserved.

Trypanosoma cruzi IIc: Phylogenetic and Phylogeographic Insights from Sequence and Microsatellite Analysis and Potential Impact on Emergent Chagas Disease

PubMed Central

Llewellyn, Martin S.; Lewis, Michael D.; Acosta, Nidia; Yeo, Matthew; Carrasco, Hernan J.; Segovia, Maikell; Vargas, Jorge; Torrico, Faustino; Miles, Michael A.; Gaunt, Michael W.

2009-01-01

Trypanosoma cruzi, the etiological agent of Chagas disease, is highly genetically diverse. Numerous lines of evidence point to the existence of six stable genetic lineages or DTUs: TcI, TcIIa, TcIIb, TcIIc, TcIId, and TcIIe. Molecular dating suggests that T. cruzi is likely to have been an endemic infection of neotropical mammalian fauna for many millions of years. Here we have applied a panel of 49 polymorphic microsatellite markers developed from the online T. cruzi genome to document genetic diversity among 53 isolates belonging to TcIIc, a lineage so far recorded almost exclusively in silvatic transmission cycles but increasingly a potential source of human infection. These data are complemented by parallel analysis of sequence variation in a fragment of the glucose-6-phosphate isomerase gene. New isolates confirm that TcIIc is associated with terrestrial transmission cycles and armadillo reservoir hosts, and demonstrate that TcIIc is far more widespread than previously thought, with a distribution at least from Western Venezuela to the Argentine Chaco. We show that TcIIc is truly a discrete T. cruzi lineage, that it could have an ancient origin and that diversity occurs within the terrestrial niche independently of the host species. We also show that spatial structure among TcIIc isolates from its principal host, the armadillo Dasypus novemcinctus, is greater than that among TcI from Didelphis spp. opossums and link this observation to differences in ecology of their respective niches. Homozygosity in TcIIc populations and some linkage indices indicate the possibility of recombination but cannot yet be effectively discriminated from a high genome-wide frequency of gene conversion. Finally, we suggest that the derived TcIIc population genetic data have a vital role in determining the origin of the epidemiologically important hybrid lineages TcIId and TcIIe. PMID:19721699

Classification of the treble clef zinc finger: noteworthy lessons for structure and function evolution.

PubMed

Kaur, Gurmeet; Subramanian, Srikrishna

2016-08-26

Treble clef (TC) zinc fingers constitute a large fold-group of structural zinc-binding protein domains that mediate numerous cellular functions. We have analysed the sequence, structure, and function relationships among all TCs in the Protein Data Bank. This led to the identification of novel TCs, such as lsr2, YggX and TFIIIC τ 60 kDa subunit, and prediction of a nuclease-like function for the DUF1364 family. The structural malleability of TCs is evident from the many examples with variations to the core structural elements of the fold. We observe domains wherein the structural core of the TC fold is circularly permuted, and also some examples where the overall fold resembles both the TC motif and another unrelated fold. All extant TC families do not share a monophyletic origin, as several TC proteins are known to have been present in the last universal common ancestor and the last eukaryotic common ancestor. We identify several TCs where the zinc-chelating site and residues are not merely responsible for structure stabilization but also perform other functions, such as being redox active in C1B domain of protein kinase C, a nucleophilic acceptor in Ada and catalytic in organomercurial lyase, MerB.

Classification of the treble clef zinc finger: noteworthy lessons for structure and function evolution

NASA Astrophysics Data System (ADS)

Kaur, Gurmeet; Subramanian, Srikrishna

2016-08-01

Treble clef (TC) zinc fingers constitute a large fold-group of structural zinc-binding protein domains that mediate numerous cellular functions. We have analysed the sequence, structure, and function relationships among all TCs in the Protein Data Bank. This led to the identification of novel TCs, such as lsr2, YggX and TFIIIC τ 60 kDa subunit, and prediction of a nuclease-like function for the DUF1364 family. The structural malleability of TCs is evident from the many examples with variations to the core structural elements of the fold. We observe domains wherein the structural core of the TC fold is circularly permuted, and also some examples where the overall fold resembles both the TC motif and another unrelated fold. All extant TC families do not share a monophyletic origin, as several TC proteins are known to have been present in the last universal common ancestor and the last eukaryotic common ancestor. We identify several TCs where the zinc-chelating site and residues are not merely responsible for structure stabilization but also perform other functions, such as being redox active in C1B domain of protein kinase C, a nucleophilic acceptor in Ada and catalytic in organomercurial lyase, MerB.

The Yersinia pseudotuberculosis and Yersinia pestis toxin complex is active against cultured mammalian cells.

PubMed

Hares, Michelle C; Hinchliffe, Stewart J; Strong, Philippa C R; Eleftherianos, Ioannis; Dowling, Andrea J; ffrench-Constant, Richard H; Waterfield, Nick

2008-11-01

The toxin complex (Tc) genes were first identified in the insect pathogen Photorhabdus luminescens and encode approximately 1 MDa protein complexes which are toxic to insect pests. Subsequent genome sequencing projects have revealed the presence of tc orthologues in a range of bacterial pathogens known to be associated with insects. Interestingly, members of the mammalian-pathogenic yersiniae have also been shown to encode Tc orthologues. Studies in Yersinia enterocolitica have shown that divergent tc loci either encode insect-active toxins or play a role in colonization of the gut in gastroenteritis models of rats. So far little is known about the activity of the Tc proteins in the other mammalian-pathogenic yersiniae. Here we present work to suggest that Tc proteins in Yersinia pseudotuberculosis and Yersinia pestis are not insecticidal toxins but have evolved for mammalian pathogenicity. We show that Tc is secreted by Y. pseudotuberculosis strain IP32953 during growth in media at 28 degrees C and 37 degrees C. We also demonstrate that oral toxicity of strain IP32953 to Manduca sexta larvae is not due to Tc expression and that lysates of Escherichia coli BL21 expressing the Yersinia Tc proteins are not toxic to Sf9 insect cells but are toxic to cultured mammalian cell lines. Cell lysates of E. coli BL21 expressing the Y. pseudotuberculosis Tc proteins caused actin ruffles, vacuoles and multi-nucleation in cultured human gut cells (Caco-2); similar morphology was observed after application of a lysate of E. coli BL21 expressing the Y. pestis Tc proteins to mouse fibroblast NIH3T3 cells, but not Caco-2 cells. Finally, transient expression of the individual Tc proteins in Caco-2 and NIH3T3 cell lines reproduced the actin and nuclear rearrangement observed with the topical applications. Together these results add weight to the growing hypothesis that the Tc proteins in Y. pseudotuberculosis and Y. pestis have been adapted for mammalian pathogenicity. We further conclude that Tc proteins from Y. pseudotuberculosis and Y. pestis display differential mammalian cell specificity in their toxicity.

Genetic diversity of Trypanosoma cruzi in bats, and multilocus phylogenetic and phylogeographical analyses supporting Tcbat as an independent DTU (discrete typing unit).

PubMed

Lima, Luciana; Espinosa-Álvarez, Oneida; Ortiz, Paola A; Trejo-Varón, Javier A; Carranza, Julio C; Pinto, C Miguel; Serrano, Myrna G; Buck, Gregory A; Camargo, Erney P; Teixeira, Marta M G

2015-11-01

Trypanosoma cruzi is a complex of phenotypically and genetically diverse isolates distributed in six discrete typing units (DTUs) designated as TcI-TcVI. Five years ago, T. cruzi isolates from Brazilian bats showing unique patterns of traditional ribosomal and spliced leader PCRs not clustering into any of the six DTUs were designated as the Tcbat genotype. In the present study, phylogenies inferred using SSU rRNA (small subunit of ribosomal rRNA), gGAPDH (glycosomal glyceraldehyde 3-phosphate dehydrogenase) and Cytb (cytochrome b) genes strongly supported Tcbat as a monophyletic lineage prevalent in Brazil, Panama and Colombia. Providing strong support for Tcbat, sequences from 37 of 47 nuclear and 12 mitochondrial genes (retrieved from a draft genome of Tcbat) and reference strains of all DTUs available in databanks corroborated Tcbat as an independent DTU. Consistent with previous studies, multilocus analysis of most nuclear genes corroborated the evolution of T. cruzi from bat trypanosomes its divergence into two main phylogenetic lineages: the basal TcII; and the lineage clustering TcIV, the clade comprising TcIII and the sister groups TcI-Tcbat. Most likely, the common ancestor of Tcbat and TcI was a bat trypanosome. However, the results of the present analysis did not support Tcbat as the ancestor of all DTUs. Despite the insights provided by reports of TcIII, TcIV and TcII in bats, including Amazonian bats harbouring TcII, further studies are necessary to understand the roles played by bats in the diversification of all DTUs. We also demonstrated that in addition to value as molecular markers for DTU assignment, Cytb, ITS rDNA and the spliced leader (SL) polymorphic sequences suggest spatially structured populations of Tcbat. Phylogenetic and phylogeographical analyses, multiple molecular markers specific to Tcbat, and the degrees of sequence divergence between Tcbat and the accepted DTUs strongly support the definitive classification of Tcbat as a new DTU. Copyright © 2015 Elsevier B.V. All rights reserved.

Repertoire, genealogy and genomic organization of cruzipain and homologous genes in Trypanosoma cruzi, T. cruzi-like and other trypanosome species.

PubMed

Lima, Luciana; Ortiz, Paola A; da Silva, Flávia Maia; Alves, João Marcelo P; Serrano, Myrna G; Cortez, Alane P; Alfieri, Silvia C; Buck, Gregory A; Teixeira, Marta M G

2012-01-01

Trypanosoma cruzi, the agent of Chagas disease, is a complex of genetically diverse isolates highly phylogenetically related to T. cruzi-like species, Trypanosoma cruzi marinkellei and Trypanosoma dionisii, all sharing morphology of blood and culture forms and development within cells. However, they differ in hosts, vectors and pathogenicity: T. cruzi is a human pathogen infective to virtually all mammals whilst the other two species are non-pathogenic and bat restricted. Previous studies suggest that variations in expression levels and genetic diversity of cruzipain, the major isoform of cathepsin L-like (CATL) enzymes of T. cruzi, correlate with levels of cellular invasion, differentiation, virulence and pathogenicity of distinct strains. In this study, we compared 80 sequences of genes encoding cruzipain from 25 T. cruzi isolates representative of all discrete typing units (DTUs TcI-TcVI) and the new genotype Tcbat and 10 sequences of homologous genes from other species. The catalytic domain repertoires diverged according to DTUs and trypanosome species. Relatively homogeneous sequences are found within and among isolates of the same DTU except TcV and TcVI, which displayed sequences unique or identical to those of TcII and TcIII, supporting their origin from the hybridization between these two DTUs. In network genealogies, sequences from T. cruzi clustered tightly together and closer to T. c. marinkellei than to T. dionisii and largely differed from homologues of T. rangeli and T. b. brucei. Here, analysis of isolates representative of the overall biological and genetic diversity of T. cruzi and closest T. cruzi-like species evidenced DTU- and species-specific polymorphisms corroborating phylogenetic relationships inferred with other genes. Comparison of both phylogenetically close and distant trypanosomes is valuable to understand host-parasite interactions, virulence and pathogenicity. Our findings corroborate cruzipain as valuable target for drugs, vaccine, diagnostic and genotyping approaches.

Recombinant β-1,3-1,4-glucanase from Theobroma cacao impairs Moniliophthora perniciosa mycelial growth.

PubMed

Britto, Dahyana Santos; Pirovani, Carlos Priminho; Andrade, Bruno Silva; Dos Santos, Tassiara Pereira; Pungartnik, Cristina; Cascardo, Júlio Cezar M; Micheli, Fabienne; Gesteira, Abelmon S

2013-09-01

In this work, we identified a gene from Theobroma cacao L. genome and cDNA libraries, named TcGlu2, that encodes a β-1,3-1,4-glucanase. The TcGlu2 ORF was 720 bp in length and encoded a polypeptide of 239 amino acids with a molecular mass of 25.58 kDa. TcGlu2 contains a conserved domain characteristic of β-1,3-1,4-glucanases and presented high protein identity with β-1,3-1,4-glucanases from other plant species. Molecular modeling of TcGlu2 showed an active site of 13 amino acids typical of glucanase with β-1,3 and 1,4 action mode. The recombinant cDNA TcGlu2 obtained by heterologous expression in Escherichia coli and whose sequence was confirmed by mass spectrometry, has a molecular mass of about 22 kDa (with His-Tag) and showed antifungal activity against the fungus Moniliophthora perniciosa, causal agent of the witches' broom disease in cacao. The integrity of the hyphae membranes of M. perniciosa, incubated with protein TcGlu2, was analyzed with propidium iodide. After 1 h of incubation, a strong fluorescence emitted by the hyphae indicating the hydrolysis of the membrane by TcGlu2, was observed. To our knowledge, this is the first study of a cacao β-1,3-1,4-glucanase expression in heterologous system and the first analysis showing the antifungal activity of a β-1,3-1,4-glucanase, in particular against M. perniciosa.

Genetic profiling of Trypanosoma cruzi directly in infected tissues using nested PCR of polymorphic microsatellites.

PubMed

Valadares, Helder Magno Silva; Pimenta, Juliana Ramos; de Freitas, Jorge Marcelo; Duffy, Tomás; Bartholomeu, Daniella C; Oliveira, Riva de Paula; Chiari, Egler; Moreira, Maria da Consolação Vieira; Filho, Geraldo Brasileiro; Schijman, Alejandro Gabriel; Franco, Glória Regina; Machado, Carlos Renato; Pena, Sérgio Danilo Junho; Macedo, Andréa Mara

2008-06-01

The investigation of the importance of the genetics of Trypanosoma cruzi in determining the clinical course of Chagas disease will depend on precise characterisation of the parasites present in the tissue lesions. This can be adequately accomplished by the use of hypervariable nuclear markers such as microsatellites. However the unilocal nature of these loci and the scarcity of parasites in chronic lesions make it necessary to use high sensitivity PCR with nested primers, whose design depends on the availability of long flanking regions, a feature not hitherto available for any known T. cruzi microsatellites. Herein, making use of the extensive T. cruzi genome sequence now available and using the Tandem Repeats Finder software, it was possible to identify and characterise seven new microsatellite loci--six composed of trinucleotide (TcTAC15, TcTAT20, TcAAT8, TcATT14, TcGAG10 and TcCAA10) and one composed of tetranucleotide (TcAAAT6) motifs. All except the TcCAA10 locus were physically mapped onto distinct intergenic regions of chromosome III of the CL Brener clone contigs. The TcCAA10 locus was localised within a hypothetical protein gene in the T. cruzi genome. All microsatellites were polymorphic and useful for T. cruzi genetic variability studies. Using the TcTAC15 locus it was possible to separate the strains belonging to the T. cruzi I lineage (DTU I) from those belonging to T. cruzi II (DTU IIb), T. cruzi III (DTU IIc) and a hybrid group (DTU IId, IIe). The long flanking regions of these novel microsatellites allowed construction of nested primers and the use of full nested PCR protocols. This strategy enabled us to detect and differentiate T. cruzi strains directly in clinical specimens including heart, blood, CSF and skin tissues from patients in the acute and chronic phases of Chagas disease.

Single nucleotide polymorphism of FSHβ gene associated with reproductive traits in Japanese flounder ( Paralichthys olivaceus)

NASA Astrophysics Data System (ADS)

He, Feng; Wen, Haishen; Yu, Dahui; Li, Jifang; Shi, Bao; Chen, Caifang; Zhang, Jiaren; Jin, Guoxiong; Chen, Xiaoyan; Shi, Dan; Yang, Yanping

2010-12-01

Follicle stimulating hormone β (FSHβ) of Japanese flounder ( Paralichthys olivaceus) plays a key role in the regulation of gonadal development. This study aimed to investigate molecular genetic characteristics of the FSHβ gene and elucidate the effects of single nucleotide polymorphisms (SNPs) of FSHβ on reproductive traits in Japanese flounder. We used polymerase chain reaction single-strand conformation polymorphism (PCR-SSCP) and sequencing of the FSHβ gene in 60 individuals. We identified only an SNP (T/C) in the coding region of exon3 of FSHβ. The SNP (T/C) did not lead to amino acid changes at the position 340 bp of FSHβ gene. Statistical analysis showed that the SNP was significantly associated with testosterone (T) level and gonadosomatic index (GSI) ( P < 0.05). Individuals with genotype TC of the SNP had significantly higher serum T levels and GSI ( P < 0.05) than that of genotype CC. Therefore, FSHβ gene could be a useful molecular marker in selection for prominent reproductive trait in Japanese Flounder.

IMGT, the International ImMunoGeneTics database.

PubMed Central

Lefranc, M P; Giudicelli, V; Busin, C; Bodmer, J; Müller, W; Bontrop, R; Lemaitre, M; Malik, A; Chaume, D

1998-01-01

IMGT, the international ImMunoGeneTics database, is an integrated database specialising in Immunoglobulins (Ig), T cell Receptors (TcR) and Major Histocompatibility Complex (MHC) of all vertebrate species, created by Marie-Paule Lefranc, CNRS, Montpellier II University, Montpellier, France (lefranc@ligm.crbm.cnrs-mop.fr). IMGT includes three databases: LIGM-DB (for Ig and TcR), MHC/HLA-DB and PRIMER-DB (the last two in development). IMGT comprises expertly annotated sequences and alignment tables. LIGM-DB contains more than 23 000 Immunoglobulin and T cell Receptor sequences from 78 species. MHC/HLA-DB contains Class I and Class II Human Leucocyte Antigen alignment tables. An IMGT tool, DNAPLOT, developed for Ig, TcR and MHC sequence alignments, is also available. IMGT works in close collaboration with the EMBL database. IMGT goals are to establish a common data access to all immunogenetics data, including nucleotide and protein sequences, oligonucleotide primers, gene maps and other genetic data of Ig, TcR and MHC molecules, and to provide a graphical user friendly data access. IMGT has important implications in medical research (repertoire in autoimmune diseases, AIDS, leukemias, lymphomas), therapeutical approaches (antibody engineering), genome diversity and genome evolution studies. IMGT is freely available at http://imgt.cnusc.fr:8104 PMID:9399859

Trypanosoma cruzi contains two galactokinases; molecular and biochemical characterization.

PubMed

Lobo-Rojas, Ángel E; González-Marcano, Eglys B; Valera-Vera, Edward A; Acosta, Héctor R; Quiñones, Wilfredo A; Burchmore, Richard J S; Concepción, Juan L; Cáceres, Ana J

2016-10-01

Two different putative galactokinase genes, found in the genome database of Trypanosoma cruzi were cloned and sequenced. Expression of the genes in Escherichia coli resulted for TcGALK-1 in the synthesis of a soluble and active enzyme, and in the case of TcGALK-2 gene a less soluble protein, with predicted molecular masses of 51.9kDa and 51.3kDa, respectively. The Km values determined for the recombinant proteins were for galactose 0.108mM (TcGALK-1) and 0.091mM (TcGALK-2) and for ATP 0.36mM (TcGALK-1) and 0.1mM (TcGALK-2). Substrate inhibition by ATP (Ki 0.414mM) was only observed for TcGALK-2. Gel-filtration chromatography showed that natural TcGALKs and recombinant TcGALK-1 are monomeric. In agreement with the possession of a type-1 peroxisome-targeting signal by both TcGALKs, they were found to be present inside glycosomes using two different methods of subcellular fractionation in conjunction with mass spectrometry. Both genes are expressed in epimastigote and trypomastigote stages since the respective proteins were immunodetected by western blotting. The T. cruzi galactokinases present their highest (52-47%) sequence identity with their counterpart from Leishmania spp., followed by prokaryotic galactokinases such as those from E. coli and Lactococcus lactis (26-23%). In a phylogenetic analysis, the trypanosomatid galactokinases form a separate cluster, showing an affiliation with bacteria. Epimastigotes of T. cruzi can grow in glucose-depleted LIT-medium supplemented with 20mM of galactose, suggesting that this hexose, upon phosphorylation by a TcGALK, could be used in the synthesis of UDP-galactose and also as a possible carbon and energy source. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

Acute effect of carbamazepine on corticothalamic 5-9-Hz and thalamocortical spindle (10-16-Hz) oscillations in the rat.

PubMed

Zheng, Thomas W; O'Brien, Terence J; Kulikova, Sofya P; Reid, Christopher A; Morris, Margaret J; Pinault, Didier

2014-03-01

A major side effect of carbamazepine (CBZ), a drug used to treat neurological and neuropsychiatric disorders, is drowsiness, a state characterized by increased slow-wave oscillations with the emergence of sleep spindles in the electroencephalogram (EEG). We conducted cortical EEG and thalamic cellular recordings in freely moving or lightly anesthetized rats to explore the impact of CBZ within the intact corticothalamic (CT)-thalamocortical (TC) network, more specifically on CT 5-9-Hz and TC spindle (10-16-Hz) oscillations. Two to three successive 5-9-Hz waves were followed by a spindle in the cortical EEG. A single systemic injection of CBZ (20 mg/kg) induced a significant increase in the power of EEG 5-9-Hz oscillations and spindles. Intracellular recordings of glutamatergic TC neurons revealed 5-9-Hz depolarizing wave-hyperpolarizing wave sequences prolonged by robust, rhythmic spindle-frequency hyperpolarizing waves. This hybrid sequence occurred during a slow hyperpolarizing trough, and was at least 10 times more frequent under the CBZ condition than under the control condition. The hyperpolarizing waves reversed at approximately -70 mV, and became depolarizing when recorded with KCl-filled intracellular micropipettes, indicating that they were GABAA receptor-mediated potentials. In neurons of the GABAergic thalamic reticular nucleus, the principal source of TC GABAergic inputs, CBZ augmented both the number and the duration of sequences of rhythmic spindle-frequency bursts of action potentials. This indicates that these GABAergic neurons are responsible for the generation of at least the spindle-frequency hyperpolarizing waves in TC neurons. In conclusion, CBZ potentiates GABAA receptor-mediated TC spindle oscillations. Furthermore, we propose that CT 5-9-Hz waves can trigger TC spindles. © 2013 Federation of European Neuroscience Societies and John Wiley & Sons Ltd.

Detection of bacterial infection by a technetium-99m-labeled peptidoglycan aptamer.

PubMed

Ferreira, Iêda Mendes; de Sousa Lacerda, Camila Maria; Dos Santos, Sara Roberta; de Barros, André Luís Branco; Fernandes, Simone Odília; Cardoso, Valbert Nascimento; de Andrade, Antero Silva Ribeiro

2017-09-01

Nuclear medicine clinicians are still waiting for the optimal scintigraphic imaging agents capable of distinguishing between infection and inflammation, and between fungal and bacterial infections. Aptamers have several properties that make them suitable for molecular imaging. In the present study, a peptidoglycan aptamer (Antibac1) was labeled with 99m Tc and evaluated by biodistribution studies and scintigraphic imaging in infection-bearing mice. Labeling with 99m Tc was performed by the direct method and the complex stability was evaluated in saline, plasma and in the molar excess of cysteine. The biodistribution and scintigraphic imaging studies with the 99m Tc-Antibac1 were carried out in two different experimental infection models: Bacterial-infected mice (S. aureus) and fungal-infected mice (C. albicans). A 99m Tc radiolabeled library, consisting of oligonucleotides with random sequences, was used as a control for both models. Radiolabeling yields were superior to 90% and 99m Tc-Antibac1 was highly stable in presence of saline, plasma, and cysteine up to 6h. Scintigraphic images of S. aureus infected mice at 1.5 and 3.0h after 99m Tc-Antibac1 injection showed target to non-target ratios of 4.7±0.9 and 4.6±0.1, respectively. These values were statistically higher than those achieved for the 99m Tc-library at the same time frames (1.6±0.4 and 1.7±0.4, respectively). Noteworthy, 99m Tc-Antibac1 and 99m Tc-library showed similar low target to non-target ratios in the fungal-infected model: 2.0±0.3 and 2.0±0.6for 99m Tc-Antibac1 and 2.1±0.3 and 1.9 ± 0.6 for 99m Tc-library, at the same times. These findings suggest that the 99m Tc-Antibac1 is a feasible imaging probe to identify a bacterial infection focus. In addition, this radiolabeled aptamer seems to be suitable in distinguishing between bacterial and fungal infection. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

Most high-grade neuroendocrine tumours of the lung are likely to secondarily develop from pre-existing carcinoids: innovative findings skipping the current pathogenesis paradigm.

PubMed

Pelosi, Giuseppe; Bianchi, Fabrizio; Dama, Elisa; Simbolo, Michele; Mafficini, Andrea; Sonzogni, Angelica; Pilotto, Sara; Harari, Sergio; Papotti, Mauro; Volante, Marco; Fontanini, Gabriella; Mastracci, Luca; Albini, Adriana; Bria, Emilio; Calabrese, Fiorella; Scarpa, Aldo

2018-04-01

Among lung neuroendocrine tumours (Lung-NETs), typical carcinoid (TC) and atypical carcinoid (AC) are considered separate entities as opposed to large cell neuroendocrine carcinoma (LCNEC) and small cell lung carcinoma (SCLC). By means of two-way clustering analysis of previously reported next-generation sequencing data on 148 surgically resected Lung-NETs, six histology-independent clusters (C1 → C6) accounting for 68% of tumours were identified. Low-grade Lung-NETs were likely to evolve into high-grade tumours following two smoke-related paths. Tumour composition of the first path (C5 → C1 → C6) was coherent with the hypothesis of an evolution of TC to LCNEC, even with a conversion of SCLC-featuring tumours to LCNEC. The second path (C4 → C2-C3) had a tumour composition supporting the evolution of AC to SCLC-featuring tumours. The relevant Ki-67 labelling index varied accordingly, with median values being 5%, 9% and 50% in the cluster sequence C5 → C1 → C6, 12% in cluster C4 and 50-60% in cluster C2-C3. This proof-of-concept study suggests an innovative view on the progression of pre-existing TC or AC to high-grade NE carcinomas in most Lung-NET instances.

The novel mitochondrial 16S rRNA 2336T>C mutation is associated with hypertrophic cardiomyopathy

PubMed Central

Liu, Zhong; Song, Yanrui; Li, Dan; He, Xiangyu; Li, Shishi; Wu, Bifeng; Wang, Wei; Gu, Shulian; Zhu, Xiaoyu; Wang, Xuexiang; Zhou, Qiyin; Dai, Yu; Yan, Qingfeng

2014-01-01

Background Hypertrophic cardiomyopathy (HCM) is a primary disorder characterised by asymmetric thickening of septum and left ventricular wall, with a prevalence of 0.2% in the general population. Objective To describe a novel mitochondrial DNA mutation and its association with the pathogenesis of HCM. Methods and results All maternal members of a Chinese family with maternally transmitted HCM exhibited variable severity and age at onset, and were implanted permanent pacemakers due to complete atrioventricular block (AVB). Nuclear gene screening (MYH7, MYBPC3, TNNT2 and TNNI3) was performed, and no potential pathogenic mutation was identified. Mitochondrial DNA sequencing analysis identified a novel homoplasmic 16S rRNA 2336T>C mutation. This mutation was exclusively present in maternal members and absent in non-maternal members. Conservation index by comparison to 16 other vertebrates was 94.1%. This mutation disturbs the 2336U-A2438 base pair in the stem–loop structure of 16S rRNA domain III, which is involved in the assembly of mitochondrial ribosome. Oxygen consumption rate of the lymphoblastoid cells carrying 2336T>C mutation had decreased by 37% compared with controls. A reduction in mitochondrial ATP synthesis and an increase in reactive oxidative species production were also observed. Electron microscopic analysis indicated elongated mitochondria and abnormal mitochondrial cristae shape in mutant cells. Conclusions It is suggested that the 2336T>C mutation is one of pathogenic mutations of HCM. This is the first report of mitochondrial 16S rRNA 2336T>C mutation and an association with maternally inherited HCM combined with AVB. Our findings provide a new insight into the pathogenesis of HCM. PMID:24367055

Molecular identification and genotyping of Trypanosoma cruzi DNA in autochthonous Chagas disease patients from Texas, USA.

PubMed

Garcia, Melissa N; Burroughs, Hadley; Gorchakov, Rodion; Gunter, Sarah M; Dumonteil, Eric; Murray, Kristy O; Herrera, Claudia P

2017-04-01

The parasitic protozoan Trypanosoma cruzi, the causative agent of Chagas disease, is widely distributed throughout the Americas, from the southern United States (US) to northern Argentina, and infects at least 6 million people in endemic areas. Much remains unknown about the dynamics of T. cruzi transmission among mammals and triatomine vectors in sylvatic and peridomestic eco-epidemiological cycles, as well as of the risk of transmission to humans in the US. Identification of T. cruzi DTUs among locally-acquired cases is necessary for enhancing our diagnostic and clinical prognostic capacities, as well as to understand parasite transmission cycles. Blood samples from a cohort of 15 confirmed locally-acquired Chagas disease patients from Texas were used for genotyping T. cruzi. Conventional PCR using primers specific for the minicircle variable region of the kinetoplastid DNA (kDNA) and the highly repetitive genomic satellite DNA (satDNA) confirmed the presence of T. cruzi in 12/15 patients. Genotyping was based on the amplification of the intergenic region of the miniexon gene of T. cruzi and sequencing. Sequences were analyzed by BLAST and phylogenetic analysis by Maximum Likelihood method allowed the identification of non-TcI DTUs infection in six patients, which corresponded to DTUs TcII, TcV or TcVI, but not to TcIII or TcIV. Two of these six patients were also infected with a TcI DTU, indicating mixed infections in those individuals. Electrocardiographic abnormalities were seen among patients with single non-TcI and mixed infections of non-TcI and TcI DTUs. Our results indicate a greater diversity of T. cruzi DTUs circulating among autochthonous human Chagas disease cases in the southern US, including for the first time DTUs from the TcII-TcV-TcVI group. Furthermore, the DTUs infecting human patients in the US are capable of causing Chagasic cardiac disease, highlighting the importance of parasite detection in the population. Copyright © 2017 Elsevier B.V. All rights reserved.

Pathways Impacted by Genomic Alterations in Pulmonary Carcinoid Tumors.

PubMed

Asiedu, Michael K; Thomas, Charles F; Dong, Jie; Schulte, Sandra C; Khadka, Prasidda; Sun, Zhifu; Kosari, Farhad; Jen, Jin; Molina, Julian; Vasmatzis, George; Kuang, Ray; Aubry, Marie Christine; Yang, Ping; Wigle, Dennis A

2018-04-01

Purpose: Pulmonary carcinoid tumors account for up to 5% of all lung malignancies in adults, comprise 30% of all carcinoid malignancies, and are defined histologically as typical carcinoid (TC) and atypical carcinoid (AC) tumors. The role of specific genomic alterations in the pathogenesis of pulmonary carcinoid tumors remains poorly understood. We sought to identify genomic alterations and pathways that are deregulated in these tumors to find novel therapeutic targets for pulmonary carcinoid tumors. Experimental Design: We performed integrated genomic analysis of carcinoid tumors comprising whole genome and exome sequencing, mRNA expression profiling and SNP genotyping of specimens from normal lung, TC and AC, and small cell lung carcinoma (SCLC) to fully represent the lung neuroendocrine tumor spectrum. Results: Analysis of sequencing data found recurrent mutations in cancer genes including ATP1A2, CNNM1, MACF1, RAB38, NF1, RAD51C, TAF1L, EPHB2, POLR3B , and AGFG1 The mutated genes are involved in biological processes including cellular metabolism, cell division cycle, cell death, apoptosis, and immune regulation. The top most significantly mutated genes were TMEM41B, DEFB127, WDYHV1, and TBPL1 Pathway analysis of significantly mutated and cancer driver genes implicated MAPK/ERK and amyloid beta precursor protein (APP) pathways whereas analysis of CNV and gene expression data suggested deregulation of the NF-κB and MAPK/ERK pathways. The mutation signature was predominantly C>T and T>C transitions with a minor contribution of T>G transversions. Conclusions: This study identified mutated genes affecting cancer relevant pathways and biological processes that could provide opportunities for developing targeted therapies for pulmonary carcinoid tumors. Clin Cancer Res; 24(7); 1691-704. ©2018 AACR . ©2018 American Association for Cancer Research.

A MELAS syndrome family harboring two mutations in mitochondrial genome.

PubMed

Choi, Byung-Ok; Hwang, Jung Hee; Kim, Joonki; Cho, Eun Min; Cho, Sun Young; Hwang, Su Jin; Lee, Hyang Woon; Kim, Song Ja; Chung, Ki Wha

2008-06-30

Mitochondrial myopathy, encephalopathy, lactic acidosis, and stroke-like episodes (MELAS) syndrome is a genetically heterogeneous mitochondrial disorder with variable clinical symptoms. Here, from the sequencing of the entire mitochondrial genome, we report a Korean MELAS family harboring two homoplasmic missense mutations, which were reported 9957T>C (Phe251Leu) transition mutation in the cytochrome c oxidase subunit 3 (COX3) gene and a novel 13849A>C (Asn505His) transversion mutation in the NADH dehydrogenase subunit 5 (ND5) gene. Neither of these mutations was found in 205 normal controls. Both mutations were identified from the proband and his mother, but not his father. The patients showed cataract symptom in addition to MELAS phenotype. We believe that the 9957T>C mutation is pathogenic, however, the 13849A>C mutation is of unclear significance. It is likely that the 13849A>C mutation might function as the secondary mutation which increase the expressivity of overlapping phenotypes of MELAS and cataract. This study also demonstrates the importance of full sequencing of mtDNA for the molecular genetic understanding of mitochondrial disorders.

Enolase from Trypanosoma cruzi is inhibited by its interaction with metallocarboxypeptidase-1 and a putative acireductone dioxygenase.

PubMed

Quintero-Troconis, E; Buelvas, N; Carrasco-López, C; Domingo-Sananes, M R; González-González, L; Ramírez-Molina, R; Osorio, L; Lobo-Rojas, A; Cáceres, A J; Michels, P A; Acosta, H; Quiñones, W; Concepción, J L

Purification of enolase (ENO) from the cytosol of Trypanosoma cruzi indicated that it may interact with at least five other proteins. Two of them were identified as metallocarboxypeptidase-1 (TcMCP-1) and a putative acireductone dioxygenase (ARDp). Subcellular localization studies confirmed the presence of ARDp in the cytosol, as is the case for ENO and TcMCP-1. Analysis of the ARDp sequence showed that this protein has two domains, an N-terminal ARD and a C-terminal TRP14 (thioredoxin-related protein) domain. The interactions between ENO, TcMCP-1 and ARDp were confirmed for the natural proteins from the trypanosome (using size-exclusion chromatography and co-immunoprecipitation from a cytosolic fraction) and recombinant forms (using ELISA ligand-binding assay and ENO activity assays). The ELISA ligand-binding assays permitted to verify the optimal physicochemical conditions for the interactions (representative for the physiological conditions) and to determine the affinity constants (Kd): ENO/ARDp: 9.54 ± 0.82 nM, ARDp/ENO 10.05 ± 1.11 nM, and ENO/TcMCP-1: 5.66 ± 0.61 nM. The data also show that the interaction between TcMCP-1 and ARDp is mediated by ENO acting as a "bridge". Furthermore, considerable inhibition of the ENO activity, up to 85%, is observed when the enzyme interacts with TcMCP-1 and ARDp simultaneously. All these data confirm that the interaction between ENO, TcMCP-1 and ARDp, occurring in T. cruzi's cytosol, modulates the ENO activity and suggest a possible physiological mechanism for regulation of the ENO activity by the protein-protein interaction. Copyright © 2018 Elsevier B.V. All rights reserved.

Episodic weakness due to mitochondrial DNA MT-ATP6/8 mutations.

PubMed

Auré, Karine; Dubourg, Odile; Jardel, Claude; Clarysse, Lucie; Sternberg, Damien; Fournier, Emmanuel; Laforêt, Pascal; Streichenberger, Nathalie; Petiot, Philippe; Gervais-Bernard, Hélène; Vial, Christophe; Bedat-Millet, Anne-Laure; Drouin-Garraud, Valérie; Bouillaud, Frédéric; Vandier, Christophe; Fontaine, Bertrand; Lombès, Anne

2013-11-19

To report that homoplasmic deleterious mutations in the mitochondrial DNA MT-ATP6/8 genes may be responsible for acute episodes of limb weakness mimicking periodic paralysis due to channelopathies and dramatically responding to acetazolamide. Mitochondrial DNA sequencing and restriction PCR, oxidative phosphorylation functional assays, reactive oxygen species metabolism, and patch-clamp technique in cultured skin fibroblasts. Occurrence of a typical MELAS (mitochondrial encephalopathy with lactic acidosis and stroke-like episodes) syndrome in a single member of a large pedigree with episodic weakness associated with a later-onset distal motor neuropathy led to the disclosure of 2 deleterious mitochondrial DNA mutations. The MT-ATP6 m.9185T>C p.Leu220Pro mutation, previously associated with Leigh syndrome, was present in all family members, while the MT-TL1 m.3271T>C mutation, a known cause of MELAS syndrome, was observed in the sole patient with MELAS presentation. Significant defect of complexes V and I as well as oxidative stress were observed in both primary fibroblasts and cybrid cells with 100% m.9185T>C mutation. Permanent plasma membrane depolarization and altered permeability to K(+) in fibroblasts provided a link with the paralysis episodes. Screening of 9 patients, based on their clinical phenotype, identified 4 patients with similar deleterious MT-ATP6 mutations (twice m.9185T>C and once m.9176T>C or m.8893T>C). A fifth patient presented with an original potentially deleterious MT-ATP8 mutation (m.8403T>C). All mutations were associated with almost-normal complex V activity but significant oxidative stress and permanent plasma membrane depolarization. Homoplasmic mutations in the MT-ATP6/8 genes may cause episodic weakness responding to acetazolamide treatment.

Organization and variation analysis of 5S rDNA in different ploidy-level hybrids of red crucian carp × topmouth culter.

PubMed

He, Weiguo; Qin, Qinbo; Liu, Shaojun; Li, Tangluo; Wang, Jing; Xiao, Jun; Xie, Lihua; Zhang, Chun; Liu, Yun

2012-01-01

Through distant crossing, diploid, triploid and tetraploid hybrids of red crucian carp (Carassius auratus red var., RCC♀, Cyprininae, 2n = 100) × topmouth culter (Erythroculter ilishaeformis Bleeker, TC♂, Cultrinae, 2n = 48) were successfully produced. Diploid hybrids possessed 74 chromosomes with one set from RCC and one set from TC; triploid hybrids harbored 124 chromosomes with two sets from RCC and one set from TC; tetraploid hybrids had 148 chromosomes with two sets from RCC and two sets from TC. The 5S rDNA of the three different ploidy-level hybrids and their parents were sequenced and analyzed. There were three monomeric 5S rDNA classes (designated class I: 203 bp; class II: 340 bp; and class III: 477 bp) in RCC and two monomeric 5S rDNA classes (designated class IV: 188 bp, and class V: 286 bp) in TC. In the hybrid offspring, diploid hybrids inherited three 5S rDNA classes from their female parent (RCC) and only class IV from their male parent (TC). Triploid hybrids inherited class II and class III from their female parent (RCC) and class IV from their male parent (TC). Tetraploid hybrids gained class II and class III from their female parent (RCC), and generated a new 5S rDNA sequence (designated class I-N). The specific paternal 5S rDNA sequence of class V was not found in the hybrid offspring. Sequence analysis of 5S rDNA revealed the influence of hybridization and polyploidization on the organization and variation of 5S rDNA in fish. This is the first report on the coexistence in vertebrates of viable diploid, triploid and tetraploid hybrids produced by crossing parents with different chromosome numbers, and these new hybrids are novel specimens for studying the genomic variation in the first generation of interspecific hybrids, which has significance for evolution and fish genetics.

Detection of Ultra-Rare Mitochondrial Mutations in Breast Stem Cells by Duplex Sequencing.

PubMed

Ahn, Eun Hyun; Hirohata, Kensen; Kohrn, Brendan F; Fox, Edward J; Chang, Chia-Cheng; Loeb, Lawrence A

2015-01-01

Long-lived adult stem cells could accumulate non-repaired DNA damage or mutations that increase the risk of tumor formation. To date, studies on mutations in stem cells have concentrated on clonal (homoplasmic) mutations and have not focused on rarely occurring stochastic mutations that may accumulate during stem cell dormancy. A major challenge in investigating these rare mutations is that conventional next generation sequencing (NGS) methods have high error rates. We have established a new method termed Duplex Sequencing (DS), which detects mutations with unprecedented accuracy. We present a comprehensive analysis of mitochondrial DNA mutations in human breast normal stem cells and non-stem cells using DS. The vast majority of mutations occur at low frequency and are not detectable by NGS. The most prevalent point mutation types are the C>T/G>A and A>G/T>C transitions. The mutations exhibit a strand bias with higher prevalence of G>A, T>C, and A>C mutations on the light strand of the mitochondrial genome. The overall rare mutation frequency is significantly lower in stem cells than in the corresponding non-stem cells. We have identified common and unique non-homoplasmic mutations between non-stem and stem cells that include new mutations which have not been reported previously. Four mutations found within the MT-ND5 gene (m.12684G>A, m.12705C>T, m.13095T>C, m.13105A>G) are present in all groups of stem and non-stem cells. Two mutations (m.8567T>C, m.10547C>G) are found only in non-stem cells. This first genome-wide analysis of mitochondrial DNA mutations may aid in characterizing human breast normal epithelial cells and serve as a reference for cancer stem cell mutation profiles.

Transient Expression of CRISPR/Cas9 Machinery Targeting TcNPR3 Enhances Defense Response in Theobroma cacao.

PubMed

Fister, Andrew S; Landherr, Lena; Maximova, Siela N; Guiltinan, Mark J

2018-01-01

Theobroma cacao , the source of cocoa, suffers significant losses to a variety of pathogens resulting in reduced incomes for millions of farmers in developing countries. Development of disease resistant cacao varieties is an essential strategy to combat this threat, but is limited by sources of genetic resistance and the slow generation time of this tropical tree crop. In this study, we present the first application of genome editing technology in cacao, using Agrobacterium-mediated transient transformation to introduce CRISPR/Cas9 components into cacao leaves and cotyledon cells. As a first proof of concept, we targeted the cacao Non-Expressor of Pathogenesis-Related 3 (TcNPR3) gene, a suppressor of the defense response. After demonstrating activity of designed single-guide RNAs (sgRNA) in vitro , we used Agrobacterium to introduce a CRISPR/Cas9 system into leaf tissue, and identified the presence of deletions in 27% of TcNPR3 copies in the treated tissues. The edited tissue exhibited an increased resistance to infection with the cacao pathogen Phytophthora tropicalis and elevated expression of downstream defense genes. Analysis of off-target mutagenesis in sequences similar to sgRNA target sites using high-throughput sequencing did not reveal mutations above background sequencing error rates. These results confirm the function of NPR3 as a repressor of the cacao immune system and demonstrate the application of CRISPR/Cas9 as a powerful functional genomics tool for cacao. Several stably transformed and genome edited somatic embryos were obtained via Agrobacterium -mediated transformation, and ongoing work will test the effectiveness of this approach at a whole plant level.

Transient Expression of CRISPR/Cas9 Machinery Targeting TcNPR3 Enhances Defense Response in Theobroma cacao

PubMed Central

Fister, Andrew S.; Landherr, Lena; Maximova, Siela N.; Guiltinan, Mark J.

2018-01-01

Theobroma cacao, the source of cocoa, suffers significant losses to a variety of pathogens resulting in reduced incomes for millions of farmers in developing countries. Development of disease resistant cacao varieties is an essential strategy to combat this threat, but is limited by sources of genetic resistance and the slow generation time of this tropical tree crop. In this study, we present the first application of genome editing technology in cacao, using Agrobacterium-mediated transient transformation to introduce CRISPR/Cas9 components into cacao leaves and cotyledon cells. As a first proof of concept, we targeted the cacao Non-Expressor of Pathogenesis-Related 3 (TcNPR3) gene, a suppressor of the defense response. After demonstrating activity of designed single-guide RNAs (sgRNA) in vitro, we used Agrobacterium to introduce a CRISPR/Cas9 system into leaf tissue, and identified the presence of deletions in 27% of TcNPR3 copies in the treated tissues. The edited tissue exhibited an increased resistance to infection with the cacao pathogen Phytophthora tropicalis and elevated expression of downstream defense genes. Analysis of off-target mutagenesis in sequences similar to sgRNA target sites using high-throughput sequencing did not reveal mutations above background sequencing error rates. These results confirm the function of NPR3 as a repressor of the cacao immune system and demonstrate the application of CRISPR/Cas9 as a powerful functional genomics tool for cacao. Several stably transformed and genome edited somatic embryos were obtained via Agrobacterium-mediated transformation, and ongoing work will test the effectiveness of this approach at a whole plant level. PMID:29552023

Distribution of gene mutations in sporadic congenital cataract in a Han Chinese population

PubMed Central

Li, Dan; Wang, Siying; Ye, Hongfei; Tang, Yating; Qiu, Xiaodi; Fan, Qi; Rong, Xianfang; Liu, Xin; Chen, Yuhong; Yang, Jin

2016-01-01

Purpose This study aimed to investigate the genetic effects underlying non-familial sporadic congenital cataract (SCC). Methods We collected DNA samples from 74 patients with SCC and 20 patients with traumatic cataract (TC) in an age-matched group and performed genomic sequencing of 61 lens-related genes with target region capture and next-generation sequencing (NGS). The suspected SCC variants were validated with MassARRAY and Sanger sequencing. DNA samples from 103 healthy subjects were used as additional controls in the confirmation examination. Results By filtering against common variants in public databases and those associated with TC cases, we identified 23 SCC-specific variants in 17 genes from 19 patients, which were predicted to be functional. These mutations were further confirmed by examination of the 103 healthy controls. Among the mutated genes, CRYBB3 had the highest mutation frequency with mutations detected four times in four patients, followed by EPHA2, NHS, and WDR36, the mutation of which were detected two times in two patients. We observed that the four patients with CRYBB3 mutations had three different cataract phenotypes. Conclusions From this study, we concluded the clinical and genetic heterogeneity of SCC. This is the first study to report broad spectrum genotyping for patients with SCC. PMID:27307692

Evolutionary Dynamics of 5S rDNA and Recurrent Association of Transposable Elements in Electric Fish of the Family Gymnotidae (Gymnotiformes): The Case of Gymnotus mamiraua.

PubMed

da Silva, Maelin; Barbosa, Patricia; Artoni, Roberto F; Feldberg, Eliana

2016-01-01

Gymnotidae is a family of electric fish endemic to the Neotropics consisting of 2 genera: Electrophorus and Gymnotus. The genus Gymnotus is widely distributed and is found in all of the major Brazilian river systems. Physical and molecular mapping data for the ribosomal DNA (rDNA) in this genus are still scarce, with its chromosomal location known in only 11 species. As other species of Gymnotus with 2n = 54 chromosomes from the Paraná-Paraguay basin, G. mamiraua was found to have a large number of 5S rDNA sites. Isolation and cloning of the 5S rDNA sequences from G. mamiraua identified a fragment of a transposable element similar to the Tc1/mariner transposon associated with a non-transcribed spacer. Double fluorescence in situ hybridization analysis of this element and the 5S rDNA showed that they were colocalized on several chromosomes, in addition to acting as nonsyntenic markers on others. Our data show the association between these sequences and suggest that the Tc1 retrotransposon may be the agent that drives the spread of these 5S rDNA-like sequences in the G. mamiraua genome. © 2016 S. Karger AG, Basel.

Bacterial and archaeal diversity in two hot spring microbial mats from the geothermal region of Tengchong, China.

PubMed

Pagaling, Eulyn; Grant, William D; Cowan, Don A; Jones, Brian E; Ma, Yanhe; Ventosa, Antonio; Heaphy, Shaun

2012-07-01

We investigated the bacterial and archaeal diversity in two hot spring microbial mats from the geothermal region of Tengchong in the Yunnan Province, China, using direct molecular analyses. The Langpu (LP) laminated mat was found by the side of a boiling pool with temperature of 60-65 °C and a pH of 8.5, while the Tengchong (TC) streamer mat consisted of white streamers in a slightly acidic (pH 6.5) hot pool outflow with a temperature of 72 °C. Four 16S rRNA gene clone libraries were constructed and restriction enzyme analysis of the inserts was used to identify unique sequences and clone frequencies. From almost 200 clones screened, 55 unique sequences were retrieved. Phylogenetic analysis showed that the LP mat consisted of a diverse bacterial population [Cyanobacteria, Chloroflexi, Chlorobia, Nitrospirae, 'Deinococcus-Thermus', Proteobacteria (alpha, beta and delta subdivisions), Firmicutes, Bacteroidetes and Actinobacteria], while the archaeal population was dominated by methanogenic Euryarchaeota and Crenarchaeota. In contrast, the TC streamer mat consisted of a bacterial population dominated by Aquificae, while the archaeal population also contained Korarchaeota as well as Crenarchaeota and methanogenic Euryarchaeota. These mats harboured clone sequences affiliated to unidentified lineages, suggesting that they are a potential source for discovering novel bacteria and archaea.

The annotation of repetitive elements in the genome of channel catfish (Ictalurus punctatus).

PubMed

Yuan, Zihao; Zhou, Tao; Bao, Lisui; Liu, Shikai; Shi, Huitong; Yang, Yujia; Gao, Dongya; Dunham, Rex; Waldbieser, Geoff; Liu, Zhanjiang

2018-01-01

Channel catfish (Ictalurus punctatus) is a highly adaptive species and has been used as a research model for comparative immunology, physiology, and toxicology among ectothermic vertebrates. It is also economically important for aquaculture. As such, its reference genome was generated and annotated with protein coding genes. However, the repetitive elements in the catfish genome are less well understood. In this study, over 417.8 Megabase (MB) of repetitive elements were identified and characterized in the channel catfish genome. Among them, the DNA/TcMar-Tc1 transposons are the most abundant type, making up ~20% of the total repetitive elements, followed by the microsatellites (14%). The prevalence of repetitive elements, especially the mobile elements, may have provided a driving force for the evolution of the catfish genome. A number of catfish-specific repetitive elements were identified including the previously reported Xba elements whose divergence rate was relatively low, slower than that in untranslated regions of genes but faster than the protein coding sequences, suggesting its evolutionary restrictions.

The annotation of repetitive elements in the genome of channel catfish (Ictalurus punctatus)

PubMed Central

Yuan, Zihao; Zhou, Tao; Bao, Lisui; Liu, Shikai; Shi, Huitong; Yang, Yujia; Gao, Dongya; Dunham, Rex; Waldbieser, Geoff

2018-01-01

Channel catfish (Ictalurus punctatus) is a highly adaptive species and has been used as a research model for comparative immunology, physiology, and toxicology among ectothermic vertebrates. It is also economically important for aquaculture. As such, its reference genome was generated and annotated with protein coding genes. However, the repetitive elements in the catfish genome are less well understood. In this study, over 417.8 Megabase (MB) of repetitive elements were identified and characterized in the channel catfish genome. Among them, the DNA/TcMar-Tc1 transposons are the most abundant type, making up ~20% of the total repetitive elements, followed by the microsatellites (14%). The prevalence of repetitive elements, especially the mobile elements, may have provided a driving force for the evolution of the catfish genome. A number of catfish-specific repetitive elements were identified including the previously reported Xba elements whose divergence rate was relatively low, slower than that in untranslated regions of genes but faster than the protein coding sequences, suggesting its evolutionary restrictions. PMID:29763462

Deep sequencing of the Trypanosoma cruzi GP63 surface proteases reveals diversity and diversifying selection among chronic and congenital Chagas disease patients.

PubMed

Llewellyn, Martin S; Messenger, Louisa A; Luquetti, Alejandro O; Garcia, Lineth; Torrico, Faustino; Tavares, Suelene B N; Cheaib, Bachar; Derome, Nicolas; Delepine, Marc; Baulard, Céline; Deleuze, Jean-Francois; Sauer, Sascha; Miles, Michael A

2015-04-01

Chagas disease results from infection with the diploid protozoan parasite Trypanosoma cruzi. T. cruzi is highly genetically diverse, and multiclonal infections in individual hosts are common, but little studied. In this study, we explore T. cruzi infection multiclonality in the context of age, sex and clinical profile among a cohort of chronic patients, as well as paired congenital cases from Cochabamba, Bolivia and Goias, Brazil using amplicon deep sequencing technology. A 450bp fragment of the trypomastigote TcGP63I surface protease gene was amplified and sequenced across 70 chronic and 22 congenital cases on the Illumina MiSeq platform. In addition, a second, mitochondrial target--ND5--was sequenced across the same cohort of cases. Several million reads were generated, and sequencing read depths were normalized within patient cohorts (Goias chronic, n = 43, Goias congenital n = 2, Bolivia chronic, n = 27; Bolivia congenital, n = 20), Among chronic cases, analyses of variance indicated no clear correlation between intra-host sequence diversity and age, sex or symptoms, while principal coordinate analyses showed no clustering by symptoms between patients. Between congenital pairs, we found evidence for the transmission of multiple sequence types from mother to infant, as well as widespread instances of novel genotypes in infants. Finally, non-synonymous to synonymous (dn:ds) nucleotide substitution ratios among sequences of TcGP63Ia and TcGP63Ib subfamilies within each cohort provided powerful evidence of strong diversifying selection at this locus. Our results shed light on the diversity of parasite DTUs within each patient, as well as the extent to which parasite strains pass between mother and foetus in congenital cases. Although we were unable to find any evidence that parasite diversity accumulates with age in our study cohorts, putative diversifying selection within members of the TcGP63I gene family suggests a link between genetic diversity within this gene family and survival in the mammalian host.

Trypanosoma sp. diversity in Amazonian bats (Chiroptera; Mammalia) from Acre State, Brazil.

PubMed

Dos Santos, Francisco C B; Lisboa, Cristiane V; Xavier, Samanta C C; Dario, Maria A; Verde, Rair de S; Calouro, Armando M; Roque, André Luiz R; Jansen, Ana M

2017-11-16

Bats are ancient hosts of Trypanosoma species and their flying ability, longevity and adaptability to distinct environments indicate that they are efficient dispersers of parasites. Bats from Acre state (Amazon Biome) were collected in four expeditions conducted in an urban forest (Parque Zoobotânico) and one relatively more preserved area (Seringal Cahoeira) in Rio Branco and Xapuri municipalities. Trypanosoma sp. infection was detected by hemoculture and fresh blood examination. Isolated parasite species were identified by the similarity of the obtained DNA sequence from 18S rDNA polymerase chain reaction and reference strains. Overall, 367 bats from 23 genera and 32 species were examined. Chiropterofauna composition was specific to each municipality, although Artibeus sp. and Carollia sp. prevailed throughout. Trypanosoma sp. infection was detected in 85 bats (23·2%). The most widely distributed and prevalent genotypes were (in order) Trypanosoma cruzi TcI, T. cruzi marinkellei, Trypanosoma dionisii, T. cruzi TcIV and Trypanosoma rangeli. At least one still-undescribed Trypanosoma species was also detected in this study. The detection of T. cruzi TcI and TcIV (the ones associated with Chagas disease in Amazon biome) demonstrates the putative importance of these mammal hosts in the epidemiology of the disease in the Acre State.

AT-rich sequence elements promote nascent transcript cleavage leading to RNA polymerase II termination

PubMed Central

White, Eleanor; Kamieniarz-Gdula, Kinga; Dye, Michael J.; Proudfoot, Nick J.

2013-01-01

RNA Polymerase II (Pol II) termination is dependent on RNA processing signals as well as specific terminator elements located downstream of the poly(A) site. One of the two major terminator classes described so far is the Co-Transcriptional Cleavage (CoTC) element. We show that homopolymer A/T tracts within the human β-globin CoTC-mediated terminator element play a critical role in Pol II termination. These short A/T tracts, dispersed within seemingly random sequences, are strong terminator elements, and bioinformatics analysis confirms the presence of such sequences in 70% of the putative terminator regions (PTRs) genome-wide. PMID:23258704

TC-PTP and PTP1B: Regulating JAK-STAT signaling, controlling lymphoid malignancies.

PubMed

Pike, Kelly A; Tremblay, Michel L

2016-06-01

Lymphoid malignancies are characterized by an accumulation of genetic lesions that act co-operatively to perturb signaling pathways and alter gene expression programs. The Janus kinases (JAK)-signal transducers and activators of transcription (STATs) pathway is one such pathway that is frequently mutated in leukemia and lymphoma. In response to cytokines and growth factors, a cascade of reversible tyrosine phosphorylation events propagates the JAK-STAT pathway from the cell surface to the nucleus. Activated STAT family members then play a fundamental role in establishing the transcriptional landscape of the cell. In leukemia and lymphoma, somatic mutations have been identified in JAK and STAT family members, as well as, negative regulators of the pathway. Most recently, inactivating mutations in the protein tyrosine phosphatase (PTP) genes PTPN1 (PTP1B) and PTPN2 (TC-PTP) were sequenced in B cell lymphoma and T cell acute lymphoblastic leukemia (T-ALL) respectively. The loss of PTP1B and TC-PTP phosphatase activity is associated with an increase in cytokine sensitivity, elevated JAK-STAT signaling, and changes in gene expression. As inactivation mutations in PTPN1 and PTPN2 are restricted to distinct subsets of leukemia and lymphoma, a future challenge will be to identify in which cellular contexts do they contributing to the initiation or maintenance of leukemogenesis or lymphomagenesis. As well, the molecular mechanisms by which PTP1B and TC-PTP loss co-operates with other genetic aberrations will need to be elucidated to design more effective therapeutic strategies. Copyright © 2016 Elsevier Ltd. All rights reserved.

A novel Met-to-Thr mutation in the YMDD motif of reverse transcriptase from feline immunodeficiency virus confers resistance to oxathiolane nucleosides.

PubMed Central

Smith, R A; Remington, K M; Lloyd, R M; Schinazi, R F; North, T W

1997-01-01

Variants of feline immunodeficiency virus (FIV) that possess a unique methionine-to-threonine mutation within the YMDD motif of reverse transcriptase (RT) were selected by culturing virus in the presence of inhibitory concentrations of (-)-beta-L-2',3'-dideoxy-5-fluoro-3'-thiacytidine [(-)-FTC]. The mutants were resistant to (-)-FTC and (-)-beta-L-2',3'-dideoxy-3'-thiacytidine (3TC) and additionally exhibited low-level resistance to 2',3'-dideoxycytidine (ddC). DNA sequence analysis of the RT-encoding region of the pol gene amplified from resistant viruses consistently identified a Met-to-Thr mutation in the YMDD motif. Purified RT from the mutants was also resistant to the 5'-triphosphate forms of 3TC, (-)-FTC, and ddC. Site-directed mutants of FIV were engineered which contain either the novel Met-to-Thr mutation or the Met-to-Val mutation seen in oxathiolane nucleoside-resistant HIV-1. Both site-directed mutants displayed resistance to 3TC, thus confirming the role of these mutations in the resistance of FIV to beta-L-3'-thianucleosides. PMID:9032372

Global molecular changes in a tibial compression induced ACL rupture model of post-traumatic osteoarthritis.

PubMed

Chang, Jiun C; Sebastian, Aimy; Murugesh, Deepa K; Hatsell, Sarah; Economides, Aris N; Christiansen, Blaine A; Loots, Gabriela G

2017-03-01

Joint injury causes post-traumatic osteoarthritis (PTOA). About ∼50% of patients rupturing their anterior cruciate ligament (ACL) will develop PTOA within 1-2 decades of the injury, yet the mechanisms responsible for the development of PTOA after joint injury are not well understood. In this study, we examined whole joint gene expression by RNA sequencing (RNAseq) at 1 day, 1-, 6-, and 12 weeks post injury, in a non-invasive tibial compression (TC) overload mouse model of PTOA that mimics ACL rupture in humans. We identified 1446 genes differentially regulated between injured and contralateral joints. This includes known regulators of osteoarthritis such as MMP3, FN1, and COMP, and several new genes including Suco, Sorcs2, and Medag. We also identified 18 long noncoding RNAs that are differentially expressed in the injured joints. By comparing our data to gene expression data generated using the surgical destabilization of the medial meniscus (DMM) PTOA model, we identified several common genes and shared mechanisms. Our study highlights several differences between these two models and suggests that the TC model may be a more rapidly progressing model of PTOA. This study provides the first account of gene expression changes associated with PTOA development and progression in a TC model. © 2016 The Authors. Journal of Orthopaedic Research Published by Wiley Periodicals, Inc. J Orthop Res 35:474-485, 2017. © 2016 The Authors. Journal of Orthopaedic Research Published by Wiley Periodicals, Inc.

Global molecular changes in a tibial compression induced ACL rupture model of post‐traumatic osteoarthritis

PubMed Central

Chang, Jiun C.; Sebastian, Aimy; Murugesh, Deepa K.; Hatsell, Sarah; Economides, Aris N.; Christiansen, Blaine A.

2016-01-01

ABSTRACT Joint injury causes post‐traumatic osteoarthritis (PTOA). About ∼50% of patients rupturing their anterior cruciate ligament (ACL) will develop PTOA within 1–2 decades of the injury, yet the mechanisms responsible for the development of PTOA after joint injury are not well understood. In this study, we examined whole joint gene expression by RNA sequencing (RNAseq) at 1 day, 1‐, 6‐, and 12 weeks post injury, in a non‐invasive tibial compression (TC) overload mouse model of PTOA that mimics ACL rupture in humans. We identified 1446 genes differentially regulated between injured and contralateral joints. This includes known regulators of osteoarthritis such as MMP3, FN1, and COMP, and several new genes including Suco, Sorcs2, and Medag. We also identified 18 long noncoding RNAs that are differentially expressed in the injured joints. By comparing our data to gene expression data generated using the surgical destabilization of the medial meniscus (DMM) PTOA model, we identified several common genes and shared mechanisms. Our study highlights several differences between these two models and suggests that the TC model may be a more rapidly progressing model of PTOA. This study provides the first account of gene expression changes associated with PTOA development and progression in a TC model. © 2016 The Authors. Journal of Orthopaedic Research Published by Wiley Periodicals, Inc. J Orthop Res 35:474–485, 2017. PMID:27088242

Trypanosoma cruzi strain TcI is associated with chronic Chagas disease in the Brazilian Amazon.

PubMed

Santana, Rosa Amélia Gonçalves; Magalhães, Laylah Kelre Costa; Magalhães, Laise Kelman Costa; Prestes, Suzane Ribeiro; Maciel, Marcel Gonçalves; da Silva, George Allan Villarouco; Monteiro, Wuelton Marcelo; de Brito, Felipe Rocha; de Aguiar Raposo Câmara Coelho, Leila Inês; Barbosa-Ferreira, João Marcos; Guerra, Jorge Augusto Oliveira; Silveira, Henrique; das Graças Vale Barbosa, Maria

2014-06-11

Chagas disease in the Amazon region is considered an emerging anthropozoonosis with a predominance of the discrete typing units (DTUs) TcI and TcIV. These DTUs are responsible for cases of acute disease associated with oral transmission. Chronic disease cases have been detected through serological surveys. However, the mode of transmission could not be determined, or any association of chronic disease with a specific T. cruzi DTU's. The aim of this study was to characterize Trypanosoma cruzi in patients with chronic Chagas disease in the State of Amazonas, Brazil. Blood culture and xenodiagnosis were performed in 36 patients with positive serology for Chagas disease who participated in a serological survey performed in urban and rural areas of Manaus, Amazonas. DNA samples were extracted from the feces of triatomines used for xenodiagnosis, and the nontranscribed spacer of the mini-exon gene and the mitochondrial gene cytochrome oxidase subunit II (COII) were amplified by PCR and sequenced. Blood culture and xenodiagnosis were negative in 100% of samples; however, molecular techniques revealed that in 13 out of 36 (36%) fecal samples from xenodiagnosis, T. cruzi was characterized as the DTU TcI, and different haplotypes were identified within the same DTU. The DTU TcI, which is mainly associated with acute cases of Chagas disease in the Amazon region, is also responsible for chronic infection in patients from a region in the State of Amazonas.

Trypanosoma cruzi strain TcI is associated with chronic Chagas disease in the Brazilian Amazon

PubMed Central

2014-01-01

Background Chagas disease in the Amazon region is considered an emerging anthropozoonosis with a predominance of the discrete typing units (DTUs) TcI and TcIV. These DTUs are responsible for cases of acute disease associated with oral transmission. Chronic disease cases have been detected through serological surveys. However, the mode of transmission could not be determined, or any association of chronic disease with a specific T. cruzi DTU’s. The aim of this study was to characterize Trypanosoma cruzi in patients with chronic Chagas disease in the State of Amazonas, Brazil. Methods Blood culture and xenodiagnosis were performed in 36 patients with positive serology for Chagas disease who participated in a serological survey performed in urban and rural areas of Manaus, Amazonas. DNA samples were extracted from the feces of triatomines used for xenodiagnosis, and the nontranscribed spacer of the mini-exon gene and the mitochondrial gene cytochrome oxidase subunit II (COII) were amplified by PCR and sequenced. Results Blood culture and xenodiagnosis were negative in 100% of samples; however, molecular techniques revealed that in 13 out of 36 (36%) fecal samples from xenodiagnosis, T. cruzi was characterized as the DTU TcI, and different haplotypes were identified within the same DTU. Conclusion The DTU TcI, which is mainly associated with acute cases of Chagas disease in the Amazon region, is also responsible for chronic infection in patients from a region in the State of Amazonas. PMID:24916362

Experimental study of /sup 99m/Tc pertechnetate abdominal scans in jejunal intussusception: preliminary results

DOE Office of Scientific and Technical Information (OSTI.GOV)

James, A.E. Jr.; Strecker, E.P.; Miller, F.J. Jr.

1975-07-01

Recent communications have related the diagnosis of small bowel intussusceptions to abnormal accumulations of the radiopharmaceutical /sup 99m/Tc pertechnetate on abdominal scans. Considering the pathophysiological alterations attendant to intussusceptions, we have attempted an experimental model to examine these changes in temporal sequence. This study was initiated to understand the etiology better and to characterize the abnormalities noted on the /sup 99m/Tc pertechnetate abdominal scans.

Molecular characterization and functional analysis of serine/threonine protein phosphatase of Toxocara canis.

PubMed

Ma, Guang Xu; Zhou, Rong Qiong; Hu, Shi Jun; Huang, Han Cheng; Zhu, Tao; Xia, Qing You

2014-06-01

Toxocara canis (T. canis) is a widely prevalent zoonotic parasite that infects a wide range of mammalian hosts, including humans. We generated the full-length complementary DNA (cDNA) of the serine/threonine phosphatase gene of T. canis (Tc stp) using 5' rapid amplification of the cDNA ends. The 1192-bp sequence contained a continuous 942-nucleotide open reading frame, encoding a 313-amino-acid polypeptide. The Tc STP polypeptide shares a high level of amino-acid sequence identity with the predicted STPs of Loa loa (89%), Brugia malayi (86%), Oesophagostomum columbianum (76%), and Oesophagostomumdentatum (76%). The Tc STP contains GDXHG, GDXVDRG, GNHE motifs, which are characteristic of members of the phosphoprotein phosphatase family. Our quantitative real-time polymerase chain reaction analysis showed that the Tc STP was expressed in six different tissues in the adult male, with high-level expression in the spermary, vas deferens, and musculature, but was not expressed in the adult female, suggesting that Tc STP might be involved in spermatogenesis and mating behavior. Thus, STP might represent a potential molecular target for controlling T. canis reproduction. Copyright © 2014 Elsevier Inc. All rights reserved.

High-resolution characterization of a hepatocellular carcinoma genome.

PubMed

Totoki, Yasushi; Tatsuno, Kenji; Yamamoto, Shogo; Arai, Yasuhito; Hosoda, Fumie; Ishikawa, Shumpei; Tsutsumi, Shuichi; Sonoda, Kohtaro; Totsuka, Hirohiko; Shirakihara, Takuya; Sakamoto, Hiromi; Wang, Linghua; Ojima, Hidenori; Shimada, Kazuaki; Kosuge, Tomoo; Okusaka, Takuji; Kato, Kazuto; Kusuda, Jun; Yoshida, Teruhiko; Aburatani, Hiroyuki; Shibata, Tatsuhiro

2011-05-01

Hepatocellular carcinoma, one of the most common virus-associated cancers, is the third most frequent cause of cancer-related death worldwide. By massively parallel sequencing of a primary hepatitis C virus-positive hepatocellular carcinoma (36× coverage) and matched lymphocytes (>28× coverage) from the same individual, we identified more than 11,000 somatic substitutions of the tumor genome that showed predominance of T>C/A>G transition and a decrease of the T>C substitution on the transcribed strand, suggesting preferential DNA repair. Gene annotation enrichment analysis of 63 validated non-synonymous substitutions revealed enrichment of phosphoproteins. We further validated 22 chromosomal rearrangements, generating four fusion transcripts that had altered transcriptional regulation (BCORL1-ELF4) or promoter activity. Whole-exome sequencing at a higher sequence depth (>76× coverage) revealed a TSC1 nonsense substitution in a subpopulation of the tumor cells. This first high-resolution characterization of a virus-associated cancer genome identified previously uncharacterized mutation patterns, intra-chromosomal rearrangements and fusion genes, as well as genetic heterogeneity within the tumor.

Trypanosoma cruzi H+-ATPase 1 (TcHA1) and 2 (TcHA2) genes complement yeast mutants defective in H+ pumps and encode plasma membrane P-type H+-ATPases with different enzymatic properties.

PubMed

Luo, Shuhong; Scott, David A; Docampo, Roberto

2002-11-15

Previous studies in Trypanosoma cruzi have shown that intracellular pH homeostasis requires ATP and is affected by H(+)-ATPase inhibitors, indicating a major role for ATP-driven proton pumps in intracellular pH control. In the present study, we report the cloning and sequencing of a pair of genes linked in tandem (TcHA1 and TcHA2) in T. cruzi which encode proteins with homology to fungal and plant P-type proton-pumping ATPases. The genes are expressed at the mRNA level in different developmental stages of T. cruzi: TcHA1 is expressed maximally in epimastigotes, whereas TcHA2 is expressed predominantly in trypomastigotes. The proteins predicted from the nucleotide sequence of the genes have 875 and 917 amino acids and molecular masses of 96.3 and 101.2 kDa, respectively. Full-length TcHA1 and an N-terminal truncated version of TcHA2 complemented a Saccharomyces cerevisiae strain deficient in P-type H(+)-ATPase activity, the proteins localized to the yeast plasma membrane, and ATP-driven proton pumping could be detected in proteoliposomes reconstituted from plasma membrane purified from transfected yeast. The reconstituted proton transport activity was reduced by inhibitors of P-type H(+)-ATPases. C-terminal truncation did not affect complementation of mutant yeast, suggesting the lack of C-terminal autoinhibitory domains in these proteins. ATPase activity in plasma membrane from TcHA1- and (N-terminal truncated) TcHA2-transfected yeast was inhibited to different extents by vanadate, whereas the latter yeast strain was more resistant to extremes of pH, suggesting that the native proteins may serve different functions at different stages in the T. cruzi life cycle.

pTC Plasmids from Sulfolobus Species in the Geothermal Area of Tengchong, China: Genomic Conservation and Naturally-Occurring Variations as a Result of Transposition by Mobile Genetic Elements

PubMed Central

Xiang, Xiaoyu; Huang, Xiaoxing; Wang, Haina; Huang, Li

2015-01-01

Plasmids occur frequently in Archaea. A novel plasmid (denoted pTC1) containing typical conjugation functions has been isolated from Sulfolobus tengchongensis RT8-4, a strain obtained from a hot spring in Tengchong, China, and characterized. The plasmid is a circular double-stranded DNA molecule of 20,417 bp. Among a total of 26 predicted pTC1 ORFs, 23 have homologues in other known Sulfolobus conjugative plasmids (CPs). pTC1 resembles other Sulfolobus CPs in genome architecture, and is most highly conserved in the genomic region encoding conjugation functions. However, attempts to demonstrate experimentally the capacity of the plasmid for conjugational transfer were unsuccessful. A survey revealed that pTC1 and its closely related plasmid variants were widespread in the geothermal area of Tengchong. Variations of the plasmids at the target sites for transposition by an insertion sequence (IS) and a miniature inverted-repeat transposable element (MITE) were readily detected. The IS was efficiently inserted into the pTC1 genome, and the inserted sequence was inactivated and degraded more frequently in an imprecise manner than in a precise manner. These results suggest that the host organism has evolved a strategy to maintain a balance between the insertion and elimination of mobile genetic elements to permit genomic plasticity while inhibiting their fast spreading. PMID:25686154

pTC Plasmids from Sulfolobus Species in the Geothermal Area of Tengchong, China: Genomic Conservation and Naturally-Occurring Variations as a Result of Transposition by Mobile Genetic Elements.

PubMed

Xiang, Xiaoyu; Huang, Xiaoxing; Wang, Haina; Huang, Li

2015-02-12

Plasmids occur frequently in Archaea. A novel plasmid (denoted pTC1) containing typical conjugation functions has been isolated from Sulfolobus tengchongensis RT8-4, a strain obtained from a hot spring in Tengchong, China, and characterized. The plasmid is a circular double-stranded DNA molecule of 20,417 bp. Among a total of 26 predicted pTC1 ORFs, 23 have homologues in other known Sulfolobus conjugative plasmids (CPs). pTC1 resembles other Sulfolobus CPs in genome architecture, and is most highly conserved in the genomic region encoding conjugation functions. However, attempts to demonstrate experimentally the capacity of the plasmid for conjugational transfer were unsuccessful. A survey revealed that pTC1 and its closely related plasmid variants were widespread in the geothermal area of Tengchong. Variations of the plasmids at the target sites for transposition by an insertion sequence (IS) and a miniature inverted-repeat transposable element (MITE) were readily detected. The IS was efficiently inserted into the pTC1 genome, and the inserted sequence was inactivated and degraded more frequently in an imprecise manner than in a precise manner. These results suggest that the host organism has evolved a strategy to maintain a balance between the insertion and elimination of mobile genetic elements to permit genomic plasticity while inhibiting their fast spreading.

Timing of Getter Material Addition in Cementitious Wasteforms

NASA Astrophysics Data System (ADS)

Lawter, A.; Qafoku, N. P.; Asmussen, M.; Neeway, J.; Smith, G. L.

2015-12-01

A cementitious waste form, Cast Stone, is being evaluated as a possible supplemental immobilization technology for the Hanford sites's low activity waste (LAW), which contains radioactive 99Tc and 129I, as part of the tank waste cleanup mission. Cast Stone is made of a dry blend 47% blast furnace slag, 45% fly ash, and 8% ordinary Portland cement, mixed with a low-activity waste (LAW). To improve the retention of Tc and/or I in Cast Stone, materials with a high affinity for Tc and/or I, termed "getters," can be added to provide a stable domain for the radionuclides of concern. Previous testing conducted with a variety of getters has identified Tin(II)-Apatite and Silver Exchanged Zeolite as promising candidates for Tc and I, respectively. Investigation into the sequence in which getters are added to Cast Stone was performed following two methods: 1) adding getters to the Cast Stone dry blend, and then mixing with liquid waste, and 2) adding getters to the liquid waste first, followed by addition of the Cast Stone dry blend. Cast Stone monolith samples were prepared with each method and leach tests, following EPA method 1315, were conducted in either distilled water or simulated vadose zone porewater for a period of up to 63 days. The leachate was analyzed for Tc, I, Na, NO3-, NO2- and Cr with ICP-MS, ICP-OES and ion chromatography and the results indicated that the Cast Stone with getter addition in the dry blend mix (method 1) has lower rates of Tc and I leaching. The mechanisms of radionuclide release from the Cast Stone were also investigated with a variety of solid phase characterization techniques of the monoliths before and after leaching, such as XRD, SEM/EDS, TEM/SAED and other spectroscopic techniques.

Genetic and biochemical findings in Chinese children with Leigh syndrome.

PubMed

Ma, Yan-Yan; Wu, Tong-Fei; Liu, Yu-Peng; Wang, Qiao; Song, Jin-Qing; Li, Xi-Yuan; Shi, Xiu-Yu; Zhang, Wei-Na; Zhao, Meng; Hu, Lin-Yan; Yang, Yan-Ling; Zou, Li-Ping

2013-11-01

This study investigated the genetic and enzymological features of Leigh syndrome due to respiratory chain complex deficiency in Chinese patients. The clinical features of 75 patients were recorded. Mitochondrial respiratory chain enzyme activities were determined via spectrophotometry. Mitochondrial gene sequence analysis was performed in 23 patients. Five core pedigrees were investigated via restriction fragment length polymorphism and gene sequencing. Psychomotor retardation (55%), motor regression (20%), weakness (29%), and epilepsy (25%) were the most frequent manifestations. Sixty-four patients (85.3%) had isolated respiratory complex deficiencies: complex I was seen in 28 patients (37.3%); complex II, seven (9.3%); complex III, six (8%); complex IV, ten (13.3%); and complex V, 13 patients (17.3%). Eleven patients (14.7%) had combined complex deficiencies. Mitochondrial DNA mutations were detected in 10 patients. Eight point mutations were found in mitochondrial structural genes: m.4833A>G in ND2, m.10191T>C in ND3, m.12338T>C and m.13513G>A in ND5, m.14502T>C and m.14487T>C in ND6, m.8108A>G in COXII, and m.8993T>G in ATPase6. Three mutations were found in tRNA genes: m.4395A>G in tRNA-Gln, m.10454T>C in tRNA-Arg, and m.5587T>C in tRNA-Ala. One patient and their mother both had the m.12338T>C and m.8993T>C mutations. In conclusion, mitochondrial respiratory chain complex I deficiency and structural gene mutations frequently occur in Chinese Leigh syndrome patients. Copyright © 2013 Elsevier Ltd. All rights reserved.

Substrate sequence selectivity of APOBEC3A implicates intra-DNA interactions.

PubMed

Silvas, Tania V; Hou, Shurong; Myint, Wazo; Nalivaika, Ellen; Somasundaran, Mohan; Kelch, Brian A; Matsuo, Hiroshi; Kurt Yilmaz, Nese; Schiffer, Celia A

2018-05-14

The APOBEC3 (A3) family of human cytidine deaminases is renowned for providing a first line of defense against many exogenous and endogenous retroviruses. However, the ability of these proteins to deaminate deoxycytidines in ssDNA makes A3s a double-edged sword. When overexpressed, A3s can mutate endogenous genomic DNA resulting in a variety of cancers. Although the sequence context for mutating DNA varies among A3s, the mechanism for substrate sequence specificity is not well understood. To characterize substrate specificity of A3A, a systematic approach was used to quantify the affinity for substrate as a function of sequence context, length, secondary structure, and solution pH. We identified the A3A ssDNA binding motif as (T/C)TC(A/G), which correlated with enzymatic activity. We also validated that A3A binds RNA in a sequence specific manner. A3A bound tighter to substrate binding motif within a hairpin loop compared to linear oligonucleotide, suggesting A3A affinity is modulated by substrate structure. Based on these findings and previously published A3A-ssDNA co-crystal structures, we propose a new model with intra-DNA interactions for the molecular mechanism underlying A3A sequence preference. Overall, the sequence and structural preferences identified for A3A leads to a new paradigm for identifying A3A's involvement in mutation of endogenous or exogenous DNA.

Hereditary Angioedema Nationwide Study in Slovenia Reveals Four Novel Mutations in SERPING1 Gene

PubMed Central

Rijavec, Matija; Korošec, Peter; Šilar, Mira; Zidarn, Mihaela; Miljković, Jovan; Košnik, Mitja

2013-01-01

Hereditary angioedema (HAE) is a rare autosomal dominant disease characterized by swelling of the face, lips, tongue, larynx, genitalia, or extremities, with abdominal pain caused by intra-abdominal edema. HAE is caused by mutations affecting the C1 inhibitor gene, SERPING1, resulting in low levels of C1 inhibitor (Type I HAE) or normal levels of ineffective C1 inhibitor (Type II HAE). A nationwide survey identified nine unrelated families with HAE in Slovenia, among whom 17 individuals from eight families were recruited for genetic analyses. A diagnosis of HAE was established in the presence of clinical and laboratory criteria (low C1 inhibitor antigenic levels and/or function), followed up by a positive family history. Genetic studies were carried out using PCR and sequencing to detect SERPING1 mutations in promoter, noncoding exon 1, the 7 coding exons, and exon-intron boundaries. Multiplex ligation-dependent probe amplification was performed in order to search for large deletions/duplications in SERPING1 gene. A mutation responsible for HAE was identified in patients from seven families with the disease. In HAE type I families, one previously reported substitution (Gln67Stop, c.265C>T) and four novel mutations were identified. The new mutations included two missense substitutions, Ser128Phe (c.449C>T), and Glu429Lys (c.1351G>A), together with two frameshift mutations, indel (c.49delGinsTT) and deletion (c.593_594delCT). Both families with HAE type II harbored the two well-known substitutions affecting the arginyl residue at the reactive center in exon 8, Arg444Cys (c.1396C>T) and Arg444His (c.1397G>A), respectively. In one patient only the homozygous variant g.566T>C (c.-21T>C) was identified. Our study identified four novel mutations in the Slovenian HAE population, highlighting the heterogeneity of mutations in the SERPING1 gene causing C1 inhibitor deficiency and HAE. In a single patient with HAE a homozygous variant g.566T>C (c.-21T>C) might be responsible for the disease. PMID:23437219

Hereditary angioedema nationwide study in Slovenia reveals four novel mutations in SERPING1 gene.

PubMed

Rijavec, Matija; Korošec, Peter; Šilar, Mira; Zidarn, Mihaela; Miljković, Jovan; Košnik, Mitja

2013-01-01

Hereditary angioedema (HAE) is a rare autosomal dominant disease characterized by swelling of the face, lips, tongue, larynx, genitalia, or extremities, with abdominal pain caused by intra-abdominal edema. HAE is caused by mutations affecting the C1 inhibitor gene, SERPING1, resulting in low levels of C1 inhibitor (Type I HAE) or normal levels of ineffective C1 inhibitor (Type II HAE). A nationwide survey identified nine unrelated families with HAE in Slovenia, among whom 17 individuals from eight families were recruited for genetic analyses. A diagnosis of HAE was established in the presence of clinical and laboratory criteria (low C1 inhibitor antigenic levels and/or function), followed up by a positive family history. Genetic studies were carried out using PCR and sequencing to detect SERPING1 mutations in promoter, noncoding exon 1, the 7 coding exons, and exon-intron boundaries. Multiplex ligation-dependent probe amplification was performed in order to search for large deletions/duplications in SERPING1 gene. A mutation responsible for HAE was identified in patients from seven families with the disease. In HAE type I families, one previously reported substitution (Gln67Stop, c.265C>T) and four novel mutations were identified. The new mutations included two missense substitutions, Ser128Phe (c.449C>T), and Glu429Lys (c.1351G>A), together with two frameshift mutations, indel (c.49delGinsTT) and deletion (c.593_594delCT). Both families with HAE type II harbored the two well-known substitutions affecting the arginyl residue at the reactive center in exon 8, Arg444Cys (c.1396C>T) and Arg444His (c.1397G>A), respectively. In one patient only the homozygous variant g.566T>C (c.-21T>C) was identified. Our study identified four novel mutations in the Slovenian HAE population, highlighting the heterogeneity of mutations in the SERPING1 gene causing C1 inhibitor deficiency and HAE. In a single patient with HAE a homozygous variant g.566T>C (c.-21T>C) might be responsible for the disease.

Proteome analysis of the cardiac and pericardial tissue of Biomphalaria tenagophila populations susceptible and resistant to Schistosoma mansoni infection.

PubMed

Jannotti-Passos, Liana K; Andrade, Hélida M; Caldeira, Roberta L; Romanha, Alvaro J; Murta, Silvane M F; Chapeaurouge, Donat A; Perales, Jonas; Coelho, Paulo Marcos Z; Carvalho, Omar S

2008-03-01

For a better comprehension of the parasite-host interaction, proteins expressed by the cardiac and pericardial tissues were compared between susceptible (Cabo Frio) and resistant (Taim) Biomphalaria tenagophila populations, challenged (c) and non-challenged (nc) with Schistosoma mansoni. Proteins were separated by two-dimensional gel electrophoresis (2DE) and stained with Coomassie blue. A total of 146 and 135 spots were observed in Cabo Frio (CFnc) and in Taim (Tnc) non-challenged populations, respectively, whereas 153 spots were detected in both Cabo Frio (CFc) and Taim (Tc) challenged populations. Regarding comparisons between CFnc and CFc, the numbers of exclusive spots obtained were one and nine, respectively, whereas Tnc yielded 17 and Tc eight exclusive spots. By comparing the total of spots in CF (nc+c) with T (nc+c) populations, we obtained: four exclusive spots for CFc; zero for CFnc; four for Tc and; one for Tnc. A quantitative comparison (reason>2.5) of the total spots of CF (nc+c) with T (nc+c) populations allowed us to distinguish five more intense spots for Tc, 14 for Tnc, 15 for CFnc and 11 for CFc. In the CFnc population, two proteins were identified: actin and ATP synthase alpha chain; in the CFc population, four proteins: actin, calmodulin, HSP70, and dehydrogenase; in the Tnc population, five proteins: matrilin, HSP70, actin, ATP synthase alpha chain and intermediate filament of the protein; and in the Tc population, three proteins: actin, alpha-S1 casein and ATP synthase alpha chain. Out of a total of 79 spots, only nine proteins were identified due to the low number of available nucleotide sequences in the GenBank. Nevertheless, knowing proteins regarded as differentially expressed is indispensable for hitherto unidentified genes implicated in B. tenagophila resistance and or susceptibility to S. mansoni infection.

Deep Sequencing of the Trypanosoma cruzi GP63 Surface Proteases Reveals Diversity and Diversifying Selection among Chronic and Congenital Chagas Disease Patients

PubMed Central

Llewellyn, Martin S.; Messenger, Louisa A.; Luquetti, Alejandro O.; Garcia, Lineth; Torrico, Faustino; Tavares, Suelene B. N.; Cheaib, Bachar; Derome, Nicolas; Delepine, Marc; Baulard, Céline; Deleuze, Jean-Francois; Sauer, Sascha; Miles, Michael A.

2015-01-01

Background Chagas disease results from infection with the diploid protozoan parasite Trypanosoma cruzi. T. cruzi is highly genetically diverse, and multiclonal infections in individual hosts are common, but little studied. In this study, we explore T. cruzi infection multiclonality in the context of age, sex and clinical profile among a cohort of chronic patients, as well as paired congenital cases from Cochabamba, Bolivia and Goias, Brazil using amplicon deep sequencing technology. Methodology/ Principal Findings A 450bp fragment of the trypomastigote TcGP63I surface protease gene was amplified and sequenced across 70 chronic and 22 congenital cases on the Illumina MiSeq platform. In addition, a second, mitochondrial target—ND5—was sequenced across the same cohort of cases. Several million reads were generated, and sequencing read depths were normalized within patient cohorts (Goias chronic, n = 43, Goias congenital n = 2, Bolivia chronic, n = 27; Bolivia congenital, n = 20), Among chronic cases, analyses of variance indicated no clear correlation between intra-host sequence diversity and age, sex or symptoms, while principal coordinate analyses showed no clustering by symptoms between patients. Between congenital pairs, we found evidence for the transmission of multiple sequence types from mother to infant, as well as widespread instances of novel genotypes in infants. Finally, non-synonymous to synonymous (dn:ds) nucleotide substitution ratios among sequences of TcGP63Ia and TcGP63Ib subfamilies within each cohort provided powerful evidence of strong diversifying selection at this locus. Conclusions/Significance Our results shed light on the diversity of parasite DTUs within each patient, as well as the extent to which parasite strains pass between mother and foetus in congenital cases. Although we were unable to find any evidence that parasite diversity accumulates with age in our study cohorts, putative diversifying selection within members of the TcGP63I gene family suggests a link between genetic diversity within this gene family and survival in the mammalian host. PMID:25849488

Initial direct comparison of 99mTc-TOC and 99mTc-TATE in identifying sites of disease in patients with proven GEP NETs.

PubMed

Cwikla, Jaroslaw B; Mikolajczak, Renata; Pawlak, Dariusz; Buscombe, John R; Nasierowska-Guttmejer, Anna; Bator, Andrzej; Maecke, Helmut R; Walecki, Jerzy

2008-07-01

The imaging of neuroendocrine tumors has become one of the most significant areas in nuclear oncology. In an attempt to provide high-quality imaging and possible sensitivity at a reduced cost, time, and radiation dose, several (99m)Tc agents have been proposed. The aim of this initial study was to compare the tumor uptake and biodistribution of 2 new 6-hydrazinopyridine-3-carboxylic acid (HYNIC)-derivatized Tyr(3)-octreotide analogs, (99m)Tc-[HYNIC,Tyr(3)]octreotide ((99m)Tc-TOC) and (99m)Tc-[HYNIC,Tyr(3),Thr(8)]octreotide ((99m)Tc-TATE), in patients with somatostatin receptor-expressing tumors. Each of 12 patients with proven gastrointestinal pancreatic neuroendocrine tumors received a mean activity of 520 MBq of (99m)Tc-TOC and (99m)Tc-TATE. Scintigraphy with both tracers was performed 3-4 h after their injection using standard whole-body and SPECT imaging. The images were reviewed subjectively by 2 readers, who reported tumor uptake lesion by lesion. Both radiotracers demonstrated concordance between the results in 7 patients (58%). In total, 110 sites of disease were identified with (99m)Tc-TOC, compared with 115 with (99m)Tc-TATE. There was 1 case in which (99m)Tc-TOC identified sites of disease not seen on (99m)Tc-TATE imaging but 4 cases in which some sites of disease were seen with (99m)Tc-TATE and not (99m)Tc-TOC. In this initial study, both tracers seem to show similar sites of tumor, with (99m)Tc-TATE having a slight edge in the total number of lesions seen, especially in lymph node metastases.

The multiple and complex and changeable scenarios of the Trypanosoma cruzi transmission cycle in the sylvatic environment.

PubMed

Jansen, Ana Maria; Xavier, Samanta C C; Roque, André Luiz R

2015-11-01

In this study, we report and discuss the results generated from over 20 years of studies of the Trypanosoma cruzi sylvatic transmission cycle. Our results have uncovered new aspects and reviewed old concepts on issues including reservoirs, true generalist species, association of mammalian species with distinct discrete typing units - DTUs, distribution of T. cruzi genotypes in the wild, mixed infections, and T. cruzi transmission ecology. Using parasitological and serological tests, we examined T. cruzi infection in 7,285 mammalian specimens from nine mammalian orders dispersed all over the Brazilian biomes. The obtained T. cruzi isolates were characterized by mini-exon gene sequence polymorphism and PCR RFLP to identify DTUs. Infection by T. cruzi was detected by serological methods in 20% of the examined animals and isolated from 41% of those infected, corresponding to 8% of all the examined mammals. Each mammal taxon responded uniquely to T. cruzi infection. Didelphis spp. are able to maintain high and long-lasting parasitemias (positive hemocultures) caused by TcI but maintain and rapidly control parasitemias caused by TcII to almost undetectable levels. In contrast, the tamarin species Leontopithecus rosalia and L. chrysomelas maintain long-lasting and high parasitemias caused by TcII similarly to Philander sp. The coati Nasua nasua maintains high parasitemias by both parental T. cruzi DTUs TcI or TcII and by TcII/TcIV (formerly Z3) at detectable levels. Wild and domestic canidae seem to display only a short period of reservoir competence. T. cruzi infection was demonstrated in the wild canid species Cerdocyon thous and Chrysocyon brachyurus, and positive hemoculture was obtained in one hyper carnivore species (Leopardus pardalis), demonstrating that T. cruzi transmission is deeply immersed in the trophic net. T. cruzi DTU distribution in nature did not exhibit any association with a particular biome or habitat. TcI predominates throughout (58% of the T. cruzi isolates); however, in spite of being significantly less frequent (17%), TcII is also widely distributed. Concomitant DTU infection occurred in 16% of infected mammals of all biomes and included arboreal and terrestrial species, as well as bats. TcI/TcII concomitant infection was the most common and widely dispersed, with mixed TcI/TcII infections especially common in coatis and in Didelphimorphia. The second most common pattern of concomitant infection was TcI/TcIV, observed in Chiroptera, Didelphimorphia and Primates. Taken together, our results demonstrate the complexity of T. cruzi reservoir system and its transmission strategies, indicating that there is considerably more to be learned regarding ecology of T. cruzi. Copyright © 2015 Elsevier B.V. All rights reserved.

Kinetics, subcellular localization, and contribution to parasite virulence of a Trypanosoma cruzi hybrid type A heme peroxidase (TcAPx-CcP)

PubMed Central

Hugo, Martín; Martínez, Alejandra; Trujillo, Madia; Estrada, Damián; Mastrogiovanni, Mauricio; Linares, Edlaine; Augusto, Ohara; Issoglio, Federico; Zeida, Ari; Estrín, Darío A.; Heijnen, Harry F. G.; Piacenza, Lucía; Radi, Rafael

2017-01-01

The Trypanosoma cruzi ascorbate peroxidase is, by sequence analysis, a hybrid type A member of class I heme peroxidases [TcAPx-cytochrome c peroxidase (CcP)], suggesting both ascorbate (Asc) and cytochrome c (Cc) peroxidase activity. Here, we show that the enzyme reacts fast with H2O2 (k = 2.9 × 107 M−1⋅s−1) and catalytically decomposes H2O2 using Cc as the reducing substrate with higher efficiency than Asc (kcat/Km = 2.1 × 105 versus 3.5 × 104 M−1⋅s−1, respectively). Visible-absorption spectra of purified recombinant TcAPx-CcP after H2O2 reaction denote the formation of a compound I-like product, characteristic of the generation of a tryptophanyl radical-cation (Trp233•+). Mutation of Trp233 to phenylalanine (W233F) completely abolishes the Cc-dependent peroxidase activity. In addition to Trp233•+, a Cys222-derived radical was identified by electron paramagnetic resonance spin trapping, immunospin trapping, and MS analysis after equimolar H2O2 addition, supporting an alternative electron transfer (ET) pathway from the heme. Molecular dynamics studies revealed that ET between Trp233 and Cys222 is possible and likely to participate in the catalytic cycle. Recognizing the ability of TcAPx-CcP to use alternative reducing substrates, we searched for its subcellular localization in the infective parasite stages (intracellular amastigotes and extracellular trypomastigotes). TcAPx-CcP was found closely associated with mitochondrial membranes and, most interestingly, with the outer leaflet of the plasma membrane, suggesting a role at the host–parasite interface. TcAPx-CcP overexpressers were significantly more infective to macrophages and cardiomyocytes, as well as in the mouse model of Chagas disease, supporting the involvement of TcAPx-CcP in pathogen virulence as part of the parasite antioxidant armamentarium. PMID:28179568

Investigation of the association of two candidate genes (H-FABP and PSMC1) with growth and carcass traits in Qinchuan beef cattle from China.

PubMed

Liang, W; Zhang, H L; Liu, Y; Lu, B C; Liu, X; Li, Q; Cao, Y

2014-03-17

Growth and carcass traits are economically important quality characteristics of beef cattle and are complex quantitative traits that are controlled by multiple genes. In this study, 2 candidate genes, H-FABP (encoding the heart fatty acid-binding protein) and PSMC1 (encoding the proteasome 26S subunit of ATPase 1) were investigated in Qinchuan beef cattle of China. PCR-SSCP and DNA sequencing methods were used to detect mutations in the H-FABP and PSMC1 genes in Qinchuan cattle, and a T>C mutation in exon 1 of H-FABP and a T>C mutation in exon 9 of PSMC1 were identified. The association of these 2 single nucleotide polymorphisms with growth and carcass traits of Qinchuan cattle was analyzed. The T>C mutation in H-FABP was significantly associated with body length and dressing percentage (P < 0.05) and the T>C mutation in PSMC1 with body length and hip width (P < 0.05), indicating that both of the 2 mutations in H-FABP and PSMC1 had effects on growth and carcass traits in the Qinchuan beef cattle breed. Thus, the results of our study suggest that the H-FABP and PSMC1 gene polymorphisms could be used as genetic markers in marker-assisted selection for improving Qinchuan beef cattle.

The mitochondrial C16069T polymorphism, not mitochondrial D310 (D-loop) mononucleotide sequence variations, is associated with bladder cancer.

PubMed

Shakhssalim, Nasser; Houshmand, Massoud; Kamalidehghan, Behnam; Faraji, Abolfazl; Sarhangnejad, Reza; Dadgar, Sepideh; Mobaraki, Maryam; Rosli, Rozita; Sanati, Mohammad Hossein

2013-12-05

Bladder cancer is a relatively common and potentially life-threatening neoplasm that ranks ninth in terms of worldwide cancer incidence. The aim of this study was to determine deletions and sequence variations in the mitochondrial displacement loop (D-loop) region from the blood specimens and tumoral tissues of patients with bladder cancer, compared to adjacent non-tumoral tissues. The DNA from blood, tumoral tissues and adjacent non-tumoral tissues of twenty-six patients with bladder cancer and DNA from blood of 504 healthy controls from different ethnicities were investigated to determine sequence variation in the mitochondrial D-loop region using multiplex polymerase chain reaction (PCR), DNA sequencing and southern blotting analysis. From a total of 110 variations, 48 were reported as new mutations. No deletions were detected in tumoral tissues, adjacent non-tumoral tissues and blood samples from patients. Although the polymorphisms at loci 16189, 16261 and 16311 were not significantly correlated with bladder cancer, the C16069T variation was significantly present in patient samples compared to control samples (p < 0.05). Interestingly, there was no significant difference (p > 0.05) of C variations, including C7TC6, C8TC6, C9TC6 and C10TC6, in D310 mitochondrial DNA between patients and control samples. Our study suggests that 16069 mitochondrial DNA D-Loop mutations may play a significant role in the etiology of bladder cancer and facilitate the definition of carcinogenesis-related mutations in human cancer.

Cloning and characterization of a DNA polymerase beta gene from Trypanosoma cruzi.

PubMed

Venegas, Juan A; Aslund, Lena; Solari, Aldo

2009-06-01

A gene coding for a DNA polymerase beta from the Trypanosoma cruzi Miranda clone, belonging to the TcI lineage, was cloned (Miranda Tcpol beta), using the information from eight peptides of the T. cruzi beta-like DNA polymerase purified previously. The gene encodes for a protein of 403 amino acids which is very similar to the two T. cruzi CL Brener (TcIIe lineage) sequences published, but has three different residues in highly conserved segments. At the amino acid level, the identity of TcI-pol beta with mitochondrial pol beta and pol beta-PAK from other trypanosomatids was between 68-80% and 22-30%, respectively. Miranda Tc-pol beta protein has an N-terminal sequence similar to that described in the mitochondrial Crithidia fasciculata pol beta, which suggests that the TcI-pol beta plays a role in the organelle. Northern and Western analyses showed that this T. cruzi gene is highly expressed both in proliferative and non-proliferative developmental forms. These results suggest that, in addition to replication of kDNA in proliferative cells, this enzyme may have another function in non-proliferative cells, such as DNA repair role similar to that which has extensively been described in a vast spectrum of eukaryotic cells.

Identification of a functional enhancer variant within the chronic pancreatitis-associated SPINK1 c.101A>G (p.Asn34Ser)-containing haplotype.

PubMed

Boulling, Arnaud; Masson, Emmanuelle; Zou, Wen-Bin; Paliwal, Sumit; Wu, Hao; Issarapu, Prachand; Bhaskar, Seema; Génin, Emmanuelle; Cooper, David N; Li, Zhao-Shen; Chandak, Giriraj R; Liao, Zhuan; Chen, Jian-Min; Férec, Claude

2017-08-01

The haplotype harboring the SPINK1 c.101A>G (p.Asn34Ser) variant (also known as rs17107315:T>C) represents the most important heritable risk factor for idiopathic chronic pancreatitis identified to date. The causal variant contained within this risk haplotype has however remained stubbornly elusive. Herein, we set out to resolve this enigma by employing a hypothesis-driven approach. First, we searched for variants in strong linkage disequilibrium (LD) with rs17107315:T>C using HaploReg v4.1. Second, we identified two candidate SNPs by visual inspection of sequences spanning all 25 SNPs found to be in LD with rs17107315:T>C, guided by prior knowledge of pancreas-specific transcription factors and their cognate binding sites. Third, employing a novel cis-regulatory module (CRM)-guided approach to further filter the two candidate SNPs yielded a solitary candidate causal variant. Finally, combining data from phylogenetic conservation and chromatin accessibility, cotransfection transactivation experiments, and population genetic studies, we suggest that rs142703147:C>A, which disrupts a PTF1L-binding site within an evolutionarily conserved HNF1A-PTF1L CRM located ∼4 kb upstream of the SPINK1 promoter, contributes to the aforementioned chronic pancreatitis risk haplotype. Further studies are required not only to improve the characterization of this functional SNP but also to identify other functional components that might contribute to this high-risk haplotype. © 2017 Wiley Periodicals, Inc.

Functional analysis of the theobroma cacao NPR1 gene in arabidopsis

PubMed Central

2010-01-01

Background The Arabidopsis thaliana NPR1 gene encodes a transcription coactivator (NPR1) that plays a major role in the mechanisms regulating plant defense response. After pathogen infection and in response to salicylic acid (SA) accumulation, NPR1 translocates from the cytoplasm into the nucleus where it interacts with other transcription factors resulting in increased expression of over 2000 plant defense genes contributing to a pathogen resistance response. Results A putative Theobroma cacao NPR1 cDNA was isolated by RT-PCR using degenerate primers based on homologous sequences from Brassica, Arabidopsis and Carica papaya. The cDNA was used to isolate a genomic clone from Theobroma cacao containing a putative TcNPR1 gene. DNA sequencing revealed the presence of a 4.5 kb coding region containing three introns and encoding a polypeptide of 591 amino acids. The predicted TcNPR1 protein shares 55% identity and 78% similarity to Arabidopsis NPR1, and contains each of the highly conserved functional domains indicative of this class of transcription factors (BTB/POZ and ankyrin repeat protein-protein interaction domains and a nuclear localization sequence (NLS)). To functionally define the TcNPR1 gene, we transferred TcNPR1 into an Arabidopsis npr1 mutant that is highly susceptible to infection by the plant pathogen Pseudomonas syringae pv. tomato DC3000. Driven by the constitutive CaMV35S promoter, the cacao TcNPR1 gene partially complemented the npr1 mutation in transgenic Arabidopsis plants, resulting in 100 fold less bacterial growth in a leaf infection assay. Upon induction with SA, TcNPR1 was shown to translocate into the nucleus of leaf and root cells in a manner identical to Arabidopsis NPR1. Cacao NPR1 was also capable of participating in SA-JA signaling crosstalk, as evidenced by the suppression of JA responsive gene expression in TcNPR1 overexpressing transgenic plants. Conclusion Our data indicate that the TcNPR1 is a functional ortholog of Arabidopsis NPR1, and is likely to play a major role in defense response in cacao. This fundamental knowledge can contribute to breeding of disease resistant cacao varieties through the application of molecular markers or the use of transgenic strategies. PMID:21078185

Functional analysis of the Theobroma cacao NPR1 gene in Arabidopsis.

PubMed

Shi, Zi; Maximova, Siela N; Liu, Yi; Verica, Joseph; Guiltinan, Mark J

2010-11-15

The Arabidopsis thaliana NPR1 gene encodes a transcription coactivator (NPR1) that plays a major role in the mechanisms regulating plant defense response. After pathogen infection and in response to salicylic acid (SA) accumulation, NPR1 translocates from the cytoplasm into the nucleus where it interacts with other transcription factors resulting in increased expression of over 2000 plant defense genes contributing to a pathogen resistance response. A putative Theobroma cacao NPR1 cDNA was isolated by RT-PCR using degenerate primers based on homologous sequences from Brassica, Arabidopsis and Carica papaya. The cDNA was used to isolate a genomic clone from Theobroma cacao containing a putative TcNPR1 gene. DNA sequencing revealed the presence of a 4.5 kb coding region containing three introns and encoding a polypeptide of 591 amino acids. The predicted TcNPR1 protein shares 55% identity and 78% similarity to Arabidopsis NPR1, and contains each of the highly conserved functional domains indicative of this class of transcription factors (BTB/POZ and ankyrin repeat protein-protein interaction domains and a nuclear localization sequence (NLS)). To functionally define the TcNPR1 gene, we transferred TcNPR1 into an Arabidopsis npr1 mutant that is highly susceptible to infection by the plant pathogen Pseudomonas syringae pv. tomato DC3000. Driven by the constitutive CaMV35S promoter, the cacao TcNPR1 gene partially complemented the npr1 mutation in transgenic Arabidopsis plants, resulting in 100 fold less bacterial growth in a leaf infection assay. Upon induction with SA, TcNPR1 was shown to translocate into the nucleus of leaf and root cells in a manner identical to Arabidopsis NPR1. Cacao NPR1 was also capable of participating in SA-JA signaling crosstalk, as evidenced by the suppression of JA responsive gene expression in TcNPR1 overexpressing transgenic plants. Our data indicate that the TcNPR1 is a functional ortholog of Arabidopsis NPR1, and is likely to play a major role in defense response in cacao. This fundamental knowledge can contribute to breeding of disease resistant cacao varieties through the application of molecular markers or the use of transgenic strategies.

Systematic screening for mutations in the 5{prime}-regulatory region of the human dopamine D{sub 1} receptor (DRD1) gene in patients with schizophrenia and bipolar affective disorder

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cichon, S.; Noethen, M.M.; Stoeber, G.

1996-07-26

A possible dysregulation of dopaminergic neurotransmission has been implicated in a variety of neuropsychiatric diseases. In the present study we systematically searched for the presence of mutations in the 5{prime}-flanking region of the dopamine D{sub 1} receptor (DRD1) gene. This region has previously been shown to contain a functional promoter. We investigated 119 unrelated individuals (including 36 schizophrenic patients, 38 bipolar affective patients, and 45 healthy controls) using single-strand conformation analysis (SSCA). Eleven overlapping PCR fragments covered 2,189 bp of DNA sequence. We identified six single base substitutions: -2218T/C, -2102C/A, -2030T/C, -1992G/A, -1251G/C, and -800T/C. None of the mutations wasmore » found to be located in regions which have important influence on the level of transcriptional activity. Allele frequencies were similar in patients and controls, indicating that genetic variation in the 5{prime}-regulatory region of the DRD1 gene is unlikely to play a frequent, major role in the genetic predisposition to either schizophrenia or bipolar affective disorder. 31 refs., 3 tabs.« less

Identification of novel mammalian hosts and Brazilian biome geographic distribution of Trypanosoma cruzi TcIII and TcIV.

PubMed

Barros, Juliana Helena S; Xavier, Samanta Cristina C; Bilac, Daniele; Lima, Valdirene Santos; Dario, Maria Augusta; Jansen, Ana Maria

2017-08-01

Trypanosoma cruzi is a parasitic protozoan responsible for Chagas disease. Seven different Discrete Typing Units (DTUs) of T. cruzi are currently identified in nature: TcI-TcVI, and TcBat whose distribution patterns in nature, hosts/reservoirs and eco-epidemiological importance are still little known. Here, we present novel data on the geographic distribution and diversity of mammalian hosts and vectors of T. cruzi DTUs TcIII and TcIV. In this study, we analyzed 61 T. cruzi isolates obtained from 18 species of mammals (five orders) and two Hemiptera genera. Samples were collected from five Brazilian biomes (Pantanal, Caatinga, Cerrado, Atlantic Rainforest, and Amazon) previously characterized as Z3 or mixed infection (TcI-Z3) by mini-exon gene PCR. To identify TcIII and TcIV genotypes, we applied restriction fragment length polymorphism analysis to the PCR-amplified histone 3 gene. DTUs TcIII and TcIV were identified in single and mixed infections from wide dispersion throughout five Brazilian biomes studied, with TcIV being the most common. Pantanal was the biome that displayed the largest number of samples characterized as TcIII and TcIV in single and mixed infections, followed by Atlantic Rainforest and Amazon. Species from the Didelphimorphia order displayed the highest frequency of infection and were found in all five biomes. We report, for the first time, the infection of a species of the Artiodactyla order by DTU TcIII. In addition, we describe new host species: five mammals (marsupials and rodents) and two genera of Hemiptera. Our data indicate that DTUs TcIII and TcIV are more widespread and infect a larger number of mammalian species than previously thought. In addition, they are transmitted in restricted foci and cycles, but in different microhabitats and areas with distinct ecological profiles. Finally, we show that DTUs TcIII and TcIV do not present any specific association with biomes or host species. Copyright © 2017. Published by Elsevier B.V.

A variant in the sonic hedgehog regulatory sequence (ZRS) is associated with triphalangeal thumb and deregulates expression in the developing limb

PubMed Central

Furniss, Dominic; Lettice, Laura A.; Taylor, Indira B.; Critchley, Paul S.; Giele, Henk; Hill, Robert E.; Wilkie, Andrew O.M.

2008-01-01

A locus for triphalangeal thumb, variably associated with pre-axial polydactyly, was previously identified in the zone of polarizing activity regulatory sequence (ZRS), a long range limb-specific enhancer of the Sonic Hedgehog (SHH) gene at human chromosome 7q36.3. Here, we demonstrate that a 295T>C variant in the human ZRS, previously thought to represent a neutral polymorphism, acts as a dominant allele with reduced penetrance. We found this variant in three independently ascertained probands from southern England with triphalangeal thumb, demonstrated significant linkage of the phenotype to the variant (LOD = 4.1), and identified a shared microsatellite haplotype around the ZRS, suggesting that the probands share a common ancestor. An individual homozygous for the 295C allele presented with isolated bilateral triphalangeal thumb resembling the heterozygous phenotype, suggesting that the variant is largely dominant to the wild-type allele. As a functional test of the pathogenicity of the 295C allele, we utilized a mutated ZRS construct to demonstrate that it can drive ectopic anterior expression of a reporter gene in the developing mouse forelimb. We conclude that the 295T>C variant is in fact pathogenic and, in southern England, appears to be the most common cause of triphalangeal thumb. Depending on the dispersal of the founding mutation, it may play a wider role in the aetiology of this disorder. PMID:18463159

Tissue expression pattern of ABCG transporter indicates functional roles in reproduction of Toxocara canis.

PubMed

Luo, Yong-Li; Ma, Guang-Xu; Luo, Yong-Fang; Kuang, Ce-Yan; Jiang, Ai-Yun; Li, Guo-Qing; Zhou, Rong-Qiong

2018-03-01

Toxocara canis is a zoonotic parasite with worldwide distribution. ATP-binding cassette (ABC) transporters are integral membrane proteins which involve in a range of biological processes in various organisms. In present study, the full-length coding sequence of abcg-5 gene of T. canis (Tc-abcg-5) was cloned and characterized. A 633 aa polypeptide containing two conserved Walker A and Walker B motifs was predicted from a continuous 1902 nt open reading frame. Quantitative real-time PCR was employed to determine the transcriptional levels of Tc-abcg-5 gene in adult male and female worms, which indicated high mRNA level of Tc-abcg-5 in the reproductive tract of adult female T. canis. Tc-abcg-5 was expressed to produce rabbit polyclonal antiserum against recombinant TcABCG5. Indirect-fluorescence immunohistochemical assays were carried out to detect the tissue distribution of TcABCG5, which showed predominant distribution of TcABCG5 in the uterus (especially in the germ cells) of adult female T. canis. Tissue transcription and expression pattern of Tc-abcg-5 indicated that Tc-abcg-5 might play essential roles in the reproduction of this parasitic nematode.

Effect of polymorphisms in the CSN3 (κ-casein) gene on milk production traits in Chinese Holstein Cattle.

PubMed

Alim, M A; Dong, T; Xie, Y; Wu, X P; Zhang, Yi; Zhang, Shengli; Sun, D X

2014-11-01

This study was designed to evaluate significant associations between single nucleotide polymorphisms (SNPs) and milk composition and milk production traits in Chinese Holstein cows. Six SNPs were identified in the κ-casein gene using pooled DNA sequencing. The identified SNPs were genotyped by Matrix-assisted laser desorption/ionization time of flight mass spectrometry (MALDI-TOF MS) methods from 507 individuals. Out of six, we identified three non-synonymous SNPs (g.10888T>C, g.10924C>A and g.10944A>G) that changed in the protein product. SIFT (Sorting_Intolerant_From_Tolerant) prediction score (0.01) demonstrated that protein changed Isoleucine > Threonine (g.10888T>C) will affect the phenotypes. Significant associations between identified SNPs and three yield traits (milk, protein and fat) and two composition traits (fat and protein percentages) were found whereas it did not reach significance for fat percentage in haplotypes association. Importantly, the significant SNPs in our results showed a large proportion of the phenotypic variation of milk protein yield and concentration. Our results suggest that CSN3 is an important candidate gene that influences milk production traits, and identified polymorphisms and haplotypes could be used as a genetic marker in programs of marker-assisted selection for the genetic improvement of milk production traits in dairy cattle.

Direct molecular identification of Trypanosoma cruzi discrete typing units in domestic and peridomestic Triatoma infestans and Triatoma sordida from the Argentine Chaco.

PubMed

Maffey, L; Cardinal, M V; Ordóñez-Krasnowski, P C; Lanati, L A; Lauricella, M A; Schijman, A G; Gürtler, R E

2012-10-01

We assessed the distribution of Trypanosoma cruzi Discrete Typing Units (DTUs) in domestic and peridomestic Triatoma infestans and Triatoma sordida specimens collected in a well-defined rural area in Pampa del Indio, northeastern Argentina. Microscopically-positive bugs were randomly selected with a multi-level sampling design, and DTUs were identified using direct PCR strategies. TcVI predominated in 61% of 69 T. infestans and in 56% of 9 T. sordida. TcV was the secondary DTU in T. infestans (16%) and was found in 1 T. sordida specimen (11%). Three T. sordida (33%) were found infected with TcI, a DTU also identified in local Didelphis albiventris opossums. Mixed DTU infections occurred rarely (5%) and were detected both directly from the bugs' rectal ampoule and parasite cultures. The identified DTUs and bug collection sites of T. infestans were significantly associated. Bugs infected with TcV were almost exclusively captured in domiciles whereas those with TcVI were found similarly in domiciles and peridomiciles. All mixed infections occurred in domiciles. TcV-infected bugs fed more often on humans than on dogs, whereas TcVI-infected bugs showed the reverse pattern. T. sordida is a probable sylvatic vector of TcI linked to D. albiventris, and could represent a secondary vector of TcVI and TcV in the domestic/peridomestic cycle.

Direct molecular identification of Trypanosoma cruzi Discrete Typing Units in domestic and peridomestic Triatoma infestans and Triatoma sordida from the Argentine Chaco

PubMed Central

MAFFEY, L.; CARDINAL, M.V.; ORDÓÑEZ-KRASNOWSKI, P.C.; LANATI, L.A.; LAURICELLA, M.A.; SCHIJMAN, A.G.; GÜRTLER, R.E.

2013-01-01

SUMMARY We assessed the distribution of Trypanosoma cruzi Discrete Typing Units (DTUs) in domestic and peridomestic Triatoma infestans and Triatoma sordida specimens collected in a well-defined rural area in Pampa del Indio, northeastern Argentina. Microscopically-positive bugs were randomly selected with a multi-level sampling design, and DTUs were identified using direct PCR strategies. TcVI predominated in 61% of 69 T. infestans and in 56% of 9 T. sordida. TcV was the secondary DTU in T. infestans (16%) and was found in one T. sordida specimen (11%). Three T. sordida (33%) were found infected with TcI, a DTU also identified in local Didelphis albiventris opossums. Mixed DTU infections occurred rarely (5%) and were detected both directly from the bugs’ rectal ampoule and parasite cultures. The identified DTUs and bug collection sites of T. infestans were significantly associated. Bugs infected with TcV were almost exclusively captured in domiciles whereas those with TcVI were found similarly in domiciles and peridomiciles. All mixed infections occurred in domiciles. TcV-infected bugs fed more often on humans than on dogs, whereas TcVI-infected bugs showed the reverse pattern. T. sordida is a probable sylvatic vector of TcI linked to D. albiventris, and could represent a secondary vector of TcVI and TcV in the domestic/peridomestic cycle. PMID:23036510

Horizontal Transfer of Tetracycline Resistance Genes in the Subsurface of a Poultry Farm

NASA Astrophysics Data System (ADS)

You, Y.; Ward, M.; Hilpert, M.

2008-12-01

Concentrated animal feeding operations (CAFOs) are considered to be important man-made reservoirs of antibiotic resistant bacteria and antibiotic resistance genes. At a poultry farm, we, together with Mr.~James Doolittle from USDA, measured the apparent subsurface electrical conductivity (ECa) using a EM38 meter. The resulting ECaR) associated with the poultry farm due to the fact that tetracycline (Tc) is one of the most frequently used antibiotics in food animal production and therefore is probably used at this farm. Soil and aquifer samples were taken from the farm. TcR bacteria were detected, with higher concentrations in the top layer of soil than in the aquifer. TcR bacteria were then enriched from a soil sample, and two classes of TcR genes were detected: tet(M) genes encoding ribosomal protection proteins and tet(L) genes encoding tet efflux pumps. Sequences of the PCR products were compared to known tet(M) and tet(L) genes in GenBank using BLASTN. Phylogenetic trees were also built based on the sequence information. The tet(M) genes found in our soil sample were highly similar to those located on transposons. In a soil microcosm experiment, we used the aforementioned soil sample as incubation medium as well as genetic donor (TcR soil bacteria), and a green fluorescent strain of E. coli as a model genetic recipient to study horizontal transfer of TcR genes from soil bacteria to naïve bacteria. Concentrations of inoculated E. coli were continuously monitored for 15 days, TcR E. coli isolated, and colony PCR performed. The tet(M) genes were found to be transferred to naïve E. coli. The highest horizontal transfer ratio, 0.62 transconjugant per recipient, was observed when Tc was supplemented to a soil microcosm at a concentration of 140 μg/kg soil. Modeling is also ongoing to obtain a better understanding of this complex phenomenon.

Molecular cloning and expression analysis of the sucrose transporter gene family from Theobroma cacao L.

PubMed

Li, Fupeng; Wu, Baoduo; Qin, Xiaowei; Yan, Lin; Hao, Chaoyun; Tan, Lehe; Lai, Jianxiong

2014-08-10

In this study, we performed cloning and expression analysis of six putative sucrose transporter genes, designated TcSUT1, TcSUT2, TcSUT3, TcSUT4, TcSUT5 and TcSUT6, from the cacao genotype 'TAS-R8'. The combination of cDNA and genomic DNA sequences revealed that the cacao SUT genes contained exon numbers ranging from 1 to 14. The average molecular mass of all six deduced proteins was approximately 56 kDa (range 52 to 66 kDa). All six proteins were predicted to exhibit typical features of sucrose transporters with 12 trans-membrane spanning domains. Phylogenetic analysis revealed that TcSUT2 and TcSUT4 belonged to Group 2 SUT and Group 4 SUT, respectively, and the other TcSUT proteins were belonging to Group 1 SUT. Real-time PCR was conducted to investigate the expression pattern of each member of the SUT family in cacao. Our experiment showed that TcSUT1 was expressed dominantly in pods and that, TcSUT3 and TcSUT4 were highly expressed in both pods and in bark with phloem. Within pods, TcSUT1 and TcSUT4 were expressed more in the seed coat and seed from the pod enlargement stage to the ripening stage. TcSUT5 expression sharply increased to its highest expression level in the seed coat during the ripening stage. Expression pattern analysis indicated that TcSUT genes may be associated with photoassimilate transport into developing seeds and may, therefore, have an impact on seed production. Copyright © 2014 Elsevier B.V. All rights reserved.

The evolving role of the orphan nuclear receptor ftz-f1, a pair-rule segmentation gene.

PubMed

Heffer, Alison; Grubbs, Nathaniel; Mahaffey, James; Pick, Leslie

2013-01-01

Segmentation is a critical developmental process that occurs by different mechanisms in diverse taxa. In insects, there are three common modes of embryogenesis-short-, intermediate-, and long-germ development-which differ in the number of segments specified at the blastoderm stage. While genes involved in segmentation have been extensively studied in the long-germ insect Drosophila melanogaster (Dm), it has been found that their expression and function in segmentation in short- and intermediate-germ insects often differ. Drosophila ftz-f1 encodes an orphan nuclear receptor that functions as a maternally expressed pair-rule segmentation gene, responsible for the formation of alternate body segments during Drosophila embryogenesis. Here we investigated the expression and function of ftz-f1 in the short-germ beetle, Tribolium castaneum (Tc). We found that Tc-ftz-f1 is expressed in stripes in Tribolium embryos. These stripes overlap alternate Tc-Engrailed (Tc-En) stripes, indicative of a pair-rule expression pattern. To test whether Tc-ftz-f1 has pair-rule function, we utilized embryonic RNAi, injecting double-stranded RNA corresponding to Tc-ftz-f1 coding or non-coding regions into early Tribolium embryos. Knockdown of Tc-ftz-f1 produced pair-rule segmentation defects, evidenced by loss of expression of alternate En stripes. In addition, a later role for Tc-ftz-f1 in cuticle formation was revealed. These results identify a new pair-rule gene in Tribolium and suggest that its role in segmentation may be shared among holometabolous insects. Interestingly, while Tc-ftz-f1 is expressed in pair-rule stripes, the gene is ubiquitously expressed in Drosophila embryos. Thus, the pair-rule function of ftz-f1 is conserved despite differences in expression patterns of ftz-f1 genes in different lineages. This suggests that ftz-f1 expression changed after the divergence of lineages leading to extant beetles and flies, likely due to differences in cis-regulatory sequences. We propose that the dependence of Dm-Ftz-F1 on interaction with the homeodomain protein Ftz which is expressed in stripes in Drosophila, loosened constraints on Dm-ftz-f1 expression, allowing for ubiquitous expression of this pair-rule gene in Drosophila. © 2013 Wiley Periodicals, Inc.

Transcriptome-wide identification and screening of WRKY factors involved in the regulation of taxol biosynthesis in Taxus chinensis.

PubMed

Zhang, Meng; Chen, Ying; Nie, Lin; Jin, Xiaofei; Liao, Weifang; Zhao, Shengying; Fu, Chunhua; Yu, Longjiang

2018-03-26

WRKY, a plant-specific transcription factor family, plays important roles in pathogen defense, abiotic cues, phytohormone signaling, and regulation of plant secondary metabolism. However, little is known about the roles, functions, and mechanisms of WRKY in taxane biosynthesis in Taxus spp. In this study, 61 transcripts were identified from Taxus chinensis transcriptome datasets by using hidden Markov model search. All of these transcripts encoded proteins containing WRKY domains, which were designated as TcWRKY1-61. After phylogenetic analysis of the WRKY domains of TcWRKYs and AtWRKYs, 16, 8, 10, 14, 5, 7, and 1 TcWRKYs were cladded into Group I, IIa-IIe, and III, respectively. Then, six representative TcWRKYs were selected to classify their effects on taxol biosynthesis. After MeJA (methyl jasmonate acid) and SA (salicylic acid) treatments, all of the six TcWRKYs were upregulated by MeJA treatment. TcWRKY44 (IId) and TcWRKY47 (IIa) were upregulated, whereas TcWRKY8 (IIc), TcWRKY20 (III), TcWRKY26 (I), TcWRKY41 (IIe), and TcWRKY52 (IIb) were downregulated by SA treatment. Overexpression experiments showed that the six selected TcWRKYs exerted different effects on taxol biosynthesis. In specific, TcWRKY8 and TcWRKY47 significantly improved the expression levels of taxol-biosynthesis-related genes. Transcriptome-wide identification of WRKY factors in Taxus not only enhances our understanding of plant WRKY factors but also identifies candidate regulators of taxol biosynthesis.

A multicopper oxidase-related protein is essential for insect viability, longevity and ovary development.

PubMed

Peng, Zeyu; Green, Peter G; Arakane, Yasuyuki; Kanost, Michael R; Gorman, Maureen J

2014-01-01

Typical multicopper oxidases (MCOs) have ten conserved histidines and one conserved cysteine that coordinate four copper atoms. These copper ions are required for oxidase activity. During our studies of insect MCOs, we discovered a gene that we named multicopper oxidase-related protein (MCORP). MCORPs share sequence similarity with MCOs, but lack many of the copper-coordinating residues. We identified MCORP orthologs in many insect species, but not in other invertebrates or vertebrates. We predicted that MCORPs would lack oxidase activity due to the absence of copper-coordinating residues. To test this prediction, we purified recombinant Tribolium castaneum (red flour beetle) MCORP and analyzed its enzymatic activity using a variety of substrates. As expected, no oxidase activity was detected. To study MCORP function in vivo, we analyzed expression profiles of TcMCORP and Anopheles gambiae (African malaria mosquito) MCORP, and assessed RNAi-mediated knockdown phenotypes. We found that both MCORPs are constitutively expressed at a low level in all of the tissues we analyzed. Injection of TcMCORP dsRNA into larvae resulted in 100% mortality prior to adult eclosion, with death occurring mainly during the pharate pupal stage or late pharate adult stage. Injection of TcMCORP dsRNA into pharate pupae resulted in the death of approximately 20% of the treated insects during the pupal to adult transition and a greatly shortened life span for the remaining insects. In addition, knockdown of TcMCORP in females prevented oocyte maturation and, thus, greatly decreased the number of eggs laid. These results indicate that TcMCORP is an essential gene and that its function is required for reproduction. An understanding of the role MCORP plays in insect physiology may help to develop new strategies for controlling insect pests.

A Trypanosoma cruzi-secreted 80 kDa proteinase with specificity for human collagen types I and IV.

PubMed Central

Santana, J M; Grellier, P; Schrével, J; Teixeira, A R

1997-01-01

Specific interactions between parasites and extracellular matrix components are an important mechanism in the dissemination of Chagas' disease. Binding of the extracellular matrix proteins to Trypanosoma cruzi receptors has been described as a significant step in this phenomenon. In this study, a specific proteinase activity was identified in cell-free extracts of amastigote, trypomastigote and epimastigote forms of T. cruzi using the collagenase fluorogenic substrate N-Suc-Gly-Pro-Leu-Gly-Pro-7-amido-4-methylcoumarin. Isolation of this activity was achieved by a four-step FPLC procedure. Optimal enzyme activity was found to occur at pH 8.0 and was associated with a single T. cruzi 80 kDa protein (Tc 80 proteinase) on SDS/PAGE under reducing conditions. An internal peptide sequence of Tc 80 proteinase was obtained (AGDNYTPPE), and no similarity was found to previously described proteinases of T. cruzi. This enzyme activity is strongly inhibited by HgCl2, tosyl-lysylchloromethane ('TLCK') p-chloromercuribenzoate and benzyloxycarbonyl-Phe-Ala-diazomethane. The purified enzyme was able to hydrolyse purified human [14C]collagen types I and IV at neutral pH, but not 14C-labelled BSA, rat laminin, rabbit IgG or small proteins such as insulin or cytochrome c. In addition, Tc 80 proteinase activity was found to be secreted by T. cruzi forms infective to mammalian cells. Furthermore we demonstrated that purified Tc 80 proteinase mediates native collagen type I hydrolysis in rat mesentery. This feature is compared with that of Clostridium histolyticum collagenase. These findings suggest that Tc 80 proteinase may facilitate T. cruzi host-cell infection by degrading the collagens of the extracellular matrix and could represent a good target for Chagas' disease chemotherapy. PMID:9224638

Molecular mechanics of tropocollagen-hydroxyapatite biomaterials

NASA Astrophysics Data System (ADS)

Dubey, Devendra Kumar

Hard biomaterials such as bone, dentin, and nacre show remarkable mechanical performance and serve as inspiration for development of next generation of composite materials with high strength and toughness. Such materials have primarily an organic phase (e.g. tropocollagen (TC) or chitin) and a mineral phase (e.g. hydroxyapatite (HAP) or aragonite) arranged in a staggered arrangement at nanoscopic length scales. Interfacial interactions between the organic phases and the mineral phases and structural effects arising due to the staggered and hierarchical arrangements are identified to be the two most important determinants for high mechanical performance of such biomaterials. Effects of these determinants in such biomaterials are further intertwined with factors such as loading configuration, chemical environment, mineral crystal shape, and residue sequences in polymer chains. Atomistic modeling is a desired approach to investigate such sub nanoscale issues as experimental techniques for investigations at such small scale are still in nascent stage. For this purpose, explicit three dimensional (3D) molecular dynamics (MD) and ab initio MD simulations of quasi-static mechanical deformations of idealized Tropocollagen-Hydroxyapatite (TC-HAP) biomaterials with distinct interfacial arrangements and different loading configurations are performed. Focus is on developing insights into the molecular level mechanics of TC-HAP biomaterials at fundamental lengthscale with emphasis on interface phenomenon. Idealized TC-HAP atomistic models are analyzed for their mechanical strength and fracture failure behavior from the viewpoint of interfacial interactions between TC and HAP and associated molecular mechanisms. In particular, study focuses on developing an understanding of factors such as role of interfacial structural arrangement, hierarchical structure design, influence of water, effect of changes in HAP crystal shape, and mutations in TC molecule on the mechanical strength of TC-HAP biomaterials. In conjunction, a continuum level tension-shear-chain (TSC) model is also implemented to analyze fracture resistance characteristics in TC-HAP nanocomposites. Results and analyses shed light on the failure mechanisms in TC-HAP type nanocomposite systems with a chemo-mechanical understanding of the interfacial interaction between TC and HAP. Analyses show that (1) failure of TC-HAP nanocomposites at nanoscale is predominantly peak strain dependent phenomenon, (2) presence of water in most cases strengthens the TC-HAP biomaterial by acting as a bridge via hydrogen bond mediated crosslinks, (3) TC-HAP nanostructures with plate shaped HAP crystals show higher toughness and stability as compared to TC-HAP nanostructures with needle shaped HAP crystals, and (4) mutations in TC are responsible for Osteogenesis Imperfecta bone disorder in an indirect manner, wherein mutations in TC affect the shape and distribution of mineral phase during growth and nucleation period of bone. Overall study emphasizes that interfacial structural arrangement between polymer phase and mineral phase in TC-HAP and similar nanocomposite biomaterials is an important factor in determining their mechanical strength and should be carefully studied and selected for development of high performance nanocomposite biomaterials. Findings and understandings from this research have significant impact on polymer-ceramic nanocomposite mechanics, biomaterial and biomimetic materials development, and bone fragility disorders related medical science development.

The tRNA(Gly) T10003C mutation in mitochondrial haplogroup M11b in a Chinese family with diabetes decreases the steady-state level of tRNA(Gly), increases aberrant reactive oxygen species production, and reduces mitochondrial membrane potential.

PubMed

Li, Wei; Wen, Chaowei; Li, Weixing; Wang, Hailing; Guan, Xiaomin; Zhang, Wanlin; Ye, Wei; Lu, Jianxin

2015-10-01

Mitochondrial diabetes originates mainly from mutations located in maternally transmitted, mitochondrial tRNA-coding genes. In a genetic screening program of type 2 diabetes conducted with a Chinese Han population, we found one family with suggestive maternally transmitted diabetes. The proband's mitochondrial genome was analyzed using DNA sequencing. Total 42 known nucleoside changes and 1 novel variant were identified, and the entire mitochondrial DNA sequence was assigned to haplogroup M11b. Phylogenetic analysis showed that a homoplasmic mutation, 10003T>C transition, occurred at the highly conserved site in the gene encoding tRNA(Gly). Using a transmitochondrial cybrid cell line harboring this mutation, we observed that the steady-state level of tRNA(Gly) significantly affected and the amount of tRNA(Gly) decreased by 97%, production of reactive oxygen species was enhanced, and mitochondrial membrane potential, mtDNA copy number and cellular oxygen consumption rate were remarkably decreased compared with wild-type cybrid cells. The homoplasmic 10003T>C mutation in the mitochondrial tRNA(Gly) gene suggested to be as a pathogenesis-related mutation which might contribute to the maternal inherited diabetes in the Han Chinese family.

Novel Tay-Sachs disease mutations from China.

PubMed

Akalin, N; Shi, H P; Vavougios, G; Hechtman, P; Lo, W; Scriver, C R; Mahuran, D; Kaplan, F

1992-01-01

We describe three HEXA mutations associated with infantile Tay-Sachs disease (TSD) in three unrelated nonconsanguineous Chinese families. Novel mutations were found in two of these families. The third is a previously reported mutation (G-->A transition at nt 1444) (Nakano et al., 1988). Direct sequencing of PCR products identified a novel insertion of an A after nt 547 in family 1. This change generates an early termination codon 6 bp downstream from the insertion site. Allele-specific oligonucleotide hybridization confirmed homozygosity in the proband. Single strand conformational polymorphism analysis and direct sequencing of amplified exon 13 revealed a T-->C transition at nt 1453 with the corresponding amino acid substitution W485R in the second family. This mutation creates an Fnu4HI restriction site. The proband is homozygous for this allele. When the site-specific mutagenized alpha cDNA carrying the T-->C transition at nt 1453 was expressed in COS 1 cells hexosaminidase S activity was not detectable above background. A G-->A transition at nt 1444 (exon 13) corresponding to the E482K substitution was found in the third family. This mutation occurs at a CpG dinucleotide. It has been reported in an Italian TSD proband and causes defective intracellular transport of the alpha-subunit from the rough endoplasmic reticulum to the Golgi apparatus.

Structural characterisation of a water-soluble polysaccharide from tissue-cultured Dendrobium huoshanense C.Z. Tang et S.J. Cheng.

PubMed

Si, Hua-Yang; Chen, Nai-Fu; Chen, Nai-Dong; Huang, Cheng; Li, Jun; Wang, Hui

2018-02-01

A water-soluble polysaccharide TC-DHPA4 with a molecular weight of 8.0 × 10 5  Da was isolated from tissue-cultured Dendrobium huoshanense by anion exchange and gel permeation chromatography. Monosaccharide analysis revealed that the homogeneous polysaccharide was made up of rhamnose, arabinose, mannose, glucose, galactose and glucuronic acid with a molar ratio of 1.28:1:1.67:4.71:10.43:1.42. The sugar residue sequence analysis based on the GC-MS files and NMR spectra indicated that the backbone of TC-DHPA4 consisted of the repeated units:→6)-β-Galp-(1→6)-β-Galp-(1→4)-β-GlcpA-(1→6)-β-Glcp-(1→6)-β-Glcp-(→. The sugar residue sequences β-Glcp-(1→)-α-Rhap-(1→3)-β-Galp-(1→, β-Glcp-(1→4)-α-Rhap-(1→3)-β-Galp-(1→, β-Galp-(1→6)-β-Manp-(1→3)-β-Galp-(1→, and α-l-Araf-(1→2)-β-Manp-(1→3)-β-Galp-(1→ were identified as the branches attached to the C-3 position of (1→6)-linked galactose in the backbone.

Presence of Trypanosoma cruzi in pregnant women and typing of lineages in congenital cases.

PubMed

Ortiz, Sylvia; Zulantay, Inés; Solari, Aldo; Bisio, Margarita; Schijman, Alejandro; Carlier, Yves; Apt, Werner

2012-12-01

The objective of this study was to determine the presence of Trypanosoma cruzi in blood samples of mothers with chronic Chagas disease and their newborn by conventional PCR targeted to minicircle kinetoplastidic DNA (kDNA), and to determine the lineages in mother/newborn pairs of the congenital cases by hybridization assays with probes belonging to the TcII, TcI and TcV Discrete Typing Units (DTU). In 63 (57.2%) of the mothers the presence of circulating T. cruzi was demonstrated by PCR immediately before delivery and in three newborn (3%) congenital transmission was confirmed by serial PCR and conventional serology between 1 and 16 months of life, at which point treatment was started. The hybridization signals showed that two of the newborn had the same DTU as their mother (TcI, TcII and TcV), whilst in the third congenital case only TcV was detected in the cord blood, suggesting that in this infant TcI and TcII did not cross the placenta or the parasite was not present at a detectable level. Levels T. cruzi DNA was determined by TaqMan Probe based Real Time PCR assay targeted to nuclear satellite sequences in these three pairs of samples. Copyright © 2012 Elsevier B.V. All rights reserved.

Inability of Prevotella bryantii to Form a Functional Shine-Dalgarno Interaction Reflects Unique Evolution of Ribosome Binding Sites in Bacteroidetes

PubMed Central

Accetto, Tomaž; Avguštin, Gorazd

2011-01-01

The Shine-Dalgarno (SD) sequence is a key element directing the translation to initiate at the authentic start codons and also enabling translation initiation to proceed in 5′ untranslated mRNA regions (5′-UTRs) containing moderately strong secondary structures. Bioinformatic analysis of almost forty genomes from the major bacterial phylum Bacteroidetes revealed, however, a general absence of SD sequence, drop in GC content and consequently reduced tendency to form secondary structures in 5′-UTRs. The experiments using the Prevotella bryantii TC1-1 expression system were in agreement with these findings: neither addition nor omission of SD sequence in the unstructured 5′-UTR affected the level of the reporter protein, non-specific nuclease NucB. Further, NucB level in P. bryantii TC1-1, contrary to hMGFP level in Escherichia coli, was five times lower when SD sequence formed part of the secondary structure with a folding energy -5,2 kcal/mol. Also, the extended SD sequences did not affect protein levels as in E. coli. It seems therefore that a functional SD interaction does not take place during the translation initiation in P. bryanttii TC1-1 and possibly other members of phylum Bacteroidetes although the anti SD sequence is present in 16S rRNA genes of their genomes. We thus propose that in the absence of the SD sequence interaction, the selection of genuine start codons in Bacteroidetes is accomplished by binding of ribosomal protein S1 to unstructured 5′-UTR as opposed to coding region which is inaccessible due to mRNA secondary structure. Additionally, we found that sequence logos of region preceding the start codons may be used as taxonomical markers. Depending on whether complete sequence logo or only part of it, such as information content and base proportion at specific positions, is used, bacterial genera or families and in some cases even bacterial phyla can be distinguished. PMID:21857964

Photochemical behavior of the quadruply metal-metal bonded [Tc 2Cl 8] 2– anion in acetonitrile

DOE PAGES

Burton-Pye, Benjamin P.; Poineau, Frederic; Bertoia, Julie; ...

2016-09-23

Here, the photochemical behavior of [Tc 2Cl 8] 2– was investigated in acetonitrile. The speciation of Tc before and after irradiation at 254 nm was performed by UV-visible spectroscopy and electrospray ionization mass spectrometry (ESI-MS). Upon irradiation at 254 nm, [Tc 2Cl 8] 2– was unstable, the scission of the Tc ≡ Tc unit occurred and the complex [TcCl 4(CH 3CN) 2] was identified. The disappearance rate of [M 2Cl 8] 2– (M = Tc, Re) under irradiation has been measured and was ~7.5 time faster for Tc than for Re.

Trichocystatin-2 (TC-2): an endogenous inhibitor of cysteine proteinases in Trichomonas vaginalis is associated with TvCP39.

PubMed

Puente-Rivera, Jonathan; Ramón-Luing, Lucero de los Ángeles; Figueroa-Angulo, Elisa Elvira; Ortega-López, Jaime; Arroyo, Rossana

2014-09-01

The causal agent of trichomoniasis is a parasitic protist, Trichomonas vaginalis, which is rich in proteolytic activity, primarily carried out by cysteine proteases (CPs). Some CPs are known virulence factors. T. vaginalis also possesses three genes encoding endogenous cystatin-like CP inhibitors. The aim of this study was to identify and characterize one of these CP inhibitors. Using two-dimensional gel electrophoresis (2-DE) and mass spectrometry (MS), a cystatin-like peptidase inhibitor dubbed Trichocystatin-2 (TC-2) was identified in the T. vaginalis active degradome in association with TvCP39, a 39kDa CP involved in cytotoxicity. To characterize the TC-2 inhibitor, we cloned and expressed the tvicp-2 gene, purified the recombinant protein (TC-2r), and produced a specific polyclonal antibody (α-TC-2r). This antibody recognized a 10kDa protein band by western blotting. An indirect immunofluorescence assay (IFA) and cell fractionation assays using the α-TC-2r antibody showed that TC-2 was localized in the cytoplasm and lysosomes and that it colocalized with TvCP39. TC-2r showed inhibitory activity against papain, cathepsin-L, and TvCP39 in trichomonad extracts and live parasites but not legumain-like CPs. Live trichomonads treated with TC-2r showed reduced trichomonal cytotoxicity to HeLa cell monolayers in a TC-2r-concentration-dependent manner. In this study, we identified and characterized an endogenous cystatin-like inhibitor in T. vaginalis, TC-2, which is associated with TvCP39 and appears to regulate the cellular damage caused by T. vaginalis. Copyright © 2014 Elsevier Ltd. All rights reserved.

Identification of single nucleotide polymorphisms in the ASB15 gene and their associations with chicken growth and carcass traits.

PubMed

Wang, Y C; Jiang, R R; Kang, X T; Li, Z J; Han, R L; Geng, J; Fu, J X; Wang, J F; Wu, J P

2015-09-25

ASB15 is a member of the ankyrin repeat and suppressor of cytokine signaling box family, and is predominantly expressed in skeletal muscle. In the present study, an F2 resource population of Gushi chickens crossed with Anka broilers was used to investigate the genetic effects of the chicken ASB15 gene. Two single nucleotide polymorphisms (SNPs) (rs315759231 A>G and rs312619270 T>C) were identified in exon 7 of the ASB15 gene using forced chain reaction-restriction fragment length polymorphism and DNA sequencing. One was a missense SNP (rs315759231 A>G) and the other was a synonymous SNP (rs312619270 T>C). The rs315759231 A>G polymorphism was significantly associated with body weight at birth, 12-week body slanting length, semi-evisceration weight, evisceration weight, leg muscle weight, and carcass weight (P < 0.05). The rs312619270 T>C polymorphism was significantly associated with body weight at birth, 4, 8, and 12-week body weight, 8-week shank length, 12-week breast bone length, 8 and 12-week body slanting length, breast muscle weight, and carcass weight (P < 0.05). Our results suggest that the ASB15 gene profoundly affects chicken growth and carcass traits.

MicroRNA expression profiling in alveolar macrophages of indigenous Chinese Tongcheng pigs infected with PRRSV in vivo.

PubMed

Zhou, Xiang; Michal, Jennifer J; Jiang, Zhihua; Liu, Bang

2017-11-01

Porcine respiratory and reproductive syndrome (PRRS), caused by PRRS virus (PRRSV), is one of the most serious infectious diseases in the swine industry worldwide. Indigenous Chinese Tongcheng (TC) pigs reportedly show strong resistance to PRRSV infection. The miRNA expression profiles of porcine alveolar macrophages (PAMs) of control TC pigs and those infected with PRRSV in vivo were analyzed by high-throughput sequencing to explore changes induced by infection. A total of 182 known miRNAs including 101 miRNA-5p and 81 miRNA-3p were identified with 23 up-regulated differentially expressed miRNAs (DEmiRNAs) and 25 down-regulated DEmiRNAs. Gene Ontology analysis showed that predicted target genes for the DEmiRNAs were enriched in immune response, transcription regulation, and cell death. The integrative analysis of mRNA and miRNA expression revealed that down-regulated methylation-related genes (DNMT1 and DNMT3b) were targeted by five up-regulated DEmiRNAs. Furthermore, 35 pairs of miRNAs (70 miRNAs) were co-expressed after PRRSV infection and six pairs were co-expressed differently. Our results describe miRNA expression profiles of TC pigs in response to PRRSV infection and lay a strong foundation for developing novel therapies to control PRRS in pigs.

Trypanosoma cruzi IV causing outbreaks of acute Chagas disease and infections by different haplotypes in the Western Brazilian Amazonia.

PubMed

Monteiro, Wuelton Marcelo; Magalhães, Laylah Kelre Costa; de Sá, Amanda Regina Nichi; Gomes, Mônica Lúcia; Toledo, Max Jean de Ornelas; Borges, Lara; Pires, Isa; Guerra, Jorge Augusto de Oliveira; Silveira, Henrique; Barbosa, Maria das Graças Vale

2012-01-01

Chagas disease is an emergent tropical disease in the Brazilian Amazon Region, with an increasing number of cases in recent decades. In this region, the sylvatic cycle of Trypanosoma cruzi transmission, which constitutes a reservoir of parasites that might be associated with specific molecular, epidemiological and clinical traits, has been little explored. The objective of this work is to genetically characterize stocks of T. cruzi from human cases, triatomines and reservoir mammals in the State of Amazonas, in the Western Brazilian Amazon. We analyzed 96 T. cruzi samples from four municipalities in distant locations of the State of Amazonas. Molecular characterization of isolated parasites from cultures in LIT medium or directly from vectors or whole human blood was performed by PCR of the non-transcribed spacer of the mini-exon and of the 24 S alfa ribosomal RNA gene, RFLP and sequencing of the mitochondrial cytochrome c oxidase subunit II (COII) gene, and by sequencing of the glucose-phosphate isomerase gene. The T. cruzi parasites from two outbreaks of acute disease were all typed as TcIV. One of the outbreaks was triggered by several haplotypes of the same DTU. TcIV also occurred in isolated cases and in Rhodnius robustus. Incongruence between mitochondrial and nuclear phylogenies is likely to be indicative of historical genetic exchange events resulting in mitochondrial introgression between TcIII and TcIV DTUs from Western Brazilian Amazon. TcI predominated among triatomines and was the unique DTU infecting marsupials. DTU TcIV, rarely associated with human Chagas disease in other areas of the Amazon basin, is the major strain responsible for the human infections in the Western Brazilian Amazon, occurring in outbreaks as single or mixed infections by different haplotypes.

Characterization of a stearoyl-acyl carrier protein desaturase gene family from chocolate tree, Theobroma cacao L.

PubMed

Zhang, Yufan; Maximova, Siela N; Guiltinan, Mark J

2015-01-01

In plants, the conversion of stearoyl-ACP to oleoyol-ACP is catalyzed by a plastid-localized soluble stearoyl-acyl carrier protein (ACP) desaturase (SAD). The activity of SAD significantly impacts the ratio of saturated and unsaturated fatty acids, and is thus a major determinant of fatty acid composition. The cacao genome contains eight putative SAD isoforms with high amino acid sequence similarities and functional domain conservation with SAD genes from other species. Sequence variation in known functional domains between different SAD family members suggested that these eight SAD isoforms might have distinct functions in plant development, a hypothesis supported by their diverse expression patterns in various cacao tissues. Notably, TcSAD1 is universally expressed across all the tissues, and its expression pattern in seeds is highly correlated with the dramatic change in fatty acid composition during seed maturation. Interestingly, TcSAD3 and TcSAD4 appear to be exclusively and highly expressed in flowers, functions of which remain unknown. To test the function of TcSAD1 in vivo, transgenic complementation of the Arabidopsis ssi2 mutant was performed, demonstrating that TcSAD1 successfully rescued all AtSSI2 related phenotypes further supporting the functional orthology between these two genes. The identification of the major SAD gene responsible for cocoa butter biosynthesis provides new strategies for screening for novel genotypes with desirable fatty acid compositions, and for use in breeding programs to help pyramid genes for quality and other traits such as disease resistance.

Circulation of Tc Ia discrete type unit Trypanosoma cruzi in Yucatan Mexico.

PubMed

Monteón, Victor; Triana-Chávez, Omar; Mejía-Jaramillo, Ana; Pennignton, Pamela; Ramos-Ligonio, Ángel; Acosta, Karla; Lopez, Ruth

2016-06-01

The etiologic agent Trypanosoma cruzi (Tc) has been grouped into six discrete type units (DTU I-VI); within DTU-I exists four subgroups defined Ia-Id. In Colombia, the genotype Ia is associated with human infection and domiciliated Rhodnius vector. In the Yucatan Peninsula of Mexico, the main vector involved in T. cruzi transmission is Triatoma dimidiata predominantly via sylvatic and peridomiciliated cycles. In this study, multiple sequence analysis of mini-exon intergenic regions of T. cruzi isolates obtained from T. dimidiata in the Yucatan Peninsula of Mexico revealed they belonged to Tc Ia DTU along with two additional Mexican strains located 1,570 km away from Yucatan. In conclusion Tc Ia circulates in the Yucatan peninsula in T. dimidiata vector and likewise in the northwest region of Mexico.

Functional Specialization Among Members Of Knickkopf Family Of Proteins In Insect Cuticle Organization

PubMed Central

Chaudhari, Sujata S.; Moussian, Bernard; Specht, Charles A.; Arakane, Yasuyuki; Kramer, Karl J.; Beeman, Richard W.; Muthukrishnan, Subbaratnam

2014-01-01

Our recent study on the functional analysis of the Knickkopf protein from T. castaneum (TcKnk), indicated a novel role for this protein in protection of chitin from degradation by chitinases. Knk is also required for the laminar organization of chitin in the procuticle. During a bioinformatics search using this protein sequence as the query, we discovered the existence of a small family of three Knk-like genes (including the prototypical TcKnk) in the T. castaneum genome as well as in all insects with completed genome assemblies. The two additional Knk-like genes have been named TcKnk2 and TcKnk3. Further complexity arises as a result of alternative splicing and alternative polyadenylation of transcripts of TcKnk3, leading to the production of three transcripts (and by inference, three proteins) from this gene. These transcripts are named TcKnk3-Full Length (TcKnk3-FL), TcKnk3-5′ and TcKnk3-3′. All three Knk-family genes appear to have essential and non-redundant functions. RNAi for TcKnk led to developmental arrest at every molt, while down-regulation of either TcKnk2 or one of the three TcKnk3 transcripts (TcKnk3-3′) resulted in specific molting arrest only at the pharate adult stage. All three Knk genes appear to influence the total chitin content at the pharate adult stage, but to variable extents. While TcKnk contributes mostly to the stability and laminar organization of chitin in the elytral and body wall procuticles, proteins encoded by TcKnk2 and TcKnk3-3′ transcripts appear to be required for the integrity of the body wall denticles and tracheal taenidia, but not the elytral and body wall procuticles. Thus, the three members of the Knk-family of proteins perform different essential functions in cuticle formation at different developmental stages and in different parts of the insect anatomy. PMID:25144557

Functional specialization among members of Knickkopf family of proteins in insect cuticle organization.

PubMed

Chaudhari, Sujata S; Moussian, Bernard; Specht, Charles A; Arakane, Yasuyuki; Kramer, Karl J; Beeman, Richard W; Muthukrishnan, Subbaratnam

2014-08-01

Our recent study on the functional analysis of the Knickkopf protein from T. castaneum (TcKnk), indicated a novel role for this protein in protection of chitin from degradation by chitinases. Knk is also required for the laminar organization of chitin in the procuticle. During a bioinformatics search using this protein sequence as the query, we discovered the existence of a small family of three Knk-like genes (including the prototypical TcKnk) in the T. castaneum genome as well as in all insects with completed genome assemblies. The two additional Knk-like genes have been named TcKnk2 and TcKnk3. Further complexity arises as a result of alternative splicing and alternative polyadenylation of transcripts of TcKnk3, leading to the production of three transcripts (and by inference, three proteins) from this gene. These transcripts are named TcKnk3-Full Length (TcKnk3-FL), TcKnk3-5' and TcKnk3-3'. All three Knk-family genes appear to have essential and non-redundant functions. RNAi for TcKnk led to developmental arrest at every molt, while down-regulation of either TcKnk2 or one of the three TcKnk3 transcripts (TcKnk3-3') resulted in specific molting arrest only at the pharate adult stage. All three Knk genes appear to influence the total chitin content at the pharate adult stage, but to variable extents. While TcKnk contributes mostly to the stability and laminar organization of chitin in the elytral and body wall procuticles, proteins encoded by TcKnk2 and TcKnk3-3' transcripts appear to be required for the integrity of the body wall denticles and tracheal taenidia, but not the elytral and body wall procuticles. Thus, the three members of the Knk-family of proteins perform different essential functions in cuticle formation at different developmental stages and in different parts of the insect anatomy.

Acquired mutations associated with ibrutinib resistance in Waldenström macroglobulinemia.

PubMed

Xu, Lian; Tsakmaklis, Nicholas; Yang, Guang; Chen, Jiaji G; Liu, Xia; Demos, Maria; Kofides, Amanda; Patterson, Christopher J; Meid, Kirsten; Gustine, Joshua; Dubeau, Toni; Palomba, M Lia; Advani, Ranjana; Castillo, Jorge J; Furman, Richard R; Hunter, Zachary R; Treon, Steven P

2017-05-04

Ibrutinib produces high response rates and durable remissions in Waldenström macroglobulinemia (WM) that are impacted by MYD88 and CXCR4 WHIM mutations. Disease progression can develop on ibrutinib, although the molecular basis remains to be clarified. We sequenced sorted CD19 + lymphoplasmacytic cells from 6 WM patients who progressed after achieving major responses on ibrutinib using Sanger, TA cloning and sequencing, and highly sensitive and allele-specific polymerase chain reaction (AS-PCR) assays that we developed for Bruton tyrosine kinase ( BTK ) mutations. AS-PCR assays were used to screen patients with and without progressive disease on ibrutinib, and ibrutinib-naïve disease. Targeted next-generation sequencing was used to validate AS-PCR findings, assess for other BTK mutations, and other targets in B-cell receptor and MYD88 signaling. Among the 6 progressing patients, 3 had BTK Cys481 variants that included BTK Cys481Ser(c.1635G>C and c.1634T>A) and BTK Cys481Arg(c.1634T>C) Two of these patients had multiple BTK mutations. Screening of 38 additional patients on ibrutinib without clinical progression identified BTK Cys481 mutations in 2 (5.1%) individuals, both of whom subsequently progressed. BTK Cys481 mutations were not detected in baseline samples or in 100 ibrutinib-naive WM patients. Using mutated MYD88 as a tumor marker, BTK Cys481 mutations were subclonal, with a highly variable clonal distribution. Targeted deep-sequencing confirmed AS-PCR findings, and identified an additional BTK Cys481Tyr(c.1634G>A) mutation in the 2 patients with multiple other BTK Cys481 mutations, as well as CARD11 Leu878Phe(c.2632C>T) and PLCγ2 Tyr495His(c.1483T>C) mutations. Four of the 5 patients with BTK C481 variants were CXCR4 mutated. BTK Cys481 mutations are common in WM patients with clinical progression on ibrutinib, and are associated with mutated CXCR4 . © 2017 by The American Society of Hematology.

[Mutation analysis of seven patients with Waardenburg syndrome].

PubMed

Hao, Ziqi; Zhou, Yongan; Li, Pengli; Zhang, Quanbin; Li, Jiao; Wang, Pengfei; Li, Xiangshao; Feng, Yong

2016-06-01

To perform genetic analysis for 7 patients with Waardenburg syndrome. Potential mutation of MITF, PAX3, SOX10 and SNAI2 genes was screened by polymerase chain reaction and direct sequencing. Functions of non-synonymous polymorphisms were predicted with PolyPhen2 software. Seven mutations, including c.649-651delAGA (p.R217del), c.72delG (p.G24fs), c.185T>C (p.M62T), c.118C>T (p.Q40X), c.422T>C (p.L141P), c.640C>T (p.R214X) and c.28G>T(p.G43V), were detected in the patients. Among these, four mutations of the PAX3 gene (c.72delG, c.185T>C, c.118C>T and c.128G>T) and one SOX10 gene mutation (c.422T>C) were not reported previously. Three non-synonymous SNPs (c.185T>C, c.128G>T and c.422T>C) were predicted as harmful. Genetic mutations have been detected in all patients with Waardenburg syndrome.

2'β-Fluoro-Tricyclo Nucleic Acids (2'F-tc-ANA): Thermal Duplex Stability, Structural Studies, and RNase H Activation.

PubMed

Istrate, Alena; Katolik, Adam; Istrate, Andrei; Leumann, Christian J

2017-08-01

We describe the synthesis, thermal stability, structural and RNase H activation properties of 2'β-fluoro-tricyclo nucleic acids (2'F-tc-ANA). Three 2'F-tc-ANA nucleosides (T, 5Me C and A) were synthesized starting from a previously described fluorinated tricyclo sugar intermediate. NMR analysis and quantum mechanical calculations indicate that 2'F-tc-ANA nucleosides prefer sugar conformations in the East and South regions of the pseudorotational cycle. UV-melting experiments revealed that non-consecutive insertions of 2'F-tc-ANA units in DNA reduce the affinity to DNA and RNA complements. However, an oligonucleotide with five contiguous 2'F-tc-ANA-T insertions exhibits increased affinity to complementary RNA. Moreover, a fully modified 10-mer 2'F-tc-ANA oligonucleotide paired to both DNA (+1.6 °C/mod) and RNA (+2.5 °C/mod) with significantly higher affinity compared to corresponding unmodified DNA, and similar affinity compared to corresponding tc-DNA. In addition, CD spectroscopy and molecular dynamics simulations indicate that the conformation of the 2'F-tc-ANA/RNA duplex is similar to that of a DNA/RNA duplex. Moreover, in some sequence contexts, 2'F-tc-ANA promotes RNase H-mediated cleavage of a complementary RNA strand. Taken together, 2'F-tc-ANA represents a nucleic acid analogue that offers the advantage of high RNA affinity while maintaining the ability to activate RNase H, and can be considered a prospective candidate for gene silencing applications. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

[Differential expression of DTSsa4 Tc1-like transposons in closely related populations of Baikal ciscoes].

PubMed

Bychenko, O S; Sukhanova, L V; Azhikina, T L; Sverdlov, E D

2009-01-01

Two representatives of Baikal ciscoes - lake cisco and omul - diverged from a common ancestor as recently as 10-20 thousand years ago. We have found an increasing expression level of DTSsa4 Tc1-like DNA transposons in cisco and omul brains. The mapping of the sequences of these transposons from Salmo salar and Danio rerio genomes has shown that in some cases, these transposons are located in the 5' and 3' regions, as well as in the promoter regions of various genes. Probably, Tc1-like transposons affect the activity of neighboring genes, providing the adaptive divergence of the cisco population.

Distribution and abundance of archaeal and bacterial ammonia oxidizers in the sediments of the Dongjiang River, a drinking water supply for Hong Kong.

PubMed

Sun, Wei; Xia, Chunyu; Xu, Meiying; Guo, Jun; Wang, Aijie; Sun, Guoping

2013-01-01

Ammonia-oxidizing archaea (AOA) and bacteria (AOB) play important roles in nitrification. However, limited information about the characteristics of AOA and AOB in the river ecosystem is available. The distribution and abundance of AOA and AOB in the sediments of the Dongjiang River, a drinking water source for Hong Kong, were investigated by clone library analysis and quantitative real-time PCR. Phylogenetic analysis showed that Group 1.1b- and Group 1.1b-associated sequences of AOA predominated in sediments with comparatively high carbon and nitrogen contents (e.g. total carbon (TC) >13 g kg(-1) sediment, NH4(+)-N >144 mg kg(-1) sediment), while Group 1.1a- and Group 1.1a-associated sequences were dominant in sediments with opposite conditions (e.g. TC <4 g kg(-1) sediment, NH4(+)-N <93 mg kg(-1) sediment). Although Nitrosomonas- and Nitrosospira-related sequences of AOB were detected in the sediments, nearly 70% of the sequences fell into the Nitrosomonas-like B cluster, suggesting similar sediment AOB communities along the river. Higher abundance of AOB than AOA was observed in almost all of the sediments in the Dongjiang River, while significant correlations were only detected between the distribution of AOA and the sediment pH and TC, which suggested that AOA responded more sensitively than AOB to variations of environmental factors. These results extend our knowledge about the environmental responses of ammonia oxidizers in the river ecosystem.

Sequence variants in the bovine silent information regulator 6, their linkage and their associations with body measurements and carcass quality traits in Qinchuan cattle.

PubMed

Gui, Linsheng; Jiang, Bijie; Zhang, Yaran; Zan, Linsen

2015-03-15

Silent information regulator 6 (SIRT6) belongs to the family of class III nicotinamide adenine dinucleotide (NAD)-dependent deacetylase and plays an essential role in DNA repair and metabolism. This study was conducted to detect potential polymorphisms of the bovine SIRT6 gene and explore their relationships with body measurement and carcass quality in Qinchuan cattle. Four sequence variants (SVs) were identified in intron 6, exon 7, exon 9, and 3' UTR, via sequencing technology conducted in 468 individual Qinchuan cattle. Eleven different haplotypes were identified, of which two major haplotypes had a frequency of 45.7% (-CACT-) and 14.8% (-CGTC-). Three SVs (SV2, SV3 and SV4) were significantly associated with some of the body measurements and carcass quality traits (P<0.05 or P<0.01), and the H2H7 (CC-GA-TT-TC) diplotype had better performance than other combinations. Our results suggest that some polymorphisms in SIRT6 are associated with production traits and may be used as candidates for marker-assisted selection (MAS) and management in beef cattle breeding programs. Copyright © 2015 Elsevier B.V. All rights reserved.

Identification of a Novel Missense FBN2 Mutation in a Chinese Family with Congenital Contractural Arachnodactyly Using Exome Sequencing

PubMed Central

Deng, Hao; Lu, Qian; Xu, Hongbo; Deng, Xiong; Yuan, Lamei; Yang, Zhijian; Guo, Yi; Lin, Qiongfen; Xiao, Jingjing; Guan, Liping; Song, Zhi

2016-01-01

Congenital contractural arachnodactyly (CCA, OMIM 121050), also known as Beals-Hecht syndrome, is an autosomal dominant disorder of connective tissue. CCA is characterized by arachnodactyly, dolichostenomelia, pectus deformities, kyphoscoliosis, congenital contractures and a crumpled appearance of the helix of the ear. The aim of this study is to identify the genetic cause of a 4-generation Chinese family of Tujia ethnicity with congenital contractural arachnodactyly by exome sequencing. The clinical features of patients in this family are consistent with CCA. A novel missense mutation, c.3769T>C (p.C1257R), in the fibrillin 2 gene (FBN2) was identified responsible for the genetic cause of our family with CCA. The p.C1257R mutation occurs in the 19th calcium-binding epidermal growth factor-like (cbEGF) domain. The amino acid residue cysteine in this domain is conserved among different species. Our findings suggest that exome sequencing is a powerful tool to discover mutation(s) in CCA. Our results may also provide new insights into the cause and diagnosis of CCA, and may have implications for genetic counseling and clinical management. PMID:27196565

Validation of transcutaneous bilirubin nomogram for identifying neonatal hyperbilirubinemia in healthy Chinese term and late-preterm infants: a multicenter study.

PubMed

Yu, Zhangbin; Han, Shuping; Wu, Jinxia; Li, Mingxia; Wang, Huaiyan; Wang, Jimei; Liu, Jiebo; Pan, Xinnian; Yang, Jie; Chen, Chao

2014-01-01

to prospectively validate a previously constructed transcutaneous bilirubin (TcB) nomogram for identifying severe hyperbilirubinemia in healthy Chinese term and late-preterm infants. this was a multicenter study that included 9,174 healthy term and late-preterm infants in eight hospitals of China. TcB measurements were performed using a JM-103 bilirubinometer. TcB values were plotted on a previously developed TcB nomogram, to identify the predictive ability for subsequent significant hyperbilirubinemia. in the present study, 972 neonates (10.6%) developed significant hyperbilirubinemia. The 40(th) percentile of the nomogram could identify all neonates who were at risk of significant hyperbilirubinemia, but with a low positive predictive value (PPV) (18.9%). Of the 453 neonates above the 95(th) percentile, 275 subsequently developed significant hyperbilirubinemia, with a high PPV (60.7%), but with low sensitivity (28.3%). The 75(th) percentile was highly specific (81.9%) and moderately sensitive (79.8%). The area under the curve (AUC) for the TcB nomogram was 0.875. this study validated the previously developed TcB nomogram, which could be used to predict subsequent significant hyperbilirubinemia in healthy Chinese term and late-preterm infants. However, combining TcB nomogram and clinical risk factors could improve the predictive accuracy for severe hyperbilirubinemia, which was not assessed in the study. Further studies are necessary to confirm this combination. Copyright © 2014 Sociedade Brasileira de Pediatria. Published by Elsevier Editora Ltda. All rights reserved.

Biological and Molecular Characterization of Trypanosoma cruzi Strains from Four States of Brazil.

PubMed

Ribeiro, Aline Rimoldi; Lima, Luciana; de Almeida, Larissa Aguiar; Monteiro, Joana; Moreno, Cláudia Jassica Gonçalves; Nascimento, Juliana Damieli; de Araújo, Renato Freitas; Mello, Fernanda; Martins, Luciamáre Perinetti Alves; Graminha, Márcia Aparecida Silva; Teixeira, Marta Maria Geraldes; Silva, Marcelo Sousa; Steindel, Mário; da Rosa, João Aristeu

2018-02-01

Chagas disease affects between six and seven million people. Its etiological agent, Trypanosoma cruzi , is classified into six discrete typing units (DTUs). The biological study of 11 T. cruzi strains presented here included four parameters: growth kinetics, parasitemia curves, rate of macrophage infection, and serology to evaluate IgM, total IgG, IgG1, IgG2a, and IgG3. Sequencing of small subunit of ribosomal RNA (SSU rRNA)was performed and the T. cruzi strains were classified into three DTUs. When their growth in liver infusion tryptose medium was represented in curves, differences among the strains could be noted. The parasitemia profile varied among the strains from the TcI, TcII, and TcIII groups, and the 11 T. cruzi strains produced distinct parasitemia levels in infected BALB/c. The TcI group presented the highest rate of macrophage infection by amastigotes, followed by TcII and TcIII. Reactivity to immunoglobulins was observed in the TcI, TcII, and TcIII; all the animals infected with the different strains of T. cruzi showed anti- T. cruzi antibodies. The molecular study presented here resulted in the classification of the T. cruzi strains into the TcI (Bolivia, T lenti, Tm, SC90); TcII (Famema, SC96, SI8, Y); and TcIII (QMM3, QMM5, SI5) groups. These biological and molecular results from 11 T. cruzi strains clarified the factors involved in the biology of the parasite and its hosts. The collection of triatomine (vector) species, and the study of geographic distribution, as well as biological and molecular characterization of the parasite, will contribute to the reporting and surveillance measures in Brazilian states.

Sequence variations of the alpha-globin genes: scanning of high CG content genes with DHPLC and DG-DGGE.

PubMed

Lacerra, Giuseppina; Fiorito, Mirella; Musollino, Gennaro; Di Noce, Francesca; Esposito, Maria; Nigro, Vincenzo; Gaudiano, Carlo; Carestia, Clementina

2004-10-01

The alpha-globin chains are encoded by two duplicated genes (HBA2 and HBA1, 5'-3') showing overall sequence homology >96% and average CG content >60%. alpha-Thalassemia, the most prevalent worldwide autosomal recessive disorder, is a hereditary anemia caused by sequence variations of these genes in about 25% of carriers. We evaluated the overall sensitivity and suitability of DHPLC and DG-DGGE in scanning both the alpha-globin genes by carrying out a retrospective analysis of 19 variant alleles in 29 genotypes. The HBA2 alleles c.1A>G, c.79G>A, and c.281T>G, and the HBA1 allele c.475C>A were new. Three pathogenic sequence variations were associated in cis with nonpathogenic variations in all families studied; they were the HBA2 variation c.2T>C associated with c.-24C>G, and the HBA2 variations c.391G>C and c.427T>C, both associated with c.565G>A. We set up original experimental conditions for DHPLC and DG-DGGE and analyzed 10 normal subjects, 46 heterozygotes, seven homozygotes, seven compound heterozygotes, and six compound heterozygotes for a hybrid gene. Both the methodologies gave reproducible results and no false-positive was detected. DHPLC showed 100% sensitivity and DG-DGGE nearly 90%. About 100% of the sequence from the cap site to the polyA addition site could be scanned by DHPLC, about 87% by DG-DGGE. It is noteworthy that the three most common pathogenic sequence variations (HBA2 alleles c.2T>C, c.95+2_95+6del, and c.523A>G) were unambiguously detected by both the methodologies. Genotype diagnosis must be confirmed with PCR sequencing of single amplicons or with an allele-specific method. This study can be helpful for scanning genes with high CG content and offers a model suitable for duplicated genes with high homology. Copyright 2004 Wiley-Liss, Inc.

Imputation of Exome Sequence Variants into Population- Based Samples and Blood-Cell-Trait-Associated Loci in African Americans: NHLBI GO Exome Sequencing Project

PubMed Central

Auer, Paul L.; Johnsen, Jill M.; Johnson, Andrew D.; Logsdon, Benjamin A.; Lange, Leslie A.; Nalls, Michael A.; Zhang, Guosheng; Franceschini, Nora; Fox, Keolu; Lange, Ethan M.; Rich, Stephen S.; O’Donnell, Christopher J.; Jackson, Rebecca D.; Wallace, Robert B.; Chen, Zhao; Graubert, Timothy A.; Wilson, James G.; Tang, Hua; Lettre, Guillaume; Reiner, Alex P.; Ganesh, Santhi K.; Li, Yun

2012-01-01

Researchers have successfully applied exome sequencing to discover causal variants in selected individuals with familial, highly penetrant disorders. We demonstrate the utility of exome sequencing followed by imputation for discovering low-frequency variants associated with complex quantitative traits. We performed exome sequencing in a reference panel of 761 African Americans and then imputed newly discovered variants into a larger sample of more than 13,000 African Americans for association testing with the blood cell traits hemoglobin, hematocrit, white blood count, and platelet count. First, we illustrate the feasibility of our approach by demonstrating genome-wide-significant associations for variants that are not covered by conventional genotyping arrays; for example, one such association is that between higher platelet count and an MPL c.117G>T (p.Lys39Asn) variant encoding a p.Lys39Asn amino acid substitution of the thrombpoietin receptor gene (p = 1.5 × 10−11). Second, we identified an association between missense variants of LCT and higher white blood count (p = 4 × 10−13). Third, we identified low-frequency coding variants that might account for allelic heterogeneity at several known blood cell-associated loci: MPL c.754T>C (p.Tyr252His) was associated with higher platelet count; CD36 c.975T>G (p.Tyr325∗) was associated with lower platelet count; and several missense variants at the α-globin gene locus were associated with lower hemoglobin. By identifying low-frequency missense variants associated with blood cell traits not previously reported by genome-wide association studies, we establish that exome sequencing followed by imputation is a powerful approach to dissecting complex, genetically heterogeneous traits in large population-based studies. PMID:23103231

Use of 99mTc-Tilmanocept as a Single Agent for Sentinel Lymph Node Identification in Breast Cancer: A Retrospective Pilot Study.

PubMed

Unkart, Jonathan T; Wallace, Anne M

2017-09-01

99m Tc-tilmanocept received recent Food and Drug Administration approval for lymphatic mapping in 2013. However, to our knowledge, no prior studies have evaluated the use of 99m Tc-tilmanocept as a single agent in sentinel lymph node (SLN) biopsy in breast cancer. Methods: We executed this retrospective pilot study to assess the ability of 99m Tc-tilmanocept to identify sentinel nodes as a single agent in clinically node-negative breast cancer patients. Patients received a single intradermal injection overlying the tumor of either 18.5 MBq (0.5 mCi) of 99m Tc-tilmanocept on the day of surgery or 74.0 MBq (2.0 mCi) on the day before surgery by a radiologist. Immediate 3-view lymphoscintigraphy was performed. Intraoperatively, SLNs were identified with a portable γ-probe. A node was classified as hot if the count (per second) of the node was more than 3 times the background count. Descriptive statistics are reported. Results: Nineteen patients underwent SLN biopsy with single-agent 99m Tc-tilmanocept. Immediate lymphoscintigraphy identified at least 1 sentinel node in 13 of 17 patients (76.5%). Intraoperatively, at least 1 (mean, 1.7 ± 0.8; range, 1-3) hot node was identified in all patients. Three patients (15.8%) had 1 disease-positive SLN. Conclusion: In this small, retrospective pilot study, 99m Tc-tilmanocept performed well as a single agent for intraoperative sentinel node identification in breast cancer. A larger, randomized clinical trial is warranted to compare 99m Tc-tilmanocept as a single agent with other radiopharmaceuticals for sentinel node identification in breast cancer. © 2017 by the Society of Nuclear Medicine and Molecular Imaging.

Telocytes in Crohn’s disease

PubMed Central

Milia, Anna Franca; Ruffo, Martina; Manetti, Mirko; Rosa, Irene; Conte, Dalila; Fazi, Marilena; Messerini, Luca; Ibba-Manneschi, Lidia

2013-01-01

Crohn’s disease (CD) is a relapsing chronic inflammatory disorder that may involve all the gastrointestinal tract with a prevalence of terminal ileum. Intestinal lesions have a characteristic discontinuous and segmental distribution and may affect all layers of the gut wall. Telocytes (TC), a peculiar type of stromal cells, have been recently identified in a variety of tissues and organs, including gastrointestinal tract of humans and mammals. Several roles have been proposed for TC, including mechanical support, spatial relationships with different cell types, intercellular signalling and modulation of intestinal motility. The aim of our study was to investigate the presence and distribution of TC in disease-affected and -unaffected ileal specimens from CD patients compared with controls. TC were identified by CD34/PDGFRα immunohistochemistry. In affected CD specimens TC disappeared, particularly where fibrosis and architectural derangement of the intestinal wall were observed. In the thickened muscularis mucosae and submucosa, few TC entrapped in the fibrotic extracellular matrix were found. A discontinuous network of TC was present around smooth muscle bundles, ganglia and enteric strands in the altered muscularis propria. At the myenteric plexus, the loss of TC network was paralleled by the loss of interstitial cells of Cajal network. In the unaffected CD specimens, TC were preserved in their distribution. Our results suggest that in CD the loss of TC might have important pathophysiological implications contributing to the architectural derangement of the intestinal wall and gut dysmotility. Further functional studies are necessary to better clarify the role of TC loss in CD pathophysiology. PMID:24251911

A novel homozygous missense variant in NECTIN4 (PVRL4) causing ectodermal dysplasia cutaneous syndactyly syndrome.

PubMed

Ahmad, Farooq; Nasir, Abdul; Thiele, Holger; Umair, Muhammad; Borck, Guntram; Ahmad, Wasim

2018-02-12

Ectodermal dysplasia syndactyly syndrome 1 (EDSS1) is a rare form of ectodermal dysplasia including anomalies of hair, nails, and teeth along with bilateral cutaneous syndactyly of hands and feet. In the present report, we performed a clinical and genetic characterization of a consanguineous Pakistani family with four individuals affected by EDSS1. We performed exome sequencing using DNA of one affected individual. Exome data analysis identified a novel homozygous missense variant (c.242T>C; p.(Leu81Pro)) in NECTIN4 (PVRL4). Sanger sequencing validated this variant and confirmed its cosegregation with the disease phenotype in the family members. Thus, our report adds a novel variant to the NECTIN4 mutation spectrum and contributes to the NECTIN4-related clinical characterization. © 2018 John Wiley & Sons Ltd/University College London.

Reidentification of Ebola Virus E718 and ME as Ebola Virus/H.sapiens-tc/COD/1976/Yambuku-Ecran.

PubMed

Kuhn, Jens H; Lofts, Loreen L; Kugelman, Jeffrey R; Smither, Sophie J; Lever, Mark S; van der Groen, Guido; Johnson, Karl M; Radoshitzky, Sheli R; Bavari, Sina; Jahrling, Peter B; Towner, Jonathan S; Nichol, Stuart T; Palacios, Gustavo

2014-11-20

Ebola virus (EBOV) was discovered in 1976 around Yambuku, Zaire. A lack of nomenclature standards resulted in a variety of designations for each isolate, leading to confusion in the literature and databases. We sequenced the genome of isolate E718/ME/Ecran and unified the various designations under Ebola virus/H.sapiens-tc/COD/1976/Yambuku-Ecran. Copyright © 2014 Kuhn et al.

Characterization of a stearoyl-acyl carrier protein desaturase gene family from chocolate tree, Theobroma cacao L

PubMed Central

Zhang, Yufan; Maximova, Siela N.; Guiltinan, Mark J.

2015-01-01

In plants, the conversion of stearoyl-ACP to oleoyol-ACP is catalyzed by a plastid-localized soluble stearoyl-acyl carrier protein (ACP) desaturase (SAD). The activity of SAD significantly impacts the ratio of saturated and unsaturated fatty acids, and is thus a major determinant of fatty acid composition. The cacao genome contains eight putative SAD isoforms with high amino acid sequence similarities and functional domain conservation with SAD genes from other species. Sequence variation in known functional domains between different SAD family members suggested that these eight SAD isoforms might have distinct functions in plant development, a hypothesis supported by their diverse expression patterns in various cacao tissues. Notably, TcSAD1 is universally expressed across all the tissues, and its expression pattern in seeds is highly correlated with the dramatic change in fatty acid composition during seed maturation. Interestingly, TcSAD3 and TcSAD4 appear to be exclusively and highly expressed in flowers, functions of which remain unknown. To test the function of TcSAD1 in vivo, transgenic complementation of the Arabidopsis ssi2 mutant was performed, demonstrating that TcSAD1 successfully rescued all AtSSI2 related phenotypes further supporting the functional orthology between these two genes. The identification of the major SAD gene responsible for cocoa butter biosynthesis provides new strategies for screening for novel genotypes with desirable fatty acid compositions, and for use in breeding programs to help pyramid genes for quality and other traits such as disease resistance. PMID:25926841

Molecular Epidemiology of Human Oral Chagas Disease Outbreaks in Colombia

PubMed Central

Ramírez, Juan David; Montilla, Marleny; Cucunubá, Zulma M.; Floréz, Astrid Carolina; Zambrano, Pilar; Guhl, Felipe

2013-01-01

Background Trypanosoma cruzi, the causative agent of Chagas disease, displays significant genetic variability revealed by six Discrete Typing Units (TcI-TcVI). In this pathology, oral transmission represents an emerging epidemiological scenario where different outbreaks associated to food/beverages consumption have been reported in Argentina, Bolivia, Brazil, Ecuador and Venezuela. In Colombia, six human oral outbreaks have been reported corroborating the importance of this transmission route. Molecular epidemiology of oral outbreaks is barely known observing the incrimination of TcI, TcII, TcIV and TcV genotypes. Methodology and Principal Findings High-throughput molecular characterization was conducted performing MLMT (Multilocus Microsatellite Typing) and mtMLST (mitochondrial Multilocus Sequence Typing) strategies on 50 clones from ten isolates. Results allowed observing the occurrence of TcI, TcIV and mixed infection of distinct TcI genotypes. Thus, a majority of specific mitochondrial haplotypes and allelic multilocus genotypes associated to the sylvatic cycle of transmission were detected in the dataset with the foreseen presence of mitochondrial haplotypes and allelic multilocus genotypes associated to the domestic cycle of transmission. Conclusions These findings suggest the incrimination of sylvatic genotypes in the oral outbreaks occurred in Colombia. We observed patterns of super-infection and/or co-infection with a tailored association with the severe forms of myocarditis in the acute phase of the disease. The transmission dynamics of this infection route based on molecular epidemiology evidence was unraveled and the clinical and biological implications are discussed. PMID:23437405

A Novel Point Mutation at Position 156 of Reverse Transcriptase from Feline Immunodeficiency Virus Confers Resistance to the Combination of (−)-β-2′,3′-Dideoxy-3′-Thiacytidine and 3′-Azido-3′-Deoxythymidine

PubMed Central

Smith, Robert A.; Remington, Kathryn M.; Preston, Bradley D.; Schinazi, Raymond F.; North, Thomas W.

1998-01-01

Mutants of feline immunodeficiency virus (FIV) resistant to (−)-β-2′,3′-dideoxy-3′-thiacytidine (3TC) were selected by culturing virus in the presence of increasing stepwise concentrations of 3TC. Two plaque-purified variants were isolated from the original mutant population, and both of these mutants were resistant to 3TC. Surprisingly, these mutants were also phenotypically resistant to 3′-azido-3′-deoxythymidine (AZT) and to the combination of 3TC and AZT. Purified reverse transcriptase (RT) from one of these plaque-purified mutants was resistant to the 5′-triphosphates of 3TC and AZT. DNA sequence analysis of the RT-encoding region of the pol gene amplified from the plaque-purified mutants revealed a Pro-to-Ser mutation at position 156 of RT. A site-directed mutant of FIV engineered to contain this Pro-156-Ser mutation was resistant to 3TC, AZT, and the combination of 3TC and AZT, confirming the role of the Pro-156-Ser mutation in the resistance of FIV to these two nucleoside analogs. This represents the first report of a lentiviral mutant resistant to the combination of AZT and 3TC due to a single, unique point mutation. PMID:9499094

Biological behavior of different Trypanosoma cruzi isolates circulating in an endemic area for Chagas disease in the Gran Chaco region of Argentina.

PubMed

Ragone, Paula G; Pérez Brandán, Cecilia; Padilla, Angel M; Monje Rumi, Mercedes; Lauthier, Juan J; Alberti D'Amato, Anahí M; Tomasini, Nicolás; Cimino, Ruben O; Romero, Nélida M; Portelli, Marcela; Nasser, Julio R; Basombrío, Miguel A; Diosque, Patricio

2012-09-01

The biological behavior of the different Trypanosoma cruzi strains is still unclear and the importance of exploring the relevance of these differences in natural isolates is of great significance. Herein we describe the biological behavior of four T. cruzi isolates circulating sympatrically in a restricted geographic area in Argentina endemic for Chagas Disease. These isolates were characterized as belonging to the Discrete Typing Units (DTUs) TcI, TcIII, TcV and TcVI as shown by Multilocus Enzyme Electrophoresis and Multilocus Sequence Typing. In order to study the natural behavior of the different isolates and to preserve their natural properties, we developed a vector transmission model that allows their maintenance in the laboratory. The model consisted of serial passages of these parasites between insect vectors and mice. Vector-derived parasite forms were then inoculated in C57BL/6J mice and number of parasite in peripheral blood, serological response and histological damage in acute and chronic phases of the infection were measured. Parasites from DTUs TcI, TcIII and TcVI were detected by direct fresh blood examination, while TcV parasites could only be detected by Polimerase Chain Reaction. No significant difference in the anti-T. cruzi antibody response was found during the chronic phase of infection, except for mice infected with TcV parasites where no antibodies could be detected. Histological sections showed that TcI isolate produced more damage in skeletal muscle while TcVI induced more inflammation in the heart. This work shows differential biological behavior among different parasite isolates obtained from the same cycle of transmission, permitting the opportunity to formulate future hypotheses of clinical and epidemiological importance. Copyright © 2012 Elsevier B.V. All rights reserved.

Secrets of soil survival revealed by the genome sequence of Arthrobacter aurescens TC1.

PubMed

Mongodin, Emmanuel F; Shapir, Nir; Daugherty, Sean C; DeBoy, Robert T; Emerson, Joanne B; Shvartzbeyn, Alla; Radune, Diana; Vamathevan, Jessica; Riggs, Florenta; Grinberg, Viktoria; Khouri, Hoda; Wackett, Lawrence P; Nelson, Karen E; Sadowsky, Michael J

2006-12-01

Arthrobacter sp. strains are among the most frequently isolated, indigenous, aerobic bacterial genera found in soils. Member of the genus are metabolically and ecologically diverse and have the ability to survive in environmentally harsh conditions for extended periods of time. The genome of Arthrobacter aurescens strain TC1, which was originally isolated from soil at an atrazine spill site, is composed of a single 4,597,686 basepair (bp) circular chromosome and two circular plasmids, pTC1 and pTC2, which are 408,237 bp and 300,725 bp, respectively. Over 66% of the 4,702 open reading frames (ORFs) present in the TC1 genome could be assigned a putative function, and 13.2% (623 genes) appear to be unique to this bacterium, suggesting niche specialization. The genome of TC1 is most similar to that of Tropheryma, Leifsonia, Streptomyces, and Corynebacterium glutamicum, and analyses suggest that A. aurescens TC1 has expanded its metabolic abilities by relying on the duplication of catabolic genes and by funneling metabolic intermediates generated by plasmid-borne genes to chromosomally encoded pathways. The data presented here suggest that Arthrobacter's environmental prevalence may be due to its ability to survive under stressful conditions induced by starvation, ionizing radiation, oxygen radicals, and toxic chemicals.

Whole exome sequencing is necessary to clarify ID/DD cases with de novo copy number variants of uncertain significance: Two proof-of-concept examples.

PubMed

Giorgio, Elisa; Ciolfi, Andrea; Biamino, Elisa; Caputo, Viviana; Di Gregorio, Eleonora; Belligni, Elga Fabia; Calcia, Alessandro; Gaidolfi, Elena; Bruselles, Alessandro; Mancini, Cecilia; Cavalieri, Simona; Molinatto, Cristina; Cirillo Silengo, Margherita; Ferrero, Giovanni Battista; Tartaglia, Marco; Brusco, Alfredo

2016-07-01

Whole exome sequencing (WES) is a powerful tool to identify clinically undefined forms of intellectual disability/developmental delay (ID/DD), especially in consanguineous families. Here we report the genetic definition of two sporadic cases, with syndromic ID/DD for whom array-Comparative Genomic Hybridization (aCGH) identified a de novo copy number variant (CNV) of uncertain significance. The phenotypes included microcephaly with brachycephaly and a distinctive facies in one proband, and hypotonia in the legs and mild ataxia in the other. WES allowed identification of a functionally relevant homozygous variant affecting a known disease gene for rare syndromic ID/DD in each proband, that is, c.1423C>T (p.Arg377*) in the Trafficking Protein Particle Complex 9 (TRAPPC9), and c.154T>C (p.Cys52Arg) in the Very Low Density Lipoprotein Receptor (VLDLR). Four mutations affecting TRAPPC9 have been previously reported, and the present finding further depicts this syndromic form of ID, which includes microcephaly with brachycephaly, corpus callosum hypoplasia, facial dysmorphism, and overweight. VLDLR-associated cerebellar hypoplasia (VLDLR-CH) is characterized by non-progressive congenital ataxia and moderate-to-profound intellectual disability. The c.154T>C (p.Cys52Arg) mutation was associated with a very mild form of ataxia, mild intellectual disability, and cerebellar hypoplasia without cortical gyri simplification. In conclusion, we report two novel cases with rare causes of autosomal recessive ID, which document how interpreting de novo array-CGH variants represents a challenge in consanguineous families; as such, clinical WES should be considered in diagnostic testing. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

Discrete typing units of Trypanosoma cruzi identified in rural dogs and cats in the humid Argentinean Chaco

PubMed Central

ENRIQUEZ, G.F.; CARDINAL, M.V.; OROZCO, M.M.; LANATI, L.; SCHIJMAN, A.G.; GÜRTLER, R.E.

2013-01-01

SUMMARY The discrete typing units (DTUs) of Trypanosoma cruzi that infect domestic dogs and cats have rarely been studied. With this purpose we conducted a cross-sectional xenodiagnostic survey of dog and cat populations residing in two infested rural villages in Pampa del Indio, in the humid Argentine Chaco. Parasites were isolated by culture from 44 dogs and 12 cats with a positive xenodiagnosis. DTUs were identified from parasite culture samples using a strategy based on multiple polymerase-chain reactions. TcVI was identified in 37 of 44 dogs and in 10 of 12 cats, whereas TcV was identified in five dogs and in two cats –a new finding for cats. No mixed infections were detected. The occurrence of two dogs infected with TcIII –classically found in armadillos– suggests a probable link with the local sylvatic transmission cycle involving Dasypus novemcinctus armadillos and a potential risk of human infection with TcIII. Our study reinforces the importance of dogs and cats as domestic reservoir hosts and sources of various DTUs infecting humans, and suggests a link between dogs and the sylvatic transmission cycle of TcIII. PMID:23058180

Cholesterol negatively regulates IL-9-producing CD8+ T cell differentiation and antitumor activity.

PubMed

Ma, Xingzhe; Bi, Enguang; Huang, Chunjian; Lu, Yong; Xue, Gang; Guo, Xing; Wang, Aibo; Yang, Maojie; Qian, Jianfei; Dong, Chen; Yi, Qing

2018-05-09

CD8 + T cells can be polarized into IL-9-secreting (Tc9) cells. We previously showed that adoptive therapy using tumor-specific Tc9 cells generated stronger antitumor responses in mouse melanoma than classical Tc1 cells. To understand why Tc9 cells exert stronger antitumor responses, we used gene profiling to compare Tc9 and Tc1 cells. Tc9 cells expressed different levels of cholesterol synthesis and efflux genes and possessed significantly lower cholesterol content than Tc1 cells. Unique to Tc9, but not other CD8 + or CD4 + T cell subsets, manipulating cholesterol content in polarizing Tc9 cells significantly affected IL-9 expression and Tc9 differentiation and antitumor response in vivo. Mechanistic studies showed that IL-9 was indispensable for Tc9 cell persistence and antitumor effects, and cholesterol or its derivatives inhibited IL-9 expression by activating liver X receptors (LXRs), leading to LXR Sumoylation and reduced p65 binding to Il9 promoter. Our study identifies cholesterol as a critical regulator of Tc9 cell differentiation and function. © 2018 Ma et al.

Trypanosoma cruzi diversity in the Gran Chaco: mixed infections and differential host distribution of TcV and TcVI.

PubMed

Monje-Rumi, María M; Brandán, Cecilia Pérez; Ragone, Paula G; Tomasini, Nicolás; Lauthier, Juan J; Alberti D'Amato, Anahí M; Cimino, Rubén O; Orellana, Viviana; Basombrío, Miguel A; Diosque, Patricio

2015-01-01

The transmission cycles of Trypanosoma cruzi in the Gran Chaco are complex networks involving domestic and wild components, whose interrelationships are not well understood. Knowing the circuit of transmission of the different Discrete Typing Units (DTUs) of T. cruzi in the complex environment of the Chaco region is relevant to understanding how the different components (reservoirs, vectors, ecotopes) interact. In the present study we identified the DTUs infecting humans and dogs in two rural areas of the Gran Chaco in Argentina, using molecular methods which avoid parasite culture. Blood samples of humans and dogs were typified by PCR-DNA blotting and hybridization assays with five specific DNA probes (TcI, TcII, TcIII, TcV and TcVI). PCR analyses were performed on seropositive human and dog samples and showed the presence of T. cruzi DNA in 41.7% (98/235) and 53% (35/66) samples, respectively. The identification of infective DTUs was determined in 83.6% (82/98) and 91.4% (32/35) in human and dog samples, respectively. Single infections (36.7% - 36/98) and a previously not detected high proportion of mixed infections (47.9% - 47/98) were found. In a 15.3% (15/98) of samples the infecting DTU was not identified. Among the single infections TcV was the most prevalent DTU (30.6% - 30/98) in human samples; while TcVI (42.8% - 15/35) showed the highest prevalence in dog samples. TcV/TcVI was the most prevalent mixed infection in humans (32.6% - 32/98); and TcI/TcVI (14.3% - 5/35) in dogs. Significant associations between TcV with humans and TcVI with dogs were detected. For the first time, the presence of TcIII was detected in humans from this region. The occurrence of one human infected whit TcIII (a principally wild DTU) could be suggested the emergence of this, in domestic cycles in the Gran Chaco. Copyright © 2014 Elsevier B.V. All rights reserved.

Clinicopathological features of 22C3 PD-L1 expression with mismatch repair, Epstein-Barr virus status, and cancer genome alterations in metastatic gastric cancer.

PubMed

Kawazoe, Akihito; Shitara, Kohei; Kuboki, Yasutoshi; Bando, Hideaki; Kojima, Takashi; Yoshino, Takayuki; Ohtsu, Atsushi; Ochiai, Atsushi; Togashi, Yosuke; Nishikawa, Hiroyoshi; Doi, Toshihiko; Kuwata, Takeshi

2018-06-01

Recently, the U.S. Food and Drug Administration approved pembrolizumab for patients (pts) with PD-L1-positive metastatic gastric cancer (MGC) based on 22C3 immunohistochemistry (IHC) assay. However, little is known about detailed clinicopathological features of 22C3 PD-L1 expression in MGC. Pts with histologically confirmed MGC were eligible for this prospective observational study. PD-L1 expression (22C3) on tumor cell (TC) or immune cell (IC) and mismatch repair (MMR) were analyzed by IHC. Epstein-Barr virus (EBV) was detected by in situ hybridization. The expressions of tyrosine kinase receptors (RTKs) and cancer genome alterations were evaluated by IHC or next-generation sequencing. A total of 225 pts were analyzed in this study. PD-L1 expression on TC, PD-L1 on IC, MMR-deficient (D-MMR), and EBV positivity were identified in 8.4, 65.3, 6.2, and 6.2% cases, respectively. PD-L1 expression in TC was more frequently observed in pts with D-MMR (P < 0.001), PIK3CA mutation (P = 0.020), and KRAS mutation (P = 0.002), and PD-L1 on IC was associated with EBV positivity (P = 0.034), and lymph-node metastasis (P < 0.001). PD-L1 expression on either IC or TC was less frequently observed in pts with peritoneal metastasis and Borrmann Type 4. A significant association was not observed between PD-L1 expression and RTKs expression or presence of other gene alterations. PD-L1 expression on either TC or IC was not prognostic factor. 22C3 PD-L1 expression in MGC was associated with distinct clinicopathological features, but was not a prognostic factor.

Clinical and virologic follow-up in perinatally HIV-1-infected children and adolescents in Madrid with triple-class antiretroviral drug-resistant viruses.

PubMed

Rojas Sánchez, P; de Mulder, M; Fernandez-Cooke, E; Prieto, L; Rojo, P; Jiménez de Ory, S; José Mellado, M; Navarro, M; Tomas Ramos, J; Holguín, Á

2015-06-01

Drug resistance mutations compromise the success of antiretroviral treatment in human immunodeficiency virus type 1 (HIV-1)-infected children. We report the virologic and clinical follow-up of the Madrid cohort of perinatally HIV-infected children and adolescents after the selection of triple-class drug-resistant mutations (TC-DRM). We identified patients from the cohort carrying HIV-1 variants with TC-DRM to nucleoside reverse transcriptase inhibitors, nonnucleoside reverse transcriptase inhibitors and protease inhibitors according to IAS-USA-2013. We recovered pol sequences or resistance profiles from 2000 to 2011 and clinical-immunologic-virologic data from the moment of TC-DRM detection until December 2013. Viruses harbouring TC-DRM were observed in 48 (9%) of the 534 children and adolescents from 2000 to 2011, rising to 24.4% among those 197 with resistance data. Among them, 95.8% were diagnosed before 2003, 91.7% were Spaniards, 89.6% carried HIV-1-subtype B and 75% received mono/dual therapy as first regimen. The most common TC-DRM present in ≥50% of them were D67NME, T215FVY, M41L and K103N (retrotranscriptase) and L90M (protease). The susceptibility to darunavir, tipranavir, etravirine and rilpivirine was 67.7%, 43.7%, 33.3% and 33.3%, respectively, and all reported high resistance to didanosine, abacavir and nelfinavir. Despite the presence of HIV-1 resistance mutations to the three main antiretroviral families in our paediatric cohort, some drugs maintained their susceptibility, mainly the new protease inhibitors (tipranavir and darunavir) and nonnucleoside reverse transcriptase inhibitors (etravirine and rilpivirine). These data will help to improve the clinical management of HIV-infected children with triple resistance in Spain. Copyright © 2015 European Society of Clinical Microbiology and Infectious Diseases. Published by Elsevier Ltd. All rights reserved.

Characterization of the M32 metallocarboxypeptidase of Trypanosoma brucei: differences and similarities with its orthologue in Trypanosoma cruzi

PubMed Central

Frasch, Alejandra P.; Carmona, Adriana K.; Juliano, Luiz; Cazzulo, Juan J.; Niemirowicz, Gabriela T.

2012-01-01

Metallocarboxypeptidases (MCP) of the M32 family of peptidases have been identified in a number of prokaryotic organisms but they are absent from eukaryotic genomes with the remarkable exception of those of trypanosomatids. The genome of Trypanosoma brucei, the causative agent of Sleeping Sickness, encodes one such MCP which displays 72% identity to the characterized TcMCP-1 from Trypanosoma cruzi. As its orthologue, TcMCP-1, Trypanosoma brucei MCP is a cytosolic enzyme expressed in both major stages of the parasite. Purified recombinant TbMCP-1 exhibits a significant hydrolytic activity against the carboxypeptidase B substrate FA (furylacryloil)-Ala-Lys at pH 7.0–7.8 resembling the T. cruzi enzyme. S everal divalent cations had little effect on TbMCP-1 activity but increasing amounts of Co2+ inhibited the enzyme. Despite having similar tertiary structure, both protozoan MCPs display different substrate specificity with respect to P1 position. Thus, TcMCP-1 enzyme cleaved Abz-FVK-(Dnp)-OH substrate (where Abz: o-aminobenzoic acid and Dnp: 2,4-dinitrophenyl) whereas TbMCP-1 had no activity on this substrate. Comparative homology models and sequence alignments using TcMCP-1 as a template led us to map several residues that could explain this difference. To verify this hypothesis, site-directed mutagenesis was undertaken replacing the TbMCP-1 residues by those present in TcMCP-1. We found that the substitution A414M led TbMCP-1 to gain activity on Abz-FVK-(Dnp)-OH, thus showing that this residue is involved in specificity determination, probably being part of the S1 sub-site. Moreover, the activity of both protozoan MCPs was explored on two vasoactive compounds such as bradykinin and angiotensin I resulting in two different hydrolysis patterns. PMID:22575602

Optimizing MR imaging-guided navigation for focused ultrasound interventions in the brain

NASA Astrophysics Data System (ADS)

Werner, B.; Martin, E.; Bauer, R.; O'Gorman, R.

2017-03-01

MR imaging during transcranial MR imaging-guided Focused Ultrasound surgery (tcMRIgFUS) is challenging due to the complex ultrasound transducer setup and the water bolus used for acoustic coupling. Achievable image quality in the tcMRIgFUS setup using the standard body coil is significantly inferior to current neuroradiologic standards. As a consequence, MR image guidance for precise navigation in functional neurosurgical interventions using tcMRIgFUS is basically limited to the acquisition of MR coordinates of salient landmarks such as the anterior and posterior commissure for aligning a stereotactic atlas. Here, we show how improved MR image quality provided by a custom built MR coil and optimized MR imaging sequences can support imaging-guided navigation for functional tcMRIgFUS neurosurgery by visualizing anatomical landmarks that can be integrated into the navigation process to accommodate for patient specific anatomy.

Sequence variations in the osteoprotegerin gene promoter in patients with postmenopausal osteoporosis.

PubMed

Arko, B; Prezelj, J; Komel, R; Kocijancic, A; Hudler, P; Marc, J

2002-09-01

Osteoprotegerin (OPG) is a recently discovered member of the TNF receptor superfamily that acts as an important paracrine regulator of bone remodeling. OPG knockout mice develop severe osteoporosis, whereas administration of OPG can prevent ovariectomy-induced bone loss. These findings implicate a role for OPG in the development of osteoporosis. In the present study, we screened the OPG gene promoter for sequence variations and examined their association with bone mineral density (BMD) in 103 osteoporotic postmenopausal women. Single-strand conformation polymorphism analysis followed by DNA sequencing revealed a presence of four nucleotide substitutions: 209 G-->A, 245 T-->G, 889 C-->T, and 950 T-->C. The frequencies of genotypes were as follows: GG (89.3%), GA (10.7%) for 209 G-->A polymorphism; TT (89.3%), TG (10.7%) for 245 T-->G polymorphism; and TT (25.2%), TC (53.4%), CC (21.4%) for 950 T-->C polymorphism. Substitution 889 C-->T was found in only two patients. Statistically significant association of genotypes with BMD at the lumbar spine (P = 0.005) was observed for 209 G-->A and 245 T-->G polymorphisms. Haplotype GATG was associated with lower BMD as compared with GGTT haplotype. Our results suggest that 209 G-->A and 245 T-->G polymorphisms in the OPG gene promoter may contribute to the genetic regulation of BMD.

Localization of hemorrhage in a recurrent hemothorax using Tc-99m-sulfur colloid

DOE Office of Scientific and Technical Information (OSTI.GOV)

Taillefer, R.; Essiambre, R.; Lemieux, R.

1981-05-01

Tc99m-sulfur colloid scintigraphy has proven clinically useful in identifying gastrointestinal hemorrhages. The authors describe a patient with recurrent hemothorax under oral anticoagulation therapy in which Tc-99m-sulfur colloid imaging was used to determine the site of bleeding.

Two missense mutations in melanocortin 1 receptor (MC1R) are strongly associated with dark ventral coat color in reindeer (Rangifer tarandus).

PubMed

Våge, D I; Nieminen, M; Anderson, D G; Røed, K H

2014-10-01

The protein-coding region of melanocortin 1 receptor (MC1R) was sequenced to identify potential variation affecting coat color in reindeer (Rangifer tarandus). A T→C sequence variation at nucleotide position 218 (c.218T>C) causing an amino acid (aa) change from methionine to threonine at aa position 73 (p.Met73Thr) was identified. In addition, a T→G sequence variation was found at nucleotide position 839 (c.839T>G), causing phenylalanine to be exchanged by cysteine at aa position 280 (p.Phe280Cys). The two sequence variants (c.218C and c.839G) were found to be closely associated with a darker belly coat compared with animals not having any of these two variants. The aa acid change p.Met73Thr affects the same position as p.Met73Lys previously reported to give constitutive activation of MC1R in black sheep (Ovis aries), whereas p.Phe280Cys is identical to one of two variants previously reported to be associated with dark coat color in Arctic fox (Alopex lagopus), supporting that the two variants found in reindeer are functional. The complete absence of Thr73 and Cys280 among the 51 wild reindeer analyzed provides some evidence that these variants are more common in the domestic herds. © 2014 Stichting International Foundation for Animal Genetics.

Novel domain-specific POU3F4 mutations are associated with X-linked deafness: examples from different populations.

PubMed

Bademci, Guney; Lasisi, Akeem; Yariz, Kemal O; Montenegro, Paola; Menendez, Ibis; Vinueza, Rodrigo; Paredes, Rosario; Moreta, Germania; Subasioglu, Asli; Blanton, Susan; Fitoz, Suat; Incesulu, Armagan; Sennaroglu, Levent; Tekin, Mustafa

2015-02-25

Mutations in the POU3F4 gene cause X-linked deafness type 3 (DFN3), which is characterized by inner ear anomalies. Three Turkish, one Ecuadorian, and one Nigerian families were included based on either inner ear anomalies detected in probands or X-linked family histories. Exome sequencing and/or Sanger sequencing were performed in order to identify the causative DNA variants in these families. Four novel, c.707A>C (p.(Glu236Ala)), c.772delG (p.(Glu258ArgfsX30)), c.902C>T (p.(Pro301Leu)), c.987T>C (p.(Ile308Thr)), and one previously reported mutation c.346delG (p.(Ala116ProfsX26)) in POU3F4, were identified. All mutations identified are predicted to affect the POU-specific or POU homeo domains of the protein and co-segregated with deafness in all families. Expanding the spectrum of POU3F4 mutations in different populations along with their associated phenotypes provides better understanding of their clinical importance and will be helpful in clinical evaluation and counseling of the affected individuals.

Mosaicism in HIF2A-related polycythemia-paraganglioma syndrome.

PubMed

Buffet, Alexandre; Smati, Sarra; Mansuy, Ludovic; Ménara, Mélanie; Lebras, Maëlle; Heymann, Marie-Françoise; Simian, Christophe; Favier, Judith; Murat, Arnaud; Cariou, Bertrand; Gimenez-Roqueplo, Anne-Paule

2014-02-01

HIF2A germline mutations were known to cause congenital polycythemia. Recently, HIF2A somatic mutations were found in several patients with polycythemia and paraganglioma, pheochromocytoma, or somatostatinoma, suggesting the occurrence of a de novo postzygotic HIF2A mutation that has not been demonstrated clearly. Patient 1 is a woman suffering from polycythemia diagnosed at the age of 16 years. She was operated on for a pheochromocytoma at 45 years and for two abdominal paragangliomas at 59 years. She was also diagnosed with somatostatinoma. Patient 2 is a young boy who suffered from polycythemia since infancy. He underwent surgery for a nonfunctional adrenal paraganglioma at the age of 9 years. We sequenced by Sanger and next-generation sequencing the HIF2A gene in DNA extracted from tumors, leukocytes, and buccal cells. In patient 1, we identified a somatic HIF2A mutation (c.1586T>C; p.Leu529Pro) in DNA extracted from both paragangliomas. The mutation was detected as a somatic mosaic in DNA extracted from somatostatinoma and was absent from germline DNA. In patient 2, we found an HIF2A heterozygous mutation (c.1625T>C; p.Leu542Pro) in the paraganglioma, but the mutation was also present as a mosaic in leukocyte DNA and in DNA extracted from buccal cells (3.3 and 8.96% of sequencing reads, respectively). Both mutations disrupt the hydroxylation domain of the HIF2α protein. Our study shows that HIF2A-related tumors are caused by postzygotic mutations occurring in early developmental stages. Potential germline mosaicism should be considered during the familial genetic counseling when an individual has been diagnosed with HIF2A-related polycythemia-paraganglioma syndrome.

Trypanosoma cruzi IV Causing Outbreaks of Acute Chagas Disease and Infections by Different Haplotypes in the Western Brazilian Amazonia

PubMed Central

Monteiro, Wuelton Marcelo; Magalhães, Laylah Kelre Costa; de Sá, Amanda Regina Nichi; Gomes, Mônica Lúcia; Toledo, Max Jean de Ornelas; Borges, Lara; Pires, Isa; de Oliveira Guerra, Jorge Augusto; Silveira, Henrique; Barbosa, Maria das Graças Vale

2012-01-01

Background Chagas disease is an emergent tropical disease in the Brazilian Amazon Region, with an increasing number of cases in recent decades. In this region, the sylvatic cycle of Trypanosoma cruzi transmission, which constitutes a reservoir of parasites that might be associated with specific molecular, epidemiological and clinical traits, has been little explored. The objective of this work is to genetically characterize stocks of T. cruzi from human cases, triatomines and reservoir mammals in the State of Amazonas, in the Western Brazilian Amazon. Methodology/Principal Findings We analyzed 96 T. cruzi samples from four municipalities in distant locations of the State of Amazonas. Molecular characterization of isolated parasites from cultures in LIT medium or directly from vectors or whole human blood was performed by PCR of the non-transcribed spacer of the mini-exon and of the 24 S alfa ribosomal RNA gene, RFLP and sequencing of the mitochondrial cytochrome c oxidase subunit II (COII) gene, and by sequencing of the glucose-phosphate isomerase gene. The T. cruzi parasites from two outbreaks of acute disease were all typed as TcIV. One of the outbreaks was triggered by several haplotypes of the same DTU. TcIV also occurred in isolated cases and in Rhodnius robustus. Incongruence between mitochondrial and nuclear phylogenies is likely to be indicative of historical genetic exchange events resulting in mitochondrial introgression between TcIII and TcIV DTUs from Western Brazilian Amazon. TcI predominated among triatomines and was the unique DTU infecting marsupials. Conclusion/Significance DTU TcIV, rarely associated with human Chagas disease in other areas of the Amazon basin, is the major strain responsible for the human infections in the Western Brazilian Amazon, occurring in outbreaks as single or mixed infections by different haplotypes. PMID:22848457

Novel GALNT3 mutations causing hyperostosis-hyperphosphatemia syndrome result in low intact fibroblast growth factor 23 concentrations.

PubMed

Ichikawa, Shoji; Guigonis, Vincent; Imel, Erik A; Courouble, Mélanie; Heissat, Sophie; Henley, John D; Sorenson, Andrea H; Petit, Barbara; Lienhardt, Anne; Econs, Michael J

2007-05-01

Hyperostosis-hyperphosphatemia syndrome (HHS) is a rare metabolic disorder characterized by hyperphosphatemia and localized hyperostosis. HHS is caused by mutations in GALNT3, which encodes UDP-N-acetyl-alpha-D-galactosamine:polypeptide N- acetylgalactosaminyltransferase 3. Familial tumoral calcinosis (TC), characterized by ectopic calcifications and hyperphosphatemia, is caused by mutations in the GALNT3 or fibroblast growth factor 23 (FGF23) genes. Our objective was to identify mutations in FGF23 or GALNT3 and determine serum FGF23 levels in an HHS patient. Mutation detection in FGF23 and GALNT3 was performed by DNA sequencing, and serum FGF23 concentrations were measured by ELISA. A 5-year-old French boy with HHS and his family members participated. The patient presented with painful cortical lesions in his leg. Radiographs of the affected bone showed diaphyseal hyperostosis. The lesional tissue comprised trabeculae of immature, woven bone surrounded by fibrous tissue. Biochemistry revealed elevated phosphate, tubular maximum rate for phosphate reabsorption per deciliter of glomerular filtrate, and 1,25-dihydroxyvitamin D levels. The patient was a compound heterozygote for two novel GALNT3 mutations. His parents and brother were heterozygous for one of the mutations and had no biochemical abnormalities. Intact FGF23 level in the patient was low normal, whereas C-terminal FGF23 was elevated, a pattern similar to TC. The presence of GALNT3 mutations and elevated C-terminal, but low intact serum FGF23, levels in HHS resemble those seen in TC, suggesting that HHS and TC are different manifestations of the same disorder. The absence of biochemical abnormalities in the heterozygous individuals suggests that one normal allele is sufficient for secretion of intact FGF23.

Synthesis and evaluation of Tc-99m-labeled RRL-containing peptide as a non-invasive tumor imaging agent in a mouse fibrosarcoma model.

PubMed

Kim, Dae-Weung; Kim, Woo Hyoung; Kim, Myoung Hyoun; Kim, Chang Guhn

2015-11-01

Arginine-arginine-leucine (RRL) is considered a tumor endothelial cell-specific binding sequence. RRL-containing peptide targeting tumor vessels is an excellent candidate for tumor imaging. In this study, we developed RRL-containing hexapeptides and evaluated their feasibility as a tumor imaging agent in a HT-1080 fibrosarcoma-bearing murine model. The hexapeptide, glutamic acid-cysteine-glycine (ECG)-RRL was synthesized using Fmoc solid-phase peptide synthesis. Radiolabeling efficiency was evaluated using instant thin-layer chromatography. Uptake of Tc-99m ECG-RRL within HT-1080 cells was evaluated in vitro by confocal microscopy and cellular binding affinity was calculated. Gamma images were acquired In HT-1080 fibrosarcoma tumor-bearing mice, and the tumor-to-muscle uptake ratio was calculated. The inflammatory-to-normal muscle uptake ratio was also calculated in an inflammation mouse model. A biodistribution study was performed to calculate %ID/g. A high yield of Tc-99m ECG-RRL complexes was prepared after Tc-99m radiolabeling. Binding of Tc-99m ECG-RRL to tumor cells had was confirmed by in vitro studies. Gamma camera imaging in the murine model showed that Tc-99m ECG-RRL accumulated substantially in the subcutaneously engrafted tumor and that tumoral uptake was blocked by co-injecting excess RRL. Moreover, Tc-99m ECG-RRL accumulated minimally in inflammatory lesions. We successfully developed Tc-99m ECG-RRL as a new tumor imaging candidate. Specific tumoral uptake of Tc-99m ECG-RRL was evaluated both in vitro and in vivo, and it was determined to be a good tumor imaging candidate. Additionally, Tc-99m ECG-RRL effectively distinguished between cancerous tissue and inflammatory lesions.

A Major Facilitator Superfamily protein encoded by TcMucK gene is not required for cuticle pigmentation, growth and development in Tribolium castaneum.

PubMed

Mun, Seulgi; Noh, Mi Young; Osanai-Futahashi, Mizuko; Muthukrishnan, Subbaratnam; Kramer, Karl J; Arakane, Yasuyuki

2014-06-01

Insect cuticle pigmentation and sclerotization (tanning) are vital physiological processes for insect growth, development and survival. We have previously identified several colorless precursor molecules as well as enzymes involved in their biosynthesis and processing to yield the mature intensely colored body cuticle pigments. A recent study indicated that the Bombyx mori (silkmoth) gene, BmMucK, which encodes a protein orthologous to a Culex pipiens quiquefasciatus (Southern house mosquito) cis,cis, muconate transporter, is a member of the "Major Facilitator Superfamily" (MFS) of transporter proteins and is associated with the appearance of pigmented body segments of naturally occurring body color mutants of B. mori. While RNA interference of the BmMucK gene failed to result in any observable phenotype, RNAi using a dsRNA for an orthologous gene from the red flour beetle, Tribolium castaneum, was reported to result in molting defects and darkening of the cuticle and some body parts, leading to the suggestion that orthologs of MucK genes may differ in their functions among insects. To verify the role and essentiality of the ortholog of this gene in development and body pigmentation function in T. castaneum we obtained cDNAs for the orthologous gene (TcMucK) from RNA isolated from the GA-1 wild-type strain of T. castaneum. The sequence of a 1524 nucleotides-long cDNA for TcMucK which encodes the putatively full-length protein, was assembled from two overlapping RT-PCR fragments and the expression profile of this gene during development was analyzed by real-time PCR. This cDNA encodes a 55.8 kDa protein consisting of 507 amino acid residues and includes 11 putative transmembrane segments. Transcripts of TcMucK were detected throughout all of the developmental stages analyzed. The function of this gene was explored by injection of two different double-stranded RNAs targeting different regions of the TcMucK gene (dsTcMucKs) into young larvae to down-regulate transcripts during subsequent stages of insect development until the adult stage. RNA interference of TcMucK had no observable effects on larval, pupal or adult pigmentation. In addition, it did not affect larval-larval, larval-pupal and pupal-adult molting or survival. Thus, in contrast to the results of Zhao et al. (2012), our study demonstrates that TcMucK is not essential for growth, development or cuticle pigmentation of T. castaneum. Copyright © 2014 Elsevier Ltd. All rights reserved.

Proanthocyanidin synthesis in Theobroma cacao: genes encoding anthocyanidin synthase, anthocyanidin reductase, and leucoanthocyanidin reductase

PubMed Central

2013-01-01

Background The proanthocyanidins (PAs), a subgroup of flavonoids, accumulate to levels of approximately 10% total dry weight of cacao seeds. PAs have been associated with human health benefits and also play important roles in pest and disease defense throughout the plant. Results To dissect the genetic basis of PA biosynthetic pathway in cacao (Theobroma cacao), we have isolated three genes encoding key PA synthesis enzymes, anthocyanidin synthase (ANS), anthocyanidin reductase (ANR) and leucoanthocyanidin reductase (LAR). We measured the expression levels of TcANR, TcANS and TcLAR and PA content in cacao leaves, flowers, pod exocarp and seeds. In all tissues examined, all three genes were abundantly expressed and well correlated with PA accumulation levels, suggesting their active roles in PA synthesis. Overexpression of TcANR in an Arabidopsis ban mutant complemented the PA deficient phenotype in seeds and resulted in reduced anthocyanidin levels in hypocotyls. Overexpression of TcANS in tobacco resulted in increased content of both anthocyanidins and PAs in flower petals. Overexpression of TcANS in an Arabidopsis ldox mutant complemented its PA deficient phenotype in seeds. Recombinant TcLAR protein converted leucoanthocyanidin to catechin in vitro. Transgenic tobacco overexpressing TcLAR had decreased amounts of anthocyanidins and increased PAs. Overexpressing TcLAR in Arabidopsis ldox mutant also resulted in elevated synthesis of not only catechin but also epicatechin. Conclusion Our results confirm the in vivo function of cacao ANS and ANR predicted based on sequence homology to previously characterized enzymes from other species. In addition, our results provide a clear functional analysis of a LAR gene in vivo. PMID:24308601

Proanthocyanidin synthesis in Theobroma cacao: genes encoding anthocyanidin synthase, anthocyanidin reductase, and leucoanthocyanidin reductase.

PubMed

Liu, Yi; Shi, Zi; Maximova, Siela; Payne, Mark J; Guiltinan, Mark J

2013-12-05

The proanthocyanidins (PAs), a subgroup of flavonoids, accumulate to levels of approximately 10% total dry weight of cacao seeds. PAs have been associated with human health benefits and also play important roles in pest and disease defense throughout the plant. To dissect the genetic basis of PA biosynthetic pathway in cacao (Theobroma cacao), we have isolated three genes encoding key PA synthesis enzymes, anthocyanidin synthase (ANS), anthocyanidin reductase (ANR) and leucoanthocyanidin reductase (LAR). We measured the expression levels of TcANR, TcANS and TcLAR and PA content in cacao leaves, flowers, pod exocarp and seeds. In all tissues examined, all three genes were abundantly expressed and well correlated with PA accumulation levels, suggesting their active roles in PA synthesis. Overexpression of TcANR in an Arabidopsis ban mutant complemented the PA deficient phenotype in seeds and resulted in reduced anthocyanidin levels in hypocotyls. Overexpression of TcANS in tobacco resulted in increased content of both anthocyanidins and PAs in flower petals. Overexpression of TcANS in an Arabidopsis ldox mutant complemented its PA deficient phenotype in seeds. Recombinant TcLAR protein converted leucoanthocyanidin to catechin in vitro. Transgenic tobacco overexpressing TcLAR had decreased amounts of anthocyanidins and increased PAs. Overexpressing TcLAR in Arabidopsis ldox mutant also resulted in elevated synthesis of not only catechin but also epicatechin. Our results confirm the in vivo function of cacao ANS and ANR predicted based on sequence homology to previously characterized enzymes from other species. In addition, our results provide a clear functional analysis of a LAR gene in vivo.

Preparation and comparative evaluation of 99m Tc-HYNIC-cNGR and 99m Tc-HYNIC-PEG2 -cNGR as tumor-targeting molecular imaging probes.

PubMed

Vats, Kusum; Satpati, Drishty; Sharma, Rohit; Kumar, Chandan; Sarma, Haladhar Dev; Banerjee, Sharmila

2018-02-01

The tripeptide sequence asparagine-glycine-arginine (NGR) specifically recognizes aminopeptidase N (APN or CD13) receptors highly expressed on tumor cells and vasculature. Thus, NGR peptides can precisely deliver therapeutic and diagnostic compounds to CD13 expressing cancer sites. In this regard, 2 NGR peptide ligands, HYNIC-c(NGR) and HYNIC-PEG 2 -c(NGR), were synthesized, radiolabeled with 99m Tc, and evaluated in CD13-positive human fibrosarcoma HT-1080 tumor xenografts. The radiotracers, 99m Tc-HYNIC-c(NGR) and 99m Tc-HYNIC-PEG 2 -c(NGR), could be prepared in approximately 95% radiochemical purity and exhibited excellent in vitro and in vivo stability. The radiotracers were hydrophilic in nature with log P values being -2.33 ± 0.05 and -2.61 ± 0.08. The uptake of 2 radiotracers 99m Tc-HYNIC-c(NGR) and 99m Tc-HYNIC-PEG 2 -c(NGR) was similar in nude mice bearing human fibrosarcoma HT-1080 tumor xenografts, which was significantly reduced (P < .05) during blocking studies. The 2 radiotracers being hydrophilic cleared rapidly from blood, liver, and intestine and were excreted through renal pathway. The pharmacokinetics of 99m Tc-labeled HYNIC peptide could not be modulated through introduction of PEG 2 unit, thus posing a challenge for studies with other linkers towards enhanced tumor uptake and retention. Copyright © 2017 John Wiley & Sons, Ltd.

Assessing Fungal Population in Soil Planted with Cry1Ac and CPTI Transgenic Cotton and Its Conventional Parental Line Using 18S and ITS rDNA Sequences over Four Seasons.

PubMed

Qi, Xiemin; Liu, Biao; Song, Qinxin; Zou, Bingjie; Bu, Ying; Wu, Haiping; Ding, Li; Zhou, Guohua

2016-01-01

Long-term growth of genetically modified plants (GMPs) has raised concerns regarding their ecological effects. Here, FLX-pyrosequencing of region I (18S) and region II (ITS1, 5.8S, and ITS2) rDNA was used to characterize fungal communities in soil samples after 10-year monoculture of one representative transgenic cotton line (TC-10) and 15-year plantation of various transgenic cotton cultivars (TC-15mix) over four seasons. Soil fungal communities in the rhizosphere of non-transgenic control (CC) were also compared. No notable differences were observed in soil fertility variables among CC, TC-10, and TC-15mix. Within seasons, the different estimations were statistically indistinguishable. There were 411 and 2 067 fungal operational taxonomic units in the two regions, respectively. More than 75% of fungal taxa were stable in both CC and TC except for individual taxa with significantly different abundance between TC and CC. Statistical analysis revealed no significant differences between CC and TC-10, while discrimination of separating TC-15mix from CC and TC-10 with 37.86% explained variance in PCoA and a significant difference of Shannon indexes between TC-10 and TC-15mix were observed in region II. As TC-15mix planted with a mixture of transgenic cottons (Zhongmian-29, 30, and 33B) for over 5 years, different genetic modifications may introduce variations in fungal diversity. Further clarification is necessary by detecting the fungal dynamic changes in sites planted in monoculture of various transgenic cottons. Overall, we conclude that monoculture of one representative transgenic cotton cultivar may have no effect on fungal diversity compared with conventional cotton. Furthermore, the choice of amplified region and methodology has potential to affect the outcome of the comparison between GM-crop and its parental line.

Identification of eight mutations and three sequence variations in the cystic fibrosis transmembrane conductance regulator (CFTR) gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ghanem, N.; Costes, B.; Girodon, E.

1994-05-15

To determine cystic fibrosis (CF) defects in a sample of 224 non-[Delta]F508 CF chromosomes, the authors used denaturing gradient gel multiplex analysis of CF transmembrane conductance regulator gene segments, a strategy based on blind exhaustive analysis rather than a search for known mutations. This process allowed detection of 11 novel variations comprising two nonsense mutations (Q890X and W1204X), a splice defect (405 + 4 A [yields] G), a frameshift (3293delA), four presumed missense mutations (S912L, H949Y, L1065P, Q1071P), and three sequence polymorphisms (R31C or 223 C/T, 3471 T/C, and T1220I or 3791 C/T). The authors describe these variations, together withmore » the associated phenotype when defects on both CF chromosomes were identified. 8 refs., 1 fig., 1 tab.« less

Novel SNPs in the exon region of bovine DKK4 gene and their association with body measurement traits in Qinchuan cattle.

PubMed

Gao, J B; Li, Y K; Yang, N; Ma, X H; Adoligbe, C; Jiang, B J; Fu, C Z; Cheng, G; Zan, L S

2013-02-28

The aim of this study was to determine whether single nucleotide polymorphisms (SNPs) of bovine Dickkopf homolog 4 (DKK4) are associated with body measurement traits in Qinchuan cattle. By using PCR-SSCP technology and DNA sequencing, we discovered 5 DKK4 SNPs in Qingchuan cattle, including -65G>A and -77G>T in the 5'-untranslated region, 1532C>G and 1533T>C in exon 2, and 2088C>T in exon 3. The sequencing map showed that 1532C>G and 1533T>C were in close linkage disequilibrium and were treated as 1532C>G-1533T>C in this study. Allele frequencies were calculated and analyzed by the chi-square test, which showed that -65G>A and 1532C>G-1533T>C were in Hardy-Weinberg equilibrium (P > 0.05), whereas -77G>T and 2088C>T were not in all 633 tested Qinchuan cattle individuals (P < 0.01). Gene heterozygosity (HE), effective allele number (NE), and polymorphism information content (PIC) were 0.407, 1.686, and 0.324 at -65G>A; 0.472, 1.894, and 0.361 at -77G>T; 0.476, 1.908, and 0.363 at 1532C>G-1533T>C; and 0.218, 1.279, and 0.195 at 2088C>T. We also evaluated the potential association of these SNPs with body measurement traits in all 633 individuals; the results suggest that several SNPs in Qinchuan cattle DKK4 were significantly associated with body length, hip height, rump length, hip width, heart girth, and pin bone width (P < 0.05 and P < 0.01). These results suggest that bovine DKK4 could be used as candidate gene for Qinchuan cattle breeding.

Isolation of Persicaria minor sesquiterpene synthase promoter and its deletions for transgenic Arabidopsis thaliana

NASA Astrophysics Data System (ADS)

Omar, Aimi Farehah; Ismail, Ismanizan

2016-11-01

Sesquiterpene synthase (SS) catalyzes the formation of sesquiterpenes from farnesyl diphosphate (FDP) via carbocation intermediates. In this study, the promoter region of sesquiterpene synthase was isolated from Persicaria minor to identify possible cis-acting elements in the promoter. The full-length PmSS promoter of P. minor is 1824-bp sequences. The sequence was analyzed and several putative cis-acting regulatory elements were identified. Three cis-acting regulatory elements were selected for deletion analysis which are cis-acting element involved in wound responsiveness (WUN), cis - acting element involved in defense and stress responsiveness (TC) and cis-acting element involved in ABA responsiveness (ABRE). Series of deletions were conducted to assess the promoter activity producing three truncated fragments promoter; Prom 2 1606-bp, Prom 3 1144- bp, and Prom 4 921-bp. The full-length promoter and its deletion series were cloned into the pBGWFS7 vector which contain β-glucuronidase (GUS) gene and green fluorescent protein (GFP) as the reporter gene. All constructs were successfully transformed into Arabidopsis thaliana based on PCR of positive BASTA resistance plants.

Experimental evidences of 95 mTc production in a nuclear reactor.

PubMed

Cohen, I M; Robles, A; Mendoza, P; Airas, R M; Montoya, E H

2018-05-01

95 m Tc has been identified as by-product in some solutions of 99 m Tc obtained by irradiation of molybdenum trioxide in a reactor neutron flux. The characterization was carried out using both measurements by gamma spectrometry and half-life determination. The possible ways that lead to the 95 m Tc production in a nuclear reactor are discussed. Copyright © 2018. Published by Elsevier Ltd.

Trypanosoma cruzi Clone Dm28c Draft Genome Sequence

PubMed Central

Grisard, Edmundo Carlos; Teixeira, Santuza Maria Ribeiro; de Almeida, Luiz Gonzaga Paula; Stoco, Patricia Hermes; Gerber, Alexandra Lehmkuhl; Talavera-López, Carlos; Lima, Oberdan Cunha; Andersson, Björn

2014-01-01

Trypanosoma cruzi affects millions of people worldwide. Clinical variability of Chagas disease can be due to the genetic variability of this parasite, requiring further genome studies. Here we report the genome sequence of the T. cruzi Dm28c clone (TcI), a strain related to the sylvatic cycle of the parasite. PMID:24482508

Telocytes in Crohn's disease.

PubMed

Milia, Anna Franca; Ruffo, Martina; Manetti, Mirko; Rosa, Irene; Conte, Dalila; Fazi, Marilena; Messerini, Luca; Ibba-Manneschi, Lidia

2013-12-01

Crohn's disease (CD) is a relapsing chronic inflammatory disorder that may involve all the gastrointestinal tract with a prevalence of terminal ileum. Intestinal lesions have a characteristic discontinuous and segmental distribution and may affect all layers of the gut wall. Telocytes (TC), a peculiar type of stromal cells, have been recently identified in a variety of tissues and organs, including gastrointestinal tract of humans and mammals. Several roles have been proposed for TC, including mechanical support, spatial relationships with different cell types, intercellular signalling and modulation of intestinal motility. The aim of our study was to investigate the presence and distribution of TC in disease-affected and -unaffected ileal specimens from CD patients compared with controls. TC were identified by CD34/PDGFRα immunohistochemistry. In affected CD specimens TC disappeared, particularly where fibrosis and architectural derangement of the intestinal wall were observed. In the thickened muscularis mucosae and submucosa, few TC entrapped in the fibrotic extracellular matrix were found. A discontinuous network of TC was present around smooth muscle bundles, ganglia and enteric strands in the altered muscularis propria. At the myenteric plexus, the loss of TC network was paralleled by the loss of interstitial cells of Cajal network. In the unaffected CD specimens, TC were preserved in their distribution. Our results suggest that in CD the loss of TC might have important pathophysiological implications contributing to the architectural derangement of the intestinal wall and gut dysmotility. Further functional studies are necessary to better clarify the role of TC loss in CD pathophysiology. © 2013 The Authors. Journal of Cellular and Molecular Medicine published by John Wiley & Sons Ltd and Foundation for Cellular and Molecular Medicine.

Histopathological Effects of the Yen-Tc Toxin Complex from Yersinia entomophaga MH96 (Enterobacteriaceae) on the Costelytra zealandica (Coleoptera: Scarabaeidae) Larval Midgut

PubMed Central

Hares, Michelle C.; Jones, Sandra A.; Harper, Lincoln A.; Vernon, James R.; Harland, Duane P.; Jackson, Trevor A.; Hurst, Mark R. H.

2012-01-01

Yersinia entomophaga MH96, which was originally isolated from the New Zealand grass grub, Costelytra zealandica, produces an orally active proteinaceous toxin complex (Yen-Tc), and this toxin is responsible for mortality in a range of insect species, mainly within the Coleoptera and Lepidoptera. The genes encoding Yen-Tc are members of the toxin complex (Tc) family, with orthologs identified in several other bacterial species. As the mechanism of Yen-Tc activity remains unknown, a histopathological examination of C. zealandica larvae was undertaken in conjunction with cultured cells to identify the effects of Yen-Tc and to distinguish the contributions that its individual subunit components make upon intoxication. A progressive series of events that led to the deterioration of the midgut epithelium was observed. Additionally, experiments using a cell culture assay system were carried out to determine the cellular effects of intoxication on cells after topical application and the transient expression of Yen-Tc and its individual components. While observations were broadly consistent with those previously reported for other Tc family members, some differences were noted. In particular, the distinct stepwise disintegration of the midgut shared features associated with both apoptosis and necrotic programmed cell death pathways. Second, we observed, for the first time, a contribution of toxicity from two chitinases associated with the Yen-Tc complex. Our findings were suggestive of the activities encoded within the subunit components of Yen-Tc targeting different sites along putative programmed cell death pathways. Given the observed broad host range for Yen-Tc, these targeted loci are likely to be widely shared among insects. PMID:22544254

Autosomal Dominant Mutation in the Signal Peptide of Renin in a Kindred with Anemia, Hyperuricemia, and CKD

PubMed Central

Beck, Bodo B.; Trachtman, Howard; Gitman, Michael; Miller, Ilene; Sayer, John A.; Pannes, Andrea; Baasner, Anne; Hildebrandt, Friedhelm; Wolf, Matthias T.F.

2012-01-01

Homozygous or compound heterozygous Renin (REN) mutations cause renal tubular dysgenesis (RTD), which is characterized by death in utero due to renal failure and pulmonary hypoplasia. The phenotype resembles the fetopathy caused by angiotensin-converting enzyme inhibitor or angiotensin receptor blocker intake during pregnancy. Recently, heterozygous REN mutations were shown to result in early-onset hyperuricemia, anemia and chronic renal failure. So far, only three different heterozygous REN mutations were reported. We performed mutation analysis of the REN gene in 39 kindreds with hyperuricemia and chronic kidney disease (CKD) previously tested negative for mutations in the UMOD and HNF1β genes. We identified one kindred with a novel c.28T>C (p.W10R) REN mutation in the signal sequence, concluding that REN mutations are rare events in CKD patients. Affected individuals over four generations were identified carrying the novel REN mutation and were characterized by significant anemia, hyperuricemia and CKD. Anemia was severe and disproportional to the degree of renal impairment. Moreover all heterozygous REN mutations are localized in the signal sequence. Therefore, screening of the REN gene for CKD patients with hyperuricemia and anemia may be focusing on exon 1 sequencing, which encodes the signal peptide. PMID:21903317

Etiologies, predictors and economic impact of readmission within one-month among patients with takotsubo cardiomyopathy.

PubMed

Shah, Mahek; Ram, Pradhum; Lo, Kevin Bryan U; Sirinvaravong, Natee; Patel, Brijesh; Tripathi, Byomesh; Patil, Shantanu; Figueredo, Vincent M

2018-05-03

Limited data exists on readmission among patients with takotsubo cardiomyopathy [TC], a commonly reversible cause of heart failure. We sought to identify etiologies and predictors for readmission among TC patients. We queried the National Readmissions Database for 2013-2014 to identify patients with primary admission for TC using ICD-9CM code 429.83. Patients who were readmitted to the hospital within 1-month post-discharge were further evaluated to identify etiologies, predictors and the resultant economic burden of readmission. Additionally, we analyzed readmission for TC at 6-months. We studied 5,997 patients admitted with TC, of whom 1.2% experienced in-hospital mortality. The median age was 67 years with 91.5% of the studied patients being female. Among survivors, 10.3% of the patients were readmitted within 1-month Twenty-five percent of the initial 1-month readmissions occurred within 4-days, 50% within 10-days and 75% within 20-days from discharge. The commonest etiologies for readmission were cardiac (26%), respiratory (16%) and gastrointestinal (11%) causes. Heart failure was the commonest cardiac etiology. Significant predictors of increased 1-month readmission included systemic thromboembolic events, length of stay ≥3 days, and underlying psychoses. Obesity and private insurance predicted lower 1-month readmission. The annual national cost impact for index admission and 1-month readmissions was ≈112$ million. Recurrent TC was seen among 1.9% of patients readmitted within 6-months. While the overall rate of 1-month readmission following TC is low, associated economic burden from readmission is still significant. Patients are readmitted for mostly non-cardiac causes. Readmission for another episode of TC within six-months was uncommon. This article is protected by copyright. All rights reserved.

Tc-99m tilmanocept versus Tc-99m sulfur colloid in breast cancer sentinel lymph node identification: Results from a randomized, blinded clinical trial.

PubMed

Unkart, Jonathan T; Hosseini, Ava; Wallace, Anne M

2017-12-01

No prior trials have compared sentinel lymph node (SLN) identification outcomes between Tc-99m tilmanocept (TcTM) and Tc-99m sulfur colloid (TcSC) in breast cancer (BC). We report on the secondary outcomes from a randomized, double-blinded, single surgeon clinical trial comparing post-injection site pain between TcTM and TcSC. Patients were randomized to receive a preoperative single, peritumoral intradermal injection of TcTM or TcSC. The number of total, "hot", and blue nodes detected and removed were compared between groups. Fifty-two (27-TcSC and 25-TcTM) patients were enrolled and underwent definitive surgical treatment. At least one "hot" SLN was detected in all patients. Three (5.8%) patients had a disease positive-SLN. The total number of SLNs removed was 61 (mean 2.26 (standard deviation (SD) 0.90)) in the TcSC group and 54 (mean 2.16 (SD 0.90)) in the TcTM group, P = 0.69. The total number of "hot" nodes in the TcSC group was 1.96 (SD 0.76) compared to 2.04 (SD 0.73) in the TcTM group, P = 0.71. The number of identified SLNs did not differ significantly between TcTM and TcSC. Given that no significant technical advantages exist between the two agents, surgeons should choose a radiopharmaceutical based on cost and side effect profile. © 2017 Wiley Periodicals, Inc.

A functional variation in the hypocretin neuropeptide precursor gene may be associated with obstructive sleep apnea syndrome in Japan.

PubMed

Ahmed, Wael A; Tsutsumi, Makiko; Nakata, Seiichi; Mori, Terumi; Nishimura, Yoichi; Fujisawa, Toshiyuki; Kato, Ichiro; Nakashima, Mayuki; Kurahashi, Hiroki; Suzuki, Kenji

2012-04-01

To evaluate the association of hypocretin neuropeptide precursor gene (HCRT) variations with obstructive sleep apnea syndrome (OSAS) in a cohort of Japanese patients and to further evaluate whether the significant HCRT variations have potential functional consequences on HCRT expression. Case-control genetic association study. We studied the genetic variations within the HCRT gene. The study population consisted of 100 OSAS patients and 100 control subjects. The HCRT gene was amplified by polymerase chain reaction in all study subjects followed by direct sequencing and analysis of sequencing data. Two genetic variations within the HCRT intron, IVS1+16T>C (rs9902709) and IVS1-69G>C, were identified with significant differences between patients and controls (P < .05). A reporter gene assay using HeLa cells showed that the construct containing the C allele of the rs9902709 variation had significantly higher luciferase activity compared with the construct containing the T allele (P = .002). Furthermore, enzyme immunoassay revealed that subjects with T/C and C/C genotypes for rs9902709 had 1.4-fold and 1.5-fold increases in sera levels of orexin-A, respectively. Our genetic association study, followed by functional and quantitative phenotyping assays, demonstrated a functional locus within the HCRT gene, which may act to increase HCRT expression and lead to a protective effect against the development of OSAS. Copyright © 2012 The American Laryngological, Rhinological, and Otological Society, Inc.

Ecological scenario and Trypanosoma cruzi DTU characterization of a fatal acute Chagas disease case transmitted orally (Espírito Santo state, Brazil).

PubMed

Dario, Maria Augusta; Rodrigues, Marina Silva; Barros, Juliana Helena da Silva; Xavier, Samanta Cristina das Chagas; D'Andrea, Paulo Sérgio; Roque, André Luiz Rodrigues; Jansen, Ana Maria

2016-08-31

Trypanosoma cruzi infection via oral route results in outbreaks or cases of acute Chagas disease (ACD) in different Brazilian regions and poses a novel epidemiological scenario. In the Espírito Santo state (southeastern Brazil), a fatal case of a patient with ACD led us to investigate the enzootic scenario to avoid the development of new cases. At the studied locality, Triatoma vitticeps exhibited high T. cruzi infection rates and frequently invaded residences. Sylvatic and domestic mammals in the Rio da Prata locality, where the ACD case occurred, and in four surrounding areas (Baia Nova, Buenos Aires, Santa Rita and Todos os Santos) were examined and underwent parasitological and serological tests. Triatomines were collected for a fecal material exam, culturing and mini-exon gene molecular characterization, followed by RFLP-PCR of H3/Alul. Paraffin-embedded cardiac tissue of a patient was washed with xylene to remove paraffin and DNA was extracted using the phenol-chloroform method. For genotype characterization, PCR was performed to amplify the 1f8, GPI and 18S rRNA genes. In the case of V7V8 SSU rRNA, the PCR products were molecularly cloned. PCR products were sequenced and compared to sequences in GenBank. Phylogenetic analysis using maximum likelihood method with 1000 bootstrap replicates was performed. None of the animals showed positive hemocultures. Three rodents and two dogs showed signs of infection, as inferred from borderline serological titers. T. vitticeps was the only triatomine species identified and showed T. cruzi infection by DTUs TcI and TcIV. The analysis of cardiac tissue DNA showed mixed infection by T. cruzi (DTUs I, II, III and IV) and Trypanosoma dionisii. Each case or outbreak of ACD should be analyzed as a particular epidemiological occurrence. The results indicated that mixed infections in humans may play a role in pathogenicity and may be more common than is currently recognized. Direct molecular characterization from biological samples is essential because this procedure avoids parasite selection. T. dionisii may under certain and unknown circumstances infect humans. The distribution of T. cruzi DTUS TcIII and TcIV in Brazilian biomes is broader than has been assumed to date.

Understanding the geographic distribution of tropical cyclone formation for applications in climate models

NASA Astrophysics Data System (ADS)

Tory, Kevin J.; Ye, H.; Dare, R. A.

2018-04-01

Projections of Tropical cyclone (TC) formation under future climate scenarios are dependent on climate model simulations. However, many models produce unrealistic geographical distributions of TC formation, especially in the north and south Atlantic and eastern south Pacific TC basins. In order to improve confidence in projections it is important to understand the reasons behind these model errors. However, considerable effort is required to analyse the many models used in projection studies. To address this problem, a novel diagnostic is developed that provides compelling insight into why TCs form where they do, using a few summary diagrams. The diagnostic is developed after identifying a relationship between seasonal climatologies of atmospheric variables in 34 years of ECMWF reanalysis data, and TC detection distributions in the same data. Geographic boundaries of TC formation are constructed from four threshold quantities. TCs form where Emanuel's Maximum Potential Intensity, V_{{PI}}, exceeds 40 {ms}^{{ - 1}}, 700 hPa relative humidity, RH_{{700}}, exceeds 40%, and the magnitude of the difference in vector winds between 850 and 200 hPa, V_{{sh}}, is less than 20 {ms}^{{ - 1}}. The equatorial boundary is best defined by a composite quantity containing the ratio of absolute vorticity (η ) to the meridional gradient of absolute vorticity (β ^{*}), rather than η alone. {β ^*} is also identified as a potentially important ingredient for TC genesis indices. A comparison of detected Tropical Depression (TD) and Tropical Storm (TS) climatologies revealed TDs more readily intensify further to TS where {V_{PI}} is elevated and {V_{sh}} is relatively weak. The distributions of each threshold quantity identify the factors that favour and suppress TC formation throughout the tropics in the real world. This information can be used to understand why TC formation is poorly represented in some climate models, and shows potential for understanding anomalous TC formation behaviour in the real world.

Characterization of a potentially novel 'blown pack' spoilage bacterium isolated from bovine hide.

PubMed

Moschonas, G; Bolton, D J

2013-03-01

To characterize a psychrotrophic bacterium, designated TC1, previously isolated from a cattle hide in Ireland, and to investigate the ability of this strain to cause 'blown pack' spoilage (BPS) of vacuum-packaged beef primals. TC1 was characterized using a combination of phenotypic, chemotaxonomic and genotypic analyses and was assessed for its ability to spoil vacuum-packaged beef at refrigerated temperatures. TC1 was Gram-positive and formed elliptical subterminal endospores. The strain was able to grow between 0 and 33 °C, with optimal growth between 23 and 24 °C. TC1 could be differentiated from its phylogenetically closest neighbour (Clostridium lituseburense DSM 797(T)) by 16S rRNA gene sequencing, pulsed-field gel electrophoresis and cellular fatty acid composition. TC1 spoiled (BPS) beef within 42 days when inoculated in cold-stored (1 °C) vacuum-packed beef. The phenotypic, chemotaxonomic and genotypic characterization indicated that TC1 may represent a potentially novel, cold-tolerant, gas-producing bacterium of considerable economic significance to the beef industry. This study reports and characterizes an emerging BPS bacterium, which should be considered in future activities designed to minimize the psychrophilic and psychrotrophic spoilage of vacuum-packaged beef. © 2012 The Society for Applied Microbiology.

Ocular and extraocular expression of opsins in the rhopalium of Tripedalia cystophora (Cnidaria: Cubozoa).

PubMed

Bielecki, Jan; Zaharoff, Alexander K; Leung, Nicole Y; Garm, Anders; Oakley, Todd H

2014-01-01

A growing body of work on the neuroethology of cubozoans is based largely on the capabilities of the photoreceptive tissues, and it is important to determine the molecular basis of their light sensitivity. The cubozoans rely on 24 special purpose eyes to extract specific information from a complex visual scene to guide their behavior in the habitat. The lens eyes are the most studied photoreceptive structures, and the phototransduction in the photoreceptor cells is based on light sensitive opsin molecules. Opsins are photosensitive transmembrane proteins associated with photoreceptors in eyes, and the amino acid sequence of the opsins determines the spectral properties of the photoreceptors. Here we show that two distinct opsins (Tripedalia cystophora-lens eye expressed opsin and Tripedalia cystophora-neuropil expressed opsin, or Tc-leo and Tc-neo) are expressed in the Tripedalia cystophora rhopalium. Quantitative PCR determined the level of expression of the two opsins, and we found Tc-leo to have a higher amount of expression than Tc-neo. In situ hybridization located Tc-leo expression in the retinal photoreceptors of the lens eyes where the opsin is involved in image formation. Tc-neo is expressed in a confined part of the neuropil and is probably involved in extraocular light sensation, presumably in relation to diurnal activity.

Sequence change in the HS2-LCR and Ggamma-globin gene promoter region of sickle cell anemia patients.

PubMed

Adorno, E V; Moura-Neto, J P; Lyra, I; Zanette, A; Santos, L F O; Seixas, M O; Reis, M G; Goncalves, M S

2008-02-01

The fetal hemoglobin (HbF) levels and betaS-globin gene haplotypes of 125 sickle cell anemia patients from Brazil were investigated. We sequenced the Ggamma- and Agamma-globin gene promoters and the DNase I-2 hypersensitive sites in the locus control regions (HS2-LCR) of patients with HbF level disparities as compared to their betaS haplotypes. Sixty-four (51.2%) patients had CAR/Ben genotype; 36 (28.8%) Ben/Ben; 18 (14.4%) CAR/CAR; 2 (1.6%) CAR/Atypical; 2 (1.6%) Ben/Cam; 1 (0.8%) CAR/Cam; 1 (0.8%) CAR/Arab-Indian, and 1 (0.8%) Sen/Atypical. The HS2-LCR sequence analyses demonstrated a c.-10.677G>A change in patients with the Ben haplotype and high HbF levels. The Gg gene promoter sequence analyses showed a c.-157T>C substitution shared by all patients, and a c.-222_-225del related to the Cam haplotype. These results identify new polymorphisms in the HS2-LCR and Gg-globin gene promoter. Further studies are required to determine the correlation between HbF synthesis and the clinical profile of sickle cell anemia patients.

Identification of a new C-type lectin, TES-70, secreted by infective larvae of Toxocara canis, which binds to host ligands.

PubMed

Loukas, A; Doedens, A; Hintz, M; Maizels, R M

2000-11-01

Infective larvae of the dog roundworm Toxocara canis survive in the tissues of their hosts for extended periods in a state of developmental arrest, successfully evading immune destruction. This survival strategy is thought to be mediated by T. canis excretory/secretory (TES) products which downregulate or divert the immune response. We purified one of the major TES products, TES-70 and gained amino acid sequence from 4 tryptic peptides. These peptides were matched to a predicted protein from a cDNA that was isolated by expression screening a T. canis cDNA library with mouse anti-TES serum. The predicted protein (Tc-CTL-4) is similar to, but larger than, Tc-CTL-1, a 32-kDa C-type lectin secreted by T. canis larvae. Tc-CTL-4 has a signal peptide, 2 Cys-rich domains and a C-terminal calcium-dependent C-type lectin domain that shares sequence similarity with host immune cell receptors such as macrophage mannose receptor and CD23. The lectin domain was expressed in bacteria and antiserum to the purified recombinant protein was used to confirm that Tc-ctl-4 did encode the native TES-70 glycoprotein. TES-70 selectively bound to ligands on the surface of Madin-Darby Canine Kidney cells in vitro in a calcium-dependent manner, inhibitable by mammalian serum, indicating that a host glycan is the native ligand for this new parasite lectin.

Complete genome sequence analysis of a duck circovirus from Guangxi pockmark ducks.

PubMed

Xie, Liji; Xie, Zhixun; Zhao, Guangyuan; Liu, Jiabo; Pang, Yaoshan; Deng, Xianwen; Xie, Zhiqin; Fan, Qing

2012-12-01

We report here the complete genomic sequence of a novel duck circovirus (DuCV) strain, GX1104, isolated from Guangxi pockmark ducks in Guangxi, China. The whole nucleotide sequence had the highest homology (97.2%) with the sequence of strain TC/2002 (GenBank accession number AY394721.1) and had a low homology (76.8% to 78.6%) with the sequences of other strains isolated from China, Germany, and the United States. This report will help to understand the epidemiology and molecular characteristics of Guangxi pockmark duck circovirus in southern China.

Evaluation of the Roche prototype 454 HIV-1 ultradeep sequencing drug resistance assay in a routine diagnostic laboratory.

PubMed

Garcia-Diaz, A; Guerrero-Ramos, A; McCormick, A L; Macartney, M; Conibear, T; Johnson, M A; Haque, T; Webster, D P

2013-10-01

Studies have shown that low-frequency resistance mutations can influence treatment outcome. However, the lack of a standardized high-throughput assay has precluded their detection in clinical settings. To evaluate the performance of the Roche prototype 454 UDS HIV-1 drug resistance assay (UDS assay) in a routine diagnostic laboratory. 50 plasma samples, previously characterized by population sequencing and that had shown ≥1 resistance associated mutation (RAM), were retrospectively tested by the UDS assay, including 18 B and 32 non-B subtypes; viral loads between 114-1,806,407 cp/ml; drug-naive (n=27) and drug-experienced (n=23) individuals. The UDS assay was successful for 37/50 (74%) samples. It detected all RAMs found by population sequencing at frequencies above 20%. In addition, 39 low-frequency RAMs were exclusively detected by the UDS assay at frequencies below 20% in both drug-naïve (19/26, 73%) and drug-experienced (9/18, 50%) individuals. UDS results would lead to changes from susceptible to resistant to efavirenz (EFV) in one drug-naive individual with suboptimal response to an EFV-containing regimen and from susceptible to resistance to lamivudine (3TC) in one drug naïve subject who subsequently failed a 3TC-containing regimen and in a treatment experienced subject who had failed a 3TC-containing regimen. The UDS assay performed well across a wide range of subtypes and viral loads; it showed perfect agreement with population sequencing for all RAMs analyzed. In addition, the UDS assay detected additional mutations at frequencies below 20% which correlate with patients' treatment history and had in some cases important prognostic implications. Copyright © 2013 Elsevier B.V. All rights reserved.

Low-activity 124I-PET/low-dose CT versus 99mTc-pertechnetate planar scintigraphy or 99mTc-pertechnetate single-photon emission computed tomography of the thyroid: a pilot comparison.

PubMed

Darr, Andreas M; Opfermann, Thomas; Niksch, Tobias; Driesch, Dominik; Marlowe, Robert J; Freesmeyer, Martin

2013-10-01

The standard thyroid functional imaging method, 99mTc-pertechnetate (99mTc-PT) planar scintigraphy, has technical drawbacks decreasing its sensitivity in detecting nodules or anatomical pathology. 124I-PET, lacking these disadvantages and allowing simultaneous CT, may have greater sensitivity for these purposes. We performed a blinded pilot comparison of 124I-PET(/CT) versus 99mTc-PT planar scintigraphy or its cross-sectional enhancement, 99mTc-PT single-photon emission CT (SPECT), in characterizing the thyroid gland with benign disease. Twenty-one consecutive adults with goiter underwent low-activity (1 MBq/0.027 mCi) 124I-PET/low-dose (30 mAs) CT, 99mTc-PT planar scintigraphy, and 99mTc-PT-SPECT. Endpoints included the numbers of “hot spots” with/without central photopenia and “cold spots” detected, the proportion of these lesions with morphological correlates, the mean volume and diameter of visualized nodules, and the number of cases of lobus pyramidalis or retrosternal thyroid tissue identified. 124I-PET detected significantly more “hot spots” with/without central photopenia (P < 0.001), significantly more nodules (P < 0.001), and more “cold spots” than did 99mTc-PT planar scintigraphy or 99mTc-PT-SPECT, including all lesions seen on the 99mTc-PT modalities. Ultrasonographic correlates were found for all nodules visualized on all 3 modalities and 92.5% of nodules seen only on 124I-PET. Nodules discernible only on 124I-PET had significantly smaller mean volume or diameter (P < 0.001) than did those visualized on 99mTc-PT planar scintigraphy or 99mTc-PT-SPECT. 124I-PET(/CT) identified significantly more patients with a lobus pyramidalis (P < 0.001) or retrosternal thyroid tissue (P < 0.05). 124I-PET(/CT) may provide superior imaging of benign thyroid disease compared to planar or cross-sectional 99mTc-PT scintigraphy.

Large-Scale Conformational Changes of Trypanosoma cruzi Proline Racemase Predicted by Accelerated Molecular Dynamics Simulation

PubMed Central

McCammon, J. Andrew

2011-01-01

Chagas' disease, caused by the protozoan parasite Trypanosoma cruzi (T. cruzi), is a life-threatening illness affecting 11–18 million people. Currently available treatments are limited, with unacceptable efficacy and safety profiles. Recent studies have revealed an essential T. cruzi proline racemase enzyme (TcPR) as an attractive candidate for improved chemotherapeutic intervention. Conformational changes associated with substrate binding to TcPR are believed to expose critical residues that elicit a host mitogenic B-cell response, a process contributing to parasite persistence and immune system evasion. Characterization of the conformational states of TcPR requires access to long-time-scale motions that are currently inaccessible by standard molecular dynamics simulations. Here we describe advanced accelerated molecular dynamics that extend the effective simulation time and capture large-scale motions of functional relevance. Conservation and fragment mapping analyses identified potential conformational epitopes located in the vicinity of newly identified transient binding pockets. The newly identified open TcPR conformations revealed by this study along with knowledge of the closed to open interconversion mechanism advances our understanding of TcPR function. The results and the strategy adopted in this work constitute an important step toward the rationalization of the molecular basis behind the mitogenic B-cell response of TcPR and provide new insights for future structure-based drug discovery. PMID:22022240

Large-scale conformational changes of Trypanosoma cruzi proline racemase predicted by accelerated molecular dynamics simulation.

PubMed

de Oliveira, César Augusto F; Grant, Barry J; Zhou, Michelle; McCammon, J Andrew

2011-10-01

Chagas' disease, caused by the protozoan parasite Trypanosoma cruzi (T. cruzi), is a life-threatening illness affecting 11-18 million people. Currently available treatments are limited, with unacceptable efficacy and safety profiles. Recent studies have revealed an essential T. cruzi proline racemase enzyme (TcPR) as an attractive candidate for improved chemotherapeutic intervention. Conformational changes associated with substrate binding to TcPR are believed to expose critical residues that elicit a host mitogenic B-cell response, a process contributing to parasite persistence and immune system evasion. Characterization of the conformational states of TcPR requires access to long-time-scale motions that are currently inaccessible by standard molecular dynamics simulations. Here we describe advanced accelerated molecular dynamics that extend the effective simulation time and capture large-scale motions of functional relevance. Conservation and fragment mapping analyses identified potential conformational epitopes located in the vicinity of newly identified transient binding pockets. The newly identified open TcPR conformations revealed by this study along with knowledge of the closed to open interconversion mechanism advances our understanding of TcPR function. The results and the strategy adopted in this work constitute an important step toward the rationalization of the molecular basis behind the mitogenic B-cell response of TcPR and provide new insights for future structure-based drug discovery.

HFE gene polymorphism defined by sequence-based typing of the Brazilian population and a standardized nomenclature for HFE allele sequences.

PubMed

Campos, W N; Massaro, J D; Martinelli, A L C; Halliwell, J A; Marsh, S G E; Mendes-Junior, C T; Donadi, E A

2017-10-01

The HFE molecule controls iron uptake from gut, and defects in the molecule have been associated with iron overload, particularly in hereditary hemochromatosis. The HFE gene including both coding and boundary intronic regions were sequenced in 304 Brazilian individuals, encompassing healthy individuals and patients exhibiting hereditary or acquired iron overload. Six sites of variation were detected: (1) H63D C>G in exon 2, (2) IVS2 (+4) T>C in intron 2, (3) a C>G transversion in intron 3, (4) C282Y G>A in exon 4, (5) IVS4 (-44) T>C in intron 4, and (6) a new guanine deletion (G>del) in intron 5, which were used for haplotype inference. Nine HFE alleles were detected and six of these were officially named on the basis of the HLA Nomenclature, defined by the World Health Organization (WHO) Nomenclature Committee for Factors of the HLA System, and published via the IPD-IMGT/HLA website. Four alleles, HFE*001, *002, *003, and *004 exhibited variation within their exon sequences. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Immobilization of 99-Technetium (VII) by Fe(II)-Goethite and Limited Reoxidation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Um, Wooyong; Chang, Hyun-Shik; Icenhower, Jonathan P.

2011-05-04

Synthesized goethite was successfully used with addition of Fe(II) to sequester Tc present in both deionized water and simulated off-gas scrubber waste solutions. Pertechnetate concentration in solution decreased immediately when the pH was raised above 7 by addition of sodium hydroxide. Removal of Tc(VII) from solution occurred most likely as a result of heterogeneous surface-catalyzed reduction to Tc(IV) and subsequent co-precipitation onto the goethite. The final Tc-bearing solid was identified as goethite-dominated Fe(III)-(oxy)hydroxide based on XRD analysis, confirming the widespread observation of its characteristic acicular habit by TEM/SEM images. Analysis of the solid precipitate by XAFS showed that the dominantmore » oxidation state of Tc was Tc(IV) and was in octahedral coordination with Tc-O, Fe-O, and Tc-Fe bond distances that are consistent with direct substitution of Tc for Fe in the goethite structure. In some experiments the final Tc-goethite product was subsequently armored with additional layers of freshly precipitated goethite. Successful incorporation of Tc(IV) within the goethite mineral lattice and subsequent goethite armoring can limit re-oxidation of Tc(IV) and its subsequent release from Tc-goethite waste forms, even when the final product is placed in oxidizing environments that typify shallow waste burial facilities.« less

TcCYPR04, a Cacao Papain-Like Cysteine-Protease Detected in Senescent and Necrotic Tissues Interacts with a Cystatin TcCYS4

PubMed Central

Cardoso, Thyago Hermylly Santana; Freitas, Ana Camila Oliveira; Andrade, Bruno Silva; de Sousa, Aurizangela Oliveira; Santiago, André da Silva; Koop, Daniela Martins; Gramacho, Karina Peres; Alvim, Fátima Cerqueira; Micheli, Fabienne; Pirovani, Carlos Priminho

2015-01-01

The interaction amongst papain-like cysteine-proteases (PLCP) and their substrates and inhibitors, such as cystatins, can be perceived as part of the molecular battlefield in plant-pathogen interaction. In cacao, four cystatins were identified and characterized by our group. We identified 448 proteases in cacao genome, whereof 134 were cysteine-proteases. We expressed in Escherichia coli a PLCP from cacao, named TcCYSPR04. Immunoblottings with anti-TcCYSPR04 exhibited protein increases during leaf development. Additional isoforms of TcCYSPR04 appeared in senescent leaves and cacao tissues infected by Moniliophthora perniciosa during the transition from the biotrophic to the saprophytic phase. TcCYSPR04 was induced in the apoplastic fluid of Catongo and TSH1188 cacao genotypes, susceptible and resistant to M. perniciosa, respectively, but greater intensity and additional isoforms were observed in TSH1188. The fungal protein MpNEP induced PLCP isoform expression in tobacco leaves, according to the cross reaction with anti-TcCYSPR04. Several protein isoforms were detected at 72 hours after treatment with MpNEP. We captured an active PLCP from cacao tissues, using a recombinant cacao cystatin immobilized in CNBr-Sepharose. Mass spectrometry showed that this protein corresponds to TcCYSPR04. A homology modeling was obtained for both proteins. In order to become active, TcCYSPR04 needs to lose its inhibitory domain. Molecular docking showed the physical-chemical complementarities of the interaction between the cacao enzyme and its inhibitor. We propose that TcCYSPR04 and its interactions with cacao cystatins are involved in the senescence and necrosis events related to witches’ broom symptoms. This molecular interaction may be the target for future interventions to control witches' broom disease. PMID:26641247

TcCYPR04, a Cacao Papain-Like Cysteine-Protease Detected in Senescent and Necrotic Tissues Interacts with a Cystatin TcCYS4.

PubMed

Cardoso, Thyago Hermylly Santana; Freitas, Ana Camila Oliveira; Andrade, Bruno Silva; Sousa, Aurizangela Oliveira de; Santiago, André da Silva; Koop, Daniela Martins; Gramacho, Karina Peres; Alvim, Fátima Cerqueira; Micheli, Fabienne; Pirovani, Carlos Priminho

2015-01-01

The interaction amongst papain-like cysteine-proteases (PLCP) and their substrates and inhibitors, such as cystatins, can be perceived as part of the molecular battlefield in plant-pathogen interaction. In cacao, four cystatins were identified and characterized by our group. We identified 448 proteases in cacao genome, whereof 134 were cysteine-proteases. We expressed in Escherichia coli a PLCP from cacao, named TcCYSPR04. Immunoblottings with anti-TcCYSPR04 exhibited protein increases during leaf development. Additional isoforms of TcCYSPR04 appeared in senescent leaves and cacao tissues infected by Moniliophthora perniciosa during the transition from the biotrophic to the saprophytic phase. TcCYSPR04 was induced in the apoplastic fluid of Catongo and TSH1188 cacao genotypes, susceptible and resistant to M. perniciosa, respectively, but greater intensity and additional isoforms were observed in TSH1188. The fungal protein MpNEP induced PLCP isoform expression in tobacco leaves, according to the cross reaction with anti-TcCYSPR04. Several protein isoforms were detected at 72 hours after treatment with MpNEP. We captured an active PLCP from cacao tissues, using a recombinant cacao cystatin immobilized in CNBr-Sepharose. Mass spectrometry showed that this protein corresponds to TcCYSPR04. A homology modeling was obtained for both proteins. In order to become active, TcCYSPR04 needs to lose its inhibitory domain. Molecular docking showed the physical-chemical complementarities of the interaction between the cacao enzyme and its inhibitor. We propose that TcCYSPR04 and its interactions with cacao cystatins are involved in the senescence and necrosis events related to witches' broom symptoms. This molecular interaction may be the target for future interventions to control witches' broom disease.

Transcranial Motor-Evoked Potentials Are More Readily Acquired Than Somatosensory-Evoked Potentials in Children Younger Than 6 Years.

PubMed

McIntyre, Ian W; Francis, Lisa; McAuliffe, John J

2016-01-01

There is a general belief that somatosensory-evoked potentials (SSEPs) are more easily obtained than transcranial motor-evoked potentials (TcMEPs) in children younger than 6 years. We tested this assumption and the assumption that motor-evoked potentials are rarely obtained in children younger than 2 years. The records of all patients who were monitored during surgical procedures between April 1, 2010, and June 30, 2013, were reviewed and those who were younger than 72 months at the time of surgery were identified and analyzed for the rate of obtaining clinically useful SSEPs and motor-evoked potentials. Subgroup analysis was performed by age. A total of 146 patients were identified, 9 had SSEPs without TcMEPs monitored, 117 had both TcMEPs and SSEPs monitored, and the remainder had only electromyographic monitoring. All patients who were to have TcMEPs recorded received a total IV anesthetic. Among the 117 patients who had both SSEPs and TcMEPs monitored, clinically relevant TcMEPs were obtained more frequently than SSEPs (110/117 vs 89/117; χ = 14.82; P = 0.00012). There were significant differences between the rates of obtaining SSEPs and TcMEPs in the 0- to 23-month (P = 0.0038) and 24- to 47-month (P = 0.0056) age groups. Utilization of a double-train stimulation technique facilitated obtaining TcMEPs in the youngest patients. TcMEPs can be obtained more easily than SSEPs in patients younger than 72 months if a permissive anesthetic technique is used. The success rate for obtaining TcMEPs can be further enhanced by the use of a temporal facilitation (double-train) stimulation technique.

A context-dependent combination of Wnt receptors controls axis elongation and leg development in a short germ insect

PubMed Central

Beermann, Anke; Prühs, Romy; Lutz, Rebekka; Schröder, Reinhard

2011-01-01

Short germ embryos elongate their primary body axis by consecutively adding segments from a posteriorly located growth zone. Wnt signalling is required for axis elongation in short germ arthropods, including Tribolium castaneum, but the precise functions of the different Wnt receptors involved in this process are unclear. We analysed the individual and combinatorial functions of the three Wnt receptors, Frizzled-1 (Tc-Fz1), Frizzled-2 (Tc-Fz2) and Frizzled-4 (Tc-Fz4), and their co-receptor Arrow (Tc-Arr) in the beetle Tribolium. Knockdown of gene function and expression analyses revealed that Frizzled-dependent Wnt signalling occurs anteriorly in the growth zone in the presegmental region (PSR). We show that simultaneous functional knockdown of the Wnt receptors Tc-fz1 and Tc-fz2 via RNAi resulted in collapse of the growth zone and impairment of embryonic axis elongation. Although posterior cells of the growth zone were not completely abolished, Wnt signalling within the PSR controls axial elongation at the level of pair-rule patterning, Wnt5 signalling and FGF signalling. These results identify the PSR in Tribolium as an integral tissue required for the axial elongation process, reminiscent of the presomitic mesoderm in vertebrates. Knockdown of Tc-fz1 alone interfered with the formation of the proximo-distal and the dorso-ventral axes during leg development, whereas no effect was observed with single Tc-fz2 or Tc-fz4 RNAi knockdowns. We identify Tc-Arr as an obligatory Wnt co-receptor for axis elongation, leg distalisation and segmentation. We discuss how Wnt signalling is regulated at the receptor and co-receptor levels in a dose-dependent fashion. PMID:21652652

Utility of Decision Rules for Transcutaneous Bilirubin Measurements

PubMed Central

Burgos, Anthony E.; Flaherman, Valerie; Chung, Esther K.; Simpson, Elizabeth A.; Goyal, Neera K.; Von Kohorn, Isabelle; Dhepyasuwan, Niramol

2016-01-01

BACKGROUND: Transcutaneous bilirubin (TcB) meters are widely used for screening newborns for jaundice, with a total serum bilirubin (TSB) measurement indicated when the TcB value is classified as “positive” by using a decision rule. The goal of our study was to assess the clinical utility of 3 recommended TcB screening decision rules. METHODS: Paired TcB/TSB measurements were collected at 34 newborn nursery sites. At 27 sites (sample 1), newborns were routinely screened with a TcB measurement. For sample 2, sites that typically screen with TSB levels also obtained a TcB measurement for the study. Three decision rules to define a positive TcB measurement were evaluated: ≥75th percentile on the Bhutani nomogram, 70% of the phototherapy level, and within 3 mg/dL of the phototherapy threshold. The primary outcome was a TSB level at/above the phototherapy threshold. The rate of false-negative TcB screens and percentage of blood draws avoided were calculated for each decision rule. RESULTS: For sample 1, data were analyzed on 911 paired TcB-TSB measurements from a total of 8316 TcB measurements. False-negative rates were <10% with all decision rules; none identified all 31 newborns with a TSB level at/above the phototherapy threshold. The percentage of blood draws avoided ranged from 79.4% to 90.7%. In sample 2, each rule correctly identified all 8 newborns with TSB levels at/above the phototherapy threshold. CONCLUSIONS: Although all of the decision rules can be used effectively to screen newborns for jaundice, each will “miss” some infants with a TSB level at/above the phototherapy threshold. PMID:27244792

Frequent genes in rare diseases: panel-based next generation sequencing to disclose causal mutations in hereditary neuropathies.

PubMed

Dohrn, Maike F; Glöckle, Nicola; Mulahasanovic, Lejla; Heller, Corina; Mohr, Julia; Bauer, Christine; Riesch, Erik; Becker, Andrea; Battke, Florian; Hörtnagel, Konstanze; Hornemann, Thorsten; Suriyanarayanan, Saranya; Blankenburg, Markus; Schulz, Jörg B; Claeys, Kristl G; Gess, Burkhard; Katona, Istvan; Ferbert, Andreas; Vittore, Debora; Grimm, Alexander; Wolking, Stefan; Schöls, Ludger; Lerche, Holger; Korenke, G Christoph; Fischer, Dirk; Schrank, Bertold; Kotzaeridou, Urania; Kurlemann, Gerhard; Dräger, Bianca; Schirmacher, Anja; Young, Peter; Schlotter-Weigel, Beate; Biskup, Saskia

2017-12-01

Hereditary neuropathies comprise a wide variety of chronic diseases associated to more than 80 genes identified to date. We herein examined 612 index patients with either a Charcot-Marie-Tooth phenotype, hereditary sensory neuropathy, familial amyloid neuropathy, or small fiber neuropathy using a customized multigene panel based on the next generation sequencing technique. In 121 cases (19.8%), we identified at least one putative pathogenic mutation. Of these, 54.4% showed an autosomal dominant, 33.9% an autosomal recessive, and 11.6% an X-linked inheritance. The most frequently affected genes were PMP22 (16.4%), GJB1 (10.7%), MPZ, and SH3TC2 (both 9.9%), and MFN2 (8.3%). We further detected likely or known pathogenic variants in HINT1, HSPB1, NEFL, PRX, IGHMBP2, NDRG1, TTR, EGR2, FIG4, GDAP1, LMNA, LRSAM1, POLG, TRPV4, AARS, BIC2, DHTKD1, FGD4, HK1, INF2, KIF5A, PDK3, REEP1, SBF1, SBF2, SCN9A, and SPTLC2 with a declining frequency. Thirty-four novel variants were considered likely pathogenic not having previously been described in association with any disorder in the literature. In one patient, two homozygous mutations in HK1 were detected in the multigene panel, but not by whole exome sequencing. A novel missense mutation in KIF5A was considered pathogenic because of the highly compatible phenotype. In one patient, the plasma sphingolipid profile could functionally prove the pathogenicity of a mutation in SPTLC2. One pathogenic mutation in MPZ was identified after being previously missed by Sanger sequencing. We conclude that panel based next generation sequencing is a useful, time- and cost-effective approach to assist clinicians in identifying the correct diagnosis and enable causative treatment considerations. © 2017 International Society for Neurochemistry.

Active site remodeling switches HIV specificity of antiretroviral TRIMCyp

PubMed Central

Price, Amanda J; Marzetta, Flavia; Lammers, Michael; Ylinen, Laura M J; Schaller, Torsten; Wilson, Sam J; Towers, Greg J; James, Leo C

2011-01-01

TRIMCyps are primate antiretroviral proteins that potently inhibit HIV replication. Here we describe how rhesus macaque TRIMCyp (RhTC) has evolved to target and restrict HIV-2. We show that the ancestral cyclophilin A (CypA) domain of RhTC targets HIV-2 capsid with weak affinity, which is strongly increased in RhTC by two mutations (D66N and R69H) at the expense of HIV-1 binding. These mutations disrupt a constraining intramolecular interaction in CypA, triggering the complete restructuring (>16 Å) of an active site loop. This new configuration discriminates between divergent HIV-1 and HIV-2 loop conformations mediated by capsid residue 88. Viral sensitivity to RhTC restriction can be conferred or abolished by mutating position 88. Furthermore, position 88 determines the susceptibility of naturally occurring HIV-1 sequences to restriction. Our results reveal the complex molecular, structural and thermodynamic changes that underlie the ongoing evolutionary race between virus and host. PMID:19767750

Association mapping of seed and disease resistance traits in Theobroma cacao L.

PubMed

Motilal, Lambert A; Zhang, Dapeng; Mischke, Sue; Meinhardt, Lyndel W; Boccara, Michel; Fouet, Olivier; Lanaud, Claire; Umaharan, Pathmanathan

2016-12-01

Microsatellite and single nucleotide polymorphism markers that could be used in marker assisted breeding of cacao were identified for number of filled seeds, black pod resistance and witches' broom disease resistance. An association mapping approach was employed to identify markers for seed number and resistance to black pod and witches' broom disease (WBD) in cacao (Theobroma cacao L.). Ninety-five microsatellites (SSRs) and 775 single nucleotide polymorphisms (SNPs) were assessed on 483 unique trees in the International Cocoa Genebank Trinidad (ICGT). Linkage disequilibrium (LD) and association mapping studies were conducted to identify markers to tag the phenotypic traits. Decay of LD occurred over an average 9.3 cM for chromosomes 1-9 and 2.5 cM for chromosome 10. Marker/trait associations were generally identified based on general linear models (GLMs) that incorporated principal components from molecular information on relatedness factor. Seven markers (mTcCIR 8, 66, 126, 212; TcSNP368, 697, 1370) on chromosomes 1 and 9 were identified for number of filled seeds (NSEED). A single marker was found for black pod resistance (mTcCIR280) on chromosome 3, whereas six markers on chromosomes 4, 5, 6, 8, and 10 were detected for WBD (mTcCIR91, 183; TcSNP375, 720, 1230 and 1374). It is expected that this association mapping study in cacao would contribute to the knowledge of the genetic determinism of cocoa traits and that the markers identified herein would prove useful in marker assisted breeding of cacao.

Whole-exome sequencing identifies novel compound heterozygous mutations in USH2A in Spanish patients with autosomal recessive retinitis pigmentosa.

PubMed

Méndez-Vidal, Cristina; González-Del Pozo, María; Vela-Boza, Alicia; Santoyo-López, Javier; López-Domingo, Francisco J; Vázquez-Marouschek, Carmen; Dopazo, Joaquin; Borrego, Salud; Antiñolo, Guillermo

2013-01-01

Retinitis pigmentosa (RP) is an inherited retinal dystrophy characterized by extreme genetic and clinical heterogeneity. Thus, the diagnosis is not always easily performed due to phenotypic and genetic overlap. Current clinical practices have focused on the systematic evaluation of a set of known genes for each phenotype, but this approach may fail in patients with inaccurate diagnosis or infrequent genetic cause. In the present study, we investigated the genetic cause of autosomal recessive RP (arRP) in a Spanish family in which the causal mutation has not yet been identified with primer extension technology and resequencing. We designed a whole-exome sequencing (WES)-based approach using NimbleGen SeqCap EZ Exome V3 sample preparation kit and the SOLiD 5500×l next-generation sequencing platform. We sequenced the exomes of both unaffected parents and two affected siblings. Exome analysis resulted in the identification of 43,204 variants in the index patient. All variants passing filter criteria were validated with Sanger sequencing to confirm familial segregation and absence in the control population. In silico prediction tools were used to determine mutational impact on protein function and the structure of the identified variants. Novel Usher syndrome type 2A (USH2A) compound heterozygous mutations, c.4325T>C (p.F1442S) and c.15188T>G (p.L5063R), located in exons 20 and 70, respectively, were identified as probable causative mutations for RP in this family. Family segregation of the variants showed the presence of both mutations in all affected members and in two siblings who were apparently asymptomatic at the time of family ascertainment. Clinical reassessment confirmed the diagnosis of RP in these patients. Using WES, we identified two heterozygous novel mutations in USH2A as the most likely disease-causing variants in a Spanish family diagnosed with arRP in which the cause of the disease had not yet been identified with commonly used techniques. Our data reinforce the clinical role of WES in the molecular diagnosis of highly heterogeneous genetic diseases where conventional genetic approaches have previously failed in achieving a proper diagnosis.

Whole-genome characterization of a Peruvian alpaca rotavirus isolate expressing a novel VP4 genotype.

PubMed

Rojas, Miguel; Gonçalves, Jorge Luiz S; Dias, Helver G; Manchego, Alberto; Pezo, Danilo; Santos, Norma

2016-11-30

The SA44 isolate of Rotavirus A (RVA) was identified from a neonatal Peruvian alpaca presenting with diarrhea, and the full-length genome sequence of the isolate (designated RVA/Alpaca-tc/PER/SA44/2014/G3P[40]) was determined. Phylogenetic analyses showed that the isolate possessed the genotype constellation G3-P[40]-I8-R3-C3-M3-A9-N3-T3-E3-H6, which differs considerably from those of RVA strains isolated from other species of the order Artiodactyla. Overall, the genetic constellation of the SA44 strain was quite similar to those of RVA strains isolated from a bat in Asia (MSLH14 and MYAS33). Nonetheless, phylogenetic analyses of each genome segment identified a distinct combination of genes. Several sequences were closely related to corresponding gene sequences in RVA strains from other species, including human (VP1, VP2, NSP1, and NSP2), simian (VP3 and NSP5), bat (VP6 and NSP4), and equine (NSP3). The VP7 gene sequence was closely related to RVA strains from a Peruvian alpaca (K'ayra/3368-10; 99.0% nucleotide and 99.7% amino acid identity) and from humans (RCH272; 95% nucleotide and 99.0% amino acid identity). The nucleotide sequence of the VP4 gene was distantly related to other VP4 sequences and was designated as the reference strain for the new P[40] genotype. This unique genetic makeup suggests that the SA44 strain emerged from multiple reassortment events between bat-, equine-, and human-like RVA strains. Copyright © 2016 Elsevier B.V. All rights reserved.

Non-hyperfunctioning nodules from multinodular goiters: a minor role in pathogenesis for somatic activating mutations in the TSH-receptor and Gsalpha subunit genes.

PubMed

Derrien, C; Sonnet, E; Gicquel, I; Le Gall, J Y; Poirier, J Y; David, V; Maugendre, D

2001-05-01

Constitutive activation of the cAMP pathway stimulates thyrocyte proliferation. Gain-of-function mutations in Gsalpha protein have already been identified in thyroid nodules which have lost the ability to trap iodine. In contrast, most of the studies failed to detect somatic activating mutations in the thyrotropin receptor (TSH-R) in non-hyperfunctioning thyroid tumors. The aim of this study was to screen for mutations TSH-R exon 10, encoding the whole intracytoplasmic area involved in signal transduction, and Gsalpha exons 8 and 9, containing the two hot-spot codons 201 and 227, in a subset of non-hyperfunctioning nodules from multinodular goiter. Identified by matching ultrasonography and scintiscan, 22 eufunctioning (normal 99Tc uptake) and 15 nonfunctioning (decreased 99Tc uptake) nodules from 27 non-toxic multinodular goiters were isolated. After DNA extraction, TSH-R exon 10 was analyzed by direct sequencing of the PCR products and Gsalpha exons 8 and 9 by Denaturing Gradient Gel Electrophoresis. No mutation of TSH-R or Gsalpha was detected in the 37 nodules analyzed. This absence of mutation, despite the use of two sensitive screening methods associated with the analysis of the TSH-R whole intracytoplasmic area and Gsalpha two hot-spot codons, suggests that TSH-R and Gsalpha play a minor role in the pathogenesis of non-toxic nodules from multinodular goiters.

Novel mutations of the AGXT gene causing primary hyperoxaluria type 1.

PubMed

Yuen, Yuet-Ping; Lai, Chi-Kong; Tong, Gensy Mei-Wah; Wong, Ping-Nam; Wong, Francis Kim-Ming; Mak, Siu-Ka; Lo, Kin-Yee; Wong, Andrew Kui-Man; Tong, Sui-Fan; Chan, Yan-Wo; Lam, Ching-Wan

2004-01-01

Primary hyperoxaluria type 1 (PH1), an inherited cause of nephrolithiasis, is due to a functional defect of the liver-specific peroxisomal enzyme alanine:glyoxylate aminotransferase (AGT). A definitive PH1 diagnosis can be established by analyzing AGT activity in liver tissue or mutation analysis of the AGXT gene. The molecular basis of PH1 in three Chinese patients, two with adult-onset and one with childhood-onset recurrent nephrolithiasis, was established by analyzing the entire AGXT gene. Three novel mutations (c2T>C, c817insAG and c844C>T) and two previously reported mutations (c33insC and 679-IVS6+2delAAgt) were identified. c2T>C converts the initiation codon from ATG to ACG, which predicts significant reduction, if not complete abolition, of protein translation. c817insAG leads to a frameshift and changes the amino acid sequence after codon 274. c844C>T changes glutamine at codon 282 to a termination codon, resulting in protein truncation. This is the first report describing AGXT gene mutations in Chinese patients with PH1. AGXT genotypes cannot fully explain the clinical heterogeneity of PH1, and other factors involved in disease pathogenesis remain to be identified. Our experience emphasizes the importance of excluding PH1 in patients with recurrent nephrolithiasis to avoid delay or inappropriate management.

Kit for the rapid preparation of .sup.99m Tc red blood cells

DOEpatents

Richards, Powell; Smith, Terry D.

1976-01-01

A method and sample kit for the preparation of .sup.99m Tc-labeled red blood cells in a closed, sterile system. A partially evacuated tube, containing a freeze-dried stannous citrate formulation with heparin as an anticoagulant, allows whole blood to be automatically drawn from the patient. The radioisotope is added at the end of the labeling sequence to minimize operator exposure. Consistent 97% yields in 20 minutes are obtained with small blood samples. Freeze-dried kits have remained stable after five months.

Sequence of Reston Virus Isolate AZ-1435, an Ebolavirus Isolate Obtained during the 1989-1990 Reston Virus Epizootic in the United States.

PubMed

Cornish, Joseph P; Diaz, Larissa; Ricklefs, Stacy M; Kanakabandi, Kishore; Sword, Jennifer; Jahrling, Peter B; Kuhn, Jens H; Porcella, Stephen F; Johnson, Reed F

2017-01-12

Reston virus (RESTV) was discovered in 1989-1990 during three connected epizootics of highly lethal viral hemorrhagic fever among captive macaques in primate housing facilities in the United States and Philippines. Currently, only one RESTV isolate from that outbreak (named Pennsylvania) has been sequenced. Here, we report the sequence of a second isolate, Reston virus/M.fascicularis-tc/USA/1990/Philippines89-AZ1435. Copyright © 2017 Cornish et al.

Theobroma cacao cystatins impair Moniliophthora perniciosa mycelial growth and are involved in postponing cell death symptoms.

PubMed

Pirovani, Carlos Priminho; da Silva Santiago, André; dos Santos, Lívia Santana; Micheli, Fabienne; Margis, Rogério; da Silva Gesteira, Abelmon; Alvim, Fátima Cerqueira; Pereira, Gonçalo Amarante Guimarães; de Mattos Cascardo, Júlio Cézar

2010-11-01

Three cystatin open reading frames named TcCys1, TcCys2 and TcCys3 were identified in cDNA libraries from compatible interactions between Theobroma cacao (cacao) and Moniliophthora perniciosa. In addition, an ORF named TcCys4 was identified in the cDNA library of the incompatible interaction. The cDNAs encoded conceptual proteins with 209, 127, 124, and 205 amino acid residues, with a deduced molecular weight of 24.3, 14.1, 14.3 and 22.8 kDa, respectively. His-tagged recombinant proteins were purified from Escherichia coli expression, and showed inhibitory activities against M. perniciosa. The four recombinant cystatins exhibited K(i) values against papain in the range of 152-221 nM. Recombinant TcCYS3 and TcCYS4 immobilized in CNBr-Sepharose were efficient to capture M. perniciosa proteases from culture media. Polyclonal antibodies raised against the recombinant TcCYS4 detected that the endogenous protein was more abundant in young cacao tissues, when compared with mature tissues. A ~85 kDa cacao multicystatin induced by M. perniciosa inoculation, MpNEP (necrosis and ethylene-inducing protein) and M. perniciosa culture supernatant infiltration were detected by anti-TcCYS4 antibodies in cacao young tissues. A direct role of the cacao cystatins in the defense against this phytopathogen was proposed, as well as its involvement in the development of symptoms of programmed cell death.

Structure, kinetic characterization and subcellular localization of the two ribulose 5-phosphate epimerase isoenzymes from Trypanosoma cruzi

PubMed Central

Gonzalez, Soledad Natalia; Valsecchi, Wanda Mariela; Maugeri, Dante; Delfino, José María; Cazzulo, Juan José

2017-01-01

The enzyme of the pentose phosphate pathway (PPP) ribulose-5-phosphate-epimerase (RPE) is encoded by two genes present in the genome of Trypanosoma cruzi CL Brener clone: TcRPE1 and TcRPE2. Despite high sequence similarity at the amino acid residue level, the recombinant isoenzymes show a strikingly different kinetics. Whereas TcRPE2 follows a typical michaelian behavior, TcRPE1 shows a complex kinetic pattern, displaying a biphasic curve, suggesting the coexistence of -at least- two kinetically different molecular forms. Regarding the subcellular localization in epimastigotes, whereas TcRPE1 is a cytosolic enzyme, TcRPE2 is localized in glycosomes. To our knowledge, TcRPE2 is the first PPP isoenzyme that is exclusively localized in glycosomes. Over-expression of TcRPE1, but not of TcRPE2, significantly reduces the parasite doubling time in vitro, as compared with wild type epimastigotes. Both TcRPEs represent single domain proteins exhibiting the classical α/β TIM-barrel fold, as expected for enzymes with this activity. With regard to the architecture of the active site, all the important amino acid residues for catalysis -with the exception of M58- are also present in both TcRPEs models. The superimposition of the binding pocket of both isoenzyme models shows that they adopt essentially identical positions in the active site with a residue specific RMSD < 2Å, with the sole exception of S12, which displays a large deviation (residue specific RMSD: 11.07 Å). Studies on the quaternary arrangement of these isoenzymes reveal that both are present in a mixture of various oligomeric species made up of an even number of molecules, probably pointing to the dimer as their minimal functional unit. This multiplicity of oligomeric species has not been reported for any of the other RPEs studied so far and it might bear implications for the regulation of TcRPEs activity, although further investigation will be necessary to unravel the physiological significance of these structural findings. PMID:28207833

Structure, kinetic characterization and subcellular localization of the two ribulose 5-phosphate epimerase isoenzymes from Trypanosoma cruzi.

PubMed

Gonzalez, Soledad Natalia; Valsecchi, Wanda Mariela; Maugeri, Dante; Delfino, José María; Cazzulo, Juan José

2017-01-01

The enzyme of the pentose phosphate pathway (PPP) ribulose-5-phosphate-epimerase (RPE) is encoded by two genes present in the genome of Trypanosoma cruzi CL Brener clone: TcRPE1 and TcRPE2. Despite high sequence similarity at the amino acid residue level, the recombinant isoenzymes show a strikingly different kinetics. Whereas TcRPE2 follows a typical michaelian behavior, TcRPE1 shows a complex kinetic pattern, displaying a biphasic curve, suggesting the coexistence of -at least- two kinetically different molecular forms. Regarding the subcellular localization in epimastigotes, whereas TcRPE1 is a cytosolic enzyme, TcRPE2 is localized in glycosomes. To our knowledge, TcRPE2 is the first PPP isoenzyme that is exclusively localized in glycosomes. Over-expression of TcRPE1, but not of TcRPE2, significantly reduces the parasite doubling time in vitro, as compared with wild type epimastigotes. Both TcRPEs represent single domain proteins exhibiting the classical α/β TIM-barrel fold, as expected for enzymes with this activity. With regard to the architecture of the active site, all the important amino acid residues for catalysis -with the exception of M58- are also present in both TcRPEs models. The superimposition of the binding pocket of both isoenzyme models shows that they adopt essentially identical positions in the active site with a residue specific RMSD < 2Å, with the sole exception of S12, which displays a large deviation (residue specific RMSD: 11.07 Å). Studies on the quaternary arrangement of these isoenzymes reveal that both are present in a mixture of various oligomeric species made up of an even number of molecules, probably pointing to the dimer as their minimal functional unit. This multiplicity of oligomeric species has not been reported for any of the other RPEs studied so far and it might bear implications for the regulation of TcRPEs activity, although further investigation will be necessary to unravel the physiological significance of these structural findings.

Comparative evaluation of [(99m)tc]tilmanocept for sentinel lymph node mapping in breast cancer patients: results of two phase 3 trials.

PubMed

Wallace, Anne M; Han, Linda K; Povoski, Stephen P; Deck, Kenneth; Schneebaum, Schlomo; Hall, Nathan C; Hoh, Carl K; Limmer, Karl K; Krontiras, Helen; Frazier, Thomas G; Cox, Charles; Avisar, Eli; Faries, Mark; King, Dennis W; Christman, Lori; Vera, David R

2013-08-01

Sentinel lymph node (SLN) surgery is used worldwide for staging breast cancer patients and helps limit axillary lymph node dissection. [(99m)Tc]Tilmanocept is a novel receptor-targeted radiopharmaceutical evaluated in 2 open-label, nonrandomized, within-patient, phase 3 trials designed to assess the lymphatic mapping performance. A total of 13 centers contributed 148 patients with breast cancer. Each patient received [(99m)Tc]tilmanocept and vital blue dye (VBD). Lymph nodes identified intraoperatively as radioactive and/or blue stained were excised and histologically examined. The primary endpoint, concordance (lower boundary set point at 90 %), was the proportion of nodes detected by VBD and [(99m)Tc]tilmanocept. A total of 13 centers contributed 148 patients who were injected with both agents. Intraoperatively, 207 of 209 nodes detected by VBD were also detected by [(99m)Tc]tilmanocept for a concordance rate of 99.04 % (p < 0.0001). [(99m)Tc]tilmanocept detected a total of 320 nodes, of which 207 (64.7 %) were detected by VBD. [(99m)Tc]Tilmanocept detected at least 1 SLN in more patients (146) than did VBD (131, p < 0.0001). In 129 of 131 patients with ≥1 blue node, all blue nodes were radioactive. Of 33 pathology-positive nodes (18.2 % patient pathology rate), [(99m)Tc]tilmanocept detected 31 of 33, whereas VBD detected only 25 of 33 (p = 0.0312). No pathology-positive SLNs were detected exclusively by VBD. No serious adverse events were attributed to [(99m)Tc]tilmanocept. [(99m)Tc]Tilmanocept demonstrated success in detecting a SLN while meeting the primary endpoint. Interestingly, [(99m)Tc]tilmanocept was additionally noted to identify more SLNs in more patients. This localization represented a higher number of metastatic breast cancer lymph nodes than that of VBD.

Genotype diversity of Trypanosoma cruzi in small rodents and Triatoma sanguisuga from a rural area in New Orleans, Louisiana.

PubMed

Herrera, Claudia P; Licon, Meredith H; Nation, Catherine S; Jameson, Samuel B; Wesson, Dawn M

2015-02-24

Chagas disease is an anthropozoonosis caused by the protozoan parasite Trypanosoma cruzi that represents a major public health problem in Latin America. Although the United States is defined as non-endemic for Chagas disease due to the rarity of human cases, the presence of T. cruzi has now been amply demonstrated as enzootic in different regions of the south of the country from Georgia to California. In southeastern Louisiana, a high T. cruzi infection rate has been demonstrated in Triatoma sanguisuga, the local vector in this area. However, little is known about the role of small mammals in the wild and peridomestic transmission cycles. This study focused on the molecular identification and genotyping of T. cruzi in both small rodents and T. sanguisuga from a rural area of New Orleans, Louisiana. DNA extractions were prepared from rodent heart, liver, spleen and skeletal muscle tissues and from cultures established from vector feces. T. cruzi infection was determined by standard PCR using primers specific for the minicircle variable region of the kinetoplastid DNA (kDNA) and the highly repetitive genomic satellite DNA (satDNA). Genotyping of discrete typing units (DTUs) was performed by amplification of mini-exon and 18S and 24Sα rRNA genes and subsequent sequence analysis. The DTUs TcI, TcIV and, for the first time, TcII, were identified in tissues of mice and rats naturally infected with T. cruzi captured in an area of New Orleans, close to the house where the first human case of Chagas disease was reported in Louisiana. The T. cruzi infection rate in 59 captured rodents was 76%. The frequencies of the detected DTUs in such mammals were TcI 82%, TcII 22% and TcIV 9%; 13% of all infections contained more than one DTU. Our results indicate a probable presence of a considerably greater diversity in T. cruzi DTUs circulating in the southeastern United States than previously reported. Understanding T. cruzi transmission dynamics in sylvatic and peridomestic cycles in mammals and insect vectors will be crucial to estimating the risk of local, vector-borne transmission of T. cruzi to humans in the United States.

Systematic XAS study on the reduction and uptake of Tc by magnetite and mackinawite.

PubMed

Yalçıntaş, Ezgi; Scheinost, Andreas C; Gaona, Xavier; Altmaier, Marcus

2016-11-28

The mechanisms for the reduction and uptake of Tc by magnetite (Fe 3 O 4 ) and mackinawite (FeS) are investigated using X-ray absorption spectroscopy (XANES and EXAFS), in combination with thermodynamic calculations of the Tc/Fe systems and accurate characterization of the solution properties (pH m , pe, [Tc]). Batch sorption experiments were performed under strictly anoxic conditions using freshly prepared magnetite and mackinawite in 0.1 M NaCl solutions with varying initial Tc(vii) concentrations (2 × 10 -5 and 2 × 10 -4 M) and Tc loadings (400-900 ppm). XANES confirms the complete reduction of Tc(vii) to Tc(iv) in all investigated systems, as predicted from experimental (pH m + pe) measurements and thermodynamic calculations. Two Tc endmember species are identified by EXAFS in the magnetite system, Tc substituting for Fe in the magnetite structure and Tc-Tc dimers sorbed to the magnetite {111} faces through a triple bond. The sorption endmember is favoured at higher [Tc], whereas incorporation prevails at low [Tc] and less alkaline pH conditions. The key role of pH in the uptake mechanism is interpreted in terms of magnetite solubility, with higher [Fe] and greater recrystallization rates occurring at lower pH values. A TcS x -like phase is predominant in all investigated mackinawite systems, although the contribution of up to 20% of TcO 2 ·xH 2 O(s) (likely as surface precipitate) is observed for the highest investigated loadings (900 ppm). These results provide key inputs for an accurate mechanistic interpretation of the Tc uptake by magnetite and mackinawite, so far controversially discussed in the literature, and represent a highly relevant contribution to the investigation of Tc retention processes in the context of nuclear waste disposal.

Freezing transition of the random bond RNA model: Statistical properties of the pairing weights

NASA Astrophysics Data System (ADS)

Monthus, Cécile; Garel, Thomas

2007-03-01

To characterize the pairing specificity of RNA secondary structures as a function of temperature, we analyze the statistics of the pairing weights as follows: for each base (i) of the sequence of length N , we consider the (N-1) pairing weights wi(j) with the other bases (j≠i) of the sequence. We numerically compute the probability distributions P1(w) of the maximal weight wimax=maxj[wi(j)] , the probability distribution Π(Y2) of the parameter Y2(i)=∑jwi2(j) , as well as the average values of the moments Yk(i)=∑jwik(j) . We find that there are two important temperatures TcTgap , the distribution P1(w) vanishes at some value w0(T)<1 , and accordingly the moments Yk(i)¯ decay exponentially as [w0(T)]k in k . For T

Psychiatric Illness in Takotsubo (Stress) Cardiomyopathy: A Review.

PubMed

Nayeri, Arash; Rafla-Yuan, Eric; Krishnan, Srikanth; Ziaeian, Boback; Cadeiras, Martin; McPherson, John A; Wells, Quinn S

Takotsubo cardiomyopathy (TC), also known as stress-induced cardiomyopathy, has been increasingly described in relation to psychiatric illness. We performed a literature review to identify the key findings related to psychiatric illness in TC that may be relevant to the practice of mental health and other health care providers. The association of psychiatric illness with TC in addition to the spectrum of psychiatric illness found in TC, the role of exacerbation or treatment of psychiatric illness in triggering TC, different modes of presentation, prognostic implications, and long-term management of psychiatric illness in TC are discussed. Additionally, we review the limitations of the pre-existing literature and suggest areas of future research. There is a strong association between pre-existing psychiatric illness, particularly anxiety and mood spectrum disorders, and TC. Acute exacerbation of psychiatric illness, rapid uptitration or overdose of certain psychotropic agents, and electroconvulsive therapy may trigger TC. Further studies are needed to better evaluate the prognostic significance and long-term management of psychiatric illness in TC. Copyright © 2018 Academy of Consultation-Liaison Psychiatry. Published by Elsevier Inc. All rights reserved.

Definition of RNA Polymerase II CoTC Terminator Elements in the Human Genome

PubMed Central

Nojima, Takayuki; Dienstbier, Martin; Murphy, Shona; Proudfoot, Nicholas J.; Dye, Michael J.

2013-01-01

Summary Mammalian RNA polymerase II (Pol II) transcription termination is an essential step in protein-coding gene expression that is mediated by pre-mRNA processing activities and DNA-encoded terminator elements. Although much is known about the role of pre-mRNA processing in termination, our understanding of the characteristics and generality of terminator elements is limited. Whereas promoter databases list up to 40,000 known and potential Pol II promoter sequences, fewer than ten Pol II terminator sequences have been described. Using our knowledge of the human β-globin terminator mechanism, we have developed a selection strategy for mapping mammalian Pol II terminator elements. We report the identification of 78 cotranscriptional cleavage (CoTC)-type terminator elements at endogenous gene loci. The results of this analysis pave the way for the full understanding of Pol II termination pathways and their roles in gene expression. PMID:23562152

Influence of the chelator structures on the stability of Re and Tc tricarbonyl complexes with iminodiacetic acid tridentate ligands: a computational study.

PubMed

Hernández-Valdés, Daniel; Rodríguez-Riera, Zalua; Díaz-García, Alicia; Benoist, Eric; Jáuregui-Haza, Ulises

2016-08-01

The development of novel radiopharmaceuticals for nuclear medicine based on M(CO)3 (M = Tc, Re) complexes has attracted great attention. The versatility of this core and the easy production of the fac-[M(CO)3(H2O)3](+) precursor could explain this interest. The main characteristics of these tricarbonyl complexes are the high substitution stability of the three CO ligands and the corresponding lability of the coordinated water molecules, yielding, via easy exchange of a variety of bi- and tridentate ligands, complexes xof very high kinetic stability. Here, a computational study of different tricarbonyl complexes of Re(I) and Tc(I) was performed using density functional theory. The solvent effect was simulated using the polarizable continuum model. These structures were used as a starting point to investigate the relative stabilities of tricarbonyl complexes with various tridentate ligands. These complexes included an iminodiacetic acid unit for tridentate coordination to the fac-[M(CO)3](+) moiety (M = Re, Tc), an aromatic ring system bearing a functional group (-NO2, -NH2, and -Cl) as a linking site model, and a tethering moiety (a methylene, ethylene, propylene butylene, or pentylene bridge) between the linking and coordinating sites. The optimized complexes showed geometries comparable to those inferred from X-ray data. In general, the Re complexes were more stable than the corresponding Tc complexes. Furthermore, using NH2 as the functional group, a medium length carbon chain, and ortho substitution increased complex stability. All of the bonds involving the metal center presented a closed shell interaction with dative or covalent character, and the strength of these bonds decreased in the sequence Tc-CO > Tc-O > Tc-N.

Molecular characterization and interactome analysis of Trypanosoma cruzi tryparedoxin II.

PubMed

Arias, Diego G; Piñeyro, María Dolores; Iglesias, Alberto A; Guerrero, Sergio A; Robello, Carlos

2015-04-29

Trypanosoma cruzi, the causative agent of Chagas disease, possesses two tryparedoxins (TcTXNI and TcTXNII), belonging to the thioredoxin superfamily. TXNs are oxidoreductases which mediate electron transfer between trypanothione and peroxiredoxins. This constitutes a difference with the host cells, in which these activities are mediated by thioredoxins. These differences make TXNs an attractive target for drug development. In a previous work we characterized TcTXNI, including the redox interactome. In this work we extend the study to TcTXNII. We demonstrate that TcTXNII is a transmembrane protein anchored to the surface of the mitochondria and endoplasmic reticulum, with a cytoplasmatic orientation of the redox domain. It would be expressed during the metacyclogenesis process. In order to continue with the characterization of the redox interactome of T. cruzi, we designed an active site mutant TcTXNII lacking the resolving cysteine, and through the expression of this mutant protein and incubation with T. cruzi proteins, heterodisulfide complexes were isolated by affinity chromatography and identified by mass spectrometry. This allowed us to identify sixteen TcTXNII interacting proteins, which are involved in a wide range of cellular processes, indicating the relevance of TcTXNII, and contributing to our understanding of the redox interactome of T. cruzi. T. cruzi, the causative agent of Chagas disease, constitutes a major sanitary problem in Latin America. The number of estimated infected persons is ca. 8 million, 28 million people are at risk of infection and ~20,000 deaths occur per year in endemic regions. No vaccines are available at present, and most drugs currently in use were developed decades ago and show variable efficacy with undesirable side effects. The parasite is able to live and prolipherate inside macrophage phagosomes, where it is exposed to cytotoxic reactive oxygen and nitrogen species, derived from macrophage activation. Therefore, T. cruzi antioxidant mechanisms constitute an active field of investigation, since they could provide the basis for a rational drug development. Peroxide detoxification in this parasite is achieved by ascorbate peroxidase and different thiol-dependent peroxidases. Among them, both mitochondrial and cytosolic tryparedoxin peroxidases, typical two-cysteine peroxiredoxins, were found to be important for hydrogen peroxide and peroxynitrite detoxification and their expression levels correlated with parasite infectivity and virulence. In trypanosomes tryparedoxins and not thioredoxins act as peroxiredoxin reductases, suggesting that these enzymes substitute thioredoxins in these parasites. T. cruzi possesses two tryparedoxin genes, TcTXNI and TcTXN II. Since thioredoxins are proteins with several targets actively participating of complex redox networks, we have previously investigated if this is the case also for TcTXNI, for which we described relevant partners (J Proteomics. 2011;74(9):1683-92). In this manuscript we investigated the interactions of TcTXNII. We have designed an active site mutant tryparedoxin II lacking the resolving cysteine and, through the expression of this mutant protein and its incubation with T. cruzi proteins, hetero disulfide complexes were isolated by affinity chromatography purification and identified by electrophoresis separation and MS identification. This allowed us to identify sixteen TcTXNII interacting proteins which are involved in different and relevant cellular processes. Moreover, we demonstrate that TcTXNII is a transmembrane protein anchored to the surface of the mitochondria and endoplasmic reticulum. Copyright © 2015 Elsevier B.V. All rights reserved.

T-cell receptor V sub. alpha. and C sub. alpha. alleles associated with multiple sclerosis and myasthenia gravis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Oksenberg, J.R.; Cavalli-Sforza, L.L.; Steinman, L.

1989-02-01

Polymorphic markers in genes encoding the {alpha} chain of the human T-cell receptor (TcR) have been detected by Southern blot analysis in Pss I digests. Polymorphic bands were observed at 6.3 and 2.0 kilobases (kb) with frequencies of 0.30 and 0.44, respectively, in the general population. Using the polymerase chain reaction (PCR) method, the authors amplified selected sequences derived from the full-length TcR {alpha} cDNA probe. These PcR products were used as specific probes to demonstrate that the 6.3-kb polymorphic fragment hybridizes to the variable (V)-region probe and the 2.0-kb fragment hybridizes to the constant (C)-region probe. Segregation of themore » polymorphic bands was analyzed in family studies. To look for associations between these markers and autoimmune diseases, the authors have studied the restriction fragment length polymorphism distribution of the Pss I markers in patients with multiple sclerosis, myasthenia gravis, and Graves disease. Significant differences in the frequency of the polymorphic V{sub {alpha}} and C{sub {alpha}} markers were identified between patients and healthy individuals.« less

APOBEC3B upregulation and genomic mutation patterns in serous ovarian carcinoma

PubMed Central

Leonard, Brandon; Hart, Steven N.; Burns, Michael B.; Carpenter, Michael A.; Temiz, Nuri A.; Rathore, Anurag; Vogel, Rachel Isaksson; Nikas, Jason B.; Law, Emily K.; Brown, William L.; Li, Ying; Zhang, Yuji; Maurer, Matthew J.; Oberg, Ann L.; Cunningham, Julie M.; Shridhar, Viji; Bell, Debra A.; April, Craig; Bentley, David; Bibikova, Marina; Cheetham, R. Keira; Fan, Jian-Bing; Grocock, Russell; Humphray, Sean; Kingsbury, Zoya; Peden, John; Chien, Jeremy; Swisher, Elizabeth M.; Hartmann, Lynn C.; Kalli, Kimberly R.; Goode, Ellen L.; Sicotte, Hugues; Kaufmann, Scott H.; Harris, Reuben S.

2013-01-01

Ovarian cancer is a clinically and molecularly heterogeneous disease. The driving forces behind this variability are unknown. Here we report wide variation in expression of the DNA cytosine deaminase APOBEC3B, with elevated expression in a majority of ovarian cancer cell lines (3 standard deviations above the mean of normal ovarian surface epithelial cells) and high grade primary ovarian cancers. APOBEC3B is active in the nucleus of several ovarian cancer cell lines and elicits a biochemical preference for deamination of cytosines in 5′TC dinucleotides. Importantly, examination of whole-genome sequence from 16 ovarian cancers reveals that APOBEC3B expression correlates with total mutation load as well as elevated levels of transversion mutations. In particular, high APOBEC3B expression correlates with C-to-A and C-to-G transversion mutations within 5′TC dinucleotide motifs in early-stage high grade serous ovarian cancer genomes, suggesting that APOBEC3B-catalyzed genomic uracil lesions are further processed by downstream DNA ‘repair’ enzymes including error-prone translesion polymerases. These data identify a potential role for APOBEC3B in serous ovarian cancer genomic instability. PMID:24154874

Unusual splice site mutations disrupt FANCA exon 8 definition.

PubMed

Mattioli, Chiara; Pianigiani, Giulia; De Rocco, Daniela; Bianco, Anna Monica Rosaria; Cappelli, Enrico; Savoia, Anna; Pagani, Franco

2014-07-01

The pathological role of mutations that affect not conserved splicing regulatory sequences can be difficult to determine. In a patient with Fanconi anemia, we identified two unpredictable splicing mutations that act on either sides of FANCA exon 8. In patients-derived cells and in minigene splicing assay, we showed that both an apparently benign intronic c.710-5T>C transition and the nonsense c.790C>T substitution induce almost complete exon 8 skipping. Site-directed mutagenesis experiments indicated that the c.710-5T>C transition affects a polypyrimidine tract where most of the thymidines cannot be compensated by cytidines. The c.790C>T mutation located in position -3 relative to the donor site induce exon 8 skipping in an NMD-independent manner and complementation experiments with modified U1 snRNAs showed that U1 snRNP is only partially involved in the splicing defect. Our results highlight the importance of performing splicing functional assay for correct identification of disease-causing mechanism of genomic variants and provide mechanistic insights on how these two FANCA mutations affect exon 8 definition. Copyright © 2014 Elsevier B.V. All rights reserved.

Genetic variations of the SLCO1B1 gene in the Chinese, Malay and Indian populations of Singapore.

PubMed

Ho, Woon Fei; Koo, Seok Hwee; Yee, Jie Yin; Lee, Edmund Jon Deoon

2008-01-01

OATP1B1 is a liver-specific transporter that mediates the uptake of various endogenous and exogenous compounds including many clinically used drugs from blood into hepatocytes. This study aims to identify genetic variations of SLCO1B1 gene in three distinct ethnic groups of the Singaporean population (n=288). The coding region of the gene encoding the transporter protein was screened for genetic variations in the study population by denaturing high-performance liquid chromatography and DNA sequencing. Twenty-five genetic variations of SLCO1B1, including 10 novel ones, were found: 13 in the coding exons (9 nonsynonymous and 4 synonymous variations), 6 in the introns, and 6 in the 3' untranslated region. Four novel nonsynonymous variations: 633A>G (Ile211Met), 875C>T (Ala292Val), 1837T>C (Cys613Arg), and 1877T>A (Leu626Stop) were detected as heterozygotes. Among the novel nonsynonymous variations, 633A>G, 1837T>C, and 1877T>A were predicted to be functionally significant. These data would provide fundamental and useful information for pharmacogenetic studies on drugs that are substrates of OATP1B1 in Asians.

Identification of Trypanosoma cruzi discrete typing units (DTUs) through the implementation of a high-resolution melting (HRM) genotyping assay.

PubMed

Higuera, Sonia L; Guhl, Felipe; Ramírez, Juan David

2013-04-20

Chagas disease, caused by Trypanosoma cruzi, is a geographically widespread anthropozoonosis that is considered a major public health problem in Latin America. Because this parasite presents high genetic variability, a nomenclature has been adopted to classify the parasite into six discrete typing units (DTUs): TcI, TcII, TcIII, TcIV, TcV, and TcVI, which present different eco-epidemiological, clinical, and geographic associations. Currently, the available genotyping methods present a series of drawbacks that implies the need for developing new methods for characterizing T. cruzi DTU's. The aim of this work was to genotype reference populations from T. cruzi by means of a High-Resolution Melting (HRM) genotyping assay. Amplification of the mini-exon gene allowed the genotyping of three distinct groups: TcI, TcII- TcIV- TcV, and TcIII-TcVI, while amplification of the 24sα gene generated non-overlapping melting temperature ranges for each DTU that were used to identify the groups in the six existing DTUs of Trypanosoma cruzi. The proposed genotyping assay allowed discrimination of the six genetic groups by obtaining specific melting curves for each DTU. The application of this technique is proposed because of its specificity, sensitivity, high performance, and low cost compared with other previously described characterization methods.

Novel genetic risk variants for pediatric celiac disease.

PubMed

Balasopoulou, Angeliki; Stanković, Biljana; Panagiotara, Angeliki; Nikčevic, Gordana; Peters, Brock A; John, Anne; Mendrinou, Effrosyni; Stratopoulos, Apostolos; Legaki, Aigli Ioanna; Stathakopoulou, Vasiliki; Tsolia, Aristoniki; Govaris, Nikolaos; Govari, Sofia; Zagoriti, Zoi; Poulas, Konstantinos; Kanariou, Maria; Constantinidou, Nikki; Krini, Maro; Spanou, Kleopatra; Radlovic, Nedeljko; Ali, Bassam R; Borg, Joseph; Drmanac, Radoje; Chrousos, George; Pavlovic, Sonja; Roma, Eleftheria; Zukic, Branka; Patrinos, George P; Katsila, Theodora

2016-10-24

Celiac disease is a complex chronic immune-mediated disorder of the small intestine. Today, the pathobiology of the disease is unclear, perplexing differential diagnosis, patient stratification, and decision-making in the clinic. Herein, we adopted a next-generation sequencing approach in a celiac disease trio of Greek descent to identify all genomic variants with the potential of celiac disease predisposition. Analysis revealed six genomic variants of prime interest: SLC9A4 c.1919G>A, KIAA1109 c.2933T>C and c.4268_4269delCCinsTA, HoxB6 c.668C>A, HoxD12 c.418G>A, and NCK2 c.745_746delAAinsG, from which NCK2 c.745_746delAAinsG is novel. Data validation in pediatric celiac disease patients of Greek (n = 109) and Serbian (n = 73) descent and their healthy counterparts (n = 111 and n = 32, respectively) indicated that HoxD12 c.418G>A is more prevalent in celiac disease patients in the Serbian population (P < 0.01), while NCK2 c.745_746delAAinsG is less prevalent in celiac disease patients rather than healthy individuals of Greek descent (P = 0.03). SLC9A4 c.1919G>A and KIAA1109 c.2933T>C and c.4268_4269delCCinsTA were more abundant in patients; nevertheless, they failed to show statistical significance. The next-generation sequencing-based family genomics approach described herein may serve as a paradigm towards the identification of novel functional variants with the aim of understanding complex disease pathobiology.

The B7 family of immunoregulatory receptors: A comparative and evolutionary perspective

USGS Publications Warehouse

Hansen, J.D.; Pasquier, L.D.; Lefranc, M.-P.; Lopez, V.; Benmansour, A.; Boudinot, P.

2009-01-01

In mammals, T cell activation requires specific recognition of the peptide-MHC complex by the TcR and co-stimulatory signals. Important co-stimulatory receptors expressed by T cells are the molecules of the CD28 family, that regulate T cell activation, proliferation and tolerance. These receptors recognize B7s and B7-homologous (B7H) molecules that are typically expressed by the antigen presenting cells. In teleost fish, typical T cell responses have been described and the TcR, MHC and CD28/CTLA4 genes have been characterized. In contrast, the members of the B7 gene family have only been described in mammals and birds and have yet to be addressed in lower vertebrates. To learn more about the evolution of components guiding T cell activation in vertebrates, we performed a systematic genomic survey for the B7 co-stimulatory and co-inhibitory IgSF receptors in lower vertebrates with an emphasis on teleost fish. Our search identified fish sequences that are orthologous to B7, B7-H1/B7-DC, B7-H3 and B7-H4 as defined by sequence identity, phylogeny and combinations of short or long-range syntenic relationships. However, we were unable to identify clear orthologs for B7-H2 (CD275, ICOS ligand) in bony fish, which correlates with our prior inability to find ICOS in fish. Interestingly, our results indicate that teleost fish possess a single B7.1/B7.2 (CD80/86) molecule that likely interacts with CD28/CTLA4 as the ligand-binding regions seem to be conserved in both partners. Overall, our analyses implies that gene duplication (and loss) have shaped a molecular repertoire of B7-like molecules that was recruited for the refinement of T cell activation during the evolution of the vertebrates.

Chagas disease reactivation in a heart transplant patient infected by domestic Trypanosoma cruzi discrete typing unit I (TcIDOM).

PubMed

Costales, Jaime A; Kotton, Camille N; Zurita-Leal, Andrea C; Garcia-Perez, Josselyn; Llewellyn, Martin S; Messenger, Louisa A; Bhattacharyya, Tapan; Burleigh, Barbara A

2015-08-25

Trypanosoma cruzi, causative agent of Chagas disease, displays high intraspecific genetic diversity: six genetic lineages or discrete typing units (DTUs) are currently recognized, termed TcI through TcVI. Each DTU presents a particular distribution pattern across the Americas, and is loosely associated with different transmission cycles and hosts. Several DTUs are known to circulate in Central America. It has been previously suggested that TcI infection is benign and does not lead to chronic chagasic cardiomyopathy (CCC). In this study, we genotyped T. cruzi parasites circulating in the blood and from explanted cardiac tissue of an El Salvadorian patient who developed reactivation Chagas disease while on immunosuppressive medications after undergoing heart transplant in the U.S. as treatment for end-stage CCC. Parasite typing was performed through molecular methods (restriction fragment length polymorphism of polymerase reaction chain amplified products, microsatellite typing, maxicircle sequence typing and low-stringency single primer PCR, [LSSP-PCR]) as well as lineage-specific serology. We show that the parasites infecting the patient belong to the TcI DTU exclusively. Our data indicate that the parasites isolated from the patient belong to a genotype frequently associated with human infection throughout the Americas (TcIDOM). Our results constitute compelling evidence in support of TcI DTU's ability to cause end-stage CCC and help dispel any residual bias that infection with this lineage is benign, pointing to the need for increased surveillance for dissemination of this genotype in endemic regions, the USA and globally.

The Contribution of the Activation Entropy to the Gas-Phase Stability of Modified Nucleic Acid Duplexes

NASA Astrophysics Data System (ADS)

Hari, Yvonne; Dugovič, Branislav; Istrate, Alena; Fignolé, Annabel; Leumann, Christian J.; Schürch, Stefan

2016-07-01

Tricyclo-DNA (tcDNA) is a sugar-modified analogue of DNA currently tested for the treatment of Duchenne muscular dystrophy in an antisense approach. Tandem mass spectrometry plays a key role in modern medical diagnostics and has become a widespread technique for the structure elucidation and quantification of antisense oligonucleotides. Herein, mechanistic aspects of the fragmentation of tcDNA are discussed, which lay the basis for reliable sequencing and quantification of the antisense oligonucleotide. Excellent selectivity of tcDNA for complementary RNA is demonstrated in direct competition experiments. Moreover, the kinetic stability and fragmentation pattern of matched and mismatched tcDNA heteroduplexes were investigated and compared with non-modified DNA and RNA duplexes. Although the separation of the constituting strands is the entropy-favored fragmentation pathway of all nucleic acid duplexes, it was found to be only a minor pathway of tcDNA duplexes. The modified hybrid duplexes preferentially undergo neutral base loss and backbone cleavage. This difference is due to the low activation entropy for the strand dissociation of modified duplexes that arises from the conformational constraint of the tc-sugar-moiety. The low activation entropy results in a relatively high free activation enthalpy for the dissociation comparable to the free activation enthalpy of the alternative reaction pathway, the release of a nucleobase. The gas-phase behavior of tcDNA duplexes illustrates the impact of the activation entropy on the fragmentation kinetics and suggests that tandem mass spectrometric experiments are not suited to determine the relative stability of different types of nucleic acid duplexes.

Small GTPase Tc10 and its homologue RhoT induce N-WASP-mediated long process formation and neurite outgrowth.

PubMed

Abe, Tomoyuki; Kato, Masayoshi; Miki, Hiroaki; Takenawa, Tadaomi; Endo, Takeshi

2003-01-01

Rho family small GTPases regulate multiple cellular functions through reorganization of the actin cytoskeleton. Among them, Cdc42 and Tc10 induce filopodia or peripheral processes in cultured cells. We have identified a member of the family, designated as RhoT, which is closely related to Tc10. Tc10 was highly expressed in muscular tissues and brain and remarkably induced during differentiation of C2 skeletal muscle cells and neuronal differentiation of PC12 and N1E-115 cells. On the other hand, RhoT was predominantly expressed in heart and uterus and induced during neuronal differentiation of N1E-115 cells. Tc10 exogenously expressed in fibroblasts generated actin-filament-containing peripheral processes longer than the Cdc42-formed filopodia, whereas RhoT produced much longer and thicker processes containing actin filaments. Furthermore, both Tc10 and RhoT induced neurite outgrowth in PC12 and N1E-115 cells, but Cdc42 did not do this by itself. Tc10 and RhoT as well as Cdc42 bound to the N-terminal CRIB-motif-containing portion of N-WASP and activated N-WASP to induce Arp2/3-complex-mediated actin polymerization. The formation of peripheral processes and neurites by Tc10 and RhoT was prevented by the coexpression of dominant-negative mutants of N-WASP. Thus, N-WASP is essential for the process formation and neurite outgrowth induced by Tc10 and RhoT. Neuronal differentiation of PC12 and N1E-115 cells induced by dibutyryl cyclic AMP and by serum starvation, respectively, was prevented by dominant-negative Cdc42, Tc10 and RhoT. Taken together, all these Rho family proteins are required for neuronal differentiation, but they exert their functions differentially in process formation and neurite extension. Consequently, N-WASP activated by these small GTPases mediates neuronal differentiation in addition to its recently identified role in glucose uptake.

Severe infantile leigh syndrome associated with a rare mitochondrial ND6 mutation, m.14487T>C.

PubMed

Tarnopolsky, Mark; Meaney, Brandon; Robinson, Brian; Sheldon, Katherine; Boles, Richard G

2013-08-01

We describe a case of severe infantile-onset complex I deficiency in association with an apparent de novo near-homoplasmic mutation (m.14487T>C) in the mitochondrial ND6 gene, which was previously associated with Leigh syndrome and other neurological disorders. The mutation was near-homoplasmic in muscle by NextGen sequencing (99.4% mutant), homoplasmic in muscle by Sanger sequencing, and it was associated with a severe complex I deficiency in both muscle and fibroblasts. This supports previous data regarding Leigh syndrome being on the severe end of a phenotypic spectrum including progressive myoclonic epilepsy, childhood-onset dystonia, bilateral striatal necrosis, and optic atrophy, depending on the proportion of mutant heteroplasmy. While the mother in all previously reported cases was heteroplasmic, the mother and brother of this case were homoplasmic for the wild-type, m.14487T. Importantly, the current data demonstrate the potential for cases of mutations that were previously reported to be homoplasmic by Sanger sequencing to be less homoplasmic by NextGen sequencing. This case underscores the importance of considering mitochondrial DNA mutations in families with a negative family history, even in offspring of those who have tested negative for a specific mtDNA mutation. Copyright © 2013 Wiley Periodicals, Inc.

Remote-loading labeling of liposomes with (99m)Tc-BMEDA and its stability evaluation: effects of lipid formulation and pH/chemical gradient.

PubMed

Li, Shihong; Goins, Beth; Phillips, William T; Bao, Ande

2011-03-01

Efficient, convenient, and stable radiolabeling plays a critical role for the monitoring of liposome behavior via either blood sampling, organ distribution, or noninvasive nuclear imaging. The direct labeling of liposome-carrying drugs without any prior modification undoubtedly is convenient and optimal for liposomal drug testing. In this article, we investigated the effect of various lipid formulations and pH/chemical gradients on the radiolabeling efficiency and entrapment stability of technetium-99m ((99m)Tc) remotely loaded into liposomes, using (99m)Tc-N,N-bis(2-mercaptoethyl)-N',N'-diethyl-ethylenediamine ((99m)Tc-BMEDA) complex. The tested liposomes either contained unsaturated lipid or possessed various surface charges. (99m)Tc could be efficiently loaded into various premanufactured liposomes containing either an ammonium sulfate pH, citrate pH, or glutathione (GSH) chemical gradient. (99m)Tc-entrapment stabilities of these liposomes in phosphate-buffered saline (PBS; pH 7.4) buffer at 25°C were mainly dependent on the pH/chemical gradient, but not lipid formulation. Stability sequence was ammonium sulfate pH-gradient>citrate pH-gradient>GSH-gradient. Stabilities of (99m)Tc-liposomes in 50% fetal bovine serum (FBS)/PBS (pH 7.4) buffer at 37°C are dependent on both lipid formulation and pH/chemical gradient. Specifically, (99m)Tc labeling of the ammonium sulfate pH-gradient liposomes were less stable in 50% FBS/PBS than in PBS, whereas noncationic liposomes with citrate pH- or GSH-gradient displayed higher stability, except that anionic citrate pH-gradient liposomes showed no stability difference in these two media. Cationic liposomes aggregated in 50% FBS/PBS, forming a new discrete fraction with larger particle sizes. These in vitro characterization results have indicated the optimism of using (99m)Tc-BMEDA for labeling pH/GSH gradient liposomes without the requirement of modifying lipid formulation for liposomal therapeutic-agent development.

The impact of low-frequency and rare variants on lipid levels

PubMed Central

Surakka, Ida; Horikoshi, Momoko; Mägi, Reedik; Sarin, Antti-Pekka; Mahajan, Anubha; Lagou, Vasiliki; Marullo, Letizia; Ferreira, Teresa; Miraglio, Benjamin; Timonen, Sanna; Kettunen, Johannes; Pirinen, Matti; Karjalainen, Juha; Thorleifsson, Gudmar; Hägg, Sara; Hottenga, Jouke-Jan; Isaacs, Aaron; Ladenvall, Claes; Beekman, Marian; Esko, Tõnu; Ried, Janina S; Nelson, Christopher P; Willenborg, Christina; Gustafsson, Stefan; Westra, Harm-Jan; Blades, Matthew; de Craen, Anton JM; de Geus, Eco J; Deelen, Joris; Grallert, Harald; Hamsten, Anders; Havulinna, Aki S.; Hengstenberg, Christian; Houwing-Duistermaat, Jeanine J; Hyppönen, Elina; Karssen, Lennart C; Lehtimäki, Terho; Lyssenko, Valeriya; Magnusson, Patrik KE; Mihailov, Evelin; Müller-Nurasyid, Martina; Mpindi, John-Patrick; Pedersen, Nancy L; Penninx, Brenda WJH; Perola, Markus; Pers, Tune H; Peters, Annette; Rung, Johan; Smit, Johannes H; Steinthorsdottir, Valgerdur; Tobin, Martin D; Tsernikova, Natalia; van Leeuwen, Elisabeth M; Viikari, Jorma S; Willems, Sara M; Willemsen, Gonneke; Schunkert, Heribert; Erdmann, Jeanette; Samani, Nilesh J; Kaprio, Jaakko; Lind, Lars; Gieger, Christian; Metspalu, Andres; Slagboom, P Eline; Groop, Leif; van Duijn, Cornelia M; Eriksson, Johan G; Jula, Antti; Salomaa, Veikko; Boomsma, Dorret I; Power, Christine; Raitakari, Olli T; Ingelsson, Erik; Järvelin, Marjo-Riitta; Stefansson, Kari; Franke, Lude; Ikonen, Elina; Kallioniemi, Olli; Pietiäinen, Vilja; Lindgren, Cecilia M; Thorsteinsdottir, Unnur; Palotie, Aarno; McCarthy, Mark I; Morris, Andrew P; Prokopenko, Inga; Ripatti, Samuli

2016-01-01

Using a genome-wide screen of 9.6 million genetic variants achieved through 1000 Genomes imputation in 62,166 samples, we identify association to lipids in 93 loci including 79 previously identified loci with new lead-SNPs, 10 new loci, 15 loci with a low-frequency and 10 loci with missense lead-SNPs, and, 2 loci with an accumulation of rare variants. In six loci, SNPs with established function in lipid genetics (CELSR2, GCKR, LIPC, and APOE), or candidate missense mutations with predicted damaging function (CD300LG and TM6SF2), explained the locus associations. The low-frequency variants increased the proportion of variance explained, particularly for LDL-C and TC. Altogether, our results highlight the impact of low-frequency variants in complex traits and show that imputation offers a cost-effective alternative to re-sequencing. PMID:25961943

Preliminary analysis of murine cytotoxic T cell responses to the proteins of the flavivirus Kunjin using vaccinia virus expression.

PubMed

Parrish, C R; Coia, G; Hill, A; Müllbacher, A; Westaway, E G; Blanden, R V

1991-07-01

A series of recombinant vaccinia viruses expressing various parts of the entire Kunjin virus (KUN) coding region was used to analyse the cytotoxic T (Tc) cell responses to KUN. CBA/H mice inoculated with KUN or West Nile virus were shown to develop responses to KUN or various vaccinia virus expression constructs in either primary cytotoxic assays, or after secondary stimulation of the Tc cells in vitro with KUN antigens. Tc cells from CBA mice showed the strongest response to target cells infected with recombinant vaccinia viruses expressing parts of the KUN NS3 and NS4A proteins, and only a weak response to the other structural or non-structural proteins. Further analysis of deleted versions of the NS3-NS4A region showed that the main epitope recognized was derived from a sequence of 99 amino acids spanning parts of NS3 and NS4A. No other major epitopes were detected by Tc cells from CBA mice in the remaining 3333 amino acids of the KUN polypeptide.

A novel paired domain DNA recognition motif can mediate Pax2 repression of gene transcription.

PubMed

Håvik, B; Ragnhildstveit, E; Lorens, J B; Saelemyr, K; Fauske, O; Knudsen, L K; Fjose, A

1999-12-20

The paired domain (PD) is an evolutionarily conserved DNA-binding domain encoded by the Pax gene family of developmental regulators. The Pax proteins are transcription factors and are involved in a variety of processes such as brain development, patterning of the central nervous system (CNS), and B-cell development. In this report we demonstrate that the zebrafish Pax2 PD can interact with a novel type of DNA sequences in vitro, the triple-A motif, consisting of a heptameric nucleotide sequence G/CAAACA/TC with an invariant core of three adjacent adenosines. This recognition sequence was found to be conserved in known natural Pax5 repressor elements involved in controlling the expression of the p53 and J-chain genes. By identifying similar high affinity binding sites in potential target genes of the Pax2 protein, including the pax2 gene itself, we obtained further evidence that the triple-A sites are biologically significant. The putative natural target sites also provide a basis for defining an extended consensus recognition sequence. In addition, we observed in transformation assays a direct correlation between Pax2 repressor activity and the presence of triple-A sites. The results suggest that a transcriptional regulatory function of Pax proteins can be modulated by PD binding to different categories of target sequences. Copyright 1999 Academic Press.

Unraveling the differences of the hydrolytic activity of Trypanosoma cruzi trans-sialidase and Trypanosoma rangeli sialidase: a quantum mechanics-molecular mechanics modeling study.

PubMed

Bueren-Calabuig, Juan A; Pierdominici-Sottile, Gustavo; Roitberg, Adrian E

2014-06-05

Chagas' disease, also known as American trypanosomiasis, is a lethal, chronic disease that currently affects more than 10 million people in Central and South America. The trans-sialidase from Trypanosoma cruzi (T. cruzi, TcTS) is a crucial enzyme for the survival of this parasite: sialic acids from the host are transferred to the cell surface glycoproteins of the trypanosome, thereby evading the host's immune system. On the other hand, the sialidase of T. rangeli (TrSA), which shares 70% sequence identity with TcTS, is a strict hydrolase and shows no trans-sialidase activity. Therefore, TcTS and TrSA represent an excellent framework to understand how different catalytic activities can be achieved with extremely similar structures. By means of combined quantum mechanics-molecular mechanics (QM/MM, SCC-DFTB/Amberff99SB) calculations and umbrella sampling simulations, we investigated the hydrolysis mechanisms of TcTS and TrSA and computed the free energy profiles of these reactions. The results, together with our previous computational investigations, are able to explain the catalytic mechanism of sialidases and describe how subtle differences in the active site make TrSA a strict hydrolase and TcTS a more efficient trans-sialidase.

Polymorphisms in the promoter region of the bovine lactoferrin gene influence milk somatic cell score and milk production traits in Chinese Holstein cows.

PubMed

Mao, Yongjiang; Zhu, Xiaorui; Xing, Shiyu; Zhang, Meirong; Zhang, Huimin; Wang, Xiaolong; Karrow, Niel; Yang, Liguo; Yang, Zhangping

2015-12-01

Lactoferrin is an iron-binding protein found in cow's milk that plays an important role in preventing mastitis caused by intramammary infection. In this study, 20 Chinese Holstein cows were selected randomly for PCR amplification and sequencing of the bovine lactoferrin gene promoter region and used for SNP discovery in the region between nucleotide positions -461 to -132. Three SNPs (-270T>C, -190G>A and -156A>G) were identified in bovine lactoferrin, then Chinese Holstein cows (n=866) were genotyped using Sequenom MassARRAY (Sequenom Inc., San Diego, CA) based on the previous SNP information in this study, and the associations between SNPs or haplotype and milk somatic cell score (SCS) and production traits were analyzed by the least squares method in the GLM procedure of SAS. SNPs -270T>C and -156A>G showed close linkage disequilibrium (r(2)=0.76). The SNP -190G>A showed a significant association with SCS, and individuals with genotype GG had higher SCS than genotypes AG and AA. Associations were found between the SNPs -270T>C and -190G>A with SCS and the milk composition. The software MatInspector revealed that these SNPs were located within several potential transcription factor binding sites, including NF-κB p50, KLF7 and SP1, and may alter gene expression, but further investigation will be required to elucidate the biological and practical relevance of these SNPs. Copyright © 2015 Elsevier Ltd. All rights reserved.

Over Six Thousand Trypanosoma cruzi Strains Classified into Discrete Typing Units (DTUs): Attempt at an Inventory.

PubMed

Brenière, Simone Frédérique; Waleckx, Etienne; Barnabé, Christian

2016-08-01

Trypanosoma cruzi, the causative agent of Chagas disease, presents wide genetic diversity. Currently, six discrete typing units (DTUs), named TcI to TcVI, and a seventh one called TcBat are used for strain typing. Beyond the debate concerning this classification, this systematic review has attempted to provide an inventory by compiling the results of 137 articles that have used it. A total of 6,343 DTU identifications were analyzed according to the geographical and host origins. Ninety-one percent of the data available is linked to South America. This sample, although not free of potential bias, nevertheless provides today's picture of T. cruzi genetic diversity that is closest to reality. DTUs were genotyped from 158 species, including 42 vector species. Remarkably, TcI predominated in the overall sample (around 60%), in both sylvatic and domestic cycles. This DTU known to present a high genetic diversity, is very widely distributed geographically, compatible with a long-term evolution. The marsupial is thought to be its most ancestral host and the Gran Chaco region the place of its putative origin. TcII was rarely sampled (9.6%), absent, or extremely rare in North and Central America, and more frequently identified in domestic cycles than in sylvatic cycles. It has a low genetic diversity and has probably found refuge in some mammal species. It is thought to originate in the south-Amazon area. TcIII and TcIV were also rarely sampled. They showed substantial genetic diversity and are thought to be composed of possible polyphyletic subgroups. Even if they are mostly associated with sylvatic transmission cycles, a total of 150 human infections with these DTUs have been reported. TcV and TcVI are clearly associated with domestic transmission cycles. Less than 10% of these DTUs were identified together in sylvatic hosts. They are thought to originate in the Gran Chaco region, where they are predominant and where putative parents exist (TcII and TcIII). Trends in host-DTU specificities exist, but generally it seems that the complexity of the cycles and the participation of numerous vectors and mammal hosts in a shared area, maintains DTU diversity.

A fast and simple dose-calibrator-based quality control test for the radionuclidic purity of cyclotron-produced (99m)Tc.

PubMed

Tanguay, J; Hou, X; Esquinas, P; Vuckovic, M; Buckley, K; Schaffer, P; Bénard, F; Ruth, T J; Celler, A

2015-11-07

Cyclotron production of 99mTc through the (100)Mo(p,2n)99mTc reaction channel is actively being investigated as an alternative to reactor-based (99)Mo generation by nuclear fission of (235)U. Like most radioisotope production methods, cyclotron production of 99mTc will result in creation of unwanted impurities, including Tc and non-Tc isotopes. It is important to measure the amounts of these impurities for release of cyclotron-produced 99mTc (CPTc) for clinical use. Detection of radioactive impurities will rely on measurements of their gamma (γ) emissions. Gamma spectroscopy is not suitable for this purpose because the overwhelming presence of 99mTc and the count-rate limitations of γ spectroscopy systems preclude fast and accurate measurement of small amounts of impurities. In this article we describe a simple and fast method for measuring γ emission rates from radioactive impurities in CPTc. The proposed method is similar to that used to identify (99)Mo breakthrough in generator-produced 99mTc: one dose calibrator (DC) reading of a CPTc source placed in a lead shield is followed by a second reading of the same source in air. Our experimental and theoretical analysis show that the ratio of DC readings in lead to those in air are linearly related to γ emission rates from impurities per MBq of 99mTc over a large range of clinically-relevant production conditions. We show that estimates of the γ emission rates from Tc impurities per MBq of 99mTc can be used to estimate increases in radiation dose (relative to pure 99mTc) to patients injected with CPTc-based radiopharmaceuticals. This enables establishing dosimetry-based clinical-release criteria that can be tested using commercially-available dose calibrators. We show that our approach is highly sensitive to the presence of 93gTc, 93mTc, 94gTc, 94mTc, 95mTc, 95gTc, and 96gTc, in addition to a number of non-Tc impurities.

A fast and simple dose-calibrator-based quality control test for the radionuclidic purity of cyclotron-produced 99mTc

NASA Astrophysics Data System (ADS)

Tanguay, J.; Hou, X.; Esquinas, P.; Vuckovic, M.; Buckley, K.; Schaffer, P.; Bénard, F.; Ruth, T. J.; Celler, A.

2015-11-01

Cyclotron production of {{}99\\text{m}} Tc through the 100Mo(p,2n){{}99\\text{m}} Tc reaction channel is actively being investigated as an alternative to reactor-based 99Mo generation by nuclear fission of 235U. Like most radioisotope production methods, cyclotron production of {{}99\\text{m}} Tc will result in creation of unwanted impurities, including Tc and non-Tc isotopes. It is important to measure the amounts of these impurities for release of cyclotron-produced {{}99\\text{m}} Tc (CPTc) for clinical use. Detection of radioactive impurities will rely on measurements of their gamma (γ) emissions. Gamma spectroscopy is not suitable for this purpose because the overwhelming presence of {{}99\\text{m}} Tc and the count-rate limitations of γ spectroscopy systems preclude fast and accurate measurement of small amounts of impurities. In this article we describe a simple and fast method for measuring γ emission rates from radioactive impurities in CPTc. The proposed method is similar to that used to identify 99Mo breakthrough in generator-produced {{}99\\text{m}} Tc: one dose calibrator (DC) reading of a CPTc source placed in a lead shield is followed by a second reading of the same source in air. Our experimental and theoretical analysis show that the ratio of DC readings in lead to those in air are linearly related to γ emission rates from impurities per MBq of {{}99\\text{m}} Tc over a large range of clinically-relevant production conditions. We show that estimates of the γ emission rates from Tc impurities per MBq of {{}99\\text{m}} Tc can be used to estimate increases in radiation dose (relative to pure {{}99\\text{m}} Tc) to patients injected with CPTc-based radiopharmaceuticals. This enables establishing dosimetry-based clinical-release criteria that can be tested using commercially-available dose calibrators. We show that our approach is highly sensitive to the presence of {{}93\\text{g}} Tc, {{}93\\text{m}} Tc, {{}94\\text{g}} Tc, {{}94\\text{m}} Tc, {{}95\\text{m}} Tc, {{}95\\text{g}} Tc, and {{}96\\text{g}} Tc, in addition to a number of non-Tc impurities.

Spectroscopic Properties of Tc(I) Tricarbonyl Species Relevant to the Hanford Tank Waste

DOE Office of Scientific and Technical Information (OSTI.GOV)

Levitskaia, Tatiana G.; Andersen, Amity; Chatterjee, Sayandev

2015-12-04

Technetium-99 (Tc) exists predominately in soluble forms in the liquid supernatant and salt cake fractions of the nuclear tank waste stored at the U.S. DOE Hanford Site. In the strongly alkaline environments prevalent in the tank waste, its dominant chemical form is pertechnetate (TcO4-, oxidation state +7). However, attempts to remove Tc from the Hanford tank waste using ion-exchange processes specific to TcO 4 - only met with limited success, particularly processing tank waste samples containing elevated concentrations of organic complexants. This suggests that a significant fraction of the soluble Tc can be present as non-pertechnetate low-valent Tc (oxidation statemore » < +7) (non-pertechnetate). The chemical identities of these non-pertechnetate species are poorly understood. Previous analysis of the SY-101 and SY-103 tank waste samples provided strong evidence that non-pertechnetate can be comprised of [Tc(CO) 3] + complexes containing Tc in oxidation state +1 (Lukens et al. 2004). During the last two years, our team has expanded this work and demonstrated that high-ionic-strength solutions typifying tank waste supernatants promote oxidative stability of the [Tc(CO) 3] + species (Rapko et al. 2013; Levitskaia et al. 2014). It also was observed that high-ionic-strength alkaline matrices stabilize Tc(VI) and potentially Tc(IV) oxidation states, particularly in presence organic chelators, suggesting that the relevant Tc compounds can serve as important redox intermediates facilitating the reduction of Tc(VII) to Tc(I). Designing strategies for effective Tc processing, including separation and immobilization, necessitates understanding the molecular structure of these non-pertechnetate species and their identification in the actual tank waste samples. To-date, only limited information exists regarding the nature and characterization of the Tc(I), Tc(IV), and Tc(VI) species. One objective of this project is to identify the form of non-pertechnetate in the Hanford waste. To do this, we are developing a spectral library of reference non-pertechnetate compounds that can be compared against actual waste samples. The emphasis of the fiscal year 2015 work was Tc(I) tricarbonyl [Tc(CO) 3] + compounds. The key findings are summarized below.« less

Multi-epitope proteins for improved serological detection of Trypanosoma cruzi infection and Chagas Disease.

PubMed

Duthie, Malcolm S; Guderian, Jeffery A; Vallur, Aarthy C; Misquith, Ayesha; Liang, Hong; Mohamath, Raodoh; Luquetti, Alejandro O; Carter, Darrick; Tavares, Suelene N B; Reed, Steven G

2016-03-01

We previously reported that tandem repeat (TR) proteins from Trypanosoma cruzi could serve as targets of the antibody response and be useful as diagnostic indicators. To optimize reagents for detecting T. cruzi infection we evaluated individual TR proteins and identified several that were recognized by the majority of Chagas patient's sera collected from individuals form Brazil. We then produced novel, recombinant fusion proteins to combine the reactive TR proteins into a single diagnostic product. Direct comparison of the antibody response of serum samples that were readily detected by the established fusion antigen used in commercial detection of Chagas disease, TcF, revealed strong responses to TcF43 and TcF26 proteins. While the TcF43 and TcF26 antigens enhanced detection and strength of signal, they did not compromise the specificity of detection compared to that obtained with TcF. Finally, it was apparent by testing against a panel of 84 serum samples assembled on the basis of moderate or weak reactivity against TcF (mostly signal:noise <5) that TcF43 and TcF26 could more strongly detected by many of the sera that had low TcF antibody levels. Taken together, these data indicate that TcF43 and TcF26 could be used to enhance the detection of T. cruzi infection as well as supporting a diagnosis of Chagas disease. Copyright © 2016 Elsevier Inc. All rights reserved.

Serine Protease Inhibitor Kazal Type 1 (SPINK1) c.194+2T > C Mutation May Predict Long-term Outcome of Endoscopic Treatments in Idiopathic Chronic Pancreatitis.

PubMed

Sun, Chang; Liu, Mu-Yun; Liu, Xiao-Gang; Hu, Liang-Hao; Xia, Tian; Liao, Zhuan; Li, Zhao-Shen

2015-11-01

Endoscopic interventional is a commonly used treatment method for idiopathic chronic pancreatitis. Serine protease inhibitor Kazal type 1 (SPINK1) 194+2T>C mutation is most frequently observed in Chinese pancreatitis patients and influences the clinical course of idiopathic chronic pancreatitis patients. We conducted this study to determine the impacts of this mutation on the outcome of endoscopic treatments.In this study, we enrolled 423 patients. Among them, 101 idiopathic chronic pancreatitis patients without other relevant mutations had a successful endoscopic procedure and completed follow-up. Clinical characteristics including Izbicki pain score, exocrine and endocrine function, were evaluated. Genetic sequencing was conducted to detect SPINK1 194+2T>C mutations.The c.194+2T>C mutation was found in 58 (57.43%) patients. Factors relevant to pain relief are c.194+2T>C mutation (P = 0.011), severe pain before treatment (P = 0.005), and necessary subsequent endoscopic treatments (P < 0.001). More patients with the intronic mutation had deteriorated endocrine function (P = 0.001) relative to those patients without the mutation.Patients carrying the c.194+2T>C mutation were less likely to achieve pain relief through endoscopic treatments. They also have a higher risk of endocrine function deterioration. SPINK1 c.194+2T>C mutation may be applied as a pretreatment predictor in idiopathic chronic pancreatitis patients.

Development of a genotyping microarray for Usher syndrome.

PubMed

Cremers, Frans P M; Kimberling, William J; Külm, Maigi; de Brouwer, Arjan P; van Wijk, Erwin; te Brinke, Heleen; Cremers, Cor W R J; Hoefsloot, Lies H; Banfi, Sandro; Simonelli, Francesca; Fleischhauer, Johannes C; Berger, Wolfgang; Kelley, Phil M; Haralambous, Elene; Bitner-Glindzicz, Maria; Webster, Andrew R; Saihan, Zubin; De Baere, Elfride; Leroy, Bart P; Silvestri, Giuliana; McKay, Gareth J; Koenekoop, Robert K; Millan, Jose M; Rosenberg, Thomas; Joensuu, Tarja; Sankila, Eeva-Marja; Weil, Dominique; Weston, Mike D; Wissinger, Bernd; Kremer, Hannie

2007-02-01

Usher syndrome, a combination of retinitis pigmentosa (RP) and sensorineural hearing loss with or without vestibular dysfunction, displays a high degree of clinical and genetic heterogeneity. Three clinical subtypes can be distinguished, based on the age of onset and severity of the hearing impairment, and the presence or absence of vestibular abnormalities. Thus far, eight genes have been implicated in the syndrome, together comprising 347 protein-coding exons. To improve DNA diagnostics for patients with Usher syndrome, we developed a genotyping microarray based on the arrayed primer extension (APEX) method. Allele-specific oligonucleotides corresponding to all 298 Usher syndrome-associated sequence variants known to date, 76 of which are novel, were arrayed. Approximately half of these variants were validated using original patient DNAs, which yielded an accuracy of >98%. The efficiency of the Usher genotyping microarray was tested using DNAs from 370 unrelated European and American patients with Usher syndrome. Sequence variants were identified in 64/140 (46%) patients with Usher syndrome type I, 45/189 (24%) patients with Usher syndrome type II, 6/21 (29%) patients with Usher syndrome type III and 6/20 (30%) patients with atypical Usher syndrome. The chip also identified two novel sequence variants, c.400C>T (p.R134X) in PCDH15 and c.1606T>C (p.C536S) in USH2A. The Usher genotyping microarray is a versatile and affordable screening tool for Usher syndrome. Its efficiency will improve with the addition of novel sequence variants with minimal extra costs, making it a very useful first-pass screening tool.

Development of a genotyping microarray for Usher syndrome

PubMed Central

Cremers, Frans P M; Kimberling, William J; Külm, Maigi; de Brouwer, Arjan P; van Wijk, Erwin; te Brinke, Heleen; Cremers, Cor W R J; Hoefsloot, Lies H; Banfi, Sandro; Simonelli, Francesca; Fleischhauer, Johannes C; Berger, Wolfgang; Kelley, Phil M; Haralambous, Elene; Bitner‐Glindzicz, Maria; Webster, Andrew R; Saihan, Zubin; De Baere, Elfride; Leroy, Bart P; Silvestri, Giuliana; McKay, Gareth J; Koenekoop, Robert K; Millan, Jose M; Rosenberg, Thomas; Joensuu, Tarja; Sankila, Eeva‐Marja; Weil, Dominique; Weston, Mike D; Wissinger, Bernd; Kremer, Hannie

2007-01-01

Background Usher syndrome, a combination of retinitis pigmentosa (RP) and sensorineural hearing loss with or without vestibular dysfunction, displays a high degree of clinical and genetic heterogeneity. Three clinical subtypes can be distinguished, based on the age of onset and severity of the hearing impairment, and the presence or absence of vestibular abnormalities. Thus far, eight genes have been implicated in the syndrome, together comprising 347 protein‐coding exons. Methods: To improve DNA diagnostics for patients with Usher syndrome, we developed a genotyping microarray based on the arrayed primer extension (APEX) method. Allele‐specific oligonucleotides corresponding to all 298 Usher syndrome‐associated sequence variants known to date, 76 of which are novel, were arrayed. Results Approximately half of these variants were validated using original patient DNAs, which yielded an accuracy of >98%. The efficiency of the Usher genotyping microarray was tested using DNAs from 370 unrelated European and American patients with Usher syndrome. Sequence variants were identified in 64/140 (46%) patients with Usher syndrome type I, 45/189 (24%) patients with Usher syndrome type II, 6/21 (29%) patients with Usher syndrome type III and 6/20 (30%) patients with atypical Usher syndrome. The chip also identified two novel sequence variants, c.400C>T (p.R134X) in PCDH15 and c.1606T>C (p.C536S) in USH2A. Conclusion The Usher genotyping microarray is a versatile and affordable screening tool for Usher syndrome. Its efficiency will improve with the addition of novel sequence variants with minimal extra costs, making it a very useful first‐pass screening tool. PMID:16963483

Multiple mitochondrial introgression events and heteroplasmy in trypanosoma cruzi revealed by maxicircle MLST and next generation sequencing.

PubMed

Messenger, Louisa A; Llewellyn, Martin S; Bhattacharyya, Tapan; Franzén, Oscar; Lewis, Michael D; Ramírez, Juan David; Carrasco, Hernan J; Andersson, Björn; Miles, Michael A

2012-01-01

Mitochondrial DNA is a valuable taxonomic marker due to its relatively fast rate of evolution. In Trypanosoma cruzi, the causative agent of Chagas disease, the mitochondrial genome has a unique structural organization consisting of 20-50 maxicircles (∼20 kb) and thousands of minicircles (0.5-10 kb). T. cruzi is an early diverging protist displaying remarkable genetic heterogeneity and is recognized as a complex of six discrete typing units (DTUs). The majority of infected humans are asymptomatic for life while 30-35% develop potentially fatal cardiac and/or digestive syndromes. However, the relationship between specific clinical outcomes and T. cruzi genotype remains elusive. The availability of whole genome sequences has driven advances in high resolution genotyping techniques and re-invigorated interest in exploring the diversity present within the various DTUs. To describe intra-DTU diversity, we developed a highly resolutive maxicircle multilocus sequence typing (mtMLST) scheme based on ten gene fragments. A panel of 32 TcI isolates was genotyped using the mtMLST scheme, GPI, mini-exon and 25 microsatellite loci. Comparison of nuclear and mitochondrial data revealed clearly incongruent phylogenetic histories among different geographical populations as well as major DTUs. In parallel, we exploited read depth data, generated by Illumina sequencing of the maxicircle genome from the TcI reference strain Sylvio X10/1, to provide the first evidence of mitochondrial heteroplasmy (heterogeneous mitochondrial genomes in an individual cell) in T. cruzi. mtMLST provides a powerful approach to genotyping at the sub-DTU level. This strategy will facilitate attempts to resolve phenotypic variation in T. cruzi and to address epidemiologically important hypotheses in conjunction with intensive spatio-temporal sampling. The observations of both general and specific incidences of nuclear-mitochondrial phylogenetic incongruence indicate that genetic recombination is geographically widespread and continues to influence the natural population structure of TcI, a conclusion which challenges the traditional paradigm of clonality in T. cruzi.

Epidemiological Surveillance of HIV-1 Transmitted Drug Resistance in Spain in 2004-2012: Relevance of Transmission Clusters in the Propagation of Resistance Mutations.

PubMed

Vega, Yolanda; Delgado, Elena; Fernández-García, Aurora; Cuevas, Maria Teresa; Thomson, Michael M; Montero, Vanessa; Sánchez, Monica; Sánchez, Ana Maria; Pérez-Álvarez, Lucia

2015-01-01

Our objectives were to carry out an epidemiological surveillance study on transmitted drug resistance (TDR) among individuals newly diagnosed of HIV-1 infection during a nine year period in Spain and to assess the role of transmission clusters (TC) in the propagation of resistant strains. An overall of 1614 newly diagnosed individuals were included in the study from January 2004 through December 2012. Individuals come from two different Spanish regions: Galicia and the Basque Country. Resistance mutations to reverse transcriptase inhibitors (RTI) and protease inhibitors (PI) were analyzed according to mutations included in the surveillance drug-resistance mutations list updated in 2009. TC were defined as those comprising viruses from five or more individuals whose sequences clustered in maximum likelihood phylogenetic trees with a bootstrap value ≥90%. The overall prevalence of TDR to any drug was 9.9%: 4.9% to nucleoside RTIs (NRTIs), 3.6% to non-nucleoside RTIs (NNRTIs), and 2.7% to PIs. A significant decrease of TDR to NRTIs over time was observed [from 10% in 2004 to 2% in 2012 (p=0.01)]. Sixty eight (42.2%) of 161 sequences with TDR were included in 25 TC composed of 5 or more individuals. Of them, 9 clusters harbored TDR associated with high level resistance to antiretroviral drugs. T215D revertant mutation was transmitted in a large cluster comprising 25 individuals. The impact of epidemiological networks on TDR frequency may explain its persistence in newly diagnosed individuals. The knowledge of the populations involved in TC would facilitate the design of prevention programs and public health interventions.

[Combined internal-external radiotherapy (CIERT) in a cell model].

PubMed

Oehme, Liane; Bartzsch, Thomas; Maucksch, Ute; Freudenberg, Robert; Wunderlich, Gerd; Kotzerke, Jörg

2018-06-01

Combined internal-external radiotherapy (CIERT) requires a unified assessment of biologic radiation effects in addition to the total dose. The concept of biological effective dose (BED) was evaluated in a cell model. The thyroid NIS-positive cell line FRTL-5 was irradiated with X-ray and the radiotracer Tc-99m pertechnetate either alone or in combination. The cellular uptake of the radionuclide during the incubation time of 24 h was controlled by the presence or absence of perchlorate. Dose calculation was performed based on measured uptake values. Cell specific radiobiologic parameters were derived from dose effect curves using the colony forming assay as biological endpoint. For the combination of the radiation qualities the sequence and time difference were varied. Cell survival was compared with the prediction of the BED model. The radiobiologic parameters from X-ray dose response were α = (0.22 ± 0.02) Gy -1 and β = (0.021 ± 0.001) Gy -2 . The half life for repair was (1.51 ± 0.21) h. These values could also explain the dose response curves for Tc-99m-irradiation with exponential decreasing dose rate. CIERT experiments showed no significant differences in cell survival regarding sequence and irradiation break. When the radionuclide uptake was not prevented the cell survival for the combination of X-ray and Tc-99m was lower than the prediction by BED calculations. The validity of the BED formalism for different dose rates and radiation qualities was verified. Supraaddive effects measured in the combination of X-ray and intracellular Tc-99m might be caused by Auger and conversion electrons, however further experiments are necessary. Schattauer GmbH.

Design and characterization of α-melanotropin peptide analogs cyclized through rhenium and technetium metal coordination

PubMed Central

Giblin, Michael F.; Wang, Nannan; Hoffman, Timothy J.; Jurisson, Silvia S.; Quinn, Thomas P.

1998-01-01

α-Melanocyte stimulating hormone (α-MSH) analogs, cyclized through site-specific rhenium (Re) and technetium (Tc) metal coordination, were structurally characterized and analyzed for their abilities to bind α-MSH receptors present on melanoma cells and in tumor-bearing mice. Results from receptor-binding assays conducted with B16 F1 murine melanoma cells indicated that receptor-binding affinity was reduced to approximately 1% of its original levels after Re incorporation into the cyclic Cys4,10, d-Phe7–α-MSH4-13 analog. Structural analysis of the Re–peptide complex showed that the disulfide bond of the original peptide was replaced by thiolate–metal–thiolate cyclization. A comparison of the metal-bound and metal-free structures indicated that metal complexation dramatically altered the structure of the receptor-binding core sequence. Redesign of the metal binding site resulted in a second-generation Re–peptide complex (ReCCMSH) that displayed a receptor-binding affinity of 2.9 nM, 25-fold higher than the initial Re–α-MSH analog. Characterization of the second-generation Re–peptide complex indicated that the peptide was still cyclized through Re coordination, but the structure of the receptor-binding sequence was no longer constrained. The corresponding 99mTc- and 188ReCCMSH complexes were synthesized and shown to be stable in phosphate-buffered saline and to challenges from diethylenetriaminepentaacetic acid (DTPA) and free cysteine. In vivo, the 99mTcCCMSH complex exhibited significant tumor uptake and retention and was effective in imaging melanoma in a murine-tumor model system. Cyclization of α-MSH analogs via 99mTc and 188Re yields chemically stable and biologically active molecules with potential melanoma-imaging and therapeutic properties. PMID:9788997

TERT promoter mutations in thyroid cancer: a report from a Middle Eastern population.

PubMed

Qasem, Ebtesam; Murugan, Avaniyapuram Kannan; Al-Hindi, Hindi; Xing, Mingzhao; Almohanna, Mai; Alswailem, Meshael; Alzahrani, Ali S

2015-12-01

Telomerase reverse transcriptase (TERT) promoter mutations C228T and C250T have recently been described in follicular cell-derived thyroid cancer (TC) in patients from North America and Europe. In this study, we explored whether these findings could be replicated in patients from a different ethnic group. We screened 17 benign thyroid adenomas and 265 TC samples from patients in the Middle East for these mutations by PCR and direct sequencing using DNA isolated from paraffin-embedded tumor tissues. None of the 17 benign adenomas harbored TERT promoter mutations. Of 265 TC, 34 (12.8%) harbored TERT promoter mutations, including 10/153 (6.5%) conventional papillary TC (CPTC), 8/57 (14.0%) follicular variant PTC, 9/30 (30%) tall cell variant PTC, 1/3 (30%) Hurthle cell thyroid cancer (HTC), 1/5 (20%) follicular TC, and 5/13 (38.5%) poorly differentiated TC. C250T mutation was present in only 6/265 (2.3%) cases, while C228T mutation was present in a total of 28/265 (10.6%) cases. These two mutations were mutually exclusive. TERT promoter mutations were significantly more common in older (≥45 years) than younger patients and were associated with larger tumour size, vascular invasion, higher TNM stage (stage III and IV), BRAF(V600E) mutation and persistent/recurrent disease at 6-12 months after initial treatment and at the last follow up. These associations were stronger in non-CPTC. Thus, this study on a large cohort of TC patients from Middle East demonstrates that TERT promoter mutations are relatively common, especially in the non-CPTC, and are associated with more aggressive histopathological features, BRAF(V600E) mutation, and disease persistence/recurrence than the WT TERT. © 2015 Society for Endocrinology.

Western North Pacific Tropical Cyclone Model Tracks in Present and Future Climates

NASA Astrophysics Data System (ADS)

Nakamura, Jennifer; Camargo, Suzana J.; Sobel, Adam H.; Henderson, Naomi; Emanuel, Kerry A.; Kumar, Arun; LaRow, Timothy E.; Murakami, Hiroyuki; Roberts, Malcolm J.; Scoccimarro, Enrico; Vidale, Pier Luigi; Wang, Hui; Wehner, Michael F.; Zhao, Ming

2017-09-01

Western North Pacific tropical cyclone (TC) model tracks are analyzed in two large multimodel ensembles, spanning a large variety of models and multiple future climate scenarios. Two methodologies are used to synthesize the properties of TC tracks in this large data set: cluster analysis and mass moment ellipses. First, the models' TC tracks are compared to observed TC tracks' characteristics, and a subset of the models is chosen for analysis, based on the tracks' similarity to observations and sample size. Potential changes in track types in a warming climate are identified by comparing the kernel smoothed probability distributions of various track variables in historical and future scenarios using a Kolmogorov-Smirnov significance test. Two track changes are identified. The first is a statistically significant increase in the north-south expansion, which can also be viewed as a poleward shift, as TC tracks are prevented from expanding equatorward due to the weak Coriolis force near the equator. The second change is an eastward shift in the storm tracks that occur near the central Pacific in one of the multimodel ensembles, indicating a possible increase in the occurrence of storms near Hawaii in a warming climate. The dependence of the results on which model and future scenario are considered emphasizes the necessity of including multiple models and scenarios when considering future changes in TC characteristics.

Effects of FlAsH/Tetracysteine (TC) tag on PrP proteolysis and PrPres formation by TC-scanning

PubMed Central

Taguchi, Yuzuru; Hohsfield, Lindsay A.; Hollister, Jason R.

2014-01-01

The FlAsH/tetracysteine (FlAsH/TC) tag is a powerful tool for fluorescent labeling of proteins. However, even small tags such as FlAsH/TC could alter the behavior of the tagged proteins, especially if the insertion occurs at internal sites. Defining the influence of FlAsH/TC on nearby protein-protein interactions might aid in selecting appropriate positions for internal TC insertions and allow the exploitation of serial FlAsH/TC insertions (TC-scanning) as a probe to characterize sites of protein-protein interaction. To explore this application in the context of substrate-protease interactions, we analyzed the effect of FlAsH/TC insertions on proteolysis of cellular prion protein (PrPsen) in in vitro reactions and generation of the C1 metabolic fragment of PrPsen in live neuroblastoma cells. The influence of FlAsH/TC insertion was evaluated by TC-scanning across the cleavage sites of each protease. The results showed that FlAsH/TC inhibited protease cleavage only within limited ranges of the cleavage sites that varied from about 1 to 6 residues-wide depending on the protease, providing an estimate of the PrP residues interacting with each protease. TC-scanning was also used to probe a different type of protein-protein interaction, the conformational conversion of FlAsH-PrPsen to the prion disease-associated isoform, PrPres. PrP constructs with FlAsH/TC insertions at residues 90–96 but not 97–101 were converted to FlAsH-PrPres, identifying a boundary separating loosely versus compactly folded regions of PrPres. Our observations demonstrate that TC-scanning with the FlAsH/TC tag can be a versatile method for probing protein-protein interactions and folding processes. PMID:23943295

[Clinical features and ETFDH mutations of children with late-onset glutaric aciduria type II: a report of two cases].

PubMed

Cheng, Yan-Yang; Tang, Yue; Liu, Ao-Jie; Wei, Li; Lin, Lan; Zhang, Jing; Zhi, Liang

2017-09-01

To investigate the clinical and genetic features of two families with late-onset glutaric aciduria type II caused by ETFDH mutations. Target gene sequence capture and next generation sequencing were used for sequencing of suspected patients and their family members. The patients' clinical features were retrospectively analyzed and literature review was performed. The probands of the two families had a clinical onset at the ages of 10 years and 5.5 years respectively, with the clinical manifestations of muscle weakness and muscle pain. Laboratory examinations revealed significant increases in the serum levels of creatine kinase, creatine kinase-MB, and lactate dehydrogenase. Tandem mass spectrometry showed increases in various types of acylcarnitines. The analysis of urine organic acids showed an increase in glutaric acid. Electromyography showed myogenic damage in both patients. Gene detection showed two novel mutations in the ETFDH gene (c.1331T>C from the mother and c.824C>T from the father) in patient 1, and the patient's younger brother carried the c.1331T>C mutation but had a normal phenotype. In patient 2, there was a novel mutation (c.177insT from the father) and a known mutation (c.1474T>C from the mother) in the ETFDH gene. Several family members carried such mutations. Both patients were diagnosed with glutaric aciduria type II. Their symptoms were improved after high-dose vitamin B2 treatment. For patients with unexplained muscle weakness and pain, serum creatine kinase, acylcarnitines, and urinary organic acids should be measured, and the possibility of glutaric aciduria type II should be considered. Genetic detection is helpful to make a confirmed diagnosis.

Whole-exome sequencing identifies novel compound heterozygous mutations in USH2A in Spanish patients with autosomal recessive retinitis pigmentosa

PubMed Central

Méndez-Vidal, Cristina; González-del Pozo, María; Vela-Boza, Alicia; Santoyo-López, Javier; López-Domingo, Francisco J.; Vázquez-Marouschek, Carmen; Dopazo, Joaquin; Borrego, Salud

2013-01-01

Purpose Retinitis pigmentosa (RP) is an inherited retinal dystrophy characterized by extreme genetic and clinical heterogeneity. Thus, the diagnosis is not always easily performed due to phenotypic and genetic overlap. Current clinical practices have focused on the systematic evaluation of a set of known genes for each phenotype, but this approach may fail in patients with inaccurate diagnosis or infrequent genetic cause. In the present study, we investigated the genetic cause of autosomal recessive RP (arRP) in a Spanish family in which the causal mutation has not yet been identified with primer extension technology and resequencing. Methods We designed a whole-exome sequencing (WES)-based approach using NimbleGen SeqCap EZ Exome V3 sample preparation kit and the SOLiD 5500×l next-generation sequencing platform. We sequenced the exomes of both unaffected parents and two affected siblings. Exome analysis resulted in the identification of 43,204 variants in the index patient. All variants passing filter criteria were validated with Sanger sequencing to confirm familial segregation and absence in the control population. In silico prediction tools were used to determine mutational impact on protein function and the structure of the identified variants. Results Novel Usher syndrome type 2A (USH2A) compound heterozygous mutations, c.4325T>C (p.F1442S) and c.15188T>G (p.L5063R), located in exons 20 and 70, respectively, were identified as probable causative mutations for RP in this family. Family segregation of the variants showed the presence of both mutations in all affected members and in two siblings who were apparently asymptomatic at the time of family ascertainment. Clinical reassessment confirmed the diagnosis of RP in these patients. Conclusions Using WES, we identified two heterozygous novel mutations in USH2A as the most likely disease-causing variants in a Spanish family diagnosed with arRP in which the cause of the disease had not yet been identified with commonly used techniques. Our data reinforce the clinical role of WES in the molecular diagnosis of highly heterogeneous genetic diseases where conventional genetic approaches have previously failed in achieving a proper diagnosis. PMID:24227914

The use of {sup 99m}Tc-Al{sub 2}O{sub 3} for detection of sentinel lymph nodes in breast cancer

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sinilkin, I., E-mail: sinilkinig@oncology.tomsk.ru; Chernov, V.; Medvedeva, A.

2016-08-02

Purpose: to study the feasibility of using the new radiopharmaceutical based on the technetium-99m-labeled gamma-alumina for identification of sentinel lymph nodes (SLNs) in breast cancer patients. The study included two groups of breast cancer patients who underwent single photon emission computed tomography (SPECT) and intraoperaive gamma probe identification of sentinel lymph nodes (SLNs). To identify SLNs, the day before surgery Group I patients (n = 34) were injected with radioactive {sup 99m}Tc-Al{sub 2}O{sub 3}, and Group II patients (n = 30) received {sup 99m}Tc-labeled phytate colloid. A total of 37 SLNs were detected in Group I patients. The number ofmore » identified SLNs per patient ranged from 1 to 2 (the average number of identified SLNs was 1.08). Axillary lymph nodes were the most common site of SLN localization. 18 hours after {sup 99m}Tc-Al{sub 2}O{sub 3} injection, the percentage of its accumulation in the SLN was 7–11% (of the counts in the injection site) by SPECT and 17–31% by gamma probe detection. In Group II SLNs were detected in 27 patients. 18 hours after injection of the phytate colloid the percentage of its accumulation in the SLN was 1.5–2% out of the counts in the injection site by SPECT and 4–7% by gamma probe. The new radiopharmaceutical based on the {sup 99m}Tc-Al{sub 2}O{sub 3} demonstrates high accumulation in SLNs without redistribution through the entire lymphatic basin. The sensitivity and specificity of {sup 99m}Tc-Al{sub 2}O{sub 3} were 100% for both SPECT and intraoperative gamma probe identification.« less

Transformation of tetracycline during chloramination: kinetics, products and pathways.

PubMed

Wan, Yi; Jia, Ai; Zhu, Zhou; Hu, Jianying

2013-01-01

To assess the potential adverse effects stemming from tetracycline (TC) in drinking water or disinfected wastewater, the kinetics of the chloramination of TC was investigated at room temperature, the transformation products and pathways of their generation were elucidated, and their growth inhibiting properties towards sludge bacteria were assessed. The chloramination of TC exhibited pseudo-first-order kinetics with the rate constants (k(obs)) ranging from 0.0082 to 0.041 min(-1) at pH of 6-8. Chloramination of TC generated at least 13 discernible products, and the structures of 12 products, including five chlorinated compounds, were identified using LC-ESI-MS. Two main pathways for the generation of these products were proposed: (1) chlorine substitution reactions followed by dehydration; and (2) oxidization by chloramine. The chlorinated products were proposed to be further degraded to small molecules via the scission of benzene rings of TC, and two oxidization products (2,11a-dihydroxy-keto-TC and 6,11-epoxy-2,11a-dihydroxy-TC) were the final products obtained under the experimental conditions. The chlorinated solution, even without detection of TC, exhibited greater than 80% of TC inhibitory effects towards sludge bacteria, suggesting potential effects on microorganisms in aquatic environment. Copyright © 2012 Elsevier Ltd. All rights reserved.

(99)Tc(VII) Retardation, Reduction, and Redox Rate Scaling in Naturally Reduced Sediments.

PubMed

Liu, Yuanyuan; Liu, Chongxuan; Kukkadapu, Ravi K; McKinley, James P; Zachara, John; Plymale, Andrew E; Miller, Micah D; Varga, Tamas; Resch, Charles T

2015-11-17

An experimental and modeling study was conducted to investigate pertechnetate (Tc(VII)O4(-)) retardation, reduction, and rate scaling in three sediments from Ringold formation at U.S. Department of Energy's Hanford site, where (99)Tc is a major contaminant in groundwater. Tc(VII) was reduced in all the sediments in both batch reactors and diffusion columns, with a faster rate in a sediment containing a higher concentration of HCl-extractable Fe(II). Tc(VII) migration in the diffusion columns was reductively retarded with retardation degrees correlated with Tc(VII) reduction rates. The reduction rates were faster in the diffusion columns than those in the batch reactors, apparently influenced by the spatial distribution of redox-reactive minerals along transport paths that supplied Tc(VII). X-ray computed tomography and autoradiography were performed to identify the spatial locations of Tc(VII) reduction and transport paths in the sediments, and results generally confirmed the newly found behavior of reaction rate changes from batch to column. The results from this study implied that Tc(VII) migration can be reductively retarded at Hanford site with a retardation degree dependent on reactive Fe(II) content and its distribution in sediments. This study also demonstrated that an effective reaction rate may be faster in transport systems than that in well-mixed reactors.

Volatile species of technetium and rhenium during waste vitrification

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kim, Dongsang; Kruger, Albert A.

Volatile loss of technetium (Tc) during vitrification of low-activity wastes is a technical challenge for treating and immobilizing the large volumes of radioactive and hazardous wastes stored at the U.S. Department of Energy's Hanford Site. There are various research efforts being pursued to develop technologies that can be implemented for cost effective management of Tc, including studies to understand the behavior of Tc during vitrification, with the goal of eventually increasing Tc retention in glass. Furthermore, one of these studies has focused on identifying the form or species of Tc and Re (surrogate for Tc) that evolve during the waste-to-glassmore » conversion process. This information is important for understanding the mechanism of Tc volatilization. In this paper, available information collected from the literature is critically evaluated to clarify the volatile species of Tc and Re and, more specifically, whether they volatilize as alkali pertechnetate and perrhenate or as technetium and rhenium oxides after decomposition of alkali pertechnetate and perrhenate. The evaluated data ranged from mass spectrometric identification of species volatilized from pure and binary alkali pertechnetate and perrhenate salts to structural and chemical analyses of volatilized materials during crucible melting and scaled melter processing of simulated wastes.« less

Volatile species of technetium and rhenium during waste vitrification

DOE PAGES

Kim, Dongsang; Kruger, Albert A.

2017-10-26

Volatile loss of technetium (Tc) during vitrification of low-activity wastes is a technical challenge for treating and immobilizing the large volumes of radioactive and hazardous wastes stored at the U.S. Department of Energy's Hanford Site. There are various research efforts being pursued to develop technologies that can be implemented for cost effective management of Tc, including studies to understand the behavior of Tc during vitrification, with the goal of eventually increasing Tc retention in glass. Furthermore, one of these studies has focused on identifying the form or species of Tc and Re (surrogate for Tc) that evolve during the waste-to-glassmore » conversion process. This information is important for understanding the mechanism of Tc volatilization. In this paper, available information collected from the literature is critically evaluated to clarify the volatile species of Tc and Re and, more specifically, whether they volatilize as alkali pertechnetate and perrhenate or as technetium and rhenium oxides after decomposition of alkali pertechnetate and perrhenate. The evaluated data ranged from mass spectrometric identification of species volatilized from pure and binary alkali pertechnetate and perrhenate salts to structural and chemical analyses of volatilized materials during crucible melting and scaled melter processing of simulated wastes.« less

Targeted imaging of gastrin-releasing peptide receptors with 99mTc-EDDA/HYNIC-[Lys3]-bombesin: biokinetics and dosimetry in women.

PubMed

Santos-Cuevas, Clara L; Ferro-Flores, Guillermina; Arteaga de Murphy, Consuelo; Pichardo-Romero, Pablo A

2008-08-01

The gastrin-releasing peptide receptor (GRP-R) is expressed in several normal human tissues and is overexpressed in various human tumors including breast, prostate, small-cell lung cancer and pancreatic cancer. Recently, 99mTc-EDDA/HYNIC-[Lys]-bombesin (99mTc-HYNIC-BN) was reported as a radiopharmaceutical with high stability in human serum, specific cell GRP-R binding and rapid cell internalization. The aim of this study was to determine the biokinetics and dosimetry of 99mTc-HYNIC-BN and the feasibility of using this radiopharmaceutical to image GRP-R in four early breast cancer patients and seven healthy women. Whole-body images were acquired at 20, 90, 180 min, and 24 h after 99mTc-HYNIC-BN administration. The same regions of interest were drawn around source organs on each time frame and regions of interest were converted to activity (conjugate view counting method). The image sequence was used to extrapolate 99mTc-HYNIC-BN time-activity curves in each organ to calculate the total number of disintegrations (N) that occurred in the source regions. N data were the input for the OLINDA/EXM code to calculate internal radiation dose estimates. 99mTc-HYNIC-BN had a rapid blood clearance with mainly renal excretion. No statistically significant differences (P>0.05) in the radiation-absorbed doses among cancer patients and healthy women were observed. The average equivalent doses (n=11) were 24.8+/-8.8 mSv (kidneys), 7.3+/-1.8 mSv (lungs), 6.5+/-4.0 mSv (breast), 2.0+/-0.3 mSv (pancreas), 1.6+/-0.3 mSv (liver), 1.2+/-0.2 mSv (ovaries), and 1.0+/-0.2 mSv (red marrow). The effective dose was 3.3+/-0.6 mSv. The images showed well-differentiated concentration of 99mTc-HYNIC-BN in cancer mammary tissue. All the absorbed doses were comparable with those known for most of the 99mTc studies. 99mTc-HYNIC-BN shows high tumor uptake in breasts with malignant tumors so it is a promising imaging radiopharmaceutical to target site-specific early breast cancer. The results obtained warrant a further clinical study to determine specificity/sensibility of 99mTc-HYNIC-BN.

Convergence of Cortical, Thalamocortical, and Callosal Pathways during Human Fetal Development Revealed by Diffusion MRI Tractography.

PubMed

Wang, Rongpin; Wilkinson, Molly; Kane, Tara; Takahashi, Emi

2017-01-01

There has been evidence that during brain development, emerging thalamocortical (TC) and corticothalamic (CT) pathways converge in some brain regions and follow each other's trajectories to their final destinations. Corpus callosal (CC) pathways also emerge at a similar developmental stage, and are known to converge with TC pathways in specific cortical regions in mature brains. Given the functional relationships between TC and CC pathways, anatomical convergence of the two pathways are likely important for their functional integration. However, it is unknown (1) where TC and CT subcortically converge in the human brain, and (2) where TC and CC converge in the cortex of the human brain, due to the limitations of non-invasive methods. The goals of this study were to describe the spatio-temporal relationships in the development of the TC/CT and CC pathways in the human brain, using high-angular resolution diffusion MR imaging (HARDI) tractography. Emerging cortical, TC and CC pathways were identified in postmortem fetal brains ranging from 17 gestational weeks (GW) to 30 GW, as well as in vivo 34-40 GW newborns. Some pathways from the thalami were found to be converged with pathways from the cerebral cortex as early as 17 GW. Such convergence was observed mainly in anterior and middle regions of the brain until 21 GW. At 22 GW and onwards, posterior pathways from the thalami also converged with cortical pathways. Many CC pathways reached the full length up to the cortical surface as early as 17 GW, while pathways linked to thalami (not only TC axons but also including pathways linked to thalamic neuronal migration) reached the cortical surface at and after 20 GW. These results suggest that CC pathways developed earlier than the TC pathways. The two pathways were widespread at early stages, but by 40 GW they condensed and formed groups of pathways that projected to specific regions of the cortex and overlapped in some brain regions. These results suggest that HARDI tractography has the potential to identify developing TC/CT and CC pathways with the timing and location of their convergence in fetal stages persisting in postnatal development.

Convergence of Cortical, Thalamocortical, and Callosal Pathways during Human Fetal Development Revealed by Diffusion MRI Tractography

PubMed Central

Wang, Rongpin; Wilkinson, Molly; Kane, Tara; Takahashi, Emi

2017-01-01

There has been evidence that during brain development, emerging thalamocortical (TC) and corticothalamic (CT) pathways converge in some brain regions and follow each other's trajectories to their final destinations. Corpus callosal (CC) pathways also emerge at a similar developmental stage, and are known to converge with TC pathways in specific cortical regions in mature brains. Given the functional relationships between TC and CC pathways, anatomical convergence of the two pathways are likely important for their functional integration. However, it is unknown (1) where TC and CT subcortically converge in the human brain, and (2) where TC and CC converge in the cortex of the human brain, due to the limitations of non-invasive methods. The goals of this study were to describe the spatio-temporal relationships in the development of the TC/CT and CC pathways in the human brain, using high-angular resolution diffusion MR imaging (HARDI) tractography. Emerging cortical, TC and CC pathways were identified in postmortem fetal brains ranging from 17 gestational weeks (GW) to 30 GW, as well as in vivo 34–40 GW newborns. Some pathways from the thalami were found to be converged with pathways from the cerebral cortex as early as 17 GW. Such convergence was observed mainly in anterior and middle regions of the brain until 21 GW. At 22 GW and onwards, posterior pathways from the thalami also converged with cortical pathways. Many CC pathways reached the full length up to the cortical surface as early as 17 GW, while pathways linked to thalami (not only TC axons but also including pathways linked to thalamic neuronal migration) reached the cortical surface at and after 20 GW. These results suggest that CC pathways developed earlier than the TC pathways. The two pathways were widespread at early stages, but by 40 GW they condensed and formed groups of pathways that projected to specific regions of the cortex and overlapped in some brain regions. These results suggest that HARDI tractography has the potential to identify developing TC/CT and CC pathways with the timing and location of their convergence in fetal stages persisting in postnatal development. PMID:29163000

Trends of Second Primary Malignancy in Patients with Thyroid Cancer: A Population-Based Cohort Study in Israel.

PubMed

Izkhakov, Elena; Barchana, Micha; Liphshitz, Irena; Silverman, Barbara G; Stern, Naftali; Keinan-Boker, Lital

2017-06-01

Thyroid cancer (TC) is the most common endocrine malignancy. TC patients have a good prognosis and a low disease-related mortality rate. Since such patients are often young, they may be at a higher risk for a second primary malignancy (SPM). This study sought to determine the incidence, risk, and types of SPM between 1980 and 2011, and to assess SPM trends over time among Israeli TC patients. Data were derived from the Israel National Cancer Registry. Primary TC patients diagnosed during 1980-2009 were followed up for SPM incidence until December 31, 2011. Standardized incidence ratios (SIRs) of observed to expected SPM (based on the general population rates) were calculated using Poisson regression. Analyses were stratified by time period of initial TC diagnosis (1980-1995 and 1996-2009). A total of 11,538 TC patients were identified. After exclusion of 107 duplicate cases, records of 1032 patients with SPM were analyzed (an SPM incidence of 8.9%). SIRs for all-site SPMs were 1.23 [confidence interval 1.08-1.35] for males and 1.19 [confidence interval 1.10-1.27] for females. SIRs for tumors of the urinary system and prostate were significantly elevated in males, as were SIRs for tumors of the brain, urinary system, breast, and lung in females. Variables associated with increased risk of developing SPMs included a younger age at TC diagnosis, a shorter latency period, being born in Asia/Africa for both sexes, and being born in Israel for females. Compared with the general population, a subanalysis by TC diagnosis during 1980-1995 and 1996-2009 disclosed a higher SPM incidence for the latter time period in males and for both time periods, with a slightly higher SIR for the latter time period in females. The overall risk of SPM in Israeli TC patients was significantly greater for both sexes compared with the general population, thus identifying TC patients as a high-risk group and calling for caretakers to apply specific follow-up guidelines.

[Gastrointestinal bleeding from capillary hemangioma of the ileum detected by 99mTc-HSAD scintigraphy].

PubMed

Asano, Y; Ishii, K; Sagiuchi, T; Aoki, Y; Yanaihara, H; Hayakawa, K

2001-05-01

It has been well-known that technetium-99m-human serum albumin-diethylenetriaminepenta-acetic acid (99mTc-HSAD) scintigraphy is useful for diagnosis of the localization of the gastrointestinal arterial or venous bleeding. In this report, we describe a case of venous bleeding from capillary hemangioma of the ileum end detected by 99mTc-HSAD scintigraphy. This patient was a 9-year-old girl with severe anemia. Gastrointestinal bleeding was suspected from her clinical course and laboratory tests. Immediately after melena occurred, 99mTc-HSAD scintigraphy showed the extravasation of RI suggesting gastrointestinal bleeding in the ileum end. Abdominal angiography immediately after 99mTc-HSAD scintigraphy, however, could not show the extravasation of contrast agent. Because the condition of the patient became worse, laparotomy was performed on the basis of 99mTc-HSAD scintigraphy findings. At surgery, venous bleeding from capillary hemangioma in the ileum end was observed. It was suggested that 99mTc-HSAD scintigraphy was very useful for identifying the gastrointestinal venous bleeding.

Definition of RNA polymerase II CoTC terminator elements in the human genome.

PubMed

Nojima, Takayuki; Dienstbier, Martin; Murphy, Shona; Proudfoot, Nicholas J; Dye, Michael J

2013-04-25

Mammalian RNA polymerase II (Pol II) transcription termination is an essential step in protein-coding gene expression that is mediated by pre-mRNA processing activities and DNA-encoded terminator elements. Although much is known about the role of pre-mRNA processing in termination, our understanding of the characteristics and generality of terminator elements is limited. Whereas promoter databases list up to 40,000 known and potential Pol II promoter sequences, fewer than ten Pol II terminator sequences have been described. Using our knowledge of the human β-globin terminator mechanism, we have developed a selection strategy for mapping mammalian Pol II terminator elements. We report the identification of 78 cotranscriptional cleavage (CoTC)-type terminator elements at endogenous gene loci. The results of this analysis pave the way for the full understanding of Pol II termination pathways and their roles in gene expression. Copyright © 2013 The Authors. Published by Elsevier Inc. All rights reserved.

Conditional Stochastic Models in Reduced Space: Towards Efficient Simulation of Tropical Cyclone Precipitation Patterns

NASA Astrophysics Data System (ADS)

Dodov, B.

2017-12-01

Stochastic simulation of realistic and statistically robust patterns of Tropical Cyclone (TC) induced precipitation is a challenging task. It is even more challenging in a catastrophe modeling context, where tens of thousands of typhoon seasons need to be simulated in order to provide a complete view of flood risk. Ultimately, one could run a coupled global climate model and regional Numerical Weather Prediction (NWP) model, but this approach is not feasible in the catastrophe modeling context and, most importantly, may not provide TC track patterns consistent with observations. Rather, we propose to leverage NWP output for the observed TC precipitation patterns (in terms of downscaled reanalysis 1979-2015) collected on a Lagrangian frame along the historical TC tracks and reduced to the leading spatial principal components of the data. The reduced data from all TCs is then grouped according to timing, storm evolution stage (developing, mature, dissipating, ETC transitioning) and central pressure and used to build a dictionary of stationary (within a group) and non-stationary (for transitions between groups) covariance models. Provided that the stochastic storm tracks with all the parameters describing the TC evolution are already simulated, a sequence of conditional samples from the covariance models chosen according to the TC characteristics at a given moment in time are concatenated, producing a continuous non-stationary precipitation pattern in a Lagrangian framework. The simulated precipitation for each event is finally distributed along the stochastic TC track and blended with a non-TC background precipitation using a data assimilation technique. The proposed framework provides means of efficient simulation (10000 seasons simulated in a couple of days) and robust typhoon precipitation patterns consistent with observed regional climate and visually undistinguishable from high resolution NWP output. The framework is used to simulate a catalog of 10000 typhoon seasons implemented in a flood risk model for Japan.

Translational repression by an RNA-binding protein promotes differentiation to infective forms in Trypanosoma cruzi.

PubMed

Romaniuk, Maria Albertina; Frasch, Alberto Carlos; Cassola, Alejandro

2018-06-01

Trypanosomes, protozoan parasites of medical importance, essentially rely on post-transcriptional mechanisms to regulate gene expression in insect vectors and vertebrate hosts. RNA binding proteins (RBPs) that associate to the 3'-UTR of mature mRNAs are thought to orchestrate master developmental programs for these processes to happen. Yet, the molecular mechanisms by which differentiation occurs remain largely unexplored in these human pathogens. Here, we show that ectopic inducible expression of the RBP TcUBP1 promotes the beginning of the differentiation process from non-infective epimastigotes to infective metacyclic trypomastigotes in Trypanosoma cruzi. In early-log epimastigotes TcUBP1 promoted a drop-like phenotype, which is characterized by the presence of metacyclogenesis hallmarks, namely repositioning of the kinetoplast, the expression of an infective-stage virulence factor such as trans-sialidase, increased resistance to lysis by human complement and growth arrest. Furthermore, TcUBP1-ectopic expression in non-infective late-log epimastigotes promoted full development into metacyclic trypomastigotes. TcUBP1-derived metacyclic trypomastigotes were infective in cultured cells, and developed normally into amastigotes in the cytoplasm. By artificial in vivo tethering of TcUBP1 to the 3' untranslated region of a reporter mRNA we were able to determine that translation of the reporter was reduced by 8-fold, while its mRNA abundance was not significantly compromised. Inducible ectopic expression of TcUBP1 confirmed its role as a translational repressor, revealing significant reduction in the translation rate of multiple proteins, a reduction of polysomes, and promoting the formation of mRNA granules. Expression of TcUBP1 truncated forms revealed the requirement of both N and C-terminal glutamine-rich low complexity sequences for the development of the drop-like phenotype in early-log epimastigotes. We propose that a rise in TcUBP1 levels, in synchrony with nutritional deficiency, can promote the differentiation of T. cruzi epimastigotes into infective metacyclic trypomastigotes.

Tissue expression and predicted protein structures of the bovine ANGPTL3 and association of novel SNPs with growth and meat quality traits.

PubMed

Chen, N B; Ma, Y; Yang, T; Lin, F; Fu, W W; Xu, Y J; Li, F; Li, J Y; Gao, S X

2015-08-01

Angiopoietin-like protein 3 (ANGPTL3) is a secreted protein that regulates lipid, glucose and energy metabolism. This study was conducted to better understand the effect of ANGPTL3 on important economic traits in cattle. First, transcript profiles for ANGPTL3 were measured in nine different Jiaxian cattle tissues. Second, polymorphisms were identified in the complete coding region and promoter region of the bovine ANGPTL3 gene in 707 cattle samples. Finally, an association study was carried out utilizing these single nucleotide polymorphisms (SNPs) to determine the effect of these SNPs on the growth and meat quality traits. Quantitative real-time PCR analysis showed that ANGPTL3 was mainly expressed in the liver. The promoter of the bovine ANGPTL3 contained several putative transcription factor binding sites (SF1, HNF-1, LXRα, NFκβ, HNF-3 and C/EBP). In total, four SNPs of the bovine ANGPTL3 gene were identified by direct sequencing. SNP1 (rs469906272: g.-38T>C) was identified in the promoter, SNP2 (rs451104723:g.104A>T) and SNP3 (rs482516226: g.509A>G) were identified in exon 1, and SNP4 (rs477165942: g.8661T>C) was identified in exon 6. Changes in predicted protein structures due to non-synonymous SNPs were analyzed. Haplotype frequencies and linkage disequilibrium were also investigated. Analysis of four SNPs in cattle from different native Chinese breeds (Nanyang (NY) and Jiaxian (JX)) and commercial breeds (Angus (AG), Hereford (HF), Limousin (LM), Luxi (LX), Simmental (ST) and Jinnan (JN)) revealed a significant association with growth traits (including: BW and hipbone width) and meat quality traits (including: Warner-Bratzler shear force and ribeye area). Therefore, implementation of these four mutations in selection indices in the beef industry may be beneficial in selecting individuals with superior growth and meat quality traits.

Polymorphism and haplotype analyses of swine leukocyte antigen DQA exons 2, 3, 4, and their associations with piglet diarrhea in Chinese native pig.

PubMed

Huang, X Y; Yang, Q L; Yuan, J H; Gun, S B

2015-09-08

In this study, 290 Chinese native Yantai black pig piglets were investigated to identify gene polymorphisms, for haplotype reconstruction, and to determine the association between piglet diarrhea and swine leukocyte antigen (SLA) class II DQA exons 2, 3, and 4 by polymerase chain reaction-single stranded conformational polymorphism and cloning sequencing. The results showed that the 5, 8, and 7 genotypes were identified from SLA-DQA exon 2, 3, and 4, respectively, based on the single-stranded conformational polymorphism banding patterns and found a novel allele D in exon 2 and 2 novel mutational sites of allele C (c.4828T>C) and allele F (c.4617T>C) in exon 3. Polymorphism information content testing showed that exon 2 was moderately polymorphic and that exons-3 and -4 loci were highly polymorphic. The piglet diarrhea scores for genotypes AB (1.40 ± 0.14) and AC (1.54 ± 0.17) in exon 2, AA (1.22 ± 0.32), BC (1.72 ± 0.13), DD (1.67 ± 0.35), and CF (1.22 ± 0.45) in exon 3, and AD (2.35 ± 0.25) in exon 4 were significantly higher than those for the other genotypes (P ≤ 0.05) in DQA exons. There were 14 reconstructed haplotypes in the 3 exons from 290 individuals and Hap12 may be the diarrhea-resistant gene. Haplotype distribution was extremely uneven, and the SLA-DQA gene showed genetic linkage. In this study, we identified molecular genetic markers and provided a theoretical foundation for future pig anti-disease resistance breeding.

Effect of Electron Donor and Solution Chemistry on Products of Dissimilatory Reduction of Technetium by Shewanella putrefaciens

PubMed Central

Wildung, R. E.; Gorby, Y. A.; Krupka, K. M.; Hess, N. J.; Li, S. W.; Plymale, A. E.; McKinley, J. P.; Fredrickson, J. K.

2000-01-01

To help provide a fundamental basis for use of microbial dissimilatory reduction processes in separating or immobilizing 99Tc in waste or groundwaters, the effects of electron donor and the presence of the bicarbonate ion on the rate and extent of pertechnetate ion [Tc(VII)O4−] enzymatic reduction by the subsurface metal-reducing bacterium Shewanella putrefaciens CN32 were determined, and the forms of aqueous and solid-phase reduction products were evaluated through a combination of high-resolution transmission electron microscopy, X-ray absorption spectroscopy, and thermodynamic calculations. When H2 served as the electron donor, dissolved Tc(VII) was rapidly reduced to amorphous Tc(IV) hydrous oxide, which was largely associated with the cell in unbuffered 0.85% NaCl and with extracellular particulates (0.2 to 0.001 μm) in bicarbonate buffer. Cell-associated Tc was present principally in the periplasm and outside the outer membrane. The reduction rate was much lower when lactate was the electron donor, with extracellular Tc(IV) hydrous oxide the dominant solid-phase reduction product, but in bicarbonate systems much less Tc(IV) was associated directly with the cell and solid-phase Tc(IV) carbonate may have been present. In the presence of carbonate, soluble (<0.001 μm) electronegative, Tc(IV) carbonate complexes were also formed that exceeded Tc(VII)O4− in electrophoretic mobility. Thermodynamic calculations indicate that the dominant reduced Tc species identified in the experiments would be stable over a range of Eh and pH conditions typical of natural waters. Thus, carbonate complexes may represent an important pathway for Tc transport in anaerobic subsurface environments, where it has generally been assumed that Tc mobility is controlled by low-solubility Tc(IV) hydrous oxide and adsorptive, aqueous Tc(IV) hydrolysis products. PMID:10831424

The activity of TcCYS4 modified by variations in pH and temperature can affect symptoms of witches' broom disease of cocoa, caused by the fungus Moniliophthora perniciosa.

PubMed

Freitas, Ana Camila Oliveira; Souza, Cristiane Ferreira; Monzani, Paulo Sérgio; Garcia, Wanius; de Almeida, Alex Alan Furtado; Costa, Marcio Gilberto Cardoso; Pirovani, Carlos Priminho

2015-01-01

The phytocystatins regulate various physiological processes in plants, including responses to biotic and abiotic stresses, mainly because they act as inhibitors of cysteine proteases. In this study, we have analyzed four cystatins from Theobroma cacao L. previously identified in ESTs libraries of the interaction with the fungus Moniliophthora perniciosa and named TcCYS1, TcCYS2, TcCYS3 and TcCYS4. The recombinant cystatins were purified and subjected to the heat treatment, at different temperatures, and their thermostabilities were monitored using their ability to inhibit papain protease. TcCYS1 was sensitive to temperatures above 50°C, while TcCYS2, TcCYS3, and TcCYS4 were thermostable. TcCYS4 presented a decrease of inhibitory activity when it was treated at temperatures between 60 and 70°C, with the greater decrease occurring at 65°C. Analyses by native gel electrophoresis and size-exclusion chromatography showed that TcCYS4 forms oligomers at temperatures between 60 and 70°C, condition where reduction of inhibitory activity was observed. TcCYS4 oligomers remain stable for up to 20 days after heat treatment and are undone after treatment at 80°C. TcCYS4 presented approximately 90% of inhibitory activity at pH values between 5 and 9. This protein treated at temperatures above 45°C and pH 5 presented reduced inhibitory activity against papain, suggesting that the pH 5 enhances the formation of TcCYS4 oligomers. A variation in the titratable acidity was observed in tissues of T. cacao during the symptoms of witches' broom disease. Our findings suggest that the oligomerization of TcCYS4, favored by variations in pH, is an endergonic process. We speculate that this process can be involved in the development of the symptoms of witches' broom disease in cocoa.

The Activity of TcCYS4 Modified by Variations in pH and Temperature Can Affect Symptoms of Witches’ Broom Disease of Cocoa, Caused by the Fungus Moniliophthora perniciosa

PubMed Central

Freitas, Ana Camila Oliveira; Souza, Cristiane Ferreira; Monzani, Paulo Sérgio; Garcia, Wanius; de Almeida, Alex Alan Furtado; Costa, Marcio Gilberto Cardoso; Pirovani, Carlos Priminho

2015-01-01

The phytocystatins regulate various physiological processes in plants, including responses to biotic and abiotic stresses, mainly because they act as inhibitors of cysteine proteases. In this study, we have analyzed four cystatins from Theobroma cacao L. previously identified in ESTs libraries of the interaction with the fungus Moniliophthora perniciosa and named TcCYS1, TcCYS2, TcCYS3 and TcCYS4. The recombinant cystatins were purified and subjected to the heat treatment, at different temperatures, and their thermostabilities were monitored using their ability to inhibit papain protease. TcCYS1 was sensitive to temperatures above 50°C, while TcCYS2, TcCYS3, and TcCYS4 were thermostable. TcCYS4 presented a decrease of inhibitory activity when it was treated at temperatures between 60 and 70°C, with the greater decrease occurring at 65°C. Analyses by native gel electrophoresis and size-exclusion chromatography showed that TcCYS4 forms oligomers at temperatures between 60 and 70°C, condition where reduction of inhibitory activity was observed. TcCYS4 oligomers remain stable for up to 20 days after heat treatment and are undone after treatment at 80°C. TcCYS4 presented approximately 90% of inhibitory activity at pH values between 5 and 9. This protein treated at temperatures above 45°C and pH 5 presented reduced inhibitory activity against papain, suggesting that the pH 5 enhances the formation of TcCYS4 oligomers. A variation in the titratable acidity was observed in tissues of T. cacao during the symptoms of witches’ broom disease. Our findings suggest that the oligomerization of TcCYS4, favored by variations in pH, is an endergonic process. We speculate that this process can be involved in the development of the symptoms of witches’ broom disease in cocoa. PMID:25830226

Genetic evaluations of Chinese patients with odontohypophosphatasia resulting from heterozygosity for mutations in the tissue-non-specific alkaline phosphatase gene.

PubMed

Wan, Jia; Zhang, Li; Liu, Tang; Wang, Yewei

2017-08-01

Hypophosphatasia is a rare heritable metabolic disorder characterized by defective bone and tooth mineralization accompanied by a deficiency of tissue-non-specific (liver/bone/kidney) isoenzyme of alkaline phosphatase activity, caused by a number of loss-of-function mutations in the alkaline phosphatase liver type gene. We seek to explore the clinical manifestations and identify the mutations associated with the disease in a Chinese odonto- hypophosphatasia family. The proband and his younger brother affected with premature loss of primary teeth at their 2-year-old. They have mild abnormal serum alkaline phosphatase and 25-hydroxy vitamin D values, but the serum alkaline phosphatase activity of their father, mother and grandmother, who showed no clinical symptoms of hypophosphatasia, was exhibited significant decreased. In addition to premature loss of primary teeth, the proband and his younger brother showed low bone mineral density, X-rays showed that they had slight metaphyseal osteoporosis changes, but no additional skeletal abnormalities. Deoxyribonucleic acid sequencing and analysis revealed a single nucleotide polymorphism c.787T>C (p.Y263H) in exon 7 and/or a novel mutation c.-92C>T located at 5'UTR were found in the affected individuals. We examined all individuals of an odonto- hypophosphatasia family by clinical and radiographic examinations as well as laboratory assays. Furthermore, all 12 exons and the exon-intron boundaries of the alkaline phosphatase liver type gene were amplified and directly sequenced for further analysis and screened for mutations. Our present findings suggest the single nucleotide polymorphism c.787T>C and c.-92C>T should be responsible for the odonto- hypophosphatasia disorders in this family.

A tree-based statistical classification algorithm (CHAID) for identifying variables responsible for the occurrence of faecal indicator bacteria during waterworks operations

NASA Astrophysics Data System (ADS)

Bichler, Andrea; Neumaier, Arnold; Hofmann, Thilo

2014-11-01

Microbial contamination of groundwater used for drinking water can affect public health and is of major concern to local water authorities and water suppliers. Potential hazards need to be identified in order to protect raw water resources. We propose a non-parametric data mining technique for exploring the presence of total coliforms (TC) in a groundwater abstraction well and its relationship to readily available, continuous time series of hydrometric monitoring parameters (seven year records of precipitation, river water levels, and groundwater heads). The original monitoring parameters were used to create an extensive generic dataset of explanatory variables by considering different accumulation or averaging periods, as well as temporal offsets of the explanatory variables. A classification tree based on the Chi-Squared Automatic Interaction Detection (CHAID) recursive partitioning algorithm revealed statistically significant relationships between precipitation and the presence of TC in both a production well and a nearby monitoring well. Different secondary explanatory variables were identified for the two wells. Elevated water levels and short-term water table fluctuations in the nearby river were found to be associated with TC in the observation well. The presence of TC in the production well was found to relate to elevated groundwater heads and fluctuations in groundwater levels. The generic variables created proved useful for increasing significance levels. The tree-based model was used to predict the occurrence of TC on the basis of hydrometric variables.

[Differences between Chicago and traditional classifications in the diagnosis of esophageal motor disorders with high-resolution manometry and topography of esophageal pressure].

PubMed

Abreu-Y Abreu, A T; González Sánchez, C B; Villanueva Sáenz, E; Valdovinos Díaz, M A

2010-01-01

With the introduction of high resolution manometry (HRM) and esophageal topography a novel classification (Chicago Classification) has been proposed for the diagnosis of esophageal motor disorders (EMD). Clinical differences with the traditional classification are currently under evaluation. To investigate differences between the Chicago (CC) and traditional (TC) classifications in the diagnosis of EMD. Consecutive patients with indication for esophageal manometry were studied. HRM was performed with a 36 sensors solid-state catheter and Manoview software (V2.0).Conventional manometric tracings were analyzed by an investigator blinded to the results of HRM. Diagnosis by CC and CT were compared. Two hundred patients were studied, 106 (53%) of them women (53%) with a mean patient age of 43.4 (range 16 - 84) years. Preoperative evaluation for GERD 152 (76%) was the most frequent indication. Achalasia (8), scleroderma (2) and peristaltic dysfunction (60 vs. 59) were similarly diagnosed by CC and CT. Spastic disorders were more frequently identified by CC: nutcracker esophagus (NC) in 3, spastic NC in3 and segmental NC in 11 patients versus TC: NC 5. Three patients had spasm with CC and 1 with TC. Non specific motor disorder was diagnosed by TC and 2 patients had functional obstruction with CC. Hypotensive lower esophageal sphincter was identified in 63 patients with CC vs.57 with TC. Spastic disorders and functional obstruction were the EMD better identified by HRM and CC.

Functional analysis of a WRKY transcription factor involved in transcriptional activation of the DBAT gene in Taxus chinensis.

PubMed

Li, S; Zhang, P; Zhang, M; Fu, C; Yu, L

2013-01-01

Although the regulation of taxol biosynthesis at the transcriptional level remains unclear, 10-deacetylbaccatin III-10 β-O-acetyl transferase (DBAT) is a critical enzyme in the biosynthesis of taxol. The 1740 bp fragment 5'-flanking sequence of the dbat gene was cloned from Taxus chinensis cells. Important regulatory elements needed for activity of the dbat promoter were located by deletion analyses in T. chinensis cells. A novel WRKY transcription factor, TcWRKY1, was isolated with the yeast one-hybrid system from a T. chinensis cell cDNA library using the important regulatory elements as bait. The gene expression of TcWRKY1 in T. chinensis suspension cells was specifically induced by methyl jasmonate (MeJA). Biochemical analysis indicated that TcWRKY1 protein specifically interacts with the two W-box (TGAC) cis-elements among the important regulatory elements. Overexpression of TcWRKY1 enhanced dbat expression in T. chinensis suspension cells, and RNA interference (RNAi) reduced the level of transcripts of dbat. These results suggest that TcWRKY1 participates in regulation of taxol biosynthesis in T. chinensis cells, and that dbat is a target gene of this transcription factor. This research also provides a potential candidate gene for engineering increased taxol accumulation in Taxus cell cultures. © 2012 German Botanical Society and The Royal Botanical Society of the Netherlands.

Syndrome of Hepatic Cirrhosis, Dystonia, Polycythemia, and Hypermanganesemia Caused by Mutations in SLC30A10, a Manganese Transporter in Man

PubMed Central

Tuschl, Karin; Clayton, Peter T.; Gospe, Sidney M.; Gulab, Shamshad; Ibrahim, Shahnaz; Singhi, Pratibha; Aulakh, Roosy; Ribeiro, Reinaldo T.; Barsottini, Orlando G.; Zaki, Maha S.; Del Rosario, Maria Luz; Dyack, Sarah; Price, Victoria; Rideout, Andrea; Gordon, Kevin; Wevers, Ron A.; “Kling” Chong, W.K.; Mills, Philippa B.

2012-01-01

Environmental manganese (Mn) toxicity causes an extrapyramidal, parkinsonian-type movement disorder with characteristic magnetic resonance images of Mn accumulation in the basal ganglia. We have recently reported a suspected autosomal recessively inherited syndrome of hepatic cirrhosis, dystonia, polycythemia, and hypermanganesemia in cases without environmental Mn exposure. Whole-genome mapping of two consanguineous families identified SLC30A10 as the affected gene in this inherited type of hypermanganesemia. This gene was subsequently sequenced in eight families, and homozygous sequence changes were identified in all affected individuals. The function of the wild-type protein and the effect of sequence changes were studied in the manganese-sensitive yeast strain Δpmr1. Expressing human wild-type SLC30A10 in the Δpmr1 yeast strain rescued growth in high Mn conditions, confirming its role in Mn transport. The presence of missense (c.266T>C [p.Leu89Pro]) and nonsense (c.585del [p.Thr196Profs∗17]) mutations in SLC30A10 failed to restore Mn resistance. Previously, SLC30A10 had been presumed to be a zinc transporter. However, this work has confirmed that SLC30A10 functions as a Mn transporter in humans that, when defective, causes Mn accumulation in liver and brain. This is an important step toward understanding Mn transport and its role in neurodegenerative processes. PMID:22341972

Over Six Thousand Trypanosoma cruzi Strains Classified into Discrete Typing Units (DTUs): Attempt at an Inventory

PubMed Central

Brenière, Simone Frédérique; Waleckx, Etienne; Barnabé, Christian

2016-01-01

Trypanosoma cruzi, the causative agent of Chagas disease, presents wide genetic diversity. Currently, six discrete typing units (DTUs), named TcI to TcVI, and a seventh one called TcBat are used for strain typing. Beyond the debate concerning this classification, this systematic review has attempted to provide an inventory by compiling the results of 137 articles that have used it. A total of 6,343 DTU identifications were analyzed according to the geographical and host origins. Ninety-one percent of the data available is linked to South America. This sample, although not free of potential bias, nevertheless provides today’s picture of T. cruzi genetic diversity that is closest to reality. DTUs were genotyped from 158 species, including 42 vector species. Remarkably, TcI predominated in the overall sample (around 60%), in both sylvatic and domestic cycles. This DTU known to present a high genetic diversity, is very widely distributed geographically, compatible with a long-term evolution. The marsupial is thought to be its most ancestral host and the Gran Chaco region the place of its putative origin. TcII was rarely sampled (9.6%), absent, or extremely rare in North and Central America, and more frequently identified in domestic cycles than in sylvatic cycles. It has a low genetic diversity and has probably found refuge in some mammal species. It is thought to originate in the south-Amazon area. TcIII and TcIV were also rarely sampled. They showed substantial genetic diversity and are thought to be composed of possible polyphyletic subgroups. Even if they are mostly associated with sylvatic transmission cycles, a total of 150 human infections with these DTUs have been reported. TcV and TcVI are clearly associated with domestic transmission cycles. Less than 10% of these DTUs were identified together in sylvatic hosts. They are thought to originate in the Gran Chaco region, where they are predominant and where putative parents exist (TcII and TcIII). Trends in host-DTU specificities exist, but generally it seems that the complexity of the cycles and the participation of numerous vectors and mammal hosts in a shared area, maintains DTU diversity. PMID:27571035

Dietary pattern as identified by factorial analysis and its association with lipid profile and fasting plasma glucose among Iranian individuals with spinal cord injury.

PubMed

Sabour, Hadis; Soltani, Zahra; Latifi, Sahar; Javidan, Abbas Norouzi

2016-07-01

Plasma lipids (triglyceride (TG), total cholesterol (TC), high-density lipoprotein (HDL-C) and low-density lipoprotein (LDL-C)) may be associated with dietary intakes. The purpose of this study was to identify the most common food patterns among Iranian persons with spinal cord injury (SCI) and investigate their associations with lipid profile. Cross-sectional. Tertiary rehabilitation center. Referred individuals to Brain and Spinal Injury Research Center (BASIR) from 2011 to 2014. Dietary intakes were assessed by 24-hour dietary recall interviews in three non-consecutive days. Principal component analysis (PCA) was used to identify dietary patterns. Total of 100 persons (83 male and 17 female) entered the study. Four food patterns were detected. The most common dietary pattern (Pattern 1) included processed meat, sweets desserts and soft drink and was similar to 'Western' food pattern described previously. Pattern 1 was related to higher levels of TC and LDL-C (r = 0.09; P = 0.04 and r = 0.11; P = 0.03 for TC and LDL-C, respectively) only in male participants. Pattern 2 which included tea, nuts, vegetable oil and sugars had a positive association with TC level (r = 0.11; P = 0.02) again in male participants. Pattern 3 which represented a healthy food pattern showed no significant influence on lipid profiles. In this study, the four most common dietary patterns among Iranian individuals with SCI have been identified. Western food pattern was the most common diet and was associated with increased TC and LDL-C. The healthy food pattern, in which the major source of calories was protein, was not associated with variance in lipid profile.

Apolipoprotein C3 (-455T>C) polymorphism confers susceptibility to nonalcoholic fatty liver disease in the Southern Han Chinese population

PubMed Central

Li, Min-Rui; Zhang, Sheng-Hong; Chao, Kang; Liao, Xian-Hua; Yao, Jia-Yan; Chen, Min-Hu; Zhong, Bi-Hui

2014-01-01

AIM: To investigate the relationship between Apolipoprotein C3 (APOC3) (-455T>C) polymorphism and nonalcoholic fatty liver disease (NAFLD) in the Southern Chinese Han population. METHODS: In this prospective case-control study, we recruited 300 NAFLD patients and 300 healthy controls to a cohort representing Southern Chinese Han population at The First Affiliated Hospital, Sun Yat-sen University, from January to December 2012. Polymerase chain reaction-restriction fragment length polymorphism and DNA sequencing were used to genotype the APOC3 (-455T>C) variants. RESULTS: After adjusting for age, gender, and body-mass index, TC and CC genotypes were found to increase the susceptibility to NAFLD compared to the TT genotype, with adjusted odds ratios (ORs) of 1.77 (95%CI: 1.16-2.72) and 2.80 (95%CI: 1.64-4.79), respectively. Further stratification analysis indicated that carriers of the CC genotype was more susceptible to insulin resistance (IR) than those of the TT genotype, with an OR of 3.24 (95%CI: 1.52-6.92). The CC genotype also was associated with a significantly higher risk of hypertension, hypertriglyceridemia, and low levels of high-density lipoprotein cholesterol (HDL) (P < 0.05). No association was found between the APOC3 (-455T>C) polymorphism and obesity, impaired glucose tolerance, hyperuricemia, hypercholesterolemia, or high levels of low-density lipoprotein cholesterol (LDL) (P > 0.05). CONCLUSION: APOC3 (-455T>C) genetic variation is involved in the susceptibility to developing NAFLD, IR, hypertension, hypertriglyceridemia, and low HDL in the Southern Chinese Han population. PMID:25320541

Chlamydia muridarum Genital and Gastrointestinal Infection Tropism Is Mediated by Distinct Chromosomal Factors.

PubMed

Morrison, Sandra G; Giebel, Amanda M; Toh, Evelyn C; Spencer, Horace J; Nelson, David E; Morrison, Richard P

2018-07-01

Some members of the genus Chlamydia , including the human pathogen Chlamydia trachomatis , infect multiple tissues, including the genital and gastrointestinal (GI) tracts. However, it is unknown if bacterial targeting to these sites is mediated by multifunctional or distinct chlamydial factors. We previously showed that disruption of individual large clostridial toxin homologs encoded within the Chlamydia muridarum plasticity zone were not critical for murine genital tract infection. Here, we assessed whether cytotoxin genes contribute to C. muridarum GI tropism. Infectivity and shedding of wild-type (WT) C. muridarum and three mutants containing nonsense mutations in different cytotoxin genes, tc0437 , tc0438 , and tc0439 , were compared in mouse genital and GI infection models. One mutant, which had a nonsense mutation in tc0439 , was highly attenuated for GI infection and had a GI 50% infectious dose (ID 50 ) that was 1,000 times greater than that of the WT. GI inoculation with this mutant failed to elicit anti-chlamydial antibodies or to protect against subsequent genital tract infection. Genome sequencing of the tc0439 mutant revealed additional chromosomal mutations, and phenotyping of additional mutants suggested that the GI attenuation might be linked to a nonsense mutation in tc0600 The molecular mechanism underlying this dramatic difference in tissue-tropic virulence is not fully understood. However, isolation of these mutants demonstrates that distinct chlamydial chromosomal factors mediate chlamydial tissue tropism and provides a basis for vaccine initiatives to isolate chlamydia strains that are attenuated for genital infection but retain the ability to colonize the GI tract and elicit protective immune responses. Copyright © 2018 Morrison et al.

Passport, a native Tc1 transposon from flatfish, is functionally active in vertebrate cells

PubMed Central

Clark, Karl J.; Carlson, Daniel F.; Leaver, Michael J.; Foster, Linda K.; Fahrenkrug, Scott C.

2009-01-01

The Tc1/mariner family of DNA transposons is widespread across fungal, plant and animal kingdoms, and thought to contribute to the evolution of their host genomes. To date, an active Tc1 transposon has not been identified within the native genome of a vertebrate. We demonstrate that Passport, a native transposon isolated from a fish (Pleuronectes platessa), is active in a variety of vertebrate cells. In transposition assays, we found that the Passport transposon system improved stable cellular transgenesis by 40-fold, has an apparent preference for insertion into genes, and is subject to overproduction inhibition like other Tc1 elements. Passport represents the first vertebrate Tc1 element described as both natively intact and functionally active, and given its restricted phylogenetic distribution, may be contemporaneously active. The Passport transposon system thus complements the available genetic tools for the manipulation of vertebrate genomes, and may provide a unique system for studying the infiltration of vertebrate genomes by Tc1 elements. PMID:19136468

Passport, a native Tc1 transposon from flatfish, is functionally active in vertebrate cells.

PubMed

Clark, Karl J; Carlson, Daniel F; Leaver, Michael J; Foster, Linda K; Fahrenkrug, Scott C

2009-03-01

The Tc1/mariner family of DNA transposons is widespread across fungal, plant and animal kingdoms, and thought to contribute to the evolution of their host genomes. To date, an active Tc1 transposon has not been identified within the native genome of a vertebrate. We demonstrate that Passport, a native transposon isolated from a fish (Pleuronectes platessa), is active in a variety of vertebrate cells. In transposition assays, we found that the Passport transposon system improved stable cellular transgenesis by 40-fold, has an apparent preference for insertion into genes, and is subject to overproduction inhibition like other Tc1 elements. Passport represents the first vertebrate Tc1 element described as both natively intact and functionally active, and given its restricted phylogenetic distribution, may be contemporaneously active. The Passport transposon system thus complements the available genetic tools for the manipulation of vertebrate genomes, and may provide a unique system for studying the infiltration of vertebrate genomes by Tc1 elements.

⁹⁹mTc/Re complexes bearing bisnitroimidazole or mononitroimidazole as potential bioreductive markers for tumor: synthesis, physicochemical characterization and biological evaluation.

PubMed

Mei, Lei; Wang, Yue; Chu, Taiwei

2012-12-01

Four monoamine-monoamide dithiol (MAMA) ligands containing two or one nitroimidazole moieties were synthesized and labeled with (99m)Tc (labeling yield > 95%). The proposed structures of (99m)Tc-complexes are identified by comparison with analogous Re-MAMA complexes. (99m)Tc-MAMA complexes show better physicochemical characters than (99m)TcO-(PnAO-1-(2-nitroimidazole)). Reduction potentials of nitro groups of the rhenium complexes are within the range for bioreductive compounds. As expected, biodistribution studies demonstrate that the 2-nitroimidazole complex shows better tumor-to-tissue ratios than 4-nitroimidazole analog for mononitroimidazole complexes, but not for MAMA-bisnitroimidazoles due to higher lipophilicity. Both the bisnitroimidazole compounds show rapider excretion, lower background activity in liver and higher tumor-to-tissue ratios than the mononitroimidazoles. Better biodistribution characteristic makes both the MAMA-bisnitroimidazole complexes, especially (99m)Tc-15, be potential tumor hypoxia marker. Copyright © 2012 Elsevier Masson SAS. All rights reserved.

Comparison of Exposures Among Arab American and Non-Hispanic White Female Thyroid Cancer Cases in Metropolitan Detroit

PubMed Central

Peterson, L.; Soliman, A.; Ruterbusch, J. J.; Smith, N.

2013-01-01

Arab American (ArA) women may be at greater risk for thyroid cancer (TC) than White women. This case-case comparison explored differences in known and proposed risk factors of TC among ArA and non-Hispanic White (NHW) female TC cases in metropolitan Detroit. Cases of invasive TC identified from a population-based registry responded to a telephone survey regarding potential TC risk factors. Thirty ArA women (response rate 52%) and 70 NHW women (67%) participated. NHW women reported significantly more prior thyroid disease (TD), family history of TD, hormone use, cumulative years of hormone use, cigarette and alcohol consumption. In adjusted logistic regression analysis, ArA women had significantly higher odds of exposure to dental x-rays (OR = 3.48, CI 1.01–12.00) and medical radiation (OR = 13.58, CI 1.49–124.04) than NHW women. Risk factors for TC may differ among ArA women and their NHW counterparts. PMID:21647624

Comparison of exposures among Arab American and non-Hispanic White female thyroid cancer cases in metropolitan Detroit.

PubMed

Peterson, L; Soliman, A; Ruterbusch, J J; Smith, N; Schwartz, K

2011-12-01

Arab American (ArA) women may be at greater risk for thyroid cancer (TC) than White women. This case-case comparison explored differences in known and proposed risk factors of TC among ArA and non-Hispanic White (NHW) female TC cases in metropolitan Detroit. Cases of invasive TC identified from a population-based registry responded to a telephone survey regarding potential TC risk factors. Thirty ArA women (response rate 52%) and 70 NHW women (67%) participated. NHW women reported significantly more prior thyroid disease (TD), family history of TD, hormone use, cumulative years of hormone use, cigarette and alcohol consumption. In adjusted logistic regression analysis, ArA women had significantly higher odds of exposure to dental x-rays (OR = 3.48, CI 1.01-12.00) and medical radiation (OR = 13.58, CI 1.49-124.04) than NHW women. Risk factors for TC may differ among ArA women and their NHW counterparts.

Distribution and linkage disequilibrium analysis of polymorphisms of GH1 gene in different populations of pigs associated with body size.

PubMed

Cheng, Yunyun; Liu, Songcai; Su, Dan; Lu, Chao; Zhang, Xin; Wu, Qingyan; Li, Siming; Fu, Haoyu; Yu, Hao; Hao, Linlin

2016-03-01

Growth hormone (GH) has been considered as a candidate gene for growth and body size in pigs. In this study, polymorphisms of the GH1 gene were evaluated for associations with body size traits in 190 pig individuals. Seventeen single-nucleotide polymorphisms (SNPs) were identified in GH1 gene of the large pig breeds and miniature pig breeds using direct sequencing and genotyped by allele-specific PCR approach. Notably, six (g.237A>G, g.283T>C, g.309A>G, g.318A>G, g.540A>G and g.544A>G) of them were significantly associated with body size, of which three loci (g.283T>C, g.309A>G, g.318A>G) located in the signal-peptide coding region of GH1 gene compose a CGG haplotype for large pigs and TAA haplotype for miniature pigs (P <0.001), two loci (g.540A>G and g.544A>G) located in the second intron of GH1 gene compose a GG haplotype for large pigs and AA haplotype for miniature pigs (P < 0.001). Our results demonstrate that these SNPs in GH1 gene are associated with the body size of pigs providing genetic basis for pig breeding with the improved economic benefits.

Occurrence of potentially pathogenic nontuberculous mycobacteria in Mexican household potable water: a pilot study.

PubMed

Perez-Martinez, Iza; Aguilar-Ayala, Diana A; Fernandez-Rendon, Elizabeth; Carrillo-Sanchez, Alma K; Helguera-Repetto, Addy C; Rivera-Gutierrez, Sandra; Estrada-Garcia, Teresa; Cerna-Cortes, Jorge F; Gonzalez-Y-Merchand, Jorge A

2013-12-11

Nontuberculous mycobacteria (NTM) are environmental opportunistic pathogens found in natural and human-engineered waters, including drinking water distribution systems and household plumbing. This pilot study examined the frequency of occurrence of NTM in household potable water samples in Mexico City. Potable water samples were collected from the "main house faucet" and kitchen faucet. The presence of aerobic-mesophilic bacteria (AMB), total coliforms (TC), fecal coliforms (FC) and NTM species were determined. Mycobacteria species were identified by PCR restriction enzyme pattern analysis (PRA) of the 65-kDa heat shock protein gene (hsp65) and sequencing of the hypervariable region 2 (V2) of the 16S rRNA gene and of the rpoB gene. AMB (<100 CFU/ml) were present in 118 out of 120 samples; only two samples were outside guidelines ranges (>100 CFU/ml). TC and FC were detected in four and one samples, respectively. NTM species were recovered from 16% samples (19/120) and included M. mucogenicum (nine), M. porcinum (three), M. avium (three), M. gordonae (one), M. cosmeticum (one), M. fortuitum (one), and Mycobacterium sp (one). All household water samples that contained NTM complied with the standards required to grade the water as "good quality" potable water. Household potable water may be a potential source of NTM infection in Mexico City.

Exome-wide association study of plasma lipids in >300,000 individuals

PubMed Central

Liu, Dajiang J.; Peloso, Gina M.; Yu, Haojie; Butterworth, Adam S.; Wang, Xiao; Mahajan, Anubha; Saleheen, Danish; Emdin, Connor; Alam, Dewan; Alves, Alexessander Couto; Amouyel, Philippe; di Angelantonio, Emanuele; Arveiler, Dominique; Assimes, Themistocles L.; Auer, Paul L.; Baber, Usman; Ballantyne, Christie M.; Bang, Lia E.; Benn, Marianne; Bis, Joshua C.; Boehnke, Michael; Boerwinkle, Eric; Bork-Jensen, Jette; Bottinger, Erwin P.; Brandslund, Ivan; Brown, Morris; Busonero, Fabio; Caulfield, Mark J; Chambers, John C; Chasman, Daniel I.; Chen, Y. Eugene; Chen, Yii-Der Ida; Chowdhury, Rajiv; Christensen, Cramer; Chu, Audrey Y.; Connell, John M; Cucca, Francesco; Cupples, L. Adrienne; Damrauer, Scott M.; Davies, Gail; Deary, Ian J; Dedoussis, George; Denny, Joshua C.; Dominiczak, Anna; Dubé, Marie-Pierre; Ebeling, Tapani; Eiriksdottir, Gudny; Esko, Tõnu; Farmaki, Aliki-Eleni; Feitosa, Mary F; Ferrario, Marco; Ferrieres, Jean; Ford, Ian; Fornage, Myriam; Franks, Paul W.; Frayling, Timothy M.; Frikke-Schmidt, Ruth; Fritsche, Lars; Frossard, Philippe; Fuster, Valentin; Ganesh, Santhi K.; Gao, Wei; Garcia, Melissa E.; Gieger, Christian; Giulianini, Franco; Goodarzi, Mark O.; Grallert, Harald; Grarup, Niels; Groop, Leif; Grove, Megan L.; Gudnason, Vilmundur; Hansen, Torben; Harris, Tamara B.; Hayward, Caroline; Hirschhorn, Joel N.; Holmen, Oddgeir L.; Huffman, Jennifer; Huo, Yong; Hveem, Kristian; Jabeen, Sehrish; Jackson, Anne U; Jakobsdottir, Johanna; Jarvelin, Marjo-Riitta; Jensen, Gorm B; Jørgensen, Marit E.; Jukema, J. Wouter; Justesen, Johanne M.; Kamstrup, Pia R.; Kanoni, Stavroula; Karpe, Fredrik; Kee, Frank; Khera, Amit V.; Klarin, Derek; Koistinen, Heikki A.; Kooner, Jaspal S; Kooperberg, Charles; Kuulasmaa, Kari; Kuusisto, Johanna; Laakso, Markku; Lakka, Timo; Langenberg, Claudia; Langsted, Anne; Launer, Lenore J.; Lauritzen, Torsten; Liewald, David CM; Lin, Li An; Linneberg, Allan; Loos, Ruth J.F.; Lu, Yingchang; Lu, Xiangfeng; Mägi, Reedik; Malarstig, Anders; Manichaikul, Ani; Manning, Alisa K.; Mäntyselkä, Pekka; Marouli, Eirini; Masca, Nicholas GD; Maschio, Andrea; Meigs, James B.; Melander, Olle; Metspalu, Andres; Morris, Andrew P; Morrison, Alanna C.; Mulas, Antonella; Müller-Nurasyid, Martina; Munroe, Patricia B.; Neville, Matt J; Nielsen, Jonas B.; Nielsen, Sune F; Nordestgaard, Børge G; Ordovas, Jose M.; Mehran, Roxana; O’Donnell, Christoper J.; Orho-Melander, Marju; Molony, Cliona M.; Muntendam, Pieter; Padmanabhan, Sandosh; Palmer, Colin NA; Pasko, Dorota; Patel, Aniruddh P.; Pedersen, Oluf; Perola, Markus; Peters, Annette; Pisinger, Charlotta; Pistis, Giorgio; Polasek, Ozren; Poulter, Neil; Psaty, Bruce M.; Rader, Daniel J.; Rasheed, Asif; Rauramaa, Rainer; Reilly, Dermot; Reiner, Alex P.; Renström, Frida; Rich, Stephen S; Ridker, Paul M; Rioux, John D.; Robertson, Neil R; Roden, Dan M.; Rotter, Jerome I.; Rudan, Igor; Salomaa, Veikko; Samani, Nilesh J; Sanna, Serena; Sattar, Naveed; Schmidt, Ellen M.; Scott, Robert A.; Sever, Peter; Sevilla, Raquel S.; Shaffer, Christian M.; Sim, Xueling; Sivapalaratnam, Suthesh; Small, Kerrin S; Smith, Albert V.; Smith, Blair H; Somayajula, Sangeetha; Southam, Lorraine; Spector, Timothy D; Speliotes, Elizabeth K.; Starr, John M; Stirrups, Kathleen E; Stitziel, Nathan; Strauch, Konstantin; Stringham, Heather M; Surendran, Praveen; Tada, Hayato; Tall, Alan R.; Tang, Hua; Tardif, Jean-Claude; Taylor, Kent D; Trompet, Stella; Tsao, Philip S.; Tuomilehto, Jaakko; Tybjaerg-Hansen, Anne; van Zuydam, Natalie R; Varbo, Anette; Varga, Tibor V; Virtamo, Jarmo; Waldenberger, Melanie; Wang, Nan; Wareham, Nick J.; Warren, Helen R; Weeke, Peter E.; Weinstock, Joshua; Wessel, Jennifer; Wilson, James G.; Wilson, Peter W. F.; Xu, Ming; Yaghootkar, Hanieh; Young, Robin; Zeggini, Eleftheria; Zhang, He; Zheng, Neil S.; Zhang, Weihua; Zhang, Yan; Zhou, Wei; Zhou, Yanhua; Zoledziewska, Magdalena; Howson, Joanna MM; Danesh, John; McCarthy, Mark I; Cowan, Chad; Abecasis, Goncalo; Deloukas, Panos; Musunuru, Kiran; Willer, Cristen J.; Kathiresan, Sekar

2017-01-01

We screened DNA sequence variants on an exome-focused genotyping array in >300,000 participants with replication in >280,000 participants and identified 444 independent variants in 250 loci significantly associated with total cholesterol (TC), high-density lipoprotein cholesterol (HDL-C), low-density lipoprotein cholesterol (LDL-C), and/or triglycerides (TG). At two loci (JAK2 and A1CF), experimental analysis in mice revealed lipid changes consistent with the human data. We utilized mapped variants to address four clinically relevant questions and found the following: (1) beta-thalassemia trait carriers displayed lower TC and were protected from coronary artery disease; (2) outside of the CETP locus, there was not a predictable relationship between plasma HDL-C and risk for age-related macular degeneration; (3) only some mechanisms of lowering LDL-C seemed to increase risk for type 2 diabetes; and (4) TG-lowering alleles involved in hepatic production of TG-rich lipoproteins (e.g., TM6SF2, PNPLA3) tracked with higher liver fat, higher risk for type 2 diabetes, and lower risk for coronary artery disease whereas TG-lowering alleles involved in peripheral lipolysis (e.g., LPL, ANGPTL4) had no effect on liver fat but lowered risks for both type 2 diabetes and coronary artery disease. PMID:29083408

A DTU-dependent blood parasitism and a DTU-independent tissue parasitism during mixed infection of Trypanosoma cruzi in immunosuppressed mice.

PubMed

Sales-Campos, Helioswilton; Kappel, Henrique Borges; Andrade, Cristiane Pontes; Lima, Tiago Pereira; Mattos, Mardén Estevão; de Castilho, Alessandra; Correia, Dalmo; Giraldo, Luis Eduardo Ramirez; Lages-Silva, Eliane

2014-01-01

Trypanosoma cruzi (Tc) diversity is determined by different biological, genetic, and biochemical markers and has been grouped into six discrete typing units (DTUs) or taxonomic groups (TcI-TcVI). This variability, coupled with natural reinfection or the hosts' immunosuppression, may play an important role in the pathogenesis of Chagas disease. Therefore, we evaluated the blood and tissue parasitism and genetic profile of mice coinfected with the TcII (JG) strain and TcI AQ1-7 (AQ) or MUTUM (MT) strains during the acute and chronic phases of the disease and during immunosuppression. T. cruzi blood populations in mixed infections were clearly associated with the TcII strain during acute and chronic phases or during immunosuppression. However, in tissues, the parasite populations were distributed according to the strain and the stage of infection. TcII populations overlapped TcI strains during the acute phase; in contrast, during chronic phase, both TcI strains were more prevalent than the TcII strain. The immunosuppression induced selective exacerbation of parasite populations, leading to reactivation of the TcII strain when associated with the AQ, but not with MT strain. Thus, a differential distribution of T. cruzi populations in blood and tissues with overlapping according to the stage of infection and strain used was observed. Blood parasitism was associated with the DTU TcII and tissue parasitism with a specific parasite strain and not with DTUs. Finally, to our knowledge, this is the first study to analyze subpatent blood parasitism and to simultaneously identify different T. cruzi populations in tissues and blood.

Clinical significance of TC21 overexpression in oral cancer.

PubMed

Macha, Muzafar A; Matta, Ajay; Sriram, Uma; Thakkar, Alok; Shukla, N K; Datta Gupta, Siddhartha; Ralhan, Ranju

2010-07-01

In search of novel molecular markers for oral cancer, we reported increased levels of TC21/R-Ras2 transcripts in oral squamous cell carcinoma by differential display. The aim of this study was to determine the clinical significance of TC21 in oral cancer. Immunohistochemical analysis of TC21 protein expression was carried out in 120 leukoplakias, 83 OSCCs and 30 non-malignant tissues, confirmed by immunoblotting, and correlated with clinicopathological parameters as well as disease prognosis. Co-immunoprecipitation assays were carried out to identify the interaction partners of TC21 protein in oral cancer cells and tissues. TC21 nuclear expression increased from normal oral tissues to leukoplakia and frank malignancy (P < 0.001). TC21 overexpression was observed in 74.2% leukoplakia with no dysplasia, 75.9% dysplasias and 79.5% OSCCs in comparison with normal oral tissues. Receiver operating characteristic analysis showed that the area-under-the curve values were 0.895, 0.885, and 0.919, while the positive predictive values were 95.8%, 95.6%, and 97.1%, for nuclear immunostaining for normal versus leukoplakia with no dysplasia, leukoplakic lesions with dysplasia, and OSCCs, respectively. Immunoblotting confirmed overexpression of TC21 in oral lesions. Using co-immunoprecipitation assays, we showed interactions of TC21 with Erk2, PI3-K, 14-3-3zeta and 14-3-3sigma proteins in oral cancer cells. Our findings suggested that alteration in TC21 expression is an early event in oral cancer and correlates with poor prognosis of OSCCs. TC21 interactions with Erk2, PI3-K, 14-3-3zeta and 14-3-3sigma proteins in oral cancer cells and tissues suggests the involvement of TC21 in signaling pathways in oral cancer.

Development and Pharmacological Evaluation of New Bone-Targeted (99m)Tc-Radiolabeled Bisphosphonates.

PubMed

Makris, George; Tseligka, Eirini D; Pirmettis, Ioannis; Papadopoulos, Minas S; Vizirianakis, Ioannis S; Papagiannopoulou, Dionysia

2016-07-05

A novel bisphosphonate, 1-(3-aminopropylamino)ethane-1,1-diyldiphosphonic acid (3), was coupled to the tridentate chelators di-2-picolylamine, 2-picolylamine-N-acetic acid, iminodiacetic acid, 3-((2-aminoethyl)thio)-3-(1H-imidazol-4-yl)propanoic acid, and 2-((2-carboxyethyl)thio)-3-(1H-imidazol-4-yl)propanoic acid to form ligands 6, 9, 11, 15, and 19, respectively. Organometallic complexes of the general formula [Re/(99m)Tc(CO)3(κ(3)-L)] were synthesized, where L denotes ligand 6, 9, 11, 15, or 19. The rhenium complexes were prepared at the macroscopic level and characterized by spectroscopic methods. The technetium-99m organometallic complexes were synthesized in high yield and were identified by comparative reversed-phase HPLC with their Re analogues. The (99m)Tc tracers were stable in vitro and exhibited binding to hydroxyapatite. In biodistribution studies, all of the (99m)Tc complexes exhibited high bone uptake superior to that of 25, which is the directly (99m)Tc-labeled bisphosphonate 3, and comparable to that of (99m)Tc-methylene diphosphonate ((99m)Tc-MDP). The tracers [(99m)Tc(CO)3(6)] (26), [(99m)Tc(CO)3(9)] (27), [(99m)Tc(CO)3(11)] (28), and [(99m)Tc(CO)3(15)] (29) exhibited higher bone/blood ratios than (99m)Tc-MDP. 26 had the highest bone uptake at 1 h p.i. The new bisphosphonates showed no substantial growth inhibitory capacity in PC-3, Saos-2, and MCF-7 established cancer cell lines at low concentrations. Incubation of 26 with the same cancer cell lines indicated a rapid and saturated uptake. The promising properties of 26-29 indicate their potential for use as bone-imaging agents.

Will Outer Tropical Cyclone Size Change due to Anthropogenic Warming?

NASA Astrophysics Data System (ADS)

Schenkel, B. A.; Lin, N.; Chavas, D. R.; Vecchi, G. A.; Knutson, T. R.; Oppenheimer, M.

2017-12-01

Prior research has shown significant interbasin and intrabasin variability in outer tropical cyclone (TC) size. Moreover, outer TC size has even been shown to vary substantially over the lifetime of the majority of TCs. However, the factors responsible for both setting initial outer TC size and determining its evolution throughout the TC lifetime remain uncertain. Given these gaps in our physical understanding, there remains uncertainty in how outer TC size will change, if at all, due to anthropogenic warming. The present study seeks to quantify whether outer TC size will change significantly in response to anthropogenic warming using data from a high-resolution global climate model and a regional hurricane model. Similar to prior work, the outer TC size metric used in this study is the radius in which the azimuthal-mean surface azimuthal wind equals 8 m/s. The initial results from the high-resolution global climate model data suggest that the distribution of outer TC size shifts significantly towards larger values in each global TC basin during future climates, as revealed by 1) statistically significant increase of the median outer TC size by 5-10% (p<0.05) according to a 1,000-sample bootstrap resampling approach with replacement and 2) statistically significant differences between distributions of outer TC size from current and future climate simulations as shown using two-sample Kolmogorov Smirnov testing (p<<0.01). Additional analysis of the high-resolution global climate model data reveals that outer TC size does not uniformly increase within each basin in future climates, but rather shows substantial locational dependence. Future work will incorporate the regional mesoscale hurricane model data to help focus on identifying the source of the spatial variability in outer TC size increases within each basin during future climates and, more importantly, why outer TC size changes in response to anthropogenic warming.

Selective Imaging of Vascular Endothelial Growth Factor Receptor-1 and Receptor-2 in Atherosclerotic Lesions in Diabetic and Non-diabetic ApoE-/- Mice.

PubMed

Tekabe, Yared; Johnson, Lynne L; Rodriquez, Krissy; Li, Qing; Backer, Marina; Backer, Joseph M

2018-02-01

Plaque vulnerability is associated with inflammation and angiogenesis, processes that rely on vascular endothelial growth factor (VEGF) signaling via two receptors, VEGFR-1 and VEGFR-2. We have recently reported that enhanced uptake of scVEGF-PEG-DOTA/Tc-99m (scV/Tc) single photon emission computed tomography (SPECT) tracer that targets both VEGFR-1 and VEGFR-2, identifies accelerated atherosclerosis in diabetic relative to non-diabetic ApoE -/- mice. Since VEGFR-1 and VEGFR-2 may play different roles in atherosclerotic plaques, we reasoned that selective imaging of each receptor can provide more detailed information on plaque biology. Recently described VEGFR-1 and VEGFR-2 selective mutants of scVEGF, named scVR1 and scVR2, were site-specifically derivatized with Tc-99m chelator DOTA via 3.4 kDa PEG linker, and their selectivity to the cognate receptors was confirmed in vitro. scVR1 and scVR2 conjugates were radiolabeled with Tc-99m to specific activity of 110 ± 11 MBq/nmol, yielding tracers named scVR1/Tc and scVR2/Tc. 34-40 week old diabetic and age-matched non-diabetic ApoE -/- mice were injected with tracers, 2-3 h later injected with x-ray computed tomography (CT) contrast agent and underwent hybrid SPECT/CT imaging. Tracer uptake, localized to proximal aorta and brachiocephalic vessels, was quantified as %ID from. Tracer uptake was also quantified as %ID/g from gamma counting of harvested plaques. Harvested atherosclerotic arterial tissue was used for immunofluorescent analyses of VEGFR-1 and VEGFR-2 and various lineage-specific markers. Focal, receptor-mediated uptake in proximal aorta and brachiocephalic vessels was detected for both scVR1/Tc and scVR2/Tc tracers. Uptake of scVR1/Tc and scVR2/Tc was efficiently inhibited only by "cold" proteins of the same receptor selectivity. Tracer uptake in this area, expressed as %ID, was higher in diabetic vs. non- diabetic mice for scVR1/Tc (p = 0.01) but not for scVR2/Tc. Immunofluorescent analysis revealed enhanced VEGFR-1 prevalence in and around plaque area in diabetic mice. Selective VEGFR-1 and VEGFR-2 imaging of atherosclerotic lesions may be useful to explore plaque biology and identify vulnerability.

Effect of Phototherapy on the Reliability of Transcutaneous Bilirubin Devices in Term and Near-Term Infants: A Systematic Review and Meta-Analysis.

PubMed

Nagar, Gaurav; Vandermeer, Ben; Campbell, Sandy; Kumar, Manoj

2016-01-01

Transcutaneous bilirubin (TcB) devices are commonly used for screening of hyperbilirubinemia in term and near-term infants not exposed to phototherapy. However, the accuracy of TcB devices in infants exposed to phototherapy is unclear. To conduct a systematic review of studies comparing TcB devices with total serum bilirubin (TSB) in infants receiving phototherapy or in the postphototherapy phase. MEDLINE, EMBASE, Cochrane Library, CINAHL and Scopus databases (from inception to May 8, 2014) were searched. Additional citations were identified from the bibliography of selected articles and from the abstracts of conference proceedings. The studies were included if they compared TcB results with TSB in term and near-term infants during phototherapy or after discontinuation of phototherapy. Two reviewers independently assessed studies for inclusion, and discrepancies were resolved with consensus. Risk of bias was assessed using the QUADAS-2 tool. Fourteen studies were identified. The pooled estimates of correlation coefficients (r) during phototherapy were: covered sites 0.71 (95% CI 0.64-0.77, 11 studies), uncovered sites 0.65 (95% CI 0.55-0.74), 8 studies), forehead 0.70 (95% CI 0.64-0.75, 12 studies) and sternum 0.64 (95% CI 0.43-0.77, 5 studies). Two studies also provided results as Bland-Altman difference plots (mean TcB-TSB differences -29.2 and 30 µmol/l, respectively). The correlation coefficient improved marginally in the postphototherapy phase (r = 0.72, 95% CI 0.64-0.78, 4 studies). We found a moderate correlation between TcB and TSB during phototherapy with a marginal improvement in the postphototherapy phase. Further research is needed before the use of TcB devices can be recommended for these settings. © 2016 S. Karger AG, Basel.

CYP1A1, CYP3A5 and CYP3A7 polymorphisms and testicular cancer susceptibility.

PubMed

Kristiansen, W; Haugen, T B; Witczak, O; Andersen, J M; Fosså, S D; Aschim, E L

2011-02-01

Testicular cancer (TC) incidence is increasing worldwide, but the aetiology remains largely unknown. An unbalanced level of oestrogens and androgens in utero is hypothesized to influence TC risk. Polymorphisms in genes encoding cytochrome P450 (CYP) enzymes involved in metabolism of reproductive hormones, such as CYP1A1, CYP3A5 and CYP3A7, may contribute to variability of an individual's susceptibility to TC. The aim of this case-control study was to investigate possible associations between different CYP genotypes and TC, as well as histological type of TC. The study comprised 652 TC cases and 199 controls of Norwegian Caucasian origin. Genotyping of the CYP1A1*2A (MspI), CYP1A1*2C (I462V), CYP1A1*4 (T461N), CYP3A5*3C (A6986G) and CYP3A7*2 (T409R) polymorphisms was performed using TaqMan allelic discrimination or sequencing. The CYP1A1*2A allele was associated with 44% reduced risk of TC with each polymorphic allele [odds ratio (OR) = 0.56, 95% confidence interval (CI) = 0.40-0.78, p(trend) = 0.001], whereas the CYP1A1*2C allele was associated with 56% reduced risk of TC with each polymorphic allele (OR = 0.44, 95% CI = 0.25-0.75, p(trend) = 0.003). The decreased risk per allele was significant for seminomas (OR = 0.46, 95% CI, 0.31-0.70, p(trend) < 0.001 and OR = 0.31, 95% CI = 0.14-0.66, p(trend) = 0.002, respectively), but only borderline significant for non-seminomas (OR = 0.65, 95% CI = 0.45-0.95, p(trend) = 0.027 and OR = 0.55, 95% CI = 0.30-1.01, p(trend) = 0.052, respectively). There were no statistically significant differences in the distribution of the CYP3A5*3C and CYP3A7*2 polymorphic alleles between TC cases and controls. This study suggests that polymorphisms in the CYP1A1 gene may contribute to variability of individual susceptibility to TC. © 2010 The Authors. International Journal of Andrology © 2010 European Academy of Andrology.

Molecular analysis of brazilian patients with combined pituitary hormone deficiency and orthotopic posterior pituitary lobe reveals eight different PROP1 alterations with three novel mutations.

PubMed

Madeira, Joao Lo; Nishi, Mirian Y; Nakaguma, Marilena; Benedetti, Anna F; Biscotto, Isabela Peixoto; Fernandes, Thamiris; Pequeno, Thiago; Figueiredo, Thalita; Franca, Marcela M; Correa, Fernanda A; Otto, Aline P; Abrão, Milena; Miras, Mirta B; Santos, Silvana; Jorge, Alexander Al; Costalonga, Everlayny F; Mendonca, Berenice B; Arnhold, Ivo Jp; Carvalho, Luciani R

2017-12-01

Mutations in PROP1, HESX1 and LHX3 are associated with combined pituitary hormone deficiency (CPHD) and orthotopic posterior pituitary lobe (OPP). To identify mutations in PROP1, HESX1 and LHX3 in a large cohort of patients with CPHD and OPP (35 Brazilian, two Argentinian). We studied 23 index patients with CPHD and OPP (six familial and 17 sporadic) as well as 14 relatives. PROP1 was sequenced by the Sanger method in all except one sporadic case studied using a candidate gene panel. Multiplex ligation-dependent probe amplification (MLPA) was applied to one familial case in whom PROP1 failed to amplify by PCR. In the 13 patients without PROP1 mutations, HESX1 and LHX3 were sequenced by the Sanger method. We identified PROP1 mutations in 10 index cases. Three mutations were novel: one affecting the initiation codon (c.1A>G) and two affecting splicing sites, c.109+1G>A and c.342+1G>C. The known mutations, c.150delA (p.Arg53Aspfs*112), c.218G>A (p.Arg73His), c.263T>C (p.Phe88Ser) and c.301_302delAG (p.Leu102Cysfs*8), were also detected. MLPA confirmed complete PROP1 deletion in one family. We did not identify HESX1 and LHX3 mutations by Sanger. PROP1 mutations are a prevalent cause of congenital CPHD with OPP, and therefore, PROP1 sequencing must be the first step of molecular investigation in patients with CPHD and OPP, especially in populations with a high frequency of PROP1 mutations. In the absence of mutations, massively parallel sequencing is a promising approach. The high prevalence and diversity of PROP1 mutations is associated with the ethnic background of this cohort. © 2017 John Wiley & Sons Ltd.

Clinical features of Hispanic thyroid cancer cases and the role of known genetic variants on disease risk

PubMed Central

Estrada-Florez, Ana P.; Bohórquez, Mabel E.; Sahasrabudhe, Ruta; Prieto, Rodrigo; Lott, Paul; Duque, Carlos S.; Donado, Jorge; Mateus, Gilbert; Bolaños, Fernando; Vélez, Alejandro; Echeverry, Magdalena; Carvajal-Carmona, Luis G.

2016-01-01

Abstract Thyroid cancer (TC) is the second most common cancer among Hispanic women. Recent genome-wide association (GWA) and candidate studies identified 6 single nucleotide polymorphisms (SNPs; rs966423, rs2439302, rs965513, rs6983267, rs944289, and rs116909374), associated with increased TC risk in Europeans but their effects on disease risk have not been comprehensively tested in Hispanics. In this study, we aimed to describe the main clinicopathological manifestations and to evaluate the effects of known SNPs on TC risk and on clinicopathological manifestations in a Hispanic population. We analyzed 281 nonmedullary TC cases and 1146 cancer-free controls recruited in a multicenter population-based study in Colombia. SNPs were genotyped by Kompetitive allele specific polymerase chain reaction (KASP) technique. Association between genetic variants and TC risk was assessed by computing odds ratios (OR) and confidence intervals (CIs). Consistent with published data in U.S. Hispanics, our cases had a high prevalence of large tumors (>2 cm, 43%) and a high female/male ratio (5:1). We detected significant associations between TC risk and rs965513A (OR = 1.41), rs944289T (OR = 1.26), rs116909374A (OR = 1.96), rs2439302G (OR = 1.19), and rs6983267G (OR = 1.18). Cases carried more risk alleles than controls (5.16 vs. 4.78, P = 4.8 × 10−6). Individuals with ≥6 risk alleles had >6-fold increased TC risk (OR = 6.33, P = 4.0 × 10−6) compared to individuals with ≤2 risk alleles. rs944289T and rs116909374A were strongly associated with follicular histology (ORs = 1.61 and 3.33, respectively); rs2439302G with large tumors (OR = 1.50); and rs965513A with regional disease (OR = 1.92). To our knowledge, this is the first study of known TC risk variants in South American Hispanics and suggests that they increase TC susceptibility in this population and can identify patients at higher risk of severe disease. PMID:27512836

Clinical features of Hispanic thyroid cancer cases and the role of known genetic variants on disease risk.

PubMed

Estrada-Florez, Ana P; Bohórquez, Mabel E; Sahasrabudhe, Ruta; Prieto, Rodrigo; Lott, Paul; Duque, Carlos S; Donado, Jorge; Mateus, Gilbert; Bolaños, Fernando; Vélez, Alejandro; Echeverry, Magdalena; Carvajal-Carmona, Luis G

2016-08-01

Thyroid cancer (TC) is the second most common cancer among Hispanic women. Recent genome-wide association (GWA) and candidate studies identified 6 single nucleotide polymorphisms (SNPs; rs966423, rs2439302, rs965513, rs6983267, rs944289, and rs116909374), associated with increased TC risk in Europeans but their effects on disease risk have not been comprehensively tested in Hispanics. In this study, we aimed to describe the main clinicopathological manifestations and to evaluate the effects of known SNPs on TC risk and on clinicopathological manifestations in a Hispanic population.We analyzed 281 nonmedullary TC cases and 1146 cancer-free controls recruited in a multicenter population-based study in Colombia. SNPs were genotyped by Kompetitive allele specific polymerase chain reaction (KASP) technique. Association between genetic variants and TC risk was assessed by computing odds ratios (OR) and confidence intervals (CIs).Consistent with published data in U.S. Hispanics, our cases had a high prevalence of large tumors (>2 cm, 43%) and a high female/male ratio (5:1). We detected significant associations between TC risk and rs965513A (OR = 1.41), rs944289T (OR = 1.26), rs116909374A (OR = 1.96), rs2439302G (OR = 1.19), and rs6983267G (OR = 1.18). Cases carried more risk alleles than controls (5.16 vs. 4.78, P = 4.8 × 10). Individuals with ≥6 risk alleles had >6-fold increased TC risk (OR = 6.33, P = 4.0 × 10) compared to individuals with ≤2 risk alleles. rs944289T and rs116909374A were strongly associated with follicular histology (ORs = 1.61 and 3.33, respectively); rs2439302G with large tumors (OR = 1.50); and rs965513A with regional disease (OR = 1.92).To our knowledge, this is the first study of known TC risk variants in South American Hispanics and suggests that they increase TC susceptibility in this population and can identify patients at higher risk of severe disease.

Comparison of Tc-99m maraciclatide and Tc-99m sestamibi molecular breast imaging in patients with suspected breast cancer.

PubMed

O'Connor, Michael K; Morrow, Melissa M B; Hunt, Katie N; Boughey, Judy C; Wahner-Roedler, Dietlind L; Conners, Amy Lynn; Rhodes, Deborah J; Hruska, Carrie B

2017-12-01

Molecular breast imaging (MBI) performed with 99m Tc sestamibi has been shown to be a valuable technique for the detection of breast cancer. Alternative radiotracers such as 99m Tc maraciclatide may offer improved uptake in breast lesions. The purpose of this study was to compare relative performance of 99m Tc sestamibi and 99m Tc maraciclatide in patients with suspected breast cancer, using a high-resolution dedicated gamma camera for MBI. Women with breast lesions suspicious for malignancy were recruited to undergo two MBI examinations-one with 99m Tc sestamibi and one with 99m Tc maraciclatide. A radiologist interpreted MBI studies in a randomized, blinded fashion to assign an assessment score (1-5) and measured lesion size. Lesion-to-background (L/B) ratio was measured with region-of-interest analysis. Among 39 analyzable patients, 21 malignant tumors were identified in 21 patients. Eighteen of 21 tumors (86%) were seen on 99m Tc sestamibi MBI and 19 of 21 (90%) were seen on 99m Tc maraciclatide MBI (p = 1). Tumor extent measured with both radiopharmaceuticals correlated strongly with pathologic size ( 99m Tc sestamibi, r = 0.84; 99m Tc maraciclatide, r = 0.81). The L/B ratio in detected breast cancers was similar for the two radiopharmaceuticals: 1.55 ± 0.36 (mean ± S.D.) for 99m Tc sestamibi and 1.62 ± 0.37 (mean ± S.D.) for 99m Tc maraciclatide (p = 0.53). No correlation was found between the L/B ratio and molecular subtype for 99m Tc sestamibi (r s  = 0.12, p = 0.63) or 99m Tc maraciclatide (r s  = -0.12, p = 0.64). Of 20 benign lesions, 10 (50%) were seen on 99m Tc sestamibi and 9 of 20 (45%) were seen on 99m Tc maraciclatide images (p = 0.1). The average L/B ratio for benign lesions was 1.34 ±0.40 (mean ±S.D.) for 99m Tc sestamibi and 1.41 ±0.52 (mean ±S.D.) for 99m Tc maraciclatide (p = 0.75). Overall diagnostic performance was similar for both radiopharmaceuticals. AUC from ROC analysis was 0.83 for 99m Tc sestamibi and 0.87 for 99m Tc maraciclatide (p = 0.64). 99m Tc maraciclatide offered comparable lesion uptake to 99m Tc sestamibi, in both malignant and benign lesions. There was good correlation between lesion extent and uptake measured from both radiopharmaceuticals. 99m Tc maraciclatide offered a marginal (but not significant) improvement in sensitivity over 99m Tc sestamibi. Our findings did not support an association between the uptake of either radiopharmaceutical and tumor molecular subtype. ClinicalTrials.gov, NCT00888589.

NDP gene mutations in 14 French families with Norrie disease.

PubMed

Royer, Ghislaine; Hanein, Sylvain; Raclin, Valérie; Gigarel, Nadine; Rozet, Jean-Michel; Munnich, Arnold; Steffann, Julie; Dufier, Jean-Louis; Kaplan, Josseline; Bonnefont, Jean-Paul

2003-12-01

Norrie disease is a rare X-inked recessive condition characterized by congenital blindness and occasionally deafness and mental retardation in males. This disease has been ascribed to mutations in the NDP gene on chromosome Xp11.1. Previous investigations of the NDP gene have identified largely sixty disease-causing sequence variants. Here, we report on ten different NDP gene allelic variants in fourteen of a series of 21 families fulfilling inclusion criteria. Two alterations were intragenic deletions and eight were nucleotide substitutions or splicing variants, six of them being hitherto unreported, namely c.112C>T (p.Arg38Cys), c.129C>G (p.His43Gln), c.133G>A (p.Val45Met), c.268C>T (p.Arg90Cys), c.382T>C (p.Cys128Arg), c.23479-1G>C (unknown). No NDP gene sequence variant was found in seven of the 21 families. This observation raises the issue of misdiagnosis, phenocopies, or existence of other X-linked or autosomal genes, the mutations of which would mimic the Norrie disease phenotype. Copyright 2003 Wiley-Liss, Inc.

Gene analysis of steroid 5 alpha-reductase 1 in hyperandrogenic women.

PubMed

Eminović, Izet; Komel, Radovan; Prezelj, Janez; Karamehić, Jasenko; Gavrankapetanović, Faris; Heljić, Becir

2005-08-01

To examine the gene encoding for 5alpha-reductase type 1 in hyperandrogenic women, and assess the association of its eventual mutations or polymorphisms with the development of the hyperandrogenic female pattern. Sixteen hyperandrogenic women were included in the study. Single-stranded conformation polymorphism analysis (SSCP) and DNA sequencing were performed after polymerase chain reaction amplification of each of the 5 exons of the SRD5A1 gene in both hyperandrogenic and control group (16 participants). Sequence analysis identified the existence of many polymorphisms; in codon 24 of exon 1, GGC (Gly) into GAC (Asp); in codon 30 of exon 1, CGG (Arg) into CGC (Arg); in exon 3 codon 169, ACA to ACG (both encoding for threonine); in exon 5, AGA to AGG (both encoding for arginine, codon 260); and T/C polymorphism in intron 2. Polymorphisms were found in both groups. Polymorphisms of SRD5A1 gene were the same in both hyperandrogenic and healthy women, indicating no significant associations of genetic polymorphisms/variations of SRD5A1 gene with clinical manifestations of hyperandrogenic disorders in women.

Large telangiectatic focal nodular hyperplasia presenting with normal radionuclide studies: Case report

DOE Office of Scientific and Technical Information (OSTI.GOV)

Peterfy, C.G.; Rosenthall, L.

1990-12-01

A 9 cm-lesion of telangiectatic focal nodular hyperplasia was incidentally identified in a 31-yr-old female. Despite a typical appearance by X-ray computed tomography and ultrasonography, scintigraphy with technetium-99m-({sup 99m}Tc) colloid, {sup 99m}Tc-diethyliminodiacetic acid, and {sup 99m}Tc-labeled red cells failed to demonstrate any abnormalities. These findings are felt to reflect the relative lack of architectural disruption that histologically characterizes this particular lesion. The present report described the imaging characteristics of the telangiectatic form of focal nodular hyperplasia.

Transposon Invasion of the Paramecium Germline Genome Countered by a Domesticated PiggyBac Transposase and the NHEJ Pathway

PubMed Central

Dubois, Emeline; Bischerour, Julien; Marmignon, Antoine; Mathy, Nathalie; Régnier, Vinciane; Bétermier, Mireille

2012-01-01

Sequences related to transposons constitute a large fraction of extant genomes, but insertions within coding sequences have generally not been tolerated during evolution. Thanks to their unique nuclear dimorphism and to their original mechanism of programmed DNA elimination from their somatic nucleus (macronucleus), ciliates are emerging model organisms for the study of the impact of transposable elements on genomes. The germline genome of the ciliate Paramecium, located in its micronucleus, contains thousands of short intervening sequences, the IESs, which interrupt 47% of genes. Recent data provided support to the hypothesis that an evolutionary link exists between Paramecium IESs and Tc1/mariner transposons. During development of the macronucleus, IESs are excised precisely thanks to the coordinated action of PiggyMac, a domesticated piggyBac transposase, and of the NHEJ double-strand break repair pathway. A PiggyMac homolog is also required for developmentally programmed DNA elimination in another ciliate, Tetrahymena. Here, we present an overview of the life cycle of these unicellular eukaryotes and of the developmentally programmed genome rearrangements that take place at each sexual cycle. We discuss how ancient domestication of a piggyBac transposase might have allowed Tc1/mariner elements to spread throughout the germline genome of Paramecium, without strong counterselection against insertion within genes. PMID:22888464

Mesocarp localization of a bi-functional resveratrol/hydroxycinnamic acid glucosyltransferase of Concord grape (Vitis labrusca).

PubMed

Hall, Dawn; De Luca, Vincenzo

2007-02-01

Resveratrol is a stilbene with well-known health-promoting effects in humans that is produced constitutively or accumulates as a phytoalexin in several plant species including grape (Vitis sp.). Grape berries accumulate stilbenes in the exocarp as cis- and trans-isomers of resveratrol, together with their respective 3-O-monoglucosides. An enzyme glucosylating cis- and trans-resveratrol was purified to apparent homogeneity from Concord (Vitis labrusca) grape berries, and peptide sequencing associated it to an uncharacterized Vitis vinifera full-length clone (TC38971, tigr database). A corresponding gene from Vitis labrusca (VLRSgt) had 98% sequence identity to clone TC38971 and 92% sequence identity to a Vitis viniferap-hydroxybenzoic acid glucosyltransferase that produces glucose esters. The recombinant enzyme was active over a broad pH range (5.5-10), producing glucosides of stilbenes, flavonoids and coumarins at higher pH and glucose esters of several hydroxybenzoic and hydroxycinnamic acids at low pH. Vitis labrusca grape berries accumulated both stilbene glucosides and hydroxycinnamic acid glucose esters, consistent with the bi-functional role of VLRSgt in stilbene and hydroxycinnamic acid modification. While phylogenetic analysis of VLRSgt and other functionally characterized glucosyltransferases places it with other glucose ester-producing enzymes, the present results indicate broader biochemical activities for this class of enzymes.

The distinctive microbial community improves composting efficiency in a full-scale hyperthermophilic composting plant.

PubMed

Yu, Zhen; Tang, Jia; Liao, Hanpeng; Liu, Xiaoming; Zhou, Puxiong; Chen, Zhi; Rensing, Christopher; Zhou, Shungui

2018-06-07

The application of conventional thermophilic composting (TC) is limited by poor efficiency. Newly-developed hyperthermophilic composting (HTC) is expected to overcome this shortcoming. However, the characterization of microbial communities associated with HTC remains unclear. Here, we compared the performance of HTC and TC in a full-scale sludge composting plant, and found that HTC running at the hyperthermophilic and thermophilic phases for 21 days, led to higher composting efficiency and techno-economic advantages over TC. Results of high-throughput sequencing showed drastic changes in the microbial community during HTC. Thermaceae (35.5-41.7%) was the predominant family in the hyperthermophilic phase, while the thermophilic phase was dominated by both Thermaceae (28.0-53.3%) and Thermoactinomycetaceae (29.9-36.1%). The change of microbial community could be the cause of continuous high temperature in HTC, and thus improve composting efficiency by accelerating the maturation process. This work has provided theoretical and practical guidance for managing sewage sludge by HTC. Copyright © 2018 Elsevier Ltd. All rights reserved.

Insights into the failure of the potential, neutral myocardial imaging agent TcN-NOET: physicochemical identification of by-products and degradation species.

PubMed

Tisato, Francesco; Bolzati, Cristina; Refosco, Fiorenzo; Porchia, Marina; Seraglia, Roberta; Carta, Davide; Pasqualini, Roberto

2012-04-01

The neutral complex [(99m)Tc(N)(NOEt)(2)], often referred to as TcN-NOET [NOEt=N-ethoxy,N-ethyldithiocarbamate(1-)], was proposed several years ago as a myocardial imaging agent. Despite some favorable clinical properties evidenced during phase I and phase II studies, the overall results of the European and American phase III clinical studies have been judged insufficient for a successful approval process by the regulatory agencies. Non-carrier-added and carrier-added experiments using short-lived (99m)Tc and long-lived (99g)Tc have been utilized to prepare a series of bis-substituted [Tc(N)(DTC)(2)] complexes [DTC=dithiocarbamate(1-)]. They have been purified by means of chromatographic techniques (high-performance liquid chromatography and thin-layer chromatography) and identified via double detection (UV-vis and radiometry) by comparison with authenticated samples of (99g)Tc compounds prepared by conventional coordination chemistry procedures. The molecular structure of the lipophilic, neutral complex cis-[Tc(N)(NOEt)(2)] has been assigned by comparison with similar nitrido-Tc(V) complexes already reported in the literature. Novel bis-substituted nitrido-Tc complexes containing hydrolyzed portions of coordinated NOEt, namely, N-ethyldithiocarbamate [NHEt(1-)] and N-hydroxy, N-ethyldithiocarbamate [NOHEt(1-)], have been prepared and characterized by means of multinuclear nuclear magnetic resonance spectroscopy and mass spectrometry. Despite the identification of these "hydrolyzed" species, it is still unclear whether the failure to reach the clinical goal of the perfusion tracer [(99m)Tc(N)(NOEt)(2)] is related to the degradation processes evidenced in this study or is the result of the mediocre imaging properties of the tracer. Copyright © 2012 Elsevier Inc. All rights reserved.

Role of Yersinia pestis Toxin Complex Family Proteins in Resistance to Phagocytosis by Polymorphonuclear Leukocytes

PubMed Central

Carmody, Aaron B.; Jarrett, Clayton O.; Hinnebusch, B. Joseph

2013-01-01

Yersinia pestis carries homologues of the toxin complex (Tc) family proteins, which were first identified in other Gram-negative bacteria as having potent insecticidal activity. The Y. pestis Tc proteins are neither toxic to fleas nor essential for survival of the bacterium in the flea, even though tc gene expression is highly upregulated and much more of the Tc proteins YitA and YipA are produced in the flea than when Y. pestis is grown in vitro. We show that Tc+ and Tc− Y. pestis strains are transmitted equivalently from coinfected fleas, further demonstrating that the Tc proteins have no discernible role, either positive or negative, in transmission by the flea vector. Tc proteins did, however, confer Y. pestis with increased resistance to killing by polymorphonuclear leukocytes (PMNs). Resistance to killing was not the result of decreased PMN viability or increased intracellular survival but instead correlated with a Tc protein-dependent resistance to phagocytosis that was independent of the type III secretion system (T3SS). Correspondingly, we did not detect T3SS-dependent secretion of the native Tc proteins YitA and YipA or the translocation of YitA– or YipA–β-lactamase fusion proteins into CHO-K1 (CHO) cells or human PMNs. Thus, although highly produced by Y. pestis within the flea and related to insecticidal toxins, the Tc proteins do not affect interaction with the flea or transmission. Rather, the Y. pestis Tc proteins inhibit phagocytosis by mouse PMNs, independent of the T3SS, and may be important for subverting the mammalian innate immune response immediately following transmission from the flea. PMID:23959716

Dysregulation of NRXN1 by mutant MIR8485 leads to calcium overload in pre-synapses inducing neurodegeneration in Multiple sclerosis.

PubMed

Kattimani, Yogita; Veerappa, Avinash M

2018-04-09

To identify Damaging mutations in microRNAs (miRNAs) and 3' untranslated regions (UTRs) of target genes to establish Multiple sclerosis (MS) disease pathway. Female aged 16, with Relapsing Remitting Multiple sclerosis (RRMS) was reported with initial symptoms of blurred vision, severe immobility, upper and lower limb numbness and backache. Whole Exome Sequencing (WES) and disease pathway analysis was performed to identify mutations in miRNAs and UTRs. We identified Deleterious/Damaging multibase mutations in MIR8485 and NRXN1. miR-8485 was found carrying frameshift homozygous deletion of bases CA, while NRXN1 was found carrying nonframeshift homozygous substitution of bases CT to TC in exon 8 replacing Serine with Leucine. Mutations in miR-8485 and NRXN1 was found to alter calcium homeostasis and NRXN1/NLGN1 cell adhesion molecule binding affinities. The miR-8485 mutation leads to overexpression of NRXN1 altering pre-synaptic Ca 2+ homeostasis, inducing neurodegeneration. Copyright © 2018 Elsevier B.V. All rights reserved.

Development of a Luminex Bead Based Assay for Diagnosis of Toxocariasis Using Recombinant Antigens Tc-CTL-1 and Tc-TES-26.

PubMed

Anderson, John P; Rascoe, Lisa N; Levert, Keith; Chastain, Holly M; Reed, Matthew S; Rivera, Hilda N; McAuliffe, Isabel; Zhan, Bin; Wiegand, Ryan E; Hotez, Peter J; Wilkins, Patricia P; Pohl, Jan; Handali, Sukwan

2015-01-01

The clinical spectrum of human disease caused by the roundworms Toxocara canis and Toxocara cati ranges from visceral and ocular larva migrans to covert toxocariasis. The parasite is not typically recovered in affected tissues, so detection of parasite-specific antibodies is usually necessary for establishing a diagnosis. The most reliable immunodiagnostic methods use the Toxocara excretory-secretory antigens (TES-Ag) in ELISA formats to detect Toxocara-specific antibodies. To eliminate the need for native parasite materials, we identified and purified immunodiagnostic antigens using 2D gel electrophoresis followed by electrospray ionization mass spectrometry. Three predominant immunoreactive proteins were found in the TES; all three had been previously described in the literature: Tc-CTL-1, Tc-TES-26, and Tc-MUC-3. We generated Escherichia coli expressed recombinant proteins for evaluation in Luminex based immunoassays. We were unable to produce a functional assay with the Tc-MUC-3 recombinant protein. Tc-CTL-1 and Tc-TES-26 were successfully coupled and tested using defined serum batteries. The use of both proteins together generated better results than if the proteins were used individually. The sensitivity and specificity of the assay for detecting visceral larval migrans using Tc-CTL-1 plus Tc-TES-26 was 99% and 94%, respectively; the sensitivity for detecting ocular larval migrans was 64%. The combined performance of the new assay was superior to the currently available EIA and could potentially be employed to replace current assays that rely on native TES-Ag.

Mammary lymphoscintigraphy with various radiopharmaceuticals in breast cancer.

PubMed

Imoto, S; Murakami, K; Ikeda, H; Fukukita, H; Moriyama, N

1999-10-01

Sentinel node biopsy (SNB) in breast cancer is a promising surgical technique that avoids unnecessary axillary lymph node dissection. To optimize lymphatic mapping with radiopharmaceuticals, mammary lymphoscintigraphy with 30-50 MBq of technetium-99m-diethylenetriamine pentaacetic acid human serum albumin (99mTc-HSAD), technetium-99m-human serum albumin (99mTc-HSA), or technetium-99m-tin colloid (99mTc-TC) were investigated in 69 cases of primary breast cancer. Dynamic early images were obtained during the first 30 or 40 minutes, and static delayed images were obtained 6 hours after tracer injection. Hot spots as sentinel lymph nodes (SLNs) appeared in 51 of 69 cases (74%): in early images in 27 cases and in delayed images in 24 cases. SLNs were visualized more frequently in 23 of the 26 cases (88%) treated with 99mTc-HSAD and in 21 of the 24 cases (88%) treated with 99mTc-HSA than in only 7 of the 19 cases (37%) treated with 99mTc-TC. In 26 of the 51 cases, SLNs were identified as faint spots in delayed images. There was a significant difference in the first appearance of SLNs on the lymphoscintiscan between 43 cases of dense breast parenchyma and 26 cases of fatty breast parenchyma. These results suggest that 99mTc-HSAD or 99mTc-HSA is acceptable for lymphatic mapping, but in cases which have faint spots in delayed images or fatty breast parenchyma, gamma probe-guided SNB may result in failure or misleading false-negative SLNs.

Development of a Luminex Bead Based Assay for Diagnosis of Toxocariasis Using Recombinant Antigens Tc-CTL-1 and Tc-TES-26

PubMed Central

Anderson, John P.; Rascoe, Lisa N.; Levert, Keith; Chastain, Holly M.; Reed, Matthew S.; Rivera, Hilda N.; McAuliffe, Isabel; Zhan, Bin; Wiegand, Ryan E.; Hotez, Peter J.; Wilkins, Patricia P.; Pohl, Jan; Handali, Sukwan

2015-01-01

The clinical spectrum of human disease caused by the roundworms Toxocara canis and Toxocara cati ranges from visceral and ocular larva migrans to covert toxocariasis. The parasite is not typically recovered in affected tissues, so detection of parasite-specific antibodies is usually necessary for establishing a diagnosis. The most reliable immunodiagnostic methods use the Toxocara excretory-secretory antigens (TES-Ag) in ELISA formats to detect Toxocara-specific antibodies. To eliminate the need for native parasite materials, we identified and purified immunodiagnostic antigens using 2D gel electrophoresis followed by electrospray ionization mass spectrometry. Three predominant immunoreactive proteins were found in the TES; all three had been previously described in the literature: Tc-CTL-1, Tc-TES-26, and Tc-MUC-3. We generated Escherichia coli expressed recombinant proteins for evaluation in Luminex based immunoassays. We were unable to produce a functional assay with the Tc-MUC-3 recombinant protein. Tc-CTL-1 and Tc-TES-26 were successfully coupled and tested using defined serum batteries. The use of both proteins together generated better results than if the proteins were used individually. The sensitivity and specificity of the assay for detecting visceral larval migrans using Tc-CTL-1 plus Tc-TES-26 was 99% and 94%, respectively; the sensitivity for detecting ocular larval migrans was 64%. The combined performance of the new assay was superior to the currently available EIA and could potentially be employed to replace current assays that rely on native TES-Ag. PMID:26485145

Nuclear medicine imaging of locally advanced laryngeal and hypopharyngeal cancer

NASA Astrophysics Data System (ADS)

Medvedeva, A.; Chernov, V.; Zeltchan, R.; Sinilkin, I.; Bragina, O.; Chijevskaya, S.; Choynzonov, E.; Goldberg, A.

2017-09-01

The diagnostic capabilities of nuclear medicine imaging in the detection and assessment of the spread of laryngeal/hypopharyngeal cancer were studied. A total of 40 patients with histologically verified laryngeal and hypopharyngeal cancer and 20 patients with benign laryngeal lesions were included into the study. Submucosal injections of 99mTc-MIBI and 99mTc-Alotech were made around the tumor. Single photon emission computed tomography (SPECT) was performed 20 minutes after the injection of 99mTc-MIBI. Sentinel lymph nodes (SLNs) were detected in 26 patients. In 18 hours after the injection of 99mTc-Alotech, SPECT was performed. In 24 hours after the injection of 99mTc-Alotech, intraoperative SLN detection was performed using Gamma Finder II. SPECT with 99mTc-MIBI revealed laryngeal and hypopharyngeal tumors in 38 of the 40 patients. The 99mTc-MIBI uptake in metastatic lymph nodes was visualized in 2 (17%) of the 12 patients. Twenty eight SLNs were detected by SPECT and 31 SLNs were identified using the intraoperative gamma probe. The percentage of 99mTc-Alotech in the SLN was 5-10% of the radioactivity in the injection site by SPECT and 18-33% by intraoperative gamma probe detection. Thus, SPECT with 99mTc-MIBI is an effective tool for the diagnosis of laryngeal/hypopharyngeal cancer. The sensitivity, specificity and accuracy of this technique were 95%, 80% and 92%, respectively. The use of 99mTc-Alotech for the detection of SLNs in patients with laryngeal/hypopharyngeal cancer is characterized by 92.8% sensitivity.

Unique presentation of LHON/MELAS overlap syndrome caused by m.13046T>C in MTND5.

PubMed

Kolarova, Hana; Liskova, Petra; Tesarova, Marketa; Kucerova Vidrova, Vendula; Forgac, Martin; Zamecnik, Josef; Hansikova, Hana; Honzik, Tomas

2016-12-01

Leber hereditary optic neuropathy (LHON) and mitochondrial encephalopathy, myopathy, lactic acidosis and stroke-like episodes (MELAS) syndromes are mitochondrially inherited disorders characterized by acute visual failure and variable multiorgan system presentation, respectively. A 12-year-old girl with otherwise unremarkable medical history presented with abrupt, painless loss of vision. Over the next few months, she developed moderate sensorineural hearing loss, vertigo, migraines, anhedonia and thyroiditis. Ocular examination confirmed bilateral optic nerve atrophy. Metabolic workup documented elevated cerebrospinal fluid lactate. Initial genetic analyses excluded the three most common LHON mutations. Subsequently, Sanger sequencing of the entire mitochondrial DNA (mtDNA) genome was performed. Whole mtDNA sequencing revealed a pathogenic heteroplasmic mutation m.13046T>C in MTND5 encoding the ND5 subunit of complex I. This particular variant has previously been described in a single case report of MELAS/Leigh syndrome (subacute necrotizing encephalopathy). Based on the constellation of clinical symptoms in our patient, we diagnose the condition as LHON/MELAS overlap syndrome. We describe a unique presentation of LHON/MELAS overlap syndrome resulting from a m.13046T>C mutation in a 12-year-old girl. In patients with sudden vision loss in which three of the most prevalent LHON mitochondrial mutations have been ruled out, molecular genetic examination should be extended to other mtDNA-encoded subunits of MTND5 complex I. Furthermore, atypical clinical presentations must be considered, even in well-described phenotypes.

Diversity of culturable psychrophilic and psychrotrophic anaerobic bacteria isolated from beef abattoirs and their environments.

PubMed

Moschonas, G; Bolton, D J; McDowell, D A; Sheridan, J J

2011-07-01

This study identified 431 psychrophilic or psychrotrophic isolates from commercial Irish beef abattoir environments and "blown packs" of vacuum-packed beef, using PCR and 16S rRNA sequencing, and estimated their intraspecies genetic diversity using restriction fragment length polymorphism (RFLP) analysis and spacer region PCR (SR-PCR). Twenty-five species were identified in the 431 isolates, with the most frequently recovered species being Clostridium gasigenes (n=315), Clostridium estertheticum (n=17), and a potentially novel species designated strain TC1 (n=52). These species were previously found to be associated with a particular type of spoilage known as blown-pack spoilage (BPS), which occurs in chilled-stored (i.e., -1.5°C to 4°C) vacuum-packaged meat within 2 to 4 weeks and involves the production of large volumes of gas. Overall, the study demonstrates the considerable and not previously reported diversity of the anaerobic microflora in abattoirs and the presence of a wide range of organisms capable of causing BPS at chilled temperatures.

Differences in Brain Transcriptomes of Closely Related Baikal Coregonid Species

PubMed Central

Bychenko, Oksana S.; Sukhanova, Lyubov V.; Azhikina, Tatyana L.; Skvortsov, Timofey A.; Belomestnykh, Tuyana V.; Sverdlov, Eugene D.

2014-01-01

The aim of this work was to get deeper insight into genetic factors involved in the adaptive divergence of closely related species, specifically two representatives of Baikal coregonids—Baikal whitefish (Coregonus baicalensis Dybowski) and Baikal omul (Coregonus migratorius Georgi)—that diverged from a common ancestor as recently as 10–20 thousand years ago. Using the Serial Analysis of Gene Expression method, we obtained libraries of short representative cDNA sequences (tags) from the brains of Baikal whitefish and omul. A comparative analysis of the libraries revealed quantitative differences among ~4% tags of the fishes under study. Based on the similarity of these tags with cDNA of known organisms, we identified candidate genes taking part in adaptive divergence. The most important candidate genes related to the adaptation of Baikal whitefish and Baikal omul, identified in this work, belong to the genes of cell metabolism, nervous and immune systems, protein synthesis, and regulatory genes as well as to DTSsa4 Tc1-like transposons which are widespread among fishes. PMID:24719892

Self-assembling HA/PEI/dsRNA-p21 ternary complexes for CD44 mediated small active RNA delivery to colorectal cancer.

PubMed

Feng, Chen-Lin; Han, Yan-Xing; Guo, Hui-Hui; Ma, Xiao-Lei; Wang, Zhi-Qiang; Wang, Lu-Lu; Zheng, Wen-Sheng; Jiang, Jian-Dong

2017-11-01

Our previous work proved that sequence specific double strand RNA (dsRNA-p21) effectively activated p21 gene expression of colorectal cancer (CRC) cells and consequently suppressed CRC growth. However, efficient delivery system is a significant challenge to achieve sufficient therapy. In this study, a self-assembled HA/PEI/dsRNA-p21 ternary complex (TC-dsRNA-p21) was developed for the tumor-target delivery of dsRNA-p21 into CRC cells. Hyaluronic acid (HA) was introduced to shield the PEI/dsRNA-p21 binary complexes (BC-dsRNA-p21) for reducing the cytotoxicity of PEI and for increasing the tumor-targeted intracellular uptake by cancer cells through HA-CD44 mediated endocytosis. Comparing to the BC-dsRNA-p21, the TC-dsRNA-p21 showed increase in size, decrease in zeta potential, low cytotoxicity as well as high stability in physiological conditions due to the anionic shielding. Confocal microscopy analysis and flow cytometry confirmed that TC-dsRNA-p21 had high transfection efficiency in the CD44-abundant Lovo cells, as compared with binary complex. In vitro physiological experiment showed that, comparing to the control group, the TC-dsRNA-p21 effectively activated the expression of p21 mRNA and P21 protein, causing blockage of cell cycle at G 0 /G 1 phase and suppression of cancer cell proliferation as well as colony formation. Furthermore, in vivo distribution experiment demonstrated that the TC-dsRNA-p21 could effectively accumulate at rectal wall for up to 10 h, following in situ application. These findings indicated that TC-dsRNA-p21 might hold great potential for delivering dsRNA-p21 to treat CRC.

Low-fidelity Venezuelan equine encephalitis virus polymerase mutants to improve live-attenuated vaccine safety and efficacy

PubMed Central

Kautz, Tiffany F; Guerbois, Mathilde; Khanipov, Kamil; Yun, Ruimei; Warmbrod, Kelsey L; Fofanov, Yuriy; Weaver, Scott C; Forrester, Naomi L

2018-01-01

Abstract During RNA virus replication, there is the potential to incorporate mutations that affect virulence or pathogenesis. For live-attenuated vaccines, this has implications for stability, as replication may result in mutations that either restore the wild-type phenotype via reversion or compensate for the attenuating mutations by increasing virulence (pseudoreversion). Recent studies have demonstrated that altering the mutation rate of an RNA virus is an effective attenuation tool. To validate the safety of low-fidelity mutations to increase vaccine attenuation, several mutations in the RNA-dependent RNA-polymerase (RdRp) were tested in the live-attenuated Venezuelan equine encephalitis virus vaccine strain, TC-83. Next generation sequencing after passage in the presence of mutagens revealed a mutant containing three mutations in the RdRp, TC-83 3x, to have decreased replication fidelity, while a second mutant, TC-83 4x displayed no change in fidelity, but shared many phenotypic characteristics with TC-83 3x. Both mutants exhibited increased, albeit inconsistent attenuation in an infant mouse model, as well as increased immunogenicity and complete protection against lethal challenge of an adult murine model compared with the parent TC-83. During serial passaging in a highly permissive model, the mutants increased in virulence but remained less virulent than the parent TC-83. These results suggest that the incorporation of low-fidelity mutations into the RdRp of live-attenuated vaccines for RNA viruses can confer increased immunogenicity whilst showing some evidence of increased attenuation. However, while in theory such constructs may result in more effective vaccines, the instability of the vaccine phenotype decreases the likelihood of this being an effective vaccine strategy. PMID:29593882

Biokinetics and dosimetry in patients of 99mTc-EDDA/HYNIC-Tyr3-octreotide prepared from lyophilized kits.

PubMed

González-Vázquez, Armando; Ferro-Flores, Guillermina; Arteaga de Murphy, Consuelo; Gutiérrez-García, Zohar

2006-07-01

99mTc-EDDA/HYNIC-Tyr3-octreotide (99mTc-HYNIC-TOC) has shown high in vitro and in vivo stability, rapid background clearance and rapid detection of somatostatin receptor-positive tumors. The aim of this study was to establish a biokinetic model for 99mTc-HYNIC-TOC prepared from lyophilized kits, and to evaluate its dosimetry as a tumor imaging agent in patients with histologically confirmed neuroendocrine tumors. Whole-body images from eight patients were acquired at 5, 60, 90, 180 min and 24 h after 99mTc-HYNIC-TOC administration obtained from instant freeze-dried kit formulations with radiochemical purities >95%. Regions of interest (ROIs) were drawn around source organs on each time frame. The same set of ROIs was used for all eight scans and the count per minute (cpm) of each ROI was converted to activity using the conjugate view counting method. The image sequence was used to extrapolate 99mTc-HYNIC-TOC time-activity curves in each organ, to adjust a biokinetic model using the SAAM software, and to calculate the total number of disintegrations (N) that occurred in the source regions. N data were the input for the OLINDA/EXM code to calculate internal radiation dose estimates. Images showed an average tumor/blood (heart) ratio of 4.3+/-0.7 in receptor-positive tumors at 1 h. The mean radiation absorbed dose calculated for a study using 740 MBq was 24, 21.5, 5.5 and 1.0 mSv for spleen, kidneys, liver and bone marrow respectively and the effective dose was 4.4 mSv.

Zirconium-Based Metal–Organic Framework for Removal of Perrhenate from Water

DOE Office of Scientific and Technical Information (OSTI.GOV)

Banerjee, Debasis; Xu, Wenqian; Nie, Zimin

2016-09-06

Efficient removal of pertechnetate (TcO4-) anions from liquid waste or melter off-gas solution for alternative treatment is one of the promising options to manage 99Tc in legacy nuclear waste. Safe immobilization of 99Tc is of major importance due to its long half-life (t1/2= 2.13 × 105 yrs) and environmental mobility. Different types of inorganic and solid state ion-exchange materials such as layered double hydroxides have been shown to absorb TcO4- anions from water. However, both high capacity and selectivity have yet to be achieved in a single material. Herein, we show that a protonated version of an ultra-stable zirconium basedmore » metal-organic framework can adsorb perrhenate (ReO4-) anions, a non-radioactive sur-rogate for TcO4-, from water even in the presence of other common anions. Synchrotron based powder X-ray diffraction and molecular simulations were used to identify the position of the adsorbed ReO4- (surrogate for TcO4-) molecule within the framework.« less

Spiking in auditory cortex following thalamic stimulation is dominated by cortical network activity

PubMed Central

Krause, Bryan M.; Raz, Aeyal; Uhlrich, Daniel J.; Smith, Philip H.; Banks, Matthew I.

2014-01-01

The state of the sensory cortical network can have a profound impact on neural responses and perception. In rodent auditory cortex, sensory responses are reported to occur in the context of network events, similar to brief UP states, that produce “packets” of spikes and are associated with synchronized synaptic input (Bathellier et al., 2012; Hromadka et al., 2013; Luczak et al., 2013). However, traditional models based on data from visual and somatosensory cortex predict that ascending sensory thalamocortical (TC) pathways sequentially activate cells in layers 4 (L4), L2/3, and L5. The relationship between these two spatio-temporal activity patterns is unclear. Here, we used calcium imaging and electrophysiological recordings in murine auditory TC brain slices to investigate the laminar response pattern to stimulation of TC afferents. We show that although monosynaptically driven spiking in response to TC afferents occurs, the vast majority of spikes fired following TC stimulation occurs during brief UP states and outside the context of the L4>L2/3>L5 activation sequence. Specifically, monosynaptic subthreshold TC responses with similar latencies were observed throughout layers 2–6, presumably via synapses onto dendritic processes located in L3 and L4. However, monosynaptic spiking was rare, and occurred primarily in L4 and L5 non-pyramidal cells. By contrast, during brief, TC-induced UP states, spiking was dense and occurred primarily in pyramidal cells. These network events always involved infragranular layers, whereas involvement of supragranular layers was variable. During UP states, spike latencies were comparable between infragranular and supragranular cells. These data are consistent with a model in which activation of auditory cortex, especially supragranular layers, depends on internally generated network events that represent a non-linear amplification process, are initiated by infragranular cells and tightly regulated by feed-forward inhibitory cells. PMID:25285071

Whole Genomic Analysis of Human G12P[6] and G12P[8] Rotavirus Strains that Have Emerged in Myanmar

PubMed Central

Ide, Tomihiko; Komoto, Satoshi; Higo-Moriguchi, Kyoko; Htun, Khaing Win; Myint, Yi Yi; Myat, Theingi Win; Thant, Kyaw Zin; Thu, Hlaing Myat; Win, Mo Mo; Oo, Htun Naing; Htut, Than; Wakuda, Mitsutaka; Dennis, Francis Ekow; Haga, Kei; Fujii, Yoshiki; Katayama, Kazuhiko; Rahman, Shofiqur; Nguyen, Sa Van; Umeda, Kouji; Oguma, Keiji; Tsuji, Takao; Taniguchi, Koki

2015-01-01

G12 rotaviruses are emerging rotavirus strains causing severe diarrhea in infants and young children worldwide. However, the whole genomes of only a few G12 strains have been fully sequenced and analyzed. In this study, we sequenced and characterized the complete genomes of six G12 strains (RVA/Human-tc/MMR/A14/2011/G12P[8], RVA/Human-tc/MMR/A23/2011/G12P[6], RVA/Human-tc/MMR/A25/2011/G12P[8], RVA/Human-tc/MMR/P02/2011/G12P[8], RVA/Human-tc/MMR/P39/2011/G12P[8], and RVA/Human-tc/MMR/P43/2011/G12P[8]) detected in six stool samples from children with acute gastroenteritis in Myanmar. On whole genomic analysis, all six Myanmarese G12 strains were found to have a Wa-like genetic backbone: G12-P[8]-I1-R1-C1-M1-A1-N1-T1-E1-H1 for strains A14, A25, P02, P39, and P43, and G12-P[6]-I1-R1-C1-M1-A1-N1-T1-E1-H1 for strain A23. Phylogenetic analysis showed that most genes of the six strains examined in this study were genetically related to globally circulating human G1, G3, G9, and G12 strains. Of note is that the NSP4 gene of strain A23 exhibited the closest relationship with the cognate genes of human-like bovine strains as well as human strains, suggesting the occurrence of reassortment between human and bovine strains. Furthermore, strains A14, A25, P02, P39, and P43 were very closely related to one another in all the 11 gene segments, indicating derivation of the five strains from a common origin. On the other hand, strain A23 consistently formed distinct clusters as to all the 11 gene segments, indicating a distinct origin of strain A23 from that of strains A14, A25, P02, P39, and P43. To our knowledge, this is the first report on whole genome-based characterization of G12 strains that have emerged in Myanmar. Our observations will provide important insights into the evolutionary dynamics of spreading G12 rotaviruses in Asia. PMID:25938434

A Sensitive Method for Detecting Peptide-specific CD4+ T Cell Responses in Peripheral Blood from Patients with Myasthenia Gravis

PubMed Central

Sharma, Sapna; Malmeström, Clas; Lindberg, Christopher; Meisel, Sarah; Schön, Karin; Verolin, Martina; Lycke, Nils Yngve

2017-01-01

Myasthenia gravis (MG) is an autoimmune neurological disorder typified by skeletal muscle fatigue and most often production of autoantibodies against the nicotinic acetylcholine receptor (AChR). The present study was undertaken to assess the extent of AChR-peptide recognition in MG patients using co-culturing (DC:TC) of autologous monocyte-derived dendritic cells (moDCs) and highly enriched CD4+ T cells from the blood as compared to the traditional whole peripheral blood mononuclear cell (PBMC) cultures. We found that the DC:TC cultures were highly superior to the PBMC cultures for detection of reactivity toward HLA-DQ/DR-restricted AChR-peptides. In fact, whereas DC:TC cultures identified recognition in all MG patients the PBMC cultures failed to detect responsiveness in around 40% of the patients. Furthermore, reactivity to multiple peptides was evident in DC:TC cultures, while PBMC cultures mostly exhibited reactivity to a single peptide. No healthy control (HC) CD4+ T cells responded to the peptides in either culture system. Interestingly, whereas spontaneous production of IFNγ and IL-17 was observed in the DC:TC cultures from MG patients, recall responses to peptides enhanced IL-10 production in 9/13 MG patients, while little increase in IFNγ and IL-17 was seen. HCs did not produce cytokines to peptide stimulations. We conclude that the DC: TC culture system is significantly more sensitive and better identifies the extent of responsiveness in MG patients to AChR-peptides than traditional PBMC cultures. PMID:29114250

A Sensitive Method for Detecting Peptide-specific CD4+ T Cell Responses in Peripheral Blood from Patients with Myasthenia Gravis.

PubMed

Sharma, Sapna; Malmeström, Clas; Lindberg, Christopher; Meisel, Sarah; Schön, Karin; Verolin, Martina; Lycke, Nils Yngve

2017-01-01

Myasthenia gravis (MG) is an autoimmune neurological disorder typified by skeletal muscle fatigue and most often production of autoantibodies against the nicotinic acetylcholine receptor (AChR). The present study was undertaken to assess the extent of AChR-peptide recognition in MG patients using co-culturing (DC:TC) of autologous monocyte-derived dendritic cells (moDCs) and highly enriched CD4 + T cells from the blood as compared to the traditional whole peripheral blood mononuclear cell (PBMC) cultures. We found that the DC:TC cultures were highly superior to the PBMC cultures for detection of reactivity toward HLA-DQ/DR-restricted AChR-peptides. In fact, whereas DC:TC cultures identified recognition in all MG patients the PBMC cultures failed to detect responsiveness in around 40% of the patients. Furthermore, reactivity to multiple peptides was evident in DC:TC cultures, while PBMC cultures mostly exhibited reactivity to a single peptide. No healthy control (HC) CD4 + T cells responded to the peptides in either culture system. Interestingly, whereas spontaneous production of IFNγ and IL-17 was observed in the DC:TC cultures from MG patients, recall responses to peptides enhanced IL-10 production in 9/13 MG patients, while little increase in IFNγ and IL-17 was seen. HCs did not produce cytokines to peptide stimulations. We conclude that the DC: TC culture system is significantly more sensitive and better identifies the extent of responsiveness in MG patients to AChR-peptides than traditional PBMC cultures.

Tropical cyclone influence on the long-term variability of Philippine summer monsoon onset

NASA Astrophysics Data System (ADS)

Kubota, Hisayuki; Shirooka, Ryuichi; Matsumoto, Jun; Cayanan, Esperanza O.; Hilario, Flaviana D.

2017-12-01

The long-term variability of Philippine summer monsoon onset from 1903 to 2013 was investigated. The onset date is defined by daily rainfall data at eight stations in the northwestern Philippines. Summer monsoons tended to start earlier in May after the mid-1990s. Other early onset periods were found during the 1900s, 1920s, and 1930s, and an interdecadal variability of summer monsoon onset was identified. Independent surface wind data observed by ships in the South China Sea (SCS) revealed prevailing westerly wind in May during the early monsoon onset period. To identify atmospheric structures that trigger Philippine summer monsoon onset, we focused on the year 2013, conducting intensive upper-air observations. Tropical cyclone (TC) Yagi traveled northward in the Philippine Sea (PS) in 2013 and triggered the Philippine monsoon onset by intensifying moist low-level southwesterly wind in the southwestern Philippines and intensifying low-level southerly wind after the monsoon onset in the northwestern Philippines. The influence of TC was analyzed by the probability of the existence of TC in the PS and the SCS since 1951, which was found to be significantly correlated with the Philippine summer monsoon onset date. After the mid-1990s, early monsoon onset was influenced by active TC formation in the PS and the SCS. However, the role of TC activity decreased during the late summer monsoon periods. In general, it was found that TC activity in the PS and the SCS plays a key role in initiating Philippine summer monsoon onset. [Figure not available: see fulltext.

Trypanosoma cruzi TcSMUG L-surface mucins promote development and infectivity in the triatomine vector Rhodnius prolixus.

PubMed

Gonzalez, Marcelo S; Souza, Marcela S; Garcia, Eloi S; Nogueira, Nadir F S; Mello, Cícero B; Cánepa, Gaspar E; Bertotti, Santiago; Durante, Ignacio M; Azambuja, Patrícia; Buscaglia, Carlos A

2013-11-01

TcSMUG L products were recently identified as novel mucin-type glycoconjugates restricted to the surface of insect-dwelling epimastigote forms of Trypanosoma cruzi, the etiological agent of Chagas disease. The remarkable conservation of their predicted mature N-terminal region, which is exposed to the extracellular milieu, suggests that TcSMUG L products may be involved in structural and/or functional aspects of the interaction with the insect vector. Here, we investigated the putative roles of TcSMUG L mucins in both in vivo development and ex vivo attachment of epimastigotes to the luminal surface of the digestive tract of Rhodnius prolixus. Our results indicate that the exogenous addition of TcSMUG L N-terminal peptide, but not control T. cruzi mucin peptides, to the infected bloodmeal inhibited the development of parasites in R. prolixus in a dose-dependent manner. Pre-incubation of insect midguts with the TcSMUG L peptide impaired the ex vivo attachment of epimastigotes to the luminal surface epithelium, likely by competing out TcSMUG L binding sites on the luminal surface of the posterior midgut, as revealed by fluorescence microscopy. Together, these observations indicate that TcSMUG L mucins are a determinant of both adhesion of T. cruzi epimastigotes to the posterior midgut epithelial cells of the triatomine, and the infection of the insect vector, R. prolixus.

Formaldehyde metabolism by Escherichia coli. Carbon and solvent deuterium incorporation into glycerol, 1,2-propanediol, and 1,3-propanediol

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hunter, B.K.; Nicholls, K.M.; Sanders, J.K.

1985-07-16

Escherichia coli were grown on 14.3% uniformly TC-labeled glucose as the sole carbon source and challenged anaerobically with 90% TC-labeled formaldehyde. The major multiply labeled metabolites were identified by TC NMR spectroscopy to be glycerol and 1,2-propanediol, and a minor metabolite was shown to be 1,3-propanediol. In each case, formaldehyde is incorporated only into the C1 position. A novel form of TC NMR isotope dilution analysis of the major products reveals that all the 1,2-diol C1 is formaldehyde derived but that about 40% of the glycerol C1 is derived from bacterial sources. Glycerokinase converted the metabolite (1- TC)glycerol to equalmore » amounts of (3- TC)glycerol 3-phosphate and (1- TC)glycerol 3-phosphate, demonstrating that the metabolite is racemic. When ( TC)formaldehyde incubation was carried out in H2O/D2O mixtures, deuterium incorporation was detected by beta- and gamma-isotope shifts. The 1,3-diol is deuterium labeled only at C2 and only once, while the 1,2-diol and glycerol are each labeled independently at both C2 and C3; C3 is multiply labeled. Deuterium incorporation levels are different for each metabolite, indicating that the biosynthetic pathways probably diverge early.« less

Analysis of whole exome sequencing with cardiometabolic traits using family-based linkage and association in the IRAS Family Study

PubMed Central

Tabb, Keri L.; Hellwege, Jacklyn N.; Palmer, Nicholette D.; Dimitrov, Latchezar; Sajuthi, Satria; Taylor, Kent D.; NG, Maggie C.Y.; Hawkins, Gregory A.; Chen, Yii-Der Ida; Brown, W. Mark; McWilliams, David; Williams, Adrienne; Lorenzo, Carlos; Norris, Jill M.; Long, Jirong; Rotter, Jerome I.; Curran, Joanne E.; Blangero, John; Wagenknecht, Lynne E.; Langefeld, Carl D.; Bowden, Donald W.

2017-01-01

Summary Family-based methods are a potentially powerful tool to identify trait-defining genetic variants in extended families, particularly when used to complement conventional association analysis. We utilized two-point linkage analysis and single variant association analysis to evaluate whole exome sequencing (WES) data from 1,205 Hispanic Americans (78 families) from the Insulin Resistance Atherosclerosis Family Study. WES identified 211,612 variants above the minor allele frequency threshold of ≥0.005. These variants were tested for linkage and/or association with 50 cardiometabolic traits after quality control checks. Two-point linkage analysis yielded 10,580,600 LOD scores with 1,148 LOD scores ≥3, 183 LOD scores ≥4, and 29 LOD scores ≥5. The maximal novel LOD score was 5.50 for rs2289043:T>C, in UNC5C with subcutaneous adipose tissue volume. Association analysis identified 13 variants attaining genome-wide significance (p<5×10-08), with the strongest association between rs651821:C>T in APOA5, and triglyceride levels (p=3.67×10-10). Overall, there was a 5.2-fold increase in the number of informative variants detected by WES compared to exome chip analysis in this population, nearly 30% of which were novel variants relative to dbSNP build 138. Thus, integration of results from two-point linkage and single-variant association analysis from WES data enabled identification of novel signals potentially contributing to cardiometabolic traits. PMID:28067407

Oxidative dissolution potential of biogenic and abiogenic TcO 2 in subsurface sediments

NASA Astrophysics Data System (ADS)

Fredrickson, James K.; Zachara, John M.; Plymale, Andrew E.; Heald, Steve M.; McKinley, James P.; Kennedy, David W.; Liu, Chongxuan; Nachimuthu, Ponnusamy

2009-04-01

Technetium-99 (Tc) is an important fission product contaminant associated with sites of nuclear fuels reprocessing and geologic nuclear waste disposal. Tc is highly mobile in its most oxidized state [Tc(VII)O4-] and less mobile in the reduced form [Tc(IV)O 2· nH 2O]. Here we investigate the potential for oxidation of Tc(IV) that was heterogeneously reduced by reaction with biogenic Fe(II) in two sediments differing in mineralogy and aggregation state; unconsolidated Pliocene-age fluvial sediment from the upper Ringold (RG) Formation at the Hanford Site and a clay-rich saprolite from the Field Research Center (FRC) background site on the Oak Ridge Site. Both sediments contained Fe(III) and Mn(III/IV) as redox active phases, but FRC also contained mass-dominant Fe-phyllosilicates of different types. Shewanella putrefaciens CN32 reduced Mn(III/IV) oxides and generated Fe(II) that was reactive with Tc(VII) in heat-killed, bioreduced sediment. After bioreduction and heat-killing, biogenic Fe(II) in the FRC exceeded that in RG by a factor of two. More rapid reduction rates were observed in the RG that had lower biogenic Fe(II), and less particle aggregation. EXAFS measurements indicated that the primary reduction product was a TcO 2-like phase in both sediments. The biogenic redox product Tc(IV) oxidized rapidly and completely in RG when contacted with air. Oxidation, in contrast, was slow and incomplete in the FRC, in spite of similar molecular scale speciation of Tc compared to RG. X-ray microprobe, electron microprobe, X-ray absorption spectroscopy, and micro X-ray diffraction were applied to the whole sediment and isolated Tc-containing particles. These analyses revealed that non-oxidizable Tc(IV) in the FRC existed as complexes with octahedral Fe(III) within intra-grain domains of 50-100 μm-sized, Fe-containing micas presumptively identified as celadonite. The markedly slower oxidation rates in FRC as compared to RG were attributed to mass-transfer-limited migration of O 2 into intra-aggregate and intraparticle domains where Tc(IV) existed; and the formation of unique, oxidation-resistant, intragrain Tc(IV)-Fe(III) molecular species.

Knowledge displays: Soliciting clients to fill knowledge gaps and to reconcile knowledge discrepancies in therapeutic interaction.

PubMed

Pino, Marco

2016-06-01

To examine knowledge displays (KDs), a practice by which Therapeutic Community (TC) professionals exhibit previous knowledge about their clients' circumstances and experiences. Conversation analysis is used to examine 12 staff-led meetings recorded in Italy (8 in a drug addiction TC; 4 in a mental health TC). The TC professionals use KDs within broader sequences of talk where they solicit their clients to share personal information and where the clients provide insufficient or inconsistent responses. In these circumstances, the staff members employ KDs to pursue responses that redress emerging knowledge gaps and discrepancies regarding the clients' experiences or circumstances. KDs allow the staff members to achieve a balance between respecting their clients' right to report their own experiences and influencing the ways in which they report them. KDs help to reinforce the culture of openness that is central to many forms of therapeutic interaction, to forward the therapeutic agenda and to expand the staff members' knowledge of the clients' experiences and circumstances. KDs can be used to solicit clients to share personal information. This paper illustrates core features that underlie the function of KDs (where they are used and how they are constructed). Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

Bayesian Modeling of Temporal Coherence in Videos for Entity Discovery and Summarization.

PubMed

Mitra, Adway; Biswas, Soma; Bhattacharyya, Chiranjib

2017-03-01

A video is understood by users in terms of entities present in it. Entity Discovery is the task of building appearance model for each entity (e.g., a person), and finding all its occurrences in the video. We represent a video as a sequence of tracklets, each spanning 10-20 frames, and associated with one entity. We pose Entity Discovery as tracklet clustering, and approach it by leveraging Temporal Coherence (TC): the property that temporally neighboring tracklets are likely to be associated with the same entity. Our major contributions are the first Bayesian nonparametric models for TC at tracklet-level. We extend Chinese Restaurant Process (CRP) to TC-CRP, and further to Temporally Coherent Chinese Restaurant Franchise (TC-CRF) to jointly model entities and temporal segments using mixture components and sparse distributions. For discovering persons in TV serial videos without meta-data like scripts, these methods show considerable improvement over state-of-the-art approaches to tracklet clustering in terms of clustering accuracy, cluster purity and entity coverage. The proposed methods can perform online tracklet clustering on streaming videos unlike existing approaches, and can automatically reject false tracklets. Finally we discuss entity-driven video summarization- where temporal segments of the video are selected based on the discovered entities, to create a semantically meaningful summary.

Structure optimisation by thermal cycling for the hydrophobic-polar lattice model of protein folding

NASA Astrophysics Data System (ADS)

Günther, Florian; Möbius, Arnulf; Schreiber, Michael

2017-03-01

The function of a protein depends strongly on its spatial structure. Therefore the transition from an unfolded stage to the functional fold is one of the most important problems in computational molecular biology. Since the corresponding free energy landscapes exhibit huge numbers of local minima, the search for the lowest-energy configurations is very demanding. Because of that, efficient heuristic algorithms are of high value. In the present work, we investigate whether and how the thermal cycling (TC) approach can be applied to the hydrophobic-polar (HP) lattice model of protein folding. Evaluating the efficiency of TC for a set of two- and three-dimensional examples, we compare the performance of this strategy with that of multi-start local search (MSLS) procedures and that of simulated annealing (SA). For this aim, we incorporated several simple but rather efficient modifications into the standard procedures: in particular, a strong improvement was achieved by also allowing energy conserving state modifications. Furthermore, the consideration of ensembles instead of single samples was found to greatly improve the efficiency of TC. In the framework of different benchmarks, for all considered HP sequences, we found TC to be far superior to SA, and to be faster than Wang-Landau sampling.

Differential Lung Uptake of 99mTc-HMPAO and 99mTc-Duramycin in the Chronic Hyperoxia Rat Model

PubMed Central

Clough, Anne V.; Audi, Said H.; Haworth, Steven T.; Roerig, David L.

2015-01-01

Noninvasive radionuclide imaging has the potential to identify and assess mechanisms involved in particular stages of lung injury which occur with acute respiratory distress syndrome, for example. Lung uptake of 99mTc-hexamethylpropyleneamine oxime (HMPAO) is reported to be partially dependent on the redox status of the lung tissue while 99mTc-duramycin, a new marker of cell injury, senses cell death via apoptosis and/or necrosis. Thus, we investigated changes in lung uptake of these agents in rat exposed to hyperoxia for prolonged periods, a common model of acute lung injury. Methods Male Sprague-Dawley rats were pre-exposed to either normoxia (21% O2) or hyperoxia (85% O2) for up to 21 days. For imaging, the rats were anesthetized, injected i.v. with either 99mTc-HMPAO or 99mTc-duramycin (37-74 MBq) and planar images were acquired using a high sensitivity modular gamma camera. Subsequently, 99mTc-macroagreggated albumin (37 MBq, diam=10-40 μm) was injected i.v., imaged, and used to define a lung region-of-interest. The lung to background ratio was used as a measure of lung uptake. Results Hyperoxia exposure resulted in a 74% increase in 99mTc-HMPAO lung uptake, which peaked at 7 days and persisted for the 21 days of exposure. 99mTc-duramycin lung uptake was also maximal at 7 days of exposure but decreased to near control levels by 21 days. The sustained elevation of 99mTc-HMPAO uptake suggests ongoing changes in lung redox status whereas cell death appears to have subsided by 21 days. Conclusion These results suggest the potential use of 99mTc-HMPAO and 99mTc-duramycin as redox and cell-death imaging biomarkers, respectively, for in vivo identification and assessment of different stages of lung injury. PMID:23086010

Discrete typing units of Trypanosoma cruzi detected by real-time PCR in Chilean patients with chronic Chagas cardiomyopathy.

PubMed

Muñoz-San Martín, Catalina; Zulantay, Inés; Saavedra, Miguel; Fuentealba, Cristián; Muñoz, Gabriela; Apt, Werner

2018-05-07

Chagas disease is a major public health problem in Latin America and has spread to other countries due to immigration of infected persons. 10-30% of patients with chronic Chagas disease will develop cardiomyopathy. Chagas cardiomyopathy is the worst form of the disease, due to its high morbidity and mortality. Because of its prognostic value and adequate medical monitoring, it is very important to identify infected people who could develop Chagas cardiomyopathy. The aim of this study was to determine if discrete typing units (DTUs) of Trypanosoma cruzi are related to the presence of heart disease in patients with chronic Chagas disease. A total of 86 untreated patients, 41 with cardiomyopathy and 45 without heart involvement were submitted to clinical study. Electrocardiograms and echocardiograms were performed on the group of cardiopaths, in which all important known causes of cardiomyopathy were discarded. Sinus bradycardia and prolonged QTc interval were the most frequent electrocardiographic alterations and patients were classified in group I (46%) and group II (54%) of New York Hearth Association. In all cases real-time PCR genotyping assays were performed. In the group with cardiomyopathy, the most frequent DTU was TcI (56.1%), followed by TcII (19.5%). Mixed infections TcI + TcII were observed in 7.3% of the patients. In the group without cardiac pathologies, TcI and TcII were found at similar rates (28.9 and 31.1%, respectively) and mixed infections TcI + TcII in 17.8% of the cases. TcIII and TcIV were not detected in any sample. Taken together, our data indicate that chronic Chagas cardiomyopathy in Chile can be caused by strains belonging to TcI and TcII. Copyright © 2018 Elsevier B.V. All rights reserved.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hashimoto, Muneaki, E-mail: muneaki@juntendo.ac.jp; Nara, Takeshi, E-mail: tnara@juntendo.ac.jp; Enomoto, Masahiro, E-mail: menomoto@uhnres.utoronto.ca

Inositol 1,4,5-trisphosphate receptor (IP{sub 3}R) is a key regulator of intracellular Ca{sup 2+} concentration that release Ca{sup 2+} from Ca{sup 2+} stores in response to various external stimuli. IP{sub 3}R also works as a signal hub which form a platform for interacting with various proteins involved in diverse cell signaling. Previously, we have identified an IP{sub 3}R homolog in the parasitic protist, Trypanosoma cruzi (TcIP{sub 3}R). Parasites expressing reduced or increased levels of TcIP{sub 3}R displayed defects in growth, transformation, and infectivity. In the present study, we established parasitic strains expressing a dominant negative form of TcIP{sub 3}R, named DN-TcIP{submore » 3}R, to further investigate the physiological role(s) of TcIP{sub 3}R. We found that the growth of epimastigotes expressing DN-TcIP{sub 3}R was significantly slower than that of parasites with TcIP{sub 3}R expression levels that were approximately 65% of wild-type levels. The expression of DN-TcIP{sub 3}R in epimastigotes induced metacyclogenesis even in the normal growth medium. Furthermore, these epimastigotes showed the presence of dense mitochondria under a transmission electron microscope. Our findings confirm that TcIP{sub 3}R is crucial for epimastigote growth, as previously reported. They also suggest that a strong inhibition of the IP{sub 3}R-mediated signaling induces metacyclogenesis and that mitochondrial integrity is closely associated with this signaling. - Highlights: • We established T. cruzi strains expressing a dominant negative form of the TcIP{sub 3}R. • DN-TcIP{sub 3}R expression inhibits epimastigote growth and induces metacyclogenesis. • Microscopic analysis indicated TcIP{sub 3}R role in maintaining mitochondrial integrity. • Growth, but not microbial density, was altered by mammalian IP{sub 3}R inhibitor (2-APB).« less

Relationship between toxicities and clinical benefits of newly approved tyrosine kinase inhibitors in thyroid cancer: A meta-analysis of literature.

PubMed

Ye, Xiaobing; Zhu, Yiping; Cai, Juan

2015-10-01

The aim of this meta-analysis was to analyze the relationship of toxicities and clinical benefits of newly approved lenvatinib and sorafenib to thyroid cancer (TC) in patients. Three major medical databases, PubMed, EMBASE, and ISI web of science were systematically searched to identify all studies on lenvatinib and sorafenib in TC. A meta-analysis was performed to clarify the toxicities and clinical benefits of newly Food and Drug Administration (FDA) approved lenvatinib and sorafenib to thyroid cancer. Ten studies (n = 749) were included which evaluated the toxicities and clinical benefits of newly FDA approved lenvatinib and sorafenib to thyroid cancer. 537 (71.7%) of the 749 patients bearing TC (radioiodine-refractory, differentiated thyroid cancer) clinical benefits from lenvatinib or sorafenib, and serious adverse events occurred in 430 (57.4%) of the 749 patients ([risk ratio (RR) = 1.27, 95% confidence interval (CI) = (1.05-1.53), P = 0.01]). While 31 (4.1%) of the 749 patients died due to various reasons, that mainly accounts for severe bleeding events and cardiac arrest. The clinical benefit is obvious compared to deaths ([RR = 17.06, 95% CI = (12.08-24.11), P < 0.001]). Subgroup analyses were then conducted according to cancer type (radioiodine-refractory thyroid cancer [RR-TC] and TC). We found that in treating RR-TC, the clinical benefits are close to toxicities. While in treating TC, the clinical benefits are better than toxicities. And we found that sorafenib and lenvatinib might be proper to deal with TC (benefits rate 79.7%) compared to RR-TC (benefits rate 69.5%), taking consider of toxicities. Lenvatinib and sorafenib are useful in the treatment of TC. Although, their toxicities remain high (57.4%) in the patients, the death rate is controlled (4.1%). Take consider of toxicities, lenvatinib, and sorafenib are more useful for TC compared to RR-TC.

99Tc and Re incorporated into metal oxide polyoxometalates: oxidation state stability elucidated by electrochemistry and theory.

PubMed

McGregor, Donna; Burton-Pye, Benjamin P; Mbomekalle, Israel M; Aparicio, Pablo A; Romo, Susanna; López, Xavier; Poblet, Josep M; Francesconi, Lynn C

2012-08-20

The radioactive element technetium-99 ((99)Tc, half-life = 2.1 × 10(5) years, β(-) of 253 keV), is a major byproduct of (235)U fission in the nuclear fuel cycle. (99)Tc is also found in radioactive waste tanks and in the environment at National Lab sites and fuel reprocessing centers. Separation and storage of the long-lived (99)Tc in an appropriate and stable waste-form is an important issue that needs to be addressed. Considering metal oxide solid-state materials as potential storage matrixes for Tc, we are examining the redox speciation of Tc on the molecular level using polyoxometalates (POMs) as models. In this study we investigate the electrochemistry of Tc complexes of the monovacant Wells-Dawson isomers, α(1)-P(2)W(17)O(61)(10-) (α1) and α(2)-P(2)W(17)O(61)(10-) (α2) to identify features of metal oxide materials that can stabilize the immobile Tc(IV) oxidation state accessed from the synthesized Tc(V)O species and to interrogate other possible oxidation states available to Tc within these materials. The experimental results are consistent with density functional theory (DFT) calculations. Electrochemistry of K(7-n)H(n)[Tc(V)O(α(1)-P(2)W(17)O(61))] (Tc(V)O-α1), K(7-n)H(n)[Tc(V)O(α(2)-P(2)W(17)O(61))] (Tc(V)O-α2) and their rhenium analogues as a function of pH show that the Tc-containing derivatives are always more readily reduced than their Re analogues. Both Tc and Re are reduced more readily in the lacunary α1 site as compared to the α2 site. The DFT calculations elucidate that the highest oxidation state attainable for Re is VII while, under the same electrochemistry conditions, the highest oxidation state for Tc is VI. The M(V)→ M(IV) reduction processes for Tc(V)O-α1 are not pH dependent or only slightly pH dependent suggesting that protonation does not accompany reduction of this species unlike the M(V)O-α2 (M = (99)Tc, Re) and Re(V)O-α1 where M(V/IV) reduction process must occur hand in hand with protonation of the terminal M═O to make the π*(M═O) orbitals accessible to the addition of electrons. This result is consistent with previous extended X-ray absorption fine structure (EXAFS) and X-ray absorption near edge structure (XANES) data that reveal that the Tc(V) is "pulled" into the -α1 framework and that may facilitate the reduction of Tc(V)O-α1 and stabilize lower Tc oxidation states. This study highlights the inequivalency of the two sites, and their impact on the chemical properties of the Tc substituted in these positions.

A Key Role for Old Yellow Enzyme in the Metabolism of Drugs by Trypanosoma cruzi

PubMed Central

Kubata, Bruno Kilunga; Kabututu, Zakayi; Nozaki, Tomoyoshi; Munday, Craig J.; Fukuzumi, Shunichi; Ohkubo, Kei; Lazarus, Michael; Maruyama, Toshihiko; Martin, Samuel K.; Duszenko, Michael; Urade, Yoshihiro

2002-01-01

Trypanosoma cruzi is the etiological agent of Chagas' disease. So far, first choice anti-chagasic drugs in use have been shown to have undesirable side effects in addition to the emergence of parasite resistance and the lack of prospect for vaccine against T. cruzi infection. Thus, the isolation and characterization of molecules essential in parasite metabolism of the anti-chagasic drugs are fundamental for the development of new strategies for rational drug design and/or the improvement of the current chemotherapy. While searching for a prostaglandin (PG) F2α synthase homologue, we have identified a novel “old yellow enzyme” from T. cruzi (TcOYE), cloned its cDNA, and overexpressed the recombinant enzyme. Here, we show that TcOYE reduced 9,11-endoperoxide PGH2 to PGF2α as well as a variety of trypanocidal drugs. By electron spin resonance experiments, we found that TcOYE specifically catalyzed one-electron reduction of menadione and β-lapachone to semiquinone-free radicals with concomitant generation of superoxide radical anions, while catalyzing solely the two-electron reduction of nifurtimox and 4-nitroquinoline-N-oxide drugs without free radical production. Interestingly, immunoprecipitation experiments revealed that anti-TcOYE polyclonal antibody abolished major reductase activities of the lysates toward these drugs, identifying TcOYE as a key drug-metabolizing enzyme by which quinone drugs have their mechanism of action. PMID:12417633

Detection of Deforestation and Land Conversion in Rondonia, Brazil Using Change Detection Techniques

NASA Technical Reports Server (NTRS)

Guild, Liane S.; Cohen, Warren B,; Kauffman, J. Boone; Peterson, David L. (Technical Monitor)

2001-01-01

Fires associated with tropical deforestation, land conversion, and land use greatly contribute to emissions as well as the depletion of carbon and nutrient pools. The objective of this research was to compare change detection techniques for identifying deforestation and cattle pasture formation during a period of early colonization and agricultural expansion in the vicinity of Jamari, Rond6nia. Multi-date Landsat Thematic Mapper (TM) data between 1984 and 1992 was examined in a 94 370-ha area of active deforestation to map land cover change. The Tasseled Cap (TC) transformation was used to enhance the contrast between forest, cleared areas, and regrowth. TC images were stacked into a composite multi-date TC and used in a principal components (PC) transformation to identify change components. In addition, consecutive TC image pairs were differenced and stacked into a composite multi-date differenced image. A maximum likelihood classification of each image composite was compared for identification of land cover change. The multi-date TC composite classification had the best accuracy of 78.1% (kappa). By 1984, only 5% of the study area had been cleared, but by 1992, 11% of the area had been deforested, primarily for pasture and 7% lost due to hydroelectric dam flooding. Finally, discrimination of pasture versus cultivation was improved due to the ability to detect land under sustained clearing opened to land exhibiting regrowth with infrequent clearing.

The last Viking King: a royal maternity case solved by ancient DNA analysis.

PubMed

Dissing, Jørgen; Binladen, Jonas; Hansen, Anders; Sejrsen, Birgitte; Willerslev, Eske; Lynnerup, Niels

2007-02-14

The last of the Danish Viking Kings, Sven Estridsen, died in a.d. 1074 and is entombed in Roskilde Cathedral with other Danish kings and queens. Sven's mother, Estrid, is entombed in a pillar across the chancel. However, while there is no reasonable doubt about the identity of Sven, there have been doubts among historians whether the woman entombed was indeed Estrid. To shed light on this problem, we have extracted and analysed mitochondrial DNA (mtDNA) from pulp of teeth from each of the two royals. Four overlapping DNA-fragments covering about 400bp of hypervariable region 1 (HVR-1) of the D-loop were PCR amplified, cloned and a number of clones with each segment were sequenced. Also a segment containing the H/non-H specific nucleotide 7028 was sequenced. Consensus sequences were determined and D-loop results were replicated in an independent laboratory. This allowed the assignment of King Sven Estridsen to haplogroup H; Estrid's sequence differed from that of Sven at two positions in HVR-1, 16093T-->C and 16304T-->C, indicating that she belongs to subgroup H5a. Given the maternal inheritance of mtDNA, offspring will have the same mtDNA sequence as their mother with the exception of rare cases where the sequence has been altered by a germ line mutation. Therefore, the observation of two sequence differences makes it highly unlikely that the entombed woman was the mother of Sven. In addition, physical examination of the skeleton and the teeth strongly indicated that this woman was much younger (approximately 35 years) at the time of death than the 70 years history records tell. Although the entombed woman cannot be the Estrid, she may well be one of Sven's two daughters-in-law who were also called Estrid and who both became queens.

99mTc-HYNIC-TOC imaging in the evaluation of pancreatic masses which are potential neuroendocrine tumors.

PubMed

Qiao, Zhen; Zhang, Jingjing; Jin, Xiaona; Huo, Li; Zhu, Zhaohui; Xing, Haiqun; Li, Fang

2015-05-01

The aim of this investigation was to determine the accuracy of the findings and the diagnoses of Tc-hydrazinonicotinyl-Tyr3-octreotide scan (Tc-HYNIC-TOC imaging) in patients with pancreatic masses which were potential neuroendocrine tumors. Records of total 20 patients with pancreatic masses were retrospectively reviewed. All of the patients had been revealed by abdominal contrast CT and possibility of neuroendocrine tumors could not be excluded by CT imaging before Tc-HYNIC-TOC imaging. Tc-HYNIC-TOC imaging was performed at 1 and 4 hours post-tracer injection, and SPECT/CT images of the abdomen were also acquired. The image findings were compared to final diagnoses which were made from pathological examination. Among all 20 pancreatic masses evaluated, there were 16 malignant lesions which included 1 ductal adenocarcinoma and 15 neuroendocrine tumors. Tc-HYNIC-TOC imaging identified 14 of 15 pancreatic neuroendocrine tumors and excluded 4 of 5 lesions which were not neuroendocrine tumors. The overall sensitivity, specificity, and accuracy was therefore 93.3% (14 of 15), 80% (4 of 5), and 90.0% (18 of 20), respectively, in our patient population. Tc-HYNIC-TOC imaging provides reasonable accuracy in the evaluation pancreatic mass suspected to be neuroendocrine tumors.

Criteria predictive of limb viability at 1 year in patients with chronic severe ischemia--TcPO2 and demographic parameters.

PubMed

Chomard, D; Habault, P; Eveno, D; Le Lamer, S; Ledemeney, M; Haon, C

2000-09-01

Following an earlier study, the investigators sought to identify and define objective prognostic criteria of viability at 1 year of a limb with severe chronic ischemia. A study was undertaken in 116 patients (118 limbs) (74 men and 42 women), with a mean age of 71.9 years for men and 81.6 years for women. Static transcutaneous oxygen pressure (TcPO2) was measured with a verticalization sensitization test and inhalation of oxygen on JO and viability of the limb noted 1 year later. Logistic analysis was made of 13 oximetry parameters and two demographic parameters (age and gender). Results were analyzed in absolute terms and by tissue oxygenation ratio (TOR) (ratio between absolute TcPO2 at the foot and at a chest reference electrode). Six factors appeared to be prognostic factors of limb viability at 1 year, statistically significant at 6% according to threshold values: age, verticalization TcPO2, TcPO2 after 1 minute's inhalation of oxygen, TcPO2 after 4 minutes' inhalation of oxygen, and slope of TcPO2 and slope of TOR between 1 and 4 minutes' inhalation. A 1 year viability index integrating these criteria is suggested.

TcPho91 is a contractile vacuole phosphate sodium symporter that regulates phosphate and polyphosphate metabolism in Trypanosoma cruzi

PubMed Central

Jimenez, Veronica; Docampo, Roberto

2015-01-01

Summary We have identified a phosphate transporter (TcPho91) localized to the bladder of the contractile vacuole complex (CVC) of Trypanosoma cruzi, the etiologic agent of Chagas disease. TcPho91 has 12 transmembrane domains, an N-terminal regulatory SPX domain and an anion permease domain. Functional expression in Xenopus laevis oocytes followed by two-electrode voltage clamp showed that TcPho91 is a low affinity transporter with a Km for Pi in the millimolar range, and sodium-dependency. Epimastigotes overexpressing TcPho91-GFP have significantly higher levels of pyrophosphate (PPi) and short chain polyphosphate (polyP), suggesting accumulation of Pi in these cells. Moreover, when overexpressing parasites were maintained in a medium with low Pi, they grew at higher rates than control parasites. Only one allele of TcPho91 in the CL strain encodes for the complete open reading frame, while the other one is truncated encoding for only the N-terminal domain. Taking advantage of this characteristic, knockdown experiments were performed resulting in cells with reduced growth rate as well as a reduction in PPi and short-chain polyP levels. Our results indicate that TcPho91 is a phosphate sodium symporter involved in Pi homeostasis in T. cruzi. PMID:26031800

The differentiation and plasticity of Tc17 cells are regulated by CTLA-4-mediated effects on STATs.

PubMed

Arra, Aditya; Lingel, Holger; Kuropka, Benno; Pick, Jonas; Schnoeder, Tina; Fischer, Thomas; Freund, Christian; Pierau, Mandy; Brunner-Weinzierl, Monika C

2017-01-01

As the blockade of inhibitory surface-molecules such as CTLA-4 on T cells has led to recent advances in antitumor immune therapy, there is great interest in identifying novel mechanisms of action of CD8 + T cells to evoke effective cytotoxic antitumor responses. Using in vitro and in vivo models, we investigated the molecular pathways underlying the CTLA-4-mediated differentiation of IL-17-producing CD8 + T cells (Tc17 cells) that strongly impairs cytotoxicity. Our studies demonstrate that Tc17 cells lacking CTLA-4 signaling have limited production of STAT3-target gene products such as IL-17, IL-21, IL-23R and RORγt. Upon re-stimulation with IL-12, these cells display fast downregulation of Tc17 hallmarks and acquire Tc1 characteristics such as IFNγ and TNF-α co-expression, which is known to correlate with tumor control. Indeed, upon adoptive transfer, these cells were highly efficient in the antigen-specific rejection of established OVA-expressing B16 melanoma in vivo . Mechanistically, in primary and re-stimulated Tc17 cells, STAT3 binding to the IL-17 promoter was strongly augmented by CTLA-4, associated with less binding of STAT5 and reduced relative activation of STAT1 which is known to block STAT3 activity. Inhibiting CTLA-4-induced STAT3 activity reverses enhancement of signature Tc17 gene products, rendering Tc17 cells susceptible to conversion to Tc1-like cells with enhanced cytotoxic potential. Thus, CTLA-4 critically shapes the characteristics of Tc17 cells by regulating relative STAT3 activation, which provides new perspectives to enhance cytotoxicity of antitumor responses.

Overexpression of LncRNA HOTAIR is Associated with Poor Prognosis in Thyroid Carcinoma: A Study Based on TCGA and GEO Data.

PubMed

Li, Hong-Mei; Yang, Hong; Wen, Dong-Yue; Luo, Yi-Huan; Liang, Chun-Yan; Pan, Deng-Hua; Ma, Wei; Chen, Gang; He, Yun; Chen, Jun-Qiang

2017-05-01

The role of long non-coding RNA (lncRNA) HOX transcript antisense RNA (HOTAIR) in thyroid carcinoma (TC) remains unclear. The current study was aimed to assess the clinical value of HOTAIR expression levels in TC based on publically available data and to evaluate its potential signaling pathways. The expression data of HOTAIR and clinical information concerning TC were downloaded from The Cancer Genome Atlas (TCGA) and Gene Expression Omnibus (GEO), respectively. Furthermore, 3 online biological databases, Starbase, Cbioportal, and Multi Experiment Matrix, were used to identify HOTAIR-related genes in TC. Gene Ontology (GO), Kyoto Encyclopedia of Genes and Genomes (KEGG), and Panther pathway analyses were then undertaken to study the most enriched signaling pathways in TC (EASE score<0.1, Bonferroni<0.05). The TCGA results demonstrated that the expression level of HOTAIR in TC tissues was significantly increased compared with non-cancerous tissues (p<0.001). HOTAIR over-expression was significantly associated with poor survival in TC patients (p=0.03). Meta-analyses of GEO datasets revealed a trend consistent with the above results on HOTAIR expression levels in TC (SMD=0.23; 95%CI, 0.00-0.45; p=0.047). Finally, the results of functional analysis for HOTAIR-related genes indicated that HOTAIR might participate in tumorigenesis via the Wnt signaling pathway. In conclusion, our study demonstrates that HOTAIR may be involved in thyroid carcinogenesis, and the over-expression of HOTAIR could act as a biomarker associated with a poor outcome in TC patients. Moreover, the Wnt signaling pathway may be the key pathway regulated by HOTAIR in TC. © Georg Thieme Verlag KG Stuttgart · New York.

Mutations in the novel gene FOPV are associated with familial autosomal dominant and non-familial obliterative portal venopathy.

PubMed

Besmond, Claude; Valla, Dominique; Hubert, Laurence; Poirier, Karine; Grosse, Brigitte; Guettier, Catherine; Bernard, Olivier; Gonzales, Emmanuel; Jacquemin, Emmanuel

2018-02-01

Obliterative portal venopathy (OPV) is characterized by lesions of portal vein intrahepatic branches and is thought to be responsible for many cases of portal hypertension in the absence of cirrhosis or obstruction of large portal or hepatic veins. In most cases the cause of OPV remains unknown. The aim was to identify a candidate gene of OPV. Whole exome sequencing was performed in two families, including 6 patients with OPV. Identified mutations were confirmed by Sanger sequencing and expression of candidate gene transcript was studied by real time qPCR in human tissues. In both families, no mutations were identified in genes previously reported to be associated with OPV. In each family, we identified a heterozygous mutation (c.1783G>A, p.Gly595Arg and c.4895C>T, p.Thr1632Ile) in a novel gene located on chromosome 4, that we called FOPV (Familial Obliterative Portal Venopathy), and having a cDNA coding for 1793 amino acids. The FOPV mutations segregated with the disease in families and the pattern of inheritance was suggestive of autosomal dominant inherited OPV, with incomplete penetrance and variable expressivity. In silico analysis predicted a deleterious effect of each mutant and mutations concerned highly conserved amino acids in mammals. A deleterious heterozygous FOPV missense mutation (c.4244T>C, p.Phe1415Ser) was also identified in a patient with non-familial OPV. Expression study in liver veins showed that FOPV transcript was mainly expressed in intrahepatic portal vein. This report suggests that FOPV mutations may have a pathogenic role in some cases of familial and non-familial OPV. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

HBV genotypes and drug resistance mutations in antiretroviral treatment-naive and treatment-experienced HBV-HIV-coinfected patients.

PubMed

Archampong, Timothy Na; Boyce, Ceejay L; Lartey, Margaret; Sagoe, Kwamena W; Obo-Akwa, Adjoa; Kenu, Ernest; Blackard, Jason T; Kwara, Awewura

2017-01-01

The presence of HBV resistance mutations upon initiation or during antiretroviral therapy (ART) in HIV-coinfected patients is an important determinant of treatment response. The main objective of the study was to determine the prevalence of HBV resistance mutations in antiretroviral treatment-naive and treatment-experienced HBV-HIV-coinfected Ghanaian patients with detectable HBV viraemia. HBV-HIV-coinfected patients who were ART-naive or had received at least 9 months of lamivudine (3TC)-containing ART were enrolled in a cross-sectional study. Demographic and clinical data were collected and HBV DNA quantified. Partial HBV sequences were amplified by PCR and sequenced bi-directionally to obtain a 2.1-2.2 kb fragment for phylogenetic analysis of HBV genotypes and evaluation of drug resistance mutations. Of the 100 HBV-HIV-coinfected study patients, 75 were successfully PCR-amplified, and 63 were successfully sequenced. Of these 63 patients, 27 (42.9%) were ART-experienced and 58 (92.1%) had HBV genotype E. No resistance mutations were observed in the 36 ART-naive patients, while 21 (77.8%) of 27 treatment-experienced patients had resistance mutations. All patients with resistance mutations had no tenofovir in their regimens, and 80% of them had HIV RNA <40 copies/ml. The 3TC resistance mutations rtL180M and rtM204V were observed in 10 (47.6%) of the 21 patients, while 5 patients (23.8%) had rtV173L, rtL180M and rtM204V mutations. A high proportion of HBV-HIV-coinfected patients with detectable viraemia on 3TC-containing ART had resistance mutations despite good ART adherence as determined by HIV RNA suppression. This study emphasizes the need for dual therapy as part of a fully suppressive ART in all HBV-HIV-coinfected patients in Ghana.

Transcutaneous bilirubin levels in newborns <35 weeks' gestation.

PubMed

Maisels, M J; Coffey, M P; Kring, E

2015-09-01

In infants <35 weeks' gestation, we sought to define the transcutaneous bilirubin (TcB) levels at which a total serum bilirubin (TSB) level suggesting the need for phototherapy is unlikely to occur and a TSB measurement can, therefore, be avoided. Nursing staff performed 896 TcB measurements within 1 h of a TSB on 225 neonates 26 0/7-34 6/7 weeks' postmenstrual age (PMA). Generalized linear models were fit with generalized estimating equations (GEEs) to model the probability of having a TSB level at or above the phototherapy initiation cutpoint as a function of the TcB; these methods allow for multiple tests per infant. The mean difference between TcB and TSB measurements was <1 mg dl(-1) for each PMA category. When the TcB was at least 3 mg dl(-1) below the TSB cutpoint for phototherapy, there was a ⩾98% probability that the TSB was not at, or above, the recommended phototherapy level. The single exception to this was a phototherapy level of 6 mg dl(-1) for infants of 28 0/7-29 6/7 weeks' PMA, where a TcB of 4 mg dl(-1) below the phototherapy level (ie a TcB ⩽2 mg dl(-1)) was necessary to achieve ⩾98% probability. Our data support the use of routine TcB screening for infants 28-34 6/7 weeks' gestation. TcB screening in the neonatal intensive care unit can identify infants who require a TSB to confirm or exclude the need for phototherapy.

Factors Linked to Substance Use Disorder Counselors’ (Non)Implementation Likelihood of Tobacco Cessation 5 A's, Counseling, and Pharmacotherapy

PubMed Central

Laschober, Tanja C.; Muilenburg, Jessica L.; Eby, Lillian T.

2015-01-01

Study Background Despite efforts to promote the use of tobacco cessation services (TCS), implementation extensiveness remains limited. This study investigated three factors (cognitive, behavioral, environmental) identified by social cognitive theory as predictors of substance use disorder counselors’ likelihood of use versus non-use of tobacco cessation (TC) 5 A's (ask patients about tobacco use, advise to quit, assess willingness to quit, assist in quitting, arrange for follow-up contact), counseling, and pharmacotherapy with their patients who smoke cigarettes. Methods Data were collected in 2010 from 942 counselors working in 257 treatment programs that offered TCS. Cognitive factors included perceived job competence and TC attitudes. Behavioral factors encompassed TC-related skills and general training. External factors consisted of TC financial resource availability and coworker TC attitudes. Data were analyzed using logistic regression models with nested data. Results Approximately 86% of counselors used the 5 A's, 76% used counseling, and 53% used pharmacotherapy. When counselors had greater TC-related skills and greater general training they were more likely to implement the 5 A's. Implementation of counseling was more likely when counselors had more positive attitudes toward TC treatment, greater general training, greater financial resource availability, and when coworkers had more positive attitudes toward TC treatment. Implementation of pharmacotherapy was more likely when counselors had more positive attitudes toward TC treatment, greater general training, and greater financial resource availability. Conclusion Findings indicate that interventions to promote TCS implementation should consider all three factors simultaneously as suggested by social cognitive theory. PMID:26005696

Endogenous steroid hormone levels in early pregnancy and risk of testicular cancer in the offspring: a nested case-referent study.

PubMed

Holl, Katsiaryna; Lundin, Eva; Surcel, Heljä-Marja; Grankvist, Kjell; Koskela, Pentti; Dillner, Joakim; Hallmans, Göran; Wadell, Göran; Olafsdottir, Gudridur H; Ogmundsdottir, Helga M; Pukkala, Eero; Lehtinen, Matti; Stattin, Pär; Lukanova, Annekatrin

2009-06-15

According to the leading hypothesis on testicular cancer (TC) etiology exposure to a specific pattern of steroid hormones in utero, in particular, to high levels of estrogens and low levels of androgens is the major determinant of TC risk in the offspring. We performed a case-referent study nested within Finnish, Swedish and Icelandic maternity cohorts exploiting early pregnancy serum samples to evaluate the role of maternal endogenous steroid hormones with regard to the risk of TC. TC cases and referents were aged between 0 and 25 years. For each case-index mother pair, three or four matched referent-referent mother pairs were identified using national population registries. First trimester or early second trimester sera were retrieved from the index mothers of 73 TC cases and 286 matched referent mothers, and were tested for dehydroepiandrosterone sulfate (DHEAS), androstenedione, testosterone, estradiol, estrone, and sex hormone binding globulin (SHBG). Offspring of mothers with high DHEAS levels had a significantly decreased risk of TC (OR for highest vs. lowest DHEAS quartile, 0.18 (95% CI 0.06-0.58). In contrast, offspring of mothers with high androstenedione levels had an increased risk of TC (OR 4.1; 95% CI 1.2-12.0). High maternal total estradiol level also tended to be associated with an increased risk of TC in the offspring (OR 32; 95% CI 0.98-1,090). We report the first direct evidence that interplay of maternal steroid hormones in the early pregnancy is important in the etiology of TC in the offspring. Copyright 2008 UICC.

[Identifying and sequence analysis of HLA-B*2736].

PubMed

Li, Zhen; Zou, Hong-Yan; Shao, Chao-Peng; Tang, Si; Wang, Da-Ming; Cheng, Liang-Hong

2007-11-01

An unknown HLA-B allele which was similar to HLA-B*270401 was detected by FLOW-SSOPCR-SSP and heterozygous sequence-based typing (SBT) in Chinese Han individual. Its anomalous patterns suggested the possible presence of new allele. Amplifying exon 2-5(include intron 2-4) of the HLA-B*27 allele separately by using allele-specific primers and sequencing in both directions. Identifying the difference between the novel B*27 allele and B*270401. The sequence of novel B*27 from exon 2 to partial exon 5 is 1 815 bp. There are 10 nt changes from B*270401 in exon 3-4, at nt634where A-->C(codon130 AGC-->CGC, 130 S-->R); nt670 where A-->T (codon142 ACC-->TCC, 142 T-->S); nt683 where G-->T (codon146 TGG-->TTG, 146 W-->L); nt698 where A-->T (codon151 GAG-->GTG, 151 E-->V); nt774 where G-->C (codon176 GAG-->GAC, 176 E-->D); nt776 where C-->A (codon177 ACG-->AAG, 177 T-->K); nt781 where C-->G (codon179 CAG-->GAG, 179Q-->E); nt789 where G-->T (codon181 GCG-->GCT) resulting no coding change; nt1438 where C-->T (codon206 GGC-->GGT) resulting no coding change; nt1449 where G-->C (codon210 GGG-->GCG, 210G-->A). In IMGT/HLA database, only three alleles (B*270502/2706/2732) have sequences of introns. The same sequence in intron 2 showed homology between the novel HLA-B*27 allele and B*2706, but their homology could not be supported in intron 3-4. Comparing the sequence of the novel B*27 allele in intron 3 and 4 with B*27 group, it showed there are three mutations at nt106 C-->G, nt179 G-->A, nt536 G-->A and one deletion at nt168 in intron 3 and one mutations at nt82 T-->C in intron 4, but the sequence of the novel B*27 allele in intron 3 and 4 was all the same to B*070201. The sequence was submitted to Gen-Bank and the accession number was DQ915176. The allele has been confirmed as an extension of B*2736 by the WHO Nomenclature committee in November 2006.

Multifocal hyperfunctioning thyroid carcinoma without metastases.

PubMed

Nishida, Akiko T; Hirano, Shigeru; Asato, Ryo; Tanaka, Shinzo; Kitani, Yoshiharu; Honda, Nobumitsu; Fujiki, Nobuya; Miyata, Kouji; Fukushima, Hideyuki; Ito, Juichi

2008-09-01

Hyperthyroidism due to thyroid carcinoma is rare, and most cases are caused by hyperfunctioning metastatic thyroid carcinoma rather than primary carcinoma. Among primary hyperfunctioning thyroid carcinoma, multifocal thyroid carcinoma is exceedingly rare, with the only one case being reported in the literature. Here, we describe the case of a 62-year-old woman with multifocal functioning thyroid carcinoma. Technetium-99m (99m Tc) scintigraphic imaging showed four hot areas in the thyroid gland. Histopathological examination of all four nodules revealed papillary carcinoma, corresponding to hot areas in the 99m Tc scintigram. DNA sequencing of the thyrotropin receptor (TSH-R) gene from all nodules revealed no mutation, indicating that activation of TSH-R was unlikely in the pathophysiogenesis of hyperfunctioning thyroid carcinoma in the present case.

Sedimentological characteristics of the 2015 Tropical Cyclone Pam overwash deposits from Vanuatu, South Pacific

NASA Astrophysics Data System (ADS)

Hong, I.; Pilarczyk, J.; Horton, B.; Fritz, H. M.; Kosciuch, T. J.; Wallace, D. J.; Dike, C.; Rarai, A.; Harrison, M. J.; Jockley, F. R.

2016-12-01

Historical observations and overwash sediments deposited by prehistoric tropical cyclones (TC) enable the assessment of long-term patterns of tropical cyclone variability. Prehistoric TC reconstructions, however, are limited in their ability to quantify the intensity of past events. Modern analogues present an opportunity to characterize overwash sediments deposited by a TC of known intensity. On 13 March 2015, TC Pam made landfall on Vanuatu as a Category 5 storm with 10-minute sustained wind speeds as high as 250 km/h. Less than three months after landfall, we (1) measured the height and inland extent of TC Pam's storm surge; and (2) described the sedimentological characteristics of the TC Pam overwash deposits focusing on two of the hardest hit islands, Efate and Tanna. TC Pam's storm surge inundated Vanuatu with maximum high water marks of 5.6 m above mean sea level (MSL) on the island of Efate and 5.5 m above MSL on the island of Tanna. We measured surge heights of 4.2 m above MSL at our study area Manuro on Efate and 3.3 m above MSL at our study area Port Resolution Bay on Tanna. TC Pam deposited a medium-grained (mean: 1.20 Φ), moderately well-sorted (sorting: 0.55 Φ) mixed-carbonate sand with trace amounts of volcanic sediments and coral fragments at Manuro. The sand extends 130 m inland, abruptly transitioning into pumice that extends 400 m inland into Lake Otas. A sharp contact separates the base of the sand and the underlying organic-rich sand unit. In contrast, TC Pam deposited a medium-grained (mean: 1.81 Φ), moderately well-sorted (sorting: 0.67 Φ) volcanic sand at Port Resolution Bay. The sand extends up to 320 m inland. A sharp contact separates the base of the sand and the underlying rooted sandy soil. We found both a coarsening upward and fining upward sequences in trench M1 at Manuro and upward fining in trenches RB 3 and RB 2 at Port Resolution Bay. We used a combination of measured flow heights obtained at the Port Resolution Bay site and laboratory derived grain size settling velocities to calculate the distance of sediment transport caused by TC Pam's storm surge. Based on the distribution of settling velocities from our samples, transport distances for material deposited in the trench suggests a source for the overwash sand ranging from the supratidal berm to 290 m seaward in the nearshore at Port Resolution Bay.

A cricket Gene Index: a genomic resource for studying neurobiology, speciation, and molecular evolution

PubMed Central

Danley, Patrick D; Mullen, Sean P; Liu, Fenglong; Nene, Vishvanath; Quackenbush, John; Shaw, Kerry L

2007-01-01

Background As the developmental costs of genomic tools decline, genomic approaches to non-model systems are becoming more feasible. Many of these systems may lack advanced genetic tools but are extremely valuable models in other biological fields. Here we report the development of expressed sequence tags (EST's) in an orthopteroid insect, a model for the study of neurobiology, speciation, and evolution. Results We report the sequencing of 14,502 EST's from clones derived from a nerve cord cDNA library, and the subsequent construction of a Gene Index from these sequences, from the Hawaiian trigonidiine cricket Laupala kohalensis. The Gene Index contains 8607 unique sequences comprised of 2575 tentative consensus (TC) sequences and 6032 singletons. For each of the unique sequences, an attempt was made to assign a provisional annotation and to categorize its function using a Gene Ontology-based classification through a sequence-based comparison to known proteins. In addition, a set of unique 70 base pair oligomers that can be used for DNA microarrays was developed. All Gene Index information is posted at the DFCI Gene Indices web page Conclusion Orthopterans are models used to understand the neurophysiological basis of complex motor patterns such as flight and stridulation. The sequences presented in the cricket Gene Index will provide neurophysiologists with many genetic tools that have been largely absent in this field. The cricket Gene Index is one of only two gene indices to be developed in an evolutionary model system. Species within the genus Laupala have speciated recently, rapidly, and extensively. Therefore, the genes identified in the cricket Gene Index can be used to study the genomics of speciation. Furthermore, this gene index represents a significant EST resources for basal insects. As such, this resource is a valuable comparative tool for the understanding of invertebrate molecular evolution. The sequences presented here will provide much needed genomic resources for three distinct but overlapping fields of inquiry: neurobiology, speciation, and molecular evolution. PMID:17459168

Towards a climatology of tropical cyclone morphometric structures using a newly standardized passive microwave satellite dataset

NASA Astrophysics Data System (ADS)

Cossuth, J.; Hart, R. E.

2013-12-01

The structure of a tropical cyclone (TC) is a spatial representation of its organizational pattern and distribution of energy acquisition and release. Physical processes that react to both the external environment and its own internal dynamics manifest themselves in the TC shape. This structure depicts a specific phase in the TC's meteorological lifecycle, reflecting its past and potentially constraining its future development. For a number of reasons, a thorough objective definition of TC structures and an intercomparison of their varieties have been neglected. This lack of knowledge may be a key reason why TC intensity forecasts, despite numerical model improvements and theoretical advances, have been stagnant in recent years relative to track forecasts. Satellite microwave imagers provide multiple benefits in discerning TC structure, but compiling a research quality data set has been problematic due to several inherent technical and logistical issues. While there are multiple satellite sensors that incorporate microwave frequencies, inter-comparison between such sensors is limited by the different available channels, spatial resolutions, and calibration metrics between satellites, all of which provide inconsistencies in resolving TC structural features. To remedy these difficulties, a global archive of TCs as measured by all available US satellite microwave sensors is compiled and standardized. Using global historical best track data, TC microwave data is retrieved from the Defense Meteorological Satellite Program (DMSP) series (including all SSM/I and SSMIS), TMI, AMSR-E, and WindSat sensors. Standardization between sensors for each TC overpass are performed, including: 1) Recalibration of data from the 'ice scattering' channels to a common frequency (89GHz); 2) Resampling the DMSP series to a higher resolution using the Backus-Gilbert technique; and 3) Re-centering the TC center more precisely using the ARCHER technique (Wimmers and Velden 2010) to analyze the storm's rainband and eyewall organization. Ultimately, this project develops a consistent climatology of TC structures using a new database of research-quality historical TC satellite microwave observations. Not only can such data sets more accurately study TC structural evolution, but they may facilitate automated TC intensity estimates and provide methods to enhance current operational and research products, such as at the NRL TC webpage (http://www.nrlmry.navy.mil/TC.html). The process of developing the dataset and possible objective definitions of TC structures using passive microwave imagery will be described, with preliminary results suggesting new methods to identify TC structures that may interrogate and expand upon physical and dynamical theories. Structural metrics such as threshold analysis of the outlines of the TC shape as well as methods to diagnose the inner-core size, completion, and magnitude will be introduced.

A Novel Nonsense Mutation in Exon 5 of KIND1 Gene in an Iranian Family with Kindler Syndrome.

PubMed

Heidari, Mohammad Mehdi; Khatami, Mehri; Kargar, Saeed; Azari, Mojdeh; Hoseinzadeh, Hassan; Fallah, Hamedeh

2016-06-01

Kindler syndrome (KS) is an autosomal recessive skin disease characterized by actual blistering, photosensitivity and a progressive poikiloderma. The disorder results from rare mutations in the KIND1 gene. This gene contains 15 exons and expresses two kindlin-1 isoforms. The aim of this investigation was to analyze mutations in the exons 1 to 15 of KIND1 gene in an Iranian family clinically affected with Kindler syndrome. The mutations analysis of 15 coding exons of KIND1 gene was performed with PCR-SSCP and direct sequencing in 14 subjects from one Iranian family clinically affected with Kindler syndrome. We identified eight new nucleotide changes in KIND1 in this family. These changes were found in g.3892delA, g.3951T>C, g.3962T>G, g.4190G>T, g.7497G>A, g.11076T>C, g.11102C>T and g.13177C>T positions. Among them, the g.13177C>T mutation resulting in the formation of a premature stop codon (Q226X) was detected only in seven affected family individuals as homozygous but was not present in 100 unrelated healthy controls. This study suggests that nonsense mutation may lead to incomplete and non-functional protein products and is pathogenic and has meaningful implications for the diagnosis of patients with Kindler syndrome.

Occurrence of potentially pathogenic nontuberculous mycobacteria in Mexican household potable water: a pilot study

PubMed Central

2013-01-01

Background Nontuberculous mycobacteria (NTM) are environmental opportunistic pathogens found in natural and human-engineered waters, including drinking water distribution systems and household plumbing. This pilot study examined the frequency of occurrence of NTM in household potable water samples in Mexico City. Potable water samples were collected from the “main house faucet” and kitchen faucet. The presence of aerobic-mesophilic bacteria (AMB), total coliforms (TC), fecal coliforms (FC) and NTM species were determined. Mycobacteria species were identified by PCR restriction enzyme pattern analysis (PRA) of the 65-kDa heat shock protein gene (hsp65) and sequencing of the hypervariable region 2 (V2) of the 16S rRNA gene and of the rpoB gene. Results AMB (<100 CFU/ml) were present in 118 out of 120 samples; only two samples were outside guidelines ranges (>100 CFU/ml). TC and FC were detected in four and one samples, respectively. NTM species were recovered from 16% samples (19/120) and included M. mucogenicum (nine), M. porcinum (three), M. avium (three), M. gordonae (one), M. cosmeticum (one), M. fortuitum (one), and Mycobacterium sp (one). All household water samples that contained NTM complied with the standards required to grade the water as “good quality” potable water. Conclusion Household potable water may be a potential source of NTM infection in Mexico City. PMID:24330835

A strongly selected mutation in the HIV-1 genome is independent of T cell responses and neutralizing antibodies

DOE Office of Scientific and Technical Information (OSTI.GOV)

Liu, Donglai; Wang, Chu; Hora, Bhavna

Mutations rapidly accumulate in the HIV-1 genome after infection. Some of those mutations are selected by host immune responses and often cause viral fitness losses. This study is to investigate whether strongly selected mutations that are not associated with immune responses result in fitness losses. Strongly selected mutations were identified by analyzing 5'-half HIV-1 genome (gag/pol) sequences from longitudinal samples of subject CH0131. The K43R mutation in the gag gene was first detected at day 91 post screening and was fixed in the viral population at day 273 while the synonymous N323tc mutation was first detected at day 177 andmore » fixed at day 670. No conventional or cryptic T cell responses were detected against either mutation sites by ELISpot analysis. However, when fitness costs of both mutations were measured by introducing each mutation into their cognate transmitted/founder (T/F) viral genome, the K43R mutation caused a significant fitness loss while the N323tc mutation had little impact on viral fitness. In conclusion, the rapid fixation, the lack of detectable immune responses and the significant fitness cost of the K43R mutation suggests that it was strongly selected by host factors other than T cell responses and neutralizing antibodies.« less

A strongly selected mutation in the HIV-1 genome is independent of T cell responses and neutralizing antibodies

DOE PAGES

Liu, Donglai; Wang, Chu; Hora, Bhavna; ...

2017-10-10

Mutations rapidly accumulate in the HIV-1 genome after infection. Some of those mutations are selected by host immune responses and often cause viral fitness losses. This study is to investigate whether strongly selected mutations that are not associated with immune responses result in fitness losses. Strongly selected mutations were identified by analyzing 5'-half HIV-1 genome (gag/pol) sequences from longitudinal samples of subject CH0131. The K43R mutation in the gag gene was first detected at day 91 post screening and was fixed in the viral population at day 273 while the synonymous N323tc mutation was first detected at day 177 andmore » fixed at day 670. No conventional or cryptic T cell responses were detected against either mutation sites by ELISpot analysis. However, when fitness costs of both mutations were measured by introducing each mutation into their cognate transmitted/founder (T/F) viral genome, the K43R mutation caused a significant fitness loss while the N323tc mutation had little impact on viral fitness. In conclusion, the rapid fixation, the lack of detectable immune responses and the significant fitness cost of the K43R mutation suggests that it was strongly selected by host factors other than T cell responses and neutralizing antibodies.« less

Association of I-FABP gene polymorphism and the risk of coronary heart disease.

PubMed

Yuan, Dong; Yu, Changqing; Zeng, Chunyu

2015-01-01

The study aimed to investigate the association between polymorphism of I-FABP gene and coronary heart disease (CHD). 225 patients with CHD were randomly recruited into the case group, and 196 healthy elderly volunteers were recruited from Medical Examination Center of our hospital as control. General clinical data were collected and plasma TC, TG, LDL-C, HDL-C levels were measured. Besides, polymerase chain reaction (PCR) and Restriction Fragment Length Polymorphism (RFLP) technology were used to detect the polymorphism of Hha-I enzyme cleavage sites in I-FABP gene in the study population. Hha-I cleavage sites occurred at codon 54 in exon in the coding sequencing of I-FABP gene in all participants. After cleavage with Hha-I enzyme, the genotypes were identified as wild-type A/A, heterozygous mutant A/T and homozygous mutant T/T. In case group, A/T and T/T genetic carriers had significantly higher levels of TC, TG and LDL-C than A/A carriers (P<0.05). However, in control group, similar differences were not observed (P>0.05). BMI, dietary habits and I-FABP alleles were independent risk factors of CHD. The polymorphism of I-FABP gene existed in the study population. And this genetic variation had influence on lipid metabolism, which was associated with the risk of developing CHD. I-FABP gene polymorphism may contribute to the increased genetic susceptibility to CHD.

Trypanosoma cruzi TcSMUG L-surface Mucins Promote Development and Infectivity in the Triatomine Vector Rhodnius prolixus

PubMed Central

Gonzalez, Marcelo S.; Souza, Marcela S.; Garcia, Eloi S.; Nogueira, Nadir F. S.; Mello, Cícero B.; Cánepa, Gaspar E.; Bertotti, Santiago; Durante, Ignacio M.; Azambuja, Patrícia; Buscaglia, Carlos A.

2013-01-01

Background TcSMUG L products were recently identified as novel mucin-type glycoconjugates restricted to the surface of insect-dwelling epimastigote forms of Trypanosoma cruzi, the etiological agent of Chagas disease. The remarkable conservation of their predicted mature N-terminal region, which is exposed to the extracellular milieu, suggests that TcSMUG L products may be involved in structural and/or functional aspects of the interaction with the insect vector. Methodology and Principal Findings Here, we investigated the putative roles of TcSMUG L mucins in both in vivo development and ex vivo attachment of epimastigotes to the luminal surface of the digestive tract of Rhodnius prolixus. Our results indicate that the exogenous addition of TcSMUG L N-terminal peptide, but not control T. cruzi mucin peptides, to the infected bloodmeal inhibited the development of parasites in R. prolixus in a dose-dependent manner. Pre-incubation of insect midguts with the TcSMUG L peptide impaired the ex vivo attachment of epimastigotes to the luminal surface epithelium, likely by competing out TcSMUG L binding sites on the luminal surface of the posterior midgut, as revealed by fluorescence microscopy. Conclusion and Significance Together, these observations indicate that TcSMUG L mucins are a determinant of both adhesion of T. cruzi epimastigotes to the posterior midgut epithelial cells of the triatomine, and the infection of the insect vector, R. prolixus. PMID:24244781

The alpaca melanocortin 1 receptor: gene mutations, transcripts, and relative levels of expression in ventral skin biopsies.

PubMed

Chandramohan, Bathrachalam; Renieri, Carlo; La Manna, Vincenzo; La Terza, Antonietta

2015-01-01

The objectives of the present study were to characterize the MC1R gene, its transcripts and the single nucleotide polymorphisms (SNPs) associated with coat color in alpaca. Full length cDNA amplification revealed the presence of two transcripts, named as F1 and F2, differing only in the length of their 5'-terminal untranslated region (UTR) sequences and presenting a color specific expression. Whereas the F1 transcript was common to white and colored (black and brown) alpaca phenotypes, the shorter F2 transcript was specific to white alpaca. Further sequencing of the MC1R gene in white and colored alpaca identified a total of twelve SNPs; among those nine (four silent mutations (c.126C>A, c.354T>C, c.618G>A, and c.933G>A); five missense mutations (c.82A>G, c.92C>T, c.259A>G, c.376A>G, and c.901C>T)) were observed in coding region and three in the 3'UTR. A 4 bp deletion (c.224 227del) was also identified in the coding region. Molecular segregation analysis uncovered that the combinatory mutations in the MC1R locus could cause eumelanin and pheomelanin synthesis in alpaca. Overall, our data refine what is known about the MC1R gene and provides additional information on its role in alpaca pigmentation.

Performance characteristics of the ARCHITECT Active-B12 (Holotranscobalamin) assay.

PubMed

Merrigan, Stephen D; Owen, William E; Straseski, Joely A

2015-01-01

Vitamin B12 (cobalamin) is a necessary cofactor in methionine and succinyl-CoA metabolism. Studies estimate the deficiency prevalence as high as 30% in the elderly population. Ten to thirty percent of circulating cobalamin is bound to transcobalamin (holotranscobalamin, holoTC) which can readily enter cells and is therefore considered the bioactive form. The objective of our study was to evaluate the analytical performance of a high-throughput, automated holoTC assay (ARCHITECT i2000(SR) Active-B12 (Holotranscobalamin)) and compare it to other available methods. Manufacturer-specified limits of blank (LoB), detection (LoD), and quantitation (LoQ), imprecision, interference, and linearity were evaluated for the ARCHITECT HoloTC assay. Residual de-identified serum samples were used to compare the ARCHITECT HoloTC assay with the automated AxSYM Active-B12 (Holotranscobalamin) assay (Abbott Diagnostics) and the manual Active-B12 (Holotranscobalamin) Enzyme Immunoassay (EIA) (Axis-Shield Diagnostics, Dundee, Scotland, UK). Manufacturer's claims of LoB, LoD, LoQ, imprecision, interference, and linearity to the highest point tested (113.4 pmol/L) were verified for the ARCHITECT HoloTC assay. Method comparison of the ARCHITECT HoloTC to the AxSYM HoloTC produced the following Deming regression statistics: (ARCHITECT(HoloTc)) = 0.941 (AxSYM(HoloTC)) + 1.2 pmol/L, S(y/x) = 6.4, r = 0.947 (n = 98). Comparison to the Active-B12 EIA produced: (ARCHITECT(HoloTC)) = 1.105 (EIA(Active-B12)) - 6.8 pmol/L, S(y/x) = 11.0, r = 0.950 (n = 221). This assay performed acceptably for LoB, LoD, LoQ, imprecision, interference, linearity and method comparison to the predicate device (AxSYM). An additional comparison to a manual Active-B12 EIA method performed similarly, with minor exceptions. This study determined that the ARCHITECT HoloTC assay is suitable for routine clinical use, which provides a high-throughput alternative for automated testing of this emerging marker of cobalamin deficiency.

Functional significance of SPINK1 promoter variants in chronic pancreatitis.

PubMed

Derikx, Monique H M; Geisz, Andrea; Kereszturi, Éva; Sahin-Tóth, Miklós

2015-05-01

Chronic pancreatitis is a progressive inflammatory disorder of the pancreas, which often develops as a result of genetic predisposition. Some of the most frequently identified risk factors affect the serine protease inhibitor Kazal type 1 (SPINK1) gene, which encodes a trypsin inhibitor responsible for protecting the pancreas from premature trypsinogen activation. Recent genetic and functional studies indicated that promoter variants in the SPINK1 gene might contribute to disease risk in carriers. Here, we investigated the functional effects of 17 SPINK1 promoter variants using luciferase reporter gene expression assay in four different cell lines, including three pancreatic acinar cell lines (rat AR42J with or without dexamethasone-induced differentiation and mouse 266-6) and human embryonic kidney 293T cells. We found that most variants caused relatively small changes in promoter activity. Surprisingly, however, we observed significant variations in the effects of the promoter variants in the different cell lines. Only four variants exhibited consistently reduced promoter activity in all acinar cell lines, confirming previous reports that variants c.-108G>T, c.-142T>C, and c.-147A>G are risk factors for chronic pancreatitis and identifying c.-52G>T as a novel risk variant. In contrast, variant c.-215G>A, which is linked with the disease-associated splice-site mutation c.194 + 2T>C, caused increased promoter activity, which may mitigate the overall effect of the pathogenic haplotype. Our study lends further support to the notion that sequence evaluation of the SPINK1 promoter region in patients with chronic pancreatitis is justified as part of the etiological investigation. Copyright © 2015 the American Physiological Society.

A Transverse Colectomy is as Safe as an Extended Right or Left Colectomy for Mid-Transverse Colon Cancer.

PubMed

Leijssen, Lieve G J; Dinaux, Anne M; Amri, Ramzi; Kunitake, Hiroko; Bordeianou, Liliana G; Berger, David L

2018-03-19

Although extended colectomy is often chosen for patients with transverse colon cancer, the optimal surgical approach for mid-transverse colon cancer has not been established. We identified patients who underwent a transverse (TC) or an extended colectomy (EC) for mid-transverse colon cancer between 2004 and 2014. To adjust for potential selection bias between the groups, a propensity score matching analysis was performed. A total of 103 patients were included, of whom 63% underwent EC (right 47%, left 17%) and 37% TC. EC patients tend to have worse short-term outcomes. Although fewer lymph nodes were harvested after TC, 5-year overall (OS) ad disease-free survival (DFS) was comparable between the groups. When comparing long-term outcomes stage-by-stage, worse OS and DFS were seen in stage-II. All stage-II patients died of a non-cancer-related cause and recurrence occurred in pT4 TC patients who did not receive adjuvant therapy. The propensity-matched cohort demonstrated similar postoperative morbidity, but more laparoscopic procedures in EC. Additionally, TC tumors were correlated with poorer histopathological features and disease recurrence was only seen after TC. Our study underlines the oncological safety of a transverse colectomy for mid-transverse colon cancer. Although TC tumors were associated with poorer histopathological features, survival rates were comparable.

Hemostatic powder TC-325 in the management of upper and lower gastrointestinal bleeding: a two-year experience at a single institution.

PubMed

Chen, Yen-I; Barkun, Alan; Nolan, Sabrina

2015-02-01

TC-325 is a novel endoscopic hemostatic powder. Our aim was to describe a single-center experience with the use of TC-325 in the upper and lower gastrointestinal tract, while for the first time attempting to determine how long the powder remains on a lesion. The charts of consecutive patients receiving TC-325 therapy between July 2011 and July 2013 were reviewed retrospectively. Primary endpoints included immediate hemostasis and early rebleeding (≤ 72 hours). Overall, 60 patients received 67 treatments with TC-325: 21 for nonmalignant nonvariceal upper gastrointestinal bleeding, 19 for malignant upper gastrointestinal bleeding, 11 for lower gastrointestinal bleeding, and 16 for intra-procedural bleeding. Immediate hemostasis was achieved in 66 cases (98.5 %), with 6 cases (9.5 %) of early rebleeding. No serious adverse events were noted. No TC-325 powder was identified in the 11 patients who underwent second-look endoscopy, performed within 24 hours in 4 patients. TC-325 appears safe and effective for managing bleeding in the upper and lower gastrointestinal tract with a variety of causes. The time during which the powder remains in the gastrointestinal tract is short, with complete elimination from the gastrointestinal tract as early as within 24 hours after use. © Georg Thieme Verlag KG Stuttgart · New York.

TcPho91 is a contractile vacuole phosphate sodium symporter that regulates phosphate and polyphosphate metabolism in Trypanosoma cruzi.

PubMed

Jimenez, Veronica; Docampo, Roberto

2015-09-01

We have identified a phosphate transporter (TcPho91) localized to the bladder of the contractile vacuole complex (CVC) of Trypanosoma cruzi, the etiologic agent of Chagas disease. TcPho91 has 12 transmembrane domains, an N-terminal regulatory SPX (named after SYG1, Pho81 and XPR1) domain and an anion permease domain. Functional expression in Xenopus laevis oocytes followed by two-electrode voltage clamp showed that TcPho91 is a low-affinity transporter with a Km for Pi in the millimolar range, and sodium-dependency. Epimastigotes overexpressing TcPho91-green fluorescent protein have significantly higher levels of pyrophosphate (PPi ) and short-chain polyphosphate (polyP), suggesting accumulation of Pi in these cells. Moreover, when overexpressing parasites were maintained in a medium with low Pi , they grew at higher rates than control parasites. Only one allele of TcPho91 in the CL strain encodes for the complete open reading frame, while the other one is truncated encoding for only the N-terminal domain. Taking advantage of this characteristic, knockdown experiments were performed resulting in cells with reduced growth rate as well as a reduction in PPi and short-chain polyP levels. Our results indicate that TcPho91 is a phosphate sodium symporter involved in Pi homeostasis in T. cruzi. © 2015 John Wiley & Sons Ltd.

Deciphering and engineering of the final step halogenase for improved chlortetracycline biosynthesis in industrial Streptomyces aureofaciens.

PubMed

Zhu, Tao; Cheng, Xueqing; Liu, Yuntian; Deng, Zixin; You, Delin

2013-09-01

Chlortetracycline (CTC) is an important member from antibiotics tetracycline (TC) family, which inhibits protein synthesis in bacteria and is widely involved in clinical therapy, animal feeds and aquaculture. Previous works have reported intricately the biosynthesis of CTC from the intermediates in random mutants of Streptomyces aureofaciens and the crucial chlorination remained unclear. We have developed the genetic manipulation in an industrial producer, in which about 15.0g/l CTC predominated along with 1.2g/l TC, and discovered that chlorination by ctcP (an FADH2-dependent halogenase gene) is the last inefficient step during CTC biosynthesis. Firstly, the ΔctcP strain accumulated about 18.9g/l "clean" TC without KBr addition and abolished the production of CTC. Subsequently, CtcP was identified to exhibit a substrate stereo-specificity to absolute TC (4S) rather than TC (4R), with low kcat of 0.51±0.01min(-1), while it could halogenate several TC analogs. Accordingly, we devised a strategy for overexpression of ctcP in S. aureofaciens and improved CTC production to a final titer of 25.9g/l. We anticipate that our work will provide a biotechnological potential of enzymatic evolution and strain engineering towards new TC derivatives in microorganisms. © 2013 The Authors. Published by Elsevier Inc. All rights reserved.

Effective detection of the tumors causing osteomalacia using [Tc-99m]-HYNIC-octreotide (99mTc-HYNIC-TOC) whole body scan.

PubMed

Jing, Hongli; Li, Fang; Zhuang, Hongming; Wang, Zhenghua; Tian, Jian; Xing, Xiaoping; Jin, Jin; Zhong, Dingrong; Zhang, Jingjing

2013-11-01

Tumor-induced osteomalacia (TIO) is an endocrine disorder caused by tumors producing excessive fibroblast growth factor-23 (FGF-23). The causative tumors are generally small, slow-growing benign mesenchymal tumors. The only cure of the disease depends on resection of the tumors, which are extremely difficult to localize due to their small sizes and rare locations. Since these tumors are known to express somatostatin receptors, this research was undertaken to evaluate efficacy of [Tc-99m]-HYNIC-octreotide (99mTc-HYNIC-TOC) whole body imaging in this clinical setting Images of 99mTc-HYNIC-TOC scans and clinical chart from 183 patients with hypophosphatemia and clinically suspected TIO were retrospectively reviewed. The scan findings were compared to the results of histopathological examinations and clinical follow-ups. Among 183 patients, 72 were confirmed to have TIO while 103 patients were found to have other causes of hypophosphatemia. The possibility of TIO could not be either diagnosed or excluded in the remaining 8 patients. For analytical purposes, these 8 patients who could neither be diagnosed nor excluded as having TIO were regarded as having the disease, bringing the total of TIO patients to 80. The 99mTc-HYNIC-TOC scan identified 69 tumors in 80 patients with TIO, which rendered a sensitivity of 86.3% (69/80). 99mTc-HYNIC-TOC scintigraphy excluded 102 patients without TIO with a specificity of 99.1% (102/103). The overall accuracy of 99mTc-HYNIC-TOC whole body scan in the localization of tumors responsible for osteomalacia is 93.4% (171/183). Whole body 99mTc-HYNIC-TOC imaging is effective in the localization of occult tumors causing TIO. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

Multispectral Fluorescence Imaging During Robot-assisted Laparoscopic Sentinel Node Biopsy: A First Step Towards a Fluorescence-based Anatomic Roadmap.

PubMed

van den Berg, Nynke S; Buckle, Tessa; KleinJan, Gijs H; van der Poel, Henk G; van Leeuwen, Fijs W B

2017-07-01

During (robot-assisted) sentinel node (SN) biopsy procedures, intraoperative fluorescence imaging can be used to enhance radioguided SN excision. For this combined pre- and intraoperative SN identification was realized using the hybrid SN tracer, indocyanine green- 99m Tc-nanocolloid. Combining this dedicated SN tracer with a lymphangiographic tracer such as fluorescein may further enhance the accuracy of SN biopsy. Clinical evaluation of a multispectral fluorescence guided surgery approach using the dedicated SN tracer ICG- 99m Tc-nanocolloid, the lymphangiographic tracer fluorescein, and a commercially available fluorescence laparoscope. Pilot study in ten patients with prostate cancer. Following ICG- 99m Tc-nanocolloid administration and preoperative lymphoscintigraphy and single-photon emission computed tomograpy imaging, the number and location of SNs were determined. Fluorescein was injected intraprostatically immediately after the patient was anesthetized. A multispectral fluorescence laparoscope was used intraoperatively to identify both fluorescent signatures. Multispectral fluorescence imaging during robot-assisted radical prostatectomy with extended pelvic lymph node dissection and SN biopsy. (1) Number and location of preoperatively identified SNs. (2) Number and location of SNs intraoperatively identified via ICG- 99m Tc-nanocolloid imaging. (3) Rate of intraoperative lymphatic duct identification via fluorescein imaging. (4) Tumor status of excised (sentinel) lymph node(s). (5) Postoperative complications and follow-up. Near-infrared fluorescence imaging of ICG- 99m Tc-nanocolloid visualized 85.3% of the SNs. In 8/10 patients, fluorescein imaging allowed bright and accurate identification of lymphatic ducts, although higher background staining and tracer washout were observed. The main limitation is the small patient population. Our findings indicate that a lymphangiographic tracer can provide additional information during SN biopsy based on ICG- 99m Tc-nanocolloid. The study suggests that multispectral fluorescence image-guided surgery is clinically feasible. We evaluated the concept of surgical fluorescence guidance using differently colored dyes that visualize complementary features. In the future this concept may provide better guidance towards diseased tissue while sparing healthy tissue, and could thus improve functional and oncologic outcomes. Copyright © 2016 European Association of Urology. Published by Elsevier B.V. All rights reserved.

A novel framework for objective detection and tracking of TC center from noisy satellite imagery

NASA Astrophysics Data System (ADS)

Johnson, Bibin; Thomas, Sachin; Rani, J. Sheeba

2018-07-01

This paper proposes a novel framework for automatically determining and tracking the center of a tropical cyclone (TC) during its entire life-cycle from the Thermal infrared (TIR) channel data of the geostationary satellite. The proposed method handles meteorological images with noise, missing or partial information due to the seasonal variability and lack of significant spatial or vortex features. To retrieve the cyclone center from these circumstances, a synergistic approach based on objective measures and Numerical Weather Prediction (NWP) model is being proposed. This method employs a spatial gradient scheme to process missing and noisy frames or a spatio-temporal gradient scheme for image sequences that are continuous and contain less noise. The initial estimate of the TC center from the missing imagery is corrected by exploiting a NWP model based post-processing scheme. The validity of the framework is tested on Infrared images of different cyclones obtained from various Geostationary satellites such as the Meteosat-7, INSAT- 3 D , Kalpana-1 etc. The computed track is compared with the actual track data obtained from Joint Typhoon Warning Center (JTWC), and it shows a reduction of mean track error by 11 % as compared to the other state of the art methods in the presence of missing and noisy frames. The proposed method is also successfully tested for simultaneous retrieval of the TC center from images containing multiple non-overlapping cyclones.

Novel receptor-like kinases in cacao contain PR-1 extracellular domains.

PubMed

Teixeira, Paulo José Pereira Lima; Costa, Gustavo Gilson Lacerda; Fiorin, Gabriel Lorencini; Pereira, Gonçalo Amarante Guimarães; Mondego, Jorge Maurício Costa

2013-08-01

Members of the pathogenesis-related protein 1 (PR-1) family are well-known markers of plant defence responses, forming part of the arsenal of the secreted proteins produced on pathogen recognition. Here, we report the identification of two cacao (Theobroma cacao L.) PR-1s that are fused to transmembrane regions and serine/threonine kinase domains, in a manner characteristic of receptor-like kinases (RLKs). These proteins (TcPR-1f and TcPR-1g) were named PR-1 receptor kinases (PR-1RKs). Phylogenetic analysis of RLKs and PR-1 proteins from cacao indicated that PR-1RKs originated from a fusion between sequences encoding PR-1 and the kinase domain of a LecRLK (Lectin Receptor-Like Kinase). Retrotransposition marks surround TcPR-1f, suggesting that retrotransposition was involved in the origin of PR-1RKs. Genes with a similar domain architecture to cacao PR-1RKs were found in rice (Oryza sativa), barrel medic (Medicago truncatula) and a nonphototrophic bacterium (Herpetosiphon aurantiacus). However, their kinase domains differed from those found in LecRLKs, indicating the occurrence of convergent evolution. TcPR-1g expression was up-regulated in the biotrophic stage of witches' broom disease, suggesting a role for PR-1RKs during cacao defence responses. We hypothesize that PR-1RKs transduce a defence signal by interacting with a PR-1 ligand. © 2013 BSPP AND JOHN WILEY & SONS LTD.

[A novel M142T mutation in the B glycosyltransferase gene associated with B3 variant in Chinese].

PubMed

Xu, Xian-guo; Hong, Xiao-zhen; Liu, Ying; Zhu, Fa-ming; Lv, Hang-jun; Yan, Li-xing

2009-06-01

To investigate the molecular genetic basis of the B3 variant of ABO blood group system with mixed-field hemagglutination in Chinese. Serological techniques were performed to characterize the erythrocyte phenotype of two discrepant samples. A sequential agglutination method and 13 short tandem repeat (STR) loci were tested to exclude the possibility of exogenous or endogenous DNA chimera. Mutations in exons 6 and 7, including partial intron of the ABO gene, were screened by polymerase chain reaction and DNA sequencing. Haplotypes of the two individuals were also analyzed by sequencing. A mixed-field hemagglutination of RBCs with anti-B and anti-AB antibodies was detected in the two unrelated individuals. Exogenous ABO-incompatible RBC transfusion and endogenous genetic chimera were excluded by sequential agglutination method and STR. The ABO phenotypes of the two individuals were classified as A1B3 according to the ABO subgroup definition. The sequence region from intron 5 to 3'-UTR of the B allele was identical to that of ABO*B101 allele, except for a T to C substitution at nucleotide position 425 in exon 7. This substitution resulted in an amino acid change of M142T in the B glycosyltransferase. A novel B allele with 425T>C substitution resulting in B3 subgroup was identified in two Chinese individuals.

CBS mutations and MTFHR SNPs causative of hyperhomocysteinemia in Pakistani children.

PubMed

Ibrahim, Shahnaz; Maqbool, Saadia; Azam, Maleeha; Iqbal, Mohammad Perwaiz; Qamar, Raheel

2018-03-29

Three index patients with hyperhomocysteinemia and ocular anomalies were screened for cystathionine beta synthase (CBS) and methylenetetrahydrofolate reductase (MTHFR) polymorphisms. Genotyping of hyperhomocysteinemia associated MTHFR polymorphisms C677T (rs1801133) and A1298C (rs1801131) was done by PCR-restriction fragment length polymorphism. Sanger sequencing was performed for CBS exonic sequences along with consensus splice sites. In the case of MTHFR polymorphisms, all the patients were heterozygous CT for the single nucleotide polymorphism (SNP) C677T and were therefore carriers of the risk allele (T), while the patients were homozygous CC for the risk genotype of the SNP A1298C. CBS sequencing resulted in the identification of two novel mutations, a missense change (c.467T>C; p.Leu156Pro) in exon 7 and an in-frame deletion (c.808_810del; p.Glu270del) in exon 10. In addition, a recurrent missense mutation (c.770C>T; p.Thr257Met) in exon 10 of the gene was also identified. The mutations were present homozygously in the patients and were inherited from the carrier parents. This is the first report from Pakistan where novel as well as recurrent CBS mutations causing hyperhomocysteinemia and lens dislocation in three patients from different families are being reported with the predicted effect of the risk allele of the MTHFR SNP in causing hyperhomocysteinemia.

Novel mutations in PAX6, OTX2 and NDP in anophthalmia, microphthalmia and coloboma.

PubMed

Deml, Brett; Reis, Linda M; Lemyre, Emmanuelle; Clark, Robin D; Kariminejad, Ariana; Semina, Elena V

2016-04-01

Anophthalmia and microphthalmia (A/M) are developmental ocular malformations defined as the complete absence or reduction in size of the eye. A/M is a highly heterogeneous disorder with SOX2 and FOXE3 playing major roles in dominant and recessive pedigrees, respectively; however, the majority of cases lack a genetic etiology. We analyzed 28 probands affected with A/M spectrum (without mutations in SOX2/FOXE3) by whole-exome sequencing. Analysis of 83 known A/M factors identified pathogenic/likely pathogenic variants in PAX6, OTX2 and NDP in three patients. A novel heterozygous likely pathogenic variant in PAX6, c.767T>C, p.(Val256Ala), was identified in two brothers with bilateral microphthalmia, coloboma, primary aphakia, iris hypoplasia, sclerocornea and congenital glaucoma; the unaffected mother appears to be a mosaic carrier. While A/M has been reported as a rare feature, this is the first report of congenital primary aphakia in association with PAX6 and the identified allele represents the first variant in the PAX6 homeodomain to be associated with A/M. A novel pathogenic variant in OTX2, c.651delC, p.(Thr218Hisfs*76), in a patient with syndromic bilateral anophthalmia and a hemizygous pathogenic variant in NDP, c.293 C>T, p.(Pro98Leu), in two brothers with isolated bilateral microphthalmia and sclerocornea were also identified. Pathogenic/likely pathogenic variants were not discovered in the 25 remaining A/M cases. This study underscores the utility of whole-exome sequencing for identification of causative mutations in highly variable ocular phenotypes as well as the extreme genetic heterogeneity of A/M conditions.

Novel mutations in PAX6, OTX2 and NDP in anophthalmia, microphthalmia and coloboma

PubMed Central

Deml, Brett; Reis, Linda M; Lemyre, Emmanuelle; Clark, Robin D; Kariminejad, Ariana; Semina, Elena V

2016-01-01

Anophthalmia and microphthalmia (A/M) are developmental ocular malformations defined as the complete absence or reduction in size of the eye. A/M is a highly heterogeneous disorder with SOX2 and FOXE3 playing major roles in dominant and recessive pedigrees, respectively; however, the majority of cases lack a genetic etiology. We analyzed 28 probands affected with A/M spectrum (without mutations in SOX2/FOXE3) by whole-exome sequencing. Analysis of 83 known A/M factors identified pathogenic/likely pathogenic variants in PAX6, OTX2 and NDP in three patients. A novel heterozygous likely pathogenic variant in PAX6, c.767T>C, p.(Val256Ala), was identified in two brothers with bilateral microphthalmia, coloboma, primary aphakia, iris hypoplasia, sclerocornea and congenital glaucoma; the unaffected mother appears to be a mosaic carrier. While A/M has been reported as a rare feature, this is the first report of congenital primary aphakia in association with PAX6 and the identified allele represents the first variant in the PAX6 homeodomain to be associated with A/M. A novel pathogenic variant in OTX2, c.651delC, p.(Thr218Hisfs*76), in a patient with syndromic bilateral anophthalmia and a hemizygous pathogenic variant in NDP, c.293 C>T, p.(Pro98Leu), in two brothers with isolated bilateral microphthalmia and sclerocornea were also identified. Pathogenic/likely pathogenic variants were not discovered in the 25 remaining A/M cases. This study underscores the utility of whole-exome sequencing for identification of causative mutations in highly variable ocular phenotypes as well as the extreme genetic heterogeneity of A/M conditions. PMID:26130484

Complication Rates among Trauma Centers

PubMed Central

Ang, Darwin N; Rivara, Frederick P; Nathens, Avery; Jurkovich, Gregory J; Maier, Ronald V; Wang, Jin; MacKenzie, Ellen J

2009-01-01

Background To examine the association between patient complications and admission to level 1 trauma centers (TC) compared to non-trauma centers (NTC). Study Design A retrospective cohort study of data derived from the National Study on the Costs and Outcomes of Trauma (NSCOT). Patients were recruited from 18 level 1 TC and 51 NTC in 15 regions encompassing 14 states. Trained study nurses, using standardized forms, abstracted the medical records of the patients. The overall number of complications per patient was identified as well as the presence or absence of 13 specific complications. Results Patients treated in TC were more likely to have any complication compared to NTC with an adjusted relative risk (RR) of 1.34 (95% CI 1.03, 1.74). For individual complications, only urinary tract infection RR 1.94 (95% CI 1.07, 3.17) was significantly higher in TC. TC patients were more likely to have three or more complications, RR 1.83 (95% CI 1.16, 2.90). Treatment variables that are surrogates for markers of injury severity, such as use of pulmonary artery catheters, multiple operations, massive transfusions (> 2,500mL packed red blood cells), and invasive brain catheters, occurred significantly more often in TC. Conclusions Trauma centers have a slightly higher incidence rate of complications even after adjusting for patient case mix. Aggressive treatment may account for a significant portion of TC-associated complications. PA catheter use and intubation had the most influence on overall TC complication rates. Further study is needed to provide accurate benchmark measures of complication rates and to determine their causes. PMID:19854399

Preclinical evaluation of a new, stabilized neurotensin(8--13) pseudopeptide radiolabeled with (99m)tc.

PubMed

García-Garayoa, Elisa; Bläuenstein, Peter; Bruehlmeier, Matthias; Blanc, Alain; Iterbeke, Koen; Conrath, Peter; Tourwé, Dirk; Schubiger, P August

2002-03-01

The rapid degradation of neurotensin (NT) limits its clinical use in cancer imaging and therapy. Thus, a new NT(8--13) pseudopeptide, NT-VIII, was synthesized. Some changes were introduced in the sequence of NT(8--13) to stabilize the molecule against enzymatic degradation: Arg(8) was N-methylated, and Lys and Tle replaced Arg(9) and Ile(12), respectively. Finally, (NalphaHis)Ac was coupled to the N-terminus for (99m)Tc(CO)(3) labeling. This peptide was characterized both in vitro and in vivo. The new analog was labeled with (99m)Tc(CO)(3). Its metabolic stability was analyzed both in human plasma and in HT-29 cells. Binding properties, receptor downregulation, and internalization were tested with HT-29 cells. Biodistribution was evaluated in nude mice with HT-29 xenografts. (99m)Tc(CO)(3)NT-VIII showed a high stability in plasma, where most of the peptide remained intact after 24 h of incubation at 37 degreesC. However, the degradation in HT-29 cells was more rapid (46% of intact (99m)Tc(CO)(3)NT-VIII after 24 h at 37 degreesC). Binding to NT1 receptors (NTR1) was saturable and specific. Scatchard analysis showed a high affinity for (99m)Tc(CO)(3)NT-VIII, with a dissociation constant similar to (125)I-NT (1.8 vs. 1.6 nmol/L). After interacting with NTR1, (99m)Tc(CO)(3)NT-VIII was rapidly internalized, with more than 90% internalized after 30 min. It also distributed and cleared rapidly in nude mice bearing HT-29 xenografts. The highest rates of accumulation were found in kidney and tumor at all time points tested. Tumor uptake was highly specific because it could be blocked by coinjection with a high dose of (NalphaHis)Ac-NT(8--13). Tumors were clearly visualized in scintigraphy images. The changes that were introduced stabilized the molecule against enzymatic degradation without affecting binding properties. Moreover, the increase in stability enhanced tumor uptake, making this derivative a promising candidate for clinical use.

Trypanosoma cruzi vaccine candidate antigens Tc24 and TSA-1 recall memory immune response associated with HLA-A and -B supertypes in Chagasic chronic patients from Mexico.

PubMed

Villanueva-Lizama, Liliana E; Cruz-Chan, Julio V; Aguilar-Cetina, Amarú Del C; Herrera-Sanchez, Luis F; Rodriguez-Perez, Jose M; Rosado-Vallado, Miguel E; Ramirez-Sierra, Maria J; Ortega-Lopez, Jaime; Jones, Kathryn; Hotez, Peter; Bottazzi, Maria Elena; Dumonteil, Eric

2018-01-01

Trypanosoma cruzi antigens TSA-1 and Tc24 have shown promise as vaccine candidates in animal studies. We evaluated here the recall immune response these antigens induce in Chagasic patients, as a first step to test their immunogenicity in humans. We evaluated the in vitro cellular immune response after stimulation with recombinant TSA-1 (rTSA-1) or recombinant Tc24 (rTc24) in mononuclear cells of asymptomatic Chagasic chronic patients (n = 20) compared to healthy volunteers (n = 19) from Yucatan, Mexico. Proliferation assays, intracellular cytokine staining, cytometric bead arrays, and memory T cell immunophenotyping were performed by flow cytometry. Peripheral blood mononuclear cells (PBMC) from Chagasic patients showed significant proliferation after stimulation with rTc24 and presented a phenotype of T effector memory cells (CD45RA-CCR7-). These cells also produced IFN-γ and, to a lesser extent IL10, after stimulation with rTSA-1 and rTc24 proteins. Overall, both antigens recalled a broad immune response in some Chagasic patients, confirming that their immune system had been primed against these antigens during natural infection. Analysis of HLA-A and HLA-B allele diversity by PCR-sequencing indicated that HLA-A03 and HLA-B07 were the most frequent supertypes in this Mexican population. Also, there was a significant difference in the frequency of HLA-A01 and HLA-A02 supertypes between Chagasic patients and controls, while the other alleles were evenly distributed. Some aspects of the immune response, such as antigen-induced IFN-γ production by CD4+ and CD8+ T cells and CD8+ proliferation, showed significant association with specific HLA-A supertypes, depending on the antigen considered. In conclusion, our results confirm the ability of both TSA-1 and Tc24 recombinant proteins to recall an immune response induced by the native antigens during natural infection in at least some patients. Our data support the further development of these antigens as therapeutic vaccine against Chagas disease.

The molecular epidemiology of bovine rotaviruses circulating in Iran: a two-year study.

PubMed

Pourasgari, Farzaneh; Kaplon, Jérôme; Karimi-Naghlani, Shahla; Fremy, Céline; Otarod, Vahid; Ambert-Balay, Katia; Mirjalili, Ali; Pothier, Pierre

2016-12-01

Bovine group A rotavirus (bovine RVA) is recognized as a major cause of severe gastroenteritis in newborn calves. The purpose of this study was to estimate the prevalence and identify the genotypes of circulating bovine RVA in newborn diarrheic calves. Two hundred fifty-three stool samples of diarrheic calves up to 1 month old were collected from 42 industrial dairy farms in two Iranian provinces during March 2010 to February 2012. All collected samples were screened for the presence of bovine RVA by RT-PCR, and the G and P genotypes were determined by semi-nested multiplex RT-PCR assay. The results of RT-PCR indicated that 49.4 % (125 out of 253) of the samples were positive for bovine RVA. The G and P genotyping of a subset of positive samples (n = 85) by semi-nested multiplex RT-PCR revealed that G6 (55.3 %) and G10 (43.5 %) and P[5] (51.8 %) and P[11] (27 %) were the most prevalent G and P genotypes, respectively. G6P[5] was the dominant genotype (35.3 %), followed by G10P[5], G10P[11] and G6P[11], with prevalence rates of 16.5 %, 15.3 % and 10.6 %, respectively. Sequence analysis of 20 VP7 and four VP4 genes showed highest nucleotide sequence identity with the corresponding genes of strains RVA/Cow-tc/GBR/UK/1973/G6P7[5] and RVA/Cow-tc/USA/B223/XXXX/G10P[11]. The results of this study reveal the diversity of G and P genotypes in bovine RVA samples from diarrheic Iranian calves and expands our knowledge of bovine RVA infections in the Middle East. These results also highlight the importance of producing of an effective rotavirus vaccine and its inclusion in the national cattle immunization program.

Three novel HBB mutations, c.-140C>G (-90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 -20 bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of β-Thalassemia in Mexican mestizo patients.

PubMed

Rizo-de-la-Torre, L C; Ibarra, B; Sánchez-López, J Y; Magaña-Torres, M T; Rentería-López, V M; Perea-Díaz, F J

2017-10-01

Beta-thalassemia (β-thal) is frequent in Mexican patients with microcytosis and hypochromia. We report three novel mutations and analyze the actual mutational spectrum in Mexican population. One hundred and forty-nine β-thal Mexican mestizo patients were studied (154 alleles). ARMS-PCR was performed to identify Cd39C>T, IVS1:1G>A, IVS1:110G>A, -28A>C, initiation codonA>G and IVS1:5G>A mutations, and gap-PCR for δβ-thal Spanish type. DNA sequencing of HBB gene was carried out in negative samples for the initial screening. Fifteen different HBB gene mutations were observed in 148 alleles; three of them are novel: -90C>G, 20 bp deletion (at codons 78/85), and IVS2:2T>G; the mutation IVS1:6T>C that was observed for first time in our population; and eleven previously described mutations. Six alleles showed normal HBB sequence. To date, a total of 21 different mutations have been observed in Mexican patients; the four most frequent mutations are of Mediterranean origin: Cd39C>T (37.2%), IVS1:1G>A (17.3%), IVS1:110G>A (13.9%), and δβ-thal Spanish type (9.0%), which represent 77.4% of the total studied alleles. Considering the novel mutations -90C>G, -20 bp Cd78/85, IVS2:2T>G and the first observation of IVS1:6T>C, the molecular spectrum of β-thal in Mexicans comprises 21 different mutations, confirming the high allelic heterogeneity in Mexicans. © 2017 John Wiley & Sons Ltd.

Domain organization and phylogenetic analysis of proteins from the chitin deacetylase gene family of Tribolium castaneum and three other species of insects.

PubMed

Dixit, Radhika; Arakane, Yasuyuki; Specht, Charles A; Richard, Chad; Kramer, Karl J; Beeman, Richard W; Muthukrishnan, Subbaratnam

2008-04-01

A bioinformatics investigation of four insect species with annotated genome sequences identified a family of genes encoding chitin deacetylase (CDA)-like proteins, with five to nine members depending on the species. CDAs (EC 3.5.1.41) are chitin-modifying enzymes that deacetylate the beta-1,4-linked N-acetylglucosamine homopolymer. Partial deacetylation forms a heteropolysaccharide that also contains some glucosamine residues, while complete deacetylation produces the homopolymer chitosan, consisting exclusively of glucosamine. The genomes of the red flour beetle, Tribolium castaneum, the fruit fly, Drosophila melanogaster, the malaria mosquito, Anopheles gambiae, and the honey bee, Apis mellifera contain 9, 6, 5 and 5 genes, respectively, that encode proteins with a chitin deacetylase motif. The presence of alternative exons in two of the genes, TcCDA2 and TcCDA5, increases the protein diversity further. Insect CDA-like proteins were classified into five orthologous groups based on phylogenetic analysis and the presence of additional motifs. Group I enzymes include CDA1 and isoforms of CDA2, each containing in addition to a polysaccharide deacetylase-like catalytic domain, a chitin-binding peritrophin-A domain (ChBD) and a low-density lipoprotein receptor class A domain (LDLa). Group II is composed of CDA3 orthologs from each insect species with the same domain organization as group I CDAs, but differing substantially in sequence. Group III includes CDA4s, which have the ChBD domain but do not have the LDLa domain. Group IV comprises CDA5s, which are the largest CDAs because of a very long intervening region separating the ChBD and catalytic domains. Among the four insect species, Tribolium is unique in having four CDA genes in group V, whereas the other insect genomes have either one or none. Most of the CDA-like proteins have a putative signal peptide consistent with their role in modifying extracellular chitin in both cuticle and peritrophic membrane during morphogenesis and molting.

Identifying Wrist Fracture Patients with High Accuracy by Automatic Categorization of X-ray Reports

PubMed Central

de Bruijn, Berry; Cranney, Ann; O’Donnell, Siobhan; Martin, Joel D.; Forster, Alan J.

2006-01-01

The authors performed this study to determine the accuracy of several text classification methods to categorize wrist x-ray reports. We randomly sampled 751 textual wrist x-ray reports. Two expert reviewers rated the presence (n = 301) or absence (n = 450) of an acute fracture of wrist. We developed two information retrieval (IR) text classification methods and a machine learning method using a support vector machine (TC-1). In cross-validation on the derivation set (n = 493), TC-1 outperformed the two IR based methods and six benchmark classifiers, including Naive Bayes and a Neural Network. In the validation set (n = 258), TC-1 demonstrated consistent performance with 93.8% accuracy; 95.5% sensitivity; 92.9% specificity; and 87.5% positive predictive value. TC-1 was easy to implement and superior in performance to the other classification methods. PMID:16929046

Simulating seasonal tropical cyclone intensities at landfall along the South China coast

NASA Astrophysics Data System (ADS)

Lok, Charlie C. F.; Chan, Johnny C. L.

2018-04-01

A numerical method is developed using a regional climate model (RegCM3) and the Weather Forecast and Research (WRF) model to predict seasonal tropical cyclone (TC) intensities at landfall for the South China region. In designing the model system, three sensitivity tests have been performed to identify the optimal choice of the RegCM3 model domain, WRF horizontal resolution and WRF physics packages. Driven from the National Centers for Environmental Prediction Climate Forecast System Reanalysis dataset, the model system can produce a reasonable distribution of TC intensities at landfall on a seasonal scale. Analyses of the model output suggest that the strength and extent of the subtropical ridge in the East China Sea are crucial to simulating TC landfalls in the Guangdong and Hainan provinces. This study demonstrates the potential for predicting TC intensities at landfall on a seasonal basis as well as projecting future climate changes using numerical models.

A C. elegans homolog for the UV-hypersensitivity syndrome disease gene UVSSA.

PubMed

Babu, Vipin; Schumacher, Björn

2016-05-01

The transcription-coupled repair pathway (TC-NER) plays a vital role in removing transcription-blocking DNA lesions, particularly UV-induced damage. Clinical symptoms of the two TC-NER-deficiency syndromes, Cockayne syndrome (CS) and UV-hypersensitivity syndrome (UVSS) are dissimilar and the underlying molecular mechanism causing this difference in disease pathology is not yet clearly understood. UV-stimulated scaffold protein A (UVSSA) has been identified recently as a new causal gene for UVSS. Here we describe a functional homolog of the human UVSSA gene in the nematode Caenorhabditis elegans, uvs-1 (UVSSA-like-1). Mutations in uvs-1 render the animals hypersensitive to UV-B irradiation and transcription-blocking lesion-inducing illudin-M, similar to mutations in TC-NER deficient mutants. Moreover, we demonstrate that TC-NER factors including UVS-1 are required for the survival of the adult animals after UV-treatment. Copyright © 2016 Elsevier B.V. All rights reserved.

Collective stimulated Brillouin backscatter

NASA Astrophysics Data System (ADS)

Lushnikov, Pavel; Rose, Harvey

2007-11-01

We develop the statistical theory of linear collective stimulated Brillouin backscatter (CBSBS) in spatially and temporally incoherent laser beam. Instability is collective because it does not depend on the dynamics of isolated hot spots (speckles) of laser intensity, but rather depends on averaged laser beam intensity, optic f/#, and laser coherence time, Tc. CBSBS has a much larger threshold than a classical coherent beam's in long-scale-length high temperature plasma. It is a novel regime in which Tc is too large for applicability of well-known statistical theories (RPA) but Tc must be small enough to suppress single speckle processes such as self-focusing. Even if laser Tc is too large for a priori applicability of our theory, collective forward SBS^1, perhaps enhanced by high Z dopant, and its resultant self-induced Tc reduction, may regain the CBSBS regime. We identified convective and absolute CBSBS regimes. The threshold of convective instability is inside the typical parameter region of NIF designs. Well above incoherent threshold, the coherent instability growth rate is recovered. ^1 P.M. Lushnikov and H.A. Rose, Plasma Physics and Controlled Fusion, 48, 1501 (2006).

Emergence of superconductivity in heavy-electron materials

PubMed Central

Yang, Yi-feng; Pines, David

2014-01-01

Although the pairing glue for the attractive quasiparticle interaction responsible for unconventional superconductivity in heavy-electron materials has been identified as the spin fluctuations that arise from their proximity to a magnetic quantum critical point, there has been no model to describe their superconducting transition at temperature Tc that is comparable to that found by Bardeen, Cooper, and Schrieffer (BCS) for conventional superconductors, where phonons provide the pairing glue. Here we propose such a model: a phenomenological BCS-like expression for Tc in heavy-electron materials that is based on a simple model for the effective range and strength of the spin-fluctuation-induced quasiparticle interaction and reflects the unusual properties of the heavy-electron normal state from which superconductivity emerges. We show that it provides a quantitative understanding of the pressure-induced variation of Tc in the “hydrogen atoms” of unconventional superconductivity, CeCoIn5 and CeRhIn5, predicts scaling behavior and a dome-like structure for Tc in all heavy-electron quantum critical superconductors, provides unexpected connections between members of this family, and quantifies their variations in Tc with a single parameter. PMID:25489102

The pathogenesis-related protein PR-4b from Theobroma cacao presents RNase activity, Ca(2+) and Mg(2+) dependent-DNase activity and antifungal action on Moniliophthora perniciosa.

PubMed

Pereira Menezes, Sara; de Andrade Silva, Edson Mario; Matos Lima, Eline; Oliveira de Sousa, Aurizângela; Silva Andrade, Bruno; Santos Lima Lemos, Livia; Peres Gramacho, Karina; da Silva Gesteira, Abelmon; Pirovani, Carlos Priminho; Micheli, Fabienne

2014-06-11

The production and accumulation of pathogenesis-related proteins (PR proteins) in plants in response to biotic or abiotic stresses is well known and is considered as a crucial mechanism for plant defense. A pathogenesis-related protein 4 cDNA was identified from a cacao-Moniliophthora perniciosa interaction cDNA library and named TcPR-4b. TcPR-4b presents a Barwin domain with six conserved cysteine residues, but lacks the chitin-binding site. Molecular modeling of TcPR-4b confirmed the importance of the cysteine residues to maintain the protein structure, and of several conserved amino acids for the catalytic activity. In the cacao genome, TcPR-4b belonged to a small multigene family organized mainly on chromosome 5. TcPR-4b RT-qPCR analysis in resistant and susceptible cacao plants infected by M. perniciosa showed an increase of expression at 48 hours after infection (hai) in both cacao genotypes. After the initial stage (24-72 hai), the TcPR-4b expression was observed at all times in the resistant genotypes, while in the susceptible one the expression was concentrated at the final stages of infection (45-90 days after infection). The recombinant TcPR-4b protein showed RNase, and bivalent ions dependent-DNase activity, but no chitinase activity. Moreover, TcPR-4b presented antifungal action against M. perniciosa, and the reduction of M. perniciosa survival was related to ROS production in fungal hyphae. To our knowledge, this is the first report of a PR-4 showing simultaneously RNase, DNase and antifungal properties, but no chitinase activity. Moreover, we showed that the antifungal activity of TcPR-4b is directly related to RNase function. In cacao, TcPR-4b nuclease activities may be related to the establishment and maintenance of resistance, and to the PCD mechanism, in resistant and susceptible cacao genotypes, respectively.

Expressional and functional analysis of CYP15A1, a juvenile hormone epoxidase, in the red flour beetle Tribolium castaneum.

PubMed

Minakuchi, Chieka; Ishii, Fumika; Washidu, Yumiko; Ichikawa, Akio; Tanaka, Toshiharu; Miura, Ken; Shinoda, Tetsuro

2015-09-01

Juvenile hormone (JH) is synthesized and secreted by the corpora allata. In the final two steps of JH biosynthesis, farnesoic acid (FA) is converted to JH through methylation by JH acid O-methyltransferase (JHAMT) and epoxidation by the cytochrome P450 enzyme CYP15. In the present study, we identified a homolog of CYP15 from the red flour beetle Tribolium castaneum (TcCYP15A1), and analyzed its expression as well as its role in JH biosynthesis. Quantitative RT-PCR analysis showed that the level of TcCYP15A1 mRNA was high in the embryonic stage as well as in the middle of the final larval instar. In the embryonic stage, the transcript level of TcCYP15A1 started to increase 30h after egg laying (AEL), peaked 54-60h AEL, and was followed by an increase of TcJHAMT mRNA, suggesting that JH biosynthesis started at this time point. TcCYP15A1 mRNA was present, but not exclusively so in the larval corpora allata. The recombinant TcCYP15A1 protein epoxidized both FA and methyl farnesoate (MF) in highly stereo-specific manners. These results confirmed that TcCYP15A1 is involved in JH biosynthesis. The RNAi-mediated knockdown of TcCYP15A1 in the pre-final larval instar did not result in precocious metamorphosis to pupa, indicating that MF may exhibit JH-like activity in order to maintain the larval status. The double knockdown of TcJHAMT and TcCYP15A1 resulted in pupae and adults with shorter wings, suggesting that the precursors of JH, JH acid and MF, may be essential for wing expansion. Copyright © 2015 Elsevier Ltd. All rights reserved.

Lineage Analysis of Circulating Trypanosoma cruzi Parasites and Their Association with Clinical Forms of Chagas Disease in Bolivia

PubMed Central

del Puerto, Ramona; Nishizawa, Juan Eiki; Kikuchi, Mihoko; Iihoshi, Naomi; Roca, Yelin; Avilas, Cinthia; Gianella, Alberto; Lora, Javier; Gutierrez Velarde, Freddy Udalrico; Renjel, Luis Alberto; Miura, Sachio; Higo, Hiroo; Komiya, Norihiro; Maemura, Koji; Hirayama, Kenji

2010-01-01

Background The causative agent of Chagas disease, Trypanosoma cruzi, is divided into 6 Discrete Typing Units (DTU): Tc I, IIa, IIb, IIc, IId and IIe. In order to assess the relative pathogenicities of different DTUs, blood samples from three different clinical groups of chronic Chagas disease patients (indeterminate, cardiac, megacolon) from Bolivia were analyzed for their circulating parasites lineages using minicircle kinetoplast DNA polymorphism. Methods and Findings Between 2000 and 2007, patients sent to the Centro Nacional de Enfermedades Tropicales for diagnosis of Chagas from clinics and hospitals in Santa Cruz, Bolivia, were assessed by serology, cardiology and gastro-intestinal examinations. Additionally, patients who underwent colonectomies due to Chagasic magacolon at the Hospital Universitario Japonés were also included. A total of 306 chronic Chagas patients were defined by their clinical types (81 with cardiopathy, 150 without cardiopathy, 100 with megacolon, 144 without megacolon, 164 with cardiopathy or megacolon, 73 indeterminate and 17 cases with both cardiopathy and megacolon). DNA was extracted from 10 ml of peripheral venous blood for PCR analysis. The kinetoplast minicircle DNA (kDNA) was amplified from 196 out of 306 samples (64.1%), of which 104 (53.3%) were Tc IId, 4 (2.0%) Tc I, 7 (3.6%) Tc IIb, 1 (0.5%) Tc IIe, 26 (13.3%) Tc I/IId, 1 (0.5%) Tc I/IIb/IId, 2 (1.0%) Tc IIb/d and 51 (25.9%) were unidentified. Of the 133 Tc IId samples, three different kDNA hypervariable region patterns were detected; Mn (49.6%), TPK like (48.9%) and Bug-like (1.5%). There was no significant association between Tc types and clinical manifestations of disease. Conclusions None of the identified lineages or sublineages was significantly associated with any particular clinical manifestations in the chronic Chagas patients in Bolivia. PMID:20502516

Development of peptide-based lineage-specific serology for chronic Chagas disease: geographical and clinical distribution of epitope recognition.

PubMed

Bhattacharyya, Tapan; Falconar, Andrew K; Luquetti, Alejandro O; Costales, Jaime A; Grijalva, Mario J; Lewis, Michael D; Messenger, Louisa A; Tran, Trang T; Ramirez, Juan-David; Guhl, Felipe; Carrasco, Hernan J; Diosque, Patricio; Garcia, Lineth; Litvinov, Sergey V; Miles, Michael A

2014-05-01

Chagas disease, caused by infection with the protozoan Trypanosoma cruzi, remains a serious public health issue in Latin America. Genetically diverse, the species is sub-divided into six lineages, known as TcI-TcVI, which have disparate geographical and ecological distributions. TcII, TcV, and TcVI are associated with severe human disease in the Southern Cone countries, whereas TcI is associated with cardiomyopathy north of the Amazon. T. cruzi persists as a chronic infection, with cardiac and/or gastrointestinal symptoms developing years or decades after initial infection. Identifying an individual's history of T. cruzi lineage infection directly by genotyping of the parasite is complicated by the low parasitaemia and sequestration in the host tissues. We have applied here serology against lineage-specific epitopes of the T. cruzi surface antigen TSSA, as an indirect approach to allow identification of infecting lineage. Chagasic sera from chronic patients from a range of endemic countries were tested by ELISA against synthetic peptides representing lineage-specific TSSA epitopes bound to avidin-coated ELISA plates via a biotin labelled polyethylene glycol-glycine spacer to increase rotation and ensure each amino acid side chain could freely interact with their antibodies. 79/113 (70%) of samples from Brazil, Bolivia, and Argentina recognised the TSSA epitope common to lineages TcII/TcV/TcVI. Comparison with clinical information showed that a higher proportion of Brazilian TSSApep-II/V/VI responders had ECG abnormalities than non-responders (38% vs 17%; p<0.0001). Among northern chagasic sera 4/20 (20%) from Ecuador reacted with this peptide; 1/12 Venezuelan and 1/34 Colombian samples reacted with TSSApep-IV. In addition, a proposed TcI-specific epitope, described elsewhere, was demonstrated here to be highly conserved across lineages and therefore not applicable to lineage-specific serology. These results demonstrate the considerable potential for synthetic peptide serology to investigate the infection history of individuals, geographical and clinical associations of T. cruzi lineages.

Paleoseismic observations along the Langshan range-front fault, Hetao Basin, China: Tectonic and seismic implications

NASA Astrophysics Data System (ADS)

Dong, Shaopeng; Zhang, Peizhen; Zheng, Wenjun; Yu, Zhongyuan; Lei, Qiyun; Yang, Huili; Liu, Jinfeng; Gong, Huilin

2018-04-01

The Langshan range-front fault (LRF) is an active Holocene normal fault that borders Langshan Mountain and the Hetao Basin, northwest of the Ordos Plateau, China. In this study, paleoseismic trenching was undertaken at three sites (North-South): Dongshen village (TC1), Qingshan (TC2), and Wulanhashao (TC3). The paleoevents ED1, ED2, ED3 from TC1 were constrained to 6.0 ± 1.3, 9.6 ± 2.0, and 19.7 ± 4.2 ka, respectively. The single paleoevent (EQ1) from TC2 was constrained to about 6.7 ± 0.1 ka, and the paleoevents EW1, EW2, and EW3 from TC3 were constrained to 2.3 ± 0.4, 6.0 ± 1.0, and before 7.0 ka, respectively. With reference to previous research, the Holocene earthquake sequence of the LRF can be established as 2.30-2.43 (E1), 3.06-4.41 (E2), 6.71-6.80 (E3), 7.60-9.81 (E4), and 19.70 ± 4.20 (E5) ka BP. Events E1, E3, and E4 might have been caused by events with magnitudes of Mw 7.6-7.8 that ruptured the entire LRF. Event E2 might have been smaller magnitude, about M7.0, and ruptured only a portion of the fault. The vertical slip rate of the LRF at the Qingshan site is inferred as 0.9 or 1.4-1.6 mm/year in the last 6.8 ka. The slip rate at Wulanhashao is considered to have been close to, but not <0.66 mm/year since 15 ka BP. We deem the LRF is an unsegmented active fault. Although the possibility of missing events in Late Pleistocene can not be dismissed, we argue the Holocene paleoearthquake history is complete, indicating an average recurrence interval of 2500 years.

ESR1 and ESR2 polymorphisms in the BIG 1-98 trial comparing adjuvant letrozole versus tamoxifen or their sequence for early breast cancer.

PubMed

Leyland-Jones, Brian; Gray, Kathryn P; Abramovitz, Mark; Bouzyk, Mark; Young, Brandon; Long, Bradley; Kammler, Roswitha; Dell'Orto, Patrizia; Biasi, Maria Olivia; Thürlimann, Beat; Harvey, Vernon; Neven, Patrick; Arnould, Laurent; Maibach, Rudolf; Price, Karen N; Coates, Alan S; Goldhirsch, Aron; Gelber, Richard D; Pagani, Olivia; Viale, Giuseppe; Rae, James M; Regan, Meredith M

2015-12-01

Estrogen receptor 1 (ESR1) and ESR2 gene polymorphisms have been associated with endocrine-mediated physiological mechanisms, and inconsistently with breast cancer risk and outcomes, bone mineral density changes, and hot flushes/night sweats. DNA was isolated and genotyped for six ESR1 and two ESR2 single-nucleotide polymorphisms (SNPs) from tumor specimens from 3691 postmenopausal women with hormone receptor-positive breast cancer enrolled in the BIG 1-98 trial to receive tamoxifen and/or letrozole for 5 years. Associations with recurrence and adverse events (AEs) were assessed using Cox proportional hazards models. 3401 samples were successfully genotyped for five SNPs. ESR1 rs9340799(XbaI) (T>C) variants CC or TC were associated with reduced breast cancer risk (HR = 0.82,95% CI = 0.67-1.0), and ESR1 rs2077647 (T>C) variants CC or TC was associated with reduced distant recurrence risk (HR = 0.69, 95% CI = 0.53-0.90), both regardless of the treatments. No differential treatment effects (letrozole vs. tamoxifen) were observed for the association of outcome with any of the SNPs. Letrozole-treated patients with rs2077647 (T>C) variants CC and TC had a reduced risk of bone AE (HR = 0.75, 95% CI = 0.58-0.98, P interaction = 0.08), whereas patients with rs4986938 (G>A) genotype variants AA and AG had an increased risk of bone AE (HR = 1.37, 95% CI = 1.01-1.84, P interaction = 0.07). We observed that (1) rare ESR1 homozygous polymorphisms were associated with lower recurrence, and (2) ESR1 and ESR2 SNPs were associated with bone AEs in letrozole-treated patients. Genes that are involved in estrogen signaling and synthesis have the potential to affect both breast cancer recurrence and side effects, suggesting that individual treatment strategies can incorporate not only oncogenic drivers but also SNPs related to estrogen activity.

Oxidative generation of guanine radicals by carbonate radicals and their reactions with nitrogen dioxide to form site specific 5-guanidino-4-nitroimidazole lesions in oligodeoxynucleotides.

PubMed

Joffe, Avrum; Mock, Steven; Yun, Byeong Hwa; Kolbanovskiy, Alexander; Geacintov, Nicholas E; Shafirovich, Vladimir

2003-08-01

A simple photochemical approach is described for synthesizing site specific, stable 5-guanidino-4-nitroimidazole (NIm) adducts in single- and double-stranded oligodeoxynucleotides containing single and multiple guanine residues. The DNA sequences employed, 5'-d(ACC CG(1)C G(2)TC CG(3)C G(4)CC) and 5'-d(ACC CG(1)C G(2)TC C), were a portion of exon 5 of the p53 tumor suppressor gene, including the codons 157 (G(2)) and 158 (G(3)) mutation hot spots in the former sequence with four Gs and the codon 157 (G(2)) mutation hot spot in the latter sequence with two Gs. The nitration of oligodeoxynucleotides was initiated by the selective photodissociation of persulfate anions to sulfate radicals induced by UV laser pulses (308 nm). In aqueous solutions, of bicarbonate and nitrite anions, the sulfate radicals generate carbonate anion radicals and nitrogen dioxide radicals by one electron oxidation of the respective anions. The guanine residue in the oligodeoxynucleotide is oxidized by the carbonate anion radical to form the neutral guanine radical. While the nitrogen dioxide radicals do not react with any of the intact DNA bases, they readily combine with the guanine radicals at either the C8 or the C5 positions. The C8 addition generates the well-known 8-nitroguanine (8-nitro-G) lesions, whereas the C5 attack produces unstable adducts, which rapidly decompose to NIm lesions. The maximum yields of the nitro products (NIm + 8-nitro-G) were typically in the range of 20-40%, depending on the number of guanine residues in the sequence. The ratio of the NIm to 8-nitro-G lesions gradually decreases from 3.4 in the model compound, 2',3',5'-tri-O-acetylguanosine, to 2.1-2.6 in the single-stranded oligodeoxynucleotides and to 0.8-1.1 in the duplexes. The adduct of the 5'-d(ACC CG(1)C G(2)TC C) oligodeoxynucleotide containing the NIm lesion in codon 157 (G(2)) was isolated in HPLC-pure form. The integrity of this adduct was established by a detailed analysis of exonuclease digestion ladders by matrix-assisted laser desorption ionization with time-of-flight detection MS techniques.

Diversity of the causal genes in hearing impaired Algerian individuals identified by whole exome sequencing

PubMed Central

Ammar-Khodja, Fatima; Bonnet, Crystel; Dahmani, Malika; Ouhab, Sofiane; Lefèvre, Gaelle M; Ibrahim, Hassina; Hardelin, Jean-Pierre; Weil, Dominique; Louha, Malek; Petit, Christine

2015-01-01

The genetic heterogeneity of congenital hearing disorders makes molecular diagnosis expensive and time-consuming using conventional techniques such as Sanger sequencing of DNA. In order to design an appropriate strategy of molecular diagnosis in the Algerian population, we explored the diversity of the involved mutations by studying 65 families affected by autosomal recessive forms of nonsyndromic hearing impairment (DFNB forms), which are the most prevalent early onset forms. We first carried out a systematic screening for mutations in GJB2 and the recurrent p.(Arg34*) mutation in TMC1, which were found in 31 (47.7%) families and 1 (1.5%) family, respectively. We then performed whole exome sequencing in nine of the remaining families, and identified the causative mutations in all the patients analyzed, either in the homozygous state (eight families) or in the compound heterozygous state (one family): (c.709C>T: p.(Arg237*)) and (c.2122C>T: p.(Arg708*)) in OTOF, (c.1334T>G: p.(Leu445Trp)) in SLC26A4, (c.764T>A: p.(Met255Lys)) in GIPC3, (c.518T>A: p.(Cys173Ser)) in LHFPL5, (c.5336T>C: p.(Leu1779Pro)) in MYO15A, (c.1807G>T: p.(Val603Phe)) in OTOA, (c.6080dup: p.(Asn2027Lys*9)) in PTPRQ, and (c.6017del: p.(Gly2006Alafs*13); c.7188_7189ins14: p.(Val2397Leufs*2)) in GPR98. Notably, 7 of these 10 mutations affecting 8 different genes had not been reported previously. These results highlight for the first time the genetic heterogeneity of the early onset forms of nonsyndromic deafness in Algerian families. PMID:26029705

A novel COL4A3 mutation causes autosomal-recessive Alport syndrome in a large Turkish family.

PubMed

Uzak, Asli Subasioglu; Tokgoz, Bulent; Dundar, Munis; Tekin, Mustafa

2013-03-01

Alport syndrome (AS) is a genetically heterogeneous disorder that is characterized by hematuria, progressive renal failure typically resulting in end-stage renal disease, sensorineural hearing loss, and variable ocular abnormalities. Only 15% of cases with AS are autosomal recessive and are caused by mutations in the COL4A3 or COL4A4 genes, encoding type IV collagen. Clinical data in a large consanguineous family with four affected members were reviewed, and genomic DNA was extracted. For mapping, 15 microsatellite markers flanking COL4A3, COL4A4, and COL4A5 in 16 family members were typed. For mutation screening, all coding exons of COL4A3 were polymerase chain reaction- amplified and Sanger-sequenced from genomic DNA. The disease locus was mapped to chromosome 2q36.3, where COL4A3 and COL4A4 reside. Sanger sequencing revealed a novel mis-sense mutation (c.2T>C; p.M1T) in exon 1 of COL4A3. The identified nucleotide change was not found in 100 healthy ethnicity-matched controls via Sanger sequencing. We present a large consanguineous Turkish family with AS that was found to have a COL4A3 mutation as the cause of the disease. Although the relationship between the various genotypes and phenotypes in AS has not been fully elucidated, detailed clinical and molecular analyses are helpful for providing data to be used in genetic counseling. It is important to identify new mutations to clarify their clinical importance, to assess the prognosis of the disease, and to avoid renal biopsy for final diagnosis.

Surface characterization of modern resin composites: a multitechnique approach.

PubMed

Silikas, Nick; Kavvadia, Katerina; Eliades, George; Watts, David

2005-04-01

To characterize the surface properties of some modern resin composites employing a series of physicochemical methods. Specimens from three microhybrid (Palfique Estellite-PE, Z250 Filtek-ZF, Tetric Ceram-TC) and one nanofilled (Supreme Filtek-SF) conventionally photo-cured resin composites polished with Soflex disks were studied for the following properties: Surface chemical composition and degree of C=C conversion (FTIR), surface energetics (contact angles), surface texture (AFM), surface roughness (AFM, stylus profilometry) and gloss (60 degrees-, 20 degrees-angle specular gloss). Polar and non polar molecular groups were identified in all products including NH and CONH (SF, ZF, TC). SF and ZF demonstrated higher conversion than PE and TC (P< 0.05). No significant differences (P> 0.05) were found in critical surface tension, total work of adhesion and its polar and dispersion components, the latter being the highest in all products. AFM showed the smoothest surface texture in PE. The ranking of Sa, Sq, Ra and Rz roughness parameters was PEZF>TC, P< 0.05) were more sensitive than 60 degree-angle measurements (PE, SF>TC, P< 0.05) in revealing gloss differences. A positive correlation was found between Sa and Ra and a negative one between Sa and 20 degree-angle gloss.

Influence of proton-pump inhibitors on stomach wall uptake of 99mTc-tetrofosmin in cadmium-zinc-telluride SPECT myocardial perfusion imaging.

PubMed

Mouden, Mohamed; Rijkee, Karlijn S; Schreuder, Nanno; Timmer, Jorik R; Jager, Pieter L

2015-02-01

Proton-pump inhibitors (PPIs) induce potentially interfering stomach wall activity in single-photon emission computed tomography myocardial perfusion imaging (SPECT-MPI) with technetium-99m ((99m)Tc)-sestamibi. However, no data are available for (99m)Tc-tetrofosmin. We assessed the influence of prolonged (>2 weeks) PPI use on the stomach wall uptake of (99m)Tc-tetrofosmin in patients referred for stress MPI with a cadmium-zinc-telluride-based SPECT camera and its relation with dyspepsia symptoms. Consecutive patients (n=127) underwent a 1-day adenosine stress-first SPECT-MPI with (99m)Tc-tetrofosmin, of whom 54 (43%) patients had been on PPIs for more than 2 weeks. Stomach wall activity was identified on stress SPECT using computed tomographic attenuation maps and was scored using a four-point grading scale into clinically relevant (scores 2 or 3) or nonrelevant (scores 0 or 1).Patients on PPIs had stomach wall uptake more frequently as compared with patients not using PPIs (22 vs. 7%, P=0.017). Dyspepsia was similar in both groups. Prolonged use of PPIs is associated with stomach wall uptake of (99m)Tc-tetrofosmin in stress cadmium-zinc-telluride-SPECT images. Gastric symptoms were not associated with stomach wall uptake.

Characterization of the legumains encoded by the genome of Theobroma cacao L.

PubMed

Santana, Juliano Oliveira; Freire, Laís; de Sousa, Aurizangela Oliveira; Fontes Soares, Virgínia Lúcia; Gramacho, Karina Peres; Pirovani, Carlos Priminho

2016-01-01

Legumains are cysteine proteases related to plant development, protein degradation, programmed cell death, and defense against pathogens. In this study, we have identified and characterized three legumains encoded by Theobroma cacao genome through in silico analyses, three-dimensional modeling, genetic expression pattern in different tissues and as a response to the inoculation of Moniliophthora perniciosa fungus. The three proteins were named TcLEG3, TcLEG6, and TcLEG9. Histidine and cysteine residue which are part of the catalytic site were conserved among the proteins, and they remained parallel in the loop region in the 3D modeling. Three-dimensional modeling showed that the propeptide, which is located in the terminal C region of legumains blocks the catalytic cleft. Comparing dendrogram data with the relative expression analysis, indicated that TcLEG3 is related to the seed legumain group, TcLEG6 is related with the group of embryogenesis activities, and protein TcLEG9, with processes regarding the vegetative group. Furthermore, the expression analyses proposes a significant role for the three legumains during the development of Theobroma cacao and in its interaction with M. perniciosa. Copyright © 2015 Universidade Estadual de Santa Cruz, CNPJ: 40738999/0001-95. Published by Elsevier Masson SAS.. All rights reserved.

Gene structure, phylogeny and expression profile of the sucrose synthase gene family in cacao (Theobroma cacao L.).

PubMed

Li, Fupeng; Hao, Chaoyun; Yan, Lin; Wu, Baoduo; Qin, Xiaowei; Lai, Jianxiong; Song, Yinghui

2015-09-01

In higher plants, sucrose synthase (Sus, EC 2.4.1.13) is widely considered as a key enzyme involved in sucrose metabolism. Although, several paralogous genes encoding different isozymes of Sus have been identified and characterized in multiple plant genomes, to date detailed information about the Sus genes is lacking for cacao. This study reports the identification of six novel Sus genes from economically important cacao tree. Analyses of the gene structure and phylogeny of the Sus genes demonstrated evolutionary conservation in the Sus family across cacao and other plant species. The expression of cacao Sus genes was investigated via real-time PCR in various tissues, different developmental phases of leaf, flower bud and pod. The Sus genes exhibited distinct but partially redundant expression profiles in cacao, with TcSus1, TcSus5 and TcSus6, being the predominant genes in the bark with phloem, TcSus2 predominantly expressing in the seed during the stereotype stage. TcSus3 and TcSus4 were significantly detected more in the pod husk and seed coat along the pod development, and showed development dependent expression profiles in the cacao pod. These results provide new insights into the evolution, and basic information that will assist in elucidating the functions of cacao Sus gene family.

Caudal Regulates the Spatiotemporal Dynamics of Pair-Rule Waves in Tribolium

PubMed Central

El-Sherif, Ezzat; Zhu, Xin; Fu, Jinping; Brown, Susan J.

2014-01-01

In the short-germ beetle Tribolium castaneum, waves of pair-rule gene expression propagate from the posterior end of the embryo towards the anterior and eventually freeze into stable stripes, partitioning the anterior-posterior axis into segments. Similar waves in vertebrates are assumed to arise due to the modulation of a molecular clock by a posterior-to-anterior frequency gradient. However, neither a molecular candidate nor a functional role has been identified to date for such a frequency gradient, either in vertebrates or elsewhere. Here we provide evidence that the posterior gradient of Tc-caudal expression regulates the oscillation frequency of pair-rule gene expression in Tribolium. We show this by analyzing the spatiotemporal dynamics of Tc-even-skipped expression in strong and mild knockdown of Tc-caudal, and by correlating the extension, level and slope of the Tc-caudal expression gradient to the spatiotemporal dynamics of Tc-even-skipped expression in wild type as well as in different RNAi knockdowns of Tc-caudal regulators. Further, we show that besides its absolute importance for stripe generation in the static phase of the Tribolium blastoderm, a frequency gradient might serve as a buffer against noise during axis elongation phase in Tribolium as well as vertebrates. Our results highlight the role of frequency gradients in pattern formation. PMID:25329152

Cloning, expression, cellular distribution, and role in chemotaxis of a C5a receptor in rainbow trout: the first identification of a C5a receptor in a nonmammalian species

USGS Publications Warehouse

Boshra, Hani; Li, Jun; Peters, Rodney; Hansen, John; Matlapudi, Anjan; Sunyer, J. Oriol

2004-01-01

C3a, C4a, and C5a anaphylatoxins generated during complement activation play a key role in inflammation. C5a is the most potent of the three anaphylatoxins in eliciting biological responses. The effects of C5a are mediated by its binding to C5a receptor (C5aR, CD88). To date, C5aR has only been identified and cloned in mammalian species, and its evolutionary history remains ill-defined. To gain insights into the evolution, conserved structural domains, and functions of C5aR, we have cloned and characterized a C5aR in rainbow trout, a teleost fish. The isolated cDNA encoded a 350-aa protein that showed the highest sequence similarity to C5aR from other species. Genomic analysis revealed the presence of one continuous exon encoding the entire open reading frame. Northern blot analysis showed significant expression of the trout C5a receptor (TC5aR) message in PBLs and kidney. Flow cytometric analysis showed that two Abs generated against two different areas of the extracellular N-terminal region of TC5aR positively stained the same leukocyte populations from PBLs. B lymphocytes and granulocytes comprised the majority of cells recognized by the anti-TC5aR. More importantly, these Abs inhibited chemotaxis of PBLs toward a chemoattractant fraction purified from complement-activated trout serum. Our data suggest that the split between C5aR and C3aR from a common ancestral molecule occurred before the emergence of teleost fish. Moreover, we demonstrate that the overall structure of C5aR as well as its role in chemotaxis have remained conserved for >300 million years.

Two variants in the resistin gene and the response to long-term overfeeding.

PubMed

Ukkola, O; Kesäniemi, Y Antero; Tremblay, A; Bouchard, C

2004-04-01

To investigate the role of resistin gene variants on the adiposity and metabolic changes observed in response to a 100-day overfeeding protocol conducted with 12 pairs of monozygotic twins. Body-fat measurements included hydrodensitometry and abdominal fat from computed tomography. Plasma glucose and insulin during fasting and in response to an oral glucose tolerance test (OGTT) were assayed. A 4.2 MJ test meal was consumed, after which calorimetric measurements were performed for 240 min. Respiratory quotient (RQ) decreased (P=0.001) more in AA/AG than in GG subjects of the IVS2+181G>A polymorphism after the caloric surplus and the significance persisted when correction for multiple testing was performed. Total abdominal (P=0.027) and visceral (P=0.004) fat increased more in TC than in TT subjects of the IVS2+39C>T polymorphism. In response to overfeeding, glucose area under the curve during the OGTT showed a slight decrease (P=0.031) in the TC while it increased in TT subjects. OGTT insulin area tended to increase less (P=0.055) in TC than in TT subjects. After overfeeding, fasting insulin was lower in TC than in TT subjects (P=0.010). In addition, TC subjects experienced more decrease in RQ than TT subjects (P=0.034). The IVS2+181G>A variant was associated with the changes in RQ in response to overfeeding. The IVS2+39C>T polymorphism was associated with overfeeding-induced changes in abdominal visceral fat, OGTT glucose area and RQ. The results suggest that sequence variation in the resistin gene is involved in the adaptation to chronic positive energy balance.

Diversity of Culturable Psychrophilic and Psychrotrophic Anaerobic Bacteria Isolated from Beef Abattoirs and Their Environments ▿

PubMed Central

Moschonas, G.; Bolton, D. J.; McDowell, D. A.; Sheridan, J. J.

2011-01-01

This study identified 431 psychrophilic or psychrotrophic isolates from commercial Irish beef abattoir environments and “blown packs” of vacuum-packed beef, using PCR and 16S rRNA sequencing, and estimated their intraspecies genetic diversity using restriction fragment length polymorphism (RFLP) analysis and spacer region PCR (SR-PCR). Twenty-five species were identified in the 431 isolates, with the most frequently recovered species being Clostridium gasigenes (n = 315), Clostridium estertheticum (n = 17), and a potentially novel species designated strain TC1 (n = 52). These species were previously found to be associated with a particular type of spoilage known as blown-pack spoilage (BPS), which occurs in chilled-stored (i.e., −1.5°C to 4°C) vacuum-packaged meat within 2 to 4 weeks and involves the production of large volumes of gas. Overall, the study demonstrates the considerable and not previously reported diversity of the anaerobic microflora in abattoirs and the presence of a wide range of organisms capable of causing BPS at chilled temperatures. PMID:21498765

Leveraging LSTM for rapid intensifications prediction of tropical cyclones

NASA Astrophysics Data System (ADS)

Li, Y.; Yang, R.; Yang, C.; Yu, M.; Hu, F.; Jiang, Y.

2017-10-01

Tropical cyclones (TCs) usually cause severe damages and destructions. TC intensity forecasting helps people prepare for the extreme weather and could save lives and properties. Rapid Intensifications (RI) of TCs are the major error sources of TC intensity forecasting. A large number of factors, such as sea surface temperature and wind shear, affect the RI processes of TCs. Quite a lot of work have been done to identify the combination of conditions most favorable to RI. In this study, deep learning method is utilized to combine conditions for RI prediction of TCs. Experiments show that the long short-term memory (LSTM) network provides the ability to leverage past conditions to predict TC rapid intensifications.

Structure and Properties of fac-[Re(I)(CO)3(NTA)](2-) (NTA(3-) = Trianion of Nitrilotriacetic Acid) and fac-[Re(I)(CO)3(L)](n-) Analogues Useful for Assessing the Excellent Renal Clearance of the fac-[(99m)Tc(I)(CO)3(NTA)](2-) Diagnostic Renal Agent.

PubMed

Klenc, Jeffrey; Lipowska, Malgorzata; Abhayawardhana, Pramuditha L; Taylor, Andrew T; Marzilli, Luigi G

2015-07-06

We previously identified two new agents based on the [(99m)Tc(V)O](3+) core with renal clearances in human volunteers 30% higher than that of the widely used clinical tracer (99m)Tc-MAG3 (MAG3(5-) = penta-anion of mercaptoacetyltriglycine). However, renal agents with even higher clearances are needed. More recently, we changed our focus from the [(99m)Tc(V)O](3+) core to the discovery of superior tracers based on the fac-[(99m)Tc(I)(CO)3](+) core. Compared to (99m)Tc-MAG3, fac-[(99m)Tc(I)(CO)3(NTA)](2-) (NTA(3-) = trianion of nitrilotriacetic acid) holds great promise by virtue of its efficient renal clearance via tubular secretion and the absence of hepatobiliary elimination, even in patients with severely reduced renal function. We report here NMR, molecular (X-ray) structure, and solution data on fac-[Re(I)(CO)3(NTA)](2-) with a -CH2CO2(-) dangling monoanionic chain and on two fac-[Re(I)(CO)3(L)](-) analogues with either a -CH2CONH2 or a -CH2CH2OH dangling neutral chain. In these three fac-[Re(I)(CO)3(L)](n-) complexes, the fac-[Re(I)(CO)3(N(CH2CO2)2)](-) moiety is structurally similar and has similar electronic properties (as assessed by NMR data). In reported and ongoing studies, the two fac-[(99m)Tc(I)(CO)3(L)](-) analogues with these neutral dangling chains were found to have pharmacokinetic properties very similar to those of fac-[(99m)Tc(I)(CO)3(NTA)](2-). Therefore, we reach the unexpected conclusion that in fac-[(99m)Tc(I)(CO)3(L)](n-) agents, renal clearance is affected much more than anticipated by features of the core plus the chelate rings (the [(99m)Tc(I)(CO)3(N(CH2CO2)2)](-) moiety) than by the presence of a negatively charged dangling carboxylate chain.

Green tea polyphenols supplementation and Tai Chi exercise for postmenopausal osteopenic women: safety and quality of life report

PubMed Central

2010-01-01

Background Evidence suggests that both green tea polyphenols (GTP) and Tai Chi (TC) exercise may benefit bone health in osteopenic women. However, their safety in this population has never been systematically investigated. In particular, there have been hepatotoxicity concerns related to green tea extract. This study was to evaluate the safety of 24 weeks of GTP supplementation combined with TC exercise in postmenopausal osteopenic women, along with effects on quality of life in this population. Methods 171 postmenopausal women with osteopenia were randomly assigned to 4 treatment arms for 24 weeks: (1) Placebo (500 mg starch/day), (2) GTP (500 mg GTP/day), (3) Placebo + TC (placebo plus TC training at 60 min/session, 3 sessions/week), and (4) GTP + TC (GTP plus TC training). Safety was examined by assessing liver enzymes (aspartate aminotransferase, alanine aminotransferase), alkaline phosphatase, and total bilirubin at baseline and every 4 weeks. Kidney function (urea nitrogen and creatinine), calcium, and inorganic phosphorus were also assessed at the same times. Qualify of life using SF-36 questionnaire was evaluated at baseline, 12, and 24 weeks. A mixed model of repeated measures ANOVA was applied for analysis. Results 150 subjects completed the study (12% attrition rate). The compliance rates for study agents and TC exercise were 89% and 83%, respectively. Neither GTP supplementation nor TC exercise affected liver or kidney function parameters throughout the study. No adverse event due to study treatment was reported by the participants. TC exercise significantly improved the scores for role-emotional and mental health of subjects, while no effect on quality of life was observed due to GTP supplementation. Conclusions GTP at a dose of 500 mg/day and/or TC exercise at 3 hr/week for 24 weeks appear to be safe in postmenopausal osteopenic women, particularly in terms of liver and kidney functions. TC exercise for 24 weeks (3 hr/wk) significantly improved quality of life in terms of role-emotional and mental health in these subjects. ClinicalTrials.gov identifier: NCT00625391. PMID:21143878

Associations between single nucleotide polymorphisms in multiple candidate genes and body weight in rabbits

PubMed Central

El-Sabrout, Karim; Aggag, Sarah A.

2017-01-01

Aim: In this study, we examined parts of six growth genes (growth hormone [GH], melanocortin 4 receptor [MC4R], growth hormone receptor [GHR], phosphorglycerate mutase [PGAM], myostatin [MSTN], and fibroblast growth factor [FGF]) as specific primers for two rabbit lines (V-line, Alexandria) using nucleotide sequence analysis, to investigate association between detecting single nucleotide polymorphism (SNP) of these genes and body weight (BW) at market. Materials and Methods: Each line kits were grouped into high and low weight rabbits to identify DNA markers useful for association studies with high BW. DNA from blood samples of each group was extracted to amplify the six growth genes. SNP technique was used to study the associate polymorphism in the six growth genes and marketing BW (at 63 days) in the two rabbit lines. The purified polymerase chain reaction products were sequenced in those had the highest and lowest BW in each line. Results: Alignment of sequence data from each group revealed the following SNPs: At nucleotide 23 (A-C) and nucleotide 35 (T-G) in MC4R gene (sense mutation) of Alexandria and V-line high BW. Furthermore, we detected the following SNPs variation between the two lines: A SNP (T-C) at nucleotide 27 was identified by MC4R gene (sense mutation) and another one (A-C) at nucleotide 14 was identified by GHR gene (nonsense mutation) of Alexandria line. The results of individual BW at market (63 days) indicated that Alexandria rabbits had significantly higher BW compared with V-line rabbits. MC4R polymorphism showed significant association with high BW in rabbits. Conclusion: The results of polymorphism demonstrate the possibility to detect an association between BW in rabbits and the efficiency of the used primers to predict through the genetic specificity using the SNP of MC4R. PMID:28246458

Molecular characterization of Trypanosoma cruzi SAP proteins with host-cell lysosome exocytosis-inducing activity required for parasite invasion.

PubMed

Zanforlin, Tamiris; Bayer-Santos, Ethel; Cortez, Cristian; Almeida, Igor C; Yoshida, Nobuko; da Silveira, José Franco

2013-01-01

To invade target cells, Trypanosoma cruzi metacyclic forms engage distinct sets of surface and secreted molecules that interact with host components. Serine-, alanine-, and proline-rich proteins (SAP) comprise a multigene family constituted of molecules with a high serine, alanine and proline residue content. SAP proteins have a central domain (SAP-CD) responsible for interaction with and invasion of mammalian cells by metacyclic forms. Using a 513 bp sequence from SAP-CD in blastn analysis, we identified 39 full-length SAP genes in the genome of T. cruzi. Although most of these genes were mapped in the T. cruzi in silico chromosome TcChr41, several SAP sequences were spread out across the genome. The level of SAP transcripts was twice as high in metacyclic forms as in epimastigotes. Monoclonal (MAb-SAP) and polyclonal (anti-SAP) antibodies produced against the recombinant protein SAP-CD were used to investigate the expression and localization of SAP proteins. MAb-SAP reacted with a 55 kDa SAP protein released by epimastigotes and metacyclic forms and with distinct sets of SAP variants expressed in amastigotes and tissue culture-derived trypomastigotes (TCTs). Anti-SAP antibodies reacted with components located in the anterior region of epimastigotes and between the nucleus and the kinetoplast in metacyclic trypomastigotes. In contrast, anti-SAP recognized surface components of amastigotes and TCTs, suggesting that SAP proteins are directed to different cellular compartments. Ten SAP peptides were identified by mass spectrometry in vesicle and soluble-protein fractions obtained from parasite conditioned medium. Using overlapping sequences from SAP-CD, we identified a 54-aa peptide (SAP-CE) that was able to induce host-cell lysosome exocytosis and inhibit parasite internalization by 52%. This study provides novel information about the genomic organization, expression and cellular localization of SAP proteins and proposes a triggering role for extracellular SAP proteins in host-cell lysosome exocytosis during metacyclic internalization.

Molecular Characterization of Trypanosoma cruzi SAP Proteins with Host-Cell Lysosome Exocytosis-Inducing Activity Required for Parasite Invasion

PubMed Central

Zanforlin, Tamiris; Bayer-Santos, Ethel; Cortez, Cristian; Almeida, Igor C.; Yoshida, Nobuko; da Silveira, José Franco

2013-01-01

Background To invade target cells, Trypanosoma cruzi metacyclic forms engage distinct sets of surface and secreted molecules that interact with host components. Serine-, alanine-, and proline-rich proteins (SAP) comprise a multigene family constituted of molecules with a high serine, alanine and proline residue content. SAP proteins have a central domain (SAP-CD) responsible for interaction with and invasion of mammalian cells by metacyclic forms. Methods and Findings Using a 513 bp sequence from SAP-CD in blastn analysis, we identified 39 full-length SAP genes in the genome of T. cruzi. Although most of these genes were mapped in the T. cruzi in silico chromosome TcChr41, several SAP sequences were spread out across the genome. The level of SAP transcripts was twice as high in metacyclic forms as in epimastigotes. Monoclonal (MAb-SAP) and polyclonal (anti-SAP) antibodies produced against the recombinant protein SAP-CD were used to investigate the expression and localization of SAP proteins. MAb-SAP reacted with a 55 kDa SAP protein released by epimastigotes and metacyclic forms and with distinct sets of SAP variants expressed in amastigotes and tissue culture-derived trypomastigotes (TCTs). Anti-SAP antibodies reacted with components located in the anterior region of epimastigotes and between the nucleus and the kinetoplast in metacyclic trypomastigotes. In contrast, anti-SAP recognized surface components of amastigotes and TCTs, suggesting that SAP proteins are directed to different cellular compartments. Ten SAP peptides were identified by mass spectrometry in vesicle and soluble-protein fractions obtained from parasite conditioned medium. Using overlapping sequences from SAP-CD, we identified a 54-aa peptide (SAP-CE) that was able to induce host-cell lysosome exocytosis and inhibit parasite internalization by 52%. Conclusions This study provides novel information about the genomic organization, expression and cellular localization of SAP proteins and proposes a triggering role for extracellular SAP proteins in host-cell lysosome exocytosis during metacyclic internalization. PMID:24391838

Short Stature, Accelerated Bone Maturation, and Early Growth Cessation Due to Heterozygous Aggrecan Mutations

PubMed Central

Nilsson, Ola; Guo, Michael H.; Dunbar, Nancy; Popovic, Jadranka; Flynn, Daniel; Jacobsen, Christina; Lui, Julian C.; Hirschhorn, Joel N.; Baron, Jeffrey

2014-01-01

Context: Many children with idiopathic short stature have a delayed bone age. Idiopathic short stature with advanced bone age is far less common. Objective: The aim was to identify underlying genetic causes of short stature with advanced bone age. Setting and Design: We used whole-exome sequencing to study three families with autosomal-dominant short stature, advanced bone age, and premature growth cessation. Results: Affected individuals presented with short stature [adult heights −2.3 to −4.2 standard deviation scores (SDS)] with histories of early growth cessation or childhood short stature (height SDS −1.9 to −3.5 SDS), advancement of bone age, and normal endocrine evaluations. Whole-exome sequencing identified novel heterozygous variants in ACAN, which encodes aggrecan, a proteoglycan in the extracellular matrix of growth plate and other cartilaginous tissues. The variants were present in all affected, but in no unaffected, family members. In Family 1, a novel frameshift mutation in exon 3 (c.272delA) was identified, which is predicted to cause early truncation of the aggrecan protein. In Family 2, a base-pair substitution was found in a highly conserved location within a splice donor site (c.2026+1G>A), which is also likely to alter the amino acid sequence of a large portion of the protein. In Family 3, a missense variant (c.7064T>C) in exon 14 affects a highly conserved residue (L2355P) and is strongly predicted to perturb protein function. Conclusions: Our study demonstrates that heterozygous mutations in ACAN can cause a mild skeletal dysplasia, which presents clinically as short stature with advanced bone age. The accelerating effect on skeletal maturation has not previously been noted in the few prior reports of human ACAN mutations. Our findings thus expand the spectrum of ACAN defects and provide a new molecular genetic etiology for the unusual child who presents with short stature and accelerated skeletal maturation. PMID:24762113

Kit preparation and biokinetics in women of 99mTc-EDDA/HYNIC-E-[c(RGDfK)]2 for breast cancer imaging.

PubMed

Ortiz-Arzate, Zareth; Santos-Cuevas, Clara L; Ocampo-García, Blanca E; Ferro-Flores, Guillermina; García-Becerra, Rocío; Estrada, Gisela; Gómez-Argumosa, Edgar; Izquierdo-Sánchez, Vanessa

2014-04-01

In breast cancer, α(ν)β(3) and/or α(ν)β(5) integrins are overexpressed in both endothelial and tumour cells. Radiolabelled peptides based on the Arg-Gly-Asp (RGD) sequence are radiopharmaceuticals with high affinity and selectivity for these integrins. The RGD-dimer peptide (E-[c(RGDfK)]2) radiolabelled with (99m)Tc has been reported as a radiopharmaceutical with a 10-fold higher affinity for the α(ν)β(3) integrin compared with the RGD-monomer. Ethylenediamine-N,N'-diacetic acid (EDDA) is a hydrophilic molecule that may favour renal excretion when used as coligand in the (99m)Tc labelling of hydrazinonicotinamide (HYNIC) peptides and can easily be formulated in a lyophilized kit. The aim of this study was to establish a biokinetic model for (99m)Tc-EDDA/HYNIC-E-[c(RGDfK)]2 prepared from lyophilized kits and evaluate its dosimetry as a tumour-imaging agent in seven healthy women and three breast cancer patients. (99m)Tc labelling was performed by adding sodium pertechnetate solution and 0.2 mol/l phosphate buffer (pH 7.0) to a lyophilized formulation containing E-[c(RGDfK)]2, EDDA, tricine, mannitol and stannous chloride. The radiochemical purity was evaluated using reverse-phase high-performance liquid chromatography and instant thin-layer chromatography on silica gel analyses. Stability studies in human serum were carried out using size-exclusion high-performance liquid chromatography. In-vitro cell uptake was tested using breast cancer cells (MCF7, T47D and MDA-MB-231) with blocked and nonblocked receptors. Biodistribution and tumour uptake were determined in MCF7 tumour-bearing nude mice with blocked and nonblocked receptors, and images were obtained using a micro-SPECT/PET/CT. Whole-body images from seven healthy women were acquired at 0.5, 1, 3, 6 and 24 h after (99m)Tc-EDDA/HYNIC-E-[c(RGDfK)]2 administration with radiochemical purities greater than 94%. Regions of interest were drawn around the source organs at each time frame. Each region of interest was converted to activity using the conjugate view counting method. The image sequence was used to extrapolate the (99m)Tc-EDDA/HYNIC-E-[c(RGDfK)]2 time-activity curves of each organ to adjust the biokinetic model and calculate the total number of disintegrations (N) that occurred in the source regions. N data were the input for the OLINDA/EXM code to calculate internal radiation dose estimates. In three breast cancer patients with histologically confirmed cancer, static images were obtained at 1 h in the supine position with hands placed behind the head. (99m)Tc-EDDA/HYNIC-E-[c(RGDfK)]2 obtained from lyophilized kits demonstrated high stability in human serum and specific cell receptor binding. The biodistribution data from mice showed rapid blood clearance, with both renal and hepatobiliary excretion, and specific binding towards α(ν)β(3) integrins in the MCF7 tumours. In women, the blood activity showed a half-life value of 1.60 min for the fast component (T1/2α = ln2/26.01) and half-life values of 1.0 h for the first slow component (T1/2β = ln2/0.69) and 4.03 h for the second slow component (T1/2γ = ln2/0.16). Images from patients showed an average tumour/heart (blood) ratio of 3.61 ± 0.62 at 1 h. The average equivalent doses calculated for a study using 740 MBq were 4.9, 6.2, 20.7, 34.5 and 57.0 mSv for the liver, intestines, spleen, kidneys and thyroid, respectively, and the effective dose was 6.1 mSv. All absorbed doses were comparable to those known from most of the (99m)Tc studies. (99m)Tc-EDDA/HYNIC-E-[c(RGDfK)]2 obtained from kit formulations showed high tumour uptake in patients with malignant lesions, making it a promising imaging radiopharmaceutical for targeting site-specific breast cancer. The results obtained in this study warrant further clinical studies to determine the specificity and sensitivity of (99m)Tc-EDDA/HYNIC-E-[c(RGDfK)]2.

Site-Selective Regulation of Platelet-Derived Growth Factor β Receptor Tyrosine Phosphorylation by T-Cell Protein Tyrosine Phosphatase

PubMed Central

Persson, Camilla; Sävenhed, Catrine; Bourdeau, Annie; Tremblay, Michel L.; Markova, Boyka; Böhmer, Frank D.; Haj, Fawaz G.; Neel, Benjamin G.; Elson, Ari; Heldin, Carl-Henrik; Rönnstrand, Lars; Östman, Arne; Hellberg, Carina

2004-01-01

The platelet-derived growth factor (PDGF) β receptor mediates mitogenic and chemotactic signals. Like other tyrosine kinase receptors, the PDGF β receptor is negatively regulated by protein tyrosine phosphatases (PTPs). To explore whether T-cell PTP (TC-PTP) negatively regulates the PDGF β receptor, we compared PDGF β receptor tyrosine phosphorylation in wild-type and TC-PTP knockout (ko) mouse embryos. PDGF β receptors were hyperphosphorylated in TC-PTP ko embryos. Fivefold-higher ligand-induced receptor phosphorylation was observed in TC-PTP ko mouse embryo fibroblasts (MEFs) as well. Reexpression of TC-PTP partly abolished this difference. As determined with site-specific phosphotyrosine antibodies, the extent of hyperphosphorylation varied among different autophosphorylation sites. The phospholipase Cγ1 binding site Y1021, previously implicated in chemotaxis, displayed the largest increase in phosphorylation. The increase in Y1021 phosphorylation was accompanied by increased phospholipase Cγ1 activity and migratory hyperresponsiveness to PDGF. PDGF β receptor tyrosine phosphorylation in PTP-1B ko MEFs but not in PTPɛ ko MEFs was also higher than that in control cells. This increase occurred with a site distribution different from that seen after TC-PTP depletion. PDGF-induced migration was not increased in PTP-1B ko cells. In summary, our findings identify TC-PTP as a previously unrecognized negative regulator of PDGF β receptor signaling and support the general notion that PTPs display site selectivity in their action on tyrosine kinase receptors. PMID:14966296

Identification, characterization and subcellular localization of TcPDE1, a novel cAMP-specific phosphodiesterase from Trypanosoma cruzi.

PubMed Central

D'Angelo, Maximiliano A; Sanguineti, Santiago; Reece, Jeffrey M; Birnbaumer, Lutz; Torres, Héctor N; Flawiá, Mirtha M

2004-01-01

Compartmentalization of cAMP phosphodiesterases plays a key role in the regulation of cAMP signalling in mammals. In the present paper, we report the characterization and subcellular localization of TcPDE1, the first cAMP-specific phosphodiesterase to be identified from Trypanosoma cruzi. TcPDE1 is part of a small gene family and encodes a 929-amino-acid protein that can complement a heat-shock-sensitive yeast mutant deficient in phospho-diesterase genes. Recombinant TcPDE1 strongly associates with membranes and cannot be released with NaCl or sodium cholate, suggesting that it is an integral membrane protein. This enzyme is specific for cAMP and its activity is not affected by cGMP, Ca2+, calmodulin or fenotiazinic inhibitors. TcPDE1 is sensitive to the phosphodiesterase inhibitor dipyridamole but is resistant to 3-isobutyl-1-methylxanthine, theophylline, rolipram and zaprinast. Papaverine, erythro-9-(2-hydroxy-3-nonyl)-adenine hydrochloride, and vinpocetine are poor inhibitors of this enzyme. Confocal laser scanning of T. cruzi epimastigotes showed that TcPDE1 is associated with the plasma membrane and concentrated in the flagellum of the parasite. The association of TcPDE1 with this organelle was confirmed by subcellular fractionation and cell-disruption treatments. The localization of this enzyme is a unique feature that distinguishes it from all the trypanosomatid phosphodiesterases described so far and indicates that compartmentalization of cAMP phosphodiesterases could also be important in these parasites. PMID:14556647

Modeling Truncated AR Expression in a Natural Androgen Responsive Environment and Identification of RHOB as a Direct Transcriptional Target

PubMed Central

Tsai, Hui-Chi; Boucher, David L.; Martinez, Anthony; Tepper, Clifford G.; Kung, Hsing-Jien

2012-01-01

Recent studies identifying putative truncated androgen receptor isoforms with ligand-independent activity have shed new light on the acquisition of androgen depletion independent (ADI) growth of prostate cancer. In this study, we present a model system in which a C-terminally truncated variant of androgen receptor (TC-AR) is inducibly expressed in LNCaP, an androgen-dependent cell line, which expresses little truncated receptor. We observed that when TC-AR is overexpressed, the endogenous full length receptor (FL-AR) is transcriptionally downmodulated. This in essence allows us to “replace” FL-AR with TC-AR and compare their individual properties in exactly the same genetic and cellular background, which has not been performed before. We show that the TC-AR translocates to the nucleus, activates transcription of AR target genes in the absence of DHT and is sufficient to confer ADI growth to the normally androgen dependent LNCaP line. We also show that while there is significant overlap in the genes regulated by FL- and TC-AR there are also differences in the respective suites of target genes with each AR form regulating genes that the other does not. Among the genes uniquely activated by TC-AR is RHOB which is shown to be involved in the increased migration and morphological changes observed in LN/TC-AR, suggesting a role of RHOB in the regulation of androgen-independent behavior of prostate cancer cells. PMID:23209612

TC-99m MIBI SPECT imaging in patients with lung carcinoma: is it a functional probe of multidrug resistance genes?

PubMed

Ak, Ilknur; Gülbaş, Zafer; Ocak, Suna; Kaya, Eser; Alataş, Füsun; Vardareli, Erkan; Metintaş, Muzaffer

2007-01-01

Multidrug-resistance (MDR) phenotype concerns altered membrane transport that results in lower cell concentrations of cytotoxic drug in many cancer types, including lung cancer, and is related to the overexpression of a variety of proteins that act as adenosine triphosphate-dependent extrusion pumps. Tc-99m Sestamibi (MIBI) is a transport substrate for P-glycoprotein (Pgp) pump. In this study, we assessed the uptake and clearance of technetium-99m-2-hexakis 2-methoxyisobutylisonitrile (Tc-99m MIBI) from the tumor and its correlation with messenger RNA (mRNA) levels of Pgp, MDR-associated protein (MRP1), and lung resistance protein (LRP) in lung carcinoma. This study was carried out on 19 patients (mean age, 60.1 +/- 2.07 years) with advanced-stage lung carcinoma. The tumor samples obtained by bronchoscopy were assessed to estimate the levels of Pgp, MRP1, and LRP expression on mRNA level by quantitative real-time reverse-transcription polymerase chain reaction. Tc-99m MIBI chest imaging was performed 15 and 180 minutes after injection of 740 MBq Tc-99m MIBI. The early (T/Be) and delayed (T/Bd) Tc-99m MIBI uptakes and washout rate (WR) of Tc-99m MIBI from the tumor were measured. No correlation was found between the T/Be Tc-99m MIBI uptake of tumors (T/Be) and the levels of Pgp mRNA, MRP1 mRNA, and LRP mRNA by reverse-transcription polymerase chain reaction. There was a correlation between the mean T/Bd Tc-99m MIBI uptake and Pgp expression of the tumors (P = 0.001, Spearman rho = - 0.702). There was a correlation between the WR of Tc-99m MIBI from the tumor and Pgp expression of the tumor (P = 0.000, Spearman rho = 0.875). Washout rate of Tc-99m MIBI was not related to the levels of MRP1 mRNA (P = 0.93, Spearman rho = 0.02) or LRP mRNA (P = 0.47, Spearman rho = 0.177). Increased WR of Tc-99m MIBI is related in Pgp over expression of the tumor. Tc-99m MIBI single photon emission computed tomography imaging may be a functional probe of overexpression of Pgp in patients with lung carcinoma. However, Tc-99m MIBI single photon emission computed tomography imaging cannot be used to identify the MDR involved in the MRP1 or LRP in these patients.

(99m)Tc-pyrophosphate scintigraphy for differentiating light-chain cardiac amyloidosis from the transthyretin-related familial and senile cardiac amyloidoses.

PubMed

Bokhari, Sabahat; Castaño, Adam; Pozniakoff, Ted; Deslisle, Susan; Latif, Farhana; Maurer, Mathew S

2013-03-01

Differentiating immunoglobulin light-chain (AL) from transthyretin-related cardiac amyloidoses (ATTR) is imperative given implications for prognosis, therapy, and genetic counseling. We validated the discriminatory ability of (99m)Tc-pyrophosphate ((99m)Tc-PYP) scintigraphy in AL versus ATTR. Forty-five subjects (12 AL, 16 ATTR wild type, and 17 ATTR mutants) underwent (99m)Tc-PYP planar and single-photon positive emission computed tomography cardiac imaging. Scans were performed by experienced nuclear cardiologists blinded to the subjects' cohort assignment. Cardiac retention was assessed with both a semiquantitative visual score (range, 0; no uptake to 3, diffuse uptake) and by quantitative analysis by drawing a region of interest over the heart corrected for contralateral counts and calculating a heart-to-contralateral ratio. Subjects with ATTR cardiac amyloid had a significantly higher semiquantitative cardiac visual score than the AL cohort (2.9±0.06 versus 0.8±0.27; P<0.0001) as well as a higher quantitative score (1.80±0.04 versus 1.21±0.04; P<0.0001). Using a heart-to-contralateral ratio >1.5 consistent with intensely diffuse myocardial tracer retention had a 97% sensitivity and 100% specificity with area under the curve 0.992, P<0.0001 for identifying ATTR cardiac amyloidosis. (99m)Tc-PYP cardiac imaging distinguishes AL from ATTR cardiac amyloidosis and may be a simple, widely available method for identifying subjects with ATTR cardiac amyloidosis, which should be studied in a larger prospective manner.

Is traditional reading of the bedside chest radiograph appropriate to detect intraatrial central venous catheter position?

PubMed

Wirsing, Melanie; Schummer, Claudia; Neumann, Rotraud; Steenbeck, Jörg; Schmidt, Peter; Schummer, Wolfram

2008-09-01

Traditionally, the positioning of central venous catheters (CVCs) outside the right atrium (RA) in patients receiving intensive care is determined by surrogate landmarks on bedside chest radiographs (CXRs). The validity of this method was examined by comparing readings of radiologists with the results of transesophageal echocardiography (TEE). Prospective study at university hospital. Two hundred thirteen adults scheduled for cardiothoracic surgery were randomized to right or left internal jugular vein catheterization under ECG guidance. One senior radiologist and two radiologists in training independently read the CXRs, and determined whether the CVC tip ended in the RA and measured the vertical distance from the CVC tip to the carina (TC-distance). Two hundred twelve CVC tips could be identified by TEE. Only left-sided CVCs (n = 5) ended in the upper RA (2.4%). Three of those patients were shorter than 160 cm. Specificity was 94% for senior radiologist, 44% for the first radiologist in training, and 60% for the second radiologist in training. The TC-distance of intraatrial catheters was 39, 55, 59, 80, and 83 mm, respectively. Thus, a TC-distance < or = 55 mm ensured extraatrial tip position in four of five intraatrial CVCs (80%, p = 0.002). The TC-distance of extraatrial catheters ranged from - 26 to 102 mm. Reading of a bedside CXR alone is not very accurate to identify intraatrial CVC tip position. TC-distance is a helpful marker, and its specificity is as good as that of an experienced radiologist if a cutoff value of 55 mm is chosen.

Difference in resource utilization between patients with acute and chronic heart failure from Japanese administrative database.

PubMed

Kuwabara, Kazuaki; Matsuda, Shinya; Anan, Makoto; Fushimi, Kiyohide; Ishikawa, Koichi B; Horiguchi, Hiromasa; Hayashida, Kenshi; Fujimori, Kenji

2010-06-11

Many studies have reported economic evaluation of evolving agents or therapies for patients with heart failure (HF). However, little is known whether the disease progression category (acute or chronic HF) would be considered as a risk adjustment in health service research. This study profiles the difference in resource use or medical care for acute versus chronic HF. This study analyzed 17,912 HF patients treated in 62 academic hospitals and 351 community hospitals. Study variables included demographic variables, comorbid status, physical activity or disease progression at admission, procedures and laboratory tests, type and dose of heart-related medications, length of stay (LOS), and total charges (TC; 1 US$= 100 yen) for acute and chronic HF. The independent contributions of disease progression categories on LOS and TC were identified using multivariate analysis. We identified 9813 chronic and 8099 acute HF patients. Median LOS was 18 days for both chronic and acute HF, whereas TC was US$5731 and US$6447, respectively. Regression analysis revealed that acute HF was associated with a slightly greater TC, whereas performance of procedures was the most prominent factor. As NYHA class was the next most influential factor, class 3 or 4 resulted in longer LOS or greater TC, than did class 1. This study suggests that acute HF increased resource use slightly, whereas use of some practices indicated in critical care was affected more by the procedures performed. Disease progression category should remain an indicator for appropriateness of medical care. Copyright (c) 2008 Elsevier Ireland Ltd. All rights reserved.

Repellant and insecticidal activities of shyobunone and isoshyobunone derived from the essential oil of Acorus calamus rhizomes.

PubMed

Chen, Hai-Ping; Yang, Kai; Zheng, Li-Shi; You, Chun-Xue; Cai, Qian; Wang, Cheng-Fang

2015-01-01

It was found that the essential oil of Acorus calamus rhizomes showed insecticidal activity. The aim of this study was to determine the chemical composition of the essential oil from A. calamus rhizomes, evaluate insecticidal and repellant activity against Lasioderma serricorne (LS) and Tribolium castaneum (TC), and to isolate any insecticidal constituents from the essential oil. Essential oil from A. calamus was obtained by hydrodistillation and analyzed by gas chromatography (GC) flame ionization detector and GC-mass spectrometry. The insecticidal and repellant activity of the essential oil and isolated compounds was tested using a variety of methods. The main components of the essential oil were identified to be isoshyobunone (15.56%), β-asarone (10.03%), bicyclo[6.1.0]non-1-ene (9.67%), shyobunone (9.60%) and methylisoeugenol (6.69%). Among them, the two active constituents were isolated and identified as shyobunone and isoshyobunone. The essential oil showed contact toxicity against LS and TC with LD50 values of 14.40 and 32.55 μg/adult, respectively. The isolated compounds, shyobunone and isoshyobunone also exhibited strong contact toxicity against LS adults with LD50 values of 20.24 and 24.19 μg/adult, respectively, while the LD50 value of isoshyobunone was 61.90 μg/adult for TC adults. The essential oil, shyobunone and isoshyobunone were strongly repellent (98%, 90% and 94%, respectively, at 78.63 nL/cm(2), after 2 h treatment) against TC. The essential oil, shyobunone and isoshyobunone possessed insecticidal and repellant activity against LS and TC.

Positive Newborn Screen for Methylmalonic Aciduria Identifies the First Mutation in TCblR/CD320, the Gene for Cellular Uptake of Transcobalamin-bound Vitamin B12

PubMed Central

Quadros, Edward V.; Lai, Shao-Chiang; Nakayama, Yasumi; Sequeira, Jeffrey M.; Hannibal, Luciana; Wang, Sihe; Jacobsen, Donald W.; Fedosov, Sergey; Wright, Erica; Gallagher, Renata C.; Anastasio, Natascia; Watkins, David; Rosenblatt, David S.

2010-01-01

Elevated methylmalonic acid in five asymptomatic newborns whose fibroblasts showed decreased uptake of transcobalamin-bound cobalamin (holo-TC), suggested a defect in the cellular uptake of cobalamin. Analysis of TCblR/CD320, the gene for the receptor for cellular uptake of holo-TC, identified a homozygous single codon deletion, c.262_264GAG (p.E88del), resulting in the loss of a glutamic acid residue in the low-density lipoprotein receptor type A-like domain. Inserting the codon by site-directed mutagenesis fully restored TCblR function. PMID:20524213

The highly-cited Electrocardiogram-related articles in science citation index expanded: characteristics and hotspots.

PubMed

Yang, Xianglin; Gu, Jiaojiao; Yan, Hong; Xu, Zhi; Ren, Bing; Yang, Yaming; Yang, Xiaodong; Chen, Qi; Tan, Shaohua

2014-01-01

We used bibliometric analysis methodology in the expanded Science Citation Index to identify highly-cited electrocardiogram (ECG)-related articles with total citations (TC2012) exceeding 100 from the publication year to 2012. Web of Science search tools were used to identify the highly-cited articles. The aspects analyzed for highly cited publications included effect of time on citation analysis, journals and Web of Science categories, number of authors per publication, originating institutions and countries, total citation and total citation per year life cycles of articles (C2012) and research hotspots. Results showed that a total of 467 electrocardiogram-related publications were regarded as the highly-cited publications. TC2012 ranged from 101 to 2879, with 215 as the average number of citations. No highly-cited publications have emerged yet during the first two years of the present 2010 Decade. All 11 countries and institutions originating highly-cited ECG-related publications were developed countries, USA in 9 of them. Four subject categories were identified as hotspots by total citations TC2012 and C2012: atrial fibrillation, long QT syndrome, angina and myocardial infarction, and risk factor analysis and health evaluation. Copyright © 2014 Elsevier Inc. All rights reserved.

Mutations That Improve the pRE Promoter of Coliphage Lambda

PubMed Central

Mahoney, Michael E.; Wulff, Daniel L.

1987-01-01

The dya5 mutation, a C→T change at position -43 of the λ pRE promoter, results in a twofold increase in pRE activity in vivo. Smaller increases in pRE activity are found for the dya2 mutation, a T→C change at position -1 of pRE, and the dya3 mutation, an A→G change at +5 of pRE. The mutant p RE promoters retain complete dependence on cII protein for activity. These observations argue, at least for pRE-like promoters, that promoter activities are influenced by nucleotide sequences at least eight nucleotides to the 5'-side of the conventional -35 region consensus sequence, and by nucleotide sequences near the start-site of transcription. Although Hawley and McClure (1983) found A·T pairs more frequently than G·TC pairs in the region of -40 to -45 of prokaryotic promoters, other mutations that change a G·TC pair to an A·T pair at positions -41, -44 and -45 of pRE do not result in increased promoter activity. We also found that a T→C change at position -42 results in a mild decrease in promoter activity. These observations argue that Ts at positions -42 and -43 of pRE are required for maximum promoter activity, but do not support the hypothesis that As and Ts in the -40 to -45 region generally lead to higher promoter activities. PMID:2953648

Transgenic maize event TC1507: Global status of food, feed, and environmental safety

PubMed Central

Baktavachalam, Gajendra B; Delaney, Bryan; Fisher, Tracey L; Ladics, Gregory S; Layton, Raymond J; Locke, Mary EH; Schmidt, Jean; Anderson, Jennifer A; Weber, Natalie N; Herman, Rod A; Evans, Steven L

2015-01-01

Maize (Zea mays) is a widely cultivated cereal that has been safely consumed by humans and animals for centuries. Transgenic or genetically engineered insect-resistant and herbicide-tolerant maize, are commercially grown on a broad scale. Event TC1507 (OECD unique identifier: DAS-Ø15Ø7–1) or the Herculex®# I trait, an insect-resistant and herbicide-tolerant maize expressing Cry1F and PAT proteins, has been registered for commercial cultivation in the US since 2001. A science-based safety assessment was conducted on TC1507 prior to commercialization. The safety assessment addressed allergenicity; acute oral toxicity; subchronic toxicity; substantial equivalence with conventional comparators, as well as environmental impact. Results from biochemical, physicochemical, and in silico investigations supported the conclusion that Cry1F and PAT proteins are unlikely to be either allergenic or toxic to humans. Also, findings from toxicological and animal feeding studies supported that maize with TC1507 is as safe and nutritious as conventional maize. Maize with TC1507 is not expected to behave differently than conventional maize in terms of its potential for invasiveness, gene flow to wild and weedy relatives, or impact on non-target organisms. These safety conclusions regarding TC1507 were acknowledged by over 20 regulatory agencies including United States Environment Protection Agency (US EPA), US Department of Agriculture (USDA), Canadian Food Inspection Agency (CFIA), and European Food Safety Authority (EFSA) before authorizing cultivation and/or food and feed uses. A comprehensive review of the safety studies on TC1507, as well as some benefits, are presented here to serve as a reference for regulatory agencies and decision makers in other countries where authorization of TC1507 is or will be pursued. PMID:26018138

Biomarkers in Trypanosoma cruzi-infected and uninfected individuals with varying severity of cardiomyopathy in Santa Cruz, Bolivia.

PubMed

Okamoto, Emi E; Sherbuk, Jacqueline E; Clark, Eva H; Marks, Morgan A; Gandarilla, Omar; Galdos-Cardenas, Gerson; Vasquez-Villar, Angel; Choi, Jeong; Crawford, Thomas C; Do, Rose Q; Q, Rose; Fernandez, Antonio B; Colanzi, Rony; Flores-Franco, Jorge Luis; Gilman, Robert H; Bern, Caryn

2014-10-01

Twenty to thirty percent of persons with Trypanosoma cruzi infection eventually develop cardiomyopathy. If an early indicator were to be identified and validated in longitudinal studies, this could enable treatment to be prioritized for those at highest risk. We evaluated cardiac and extracellular matrix remodeling markers across cardiac stages in T. cruzi infected (Tc+) and uninfected (Tc-) individuals. Participants were recruited in a public hospital in Santa Cruz, Bolivia and assigned cardiac severity stages by electrocardiogram and echocardiogram. BNP, NTproBNP, CKMB, troponin I, MMP-2, MMP-9, TIMP-1, TIMP-2, TGFb1, and TGFb2 were measured in specimens from 265 individuals using multiplex bead systems. Biomarker levels were compared between Tc+ and Tc- groups, and across cardiac stages. Receivers operating characteristic (ROC) curves were created; for markers with area under curve>0.60, logistic regression was performed. Analyses stratified by cardiac stage showed no significant differences in biomarker levels by Tc infection status. Among Tc+ individuals, those with cardiac insufficiency had higher levels of BNP, NTproBNP, troponin I, MMP-2, TIMP-1, and TIMP-2 than those with normal ejection fraction and left ventricular diameter. No individual marker distinguished between the two earliest Tc+ stages, but in ROC-based analyses, MMP-2/MMP-9 ratio was significantly higher in those with than those without ECG abnormalities. BNP, NTproBNP, troponin I, MMP-2, TIMP-1, and TIMP-2 levels rose with increasing severity stage but did not distinguish between Chagas cardiomyopathy and other cardiomyopathies. Among Tc+ individuals without cardiac insufficiency, only the MMP-2/MMP-9 ratio differed between those with and without ECG changes.

Superficial cooling does not decrease core body temperature before, during, or after exercise in an American football uniform.

PubMed

Lopez, Rebecca M; Eberman, Lindsey E; Cleary, Michelle A

2012-12-01

The purpose of this study was to identify the effects of superficial cooling on thermoregulatory responses while exercising in a hot humid environment while wearing an American football uniform. Nine male and female subjects wore a superficial cooling garment while in a cooling (CS) experimental condition or a no cooling (NCS) control condition during an exercise task consisting of warm-up (WU), exercise (EX), and recovery (R). The exercise task simulated an American football conditioning session with subjects wearing a full American football uniform and performing anaerobic and aerobic exercises in a hot humid environment. Subjects were allowed to drink water ad libitum during rest breaks. During the WU, EX, and R periods, core body temperature (T(c)) was measured to assess the effect of the cooling garment. Neither baseline resting before warm-up T(c) nor after warm-up T(c) was significantly different between trials. No significant differences in exercise T(c) between conditions were found. Time to return to baseline T(c) revealed no significant differences between the experimental and control conditions. The authors found that the volume of fluid consumed was 34% less in the experimental condition (711.1 ± 188.0 ml) compared with the control condition (1,077.8 ± 204.8 ml). The findings indicate that the cooling garment was not effective in blunting the rise in T(c) during warm-up, attenuating a rise in T(c) during intermittent exercise, or in increasing a return to baseline T(c) during a resting recovery period in a hot humid environment while wearing an American football uniform.

Transgenic maize event TC1507: Global status of food, feed, and environmental safety.

PubMed

Baktavachalam, Gajendra B; Delaney, Bryan; Fisher, Tracey L; Ladics, Gregory S; Layton, Raymond J; Locke, Mary Eh; Schmidt, Jean; Anderson, Jennifer A; Weber, Natalie N; Herman, Rod A; Evans, Steven L

2015-01-01

Maize (Zea mays) is a widely cultivated cereal that has been safely consumed by humans and animals for centuries. Transgenic or genetically engineered insect-resistant and herbicide-tolerant maize, are commercially grown on a broad scale. Event TC1507 (OECD unique identifier: DAS-Ø15Ø7-1) or the Herculex®(#) I trait, an insect-resistant and herbicide-tolerant maize expressing Cry1F and PAT proteins, has been registered for commercial cultivation in the US since 2001. A science-based safety assessment was conducted on TC1507 prior to commercialization. The safety assessment addressed allergenicity; acute oral toxicity; subchronic toxicity; substantial equivalence with conventional comparators, as well as environmental impact. Results from biochemical, physicochemical, and in silico investigations supported the conclusion that Cry1F and PAT proteins are unlikely to be either allergenic or toxic to humans. Also, findings from toxicological and animal feeding studies supported that maize with TC1507 is as safe and nutritious as conventional maize. Maize with TC1507 is not expected to behave differently than conventional maize in terms of its potential for invasiveness, gene flow to wild and weedy relatives, or impact on non-target organisms. These safety conclusions regarding TC1507 were acknowledged by over 20 regulatory agencies including United States Environment Protection Agency (US EPA), US Department of Agriculture (USDA), Canadian Food Inspection Agency (CFIA), and European Food Safety Authority (EFSA) before authorizing cultivation and/or food and feed uses. A comprehensive review of the safety studies on TC1507, as well as some benefits, are presented here to serve as a reference for regulatory agencies and decision makers in other countries where authorization of TC1507 is or will be pursued.

Accomplishing the genotype-specific serodiagnosis of single and dual Trypanosoma cruzi infections by flow cytometry Chagas-Flow ATE-IgG2a.

PubMed

Alessio, Glaucia Diniz; de Araújo, Fernanda Fortes; Sales Júnior, Policarpo Ademar; Gomes, Matheus de Souza; Amaral, Laurence Rodrigues do; Pascoal Xavier, Marcelo Antônio; Teixeira-Carvalho, Andréa; de Lana, Marta; Martins-Filho, Olindo Assis

2018-02-01

The methods currently available for genotype-specific diagnosis of T. cruzi infection still present relevant limitations, especially to identify mixed infection. In the present investigation, we have evaluated the performance of Chagas-Flow ATE-IgG2a test for early and late differential diagnosis of single and dual genotype-specific T. cruzi infections. Serum samples from Swiss mice at early and late stages of T. cruzi infection were assayed in parallel batches for genotype-specific diagnosis of single (TcI, TcVI or TcII) and dual (TcI+TcVI, TcVI+TcII or TcII+TcI) infections. The intrinsic reactivity to TcI, TcVI and TcII target antigens, including amastigote (AI/AVI/AII), trypomastigote-(TI/TVI/TII) and epimastigote (EI/EVI/EII), at specific reverse of serum dilutions (500 to 64,000), was employed to provide reliable decision-trees for "early" vs "late", "single vs "dual" and "genotype-specific" serology. The results demonstrated that selective set of attributes "EII 500/EI 2,000/AII 500" were able to provide high-quality accuracy (81%) to segregate early and late stages of T. cruzi infection. The sets "TI 2,000/AI 1,000/EII 1,000" and "TI 8,000/AII 32,000" presented expressive scores to discriminate single from dual T. cruzi infections at early (85%) and late stages (84%), respectively. Moreover, the attributes "TI 4,000/TVI 500/TII 1,000", "TI 16,000/EI 2,000/EII 2,000/AI 500/TVI 500" showed good performance for genotype-specific diagnosis at early stage of single (72%) and dual (80%) T. cruzi infections, respectively. In addition, the attributes "TI 4,000/AII 1,000/EVI 1,000", "TI 64,000/AVI 500/AI 2,000/AII 1,000/EII 4,000" showed moderate performance for genotype-specific diagnosis at late stage of single (69%) and dual (76%) T. cruzi infections, respectively. The sets of decision-trees were assembled to construct a sequential algorithm with expressive accuracy (81%) for serological diagnosis of T. cruzi infection. These findings engender new perspectives for the application of Chagas-Flow ATE-IgG2a method for genotype-specific diagnosis in humans, with relevant contributions for epidemiological surveys as well as clinical and post-therapeutic monitoring of Chagas disease.

SWIFT: Prospective 48-Week Study to Evaluate Efficacy and Safety of Switching to Emtricitabine/Tenofovir From Lamivudine/Abacavir in Virologically Suppressed HIV-1 Infected Patients on a Boosted Protease Inhibitor Containing Antiretroviral Regimen

PubMed Central

Campo, R.; DeJesus, E.; Bredeek, U. F.; Henry, K.; Khanlou, H.; Logue, K.; Brinson, C.; Benson, P.; Dau, L.; Wang, H.; White, K.; Flaherty, J.; Fralich, T.; Guyer, B.; Piontkowsky, D.

2013-01-01

Background. In the United States, emtricitabine/tenofovir disoproxil fumarate (FTC/TDF) is a preferred nucleoside reverse transcriptase inhibitor (NRTI) backbone with lamivudine/abacavir (3TC/ABC) as a commonly used alternative. For patients infected with human immunodeficiency virus (HIV-1) virologically suppressed on a boosted protease inhibitor (PI) + 3TC/ABC regimen, the merits of switching to FTC/TDF as the NRTI backbone are unknown. Methods. SWIFT was a prospective, randomized, open-label 48-week study to evaluate efficacy and safety of switching to FTC/TDF. Subjects receiving 3TC/ABC + PI + ritonavir (RTV) with HIV-1 RNA < 200 c/mL ≥3 months were randomized to continue 3TC/ABC or switch to FTC/TDF. The primary endpoint was time to loss of virologic response (TLOVR) with noninferiority measured by delta of 12%. Virologic failure (VF) was defined as confirmed rebound or the last HIV-1 RNA measurement on study drug ≥200 c/mL. Results. In total, 311 subjects were treated in this study (155 to PI + RTV + FTC/TDF, 156 to PI + RTV + 3TC/ABC). Baseline characteristics were similar between the arms: 85% male, 28% black, median age, 46 years; and median CD4 532 cells/mm3. By TLOVR through week 48, switching to FTC/TDF was noninferior compared to continued 3TC/ABC (86.4% vs 83.3%, treatment difference 3.0% (95% confidence interval, −5.1% to 11.2%). Fewer subjects on FTC/TDF experienced VF (3 vs 11; P = .034). FTC/TDF showed greater declines in fasting low-density lipoproteins (LDL), total cholesterol (TC), and triglycerides (TG) with significant declines in LDL and TC beginning at week 12 with no TC/HDL ratio change. Switching to FTC/TDF showed improved NCEP thresholds for TC and TG and improved 10-year Framingham TC calculated scores. Decreased epidermal growth factor receptor (eGFR) was observed in both arms with a larger decrease in the FTC/TDF arm. Conclusions. Switching to FTC/TDF from 3TC/ABC maintained virologic suppression, had fewer VFs, improved lipid parameters and Framingham scores but decreased eGFR. ClinicalTrials.gov identifier. NCT00724711. PMID:23362296

Mutation screening of melatonin-related genes in patients with autism spectrum disorders

PubMed Central

2010-01-01

Background One consistent finding in autism spectrum disorders (ASD) is a decreased level of the pineal gland hormone melatonin and it has recently been demonstrated that this decrease to a large extent is due to low activity of the acetylserotonin O-methyltransferase (ASMT), the last enzyme in the melatonin synthesis pathway. Moreover, mutations in the ASMT gene have been identified, including a splice site mutation, that were associated with low ASMT activity and melatonin secretion, suggesting that the low ASMT activity observed in autism is, at least partly, due to variation within the ASMT gene. Methods In the present study, we have investigated all the genes involved in the melatonin pathway by mutation screening of AA-NAT (arylalkylamine N-acetyltransferase), ASMT, MTNR1A, MTNR1B (melatonin receptor 1A and 1B) and GPR50 (G protein-coupled receptor 50), encoding both synthesis enzymes and the three main receptors of melatonin, in 109 patients with autism spectrum disorders (ASD). A cohort of 188 subjects from the general population was used as a comparison group and was genotyped for the variants identified in the patient sample. Results Several rare variants were identified in patients with ASD, including the previously reported splice site mutation in ASMT (IVS5+2T>C). Of the variants affecting protein sequence, only the V124I in the MTNR1B gene was absent in our comparison group. However, mutations were found in upstream regulatory regions in three of the genes investigated, ASMT, MTNR1A, and MTNR1B. Conclusions Our report of another ASD patient carrying the splice site mutation IVS5+2T>C, in ASMT further supports an involvement of this gene in autism. Moreover, our results also suggest that other melatonin related genes might be interesting candidates for further investigation in the search for genes involved in autism spectrum disorders and related neurobehavioral phenotypes. However, further studies of the novel variants identified in this study are warranted to shed light on their potential role in the pathophysiology of these disorders. PMID:20377855

Mutation screening of melatonin-related genes in patients with autism spectrum disorders.

PubMed

Jonsson, Lina; Ljunggren, Elin; Bremer, Anna; Pedersen, Christin; Landén, Mikael; Thuresson, Kent; Giacobini, Maibritt; Melke, Jonas

2010-04-08

One consistent finding in autism spectrum disorders (ASD) is a decreased level of the pineal gland hormone melatonin and it has recently been demonstrated that this decrease to a large extent is due to low activity of the acetylserotonin O-methyltransferase (ASMT), the last enzyme in the melatonin synthesis pathway. Moreover, mutations in the ASMT gene have been identified, including a splice site mutation, that were associated with low ASMT activity and melatonin secretion, suggesting that the low ASMT activity observed in autism is, at least partly, due to variation within the ASMT gene. In the present study, we have investigated all the genes involved in the melatonin pathway by mutation screening of AA-NAT (arylalkylamine N-acetyltransferase), ASMT, MTNR1A, MTNR1B (melatonin receptor 1A and 1B) and GPR50 (G protein-coupled receptor 50), encoding both synthesis enzymes and the three main receptors of melatonin, in 109 patients with autism spectrum disorders (ASD). A cohort of 188 subjects from the general population was used as a comparison group and was genotyped for the variants identified in the patient sample. Several rare variants were identified in patients with ASD, including the previously reported splice site mutation in ASMT (IVS5+2T>C). Of the variants affecting protein sequence, only the V124I in the MTNR1B gene was absent in our comparison group. However, mutations were found in upstream regulatory regions in three of the genes investigated, ASMT, MTNR1A, and MTNR1B. Our report of another ASD patient carrying the splice site mutation IVS5+2T>C, in ASMT further supports an involvement of this gene in autism. Moreover, our results also suggest that other melatonin related genes might be interesting candidates for further investigation in the search for genes involved in autism spectrum disorders and related neurobehavioral phenotypes. However, further studies of the novel variants identified in this study are warranted to shed light on their potential role in the pathophysiology of these disorders.

Novel SNPs in HSPB8 gene and their association with heat tolerance traits in Sahiwal indigenous cattle.

PubMed

Verma, Nishant; Gupta, Ishwar Dayal; Verma, Archana; Kumar, Rakesh; Das, Ramendra; Vineeth, M R

2016-01-01

Heat shock proteins (HSPs) are expressed in response to heat stress, and the polymorphism in HSP genes at single-nucleotide level has been reported to be associated with heat tolerance and production performance traits in cattle. HSPB8 gene has been mapped on Bos taurus autosome 17 (BTA-17) spanning nearly 13,252 bp and comprising three exons and two introns. The present study was conducted in Sahiwal cows (n = 108) reared in subtropical climate with the objectives to identify SNPs in all three exons and part of intron 1 of HSPB8 gene and to analyze their association with heat tolerance traits in Sahiwal cows. Respiration rate (RR) and rectal temperature (RT) were recorded once during probable extreme hours in different seasons or Temperature-Humidity Index (THI), i.e., winter, spring, and summer. Heat tolerance coefficient (HTC) was also calculated to check the adaptability of the animals during the period of heat stress. The comparative sequence analysis revealed a total two single-nucleotide polymorphisms (SNPs), i.e., g.507G>A in exon 1 and g.881T>C in intron 1 of HSPB8 gene. Out of these two identified SNPs, only one SNP, i.e., g.507G>A, was found to be significantly associated with heat tolerance indicator traits (RR, RT, and HTC) in Sahiwal cows. The perusal of results across different seasons showed the significant (P < 0.01) difference in RR, RT, and HTC between winter, spring, and summer seasons. RR, RT, and HTC were found to be significantly lower (P < 0.01) in GA as compared to GG genotype of g.507G>A SNP of HSPB8 gene. However, in case of another SNP, i.e., g.881T>C, located on intron 1, the RR, RT, and HTC were having non-significant association with the different genotypes, i.e., TT and TC. These findings may partly suggest that GA genotype of SNP g.507G>A of HSPB8 gene has a probable role in heat tolerance in Sahiwal cattle and can therefore be utilized as a marker in propagation of thermo-tolerance cattle in hot tropical and subtropical climate. Nevertheless, the involvement of other regulatory mechanisms cannot be overruled.

Gene expression and pharmacology of nematode NLP-12 neuropeptides.

PubMed

McVeigh, Paul; Leech, Suzie; Marks, Nikki J; Geary, Timothy G; Maule, Aaron G

2006-05-31

This study examines the biology of NLP-12 neuropeptides in Caenorhabditis elegans, and in the parasitic nematodes Ascaris suum and Trichostrongylus colubriformis. DYRPLQFamide (1 nM-10 microM; n > or =6) produced contraction of innervated dorsal and ventral Ascaris body wall muscle preparations (10 microM, 6.8+/-1.9 g; 1 microM, 4.6+/-1.8 g; 0.1 microM, 4.1+/-2.0 g; 10 nM, 3.8+/-2.0 g; n > or =6), and also caused a qualitatively similar, but quantitatively lower contractile response (10 microM, 4.0+/-1.5 g, n=6) on denervated muscle strips. Ovijector muscle displayed no measurable response (10 microM, n=5). nlp-12 cDNAs were characterised from A. suum (As-nlp-12) and T. colubriformis (Tc-nlp-12), both of which show sequence similarity to C. elegans nlp-12, in that they encode multiple copies of -LQFamide peptides. In C. elegans, reverse transcriptase (RT)-PCR analysis showed that nlp-12 was transcribed throughout the life cycle, suggesting that DYRPLQFamide plays a constitutive role in the nervous system of this nematode. Transcription was also identified in both L3 and adult stages of T. colubriformis, in which Tc-nlp-12 is expressed in a single tail neurone. Conversely, As-nlp-12 is expressed in both head and tail tissue of adult female A. suum, suggesting species-specific differences in the transcription pattern of this gene.

A Comparison of Procedural Variations in Teaching Behavior Chains: Manual Guidance, Trainer Completion, and No Completion of Untrained Steps

ERIC Educational Resources Information Center

Bancroft, Stacie L.; Weiss, Julie S.; Libby, Myrna E.; Ahearn, William H.

2011-01-01

We compared variations for teaching a sequence of responses through forward chaining. Seven children who had been diagnosed with autism participated in a comparison of teacher completion (TC) of steps beyond the training step and manually guiding the student (SC) to complete steps beyond the training step. A no-completion (NC) condition, in which…

A missense mutation in the CRBN gene that segregates with intellectual disability and self-mutilating behaviour in a consanguineous Saudi family

PubMed Central

Sheereen, Atia; Alaamery, Manal; Bawazeer, Shahad; Al Yafee, Yusra; Massadeh, Salam; Eyaid, Wafaa

2017-01-01

Background Autosomal-recessive non-syndromic intellectual disability (ARNS-ID) is an aetiologically heterogeneous disorder. Although little is known about the function of human cereblon (CRBN), its relationship to mild cognitive deficits suggests that it is involved in the basic processes of human memory and learning. Objectives We aim to identify the genetic cause of intellectual disability and self-mutilation in a consanguineous Saudi family with five affected members. Methods Clinical whole-exome sequencing was performed on the proband patient, and Sanger sequencing was done to validate and confirm segregation in other family members. Results A missense variant (c. 1171T>C) in the CRBN gene was identified in five individuals with severe intellectual disability (ID) in a consanguineous Saudi family. The homozygous variant was co-segregating in the family with the phenotype of severe ID, seizures and self-mutilating behaviour. The missense mutation (p.C391R) reported here results in the replacement of a conserved cysteine residue by an arginine in the CULT (cereblon domain of unknown activity, binding cellular ligands and thalidomide) domain of CRBN, which contains a zinc-binding site. Conclusions These findings thus contribute to a growing list of ID disorders caused by CRBN mutations, broaden the spectrum of phenotypes attributable to ARNS-ID and provide new insight into genotype–phenotype correlations between CRBN mutations and the aetiology of ARNS-ID. PMID:28143899

Hereditary fructose intolerance: frequency and spectrum mutations of the aldolase B gene in a large patients cohort from France--identification of eight new mutations.

PubMed

Davit-Spraul, Anne; Costa, Catherine; Zater, Mokhtar; Habes, Dalila; Berthelot, Jacques; Broué, Pierre; Feillet, François; Bernard, Olivier; Labrune, Philippe; Baussan, Christiane

2008-08-01

We investigated the molecular basis of hereditary fructose intolerance (HFI) in 160 patients from 92 families by means of a PCR-based mutation screening strategy, consisting of restriction enzyme digestion and direct sequencing. Sixteen different mutations of the aldolase B (ALDOB) gene were identified in HFI patients. As in previous studies, p.A150P (64%), p.A175D (16%) and p.N335K (5%) were the most common mutated alleles, followed by p.R60X, p.A338V, c.360_363delCAAA (p.N120KfsX30), c.324G>A (p.K108K) and c.625-1G>A. Eight novel mutations were also identified in 10 families with HFI: a one-base deletion (c.146delT (p.V49GfsX27)), a small deletion (c.953del42bp), a small insertion (c.689ins TGCTAA (p.K230MfsX136)), one splice site mutation (c.112+1G>A), one nonsense mutation (c.444G>A (p.W148X)), and three missense mutations (c.170G>C (p.R57P), c.839C>A (p.A280P) and c.932T>C (p.L311P)). Our strategy allows to diagnose 75% of HFI patients using restriction enzymatic analysis and to enlarge the diagnosis to 97% of HFI patients when associated with direct sequencing.

The Alpaca Melanocortin 1 Receptor: Gene Mutations, Transcripts, and Relative Levels of Expression in Ventral Skin Biopsies

PubMed Central

Renieri, Carlo; La Terza, Antonietta

2015-01-01

The objectives of the present study were to characterize the MC1R gene, its transcripts and the single nucleotide polymorphisms (SNPs) associated with coat color in alpaca. Full length cDNA amplification revealed the presence of two transcripts, named as F1 and F2, differing only in the length of their 5′-terminal untranslated region (UTR) sequences and presenting a color specific expression. Whereas the F1 transcript was common to white and colored (black and brown) alpaca phenotypes, the shorter F2 transcript was specific to white alpaca. Further sequencing of the MC1R gene in white and colored alpaca identified a total of twelve SNPs; among those nine (four silent mutations (c.126C>A, c.354T>C, c.618G>A, and c.933G>A); five missense mutations (c.82A>G, c.92C>T, c.259A>G, c.376A>G, and c.901C>T)) were observed in coding region and three in the 3′UTR. A 4 bp deletion (c.224 227del) was also identified in the coding region. Molecular segregation analysis uncovered that the combinatory mutations in the MC1R locus could cause eumelanin and pheomelanin synthesis in alpaca. Overall, our data refine what is known about the MC1R gene and provides additional information on its role in alpaca pigmentation. PMID:25685836

Chemical and structural characterization of a model Post-Termination Complex (PoTC) for the ribosome recycling reaction: Evidence for the release of the mRNA by RRF and EF-G

PubMed Central

Iwakura, Nobuhiro; Yokoyama, Takeshi; Quaglia, Fabio; Mitsuoka, Kaoru; Mio, Kazuhiro; Shigematsu, Hideki; Shirouzu, Mikako; Kaji, Akira; Kaji, Hideko

2017-01-01

A model Post-Termination Complex (PoTC) used for the discovery of Ribosome Recycling Factor (RRF) was purified and characterized by cryo-electron microscopic analysis and biochemical methods. We established that the model PoTC has mostly one tRNA, at the P/E or P/P position, together with one mRNA. The structural studies were supported by the biochemical measurement of bound tRNA and mRNA. Using this substrate, we establish that the release of tRNA, release of mRNA and splitting of ribosomal subunits occur during the recycling reaction. Order of these events is tRNA release first followed by mRNA release and splitting almost simultaneously. Moreover, we demonstrate that IF3 is not involved in any of the recycling reactions but simply prevents the re-association of split ribosomal subunits. Our finding demonstrates that the important function of RRF includes the release of mRNA, which is often missed by the use of a short ORF with the Shine-Dalgarno sequence near the termination site. PMID:28542628

The influence of the relative thermal expansion and electric permittivity on phase transitions in the perovskite-type bidimensional layered NH3(CH2)3NH3CdBr4 compound

NASA Astrophysics Data System (ADS)

Staśkiewicz, Beata; Staśkiewicz, Anna

2017-07-01

Hydrothermal method has been used to synthesized the layered hybrid compound NH3(CH2)3NH3CdBr4 of perovskite architecture. Structural, dielectric and dilatometric properties of the compound have been analyzed. Negative thermal expansion (NTE) effect in the direction perpendicular to the perovskite plane as well as an unusual phase sequence have been reported based on X-ray diffraction analysis. Electric permittivity measurements evidenced the phase transitions at Tc1=326/328 K and Tc2=368/369 K. Relative linear expansion measurements almost confirmed these temperatures of phase transitions. Anomalies of electric permittivity and expansion behavior connected with the phase transitions are detected at practically the same temperatures as those observed earlier in differential scanning calorimetry (DSC), infrared (IR), far infrared (FIR) and Raman spectroscopy studies. Mechanism of the phase transitions is explained. Relative linear expansion study was prototype to estimate critical exponent value β for continuous phase transition at Tc1. It has been inferred that there is a strong interplay between the distortion of the inorganic network, those hydrogen bonds and the intermolecular interactions of the organic component.

MERRF/MELAS overlap syndrome due to the m.3291T>C mutation.

PubMed

Liu, Kaiming; Zhao, Hui; Ji, Kunqian; Yan, Chuanzhu

2014-03-01

We report the case of a 19-year-old Chinese female harboring the m.3291T>C mutation in the MT-TL1 gene encoding the mitochondrial transfer RNA for leucine. She presented with a complex phenotype characterized by progressive cerebellar ataxia, frequent myoclonus seizures, recurrent stroke-like episodes, migraine-like headaches with nausea and vomiting, and elevated resting lactate blood level. It is known that the myoclonus epilepsy with ragged-red fibers (MERRF) is characterized by cerebellar ataxia and myoclonus epilepsy, while that the mitochondrial encephalopathy, lactic acidosis, and stroke-like episodes (MELAS) is characterized by recurrent stroke-like episodes, migraine-like headaches, and elevated resting lactate blood level. So the patient's clinical manifestations suggest the presence of a MERRF/MELAS overlap syndrome. Muscle biopsy of the patient showed the presence of numerous scattered ragged-red fibers, some cytochrome c oxidase-deficient fibers, and several strongly succinate dehygrogenase-reactive vessels, suggestive of a mitochondrial disorder. Direct sequencing of the complete mitochondrial genome of the proband revealed no mutations other than the T-to-C transition at nucleotide position 3291. Restriction fragment length polymorphism analysis of the proband and her family revealed maternal inheritance of the mutation in a heteroplasmic manner. The analysis of aerobic respiration and glycolysis demonstrated that the fibroblasts from the patient had mitochondrial dysfunction. Our results suggest that the m.3291T>C is pathogenic. This study is the first to describe the m.3291T>C mutation in association with the MERRF/MELAS overlap syndrome.

An intrapatient comparison of 99mTc-EDDA/HYNIC-TOC with 111In-DTPA-octreotide for diagnosis of somatostatin receptor-expressing tumors.

PubMed

Gabriel, Michael; Decristoforo, Clemens; Donnemiller, Eveline; Ulmer, Hanno; Watfah Rychlinski, Christine; Mather, Stephen J; Moncayo, Roy

2003-05-01

The aim of this study was to compare the imaging abilities of the recently developed somatostatin analog, (99m)Tc-hydrazinonicotinyl-Tyr(3)-octreotide ((99m)Tc-HYNIC-TOC [(99m)Tc-TOC]), with (111)In-diethylenediaminepentaacetic acid-D-Phe(1)-octreotide ((111)In-OCT [Octreoscan]) in patients undergoing routine somatostatin receptor (SSTR) scintigraphy. Forty-one patients (20 men, 21 women; age range, 29-75 y; mean age, 56.7 y) with either histologically proven or biologically and clinically suspected endocrine tumors were enrolled in the study. Four groups were distinguished: (a) patients being evaluated for the detection and localization of neuroendocrine tumors (n = 6), (b) tumor staging (n = 19), (c) patients being investigated to determine the SSTR status of tumor lesions (n = 11), and (d) patient follow-up studies (n = 5). Each patient received a mean activity of 150 MBq (111)In-OCT and 350-400 MBq (99m)Tc-TOC. Scintigraphy with (99m)Tc-TOC was performed 4 h after injection and scintigraphy with (111)In-OCT was performed 4 and 24 h after injection. SPECT studies of areas of interest were performed 4 h after injection for both tracers as well as at 24 h after injection for (111)In-OCT. The time interval between the studies using each tracer ranged from 2 to 22 d (mean interval, 9.3 d). (111)In-OCT and (99m)Tc-TOC showed an equivalent scan result in 32 patients (78%), 9 cases showed discrepancies (22%), false-negative results with (111)In-OCT were seen in 6 cases (14.6%), whereas (99m)Tc-TOC was false-positive in 2 cases (4.9%). (111)In-OCT was true-negative in both cases. The false-positive findings of the (99m)Tc-TOC studies were caused by nonspecific uptake in the bowel. In 1 case, (99m)Tc-TOC correctly identified a metastasis in the lumbar spine but both scan results were false-positive because of an inflammatory process. In 21 patients with SSTR-expressing tumors, the semiquantitative region-of-interest analysis showed that (99m)Tc-TOC achieved higher tumor-to-normal tissue ratios than (111)In-OCT. This study revealed a higher sensitivity of (99m)Tc-TOC as compared with (111)In-OCT as an imaging agent for the localization of SSTR-expressing tumors. To avoid false-positive findings with (99m)Tc-OCT due to nonspecific tracer accumulation, additional scanning at 1-2 h after injection should be done.

Candidate gene screen in the red flour beetle Tribolium reveals six3 as ancient regulator of anterior median head and central complex development.

PubMed

Posnien, Nico; Koniszewski, Nikolaus Dieter Bernhard; Hein, Hendrikje Jeannette; Bucher, Gregor

2011-12-01

Several highly conserved genes play a role in anterior neural plate patterning of vertebrates and in head and brain patterning of insects. However, head involution in Drosophila has impeded a systematic identification of genes required for insect head formation. Therefore, we use the red flour beetle Tribolium castaneum in order to comprehensively test the function of orthologs of vertebrate neural plate patterning genes for a function in insect head development. RNAi analysis reveals that most of these genes are indeed required for insect head capsule patterning, and we also identified several genes that had not been implicated in this process before. Furthermore, we show that Tc-six3/optix acts upstream of Tc-wingless, Tc-orthodenticle1, and Tc-eyeless to control anterior median development. Finally, we demonstrate that Tc-six3/optix is the first gene known to be required for the embryonic formation of the central complex, a midline-spanning brain part connected to the neuroendocrine pars intercerebralis. These functions are very likely conserved among bilaterians since vertebrate six3 is required for neuroendocrine and median brain development with certain mutations leading to holoprosencephaly.

Candidate Gene Screen in the Red Flour Beetle Tribolium Reveals Six3 as Ancient Regulator of Anterior Median Head and Central Complex Development

PubMed Central

Hein, Hendrikje Jeannette; Bucher, Gregor

2011-01-01

Several highly conserved genes play a role in anterior neural plate patterning of vertebrates and in head and brain patterning of insects. However, head involution in Drosophila has impeded a systematic identification of genes required for insect head formation. Therefore, we use the red flour beetle Tribolium castaneum in order to comprehensively test the function of orthologs of vertebrate neural plate patterning genes for a function in insect head development. RNAi analysis reveals that most of these genes are indeed required for insect head capsule patterning, and we also identified several genes that had not been implicated in this process before. Furthermore, we show that Tc-six3/optix acts upstream of Tc-wingless, Tc-orthodenticle1, and Tc-eyeless to control anterior median development. Finally, we demonstrate that Tc-six3/optix is the first gene known to be required for the embryonic formation of the central complex, a midline-spanning brain part connected to the neuroendocrine pars intercerebralis. These functions are very likely conserved among bilaterians since vertebrate six3 is required for neuroendocrine and median brain development with certain mutations leading to holoprosencephaly. PMID:22216011

Effects of concurrent drug therapy on technetium /sup 99m/Tc gluceptate biodistribution

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hinkle, G.H.; Basmadjian, G.P.; Peek, C.

Drug interactions with /sup 99m/Tc gluceptate resulting in altered biodistribution were studied using chart review and animal tests. Charts of nine patients who had abnormal gallbladder uptake of technetium /sup 99m/Tc gluceptate during a two-year period were reviewed to obtain data such as concurrent drug therapy, primary diagnosis, and laboratory values. Adult New Zealand white rabbits were then used for testing the biodistribution of technetium /sup 99m/Tc gluceptate when administered concurrently with possibly interacting drugs identified in the chart review--penicillamine, penicillin G potassium, penicillin V potassium, acetaminophen, and trimethoprim-sulfamethoxazole. Chart review revealed no conclusive patterns of altered biodistribution associated withmore » other factors. The data did suggest the possibility that the five drugs listed above might cause increased hepatobiliary clearance of the radiopharmaceutical. Animal tests showed that i.v. penicillamine caused substantial distribution of radioactivity into the gallbladder and small bowel. Minimally increased gallbladder radioactivity occurred when oral acetaminophen and trimethoprim-sulfamethoxazole were administered concurrently. Oral and i.v. penicillins did not increase gallbladder activity. Penicillamine may cause substantial alteration of the biodistribution of technetium /sup 99m/Tc gluceptate.« less

A functional aquaporin co-localizes with the vacuolar proton pyrophosphatase to acidocalcisomes and the contractile vacuole complex of Trypanosoma cruzi.

PubMed

Montalvetti, Andrea; Rohloff, Peter; Docampo, Roberto

2004-09-10

We cloned an aquaporin gene from Trypanosoma cruzi (TcAQP) that encodes a protein of 231 amino acids, which is highly hydrophobic. The protein has six putative transmembrane domains and the two signature motifs asparagine-proline-alanine (NPA) which have been shown, in other aquaporins, to be involved in the formation of an aqueous channel spanning the bilayer. TcAQP was sensitive to endo H treatment, suggesting that the protein is N-glycosylated. Oocytes of Xenopus laevis expressing TcAQP swelled under hyposmotic conditions indicating water permeability, which was abolished after preincubating oocytes with very low concentrations of the AQP inhibitors HgCl(2) and AgNO(3). glycerol transport was detected. No Immunofluorescence microscopy of T. cruzi expressing GFP-TcAQP showed co-localization of TcAQP with the vacuolar proton pyrophosphatase (V-H(+)-PPase), a marker of acidocalcisomes. This localization was confirmed by Western blotting and immunofluorescence staining using polyclonal antibodies against a C-terminal peptide of TcAQP. In addition, there was a strong anterior labeling in a vacuole, close to the flagellar pocket, that was distinct from the acidocalcisomes and that was identified by immunogold electron microscopy as the contractile vacuole complex. Taking together, the presence of an aquaporin in acidocalcisomes and the contractile vacuole complex of T. cruzi, provides support for the role of these organelles in osmotic adaptations of these parasites.

[In search of results of technical cooperation].

PubMed

Jourdan Hidalgo, L; Manuel Sotelo, J

1999-06-01

For the Pan American Health Organization (PAHO), technical cooperation (TC) is the process by which the PAHO Member States work with the Organization, as equal partners, to identify and reach their own health goals and to promote self-sufficiency in health development, through programs that respond to those countries' needs and national priorities. Since 1978, PAHO has used the American Regional Planning, Programming, Monitoring, and Evaluation System (AMPES) to establish management procedures and to facilitate decision-making in health TC. As part of AMPES, PAHO uses a "logical approach to project management" to structure the work program of the Organization and to identify the expected results from TC activities and TC resource investments. This project management approach, which replaces the "functional approaches" system used to date, also helps establish a causative relationship between the programmed activities and the results that PAHO expects, and between the activities and the hoped-for outcomes in the countries. As part of an ongoing process of rethinking international health TC, several years ago PAHO began a four-phase study on the usefulness and validity of functional approaches and on the need to propose new ones or to modify existing ones. The results of the initial phase showed it was difficult to classify the activities because the functional-approaches categories were not mutually exclusive and the TC activities were complex. Further, the expected results did not specify the product for which the PAHO Secretariat was accountable within a certain time frame nor the Secretariat's level of responsibility. Thus, a new and more flexible classification of expected results was proposed, with the following categories: cooperation networks and alliances; surveillance and information systems; standards and guidelines; research and evaluation studies; plans, projects, and policies; methods, models, and technologies; training programs; promotional campaigns and advocacy; and direct support. In the second phase of the study, it was concluded that the proposed classification system made it possible to more precisely identify the products of PAHO technical cooperation projects, the Organization's degree of responsibility, and the bases for estimating needed resources. The new system could also facilitate monitoring and evaluation. In addition, the third phase of analyzing the functional approaches has begun. Its objective is to evaluate the effect of technical cooperation based on the changes incorporated in the programming of activities.

Tetracycline Resistance in the Subsurface of a Poultry Farm: Influence of Poultry Wastes

NASA Astrophysics Data System (ADS)

You, Y.; Ball, W. P.; Ward, M. J.; Hilpert, M.

2007-12-01

Concentrated animal feeding operations (CAFOs) are considered to be important man-made reservoir of antibiotic resistant bacteria. Using the electromagnetic induction (EMI) method of geophysical characterization, we measured the apparent subsurface electrical conductivity (ECa) at a CAFO site in order to assess the movement of pollutants associated with animal waste. The map of ECa and other available data suggest that (1) soil surrounding a poultry litter storage shed is contaminated by poultry waste, (2) a contamination plume in the subsurface emanates from that shed, and (3) the development of that plume is due to groundwater flow. We focused on understanding the spread of tetracycline resistance (Tc\\tiny R), because tetracycline is one of the most frequently used antibiotics in food animal production and therefore probably used at our field site. Microbiological experiments show the presence of Tc\\tiny R bacteria in the subsurface and indicate higher concentrations in the top soil than in the aquifer. Environmental DNA was extracted to identify CAFO- associated Tc\\tiny R genes and to explore a link between the presence of Tc\\tiny R and CAFO practices. A "shot-gun" cloning approach is under development to target the most prevalent Tc\\tiny R gene. This gene will be monitored in future experiments, in which we will study the transmission of Tc\\tiny R to naive E.~coli under selective pressure of Tc. Experimental results will be used to develop a mathematical/numerical model in order to describe the transmission process and to subsequently make estimates regarding the large-scale spread of antibiotic resistance.

Biodegradation of individual and multiple chlorinated aliphatic hydrocarbons by methane-oxidizing cultures.

PubMed Central

Chang, H L; Alvarez-Cohen, L

1996-01-01

The microbial degradation of chlorinated and nonchlorinated methanes, ethanes, and ethanes by a mixed methane-oxidizing culture grown under chemostat and batch conditions is evaluated and compared with that by two pure methanotrophic strains: CAC1 (isolated from the mixed culture) and Methylosinus trichosporium OB3b. With the exception of 1,1-dichloroethylene, the transformation capacity (Tc) for each chlorinated aliphatic hydrocarbon was generally found to be in inverse proportion to its chlorine content within each aliphatic group (i.e., methanes, ethanes, and ethenes), whereas similar trends were not observed for degradation rate constants. Tc trends were similar for all methane-oxidizing cultures tested. None of the cultures were able to degrade the fully chlorinated aliphatics such as perchloroethylene and carbon tetrachloride. Of the four cultures tested, the chemostat-grown mixed culture exhibited the highest Tc for trichloroethylene, cis-1,2-dichloroethylene, tetrachloroethane, 1,1,1-trichloroethane, and 1,2-dichloroethane, whereas the pure batch-grown OB3b culture exhibited the highest Tc for all other compounds tested. The product toxicity of chlorinated aliphatic hydrocarbons in a mixture containing multiple compounds was cumulative and predictable when using parameters measured from the degradation of individual compounds. The Tc for each chlorinated aliphatic hydrocarbon in a mixture (Tcmix) and the total Tc for the mixture (sigma Tcmix) are functions of the individual Tc, the initial substrate concentration (S0), and the first-order rate constant (k/Ks) of each compound in the mixture, indicating the importance of identifying the properties and compositions of all potentially degradable compounds in a contaminant mixture. PMID:8795228

Seasonal features of quasi-biennial variations of NO2 stratospheric content derived from ground-based measurements

NASA Astrophysics Data System (ADS)

Ageyeva, V. Yu.; Gruzdev, A. N.

2017-01-01

Seasonal and latitudinal distributions of amplitudes of quasi-biennial variations in total NO2 content (NO2 TC), total ozone content (TOC), and stratospheric temperature are obtained. NO2 TC data from ground-based spectrometric measurements within the Network for the Detection of Atmospheric Composition Change (NDACC), TOC data from satellite measurements, and stratospheric temperature data from ERA-Interim reanalysis are used for the analysis. The differences in the NO2 TC diurnal cycles are identified between the westerly and easterly phases of the quasi-biennial oscillations (QBO) of equatorial stratospheric wind. The QBO effects in the NO2 TC, TOC, and stratospheric temperature in the Northern (NH) and Southern (SH) hemispheres are most significant in the winter-spring periods, with essential differences between the NH and SH. The NO2 TC in the Antarctic is less for the westerly phase of the QBO than that for the easterly phase, and the NO2 TC quasi-biennial variations in the SH mid-latitudes are opposite of the variations in the Antarctic. In the NH, the winter values of the NO2 TC are generally less during the westerly QBO phase than during the easterly phase, whereas in spring, on the contrary, the values for the westerly QBO phase exceed those for the easterly phase. Along with NO2, the features of the quasi-biennial variations of TOC and stratospheric temperature are discussed. Possible mechanisms of the quasi-biennial variations of the analyzed parameters are considered for the different latitudinal zones.

Non-pertechnetate Technetium Sensor Research and Development

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bryan, Samuel A.; Rapko, Brian M.; Branch, Shirmir D.

Several significant uncertainties remain regarding the understanding and modeling of the fate and speciation of technicium-99 ( 99Tc) in Hanford waste tanks, glass, and low-temperature waste forms. A significant (2% to 25%) fraction of the 99Tc in the water-soluble portion of the tank waste may be present as one or more non pertechnetate species that have not been identified and to date, cannot be effectively separated from the wastes. This task will provide a sensor specifically tuned to detect the Tc(I)-carbonyl species believed to constitute the main fraction of the non-pertechnetate form of technetium. By direct measurement of the non-pertechnetatemore » species, such a sensor will help reduce the uncertainties in the modeling of the fate and speciation of 99Tc in Hanford tanks and waste forms. This report summarizes work performed in FY2016 that was sponsored by the Department of Energy’s Office of Environmental Management and demonstrates the protocol for using fluorescent Tc(I)-tricarbonyl complex as a means to detect the non-pertechnetate species within tank waste solutions. The protocol was optimized with respect to ligand concentration, solvent choice, reaction temperature and time. This work culminated in the quantitation of Tc(I)-tricarbonyl within a waste simulant, using a standard addition method for measurement. This report also summarizes the synthesis and high-yield preparation of the low-valence technetium species, [Tc(CO) 3(H 2O) 3] +, which will be used as the technetium standard material for the demonstration of the non-pertechnetate species in actual wastes.« less

Bombesin Encapsulated in Long-Circulating pH-Sensitive Liposomes as a Radiotracer for Breast Tumor Identification.

PubMed

De Barros, André Luís Branco; Mota, Luciene Das Graças; Coelho, Marina Melo Antunes; Corrêa, Natássia Caroline Resende; De Góes, Alfredo Miranda; Oliveira, Mônica Cristina; Cardoso, Valbert Nascimento

2015-02-01

Bombesin (BBN) is a tetradecapeptide that binds specifically to gastrin-releasing peptide receptors in humans. These receptors are over-expressed in several forms of cancer; radiolabeled BBN could therefore be used to detect such cancers. However, the degradation of peptides is a critical issue in the development of tumor tracers. Liposomes can be used to overcome this problem and improve the uptake of tracers by tumors. Therefore, the purpose of this study was to prepare and characterize long-circulating and pH-sensitive liposomes (SpHL) containing 99mTc-HYNIC-βAla-Bombesin(7-14) (99mTc-BBN(7-14). In addition, the ability of this system to identify human breast cancer tissue was evaluated using biodistribution studies and scintigraphic images. Long-circulating and pH-sensitive liposomes (SpHL) were prepared and freeze-dried in the presence of cryoprotectants (glucose, mannitol, and trehalose). They were subsequently reconstituted with a solution of 99mTc-HYNIC-βAla-Bombesin(7-14) (99mTc-BBN(7-14)). The liposomes were evaluated for size, encapsulation percentage, radiotracer leakage, and storage stability. In addition, in vivo studies were performed in breast tumor-bearing nude mice. Liposomes in the presence of glucose (SpHLG), exhibited a mean diameter of 164.5 ± 6.5 nm and exhibited a 99mTc-BBN(7-14) encapsulation percentage of 30%. In addition, they remained highly stable for up to 120 days of storage. SpHLG- 99mTc-BBN(7-14) showed longer blood circulation than free 99mTc-BBN(7-14), did. The tumor-to-muscle and tumor-to-blood ratios for SpHLG-99mTc-BBN(7-14 were high at 4 h post-injection (9.31%ID/g and 7.93%ID/g, respectively). Furthermore, scintigraphic images revealed a strong signal in the tumor area, indicating tumor specificity of SpHLG-99mTc-BBN(7-14). In summary, SpHLG-99mTc-BBN(7-14) presented characteristics suitable for a diagnostic agent, and is a potential tool for tumor identification.

The pathogenesis-related protein PR-4b from Theobroma cacao presents RNase activity, Ca2+ and Mg2+ dependent-DNase activity and antifungal action on Moniliophthora perniciosa

PubMed Central

2014-01-01

Background The production and accumulation of pathogenesis-related proteins (PR proteins) in plants in response to biotic or abiotic stresses is well known and is considered as a crucial mechanism for plant defense. A pathogenesis-related protein 4 cDNA was identified from a cacao-Moniliophthora perniciosa interaction cDNA library and named TcPR-4b. Results TcPR-4b presents a Barwin domain with six conserved cysteine residues, but lacks the chitin-binding site. Molecular modeling of TcPR-4b confirmed the importance of the cysteine residues to maintain the protein structure, and of several conserved amino acids for the catalytic activity. In the cacao genome, TcPR-4b belonged to a small multigene family organized mainly on chromosome 5. TcPR-4b RT-qPCR analysis in resistant and susceptible cacao plants infected by M. perniciosa showed an increase of expression at 48 hours after infection (hai) in both cacao genotypes. After the initial stage (24-72 hai), the TcPR-4b expression was observed at all times in the resistant genotypes, while in the susceptible one the expression was concentrated at the final stages of infection (45-90 days after infection). The recombinant TcPR-4b protein showed RNase, and bivalent ions dependent-DNase activity, but no chitinase activity. Moreover, TcPR-4b presented antifungal action against M. perniciosa, and the reduction of M. perniciosa survival was related to ROS production in fungal hyphae. Conclusion To our knowledge, this is the first report of a PR-4 showing simultaneously RNase, DNase and antifungal properties, but no chitinase activity. Moreover, we showed that the antifungal activity of TcPR-4b is directly related to RNase function. In cacao, TcPR-4b nuclease activities may be related to the establishment and maintenance of resistance, and to the PCD mechanism, in resistant and susceptible cacao genotypes, respectively. PMID:24920373

Molecular Diagnosis of Chagas Disease in Colombia: Parasitic Loads and Discrete Typing Units in Patients from Acute and Chronic Phases

PubMed Central

Hernández, Carolina; Cucunubá, Zulma; Flórez, Carolina; Olivera, Mario; Valencia, Carlos; Zambrano, Pilar; León, Cielo; Ramírez, Juan David

2016-01-01

Background The diagnosis of Chagas disease is complex due to the dynamics of parasitemia in the clinical phases of the disease. The molecular tests have been considered promissory because they detect the parasite in all clinical phases. Trypanosoma cruzi presents significant genetic variability and is classified into six Discrete Typing Units TcI-TcVI (DTUs) with the emergence of foreseen genotypes within TcI as TcIDom and TcI Sylvatic. The objective of this study was to determine the operating characteristics of molecular tests (conventional and Real Time PCR) for the detection of T. cruzi DNA, parasitic loads and DTUs in a large cohort of Colombian patients from acute and chronic phases. Methodology/Principal Findings Samples were obtained from 708 patients in all clinical phases. Standard diagnosis (direct and serological tests) and molecular tests (conventional PCR and quantitative PCR) targeting the nuclear satellite DNA region. The genotyping was performed by PCR using the intergenic region of the mini-exon gene, the 24Sa, 18S and A10 regions. The operating capabilities showed that performance of qPCR was higher compared to cPCR. Likewise, the performance of qPCR was significantly higher in acute phase compared with chronic phase. The median parasitic loads detected were 4.69 and 1.33 parasite equivalents/mL for acute and chronic phases. The main DTU identified was TcI (74.2%). TcIDom genotype was significantly more frequent in chronic phase compared to acute phase (82.1% vs 16.6%). The median parasitic load for TcIDom was significantly higher compared with TcI Sylvatic in chronic phase (2.58 vs.0.75 parasite equivalents/ml). Conclusions/Significance The molecular tests are a precise tool to complement the standard diagnosis of Chagas disease, specifically in acute phase showing high discriminative power. However, it is necessary to improve the sensitivity of molecular tests in chronic phase. The frequency and parasitemia of TcIDom genotype in chronic patients highlight its possible relationship to the chronicity of the disease. PMID:27648938

Activity-Based Protein Profiling of Organophosphorus and Thiocarbamate Pesticides Reveals Multiple Serine Hydrolase Targets in Mouse Brain

PubMed Central

NOMURA, DANIEL K.; CASIDA, JOHN E.

2010-01-01

Organophosphorus (OP) and thiocarbamate (TC) agrochemicals are used worldwide as insecticides, herbicides, and fungicides, but their safety assessment in terms of potential off-targets remains incomplete. In this study, we used a chemoproteomic platform, termed activity-based protein profiling, to broadly define serine hydrolase targets in mouse brain of a panel of 29 OP and TC pesticides. Among the secondary targets identified, enzymes involved in degradation of endocannabinoid signaling lipids, monoacylglycerol lipase and fatty acid amide hydrolase, were inhibited by several OP and TC pesticides. Blockade of these two enzymes led to elevations in brain endocannabinoid levels and dysregulated brain arachidonate metabolism. Other secondary targets include enzymes thought to also play important roles in the nervous system and unannotated proteins. This study reveals a multitude of secondary targets for OP and TC pesticides and underscores the utility of chemoproteomic platforms in gaining insights into biochemical pathways that are perturbed by these toxicants. PMID:21341672

Tropical Cyclone - Equatorial Ionosphere Coupling: A Statistical Study

NASA Astrophysics Data System (ADS)

Bhagavathiammal, G. J.

2016-07-01

This paper describes the equatorial ionosphere response to tropical cyclone events which was observed over the Indian Ocean. This statistical study tries to reveal the possible Tropical Cyclone (TC) - Ionosphere coupling. Tropical cyclone track and data can be obtained from the India Meteorological Department, New Delhi. Digisonde/Ionosonde data for the equatorial latitudes can be obtained from Global Ionospheric Radio Observatory. It is believed that TC induced convection as the driving agent for the increased gravity wave activity in the lower atmosphere and these propagating gravity waves deposit their energy and momentum into the upper atmosphere as Travelling Ionospheric Disturbances (TIDs). The convective regions are identified with the help of Outgoing Long wave radiation (OLR) data from NOAA Climate Data Center/ Precipitation data from TRMM Statellite. The variability of ionospheric parameter like Total Electron Content (TEC), foF2, h'F2 and Drift velocity are examined during TC periods. This study will report the possibility of TC-Ionosphere Coupling in equatorial atmosphere.

99mTc-labeled PSMA inhibitor: Biokinetics and radiation dosimetry in healthy subjects and imaging of prostate cancer tumors in patients.

PubMed

Santos-Cuevas, Clara; Davanzo, Jenny; Ferro-Flores, Guillermina; García-Pérez, Francisco O; Ocampo-García, Blanca; Ignacio-Alvarez, Eleazar; Gómez-Argumosa, Edgar; Pedraza-López, Martha

2017-09-01

The prostate-specific membrane antigen (PSMA) is expressed in epithelial cells of the prostate and highly overexpressed in 95% of advanced prostate cancers. The aims of this study was to estimate the biokinetics and dosimetry of 99m Tc-EDDA/HYNIC-iPSMA ( 99m Tc-labeled PSMA inhibitor) in eight healthy subjects and evaluate its usefulness as a tumor-imaging agent in eight prostate cancer patients. 99m Tc-EDDA/HYNIC-iPSMA was obtained from a lyophilized formulation with radiochemical purities >98%, determined by reversed-phase HPLC and ITLC-SG analyses. Whole-body images from eight healthy subjects were acquired at 20min, and at 2, 6 and 24h after 99m Tc-EDDA/HYNIC-iPSMA administration. Regions of interest (ROIs) were drawn around the source organs on each time frame. Each ROI was corrected by background, attenuation, scattered radiation and physical decay. The image sequence was used to extrapolate the 99m Tc-EDDA/HYNIC-iPSMA time-activity curves of each organ to adjust the biokinetic model and calculate the total number of disintegrations (N) that occurred in the source regions. N data were the input for the OLINDA/EXM code to calculate internal radiation doses. In eight prostate cancer patients with histologically confirmed cancer, whole-body SPECT/CT images were obtained at 3h. The blood activity showed a half-life value of 4.98min for the fast component (T 1/2 α=ln2/8.34), 2.49h for the first slow component (T 1/2 β=ln2/0.278), and 9.24h for the second slow component (T 1/2 γ=ln2/0.076). Images from patients showed an average tumor/background ratio of 8.99±3.27 at 3h. The average equivalent doses calculated for a study using 740MBq were 3.80, 7.06, 9.69, 10.70, and 28.80mSv for the breast, spleen, salivary glands, liver, and kidneys respectively, with an effective dose of 3.42±0.78mSv. All the absorbed doses were comparable to those known for most of the 99m Tc studies. 99m Tc-EDDA/HYNIC-iPSMA obtained from kit formulations showed high tumor uptake in patients with malignant lesions, making it a promising imaging radiopharmaceutical to target site-specific prostate cancer. Copyright © 2017 Elsevier Inc. All rights reserved.

Technetium-99m-labeled ceftizoxime loaded long-circulating and pH-sensitive liposomes used to identify osteomyelitis.

PubMed

Ferreira, Soraya Maria Zandim Maciel Dias; Domingos, Giselle Pires; Ferreira, Diego dos Santos; Rocha, Talita Guieiro Ribeiro; Serakides, Rogéria; de Faria Rezende, Cleuza Maria; Cardoso, Valbert Nascimento; Fernandes, Simone Odília Antunes; Oliveira, Mônica Cristina

2012-07-15

Osteomyelitis is an infectious disease located in the bone or bone marrow. Long-circulating and pH-sensitive liposomes containing a technetium-99m-labeled antibiotic, ceftizoxime, (SpHL-(99m)Tc-CF) were developed to identify osteomyelitis foci. Biodistribution studies and scintigraphic images of bone infection or non infection-bearing rats that had been treated with these liposomes were performed. A high accumulation in infectious foci and high values in the target-non target ratio could be observed. These results indicate the potential of SpHL-(99m)Tc-CF as a potential agent for the diagnosis of bone infections. Copyright © 2012 Elsevier Ltd. All rights reserved.

[Rapid prenatal genetic diagnosis of a fetus with a high risk for Morquio A syndrome].

PubMed

Guo, Yi-bin; Ai, Yang; Zhao, Yan; Tang, Jia; Jiang, Wei-ying; Du, Min-lian; Ma, Hua-mei; Zhong, Yan-fang

2012-04-01

To provide rapid and accurate prenatal genetic diagnosis for a fetus with high risk of Morquio A syndrome. Based on ascertained etiology of the proband and genotypes of the parents, particular mutations of the GALNS gene were screened at 10th gestational week with amplification refractory mutation system (ARMS), denaturing high performance liquid chromatography (DHPLC), and direct DNA sequencing. DHPLC screening has identified abnormal double peaks in the PCR products of exons 1 and 10, whilst only a single peak was detected in normal controls. Amplification of ARMS specific primers derived a specific product for the fetus's gene, whilst no similar product was detected in normal controls. Sequencing of PCR products confirmed that exons 1 and 10 of the GALNS gene from the fetus contained a heterozygous paternal c.106-111 del (p.L36-L37 del) deletion and a heterozygous maternal c.1097 T>C (p.L366P) missense mutation, which resulted in a compound heterozygote status. The fetus was diagnosed with Morquio A syndrome and a genotype similar to the proband. Termination of the pregnancy was recommended. Combined ARMS, DHPLC and DNA sequencing are effective for rapid and accurate prenatal diagnosis for fetus with a high risk for Morquio A syndrome. Such methods are particularly suitable for early diagnosis when pathogenesis is clear. Furthermore, combined ARMS and DHPLC are suitable for rapid processing of large numbers of samples for the identification of new mutations.

New paleomagnetic data from the Djhavakheti Highland volcanic region (Lesser Caucasus): The Plio-Pleistocene Dashbashi sequence.

NASA Astrophysics Data System (ADS)

María Sánchez-Moreno, Elisa; Calvo-Rathert, Manuel; Gogichaishvili, Avto; Vashakidze, Goga T.; Lebedev, Vladimir A.

2017-04-01

The Djhavakheti Highland volcanic region in the central sector of the Lesser Caucasus (South Georgia) is one of the largest neo-volcanic areas of the Caucasus. It displays an eruptive activity that provides long and continuous sequences of basaltic lava flows whose mineralogy is capable to record in a reliable way the direction and intensity of the Earth's magnetic field at the time of its cooling. Paleomagnetic and paleointensity data in this area, despite their interest, are scarce in comparison to the rest of the Alpine-Himalayan Belt. Therefore this study contributes to complete the knowledge of the magnetic field record in this region. Recently, a new sequence named Dashbashi was sampled in the volcanic Djhavakheti Highland region. The sequence consists of 16 basaltic lava flows divided into three sections of different ages which are separated by erosion surfaces. The first section (flows DB01 to DB06) has an approximate age of 3.25 ± 0.25 M.a., the second (flows DB07 to DB14), an estimated age of 2.45 ± 0.25 M.a. and lavas DB15 and DB16 yield a similar or lower age. Rock-magnetic experiments were performed to determine the carriers of remanent magnetisation, their thermal stability and grain size. These experiments included the measurement of thermomagnetic curves, hysteresis parameters and isothermal remanent magnetisation (IRM) acquisition curves. All experiments were performed at the UBU paleomagnetic laboratory with a Variable Field Translation Balance (VFTB). Three types of behavior have been differentiated: i) Type H: Reversible behaviour and a single ferromagnetic phase with high Curie temperature (Tc) close to 580°. This phase corresponds to magnetite/ Ti-poor titanomagnetite. ii) Type H*: Single high temperature ferromagnetic phase and more irreversible behaviour that distinguishes them Type H. iii) Type M: Two ferromagnetic phases, the high Tc present in all samples, and another medium Tc (≈400-500°C) titanomagnetite/titanomaghemite with lower titanium content. Paleomagnetic measurements were also carried out at the UBU paleomagnetic laboratory with a 2G cryogenic magnetometer and included both thermal and alternating field (AF) demagnetization. A characteristic remanent magnetization (ChRM) could be determined in all studied flows. After analyzing the paleomagnetic directions obtained for the 16 lava flows of the Dashbashi sequence, it could be observed that the polarities determined for each of them show an inverse-intermediate latitude, which could correspond to an unstable directional behavior. With the purpose of analyzing the behaviour of secular variation in the studied section, and confirm its unstable character, the scatter of paleosecular variation (PSV) of the virtual geomagnetic poles VGPs was calculated, obtaining a very low dispersion value.

Conformational divergence in the HA-33/HA-17 trimer of serotype C and D botulinum toxin complex.

PubMed

Sagane, Yoshimasa; Hayashi, Shintaro; Akiyama, Tomonori; Matsumoto, Takashi; Hasegawa, Kimiko; Yamano, Akihito; Suzuki, Tomonori; Niwa, Koichi; Watanabe, Toshihiro; Yajima, Shunsuke

2016-08-05

Clostridium botulinum produces a large toxin complex (L-TC) comprising botulinum neurotoxin associated with auxiliary nontoxic proteins. A complex of 33- and 17-kDa hemagglutinins (an HA-33/HA-17 trimer) enhances L-TC transport across the intestinal epithelial cell layer via binding HA-33 to a sugar on the cell surface. At least two subtypes of serotype C/D HA-33 exhibit differing preferences for the sugars sialic acid and galactose. Here, we compared the three-dimensional structures of the galactose-binding HA-33 and HA-33/HA-17 trimers produced by the C-Yoichi strain. Comparisons of serotype C/D HA-33 sequences reveal a variable region with relatively low sequence similarity across the C. botulinum strains; the variability of this region may influence the manner of sugar-recognition by HA-33. Crystal structures of sialic acid- and galactose-binding HA-33 are broadly similar in appearance. However, small-angle X-ray scattering revealed distinct solution structures for HA-33/HA-17 trimers. A structural change in the C-terminal variable region of HA-33 might cause a dramatic shift in the conformation and sugar-recognition mode of HA-33/HA-17 trimer. Copyright © 2016 Elsevier Inc. All rights reserved.

[Correlation between adenylosuccinate lyase (ADSL) gene polymorphism and inosine monophosphate acid (IMP) content in domestic fowl and genetic relationship between red jungle fowl and domestic fowl].

PubMed

Shu, Jing-Ting; Bao, Wen-Bin; Zhang, Hong-Xia; Zhang, Xue-Yu; Ji, Cong-Liang; Chen, Guo-Hong

2007-03-01

This study investigates single nucleotide polymorphism (SNP) of the adenylosuccinate lyase(ADSL) gene in variety chicken breeds, including Recessive White chickens, Silkies chickens, Baier chickens, Tibetan chickens and two red jungle fowls. Primers for exon 2 in ADSL gene were designed based on the chicken genomic sequence and a SNP(C/T at 3484) was detected by PCR-SSCP and DNA sequencing. Three genotypes within all breeds were found and least square analysis showed that TT genotype birds had a significant higher inosine monophosphate acid (IMP) content than TC (P < 0.01) and CC (P < 0.05) genotype birds, TC genotype birds had a little higher IMP content than CC genotype birds, but the difference was not significant. We proposed this SNP site correlated with IMP content in chickens. A neighbour-joining dendrogram was constructed based on the Nei's genentic distance. The genetic relationship between Chinese red jungle fowl and Tibetan chickens was the nearest, whereas Baier chickens were more closer to Silkies chickens. The Chinese red jungle fowls were relatively closer to the domestic fowls, whereas Thailand red jungle fowls were relatively diverging to the Chinese native breeds. These results supported the theory concerning the independent origins of Chinese native fowl breeds.

Cultivation-Independent Screening Revealed Hot Spots of IncP-1, IncP-7 and IncP-9 Plasmid Occurrence in Different Environmental Habitats

PubMed Central

Dealtry, Simone; Ding, Guo-Chun; Weichelt, Viola; Dunon, Vincent; Schlüter, Andreas; Martini, María Carla; Papa, María Florencia Del; Lagares, Antonio; Amos, Gregory Charles Auton; Wellington, Elizabeth Margaret Helen; Gaze, William Hugo; Sipkema, Detmer; Sjöling, Sara; Springael, Dirk; Heuer, Holger; van Elsas, Jan Dirk; Thomas, Christopher; Smalla, Kornelia

2014-01-01

IncP-1, IncP-7 and IncP-9 plasmids often carry genes encoding enzymes involved in the degradation of man-made and natural contaminants, thus contributing to bacterial survival in polluted environments. However, the lack of suitable molecular tools often limits the detection of these plasmids in the environment. In this study, PCR followed by Southern blot hybridization detected the presence of plasmid-specific sequences in total community (TC-) DNA or fosmid DNA from samples originating from different environments and geographic regions. A novel primer system targeting IncP-9 plasmids was developed and applied along with established primers for IncP-1 and IncP-7. Screening TC-DNA from biopurification systems (BPS) which are used on farms for the purification of pesticide-contaminated water revealed high abundances of IncP-1 plasmids belonging to different subgroups as well as IncP-7 and IncP-9. The novel IncP-9 primer-system targeting the rep gene of nine IncP-9 subgroups allowed the detection of a high diversity of IncP-9 plasmid specific sequences in environments with different sources of pollution. Thus polluted sites are “hot spots” of plasmids potentially carrying catabolic genes. PMID:24587126

Dysferlinopathy in Switzerland: clinical phenotypes and potential founder effects.

PubMed

Petersen, Jens A; Kuntzer, Thierry; Fischer, Dirk; von der Hagen, Maja; Huebner, Angela; Kana, Veronika; Lobrinus, Johannes A; Kress, Wolfram; Rushing, Elisabeth J; Sinnreich, Michael; Jung, Hans H

2015-10-06

Dysferlin is reduced in patients with limb girdle muscular dystrophy type 2B, Miyoshi myopathy, distal anterior compartment myopathy, and in certain Ethnic clusters. We evaluated clinical and genetic patient data from three different Swiss Neuromuscular Centers. Thirteen patients from 6 non-related families were included. Age of onset was 18.8 ± 4.3 years. In all patients, diallelic disease-causing mutations were identified in the DYSF gene. Nine patients from 3 non-related families from Central Switzerland carried the identical homozygous mutation, c.3031 + 2 T>C. A possible founder effect was confirmed by haplotype analysis. Three patients from two different families carried the heterozygous mutation, c.1064_1065delAA. Two novel mutations were identified (c.2869 C>T (p.Gln957Stop), c.5928 G>A (p.Trp1976Stop)). Our study confirms the phenotypic heterogeneity associated with DYSF mutations. Two mutations (c.3031 + 2 T>C, c.1064_1065delAA) appear common in Switzerland. Haplotype analysis performed on one case (c. 3031 + 2 T>C) suggested a possible founder effect.

Coupling chemical transport model source attributions with positive matrix factorization: application to two IMPROVE sites impacted by wildfires.

PubMed

Sturtz, Timothy M; Schichtel, Bret A; Larson, Timothy V

2014-10-07

Source contributions to total fine particle carbon predicted by a chemical transport model (CTM) were incorporated into the positive matrix factorization (PMF) receptor model to form a receptor-oriented hybrid model. The level of influence of the CTM versus traditional PMF was varied using a weighting parameter applied to an object function as implemented in the Multilinear Engine (ME-2). The methodology provides the ability to separate features that would not be identified using PMF alone, without sacrificing fit to observations. The hybrid model was applied to IMPROVE data taken from 2006 through 2008 at Monture and Sula Peak, Montana. It was able to separately identify major contributions of total carbon (TC) from wildfires and minor contributions from biogenic sources. The predictions of TC had a lower cross-validated RMSE than those from either PMF or CTM alone. Two unconstrained, minor features were identified at each site, a soil derived feature with elevated summer impacts and a feature enriched in sulfate and nitrate with significant, but sporadic contributions across the sampling period. The respective mean TC contributions from wildfires, biogenic emissions, and other sources were 1.18, 0.12, and 0.12 ugC/m(3) at Monture and 1.60, 0.44, and 0.06 ugC/m(3) at Sula Peak.

Orthopaedic podiatry triage: process outcomes of a skill mix initiative.

PubMed

Homeming, Lyndon J; Kuipers, Pim; Nihal, Aneel

2012-11-01

The Orthopaedic Podiatry Triage Clinic (OPodTC) is a 'skill mix' model of care developed in Queensland Health to address the problem of lengthy waiting times for orthopaedic surgery on foot and ankle pathologies. It is based on the recognition that many orthopaedic surgery referrals can be identified early and treated conservatively with podiatry, averting the need for more costly and invasive surgical interventions. The model is collaborative and relies on screening and triage by the podiatrist, rather than delegation by the orthopaedic surgeon. Screening and triage through OPodTC was trialled at three Queensland Health hospital facilities during 2009 and 2010 to improve service timeliness. Patients identified by the OPodTC podiatrist as suitable for conservative management were provided with non-surgical podiatry interventions and discharged if appropriate. Those identified as still requiring surgical intervention after the benefit of interim conservative treatment provided by the podiatrist (or who chose to remain on the list) were returned to their previous place on the orthopaedic waiting list. This paper presents a summary and description of waiting list changes in association with this trial. The OPodTC intervention resulted in a reduction in the non-urgent category of the waiting list across the three hospitals of between 23.3% and 49.7%. Indications from wait-list service data demonstrated increased timeliness and improved patient flow, which are core goals of these skill mix initiatives. This study highlights the potential of screening and triage functions in the skill mix debate. In this example, conservative treatment options were considered first, suitable patients did not have to wait long periods to receive timely and appropriate interventions, and those for whom surgery was indicated, were provided with a more targeted service.

Accomplishing the genotype-specific serodiagnosis of single and dual Trypanosoma cruzi infections by flow cytometry Chagas-Flow ATE-IgG2a

PubMed Central

Alessio, Glaucia Diniz; de Araújo, Fernanda Fortes; Sales Júnior, Policarpo Ademar; Gomes, Matheus de Souza; do Amaral, Laurence Rodrigues; Pascoal Xavier, Marcelo Antônio; Teixeira-Carvalho, Andréa; de Lana, Marta

2018-01-01

The methods currently available for genotype-specific diagnosis of T. cruzi infection still present relevant limitations, especially to identify mixed infection. In the present investigation, we have evaluated the performance of Chagas-Flow ATE-IgG2a test for early and late differential diagnosis of single and dual genotype-specific T. cruzi infections. Serum samples from Swiss mice at early and late stages of T. cruzi infection were assayed in parallel batches for genotype-specific diagnosis of single (TcI, TcVI or TcII) and dual (TcI+TcVI, TcVI+TcII or TcII+TcI) infections. The intrinsic reactivity to TcI, TcVI and TcII target antigens, including amastigote (AI/AVI/AII), trypomastigote-(TI/TVI/TII) and epimastigote (EI/EVI/EII), at specific reverse of serum dilutions (500 to 64,000), was employed to provide reliable decision-trees for “early” vs “late”, “single vs “dual” and “genotype-specific” serology. The results demonstrated that selective set of attributes “EII 500/EI 2,000/AII 500” were able to provide high-quality accuracy (81%) to segregate early and late stages of T. cruzi infection. The sets “TI 2,000/AI 1,000/EII 1,000” and “TI 8,000/AII 32,000” presented expressive scores to discriminate single from dual T. cruzi infections at early (85%) and late stages (84%), respectively. Moreover, the attributes “TI 4,000/TVI 500/TII 1,000”, “TI 16,000/EI 2,000/EII 2,000/AI 500/TVI 500” showed good performance for genotype-specific diagnosis at early stage of single (72%) and dual (80%) T. cruzi infections, respectively. In addition, the attributes “TI 4,000/AII 1,000/EVI 1,000”, “TI 64,000/AVI 500/AI 2,000/AII 1,000/EII 4,000” showed moderate performance for genotype-specific diagnosis at late stage of single (69%) and dual (76%) T. cruzi infections, respectively. The sets of decision-trees were assembled to construct a sequential algorithm with expressive accuracy (81%) for serological diagnosis of T. cruzi infection. These findings engender new perspectives for the application of Chagas-Flow ATE-IgG2a method for genotype-specific diagnosis in humans, with relevant contributions for epidemiological surveys as well as clinical and post-therapeutic monitoring of Chagas disease. PMID:29462135

Evaluation of Technetium Getters to Improve the Performance of Cast Stone

DOE Office of Scientific and Technical Information (OSTI.GOV)

Neeway, James J.; Qafoku, Nikolla P.; Serne, R. Jeffrey

2015-11-01

Cast Stone has been selected as the preferred waste form for solidification of aqueous secondary liquid effluents from the Hanford Tank Waste Treatment and Immobilization Plant (WTP) process condensates and low-activity waste (LAW) melter off-gas caustic scrubber effluents. Cast Stone is also being evaluated as a supplemental immobilization technology to provide the necessary LAW treatment capacity to complete the Hanford tank waste cleanup mission in a timely and cost effective manner. One of the major radionuclides that Cast Stone has the potential to immobilize is technetium (Tc). The mechanism for immobilization is through the reduction of the highly mobile Tc(VII)more » species to the less mobile Tc(IV) species by the blast furnace slag (BFS) used in the Cast Stone formulation. Technetium immobilization through this method would be beneficial because Tc is one of the most difficult contaminants to address at the U.S. Department of Energy (DOE) Hanford Site due to its complex chemical behavior in tank waste, limited incorporation in mid- to high-temperature immobilization processes (vitrification, steam reformation, etc.), and high mobility in subsurface environments. In fact, the Tank Closure and Waste Management Environmental Impact Statement for the Hanford Site, Richland, Washington (TC&WM EIS) identifies technetium-99 ( 99Tc) as one of the radioactive tank waste components contributing the most to the environmental impact associated with the cleanup of the Hanford Site. The TC&WM EIS, along with an earlier supplemental waste-form risk assessment, used a diffusion-limited release model to estimate the release of different contaminants from the WTP process waste forms. In both of these predictive modeling exercises, where effective diffusivities based on grout performance data available at the time, groundwater at the 100-m down-gradient well exceeded the allowable maximum permissible concentrations for 99Tc. (900 pCi/L). Recent relatively short-term (63 day) leach tests conducted on both LAW and secondary waste Cast Stone monoliths indicated that 99Tc diffusivities were at or near diffusivities where the groundwater at the 100-m down-gradient well would exceed the allowable maximum permissible 99Tc concentrations. There is, therefore, a need and an opportunity to improve the retention of Tc in the Cast Stone waste form. One method to improve the performance of the Cast Stone waste form is through the addition of “getters” that selectively sequester Tc inside Cast Stone.« less

Prevalence of Trypanosoma cruzi's Discrete Typing Units in a cohort of Latin American migrants in Spain.

PubMed

Martinez-Perez, Angela; Poveda, Cristina; Ramírez, Juan David; Norman, Francesca; Gironés, Núria; Guhl, Felipe; Monge-Maillo, Begoña; Fresno, Manuel; López-Vélez, Rogelio

2016-05-01

Chagas disease is caused by the protozoan Trypanosoma cruzi. This is an endemic disease in the Americas, but increased migration to Europe has made it emerge in countries where it was previously unknown, being Spain the second non endemic country in number of patients. T. cruzi is a parasite with a wide genetic diversity, which has been grouped by consensus into 6 Discrete Typing Units (DTUs) affecting humans. Some authors have linked these DTUs either to a specific epidemiological context or to the different clinical presentations. Our main objective was to describe the T. cruzi DTUs identified from a population of chronically infected Latin American migrants attending a reference clinic in Madrid. 149 patients meeting this condition were selected for the study. Molecular characterization was performed by an algorithm that combines PCR of the intergenic region of the mini exon-gene, the 24Sα and 18S regions of rDNA and the variable region of the satellite DNA. A descriptive analysis was performed and associations between geographical/clinical data and the different DTUs were tested. DTUs could be determined in 105 out of 149 patients, 93.3% were from Bolivia, 67.7% were women and median age was 35 years (IQR 29-44). The most common DTU found was TcV (58; 55.2%), followed by TcIV (17; 16.2%), TcII (10; 9.5%) and TcI (4; 3.8%). TcIII and TcVI were not identified from any patient, and 15.2% patients presented mixed infections. In addition, we determined DTUs after treatment in a subset of patients. In 57% patients had different DTUs before and after treatment. DTUs distribution from this study indicates active transmission of T. cruzi is occurring in Bolivia, in both domestic and sylvatic cycles. TcIV was confirmed as a cause of chronic human disease. The current results indicate no correlation between DTU and any specific clinical presentation associated with Chagas disease, nor with geographical origin. Treatment with benznidazole does not always clear T. cruzi's genetic material from blood, and DTUs detected in the same patient may vary over time indicating that polyparasitism is frequent. Copyright © 2016 Elsevier B.V. All rights reserved.

The polymorphisms of bovine VEGF gene and their associations with growth traits in Chinese cattle.

PubMed

Pang, Yonghong; Wang, Juqiang; Zhang, Chunlei; Lei, Chuzhao; Lan, Xianyong; Yue, Wangping; Gu, Chuanwen; Chen, Danxia; Chen, Hong

2011-02-01

PCR-SSCP and DNA sequencing methods were employed to screen the genetic variation of VEGF gene in 671 individuals belonging to three Chinese indigenous cattle breeds including Nanyang, Jiaxian Red and Qinchuan. Three haplotypes (A, B and C), four observed genotypes (AA, AB, BB and AC) and three new SNPs (6765T>C ss130456744, 6860A>G ss130456745, 6893T>C ss130456746) were detected. The analysis suggested that one SNP (ss130456744) in the bovine VEGF gene had significant effects on birth weight, body weight and heart girth at 6 months old in the Nanyang breed (P < 0.05). The results showed that the SNP (ss130456744) in intron 2 of the VEGF gene is associated with early development and growth of Chinese cattle. These findings raise hope that this polymorphism can be a molecular breeding marker in breeding strategies through marker assisted selection (MAS) in Chinese domestic cattle.

The maternal-effect, selfish genetic element Medea is associated with a composite Tc1 transposon.

PubMed

Lorenzen, Marcé D; Gnirke, Andreas; Margolis, Jonathan; Garnes, Jeffrey; Campbell, Margie; Stuart, Jeffrey J; Aggarwal, Rajat; Richards, Stephen; Park, Yoonseong; Beeman, Richard W

2008-07-22

Maternal-Effect Dominant Embryonic Arrest ("Medea") factors are selfish nuclear elements that combine maternal-lethal and zygotic-rescue activities to gain a postzygotic survival advantage. We show that Medea(1) activity in Tribolium castaneum is associated with a composite Tc1 transposon inserted just downstream of the neurotransmitter reuptake symporter bloated tubules (blot), whose Drosophila ortholog has both maternal and zygotic functions. The 21.5-kb insertion contains defective copies of elongation initiation factor-3, ATP synthase subunit C, and an RNaseD-related gene, as well as a potentially intact copy of a prokaryotic DUF1703 gene. Sequence comparisons suggest that the current distribution of Medea(1) reflects global emanation after a single transpositional event in recent evolutionary time. The Medea system in Tribolium represents an unusual type of intragenomic conflict and could provide a useful vehicle for driving desirable genes into populations.

The maternal-effect, selfish genetic element Medea is associated with a composite Tc1 transposon

PubMed Central

Lorenzen, Marcé D.; Gnirke, Andreas; Margolis, Jonathan; Garnes, Jeffrey; Campbell, Margie; Stuart, Jeffrey J.; Aggarwal, Rajat; Richards, Stephen; Park, Yoonseong; Beeman, Richard W.

2008-01-01

Maternal-Effect Dominant Embryonic Arrest (“Medea”) factors are selfish nuclear elements that combine maternal-lethal and zygotic-rescue activities to gain a postzygotic survival advantage. We show that Medea1 activity in Tribolium castaneum is associated with a composite Tc1 transposon inserted just downstream of the neurotransmitter reuptake symporter bloated tubules (blot), whose Drosophila ortholog has both maternal and zygotic functions. The 21.5-kb insertion contains defective copies of elongation initiation factor-3, ATP synthase subunit C, and an RNaseD-related gene, as well as a potentially intact copy of a prokaryotic DUF1703 gene. Sequence comparisons suggest that the current distribution of Medea1 reflects global emanation after a single transpositional event in recent evolutionary time. The Medea system in Tribolium represents an unusual type of intragenomic conflict and could provide a useful vehicle for driving desirable genes into populations. PMID:18621706

Identification of an AVP-NPII mutation within the AVP moiety in a family with neurohypophyseal diabetes insipidus: review of the literature.

PubMed

Koufaris, Costas; Alexandrou, Angelos; Sismani, Carolina; Skordis, Nicos

2015-01-01

Familial neurohypophyseal diabetes insipidus (FNDI) is a disorder characterized by excess excretion of diluted urine (polyuria) and increased uptake of fluids (polydipsia). The disorder is caused by mutations affecting the AVP-NPII gene, resulting in absent or deficient secretion of the antidiuretic hormone arginine vasopressin (AVP) by the neurohypophysis. In this study we examined a three-generation Cypriot kindred suspected to have FNDI. Direct sequencing analysis of AVP-NPII identified a missense mutation (NM_000490.4:c.61T>C; p.Tyr21His; rs121964893) within the AVP moiety on exon 1 of the gene in all affected family members. So far, only three studies have reported mutations within the AVP moiety of AVP-NPIIas being associated with FNDI, with the vast majority of identified FNDI mutations being located within the signalling peptide or the neurophysis II (NPII) moiety of the gene. The mutation within the AVP moiety identified here had been reported previously in a Turkish kindred with FNDI. Consequently, the findings of this study confirm the causal role of mutations within the AVP moiety in FNDI. Herein we review reported mutations within the AVP moiety of AVP-NPII and their contribution to FNDI.

Significance of genetic variants in DLC1 and their association with hepatocellular carcinoma

PubMed Central

XIE, CHENG-RONG; SUN, HONG-GUANG; SUN, YU; ZHAO, WEN-XIU; ZHANG, SHENG; WANG, XIAO-MIN; YIN, ZHEN-YU

2015-01-01

DLC1 has been shown to be downregulated or absent in hepatocellular carcinoma (HCC) and is associated with tumorigenesis and development. However, only a small number of studies have focused on genetic variations of DLC1. The present study performed exon sequencing for the DLC1 gene in HCC tissue samples from 105 patients to identify functional genetic variation of DLC1 and its association with HCC susceptibility, clinicopathological features and prognosis. A novel missense mutation and four non-synonymous single nucleotide polymorphisms (SNPs; rs3816748, rs11203495, rs3816747 and rs532841) were identified. A significant correlation of rs3816747 polymorphisms with HCC susceptibility was identified. Compared to individuals with the GG genotype of rs3816747, those with the GA (odds ratio (OR)=0.486; P=0.037) or GA+AA genotype (OR=0.51; P=0.039) were associated with a significantly decreased HCC risk. Furthermore, patients with the GC+CC genotype of rs3816748, the TC+CC genotype of rs11203495 or the GA+AA genotype of rs3816747 had small-sized tumors compared with those carrying the wild-type genotype. No significant association of DLC1 SNPs with the patients' prognosis was found. These results indicated that genetic variations in the DLC1 gene may confer a risk for HCC. PMID:26095787

Quetzal: a transposon of the Tc1 family in the mosquito Anopheles albimanus.

PubMed

Ke, Z; Grossman, G L; Cornel, A J; Collins, F H

1996-10-01

A member of the Tc1 family of transposable elements has been identified in the Central and South American mosquito Anopheles albimanus. The full-length Quetzal element is 1680 base pairs (bp) in length, possesses 236 bp inverted terminal repeats (ITRs), and has a single open reading frame (ORF) with the potential of encoding a 341-amino-acid (aa) protein that is similar to the transposases of other members of the Tc1 family, particularly elements described from three different Drosophila species. The approximately 10-12 copies per genome of Quetzal are found in the euchromatin of all three chromosomes of A. albimanus. One full-length clone, Que27, appears capable of encoding a complete transposase and may represent a functional copy of this element.