Primer-independent RNA sequencing with bacteriophage phi6 RNA polymerase and chain terminators.
Makeyev, E V; Bamford, D H
2001-05-01
Here we propose a new general method for directly determining RNA sequence based on the use of the RNA-dependent RNA polymerase from bacteriophage phi6 and the chain terminators (RdRP sequencing). The following properties of the polymerase render it appropriate for this application: (1) the phi6 polymerase can replicate a number of single-stranded RNA templates in vitro. (2) In contrast to the primer-dependent DNA polymerases utilized in the sequencing procedure by Sanger et al. (Proc Natl Acad Sci USA, 1977, 74:5463-5467), it initiates nascent strand synthesis without a primer, starting the polymerization on the very 3'-terminus of the template. (3) The polymerase can incorporate chain-terminating nucleotide analogs into the nascent RNA chain to produce a set of base-specific termination products. Consequently, 3' proximal or even complete sequence of many target RNA molecules can be rapidly deduced without prior sequence information. The new technique proved useful for sequencing several synthetic ssRNA templates. Furthermore, using genomic segments of the bluetongue virus we show that RdRP sequencing can also be applied to naturally occurring dsRNA templates. This suggests possible uses of the method in the RNA virus research and diagnostics.
Code of Federal Regulations, 2010 CFR
2010-01-01
... the polymerase chain reaction (PCR) test for Mycoplasma gallisepticum and M. synoviae. 147.30 Section... Examination Procedures § 147.30 Laboratory procedure recommended for the polymerase chain reaction (PCR) test... should consist of the following sequences: ER12JA07.005 (c) Polymerase chain reaction. (1) Treat each...
Code of Federal Regulations, 2011 CFR
2011-01-01
... the polymerase chain reaction (PCR) test for Mycoplasma gallisepticum and M. synoviae. 147.30 Section... Examination Procedures § 147.30 Laboratory procedure recommended for the polymerase chain reaction (PCR) test... should consist of the following sequences: ER12JA07.005 (c) Polymerase chain reaction. (1) Treat each...
USDA-ARS?s Scientific Manuscript database
Polymerase chain reaction amplification of conserved genes and sequence analysis provides a very powerful tool for the identification of toxigenic as well as non-toxigenic Penicillium species. Sequences are obtained by amplification of the gene fragment, sequencing via capillary electrophoresis of d...
Identification of Brucella spp. by using the polymerase chain reaction.
Herman, L; De Ridder, H
1992-01-01
The application of two synthetic oligonucleotides as probes and as primers in the polymerase chain reaction is presented for a specific, sensitive, and quick identification of Brucella spp. The specific oligonucleotide sequences were chosen on the basis of a 16S rRNA sequence alignment between Brucella abortus and Agrobacterium tumefaciens. Images PMID:1377903
Problem-Solving Test: Pyrosequencing
ERIC Educational Resources Information Center
Szeberenyi, Jozsef
2013-01-01
Terms to be familiar with before you start to solve the test: Maxam-Gilbert sequencing, Sanger sequencing, gel electrophoresis, DNA synthesis reaction, polymerase chain reaction, template, primer, DNA polymerase, deoxyribonucleoside triphosphates, orthophosphate, pyrophosphate, nucleoside monophosphates, luminescence, acid anhydride bond,…
Madershahian, Navid; Strauch, Justus T; Breuer, Martin; Bruhin, Raimund; Straube, Eberhard; Wahlers, Thorsten
2005-03-01
We report a case of culture-negative infectious endocarditis in a 17-year-old boy in which the etiologic diagnosis could only be provided by polymerase chain reaction amplification and sequencing of the bacterial 16S rRNA gene from valve tissue.
A novel gammaherpesvirus in a large flying fox (Pteropus vampyrus) with blepharitis.
Paige Brock, A; Cortés-Hinojosa, Galaxia; Plummer, Caryn E; Conway, Julia A; Roff, Shannon R; Childress, April L; Wellehan, James F X
2013-05-01
A novel gammaherpesvirus was identified in a large flying fox (Pteropus vampyrus) with conjunctivitis, blepharitis, and meibomianitis by nested polymerase chain reaction and sequencing. Polymerase chain reaction amplification and sequencing of 472 base pairs of the DNA-dependent DNA polymerase gene were used to identify a novel herpesvirus. Bayesian and maximum likelihood phylogenetic analyses indicated that the virus is a member of the genus Percavirus in the subfamily Gammaherpesvirinae. Additional research is needed regarding the association of this virus with conjunctivitis and other ocular pathology. This virus may be useful as a biomarker of stress and may be a useful model of virus recrudescence in Pteropus spp.
Cruz-Perez, Patricia; Buttner, Mark P.
2004-05-11
A method for detecting the fungus Stachybotrys chartarum includes isolating DNA from a sample suspected of containing the fungus Stachybotrys chartarum. The method further includes subjecting the DNA to polymerase chain reaction amplification utilizing at least one of several primers, the several primers each including one of the base sequences 5'GTTGCTTCGGCGGGAAC3', 5'TTTGCGTTTGCCACTCAGAG3', 5'ACCTATCGTTGCTTCGGCG3', and 5'GCGTTTGCCACTCAGAGAATACT3'. The method additionally includes detecting the fungus Stachybotrys chartarum by visualizing the product of the polymerase chain reaction.
D'iachenko, A G; Dzhalagoniia, B E; Kapanadze, B I
1993-01-01
The gene amplification technique was used for detection and sequence analysis of STLV-1 Papio proviral DNA. The polymerase chain reaction was performed with a primer pair at tax region of HTLV-1, 7336-7354, sense strand, and 7516-7494, antisense strand. One microgram of DNAs isolated from LUG-4 cells and autopsies was used in a reaction volume of 50 microliters involving 30 cycles of amplifications. The reaction product was blunt-end cloned into pUC19 cut with Smal. The sequence was done with T7-polymerase using 32P-dATR as a label. Our results indicate that STLV-1 Papio provirus is actually present in the cells of a lymphoid cell line and tumor cells of lymphomatous monkeys. There are some differences between STLV-1 Papio and reported sequences of HTLV-1 and STLV-1.
Lakatos, Béla; Hornyák, Ákos; Demeter, Zoltán; Forgách, Petra; Kennedy, Frances; Rusvai, Miklós
2017-12-01
Adenoviral nucleic acid was detected by polymerase chain reaction (PCR) in formalin-fixed paraffin-embedded tissue samples of a cat that had suffered from disseminated adenovirus infection. The identity of the amplified products from the hexon and DNA-dependent DNA polymerase genes was confirmed by DNA sequencing. The sequences were clearly distinguishable from corresponding hexon and polymerase sequences of other mastadenoviruses, including human adenoviruses. These results suggest the possible existence of a distinct feline adenovirus.
[Application of the polymerase chain reaction (PCR) in the diagnosis of Hb S-beta(+)-thalassemia].
Harano, K; Harano, T; Kushida, Y; Ueda, S
1991-08-01
Isoelectric focusing of the hemolysate prepared from a two-year-old American black boy with microcytic hypochromia showed the presence of a high percentage (63.3%) of such Hb variant as Hb S, while the levels of Hb A, Hb F and Hb A2 were 20.0%, 12.7%, and 4.0%, respectively. The ratio of the non-alpha-chain to the alpha-chain of the biosynthesized globin chains was 0.49. The variant was identified as Hb S by amino acid analysis of the abnormal peptide (beta T-1) and digestion of DNA amplified by the polymerase chain reaction with enzyme Eco 81 I. This was further confirmed by DNA sequencing. DNA sequencing of a beta-gene without the beta s-mutation revealed a nucleotide change of T to C in the polyadenylation signal sequence AATAAA 3' to the beta-gene, resulting in beta(+)-thalassemia. These results are consistent with the existence of a beta s-gene and a beta(+)-thalassemia gene in trans.
Primers for polymerase chain reaction to detect genomic DNA of Toxocara canis and T. cati.
Wu, Z; Nagano, I; Xu, D; Takahashi, Y
1997-03-01
Primers for polymerase chain reaction to amplify genomic DNA of both Toxocara canis and T. cati were constructed by adapting cloning and sequencing random amplified polymorphic DNA. The primers are expected to detect eggs and/or larvae of T. canis and T. cati, both of which are known to cause toxocariasis in humans.
ERIC Educational Resources Information Center
Hamilton, Kenny; Barfoot, Jan; Crawford, Kathleen E.; Simpson, Craig G.; Beaumont, Paul C.; Bownes, Mary
2006-01-01
We describe a polymerase chain reaction (PCR) protocol suitable for use in secondary schools and colleges. This PCR protocol can be used to investigate genetic variation between plants. The protocol makes use of primers which are complementary to sequences of nucleotides that are highly conserved across different plant genera. The regions of…
Geographic variation in marine turtle fibropapillomatosis
Greenblatt, R.J.; Work, Thierry M.; Dutton, P.; Sutton, C.A.; Spraker, T.R.; Casey, R.N.; Diez, C.E.; Parker, Dana C.; St. Ledger, J.; Balazs, G.H.; Casey, J.W.
2005-01-01
We document three examples of fibropapillomatosis by histology, quantitative polymerase chain reaction (qPCR), and sequence analysis from three different geographic areas. Tumors compatible in morphology with fibropapillomatosis were seen in green turtles from Puerto Rico and San Diego (California) and in a hybrid loggerhead/ hawksbill turtle from Florida Bay (Florida). Tumors were confirmed as fibropapillomas on histology, although severity of disease varied between cases. Polymerase chain reaction (PCR) analyses revealed infection with the fibropapilloma-associated turtle herpesvirus (FPTHV) in all cases, albeit at highly variable copy numbers per cell. Alignment of a portion of the polymerase gene from each fibropapilloma-associated turtle herpesvirus isolate demonstrated geographic variation in sequence. These cases illustrate geographic variation in both the pathology and the virology of fibropapillomatosis.
Geographic variation in marine turtle fibropapillomatosis.
Greenblatt, Rebecca J; Work, Thierry M; Dutton, Peter; Sutton, Claudia A; Spraker, Terry R; Casey, Rufina N; Diez, Carlos E; Parker, Denise; St Leger, Judy; Balazs, George H; Casey, James W
2005-09-01
We document three examples of fibropapillomatosis by histology, quantitative polymerase chain reaction (qPCR), and sequence analysis from three different geographic areas. Tumors compatible in morphology with fibropapillomatosis were seen in green turtles from Puerto Rico and San Diego (California) and in a hybrid loggerhead/ hawksbill turtle from Florida Bay (Florida). Tumors were confirmed as fibropapillomas on histology, although severity of disease varied between cases. Polymerase chain reaction (PCR) analyses revealed infection with the fibropapilloma-associated turtle herpesvirus (FPTHV) in all cases, albeit at highly variable copy numbers per cell. Alignment of a portion of the polymerase gene from each fibropapilloma-associated turtle herpesvirus isolate demonstrated geographic variation in sequence. These cases illustrate geographic variation in both the pathology and the virology of fibropapillomatosis.
Generation of non-genomic oligonucleotide tag sequences for RNA template-specific PCR
Pinto, Fernando Lopes; Svensson, Håkan; Lindblad, Peter
2006-01-01
Background In order to overcome genomic DNA contamination in transcriptional studies, reverse template-specific polymerase chain reaction, a modification of reverse transcriptase polymerase chain reaction, is used. The possibility of using tags whose sequences are not found in the genome further improves reverse specific polymerase chain reaction experiments. Given the absence of software available to produce genome suitable tags, a simple tool to fulfill such need was developed. Results The program was developed in Perl, with separate use of the basic local alignment search tool, making the tool platform independent (known to run on Windows XP and Linux). In order to test the performance of the generated tags, several molecular experiments were performed. The results show that Tagenerator is capable of generating tags with good priming properties, which will deliberately not result in PCR amplification of genomic DNA. Conclusion The program Tagenerator is capable of generating tag sequences that combine genome absence with good priming properties for RT-PCR based experiments, circumventing the effects of genomic DNA contamination in an RNA sample. PMID:16820068
Hase, Ryota; Hirooka, Takuya; Itabashi, Takashi; Endo, Yasunobu; Otsuka, Yoshihito
2018-05-15
A 65-year-old man presented with gradually exacerbating low back pain. Magnetic resonance imaging revealed vertebral osteomyelitis in the Th11-L2 vertebral bodies and discs. The patient showed negative findings on conventional cultures. Direct broad-range polymerase chain reaction (PCR) with sequencing of the biopsied specimen had the highest similarity to the 16S rRNA gene of Helicobacter cinaedi. This case suggests that direct broad-range PCR with sequencing should be considered when conventional cultures cannot identify the causative organism of vertebral osteomyelitis, and that this method may be particularly useful when the pathogen is a fastidious organism, such as H. cinaedi.
Bjourson, A J; Stone, C E; Cooper, J E
1992-01-01
A novel subtraction hybridization procedure, incorporating a combination of four separation strategies, was developed to isolate unique DNA sequences from a strain of Rhizobium leguminosarum bv. trifolii. Sau3A-digested DNA from this strain, i.e., the probe strain, was ligated to a linker and hybridized in solution with an excess of pooled subtracter DNA from seven other strains of the same biovar which had been restricted, ligated to a different, biotinylated, subtracter-specific linker, and amplified by polymerase chain reaction to incorporate dUTP. Subtracter DNA and subtracter-probe hybrids were removed by phenol-chloroform extraction of a streptavidin-biotin-DNA complex. NENSORB chromatography of the sequences remaining in the aqueous layer captured biotinylated subtracter DNA which may have escaped removal by phenol-chloroform treatment. Any traces of contaminating subtracter DNA were removed by digestion with uracil DNA glycosylase. Finally, remaining sequences were amplified by polymerase chain reaction with a probe strain-specific primer, labelled with 32P, and tested for specificity in dot blot hybridizations against total genomic target DNA from each strain in the subtracter pool. Two rounds of subtraction-amplification were sufficient to remove cross-hybridizing sequences and to give a probe which hybridized only with homologous target DNA. The method is applicable to the isolation of DNA and RNA sequences from both procaryotic and eucaryotic cells. Images PMID:1637166
Preparation of 13C/15N-labeled oligomers using the polymerase chain reaction
Chen, Xian; Gupta, Goutam; Bradbury, E. Morton
2001-01-01
Preparation of .sup.13 C/.sup.15 N-labeled DNA oligomers using the polymerase chain reaction (PCR). A PCR based method for uniform (.sup.13 C/.sup.15 N)-labeling of DNA duplexes is described. Multiple copies of a blunt-ended duplex are cloned into a plasmid, each copy containing the sequence of interest and restriction Hinc II sequences at both the 5' and 3' ends. PCR using bi-directional primers and uniformly .sup.13 C/.sup.15 N-labeled dNTP precursors generates labeled DNA duplexes containing multiple copies of the sequence of interest. Twenty-four cycles of PCR, followed by restriction and purification, gave the uniformly .sup.13 C/.sup.15 N-labeled duplex sequence with a 30% yield. Such labeled duplexes find significant applications in multinuclear magnetic resonance spectroscopy.
Pancrazzi, Alessandro; Guglielmelli, Paola; Ponziani, Vanessa; Bergamaschi, Gaetano; Bosi, Alberto; Barosi, Giovanni; Vannucchi, Alessandro M
2008-09-01
Acquired mutations in the juxtamembrane region of MPL (W515K or W515L), the receptor for thrombopoietin, have been described in patients with primary myelofibrosis or essential thrombocythemia, which are chronic myeloproliferative disorders. We have developed a real-time polymerase chain reaction assay for the detection and quantification of MPL mutations that is based on locked nucleic acid fluorescent probes. Mutational analysis was performed using DNA from granulocytes. Reference curves were obtained using cloned fragments of MPL containing either the wild-type or mutated sequence; the predicted sensitivity level was at least 0.1% mutant allele in a wild-type background. None of the 60 control subjects presented with a MPLW515L/K mutation. Of 217 patients with myelofibrosis, 19 (8.7%) harbored the MPLW515 mutation, 10 (52.6%) with the W515L allele. In one case, both the W515L and W515K alleles were detected by real-time polymerase chain reaction. By comparing results obtained with conventional sequencing, no erroneous genotype attribution using real-time polymerase chain reaction was found, whereas one patient considered wild type according to sequence analysis actually harbored a low W515L allele burden. This is a simple, sensitive, and cost-effective procedure for large-scale screening of the MPLW515L/K mutation in patients suspected to have a myeloproliferative disorder. It can also provide a quantitative estimate of mutant allele burden that might be useful for both patient prognosis and monitoring response to therapy.
Verweij, S P; Catsburg, A; Ouburg, S; Lombardi, A; Heijmans, R; Dutly, F; Frei, R; Morré, S A; Goldenberger, D
2011-11-01
The management of the ongoing lymphogranuloma venereum epidemic in industrialized Western countries caused by Chlamydia trachomatis variant L2b still needs improvements in diagnosis, therapy and prevention. We therefore developed the first rapid C. trachomatis variant L2b-specific polymerase chain reaction to circumvent laborious ompA gene sequencing. © 2011 The Authors. Clinical Microbiology and Infection © 2011 European Society of Clinical Microbiology and Infectious Diseases.
Reiman, Anne; Pandey, Sarojini; Lloyd, Kate L; Dyer, Nigel; Khan, Mike; Crockard, Martin; Latten, Mark J; Watson, Tracey L; Cree, Ian A; Grammatopoulos, Dimitris K
2016-11-01
Background Detection of disease-associated mutations in patients with familial hypercholesterolaemia is crucial for early interventions to reduce risk of cardiovascular disease. Screening for these mutations represents a methodological challenge since more than 1200 different causal mutations in the low-density lipoprotein receptor has been identified. A number of methodological approaches have been developed for screening by clinical diagnostic laboratories. Methods Using primers targeting, the low-density lipoprotein receptor, apolipoprotein B, and proprotein convertase subtilisin/kexin type 9, we developed a novel Ion Torrent-based targeted re-sequencing method. We validated this in a West Midlands-UK small cohort of 58 patients screened in parallel with other mutation-targeting methods, such as multiplex polymerase chain reaction (Elucigene FH20), oligonucleotide arrays (Randox familial hypercholesterolaemia array) or the Illumina next-generation sequencing platform. Results In this small cohort, the next-generation sequencing method achieved excellent analytical performance characteristics and showed 100% and 89% concordance with the Randox array and the Elucigene FH20 assay. Investigation of the discrepant results identified two cases of mutation misclassification of the Elucigene FH20 multiplex polymerase chain reaction assay. A number of novel mutations not previously reported were also identified by the next-generation sequencing method. Conclusions Ion Torrent-based next-generation sequencing can deliver a suitable alternative for the molecular investigation of familial hypercholesterolaemia patients, especially when comprehensive mutation screening for rare or unknown mutations is required.
Molecular diagnostics of periodontitis.
Korona-Głowniak, Izabela; Siwiec, Radosław; Berger, Marcin; Malm, Anna; Szymańska, Jolanta
2017-01-28
The microorganisms that form dental plaque are the main cause of periodontitis. Their identification and the understanding of the complex relationships and interactions that involve these microorganisms, environmental factors and the host's health status enable improvement in diagnostics and targeted therapy in patients with periodontitis. To this end, molecular diagnostics techniques (both techniques based on the polymerase chain reaction and those involving nucleic acid analysis via hybridization) come increasingly into use. On the basis of a literature review, the following methods are presented: polymerase chain reaction (PCR), real-time polymerase chain reaction (real-time PCR), 16S rRNA-encoding gene sequencing, checkerboard and reverse-capture checkerboard hybridization, microarrays, denaturing gradient gel electrophoresis (DGGE), temperature gradient gel electrophoresis (TGGE), as well as terminal restriction fragment length polymorphism (TRFLP) and next generation sequencing (NGS). The advantages and drawbacks of each method in the examination of periopathogens are indicated. The techniques listed above allow fast detection of even small quantities of pathogen present in diagnostic material and prove particularly useful to detect microorganisms that are difficult or impossible to grow in a laboratory.
Fang, Weijia; Xu, Nong; Jin, Dazhi; Chen, Yu; Chen, Xiaogang; Zheng, Yi; Shen, Hong; Yuan, Ying; Zheng, Shusen
2012-01-01
Dihydropyrimidine dehydrogenase is a key enzyme acting on the metabolic pathway of medications for gastric cancer. High-resolution melting curve technology, which was developed recently, can distinguish the wild-type dihydropyrimidine dehydrogenase gene from multiple polymorphisms by fluorescent quantitative polymerase chain reaction products in a direct and effective manner. T85C polymorphisms of dihydropyrimidine dehydrogenase in the peripheral blood of 112 Chinese gastric cancer patients were detected by real-time polymerase chain reaction combined with high-resolution melting curve technology. Primer design, along with the reaction system and conditions, was optimized based on the GenBank sequence. Seventy nine cases of wild-type (TT, [70.5%]), 29 cases of heterozygous (TC, [25.9%]), and 4 cases of homozygous mutant (CC, [3.6%]) were observed. The result was completely consistent with the results of the sequencing. Real-time polymerase chain reaction combined with high-resolution melting curve technology is a rapid, simple, reliable, direct-viewing, and convenient method for the detection and screening of polymorphisms.
Sequences of heavy and light chain variable regions from four bovine immunoglobulins.
Armour, K L; Tempest, P R; Fawcett, P H; Fernie, M L; King, S I; White, P; Taylor, G; Harris, W J
1994-12-01
Oligodeoxyribonucleotide primers based on the 5' ends of bovine IgG1/2 and lambda constant (C) region genes, together with primers encoding conserved amino acids at the N-terminus of mature variable (V) regions from other species, have been used in cDNA and polymerase chain reactions (PCRs) to amplify heavy and light chain V region cDNA from bovine heterohybridomas. The amino acid sequences of VH and V lambda from four bovine immunoglobulins of different specificities are presented.
Pancrazzi, Alessandro; Guglielmelli, Paola; Ponziani, Vanessa; Bergamaschi, Gaetano; Bosi, Alberto; Barosi, Giovanni; Vannucchi, Alessandro M.
2008-01-01
Acquired mutations in the juxtamembrane region of MPL (W515K or W515L), the receptor for thrombopoietin, have been described in patients with primary myelofibrosis or essential thrombocythemia, which are chronic myeloproliferative disorders. We have developed a real-time polymerase chain reaction assay for the detection and quantification of MPL mutations that is based on locked nucleic acid fluorescent probes. Mutational analysis was performed using DNA from granulocytes. Reference curves were obtained using cloned fragments of MPL containing either the wild-type or mutated sequence; the predicted sensitivity level was at least 0.1% mutant allele in a wild-type background. None of the 60 control subjects presented with a MPLW515L/K mutation. Of 217 patients with myelofibrosis, 19 (8.7%) harbored the MPLW515 mutation, 10 (52.6%) with the W515L allele. In one case, both the W515L and W515K alleles were detected by real-time polymerase chain reaction. By comparing results obtained with conventional sequencing, no erroneous genotype attribution using real-time polymerase chain reaction was found, whereas one patient considered wild type according to sequence analysis actually harbored a low W515L allele burden. This is a simple, sensitive, and cost-effective procedure for large-scale screening of the MPLW515L/K mutation in patients suspected to have a myeloproliferative disorder. It can also provide a quantitative estimate of mutant allele burden that might be useful for both patient prognosis and monitoring response to therapy. PMID:18669880
First report of Cocksfoot mottle virus infecting wheat (Triticum aestivum) in Ohio
USDA-ARS?s Scientific Manuscript database
Cocksfoot mottle virus (CfMV) was discovered in Ohio wheat during a 2016 field survey utilizing RNA-Seq to identify virus-like sequences. Virus sequences were confirmed by reverse transcriptase-polymerase chain reaction (RT-PCR) and Sanger sequencing, and CfMV was transmitted to orchardgrass and pas...
Biggar, Kyle K; Wu, Cheng-Wei; Storey, Kenneth B
2014-10-01
This study makes a significant advancement on a microRNA amplification technique previously used for expression analysis and sequencing in animal models without annotated mature microRNA sequences. As research progresses into the post-genomic era of microRNA prediction and analysis, the need for a rapid and cost-effective method for microRNA amplification is critical to facilitate wide-scale analysis of microRNA expression. To facilitate this requirement, we have reoptimized the design of amplification primers and introduced a polyadenylation step to allow amplification of all mature microRNAs from a single RNA sample. Importantly, this method retains the ability to sequence reverse transcription polymerase chain reaction (RT-PCR) products, validating microRNA-specific amplification. Copyright © 2014 Elsevier Inc. All rights reserved.
DNA polymerase preference determines PCR priming efficiency.
Pan, Wenjing; Byrne-Steele, Miranda; Wang, Chunlin; Lu, Stanley; Clemmons, Scott; Zahorchak, Robert J; Han, Jian
2014-01-30
Polymerase chain reaction (PCR) is one of the most important developments in modern biotechnology. However, PCR is known to introduce biases, especially during multiplex reactions. Recent studies have implicated the DNA polymerase as the primary source of bias, particularly initiation of polymerization on the template strand. In our study, amplification from a synthetic library containing a 12 nucleotide random portion was used to provide an in-depth characterization of DNA polymerase priming bias. The synthetic library was amplified with three commercially available DNA polymerases using an anchored primer with a random 3' hexamer end. After normalization, the next generation sequencing (NGS) results of the amplified libraries were directly compared to the unamplified synthetic library. Here, high throughput sequencing was used to systematically demonstrate and characterize DNA polymerase priming bias. We demonstrate that certain sequence motifs are preferred over others as primers where the six nucleotide sequences at the 3' end of the primer, as well as the sequences four base pairs downstream of the priming site, may influence priming efficiencies. DNA polymerases in the same family from two different commercial vendors prefer similar motifs, while another commercially available enzyme from a different DNA polymerase family prefers different motifs. Furthermore, the preferred priming motifs are GC-rich. The DNA polymerase preference for certain sequence motifs was verified by amplification from single-primer templates. We incorporated the observed DNA polymerase preference into a primer-design program that guides the placement of the primer to an optimal location on the template. DNA polymerase priming bias was characterized using a synthetic library amplification system and NGS. The characterization of DNA polymerase priming bias was then utilized to guide the primer-design process and demonstrate varying amplification efficiencies among three commercially available DNA polymerases. The results suggest that the interaction of the DNA polymerase with the primer:template junction during the initiation of DNA polymerization is very important in terms of overall amplification bias and has broader implications for both the primer design process and multiplex PCR.
Recombination of polynucleotide sequences using random or defined primers
Arnold, Frances H.; Shao, Zhixin; Affholter, Joseph A.; Zhao, Huimin H; Giver, Lorraine J.
2000-01-01
A method for in vitro mutagenesis and recombination of polynucleotide sequences based on polymerase-catalyzed extension of primer oligonucleotides is disclosed. The method involves priming template polynucleotide(s) with random-sequences or defined-sequence primers to generate a pool of short DNA fragments with a low level of point mutations. The DNA fragments are subjected to denaturization followed by annealing and further enzyme-catalyzed DNA polymerization. This procedure is repeated a sufficient number of times to produce full-length genes which comprise mutants of the original template polynucleotides. These genes can be further amplified by the polymerase chain reaction and cloned into a vector for expression of the encoded proteins.
Recombination of polynucleotide sequences using random or defined primers
Arnold, Frances H.; Shao, Zhixin; Affholter, Joseph A.; Zhao, Huimin; Giver, Lorraine J.
2001-01-01
A method for in vitro mutagenesis and recombination of polynucleotide sequences based on polymerase-catalyzed extension of primer oligonucleotides is disclosed. The method involves priming template polynucleotide(s) with random-sequences or defined-sequence primers to generate a pool of short DNA fragments with a low level of point mutations. The DNA fragments are subjected to denaturization followed by annealing and further enzyme-catalyzed DNA polymerization. This procedure is repeated a sufficient number of times to produce full-length genes which comprise mutants of the original template polynucleotides. These genes can be further amplified by the polymerase chain reaction and cloned into a vector for expression of the encoded proteins.
deWit, D; Wootton, M; Allan, B; Steyn, L
1993-01-01
A simple method for the production of internal control DNA for two well-established Mycobacterium tuberculosis polymerase chain reaction assays is described. The internal controls were produced from Mycobacterium kansasii DNA with the same primers but at a lower annealing temperature than that used in the standard assays. In both assays, therefore, the internal control DNA has the same primer-binding sequences at the target DNA. One-microgram quantities of internal control DNA which was not contaminated with target DNA could easily be produced by this method. The inclusion of the internal control in the reaction mixture did not affect the efficiency of amplification of the target DNA. The method is simple and rapid and should be adaptable to most M. tuberculosis polymerase chain reaction assays. Images PMID:8370752
New single-copy nuclear genes for scale insect systematics
USDA-ARS?s Scientific Manuscript database
Despite the advent of next-generation sequencing, the polymerase chain reaction (PCR) and Sanger sequencing remain useful tools for molecular identification and systematics. To date, molecular systematics of scale insects has been constrained by the paucity of loci that researchers have been able to...
Beyhan, Yunus E; Karakus, Mehmet; Karagoz, Alper; Mungan, Mesut; Ozkan, Aysegul T; Hokelek, Murat
2017-09-01
To characterize the cutaneous leishmaniasis (CL) isolates of Syrian and Central Anatolia patients at species levels. Methods: Skin scrapings of 3 patients (2 Syrian, 1 Turkish) were taken and examined by direct examination, culture in Novy-MacNeal-Nicole (NNN) medium, internal transcribed spacer polymerase chain reaction and sequence analysis (PCR). Results:According to microscopic examination, culture and PCR methods, 3 samples were detected positive. The sequencing results of all isolates in the study were identified as Leishmania tropica. The same genotypes were detected in the 3 isolates and nucleotide sequence submitted into GenBank with the accession number: KP689599. Conclusion: This finding could give information about the transmission of CL between Turkey and Syria. Because of the Syrian civil war, most of the Syrian citizens circulating in Turkey and different part of Europe, this can be increase the risk of spreading the disease. So, prevention measurements must be taken urgently.
Thomas, W. Kelley; Vida, J. T.; Frisse, Linda M.; Mundo, Manuel; Baldwin, James G.
1997-01-01
To effectively integrate DNA sequence analysis and classical nematode taxonomy, we must be able to obtain DNA sequences from formalin-fixed specimens. Microdissected sections of nematodes were removed from specimens fixed in formalin, using standard protocols and without destroying morphological features. The fixed sections provided sufficient template for multiple polymerase chain reaction-based DNA sequence analyses. PMID:19274156
Molecular identification of Mango, Mangifera indica L.var. totupura
Jagarlamudi, Sankar; G, Rosaiah; Kurapati, Ravi Kumar; Pinnamaneni, Rajasekhar
2011-01-01
Mango (>Mangifera indica) belonging to Anacardiaceae family is a fruit that grows in tropical regions. It is considered as the King of fruits. The present work was taken up to identify a tool in identifying the mango species at the molecular level. The chloroplast trnL-F region was amplified from extracted total genomic DNA using the polymerase chain reaction (PCR) and sequenced. Sequence of the dominant DGGE band revealed that Mangifera indica in tested leaves was Mangifera indica (100% similarity to the ITS sequences of Mangifera indica). This sequence was deposited in NCBI with the accession no. GQ927757. Abbreviations AFLP - Amplified fragment length polymorphism , cpDNA - Chloroplast DNA, DDGE - Denaturing gradient gel electrophoresis, DNA - Deoxyribo nucleic acid, EDTA - Ethylenediamine tetraacetic acid, HCl - Hydrochloric acid, ISSR - Inter simple sequence repeats, ITS - Internal transcribed spacer, MATAB - Methyl Ammonium Bromide, Na2SO3 - Sodium sulphite, NaCl - Sodium chloride, NCBI - National Centre for Biotechnology Information, PCR - Polymerase chain reaction, PEG - Polyethylene glycol, RAPD - Randomly amplified polymorphic DNA, trnL-F - Transfer RNA genes start codon- termination codon. PMID:21423885
Targeting Conserved Genes in Penicillium Species.
Peterson, Stephen W
2017-01-01
Polymerase chain reaction amplification of conserved genes and sequence analysis provides a very powerful tool for the identification of toxigenic as well as non-toxigenic Penicillium species. Sequences are obtained by amplification of the gene fragment, sequencing via capillary electrophoresis of dideoxynucleotide-labeled fragments or NGS. The sequences are compared to a database of validated isolates. Identification of species indicates the potential of the fungus to make particular mycotoxins.
Oakley, Brian B; Line, J Eric; Berrang, Mark E; Johnson, Jessica M; Buhr, R Jeff; Cox, Nelson A; Hiett, Kelli L; Seal, Bruce S
2012-02-01
Although Campylobacter is an important food-borne human pathogen, there remains a lack of molecular diagnostic assays that are simple to use, cost-effective, and provide rapid results in research, clinical, or regulatory laboratories. Of the numerous Campylobacter assays that do exist, to our knowledge none has been empirically tested for specificity using high-throughput sequencing. Here we demonstrate the power of next-generation sequencing to determine the specificity of a widely cited Campylobacter-specific polymerase chain reaction (PCR) assay and describe a rapid method for direct cell suspension PCR to quickly and easily screen samples for Campylobacter. We present a specific protocol which eliminates the need for time-consuming and expensive genomic DNA extractions and, using a high-processivity polymerase, demonstrate conclusive screening of samples in <1 h. Pyrosequencing results show the assay to be extremely (>99%) sensitive, and spike-back experiments demonstrated a detection threshold of <10(2) CFU mL(-1). Additionally, we present 2 newly designed broad-range bacterial primer sets targeting the 23S rRNA gene that have wide applicability as internal amplification controls. Empirical testing of putative taxon-specific assays using high-throughput sequencing is an important validation step that is now financially feasible for research, regulatory, or clinical applications. Published by Elsevier Inc.
Adewale, B; Mafe, M A; Oyerinde, J P O
2005-01-01
Annual mass treatment with ivermectin for 12-15 years in endemic communities is the control strategy adopted by the African Programme for Onchocerciasis Control (APOC) for the control of onchocerciasis in Nigeria. This long-term treatment necessitates the use of Polymerase Chain Reaction (PCR) for the proper identification of the Onchocerca species and strains in endemic areas and also for monitoring recrudescence of infection in areas where infection has been controlled. This study, which forms part of a larger study on transmission of onchocerciasis identifies the Onchocerca volvulus strain in Ondo state using the Polymerase Chain Reaction (PCR) technique. Deoxyribonucleic acid (DNA) was extracted from the adult worm of Onchocerca parasite using the glass bead method of extraction. The repeated sequence family present in the genome of the parasite designated as 0-150bp was amplified by the polymerase chain reaction (PCR). The amplified parasites produced significant products visible as bands in a 2% agarose gel stained with ethidium bromide. Hybridization of the PCR products with specific DNA probe identified the products as forest strain of Onchocerca volvulus. The epidemiological implication of this is that there would be more of the skin lesions and low blindness rate in the area.
Arnold, Frances H.; Shao, Zhixin; Zhao, Huimin; Giver, Lorraine J.
2002-01-01
A method for in vitro mutagenesis and recombination of polynucleotide sequences based on polymerase-catalyzed extension of primer oligonucleotides is disclosed. The method involves priming template polynucleotide(s) with random-sequences or defined-sequence primers to generate a pool of short DNA fragments with a low level of point mutations. The DNA fragments are subjected to denaturization followed by annealing and further enzyme-catalyzed DNA polymerization. This procedure is repeated a sufficient number of times to produce full-length genes which comprise mutants of the original template polynucleotides. These genes can be further amplified by the polymerase chain reaction and cloned into a vector for expression of the encoded proteins.
No implication of Simian virus 40 in pathogenesis of malignant pleural mesothelioma in Slovenia.
Hmeljak, Julija; Kern, Izidor; Cör, Andrej
2010-01-01
Malignant mesothelioma is predominantly caused by asbestos exposure, although the association of Simian virus 40 in its pathogenesis is currently still under debate. Simian virus 40, a DNA rhesus monkey virus with oncogenic properties, accidentally contaminated early batches of polio vaccine in the 1960s. In the 1990s, viral sequences and proteins were discovered in several human tumors, which triggered research to find a link between Simian virus 40 and human cancers, especially malignant mesothelioma. The aim of our study was to establish an effective laboratory procedure for Simian virus 40 detection and to investigate the presence of Simian virus 40 DNA and small t antigen in mesothelioma samples from Slovenian patients. Paraffin-embedded malignant pleural mesothelioma specimens from 103 Slovenian patients were collected and used for total DNA isolation and real-time polymerase chain reaction for Simian virus 40 small t and large T DNA analysis. Special attention was devoted to primer design, good laboratory practice and polymerase chain reaction contamination prevention. Polymerase chain reaction products were sequenced and BLAST aligned. One 5 microm thick paraffin section from each patient's tissue block was stained with hematoxylin and eosin for histological typing and one for immunohistochemical detection of Simian virus 40 small t antigen using a monoclonal antibody against Simian virus 40 (Pab280). SV40-expressing Wi-38 cells were used as positive control in both PCR and immunohistochemistry. In real-time polymerase chain reaction analyses, only 4 samples gave products with primer pairs amplifying small t antigen and were inconsistent and poorly reproducible. BLAST alignment showed no homology with any deposited SV40 sequences. No immunopositive staining for SV40 small t antigen was found in any of the samples. We found no evidence of SV40 presence in tissue samples from 103 Slovenian patients with malignant pleural mesothelioma. Asbestos exposure remains the main risk factor for malignant pleural mesothelioma in Slovenia.
Spliced RNA of woodchuck hepatitis virus.
Ogston, C W; Razman, D G
1992-07-01
Polymerase chain reaction was used to investigate RNA splicing in liver of woodchucks infected with woodchuck hepatitis virus (WHV). Two spliced species were detected, and the splice junctions were sequenced. The larger spliced RNA has an intron of 1300 nucleotides, and the smaller spliced sequence shows an additional downstream intron of 1104 nucleotides. We did not detect singly spliced sequences from which the smaller intron alone was removed. Control experiments showed that spliced sequences are present in both RNA and DNA in infected liver, showing that the viral reverse transcriptase can use spliced RNA as template. Spliced sequences were detected also in virion DNA prepared from serum. The upstream intron produces a reading frame that fuses the core to the polymerase polypeptide, while the downstream intron causes an inframe deletion in the polymerase open reading frame. Whereas the splicing patterns in WHV are superficially similar to those reported recently in hepatitis B virus, we detected no obvious homology in the coding capacity of spliced RNAs from these two viruses.
Building block synthesis using the polymerase chain assembly method.
Marchand, Julie A; Peccoud, Jean
2012-01-01
De novo gene synthesis allows the creation of custom DNA molecules without the typical constraints of traditional cloning assembly: scars, restriction site incompatibility, and the quest to find all the desired parts to name a few. Moreover, with the help of computer-assisted design, the perfect DNA molecule can be created along with its matching sequence ready to download. The challenge is to build the physical DNA molecules that have been designed with the software. Although there are several DNA assembly methods, this section presents and describes a method using the polymerase chain assembly (PCA).
Development of the polymerase chain reaction for diagnosis of chancroid.
Chui, L; Albritton, W; Paster, B; Maclean, I; Marusyk, R
1993-01-01
The published nucleotide sequences of the 16S rRNA gene of Haemophilus ducreyi were used to develop primer sets and probes for the diagnosis of chancroid by polymerase chain reaction (PCR) DNA amplification. One set of broad specificity primers yielded a 303-bp PCR product from all bacteria tested. Two 16-base probes internal to this sequence were species specific for H. ducreyi when tested with 12 species of the families Pasteurellaceae and Enterobacteriaceae. The two probes in combination with the broad specificity primers were 100% sensitive with 51 strains of H. ducreyi isolated from six continents over a 15-year period. The direct detection of H. ducreyi from 100 clinical specimens by PCR showed a sensitivity of 83 to 98% and a specificity of 51 to 67%, depending on the number of amplification cycles. Images PMID:8458959
Shimizu, Eri; Kato, Hisashi; Nakagawa, Yuki; Kodama, Takashi; Futo, Satoshi; Minegishi, Yasutaka; Watanabe, Takahiro; Akiyama, Hiroshi; Teshima, Reiko; Furui, Satoshi; Hino, Akihiro; Kitta, Kazumi
2008-07-23
A novel type of quantitative competitive polymerase chain reaction (QC-PCR) system for the detection and quantification of the Roundup Ready soybean (RRS) was developed. This system was designed based on the advantage of a fully validated real-time PCR method used for the quantification of RRS in Japan. A plasmid was constructed as a competitor plasmid for the detection and quantification of genetically modified soy, RRS. The plasmid contained the construct-specific sequence of RRS and the taxon-specific sequence of lectin1 (Le1), and both had 21 bp oligonucleotide insertion in the sequences. The plasmid DNA was used as a reference molecule instead of ground seeds, which enabled us to precisely and stably adjust the copy number of targets. The present study demonstrated that the novel plasmid-based QC-PCR method could be a simple and feasible alternative to the real-time PCR method used for the quantification of genetically modified organism contents.
The actin multigene family and livestock speciation using the polymerase chain reaction.
Fairbrother, K S; Hopwood, A J; Lockley, A K; Bardsley, R G
1998-01-01
Actins constitute a family of highly-conserved multifunctional intracellular proteins, best known as myofibrillar components in striated muscle fibres. Most vertebrate genomes contain numerous actin genes with high sequence homology in protein coding regions but considerable variability in intron number and sizes. This genetic diversity can be utilised for livestock speciation purposes. The high sequence conservation has enabled a single pair of oligonucleotides to be used to prime the polymerase chain reaction (PCR) with DNA extracted from all animals so far studied. Multiple amplification products were obtained which on gel electrophoresis constituted characteristic species-specific 'fingerprints'. The patterns were reproducible, did not vary between individuals of the same breed or between different breeds within a species, and could be generated even from heat-processed muscle held at 120 degrees C for one hour. Given the capacity of PCR to amplify relatively short sequences in highly-degraded DNA, this approach may be suitable for authentication of processed meat products.
Ulrich, Ricky L; Ulrich, Melanie P; Schell, Mark A; Kim, H Stanley; DeShazer, David
2006-05-01
Burkholderia mallei and Burkholderia pseudomallei, the etiologic agents responsible for glanders and melioidosis, respectively, are genetically and phenotypically similar and are category B biothreat agents. We used an in silico approach to compare the B. mallei ATCC 23344 and B. pseudomallei K96243 genomes to identify nucleotide sequences unique to B. mallei. Five distinct B. mallei DNA sequences and/or genes were identified and evaluated for polymerase chain reaction (PCR) assay development. Genomic DNAs from a collection of 31 B. mallei and 34 B. pseudomallei isolates, obtained from various geographic, clinical, and environmental sources over a 70-year period, were tested with PCR primers targeted for each of the B. mallei ATCC 23344-specific nucleotide sequences. Of the 5 chromosomal targets analyzed, only PCR primers designed to bimA(Bm) were specific for B. mallei. These primers were used to develop a rapid PCR assay for the definitive identification of B. mallei and differentiation from all other bacteria.
Rahal, M; Kervaire, B; Villard, J; Tiercy, J-M
2008-03-01
Human leukocyte antigen (HLA) typing by polymerase chain reaction-sequence-specific oligonucleotide (PCR-SSO) hybridization on solid phase (microbead assay) or polymerase chain reaction-sequence-specific primers (PCR-SSP) requires interpretation softwares to detect all possible allele combinations. These programs propose allele calls by taking into account false-positive or false-negative signal(s). The laboratory has the option to validate typing results in the presence of strongly cross-reacting or apparent false-negative signals. Alternatively, these seemingly aberrant signals may disclose novel variants. We report here four new HLA-B (B*5620 and B*5716) and HLA-DRB1 alleles (DRB1*110107 and DRB1*1474) that were detected by apparent false-negative or -positive hybridization or amplification patterns, and ultimately resolved by sequencing. To avoid allele misassignments, a comprehensive evaluation of acquired data as documented in a quality assurance system is therefore required to confirm unambiguous typing interpretation.
Isolation and characterization of microsatellite markers in Fraser fir (Abies fraseri)
S.A. Josserand; K.M. Potter; G. Johnson; J.A. Bowen; J. Frampton; C.D. Nelson
2006-01-01
We describe the isolation and characterization of 14 microsatellite loci from Fraser fir (Abies fraseri). These markers originated from cloned inserts enriched for DNA sequences containing tandem di- and tri-nucleotide repeats. In total, 36 clones were selected, sequenced and evaluated. Polymerase chain reaction (PCR) primers for 14 of these...
Meinhardt, Kelley A; Bertagnolli, Anthony; Pannu, Manmeet W; Strand, Stuart E; Brown, Sally L; Stahl, David A
2015-04-01
Ammonia-oxidizing archaea (AOA) and bacteria (AOB) fill key roles in the nitrogen cycle. Thus, well-vetted methods for characterizing their distribution are essential for framing studies of their significance in natural and managed systems. Quantification of the gene coding for one subunit of the ammonia monooxygenase (amoA) by polymerase chain reaction is frequently employed to enumerate the two groups. However, variable amplification of sequence variants comprising this conserved genetic marker for ammonia oxidizers potentially compromises within- and between-system comparisons. We compared the performance of newly designed non-degenerate quantitative polymerase chain reaction primer sets to existing primer sets commonly used to quantify the amoA of AOA and AOB using a collection of plasmids and soil DNA samples. The new AOA primer set provided improved quantification of model mixtures of different amoA sequence variants and increased detection of amoA in DNA recovered from soils. Although both primer sets for the AOB provided similar results for many comparisons, the new primers demonstrated increased detection in environmental application. Thus, the new primer sets should provide a useful complement to primers now commonly used to characterize the environmental distribution of AOA and AOB. © 2014 Society for Applied Microbiology and John Wiley & Sons Ltd.
Nadin-Davis, S A; Huang, W; Wandeler, A I
1996-03-01
Since its recognition as a discrete epizootic in Florida in the early 1950s, the raccoon strain of rabies virus (RV) has spread over almost the entire eastern seaboard of the US and now threatens to enter the southernmost regions of Canada. To characterise this RV strain in more detail, nucleotide sequencing of the N and G genes, encoding the nucleoprotein and glycoprotein, respectively, of representative isolates has been undertaken. This sequence information generated a conserved restriction map of the N gene, thereby permitting unequivocal identification of this strain by molecular techniques. Comparisons of the predicted nucleoprotein and glycoprotein products with those of other RV strains identified a number of amino acid sequence variations conserved only in the raccoon strain. This information was used to design strain-specific primers targeted to the N gene sequences encoding these residues. The incorporation of these primers into a multiplex polymerase chain reaction (PCR) protocol permitted easy and rapid discrimination between the raccoon RV strain and indigenous Ontario RVs.
D'Souza, Yasmin; Fombonne, Eric; Ward, Brian J
2006-10-01
Despite epidemiologic evidence to the contrary, claims of an association between measles-mumps-rubella vaccination and the development of autism have persisted. Such claims are based primarily on the identification of measles virus nucleic acids in tissues and body fluids by polymerase chain reaction. We sought to determine whether measles virus nucleic acids persist in children with autism spectrum disorder compared with control children. Peripheral blood mononuclear cells were isolated from 54 children with autism spectrum disorder and 34 developmentally normal children, and up to 4 real-time polymerase chain reaction assays and 2 nested polymerase chain reaction assays were performed. These assays targeted the nucleoprotein, fusion, and hemagglutinin genes of measles virus using previously published primer pairs with detection by SYBR green I. Our own real-time assay targeted the fusion gene using novel primers and an internal fluorescent probe. Positive reactions were evaluated rigorously, and amplicons were sequenced. Finally, anti-measles antibody titers were measured by enzyme immunoassay. The real-time assays based on previously published primers gave rise to a large number of positive reactions in both autism spectrum disorder and control samples. Almost all of the positive reactions in these assays were eliminated by evaluation of melting curves and amplicon band size. The amplicons for the remaining positive reactions were cloned and sequenced. No sample from either autism spectrum disorder or control groups was found to contain nucleic acids from any measles virus gene. In the nested polymerase chain reaction and in-house assays, none of the samples yielded positive results. Furthermore, there was no difference in anti-measles antibody titers between the autism and control groups. There is no evidence of measles virus persistence in the peripheral blood mononuclear cells of children with autism spectrum disorder.
Khulordava, Irakli; Miller, Geraldine; Haas, David; Li, Haijing; McKinsey, Joel; Vanderende, Daniel; Tang, Yi-Wei
2003-05-01
We report two cases of culture-negative bacterial endocarditis in which the organisms were identified by amplification and sequencing of the bacterial 16S rRNA gene. These results support an important role for polymerase chain reaction followed by direct sequencing to determine the etiology of culture-negative bacterial endocarditis and to guide appropriate antimicrobial therapy.
Reverse transcription polymerase chain reaction protocols for cloning small circular RNAs.
Navarro, B; Daròs, J A; Flores, R
1998-07-01
A protocol is described for general application for cloning small circular RNAs which requires only minimal amounts of template (approximately 50 ng) of unknown sequence. Both cDNA strands are synthesized with a 26-mer primer whose six 3'-terminal positions are totally degenerate in two consecutive reactions catalyzed by reverse transcriptase and DNA polymerase, respectively. The cDNAs are then PCR-amplified, using a 20-mer primer with the non-degenerate sequence of the previous primer, cloned and sequenced. This information permits the synthesis of one or more pairs of specific and adjacent primers for obtaining full-length cDNA clones by a protocol which is also described.
Stephen, Alexa A; Leone, Angelique M; Toplon, David E; Archer, Linda L; Wellehan, James F X
2016-12-01
A juvenile female bald eagle ( Haliaeetus leucocephalus ) was presented with emaciation and proliferative periocular lesions. The eagle did not respond to supportive therapy and was euthanatized. Histopathologic examination of the skin lesions revealed plaques of marked epidermal hyperplasia parakeratosis, marked acanthosis and spongiosis, and eosinophilic intracytoplasmic inclusion bodies. Novel polymerase chain reaction (PCR) assays were done to amplify and sequence DNA polymerase and rpo147 genes. The 4b gene was also analyzed by a previously developed assay. Bayesian and maximum likelihood phylogenetic analyses of the obtained sequences found it to be poxvirus of the genus Avipoxvirus and clustered with other raptor isolates. Better phylogenetic resolution was found in rpo147 rather than the commonly used DNA polymerase. The novel consensus rpo147 PCR assay will create more accurate phylogenic trees and allow better insight into poxvirus history.
Kernif, Tahar; Aissi, Meriem; Doumandji, Salah-Eddine; Chomel, Bruno B.; Raoult, Didier; Bitam, Idir
2010-01-01
Bartonella species are being recognized as important bacterial human and canine pathogens, and are associated with multiple arthropod vectors. Bartonella DNA extracted from blood samples was obtained from domestic dogs in Algiers, Algeria. Polymerase chain reaction (PCR) and DNA sequence analyses of the ftsZ gene and the 16S-23S intergenic spacer region (ITS) were performed. Three Bartonella species: Bartonella vinsonii subsp. berkhoffii, Bartonella clarridgeiae, and Bartonells elizabethae were detected infecting Algerian dogs. To our knowledge, this study is the first report of detection by PCR amplification of Bartonella in dogs in North Africa. PMID:20682871
Food Fish Identification from DNA Extraction through Sequence Analysis
ERIC Educational Resources Information Center
Hallen-Adams, Heather E.
2015-01-01
This experiment exposed 3rd and 4th y undergraduates and graduate students taking a course in advanced food analysis to DNA extraction, polymerase chain reaction (PCR), and DNA sequence analysis. Students provided their own fish sample, purchased from local grocery stores, and the class as a whole extracted DNA, which was then subjected to PCR,…
Error Rate Comparison during Polymerase Chain Reaction by DNA Polymerase
McInerney, Peter; Adams, Paul; Hadi, Masood Z.
2014-01-01
As larger-scale cloning projects become more prevalent, there is an increasing need for comparisons among high fidelity DNA polymerases used for PCR amplification. All polymerases marketed for PCR applications are tested for fidelity properties (i.e., error rate determination) by vendors, and numerous literature reports have addressed PCR enzyme fidelity. Nonetheless, it is often difficult to make direct comparisons among different enzymes due to numerous methodological and analytical differences from study to study. We have measured the error rates for 6 DNA polymerases commonly used in PCR applications, including 3 polymerases typically used for cloning applications requiring high fidelity. Error ratemore » measurement values reported here were obtained by direct sequencing of cloned PCR products. The strategy employed here allows interrogation of error rate across a very large DNA sequence space, since 94 unique DNA targets were used as templates for PCR cloning. The six enzymes included in the study, Taq polymerase, AccuPrime-Taq High Fidelity, KOD Hot Start, cloned Pfu polymerase, Phusion Hot Start, and Pwo polymerase, we find the lowest error rates with Pfu , Phusion, and Pwo polymerases. Error rates are comparable for these 3 enzymes and are >10x lower than the error rate observed with Taq polymerase. Mutation spectra are reported, with the 3 high fidelity enzymes displaying broadly similar types of mutations. For these enzymes, transition mutations predominate, with little bias observed for type of transition.« less
Kim, Bo-Bae; Kim, Minji; Park, Yun-Hee; Ko, Youngkyung; Park, Jun-Beom
2017-06-01
Objective Next-generation sequencing was performed to evaluate the effects of short-term application of dexamethasone on human gingiva-derived mesenchymal stem cells. Methods Human gingiva-derived stem cells were treated with a final concentration of 10 -7 M dexamethasone and the same concentration of vehicle control. This was followed by mRNA sequencing and data analysis, gene ontology and pathway analysis, quantitative real-time polymerase chain reaction of mRNA, and western blot analysis of RUNX2 and β-catenin. Results In total, 26,364 mRNAs were differentially expressed. Comparison of the results of dexamethasone versus control at 2 hours revealed that 7 mRNAs were upregulated and 25 mRNAs were downregulated. The application of dexamethasone reduced the expression of RUNX2 and β-catenin in human gingiva-derived mesenchymal stem cells. Conclusion The effects of dexamethasone on stem cells were evaluated with mRNA sequencing, and validation of the expression was performed with qualitative real-time polymerase chain reaction and western blot analysis. The results of this study can provide new insights into the role of mRNA sequencing in maxillofacial areas.
NASA Astrophysics Data System (ADS)
Lily; Siregar, Y.; Ilyas, S.
2018-03-01
This study purposed to describe the product Polymerase Chain Reaction (PCR) and sequencing of DNA Mycobacterium (M.) tuberculosis from sputum of tuberculosis (TB) patients in Medan. Sputum was collected from patients that diagnosed with pulmonary TB by a physician. Specimen processed by PCR method of Li et al. and sequencing at Macrogen Laboratory. All of 12 product PCR were showed brightness bands at 126 base pair (bp). These results indicated similarity to the study of Li et al. Sequencing analysis showed the presence of a mutation and non-mutation groups of M. tuberculosis. The reference and outcome berange of the mutation and non-mutation of M. tuberculosis were 56-107, 59-85, 60-120 and 63-94, respectively. The percentage bp difference between the outcome and references for mutation and non-mutation were 3.448-6.569and 3.278-7.428%, respectively. In conclusion, the successful amplification of PCR products in a 1.5% agarose gel electrophoresis where all 12 sputa contained rpoB-positive M. tuberculosis and 0.644% difference was found between the outcome with reference bp of the mutation and non-mutation M. tuberculosis groups.
Tan, Qian-Qian; Zhu, Li; Li, Yi; Liu, Wen; Ma, Wei-Hua; Lei, Chao-Liang; Wang, Xiao-Ping
2015-01-01
The cabbage beetle Colaphellus bowringi Baly is a serious insect pest of crucifers and undergoes reproductive diapause in soil. An understanding of the molecular mechanisms of diapause regulation, insecticide resistance, and other physiological processes is helpful for developing new management strategies for this beetle. However, the lack of genomic information and valid reference genes limits knowledge on the molecular bases of these physiological processes in this species. Using Illumina sequencing, we obtained more than 57 million sequence reads derived from C. bowringi, which were assembled into 39,390 unique sequences. A Clusters of Orthologous Groups classification was obtained for 9,048 of these sequences, covering 25 categories, and 16,951 were assigned to 255 Kyoto Encyclopedia of Genes and Genomes pathways. Eleven candidate reference gene sequences from the transcriptome were then identified through reverse transcriptase polymerase chain reaction. Among these candidate genes, EF1α, ACT1, and RPL19 proved to be the most stable reference genes for different reverse transcriptase quantitative polymerase chain reaction experiments in C. bowringi. Conversely, aTUB and GAPDH were the least stable reference genes. The abundant putative C. bowringi transcript sequences reported enrich the genomic resources of this beetle. Importantly, the larger number of gene sequences and valid reference genes provide a valuable platform for future gene expression studies, especially with regard to exploring the molecular mechanisms of different physiological processes in this species.
Apostoli, Paola; Zicari, Sonia; Lo Presti, Alessandra; Ciccozzi, Massimo; Ciotti, Marco; Caruso, Arnaldo; Fiorentini, Simona
2012-03-01
Human metapneumovirus (hMPV) is a pathogen of the respiratory tract with a worldwide distribution. The purpose of this study was to identify hMPV as the cause of acute respiratory diseases in children admitted at Spedali Civili, a public hospital in Brescia, Italy. Eight hundred forty-six nasopharyngeal aspirate samples negative for the presence of other common respiratory viruses were tested for the presence of hMPV RNA by reverse transcription-polymerase chain reaction. Of the 846 samples, 79 (9.3%) were positive for hMPV. Polymerase chain reaction products, obtained by amplification of the partial nucleotide sequence of gene F, were sequenced and compared with sequences deposited in GenBank. All four hMPV subtypes were identified, including the proposed subtype A2 sublineages "A" and "B". In successive epidemic seasons, large outbreaks of hMPV alternated with small outbreaks in a biannual pattern. This local study provides further evidence that hMPV infection should be considered as a reason for hospital admission for acute respiratory disease in children. Copyright © 2012 Wiley Periodicals, Inc.
Detection of canine cytokine gene expression by reverse transcription-polymerase chain reaction.
Pinelli, E; van der Kaaij, S Y; Slappendel, R; Fragio, C; Ruitenberg, E J; Bernadina, W; Rutten, V P
1999-08-02
Further characterization of the canine immune system will greatly benefit from the availability of tools to detect canine cytokines. Our interest concerns the study on the role of cytokines in canine visceral leishmaniasis. For this purpose, we have designed specific primers using previously published sequences for the detection of canine IL-2, IFN-gamma and IL10 mRNA by reverse transcription-polymerase chain reaction (RT-PCR). For IL-4, we have cloned and sequenced this cytokine gene, and developed canine-specific primers. To control for sample-to-sample variation in the quantity of mRNA and variation in the RT and PCR reactions, the mRNA levels of glyceraldehyde-3-phosphate dehydrogenase (G3PDH), a housekeeping gene, were determined in parallel. Primers to amplify G3PDH were designed from consensus sequences obtained from the Genbank database. The mRNA levels of the cytokines mentioned here were detected from ConA-stimulated peripheral mononuclear cells derived from Leishmania-infected dogs. A different pattern of cytokine production among infected animals was found.
Liu, Yi-Ke; Li, He-Ping; Huang, Tao; Cheng, Wei; Gao, Chun-Sheng; Zuo, Dong-Yun; Zhao, Zheng-Xi; Liao, Yu-Cai
2014-10-29
Wheat-specific ribosomal protein L21 (RPL21) is an endogenous reference gene suitable for genetically modified (GM) wheat identification. This taxon-specific RPL21 sequence displayed high homogeneity in different wheat varieties. Southern blots revealed 1 or 3 copies, and sequence analyses showed one amplicon in common wheat. Combined analyses with sequences from common wheat (AABBDD) and three diploid ancestral species, Triticum urartu (AA), Aegilops speltoides (BB), and Aegilops tauschii (DD), demonstrated the presence of this amplicon in the AA genome. Using conventional qualitative polymerase chain reaction (PCR), the limit of detection was 2 copies of wheat haploid genome per reaction. In the quantitative real-time PCR assay, limits of detection and quantification were about 2 and 8 haploid genome copies, respectively, the latter of which is 2.5-4-fold lower than other reported wheat endogenous reference genes. Construct-specific PCR assays were developed using RPL21 as an endogenous reference gene, and as little as 0.5% of GM wheat contents containing Arabidopsis NPR1 were properly quantified.
Meesapyodsuk, Dauenpen; Balsevich, John; Reed, Darwin W.; Covello, Patrick S.
2007-01-01
Saponaria vaccaria (Caryophyllaceae), a soapwort, known in western Canada as cowcockle, contains bioactive oleanane-type saponins similar to those found in soapbark tree (Quillaja saponaria; Rosaceae). To improve our understanding of the biosynthesis of these saponins, a combined polymerase chain reaction and expressed sequence tag approach was taken to identify the genes involved. A cDNA encoding a β-amyrin synthase (SvBS) was isolated by reverse transcription-polymerase chain reaction and characterized by expression in yeast (Saccharomyces cerevisiae). The SvBS gene is predominantly expressed in leaves. A S. vaccaria developing seed expressed sequence tag collection was developed and used for the isolation of a full-length cDNA bearing sequence similarity to ester-forming glycosyltransferases. The gene product of the cDNA, classified as UGT74M1, was expressed in Escherichia coli, purified, and identified as a triterpene carboxylic acid glucosyltransferase. UGT74M1 is expressed in roots and leaves and appears to be involved in monodesmoside biosynthesis in S. vaccaria. PMID:17172290
DOE Office of Scientific and Technical Information (OSTI.GOV)
Nasarabadi, Shanavaz
2011-01-11
A polymerase chain reaction system for analyzing a sample containing nucleic acid includes providing magnetic beads; providing a flow channel having a polymerase chain reaction chamber, a pre polymerase chain reaction magnet position adjacent the polymerase chain reaction chamber, and a post pre polymerase magnet position adjacent the polymerase chain reaction chamber. The nucleic acid is bound to the magnetic beads. The magnetic beads with the nucleic acid flow to the pre polymerase chain reaction magnet position in the flow channel. The magnetic beads and the nucleic acid are washed with ethanol. The nucleic acid in the polymerase chain reactionmore » chamber is amplified. The magnetic beads and the nucleic acid are separated into a waste stream containing the magnetic beads and a post polymerase chain reaction mix containing the nucleic acid. The reaction mix containing the nucleic acid flows to an analysis unit in the channel for analysis.« less
DIFFERENTIATING HUMAN FROM ANIMAL ISOLATES OF CRYPTOSPORIDIUM PARVUM
We analyzed 9s Cryptosporidium parvum isolates from humans and animals by a polymerase chain reaction/restriction fragment length polymorphism method based on the thrombospondin-related anonymous protein 2 gene sequence. Used as a molecular marker, this method can differentiate ...
Kledmanee, Kan; Suwanpakdee, Sarin; Krajangwong, Sakranmanee; Chatsiriwech, Jarin; Suksai, Parut; Suwannachat, Pongpun; Sariya, Ladawan; Buddhirongawatr, Ruangrat; Charoonrut, Phingphol; Chaichoun, Kridsada
2009-01-01
A multiplex polymerase chain reaction (PCR) has been developed for simultaneous detection of canine blood parasites, Ehrlichia canis, Babesia spp and Hepatozoon canis, from blood samples in a single reaction. The multiplex PCR primers were specific to E. canis VirB9, Babesia spp 16S rRNA and H. canis 16S rRNA genes. Specificity of the amplicons was confirmed by DNA sequencing. The assay was evaluated using normal canine and infected blood samples, which were detected by microscopic examination. This multiplex PCR offers scope for simultaneous detection of three important canine blood parasites and should be valuable in monitoring parasite infections in dogs and ticks.
Teixeira, M M; Campaner, M; Camargo, E P
1994-01-01
To improve the diagnosis of Phytomonas infections in plants, we developed a polymerase chain reaction (PCR) assay using synthetic oligonucleotides complementary to conserved sequences of the 18S small subunit ribosomal (SSU) gene. From 10 ng upward of DNA of cultures of Phytomonas isolated from plants, fruits, and insects, PCR amplified an 800-bp DNA band that, after restriction analysis and probe hybridization, proved to be of 18S rDNA Phytomonas origin. PCR was also done with sap samples of tomatoes experimentally infected with Phytomonas, yielding amplified 800-bp ribosomal DNA bands before any flagellate could be detected by microscopic examination of the fruit sap.
Diagnostic exercise: chronic vomiting in a dog.
Ellis, A E; Brown, C A; Miller, D L
2010-09-01
An approximately one-and-a-half-year-old, neutered male, mixed-breed dog was presented for a chronic history of vomiting. Profuse diarrhea was also noted during examination. An exploratory laparotomy was performed, bone chips were removed from the stomach, and a raised, circular area of gastric mucosa was biopsied. Histologically, there was severe gastric cryptosporidiosis as well as numerous spiral bacteria, consistent with Helicobacter spp. Polymerase chain reaction revealed visible bands for the 18S ribosomal RNA gene for Cryptosporidium spp. The polymerase chain reaction product was sequenced and was found to be most similar to Cryptosporidium muris. Both the gastric location and the species of Cryptosporidium are unusual in a dog.
Nested methylation-specific polymerase chain reaction cancer detection method
Belinsky, Steven A [Albuquerque, NM; Palmisano, William A [Edgewood, NM
2007-05-08
A molecular marker-based method for monitoring and detecting cancer in humans. Aberrant methylation of gene promoters is a marker for cancer risk in humans. A two-stage, or "nested" polymerase chain reaction method is disclosed for detecting methylated DNA sequences at sufficiently high levels of sensitivity to permit cancer screening in biological fluid samples, such as sputum, obtained non-invasively. The method is for detecting the aberrant methylation of the p16 gene, O 6-methylguanine-DNA methyltransferase gene, Death-associated protein kinase gene, RAS-associated family 1 gene, or other gene promoters. The method offers a potentially powerful approach to population-based screening for the detection of lung and other cancers.
Kutyavin, Igor V.
2013-01-01
Described in the article is a new approach for the sequence-specific detection of nucleic acids in real-time polymerase chain reaction (PCR) using fluorescently labeled oligonucleotide probes. The method is based on the production of PCR amplicons, which fold into dumbbell-like secondary structures carrying a specially designed ‘probe-luring’ sequence at their 5′ ends. Hybridization of this sequence to a complementary ‘anchoring’ tail introduced at the 3′ end of a fluorescent probe enables the probe to bind to its target during PCR, and the subsequent probe cleavage results in the florescence signal. As it has been shown in the study, this amplicon-endorsed and guided formation of the probe-target duplex allows the use of extremely short oligonucleotide probes, up to tetranucleotides in length. In particular, the short length of the fluorescent probes makes possible the development of a ‘universal’ probe inventory that is relatively small in size but represents all possible sequence variations. The unparalleled cost-effectiveness of the inventory approach is discussed. Despite the short length of the probes, this new method, named Angler real-time PCR, remains highly sequence specific, and the results of the study indicate that it can be effectively used for quantitative PCR and the detection of polymorphic variations. PMID:24013564
Polymerase chain displacement reaction.
Harris, Claire L; Sanchez-Vargas, Irma J; Olson, Ken E; Alphey, Luke; Fu, Guoliang
2013-02-01
Quantitative PCR assays are now the standard method for viral diagnostics. These assays must be specific, as well as sensitive, to detect the potentially low starting copy number of viral genomic material. We describe a new technique, polymerase chain displacement reaction (PCDR), which uses multiple nested primers in a rapid, capped, one-tube reaction that increases the sensitivity of normal quantitative PCR (qPCR) assays. Sensitivity was increased by approximately 10-fold in a proof-of-principle test on dengue virus sequence. In PCDR, when extension occurs from the outer primer, it displaces the extension strand produced from the inner primer by utilizing a polymerase that has strand displacement activity. This allows a greater than 2-fold increase of amplification product for each amplification cycle and therefore increased sensitivity and speed over conventional PCR. Increased sensitivity in PCDR would be useful in nucleic acid detection for viral diagnostics.
USE OF TAQMAN TO ENUMERATE ENTEROCOCCUS FAECALIS IN WATER
The Polymerase Chain Reaction (PCR) has become a useful tool in the detection of microorganisms. However, conventional PCR is somewhat time-consuming considering that additional steps (e.g., gel electrophoresis and gene sequencing) are required to confirm the presence of the tar...
Expression and mutational analysis of Cip/Kip family in early glottic cancer.
Kim, D-K; Lee, J H; Lee, O J; Park, C H
2015-02-01
Genetic alteration of cyclin-dependent kinase inhibitors has been associated with carcinogenesis mechanisms in various organs. This study aimed to evaluate the expression and mutational analysis of Cip/Kip family cyclin-dependent kinase inhibitors (p21CIP1/WAF1, p27KIP1 and p57KIP2) in early glottic cancer. Expressions of Cip/Kip family and p53 were determined by quantitative reverse transcription polymerase chain reaction and densitometry. For the analysis of p21 inactivation, sequence alteration was assessed using single-strand conformational polymorphism polymerase chain reaction. Additionally, the inactivation mechanism of p27 and p57 were investigated using DNA methylation analysis. Reduced expression of p27 and p57 were detected in all samples, whereas the expression of p21 was incompletely down-regulated in 6 of 11 samples. Additionally, single-strand conformational polymorphism polymerase chain reaction analysis showed the p53 mutation at exon 6. Methylation of p27 and p57 was detected by DNA methylation assay. Our results suggest that the Cip/Kip family may have a role as a molecular mechanism of carcinogenesis in early glottic cancer.
2006-01-01
isolated using a routine salting-out method (DNA E-Z Prepkit, Orchid Diagnostics Europe, St Katelijne Waver, Belgium). Sequence based typing In...electrophoresis using ethidiumbromide to show the single 2 KB band before sequencing. Next, sequencing reactions were performed separately for exons 2, 3...Multiplex reverse transcription-polymerase chain reaction for simultaneous screening of 29 translocations and chromosomal aberrations in acute
Cankar, Katarina; Chauvensy-Ancel, Valérie; Fortabat, Marie-Noelle; Gruden, Kristina; Kobilinsky, André; Zel, Jana; Bertheau, Yves
2008-05-15
Detection of nonauthorized genetically modified organisms (GMOs) has always presented an analytical challenge because the complete sequence data needed to detect them are generally unavailable although sequence similarity to known GMOs can be expected. A new approach, differential quantitative polymerase chain reaction (PCR), for detection of nonauthorized GMOs is presented here. This method is based on the presence of several common elements (e.g., promoter, genes of interest) in different GMOs. A statistical model was developed to study the difference between the number of molecules of such a common sequence and the number of molecules identifying the approved GMO (as determined by border-fragment-based PCR) and the donor organism of the common sequence. When this difference differs statistically from zero, the presence of a nonauthorized GMO can be inferred. The interest and scope of such an approach were tested on a case study of different proportions of genetically modified maize events, with the P35S promoter as the Cauliflower Mosaic Virus common sequence. The presence of a nonauthorized GMO was successfully detected in the mixtures analyzed and in the presence of (donor organism of P35S promoter). This method could be easily transposed to other common GMO sequences and other species and is applicable to other detection areas such as microbiology.
Garg, Pankaj
2017-07-01
Histopathology is commonly used to diagnose tuberculosis in fistula-in-ano. The aim was to compare the sensitivity of polymerase chain reaction and histopathology in detecting tuberculosis in fistula-in-ano. The histopathology and polymerase chain-reaction of tissue (fistula tract) was done in all the consecutive operated cases. When pus sample was also available, polymerase chain reaction-pus was also done RESULTS: Three hundred forty seven samples (179 patients) were tested over 2 years (median 6.5 months). The mean age was 38.8 ± 10.7 years, and male/female was 170/9. Histopathology and polymerase chain reaction of tissue (fistula tract) was done in 152 and 165 patients, respectively. Polymerase chain reaction (pus) could be done in 30 patients. Overall, tuberculosis was detected in 20/179 (11.2%) patients. Of these, tuberculosis was detected by histopathology (tissue) in 1/152 (0.7%) and by polymerase chain reaction (tissue) in 14/165 (8.5%) patients. In pus, polymerase chain reaction detected tuberculosis in 6/30 (20%) patients. Both polymerase chain reaction of tissue and pus were positive in one patient. Polymerase chain reaction (tissue) and polymerase chain reaction (pus) were significantly more sensitive than histopathology (tissue) for detecting tuberculosis [histopathology 1/152 vs. polymerase chain reaction (tissue) 14/165, p = 0.0009] [histopathology 1/152 vs. polymerase chain reaction (pus) 6/30, p < 0.0001]. In 20 patients detected to have tuberculosis, four drug anti-tubercular therapy was recommended for 6 months. The therapy was completed in 13 patients and 12/13 (92.3%) were cured. The therapy is continuing in 3/20 patients. Four patients did not take the therapy. None of them was cured. Polymerase chain reaction was significantly more sensitive than histopathology in detecting tuberculosis in fistula-in-ano. Histopathology might be missing out tuberculosis in many patients leading to recurrence of the fistula.
Molecular Diagnostic Analysis of Outbreak Scenarios
ERIC Educational Resources Information Center
Morsink, M. C.; Dekter, H. E.; Dirks-Mulder, A.; van Leeuwen, W. B.
2012-01-01
In the current laboratory assignment, technical aspects of the polymerase chain reaction (PCR) are integrated in the context of six different bacterial outbreak scenarios. The "Enterobacterial Repetitive Intergenic Consensus Sequence" (ERIC) PCR was used to analyze different outbreak scenarios. First, groups of 2-4 students determined optimal…
Hammond, R W; Crosslin, J M; Pasini, R; Howell, W E; Mink, G I
1999-07-01
Prunus necrotic ringspot ilarvirus (PNRSV) exists as a number of biologically distinct variants which differ in host specificity, serology, and pathology. Previous nucleotide sequence alignment and phylogenetic analysis of cloned reverse transcription-polymerase chain reaction (RT-PCR) products of several biologically distinct sweet cherry isolates revealed correlations between symptom type and the nucleotide and amino acid sequences of the 3a (putative movement protein) and 3b (coat protein) open reading frames. Based upon this analysis, RT-PCR assays have been developed that can identify isolates displaying different symptoms and serotypes. The incorporation of primers in a multiplex PCR protocol permits rapid detection and discrimination among the strains. The results of PCR amplification using type-specific primers that amplify a portion of the coat protein gene demonstrate that the primer-selection procedure developed for PNRSV constitutes a reliable method of viral strain discrimination in cherry for disease control and will also be useful for examining biological diversity within the PNRSV virus group.
Huang, Chien-Hsun; Chang, Mu-Tzu; Huang, Mu-Chiou; Wang, Li-Tin; Huang, Lina; Lee, Fwu-Ling
2012-10-01
To clearly identify specific species and subspecies of the Lactobacillus acidophilus group using phenotypic and genotypic (16S rDNA sequence analysis) techniques alone is difficult. The aim of this study was to use the recA gene for species discrimination in the L. acidophilus group, as well as to develop a species-specific primer and single nucleotide polymorphism primer based on the recA gene sequence for species and subspecies identification. The average sequence similarity for the recA gene among type strains was 80.0%, and most members of the L. acidophilus group could be clearly distinguished. The species-specific primer was designed according to the recA gene sequencing, which was employed for polymerase chain reaction with the template DNA of Lactobacillus strains. A single 231-bp species-specific band was found only in L. delbrueckii. A SNaPshot mini-sequencing assay using recA as a target gene was also developed. The specificity of the mini-sequencing assay was evaluated using 31 strains of L. delbrueckii species and was able to unambiguously discriminate strains belonging to the subspecies L. delbrueckii subsp. bulgaricus. The phylogenetic relationships of most strains in the L. acidophilus group can be resolved using recA gene sequencing, and a novel method to identify the species and subspecies of the L. delbrueckii and L. delbrueckii subsp. bulgaricus was developed by species-specific polymerase chain reaction combined with SNaPshot mini-sequencing. Copyright © 2012 Society of Chemical Industry.
Pavlovic, Melanie; Koehler, Nina; Anton, Martina; Dinkelmeier, Anna; Haase, Maren; Stellberger, Thorsten; Busch, Ulrich; Baiker, Armin E
2017-08-01
The purpose of the described method is the detection of and differentiation between RNA and DNA of human immunodeficiency virus (HIV)-derived lentiviral vectors (LV) in cell culture supernatants and swab samples. For the analytical surveillance of genetic engineering, operations methods for the detection of the HIV-1-based LV generations are required. Furthermore, for research issues, it is important to prove the absence of LV particles for downgrading experimental settings in terms of the biosafety level. Here, a quantitative polymerase chain reaction method targeting the long terminal repeat U5 subunit and the start sequence of the packaging signal ψ is described. Numerous controls are included in order to monitor the technical procedure.
Unknown sequence amplification: Application to in vitro genome walking in Chlamydia trachomatis L2
DOE Office of Scientific and Technical Information (OSTI.GOV)
Copley, C.G.; Boot, C.; Bundell, K.
1991-01-01
A recently described technique, Chemical Genetics' unknown sequence amplification method, which requires only one specific oligonucleotide, has broadened the applicability of the polymerase chain reaction to DNA of unknown sequence. The authors have adapted this technique to the study of the genome of Chlamydia trachomatis, an obligate intracellular bacterium, and describe modifications that significantly improve the utility of this approach. These techniques allow for rapid genomic analysis entirely in vitro, using DNA of limited quantity of purity.
Isolation and characterization of DNA from archaeological bone.
Hagelberg, E; Clegg, J B
1991-04-22
DNA was extracted from human and animal bones recovered from archaeological sites and mitochondrial DNA sequences were amplified from the extracts using the polymerase chain reaction. Evidence is presented that the amplified sequences are authentic and do not represent contamination by extraneous DNA. The results show that significant amounts of genetic information can survive for long periods in bone, and have important implications for evolutionary genetics, anthropology and forensic science.
BIALLELIC POLYMORPHISM IN THE INTRON REGION OF B-TUBULIN GENE OF CRYPTOSPORIDIUM PARASITES
Nucleotide sequencing of polymerase chain reaction-amplified intron region of the Cryptosporidium parvum B-tubulin gene in 26 human and 15 animal isolates revealed distinct genetic polymorphism between the human and bovine genotypes. The separation of 2 genotypes of C. parvum is...
DEVELOPMENT OF A MOLECULAR METHOD TO IDENTIFY HEPATITIS E VIRUS IN WATER
Hepatitis E virus (HEV) causes an infectious form of hepatitis associated with contaminated water. By analyzing the sequence of several HEV isolates, a reverse transciption-polymerase chain reaction method was developed and optimized that should be able to identify all of the kn...
Liu, Jia; Guo, Jinchao; Zhang, Haibo; Li, Ning; Yang, Litao; Zhang, Dabing
2009-11-25
Various polymerase chain reaction (PCR) methods were developed for the execution of genetically modified organism (GMO) labeling policies, of which an event-specific PCR detection method based on the flanking sequence of exogenous integration is the primary trend in GMO detection due to its high specificity. In this study, the 5' and 3' flanking sequences of the exogenous integration of MON89788 soybean were revealed by thermal asymmetric interlaced PCR. The event-specific PCR primers and TaqMan probe were designed based upon the revealed 5' flanking sequence, and the qualitative and quantitative PCR assays were established employing these designed primers and probes. In qualitative PCR, the limit of detection (LOD) was about 0.01 ng of genomic DNA corresponding to 10 copies of haploid soybean genomic DNA. In the quantitative PCR assay, the LOD was as low as two haploid genome copies, and the limit of quantification was five haploid genome copies. Furthermore, the developed PCR methods were in-house validated by five researchers, and the validated results indicated that the developed event-specific PCR methods can be used for identification and quantification of MON89788 soybean and its derivates.
Johnstone, E M; Chaney, M O; Norris, F H; Pascual, R; Little, S P
1991-07-01
Neuritic plaque and cerebrovascular amyloid deposits have been detected in the aged monkey, dog, and polar bear and have rarely been found in aged rodents (Biochem. Biophy. Res. Commun., 12 (1984) 885-890; Proc. Natl. Acad. Sci. U.S.A., 82 (1985) 4245-4249). To determine if the primary structure of the 42-43 residue amyloid peptide is conserved in species that accumulate plaques, the region of the amyloid precursor protein (APP) cDNA that encodes the peptide region was amplified by the polymerase chain reaction and sequenced. The deduced amino acid sequence was compared to those species where amyloid accumulation has not been detected. The DNA sequences of dog, polar bear, rabbit, cow, sheep, pig and guinea pig were compared and a phylogenetic tree was generated. We conclude that the amino acid sequence of dog and polar bear and other mammals which may form amyloid plaques is conserved and the species where amyloid has not been detected (mouse, rat) may be evolutionarily a distinct group. In addition, the predicted secondary structure of mouse and rat amyloid that differs from that of amyloid bearing species is its lack of propensity to form a beta sheeted structure. Thus, a cross-species examination of the amyloid peptide may suggest what is essential for amyloid deposition.
Due to the accumulating evidence that suggests that numerous unhealthy conditions in the indoor environment are the result of abnormal growth of the filamentous fungi (mold) in and on building surfaces, it is necessary to accurately determine the organisms responsible for these m...
UW Team Reaches Out to Grade- and High-School Students.
ERIC Educational Resources Information Center
Hood, Leroy
1994-01-01
Describes an outreach program designed to expose high school students to cutting-edge science. High school students are provided with hands-on experience in molecular biology (polymerase chain reaction, restriction mapping, chromatography, gel electrophoresis, human DNA sequencing, etc.) and may have an opportunity to participate in the Human…
Isolation and characterization of an AGAMOUS homolog from Fraxinus pennsylvanica
Ningxia Du; Paula M. Pijut
2010-01-01
An AGAMOUS homolog (FpAG) was isolated from green ash (Fraxinus pennsylvanica) using a reverse transcriptase polymerase chain reaction method. Southern blot analysis indicated that FpAG was present as a single-copy sequence in the genome of green ash. RNA accumulated in the reproductive tissues (female...
A Practical Workshop for Generating Simple DNA Fingerprints of Plants
ERIC Educational Resources Information Center
Rouziere, A.-S.; Redman, J. E.
2011-01-01
Gel electrophoresis DNA fingerprints offer a graphical and visually appealing illumination of the similarities and differences between DNA sequences of different species and individuals. A polymerase chain reaction (PCR) and restriction digest protocol was designed to give high-school students the opportunity to generate simple fingerprints of…
Checking of individuality by DNA profiling.
Brdicka, R; Nürnberg, P
1993-08-25
A review of methods of DNA analysis used in forensic medicine for identification, paternity testing, etc. is provided. Among other techniques, DNA fingerprinting using different probes and polymerase chain reaction-based techniques such as amplified sequence polymorphisms and minisatellite variant repeat mapping are thoroughly described and both theoretical and practical aspects are discussed.
Basic quantitative polymerase chain reaction using real-time fluorescence measurements.
Ares, Manuel
2014-10-01
This protocol uses quantitative polymerase chain reaction (qPCR) to measure the number of DNA molecules containing a specific contiguous sequence in a sample of interest (e.g., genomic DNA or cDNA generated by reverse transcription). The sample is subjected to fluorescence-based PCR amplification and, theoretically, during each cycle, two new duplex DNA molecules are produced for each duplex DNA molecule present in the sample. The progress of the reaction during PCR is evaluated by measuring the fluorescence of dsDNA-dye complexes in real time. In the early cycles, DNA duplication is not detected because inadequate amounts of DNA are made. At a certain threshold cycle, DNA-dye complexes double each cycle for 8-10 cycles, until the DNA concentration becomes so high and the primer concentration so low that the reassociation of the product strands blocks efficient synthesis of new DNA and the reaction plateaus. There are two types of measurements: (1) the relative change of the target sequence compared to a reference sequence and (2) the determination of molecule number in the starting sample. The first requires a reference sequence, and the second requires a sample of the target sequence with known numbers of the molecules of sequence to generate a standard curve. By identifying the threshold cycle at which a sample first begins to accumulate DNA-dye complexes exponentially, an estimation of the numbers of starting molecules in the sample can be extrapolated. © 2014 Cold Spring Harbor Laboratory Press.
Bell, Stephanie A; Pusterla, Nicola; Balasuriya, Udeni B R; Mapes, Samantha M; Nyberg, Nicole L; MacLachlan, N James
2008-07-27
Equids are commonly infected by herpesviruses, but isolation of herpesviruses from mules has apparently not been previously reported. Furthermore, the genomic relationships among the various equid herpesviruses are poorly characterized. We describe the isolation and preliminary characterization of a mule gammaherpesvirus tentatively identified as asinine herpesvirus-2 (AHV-2; also designated equid herpesvirus-7 (EHV-7)) from the nasal secretions (NS) of a healthy mule in northern California. The virus was initially identified by transmission electron microscopic examination of lysates of cell culture inoculated with NS collected from the mule. A 913 nucleotide sequence of the DNA polymerase gene was amplified using degenerate primers, and comparison of this sequence with those of various other herpesviruses showed that the mule herpesvirus was most closely related to EHV-2 (AHV-2 sequences were not available for comparison). The sequence of a shorter portion (166 nucleotides) of the mule herpesvirus DNA polymerase gene was identical to that of the published sequence of an asinine gammaherpesvirus, previously designated as AHV-4-3 (AY054992). AHV-2 was detected by real-time polymerase chain reaction assay in the NS of approximately 8% of a cohort of 114 healthy mules and 13 donkeys.
K.D. Jermstad; L.A. Sheppard; B.B. Kinloch; A. Delfino-Mix; E.S. Ersoz; K.V. Krutovsky; D.B Neale
2006-01-01
The nucleotide-binding-site and leucine-rich-repeat (NBSâLRR) class of R proteins is abundant and widely distributed in plants. By using degenerate primers designed on the NBS domain in lettuce, we amplified sequences in sugar pine that shared sequence identity with many of the NBSâLRR class resistance genes catalogued in GenBank. The polymerase chain reaction products...
McKinney, Nancy
2002-01-01
PCR (polymerase chain reaction) primers for the detection of certain Bacillus species, such as Bacillus anthracis. The primers specifically amplify only DNA found in the target species and can distinguish closely related species. Species-specific PCR primers for Bacillus anthracis, Bacillus globigii and Clostridium perfringens are disclosed. The primers are directed to unique sequences within sasp (small acid soluble protein) genes.
Roura, X; Santamarina, G; Tabar, M-D; Francino, O; Altet, L
2018-05-25
The presence of Bartonella spp. was detected by polymerase chain reaction (PCR) in dogs from Spain with blood culture-negative endocarditis. The aim of this study is to add information about canine infectious endocarditis in Europe. Thirty dogs with naturally occurring blood culture-negative endocarditis were examined from 2010 to 2017 at three veterinary referral hospitals, located in northwest, northeast, and southeast of Spain. It is a retrospective study. Medical records were reviewed to extract relevant data. Frozen or paraffin-embedded cardiac valve tissue and/or ethylenediamine tetraacetic acid blood samples were evaluated by PCR for the presence of Bartonella DNA. Positive results were sequenced to confirm the species. Polymerase chain reaction was positive for eight out of 30 dogs included (26.6%). Bartonella rochalimae, Bartonella vinsonii subsp. berkhoffii, and Bartonella koehlerae were detected in valve tissue or blood. Bartonella could be an important cause of blood culture-negative infectious endocarditis in dogs from Spain. The outcome for those dogs affected with Bartonella spp. was grave. Prompt empirical treatment with amoxicillin-clavulanate plus fluoroquinolones could be of value in cases of blood culture-negative endocarditis. Copyright © 2018 Elsevier B.V. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Flores, J.; Sears, J.; Schael, I.P.
1990-08-01
We have synthesized {sup 32}P-labeled hybridization probes from a hyperdivergent region (nucleotides 51 to 392) of the rotavirus gene encoding the VP7 glycoprotein by using the polymerase chain reaction method. Both RNA (after an initial reverse transcription step) and cloned cDNA from human rotavirus serotypes 1 through 4 could be used as templates to amplify this region. High-stringency hybridization of each of the four probes to rotavirus RNAs dotted on nylon membranes allowed the specific detection of corresponding sequences and thus permitted identification of the serotype of the strains dotted. The procedure was useful when applied to rotaviruses isolated frommore » field studies.« less
Subacute Sclerosing Panencephalitis in an Infant: Diagnostic Role of Viral Genome Analysis
Baram, Tallie Z.; Gonzalez-Gomez, Ignacio; Xie, Zong-De; Yao, Dapeng; Gilles, Floyd H.; Nelson, Marvin D.; Nguyen, Hahn T.; Peters, Julius
2013-01-01
Subacute sclerosing panencephalitis (SSPE) is related to “defective” measles virus or vaccination, though an association with parainfluenza viruses has been reported. SSPE is characterized by a slow, erratic course and elevated cerebrospinal fluid measles titers. An immunocompetent, vaccinated infant, with onset of symptoms in parainfiuenza virus season and a catastrophic course is described. Cerebrospinal fluid titers were negative, but postmortem brain had typical SSPE lesions. Patient brain-derived RNA, subjected to reverse transcription followed by polymerase chain reaction yielded polymerase chain reaction products with measles virus but not parainfluenza virus genes. The sequenced fragment revealed multiple mutations, typical for SSPE. SSPE can thus present in infants, with short latency and no cerebrospinal fluid antibodies. Viral genomic analysis may be diagnostic, permitting early therapy. PMID:8024248
Rosner, A; Maslenin, L; Spiegel, S
1998-09-01
A method based on differences in electrophoretic mobility of RNA transcripts made from polymerase chain reaction (PCR) products was used for differentiation among virus isolates. A T7 RNA polymerase promoter was attached to amplified prunus necrotic ringspot virus (PNRSV) sequences by PCR. The PCR products then served as a template for transcription. Single-stranded transcripts originated from different PNRSV isolates varied in electrophoretic mobility in polyacrylamide gels, presumably because of transcript conformation polymorphism (TCP). This procedure was applied for the differentiation of PNRSV isolates.
COLD-PCR Technologies in the Area of Personalized Medicine: Methodology and Applications.
Mauger, Florence; How-Kit, Alexandre; Tost, Jörg
2017-06-01
Somatic mutations bear great promise for use as biomarkers for personalized medicine, but are often present only in low abundance in biological material and are therefore difficult to detect. Many assays for mutation analysis in cancer-related genes (hotspots) have been developed to improve diagnosis, prognosis, prediction of drug resistance, and monitoring of the response to treatment. Two major approaches have been developed: mutation-specific amplification methods and methods that enrich and detect mutations without prior knowledge on the exact location and identity of the mutation. CO-amplification at Lower Denaturation temperature Polymerase Chain Reaction (COLD-PCR) methods such as full-, fast-, ice- (improved and complete enrichment), enhanced-ice, and temperature-tolerant COLD-PCR make use of a critical temperature in the polymerase chain reaction to selectively denature wild-type-mutant heteroduplexes, allowing the enrichment of rare mutations. Mutations can subsequently be identified using a variety of laboratory technologies such as high-resolution melting, digital polymerase chain reaction, pyrosequencing, Sanger sequencing, or next-generation sequencing. COLD-PCR methods are sensitive, specific, and accurate if appropriately optimized and have a short time to results. A large variety of clinical samples (tumor DNA, circulating cell-free DNA, circulating cell-free fetal DNA, and circulating tumor cells) have been studied using COLD-PCR in many different applications including the detection of genetic changes in cancer and infectious diseases, non-invasive prenatal diagnosis, detection of microorganisms, or DNA methylation analysis. In this review, we describe in detail the different COLD-PCR approaches, highlighting their specificities, advantages, and inconveniences and demonstrating their use in different fields of biological and biomedical research.
Corless, Christopher L.; Harrell, Patina; Lacouture, Mario; Bainbridge, Troy; Le, Claudia; Gatter, Ken; White, Clifton; Granter, Scott; Heinrich, Michael C.
2006-01-01
Oncogenic mutations of the receptor tyrosine kinase KIT contribute to the pathogenesis of gastrointestinal stromal tumors, systemic mastocytosis (SM), and some cases of acute myelogenous leukemia (AML). The D816V substitution in the activation loop of KIT results in relative resistance to the kinase inhibitor imatinib (Gleevec). Because this mutation occurs in 80 to 95% of adult SM, its detection has diagnostic and predictive significance. Unfortunately, the fraction of mutation-positive cells in clinical SM samples is often below the 20 to 30% threshold needed for detection by direct DNA sequencing. We have developed an allele-specific polymerase chain reaction assay using a mutation-specific primer combined with a wild-type blocking oligonucleotide that amplifies D816V at the level of 1% mutant allele in DNA extracted from formalin-fixed, paraffin-embedded tissue. There were no amplifications among 64 KIT wild-type tumors and cell lines, whereas all D816V-mutant samples (eight AML and 11 mast cell disease) were positive. Other D816 substitutions associated with resistance to imatinib in vitro are rare in SM. Among these D816F was detectable with the assay whereas D816H, D816Y, and D816G did not amplify. Nine biopsies (bone marrow, skin, or colon) with suspected SM were negative by denaturing high performance liquid chromatography and/or DNA sequencing but positive by allele-specific polymerase chain reaction. Thus, the assay may be useful in confirming the diagnosis of SM. PMID:17065430
Wang, F; Zhang, Y Q; Ding, J; Yu, L X
2017-10-18
To evaluate the ability of multiplex competitive fluorescence polymerase chain reaction in detection of large deletion and duplication genotypes of X-linked Alport syndrome. Clinical diagnosis of X-linked Alport syndrome was based on either abnormal staining of type IV collagen α5 chain in the epidermal basement membrane alone or with abnormal staining of type IV collagen α5 chain in the glomerular basement membrane and Bowman's capsule/ultrastructural changes in the glomerular basement membrane typical of Alport syndrome. A total of 20 unrelated Chinese patients (13 males and 7 females) clinically diagnosed as X-linked Alport syndrome were included in the study. Their genotypes were unknown. Control subjects included a male patient with other renal disease and two patients who had large deletions in COL4A5 gene detected by multiplex ligation-dependent probe amplification. Genomic DNA was isolated from peripheral blood leukocytes in all the participants. Multiplex competitive fluorescence polymerase chain reaction was used to coamplify 53 exons of COL4A5 gene and four reference genes in a single reaction. When a deletion removed exon 1 of COL4A5 gene was identified, the same method was used to coamplify the first 4 exons of COL4A5 and COL4A6 genes, a promoter shared by COL4A5 and COL4A6 genes, and three reference genes in a single reaction. Any copy number loss suggested by this method was verified by electrophoresis of corresponding polymerase chain reaction amplified products or DNA sequencing to exclude possible DNA variations in the primer regions. Genotypes of two positive controls identified by multiplex competitive fluorescence polymerase chain reaction were consistent with those detected by multiplex ligation-dependent probe amplification. Deletions were identified in 6 of the 20 patients, including two large deletions removing the 5' part of both COL4A5 and COL4A6 genes with the breakpoint located in the second intron of COL4A6, two large deletions removing more than 30 exons of COL4A5 gene, one large deletion removing at least 1 exon of COL4A5 gene, and one small deletion involving 13 bps. No duplication was found. Our results show that multiplex competitive fluorescence polymerase chain reaction is a good alternative to classical techniques for large deletion genotyping in X-linked Alport syndrome.
König, Katharina; Peifer, Martin; Fassunke, Jana; Ihle, Michaela A; Künstlinger, Helen; Heydt, Carina; Stamm, Katrin; Ueckeroth, Frank; Vollbrecht, Claudia; Bos, Marc; Gardizi, Masyar; Scheffler, Matthias; Nogova, Lucia; Leenders, Frauke; Albus, Kerstin; Meder, Lydia; Becker, Kerstin; Florin, Alexandra; Rommerscheidt-Fuss, Ursula; Altmüller, Janine; Kloth, Michael; Nürnberg, Peter; Henkel, Thomas; Bikár, Sven-Ernö; Sos, Martin L; Geese, William J; Strauss, Lewis; Ko, Yon-Dschun; Gerigk, Ulrich; Odenthal, Margarete; Zander, Thomas; Wolf, Jürgen; Merkelbach-Bruse, Sabine; Buettner, Reinhard; Heukamp, Lukas C
2015-07-01
The Network Genomic Medicine Lung Cancer was set up to rapidly translate scientific advances into early clinical trials of targeted therapies in lung cancer performing molecular analyses of more than 3500 patients annually. Because sequential analysis of the relevant driver mutations on fixated samples is challenging in terms of workload, tissue availability, and cost, we established multiplex parallel sequencing in routine diagnostics. The aim was to analyze all therapeutically relevant mutations in lung cancer samples in a high-throughput fashion while significantly reducing turnaround time and amount of input DNA compared with conventional dideoxy sequencing of single polymerase chain reaction amplicons. In this study, we demonstrate the feasibility of a 102 amplicon multiplex polymerase chain reaction followed by sequencing on an Illumina sequencer on formalin-fixed paraffin-embedded tissue in routine diagnostics. Analysis of a validation cohort of 180 samples showed this approach to require significantly less input material and to be more reliable, robust, and cost-effective than conventional dideoxy sequencing. Subsequently, 2657 lung cancer patients were analyzed. We observed that comprehensive biomarker testing provided novel information in addition to histological diagnosis and clinical staging. In 2657 consecutively analyzed lung cancer samples, we identified driver mutations at the expected prevalence. Furthermore we found potentially targetable DDR2 mutations at a frequency of 3% in both adenocarcinomas and squamous cell carcinomas. Overall, our data demonstrate the utility of systematic sequencing analysis in a clinical routine setting and highlight the dramatic impact of such an approach on the availability of therapeutic strategies for the targeted treatment of individual cancer patients.
Sun, Zichen; Stack, Colin; Šlapeta, Jan
2012-05-25
In order to investigate the genetic variation between Tritrichomonas foetus from bovine and feline origins, cysteine protease 8 (CP8) coding sequence was selected as the polymorphic DNA marker. Direct sequencing of CP8 coding sequence of T. foetus from four feline isolates and two bovine isolates with polymerase chain reaction successfully revealed conserved nucleotide polymorphisms between feline and bovine isolates. These results provide useful information for CP8-based molecular differentiation of T. foetus genotypes. Copyright © 2011 Elsevier B.V. All rights reserved.
DNA capture elements for rapid detection and identification of biological agents
NASA Astrophysics Data System (ADS)
Kiel, Johnathan L.; Parker, Jill E.; Holwitt, Eric A.; Vivekananda, Jeeva
2004-08-01
DNA capture elements (DCEs; aptamers) are artificial DNA sequences, from a random pool of sequences, selected for their specific binding to potential biological warfare agents. These sequences were selected by an affinity method using filters to which the target agent was attached and the DNA isolated and amplified by polymerase chain reaction (PCR) in an iterative, increasingly stringent, process. Reporter molecules were attached to the finished sequences. To date, we have made DCEs to Bacillus anthracis spores, Shiga toxin, Venezuelan Equine Encephalitis (VEE) virus, and Francisella tularensis. These DCEs have demonstrated specificity and sensitivity equal to or better than antibody.
Andris-Widhopf, Jennifer; Steinberger, Peter; Fuller, Roberta; Rader, Christoph; Barbas, Carlos F
2011-09-01
The development of therapeutic antibodies for use in the treatment of human diseases has long been a goal for many researchers in the antibody field. One way to obtain these antibodies is through phage-display libraries constructed from human lymphocytes. This protocol describes the construction of human Fab (fragment antigen binding) antibody libraries. In this method, the individual rearranged heavy- and light-chain variable regions are amplified separately and are linked through a series of overlap polymerase chain reaction (PCR) steps to give the final Fab products that are used for cloning.
Artificial mismatch hybridization
Guo, Zhen; Smith, Lloyd M.
1998-01-01
An improved nucleic acid hybridization process is provided which employs a modified oligonucleotide and improves the ability to discriminate a control nucleic acid target from a variant nucleic acid target containing a sequence variation. The modified probe contains at least one artificial mismatch relative to the control nucleic acid target in addition to any mismatch(es) arising from the sequence variation. The invention has direct and advantageous application to numerous existing hybridization methods, including, applications that employ, for example, the Polymerase Chain Reaction, allele-specific nucleic acid sequencing methods, and diagnostic hybridization methods.
ERIC Educational Resources Information Center
Valasek, Mark A.; Repa, Joyce J.
2005-01-01
In recent years, real-time polymerase chain reaction (PCR) has emerged as a robust and widely used methodology for biological investigation because it can detect and quantify very small amounts of specific nucleic acid sequences. As a research tool, a major application of this technology is the rapid and accurate assessment of changes in gene…
PCR Cloning of Partial "nbs" Sequences from Grape ("Vitis aestivalis" Michx)
ERIC Educational Resources Information Center
Chang, Ming-Mei; DiGennaro, Peter; Macula, Anthony
2009-01-01
Plants defend themselves against pathogens via the expressions of disease resistance (R) genes. Many plant R gene products contain the characteristic nucleotide-binding site (NBS) and leucine-rich repeat (LRR) domains. There are highly conserved motifs within the NBS domain which could be targeted for polymerase chain reaction (PCR) cloning of R…
USDA-ARS?s Scientific Manuscript database
Symptoms of abnormal proliferation of shoots resulting in formation of witches’ broom growths were observed in diseased plants of passion fruit (Passiflora edulis f. flavicarpa Deg.) in Brazil. RFLP analysis of 16S rRNA gene sequences amplified in polymerase chain reactions containing template DNAs...
cDNA encoding a polypeptide including a hevein sequence
Raikhel, N.V.; Broekaert, W.F.; Namhai Chua; Kush, A.
1993-02-16
A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1,018 nucleotides long and includes an open reading frame of 204 amino acids.
Phylogeographic patterns of Armillaria ostoyae in the western United States
J. W. Hanna; N. B. Klopfenstein; M. -S. Kim; G. I. McDonald; J. A. Moore
2007-01-01
Nuclear ribosomal DNA regions (i.e. large subunit, internal transcribed spacer, 5.8S and intergenic spacer) were sequenced using a direct-polymerase chain reaction method from Armillaria ostoyae genets collected from the western USA. Many of the A. ostoyae genets contained heterogeneity among rDNA repeats, indicating intragenomic variation and likely intraspecific...
[Prevalence of Bartonella henselae in blood donors and risk of blood transmission in Chile].
Núñez, M Antonieta; Contreras, Karla; Depix, M Soledad; Geoffroy, Enrique; Villagra, Nicolás; Mellado, Sandra; Salinas, Ana M
2017-12-01
Bartonella henselae is the causal agent of cat scratch disease in immunocompetent persons and bacterial angiomatosis in immunocompromised patients. In Chile, the prevalence of antibodies against B. henselae in healthy children and adolescents is 13.3%, in persons with occupational risk 60.5%, and in cats 85.6%. There are no published data regarding the seroprevalence in blood donors in our country, so determining if B. henselae is present in the blood of donors at the time of donation is very important, since this microorganism can survive up to 35 days in the red blood cells stored in a blood bank at 4 °C. To determine the prevalence of B. henselae in blood donors. 140 donor blood samples were analyzed to detect the presence of B. henselae, using the polymerase chain reaction technique. 13.6% of the blood donors with positive polymerase chain reaction for B. henselae were obtained. The sequence of the amplified fragments showed an identity of over 98% with respect to B. henselae reference sequences. The risk of blood transmission is due to a country with high B. henselae infection.
Aguilera Galaviz, Luis Alejandro; Aceves Medina, Ma del Carmen; Estrada García, Iris C
2002-01-01
Streptococcus mutans is a pathogen related to the occurrence of human dental caries. The determination of total amounts of mutans streptococci, as well as the proportion related to other oral bacteria, is of interest when assessing the risk of developing caries. In this context, it is better to use a sensitive, specific and non-time consuming method such as the polymerase chain reaction (PCR), than to use culture and biochemical identification methods. In this work we identified potentially cariogenic strains of S. mutans and assessed the relationship with the dmft, DMFT or dmft/DMFT index. Using DNA isolated from dental plaque, a 192 bp sequence was identified and amplified from the spaP gene and a 722 bp sequence from the dexA gene. The results suggest that it is important to evaluate the presence of cariogenic S. mutans strains in plaque content rather than the accumulation of plaque itself However, other factors like diet, hygiene, genetic background, the flow rate of saliva and the presence of specific antibodies, also play a key role in the development of caries.
The Molecular Basis of Muscular Dystrophy in the mdx Mouse: A Point Mutation
NASA Astrophysics Data System (ADS)
Sicinski, Piotr; Geng, Yan; Ryder-Cook, Allan S.; Barnard, Eric A.; Darlison, Mark G.; Barnard, Pene J.
1989-06-01
The mdx mouse is an X-linked myopathic mutant, an animal model for human Duchenne muscular dystrophy. In both mouse and man the mutations lie within the dystrophin gene, but the phenotypic differences of the disease in the two species confer much interest on the molecular basis of the mdx mutation. The complementary DNA for mouse dystrophin has been cloned, and the sequence has been used in the polymerase chain reaction to amplify normal and mdx dystrophin transcripts in the area of the mdx mutation. Sequence analysis of the amplification products showed that the mdx mouse has a single base substitution within an exon, which causes premature termination of the polypeptide chain.
Fredholm, Daniel V; Coleman, James K; Childress, April L; Wellehan, James F X
2015-03-01
Agamid adenovirus 1 (AgAdv-1) is a significant cause of disease in bearded dragons (Pogona sp.). Clinical manifestations of AgAdv-1 infection are variable and often nonspecific; the manifestations range from lethargy, weight loss, and inappetence, to severe enteritis, hepatitis, and sudden death. Currently, diagnosis of AgAdv-1 infection is achieved through a single published method: standard nested polymerase chain reaction (nPCR) and sequencing. Standard nPCR with sequencing provides reliable sensitivity, specificity, and validation of PCR products. However, this process is comparatively expensive, laborious, and slow. Probe hybridization, as used in a TaqMan assay, represents the best option for validating PCR products aside from the time-consuming process of sequencing. This study developed a real-time PCR (qPCR) assay using a TaqMan probe-based assay, targeting a highly conserved region of the AgAdv-1 genome. Standard curves were generated, detection results were compared with the gold standard conventional PCR and sequencing assay, and limits of detection were determined. Additionally, the qPCR assay was run on samples known to be positive for AgAdv-1 and samples known to be positive for other adenoviruses. Based on the results of these evaluations, this assay allows for a less expensive, rapid, quantitative detection of AgAdv-1 in bearded dragons. © 2015 The Author(s).
Molecular cloning and expression analysis of annexin A2 gene in sika deer antler tip.
Xia, Yanling; Qu, Haomiao; Lu, Binshan; Zhang, Qiang; Li, Heping
2018-04-01
Molecular cloning and bioinformatics analysis of annexin A2 ( ANXA2 ) gene in sika deer antler tip were conducted. The role of ANXA2 gene in the growth and development of the antler were analyzed initially. The reverse transcriptase polymerase chain reaction (RT-PCR) was used to clone the cDNA sequence of the ANXA2 gene from antler tip of sika deer ( Cervus Nippon hortulorum ) and the bioinformatics methods were applied to analyze the amino acid sequence of Anxa2 protein. The mRNA expression levels of the ANXA2 gene in different growth stages were examined by real time reverse transcriptase polymerase chain reaction (real time RT-PCR). The nucleotide sequence analysis revealed an open reading frame of 1,020 bp encoding 339 amino acids long protein of calculated molecular weight 38.6 kDa and isoelectric point 6.09. Homologous sequence alignment and phylogenetic analysis indicated that the Anxa2 mature protein of sika deer had the closest genetic distance with Cervus elaphus and Bos mutus . Real time RT-PCR results showed that the gene had differential expression levels in different growth stages, and the expression level of the ANXA2 gene was the highest at metaphase (rapid growing period). ANXA2 gene may promote the cell proliferation, and the finding suggested Anxa2 as an important candidate for regulating the growth and development of deer antler.
Anderson, Steven; Bloom, Kenneth J; Vallera, Dino U; Rueschoff, Josef; Meldrum, Cliff; Schilling, Robert; Kovach, Barbara; Lee, Ju Ruey-Jiuan; Ochoa, Pam; Langland, Rachel; Halait, Harkanwal; Lawrence, H Jeffrey; Dugan, Michael C
2012-11-01
A polymerase chain reaction-based companion diagnostic (cobas 4800 BRAF V600 Mutation Test) was recently approved by the US Food and Drug Administration to select patients with BRAF-mutant metastatic melanoma for treatment with the BRAF inhibitor vemurafenib. (1) To compare the analytic performance of the cobas test to Sanger sequencing by using screening specimens from phase II and phase III trials of vemurafenib, and (2) to assess the reproducibility of the cobas test at different testing sites. Specimens from 477 patients were used to determine positive and negative percent agreements between the cobas test and Sanger sequencing for detecting V600E (1799T>A) mutations. Specimens were evaluated with a massively parallel pyrosequencing method (454) to resolve discordances between polymerase chain reaction and Sanger results. Reproducibility of the cobas test was assessed at 3 sites by using 3 reagent lots and an 8-member panel of melanoma samples. A valid cobas result was obtained for all eligible patients. Sanger sequencing had a failure rate of 9.2% (44 of 477). For the remaining 433 specimens, positive percent agreement was 96.4% (215 of 223) and negative percent agreement, 80% (168 of 210). Among 42 cobas mutation-positive/Sanger V600E-negative specimens, 17 were V600E positive and 24 were V600K positive by 454. The cobas test detected 70% of V600K mutations. In the reproducibility study, a correct interpretation was made for 100% of wild-type specimens and specimens with greater than 5% mutant alleles; V600E mutations were detected in 90% of specimens with less than 5% mutant alleles. The cobas test (1) had a lower assay failure rate than that of Sanger, (2) was more sensitive in detecting V600E mutations, (3) detected most V600K mutations, and (4) was highly reproducible.
Vollenhofer-Schrumpf, Sabine; Buresch, Ronald; Schinkinger, Manfred
2007-03-01
We have developed a new method for the detection of nucleic acid hybridization, based on a simple latex agglutination test that can be evaluated by the unaided eye. Nucleic acid, e.g., a polymerase chain reaction (PCR) product, is denatured and incubated with polystyrene beads carrying covalently bound complementary oligonucleotide sequences. Hybridization of the nucleic acids leads to aggregation of the latex particles, thereby verifying the presence of target sequence. The test is performed at room temperature, and results are available within 10 min. As a proof of principle, the hybridization/latex agglutination assay was applied to the detection of purified PCR fragments either specific for Salmonella spp. or a synthetic sequence, and to the detection of Salmonella enterica in artificially contaminated chicken samples. A few nanograms of purified PCR fragments were detectable. In artificially contaminated chicken samples, 3 colony-forming units (cfu)/25 g were detected in one of three replicates, and 30 cfu/25 g were detected in both of two replicates when samples for PCR were taken directly from primary enrichment, demonstrating the practical applicability of this test system. Even multiplex detection might be achievable. This novel kind of assay could be useful for a range of applications where hybridization of nucleic acids, e.g., PCR fragments, is to be detected.
Xu, Chen; Zhang, Nan; Huo, Qianyu; Chen, Minghui; Wang, Rengfeng; Liu, Zhili; Li, Xue; Liu, Yunde; Bao, Huijing
2016-04-15
In this article, we discuss the polymerase chain reaction (PCR)-hybridization assay that we developed for high-throughput simultaneous detection and differentiation of Ureaplasma urealyticum and Ureaplasma parvum using one set of primers and two specific DNA probes based on urease gene nucleotide sequence differences. First, U. urealyticum and U. parvum DNA samples were specifically amplified using one set of biotin-labeled primers. Furthermore, amine-modified DNA probes, which can specifically react with U. urealyticum or U. parvum DNA, were covalently immobilized to a DNA-BIND plate surface. The plate was then incubated with the PCR products to facilitate sequence-specific DNA binding. Horseradish peroxidase-streptavidin conjugation and a colorimetric assay were used. Based on the results, the PCR-hybridization assay we developed can specifically differentiate U. urealyticum and U. parvum with high sensitivity (95%) compared with cultivation (72.5%). Hence, this study demonstrates a new method for high-throughput simultaneous differentiation and detection of U. urealyticum and U. parvum with high sensitivity. Based on these observations, the PCR-hybridization assay developed in this study is ideal for detecting and discriminating U. urealyticum and U. parvum in clinical applications. Copyright © 2016 Elsevier Inc. All rights reserved.
Evidence of West Nile virus infection in Nepal.
Rutvisuttinunt, Wiriya; Chinnawirotpisan, Piyawan; Klungthong, Chonticha; Shrestha, Sanjaya Kumar; Thapa, Amod Bahadur; Pant, Arjun; Yingst, Samuel L; Yoon, In-Kyu; Fernandez, Stefan; Pavlin, Julie A
2014-11-27
Acute febrile illness is common among those seeking medical care and is frequently treated empirically with the underlying illness remaining undiagnosed in resource-poor countries. A febrile illness study was conducted 2009-2010 to identify known and unknown pathogens circulating in Nepal. Study methods included diagnostic testing and preliminary ELISA screening of acute and convalescent samples for diseases both known and unknown to be circulating in Nepal, including West Nile virus (WNV). The molecular assays including Polymerase Chain Reaction (PCR), Sanger sequencing and ultra deep sequencing on MiSeq Illumina Platform were conducted to further confirm the presence of WNV. The study enrolled 2,046 patients presenting undifferentiated febrile illness with unknown etiology. Sera from 14 out of 2,046 patients were tested positive for west nile virus (WNV) by nested Reverse Transcription-Polymerase Chain Reaction (RT-PCR). Only two out of 14 cases were confirmed for the presence of WNV by sequencing and identified as WNV lineage 1 phylogentically. The two patients were adult males with fever and no neurological symptoms from Kathmandu and Bharatpur, Nepal. Two out of 2,046 serum samples contained fragments of WNV genome resembling WNV lineage 1, which is evidence of the continued spread of WNV which should be considered a possible illness cause in Nepal.
Tyler, S D; Johnson, W M; Lior, H; Wang, G; Rozee, K R
1991-01-01
A set of synthetic oligonucleotide primers was designed for use in a polymerase chain reaction protocol to specifically detect the B subunit genes in vtx2ha and vtx2hb, which code for the production of the VT2 (Shiga-like toxin II) variant cytotoxins VT2v-a and VT2v-b, respectively. An additional set of primers amplified a fragment common to the B subunits of the VT2 and the VT2 variant genes. Subsequent restriction endonuclease digestion of this amplicon permitted prediction of specific VT2 and variant genotypes on the basis of predetermined restriction fragment length polymorphisms. Genotypes of 21 VT2-producing strains of Escherichia coli were determined using this polymerase chain reaction-restriction fragment length polymorphism procedure. Four strains contained B subunit target sequences only for VT2 genes, 9 strains contained sequences only for VT2v-a genes, and 3 strains contained sequences only for VT2v-b. For genes in combination, one strain contained B subunit genes for both VT2 and VT2v-a and two strains contained B subunit genes for VT2 and VT2v-b. Two strains of E. coli O91:H21 contained both VT2v-a and VT2v-b B subunit genes. The VT2 reference strain of E. coli, E32511, was found to contain the targeted sequences from both VT2 and VT2v-a genes, whereas the recombinant E. coli, pEB1, possessed only that of the VT2 gene. The specific activities of extracellular VT2 determined in HeLa cells ranged from 0.3 to 41.7 TCD50 per microgram of protein in strains carrying the VT2 gene target and from 0 to 50.0 TCD50 per microgram of protein in strains carrying only the VT2 variant target (TCD50 is the tissue culture dose by which 50% of the cells were affected), suggesting that phenotypic expression does not correlate with genotype. Images PMID:1679436
Andris-Widhopf, Jennifer; Steinberger, Peter; Fuller, Roberta; Rader, Christoph; Barbas, Carlos F
2011-09-01
The development of therapeutic antibodies for use in the treatment of human diseases has long been a goal for many researchers in the antibody field. One way to obtain these antibodies is through phage-display libraries constructed from human lymphocytes. This protocol describes the construction of human scFv (single chain antibody fragment) libraries using a short linker (GGSSRSS) or a long linker (GGSSRSSSSGGGGSGGGG). In this method, the individual rearranged heavy- and light-chain variable regions are amplified separately and are linked through a series of overlap polymerase chain reaction (PCR) steps to give the final scFv products that are used for cloning.
Król, Jaroslaw; Bania, Jacek; Florek, Magdalena; Pliszczak-Król, Aleksandra; Staroniewicz, Zdzislaw
2011-05-01
A set of polymerase chain reaction (PCR) assays for identification of the most important Pasteurellaceae species encountered in cats and dogs were developed. Primers for Pasteurella multocida were designed to detect a fragment of the kmt, a gene encoding the outer-membrane protein. Primers specific to Pasteurella canis, Pasteurella dagmatis, and Pasteurella stomatis were based on the manganese-dependent superoxide dismutase gene (sodA) and those specific to [Haemophilus] haemoglobinophilus on species-specific sequences of the 16S ribosomal RNA gene. All the primers were tested on respective reference and control strains and applied to the identification of 47 canine and feline field isolates of Pasteurellaceae. The PCR assays were shown to be species specific, providing a valuable supplement to phenotypic identification of species within this group of bacteria. © 2011 The Author(s)
Martín, Maria Cruz; del Rio, Beatriz; Martínez, Noelia; Magadán, Alfonso H; Alvarez, Miguel A
2008-12-01
One of the main microbiological problems of the dairy industry is the susceptibility of starter bacteria to virus infections. Lactobacillus delbrueckii, a component of thermophilic starter cultures used in the manufacture of several fermented dairy products, including yogurt, is also sensitive to bacteriophage attacks. To avoid the problems associated with these viruses, quick and sensitive detection methods are necessary. In the present study, a fast real-time quantitative polymerase chain reaction assay for the direct detection and quantification of L. delbrueckii phages in milk was developed. A set of primers and a TaqMan MGB probe was designed, based on the lysin gene sequence of different L. delbrueckii phages. The results show the proposed method to be a rapid (total processing time 30 min), specific and highly sensitive technique for detecting L. delbrueckii phages in milk.
Norrie disease in a family with a manifesting female carrier.
Sims, K B; Irvine, A R; Good, W V
1997-04-01
To show that Norrie disease can occur in a girl and to describe her ophthalmologic and genetic features. Amplification of DNA polymerase chain reaction and sequencing of asymmetric polymerase chain reaction for exon 3 were performed on the blood specimen obtained from a girl born with bilateral retinal detachments. A female child with bilateral retinal detachment who had 2 uncles in whom Norrie disease had already been diagnosed. The child had a mutation in the third exon (T776-->A; Ile 123-->Asn) identical to the mutation found in her uncles. Norrie disease can occur in girls. The most likely explanation is nonrandom or unfavorable X inactivation, although timing of development of the peripheral retina and its blood supply could render it vulnerable to effects of the mutant allele at a critical developmental phase.
Marton, Szilvia; Ihász, Katalin; Lengyel, György; Farkas, Szilvia L; Dán, Ádám; Paulus, Petra; Bányai, Krisztián; Fehér, Enikő
2015-03-01
Circoviruses of pigs and birds are established pathogens, however, the exact role of other, recently described circoviruses and circovirus-like viruses remains to be elucidated. The aim of this study was the detection of circoviruses in neglected host species, including honey bees, exotic reptiles and free-living amoebae by widely used broad-spectrum polymerase chain reaction (PCR) assays specific for the replication initiation protein coding gene of these viruses. The majority of sequences obtained from honey bees were highly similar to canine and porcine circoviruses, or, were distantly related to dragonfly cycloviruses. Other rep sequences detected in some honey bees, reptiles and amoebae showed similarities to various rep sequences deposited in the GenBank. Back-to-back PCR primers designed for the amplification of whole viral genomes failed to work that suggested the existence of integrated rep-like elements in many samples. Rolling circle amplification and exonuclease treatment confirmed the absence of small circular DNA genomes in the specimens analysed. In case of honey bees Varroa mite DNA contamination might be a source of the identified endogenous rep-like elements. The reptile and amoebae rep-like sequences were nearly identical with each other and with sequences detected in chimpanzee feces raising the possibility that detection of novel or unusual rep-like elements in some host species might originate from the microbial community of the host. Our results indicate that attention is needed when broad-spectrum rep gene specific polymerase chain reaction is chosen for laboratory diagnosis of circovirus infections.
McMeel, O M; Hoey, E M; Ferguson, A
2001-01-01
The cDNA nucleotide sequences of the lactate dehydrogenase alleles LDH-C1*90 and *100 of brown trout (Salmo trutta) were found to differ at position 308 where an A is present in the *100 allele but a G is present in the *90 allele. This base substitution results in an amino acid change from aspartic acid at position 82 in the LDH-C1 100 allozyme to a glycine in the 90 allozyme. Since aspartic acid has a net negative charge whilst glycine is uncharged, this is consistent with the electrophoretic observation that the LDH-C1 100 allozyme has a more anodal mobility relative to the LDH-C1 90 allozyme. Based on alignment of the cDNA sequence with the mouse genomic sequence, a local primer set was designed, incorporating the variable position, and was found to give very good amplification with brown trout genomic DNA. Sequencing of this fragment confirmed the difference in both homozygous and heterozygous individuals. Digestion of the polymerase chain reaction products with BslI, a restriction enzyme specific for the site difference, gave one, two and three fragments for the two homozygotes and the heterozygote, respectively, following electrophoretic separation. This provides a DNA-based means of routine screening of the highly informative LDH-C1* polymorphism in brown trout population genetic studies. Primer sets presented could be used to sequence cDNA of other LDH* genes of brown trout and other species.
Liu, Shanlin; Yang, Chentao; Zhou, Chengran; Zhou, Xin
2017-12-01
Over the past decade, biodiversity researchers have dedicated tremendous efforts to constructing DNA reference barcodes for rapid species registration and identification. Although analytical cost for standard DNA barcoding has been significantly reduced since early 2000, further dramatic reduction in barcoding costs is unlikely because Sanger sequencing is approaching its limits in throughput and chemistry cost. Constraints in barcoding cost not only led to unbalanced barcoding efforts around the globe, but also prevented high-throughput sequencing (HTS)-based taxonomic identification from applying binomial species names, which provide crucial linkages to biological knowledge. We developed an Illumina-based pipeline, HIFI-Barcode, to produce full-length Cytochrome c oxidase subunit I (COI) barcodes from pooled polymerase chain reaction amplicons generated by individual specimens. The new pipeline generated accurate barcode sequences that were comparable to Sanger standards, even for different haplotypes of the same species that were only a few nucleotides different from each other. Additionally, the new pipeline was much more sensitive in recovering amplicons at low quantity. The HIFI-Barcode pipeline successfully recovered barcodes from more than 78% of the polymerase chain reactions that didn't show clear bands on the electrophoresis gel. Moreover, sequencing results based on the single molecular sequencing platform Pacbio confirmed the accuracy of the HIFI-Barcode results. Altogether, the new pipeline can provide an improved solution to produce full-length reference barcodes at about one-tenth of the current cost, enabling construction of comprehensive barcode libraries for local fauna, leading to a feasible direction for DNA barcoding global biomes. © The Authors 2017. Published by Oxford University Press.
Kahbazi, Manijeh; Sarmadian, Hossein; Ahmadi, Azam; Didgar, Farshideh; Sadrnia, Maryam; Poolad, Toktam; Arjomandzadegan, Mohammad
2018-04-16
In clinical isolates of Mycobacterium tuberculosis (MTB), resistance to pyrazinamide occurs by mutations in any positions of the pncA gene (NC_000962.3) especially in nucleotides 359 and 374. In this study we examined the pncA gene sequence in clinical isolates of MTB. Genomic DNA of 33 clinical isolates of MTB was extracted by the Chelex100 method. The polymerase chain reactions (PCR) were performed using specific primers for amplification of 744 bp amplicon comprising the coding sequences (CDS) of the pncA gene. PCR products were sequenced by an automated sequencing Bioscience system. Additionally, semi Nested-allele specific (sNASP) and polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) methods were carried out for verification of probable mutations in nucleotides 359 and 374. Sequencing results showed that from 33 MTB clinical isolates, nine pyrazinamide-resistant isolates have mutations. Furthermore, no mutation was detected in 24 susceptible strains in the entire 561 bp of the pncA gene. Moreover, new mutations of G→A at position 3 of the pncA gene were identified in some of the resistant isolates. Results showed that the sNASP method could detect mutations in nucleotide 359 and 374 of the pncA gene, but the PCR-RFLP method by the SacII enzyme could not detect these mutations. In conclusion, the identification of new mutations in the pncA gene confirmed the probable occurrence of mutations in any nucleotides of the pncA gene sequence in resistant isolates of MTB.
Wieczorek, Anna; McHenry, Charles S
2006-05-05
The alpha subunit of the replicase of all bacteria contains a php domain, initially identified by its similarity to histidinol phosphatase but of otherwise unknown function (Aravind, L., and Koonin, E. V. (1998) Nucleic Acids Res. 26, 3746-3752). Deletion of 60 residues from the NH2 terminus of the alpha php domain destroys epsilon binding. The minimal 255-residue php domain, estimated by sequence alignment with homolog YcdX, is insufficient for epsilon binding. However, a 320-residue segment including sequences that immediately precede the polymerase domain binds epsilon with the same affinity as the 1160-residue full-length alpha subunit. A subset of mutations of a conserved acidic residue (Asp43 in Escherichia coli alpha) present in the php domain of all bacterial replicases resulted in defects in epsilon binding. Using sequence alignments, we show that the prototypical gram+ Pol C, which contains the polymerase and proofreading activities within the same polypeptide chain, has an epsilon-like sequence inserted in a surface loop near the center of the homologous YcdX protein. These findings suggest that the php domain serves as a platform to enable coordination of proofreading and polymerase activities during chromosomal replication.
Microsatellite DNA as shared genetic markers among conifer species
C.S. Echt; G.G. Vendramin; C. D. Nelson; Paula E. Marquardt
1999-01-01
Polymerase chain reaction (PCR) primer pairs for 21 simple sequence repeat (SSR) loci in Pinus strobus L, and 6 in Pinus radiata D. Don were evaluated to determine whether SSR marker amplification could be achieved in 1O other conifer species. Eighty percent of SSR primer pairs for (AC) loci that were polymorphic in P. ...
Cowpox Virus Transmission from Rats to Monkeys, the Netherlands
Martina, Byron E.E.; van Doornum, Gerard; Dorrestein, Gerry M.; Niesters, Hubert G.M.; Stittelaar, Koert J.; Wolters, Marno A.B.I.; van Bolhuis, Hester G.H.
2006-01-01
We report an outbreak of cowpox virus among monkeys at a sanctuary for exotic animals. Serologic analysis and polymerase chain reaction were performed on blood and swab samples from different rodent species trapped at the sanctuary during the outbreak. Sequence comparison and serologic results showed that brown rats (Rattus norvegicus) transmitted the virus to monkeys. PMID:16707063
A Mini-Library of Sequenced Human DNA Fragments: Linking Bench Experiments with Informatics
ERIC Educational Resources Information Center
Dalgleish, Raymond; Shanks, Morag E.; Monger, Karen; Butler, Nicola J.
2012-01-01
We describe the development of a mini-library of human DNA fragments for use in an enquiry-based learning (EBL) undergraduate practical incorporating "wet-lab" and bioinformatics tasks. In spite of the widespread emergence of the polymerase chain reaction (PCR), the cloning and analysis of DNA fragments in "Escherichia coli"…
Microsatellite DNA as shared genetic markers among conifer species
Craig S. Echt; G.G. Vendramin; C.D. Nelson; P. Marquardt
1999-01-01
Polymerase chain reaction (PCR) primer pairs for 21 simple sequence repeat (SSR) loci in Pinus strobus L. and 6 in Pinus radiata D. Don. were evaluated to determine whether SSR marker amplification could be achieved in 10 other conifer species. Eighty percent of SSR primer pairs for (AC)n loci that were polymorphic in P. ...
USDA-ARS?s Scientific Manuscript database
The present study describes the development of a real time Taqman polymerase chain reaction (PCR) assay using a fluorescent labeled probe for the detection and quantitation of chicken parvovirus (ChPV) in feces. The primers and probes were designed based on the nucleotide sequence of the non struct...
Law, Jodi Woan-Fei; Ab Mutalib, Nurul-Syakima; Chan, Kok-Gan; Lee, Learn-Han
2015-01-01
Listeria monocytogenes, a foodborne pathogen that can cause listeriosis through the consumption of food contaminated with this pathogen. The ability of L. monocytogenes to survive in extreme conditions and cause food contaminations have become a major concern. Hence, routine microbiological food testing is necessary to prevent food contamination and outbreaks of foodborne illness. This review provides insight into the methods for cultural detection, enumeration, and molecular identification of L. monocytogenes in various food samples. There are a number of enrichment and plating media that can be used for the isolation of L. monocytogenes from food samples. Enrichment media such as buffered Listeria enrichment broth, Fraser broth, and University of Vermont Medium (UVM) Listeria enrichment broth are recommended by regulatory agencies such as Food and Drug Administration-bacteriological and analytical method (FDA-BAM), US Department of Agriculture-Food and Safety (USDA-FSIS), and International Organization for Standardization (ISO). Many plating media are available for the isolation of L. monocytogenes, for instance, polymyxin acriflavin lithium-chloride ceftazidime aesculin mannitol, Oxford, and other chromogenic media. Besides, reference methods like FDA-BAM, ISO 11290 method, and USDA-FSIS method are usually applied for the cultural detection or enumeration of L. monocytogenes. most probable number technique is applied for the enumeration of L. monocytogenes in the case of low level contamination. Molecular methods including polymerase chain reaction, multiplex polymerase chain reaction, real-time/quantitative polymerase chain reaction, nucleic acid sequence-based amplification, loop-mediated isothermal amplification, DNA microarray, and next generation sequencing technology for the detection and identification of L. monocytogenes are discussed in this review. Overall, molecular methods are rapid, sensitive, specific, time- and labor-saving. In future, there are chances for the development of new techniques for the detection and identification of foodborne with improved features. PMID:26579116
Law, Jodi Woan-Fei; Ab Mutalib, Nurul-Syakima; Chan, Kok-Gan; Lee, Learn-Han
2015-01-01
Listeria monocytogenes, a foodborne pathogen that can cause listeriosis through the consumption of food contaminated with this pathogen. The ability of L. monocytogenes to survive in extreme conditions and cause food contaminations have become a major concern. Hence, routine microbiological food testing is necessary to prevent food contamination and outbreaks of foodborne illness. This review provides insight into the methods for cultural detection, enumeration, and molecular identification of L. monocytogenes in various food samples. There are a number of enrichment and plating media that can be used for the isolation of L. monocytogenes from food samples. Enrichment media such as buffered Listeria enrichment broth, Fraser broth, and University of Vermont Medium (UVM) Listeria enrichment broth are recommended by regulatory agencies such as Food and Drug Administration-bacteriological and analytical method (FDA-BAM), US Department of Agriculture-Food and Safety (USDA-FSIS), and International Organization for Standardization (ISO). Many plating media are available for the isolation of L. monocytogenes, for instance, polymyxin acriflavin lithium-chloride ceftazidime aesculin mannitol, Oxford, and other chromogenic media. Besides, reference methods like FDA-BAM, ISO 11290 method, and USDA-FSIS method are usually applied for the cultural detection or enumeration of L. monocytogenes. most probable number technique is applied for the enumeration of L. monocytogenes in the case of low level contamination. Molecular methods including polymerase chain reaction, multiplex polymerase chain reaction, real-time/quantitative polymerase chain reaction, nucleic acid sequence-based amplification, loop-mediated isothermal amplification, DNA microarray, and next generation sequencing technology for the detection and identification of L. monocytogenes are discussed in this review. Overall, molecular methods are rapid, sensitive, specific, time- and labor-saving. In future, there are chances for the development of new techniques for the detection and identification of foodborne with improved features.
Gemi: PCR Primers Prediction from Multiple Alignments
Sobhy, Haitham; Colson, Philippe
2012-01-01
Designing primers and probes for polymerase chain reaction (PCR) is a preliminary and critical step that requires the identification of highly conserved regions in a given set of sequences. This task can be challenging if the targeted sequences display a high level of diversity, as frequently encountered in microbiologic studies. We developed Gemi, an automated, fast, and easy-to-use bioinformatics tool with a user-friendly interface to design primers and probes based on multiple aligned sequences. This tool can be used for the purpose of real-time and conventional PCR and can deal efficiently with large sets of sequences of a large size. PMID:23316117
The complete mitochondrial genome of Lota lota (Gadiformes: Gadidae) from the Burqin River in China.
Lu, Zhichuang; Zhang, Nan; Song, Na; Gao, Tianxiang
2016-05-01
In this study, the complete mitochondrial genome (mitogenome) sequence of Lota lota has been determined by long polymerase chain reaction and primer walking methods. The mitogenome is a circular molecule of 16,519 bp in length and contains 37 mitochondrial genes including 13 protein-coding genes, 2 ribosomal RNA (rRNA), 22 transfer RNA (tRNA) and a control region as other bony fishes. Within the control region, we identified the termination-associated sequence domain (TAS), the central conserved sequence block domains (CSB-F and CSB-D), and the conserved sequence block domains (CSB-1, CSB-2 and CSB-3).
Wilson, D J; Kim, D S; Clarke, G A; Marshall-Clarke, S; Moss, D J
1996-12-01
We have previously identified a glycosylphosphatidylinositol-linked glycoprotein of 55 kDa (GP55) which inhibits neurite outgrowth. We now provide evidence that GP55, isolated from adult chick brain, consists of at least two bands, both of which are active, i.e., block outgrowth of neurites from chick dorsal root ganglion neurons. An antiserum raised against the adult proteins reverses the inhibition and preliminary experiments suggest that GP55 is restricted to the nervous system, increases during development from very low levels at embryonic day 10 and is most abundant after hatching. Immunofluorescence reveals that GP55 is expressed on neurons cultured from an embryonic day 14 chick brain but is barely detectable on embryonic day 10 dorsal root ganglion neurons or embryonic day 8 forebrain neurons; the neurons which respond to substrate-bound GP55. Peptide sequencing revealed considerable homology with OBCAM, a protein previously identified on the basis of binding opiates. Nested polymerase chain reaction using primers to the OBCAM sequence and internal primers to GP55 peptides produced two different polymerase chain reaction fragments with homology to OBCAM. A full length clone (E19S) corresponding to one polymerase chain reaction product and a partial length clone (E14S) corresponding to the second have been isolated from an embryonic chick brain library. Both are members of the immunoglobulin superfamily and have (or are expected to have) three C2 domains. E19S has 90% homology with LAMP at the amino acid level. This sequence only partially matches the peptides from the adult protein and hence is probably not a major component of the adult proteins. E14S (GP55-A) has 83% homology to OBCAM at the amino acid level over the region sequenced. The sequence matches several of the peptides from the adult protein and is hence likely to correspond to a major component of the adult proteins. Thus members of the GP55 family are related to OBCAM, neurotrimin, LAMP and a recently discovered chick protein CEPU-1. Our results suggest molecules within this family are capable of acting as cell adhesion molecules and inhibitors of neurite outgrowth.
Pryce, Todd M; Palladino, Silvano; Price, Diane M; Gardam, Dianne J; Campbell, Peter B; Christiansen, Keryn J; Murray, Ronan J
2006-04-01
We report a direct polymerase chain reaction/sequence (d-PCRS)-based method for the rapid identification of clinically significant fungi from 5 different types of commercial broth enrichment media inoculated with clinical specimens. Media including BacT/ALERT FA (BioMérieux, Marcy l'Etoile, France) (n = 87), BACTEC Plus Aerobic/F (Becton Dickinson, Microbiology Systems, Sparks, MD) (n = 16), BACTEC Peds Plus/F (Becton Dickinson) (n = 15), BACTEC Lytic/10 Anaerobic/F (Becton Dickinson) (n = 11) bottles, and BBL MGIT (Becton Dickinson) (n = 11) were inoculated with specimens from 138 patients. A universal DNA extraction method was used combining a novel pretreatment step to remove PCR inhibitors with a column-based DNA extraction kit. Target sequences in the noncoding internal transcribed spacer regions of the rRNA gene were amplified by PCR and sequenced using a rapid (24 h) automated capillary electrophoresis system. Using sequence alignment software, fungi were identified by sequence similarity with sequences derived from isolates identified by upper-level reference laboratories or isolates defined as ex-type strains. We identified Candida albicans (n = 14), Candida parapsilosis (n = 8), Candida glabrata (n = 7), Candida krusei (n = 2), Scedosporium prolificans (n = 4), and 1 each of Candida orthopsilosis, Candida dubliniensis, Candida kefyr, Candida tropicalis, Candida guilliermondii, Saccharomyces cerevisiae, Cryptococcus neoformans, Aspergillus fumigatus, Histoplasma capsulatum, and Malassezia pachydermatis by d-PCRS analysis. All d-PCRS identifications from positive broths were in agreement with the final species identification of the isolates grown from subculture. Earlier identification of fungi using d-PCRS may facilitate prompt and more appropriate antifungal therapy.
NASA Astrophysics Data System (ADS)
Millard, Julie T.; Pilon, André M.
2003-04-01
A recent forensic approach for identification of unknown biological samples is mitochondrial DNA (mtDNA) sequencing. We describe a laboratory exercise suitable for an undergraduate biochemistry course in which the polymerase chain reaction is used to amplify a 440 base pair hypervariable region of human mtDNA from a variety of "crime scene" samples (e.g., teeth, hair, nails, cigarettes, envelope flaps, toothbrushes, and chewing gum). Amplification is verified via agarose gel electrophoresis and then samples are subjected to cycle sequencing. Sequence alignments are made via the program CLUSTAL W, allowing students to compare samples and solve the "crime."
Chen, Guiqian; Qiu, Yuan; Zhuang, Qingye; Wang, Suchun; Wang, Tong; Chen, Jiming; Wang, Kaicheng
2018-05-09
Next generation sequencing (NGS) is a powerful tool for the characterization, discovery, and molecular identification of RNA viruses. There were multiple NGS library preparation methods published for strand-specific RNA-seq, but some methods are not suitable for identifying and characterizing RNA viruses. In this study, we report a NGS library preparation method to identify RNA viruses using the Ion Torrent PGM platform. The NGS sequencing adapters were directly inserted into the sequencing library through reverse transcription and polymerase chain reaction, without fragmentation and ligation of nucleic acids. The results show that this method is simple to perform, able to identify multiple species of RNA viruses in clinical samples.
Accurate multiplex polony sequencing of an evolved bacterial genome.
Shendure, Jay; Porreca, Gregory J; Reppas, Nikos B; Lin, Xiaoxia; McCutcheon, John P; Rosenbaum, Abraham M; Wang, Michael D; Zhang, Kun; Mitra, Robi D; Church, George M
2005-09-09
We describe a DNA sequencing technology in which a commonly available, inexpensive epifluorescence microscope is converted to rapid nonelectrophoretic DNA sequencing automation. We apply this technology to resequence an evolved strain of Escherichia coli at less than one error per million consensus bases. A cell-free, mate-paired library provided single DNA molecules that were amplified in parallel to 1-micrometer beads by emulsion polymerase chain reaction. Millions of beads were immobilized in a polyacrylamide gel and subjected to automated cycles of sequencing by ligation and four-color imaging. Cost per base was roughly one-ninth as much as that of conventional sequencing. Our protocols were implemented with off-the-shelf instrumentation and reagents.
Paula, Francisco Danilo Ferreira; Elói-Santos, Silvana Maria; Xavier, Sandra Guerra; Ganazza, Mônica Aparecida; Jotta, Patricia Yoshioka; Yunes, José Andrés; Viana, Marcos Borato; Assumpção, Juliana Godoy
2015-01-01
Minimal residual disease is an important independent prognostic factor that can identify poor responders among patients with acute lymphoblastic leukemia. The aim of this study was to analyze minimal residual disease using immunoglobulin (Ig) and T-cell receptor (TCR) gene rearrangements by conventional polymerase chain reaction followed by homo-heteroduplex analysis and to compare this with real-time polymerase chain reaction at the end of the induction period in children with acute lymphoblastic leukemia. Seventy-four patients diagnosed with acute lymphoblastic leukemia were enrolled. Minimal residual disease was evaluated by qualitative polymerase chain reaction in 57 and by both tests in 44. The Kaplan-Meier and multivariate Cox methods and the log-rank test were used for statistical analysis. Nine patients (15.8%) were positive for minimal residual disease by qualitative polymerase chain reaction and 11 (25%) by real-time polymerase chain reaction considering a cut-off point of 1×10(-3) for precursor B-cell acute lymphoblastic leukemia and 1×10(-2) for T-cell acute lymphoblastic leukemia. Using the qualitative method, the 3.5-year leukemia-free survival was significantly higher in children negative for minimal residual disease compared to those with positive results (84.1%±5.6% versus 41.7%±17.3%, respectively; p-value=0.004). There was no significant association between leukemia-free survival and minimal residual disease by real-time polymerase chain reaction. Minimal residual disease by qualitative polymerase chain reaction was the only variable significantly correlated to leukemia-free survival. Given the difficulties in the implementation of minimal residual disease monitoring by real-time polymerase chain reaction in most treatment centers in Brazil, the qualitative polymerase chain reaction strategy may be a cost-effective alternative. Copyright © 2015 Associação Brasileira de Hematologia, Hemoterapia e Terapia Celular. Published by Elsevier Editora Ltda. All rights reserved.
The Glyoxylate Cycle in an Arbuscular Mycorrhizal Fungus. Carbon Flux and Gene Expression
Lammers, Peter J.; Jun, Jeongwon; Abubaker, Jehad; Arreola, Raul; Gopalan, Anjali; Bago, Berta; Hernandez-Sebastia, Cinta; Allen, James W.; Douds, David D.; Pfeffer, Philip E.; Shachar-Hill, Yair
2001-01-01
The arbuscular mycorrhizal (AM) symbiosis is responsible for huge fluxes of photosynthetically fixed carbon from plants to the soil. Lipid, which is the dominant form of stored carbon in the fungal partner and which fuels spore germination, is made by the fungus within the root and is exported to the extraradical mycelium. We tested the hypothesis that the glyoxylate cycle is central to the flow of carbon in the AM symbiosis. The results of 13C labeling of germinating spores and extraradical mycelium with 13C2-acetate and 13C2-glycerol and analysis by nuclear magnetic resonance spectroscopy indicate that there are very substantial fluxes through the glyoxylate cycle in the fungal partner. Full-length sequences obtained by polymerase chain reaction from a cDNA library from germinating spores of the AM fungus Glomus intraradices showed strong homology to gene sequences for isocitrate lyase and malate synthase from plants and other fungal species. Quantitative real-time polymerase chain reaction measurements show that these genes are expressed at significant levels during the symbiosis. Glyoxysome-like bodies were observed by electron microscopy in fungal structures where the glyoxylate cycle is expected to be active, which is consistent with the presence in both enzyme sequences of motifs associated with glyoxysomal targeting. We also identified among several hundred expressed sequence tags several enzymes of primary metabolism whose expression during spore germination is consistent with previous labeling studies and with fluxes into and out of the glyoxylate cycle. PMID:11706207
Zhou, Chengran
2017-01-01
Abstract Over the past decade, biodiversity researchers have dedicated tremendous efforts to constructing DNA reference barcodes for rapid species registration and identification. Although analytical cost for standard DNA barcoding has been significantly reduced since early 2000, further dramatic reduction in barcoding costs is unlikely because Sanger sequencing is approaching its limits in throughput and chemistry cost. Constraints in barcoding cost not only led to unbalanced barcoding efforts around the globe, but also prevented high-throughput sequencing (HTS)–based taxonomic identification from applying binomial species names, which provide crucial linkages to biological knowledge. We developed an Illumina-based pipeline, HIFI-Barcode, to produce full-length Cytochrome c oxidase subunit I (COI) barcodes from pooled polymerase chain reaction amplicons generated by individual specimens. The new pipeline generated accurate barcode sequences that were comparable to Sanger standards, even for different haplotypes of the same species that were only a few nucleotides different from each other. Additionally, the new pipeline was much more sensitive in recovering amplicons at low quantity. The HIFI-Barcode pipeline successfully recovered barcodes from more than 78% of the polymerase chain reactions that didn’t show clear bands on the electrophoresis gel. Moreover, sequencing results based on the single molecular sequencing platform Pacbio confirmed the accuracy of the HIFI-Barcode results. Altogether, the new pipeline can provide an improved solution to produce full-length reference barcodes at about one-tenth of the current cost, enabling construction of comprehensive barcode libraries for local fauna, leading to a feasible direction for DNA barcoding global biomes. PMID:29077841
Letellier, C; Kerkhofs, P; Wellemans, G; Vanopdenbosch, E
1999-01-01
A reverse-transcription polymerase chain reaction (RT-PCR) was developed to differentiate the bovine diarrhea virus (BVDV) from other pestiviruses, and to determine the genotype of the BVDV isolates. For this purpose, primer pairs were selected in the 5' untranslated region (5'UTR). The primers BE and B2 were located in highly conserved regions and were pestivirus-specific. Two primer pairs named B3B4 and B5B6 were specific of BVDV genotypes I and II, respectively. With this technique, an amplification product of the expected size was obtained with either the B3B4 or the B5B6 primer pairs for the 107 BVDV isolates tested but not for BDV or CSFV. For some isolates that were grouped in the genotype II, sequence analysis of the PCR fragments confirmed their classification into this genotype.
An, S F; Fleming, K A
1991-11-01
A problem associated with use of the polymerase chain reaction to amplify specific DNA fragments from formalin fixed, paraffin wax embedded tissues is the not infrequent failure of amplification. One possible reason for this could be the presence of inhibitor(s), which interfere with the activity of the reaction. It has been shown that such inhibitor(s) exist when amplifying the human beta globin gene (which exists in human genomic DNA as a single copy gene) from routine clinical samples. A variety of methods to remove such inhibitor(s) were investigated. The results indicate that inhibitor(s) are removed by proteinase K digestion, followed by purification with phenol/chloroform, and centrifugation through a Centricon-30 membrane (30,000 molecular weight cut off). Other factors, including the length and concentration of the DNA sequence to be amplified, can also affect amplification.
Detection of human Pneumocystis carinii by the polymerase chain reaction.
Becker-Hapak, M; Liberator, P; Graves, D
1991-01-01
Oligonucleotide primers were prepared from a clone (B12) which has been shown to be a repetitive sequence in the rat P. carinii genome. Polymerase chain reaction was employed to amplify both rat and human P. carinii DNA. The detection limit of the assay was approximately 600 ng of total nucleic acid. Amplification products from both the rat and human isolates (ca. 780 bp) were characterized by denaturing gradient gel electrophoresis after digestion with Sau3A. No amplification products were obtained when DNA from the following potential pulmonary pathogens were used in identical reactions: Aspergillus fumigatus, Cryptococcus neoformans, Candida albicans, Mycobacterium avium-intracellulare and cytomegalovirus. In a blind study using the B12 primers, P. carinii DNA was successfully amplified in clinical samples which were positive by direct immunofluorescence assay (IFA) as well as in some specimens not identified by direct IFA.
Product differentiation by analysis of DNA melting curves during the polymerase chain reaction.
Ririe, K M; Rasmussen, R P; Wittwer, C T
1997-02-15
A microvolume fluorometer integrated with a thermal cycler was used to acquire DNA melting curves during polymerase chain reaction by fluorescence monitoring of the double-stranded DNA specific dye SYBR Green I. Plotting fluorescence as a function of temperature as the thermal cycler heats through the dissociation temperature of the product gives a DNA melting curve. The shape and position of this DNA melting curve are functions of the GC/AT ratio, length, and sequence and can be used to differentiate amplification products separated by less than 2 degrees C in melting temperature. Desired products can be distinguished from undesirable products, in many cases eliminating the need for gel electrophoresis. Analysis of melting curves can extend the dynamic range of initial template quantification when amplification is monitored with double-stranded DNA specific dyes. Complete amplification and analysis of products can be performed in less than 15 min.
Bacterial Polysaccharide Co-Polymerases Share a Common Framework for Control of Polymer Length
DOE Office of Scientific and Technical Information (OSTI.GOV)
Tocilj,A.; Munger, C.; Proteau, A.
2008-01-01
The chain length distribution of complex polysaccharides present on the bacterial surface is determined by polysaccharide co-polymerases (PCPs) anchored in the inner membrane. We report crystal structures of the periplasmic domains of three PCPs that impart substantially different chain length distributions to surface polysaccharides. Despite very low sequence similarities, they have a common protomer structure with a long central alpha-helix extending 100 Angstroms into the periplasm. The protomers self-assemble into bell-shaped oligomers of variable sizes, with a large internal cavity. Electron microscopy shows that one of the full-length PCPs has a similar organization as that observed in the crystal formore » its periplasmic domain alone. Functional studies suggest that the top of the PCP oligomers is an important region for determining polysaccharide modal length. These structures provide a detailed view of components of the bacterial polysaccharide assembly machinery.« less
Theory and applications of the polymerase chain reaction.
Remick, D G; Kunkel, S L; Holbrook, E A; Hanson, C A
1990-04-01
The polymerase chain reaction (PCR) is a newly developed molecular biology technique that can significantly amplify DNA or RNA. The process consists of repetitive cycles of specific DNA synthesis, defined by short stretches of preselected DNA. With each cycle, there is a doubling of the final, desired DNA product such that a million-fold amplification is possible. This powerful method has numerous applications in diagnostic pathology, especially in the fields of microbiology, forensic science, and hematology. The PCR may be used to directly detect viral DNA, which may facilitate the diagnosis of acquired immune deficiency syndrome (AIDS) or other viral diseases. PCR amplification of DNA allows detection of specific sequences from extremely small samples, such as with forensic material. In hematology, PCR may help in the diagnosis of hemoglobinopathies or of neoplastic disorders by documenting chromosomal translocations. The new PCR opens exciting new avenues for diagnostic pathology using this new technology.
Mechanisms of tail resorption during anuran metamorphosis.
Nakai, Yuya; Nakajima, Keisuke; Yaoita, Yoshio
2017-09-26
Amphibian metamorphosis has historically attracted a good deal of scientific attention owing to its dramatic nature and easy observability. However, the genetic mechanisms of amphibian metamorphosis have not been thoroughly examined using modern techniques such as gene cloning, DNA sequencing, polymerase chain reaction or genomic editing. Here, we review the current state of knowledge regarding molecular mechanisms underlying tadpole tail resorption.
The Function of Neuroendocrine Cells in Prostate Cancer
2013-04-01
integration site. We then performed deep sequencing and aligned reads to the genome. Our analysis revealed that both histological phenotypes are derived from...lentiviral integration site analysis . (B) Laser capture microdissection was performed on individual glands containing both squamous and...lentiviral integration site analysis . LTR: long terminal repeat (viral DNA), PCR: polymerase chain reaction. (D) Venn diagrams depict shared lentiviral
USDA-ARS?s Scientific Manuscript database
A quick polymerase chain reaction (PCR) assay was developed for the detection of Leifsonia xyli subsp. xyli (Lxx), the bacterial causal agent of ratoon stunting disease (RSD) of sugarcane, in crude juice samples from stalks. After removal of abiotic impurities and large molecular weight microorgani...
Peano, C; Lesignoli, F; Gulli, M; Corradini, R; Samson, M C; Marchelli, R; Marmiroli, N
2005-09-15
In the present study a peptide nucleic acid (PNA)-mediated polymerase chain reaction (PCR) clamping method was developed and applied to the detection of genetically modified organisms (GMO), to test PCR products for band identity and to obtain a semiquantitative evaluation of GMO content. The minimal concentration of PNA necessary to block the PCR was determined by comparing PCRs containing a constant amount of DNA in the presence of increasing concentration of target-specific PNA. The lowest PNA concentration at which specific inhibition took place, by the inhibition of primer extension and/or steric hindrance, was the most efficient condition. Optimization of PCR clamping by PNA was observed by testing five different PNAs with a minimum of 13 bp to a maximum of 15 bp, designed on the target sequence of Roundup Ready soybean. The results obtained on the DNA extracted from Roundup Ready soybean standard flour were verified also on DNA extracted from standard flours of maize GA21, Bt176, Bt11, and MON810. A correlation between the PNA concentration necessary for inducing PCR clamping and the percentage of the GMO target sequence in the sample was found.
A PCR method based on 18S rRNA gene for detection of malaria parasite in Balochistan.
Shahwani, Zubeda; Aleem, Abdul; Ahmed, Nazeer; Mushtaq, Muhammad; Afridi, Sarwat
2016-12-01
To establish a polymerase chain reaction method based on 18S ribosomal ribonucleic acid gene for the detection of plasmodium deoxyribonucleic acid in patients suffering from malaria symptoms. This cross-sectional study was conducted from September 2013 to October 2014 in district Quetta of Pakistan's Balochistan province. Blood samples were collected from patients suffering from general symptoms of malaria. A polymerase chain reaction-based technique was applied for the diagnosis of malaria and detection of responsible species in the patients who were suspected to carry the parasite. Performance of this polymerase chain reaction method was compared against the microscopy results. Parasite number was also calculated for microscopy positive samples.All samples after the genomic deoxyribonucleic acid isolation were subjected to polymerase chain reaction amplification and agarose gel electrophoresis. Of the 200 samples, 114(57%) were confirmed as positive and 86(43%) as negative for malaria by microscopy. Polymerase chain reaction identified 124(62%) samples as positive and 76(38%) as negative for malaria. The comparative analysis of both diagnostic methods confirmed 109(54.5%) samples as positive by both techniques. Besides, 5(6.58%) samples were identified as false positive and 15(12.1%) samples as false negative by polymerase chain reaction. Sensitivity, specificity and positive predictive values for polymerase chain reaction in comparison to microscopy were 87.98%, 93.42% and 96%, respectively. Polymerase chain reaction-based methods in malaria diagnosis and species identification were found to be more effective than other techniques.
Identification of duck plague virus by polymerase chain reaction.
Hansen, W R; Brown, S E; Nashold, S W; Knudson, D L
1999-01-01
A polymerase chain reaction (PCR) assay was developed for detecting duck plague virus. A 765-bp EcoRI fragment cloned from the genome of the duck plague vaccine (DP-VAC) virus was sequenced for PCR primer development. The fragment sequence was found by GenBank alignment searches to be similar to the 3' ends of an undefined open reading frame and the gene for DNA polymerase protein in other herpesviruses. Three of four primers sets were found to be specific for the DP-VAC virus and 100% (7/7) of field isolates but did not amplify DNA from inclusion body disease of cranes virus. The specificity of one primer set was tested with genome templates from other avian herpesviruses, including those from a golden eagle, bald eagle, great horned owl, snowy owl, peregrine falcon, prairie falcon, pigeon, psittacine, and chicken (infectious laryngotracheitis), but amplicons were not produced. Hence, this PCR test is highly specific for duck plague virus DNA. Two primer sets were able to detect 1 fg of DNA from the duck plague vaccine strain, equivalent to five genome copies. In addition, the ratio of tissue culture infectious doses to genome copies of duck plague vaccine virus from infected duck embryo cells was determined to be 1:100, making the PCR assay 20 times more sensitive than tissue culture for detecting duck plague virus. The speed, sensitivity, and specificity of this PCR provide a greatly improved diagnostic and research tool for studying the epizootiology of duck plague.
Progranulin mutation causes frontotemporal dementia in the Swedish Karolinska family.
Chiang, Huei-Hsin; Rosvall, Lina; Brohede, Jesper; Axelman, Karin; Björk, Behnosh F; Nennesmo, Inger; Robins, Tiina; Graff, Caroline
2008-11-01
Frontotemporal dementia (FTD) is a neurodegenerative disease characterized by cognitive impairment, language dysfunction, and/or changes in personality. Recently it has been shown that progranulin (GRN) mutations can cause FTD as well as other neurodegenerative phenotypes. DNA from 30 family members, of whom seven were diagnosed with FTD, in the Karolinska family was available for GRN sequencing. Fibroblast cell mRNA from one affected family member and six control individuals was available for relative quantitative real-time polymerase chain reaction to investigate the effect of the mutation. Furthermore, the cDNA of an affected individual was sequenced. Clinical and neuropathologic findings of a previously undescribed family branch are presented. A frameshift mutation in GRN (g.102delC) was detected in all affected family members and absent in four unaffected family members older than 70 years. Real-time polymerase chain reaction data showed an approximately 50% reduction of GRN fibroblast mRNA in an affected individual. The mutated mRNA transcripts were undetectable by cDNA sequencing. Segregation and RNA analyses showed that the g.102delC mutation, previously reported, causes FTD in the Karolinska family. Our findings add further support to the significance of GRN in FTD etiology and the presence of modifying genes, which emphasize the need for further studies into the mechanisms of clinical heterogeneity. However, the results already call for attention to the complexity of predictive genetic testing of GRN mutations.
NASA Technical Reports Server (NTRS)
Wu, Liu-Lai; Song, Il; Karuppiah, Nadarajah; Kaufman, Peter B.
1993-01-01
An asymmetric (top vs. bottom halves of pulvini) induction of invertase mRNA by gravistimulation was analyzed in oat shoot pulvini. Total RNA and poly(A)(+) RNA, isolated from oat pulvini, and two oli-gonucleotide primers, corresponding to two conserved amino acid sequences (NDPNG and WECPD) found in invertase from other species, were used for the polymerase chain reaction (PCR). A partial length cDNA (550 bp) was obtained and characterized. A 62% nucleotide sequence homology and 58% deduced amino acid sequence homology, as compared to beta-fructosidase of carrot cell wall, was found. Northern blot analysis showed that there was an obviously transient induction of invertase mRNA by gravistimulation in the oat pulvinus system. The mRNA was rapidly induced to a maximum level at 1 hour after gravistimulation treatment and gradually decreased afterwards. The mRNA level in the bottom half of the oat pulvinus was significantly higher than that in the top half of the pulvinus tissue. The kinetic induction of invertase mRNA was consistent with the transient accumulation of invertase activity during the graviresponse of the pulvinus. This indicates that the expression of the invertase gene(s) could be regulated by gravistimulation at the transcriptional level. Southern blot analysis showed that there were two to three genomic DNA fragments which hybridized with the partial-length invertase cDNA.
NASA Technical Reports Server (NTRS)
Wisotzkey, J. D.; Jurtshuk, P. Jr; Fox, G. E.
1990-01-01
The sequence of the major portion of a Bacillus cycloheptanicus strain SCH(T) 16S rRNA gene is reported. This sequence suggests that B. cycloheptanicus is genetically quite distinct from traditional Bacillus strains (e.g., B. subtilis) and may be properly regarded as belonging to a different genus. The sequence was determined from DNA that was produced by direct amplification of ribosomal DNA from a lyophilized cell pellet with straightforward polymerase chain reaction (PCR) procedures. By obviating the need to revive cell cultures from the lyophile pellet, this approach facilitates rapid 16S rDNA sequencing and thereby advances studies in molecular systematics.
The complete genomic sequence of a tentative new polerovirus identified in barley in South Korea.
Zhao, Fumei; Lim, Seungmo; Yoo, Ran Hee; Igori, Davaajargal; Kim, Sang-Min; Kwak, Do Yeon; Kim, Sun Lim; Lee, Bong Choon; Moon, Jae Sun
2016-07-01
The complete nucleotide sequence of a new barley polerovirus, tentatively named barley virus G (BVG), which was isolated in Gimje, South Korea, has been determined using an RNA sequencing technique combined with polymerase chain reaction methods. The viral genomic RNA of BVG is 5,620 nucleotides long and contains six typical open reading frames commonly observed in other poleroviruses. Sequence comparisons revealed that BVG is most closely related to maize yellow dwarf virus-RMV, with the highest amino acid identities being less than 90 % for all of the corresponding proteins. These results suggested that BVG is a member of a new species in the genus Polerovirus.
Winkfein, R J; Nishikawa, S; Connor, W; Dixon, G H
1993-07-01
A synthetic oligonucleotide primer, designed from marsupial protamine protein-sequence data [Balhorn, R., Corzett, M., Matrimas, J. A., Cummins, J. & Faden, B. (1989) Analysis of protamines isolated from two marsupials, the ring-tailed wallaby and gray short-tailed opossum, J. Cell. Biol. 107] was used to amplify, via the polymerase chain reaction, protamine sequences from a North American opossum (Didelphis marsupialis) cDNA. Using the amplified sequences as probes, several protamine cDNA clones were isolated. The protein sequence, predicted from the cDNA sequences, consisted of 57 amino acids, contained a large number of arginine residues and exhibited the sequence ARYR at its amino terminus, which is conserved in avian and most eutherian mammal protamines. Like the true protamines of trout and chicken, the opossum protamine lacked cysteine residues, distinguishing it from placental mammalian protamine 1 (P1 or stable) protamines. Examination of the protamine gene, isolated by polymerase-chain-reaction amplification of genomic DNA, revealed the presence of an intron dividing the protamine-coding region, a common characteristic of all mammalian P1 genes. In addition, extensive sequence identity in the 5' and 3' flanking regions between mouse and opossum sequences classify the marsupial protamine as being closely related to placental mammal P1. Protamine transcripts, in both birds and mammals, are present in two size classes, differing by the length of their poly(A) tails (either short or long). Examination of opossum protamine transcripts by Northern hybridization revealed four distinct mRNA species in the total RNA fraction, two of which were enriched in the poly(A)-rich fraction. Northern-blot analysis, using an intron-specific probe, revealed the presence of intron sequences in two of the four protamine transcripts. If expressed, the corresponding protein from intron-containing transcripts would differ from spliced transcripts by length (49 versus 57 amino acids) and would contain a cysteine residue.
Phenotypic and genotypic analysis of Borrelia burgdorferi isolates from various sources.
Adam, T; Gassmann, G S; Rasiah, C; Göbel, U B
1991-01-01
A total of 17 B. burgdorferi isolates from various sources were characterized by sodium dodecyl sulfate-polyacrylamide gel electrophoresis of whole-cell proteins, restriction enzyme analysis, Southern hybridization with probes complementary to unique regions of evolutionarily conserved genes (16S rRNA and fla), and direct sequencing of in vitro polymerase chain reaction-amplified fragments of the 16S rRNA gene. Three groups were distinguished on the basis of phenotypic and genotypic traits, the latter traced to the nucleotide sequence level. Images PMID:1649797
cDNA encoding a polypeptide including a hevein sequence
Raikhel, Natasha V.; Broekaert, Willem F.; Chua, Nam-Hai; Kush, Anil
1993-02-16
A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a pu GOVERNMENT RIGHTS This application was funded under Department of Energy Contract DE-AC02-76ER01338. The U.S. Government has certain rights under this application and any patent issuing thereon.
Zhu, Yueming; Zhang, Jun; Wei, Dongsheng; Wang, Yufan; Chen, Xiaoyun; Xing, Laijun; Li, Mingchun
2008-08-01
A slightly thermophilic strain, CBS-01, producing trehalose synthase (TreS), was isolated from geothermal water in this study. According to the phenotypic characteristics and phylogenetic analysis of the 16s rRNA gene sequence, it was identified as Meiothermus ruber. The trehalose synthase gene of Meiothermus ruber CBS-01 was cloned by polymerase chain reaction and sequenced. The TreS gene consisted of 2,895 nucleotides, which specified a 964-amino-acid protein. This novel TreS catalyzed reversible interconversion of maltose and trehalose.
Taketa, Kazuhisa; Azuma, Masaki; Yamamoto, Ritsu; Fujimoto, Seiichiro; Nishi, Shinzo
1996-01-01
A high serum α‐fetoprotein (AFP) level was found in a patient with endometrial adenocarcinoma of the uterus, which appeared to be hepatoid on histological examination. The AFP of this unusual patient was purified hy immunoaffinity chromatography and characterized. The electrophoretic profiles on sodium dodecyl sulfate‐polyacrylamide gel electrophoresis both before and after glycopeptidase F treatment were indistinguishable from those of a hepatoma AFP. This indicates that the patient's AFP was also composed of a single polypeptide chain of Mr 67,000 and an N‐linked sugar chain of Mr 3,000. Amino acid sequence analyses of this AFP, and of AFP from hepatoma and umbilical cord serum indicated that the N‐terminal sequences were essentially the same. The sequence, Arg‐Thr‐Leu‐His‐Arg‐Asn‐Glu‐Tyr‐Gly‐Ile, was slightly different from previous reports, but matched that deduced from the cDNA sequence. AFP isoforms due to microheterogeneity of the sugar chain were analyzed by lectin affinity electrophoresis using a series of lectins. The AFP isoform profiles were distinct from those of proteins derived from cord serum, hepatoma, yolk sac tumor and gastric cancer. The reverse‐transcription of RNA from the tumor tissue followed by a polymerase chain reaction using primers with AFP‐specific sequences gave a product of the size and nucleotide sequence expected for AFP. mRNAs possessing the requisite sequences for albumin and transferrin syntheses were also detected in the tumor. The expression of these hepatocyte‐specific proteins supported the hepatoid nature of this tumor. PMID:8766525
Comparative sequence analyses of sixteen reptilian paramyxoviruses
Ahne, W.; Batts, W.N.; Kurath, G.; Winton, J.R.
1999-01-01
Viral genomic RNA of Fer-de-Lance virus (FDLV), a paramyxovirus highly pathogenic for reptiles, was reverse transcribed and cloned. Plasmids with significant sequence similarities to the hemagglutinin-neuraminidase (HN) and polymerase (L) genes of mammalian paramyxoviruses were identified by BLAST search. Partial sequences of the FDLV genes were used to design primers for amplification by nested polymerase chain reaction (PCR) and sequencing of 518-bp L gene and 352-bp HN gene fragments from a collection of 15 previously uncharacterized reptilian paramyxoviruses. Phylogenetic analyses of the partial L and HN sequences produced similar trees in which there were two distinct subgroups of isolates that were supported with maximum bootstrap values, and several intermediate isolates. Within each subgroup the nucleotide divergence values were less than 2.5%, while the divergence between the two subgroups was 20-22%. This indicated that the two subgroups represent distinct virus species containing multiple virus strains. The five intermediate isolates had nucleotide divergence values of 11-20% and may represent additional distinct species. In addition to establishing diversity among reptilian paramyxoviruses, the phylogenetic groupings showed some correlation with geographic location, and clearly demonstrated a low level of host species-specificity within these viruses. Copyright (C) 1999 Elsevier Science B.V.
Akiyama, Hiroshi; Nakamura, Fumi; Yamada, Chihiro; Nakamura, Kosuke; Nakajima, Osamu; Kawakami, Hiroshi; Harikai, Naoki; Furui, Satoshi; Kitta, Kazumi; Teshima, Reiko
2009-11-01
To screen for unauthorized genetically modified organisms (GMO) in the various crops, we developed a multiplex real-time polymerase chain reaction high-resolution melting-curve analysis method for the simultaneous qualitative detection of 35S promoter sequence of cauliflower mosaic virus (35SP) and the nopaline synthase terminator (NOST) in several crops. We selected suitable primer sets for the simultaneous detection of 35SP and NOST and designed the primer set for the detection of spiked ColE1 plasmid to evaluate the validity of the polymerase chain reaction (PCR) analyses. In addition, we optimized the multiplex PCR conditions using the designed primer sets and EvaGreen as an intercalating dye. The contamination of unauthorized GMO with single copy similar to NK603 maize can be detected as low as 0.1% in a maize sample. Furthermore, we showed that the present method would be applicable in identifying GMO in various crops and foods like authorized GM soybean, authorized GM potato, the biscuit which is contaminated with GM soybeans and the rice which is contaminated with unauthorized GM rice. We consider this method to be a simple and reliable assay for screening for unauthorized GMO in crops and the processing food products.
Sharifdini, Meysam; Mirhendi, Hossein; Ashrafi, Keyhan; Hosseini, Mostafa; Mohebali, Mehdi; Khodadadi, Hossein; Kia, Eshrat Beigom
2015-01-01
This study was performed to evaluate nested polymerase chain reaction (PCR) and real-time PCR methods for detection of Strongyloides stercoralis in fecal samples compared with parasitological methods. A total of 466 stool samples were examined by conventional parasitological methods (formalin ether concentration [FEC] and agar plate culture [APC]). DNA was extracted using an in-house method, and mitochondrial cytochrome c oxidase subunit 1 and 18S ribosomal genes were amplified by nested PCR and real-time PCR, respectively. Among 466 samples, 12.7% and 18.2% were found infected with S. stercoralis by FEC and APC, respectively. DNA of S. stercoralis was detected in 18.9% and 25.1% of samples by real-time PCR and nested PCR, respectively. Considering parasitological methods as the diagnostic gold standard, the sensitivity and specificity of nested PCR were 100% and 91.6%, respectively, and that of real-time PCR were 84.7% and 95.8%, respectively. However, considering sequence analyzes of the selected nested PCR products, the specificity of nested PCR is increased. In general, molecular methods were superior to parasitological methods. They were more sensitive and more reliable in detection of S. stercoralis in comparison with parasitological methods. Between the two molecular methods, the sensitivity of nested PCR was higher than real-time PCR. PMID:26350449
Complete mitochondrial genome sequence of northeastern sika deer (Cervus nippon hortulorum).
Shao, Yuanchen; Zha, Daiming; Xing, Xiumei; Su, Weilin; Liu, Huamiao; Zhang, Ranran
2016-01-01
The complete mitochondrial genome of the northeastern sika deer, Cervus nippon hortulorum, was determined by accurate polymerase chain reaction. The entire genome is 16,434 bp in length and contains 13 protein-coding genes, 2 rRNA genes, 22 tRNA genes and 1 control region, all of which are arranged in a typical vertebrate manner. The overall base composition of the northeastern sika deer's mitochondrial genome is 33.3% of A, 24.5% of C, 28.7% of T and 13.5% of G. A termination associated sequence and several conserved central sequence block domains were discovered within the control region.
Sequence determination of synthesized chondroitin sulfate dodecasaccharides.
Shioiri, Tatsumasa; Tsuchimoto, Jun; Watanabe, Hideto; Sugiura, Nobuo
2016-06-01
Chondroitin sulfate (CS) is a linear acidic polysaccharide composed of repeating disaccharide units of glucuronic acid and N-acetyl-d-galactosamine. The polysaccharide is modified with sulfate groups at different positions by a variety of sulfotransferases. CS chains exhibit various biological and pathological functions by interacting with cytokines and growth factors and regulating their signal transduction. The fine structure of the CS chain defines its specific biological roles. However, structural analysis of CS has been restricted to disaccharide analysis, hampering the understanding of the structure-function relationship of CS chains. Here, we chemo-enzymatically synthesized CS dodecasaccharides having various sulfate modifications using a bioreactor system of bacterial chondroitin polymerase mutants and various CS sulfotransferases. We developed a sequencing method for CS chains using the CS dodecasaccharides. The method consists of (i) labeling a reducing end with 2-aminopyridine (PA), (ii) partial digestion of CS with testicular hyaluronidase, followed by separation of PA-conjugated oligosaccharides with different chain lengths, (iii) limited digestion of these oligosaccharides with chondroitin lyase AC II into disaccharides, followed by labeling with 2-aminobenzamide, (iv) CS disaccharide analysis using a dual-fluorescence HPLC system (reversed-phase ion-pair and ion-exchange chromatography), and (v) estimation of the composition by calculating individual disaccharide ratios. This CS chain sequencing allows characterization of CS-modifying enzymes and provides a useful tool toward understanding the structure-function relationship of CS chains. © The Author 2016. Published by Oxford University Press. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
Molecular Detection and Identification of Rickettsia Species in Ixodes pacificus in California
Phan, Jimmy Ninh; Lu, Casey Roy; Bender, William Garrett; Smoak, Robert Marion
2011-01-01
Abstract We amplified 16S rRNA, gltA, and ompA genes from Ixodes pacificus by polymerase chain reaction. Sequencing, BLAST analysis, and phylogenetic constructions indicated that two Rickettsia phylotypes are present in I. pacificus. While phylotype G021 has high homology to Ixodes scapularis endosymbiotic Rickettsia, phylotype G022 is a deeply branched novel spotted fever group Rickettsia. PMID:21413886
Cryptosporidium canis in Two Mexican Toddlers.
González-Díaz, Mariana; Urrea-Quezada, Alejandro; Villegas-Gómez, Isaac; Durazo, María; Garibay-Escobar, Adriana; Hernández, Jesús; Xiao, Lihua; Valenzuela, Olivia
2016-11-01
Cryptosporidium canis is reported for the first time in 2 toddlers in Northwestern Mexico. The 2 toddlers (33 and 34 months old) were symptomatic at diagnosis, presenting diarrhea and fever, and 1 case presented chronic malnutrition. Both toddlers were HIV-negative. C. canis was identified by SspI and VspI restriction enzyme digestion of the 18S rRNA polymerase chain reaction products and confirmed by sequence analysis.
2011-01-01
larvae were collected from three habitats (rice fields, irrigation ditches and drainage ditches) in Laguna Province in July 2002 using a plastic dipper ...Wilkerson et al. (2003). The rDNA ITS2 was amplified, and polymerase chain reaction (PCR) products were directly sequenced using Big Dye 3.0 (Applied
Biology of Symbioses between Marine Invertebrates and Intracellular Bacteria
1990-01-30
bisphosphate carboxylase We designed from published sequence information oligonucleotide primers which are complementary to conserved regions on RubisCO ...large and small subunit genes. These primers were used successfully to amplify using polymerase chain reaction (PCR) specific regions of RubisCO ...for the large subunit of ribulose bisphosphate carboxylase/oxygenase ( RubisCO ) to symbiont DNA shows that the symbionts from both deep-sea and shallow
USDA-ARS?s Scientific Manuscript database
A nested PCR assay was developed to determine the presence of a gene encoding a bacteriophage Mu-like portal protein, gp29, in 15 reference strains and 31 field isolates of Haemophilus parasuis. Specific primers, based on the gene’s sequence, were utilized. A majority of the virulent reference strai...
VH gene expression and regulation in the mutant Alicia rabbit. Rescue of VHa2 allotype expression.
Chen, H T; Alexander, C B; Young-Cooper, G O; Mage, R G
1993-04-01
Rabbits of the Alicia strain, derived from rabbits expressing the VHa2 allotype, have a mutation in the H chain locus that has a cis effect upon the expression of VHa2 and VHa- genes. A small deletion at the most J-proximal (3') end of the VH locus leads to low expression of all the genes on the entire chromosome in heterozygous ali mutants and altered relative expression of VH genes in homozygotes. To study VH gene expression and regulation, we used the polymerase chain reaction to amplify the VH genes expressed in spleens of young and adult wild-type and mutant Alicia rabbits. The cDNA from reverse transcription of splenic mRNA was amplified and polymerase chain reaction libraries were constructed and screened with oligonucleotides from framework regions 1 and 3, as well as JH. Thirty-three VH-positive clones were sequenced and analyzed. We found that in mutant Alicia rabbits, products of the first functional VH gene (VH4a2), (or VH4a2-like genes) were expressed in 2- to 8-wk-olds. Expression of both the VHx and VHy types of VHa- genes was also elevated but the relative proportions of VHx and VHy, especially VHx, decreased whereas the relative levels of expression of VH4a2 or VH4a2-like genes increased with age. Our results suggest that the appearance of sequences resembling that of the VH1a2, which is deleted in the mutant ali rabbits, could be caused by alterations of the sequences of the rearranged VH4a2 genes by gene conversions and/or rearrangement of upstream VH1a2-like genes later in development.
Partial characterization of new adenoviruses found in lizards.
Ball, Inna; Behncke, Helge; Schmidt, Volker; Geflügel, F T A; Papp, Tibor; Stöhr, Anke C; Marschang, Rachel E
2014-06-01
In the years 2011-2012, a consensus nested polymerase chain reaction was used for the detection of adenovirus (AdV) infection in reptiles. During this screening, three new AdVs were detected. One of these viruses was detected in three lizards from a group of green striped tree dragons (Japalura splendida). Another was detected in a green anole (Anolis carolinensis). A third virus was detected in a Jackson's chameleon (Chamaeleo jacksonii). Analysis of a portion of the DNA-dependent DNA polymerase genes of each of these viruses revealed that they all were different from one another and from all previously described reptilian AdVs. Phylogenetic analysis of the partial DNA polymerase gene sequence showed that all newly detected viruses clustered within the genus Atadenovirus. This is the first description of AdVs in these lizard species.
Code of Federal Regulations, 2014 CFR
2014-01-01
... the real-time polymerase chain reaction test for Mycoplasma gallisepticum (MGLP ReTi). 147.31 Section... Examination Procedures § 147.31 Laboratory procedures recommended for the real-time polymerase chain reaction.... Following incubation, 100 µl of 100 percent ethanol is added to lysate. Wash and centrifuge following...
Code of Federal Regulations, 2013 CFR
2013-01-01
... the real-time polymerase chain reaction test for Mycoplasma gallisepticum (MGLP ReTi). 147.31 Section... Examination Procedures § 147.31 Laboratory procedures recommended for the real-time polymerase chain reaction.... Following incubation, 100 µl of 100 percent ethanol is added to lysate. Wash and centrifuge following...
Code of Federal Regulations, 2012 CFR
2012-01-01
... the real-time polymerase chain reaction test for Mycoplasma gallisepticum (MGLP ReTi). 147.31 Section... Examination Procedures § 147.31 Laboratory procedures recommended for the real-time polymerase chain reaction.... Following incubation, 100 µl of 100 percent ethanol is added to lysate. Wash and centrifuge following...
Hou, Wan-ru; Tang, Yun; Hou, Yi-ling; Song, Yan; Zhang, Tian; Wu, Guang-fu
2010-07-01
Eukaryotic initiation factor (eIF) EIF1 is a universally conserved translation factor that is involved in translation initiation site selection. The cDNA and the genomic sequences of EIF1 were cloned successfully from the giant panda (Ailuropoda melanoleuca) and the black bear (Ursus thibetanus mupinensis) using reverse transcription polymerase chain reaction (RT-PCR) technology and touchdown-polymerase chain reaction, respectively. The cDNAs of the EIF1 cloned from the giant panda and the black bear are 418 bp in size, containing an open reading frame (ORF) of 342 bp encoding 113 amino acids. The length of the genomic sequence of the giant panda is 1909 bp, which contains four exons and three introns. The length of the genomic sequence of the black bear is 1897 bp, which also contains four exons and three introns. Sequence alignment indicates a high degree of homology to those of Homo sapiens, Mus musculus, Rattus norvegicus, and Bos Taurus at both amino acid and DNA levels. Topology prediction shows there are one N-glycosylation site, two Casein kinase II phosphorylation sites, and a Amidation site in the EIF1 protein of the giant panda and black bear. In addition, there is a protein kinase C phosphorylation site in EIF1 of the giant panda. The giant panda and the black bear EIF1 genes were overexpressed in E. coli BL21. The results indicated that the both EIF1 fusion proteins with the N-terminally His-tagged form gave rise to the accumulation of two expected 19 kDa polypeptide. The expression products obtained could be used to purify the proteins and study their function further.
Yang, Litao; Xu, Songci; Pan, Aihu; Yin, Changsong; Zhang, Kewei; Wang, Zhenying; Zhou, Zhigang; Zhang, Dabing
2005-11-30
Because of the genetically modified organisms (GMOs) labeling policies issued in many countries and areas, polymerase chain reaction (PCR) methods were developed for the execution of GMO labeling policies, such as screening, gene specific, construct specific, and event specific PCR detection methods, which have become a mainstay of GMOs detection. The event specific PCR detection method is the primary trend in GMOs detection because of its high specificity based on the flanking sequence of the exogenous integrant. This genetically modified maize, MON863, contains a Cry3Bb1 coding sequence that produces a protein with enhanced insecticidal activity against the coleopteran pest, corn rootworm. In this study, the 5'-integration junction sequence between the host plant DNA and the integrated gene construct of the genetically modified maize MON863 was revealed by means of thermal asymmetric interlaced-PCR, and the specific PCR primers and TaqMan probe were designed based upon the revealed 5'-integration junction sequence; the conventional qualitative PCR and quantitative TaqMan real-time PCR detection methods employing these primers and probes were successfully developed. In conventional qualitative PCR assay, the limit of detection (LOD) was 0.1% for MON863 in 100 ng of maize genomic DNA for one reaction. In the quantitative TaqMan real-time PCR assay, the LOD and the limit of quantification were eight and 80 haploid genome copies, respectively. In addition, three mixed maize samples with known MON863 contents were detected using the established real-time PCR systems, and the ideal results indicated that the established event specific real-time PCR detection systems were reliable, sensitive, and accurate.
Murray, V
1999-01-01
This article reviews the literature concerning the sequence specificity of DNA-damaging agents. DNA-damaging agents are widely used in cancer chemotherapy. It is important to understand fully the determinants of DNA sequence specificity so that more effective DNA-damaging agents can be developed as antitumor drugs. There are five main methods of DNA sequence specificity analysis: cleavage of end-labeled fragments, linear amplification with Taq DNA polymerase, ligation-mediated polymerase chain reaction (PCR), single-strand ligation PCR, and footprinting. The DNA sequence specificity in purified DNA and in intact mammalian cells is reviewed for several classes of DNA-damaging agent. These include agents that form covalent adducts with DNA, free radical generators, topoisomerase inhibitors, intercalators and minor groove binders, enzymes, and electromagnetic radiation. The main sites of adduct formation are at the N-7 of guanine in the major groove of DNA and the N-3 of adenine in the minor groove, whereas free radical generators abstract hydrogen from the deoxyribose sugar and topoisomerase inhibitors cause enzyme-DNA cross-links to form. Several issues involved in the determination of the DNA sequence specificity are discussed. The future directions of the field, with respect to cancer chemotherapy, are also examined.
Nakamura, Kosuke; Kondo, Kazunari; Akiyama, Hiroshi; Ishigaki, Takumi; Noguchi, Akio; Katsumata, Hiroshi; Takasaki, Kazuto; Futo, Satoshi; Sakata, Kozue; Fukuda, Nozomi; Mano, Junichi; Kitta, Kazumi; Tanaka, Hidenori; Akashi, Ryo; Nishimaki-Mogami, Tomoko
2016-08-15
Identification of transgenic sequences in an unknown genetically modified (GM) papaya (Carica papaya L.) by whole genome sequence analysis was demonstrated. Whole genome sequence data were generated for a GM-positive fresh papaya fruit commodity detected in monitoring using real-time polymerase chain reaction (PCR). The sequences obtained were mapped against an open database for papaya genome sequence. Transgenic construct- and event-specific sequences were identified as a GM papaya developed to resist infection from a Papaya ringspot virus. Based on the transgenic sequences, a specific real-time PCR detection method for GM papaya applicable to various food commodities was developed. Whole genome sequence analysis enabled identifying unknown transgenic construct- and event-specific sequences in GM papaya and development of a reliable method for detecting them in papaya food commodities. Copyright © 2016 Elsevier Ltd. All rights reserved.
Chaban, Bonnie; Chu, Shirley; Hendrick, Steven; Waldner, Cheryl; Hill, Janet E.
2012-01-01
The detection and subspeciation of Campylobacter fetus subsp. venerealis (CFV) from veterinary samples is important for both clinical and economic reasons. Campylobacter fetus subsp. venerealis is the causative agent of bovine genital campylobacteriosis, a venereal disease that can lead to serious reproductive problems in cattle, and strict international regulations require animals and animal products to be CFV-free for trade. This study evaluated methods reported in the literature for CFV detection and reports the translation of an extensively tested CFV-specific polymerase chain reaction (PCR) primer set; including the VenSF/VenSR primers and a real-time, quantitative PCR (qPCR) platform using SYBR Green chemistry. Three methods of preputial sample preparation for direct qPCR were evaluated and a heat lysis DNA extraction method was shown to allow for CFV detection at the level of approximately one cell equivalent per reaction (or 1.0 × 103 CFU/mL) from prepuce. The optimized sample preparation and qPCR protocols were then used to evaluate 3 western Canadian bull cohorts, which included 377 bulls, for CFV. The qPCR assay detected 11 positive bulls for the CFV-specific parA gene target. DNA sequence data confirmed the identity of the amplified product and revealed that positive samples were comprised of 2 sequence types; one identical to previously reported CFV parA gene sequences and one with a 9% sequence divergence. These results add valuable information towards our understanding of an important CFV subspeciation target and offer a significantly improved format for an internationally recognized PCR test. PMID:23277694
Pollock, Steve V; Colombo, Sergio L; Prout, Davey L; Godfrey, Ashley C; Moroney, James V
2003-12-01
This report describes a Chlamydomonas reinhardtii mutant that lacks Rubisco activase (Rca). Using the BleR (bleomycin resistance) gene as a positive selectable marker for nuclear transformation, an insertional mutagenesis screen was performed to select for cells that required a high-CO2 atmosphere for optimal growth. The DNA flanking the BleR insert of one of the high-CO2-requiring strains was cloned using thermal asymmetric interlaced-polymerase chain reaction and inverse polymerase chain reaction and sequenced. The flanking sequence matched the C. reinhardtii Rca cDNA sequence previously deposited in the National Center for Biotechnology Information database. The loss of a functional Rca in the strain was confirmed by the absence of Rca mRNA and protein. The open reading frame for Rca was cloned and expressed in pSL18, a C. reinhardtii expression vector conferring paromomycin resistance. This construct partially complemented the mutant phenotype, supporting the hypothesis that the loss of Rca was the reason the mutant grew poorly in a low-CO2 atmosphere. Sequencing of the C. reinhardtii Rca gene revealed that it contains 10 exons ranging in size from 18 to 470 bp. Low-CO2-grown rca1 cultures had a growth rate and maximum rate of photosynthesis 60% of wild-type cells. Results obtained from experiments on a cia5 rca1 double mutant also suggest that the CO2-concentrating mechanism partially compensates for the absence of an active Rca in the green alga C. reinhardtii.
Arakawa, C.K.; Deering, R.E.; Higman, K.H.; Oshima, K.H.; O'Hara, P.J.; Winton, J.R.
1990-01-01
The polymerase chain reaction [PCR) was used to amplify a portion of the nucleoprotein [NI gene of infectious hematopoietic necrosis virus (IHNV). Using a published sequence for the Round Butte isolate of IHNV, a pair of PCR pnmers was synthesized that spanned a 252 nucleotide region of the N gene from residue 319 to residue 570 of the open reading frame. This region included a 30 nucleotide target sequence for a synthetic oligonucleotide probe developed for detection of IHNV N gene messenger RNA. After 25 cycles of amplification of either messenger or genomic RNA, the PCR product (DNA) of the expected size was easily visible on agarose gels stained with ethidium bromide. The specificity of the amplified DNA was confirmed by Southern and dot-blot analysis using the biotinylated oligonucleotide probe. The PCR was able to amplify the N gene sequence of purified genomic RNA from isolates of IHNV representing 5 different electropherotypes. Using the IHNV primer set, no PCR product was obtained from viral hemorrhagic septicemia virus RNA, but 2 higher molecular weight products were synthesized from hirame rhabdovirus RNA that did not hybridize with the biotinylated probe. The PCR could be efficiently performed with all IHNV genomic RNA template concentrations tested (1 ng to 1 pg). The lowest level of sensitivity was not determined. The PCR was used to amplify RNA extracted from infected cell cultures and selected tissues of Infected rainbow trout. The combination of PCR and nucleic acid probe promises to provide a detection method for IHNV that is rapid, h~ghly specific, and sensitive.
Tan, L; Wang, H; Li, C; Pan, Y
2014-12-01
Acute exacerbations of chronic obstructive pulmonary disease (AE-COPD) are leading causes of mortality in hospital intensive care units. We sought to determine whether dental plaque biofilms might harbor pathogenic bacteria that can eventually cause lung infections in patients with severe AE-COPD. Paired samples of subgingival plaque biofilm and tracheal aspirate were collected from 53 patients with severe AE-COPD. Total bacterial DNA was extracted from each sample individually for polymerase chain reaction amplification and/or generation of bacterial 16S rDNA sequences and cDNA libraries. We used a metagenomic approach, based on bacterial 16S rDNA sequences, to compare the distribution of species present in dental plaque and lung. Analysis of 1060 sequences (20 clones per patient) revealed a wide range of aerobic, anaerobic, pathogenic, opportunistic, novel and uncultivable bacterial species. Species indistinguishable between the paired subgingival plaque and tracheal aspirate samples (97-100% similarity in 16S rDNA sequence) were dental plaque pathogens (Aggregatibacter actinomycetemcomitans, Capnocytophaga sputigena, Porphyromonas gingivalis, Tannerella forsythia and Treponema denticola) and lung pathogens (Acinetobacter baumannii, Klebsiella pneumoniae, Pseudomonas aeruginosa and Streptococcus pneumoniae). Real-time polymerase chain reaction of 16S rDNA indicated lower levels of Pseudomonas aeruginosa and Porphyromonas gingivalis colonizing the dental plaques compared with the paired tracheal aspirate samples. These results support the hypothesis that dental bacteria may contribute to the pathology of severe AE-COPD. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
A HIV-1 heterosexual transmission chain in Guangzhou, China: a molecular epidemiological study.
Han, Zhigang; Leung, Tommy W C; Zhao, Jinkou; Wang, Ming; Fan, Lirui; Li, Kai; Pang, Xinli; Liang, Zhenbo; Lim, Wilina W L; Xu, Huifang
2009-09-25
We conducted molecular analyses to confirm four clustering HIV-1 infections (Patient A, B, C & D) in Guangzhou, China. These cases were identified by epidemiological investigation and suspected to acquire the infection through a common heterosexual transmission chain. Env C2V3V4 region, gag p17/p24 junction and partial pol gene of HIV-1 genome from serum specimens of these infected cases were amplified by reverse transcription polymerase chain reaction (RT-PCR) and nucleotide sequenced. Phylogenetic analyses indicated that their viral nucleotide sequences were significantly clustered together (bootstrap value is 99%, 98% and 100% in env, gag and pol tree respectively). Evolutionary distance analysis indicated that their genetic diversities of env, gag and pol genes were significantly lower than non-clustered controls, as measured by unpaired t-test (env gene comparison: p < 0.005; gag gene comparison: p < 0.005; pol gene comparison: p < 0.005). Epidemiological results and molecular analyses consistently illustrated these four cases represented a transmission chain which dispersed in the locality through heterosexual contact involving commercial sex worker.
Gerbod, D; Edgcomb, V P; Noël, C; Delgado-Viscogliosi, P; Viscogliosi, E
2000-09-01
Small subunit rDNA genes were amplified by polymerase chain reaction using specific primers from mixed-population DNA obtained from the whole hindgut of the termite Calotermes flavicollis. Comparative sequence analysis of the clones revealed two kinds of sequences that were both from parabasalid symbionts. In a molecular tree inferred by distance, parsimony and likelihood methods, and including 27 parabasalid sequences retrieved from the data bases, the sequences of the group II (clones Cf5 and Cf6) were closely related to the Devescovinidae/Calonymphidae species and thus were assigned to the Devescovinidae Foaina. The sequence of the group I (clone Cf1) emerged within the Trichomonadinae and strongly clustered with Tetratrichomonas gallinarum. On the basis of morphological data, the Monocercomonadidae Hexamastix termitis might be the most likely origin of this sequence.
Code of Federal Regulations, 2010 CFR
2010-01-01
... the real-time polymerase chain reaction test for Mycoplasma gallisepticum (MGLP ReTi). 147.31 Section... Examination Procedures § 147.31 Laboratory procedures recommended for the real-time polymerase chain reaction... lp gene. (c) MGLP ReTi. Primers and probe should be utilized in a 25 µl reaction containing 12.5 µl...
Code of Federal Regulations, 2011 CFR
2011-01-01
... the real-time polymerase chain reaction test for Mycoplasma gallisepticum (MGLP ReTi). 147.31 Section... Examination Procedures § 147.31 Laboratory procedures recommended for the real-time polymerase chain reaction... lp gene. (c) MGLP ReTi. Primers and probe should be utilized in a 25 µl reaction containing 12.5 µl...
Blood-Borne Candidatus Borrelia algerica in a Patient with Prolonged Fever in Oran, Algeria
Fotso Fotso, Aurélien; Angelakis, Emmanouil; Mouffok, Nadjet; Drancourt, Michel; Raoult, Didier
2015-01-01
To improve the knowledge base of Borrelia in north Africa, we tested 257 blood samples collected from febrile patients in Oran, Algeria, between January and December 2012 for Borrelia species using flagellin gene polymerase chain reaction sequencing. A sequence indicative of a new Borrelia sp. named Candidatus Borrelia algerica was detected in one blood sample. Further multispacer sequence typing indicated this Borrelia sp. had 97% similarity with Borrelia crocidurae, Borrelia duttonii, and Borrelia recurrentis. In silico comparison of Candidatus B. algerica spacer sequences with those of Borrelia hispanica and Borrelia garinii revealed 94% and 89% similarity, respectively. Candidatus B. algerica is a new relapsing fever Borrelia sp. detected in Oran. Further studies may help predict its epidemiological importance. PMID:26416117
A family of cellular proteins related to snake venom disintegrins.
Weskamp, G; Blobel, C P
1994-03-29
Disintegrins are short soluble integrin ligands that were initially identified in snake venom. A previously recognized cellular protein with a disintegrin domain was the guinea pig sperm protein PH-30, a protein implicated in sperm-egg membrane binding and fusion. Here we present peptide sequences that are characteristic for several cellular disintegrin-domain proteins. These peptide sequences were deduced from cDNA sequence tags that were generated by polymerase chain reaction from various mouse tissue and a mouse muscle cell line. Northern blot analysis with four sequence tags revealed distinct mRNA expression patterns. Evidently, cellular proteins containing a disintegrin domain define a superfamily of potential integrin ligands that are likely to function in important cell-cell and cell-matrix interactions.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Srienc, Friedrich; Jackson, John K.; Somers, David A.
A genetically engineered Pseudomonas oleovorans phaC1 polyhydroxyalkanoate (PHA) polymerase having tailored substrate specificity is provided. The modified PHA polymerase is preferably a "bispecific" PHA polymerase capable of copolymerizing a short chain length monomer and a medium chain length monomer is provided. Methods for making the modified PHA polymerase and for making nucleic acids encoding the modified PHA polymerase are also disclosed, as are methods of producing PHA using the modified PHA polymerase. The invention further includes methods to assay for altered substrate specificity.
Shete, Anita M; Yadav, Pragya; Kumar, Vimal; Nikam, Tushar; Mehershahi, Kurosh; Kokate, Prasad; Patil, Deepak; Mourya, Devendra T
2017-01-01
Bats are recognized as important reservoirs for emerging infectious disease and some unknown viral diseases. Two novel viruses, Malsoor virus (family Bunyaviridae, genus, Phlebovirus) and a novel adenovirus (AdV) (family, Adenoviridae genus, Mastadenovirus), were identified from Rousettus bats in the Maharashtra State of India. This study was done to develop and optimize real time reverse transcription - polymerase chain reaction (RT-PCR) assays for Malsoor virus and real time and nested PCR for adenovirus from Rousettus bats. For rapid and accurate screening of Malsoor virus and adenovirus a nested polymerase chain reaction and TaqMan-based real-time PCR were developed. Highly conserved region of nucleoprotein gene of phleboviruses and polymerase gene sequence from the Indian bat AdV isolate polyprotein gene were selected respectively for diagnostic assay development of Malsoor virus and AdV. Sensitivity and specificity of assays were calculated and optimized assays were used to screen bat samples. Molecular diagnostic assays were developed for screening of Malsoor virus and AdV and those were found to be specific. Based on the experiments performed with different parameters, nested PCR was found to be more sensitive than real-time PCR; however, for rapid screening, real-time PCR can be used and further nested PCR can be used for final confirmation or in those laboratories where real-time facility/expertise is not existing. This study reports the development and optimization of nested RT-PCR and a TaqMan-based real-time PCR for Malsoor virus and AdV. The diagnostic assays can be used for rapid detection of these novel viruses to understand their prevalence among bat population.
USDA-ARS?s Scientific Manuscript database
Escherichia albertii is a recently described organism that has been associated with diarrhea in humans and with infection and death in birds. It has also been found in healthy birds. E. albertii has been found in two healthy chickens from Australia and a dead chicken from Washington state. The pr...
DOE Office of Scientific and Technical Information (OSTI.GOV)
Vilches, C.; Pablo, R. de; Herrero, M.J.
1994-12-31
HLA-B73, first described by Mayr and Kirnbauer (1981), is a poorly characterized allospecificity, serologically related to the B7-CREG. We polymerase chain reaction-amplified, cloned and sequenced the HLA-B alleles of the B-LCL LE023, established from a Spanish Caucasoid individual expressing HLA-B73. 5 refs., 2 figs.
Litvintseva, Anastasia P.; Marsden-Haug, Nicola; Hurst, Steven; Hill, Heather; Gade, Lalitha; Driebe, Elizabeth M.; Ralston, Cindy; Roe, Chandler; Barker, Bridget M.; Goldoft, Marcia; Keim, Paul; Wohrle, Ron; Thompson, George R.; Engelthaler, David M.; Brandt, Mary E.; Chiller, Tom
2015-01-01
We used real-time polymerase chain reaction and culture to demonstrate persistent colonization of soils by Coccidioides immitis, an agent of valley fever, in Washington State linked to recent human infections and located outside the endemic range. Whole-genome sequencing confirmed genetic identity between isolates from soil and one of the case-patients. PMID:25165087
Incorporating microbiota data into epidemiologic models: examples from vaginal microbiota research.
van de Wijgert, Janneke H; Jespers, Vicky
2016-05-01
Next generation sequencing and quantitative polymerase chain reaction technologies are now widely available, and research incorporating these methods is growing exponentially. In the vaginal microbiota (VMB) field, most research to date has been descriptive. The purpose of this article is to provide an overview of different ways in which next generation sequencing and quantitative polymerase chain reaction data can be used to answer clinical epidemiologic research questions using examples from VMB research. We reviewed relevant methodological literature and VMB articles (published between 2008 and 2015) that incorporated these methodologies. VMB data have been analyzed using ecologic methods, methods that compare the presence or relative abundance of individual taxa or community compositions between different groups of women or sampling time points, and methods that first reduce the complexity of the data into a few variables followed by the incorporation of these variables into traditional biostatistical models. To make future VMB research more clinically relevant (such as studying associations between VMB compositions and clinical outcomes and the effects of interventions on the VMB), it is important that these methods are integrated with rigorous epidemiologic methods (such as appropriate study designs, sampling strategies, and adjustment for confounding). Crown Copyright © 2016. Published by Elsevier Inc. All rights reserved.
Muldoon, L. L.; Neuwelt, E. A.; Pagel, M. A.; Weiss, D. L.
1994-01-01
The Korat cat provides an animal model for type II GM2-gangliosidosis (Sandhoff disease) that may be suitable for tests of gene replacement therapy with the HEXB gene encoding the beta subunit of the beta-hexosaminidases. In the present report, we examined the brain and liver pathology of a typical Sandhoff-affected cat. We characterized the feline HEXB complementary DNA (cDNA) and determined the molecular defect in this feline model. cDNA libraries were produced from one normal and one affected animal, and cDNA clones homologous to human HEXB were sequenced. In the affected cDNA clone, the deletion of a cytosine residue at position +39 of the putative coding region results in a frame shift and a stop codon at base +191. This disease-related deletion was consistently detected by sequencing of cloned polymerase chain reaction amplified reverse transcribed messenger RNA from one more normal Korat and two additional affected animals. The defect was further demonstrated using single-strand conformational polymorphism analysis of the polymerase chain reaction products. In addition, alternative splicing of both normal and affected messenger RNAs was demonstrated. These results should facilitate the use of this animal model to assess gene therapy. Images Figure 1 Figure 3 Figure 4 Figure 5 PMID:8178934
Muldoon, L L; Neuwelt, E A; Pagel, M A; Weiss, D L
1994-05-01
The Korat cat provides an animal model for type II GM2-gangliosidosis (Sandhoff disease) that may be suitable for tests of gene replacement therapy with the HEXB gene encoding the beta subunit of the beta-hexosaminidases. In the present report, we examined the brain and liver pathology of a typical Sandhoff-affected cat. We characterized the feline HEXB complementary DNA (cDNA) and determined the molecular defect in this feline model. cDNA libraries were produced from one normal and one affected animal, and cDNA clones homologous to human HEXB were sequenced. In the affected cDNA clone, the deletion of a cytosine residue at position +39 of the putative coding region results in a frame shift and a stop codon at base +191. This disease-related deletion was consistently detected by sequencing of cloned polymerase chain reaction amplified reverse transcribed messenger RNA from one more normal Korat and two additional affected animals. The defect was further demonstrated using single-strand conformational polymorphism analysis of the polymerase chain reaction products. In addition, alternative splicing of both normal and affected messenger RNAs was demonstrated. These results should facilitate the use of this animal model to assess gene therapy.
Hypothalamic amenorrhea in a Camurati-Engelmann disease--a case report.
Meczekalski, Blazej; Czyzyk, Adam; Podfigurna-Stopa, Agnieszka; Rydzewski, Bogdan; Sroczynski, Jakub; Lipinska, Małgorzata; Sokalski, Jerzy; Krawczynski, Maciej; Jamsheer, Aleksander; Katulski, Krzysztof; Genazzani, Alessandro
2013-05-01
A case report of a patient diagnosed with Camurati-Engelmann Disease (CED) in association with the functional hypothalamic amenorrhea disturbances. CED is a very rare genetically determined disorder classified as a type of bone dysplasia. Case report. Department of Gynecological Endocrinology, 3rd grade Medical University Hospital. Twenty-one years old female patient with CED admitted to the hospital because of primary amenorrhea. Her history revealed skeletal deformities and hearing impairment. Clinical examination, ultrasound, laboratory evaluations (including serum gonadotropins (FSH, LH) at basal state and after stimulation with gonadotropin-releasing hormone, serum basal estradiol) radiological studies (X-ray of the head, the lumbar spine and lower extremities; a computed tomography of the head), G-banding karyotype, polymerase chain reaction and DNA sequencing. Hormonal serum evaluations were made using an enzyme-linked immunosorbent assay. The exon 4 of the transforming growth factor beta 1 gene was amplified by a polymerase chain reaction and the product was directly sequenced. The hormonal analysis was characteristic for the hypogonadotropic hypogonadism. Radiological and molecular analyses confirmed CED diagnosis. The hypothalamic amenorrhea in a patient with CED may be explained as a consequence of fat hypotrophy and very low body mass index. Therefore, impairment within hypothalamic-pituitary axis in patients with CED should be treated with special attention.
Xia, Minghui; Qi, Qingguo
2013-01-01
We used denaturing gradient gel electrophoresis (DGGE) to compare bacterial profiles in periodontium and root canals of teeth with combined periodontal-endodontic lesions. Samples of dental plaque and necrotic pulp were collected from thirteen extracted teeth with advanced periodontitis. Genomic DNA was extracted for polymerase chain reaction (PCR) analysis using universal bacterial primers. The PCR products were then loaded onto DGGE gels to obtain fractionated bands. Characteristic DGGE bands were excised and DNA was cloned and sequenced. The number of bands, which indicates the number of bacterial species, was compared between dental plaques and necrotic pulp tissues from the same tooth. Although the difference was statistically significant (P < 0.01), there was no positive correlation; similarity (Dice coefficient) was 13.1% to 62.5%. Some bacteria species were present in both the periodontal pockets and root canals of the same tooth; however, periodontal bacteria did not always invade the root canals, and some bacteria in root canals were not present in periodontal pockets of the same tooth. In some teeth, unique bacteria in root canals had not passed from periodontal pockets. A basic local alignment search tool (BLAST) sequence search in Genbank indicated that new bacteria species were present in periodontal pockets and root canals. Their characteristics must thus be further analyzed.
Kaewmanee, M; Phoksawat, W; Romphruk, A; Romphruk, A V; Jumnainsong, A; Leelayuwat, C
2013-06-01
Natural killer group 2 member D (NKG2D) on immune effector cells recognizes multiple stress-inducible ligands. NKG2D single-nucleotide polymorphism (SNP) haplotypes were related to the levels of cytotoxic activity of peripheral blood mononuclear cells. Indeed, these polymorphisms were also located in NKG2F. Isothermal multiple displacement amplification (IMDA) is used for whole genome amplification (WGA) that can amplify very small genomic DNA templates into microgram with whole genome coverage. This is particularly useful in the cases of limited amount of valuable DNA samples requiring multi-locus genotyping. In this study, we evaluated the quality and applicability of IMDA to genetic studies in terms of sensitivity, efficiency of IMDA re-amplification and stability of IMDA products. The smallest amount of DNA to be effectively amplified by IMDA was 200 pg yielding final DNA of approximately 16 µg within 1.5 h. IMDA could be re-amplified only once (second round of amplification), and could be kept for 5 months at 4°C and more than a year at -20°C without loosing genome coverage. The amplified products were used successfully to setup a multiplex polymerase chain reaction-sequence-specific primer for SNP typing of the NKG2D/F genes. The NKG2D/F multiplex polymerase chain reaction (PCR) contained six PCR mixtures for detecting 10 selected SNPs, including 8 NKG2D/F SNP haplotypes and 2 additional NKG2D coding SNPs. This typing procedure will be applicable in both clinical and research laboratories. Thus, our data provide useful information and limitations for utilization of genome-wide amplification using IMDA and its application for multiplex NKG2D/F typing. © 2013 John Wiley & Sons Ltd.
Martin, David H.; Zozaya, Marcela; Lillis, Rebecca A.; Myers, Leann; Nsuami, M. Jacques; Ferris, Michael J.
2013-01-01
Background. The prevalence of Trichomonas vaginalis infection is highest in women with intermediate Nugent scores. We hypothesized that the vaginal microbiota in T. vaginalis–infected women differs from that in T. vaginalis–uninfected women. Methods. Vaginal samples from 30 T. vaginalis–infected women were matched by Nugent score to those from 30 T. vaginalis–uninfected women. Equal numbers of women with Nugent scores categorized as normal, intermediate, and bacterial vaginosis were included. The vaginal microbiota was assessed using 454 pyrosequencing analysis of polymerase chain reaction–amplified 16S ribosomal RNA gene sequences. The 16S ribosomal RNA gene sequence of an unknown organism was obtained by universal bacterial polymerase chain reaction amplification, cloning, and sequencing. Results. Principal coordinates analysis of the pyrosequencing data showed divergence of the vaginal microbiota in T. vaginalis–infected and T. vaginalis–uninfected patients among women with normal and those with intermediate Nugent scores but not among women with bacterial vaginosis. Cluster analysis revealed 2 unique groups of T. vaginalis–infected women. One had high abundance of Mycoplasma hominis and other had high abundance of an unknown Mycoplasma species. Women in the former group had clinical evidence of enhanced vaginal inflammation. Conclusions. T. vaginalis may alter the vaginal microbiota in a manner that is favorable to its survival and/or transmissibility. An unknown Mycoplasma species plays a role in some of these transformations. In other cases, these changes may result in a heightened host inflammatory response. PMID:23482642
Martin, David H; Zozaya, Marcela; Lillis, Rebecca A; Myers, Leann; Nsuami, M Jacques; Ferris, Michael J
2013-06-15
The prevalence of Trichomonas vaginalis infection is highest in women with intermediate Nugent scores. We hypothesized that the vaginal microbiota in T. vaginalis-infected women differs from that in T. vaginalis-uninfected women. Vaginal samples from 30 T. vaginalis-infected women were matched by Nugent score to those from 30 T. vaginalis-uninfected women. Equal numbers of women with Nugent scores categorized as normal, intermediate, and bacterial vaginosis were included. The vaginal microbiota was assessed using 454 pyrosequencing analysis of polymerase chain reaction-amplified 16S ribosomal RNA gene sequences. The 16S ribosomal RNA gene sequence of an unknown organism was obtained by universal bacterial polymerase chain reaction amplification, cloning, and sequencing. Principal coordinates analysis of the pyrosequencing data showed divergence of the vaginal microbiota in T. vaginalis-infected and T. vaginalis-uninfected patients among women with normal and those with intermediate Nugent scores but not among women with bacterial vaginosis. Cluster analysis revealed 2 unique groups of T. vaginalis-infected women. One had high abundance of Mycoplasma hominis and other had high abundance of an unknown Mycoplasma species. Women in the former group had clinical evidence of enhanced vaginal inflammation. T. vaginalis may alter the vaginal microbiota in a manner that is favorable to its survival and/or transmissibility. An unknown Mycoplasma species plays a role in some of these transformations. In other cases, these changes may result in a heightened host inflammatory response.
DOE Office of Scientific and Technical Information (OSTI.GOV)
McGuire, M.C.; Nogueira, C.P.; Bartels, C.F.
1989-02-01
A point mutation in the gene for human serum cholinesterase was identified that changes Asp-70 to Gly in the atypical form of serum cholinesterase. The mutation in nucleotide 209, which changes codon 70 from GAT to GGT, was found by sequencing a genomic clone and sequencing selected regions of DNA amplified by the polymerase chain reaction. The entire coding sequences for usual and atypical cholinesterases were compared, and no other consistent base differences were found. The nucleotide-209 mutation was detected in all five atypical cholinesterase families examined. There was complete concordance between this mutation and serum cholinesterase phenotypes for allmore » 14 heterozygous and 6 homozygous atypical subjects tested. The mutation causes the loss of a Sau3A1 restriction site; the resulting DNA fragment length polymorphism was verified by electrophoresis of {sup 32}P-labeled DNA restriction fragments from usual and atypical subjects. Dot-blot hybridization analysis with a 19-mer allele-specific probe to the DNA amplified by the polymerase chain reaction distinguished between the usual and atypical genotypes. The authors conclude that the Asp-70 {yields} Gly mutation accounts for reduced affinity of atypical cholinesterase for choline esters and that Asp-70 must be an important component of the anionic site. Heterogeneity in atypical alleles may exist, but the Asp-70 point mutation may represent an appreciable portion of the atypical gene pool.« less
Miller, Kennon; Harrington, Susan M; Procop, Gary W
2015-08-01
New molecular diagnostic tests are attractive because of the potential they hold for improving diagnostics in microbiology. The value of these tests, which is often assumed, should be investigated to determine the best use of these potentially powerful tools. To investigate the usefulness of broad-range polymerase chain reaction (PCR), followed by sequencing, in mycobacterial infections. We reviewed the test performance of acid-fast bacilli (AFB) PCR and traditional diagnostic methods (histopathology, AFB smear, and culture). We assessed the diagnostic effect and cost of the unrestricted ordering of broad-range PCR for the detection and identification of mycobacteria in clinical specimens. The AFB PCR was less sensitive than culture and histopathology and was less specific than culture, AFB smear, and histopathology. During 18 months, $93 063 was spent on 183 patient specimens for broad-range PCR and DNA sequencing for mycobacteria to confirm one culture-proven Mycobacterium tuberculosis infection that was also known to be positive by AFB smear and histopathology. In this cohort, there was a false-negative AFB PCR for M tuberculosis and a false-positive AFB PCR for Mycobacterium lentiflavum . Testing of AFB smear-negative specimens from patients without an inflammatory response supportive of a mycobacterial infection is costly and has not been proven to improve patient care. Traditional diagnostics (histopathology, AFB smear, and culture) should remain the primary methods for the detection of mycobacteria in clinical specimens.
Spotin, Adel; Gholami, Shirzad; Nasab, Abbas Najafi; Fallah, Esmaeil; Oskouei, Mahmoud Mahami; Semnani, Vahid; Shariatzadeh, Seyyed Ali; Shahbazi, Abbas
2015-04-01
The definitive identification of Echinococcus species is currently carried out by sequencing and phylogenetic strategies. However, the application of polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) patterns is not broadly used as a result of heterogeneity traits of Echinococcus genome in different regions of the world. Therefore, designing and conducting a standardized pattern should indigenously be considered in under-studied areas. In this investigation, an in silico mapping was designed and developed for eight Echinococcus spp. on the basis of regional sequences in Iran and the world. The numbers of 60 Echinococcus isolates were collected from the liver and lungs of 15 human, 15 sheep, 15 cattle, and 15 camel cases in Semnan province, Central Iran. DNA samples were extracted and examined by polymerase chain reaction of ribosomal DNA (rDNA) internal transcribed spacer 1 (ITS1) and PCR-RFLP via Rsa1 endonuclease enzyme. Moreover, 15 amplicons of cytochrome oxidase 1 (Cox1) were directly sequenced in order to identify the strains/haplotypes. PCR-RFLP and phylogenetic analyses revealed firmly the presence of the G1 and G6 genotypes with heterogeneity (three novel haplotypes) of Cox1 gene although no other expected genotypes were found in the region. Finding shows that the identification of novel haplotypes along with discrimination of Echinococcus spp. through regional patterns can unambiguously illustrate the real taxonomic status of parasite in Central Iran.
Li, H.; Gailbreath, K.; Bender, L.C.; West, K.; Keller, J.; Crawford, T.B.
2003-01-01
Six members of the malignant catarrhal fever (MCF) virus group of ruminant rhadinoviruses have been identified to date. Four of these viruses are clearly associated with clinical disease: alcelaphine herpesvirus 1 (AlHV-1) carried by wildebeest (Connochaetes spp.); ovine herpesvirus 2 (OvHV-2), ubiquitous in domestic sheep; caprine herpesvirus 2 (CpHV-2), endemic in domestic goats; and the virus of unknown origin found causing classic MCF in white-tailed deer (Odocoileus virginianus; MCFV-WTD). Using serology and polymerase chain reaction with degenerate primers targeting a portion of the herpesviral DNA polymerase gene, evidence of three previously unrecognized rhadinoviruses in the MCF virus group was found in muskox (Ovibos moschatus), Nubian ibex (Capra nubiana), and gemsbok (South African oryx, Oryx gazella), respectively. Based on sequence alignment, the viral sequence in the muskox is most closely related to MCFV-WTD (81.5% sequence identity) and that in the Nubian ibex is closest to CpHV-2 (89.3% identity). The viral sequence in the gemsbok is most closely related to AlHV-1 (85.1% identity). No evidence of disease association with these viruses has been found. ?? Wildlife Disease Association 2003.
Bio-barcode gel assay for microRNA
NASA Astrophysics Data System (ADS)
Lee, Hyojin; Park, Jeong-Eun; Nam, Jwa-Min
2014-02-01
MicroRNA has been identified as a potential biomarker because expression level of microRNA is correlated with various cancers. Its detection at low concentrations would be highly beneficial for cancer diagnosis. Here, we develop a new type of a DNA-modified gold nanoparticle-based bio-barcode assay that uses a conventional gel electrophoresis platform and potassium cyanide chemistry and show this assay can detect microRNA at aM levels without enzymatic amplification. It is also shown that single-base-mismatched microRNA can be differentiated from perfectly matched microRNA and the multiplexed detection of various combinations of microRNA sequences is possible with this approach. Finally, differently expressed microRNA levels are selectively detected from cancer cells using the bio-barcode gel assay, and the results are compared with conventional polymerase chain reaction-based results. The method and results shown herein pave the way for practical use of a conventional gel electrophoresis for detecting biomolecules of interest even at aM level without polymerase chain reaction amplification.
Actinomyces israelii in radicular cysts: a molecular study.
Gomes, Nathália Rodrigues; Diniz, Marina Gonçalves; Pereira, Thais Dos Santos Fontes; Estrela, Carlos; de Macedo Farias, Luiz; de Andrade, Bruno Augusto Benevenuto; Gomes, Carolina Cavaliéri; Gomez, Ricardo Santiago
2017-05-01
To investigate whether the microscopic filamentous aggregates observed in radicular cysts are associated with the molecular identification of Actinomyces israelii. Moreover, to verify whether this bacterium can be detected in radicular cyst specimens not presenting aggregates. Microscopic colonies suggestive of Actinomyces were found in 8 out of 279 radicular cyst samples (case group). The case and control groups (n = 12; samples without filamentous colonies) were submitted to the semi-nested polymerase chain reaction to test the presence of A israelii. DNA sequencing was performed to validate polymerase chain reaction results. Two and 3 samples in the case and control groups, respectively, did not present a functional genomic DNA template and were excluded from the study. A israelii was identified in all samples of the case group and in 3 out of 9 samples of the control group. Although A israelii is more commonly identified in radicular cysts presenting filamentous aggregates, it also appears to be detected in radicular cysts without this microscopic finding. Copyright © 2017 Elsevier Inc. All rights reserved.
Genetic diversity of Chlamydia among captive birds from central Argentina.
Frutos, María C; Monetti, Marina S; Vaulet, Lucia Gallo; Cadario, María E; Fermepin, Marcelo Rodríguez; Ré, Viviana E; Cuffini, Cecilia G
2015-01-01
To study the occurrence of Chlamydia spp. and their genetic diversity, we analysed 793 cloacal swabs from 12 avian orders, including 76 genera, obtained from 80 species of asymptomatic wild and captive birds that were examined with conventional nested polymerase chain reaction and quantitative polymerase chain reaction. Chlamydia spp. were not detected in wild birds; however, four species (Chlamydia psittaci, Chlamydia pecorum, Chlamydia pneumoniae and Chlamydia gallinacea) were identified among captive birds (Passeriformes, n = 20; Psittaciformes, n = 15; Rheiformes, n = 8; Falconiformes n = 2; Piciformes n = 2; Anseriformes n = 1; Galliformes n = 1; Strigiformes n = 1). Two pathogens (C. pneumoniae and C. pecorum) were identified simultaneously in samples obtained from captive birds. Based on nucleotide-sequence variations of the ompA gene, three C. psittaci-positive samples detected were grouped into a cluster with the genotype WC derived from mammalian hosts. A single positive sample was phylogenetically related to a new strain of C. gallinacea. This report contributes to our increasing understanding of the abundance of Chlamydia in the animal kingdom.
Colorimetric Detection of Specific DNA Segments Amplified by Polymerase Chain Reactions
NASA Astrophysics Data System (ADS)
Kemp, David J.; Smith, Donald B.; Foote, Simon J.; Samaras, N.; Peterson, M. Gregory
1989-04-01
The polymerase chain reaction (PCR) procedure has many potential applications in mass screening. We describe here a general assay for colorimetric detection of amplified DNA. The target DNA is first amplified by PCR, and then a second set of oligonucleotides, nested between the first two, is incorporated by three or more PCR cycles. These oligonucleotides bear ligands: for example, one can be biotinylated and the other can contain a site for a double-stranded DNA-binding protein. After linkage to an immobilized affinity reagent (such as a cloned DNA-binding protein, which we describe here) and labeling with a second affinity reagent (for example, avidin) linked to horseradish peroxidase, reaction with a chromogenic substrate allows detection of the amplified DNA. This amplified DNA assay (ADA) is rapid, is readily applicable to mass screening, and uses routine equipment. We show here that it can be used to detect human immunodeficiency virus sequences specifically against a background of human DNA.
Polymerase chain reaction for detection of Leptospira spp. in clinical samples.
Mérien, F; Amouriaux, P; Perolat, P; Baranton, G; Saint Girons, I
1992-01-01
A sensitive assay for Leptospira spp., the causative agent of leptospirosis, was developed on the basis of the polymerase chain reaction (PCR). A 331-bp sequence from the Leptospira interrogans serovar canicola rrs (16S) gene was amplified, and the PCR products were analyzed by DNA-DNA hybridization by using a 289-bp fragment internal to the amplified DNA. Specific PCR products also were obtained with DNA from the closely related nonpathogenic Leptospira biflexa but not with DNA from other spirochetes, such as Borrelia burgdorferi, Borrelia hermsii, Treponema denticola, Treponema pallidum, Spirochaeta aurantia, or more distant organisms such as Escherichia coli, Staphylococcus aureus, Mycobacterium tuberculosis, and Proteus mirabilis. The assay was able to detect as few as 10 bacteria. Leptospira DNA was detected in urine from experimentally infected mice. In addition, the test was found to be suitable for diagnosing leptospirosis in humans. Cerebrospinal fluid and urine from patients with leptospirosis were positive, whereas samples from control uninfected patients were negative. Images PMID:1400983
Sanogo, Yibayiri O; Kim, Chang-Hyun; Lampman, Richard; Novak, Robert J
2007-07-01
In North America, West Nile and St. Louis encephalitis viruses have been detected in a wide range of vector species, but the majority of isolations continue to be from pools of mixed mosquitoes in the Culex subgenus Culex. Unfortunately, the morphologic identification of these important disease vectors is often difficult, particularly in regions of sympatry. We developed a sensitive real-time TaqMan polymerase chain reaction assay that allows reliable identification of Culex mosquitoes including Culex pipiens pipiens, Cx. p. quinquefasciatus, Cx. restuans, Cx. salinarius, Cx. nigripalpus, and Cx. tarsalis. Primers and fluorogenic probes specific to each species were designed based on sequences of the acetylcholinesterase gene (Ace2). Both immature and adult mosquitoes were successfully identified as individuals and as mixed species pools. This identification technique provides the basis for a rapid, sensitive, and high-throughput method for expounding the species-specific contribution of vectors to various phases of arbovirus transmission.
Scholz, Holger C; Joseph, Marina; Tomaso, Herbert; Al Dahouk, Sascha; Witte, Angela; Kinne, Joerg; Hagen, Ralph M; Wernery, Renate; Wernery, Ulrich; Neubauer, Heinrich
2006-04-01
A polymerase chain reaction (PCR) assay targeting the flagellin P (fliP)-I S407A genomic region of Burkholderia mallei was developed for the specific detection of this organism in pure cultures and clinical samples from a recent outbreak of equine glanders. Primers deduced from the known fliP-IS407A sequence of B. mallei American Type Culture Collection (ATCC) 23344(T) allowed the specific amplification of a 989-bp fragment from each of the 20 B. mallei strains investigated, whereas other closely related organisms tested negative. The detection limit of the assay was 10 fg for purified DNA of B. mallei ATCC 23344(T). B. mallei DNA was also amplified from various tissues of horses with a generalized B. mallei infection. The developed PCR assay can be used as a simple and rapid tool for the specific and sensitive detection of B. mallei in clinical samples.
Cifuentes, D; Chynoweth, R; Guillén, J; De la Rúa, P; Bielza, P
2012-06-01
Control of Frankliniella occidentalis (Pergande) is a serious problem for agriculture all over the world because of the limited range of insecticides that are available. Insecticide resistance in F. occidentalis has been reported for all major insecticide groups. Our previous studies showed that cytochrome P450-mediated detoxification is a major mechanism responsible for insecticide resistance in this pest. Degenerate polymerase chain reaction was used to identify P450 genes that might be involved in acrinathrin resistance, in a laboratory population of F. occidentalis. Associated sequences were classified as belonging to the CYP4 and CYP6 families. Real-time quantitative polymerase chain reaction analyses revealed that two genes, CYP6EB1 and CYP6EC1, were over-expressed in adults and L2 larvae of the resistant population, when compared with the susceptible population, suggesting their possible involvement in resistance to acrinathrin.
Inkjet Printing Based Droplet Generation for Integrated Online Digital Polymerase Chain Reaction.
Zhang, Weifei; Li, Nan; Koga, Daisuke; Zhang, Yong; Zeng, Hulie; Nakajima, Hizuru; Lin, Jin-Ming; Uchiyama, Katsumi
2018-04-17
We report on the development of a novel and flexible online digital polymerase chain reaction (dPCR) system. The system was composed of three parts: an inkjet for generating the droplets, a coiled fused-silica capillary for thermal cycling, and a laser-induced fluorescence detector (LIFD) for positive droplet counting. Upon inkjet printing, monodisperse droplets were continuously generated in the oil phase and then introduced into the capillary in the form of a stable dispersion. The droplets containing one or zero molecules of target DNA passed through the helical capillary that was attached to a cylindrical thermal cycler for PCR amplification, resulting in the generation of fluorescence for the DNA-positive droplet. After 36 PCR cycles, the fluorescence signal intensity was detected by laser-induced fluorescence located at the downstream of the capillary, followed by a positive/negative counting. The present system was successfully applied to the absolute quantification of the HPV sequence in Caski cells with dynamic ranges spanning 4 orders of magnitude.
Assignment of the human PAX4 gene to chromosome band 7q32 by fluorescence in situ hybridization.
Tamura, T; Izumikawa, Y; Kishino, T; Soejima, H; Jinno, Y; Niikawa, N
1994-01-01
Of the nine known members of a human paired box-containing gene family (Pax), only PAX4 has not been precisely localized. We screened a cosmid library of human genomic DNA using polymerase chain reaction products for PAX4 as a probe and isolated three positive cosmid clones. Sequence analysis revealed that at least two of them had exon-like sequences and showed extensive homology to Pax-4 in the mouse. These two cosmid clones were mapped to human chromosome band 7q32 by fluorescence in situ hybridization.
Genomic characterization of Indian isolates of egg drop syndrome 1976 virus.
Raj, G D; Sivakumar, S; Sudharsan, S; Mohan, A C; Nachimuthu, K
2001-02-01
Five Indian isolates of egg drop syndrome (EDS) 1976 virus and the reference strain 127 were compared by restriction enzyme analysis of viral DNA, and the hexon gene amplified by polymerase chain reaction. Using these techniques, no differences were seen among these viruses. However, partial sequencing of the hexon gene revealed major differences (4.6%) in one of the isolates sequenced, EDS Kerala. Phylogenetic analysis also placed this isolate in a different lineage compared with the other isolates. The need for constant monitoring of the genetic nature of the field isolates of EDS viruses is emphasized.
Knierim, Dennis; Tsai, Wen-Shi; Kenyon, Lawrence
2013-06-01
Polerovirus infection was detected by reverse transcription polymerase chain reaction (RT-PCR) in 29 pepper plants (Capsicum spp.) and one black nightshade plant (Solanum nigrum) sample collected from fields in India, Indonesia, Mali, Philippines, Thailand and Taiwan. At least two representative samples for each country were selected to generate a general polerovirus RT-PCR product of 1.4 kb length for sequencing. Sequence analysis of the partial genome sequences revealed the presence of pepper vein yellows virus (PeVYV) in all 13 samples. A 1990 Australian herbarium sample of pepper described by serological means as infected with capsicum yellows virus (CYV) was identified by sequence analysis of a partial CP sequence as probably infected with a potato leaf roll virus (PLRV) isolate.
Hammondia heydorni oocysts in the faeces of a greyhound in New Zealand.
Ellis, J T; Pomroy, W E
2003-02-01
To identify oocysts found in faecal material of a greyhound. Polymerase chain reaction (PCR) and DNA sequencing were used to study genomic DNA isolated from oocysts purified from faeces of a greyhound. Database searches with the DNA sequences obtained showed they were derived from Hammondia heydorni. A species-specific PCR was developed to detect H. heydorni DNA. Light microscopy in conjunction with PCR and DNA sequencing definitively identified the presence of H. heydorni oocysts in faeces of a greyhound. This study confirms the presence of H. heydorni in New Zealand and indicates the need to correctly identify similar oocysts from dogs, rather than assume they are Neospora caninum.
The complete mitochondrial genome of Pholis nebulosus (Perciformes: Pholidae).
Wang, Zhongquan; Qin, Kaili; Liu, Jingxi; Song, Na; Han, Zhiqiang; Gao, Tianxiang
2016-11-01
In this study, the complete mitochondrial genome (mitogenome) sequence of Pholis nebulosus has been determined by long polymerase chain reaction and primer-walking methods. The mitogenome is a circular molecule of 16 524 bp in length, including the typical structure of 13 protein-coding genes, 2 ribosomal RNA genes, 22 transfer RNA genes and 2 non-coding regions (L-strand replication origin and control region), the gene contents of which are identical to those observed in most bony fishes. Within the control region, we identified the termination-associated sequence domain (TAS), and the conserved sequence block domain (CSB-F, CSB-E, CSB-D, CSB-C, CSB-B, CSB-A, CSB-1, CSB-2, CSB-3).
LeCuyer, Tessa E.; Rink, Anette; Bradway, Daniel S.; Evermann, James F.; Nicola, Anthony V.; Baszler, Timothy; Haldorson, Gary J.
2017-01-01
Fetal tissues and placenta from a third trimester Mediterranean miniature donkey (Equus asinus) abortion were submitted to the Washington State University, Washington Animal Disease Diagnostic Laboratory for abortion diagnosis. Microscopic examination of formalin-fixed tissues revealed multifocal necrotizing placentitis. Several cells within the necrotic foci contained large, eosinophilic, intranuclear inclusions. Virus isolation from fresh, frozen placenta identified a cytopathic, syncytia-forming virus. Polymerase chain reaction (PCR) from the cultured virus using degenerate universal herpesvirus primers amplified a 699—base pair portion of the DNA polymerase gene. The PCR amplicon had 96.7% nucleotide identity with the DNA polymerase gene of Equid herpesvirus 7 (EHV-7; asinine herpesvirus 2), a gammaherpesvirus. An identical sequence was obtained when the same degenerate herpesvirus primers were used for PCR on the formalin-fixed placenta. Additionally, the amplicon had complete identity with short sequences of asinine herpesviruses that have been published in association with interstitial pneumonia in donkeys. EHV-7 has previously been isolated from nasal secretions of normal donkeys and mules. Our report describes a case of abortion associated with EHV-7 or a similar virus. PMID:26462760
Naum-Onganía, Gabriela; Gago-Zachert, Selma; Peña, Eduardo; Grau, Oscar; Garcia, Maria Laura
2003-10-01
Citrus psorosis virus (CPsV), the type member of genus Ophiovirus, has three genomic RNAs. Complete sequencing of CPsV RNA 1 revealed a size of 8184 nucleotides and Northern blot hybridization with chain specific probes showed that its non-coding strand is preferentially encapsidated. The complementary strand of RNA 1 contains two open reading frames (ORFs) separated by a 109-nt intergenic region, one located near the 5'-end potentially encoding a 24K protein of unknown function, and another of 280K containing the core polymerase motifs characteristic of viral RNA-dependent RNA polymerases (RdRp). Comparison of the core RdRp motifs of negative-stranded RNA viruses, supports grouping CPsV, Ranunculus white mottle virus (RWMV) and Mirafiori lettuce virus (MiLV) within the same genus (Ophiovirus), constituting a monophyletic group separated from all other negative-stranded RNA viruses. Furthermore, RNAs 1 of MiLV, CPsV and RWMV are similar in size and those of MiLV and CPsV also in genomic organization and sequence.
Kapoor, Reetika; Srivastava, Nishant; Kumar, Shailender; Saritha, R K; Sharma, Susheel Kumar; Jain, Rakesh Kumar; Baranwal, Virendra Kumar
2017-09-01
Recombinase polymerase amplification (RPA) is a rapid, isothermal amplification method with high specificity and sensitivity. In this study, an assay was developed and evaluated for the detection of banana bunchy top virus (BBTV) in infected banana plants. Three oligonucleotide primer pairs were designed from the replicase initiator protein gene sequences of BBTV to function both in RPA as well as in polymerase chain reaction (PCR). A total of 133 symptomatic as well as asymptomatic banana leaf samples from various cultivars were collected from the different regions of India and evaluated for BBTV infection using the RPA assay. BBTV was efficiently detected using crude leaf sap in RPA and the results obtained were consistent with PCR-based detection using purified DNA as template. To our knowledge, this is the first report of reliable diagnosis of BBTV infection by RPA using crude leaf sap as a template.
Human papillomavirus DNA detected in breast milk.
Sarkola, Marja; Rintala, Marjut; Grénman, Seija; Syrjänen, Stina
2008-06-01
Human papillomavirus (HPV) testing of 223 breast milk samples 3 days postpartum was performed with polymerase chain reaction, hybridization, and sequencing. HPV-16-DNA was detected in 4.0% of the samples. HPV carriage in the breast milk was not correlated with mother's oral or cervical HPV-status or the demographic data. Oral HPV-infection of the spouse at month 6 and 12 postpartum was statistically significantly associated with HPV carriage in the breast milk.
Fasciola hepatica Infection in an Indigenous Community of the Peruvian Jungle
Cabada, Miguel M.; Castellanos-Gonzalez, Alejandro; Lopez, Martha; Caravedo, María Alejandra; Arque, Eulogia; White, Arthur Clinton
2016-01-01
Fasciola hepatica is a zoonotic infection with a worldwide distribution. Autochthonous cases have not been reported in the Amazon region of Peru. Operculated eggs resembling F. hepatica were identified in the stools of five out of 215 subjects in a remote indigenous community of the Peruvian jungle. Polymerase chain reaction targeting Fasciola hepatica cytochrome oxidase subunit 1 (COI) gene and sequencing of the products confirmed Fasciola infection. PMID:26976892
Takaesu, Azusa; Watanabe, Kiyotaka; Takai, Shinji; Sasaki, Yukako; Orino, Koichi
2008-01-01
Background Iron-storage protein, ferritin plays a central role in iron metabolism. Ferritin has dual function to store iron and segregate iron for protection of iron-catalyzed reactive oxygen species. Tissue ferritin is composed of two kinds of subunits (H: heavy chain or heart-type subunit; L: light chain or liver-type subunit). Ferritin gene expression is controlled at translational level in iron-dependent manner or at transcriptional level in iron-independent manner. However, sequencing analysis of marine mammalian ferritin subunits has not yet been performed fully. The purpose of this study is to reveal cDNA-derived amino acid sequences of cetacean ferritin H and L subunits, and demonstrate the possibility of expression of these subunits, especially H subunit, by iron. Methods Sequence analyses of cetacean ferritin H and L subunits were performed by direct sequencing of polymerase chain reaction (PCR) fragments from cDNAs generated via reverse transcription-PCR of leukocyte total RNA prepared from blood samples of six different dolphin species (Pseudorca crassidens, Lagenorhynchus obliquidens, Grampus griseus, Globicephala macrorhynchus, Tursiops truncatus, and Delphinapterus leucas). The putative iron-responsive element sequence in the 5'-untranslated region of the six different dolphin species was revealed by direct sequencing of PCR fragments obtained using leukocyte genomic DNA. Results Dolphin H and L subunits consist of 182 and 174 amino acids, respectively, and amino acid sequence identities of ferritin subunits among these dolphins are highly conserved (H: 99–100%, (99→98) ; L: 98–100%). The conserved 28 bp IRE sequence was located -144 bp upstream from the initiation codon in the six different dolphin species. Conclusion These results indicate that six different dolphin species have conserved ferritin sequences, and suggest that these genes are iron-dependently expressed. PMID:18954429
Problem-Solving Test: Real-Time Polymerase Chain Reaction
ERIC Educational Resources Information Center
Szeberenyi, Jozsef
2009-01-01
Terms to be familiar with before you start to solve the test: polymerase chain reaction, DNA amplification, electrophoresis, breast cancer, "HER2" gene, genomic DNA, "in vitro" DNA synthesis, template, primer, Taq polymerase, 5[prime][right arrow]3[prime] elongation activity, 5[prime][right arrow]3[prime] exonuclease activity, deoxyribonucleoside…
[Study on correlation between ITS sequence of Arctium lappa and quality of Fructus Arctii].
Xu, Liang; Dou, Deqiang; Wang, Bing; Yang, Yanyun; Kang, Tingguo
2011-07-01
To study the correlation between ITS sequence of Arctium lappa and Fructus Arctii quality of different origin. The samples of Fructu arctii materials were collected from 26 different producing areas. Their ITS sequence were determined after polymerase chain reaction (PCR) and quality were evaluated through the determination of arctiin content by HPLC. Genetic diversity, genotype and correlation were analyzed by ClustalX (1.81), Mage 4.0, SPSS 13.0 statistical software. ITS sequence of A. was obtained from 26 samples, and was registered in the GenBank. Corresponding arctiin content of Fructus arctii and 1000-grain weight were determined. A. lappa genotype correlated with Fructus arctii quality by statistical analysis. The research provided a foundation for revealing the molecular mechanism of Fructus arctii geoherbs.
Supsrisunjai, Chavalit; Kootiratrakarn, Tanawatt; Puangpet, Pailin; Bunnag, Thareena; Chaowalit, Prapaipit; Wessagowit, Vesarat
2017-05-01
AbstractSeveral case reports of autochthonous leishmaniasis in Thailand have been published since 1996. Most of the previous cases presented with visceral leishmaniasis (VL) and were mostly reported in southern part of Thailand. Recently, it has been evident that Leishmania martiniquensis is the main cause of Leishmania infection in Thailand. However, Leishmania siamensis (PCM2 Trang isolate) was found to be of a separate lineage with restricted distribution in southern Thailand and also a cause of disseminated dermal and visceral leishmaniasis in one published case. Here we report the first patient from central Thailand with human immunodeficiency virus infection presenting with disseminated dermal leishmaniasis. Polymerase chain reaction and DNA sequencing analysis (large subunit of RNA polymerase II and 18S ribosomal RNA internal transcribed spacer 1) from the tissue biopsy sample revealed the pathogen sequences to be highly homologous to PCM2 Trang strain previously reported from southern Thailand.
Supsrisunjai, Chavalit; Kootiratrakarn, Tanawatt; Puangpet, Pailin; Bunnag, Thareena; Chaowalit, Prapaipit; Wessagowit, Vesarat
2017-01-01
Several case reports of autochthonous leishmaniasis in Thailand have been published since 1996. Most of the previous cases presented with visceral leishmaniasis (VL) and were mostly reported in southern part of Thailand. Recently, it has been evident that Leishmania martiniquensis is the main cause of Leishmania infection in Thailand. However, Leishmania siamensis (PCM2 Trang isolate) was found to be of a separate lineage with restricted distribution in southern Thailand and also a cause of disseminated dermal and visceral leishmaniasis in one published case. Here we report the first patient from central Thailand with human immunodeficiency virus infection presenting with disseminated dermal leishmaniasis. Polymerase chain reaction and DNA sequencing analysis (large subunit of RNA polymerase II and 18S ribosomal RNA internal transcribed spacer 1) from the tissue biopsy sample revealed the pathogen sequences to be highly homologous to PCM2 Trang strain previously reported from southern Thailand. PMID:28138050
Terminations of DNA synthesis on 'proflavine and light'-treated phi X174 single-stranded DNA.
Piette, J; Calberg-Bacq, C M; Lopez, M; van de Vorst, A
1984-04-05
Bacteriophage phi X174 single-stranded DNA molecules were primed with five different restriction fragments and irradiated with visible light in the presence of proflavine. This photodamaged DNA was used as template for the in vitro complementary chain synthesis by E. coli DNA polymerase I (Klenow fragment). Chain terminations were observed by polyacrylamide gel electrophoresis of the synthesized products and localized by comparison with standard sequencing performed simultaneously on the untreated template. 90% of the chain terminations occurred one nucleotide before a guanine residue in the template strand. More than 80% of the sequenced guanine residues were blocking lesions demonstrating the absence of 'hot-spots' for the photodamaging effect of proflavine. At a defined position, the chain termination frequency increased linearly with the irradiation time and was directly influenced by the proflavine concentration present. An important part of lesions resulted from the action of singlet oxygen produced by excited proflavine as shown by the effect that both NaN3 and 2H2O exerted on the reaction. The induced blocking lesions must be important in vivo since no complete replicative forms could be extracted from cell infected with bacteriophages inactivated by 'proflavine and light' treatment.
Kaur, Jasmine; Sharma, Anshul; Lee, Sulhee; Park, Young-Seo
2018-06-01
Lactobacillus brevis is a part of a large family of lactic acid bacteria that are present in cheese, sauerkraut, sourdough, silage, cow manure, feces, and the intestinal tract of humans and rats. It finds its use in food fermentation, and so is considered a "generally regarded as safe" organism. L. brevis strains are extensively used as probiotics and hence, there is a need for identifying and characterizing these strains. For identification and discrimination of the bacterial species at the subspecific level, repetitive element-polymerase chain reaction method is a reliable genomic fingerprinting tool. The objective of the present study was to characterize 13 strains of L. brevis isolated from various fermented foods using repetitive element-polymerase chain reaction. Repetitive element-polymerase chain reaction was performed using three primer sets, REP, Enterobacterial Repetitive Intergenic Consensus (ERIC), and (GTG) 5 , which produced different fingerprinting patterns that enable us to distinguish between the closely related strains. Fingerprinting patterns generated band range in between 150 and 5000 bp with REP, 200-7500 bp with ERIC, and 250-2000 bp with (GTG) 5 primers, respectively. The Jaccard's dissimilarity matrices were used to obtain dendrograms by the unweighted neighbor-joining method using genetic dissimilarities based on repetitive element-polymerase chain reaction fingerprinting data. Repetitive element-polymerase chain reaction proved to be a rapid and easy method that can produce reliable results in L. brevis species.
Qualtieri, Antonio; Le, Pera Maria; Pedace, Vera; Magariello, Angela; Brancati, Carlo
2002-02-01
We have identified a new neutral hemoglobin variant in a pregnant Italian woman, that resulted from a GTG-->CTG replacement at codon 126 of the beta chain, corresponding to a Val-->Leu amino acid change at position beta126(H4). Thermal and isopropanol stability tests were normal and there were no abnormal clinical features. Routine electrophoretic and ion exchange chromatographic methods for hemoglobin separation failed to show this variant, but reversed phase high performance liquid chromatography revealed an abnormal peak eluting near the normal beta chain. No abnormal tryptic peptide was revealed on the high performance liquid chromatographic elution pattern of the total globin digest. The mutation was determined at the DNA level by amplification of the three beta exons by polymerase chain reaction and direct sequencing of one exon that showed an abnormal migration on single strand conformational polymorphism analysis.
Hung, G C; Jacobs, D E; Krecek, R C; Gasser, R B; Chilton, N B
1996-12-01
Genomic DNA was isolated from adult Strongylus asini collected from zebra. The second ribosomal transcribed spacer (ITS-2) was amplified and sequenced using polymerase chain reaction (PCR) based techniques. The DNA sequence was compared with previously published data for 3 related Strongylus species. A PCR-linked restriction fragment length polymorphism method allowed the 4 species to be differentiated unequivocally. The ITS-2 sequence of S. asini was found to be more similar to those of S. edentatus (87.1%) and S. equinus (95.3%) than to that of S vulgaris (73.9%). This result confirms that S. Asini and S vulgaris represent separate species and supports the retention of the 4 species within 1 genus.
Chen, Jian; Wan, Kang-Lin
2003-10-01
To recombine OspC gene from Borrelia burgdorferi PD91 of China and expressed it in E. coli for early diagnosis of Lyme disease. The OspC gene was amplified from the genome of Borrelia burgdorferi PD91 strain by polymerase chain reaction and recombined with plasmid PET-11D. The recombinant plasmid PET-11D-OspC was identified with PCR, restriction endonuclease analysis and sequencing. The antigenicity was verified with Western Blot. OspC gene was cloned correctly into vector PET-11D. The resultant sequence was definitely different from the published sequence. The recombinant OspC seemed to have had strong antigenicity. The findings laid basis for the studies on early diagnosis of Lyme disease.
Giuffrida, Maria Chiara; D'Agata, Roberta; Spoto, Giuseppe
2017-01-01
Droplet microfluidics combined with the isothermal circular strand displacement polymerization (ICSDP) represents a powerful new technique to detect both single-stranded DNA and microRNA sequences. The method here described helps in overcoming some drawbacks of the lately introduced droplet polymerase chain reaction (PCR) amplification when implemented in microfluidic devices. The method also allows the detection of nanoliter droplets of nucleic acids sequences solutions, with a particular attention to microRNA sequences that are detected at the picomolar level. The integration of the ICSDP amplification protocol in droplet microfluidic devices reduces the time of analysis and the amount of sample required. In addition, there is also the possibility to design parallel analyses to be integrated in portable devices.
Dynamics of Delayed p53 Mutations in Mice Given Whole-Body Irradiation at 8 Weeks
DOE Office of Scientific and Technical Information (OSTI.GOV)
Okazaki, Ryuji, E-mail: ryuji-o@med.uoeh-u.ac.j; Ootsuyama, Akira; Kakihara, Hiroyo
2011-01-01
Purpose: Ionizing irradiation might induce delayed genotoxic effects in a p53-dependent manner. However, a few reports have shown a p53 mutation as a delayed effect of radiation. In this study, we investigated the p53 gene mutation by the translocation frequency in chromosome 11, loss of p53 alleles, p53 gene methylation, p53 nucleotide sequence, and p53 protein expression/phosphorylation in p53{sup +/+} and p53{sup +/-} mice after irradiation at a young age. Methods and Materials: p53{sup +/+} and p53{sup +/-} mice were exposed to 3 Gy of whole-body irradiation at 8 weeks of age. Chromosome instability was evaluated by fluorescence in situmore » hybridization analysis. p53 allele loss was evaluated by polymerase chain reaction, and p53 methylation was evaluated by methylation-specific polymerase chain reaction. p53 sequence analysis was performed. p53 protein expression was evaluated by Western blotting. Results: The translocation frequency in chromosome 11 showed a delayed increase after irradiation. In old irradiated mice, the number of mice that showed p53 allele loss and p53 methylation increased compared to these numbers in old non-irradiated mice. In two old irradiated p53{sup +/-} mice, the p53 sequence showed heteromutation. In old irradiated mice, the p53 and phospho-p53 protein expressions decreased compared to old non-irradiated mice. Conclusion: We concluded that irradiation at a young age induced delayed p53 mutations and p53 protein suppression.« less
McGuire, M C; Nogueira, C P; Bartels, C F; Lightstone, H; Hajra, A; Van der Spek, A F; Lockridge, O; La Du, B N
1989-01-01
A point mutation in the gene for human serum cholinesterase was identified that changes Asp-70 to Gly in the atypical form of serum cholinesterase. The mutation in nucleotide 209, which changes codon 70 from GAT to GGT, was found by sequencing a genomic clone and sequencing selected regions of DNA amplified by the polymerase chain reaction. The entire coding sequences for usual and atypical cholinesterases were compared, and no other consistent base differences were found. A polymorphic site near the C terminus of the coded region was detected, but neither allele at this locus segregated consistently with the atypical trait. The nucleotide-209 mutation was detected in all five atypical cholinesterase families examined. There was complete concordance between this mutation and serum cholinesterase phenotypes for all 14 heterozygous and 6 homozygous atypical subjects tested. The mutation causes the loss of a Sau3A1 restriction site; the resulting DNA fragment length polymorphism was verified by electrophoresis of 32P-labeled DNA restriction fragments from usual and atypical subjects. Dot-blot hybridization analysis with a 19-mer allele-specific probe to the DNA amplified by the polymerase chain reaction distinguished between the usual and atypical genotypes. We conclude that the Asp-70----Gly mutation (acidic to neutral amino acid substitution) accounts for reduced affinity of atypical cholinesterase for choline esters and that Asp-70 must be an important component of the anionic site. Heterogeneity in atypical alleles may exist, but the Asp-70 point mutation may represent an appreciable portion of the atypical gene pool. Images PMID:2915989
Sarkar, F H; Kupsky, W J; Li, Y W; Sreepathi, P
1994-03-01
Mutations in the p53 gene have been recognized in brain tumors, and clonal expansion of p53 mutant cells has been shown to be associated with glioma progression. However, studies on the p53 gene have been limited by the need for frozen tissues. We have developed a method utilizing polymerase chain reaction (PCR) for the direct analysis of p53 mutation by single-strand conformation polymorphism (SSCP) and by direct DNA sequencing of the p53 gene using a single 10-microns paraffin-embedded tissue section. We applied this method to screen for p53 gene mutations in exons 5-8 in human gliomas utilizing paraffin-embedded tissues. Twenty paraffin blocks containing tumor were selected from surgical specimens from 17 different adult patients. Tumors included six anaplastic astrocytomas (AAs), nine glioblastomas (GBs), and two mixed malignant gliomas (MMGs). The tissue section on the stained glass slide was used to guide microdissection of an unstained adjacent tissue section to ensure > 90% of the tumor cell population for p53 mutational analysis. Simultaneously, microdissection of the tissue was also carried out to obtain normal tissue from adjacent areas as a control. Mutations in the p53 gene were identified in 3 of 17 (18%) patients by PCR-SSCP analysis and subsequently confirmed by PCR-based DNA sequencing. Mutations in exon 5 resulting in amino acid substitution were found in one thalamic AA (codon 158, CGC > CTT: Arg > Leu) and one cerebral hemispheric GB (codon 151, CCG > CTG: Pro > Leu).(ABSTRACT TRUNCATED AT 250 WORDS)
[A new human leukocyte antigen class I allele, HLA- B*52:11].
Li, Xiao-feng; Zhang, Xu; Zhang, Kun-lian; Chen, Yang; Liu, Xian-zhi; Li, Jian-ping
2011-12-01
To identify and confirm a novel HLA allele. A new human leukocyte antigen class I allele was found during routine HLA genotyping by polymerase chain reaction-sequence specific oligonucleotide probes (PCR-SSOP) and sequencing-based typing (SBT). The novel HLA-B*52 allele was identical to B*52:01:01 with an exception of one base substitution at position 583 of exon 3 where a C was changed to T resulting in codon 195 changed from CAC(H) to TAC(Y). A new HLA class I allele, B*52:11, is identified, and is named officially by the WHO Nomenclature Committee.
Molecular characterization of canine parvovirus (CPV) infection in dogs in Turkey.
Timurkan, Mehmet; Oğuzoğlu, Tuba
2015-01-01
This study provides data about canine parvovirus (CPV) types circulating among dogs in Turkey. Sixty-five samples from dogs with and without clinical signs of parvovirus infection were collected between April 2009 and February 2010. The samples were subsequently tested for CPV using polymerase chain reaction (PCR). Twenty-five samples (38.4%) were positive; when positive samples were characterized by sequence analysis, results showed that both CPV-2a (17/25, 68%) and CPV-2b (8/25, 32%) strains are circulating among domestic dogs in Turkey. This is the first molecular characterization study of CPVs from dogs based on partial VP2 gene sequences in Turkey.
The mini-exon genes of three Phytomonas isolates that differ in plant tissue tropism.
Sturm, N R; Fernandes, O; Campbell, D A
1995-08-01
The tandem mini-exon gene repeat is an ideal diagnostic target for trypanosomatids because it includes sequences that are conserved absolutely coupled with regions of extreme variability. We have exploited these features and the polymerase chain reaction to differentiate Phytomonas strains isolated from phloem, fruit or latex of various host plants. While the transcribed regions are nearly identical, the intergenic sequences are variable in size and content (130-332 base pairs). The mini-exon genes of these phytomonads can therefore be distinguished from each other and from the corresponding genes in insect trypanosomes, with which they are oft confused.
Xie, Bingkun; Yang, Wei; Ouyang, Yongchang; Chen, Lichan; Jiang, Hesheng; Liao, Yuying; Liao, D. Joshua
2016-01-01
Tens of thousands of chimeric RNAs have been reported. Most of them contain a short homologous sequence (SHS) at the joining site of the two partner genes but are not associated with a fusion gene. We hypothesize that many of these chimeras may be technical artifacts derived from SHS-caused mis-priming in reverse transcription (RT) or polymerase chain reactions (PCR). We cloned six chimeric complementary DNAs (cDNAs) formed by human mitochondrial (mt) 16S rRNA sequences at an SHS, which were similar to several expression sequence tags (ESTs).These chimeras, which could not be detected with cDNA protection assay, were likely formed because some regions of the 16S rRNA are reversely complementary to another region to form an SHS, which allows the downstream sequence to loop back and anneal at the SHS to prime the synthesis of its complementary strand, yielding a palindromic sequence that can form a hairpin-like structure.We identified a 16S rRNA that ended at the 4th nucleotide(nt) of the mt-tRNA-leu was dominant and thus should be the wild type. We also cloned a mouse Bcl2-Nek9 chimeric cDNA that contained a 5-nt unmatchable sequence between the two partners, contained two copies of the reverse primer in the same direction but did not contain the forward primer, making it unclear how this Bcl2-Nek9 was formed and amplified. Moreover, a cDNA was amplified because one primer has 4 nts matched to the template, suggesting that there may be many more artificial cDNAs than we have realized, because the nuclear and mt genomes have many more 4-nt than 5-nt or longer homologues. Altogether, the chimeric cDNAs we cloned are good examples suggesting that many cDNAs may be artifacts due to SHS-caused mis-priming and thus greater caution should be taken when new sequence is obtained from a technique involving DNA polymerization. PMID:27148738
Distemper outbreak and its effect on African wild dog conservation.
van de Bildt, Marco W G; Kuiken, Thijs; Visee, Aart M; Lema, Sangito; Fitzjohn, Tony R; Osterhaus, Albert D M E
2002-02-01
In December 2000, an infectious disease spread through a captive breeding group of African wild dogs (Lycaon pictus) in Tanzania, killing 49 of 52 animals within 2 months. The causative agent was identified as Canine distemper virus (CDV) by means of histologic examination, virus isolation, reverse transcriptase-polymerase chain reaction analysis, and nucleotide sequencing. This report emphasizes the importance of adequate protection against infectious diseases for the successful outcome of captive breeding programs of endangered species.
Fasciola hepatica Infection in an Indigenous Community of the Peruvian Jungle.
Cabada, Miguel M; Castellanos-Gonzalez, Alejandro; Lopez, Martha; Caravedo, María Alejandra; Arque, Eulogia; White, Arthur Clinton
2016-06-01
Fasciola hepatica is a zoonotic infection with a worldwide distribution. Autochthonous cases have not been reported in the Amazon region of Peru. Operculated eggs resembling F. hepatica were identified in the stools of five out of 215 subjects in a remote indigenous community of the Peruvian jungle. Polymerase chain reaction targeting Fasciola hepatica cytochrome oxidase subunit 1 (COI) gene and sequencing of the products confirmed Fasciola infection. © The American Society of Tropical Medicine and Hygiene.
Folmer, O; Black, M; Hoeh, W; Lutz, R; Vrijenhoek, R
1994-10-01
We describe "universal" DNA primers for polymerase chain reaction (PCR) amplification of a 710-bp fragment of the mitochondrial cytochrome c oxidase subunit I gene (COI) from 11 invertebrate phyla: Echinodermata, Mollusca, Annelida, Pogonophora, Arthropoda, Nemertinea, Echiura, Sipuncula, Platyhelminthes, Tardigrada, and Coelenterata, as well as the putative phylum Vestimentifera. Preliminary comparisons revealed that these COI primers generate informative sequences for phylogenetic analyses at the species and higher taxonomic levels.
Taira, Chiaki; Matsuda, Kazuyuki; Yamaguchi, Akemi; Sueki, Akane; Koeda, Hiroshi; Takagi, Fumio; Kobayashi, Yukihiro; Sugano, Mitsutoshi; Honda, Takayuki
2013-09-23
Single nucleotide alterations such as single nucleotide polymorphisms (SNP) and single nucleotide mutations are associated with responses to drugs and predisposition to several diseases, and they contribute to the pathogenesis of malignancies. We developed a rapid genotyping assay based on the allele-specific polymerase chain reaction (AS-PCR) with our droplet-PCR machine (droplet-AS-PCR). Using 8 SNP loci, we evaluated the specificity and sensitivity of droplet-AS-PCR. Buccal cells were pretreated with proteinase K and subjected directly to the droplet-AS-PCR without DNA extraction. The genotypes determined using the droplet-AS-PCR were then compared with those obtained by direct sequencing. Specific PCR amplifications for the 8 SNP loci were detected, and the detection limit of the droplet-AS-PCR was found to be 0.1-5.0% by dilution experiments. Droplet-AS-PCR provided specific amplification when using buccal cells, and all the genotypes determined within 9 min were consistent with those obtained by direct sequencing. Our novel droplet-AS-PCR assay enabled high-speed amplification retaining specificity and sensitivity and provided ultra-rapid genotyping. Crude samples such as buccal cells were available for the droplet-AS-PCR assay, resulting in the reduction of the total analysis time. Droplet-AS-PCR may therefore be useful for genotyping or the detection of single nucleotide alterations. Copyright © 2013 Elsevier B.V. All rights reserved.
Molecular basis of beta-thalassemia in the Maldives.
Furuumi, H; Firdous, N; Inoue, T; Ohta, H; Winichagoon, P; Fucharoen, S; Fukumaki, Y
1998-03-01
We have systematically analyzed beta-thalassemia genes using polymerase chain reaction-related techniques, dot-blot hybridization with oligonucleotide probes, allele specific-polymerase chain reaction, and sequencing of amplified DNA fragments from 41 unrelated patients, including 37 beta-thalassemia homozygotes, three with beta-thalassemia/Hb E, and one with beta-thalassemia/Hb S. Four different beta-thalassemia mutations were detected in 78 alleles. These are the IVS-I-5 (G-->C), codon 30 (AGG-->ACG) [also indicated as IVS-I (-1)], IVS-I-1 (G-->A), and codons 41/42 (-TTCT) mutations. The distribution of the beta-thalassemia mutations in the Maldives is 58 alleles (74.3%) with the IVS-I-5 (G-->C) mutation, 12 (15.4%) with the codon 30 (AGG-->ACG) mutation, seven (9%) with the IVS-I-1 (G-->A) mutation, and one with the codons 41/42 (-TTCT) mutation. The first three mutations account for 98.7% of the total number of beta-thalassemia chromosomes studied. These mutations are clustered in the region spanning 6 bp around the junction of exon 1 and the first intervening sequence of the beta-globin gene. These observations have significant implications for setting up a thalassemia prevention and control program in the Maldives. Analysis of haplotypes and frameworks of chromosomes bearing each beta-thalassemia mutation suggested that the origin and spread of these mutations were reflected by the historical record.
A novel EML4-ALK variant: exon 6 of EML4 fused to exon 19 of ALK.
Penzel, Roland; Schirmacher, Peter; Warth, Arne
2012-07-01
Cytotoxic chemotherapy remains the mainstay of treatment for most patients with advanced disease. Recently, anaplastic lymphoma kinase (ALK) expression as a major target for successful treatment with ALK inhibitors was detected in a subset of non-small-cell lung carcinomas, usually as a result of echinoderm microtubule-associated protein-like 4 (EML4)-ALK rearrangements. Although the chromosomal breakpoint within the EML4 gene varied, the breakpoint within ALK was most frequently reported within intron 19 or rarely in exon 20. Therefore, the different EML4-ALK variants so far contain the same 3' portion of ALK starting with exon 20. Here, we report a novel EML4-ALK variant detected by reverse transcription polymerase chain reaction analysis. Subsequent sequencing revealed an EML4-ALK fusion variant in which exon 6 of EML4 was fused to exon 19 of ALK. It occurred in a predominant solid pulmonary adenocarcinoma of a 65-year-old woman with a clear split signal of ALK in fluorescence in situ hybridization analysis and a weakly homogeneous ALK expression in immunohistochemical staining. Because of the growing number of fusion variants a primary reverse transcription polymerase chain reaction-based screening for ALK-positive non-small-cell lung carcinoma patients may not be sufficient for predictive diagnostics but transcript-based approaches and sequencing of ALK fusion variants might finally contribute to an optimized selection of patients.
Belkahia, Hanène; Ben Said, Mourad; Sayahi, Lotfi; Alberti, Alberto; Messadi, Lilia
2015-10-29
Little information is currently available regarding the presence of Anaplasma species in North African dromedaries. To fill this gap in knowledge, the prevalence, risk factors, and genetic diversity of Anaplasma species were investigated in Tunisian dromedary camels. A total of 226 camels from three different bioclimatic areas were sampled and tested for the presence of Anaplasma species by quantitative polymerase chain reaction (qPCR) and nested polymerase chain reaction (nPCR) assays. Detected Anaplasma strains were characterized by 16S rRNA sequence analysis. Overall infection rate of Anaplasma spp. was 17.7%, and was significantly higher in females. Notably, A. marginale, A. centrale, A. bovis, and A. phagocytophilum were not detected. Animals were severely infested by three tick species belonging to the genus Hyalomma (H. dromedarii, H. impeltatum, and H. excavatum). Alignment, similarity comparison, and phylogenetic analysis of the 16S rRNA sequence variants obtained in this study suggest that Tunisian dromedaries are infected by more than one novel Anaplasma strain genetically related to A. platys. This study reports the presence of novel Anaplasma sp. strains genetically related to A. platys in dromedaries from various bioclimatic areas of Tunisia. Findings raise new concerns about the specificity of the direct and indirect diagnostic tests routinely used to detect different Anaplasma species in ruminants and provide useful molecular information to elucidate the evolutionary history of bacterial species related to A. platys.
Abdulmawjood, A; Roth, S; Bülte, M
2002-10-01
For the detection of food born bacteria by polymerase chain reaction (PCR) in food products, an internal amplification control (IAC) is required in order to prevent false negative results that might be caused by PCR inhibitors. In the present study, two IACs were constructed using two different methods. These IACs were designed in a way that the same primer pair can be used to amplify the target DNA and coamplify the IAC. The first IAC with a size of approximately 200 bp was constructed by deleting a part of the amplicon of the original target DNA (500 bp) between the two primer sites to produce an IAC smaller than the target DNA. The second IAC with a size of approximately 600 bp was synthesized in a one step PCR reaction. The primers used in this reaction possessed 5' over-hanging ends, which were identical to the primers used in the diagnostic reaction, whereas their 3' ends were complementary to the (pUC19) predetermined DNA sequence of defined length and sequence. The concentration of IACs appeared to be critical. Too much IAC DNA template would out-compete the target DNA template, thus giving a false negative result. However the use of an optimal IAC concentration increased the reliability of the PCR assays and appeared to be useful for food diagnostics.
Designing a Polymerase Chain Reaction Device Working with Radiation and Convection Heat Transfer
NASA Astrophysics Data System (ADS)
Madadelahi, M.; Kalan, K.; Shamloo, A.
2018-05-01
Gene proliferation is vital for infectious and genetic diseases diagnosis from a blood sample, even before birth. In addition, DNA sequencing, genetic finger-print analyzing, and genetic mutation detecting can be mentioned as other procedures requiring gene reproduction. Polymerase chain reaction, briefly known as PCR, is a convenient and effective way to accomplish this task; where the DNA containing sample faces three temperature phases alternatively. These phases are known as denaturation, annealing, and elongation/extension which in this study -regarding the type of the primers and the target DNA sequence- are set to occur at 95, 58, and 72 degrees of Celsius. In this study, a PCR device has been designed and fabricated which uses radiation and convection heat transfer at the same time to set and control the mentioned thermal sections. A 300W incandescent light bulb able to immediately turn off and on along with two 8×8 cm DC fans, controlled by a microcontroller as well as PID and PD controller codes are used to monitor the applied thermal cycles. In designing the controller codes it has been concerned that they not only control the temperature over the set-points as well as possible, but also increase the temperature variation rate between each two phases. The temperature data were plotted and DNA samples were used to assess the device function.
NASA Astrophysics Data System (ADS)
Pérez Urquiza, M.; Acatzi Silva, A. I.
2014-02-01
Three certified reference materials produced from powdered seeds to measure the copy number ratio sequences of p35S/hmgA in maize containing MON 810 event, p35S/Le1 in soybeans containing GTS 40-3-2 event and DREB1A/acc1 in wheat were produced according to the ISO Guides 34 and 35. In this paper, we report digital polymerase chain reaction (dPCR) protocols, performance parameters and results of copy number ratio content of genetically modified organisms (GMOs) in these materials using two new dPCR systems to detect and quantify molecular deoxyribonucleic acid: the BioMark® (Fluidigm) and the OpenArray® (Life Technologies) systems. These technologies were implemented at the National Institute of Metrology in Mexico (CENAM) and in the Reference Center for GMO Detection from the Ministry of Agriculture (CNRDOGM), respectively. The main advantage of this technique against the more-used quantitative polymerase chain reaction (qPCR) is that it generates an absolute number of target molecules in the sample, without reference to standards or an endogenous control, which is very useful when not much information is available for new developments or there are no standard reference materials in the market as in the wheat case presented, or when it was not possible to test the purity of seeds as in the maize case presented here. Both systems reported enhanced productivity, increased reliability and reduced instrument footprint. In this paper, the performance parameters and uncertainty of measurement obtained with both systems are presented and compared.
Danišová, Olga; Halánová, Monika; Valenčáková, Alexandra; Luptáková, Lenka
The study was conducted to compare the specificity of immunological diagnostic methods used for the diagnosis of Cryptosporidium species capable of causing life-threatening infection in both immunosuppressed and immunocompetent patients. For the detection of Cryptosporidium species in 79 animals with diarrhoea, we used three Copro-antigen tests: RIDASCREEN ® Cryptosporidium test, Cryptosporidium 2nd Generation (ELISA) and RIDA ® QUICK Cryptosporidium. For immunoassays we used positive and negative samples detected by means of polymerase chain reaction and validated by sequencing and nested polymerase chain reaction to confirm the presence six different species of Cryptosporidium species. Prevalence of cryptosporidiosis in the entire group determined by enzyme immunoassay, enzyme linked immunosorbent assay, immuno-chromatographic test and polymerase chain reaction was 34.17%, 27.84%, 6.33% and 27.84%, respectively. Sensitivity of animal samples with enzyme immunoassay, enzyme linked immunosorbent assay, and immuno-chromatographic test was 63.6%, 40.9% and 22.7%, resp., when questionable samples were considered positive, whereas specificity of enzyme immunoassay, enzyme linked immunosorbent assay and immuno-chromatographic test was 75.9%, 78.9% and 100%, respectively. Positive predictive values and negative predictive values were different for all the tests. These differences results are controversial and therefore reliability and reproducibility of immunoassays as the only diagnostic method is questionable. The use of various Cryptosporidium species in diagnosis based on immunological testing and different results obtained by individual tests indicate potential differences in Copro-antigens produced by individual Cryptosporidium species. Copyright © 2017 Sociedade Brasileira de Microbiologia. Published by Elsevier Editora Ltda. All rights reserved.
Initiation, extension, and termination of RNA synthesis by a paramyxovirus polymerase.
Jordan, Paul C; Liu, Cheng; Raynaud, Pauline; Lo, Michael K; Spiropoulou, Christina F; Symons, Julian A; Beigelman, Leo; Deval, Jerome
2018-02-01
Paramyxoviruses represent a family of RNA viruses causing significant human diseases. These include measles virus, the most infectious virus ever reported, in addition to parainfluenza virus, and other emerging viruses. Paramyxoviruses likely share common replication machinery but their mechanisms of RNA biosynthesis activities and details of their complex polymerase structures are unknown. Mechanistic and functional details of a paramyxovirus polymerase would have sweeping implications for understanding RNA virus replication and for the development of new antiviral medicines. To study paramyxovirus polymerase structure and function, we expressed an active recombinant Nipah virus (NiV) polymerase complex assembled from the multifunctional NiV L protein bound to its phosphoprotein cofactor. NiV is an emerging highly pathogenic virus that causes severe encephalitis and has been declared a global public health concern due to its high mortality rate. Using negative-stain electron microscopy, we demonstrated NiV polymerase forms ring-like particles resembling related RNA polymerases. We identified conserved sequence elements driving recognition of the 3'-terminal genomic promoter by NiV polymerase, and leading to initiation of RNA synthesis, primer extension, and transition to elongation mode. Polyadenylation resulting from NiV polymerase stuttering provides a mechanistic basis for transcription termination. It also suggests a divergent adaptation in promoter recognition between pneumo- and paramyxoviruses. The lack of available antiviral therapy for NiV prompted us to identify the triphosphate forms of R1479 and GS-5734, two clinically relevant nucleotide analogs, as substrates and inhibitors of NiV polymerase activity by delayed chain termination. Overall, these findings provide low-resolution structural details and the mechanism of an RNA polymerase from a previously uncharacterized virus family. This work illustrates important functional differences yet remarkable similarities between the polymerases of nonsegmented negative-strand RNA viruses.
Du, Yu-Jie; Hou, Yi-Ling; Hou, Wan-Ru
2013-02-01
The Giant Panda is an endangered and valuable gene pool in genetic, its important functional gene POLR2H encodes an essential shared peptide H of RNA polymerases. The genomic DNA and cDNA sequences were cloned successfully for the first time from the Giant Panda (Ailuropoda melanoleuca) adopting touchdown-PCR and reverse transcription polymerase chain reaction (RT-PCR), respectively. The length of the genomic sequence of the Giant Panda is 3,285 bp, including five exons and four introns. The cDNA fragment cloned is 509 bp in length, containing an open reading frame of 453 bp encoding 150 amino acids. Alignment analysis indicated that both the cDNA and its deduced amino acid sequence were highly conserved. Protein structure prediction showed that there was one protein kinase C phosphorylation site, four casein kinase II phosphorylation sites and one amidation site in the POLR2H protein, further shaping advanced protein structure. The cDNA cloned was expressed in Escherichia coli, which indicated that POLR2H fusion with the N-terminally His-tagged form brought about the accumulation of an expected 20.5 kDa polypeptide in line with the predicted protein. On the basis of what has already been achieved in this study, further deep-in research will be conducted, which has great value in theory and practical significance.
Willie, Nigani; Mehlotra, Rajeev K; Howes, Rosalind E; Rakotomanga, Tovonahary A; Ramboarina, Stephanie; Ratsimbasoa, Arsène C; Zimmerman, Peter A
2018-06-01
Plasmodium falciparum histidine-rich protein 2 (PfHRP2) forms the basis of many current malaria rapid diagnostic tests (RDTs). However, the parasites lacking part or all of the pfhrp2 gene do not express the PfHRP2 protein and are, therefore, not identifiable by PfHRP2-detecting RDTs. We evaluated the performance of the SD Bioline Malaria Ag P.f/Pan RDT together with pfhrp2 variation in Madagascar. Genomic DNA isolated from 260 patient blood samples were polymerase chain reaction (PCR)-amplified for the parasite 18S rRNA and pfhrp2 genes. Post-PCR ligation detection reaction-fluorescent microsphere assay (LDR-FMA) was performed for the identification of parasite species. Plasmodium falciparum histidine-rich protein 2 amplicons were sequenced. Polymerase chain reaction diagnosis of patient samples showed that 29% (75/260) were infected and P. falciparum was present in 95% (71/75) of these PCR-positive samples. Comparing RDT and P. falciparum detection by LDR-FMA, eight samples were RDT negative but P. falciparum positive (false negatives), all of which were pfhrp2 positive. The sensitivity and specificity of the RDT were 87% and 90%, respectively. Seventy-three samples were amplified for pfhrp2 , from which nine randomly selected amplicons were sequenced, yielding 13 sequences. Amplification of pfhrp2 , combined with RDT analysis and P. falciparum detection by LDR-FMA, showed that there was no indication of pfhrp2 deletion. Sequence analysis of pfhrp2 showed that the correlation between pfhrp2 sequence structure and RDT detection rates was unclear. Although the observed absence of pfhrp2 deletion from the samples screened here is encouraging, continued monitoring of the efficacy of the SD Bioline Malaria Ag P.f/Pan RDT for malaria diagnosis in Madagascar is warranted.
Equid herpesvirus 9 (EHV-9) isolates from zebras in Ontario, Canada, 1989 to 2007.
Rebelo, Ana Rita; Carman, Susy; Shapiro, Jan; van Dreumel, Tony; Hazlett, Murray; Nagy, Éva
2015-04-01
The objective of this study was to identify and partially characterize 3 equid herpesviruses that were isolated postmortem from zebras in Ontario, Canada in 1989, 2002, and 2007. These 3 virus isolates were characterized by plaque morphology, restriction fragment length polymorphism (RFLP) of their genomic deoxyribonucleic acid (DNA), real-time polymerase chain reaction (PCR) assay, and sequence analyses of the full length of the glycoprotein G (gG) gene (ORF70) and a portion of the DNA polymerase gene (ORF30). The isolates were also compared to 3 reference strains of equid herpesvirus 1 (EHV-1). Using rabbit kidney cells, the plaques for the isolates from the zebras were found to be much larger in size than the EHV-1 reference strains. The RFLP patterns of the zebra viruses differed among each other and from those of the EHV-1 reference strains. Real-time PCR and sequence analysis of a portion of the DNA polymerase gene determined that the herpesvirus isolates from the zebras contained a G at nucleotide 2254 and a corresponding N at amino acid position 752, which suggested that they could be neuropathogenic EHV-1 strains. However, subsequent phylogenetic analysis of the gG gene suggested that they were EHV-9 and not EHV-1.
Chandranaik, B M; Singh, Raj Kumar; Hosamani, Mahusudan; Krishnappa, Giriappa; Harish, Balur R; Chethana, C S; Renukaprasad, C
2011-02-01
The present paper describes the isolation of buffalo pox virus from scab lesions and its molecular characterization through B5R gene sequencing. During our study, pustular pox lesions were observed on the teats and mammary parenchyma of cattle and buffaloes, and the disease was of significant zoonotic importance since similar lesions were produced on the hands, legs, and face of people in close contact with the affected animals. The collected scab materials were subjected for virus isolation in 9-11-day-old chicken embryos by the chorioallontoic membrane route and in the Vero cell line. The virus was confirmed by a sensitive and rapid diagnostic polymerase chain reaction using the primers that amplify "A type inclusion" gene, and further, B5R gene of the virus was sequenced and compared with the corresponding sequences of other orthopoxviruses. The results showed high sequence homology of our isolates with other orthopoxviruses.
Tosto, D S; Hopp, H E
1996-01-01
The internal transcribed spacer region (ITS1 and ITS2) of the 18S-25S nuclear ribosomal DNA sequence and the intervening 5.8S region from five species of the genus Oxalis was amplified by polymerase chain reaction and subjected to direct DNA sequencing. On the basis of cytogenetic studies some species of this genus were postulated to be related by the number of chromosomes. Sequence homologies in the ITS1, 5.8S and ITS2 among species are in good agreement with previous relationships established on the basis of chromosome numbers. We also identified a highly conserved sequence of six bp in the ITS1, reported to be present in a wide range of flowering plants, but not in the Oxalidaceae family to which the genus Oxalis belongs to.
Abruzzo, Lynne V; Barron, Lynn L; Anderson, Keith; Newman, Rachel J; Wierda, William G; O'brien, Susan; Ferrajoli, Alessandra; Luthra, Madan; Talwalkar, Sameer; Luthra, Rajyalakshmi; Jones, Dan; Keating, Michael J; Coombes, Kevin R
2007-09-01
To develop a model incorporating relevant prognostic biomarkers for untreated chronic lymphocytic leukemia patients, we re-analyzed the raw data from four published gene expression profiling studies. We selected 88 candidate biomarkers linked to immunoglobulin heavy-chain variable region gene (IgV(H)) mutation status and produced a reliable and reproducible microfluidics quantitative real-time polymerase chain reaction array. We applied this array to a training set of 29 purified samples from previously untreated patients. In an unsupervised analysis, the samples clustered into two groups. Using a cutoff point of 2% homology to the germline IgV(H) sequence, one group contained all 14 IgV(H)-unmutated samples; the other contained all 15 mutated samples. We confirmed the differential expression of 37 of the candidate biomarkers using two-sample t-tests. Next, we constructed 16 different models to predict IgV(H) mutation status and evaluated their performance on an independent test set of 20 new samples. Nine models correctly classified 11 of 11 IgV(H)-mutated cases and eight of nine IgV(H)-unmutated cases, with some models using three to seven genes. Thus, we can classify cases with 95% accuracy based on the expression of as few as three genes.
copia-like retrotransposons are ubiquitous among plants.
Voytas, D F; Cummings, M P; Koniczny, A; Ausubel, F M; Rodermel, S R
1992-01-01
Transposable genetic elements are assumed to be a feature of all eukaryotic genomes. Their identification, however, has largely been haphazard, limited principally to organisms subjected to molecular or genetic scrutiny. We assessed the phylogenetic distribution of copia-like retrotransposons, a class of transposable element that proliferates by reverse transcription, using a polymerase chain reaction assay designed to detect copia-like element reverse transcriptase sequences. copia-like retrotransposons were identified in 64 plant species as well as the photosynthetic protist Volvox carteri. The plant species included representatives from 9 of 10 plant divisions, including bryophytes, lycopods, ferns, gymnosperms, and angiosperms. DNA sequence analysis of 29 cloned PCR products and of a maize retrotransposon cDNA confirmed the identity of these sequences as copia-like reverse transcriptase sequences, thereby demonstrating that this class of retrotransposons is a ubiquitous component of plant genomes. Images PMID:1379734
NASA Astrophysics Data System (ADS)
Aravindran, S.; Sahilah, A. M.; Aminah, A.
2014-09-01
Halal surveillance on halal ingredients incorporated in surimi based products were studied using polymerase chain reaction (PCR)-southern hybridization on chip analysis. The primers used in this technique were targeted on mitochondria DNA (mtDNA) of cytochrome b (cyt b) gene sequence which able to differentiate 7 type (beef, chicken, duck, goat, buffalo, lamb and pork) of species on a single chip. 17 (n = 17*3) different brands of surimi-based product were purchased randomly from Selangor local market in January 2013. Of 17 brands, 3 (n = 3*3) brands were positive for chicken DNA, 1 (n = 1*3) brand was positive for goat DNA, and the remainder 13 brands (n = 13*3) have no DNA species detected. The sensitivity of PCR-southern hybridization primers to detect each meat species was 0.1 ng. In the present study, it is evidence that PCR-Southern Hybridization analysis offered a reliable result due to its highly specific and sensitive properties in detecting non-halal additive such as plasma protein incorporation in surimi-based product.
NASA Astrophysics Data System (ADS)
Eron, Joseph J.; Gorczyca, Paul; Kaplan, Joan C.; D'Aquila, Richard T.
1992-04-01
Polymerase chain reaction (PCR) DNA quantitation (PDQ) susceptibility testing rapidly and directly measures nucleoside sensitivity of human immunodeficiency virus type 1 (HIV-1) isolates. PCR is used to quantitate the amount of HIV-1 DNA synthesized after in vitro infection of peripheral blood mononuclear cells. The relative amounts of HIV-1 DNA in cell lysates from cultures maintained at different drug concentrations reflect drug inhibition of virus replication. The results of PDQ susceptibility testing of 2- or 3-day cultures are supported by assays measuring HIV-1 p24 antigen production in supernatants of 7- or 10-day cultures. DNA sequence analyses to identify mutations in the reverse transcriptase gene that cause resistance to 3'-azido-3'-deoxythymidine also support the PDQ results. With the PDQ method, both infectivity titration and susceptibility testing can be performed on supernatants from primary cultures of peripheral blood mononuclear cells. PDQ susceptibility testing should facilitate epidemiologic studies of the clinical significance of drug-resistant HIV-1 isolates.
Leishmania (Viannia) Infection in the Domestic Dog in Chaparral, Colombia
Santaella, Julián; Ocampo, Clara B.; Saravia, Nancy G.; Méndez, Fabián; Góngora, Rafael; Gomez, Maria Adelaida; Munstermann, Leonard E.; Quinnell, Rupert J.
2011-01-01
Peridomestic transmission of American cutaneous leishmaniasis is increasingly reported and dogs may be a reservoir of Leishmania (Viannia) in this setting. We investigated the prevalence of infection in dogs in Chaparral County, Colombia, the focus of an epidemic of human cutaneous leishmaniasis caused by Leishmania (Viannia) guyanensis. Two (0.72%) of 279 dogs had lesions typical of cutaneous leishmaniasis that were biopsy positive by kinetoplast DNA polymerase chain reaction–Southern blotting. Seroprevalence was 2.2% (6 of 279) by enzyme-linked immunosorbent assay. Buffy coat and ear skin biopsy specimens were positive by polymerase chain reaction–Southern blotting in 7.3% (10 of 137) and 11.4% (12 of 105) of dogs, respectively. Overall 20% of dogs (21 of 105) showed positive results for one or more tests. Amplification and sequencing of the Leishmania 7SL RNA gene identified L. guyanensis in one dog and L. braziliensis in two dogs. No association was identified between the risk factors evaluated and canine infection. Dogs may contribute to transmission but their role in this focus appears to be limited. PMID:21540374
Chamai, Martin; Omadang, Leonard; Erume, Joseph; Ocaido, Michael; Oba, Peter; Othieno, Emmanuel; Bonaventure, Straton; Kitibwa, Annah
2016-07-29
A descriptive study was conducted to identify the different strains of Echinococcus granulosus occurring in livestock in Moroto district, Uganda. Echinococcus cysts from 104 domestic animals, including cattle, sheep, goats and camels, were taken and examined by microscopy, polymerase chain reaction with restriction fragment length polymorphism and Sanger DNA sequencing. Echinococcus granulosus genotypes or strains were identified through use of Bioinformatics tools: BioEdit, BLAST and MEGA6. The major finding of this study was the existence of a limited number of E. granulosus genotypes from cattle, goats, sheep and camels. The most predominant genotype was G1 (96.05%), corresponding to the common sheep strain. To a limited extent (3.95%), the study revealed the existence of Echinococcus canadensis G6/7 in three (n = 3) of the E. granulosus-positive samples. No other strains of E. granulosus were identified. It was concluded that the common sheep strain of Echinococcus sensu stricto and G6/7 of E. canadensis were responsible for echinococcal disease in Moroto district, Uganda.
Chromá, Magdaléna; Hricová, Kristýna; Kolář, Milan; Sauer, Pavel; Koukalová, Dagmar
2011-11-01
A total of 78 bacterial strains with known β-lactamases were used to optimize a rapid detection system consisting of multiplex polymerase chain reaction and melting curve analysis to amplify and identify blaTEM, blaSHV, and blaCTX-M genes in a single reaction. Additionally, to evaluate the applicability of this method, 32 clinical isolates of Escherichia coli displaying an extended-spectrum β-lactamase phenotype from patients hospitalized at intensive care units were tested. Results were analyzed by the Rotor-Gene operating software and Rotor-Gene ScreenClust HRM Software. The individual melting curves differed by a temperature shift or curve shape, according to the presence of β-lactamase genes. With the use of this method and direct sequencing, blaCTX-M-15-like was identified as the most prevalent β-lactamase gene. In conclusion, this novel detection system seems to be a suitable tool for rapid detection of present β-lactamase genes and their characterization. Copyright © 2011 Elsevier Inc. All rights reserved.
Cowan, Ashley F; Elkins, Kelly M
2017-12-01
Psilocybe cubensis, or "magic mushroom," is the most common species of fungus with psychedelic characteristics. Two primer sets were designed to target Psilocybe DNA using web-based software and NBCI gene sequences. DNA was extracted from eighteen samples, including twelve mushroom species, using the Qiagen DNeasy ® Plant Mini Kit. The DNA was amplified by the polymerase chain reaction (PCR) using the primers and a master mix containing either a SYBR ® Green I, Radiant™ Green, or LCGreen Plus ® intercalating dye; amplicon size was determined using agarose gel electrophoresis. The PCR assays were tested for amplifiability, specificity, reproducibility, robustness, sensitivity, and multiplexing with primers that target marijuana. The observed high resolution melt (HRM) temperatures for primer sets 1 and 7 were 78.85 ± 0.31°C and 73.22 ± 0.61°C, respectively, using SYBR ® Green I dye and 81.67 ± 0.06°C and 76.04 ± 0.11°C, respectively, using Radiant™ Green dye. © 2017 American Academy of Forensic Sciences.
Zhang, Li; Tang, Jun-Ling; Liang, Shang-Zheng
2008-06-01
Muscle segment homeobox gene (MSX)1 has been proposed as a gene in which mutations may contribute to nonsyndromic cleft lip with or without cleft palate (NSCL/P). To study MSX1 polymorphisms in NSCL/ P by means of polymerase chain reaction-single-strand conformation polymorphism (PCR-SSCP), and investigate the association of MSX1 exons 1 polymorphisms with NSCL/P. DNA were extracted from blood samples from NSCL/P and unrelated normal subjects. Genome DNA from peripheral leukocyte with these blood samples were extracted, which was used as template to amplify desired gene fragment of MSX1 exons 1 by means of polymerase chain reaction (PCR). The PCR products were examined by single-strand conformation polymorphism (SSCP). The MSX1 exons 1 polymorphisms were examined by sequencing if mutations were found. MSX1 genes of exon 1 mutation was not been found in the NSCL/P and unrelated normal subjects by SSCP. No correlation between MSX1 exon 1 and NSCL/P was found. MSX1 exon 1 may not be a key gene (susceptibility gene) in NSCL/P.
Quantitative competitive (QC) PCR for quantification of porcine DNA.
Wolf, C; Lüthy, J
2001-02-01
Many meat products nowadays may contain several species in different proportions. To protect consumers from fraud and misdeclarations, not only a qualitative but also a quantitative monitoring of ingredients of complex food products is necessary. DNA based techniques like the polymerase chain reaction (PCR) are widely used for identification of species but no answer to the proportional amount of a certain species could be given using current techniques. In this study we report the development and evaluation of a quantitative competitive polymerase chain reaction (QC-PCR) for detection and quantification of porcine DNA using a new porcine specific PCR system based on the growth hormone gene of sus scrofa. A DNA competitor differing by 30 bp in length from the porcine target sequence was constructed and used for PCR together with the target DNA. Specificity of the new primers was evaluated with DNA from cattle, sheep, chicken and turkey. The competitor concentration was adjusted to porcine DNA contents of 2 or 20% by coamplification of mixtures containing porcine and corresponding amounts of bovine DNA in defined ratios.
Alasaad, Samer; Soriguer, Ramón C; Abu-Madi, Marawan; El Behairy, Ahmed; Baños, Pablo Díez; Píriz, Ana; Fickel, Joerns; Zhu, Xing-Quan
2011-06-01
The present study aimed to establish a fluorescence-based polymerase chain reaction-linked single-strand conformation polymorphism (F-PCR-SSCP) assay for the identification of Fasciola spp. Based on the sequences of the second internal transcribed spacer (ITS-2) of the nuclear ribosomal DNA, we designed a set of genus-specific primers for the amplification of Fasciola ITS-2, with an estimated size of 140 bp. These primers were labelled by fluorescence dyes, and the PCR products were analyzed by capillary electrophoresis under non-denaturing conditions (F-PCR-SSCP). Capillary electrophoresis analysis of the fluorescence-labelled DNA fragments displayed three different peak profiles that allowed the accurate identification of Fasciola species: one single peak specific for either Fasciola hepatica or Fasciola gigantica and a doublet peak corresponding to the "intermediate" Fasciola. Validation of our novel method was performed using Fasciola specimens from different host animals from China, Spain, Nigeria, and Egypt. This F-PCR-SSCP assay provides a rapid, simple, and robust tool for the identification and differentiation between Fasciola spp.
Shibata, Kazuhiro; Itoh, Masayoshi; Aizawa, Katsunori; Nagaoka, Sumiharu; Sasaki, Nobuya; Carninci, Piero; Konno, Hideaki; Akiyama, Junichi; Nishi, Katsuo; Kitsunai, Tokuji; Tashiro, Hideo; Itoh, Mari; Sumi, Noriko; Ishii, Yoshiyuki; Nakamura, Shin; Hazama, Makoto; Nishine, Tsutomu; Harada, Akira; Yamamoto, Rintaro; Matsumoto, Hiroyuki; Sakaguchi, Sumito; Ikegami, Takashi; Kashiwagi, Katsuya; Fujiwake, Syuji; Inoue, Kouji; Togawa, Yoshiyuki; Izawa, Masaki; Ohara, Eiji; Watahiki, Masanori; Yoneda, Yuko; Ishikawa, Tomokazu; Ozawa, Kaori; Tanaka, Takumi; Matsuura, Shuji; Kawai, Jun; Okazaki, Yasushi; Muramatsu, Masami; Inoue, Yorinao; Kira, Akira; Hayashizaki, Yoshihide
2000-01-01
The RIKEN high-throughput 384-format sequencing pipeline (RISA system) including a 384-multicapillary sequencer (the so-called RISA sequencer) was developed for the RIKEN mouse encyclopedia project. The RISA system consists of colony picking, template preparation, sequencing reaction, and the sequencing process. A novel high-throughput 384-format capillary sequencer system (RISA sequencer system) was developed for the sequencing process. This system consists of a 384-multicapillary auto sequencer (RISA sequencer), a 384-multicapillary array assembler (CAS), and a 384-multicapillary casting device. The RISA sequencer can simultaneously analyze 384 independent sequencing products. The optical system is a scanning system chosen after careful comparison with an image detection system for the simultaneous detection of the 384-capillary array. This scanning system can be used with any fluorescent-labeled sequencing reaction (chain termination reaction), including transcriptional sequencing based on RNA polymerase, which was originally developed by us, and cycle sequencing based on thermostable DNA polymerase. For long-read sequencing, 380 out of 384 sequences (99.2%) were successfully analyzed and the average read length, with more than 99% accuracy, was 654.4 bp. A single RISA sequencer can analyze 216 kb with >99% accuracy in 2.7 h (90 kb/h). For short-read sequencing to cluster the 3′ end and 5′ end sequencing by reading 350 bp, 384 samples can be analyzed in 1.5 h. We have also developed a RISA inoculator, RISA filtrator and densitometer, RISA plasmid preparator which can handle throughput of 40,000 samples in 17.5 h, and a high-throughput RISA thermal cycler which has four 384-well sites. The combination of these technologies allowed us to construct the RISA system consisting of 16 RISA sequencers, which can process 50,000 DNA samples per day. One haploid genome shotgun sequence of a higher organism, such as human, mouse, rat, domestic animals, and plants, can be revealed by seven RISA systems within one month. PMID:11076861
2010-01-01
Background Multiple sequence alignments are used to study gene or protein function, phylogenetic relations, genome evolution hypotheses and even gene polymorphisms. Virtually without exception, all available tools focus on conserved segments or residues. Small divergent regions, however, are biologically important for specific quantitative polymerase chain reaction, genotyping, molecular markers and preparation of specific antibodies, and yet have received little attention. As a consequence, they must be selected empirically by the researcher. AlignMiner has been developed to fill this gap in bioinformatic analyses. Results AlignMiner is a Web-based application for detection of conserved and divergent regions in alignments of conserved sequences, focusing particularly on divergence. It accepts alignments (protein or nucleic acid) obtained using any of a variety of algorithms, which does not appear to have a significant impact on the final results. AlignMiner uses different scoring methods for assessing conserved/divergent regions, Entropy being the method that provides the highest number of regions with the greatest length, and Weighted being the most restrictive. Conserved/divergent regions can be generated either with respect to the consensus sequence or to one master sequence. The resulting data are presented in a graphical interface developed in AJAX, which provides remarkable user interaction capabilities. Users do not need to wait until execution is complete and can.even inspect their results on a different computer. Data can be downloaded onto a user disk, in standard formats. In silico and experimental proof-of-concept cases have shown that AlignMiner can be successfully used to designing specific polymerase chain reaction primers as well as potential epitopes for antibodies. Primer design is assisted by a module that deploys several oligonucleotide parameters for designing primers "on the fly". Conclusions AlignMiner can be used to reliably detect divergent regions via several scoring methods that provide different levels of selectivity. Its predictions have been verified by experimental means. Hence, it is expected that its usage will save researchers' time and ensure an objective selection of the best-possible divergent region when closely related sequences are analysed. AlignMiner is freely available at http://www.scbi.uma.es/alignminer. PMID:20525162
HIP1-ALK, a novel fusion protein identified in lung adenocarcinoma.
Hong, Mineui; Kim, Ryong Nam; Song, Ji-Young; Choi, So-Jung; Oh, Ensel; Lira, Maruja E; Mao, Mao; Takeuchi, Kengo; Han, Joungho; Kim, Jhingook; Choi, Yoon-La
2014-03-01
The most common mechanism underlying overexpression and activation of anaplastic lymphoma kinase (ALK) in non-small-cell lung carcinoma could be attributed to the formation of a fusion protein. To date, five fusion partners of ALK have been reported, namely, echinoderm microtubule associated protein like 4, tropomyosin-related kinase-fused gene, kinesin family member 5B, kinesin light chain 1, and protein tyrosine phosphatase, nonreceptor type 3. In this article, we report a novel fusion gene huntingtin interacting protein 1 (HIP1)-ALK, which is conjoined between the huntingtin-interacting protein 1 gene HIP1 and ALK. Reverse-transcriptase polymerase chain reaction and immunohistochemical analysis were used to detect this fusion gene's transcript and protein expression, respectively. We had amplified the full-length cDNA sequence of this novel fusion gene by using 5'-rapid amplification of cDNA ends. The causative genomic translocation t(2;7)(p23;q11.23) for generating this novel fusion gene was verified by using genomic sequencing. The examined adenocarcinoma showed predominant acinar pattern, and ALK immunostaining was localized to the cytoplasm, with intense staining in the submembrane region. In break-apart, fluorescence in situ hybridization analysis for ALK, split of the 5' and 3' probe signals, and isolated 3' signals were observed. Reverse-transcriptase polymerase chain reaction revealed that the tumor harbored a novel fusion transcript in which exon 21 of HIP1 was fused to exon 20 of ALK in-frame. The novel fusion gene and its protein HIP1-ALK harboring epsin N-terminal homology, coiled-coil, juxtamembrane, and kinase domains, which could play a role in carcinogenesis, could become diagnostic and therapeutic target of the lung adenocarcinoma and deserve a further study in the future.
Disseminated histoplasmosis in a domestic cat imported from the USA to Austria
Klang, Andrea; Loncaric, Igor; Spergser, Joachim; Eigelsreiter, Sabine; Weissenböck, Herbert
2013-01-01
We present a case of disseminated histoplasmosis in a domestic cat imported from the USA to Austria. Histopathological examination revealed a systemic mycosis with most severe involvement of the lungs suggestive of Histoplasma (H.) capsulatum-infection. Molecular confirmation was based on polymerase chain reaction (PCR) and sequence analysis of a fungal culture from liver samples. This is the first case of feline histoplasmosis proven by molecular diagnostic technique in Europe and reported in Austria, etc. PMID:24432230
Trypanosoma lewisi or T. lewisi-like infection in a 37-day-old Indian infant.
Verma, Archana; Manchanda, Samiksha; Kumar, Nirmal; Sharma, Archna; Goel, Masha; Banerjee, Partha Sarathi; Garg, Rajat; Singh, Brahma Pal; Balharbi, Fatima; Lejon, Veerle; Deborggraeve, Stijn; Singh Rana, Udai Veer; Puliyel, Jacob
2011-08-01
Trypanosomes were observed in the peripheral blood smear of a 37-day-old Indian infant admitted off feeds, with fever and convulsions. Trypanosoma (Herpetosoma) lewisi was identified in the blood. The species identification was confirmed by morphometry, polymerase chain reaction, and sequencing. Human infection with this organism is rare. Only seven cases of this infection have been reported previously in humans. The cases reported are reviewed to develop a composite picture of this disease.
Trypanosoma lewisi or T. lewisi-like Infection in a 37-Day-Old Indian Infant
Verma, Archana; Manchanda, Samiksha; Kumar, Nirmal; Sharma, Archna; Goel, Masha; Banerjee, Partha Sarathi; Garg, Rajat; Singh, Brahma Pal; Balharbi, Fatima; Lejon, Veerle; Deborggraeve, Stijn; Singh Rana, Udai Veer; Puliyel, Jacob
2011-01-01
Trypanosomes were observed in the peripheral blood smear of a 37-day-old Indian infant admitted off feeds, with fever and convulsions. Trypanosoma (Herpetosoma) lewisi was identified in the blood. The species identification was confirmed by morphometry, polymerase chain reaction, and sequencing. Human infection with this organism is rare. Only seven cases of this infection have been reported previously in humans. The cases reported are reviewed to develop a composite picture of this disease. PMID:21813838
Optimization of the performance of the polymerase chain reaction in silicon-based microstructures.
Taylor, T B; Winn-Deen, E S; Picozza, E; Woudenberg, T M; Albin, M
1997-01-01
We have demonstrated the ability to perform real-time homogeneous, sequence specific detection of PCR products in silicon microstructures. Optimal design/ processing result in equivalent performance (yield and specificity) for high surface-to-volume silicon structures as compared to larger volume reactions in polypropylene tubes. Amplifications in volumes as small as 0.5 microl and thermal cycling times reduced as much as 5-fold from that of conventional systems have been demonstrated for the microstructures. PMID:9224619
2007-05-08
deoxynucleotide triphosphates, from Sigma. Sequences for glyceraldehyde-3-phosphate dehydrogenase ( G3PDH ), IL-8,and TNF-a were amplified with primer...This was accomplished by normalizing all samples to the mRNA for the moderately expressed housekeeping function glyceraldehyde-3 -phosphate...without and with isolation of cells before reverse transcription and PCR. G3PDH mRNA target amplifies at 983 base pairs. The 630 base pair band is the
Cutaneous chancroid in a visitor from Vanuatu.
McBride, William J H; Hannah, Rory C S; Le Cornec, Genevera M; Bletchly, Cheryl
2008-05-01
A 23-year-old woman from Vanuatu presented to an Australian hospital with a 3-week history of a non-healing ulcer on the lower leg. A swab was submitted for a multiplex polymerase chain reaction designed to investigate genital ulcerative conditions. Haemophilus ducreyi was detected and the gene product was subsequently sequenced, confirming the diagnosis of cutaneous chancroid. The lesion responded to intramuscular benzathine penicillin. This report adds further evidence that cutaneous chancroid should be considered in the evaluation of skin ulcers in the south Pacific.
Failure to Identify Borrelia burgdorferi in Southern California Ticks by DNA Amplification
1993-01-01
reverse if necessary and identify by block, number) F;Et.D . &P SUB-GROUP ric..ettsial diseases, Lyme borreliosis , polymerase chain re on, I~~ I...DNA sequences of B. bur~dorfrri (as a positiv e control. B. burg- would be useful in assessino the risk of Lyme borreliosis in ex- dorferi alone was...vector. %%ell-documnented cases of Lyme borreliosis remain to the revised Centers for Disease Control and Prevention case rare in southern California
Distemper Outbreak and Its Effect on African Wild Dog Conservation
van de Bildt, Marco W.G.; Kuiken, Thijs; Visee, Aart M.; Lema, Sangito; Fitzjohn, Tony R.
2002-01-01
In December 2000, an infectious disease spread through a captive breeding group of African wild dogs (Lycaon pictus) in Tanzania, killing 49 of 52 animals within 2 months. The causative agent was identified as Canine distemper virus (CDV) by means of histologic examination, virus isolation, reverse transcriptase-polymerase chain reaction analysis, and nucleotide sequencing. This report emphasizes the importance of adequate protection against infectious diseases for the successful outcome of captive breeding programs of endangered species. PMID:11897078
DNA methods for identification of Chinese medicinal materials
Yip, Pui Ying; Chau, Chi Fai; Mak, Chun Yin; Kwan, Hoi Shan
2007-01-01
As adulterated and substituted Chinese medicinal materials are common in the market, therapeutic effectiveness of such materials cannot be guaranteed. Identification at species-, strain- and locality-levels, therefore, is required for quality assurance/control of Chinese medicine. This review provides an informative introduction to DNA methods for authentication of Chinese medicinal materials. Technical features and examples of the methods based on sequencing, hybridization and polymerase chain reaction (PCR) are described and their suitability for different identification objectives is discussed. PMID:17803808
Columbid herpesvirus-1 mortality in great horned owls (Bubo virginianus) from Calgary, Alberta
Rose, Nicole; Warren, Amy L.; Whiteside, Douglas; Bidulka, Julie; Robinson, John H.; Illanes, Oscar; Brookfield, Caroline
2012-01-01
Four cases of Columbid herpesvirus-1 infection in great horned owls (Bubo virginianus) were identified in Calgary, Alberta. Necropsy findings included severe multifocal hepatic and splenic necrosis, pharyngeal ulceration and necrosis, and gastrointestinal necrosis. Occasional eosinophilic intranuclear viral inclusion bodies were associated with the foci of necrosis and polymerase chain reaction (PCR) testing confirmed a diagnosis of herpesvirus-induced disease. The sequence of a PCR amplicon had 99.7% homology to Columbid herpesvirus-1. PMID:22942441
Characterization and Amplification of Gene-Based Simple Sequence Repeat (SSR) Markers in Date Palm.
Zhao, Yongli; Keremane, Manjunath; Prakash, Channapatna S; He, Guohao
2017-01-01
The paucity of molecular markers limits the application of genetic and genomic research in date palm (Phoenix dactylifera L.). Availability of expressed sequence tag (EST) sequences in date palm may provide a good resource for developing gene-based markers. This study characterizes a substantial fraction of transcriptome sequences containing simple sequence repeats (SSRs) from the EST sequences in date palm. The EST sequences studied are mainly homologous to those of Elaeis guineensis and Musa acuminata. A total of 911 gene-based SSR markers, characterized with functional annotations, have provided a useful basis not only for discovering candidate genes and understanding genetic basis of traits of interest but also for developing genetic and genomic tools for molecular research in date palm, such as diversity study, quantitative trait locus (QTL) mapping, and molecular breeding. The procedures of DNA extraction, polymerase chain reaction (PCR) amplification of these gene-based SSR markers, and gel electrophoresis of PCR products are described in this chapter.
The use of real-time polymerase chain reaction for rapid diagnosis of skeletal tuberculosis.
Kobayashi, Naomi; Fraser, Thomas G; Bauer, Thomas W; Joyce, Michael J; Hall, Gerri S; Tuohy, Marion J; Procop, Gary W
2006-07-01
We identified Mycobacterium tuberculosis DNA using real-time polymerase chain reaction on a specimen from an osteolytic lesion of a femoral condyle, in which the frozen section demonstrated granulomas. The process was much more rapid than is possible with culture. The rapid detection of M tuberculosis and the concomitant exclusion of granulomatous disease caused by nontuberculous mycobacteria or systemic fungi are necessary to appropriately treat skeletal tuberculosis. The detection and identification of M tuberculosis by culture may require several weeks using traditional methods. The real-time polymerase chain reaction method used has been shown to be rapid and reliable, and is able to detect and differentiate both tuberculous and nontuberculous mycobacteria. Real-time polymerase chain reaction may become a diagnostic standard for the evaluation of clinical specimens for the presence of mycobacteria; this case demonstrates the potential utility of this assay for the rapid diagnosis of skeletal tuberculosis.
One-Step Reverse Transcription-Polymerase Chain Reaction for Ebola and Marburg Viruses.
Park, Sun-Whan; Lee, Ye-Ji; Lee, Won-Ja; Jee, Youngmee; Choi, WooYoung
2016-06-01
Ebola and Marburg viruses (EBOVs and MARVs, respectively) are causative agents of severe hemorrhagic fever with high mortality rates in humans and nonhuman primates. In 2014, there was a major Ebola outbreak in various countries in West Africa, including Guinea, Liberia, Republic of Sierra Leone, and Nigeria. EBOV and MARV are clinically difficult to diagnose and distinguish from other African epidemic diseases. Therefore, in this study, we aimed to develop a method for rapid identification of the virus to prevent the spread of infection. We established a conventional one-step reverse transcription-polymerase chain reaction (RT-PCR) assay for these pathogens based on the Superscript Reverse Transcriptase-Platinum Taq polymerase enzyme mixture. All assays were thoroughly optimized using in vitro-transcribed RNA. We designed seven primer sets of nucleocapsid protein (NP) genes based on sequences from seven filoviruses, including five EBOVs and two MARVs. To evaluate the sensitivity of the RT-PCR assay for each filovirus, 10-fold serial dilutions of synthetic viral RNA transcripts of EBOV or MARV NP genes were used to assess detection limits of viral RNA copies. The potential for these primers to cross react with other filoviruses was also examined. The results showed that the primers were specific for individual genotype detection in the examined filoviruses. The assay established in this study may facilitate rapid, reliable laboratory diagnosis in suspected cases of Ebola and Marburg hemorrhagic fevers.
Trinh, Quoclinh; Xu, Wentao; Shi, Hui; Luo, Yunbo; Huang, Kunlun
2012-06-01
A-T linker adapter polymerase chain reaction (PCR) was modified and employed for the isolation of genomic fragments adjacent to a known DNA sequence. The improvements in the method focus on two points. The first is the modification of the PO(4) and NH(2) groups in the adapter to inhibit the self-ligation of the adapter or the generation of nonspecific products. The second improvement is the use of the capacity of rTaq DNA polymerase to add an adenosine overhang at the 3' ends of digested DNA to suppress self-ligation in the digested DNA and simultaneously resolve restriction site clone bias. The combination of modifications in the adapter and in the digested DNA leads to T/A-specific ligation, which enhances the flexibility of this method and makes it feasible to use many different restriction enzymes with a single adapter. This novel A-T linker adapter PCR overcomes the inherent limitations of the original ligation-mediated PCR method such as low specificity and a lack of restriction enzyme choice. Moreover, this method also offers higher amplification efficiency, greater flexibility, and easier manipulation compared with other PCR methods for chromosome walking. Experimental results from 143 Arabidopsis mutants illustrate that this method is reliable and efficient in high-throughput experiments. Copyright © 2012 Elsevier Inc. All rights reserved.
Characterization of a prototype strain of hepatitis E virus.
Tsarev, S A; Emerson, S U; Reyes, G R; Tsareva, T S; Legters, L J; Malik, I A; Iqbal, M; Purcell, R H
1992-01-15
A strain of hepatitis E virus (SAR-55) implicated in an epidemic of enterically transmitted non-A, non-B hepatitis, now called hepatitis E, was characterized extensively. Six cynomolgus monkeys (Macaca fascicularis) were infected with a strain of hepatitis E virus from Pakistan. Reverse transcription-polymerase chain reaction was used to determine the pattern of virus shedding in feces, bile, and serum relative to hepatitis and induction of specific antibodies. Virtually the entire genome of SAR-55 (7195 nucleotides) was sequenced. Comparison of the sequence of SAR-55 with that of a Burmese strain revealed a high level of homology except for one region encoding 100 amino acids of a putative nonstructural polyprotein. Identification of this region as hypervariable was obtained by partial sequencing of a third isolate of hepatitis E virus from Kirgizia.
Jia, Ying; Li, Xiaoge; Yang, Dong; Xu, Yi; Guo, Ying; Li, Xin
2018-01-01
The current study aims to identify the pathogenic sites in a core pedigree of Usher syndrome (USH). A core pedigree of USH was analyzed by whole exome sequencing (WES). Mutations were verified by polymerase chain reaction (PCR) amplification and Sanger sequencing. Two pathogenic variations (c.849+2T>C and c.5994G>A) in MYO7A were successfully identified and individually separated from parents. One variant (c.849+2T>C) was nonsense mutation, causing the protein terminated in advance, and the other one (c.5994G>A) located near the boundary of exon could cause aberrant splicing. This study provides a meaningful exploration for identification of clinical core genetic pedigrees. Copyright © 2017 Elsevier B.V. All rights reserved.
Palanisamy, Srikanth; Chang, YuChen; Scaria, Joy; Penha Filho, Rafael Antonio Casarin; Peters, Kenlyn E; Doiphode, Sanjay H; Sultan, Ali; Mohammed, Hussni O
2017-06-01
Pathogenic Escherichia coli has been listed among the most important bacteria associated with foodborne illnesses around the world. We investigated the genetic relatedness among Shiga toxin-producing E. coli (STEC) isolated along the animal food supply chain and from humans diagnosed with gastroenteritis in Qatar. Samples were collected from different sources along the food supply chain and from patients admitted to the hospital with complaints of gastroenteritis. All samples were screened for the presence of E. coli O157:H7 and non-O157 STEC using a combination of bacterial enrichment and molecular detection techniques. A proportional sampling approach was used to select positive samples from each source for further multilocus sequence typing (MLST) analysis. Seven housekeeping genes described for STEC were amplified by polymerase chain reaction, sequenced, and analyzed by MLST. Isolates were characterized by allele composition, sequence type (ST) and assessed for epidemiologic relationship within and among different sources. Nei's genetic distance was calculated at the allele level between sample pools in each site downstream. E. coli O157:H7 occurred at a higher rate in slaughterhouse and retail samples than at the farm or in humans in our sampling. The ST171, an ST common to enterotoxigenic E. coli and atypical enteropathogenic E. coli, was the most common ST (15%) in the food supply chain. None of the genetic distances among the different sources was statistically significant. Enterohemorrhagic E. coli pathogenic strains are present along the supply chain at different levels and with varying relatedness. Clinical isolates were the most diverse, as expected, considering the polyclonal diversity in the human microbiota. The high occurrence of these food adulterants among the farm products suggests that implementation of sanitary measures at that level might reduce the risk of human exposure.
Replaceable Microfluidic Cartridges for a PCR Biosensor
NASA Technical Reports Server (NTRS)
Francis, Kevin; Sullivan, Ron
2005-01-01
The figure depicts a replaceable microfluidic cartridge that is a component of a miniature biosensor that detects target deoxyribonucleic acid (DNA) sequences. The biosensor utilizes (1) polymerase chain reactions (PCRs) to multiply the amount of DNA to be detected, (2) fluorogenic polynucleotide probe chemicals for labeling the target DNA sequences, and (3) a high-sensitivity epifluorescence-detection optoelectronic subsystem. Microfluidics is a relatively new field of device development in which one applies techniques for fabricating microelectromechanical systems (MEMS) to miniature systems for containing and/or moving fluids. Typically, microfluidic devices are microfabricated, variously, from silicon or polymers. The development of microfluidic devices for applications that involve PCR and fluorescence-based detection of PCR products poses special challenges
Lagenaur, Laurel A; Lee, Peter P; Hamer, Dean H; Sanders-Beer, Brigitte E
2012-01-01
The vaginal microbiome, which harbors beneficial Lactobacillus strains, is believed to be a major host defense mechanism for preventing infections of the urogenital tract. It has been suggested that the gastrointestinal tract serves as a reservoir for lactobacilli that colonize the vagina. Using rhesus macaques, we examined whether oral delivery of human vaginal Lactobacillus jensenii-1153-1646, a GusA-producing strain, would result in colonization of the rectum and the vagina. Lactobacilli were identified from the vagina tracts of three macaques on the basis of β-glucuronidase enzyme production, 16S rRNA gene sequence and DNA homology using a repetitive sequence-based polymerase chain reaction. PMID:21907793
Hussey, Richard S; Huang, Guozhong; Allen, Rex
2011-01-01
Identifying parasitism genes encoding proteins secreted from a plant-parasitic nematode's esophageal gland cells and injected through its stylet into plant tissue is the key to understanding the molecular basis of nematode parasitism of plants. Parasitism genes have been cloned by directly microaspirating the cytoplasm from the esophageal gland cells of different parasitic stages of cyst or root-knot nematodes to provide mRNA to create a gland cell-specific cDNA library by long-distance reverse-transcriptase polymerase chain reaction. cDNA clones are sequenced and deduced protein sequences with a signal peptide for secretion are identified for high-throughput in situ hybridization to confirm gland-specific expression.
Cloning and sequencing the genes encoding goldfish and carp ependymin.
Adams, D S; Shashoua, V E
1994-04-20
Ependymins (EPNs) are brain glycoproteins thought to function in optic nerve regeneration and long-term memory consolidation. To date, epn genes have been characterized in two orders of teleost fish. In this study, polymerase chain reactions (PCR) were used to amplify the complete 1.6-kb epn genes, gf-I and cc-I, from genomic DNA of Cypriniformes, goldfish and carp, respectively. Amplified bands were cloned and sequenced. Each gene consists of six exons and five introns. The exon portion of gf-I encodes a predicted 215-amino-acid (aa) protein previously characterized as GF-I, while cc-I encodes a predicted 215-aa protein 95% homologous to GF-I.
Mizuno, Kouichi; Okuda, Akira; Kato, Misako; Yoneyama, Naho; Tanaka, Hiromi; Ashihara, Hiroshi; Fujimura, Tatsuhito
2003-01-16
In coffee and tea plants, caffeine is synthesized from xanthosine via a pathway that includes three methylation steps. We report the isolation of a bifunctional coffee caffeine synthase (CCS1) clone from coffee endosperm by reverse transcription-polymerase chain reaction (RT-PCR) and rapid amplification of cDNA ends (RACE) technique using previously reported sequence information for theobromine synthases (CTSs). The predicted amino acid sequences of CCS1 are more than 80% identical to CTSs and are about 40% similar to those of tea caffeine synthase (TCS1). Interestingly, CCS1 has dual methylation activity like tea TCS1.
Takeoka, Kayo; Okumura, Atsuko; Honjo, Gen; Ohno, Hitoshi
2014-01-01
In anaplastic large cell lymphoma (ALCL), the anaplastic lymphoma kinase (ALK) gene is rearranged with diverse partners due to variant translocations/inversions. Case 1 was a 39-year-old man who developed multiple tumors in the mediastinum, psoas muscle, lung, and lymph nodes. A biopsy specimen of the inguinal node was effaced by large tumor cells expressing CD30, epithelial membrane antigen, and cytoplasmic ALK, which led to a diagnosis of ALK(+) ALCL. Case 2 was a 51-year-old man who was initially diagnosed with undifferentiated carcinoma. He developed multiple skin tumors eight years after his initial presentation, and was finally diagnosed with ALK(+) ALCL. He died of therapy-related acute myeloid leukemia. G-banding and fluorescence in situ hybridization using an ALK break-apart probe revealed the rearrangement of ALK and suggested variant translocation in both cases. We applied an inverse cDNA polymerase chain reaction (PCR) strategy to identify the partner of ALK. Nucleotide sequencing of the PCR products and a database search revealed that the sequences of ATIC in case 1 and TRAF1 in case 2 appeared to follow those of ALK. We subsequently confirmed ATIC-ALK and TRAF1-ALK fusions by reverse transcriptase PCR and nucleotide sequencing. We successfully determined the partner gene of ALK in two cases of ALK(+) ALCL. ATIC is the second most common partner of variant ALK rearrangements, while the TRAF1-ALK fusion gene was first reported in 2013, and this is the second reported case of ALK(+) ALCL carrying TRAF1-ALK.
Zhang, Wei Yun; Zhang, Wenhua; Liu, Zhiyuan; Li, Cong; Zhu, Zhi; Yang, Chaoyong James
2012-01-03
We have developed a novel method for efficiently screening affinity ligands (aptamers) from a complex single-stranded DNA (ssDNA) library by employing single-molecule emulsion polymerase chain reaction (PCR) based on the agarose droplet microfluidic technology. In a typical systematic evolution of ligands by exponential enrichment (SELEX) process, the enriched library is sequenced first, and tens to hundreds of aptamer candidates are analyzed via a bioinformatic approach. Possible candidates are then chemically synthesized, and their binding affinities are measured individually. Such a process is time-consuming, labor-intensive, inefficient, and expensive. To address these problems, we have developed a highly efficient single-molecule approach for aptamer screening using our agarose droplet microfluidic technology. Statistically diluted ssDNA of the pre-enriched library evolved through conventional SELEX against cancer biomarker Shp2 protein was encapsulated into individual uniform agarose droplets for droplet PCR to generate clonal agarose beads. The binding capacity of amplified ssDNA from each clonal bead was then screened via high-throughput fluorescence cytometry. DNA clones with high binding capacity and low K(d) were chosen as the aptamer and can be directly used for downstream biomedical applications. We have identified an ssDNA aptamer that selectively recognizes Shp2 with a K(d) of 24.9 nM. Compared to a conventional sequencing-chemical synthesis-screening work flow, our approach avoids large-scale DNA sequencing and expensive, time-consuming DNA synthesis of large populations of DNA candidates. The agarose droplet microfluidic approach is thus highly efficient and cost-effective for molecular evolution approaches and will find wide application in molecular evolution technologies, including mRNA display, phage display, and so on. © 2011 American Chemical Society
Aviram-Goldring, A; Goldman, B; Netanelov-Shapira, I; Chen-Shtoyerman, R; Zvulunov, A; Tal, O; Ilan, T; Peleg, L
2000-03-01
Deletion of the entire steroid sulfatase (STS) gene is the most common molecular defect in X-linked ichthyosis (XLI) patients. Usually, additional flanking sequences are also missing. The aim of this study was to estimate the extent of deletions in an ethnically heterogeneous population of Israeli XLI patients. Multiplex polymerase chain reaction (PCR) and fluorescence in situ hybridization (FISH) techniques were applied in the analysis of blood samples of 24 patients and amniotic cells of seven affected fetuses from 22 unrelated families. In 19 families, a large deletion of the 2-3 megabase was found. It included the whole STS gene and spanned adjacent areas up- and downstream between the loci DXS 1139 and DXS 1132. Two unrelated families of Iraqi ancestry had a partial deletion of the gene and its centromeric adjacent sequence. In another family, the telomeric end of the extragenic segment was only partially missing. Application of FISH on metaphase blood cells and interphase amniotic cells confirmed the diagnosis of XLI in all patients, except the three with partial intragenic deletion. In those cases, the remaining fraction of the gene was sufficient to provide a false negative result. Diagnosis of carriers and prenatal diagnosis in uncultured cells was applicable only by FISH. Our study revealed a remarkable heterogeneity in the deletion pattern among Israeli patients with XLI. This heterogeneity could not be attributed to specific ethnic groups because of the small size of the study group. More studies involving patients of various ancestries should be carried out. In addition, this study demonstrated the usefulness of the FISH technique in the prenatal diagnosis of fetuses with suspected XLI.
Glare, E M; Paton, J C; Premier, R R; Lawrence, A J; Nisbet, I T
1990-01-01
A tandemly repeated 1,046-base-pair (bp) ClaI DNA fragment from Bordetella pertussis was cloned into Escherichia coli by using the vector pUC19. This fragment, when isolated, hybridized strongly to DNA from all 100 clinical isolates of B. pertussis tested. It was shown to have homology to single-copy sequences in Bordetella bronchiseptica but not Bordetella parapertussis and did not hybridize to lysate blots of a wide range of other bacteria, including members of the closely related genera Pasteurella, Alcaligenes, and Haemophilus. The 1,046-bp fragment was sequenced, and complementary synthetic oligonucleotides flanking a 153-bp region within the repeated element were used as primers for specific amplification of this region using the polymerase chain reaction (PCR). This procedure was then applied to the rapid (5-h) detection of B. pertussis in nasopharyngeal secretions collected from 332 children with suspected pertussis. The test yielded positive results in a total of 98 samples, compared with 66 for culture and 33 for direct immunofluorescence (IF). All of the IF-positive samples were PCR positive, as were 63 of the samples from which B. pertussis was eventually cultured. Two hundred thirty-one specimens which were negative by IF and culture were also negative in the PCR assay. However, 33 culture- and IF-negative specimens were positive by PCR assay. Several of these specimens were collected from close contacts of culture-proven pertussis patients, were follow-up specimens from such patients, or were from patients with serological evidence of pertussis and therefore may be true-rather than false-positives. Images PMID:2229381
2011-01-01
Abstract The addition of relatively short flap sequence at the 5′-end of one of the polymerase chain reaction (PCR) primers considerably improves performance of real-time assays based on 5′-nuclease activity. This new technology, called Snake, was shown to supersede the conventional methods like TaqMan, Molecular Beacons, and Scorpions in the signal productivity and discrimination of target polymorphic variations as small as single nucleotides. The present article describes a number of reaction conditions and methods that allow further improvement of the assay performance. One of the identified approaches is the use of duplex-destabilizing modifications such as deoxyinosine and deoxyuridine in the design of the Snake primers. This approach was shown to solve the most serious problem associated with the antisense amplicon folding and cleavage. As a result, the method permits the use of relatively long—in this study—14-mer flap sequences. Investigation also revealed that only the 5′-segment of the flap requires the deoxyinosine/deoxyuridine destabilization, whereas the 3′-segment is preferably left unmodified or even stabilized using 2-amino deoxyadenosine d(2-amA) and 5-propynyl deoxyuridine d(5-PrU) modifications. The base-modification technique is especially effective when applied in combination with asymmetric three-step PCR. The most valuable discovery of the present study is the effective application of modified deoxynucleoside 5′-triphosphates d(2-amA)TP and d(5-PrU)TP in Snake PCR. This method made possible the use of very short 6-8-mer 5′-flap sequences in Snake primers. PMID:21050073
Wilkes, Rebecca P; Sanchez, Elena; Riley, Matthew C; Kennedy, Melissa A
2014-01-01
Canine distemper virus (CDV) remains a common cause of infectious disease in dogs, particularly in high-density housing situations such as shelters. Vaccination of all dogs against CDV is recommended at the time of admission to animal shelters and many use a modified live virus (MLV) vaccine. From a diagnostic standpoint for dogs with suspected CDV infection, this is problematic because highly sensitive diagnostic real-time reverse transcription polymerase chain reaction (RT-PCR) tests are able to detect MLV virus in clinical samples. Real-time PCR can be used to quantitate amount of virus shedding and can differentiate vaccine strains from wild-type strains when shedding is high. However, differentiation by quantitation is not possible in vaccinated animals during acute infection, when shedding is low and could be mistaken for low level vaccine virus shedding. While there are gel-based RT-PCR assays for differentiation of vaccine strains from field strains based on sequence differences, the sensitivity of these assays is unable to match that of the real-time RT-PCR assay currently used in the authors' laboratory. Therefore, a real-time RT-PCR assay was developed that detects CDV MLV vaccine strains and distinguishes them from wild-type strains based on nucleotide sequence differences, rather than the amount of viral RNA in the sample. The test is highly sensitive, with detection of as few as 5 virus genomic copies (corresponding to 10(-1) TCID(50)). Sequencing of the DNA real-time products also allows phylogenetic differentiation of the wild-type strains. This test will aid diagnosis during outbreaks of CDV in recently vaccinated animals.
Three cases of mumps virus and enterovirus coinfection in children with enteroviral meningitis
Rasti, Mojtaba; Makvandi, Manoochehr; Neisi, Niloofar; Azaran, Azarakhsh; Rastegarvand, Nasrin; Khalafkhany, Davod; Jahangirnezhad, Emad; Teimoori, Ali; Hadian, Maryam; Shabani, Abdolnabi; Shamsizadeh, Ahmad; Nikfar, Roya; Varnaseri, Mehran
2016-01-01
Abstract Several viruses are responsible for aseptic meningitis; however, in the region of Southwest Iran, the role played by each virus is still not very well known. The aim of this study is to determine the relative frequencies of mumps virus, herpes viruses, and enteroviruses, as well as coinfections among them, in patients with aseptic meningitis. In this cross-sectional study, samples of cerebrospinal fluid were collected between December 2012 and December 2013 from patients under 14 years, who were hospitalized in Abuzar Children's Hospital in Ahvaz, Southwest Iran (the only children's hospital in Khuzestan province and Southwest Iran). All 66 cerebrospinal fluid samples and corresponding clinical data were collected from patients with aseptic meningitis by specialists, and with the patients’ consent. The DNA and RNA were extracted from these samples and subjected to polymerase chain reaction as well as reverse transcription polymerase chain reaction (RT-PCR) for detection of mumps virus, herpes viruses, and enteroviruses. Nine of the samples (3 mumps-positive and 6 enterovirus-positive) were sequenced. The mumps virus sequences were investigated for possible mutations in the SH and partial HN regions. Up to 39 patients (59.09%) were found to be positive for enteroviruses, 3 (4.5%) for mumps virus, and 1 (1.5%) for herpes viruses (specifically, the varicella-zoster virus). Two patients (3.03%) had a mumps virus and enterovirus coinfection. Among the 3 detected mumps virus samples, 1 belonged to genotype B, while the others belonged to genotype N. Six sequenced enteroviruses indicated the highest similarity with Echovirus 30. An amino acid substitution at position 51 (N→T) was detected in the HN region of genotype N mumps virus samples, in comparison to the reference strain. PMID:27930588
Three cases of mumps virus and enterovirus coinfection in children with enteroviral meningitis.
Rasti, Mojtaba; Makvandi, Manoochehr; Neisi, Niloofar; Azaran, Azarakhsh; Rastegarvand, Nasrin; Khalafkhany, Davod; Jahangirnezhad, Emad; Teimoori, Ali; Hadian, Maryam; Shabani, Abdolnabi; Shamsizadeh, Ahmad; Nikfar, Roya; Varnaseri, Mehran
2016-12-01
Several viruses are responsible for aseptic meningitis; however, in the region of Southwest Iran, the role played by each virus is still not very well known. The aim of this study is to determine the relative frequencies of mumps virus, herpes viruses, and enteroviruses, as well as coinfections among them, in patients with aseptic meningitis.In this cross-sectional study, samples of cerebrospinal fluid were collected between December 2012 and December 2013 from patients under 14 years, who were hospitalized in Abuzar Children's Hospital in Ahvaz, Southwest Iran (the only children's hospital in Khuzestan province and Southwest Iran).All 66 cerebrospinal fluid samples and corresponding clinical data were collected from patients with aseptic meningitis by specialists, and with the patients' consent. The DNA and RNA were extracted from these samples and subjected to polymerase chain reaction as well as reverse transcription polymerase chain reaction (RT-PCR) for detection of mumps virus, herpes viruses, and enteroviruses. Nine of the samples (3 mumps-positive and 6 enterovirus-positive) were sequenced. The mumps virus sequences were investigated for possible mutations in the SH and partial HN regions.Up to 39 patients (59.09%) were found to be positive for enteroviruses, 3 (4.5%) for mumps virus, and 1 (1.5%) for herpes viruses (specifically, the varicella-zoster virus). Two patients (3.03%) had a mumps virus and enterovirus coinfection. Among the 3 detected mumps virus samples, 1 belonged to genotype B, while the others belonged to genotype N. Six sequenced enteroviruses indicated the highest similarity with Echovirus 30. An amino acid substitution at position 51 (N→T) was detected in the HN region of genotype N mumps virus samples, in comparison to the reference strain.
Solomon, Isaac H; Spera, Kristyn M; Ryan, Sophia L; Helgager, Jeffrey; Andrici, Juliana; Zaki, Sherif R; Vaitkevicius, Henrikas; Leon, Kristoffer E; Wilson, Michael R; DeRisi, Joseph L; Koo, Sophia; Smirnakis, Stelios M; De Girolami, Umberto
2018-06-01
Powassan virus is a rare but increasingly recognized cause of severe neurological disease. To highlight the diagnostic challenges and neuropathological findings in a fatal case of Powassan encephalitis caused by deer tick virus (lineage II) in a patient with follicular lymphoma receiving rituximab, with nonspecific anti-GAD65 antibodies, who was initially seen with fever and orchiepididymitis. Comparison of clinical, radiological, histological, and laboratory findings, including immunohistochemistry, real-time polymerase chain reaction, antibody detection, and unbiased sequencing assays, in a single case report (first seen in December 2016) at an academic medical center. Infection with Powassan virus. Results of individual assays compared retrospectively. In a 63-year-old man with fatal Powassan encephalitis, serum and cerebrospinal fluid IgM antibodies were not detected via standard methods, likely because of rituximab exposure. Neuropathological findings were extensive, including diffuse leptomeningeal and parenchymal lymphohistiocytic infiltration, microglial proliferation, marked neuronal loss, and white matter microinfarctions most severely involving the cerebellum, thalamus, and basal ganglia. Diagnosis was made after death by 3 independent methods, including demonstration of Powassan virus antigen in brain biopsy and autopsy tissue, detection of viral RNA in serum and cerebrospinal fluid by targeted real-time polymerase chain reaction, and detection of viral RNA in cerebrospinal fluid by unbiased sequencing. Extensive testing for other etiologies yielded negative results, including mumps virus owing to prodromal orchiepididymitis. Low-titer anti-GAD65 antibodies identified in serum, suggestive of limbic encephalitis, were not detected in cerebrospinal fluid. Owing to the rarity of Powassan encephalitis, a high degree of suspicion is required to make the diagnosis, particularly in an immunocompromised patient, in whom antibody-based assays may be falsely negative. Unbiased sequencing assays have the potential to detect uncommon infectious agents and may prove useful in similar scenarios.
Hewson, Ian; Moisander, Pia H; Morrison, Amanda E; Zehr, Jonathan P
2007-05-01
We investigated diazotrophic bacterioplankton assemblage composition in the Heron Reef lagoon (Great Barrier Reef, Australia) using culture-independent techniques targeting the nifH fragment of the nitrogenase gene. Seawater was collected at 3 h intervals over a period of 72 h (i.e. over diel as well as tidal cycles). An incubation experiment was also conducted to assess the impact of phosphate (PO(4)3*) availability on nifH expression patterns. DNA-based nifH libraries contained primarily sequences that were most similar to nifH from sediment, microbial mat and surface-associated microorganisms, with a few sequences that clustered with typical open ocean phylotypes. In contrast to genomic DNA sequences, libraries prepared from gene transcripts (mRNA amplified by reverse transcription-polymerase chain reaction) were entirely cyanobacterial and contained phylotypes similar to those observed in open ocean plankton. The abundance of Trichodesmium and two uncultured cyanobacterial phylotypes from previous studies (group A and group B) were studied by quantitative-polymerase chain reaction in the lagoon samples. These were detected as transcripts, but were not detected in genomic DNA. The gene transcript abundance of these phylotypes demonstrated variability over several diel cycles. The PO(4)3* enrichment experiment had a clearer pattern of gene expression over diel cycles than the lagoon sampling, however PO(4)3* additions did not result in enhanced transcript abundance relative to control incubations. The results suggest that a number of diazotrophs in bacterioplankton of the reef lagoon may originate from sediment, coral or beachrock surfaces, sloughing into plankton with the flooding tide. The presence of typical open ocean phylotype transcripts in lagoon bacterioplankton may indicate that they are an important component of the N cycle of the coral reef.
Saade, M; Aparicio, F; Sánchez-Navarro, J A; Herranz, M C; Myrta, A; Di Terlizzi, B; Pallás, V
2000-12-01
ABSTRACT The three most economically damaging ilarviruses affecting stone fruit trees on a worldwide scale are the related Prunus necrotic ringspot virus (PNRSV), Prune dwarf virus (PDV), and Apple mosaic virus (ApMV). Nonisotopic molecular hybridization and multiplex reverse-transcription polymerase chain reaction (RT-PCR) methodologies were developed that could detect all these viruses simultaneously. The latter technique was advantageous because it was discriminatory. For RT-PCR, a degenerate antisense primer was designed which was used in conjunction with three virus-specific sense primers. The amplification efficiencies for the detection of the three viruses in the multiplex RT-PCR reaction were identical to those obtained in the single RT-PCR reactions for individual viruses. This cocktail of primers was able to amplify sequences from all of the PNRSV, ApMV, and PDV isolates tested in five Prunus spp. hosts (almond, apricot, cherry, peach, and plum) occurring naturally in single or multiple infections. For ApMV isolates, differences in the electrophoretic mobilities of the PCR products were observed. The nucleotide sequence of the amplified products of two representative ApMV isolates was determined, and comparative analysis revealed the existence of a 28-nucleotide deletion in the sequence of isolates showing the faster electrophoretic mobility. To our knowledge, this is the first report on the simultaneous detection of three plant viruses by multiplex RT-PCR in woody hosts. This multiplex RT-PCR could be a useful time and cost saving method for indexing these three ilarviruses, which damage stone fruit tree yields, and for the analysis of mother plants in certification programs.
Kutyavin, Igor V.
2010-01-01
The article describes a new technology for real-time polymerase chain reaction (PCR) detection of nucleic acids. Similar to Taqman, this new method, named Snake, utilizes the 5′-nuclease activity of Thermus aquaticus (Taq) DNA polymerase that cleaves dual-labeled Förster resonance energy transfer (FRET) probes and generates a fluorescent signal during PCR. However, the mechanism of the probe cleavage in Snake is different. In this assay, PCR amplicons fold into stem–loop secondary structures. Hybridization of FRET probes to one of these structures leads to the formation of optimal substrates for the 5′-nuclease activity of Taq. The stem–loop structures in the Snake amplicons are introduced by the unique design of one of the PCR primers, which carries a special 5′-flap sequence. It was found that at a certain length of these 5′-flap sequences the folded Snake amplicons have very little, if any, effect on PCR yield but benefit many aspects of the detection process, particularly the signal productivity. Unlike Taqman, the Snake system favors the use of short FRET probes with improved fluorescence background. The head-to-head comparison study of Snake and Taqman revealed that these two technologies have more differences than similarities with respect to their responses to changes in PCR protocol, e.g. the variations in primer concentration, annealing time, PCR asymmetry. The optimal PCR protocol for Snake has been identified. The technology’s real-time performance was compared to a number of conventional assays including Taqman, 3′-MGB-Taqman, Molecular Beacon and Scorpion primers. The test trial showed that Snake supersedes the conventional assays in the signal productivity and detection of sequence variations as small as single nucleotide polymorphisms. Due to the assay’s cost-effectiveness and simplicity of design, the technology is anticipated to quickly replace all known conventional methods currently used for real-time nucleic acid detection. PMID:19969535
Park, Y. N.; Abe, K.; Li, H.; Hsuih, T.; Thung, S. N.; Zhang, D. Y.
1996-01-01
Reverse transcription polymerase chain reaction (RT-PCR) has been used to detect hepatitis C virus (HCV) sequences in liver tissue. However, RT-PCR has a variable detection sensitivity, especially on routinely processed formalin-fixed, paraffin-embedded (FFPE) specimens. RNA-RNA and RNA-protein cross-links formed during formalin fixation is the major limiting factor preventing reverse trans criptase from extending the primers. To overcome this problem, we applied the ligation-dependent PCR (LD-PCR) for the detection of HCV RNA in FFPE liver tissue. This method uses two capture probes for RNA isolation and two hemiprobes for the subsequent PCR. Despite cross-links, the capture probes and the hemiprobes are able to form hybrids with HCV RNAs released from the FFPE tissue. The hybrids are isolated through binding of the capture probes to paramagnetic beads. The hemiprobes are then ligated by a T4 DNA ligase to form a full probe that serves as a template for the Taq DNA polymerase. A total of 22 FFPE liver specimens, 21 with hepatocellular carcinoma (HCC) and 1 with biliary cirrhosis secondary to bile duct atresia were selected for this study, of which 13 patients were HCV seropositive and 9 seronegative. HCV RNA was detectable by ID-PCR from all 13 HCV-seropositive HCCs and from 5 of 8 HCV-seronegative HCCs but not from the HCV-seronegative liver with biliary atresia. By contrast, RT-PCR detected HCV sequences in only 5 of the HCV-sero-positive and in 1 of the HCV-seronegative HCCs. To resolve the discordance between the LD-PCR and RT-PCR results, RT-PCR was performed on frozen liver tissue of the discrepant specimens, which confirmed the LD-PCR positive results. In conclusion, LD-PCR is a more sensitive method than RT-PCR for the detection of HCV sequences in routinely processed liver tissues. A high rate of HCV infection (86%) is found in HCC specimens, indicating a previously underestimated role of HCV in HCC pathogenesis. Images Figure 2 PMID:8909238
Jarvi, S.I.; Tarr, C.L.; Mcintosh, C.E.; Atkinson, C.T.; Fleischer, R.C.
2004-01-01
The native Hawaiian honeycreepers represent a classic example of adaptive radiation and speciation, but currently face one the highest extinction rates in the world. Although multiple factors have likely influenced the fate of Hawaiian birds, the relatively recent introduction of avian malaria is thought to be a major factor limiting honeycreeper distribution and abundance. We have initiated genetic analyses of class II ?? chain Mhc genes in four species of honeycreepers using methods that eliminate the possibility of sequencing mosaic variants formed by cloning heteroduplexed polymerase chain reaction products. Phylogenetic analyses group the honeycreeper Mhc sequences into two distinct clusters. Variation within one cluster is high, with dN > d S and levels of diversity similar to other studies of Mhc (B system) genes in birds. The second cluster is nearly invariant and includes sequences from honeycreepers (Fringillidae), a sparrow (Emberizidae) and a blackbird (Emberizidae). This highly conserved cluster appears reminiscent of the independently segregating Rfp-Y system of genes defined in chickens. The notion that balancing selection operates at the Mhc in the honeycreepers is supported by transpecies polymorphism and strikingly high dN/dS ratios at codons putatively involved in peptide interaction. Mitochondrial DNA control region sequences were invariant in the i'iwi, but were highly variable in the 'amakihi. By contrast, levels of variability of class II ?? chain Mhc sequence codons that are hypothesized to be directly involved in peptide interactions appear comparable between i'iwi and 'amakihi. In the i'iwi, natural selection may have maintained variation within the Mhc, even in the face of what appears to a genetic bottleneck.
Polymerase chain reaction system
Benett, William J.; Richards, James B.; Stratton, Paul L.; Hadley, Dean R.; Milanovich, Fred P.; Belgrader, Phil; Meyer, Peter L.
2004-03-02
A portable polymerase chain reaction DNA amplification and detection system includes one or more chamber modules. Each module supports a duplex assay of a biological sample. Each module has two parallel interrogation ports with a linear optical system. The system is capable of being handheld.
Fenstermacher, Katherine J; Achuthan, Vasudevan; Schneider, Thomas D; DeStefano, Jeffrey J
2018-01-16
DNA polymerases (DNAPs) recognize 3' recessed termini on duplex DNA and carry out nucleotide catalysis. Unlike promoter-specific RNA polymerases (RNAPs), no sequence specificity is required for binding or initiation of catalysis. Despite this, previous results indicate that viral reverse transcriptases bind much more tightly to DNA primers that mimic the polypurine tract. In the current report, primer sequences that bind with high affinity to Taq and Klenow polymerases were identified using a modified Selective Evolution of Ligands by Exponential Enrichment (SELEX) approach. Two Taq -specific primers that bound ∼10 (Taq1) and over 100 (Taq2) times more stably than controls to Taq were identified. Taq1 contained 8 nucleotides (5' -CACTAAAG-3') that matched the phage T3 RNAP "core" promoter. Both primers dramatically outcompeted primers with similar binding thermodynamics in PCR reactions. Similarly, exonuclease minus Klenow polymerase also selected a high affinity primer that contained a related core promoter sequence from phage T7 RNAP (5' -ACTATAG-3'). For both Taq and Klenow, even small modifications to the sequence resulted in large losses in binding affinity suggesting that binding was highly sequence-specific. The results are discussed in the context of possible effects on multi-primer (multiplex) PCR assays, molecular information theory, and the evolution of RNAPs and DNAPs. Importance This work further demonstrates that primer-dependent DNA polymerases can have strong sequence biases leading to dramatically tighter binding to specific sequences. These may be related to biological function, or be a consequences of the structural architecture of the enzyme. New sequence specificity for Taq and Klenow polymerases were uncovered and among them were sequences that contained the core promoter elements from T3 and T7 phage RNA polymerase promoters. This suggests the intriguing possibility that phage RNA polymerases exploited intrinsic binding affinities of ancestral DNA polymerases to develop their promotors. Conversely, DNA polymerases could have evolved from related RNA polymerases and retained the intrinsic binding preference despite there being no clear function for such a preference in DNA biology. Copyright © 2018 American Society for Microbiology.
Feuillie, Cécile; Merheb, Maxime M.; Gillet, Benjamin; Montagnac, Gilles; Daniel, Isabelle; Hänni, Catherine
2014-01-01
The analysis of ancient or processed DNA samples is often a great challenge, because traditional Polymerase Chain Reaction – based amplification is impeded by DNA damage. Blocking lesions such as abasic sites are known to block the bypass of DNA polymerases, thus stopping primer elongation. In the present work, we applied the SERRS-hybridization assay, a fully non-enzymatic method, to the detection of DNA refractory to PCR amplification. This method combines specific hybridization with detection by Surface Enhanced Resonant Raman Scattering (SERRS). It allows the detection of a series of double-stranded DNA molecules containing a varying number of abasic sites on both strands, when PCR failed to detect the most degraded sequences. Our SERRS approach can quickly detect DNA molecules without any need for DNA repair. This assay could be applied as a pre-requisite analysis prior to enzymatic reparation or amplification. A whole new set of samples, both forensic and archaeological, could then deliver information that was not yet available due to a high degree of DNA damage. PMID:25502338
Feuillie, Cécile; Merheb, Maxime M; Gillet, Benjamin; Montagnac, Gilles; Daniel, Isabelle; Hänni, Catherine
2014-01-01
The analysis of ancient or processed DNA samples is often a great challenge, because traditional Polymerase Chain Reaction - based amplification is impeded by DNA damage. Blocking lesions such as abasic sites are known to block the bypass of DNA polymerases, thus stopping primer elongation. In the present work, we applied the SERRS-hybridization assay, a fully non-enzymatic method, to the detection of DNA refractory to PCR amplification. This method combines specific hybridization with detection by Surface Enhanced Resonant Raman Scattering (SERRS). It allows the detection of a series of double-stranded DNA molecules containing a varying number of abasic sites on both strands, when PCR failed to detect the most degraded sequences. Our SERRS approach can quickly detect DNA molecules without any need for DNA repair. This assay could be applied as a pre-requisite analysis prior to enzymatic reparation or amplification. A whole new set of samples, both forensic and archaeological, could then deliver information that was not yet available due to a high degree of DNA damage.
Nataraju, S M; Ganesh, B; Das, S; Chowdhury, S; Nayak, M K; Ghosh, M; Chatterjee, M K; Sarkar, U; Mitra, U; Bhattacharya, M K; Arora, R; Kobayashi, N; Krishnan, T
2010-09-01
A total of 625 faecal specimens of diarrheic cases (n-313) and non diarrheic controls (n-312), were screened by RT-PCR to detect Noroviruses in children aged below 5 years in Kolkata, India. Out of the 313 fecal specimens (cases) screened using CDC primer set, 10 (3.19%) showed amplification in reverse transcription-polymerase chain reaction (RT-PCR) for Norovirus. These included 5 of 260 (1.92%) from hospitalized and 5 of 53 (9.43%) from out patients departament (OPD) cases. Nine (90%) of Norovirus positive cases belonged to genogroup GII and one specimen (10%) was positive for genogroup GI. Among the 312 non diarrheic controls 2 (0.63%) were positive for Norovirus GII. Partial RNA dependent RNA polymerase gene (RdRp) sequences corresponding to the six Norovirus GII positive samples showed homology to the sequences of Djibouti (horn of Africa), Brazil, Italy, Japan and US norovirus strains. This study shows the detection of newly emerging Norovirus strains among diarrheic and non diarrheic children in Kolkata.
Banerjee, Surajita; Biswas, Nibir; Kanti Das, Nilay; Sil, Amrita; Ghosh, Pramit; Hasanoor Raja, Abu Hena; Dasgupta, Sarbani; Kanti Datta, Pijush; Bhattacharya, Basudev
2011-12-01
Diagnosing leprosy is challenging, especially in early-stage cases, and the need for a sensitive diagnostic tool is urgent. Polymerase chain reaction (PCR) holds promise as a simple and sensitive diagnostic tool, but its usefulness in the Indian context requires further evaluation. Slit-skin smear (SSS) remains the conventional method of leprosy detection. Hence, this study was undertaken to evaluate and compare the diagnostic efficacy of PCR versus that of SSS. Punch biopsy of skin and SSS were obtained from the active margins of lesions. Cases were clinically grouped according to whether they were multibacillary (MB) or paucibacillary (PB) and classified into tuberculoid (TT), borderline tuberculoid (BT), borderline lepromatous (BL), lepromatous (LL), histoid, and indeterminate groups after clinicopathological correlation. DNA was extracted from biopsy specimens, and multiplex PCR was carried out incorporating primers intended for the amplification of a specific 372-bp fragment of a repetitive sequence of Mycobacterium leprae DNA. Among 164 patients, PCR was positive in 82.3%. The sensitivity of PCR was significantly greater (P < 0.0001) than that of SSS in both the MB (85.9% vs. 59.8%) and PB (75.4% vs. 1.8%) subgroups; the difference in sensitivity in the PB subgroup is remarkable. Positivity by PCR and SSS was found in 100% of LL and histoid leprosy, but PCR had significantly greater (P < 0.0001) positivity in BT leprosy and was of definite increased value in indeterminate and TT leprosy. Polymerase chain reaction had higher sensitivity compared with SSS, especially in diagnostically challenging and PB cases. Thus, the use of this costly but sensitive tool should be restricted to this subgroup, because SSS is sufficiently sensitive in the diagnosis of LL and histoid leprosy. © 2011 The International Society of Dermatology.
Fatal hemorrhagic fever caused by West Nile virus in the United States.
Paddock, Christopher D; Nicholson, William L; Bhatnagar, Julu; Goldsmith, Cynthia S; Greer, Patricia W; Hayes, Edward B; Risko, Joseph A; Henderson, Corey; Blackmore, Carina G; Lanciotti, Robert S; Campbell, Grant L; Zaki, Sherif R
2006-06-01
Most West Nile virus (WNV) infections in humans are asymptomatic; severe disease occurs in relatively few patients and typically manifests as encephalitis, meningitis, or acute flaccid paralysis. A few cases of life-threatening disease with diffuse hemorrhagic manifestations have been reported in Africa; however, this clinical presentation has not been documented for any of the >16,700 cases of WNV disease reported in the United States during 1999-2004. We describe a case of fulminant WNV infection in a 59-year-old Florida man who died following a brief illness that resembled hemorrhagic disease caused by Rickettsia reckettsii, dengue virus or yellow fever virus. Traditional and contemporary diagnostic assays, including culture isolation, electron microscopic examination, reverse-transcriptase polymerase chain reaction amplification, and immunohistochemical stains, were used to confirm systemic WNV infection in the patient. WNV was isolated in a cell culture from a skin biopsy specimen obtained from the patient shortly prior to death. Electron microscopic examination identified the isolate as a flavivirus, and reverse-transcriptase polymerase chain reaction amplified specific WNV sequences from the isolate and patient tissue. Quantitative polymerase chain reaction identified approximately 1x10(7) viral copies/mL in the patient's serum. WNV antigens were detected by immunohistochemical stains in intravascular mononuclear cells and endothelium in skin, lung, liver, kidney, spleen, bone marrow, and central nervous system; no viral antigens were identified in neurons or glial cells of the central nervous system. Although hemorrhagic disease is a rare manifestation of WNV infection, the findings provided by this report may offer new insights regarding the clinical spectrum and pathogenesis of WNV disease in humans.
Boehm; Gibson; Lubzens
2000-01-01
This study was initiated to search for species-specific and strain-specific satellite DNA sequences for which oligonucleotide primers could be designed to differentiate between various commercially important strains of the marine monogonont rotifers Brachionus rotundiformis and Brachionus plicatilis. Two unrelated, highly reiterated satellite sequences were cloned and characterized. The eight sequenced monomers from B. rotundiformis and six from B. plicatilis had low intrarepeat variability and were similar in their overall lengths, A + T compositions, and high degrees of repeated motif substructure. However, hybridizations to 19 representative strains, sequence characterizations, and GenBank searches indicated that these two satellites are morphotype-specific and population-specific, respectively, and share little homology to each other or to other characterized sequences in the database. Primer pairs designed for the B. rotundiformis satellite confirmed hybridization specificities on polymerase chain reaction and could serve as a useful molecular diagnostic tool to identify strains belonging to the SS morphotype, which are gaining widespread usage as first feeds for marine fish in commercial production.
Cloning and sequence analysis of Hemonchus contortus HC58cDNA.
Muleke, Charles I; Ruofeng, Yan; Lixin, Xu; Xinwen, Bo; Xiangrui, Li
2007-06-01
The complete coding sequence of Hemonchus contortus HC58cDNA was generated by rapid amplification of cDNA ends and polymerase chain reaction using primers based on the 5' and 3' ends of the parasite mRNA, accession no. AF305964. The HC58cDNA gene was 851 bp long, with open reading frame of 717 bp, precursors to 239 amino acids coding for approximately 27 kDa protein. Analysis of amino acid sequence revealed conserved residues of cysteine, histidine, asparagine, occluding loop pattern, hemoglobinase motif and glutamine of the oxyanion hole characteristic of cathepsin B like proteases (CBL). Comparison of the predicted amino acid sequences showed the protein shared 33.5-58.7% identity to cathepsin B homologues in the papain clan CA family (family C1). Phylogenetic analysis revealed close evolutionary proximity of the protein sequence to counterpart sequences in the CBL, suggesting that HC58cDNA was a member of the papain family.
Mitsui, Jun; Fukuda, Yoko; Azuma, Kyo; Tozaki, Hirokazu; Ishiura, Hiroyuki; Takahashi, Yuji; Goto, Jun; Tsuji, Shoji
2010-07-01
We have recently found that multiple rare variants of the glucocerebrosidase gene (GBA) confer a robust risk for Parkinson disease, supporting the 'common disease-multiple rare variants' hypothesis. To develop an efficient method of identifying rare variants in a large number of samples, we applied multiplexed resequencing using a next-generation sequencer to identification of rare variants of GBA. Sixteen sets of pooled DNAs from six pooled DNA samples were prepared. Each set of pooled DNAs was subjected to polymerase chain reaction to amplify the target gene (GBA) covering 6.5 kb, pooled into one tube with barcode indexing, and then subjected to extensive sequence analysis using the SOLiD System. Individual samples were also subjected to direct nucleotide sequence analysis. With the optimization of data processing, we were able to extract all the variants from 96 samples with acceptable rates of false-positive single-nucleotide variants.
Identification of tissue-embedded ascarid larvae by ribosomal DNA sequencing.
Ishiwata, Kenji; Shinohara, Akio; Yagi, Kinpei; Horii, Yoichiro; Tsuchiya, Kimiyuki; Nawa, Yukifumi
2004-01-01
Polymerase chain reaction (PCR) was applied to identify tissue-embedded ascarid nematode larvae. Two sequences of the internal transcribed spacer (ITS) regions of ribosomal DNA (rDNA), ITS1 and ITS2, of the ascarid parasites were amplified and compared with those of ascarid-nematodes registered in a DNA database (GenBank). The ITS sequences of the PCR products obtained from the ascarid parasite specimen in our laboratory were compatible with those of registered adult Ascaris and Toxocara parasites. PCR amplification of the ITS regions was sensitive enough to detect a single larva of Ascaris suum mixed with porcine liver tissue. Using this method, ascarid larvae embedded in the liver of a naturally infected turkey were identified as Toxocara canis. These results suggest that even a single larva embedded in tissues from patients with larva migrans could be identified by sequencing the ITS regions.
SxtA gene sequence analysis of dinoflagellate Alexandrium minutum
NASA Astrophysics Data System (ADS)
Norshaha, Safida Anira; Latib, Norhidayu Abdul; Usup, Gires; Yusof, Nurul Yuziana Mohd
2015-09-01
The dinoflagellate Alexandrium minutum is typically known for the production of potent neurotoxins such as saxitoxin, affecting the health of human seafood consumers via paralytic shellfish poisoning (PSP). These phenomena is related to the harmful algal blooms (HABs) that is believed to be influenced by environmental and nutritional factors. Previous study has revealed that SxtA gene is a starting gene that involved in the saxitoxin production pathway. The aim of this study was to analyse the sequence of the sxtA gene in A. minutum. The dinoflagellates culture was cultured at temperature 26°C with 16:8-hour light:dark photocycle. After the samples were harvested, RNA was extracted, complementary DNA (cDNA) was synthesised and amplified by polymerase chain reaction (PCR). The PCR products were then purified and cloned before sequenced. The SxtA sequence obtained was then analyzed in order to identify the presence of SxtA gene in Alexandrium minutum.
Gascoyne-Binzi, D M; Heritage, J; Hawkey, P M
1993-11-01
High-level tetracycline-resistant Neisseria gonorrhoeae (TRNG) has been associated with the presence of a plasmid approximately 25.2 MDa in size which carries a Tet M tetracycline resistance determinant. Two different plasmid types, American and Dutch, have previously been described, based on the restriction endonuclease digestion pattern. In this study, the tet(M) genes from the two plasmid types have been amplified by the polymerase chain reaction (PCR) and then sequenced. The gene sequences from the two plasmids shared 96.8% identity, and showed similarities with different segments of the tet(M) gene sequences from Tn1545, Tn916 and Ureaplasma urealyticum. The data suggest that it is highly likely that the Tet M determinant found in the American type plasmid has a different origin from that present in the Dutch plasmid.
Nandi, Sukdeb; Anbazhagan, Rajendra; Kumar, Manoj
2010-01-01
Canine parvovirus 2 (CPV-2) is one of the most important viruses that causes haemorrhagic gastroenteritis and myocarditis of dogs worldwide. The picture has been complicated further due to the emergence of new mutants of CPV, namely: CPV-2a, CPV-2b and CPV-2c. In this study, the molecular characterisation of strains present in the CPV vaccines available on the Indian market was performed using polymerase chain reaction and DNA sequencing. The VP1/VP2 genes of two vaccine strains and a field strain (Bhopal) were sequenced and the nucleotide and the deduced amino acid sequences were compared. The results indicated that the isolate belonged to CPV type 2b and the strains in the vaccines belonged to type CPV-2. From the study, it is inferred that the CPV strain used in commercially available vaccine preparation differed from the strains present in CPV infection in dogs in India.
Taylor, P.W.; Winton, J.R.
2002-01-01
Nested polymerase chain reaction (PCR) assays were developed using first-round primers complementary to highly conserved regions within the bacterial 16S ribosomal RNA (rRNA) gene (universal eubacterial primers) and second-round primers specific for sequences within the 16S rRNA genes of Aeromonas salmonicida, Yersinia ruckeri, andFlavobacterium psychrophilum. Following optimization of the MgCl2 concentration and primer annealing temperature, PCR employing the universal eubacterial primers was used to amplify a 1,500-base-pair (bp) product visible in agarose gels stained with ethidium bromide. The calculated detection limit of this single-round assay was less than 1.4 × 104 colony-forming units (CFU) per reaction for all bacterial species tested. Single-round PCR using primer sets specific for A. salmonicida, Y. ruckeri, and F. psychrophilumamplified bands of 271, 575, and 1,100 bp, respectively, with detection limits of less than 1.4 × 104, 1.4 × 105, and 1.4 × 105 CFU per reaction. Using the universal eubacterial primers in the first round and the species-specific primer sets in the second round of nested PCR assays improved the detection ability by approximately four orders of magnitude to fewer than 14 CFU per sample for each of the three bacterial species. Such nested assays could be adapted to a wide variety of bacterial fish pathogens for which 16S sequences are available.
Liu, Dong; Liu, Shaojun; You, Cuiping; Chen, Lin; Liu, Zhen; Liu, Liangguo; Wang, Jing; Liu, Yun
2010-04-01
Diploid eggs of allotetraploid hybrids (red crucian carp female symbol x common carp male symbol), when activated by UV-irradiated sperm of scatter scale carp, can develop into diploid progenies without chromosome duplication treatment. Diploid progenies produce diploid eggs, which develop into diploid population by the same way. To understand the molecular mechanism underlying the production of diploid eggs by the diploid fish, we constructed a forward suppression subtractive hybridization complementary DNA (cDNA) library. The cDNAs from the ovary in proliferation phase were employed as the "tester," and those in growth phase were used as the "driver." Seventy-three cDNA clones that are specifically expressed in proliferation phase were detected by dot-blot hybridization. Sequencing analyses revealed that several of these cDNAs have high homologies to the known sequences in the NCBI database. Their encoded proteins include the protein preventing mitosis catastrophe (PMC), the signal recognition particle 9, the ATP-binding cassette transporter, the glucanase-xylanase fusion protein, and others. These genes were confirmed by reverse transcriptase-polymerase chain reaction. The expression profile of the PMC gene at different time points was analyzed by quantitative real-time polymerase chain reaction. The results indicated that the expression of this suppression subtractive hybridization-identified gene changed during the time course, corresponding with the cellular phenomenon in the ovary development. Our studies provide insights into the molecular mechanism underlying the ovary development of diploid gynogenetic fish.
Hernández, Marta; Rodríguez-Lázaro, David; Esteve, Teresa; Prat, Salomé; Pla, Maria
2003-12-15
Commercialization of several genetically modified crops has been approved worldwide to date. Uniplex polymerase chain reaction (PCR)-based methods to identify these different insertion events have been developed, but their use in the analysis of all commercially available genetically modified organisms (GMOs) is becoming progressively insufficient. These methods require a large number of assays to detect all possible GMOs present in the sample and thereby the development of multiplex PCR systems using combined probes and primers targeted to sequences specific to various GMOs is needed for detection of this increasing number of GMOs. Here we report on the development of a multiplex real-time PCR suitable for multiple GMO identification, based on the intercalating dye SYBR Green I and the analysis of the melting curves of the amplified products. Using this method, different amplification products specific for Maximizer 176, Bt11, MON810, and GA21 maize and for GTS 40-3-2 soybean were obtained and identified by their specific Tm. We have combined amplification of these products in a number of multiplex reactions and show the suitability of the methods for identification of GMOs with a sensitivity of 0.1% in duplex reactions. The described methods offer an economic and simple alternative to real-time PCR systems based on sequence-specific probes (i.e., TaqMan chemistry). These methods can be used as selection tests and further optimized for uniplex GMO quantification.
Is Malassezia nana the main species in horses' ear canal microbiome?
Aldrovandi, Ana Lúcia; Osugui, Lika; Acqua Coutinho, Selene Dall'
2016-01-01
The objective of this study was to characterize genotypically Malassezia spp. isolated from the external ear canal of healthy horses. Fifty-five horses, 39 (70.9%) males and 16 (29.1%) females, from different breeds and adults were studied. External ear canals were cleaned and a sterile cotton swab was introduced to collect cerumen. A total of 110 samples were cultured into Dixon medium and were incubated at 32°C for up to 15 days. Macro- and micromorphology and phenotypic identification were performed. DNA was extracted, strains were submitted to polymerase chain reaction technique, and the products obtained were submitted to Restriction Fragment Length Polymorphism using the restriction enzymes BstCI and HhaI. Strains were sent off to genetic sequencing of the regions 26S rDNA D1/D2 and ITS1-5.8S-ITS2 rDNA. Malassezia spp. were isolated from 33/55 (60%) animals and 52/110 (47%) ear canals. No growth on Sabouraud dextrose agar was observed, confirming the lipid dependence of all strains. Polymerase chain reaction-Restriction fragment length polymorphism permitted the molecular identification of Malassezia nana - 42/52 (81%) and Malassezia slooffiae - 10/52 (19%). Sequencing confirmed RFLP identification. It was surprising that M. nana represented over 80% of the strains and no Malassezia equina was isolated in this study, differing from what was expected. Copyright © 2016 Sociedade Brasileira de Microbiologia. Published by Elsevier Editora Ltda. All rights reserved.
Molecular characterization of Toxocara spp. from soil of public areas in Ahvaz southwestern Iran.
Khademvatan, Shahram; Abdizadeh, Rahman; Tavalla, Mahdi
2014-07-01
In the present study, the microscopy and polymerase chain reaction methods were used for detection and identification of soil contamination by Toxocara eggs in squares, streets, public parks, and rubbish dumps in Ahvaz, southwestern Iran. A total of 210 soil samples were collected from different parts of the city and examined by microscopy and polymerase chain reaction (PCR) methods, following sodium nitrate flotation. Nucleotide sequencing was performed to confirm the results of the PCR method. Toxocara eggs were found in 64 and 71 soil samples using the microscopy and PCR methods, respectively. The highest contamination rate was observed in the central part of Ahvaz (39.5% and 46.5% by the microscopy and PCR methods, respectively). Based on internal transcribed spacer 2 (ITS2) PCR identification, 28% of the samples were diagnosed as Toxocara cati and 5.7% as Toxocara canis; no mixed contamination was observed. DNA sequencing of the ITS2 gene confirmed our findings. Compared to the conventional microscopic detection following by flotation, used as the gold standard, the PCR method appears to be rapid and sensitive as well as allows analysis of Toxocara spp. isolated from soil independent of the stage of egg development. Therefore, the PCR method appears to be a valuable tool for the diagnosis and differentiation of Toxocara spp. from soil samples in epidemiological studies, and will help the local health systems in effective prevention and control of disease. Copyright © 2014 Elsevier B.V. All rights reserved.
Meena, Ram Prasnna; Baranwal, V K
2016-09-01
Citrus trees harbor a large number of viral and bacterial pathogens. Citrus yellow vein clearing virus (CYVCV), Indian citrus ringspot virus (ICRSV), Citrus yellow mosaic virus (CYMV), Citrus tristeza virus (CTV) and a bacterium, Candidatus Liberibacter asiaticus (CLa) associated with huanglongbing (HLB) disease, the most prevalent pathogens in citrus orchards of different regions in India and are responsible for debilitating citriculture. For detection of these viral and bacterial pathogens a quick, sensitive and cost effective detection method is required. With this objective a multiplex polymerase chain reaction (mPCR) assay was developed for simultaneous detection of four viruses and a bacterium in citrus. Several sets of primers were designed for each virus based on the retrieved reference sequences from the GenBank. A primer pair published previously was used for greening bacterium. Each pair of primers was evaluated for their sensitivity and differentiation by simplex and mPCR. The constant amplified products were identified on the basis of molecular size in mPCR and were compared with standard PCR. The amplicons were cloned and results were confirmed with sequencing analysis. The mPCR assay was validated using naturally infected field samples for one or more citrus viruses and the huanglongbing bacterium. The mPCR assay developed here will aid in the production of virus free planting materials and rapid indexing for certification of citrus budwood programme. Copyright © 2016 Elsevier B.V. All rights reserved.
Yoshida, Wataru; Kezuka, Aki; Murakami, Yoshiyuki; Lee, Jinhee; Abe, Koichi; Motoki, Hiroaki; Matsuo, Takafumi; Shimura, Nobuaki; Noda, Mamoru; Igimi, Shizunobu; Ikebukuro, Kazunori
2013-11-01
An automatic polymerase chain reaction (PCR) product detection system for food safety monitoring using zinc finger (ZF) protein fused to luciferase was developed. ZF protein fused to luciferase specifically binds to target double stranded DNA sequence and has luciferase enzymatic activity. Therefore, PCR products that comprise ZF protein recognition sequence can be detected by measuring the luciferase activity of the fusion protein. We previously reported that PCR products from Legionella pneumophila and Escherichia coli (E. coli) O157 genomic DNA were detected by Zif268, a natural ZF protein, fused to luciferase. In this study, Zif268-luciferase was applied to detect the presence of Salmonella and coliforms. Moreover, an artificial zinc finger protein (B2) fused to luciferase was constructed for a Norovirus detection system. In the luciferase activity detection assay, several bound/free separation process is required. Therefore, an analyzer that automatically performed the bound/free separation process was developed to detect PCR products using the ZF-luciferase fusion protein. By means of the automatic analyzer with ZF-luciferase fusion protein, target pathogenic genomes were specifically detected in the presence of other pathogenic genomes. Moreover, we succeeded in the detection of 10 copies of E. coli BL21 without extraction of genomic DNA by the automatic analyzer and E. coli was detected with a logarithmic dependency in the range of 1.0×10 to 1.0×10(6) copies. Copyright © 2013 Elsevier B.V. All rights reserved.
Koppstein, David; Ashour, Joseph; Bartel, David P.
2015-01-01
The influenza polymerase cleaves host RNAs ∼10–13 nucleotides downstream of their 5′ ends and uses this capped fragment to prime viral mRNA synthesis. To better understand this process of cap snatching, we used high-throughput sequencing to determine the 5′ ends of A/WSN/33 (H1N1) influenza mRNAs. The sequences provided clear evidence for nascent-chain realignment during transcription initiation and revealed a strong influence of the viral template on the frequency of realignment. After accounting for the extra nucleotides inserted through realignment, analysis of the capped fragments indicated that the different viral mRNAs were each prepended with a common set of sequences and that the polymerase often cleaved host RNAs after a purine and often primed transcription on a single base pair to either the terminal or penultimate residue of the viral template. We also developed a bioinformatic approach to identify the targeted host transcripts despite limited information content within snatched fragments and found that small nuclear RNAs and small nucleolar RNAs contributed the most abundant capped leaders. These results provide insight into the mechanism of viral transcription initiation and reveal the diversity of the cap-snatched repertoire, showing that noncoding transcripts as well as mRNAs are used to make influenza mRNAs. PMID:25901029
DNA Polymerase III Star Requires ATP to Start Synthesis on a Primed DNA†
Wickner, William; Kornberg, Arthur
1973-01-01
DNA polymerase III star replicates a ϕX174 single-stranded, circular DNA primed with a fragment of RNA. This reaction proceeds in two stages. In stage I, a complex is formed requiring DNA polymerase III star, ATP, spermidine, copolymerase III*, and RNA-primed ϕX174 single-stranded, circular DNA. The complex, isolated by gel filtration, contains ADP and inorganic phosphate (the products of a specific ATP cleavage) as well as spermidine, polymerase III star, and copolymerase III star. In stage II, the chain grows upon addition of deoxynucleoside triphosphates; ADP and inorganic phosphate are discharged and chain elongation is resistant to antibody to copolymerase III star. Thus ATP and copolymerase III star are required to initiate chain growth but not to sustain it. Images PMID:4519657
Scher, Michael B; Elbaum, Michael B; Mogilevkin, Yakov; Hilbert, David W; Mydlo, Jack H; Sidi, A Ami; Adelson, Martin E; Mordechai, Eli; Trama, Jason P
2012-12-01
Detection of methylated DNA has been shown to be a good biomarker for bladder cancer. Bladder cancer has the highest recurrence rate of any cancer and, as such, patients are regularly monitored using invasive diagnostic techniques. As urine is easily attainable, bladder cancer is an optimal cancer to detect using DNA methylation. DNA methylation is highly specific in cancer detection. However, it is difficult to detect because of the limited amount of DNA present in the urine of patients with bladder cancer. Therefore, an improved, sensitive and noninvasive diagnostic test is needed. We developed a highly specific and sensitive nested methylation specific polymerase chain reaction assay to detect the presence of bladder cancer in small volumes of patient urine. The genes assayed for DNA methylation are BCL2, CDKN2A and NID2. The regions surrounding the DNA methylation sites were amplified in a methylation independent first round polymerase chain reaction and the amplification product from the first polymerase chain reaction was used in a real-time methylation specific polymerase chain reaction. Urine samples were collected from patients receiving treatment at Wolfson Medical Center in Holon, Israel. In a pilot clinical study using patient urine samples we were able to differentiate bladder cancer from other urogenital malignancies and nonmalignant conditions with a sensitivity of 80.9% and a specificity of 86.4%. We developed a novel methylation specific polymerase chain reaction assay for the detection and monitoring of bladder cancer using DNA extracted from patient urine. The assay may also be combined with other diagnostic tests to improve accuracy. Copyright © 2012 American Urological Association Education and Research, Inc. Published by Elsevier Inc. All rights reserved.
Drivers of the dynamics of diazotrophs and denitrifiers in North Sea bottom waters and sediments
Fan, Haoxin; Bolhuis, Henk; Stal, Lucas J.
2015-01-01
The fixation of dinitrogen (N2) and denitrification are two opposite processes in the nitrogen cycle. The former transfers atmospheric dinitrogen gas into bound nitrogen in the biosphere, while the latter returns this bound nitrogen back to atmospheric dinitrogen. It is unclear whether or not these processes are intimately connected in any microbial ecosystem or that they are spatially and/or temporally separated. Here, we measured seafloor nitrogen fixation and denitrification as well as pelagic nitrogen fixation by using the stable isotope technique. Alongside, we measured the diversity, abundance, and activity of nitrogen-fixing and denitrifying microorganisms at three stations in the southern North Sea. Nitrogen fixation ranged from undetectable to 2.4 nmol N L−1 d−1 and from undetectable to 8.2 nmol N g−1 d−1 in the water column and seafloor, respectively. The highest rates were measured in August at Doggersbank, both for the water column and for the seafloor. Denitrification ranged from 1.7 to 208.8 μmol m−2 d−1 and the highest rates were measured in May at the Oyster Grounds. DNA sequence analysis showed sequences of nifH, a structural gene for nitrogenase, related to sequences from anaerobic sulfur/iron reducers and sulfate reducers. Sequences of the structural gene for nitrite reductase, nirS, were related to environmental clones from marine sediments. Quantitative polymerase chain reaction (qPCR) data revealed the highest abundance of nifH and nirS genes at the Oyster Grounds. Quantitative reverse transcription polymerase chain reaction (qRT-PCR) data revealed the highest nifH expression at Doggersbank and the highest nirS expression at the Oyster Grounds. The distribution of the diazotrophic and denitrifying communities seems to be subject to different selecting factors, leading to spatial and temporal separation of nitrogen fixation and denitrification. These selecting factors include temperature, organic matter availability, and oxygen concentration. PMID:26257718
Cloning and pharmacological characterization of the rabbit bradykinin B2 receptor.
Bachvarov, D R; Saint-Jacques, E; Larrivée, J F; Levesque, L; Rioux, F; Drapeau, G; Marceau, F
1995-12-01
Degenerate primers, corresponding to consensus sequences of third and sixth transmembrane domains of G protein-coupled receptor superfamily, were used for the polymerase chain reaction amplification and consecutive characterization of G protein-coupled receptors present in cultured rabbit aortic smooth muscle cells. One of the isolated resulting fragments was highly homologous to the corresponding region of the bradykinin (BK) B2 receptor cloned in other species. The polymerase chain reaction fragment was used to screen a rabbit genomic library, which allowed the identification of an intronless 1101-nucleotide open reading frame which codes for a 367-amino acid receptor protein. The rabbit B2 receptor sequence is more than 80% identical to the ones determined in three other species and retain putative glycosylation, palmitoylation and phosphorylation sites. In the rabbit genomic sequence, an acceptor splice sequence was found 8 base pairs upstream of the start codon. Northern blot analysis showed a high expression of a major transcript (4.2 kilobases) in the rabbit kidney and duodenum, and a less abundant expression in other tissues. Southern blot experiments suggest that a single copy of this gene exists in the rabbit genome. The cloned rabbit B2 receptor expressed in COS-1 cells binds [3H]BK in a saturable manner (KD 2.1 nM) and this ligand competes with a series of kinin agonists and antagonist with a rank order consistent with the B2 receptor identity. The insurmountable character of the antagonism exerted by Hoe 140 against BK on the rabbit B2 receptor, previously shown in pharmacological experiments, was confirmed in binding experiments with the cloned receptor expressed in a controlled manner. By contrast, Hoe 140 competed with [3H]BK in a surmountable manner for the human B2 receptor expressed in COS-1 cells. The cloning of the rabbit B2 receptor will be useful notably for the study of the structural basis of antagonist binding and for studies on receptor regulation in a relatively large animal.
NASA Astrophysics Data System (ADS)
Lau, Han Yih; Wu, Haoqi; Wee, Eugene J. H.; Trau, Matt; Wang, Yuling; Botella, Jose R.
2017-01-01
Developing quick and sensitive molecular diagnostics for plant pathogen detection is challenging. Herein, a nanoparticle based electrochemical biosensor was developed for rapid and sensitive detection of plant pathogen DNA on disposable screen-printed carbon electrodes. This 60 min assay relied on the rapid isothermal amplification of target pathogen DNA sequences by recombinase polymerase amplification (RPA) followed by gold nanoparticle-based electrochemical assessment with differential pulse voltammetry (DPV). Our method was 10,000 times more sensitive than conventional polymerase chain reaction (PCR)/gel electrophoresis and could readily identify P. syringae infected plant samples even before the disease symptoms were visible. On the basis of the speed, sensitivity, simplicity and portability of the approach, we believe the method has potential as a rapid disease management solution for applications in agriculture diagnostics.
Lau, Han Yih; Wu, Haoqi; Wee, Eugene J H; Trau, Matt; Wang, Yuling; Botella, Jose R
2017-01-17
Developing quick and sensitive molecular diagnostics for plant pathogen detection is challenging. Herein, a nanoparticle based electrochemical biosensor was developed for rapid and sensitive detection of plant pathogen DNA on disposable screen-printed carbon electrodes. This 60 min assay relied on the rapid isothermal amplification of target pathogen DNA sequences by recombinase polymerase amplification (RPA) followed by gold nanoparticle-based electrochemical assessment with differential pulse voltammetry (DPV). Our method was 10,000 times more sensitive than conventional polymerase chain reaction (PCR)/gel electrophoresis and could readily identify P. syringae infected plant samples even before the disease symptoms were visible. On the basis of the speed, sensitivity, simplicity and portability of the approach, we believe the method has potential as a rapid disease management solution for applications in agriculture diagnostics.
Phleboviruses associated with sand flies in arid bio-geographical areas of Central Tunisia.
Dachraoui, K; Fares, W; Bichaud, L; Barhoumi, W; Beier, J C; Derbali, M; Cherni, S; Lamballerie, X de; Chelbi, I; Charrel, R N; Zhioua, E
2016-06-01
An entomological investigation was carried out in 2014 at two sites located in Central Tunisia, one irrigated and another non-irrigated situated in arid bio-geographical areas. Sand flies of the subgenus Larroussius namely Phlebotomus perfiliewi, Phlebotomus perniciosus, and Phlebotomus longicuspis are the most abundant sand fly species in the irrigated site. However, in the non-irrigated site, Phlebotomus papatasi of the Phlebotomus genus is the most abundant species. A total of 3191 sand flies were collected and pooled with up to 30 specimens per pool based on sex, trapping location and collection date, were tested for the presence of phleboviruses by nested reverse transcriptase polymerase chain reaction in the polymerase gene and sequenced. Of a total of 117 pools, 4 were positive, yielding a minimum infection rate of sand flies with phleboviruses of 0.12%. Phylogenetic analysis performed using partial nucleotide and amino acid sequence in the polymerase gene showed that these phleboviruses belonged to four different clusters corresponding to Toscana virus (TOSV), Saddaguia virus (SADV), Sandfly Fever Sicilian Virus (SFSV) and Utique virus (UTIV). This study provides more evidence that the abundance of P. perfiliewi is associated with the development of irrigation in arid bio-geographical areas of Central Tunisia which may have led to the emergence of phleboviruses. We report the first detection of TOSV from sand flies collected from Central Tunisia. Copyright © 2016 Elsevier B.V. All rights reserved.
Polymerase chain reaction-based detection of B-cell monoclonality in cytologic specimens.
Chen, Y T; Mercer, G O; Chen, Y
1993-11-01
Thirty-seven cytologic cell blocks were evaluated for B-cell monoclonality by polymerase chain reaction (PCR), 16 of them cytologically positive for lymphoma, and 21 suspicious for lymphoma but morphologically nondiagnostic. Of 37 specimens, 13 (35%) showed B-cell monoclonality, including six of 16 cytologically positive samples and seven of 21 cytologically suspicious ones. Of these 13 positive samples, seven were positive using crude lysates as substrates, and six additional positive samples were identified only when DNAs were purified and concentrated. Analysis of the DNAs further revealed poor polymerase chain reaction amplifiability and low DNA yield in many samples, indicating that cell block materials are suboptimal for this assay. We concluded that B-cell monoclonality can be detected in ethanol-fixed cytologic samples, and usage of unembedded material will likely improve the sensitivity. In specimens cytologically suspicious for lymphoma, polymerase chain reaction-based identification of monoclonal B-cell population supports the diagnosis of B-cell lymphoma and is a potentially useful test in solving this diagnostic dilemma.
Cullen, Cheryl L; Haines, Deborah M; Jackson, Marion L; Grahn, Bruce H
2002-07-01
Diffuse iris melanoma was confirmed by light-microscopic examination in 10 formalin-fixed, paraffin-embedded globes from 10 cats. To determine if feline leukemia virus or a replication defective feline leukemia virus, feline sarcoma virus, was present in these anterior uveal melanomas, immunohistochemistry and polymerase chain reaction for feline leukemia virus were utilized. Immunohistochemical staining for feline leukemia virus glycoprotein 70 was performed on all 10 tumors using an avidin-biotin complex technique. The DNA was extracted from each specimen and a 166-base pair region of the feline leukemia virus long terminal repeat was targeted by polymerase chain reaction. Immunohistochemical staining for feline leukemia virus glycoprotein 70 and polymerase chain reaction amplification of a feline leukemia virus long terminal repeat region were negative in all cases. Feline leukemia virus/feline sarcoma virus was not detected in any neoplasms and therefore was unlikely to play a role in the tumorigenesis of these feline diffuse iris melanomas.
Characterization by Deep Sequencing of Prunus virus T, a Novel Tepovirus Infecting Prunus Species.
Marais, Armelle; Faure, Chantal; Mustafayev, Eldar; Barone, Maria; Alioto, Daniela; Candresse, Thierry
2015-01-01
Double-stranded RNAs purified from a cherry tree collected in Italy and a plum tree collected in Azerbaijan were submitted to deep sequencing. Contigs showing weak but significant identity with various members of the family Betaflexiviridae were reconstructed. Sequence comparisons led to the conclusion that the viral isolates identified in the analyzed Prunus plants belong to the same viral species. Their genome organization is similar to that of some members of the family Betaflexiviridae, with three overlapping open reading frames (RNA polymerase, movement protein, and capsid protein). Phylogenetic analyses of the deduced encoded proteins showed a clustering with the sole member of the genus Tepovirus, Potato virus T (PVT). Given these results, the name Prunus virus T (PrVT) is proposed for the new virus. It should be considered as a new member of the genus Tepovirus, even if the level of nucleotide identity with PVT is borderline with the genus demarcation criteria for the family Betaflexiviridae. A reverse-transcription polymerase chain reaction detection assay was developed and allowed the identification of two other PrVT isolates and an estimate of 1% prevalence in the large Prunus collection screened. Due to the mixed infection status of all hosts identified to date, it was not possible to correlate the presence of PrVT with specific symptoms.
Hoffman, David J.; Niyogi, Salil K.
1973-01-01
The effects of dinucleoside monophosphates on the transcription of phage T4 DNA by E. coli RNA polymerase have been examined at various concentrations of the sigma subunit and extremely low concentration of ribonucleoside triphosphate. The following conclusions were reached: (i) Labeled specific dinucleoside monophosphates are incorporated as chain initiators. (ii) When the ratio of sigma factor to core enzyme is small, there is a general stimulation by most 5′-guanosyl dinucleoside monophosphates. (iii) When the ratio is increased or holoenzyme is present, ApU, CpA, UpA, and GpU are the most effective stimulators. (iv) At high concentrations of sigma factor, only certain adenosine-containing dinucleoside monophosphates (ApU, CpA, UpA, and ApA) stimulate the reaction. (v) Competition hybridization studies indicate that the RNAs stimulated by dinucleoside monophosphates (ApU, CpA, UpA, and GpU) are of the T4 “early” type. (vi) Studies involving both combinations of stimulatory dinucleoside monophosphates and competitive effects of these compounds on chain initiation by ATP and GTP suggest that the stimulatory dinucleoside monophosphates act as chain initiators and may recognize part of a continuous sequence in a promoter region. Studies based on the incorporation of 3H-labeled stimulatory dinucleoside monophosphates support the above conclusions. PMID:4568732
Characterization of a prototype strain of hepatitis E virus.
Tsarev, S A; Emerson, S U; Reyes, G R; Tsareva, T S; Legters, L J; Malik, I A; Iqbal, M; Purcell, R H
1992-01-01
A strain of hepatitis E virus (SAR-55) implicated in an epidemic of enterically transmitted non-A, non-B hepatitis, now called hepatitis E, was characterized extensively. Six cynomolgus monkeys (Macaca fascicularis) were infected with a strain of hepatitis E virus from Pakistan. Reverse transcription-polymerase chain reaction was used to determine the pattern of virus shedding in feces, bile, and serum relative to hepatitis and induction of specific antibodies. Virtually the entire genome of SAR-55 (7195 nucleotides) was sequenced. Comparison of the sequence of SAR-55 with that of a Burmese strain revealed a high level of homology except for one region encoding 100 amino acids of a putative nonstructural polyprotein. Identification of this region as hypervariable was obtained by partial sequencing of a third isolate of hepatitis E virus from Kirgizia. Images PMID:1731327
Salem, Nidá M; Golino, Deborah A; Falk, Bryce W; Rowhani, Adib
2008-01-01
The three double-stranded (ds) RNAs were detected in Rosa multiflora plants showing rose spring dwarf (RSD) symptoms. Northern blot analysis revealed three dsRNAs in preparations of both dsRNA and total RNA from R. multiflora plants. The complete sequences of the dsRNAs (referred to as dsRNA 1, dsRNA 2 and dsRNA 3) were determined based on a combination of shotgun cloning of dsRNA cDNAs and reverse transcription-polymerase chain reaction (RT-PCR). The largest dsRNA (dsRNA 1) was 1,762 bp long with a single open reading frame (ORF) that encoded a putative polypeptide containing 479 amino acid residues with a molecular mass of 55.9 kDa. This polypeptide contains amino acid sequence motifs conserved in the RNA-dependent RNA polymerases (RdRp) of members of the family Partitiviridae. Both dsRNA 2 (1,475 bp) and dsRNA 3 (1,384 bp) contained single ORFs, encoding putative proteins of unknown function. The 5' untranslated regions (UTR) of all three segments shared regions of high sequence homology. Phylogenetic analysis using the RdRp sequences of the various partitiviruses revealed that the new sequences would constitute the genome of a virus in family Partitiviridae. This virus would cluster with Fragaria chiloensis cryptic virus and Raphanus sativus cryptic virus 2. We suggest that the three dsRNA segments constitute the genome of a novel cryptic virus infecting roses; we propose the name Rosa multiflora cryptic virus (RMCV). Detection primers were developed and used for RT-PCR detection of RMCV in rose plants.
Mapping DNA polymerase errors by single-molecule sequencing
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lee, David F.; Lu, Jenny; Chang, Seungwoo
Genomic integrity is compromised by DNA polymerase replication errors, which occur in a sequence-dependent manner across the genome. Accurate and complete quantification of a DNA polymerase's error spectrum is challenging because errors are rare and difficult to detect. We report a high-throughput sequencing assay to map in vitro DNA replication errors at the single-molecule level. Unlike previous methods, our assay is able to rapidly detect a large number of polymerase errors at base resolution over any template substrate without quantification bias. To overcome the high error rate of high-throughput sequencing, our assay uses a barcoding strategy in which each replicationmore » product is tagged with a unique nucleotide sequence before amplification. Here, this allows multiple sequencing reads of the same product to be compared so that sequencing errors can be found and removed. We demonstrate the ability of our assay to characterize the average error rate, error hotspots and lesion bypass fidelity of several DNA polymerases.« less
Mapping DNA polymerase errors by single-molecule sequencing
Lee, David F.; Lu, Jenny; Chang, Seungwoo; ...
2016-05-16
Genomic integrity is compromised by DNA polymerase replication errors, which occur in a sequence-dependent manner across the genome. Accurate and complete quantification of a DNA polymerase's error spectrum is challenging because errors are rare and difficult to detect. We report a high-throughput sequencing assay to map in vitro DNA replication errors at the single-molecule level. Unlike previous methods, our assay is able to rapidly detect a large number of polymerase errors at base resolution over any template substrate without quantification bias. To overcome the high error rate of high-throughput sequencing, our assay uses a barcoding strategy in which each replicationmore » product is tagged with a unique nucleotide sequence before amplification. Here, this allows multiple sequencing reads of the same product to be compared so that sequencing errors can be found and removed. We demonstrate the ability of our assay to characterize the average error rate, error hotspots and lesion bypass fidelity of several DNA polymerases.« less
Polymerase Chain Reaction for Detection of Systemic Plant Pathogens
USDA-ARS?s Scientific Manuscript database
This chapter outlines the advances and application of the polymerase chain reaction (PCR) since its development in 1984 and its enhancements and applications to detection of viruses, viroids and phytoplasma in pome and stone fruits. PCR is probably the most rapidly and widely adopted technology eve...
Zambenedetti, Miriam Ribas; Pavoni, Daniela Parada; Dallabona, Andreia Cristine; Dominguez, Alejandro Correa; Poersch, Celina de Oliveira; Fragoso, Stenio Perdigão; Krieger, Marco Aurélio
2017-05-01
Real-time reverse transcription polymerase chain reaction (RT-PCR) is routinely used to detect viral infections. In Brazil, it is mandatory the use of nucleic acid tests to detect hepatitis C virus (HCV), hepatitis B virus and human immunodeficiency virus in blood banks because of the immunological window. The use of an internal control (IC) is necessary to differentiate the true negative results from those consequent from a failure in some step of the nucleic acid test. The aim of this study was the construction of virus-modified particles, based on MS2 bacteriophage, to be used as IC for the diagnosis of RNA viruses. The MS2 genome was cloned into the pET47b(+) plasmid, generating pET47b(+)-MS2. MS2-like particles were produced through the synthesis of MS2 RNA genome by T7 RNA polymerase. These particles were used as non-competitive IC in assays for RNA virus diagnostics. In addition, a competitive control for HCV diagnosis was developed by cloning a mutated HCV sequence into the MS2 replicase gene of pET47b(+)-MS2, which produces a non-propagating MS2 particle. The utility of MS2-like particles as IC was evaluated in a one-step format multiplex real-time RT-PCR for HCV detection. We demonstrated that both competitive and non-competitive IC could be successfully used to monitor the HCV amplification performance, including the extraction, reverse transcription, amplification and detection steps, without compromising the detection of samples with low target concentrations. In conclusion, MS2-like particles generated by this strategy proved to be useful IC for RNA virus diagnosis, with advantage that they are produced by a low cost protocol. An attractive feature of this system is that it allows the construction of a multicontrol by the insertion of sequences from more than one pathogen, increasing its applicability for diagnosing different RNA viruses.
Zambenedetti, Miriam Ribas; Pavoni, Daniela Parada; Dallabona, Andreia Cristine; Dominguez, Alejandro Correa; Poersch, Celina de Oliveira; Fragoso, Stenio Perdigão; Krieger, Marco Aurélio
2017-01-01
BACKGROUND Real-time reverse transcription polymerase chain reaction (RT-PCR) is routinely used to detect viral infections. In Brazil, it is mandatory the use of nucleic acid tests to detect hepatitis C virus (HCV), hepatitis B virus and human immunodeficiency virus in blood banks because of the immunological window. The use of an internal control (IC) is necessary to differentiate the true negative results from those consequent from a failure in some step of the nucleic acid test. OBJECTIVES The aim of this study was the construction of virus-modified particles, based on MS2 bacteriophage, to be used as IC for the diagnosis of RNA viruses. METHODS The MS2 genome was cloned into the pET47b(+) plasmid, generating pET47b(+)-MS2. MS2-like particles were produced through the synthesis of MS2 RNA genome by T7 RNA polymerase. These particles were used as non-competitive IC in assays for RNA virus diagnostics. In addition, a competitive control for HCV diagnosis was developed by cloning a mutated HCV sequence into the MS2 replicase gene of pET47b(+)-MS2, which produces a non-propagating MS2 particle. The utility of MS2-like particles as IC was evaluated in a one-step format multiplex real-time RT-PCR for HCV detection. FINDINGS We demonstrated that both competitive and non-competitive IC could be successfully used to monitor the HCV amplification performance, including the extraction, reverse transcription, amplification and detection steps, without compromising the detection of samples with low target concentrations. In conclusion, MS2-like particles generated by this strategy proved to be useful IC for RNA virus diagnosis, with advantage that they are produced by a low cost protocol. An attractive feature of this system is that it allows the construction of a multicontrol by the insertion of sequences from more than one pathogen, increasing its applicability for diagnosing different RNA viruses. PMID:28403327
Direct detection of Streptococcus mutans in human dental plaque by polymerase chain reaction.
Igarashi, T; Yamamoto, A; Goto, N
1996-10-01
Streptococcus mutans is an etiological agent in human dental caries. A method for the detection of S. mutans directly from human dental plaque by polymerase chain reaction has been developed. Oligonucleotide primers specific for a portion of the dextranase gene (dexA) of S. mutans Ingbritt (serotype c) were designed to amplify a 1272-bp DNA fragment by polymerase chain reaction. The present method specifically detected S. mutans (serotypes c, e and f), but none of the other mutans streptococci: S. cricetus (serotype a), S. rattus (serotype b), S. sobrinus (serotypes d and g), and S. downei (serotype h), other gram-positive bacteria (16 strains of 12 species of cocci and 18 strains of 12 species of bacilli) nor gram-negative bacteria (1 strain of 1 species of cocci and 20 strains of 18 species of bacilli). The method was capable of detecting 1 pg of the chromosomal DNA purified from S. mutans Ingbritt and as few as 12 colony-forming units of S. mutans cells. The S. mutans cells in human dental plaque were also directly detected. Seventy clinical isolates of S. mutans isolated from the dental plaque of 8 patients were all positive by the polymerase chain reaction. These results suggest that the dexA polymerase chain reaction is suitable for the specific detection and identification of S. mutans.
Modeling qRT-PCR dynamics with application to cancer biomarker quantification.
Chervoneva, Inna; Freydin, Boris; Hyslop, Terry; Waldman, Scott A
2017-01-01
Quantitative reverse transcription polymerase chain reaction (qRT-PCR) is widely used for molecular diagnostics and evaluating prognosis in cancer. The utility of mRNA expression biomarkers relies heavily on the accuracy and precision of quantification, which is still challenging for low abundance transcripts. The critical step for quantification is accurate estimation of efficiency needed for computing a relative qRT-PCR expression. We propose a new approach to estimating qRT-PCR efficiency based on modeling dynamics of polymerase chain reaction amplification. In contrast, only models for fluorescence intensity as a function of polymerase chain reaction cycle have been used so far for quantification. The dynamics of qRT-PCR efficiency is modeled using an ordinary differential equation model, and the fitted ordinary differential equation model is used to obtain effective polymerase chain reaction efficiency estimates needed for efficiency-adjusted quantification. The proposed new qRT-PCR efficiency estimates were used to quantify GUCY2C (Guanylate Cyclase 2C) mRNA expression in the blood of colorectal cancer patients. Time to recurrence and GUCY2C expression ratios were analyzed in a joint model for survival and longitudinal outcomes. The joint model with GUCY2C quantified using the proposed polymerase chain reaction efficiency estimates provided clinically meaningful results for association between time to recurrence and longitudinal trends in GUCY2C expression.
Identifying of meat species using polymerase chain reaction (PCR)
NASA Astrophysics Data System (ADS)
Foong, Chow Ming; Sani, Norrakiah Abdullah
2013-11-01
Meat has been widely consumed as an important protein source in daily life of human. Furthermore, with busy and intense urban lifestyle, processed food is now one of the main protein sources of one's diet. Consumers rely on the food labeling to decide if the meat product purchased is safe and reliable. Therefore, it is important to ensure the food labeling is done in a correct manner to avoid consumer fraud. More consumers are now concern about the food quality and safety as compared to before. This study described the meat species identification and detection method using Polymerase Chain Reaction (PCR) in 8 types of meats (cattle, buffalo, goat, sheep, chicken, duck, pork and horse). The objective of this study is to decide on the specificity of oligonucleotide sequences obtained from previous study. There were 5 proposed oligonucleotide primer in this study. The main important finding in this work is the specificity of oligonucleotide primers to raw meats. It if found that the oligonucleotide primers proposed were not specific to the local raw meat species. Therefore, further study is needed to obtain a species-specific oligonucletide primers for PCR, in order to be applied in food product testing.
Meyer, K; Rosa, C; Hischenhuber, C; Meyer, R
2001-01-01
A polymerase chain reaction (PCR) was developed to differentiate the thickening agents locust bean gum (LBG) and the cheaper guar gum in finished food products. Universal primers for amplification of the intergenic spacer region between trnL 3' (UAA) exon and trnF (GAA) gene in the chloroplast (cp) genome and subsequent restriction analysis were applied to differentiate guar gum and LBG. The presence of <5% (w/w) guar gum powder added to LBG powder was detectable. Based on data obtained from sequencing this intergenic spacer region, a second PCR method for the specific detection of guar gum DNA was also developed. This assay detected guar gum powder in LBG in amounts as low as 1% (w/w). Both methods successfully detected guar gum and/or LBG in ice cream stabilizers and in foodstuffs, such as dairy products, ice cream, dry seasoning mixes, a finished roasting sauce, and a fruit jelly product, but not in products with highly degraded DNA, such as tomato ketchup and sterilized chocolate cream. Both methods detected guar gum and LBG in ice cream and fresh cheese at levels <0.1%.
Suin, Vanessa; Nazé, Florence; Francart, Aurélie; Lamoral, Sophie; De Craeye, Stéphane; Kalai, Michael; Van Gucht, Steven
2014-01-01
A generic two-step lyssavirus real-time reverse transcriptase polymerase chain reaction (qRT-PCR), based on a nested PCR strategy, was validated for the detection of different lyssavirus species. Primers with 17 to 30% of degenerate bases were used in both consecutive steps. The assay could accurately detect RABV, LBV, MOKV, DUVV, EBLV-1, EBLV-2, and ABLV. In silico sequence alignment showed a functional match with the remaining lyssavirus species. The diagnostic specificity was 100% and the sensitivity proved to be superior to that of the fluorescent antigen test. The limit of detection was ≤ 1 50% tissue culture infectious dose. The related vesicular stomatitis virus was not recognized, confirming the selectivity for lyssaviruses. The assay was applied to follow the evolution of rabies virus infection in the brain of mice from 0 to 10 days after intranasal inoculation. The obtained RNA curve corresponded well with the curves obtained by a one-step monospecific RABV-qRT-PCR, the fluorescent antigen test, and virus titration. Despite the presence of degenerate bases, the assay proved to be highly sensitive, specific, and reproducible.
Nazé, Florence; Francart, Aurélie; Lamoral, Sophie; De Craeye, Stéphane; Kalai, Michael
2014-01-01
A generic two-step lyssavirus real-time reverse transcriptase polymerase chain reaction (qRT-PCR), based on a nested PCR strategy, was validated for the detection of different lyssavirus species. Primers with 17 to 30% of degenerate bases were used in both consecutive steps. The assay could accurately detect RABV, LBV, MOKV, DUVV, EBLV-1, EBLV-2, and ABLV. In silico sequence alignment showed a functional match with the remaining lyssavirus species. The diagnostic specificity was 100% and the sensitivity proved to be superior to that of the fluorescent antigen test. The limit of detection was ≤1 50% tissue culture infectious dose. The related vesicular stomatitis virus was not recognized, confirming the selectivity for lyssaviruses. The assay was applied to follow the evolution of rabies virus infection in the brain of mice from 0 to 10 days after intranasal inoculation. The obtained RNA curve corresponded well with the curves obtained by a one-step monospecific RABV-qRT-PCR, the fluorescent antigen test, and virus titration. Despite the presence of degenerate bases, the assay proved to be highly sensitive, specific, and reproducible. PMID:24822188
Beebe, N W; van den Hurk, A F; Chapman, H F; Frances, S P; Williams, C R; Cooper, R D
2002-03-01
Members of the Culex sitiens subgroup are important vectors of arboviruses, including Japanese encephalitis virus, Murray Valley encephalitis virus and Ross River virus. Of the eight described species, Cx. annulirostris Skuse, Cx. sitiens Wiedemann, and Cx. palpalis Taylor appear to be the most abundant and widespread throughout northern Australia and Papua New Guinea (PNG). Recent investigations using allozymes have shown this subgroup to contain cryptic species that possess overlapping adult morphology. We report the development of a polymerase chain reaction-restriction fragment-length polymorphism (PCR-RFLP) procedure that reliably separates these three species. This procedure utilizes the sequence variation in the ribosomal DNA ITS1 and demonstrates species-specific PCR-RFLP profiles from both colony and field collected material. Assessment of the consistency of this procedure was undertaken on mosquitoes sampled from a wide geographic area including Australia, PNG, and the Solomon Islands. Overlapping adult morphology was observed for Cx. annulirostris and Cx. palpalis in both northern Queensland and PNG and for all three species at one site in northwest Queensland.
Jaravata, Carmela V; Smith, Wayne L; Rensen, Gabriel J; Ruzante, Juliana M; Cullor, James S
2006-01-01
A modified forensic DNA extraction and real-time fluorescent polymerase chain reaction assay has been evaluated for the detection of Mycobacterium avium subsp. paratuberculosis (MAP) in bovine fecal samples using primers and fluorescent resonance energy transfer (FRET) probes targeting the IS900 gene sequence of MAP. DNA was successfully extracted from manure samples by utilizing the Whatman FTA card technology, which allows for simple processing and storage of samples at room temperature. The FTA cards were washed and subjected to a Chelex-100 incubation to remove any remaining polymerase chain reaction (PCR) inhibitors and to elute the DNA from the FTA card. This isolated DNA was then subjected to direct real time fluorescent PCR analysis. Detection of MAP DNA from bovine fecal samples spiked with known concentrations of viable MAP cells was obtained. The detection limits of the assay was consistently found to be between 10(2) and 10(4) colony forming units [CFU]/g, with some samples containing as low as 10 CFU/g, yielding positive assay results. This cost-efficient assay allows reporting of results as early as 4 h after fecal collection, which can be particularly useful in highthroughput herd screening.
Late-onset Papillon-Lefèvre syndrome without alteration of the cathepsin C gene.
Pilger, Ulrike; Hennies, Hans Christian; Truschnegg, Astrid; Aberer, Elisabeth
2003-11-01
Mutations in the cathepsin C gene have recently been detected in Papillon-Lefèvre syndrome (PLS). Until now, 5 cases with the late-onset variation of this disease have been reported in the literature. The genetic background of this type of PLS is still unknown. We describe a 46-year-old woman with late-onset transgredient palmar hyperkeratosis and a 10-year history of severe periodontal disease. Histology of skin biopsy specimens revealed a psoriasiform pattern. Dental examination showed severe gingival inflammation with loss of alveolar bone. Dental plaque investigated by a polymerase chain reaction method revealed DNA signals of 5 different dental bacteria. DNA from EDTA blood was investigated for mutations in the cathepsin C gene by polymerase chain reaction analysis and direct sequencing. A silent variation in the codon for proline-459 was detected but interpreted as a polymorphism of this gene. All genetic linkage and mutation studies for PLS performed so far have shown that PLS is genetically homogeneous. Our patient with late-onset variation of PLS, however, did not show a mutation in the cathepsin C gene. Thus, we suspect that there is another genetic cause for the late-onset forms of PLS.
Lu, Jingrang; Gerke, Tammie L; Buse, Helen Y; Ashbolt, Nicholas J
2014-12-01
A quantitative polymerase chain reaction assay (115 bp amplicon) specific to Escherichia coli K12 with an ABI(TM) internal control was developed based on sequence data encoding the rfb gene cluster. Assay specificity was evaluated using three E. coli K12 strains (ATCC W3110, MG1655 & DH1), 24 non-K12 E. coli and 23 bacterial genera. The biofilm detection limit was 10(3) colony-forming units (CFU) E. coli K12 mL(-1), but required a modified protocol, which included a bio-blocker Pseudomonas aeruginosa with ethylenediaminetetraacetic acid buffered to pH 5 prior to cell lysis/DNA extraction. The novel protocol yielded the same sensitivity for drinking water biofilms associated with Fe3O4 (magnetite)-coated SiO2 (quartz) grains and biofilm-surface iron corrosion products from a drinking water distribution system. The novel DNA extraction protocol and specific E. coli K12 assay are sensitive and robust enough for detection and quantification within iron drinking water pipe biofilms, and are particularly well suited for studying enteric bacterial interactions within biofilms.
Wanji, Samuel; Kengne-Ouafo, Arnaud J.; Joan Eyong, Ebanga E.; Kimbi, Helen K.; Tendongfor, Nicholas; Ndamukong-Nyanga, Judith L.; Nana-Djeunga, Hugues C.; Bourguinat, Catherine; Sofeu-Feugaing, David D.; Charvet, Claude L.
2012-01-01
The present study analyzed the relationship between the genetic diversity of Plasmodium falciparum and parasitologic/entomologic indices in the Mount Cameroon region by using merozoite surface protein 1 as a genetic marker. Blood samples were collected from asymptomatic children from three altitude zones (high, intermediate, and low). Parasitologic and entomologic indices were determined by microscopy and landing catch mosquito collection/circumsporozoite protein–enzyme-linked immunosorbent assay, respectively. A total of 142 randomly selected P. falciparum-positive blood samples were genotyped by using a nested polymerase chain reaction–based technique. K-1 polymerase chain reaction products were also sequenced. As opposed to high altitude, the highest malaria prevalence (70.65%) and entomologic inoculation rate (2.43 infective/bites/night) were recorded at a low altitude site. Seven (18.91%), 22 (36.66%), and 19 (42.22%) samples from high, intermediate, and low altitudes, respectively, contained multiclonal infections. A new K-1 polymorphism was identified. This study shows a positive non-linear association between low/intermediate altitude (high malaria transmission) and an increase in P. falciparum merozoite surface protein 1 block 2 polymorphisms. PMID:22556072
Single nucleotide polymorphism discrimination with and without an ethidium bromide intercalator.
Fenati, Renzo A; Connolly, Ashley R; Ellis, Amanda V
2017-02-15
Single nucleotide polymorphism (SNP) genotyping is an important aspect in understanding genetic variations. Here, we discriminate SNPs using toe-hold mediated displacement reactions. The biological target is an 80 nucleotide long double-stranded-DNA from the mtDNA HV1 region, associated with maternal ancestry. This target has been specially designed with a pendant toehold and a cationic fluorophore, ATTO 647N, as a reporter, produced in a polymerase chain reaction. Rates of reaction for the toehold-polymerase chain reaction products (TPPs) with their corresponding complementary displacing sequences, labelled with a Black Hole Quencher 1, followed the order TPP-Cytosine > TPP-Thymine > TPP-Adenine ≥ TPP-Guanine. Non-complementary rates were the slowest with mismatches involving cytosine. These reactions, operating in a static/or contact mode, gave averaged readouts between SNPs within 15 min (with 80-90% quenching), compared to 25-30 min in previous studies involving fluorescence resonance energy transfer. Addition of an intercalating agent, ethidium bromide, retarded the rate of reaction in which cytosine was involved, presumably through stabilization of the base pairing, which resulted in markedly improved discrimination of cytosine containing SNPs. Copyright © 2016 Elsevier B.V. All rights reserved.
Jiang, Chao; Luo, Yu-Qing; Yuan, Yuan; Huang, Lu-Qi; Jin, Yan; Zhao, Yu-Yang
2017-04-01
To achieve a molecular method to identify Panax ginseng, P. notoginseng,P. quinquefolius and their admixture. The ITS,18S and matK sequences of Panax genus were analyzed to develop species-specific SNP marker. Three pairs of species-specific primers were designed to establish a multiplex allele-specific polymerase chain reaction (MAS-PCR) and the samples from different region were tested. The results showed that when the annealing temperature was 60 ℃ and the cycle number was 35, approximately 250, 500,1 000 bp specific band were obtained from P. ginseng, P. notoginseng and P. quinquefolius obtain, respectively. This method could also be used to authentificate admixture samples and could detect 0.5% percent of P. notoginseng or P. quinquefolius adulterated in P. ginseng, or 0.5% percent of P. ginseng or P. quinquefolius adulterated in P. notoginseng. The detect limit of P. ginseng in P. quinquefolius was 0.5% and P. notoginseng in P. quinquefolius was 1%. This results showed that the present method could be used as a promise method to identify Panax ginseng, P. notoginseng, P. quinquefolius and their admixture. Copyright© by the Chinese Pharmaceutical Association.
Lund, Vidar; Fonahn, Wenche; Pettersen, Jens Erik; Caugant, Dominique A; Ask, Eirik; Nysaeter, Ase
2014-09-01
Cases of Legionnaires' disease associated with biological treatment plants (BTPs) have been reported in six countries between 1997 and 2010. However, knowledge about the occurrence of Legionella in BTPs is scarce. Hence, we undertook a qualitative and quantitative screening for Legionella in BTPs treating waste water from municipalities and industries in Norway, to assess the transmission potential of Legionella from these installations. Thirty-three plants from different industries were sampled four times within 1 year. By cultivation, 21 (16%) of 130 analyses were positive for Legionella species and 12 (9%) of 130 analyses were positive for Legionella pneumophila. By quantitative real-time polymerase chain reaction (PCR), 433 (99%) of 437 analyses were positive for Legionella species and 218 (46%) of 470 analyses were positive for L. pneumophila. This survey indicates that PCR could be the preferable method for detection of Legionella in samples from BTPs. Sequence types of L. pneumophila associated with outbreaks in Norway were not identified from the BTPs. We showed that a waste water treatment plant with an aeration basin can produce high concentrations of Legionella. Therefore, these plants should be considered as a possible source of community-acquired Legionella infections.
Serine proteases in rodent hippocampus.
Davies, B J; Pickard, B S; Steel, M; Morris, R G; Lathe, R
1998-09-04
Brain serine proteases are implicated in developmental processes, synaptic plasticity, and in disorders including Alzheimer's disease. The spectrum of the major enzymes expressed in brain has not been established previously. We now present a systematic study of the serine proteases expressed in adult rat and mouse hippocampus. Using a combination of techniques including polymerase chain reaction amplification and Northern blotting we show that tissue-type plasminogen activator (t-PA) is the major species represented. Unexpectedly, the next most abundant species were RNK-Met-1, a lymphocyte protease not reported previously in brain, and two new family members, BSP1 (brain serine protease 1) and BSP2. We report full-length sequences of the two new proteases; homologies indicate that these are of tryptic specificity. Although BSP2 is expressed in several brain regions, BSP1 expression is strikingly restricted to hippocampus. Other enzymes represented, but at lower levels, included elastase IV, proteinase 3, complement C2, chymotrypsin B, chymotrypsin-like protein, and Hageman factor. Although thrombin and urokinase-type plasminogen activator were not detected in the primary screen, low level expression was confirmed using specific polymerase chain reaction primers. In contrast, and despite robust expression of t-PA, the usual t-PA substrate plasminogen was not expressed at detectable levels.
Identifying of meat species using polymerase chain reaction (PCR)
DOE Office of Scientific and Technical Information (OSTI.GOV)
Foong, Chow Ming; Sani, Norrakiah Abdullah
Meat has been widely consumed as an important protein source in daily life of human. Furthermore, with busy and intense urban lifestyle, processed food is now one of the main protein sources of one’s diet. Consumers rely on the food labeling to decide if the meat product purchased is safe and reliable. Therefore, it is important to ensure the food labeling is done in a correct manner to avoid consumer fraud. More consumers are now concern about the food quality and safety as compared to before. This study described the meat species identification and detection method using Polymerase Chain Reactionmore » (PCR) in 8 types of meats (cattle, buffalo, goat, sheep, chicken, duck, pork and horse). The objective of this study is to decide on the specificity of oligonucleotide sequences obtained from previous study. There were 5 proposed oligonucleotide primer in this study. The main important finding in this work is the specificity of oligonucleotide primers to raw meats. It if found that the oligonucleotide primers proposed were not specific to the local raw meat species. Therefore, further study is needed to obtain a species-specific oligonucletide primers for PCR, in order to be applied in food product testing.« less
Jain, Neha; Merwyn, S; Rai, G P; Agarwal, G S
2012-05-01
Real-time polymerase chain reaction (real-time PCR) is a laboratory technique based on PCR. This technique is able to detect sequence-specific PCR products as they accumulate in "real time" during the PCR amplification, and also to quantify the number of substrates present in the initial PCR mixture before amplification begins. In the present study, real-time PCR assay was employed for rapid and real-time detection of Bacillus anthracis spores spiked in 0.1 g of soil and talcum powder ranging from 5 to 10(7) spores. DNA was isolated from spiked soil and talcum powder, using PBS containing 1 % Triton-X-100, followed by heat treatment. The isolated DNA was used as template for real-time PCR and PCR. Real-time PCR amplification was obtained in 60 min under the annealing condition at 60°C by employing primers targeting the pag gene of B. anthracis. In the present study, the detection limit of real-time PCR assay in soil was 10(3) spores and 10(2) spores in talcum powder, respectively, whereas PCR could detect 10(4) spores in soil and 10(3) spores in talcum powder, respectively.
Xie, Liji; Xie, Zhixun; Huang, Li; Wang, Sheng; Huang, Jiaoling; Zhang, Yanfang; Zeng, Tingting; Luo, Sisi
2017-11-01
Sequence analysis of duck plague virus (DPV) revealed that there was a 528bp (B fragment) deletion within the UL2 gene of DPV attenuated vaccine strain in comparison with field virulent strains. The finding of gene deletion provides a potential differentiation test between DPV virulent strain and attenuated strain based on their UL2 gene sizes. Thus we developed a polymerase chain reaction (PCR) assay targeting to the DPV UL2 gene for simultaneous detection of DPV virulent strain and attenuated strain, 827bp for virulent strain and 299bp for attenuated strain. This newly developed PCR for DPV was highly sensitive and specific. It detected as low as 100fg of DNA on both DPV virulent and attenuated strains, no same size bands were amplified from other duck viruses including duck paramyxovirus, duck tembusu virus, duck circovirus, Muscovy duck parvovirus, duck hepatitis virus type I, avian influenza virus and gosling plague virus. Therefore, this PCR assay can be used for the rapid, sensitive and specific detection of DPV virulent and attenuated strains affecting ducks. Copyright © 2017. Published by Elsevier B.V.
Di Francesco, Cristina E; Di Francesco, Daniela; Di Martino, Barbara; Speranza, Roberto; Santori, Domenico; Boari, Andrea; Marsilio, Fulvio
2012-01-01
A new highly sensitive and specific hemi-nested reverse transcription polymerase chain reaction (RT-PCR) assay was applied to detect nucleoprotein (NP) gene of Canine distemper virus (CDV) in samples collected from dogs showing respiratory, gastrointestinal, and neurological signs. Thirty-eight out of 86 samples were positive suggesting that despite the vaccination, canine distemper may still represent a high risk to the canine population. The 968 base pair (bp) fragments from the hemagglutinin (H) gene of 10 viral strains detected in positive samples were amplified and analyzed by restriction fragment length polymorphism (RFLP) using AluI and PsiI enzymes in order to differentiate among vaccine and wild-type CDV strains and to characterize the field viral strains. The products of the both enzymatic digestions allowed identification all viruses as wild strains of CDV. In addition, the RFLP analysis with AluI provided additional information about the identity level among the strains analyzed on the basis of the positions of the cleavage site in the nucleotide sequences of the H gene. The method could be a more useful and simpler method for molecular studies of CDV strains.
Wanji, Samuel; Kengne-Ouafo, Arnaud J; Eyong, Ebanga E Joan; Kimbi, Helen K; Tendongfor, Nicholas; Ndamukong-Nyanga, Judith L; Nana-Djeunga, Hugues C; Bourguinat, Catherine; Sofeu-Feugaing, David D; Charvet, Claude L
2012-05-01
The present study analyzed the relationship between the genetic diversity of Plasmodium falciparum and parasitologic/entomologic indices in the Mount Cameroon region by using merozoite surface protein 1 as a genetic marker. Blood samples were collected from asymptomatic children from three altitude zones (high, intermediate, and low). Parasitologic and entomologic indices were determined by microscopy and landing catch mosquito collection/circumsporozoite protein-enzyme-linked immunosorbent assay, respectively. A total of 142 randomly selected P. falciparum-positive blood samples were genotyped by using a nested polymerase chain reaction-based technique. K-1 polymerase chain reaction products were also sequenced. As opposed to high altitude, the highest malaria prevalence (70.65%) and entomologic inoculation rate (2.43 infective/bites/night) were recorded at a low altitude site. Seven (18.91%), 22 (36.66%), and 19 (42.22%) samples from high, intermediate, and low altitudes, respectively, contained multiclonal infections. A new K-1 polymorphism was identified. This study shows a positive non-linear association between low/intermediate altitude (high malaria transmission) and an increase in P. falciparum merozoite surface protein 1 block 2 polymorphisms.
Polymerase chain reaction for detection of invasive Shigella flexneri in food.
Lampel, K A; Jagow, J A; Trucksess, M; Hill, W E
1990-06-01
The polymerase chain reaction (PCR) was used to amplify a 760-base-pair (bp) fragment with the 220-kbp invasive plasmids of enteroinvasive Escherichia coli, Shigella flexneri, Shigella dysenteriae, Shigella boydii, and Shigella sonnei as templates. This PCR product was easily detected by agarose gel electrophoresis. A 210-bp AccI-PstI fragment lying within the amplified region was used as a probe in Southern hybridization blots and showed that the PCR-generated product was derived from the invasive plasmid. The application of PCR as a rapid method to detect enteroinvasive bacteria in foods was tested by inoculating lettuce with 10(4) S. flexneri cells per g in shigella broth base. Plasmid DNA was isolated from cultures of inoculated and uninoculated lettuce in broth after 0, 4, and 24 h of incubation. With the PCR, the 760-bp fragment was generated only from lettuce inoculated with S. flexneri, as shown by gel electrophoresis and confirmed both by Southern blotting and by nucleotide sequencing of the amplified region. Because the isolation of plasmid DNA, the performance of PCR, and gel electrophoresis all can be completed in 6 to 7 h, invasive enteric bacteria can be detected in less than 1 day.
PCR Amplicon Prediction from Multiplex Degenerate Primer and Probe Sets
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gardner, S. N.
2013-08-08
Assessing primer specificity and predicting both desired and off-target amplification products is an essential step for robust PCR assay design. Code is described to predict potential polymerase chain reaction (PCR) amplicons in a large sequence database such as NCBI nt from either singleplex or a large multiplexed set of primers, allowing degenerate primer and probe bases, with target mismatch annotates amplicons with gene information automatically downloaded from NCBI, and optionally it can predict whether there are also TaqMan/Luminex probe matches within predicted amplicons.
Bilateral lenticular Encephalitozoon cuniculi infection in a snow leopard (Panthera uncia).
Scurrell, Emma Jane; Holding, Ellen; Hopper, Jane; Denk, Daniela; Fuchs-Baumgartinger, Andrea; Silbermayr, Katja; Nell, Barbara
2015-01-01
Bilateral phacoclastic uveitis caused by lenticular infection with Encephalitozoon cuniculi is described in a snow leopard. The diagnosis was made on histopathological and immunohistological examination of both eyes submitted after postmortem examination. There was a positive antibody titer for E. cuniculi (1:320). Polymerase chain reaction (PCR) and sequence analysis of formalin-fixed, paraffin-embedded ocular tissue detected the DNA of E. cuniculi, strain III. No other systemic lesions attributable to the E. cuniculi infection were identified. © 2014 American College of Veterinary Ophthalmologists.
Walker, J; Tait, A
1997-11-01
A reverse-transcriptase polymerase chain reaction (PCR) procedure was used to isolate an Ostertagia circumcincta partial cDNA encoding a protein with general primary sequence features characteristic of members of the mitochondrial processing peptidase (MPP) subfamily of M16 metallopeptidases. The structural relationships of the predicted protein (Oc MPPX) with MPP subfamily proteins from other species (including the model free-living nematode Caenorhabditis elegans) were examined, and Northern analysis confirmed the expression of the Oc mppx gene in adult nematodes.
Reavill, Drury R; Schmidt, Robert E
2012-01-01
Mycobacteriosis is a serious disease across many animal species. Approximately more than 120 species are currently recognized in the genus Mycobacterium. This article describes the zoonotic potential of mycobacteria and mycobacteriosis in fish, amphibians, rodents, rabbits, and ferrets. It considers clinical signs; histology; molecular methods of identification, such as polymerase chain reaction and DNA sequencing; routes of infection; and disease progression. Studying the disease in animals may aid in understanding the pathogenesis of mycobacterial infections in humans and identify better therapy and preventative options such as vaccines.
CYP3A4*18: it is not rare allele in Japanese population.
Yamamoto, Takehito; Nagafuchi, Nobue; Ozeki, Takeshi; Kubota, Takahiro; Ishikawa, Hiroshi; Ogawa, Seishi; Yamada, Yasuhiko; Hirai, Hisamaru; Iga, Tatsuji
2003-01-01
We sequenced all 13 exons of the CYP3A4 gene derived from 48 Japanese subjects. One subject possess the 20070 T>C mutation in the exon 10 (result in leu293Pro substitution, namely CYP3A4(*)18), as heterozygote. Thus, we investigated the frequency of CYP3A4(*)18 in 118 Japanese population using polymerase chain reaction-restriction fragment length polymorphism with Msp I and determined that the frequency of the CYP3A4(*)18 allele was 1.3%.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kamb, A.; Weir, M.; Rudy, B.
1989-06-01
The study of gene family members has been aided by the isolation of related genes on the basis of DNA homology. The authors have adapted the polymerase chain reaction to screen animal genomes very rapidly and reliably for likely gene family members. Using conserved amino acid sequences to design degenerate oligonucleotide primers, they have shown that the genome of the nematode Caenorhabditis elegans contains sequences homologous to many Drosophila genes involved in pattern formation, including the segment polarity gene wingless (vertebrate int-1), and homeobox sequences characteristic of the Antennapedia, engrailed, and paired families. In addition, they have used this methodmore » to show that C. elegans contains at least five different sequences homologous to genes in the tyrosine kinase family. Lastly, they have isolated six potassium channel sequences from humans, a result that validates the utility of the method with large genomes and suggests that human potassium channel gene diversity may be extensive.« less
Flanking sequence determination and specific PCR identification of transgenic wheat B102-1-2.
Cao, Jijuan; Xu, Junyi; Zhao, Tongtong; Cao, Dongmei; Huang, Xin; Zhang, Piqiao; Luan, Fengxia
2014-01-01
The exogenous fragment sequence and flanking sequence between the exogenous fragment and recombinant chromosome of transgenic wheat B102-1-2 were successfully acquired using genome walking technology. The newly acquired exogenous fragment encoded the full-length sequence of transformed genes with transformed plasmid and corresponding functional genes including ubi, vector pBANF-bar, vector pUbiGUSPlus, vector HSP, reporter vector pUbiGUSPlus, promoter ubiquitin, and coli DH1. A specific polymerase chain reaction (PCR) identification method for transgenic wheat B102-1-2 was established on the basis of designed primers according to flanking sequence. This established specific PCR strategy was validated by using transgenic wheat, transgenic corn, transgenic soybean, transgenic rice, and non-transgenic wheat. A specifically amplified target band was observed only in transgenic wheat B102-1-2. Therefore, this method is characterized by high specificity, high reproducibility, rapid identification, and excellent accuracy for the identification of transgenic wheat B102-1-2.
Differences in a ribosomal DNA sequence of Strongylus species allows identification of single eggs.
Campbell, A J; Gasser, R B; Chilton, N B
1995-03-01
In the current study, molecular techniques were evaluated for the species identification of individual strongyle eggs. Adult worms of Strongylus edentatus, S. equinus and S. vulgaris were collected at necropsy from horses from Australia and the U.S.A. Genomic DNA was isolated and a ribosomal transcribed spacer (ITS-2) amplified and sequenced using polymerase chain reaction (PCR) techniques. The length of the ITS-2 sequence of S. edentatus, S. equinus and S. vulgaris ranged between 217 and 235 nucleotides. Extensive sequence analysis demonstrated a low degree (0-0.9%) of intraspecific variation in the ITS-2 for the Strongylus species examined, whereas the levels of interspecific differences (13-29%) were significantly greater. Interspecific differences in the ITS-2 sequences allowed unequivocal species identification of single worms and eggs using PCR-linked restriction fragment length polymorphism. These results demonstrate the potential of the ribosomal spacers as genetic markers for species identification of single strongyle eggs from horse faeces.
2004-01-01
Abstract The purpose of this study was to evaluate the cationic trypsinogen gene in miniature schnauzers for possible mutations. Genetic mutations have been linked with hereditary pancreatitis in humans. Four miniature schnauzers were selected on the basis of a clinical history of pancreatitis. One healthy miniature schnauzer and 1 healthy mixed breed canine were enrolled as controls. DNA was extracted from these canines using a commercial kit. Primers were designed to amplify the entire canine cationic trypsinogen cDNA sequence. A polymerase chain reaction (PCR) was performed and products were purified and sequenced. All sequences were then compared. The healthy control canine, a healthy miniature schnauzer, and the 4 miniature schnauzers with pancreatitis showed identical sequences of the cationic trypsinogen gene to the published sequence. We conclude that, in contrast to humans with hereditary pancreatitis, mutations of the cationic trypsinogen gene do not play a major role in the genesis of pancreatitis in the miniature schnauzer. PMID:15581228
Bishop, Micah A; Steiner, Jörg M; Moore, Lisa E; Williams, David A
2004-10-01
The purpose of this study was to evaluate the cationic trypsinogen gene in miniature schnauzers for possible mutations. Genetic mutations have been linked with hereditary pancreatitis in humans. Four miniature schnauzers were selected on the basis of a clinical history of pancreatitis. One healthy miniature schnauzer and 1 healthy mixed breed canine were enrolled as controls. DNA was extracted from these canines using a commercial kit. Primers were designed to amplify the entire canine cationic trypsinogen cDNA sequence. A polymerase chain reaction (PCR) was performed and products were purified and sequenced. All sequences were then compared. The healthy control canine, a healthy miniature schnauzer, and the 4 miniature schnauzers with pancreatitis showed identical sequences of the cationic trypsinogen gene to the published sequence. We conclude that, in contrast to humans with hereditary pancreatitis, mutations of the cationic trypsinogen gene do not play a major role in the genesis of pancreatitis in the miniature schnauzer.
Biswas, B; Mukherjee, D; Mattingly-Napier, B L; Dutta, S K
1991-10-01
Genomic amplification by the polymerase chain reaction (PCR) was used to identify a unique genomic sequence of Ehrlichia risticii directly in DNA isolated from peripheral-blood buffy coat cells of E. risticii-infected horses (Potomac horse fever) and from infected cell cultures. A specific primer pair, selected from a cloned, species-specific, 1-kb DNA fragment of the E. risticii genome as a template, was used for the amplification of the target DNA of 247 bp. The optimal number of 40 PCR cycles, determined by analyzing an amplification profile obtained with a constant Taq polymerase concentration, was used to achieve maximum amplification of the E. risticii DNA segment. Efficient amplification of target DNA was achieved with specimens processed by either the phenol extraction or rapid lysis method. The specificity of the amplified DNA product was confirmed by the proper size (247 bp) and appropriate restriction enzyme cleavage pattern of the amplified target DNA, as well as by the specific hybridization signal obtained by using a PCR-amplified 185-bp internal DNA probe. A 10(5)- to 10(6)-fold amplification of target DNA, which allowed detection of E. risticii from as few as two to three infected cells in culture and from a very small volume of buffy coat cells from infected horses, was achieved. This PCR amplification procedure was found to be highly specific and sensitive for the detection of E. risticii for the study of Potomac horse fever.
PCR performance of a thermostable heterodimeric archaeal DNA polymerase
Killelea, Tom; Ralec, Céline; Bossé, Audrey; Henneke, Ghislaine
2014-01-01
DNA polymerases are versatile tools used in numerous important molecular biological core technologies like the ubiquitous polymerase chain reaction (PCR), cDNA cloning, genome sequencing, and nucleic acid based diagnostics. Taking into account the multiple DNA amplification techniques in use, different DNA polymerases must be optimized for each type of application. One of the current tendencies is to reengineer or to discover new DNA polymerases with increased performance and broadened substrate spectra. At present, there is a great demand for such enzymes in applications, e.g., forensics or paleogenomics. Current major limitations hinge on the inability of conventional PCR enzymes, such as Taq, to amplify degraded or low amounts of template DNA. Besides, a wide range of PCR inhibitors can also impede reactions of nucleic acid amplification. Here we looked at the PCR performances of the proof-reading D-type DNA polymerase from P. abyssi, Pab-polD. Fragments, 3 kilobases in length, were specifically PCR-amplified in its optimized reaction buffer. Pab-polD showed not only a greater resistance to high denaturation temperatures than Taq during cycling, but also a superior tolerance to the presence of potential inhibitors. Proficient proof-reading Pab-polD enzyme could also extend a primer containing up to two mismatches at the 3' primer termini. Overall, we found valuable biochemical properties in Pab-polD compared to the conventional Taq, which makes the enzyme ideally suited for cutting-edge PCR-applications. PMID:24847315
Development of an ELA-DRA gene typing method based on pyrosequencing technology.
Díaz, S; Echeverría, M G; It, V; Posik, D M; Rogberg-Muñoz, A; Pena, N L; Peral-García, P; Vega-Pla, J L; Giovambattista, G
2008-11-01
The polymorphism of equine lymphocyte antigen (ELA) class II DRA gene had been detected by polymerase chain reaction-single-strand conformational polymorphism (PCR-SSCP) and reference strand-mediated conformation analysis. These methodologies allowed to identify 11 ELA-DRA exon 2 sequences, three of which are widely distributed among domestic horse breeds. Herein, we describe the development of a pyrosequencing-based method applicable to ELA-DRA typing, by screening samples from eight different horse breeds previously typed by PCR-SSCP. This sequence-based method would be useful in high-throughput genotyping of major histocompatibility complex genes in horses and other animal species, making this system interesting as a rapid screening method for animal genotyping of immune-related genes.
Mapping genes to human chromosome 19
DOE Office of Scientific and Technical Information (OSTI.GOV)
Connolly, Sarah
1996-05-01
For this project, 22 Expressed Sequence Tags (ESTs) were fine mapped to regions of human chromosome 19. An EST is a short DNA sequence that occurs once in the genome and corresponds to a single expressed gene. {sup 32}P-radiolabeled probes were made by polymerase chain reaction for each EST and hybridized to filters containing a chromosome 19-specific cosmid library. The location of the ESTs on the chromosome was determined by the location of the ordered cosmid to which the EST hybridized. Of the 22 ESTs that were sublocalized, 6 correspond to known genes, and 16 correspond to anonymous genes. Thesemore » localized ESTs may serve as potential candidates for disease genes, as well as markers for future physical mapping.« less
Lyme neuroborreliosis in 2 horses.
Imai, D M; Barr, B C; Daft, B; Bertone, J J; Feng, S; Hodzic, E; Johnston, J M; Olsen, K J; Barthold, S W
2011-11-01
Lyme neuroborreliosis--characterized as chronic, necrosuppurative to nonsuppurative, perivascular to diffuse meningoradiculoneuritis--was diagnosed in 2 horses with progressive neurologic disease. In 1 horse, Borrelia burgdorferi sensu stricto was identified by polymerase chain reaction amplification of B burgdorferi sensu stricto-specific gene targets (ospA, ospC, flaB, dbpA, arp). Highest spirochetal burdens were in tissues with inflammation, including spinal cord, muscle, and joint capsule. Sequence analysis of ospA, ospC, and flaB revealed 99.9% sequence identity to the respective genes in B burgdorferi strain 297, an isolate from a human case of neuroborreliosis. In both horses, spirochetes were visualized in affected tissues with Steiner silver impregnation and by immunohistochemistry, predominantly within the dense collagenous tissue of the dura mater and leptomeninges.
Molecular evidence of simian virus 40 infections in children
NASA Technical Reports Server (NTRS)
Butel, J. S.; Arrington, A. S.; Wong, C.; Lednicky, J. A.; Finegold, M. J.
1999-01-01
Recent studies have detected simian virus 40 (SV40) DNA in certain human tumors and normal tissues. The significance of human infections by SV40, which was first discovered as a contaminant of poliovirus vaccines used between 1955 and 1963, remains unknown. The occurrence of SV40 infections in unselected hospitalized children was evaluated. Polymerase chain reaction and DNA sequence analyses were done on archival tissue specimens from patients positive for SV40 neutralizing antibody. SV40 DNA was identified in samples from 4 of 20 children (1 Wilms' tumor, 3 transplanted kidney samples). Sequence variation among SV40 regulatory regions ruled out laboratory contamination of specimens. This study shows the presence of SV40 infections in pediatric patients born after 1982.
Molecular characterization of vancomycin-resistant Enterococcus faecium isolates from Bermuda
Akpaka, Patrick Eberechi; Kissoon, Shivnarine; Wilson, Clyde; Jayaratne, Padman; Smith, Ashley; Golding, George R.
2017-01-01
Molecular characteristics of vancomycin resistant enterococci isolates from Bermuda Island is currently unknown. This study was conducted to investigate phenotypic and genotypic characteristics of VRE isolates from Bermuda Island using the chromogenic agar, E-tests, polymerase chain reaction (PCR), pulsed-field gel electrophoresis (PFGE) and multilocus sequence typing (MLST). Eighteen E. faecium isolates were completely analyzed and were all resistant to vancomycin, susceptible to linezolid and quinupristin/dalfopristin, positive for vanA and esp genes. The MLST analysis confirmed most isolates were of the sequence types linked to clonal complex 17 (CC17) that is widely associated with outbreaks in hospitals. Infection control measures, antibiotic stewardship, and surveillance activities will continue to be a priority in hospital on the Island. PMID:28267763
Molecular characterization of vancomycin-resistant Enterococcus faecium isolates from Bermuda.
Akpaka, Patrick Eberechi; Kissoon, Shivnarine; Wilson, Clyde; Jayaratne, Padman; Smith, Ashley; Golding, George R
2017-01-01
Molecular characteristics of vancomycin resistant enterococci isolates from Bermuda Island is currently unknown. This study was conducted to investigate phenotypic and genotypic characteristics of VRE isolates from Bermuda Island using the chromogenic agar, E-tests, polymerase chain reaction (PCR), pulsed-field gel electrophoresis (PFGE) and multilocus sequence typing (MLST). Eighteen E. faecium isolates were completely analyzed and were all resistant to vancomycin, susceptible to linezolid and quinupristin/dalfopristin, positive for vanA and esp genes. The MLST analysis confirmed most isolates were of the sequence types linked to clonal complex 17 (CC17) that is widely associated with outbreaks in hospitals. Infection control measures, antibiotic stewardship, and surveillance activities will continue to be a priority in hospital on the Island.
Quantitative polymerase chain reaction (QPCR) can be used as a rapid method for detecting fecal indicator bacteria. Because false negative results can be caused by PCR inhibitors that co-extract with the DNA samples, an internal amplification control (IAC) should be run with eac...
Designing Polymerase Chain Reaction (PCR) Primer Multiplexes in the Forensic Laboratory
ERIC Educational Resources Information Center
Elkins, Kelly M.
2011-01-01
The polymerase chain reaction (PCR) is a common experiment in upper-level undergraduate biochemistry, molecular biology, and forensic laboratory courses as reagents and thermocyclers have become more affordable for institutions. Typically, instructors design PCR primers to amplify the region of interest and the students prepare their samples for…
A method was developed to remove environmental inhibitors from sample concentrates prior to detection of human enteric viruses using the reverse transcription-polymerase chain reaction (RT-PCR).Environmental inhibitors, concentrated along with viruses during water sample processi...
Objectives/Hypothesis: 1. to determine the mycology of the middle meatus using an endoscopically guided brush sampling technique and polymerase chain reaction laboratory processing of nasal mucous. 2. To compare the mycology of the middle meatus in patients with sinus disease to...
Ayo, Christiane Maria; Camargo, Ana Vitória da Silveira; Frederico, Fábio Batista; Siqueira, Rubens Camargo; Previato, Mariana; Murata, Fernando Henrique Antunes; Silveira-Carvalho, Aparecida Perpétuo; Barbosa, Amanda Pires; Brandão de Mattos, Cinara de Cássia; de Mattos, Luiz Carlos
2015-01-01
This study investigated whether polymorphisms of the MICA (major histocompatibility complex class I chain-related gene A) gene are associated with eye lesions due to Toxoplasma gondii infection in a group of immunocompetent patients from southeastern Brazil. The study enrolled 297 patients with serological diagnosis of toxoplasmosis. Participants were classified into two distinct groups after conducting fundoscopic exams according to the presence (n = 148) or absence (n = 149) of ocular scars/lesions due to toxoplasmosis. The group of patients with scars/lesions was further subdivided into two groups according to the type of the ocular manifestation observed: primary (n = 120) or recurrent (n = 28). Genotyping of the MICA and HLA alleles was performed by the polymerase chain reaction-sequence specific oligonucleotide technique (PCR-SSO; One Lambda®) and the MICA-129 polymorphism (rs1051792) was identified by nested polymerase chain reaction (PCR-RFLP). Significant associations involving MICA polymorphisms were not found. Although the MICA*002~HLA-B*35 haplotype was associated with increased risk of developing ocular toxoplasmosis (P-value = 0.04; OR = 2.20; 95% CI = 1.05-4.60), and the MICA*008~HLA-C*07 haplotype was associated with protection against the development of manifestations of ocular toxoplasmosis (P-value = 0.009; OR: 0.44; 95% CI: 0.22-0.76), these associations were not statistically significant after adjusting for multiple comparisons. MICA polymorphisms do not appear to influence the development of ocular lesions in patients diagnosed with toxoplasmosis in this study population.
Ayo, Christiane Maria; Camargo, Ana Vitória da Silveira; Frederico, Fábio Batista; Siqueira, Rubens Camargo; Previato, Mariana; Murata, Fernando Henrique Antunes; Silveira-Carvalho, Aparecida Perpétuo; Barbosa, Amanda Pires; Brandão de Mattos, Cinara de Cássia; de Mattos, Luiz Carlos
2015-01-01
This study investigated whether polymorphisms of the MICA (major histocompatibility complex class I chain-related gene A) gene are associated with eye lesions due to Toxoplasma gondii infection in a group of immunocompetent patients from southeastern Brazil. The study enrolled 297 patients with serological diagnosis of toxoplasmosis. Participants were classified into two distinct groups after conducting fundoscopic exams according to the presence (n = 148) or absence (n = 149) of ocular scars/lesions due to toxoplasmosis. The group of patients with scars/lesions was further subdivided into two groups according to the type of the ocular manifestation observed: primary (n = 120) or recurrent (n = 28). Genotyping of the MICA and HLA alleles was performed by the polymerase chain reaction-sequence specific oligonucleotide technique (PCR-SSO; One Lambda®) and the MICA-129 polymorphism (rs1051792) was identified by nested polymerase chain reaction (PCR-RFLP). Significant associations involving MICA polymorphisms were not found. Although the MICA*002~HLA-B*35 haplotype was associated with increased risk of developing ocular toxoplasmosis (P-value = 0.04; OR = 2.20; 95% CI = 1.05–4.60), and the MICA*008~HLA-C*07 haplotype was associated with protection against the development of manifestations of ocular toxoplasmosis (P-value = 0.009; OR: 0.44; 95% CI: 0.22–0.76), these associations were not statistically significant after adjusting for multiple comparisons. MICA polymorphisms do not appear to influence the development of ocular lesions in patients diagnosed with toxoplasmosis in this study population. PMID:26672749
[Research of Human-mouse Chimeric Antibodies Against Ebola Virus Nucleoprotein].
Zhou, Rongping; Sun, Lina; Liu, Yang; Wu, Wei; Li, Chuan; Liang, Mifang; Qiu, Peihong
2016-01-01
The Ebola virus is highly infectious and can result in death in ≤ 90% of infected subjects. Detection of the Ebola virus and diagnosis of infection are extremely important for epidemic control. Presently, Chinese laboratories detect the nucleic acids of the Ebola virus by real-time reverse transcription-polymerase chain reaction (RT-PCR). However, such detection takes a relatively long time and necessitates skilled personnel and expensive equipment. Enzyme-linked immunosorbent assay (ELISA) of serum is simple, easy to operate, and can be used to ascertain if a patient is infected with the Ebola virus as well as the degree of infection. Hence, ELISA can be used in epidemiological investigations and is a strong complement to detection of nucleic acids. Cases of Ebola hemorrhagic fever have not been documented in China, so quality-control material for positive serology is needed. Construction and expression of human-mouse chimeric antibodies against the nucleoprotein of the Ebola virus was carried out. Genes encoding variable heavy (VH) and variable light (VL) chains were extracted and amplified from murine hybridoma cells. Genes encoding the VH and VL chains of monoclonal antibodies were amplified by RT-PCR. According to sequence analyses, a primer was designed to amplify functional sequences relative to VH and VL chain. The eukaryotic expression vector HL51-14 carrying some human antibody heavy chain- and light chain-constant regions was used. IgG antibodies were obtained by transient transfection of 293T cells. Subsequently, immunological detection and immunological identification were identified by ELISA, immunofluorescence assay, and western blotting. These results showed that we constructed and purified two human- mouse chimeric antibodies.
The emphasis of this paper is to show that most probable number-polymerase chain reaction (MPNPCR) assay can be used to detect Cryptosporidium parvum in WWTP effluents as an alternative to immunfluorescent assay (IFA). I am concerned, however, that the paper suggests that all WW...
Using the Polymerase Chain Reaction in an Undergraduate Laboratory to Produce "DNA Fingerprints."
ERIC Educational Resources Information Center
Phelps, Tara L.; And Others
1996-01-01
Presents a laboratory exercise that demonstrates the sensitivity of the Polymerase Chain Reaction as well as its potential application to forensic analysis during a criminal investigation. Can also be used to introduce, review, and integrate population and molecular genetics topics such as genotypes, multiple alleles, allelic and genotypic…
Determining Annealing Temperatures for Polymerase Chain Reaction
ERIC Educational Resources Information Center
Porta, Angela R.; Enners, Edward
2012-01-01
The polymerase chain reaction (PCR) is a common technique used in high school and undergraduate science teaching. Students often do not fully comprehend the underlying principles of the technique and how optimization of the protocol affects the outcome and analysis. In this molecular biology laboratory, students learn the steps of PCR with an…
USDA-ARS?s Scientific Manuscript database
A duplex quantitative real-time polymerase chain reaction (qPCR) assay was developed to differentiate between Bolbophorus damnificus and Bolbophorus type II species cercariae. Both trematode species are prevalent throughout the commercial catfish industry,.as both infect the ram’s horn snail, Plano...
Ball, Inna; Hoferer, Marc; Marschang, Rachel E
2014-03-01
A cell line was established from whole 6-8-week-old central bearded dragon (Pogona vitticeps) embryos. Cells were mid-sized and showed an elongated and polymorphic form. The cell line grew in a monolayer and has been serially passaged for 17 passages at time of publication. This cell line has been used with samples from adenovirus polymerase chain reaction (PCR)-positive bearded dragons, and 2 virus isolates have been obtained so far. The isolates show a clear cytopathic effect in inoculated cells. Both virus isolates have been serially passaged on this cell line, and have been identified by PCR amplification and sequencing of a portion of the DNA-dependent DNA polymerase gene and show 100% nucleotide identity to the corresponding region of an agamid adenovirus. Electron microscopic examination of supernatant from infected cells demonstrated the presence of nonenveloped particles, with a diameter of approximately 80 nm in both virus isolates.
Loo, Jacky F C; Lau, P M; Ho, H P; Kong, S K
2013-10-15
Based on a recently reported ultra-sensitive bio-barcode (BBC) assay, we have developed an aptamer-based bio-barcode (ABC) alternative to detect a cell death marker cytochrome-c (Cyto-c) and its subsequent application to screen anti-cancer drugs. Aptamer is a short single-stranded DNA selected from a synthetic DNA library by virtue of its high binding affinity and specificity to its target based on its unique 3D structure from the nucleotide sequence after folding. In the BBC assay, an antigen (Ag) in analytes is captured by a micro-magnetic particle (MMP) coated with capturing antibodies (Abs). Gold nanoparticles (NPs) with another recognition Ab against the same target and hundreds of identical DNA molecules of known sequence are subsequently added to allow the formation of sandwich structures ([MMP-Ab1]-Ag-[Ab2-NP-DNA]). After isolating the sandwiches by a magnetic field, the DNAs hybridized to their complementary DNAs covalently bound on the NPs are released from the sandwiches after heating. Acting as an Ag identification tag, these bio-barcode DNAs with known DNA sequence are then amplified by polymerase chain reaction (PCR) and detected by fluorescence. In our ABC assay, we employed a Cyto-c-specific aptamer to substitute both the recognition Ab and barcode DNAs on the NPs in the BBC assay; and a novel isothermal recombinase polymerase amplification for the time-consuming PCR. The detection limit of our ABC assay for the Cyto-c was found to be 10 ng/mL and this new assay can be completed within 3h. Several potential anti-cancer drugs have been tested in vitro for their efficacy to kill liver cancer with or without multi-drug resistance. © 2013 Elsevier B.V. All rights reserved.
Goetz, Frederick W; Norberg, Birgitta; McCauley, Linda A R; Iliev, Dimitar B
2004-03-01
The full-length cDNA for the cod (Gadus morhua) StAR was cloned by RT-PCR and library screening using ovarian RNA. From the library screening, 2 size classes of cDNA were obtained; a 1577 bp cDNA (cStAR1) and a 2851 bp cDNA (cStAR2). The cStAR1 cDNA presumably encodes a protein of 286 amino acids. The cStAR2 cDNA was composed of 6 separated sequences that contained all of the coding regions of cStAR1 when added together, but also contained 5 noncoding regions not observed in cStAR1. Polymerase chain reactions of cod genomic DNA produced products slightly larger than cStAR2. The sequence of these products were the same as cStAR2 but revealed one additional noncoding region (intron). Thus, the fish StAR gene contains the same number of exons (7) and introns (6) as observed in mammals, but is approximately half the size of the mammalian gene. Using Northern analysis and RT-PCR, cStAR1 expression was observed only in testes, ovaries and head kidneys. Polymerase chain reaction products were also observed using cDNA from steroidogenic tissues and primers designed to regions specific for cStAR2, indicating that cStAR2 is expressed in tissues and may account for the presence of larger transcripts observed on Northern blots.
Han, Min; Kang, Xing; Liu, Zhengbin; Zhang, Tingting; Li, Yanwei; Chen, Chao; Wang, Huijuan
2017-07-01
HLA-B*57:01 is strongly associated with severe adverse drug reaction induced by the anti-HIV drug abacavir (ABC) and antibiotic flucloxacillin. This study was dedicated to establishing a new method for HLA-B*57:01 genotyping and investigating the HLA-B*57:01 distribution pattern in four Chinese populations. A single-tube duplex real-time polymerase chain reaction (PCR) system was established by combining the amplification refractory mutation system and TaqMan probe. The reliability of this assay was validated by comparing the genotyping results with those by sequence-based typing. With this assay, the distribution of HLA-B*57:01 in 354 blood samples from four ethnic groups, namely, Han, Tibetan, Uighur, and Buyei, was determined. A 100% concordance was observed between the results of real-time PCR and sequence-based typing in 50 Uighur samples. As low as 0.016 ng DNA that carried HLA-B*57:01 could be detected with this assay. HLA-B*57:01 carriers identified in 100 Northern Han Chinese, 104 Buyeis, 100 Tibetans, and 50 Uighurs were 0, 1 (0.96%), 3 (3%), and 6 (12%), respectively. The carrier rate of HLA-B*57:01 in Uighur was significantly higher than those in Northern Han (p = .001) and Buyei (p = .005). The newly established real-time PCR assay provides a rapid and reliable tool for HLA-B*57:01 allele screening before the prescription of ABC and flucloxacillin in clinical practice.
Guarene, Marco; Badulli, Carla; Cremaschi, Anna L; Sbarsi, Ilaria; Cacciatore, Rosalia; Tinelli, Carmine; Pasi, Annamaria; Bergamaschi, Paola; Perotti, Cesare G
2018-05-01
Allele-level donor-recipient match at HLA-A, HLA-B, HLA-C and HLA-DRB1 loci impacts the outcome after cord blood transplantation for hematologic malignancies and modifies the strategy of donor selection. High definition of both class I and II HLA loci at time of listing is a way to improve the attractiveness of cord blood bank inventories, reducing the time for donor search and procurement and simplifying donor choice, in particular, for patients of non-European heritage. In 2014, Luminex ® xMAP ® technology was introduced in our laboratory practice and was applied to cord blood units typing. In this study, we evaluated the impact of this strategy in comparison with the platform in use until 2013, relying on LiPA reverse polymerase chain reaction-sequence-specific oligonucleotide (revPCR-SSO) plus polymerase chain reaction-sequence-specific primer (PCR-SSP). In 2014, the time for testing was shorter (141 vs 181 days on average), the number of test repetitions was lower (in particular for HLA-A locus, p = 0.026), and the cost reduced (240.7 vs 395.6 euros per unit on average) compared to 2013, demonstrating that Luminex xMAP technology is superior to the previous approach. Luminex xMAP platform has useful application in cord blood banking programs, to achieve high-definition HLA typing of cord blood units at the time of banking in a quick, accurate, and cost-effective manner.
Isolation of Separate Ureaplasma Species From Endotracheal Secretions of Twin Patients.
Beeton, Michael L; Maxwell, Nicola C; Chalker, Victoria J; Brown, Rebecca J; Aboklaish, Ali F; Spiller, O Brad
2016-08-01
Isolation of Ureaplasma spp. from preterm neonates and the association with development of bronchopulmonary dysplasia has been previously investigated. However, few studies have contrasted the nature of infection in twins. In this article, we report that dizygotic twins (1 girl, 1 boy) born at 24 weeks gestation both yielded culturable Ureaplasma from endotracheal secretions. The samples were part of a serial blind collection cohort of ventilated premature neonates, and analysis of repeat cultures showed stable, separate infections over a period of 17 and 21 days, respectively. Immunoblot and probe-specific quantitative polymerase chain reaction analysis determined that Twin 1 was solely infected with Ureaplasma parvum (specifically, serovar 6 by gene sequencing), whereas Twin 2 was solely infected with Ureaplasma urealyticum (specifically, genotype A- serovars 2, 5, and 8 by gene sequencing). Immunoblot analysis found that the major surface antigen (multiple-banded antigen) altered relative mass for both strains during the course of infection. Quantitative polymerase chain reaction analysis of extracted endotracheal aspirates confirmed no evidence of mixed infection for either twin. Failure of sentinel ventilated preterm infants on the same ward to acquire Ureaplasma infection after the first week of birth suggests no cot-to-cot transfer of Ureaplasma infection occurred. This study demonstrated not only a contrasting clinical outcome for a set of twins infected with 2 separate species of Ureaplasma, but also the first real-time demonstration of multiple-banded antigen alteration and evolution of Ureaplasma over the course of a clinical infection. Copyright © 2016 by the American Academy of Pediatrics.
Yokoi, H; Kitahashi, T; Tanaka, T; Utagawa, E
2001-04-01
Through a year from April, 1999 to March, 2000, 20 samples, which consisted of raw sewage (2), chlorine-treated sewage (2), seawater (10) and naturally grown oysters (6), were collected monthly both from the sewage works at Mihama-ku, Chiba City and at a yacht harbor in Chiba City Bay, Japan. Astrovirus RNA were detected by reverse transcription-polymerase chain reaction (RT-PCR) and was typed by direct sequencing. Astrovirus positive products were detected from 9 samples (raw sewage; 1/2, chlorine-treated sewage; 2/2, seawater; 5/10 and oysters; 1/6) collected in April, 1999. In May, positive products were detected from 4 samples (raw sewage; 2/2 and seawater; 2/10). In June, only 1 positive product was detected from raw sewage. The number of positive samples showed a tendency to decrease and no positive products were detected from samples collected in July, 1999 to January, 2000. After that period, positive products were again detected from 3 samples (raw sewage; 1/2, chlorine-treated sewage; 2/2) collected in February, 2000. In March, the number of positive samples showed the peak and positive products were detected from 12 samples (raw sewage; 2/2, chlorine-treated sewage; 2/2, seawater; 7/10 and oysters: 1/6). Astrovirus positive products detected in April, May, June, July, 1999 and February, 2000 were classified into type 1 or 2 by sequencing, whereas in March, 2000 were type 1, 2, 3, 6 and 7.
Pan, Ling; Pasternak, David A; Xu, Jin; Xu, Mingming; Lu, Zhigang; Pasternak, Gavril W; Pan, Ying-Xian
2017-01-01
The sigma1 receptor acts as a chaperone at the endoplasmic reticulum, associates with multiple proteins in various cellular systems, and involves in a number of diseases, such as addiction, pain, cancer and psychiatric disorders. The sigma1 receptor is encoded by the single copy SIGMAR1 gene. The current study identifies five alternatively spliced variants of the mouse sigma1 receptor gene using a polymerase chain reaction cloning approach. All the splice variants are generated by exon skipping or alternative 3' or 5' splicing, producing the truncated sigma1 receptor. Similar alternative splicing has been observed in the human SIGMAR1 gene based on the molecular cloning or genome sequence prediction, suggesting conservation of alternative splicing of SIGMAR1 gene. Using quantitative polymerase chain reactions, we demonstrate differential expression of several splice variants in mouse tissues and brain regions. When expressed in HEK293 cells, all the splice variants fail to bind sigma ligands, implicating that each truncated region in these splice variants is important for ligand binding. However, co-immunoprecipitation (Co-IP) study in HEK293 cells co-transfected with tagged constructs reveals that all the splice variants maintain their ability to physically associate with a mu opioid receptor (mMOR-1), providing useful information to correlate the motifs/sequences necessary for their physical association. Furthermore, a competition Co-IP study showed that all the variants can disrupt in a dose-dependent manner the dimerization of the original sigma1 receptor with mMOR-1, suggesting a potential dominant negative function and providing significant insights into their function.
Rapid polymerase chain reaction-based screening assay for bacterial biothreat agents.
Yang, Samuel; Rothman, Richard E; Hardick, Justin; Kuroki, Marcos; Hardick, Andrew; Doshi, Vishal; Ramachandran, Padmini; Gaydos, Charlotte A
2008-04-01
To design and evaluate a rapid polymerase chain reaction (PCR)-based assay for detecting Eubacteria and performing early screening for selected Class A biothreat bacterial pathogens. The authors designed a two-step PCR-based algorithm consisting of an initial broad-based universal detection step, followed by specific pathogen identification targeted for identification of the Class A bacterial biothreat agents. A region in the bacterial 16S rRNA gene containing a highly variable sequence flanked by clusters of conserved sequences was chosen as the target for the PCR assay design. A previously described highly conserved region located within the 16S rRNA amplicon was selected as the universal probe (UniProbe, Integrated DNA Technology, Coralville, IA). Pathogen-specific TaqMan probes were designed for Bacillus anthracis, Yersinia pestis, and Francisella tularensis. Performance of the assay was assessed using genomic DNA extracted from the aforementioned biothreat-related organisms (inactivated or surrogate) and other common bacteria. The UniProbe detected the presence of all tested Eubacteria (31/31) with high analytical sensitivity. The biothreat-specific probes accurately identified organisms down to the closely related species and genus level, but were unable to discriminate between very close surrogates, such as Yersinia philomiragia and Bacillus cereus. A simple, two-step PCR-based assay proved capable of both universal bacterial detection and identification of select Class A bacterial biothreat and biothreat-related pathogens. Although this assay requires confirmatory testing for definitive species identification, the method has great potential for use in ED-based settings for rapid diagnosis in cases of suspected Category A bacterial biothreat agents.
Determination of histamine in milkfish stick implicated in food-borne poisoning.
Lee, Yi-Chen; Kung, Hsien-Feng; Wu, Chien-Hui; Hsu, Hui-Mei; Chen, Hwi-Chang; Huang, Tzou-Chi; Tsai, Yung-Hsiang
2016-01-01
An incident of food-borne poisoning causing illness in 37 victims due to ingestion of fried fish sticks occurred in September 2014, in Tainan city, southern Taiwan. Leftovers of the victims' fried fish sticks and 16 other raw fish stick samples from retail stores were collected and tested to determine the occurrence of histamine and histamine-forming bacteria. Two suspected fried fish samples contained 86.6 mg/100 g and 235.0 mg/100 g histamine; levels that are greater than the potential hazard action level (50 mg/100 g) in most illness cases. Given the allergy-like symptoms of the victims and the high histamine content in the suspected fried fish samples, this food-borne poisoning was strongly suspected to be caused by histamine intoxication. Moreover, the fish species of suspected samples was identified as milkfish (Chanos chanos), using polymerase chain reaction direct sequence analysis. In addition, four of the 16 commercial raw milkfish stick samples (25%) had histamine levels greater than the US Food & Drug Administration guideline of 5.0 mg/100 g for scombroid fish and/or products. Ten histamine-producing bacterial strains, capable of producing 373-1261 ppm of histamine in trypticase soy broth supplemented with 1.0% L-histidine, were identified as Enterobacter aerogenes (4 strains), Enterobacter cloacae (1 strain), Morganella morganii (2 strains), Serratia marcescens (1 strain), Hafnia alvei (1 strain), and Raoultella orithinolytica (1 strain), by 16S ribosomal DNA sequencing with polymerase chain reaction amplification. Copyright © 2015. Published by Elsevier B.V.
Shojaei, Taha Roodbar; Mohd Salleh, Mohamad Amran; Tabatabaei, Meisam; Ekrami, Alireza; Motallebi, Roya; Rahmani-Cherati, Tavoos; Hajalilou, Abdollah; Jorfi, Raheleh
2014-01-01
Mycobacterium tuberculosis, the causing agent of tuberculosis, comes second only after HIV on the list of infectious agents slaughtering many worldwide. Due to the limitations behind the conventional detection methods, it is therefore critical to develop new sensitive sensing systems capable of quick detection of the infectious agent. In the present study, the surface modified cadmium-telluride quantum dots and gold nanoparticles conjunct with two specific oligonucleotides against early secretory antigenic target 6 were used to develop a sandwich-form fluorescence resonance energy transfer-based biosensor to detect M. tuberculosis complex and differentiate M. tuberculosis and M. bovis Bacille Calmette-Guerin simultaneously. The sensitivity and specificity of the newly developed biosensor were 94.2% and 86.6%, respectively, while the sensitivity and specificity of polymerase chain reaction and nested polymerase chain reaction were considerably lower, 74.2%, 73.3% and 82.8%, 80%, respectively. The detection limits of the sandwich-form fluorescence resonance energy transfer-based biosensor were far lower (10 fg) than those of the polymerase chain reaction and nested polymerase chain reaction (100 fg). Although the cost of the developed nanobiosensor was slightly higher than those of the polymerase chain reaction-based techniques, its unique advantages in terms of turnaround time, higher sensitivity and specificity, as well as a 10-fold lower detection limit would clearly recommend this test as a more appropriate and cost-effective tool for large scale operations. Copyright © 2014 Elsevier Editora Ltda. All rights reserved.
Hill, D E; Liddell, S; Jenkins, M C; Dubey, J P
2001-04-01
Neospora caninum oocysts, passed in the feces of a definitive host (dog), were isolated, and genomic DNA was extracted. A polymerase cahin reaction (PCR) targeting the N. caninum-specific Nc 5 genomic sequence was performed using the isolated DNA. A synthesized competitor molecule containing part of the Nc 5 sequence was included in the assay as a check against false-negative PCR results and to quantify N. caninum oocyst DNA in fecal samples. A standard curve of the ratio of fluorescence intensity of PCR-amplified competitor to that of oocyst DNA was constructed to compare oocyst equivalents from fecal samples containing unknown numbers of N. caninum oocysts and to assess the sensitivity of the assay. The specificity of the assay was determined using the Nc 5-specific primers in PCR assays against other parasites likely to be found in canine feces. Genomic DNA sequences from the canine coccidians Hammondia heydorni, Cryptosporidium parvum, Sarcocystis cruzi, S. tenella, and Isospora ohioensis and the canine helminth parasites Strongyloides stercoralis, Toxocara canis, Dipylidium caninum, and Ancylostoma caninum were not amplified. In addition, genomic DNA sequences from oocysts of coccidian parasites that might contaminate dog feces, such as Hammondia hammondi, Toxoplasma gondii, or Eimeria tenella, were not amplified in the PCR assay. The assay should be useful in epidemiological surveys of both domestic and wild canine hosts and in investigations of oocyst biology in experimental infections.
Brealey, David; Libert, Nicolas; Abidi, Nour Elhouda; O’Dwyer, Michael; Zacharowski, Kai; Mikaszewska-Sokolewicz, Malgorzata; Schrenzel, Jacques; Simon, François; Wilks, Mark; Picard-Maureau, Marcus; Chalfin, Donald B.; Ecker, David J.; Sampath, Rangarajan; Singer, Mervyn
2015-01-01
Objective: Early identification of causative microorganism(s) in patients with severe infection is crucial to optimize antimicrobial use and patient survival. However, current culture-based pathogen identification is slow and unreliable such that broad-spectrum antibiotics are often used to insure coverage of all potential organisms, carrying risks of overtreatment, toxicity, and selection of multidrug-resistant bacteria. We compared the results obtained using a novel, culture-independent polymerase chain reaction/electrospray ionization-mass spectrometry technology with those obtained by standard microbiological testing and evaluated the potential clinical implications of this technique. Design: Observational study. Setting: Nine ICUs in six European countries. Patients: Patients admitted between October 2013 and June 2014 with suspected or proven bloodstream infection, pneumonia, or sterile fluid and tissue infection were considered for inclusion. Interventions: None. Measurements and Main Results: We tested 616 bloodstream infection, 185 pneumonia, and 110 sterile fluid and tissue specimens from 529 patients. From the 616 bloodstream infection samples, polymerase chain reaction/electrospray ionization-mass spectrometry identified a pathogen in 228 cases (37%) and culture in just 68 (11%). Culture was positive and polymerase chain reaction/electrospray ionization-mass spectrometry negative in 13 cases, and both were negative in 384 cases, giving polymerase chain reaction/electrospray ionization-mass spectrometry a sensitivity of 81%, specificity of 69%, and negative predictive value of 97% at 6 hours from sample acquisition. The distribution of organisms was similar with both techniques. Similar observations were made for pneumonia and sterile fluid and tissue specimens. Independent clinical analysis of results suggested that polymerase chain reaction/electrospray ionization-mass spectrometry technology could potentially have resulted in altered treatment in up to 57% of patients. Conclusions: Polymerase chain reaction/electrospray ionization-mass spectrometry provides rapid pathogen identification in critically ill patients. The ability to rule out infection within 6 hours has potential clinical and economic benefits. PMID:26327198
Xie, Liu; Zhang, Jing-ze; Wan, Yao; Hu, Dong-wei
2010-01-01
Strawberry anthracnose, caused by Colletotrichum spp., is a major disease of cultivated strawberry. This study identifies 31 isolates of Colletotrichum spp. which cause strawberry anthracnose in Zhejiang Province and Shanghai City, China. Eleven isolates were identified as C. acutatum, 10 as C. gloeosporioides and 10 as C. fragariae based on morphological characteristics, phylogenetic and sequence analyses. Species-specific polymerase chain reaction (PCR) and enzyme digestion further confirmed the identification of the Colletotrichum spp., demonstrating that these three species are currently the causal agents of strawberry anthracnose in the studied regions. Based on analysis of rDNA internal transcribed spacers (ITS) sequences, sequences of all C. acutatum were identical, and little genetic variability was observed between C. fragariae and C. gloeosporioides. However, the conservative nature of the MvnI specific site from isolates of C. gloeosporioides was confirmed, and this site could be used to differentiate C. gloeosporioides from C. fragariae. PMID:20043353
Peng, Rui; Zeng, Bo; Meng, Xiuxiang; Yue, Bisong; Zhang, Zhihe; Zou, Fangdong
2007-08-01
The complete mitochondrial genome sequence of the giant panda, Ailuropoda melanoleuca, was determined by the long and accurate polymerase chain reaction (LA-PCR) with conserved primers and primer walking sequence methods. The complete mitochondrial DNA is 16,805 nucleotides in length and contains two ribosomal RNA genes, 13 protein-coding genes, 22 transfer RNA genes and one control region. The total length of the 13 protein-coding genes is longer than the American black bear, brown bear and polar bear by 3 amino acids at the end of ND5 gene. The codon usage also followed the typical vertebrate pattern except for an unusual ATT start codon, which initiates the NADH dehydrogenase subunit 5 (ND5) gene. The molecular phylogenetic analysis was performed on the sequences of 12 concatenated heavy-strand encoded protein-coding genes, and suggested that the giant panda is most closely related to bears.
The DL1 repeats in the genome of Diphyllobothrium latum.
Usmanova, Nadezhda M; Kazakov, Vasiliy I
2010-07-01
Diphyllobothrium latum is a widespread intestinal parasite, which has a great clinical relevance, but there are no sequences of its nuclear genome. In this paper, a repetitive element in the D. latum genome is firstly described. The adult D. latum was obtained in the result of expulsion from intestinum of a patient suffering from diphyllobothriasis. Genomic DNA was isolated from several proglottids of this individual. PstI restriction products of D. latum genomic DNA were sequenced. Polymerase chain reaction (PCR) amplification of these products using genomic DNA and selected primers was carried out. Thereby a cluster of a repetitive element, called DL1, was discovered. For precise identification of a beginning and an end of the repeat, a product of PCR amplification of D. latum genomic DNA with one specific primer was sequenced. In discussion, several evidences that DL1 repeat is a member of the SINE family of retroposons were adduced.
Fayer, R.; Santin, M.; Trout, J.M.; DeStefano, S.; Koenen, K.; Kaur, T.
2006-01-01
Feces from 62 beavers (Castor canadensis) in Massachusetts were examined by fluorescence microscopy (IFA) and polymerase chain reaction (PCR) for Microsporidia species, Cryptosporidium spp., and Giardia spp. between January 2002 and December 2004. PCR-positive specimens were further examined by gene sequencing. Protist parasites were detected in 6.4% of the beavers. All were subadults and kits. Microsporidia species were not detected. Giardia spp. was detected by IFA from four beavers; Cryptosporidium spp. was also detected by IFA from two of these beavers. However, gene sequence data for the ssrRNA gene from these two Cryptosporidium spp.-positive beavers were inconclusive in identifying the species. Nucleotide sequences of the TPI, ssrRNA, and ??-giardin genes for Giardia spp. (deposited in GenBank) indicated that the four beavers were excreting Giardia duodenalis Assemblage B, the zoonotic genotype representing a potential source of waterborne Giardia spp. cysts. Copyright 2006 by American Association of Zoo Veterinarians.
Molecular identification of Giardia and Cryptosporidium from dogs and cats
Sotiriadou, Isaia; Pantchev, Nikola; Gassmann, Doreen; Karanis, Panagiotis
2013-01-01
The aim of the present study was to diagnose the presence of Giardia cysts and Cryptosporidium oocysts in household animals using nested polymerase chain reaction (PCR) and sequence analysis. One hundred faecal samples obtained from 81 dogs and 19 cats were investigated. The Cryptosporidium genotypes were determined by sequencing a fragment of the small subunit (SSU) rRNA gene, while the Giardia Assemblages were determined through analysis of the glutamate dehydrogenase (GDH) locus. Isolates from five dogs and two cats were positive by PCR for the presence of Giardia, and their sequences matched the zoonotic Assemblage A of Giardia. Cryptosporidium spp. isolated from one dog and one cat were both found to be C. parvum. One dog isolate harboured a mixed infection of C. parvum and Giardia Assemblage A. These findings support the growing evidence that household animals are potential reservoirs of the zoonotic pathogens Giardia spp. and Cryptosporidium spp. for infections in humans. PMID:23477297
Transcriptome sequencing and annotation of the halophytic microalga Dunaliella salina * #
Hong, Ling; Liu, Jun-li; Midoun, Samira Z.; Miller, Philip C.
2017-01-01
The unicellular green alga Dunaliella salina is well adapted to salt stress and contains compounds (including β-carotene and vitamins) with potential commercial value. A large transcriptome database of D. salina during the adjustment, exponential and stationary growth phases was generated using a high throughput sequencing platform. We characterized the metabolic processes in D. salina with a focus on valuable metabolites, with the aim of manipulating D. salina to achieve greater economic value in large-scale production through a bioengineering strategy. Gene expression profiles under salt stress verified using quantitative polymerase chain reaction (qPCR) implied that salt can regulate the expression of key genes. This study generated a substantial fraction of D. salina transcriptional sequences for the entire growth cycle, providing a basis for the discovery of novel genes. This first full-scale transcriptome study of D. salina establishes a foundation for further comparative genomic studies. PMID:28990374
Haghshenas, Maryam; Akbari, Mohammad Taghi; Karizi, Shohreh Zare; Deilamani, Faravareh Khordadpoor; Nafissi, Shahriar; Salehi, Zivar
2016-06-01
Duchenne and Becker muscular dystrophies (DMD and BMD) are X-linked neuromuscular diseases characterized by progressive muscular weakness and degeneration of skeletal muscles. Approximately two-thirds of the patients have large deletions or duplications in the dystrophin gene and the remaining one-third have point mutations. This study was performed to evaluate point mutations in Iranian DMD/BMD male patients. A total of 29 DNA samples from patients who did not show any large deletion/duplication mutations following multiplex polymerase chain reaction (PCR) and multiplex ligation-dependent probe amplification (MLPA) screening were sequenced for detection of point mutations in exons 50-79. Also exon 44 was sequenced in one sample in which a false positive deletion was detected by MLPA method. Cycle sequencing revealed four nonsense, one frameshift and two splice site mutations as well as two missense variants.
Shu, Xianghua; Liu, Yonggang; Yang, Liangyu; Song, Chunlian; Hou, Jiafa
2008-01-01
The complete coding sequences of 3 porcine genes - ASPA, NAGA, and HEXA - were amplified by the reverse transcriptase polymerase chain reaction (RT-PCR) based on the conserved sequence information of the mouse or other mammals and referenced pig ESTs. These 3 novel porcine genes were then deposited in the NCBI database and assigned GeneIDs: 100142661, 100142664 and 100142667. The phylogenetic tree analysis revealed that the porcine ASPA, NAGA, and HEXA all have closer genetic relationships with the ASPA, NAGA, and HEXA of cattle. Tissue expression profile analysis was also carried out and results revealed that swine ASPA, NAGA, and HEXA genes were differentially expressed in various organs, including skeletal muscle, the heart, liver, fat, kidney, lung, and small and large intestines. Our experiment is the first one to establish the foundation for further research on these 3 swine genes.
An improved and validated RNA HLA class I SBT approach for obtaining full length coding sequences.
Gerritsen, K E H; Olieslagers, T I; Groeneweg, M; Voorter, C E M; Tilanus, M G J
2014-11-01
The functional relevance of human leukocyte antigen (HLA) class I allele polymorphism beyond exons 2 and 3 is difficult to address because more than 70% of the HLA class I alleles are defined by exons 2 and 3 sequences only. For routine application on clinical samples we improved and validated the HLA sequence-based typing (SBT) approach based on RNA templates, using either a single locus-specific or two overlapping group-specific polymerase chain reaction (PCR) amplifications, with three forward and three reverse sequencing reactions for full length sequencing. Locus-specific HLA typing with RNA SBT of a reference panel, representing the major antigen groups, showed identical results compared to DNA SBT typing. Alleles encountered with unknown exons in the IMGT/HLA database and three samples, two with Null and one with a Low expressed allele, have been addressed by the group-specific RNA SBT approach to obtain full length coding sequences. This RNA SBT approach has proven its value in our routine full length definition of alleles. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Diversity of phytases in the rumen.
Nakashima, Brenda A; McAllister, Tim A; Sharma, Ranjana; Selinger, L Brent
2007-01-01
Examples of a new class of phytase related to protein tyrosine phosphatases (PTP) were recently isolated from several anaerobic bacteria from the rumen of cattle. In this study, the diversity of PTP-like phytase gene sequences in the rumen was surveyed by using the polymerase chain reaction (PCR). Two sets of degenerate primers were used to amplify sequences from rumen fluid total community DNA and genomic DNA from nine bacterial isolates. Four novel PTP-like phytase sequences were retrieved from rumen fluid, whereas all nine of the anaerobic bacterial isolates investigated in this work contained PTP-like phytase sequences. One isolate, Selenomonas lacticifex, contained two distinct PTP-like phytase sequences, suggesting that multiple phytate hydrolyzing enzymes are present in this bacterium. The degenerate primer and PCR conditions described here, as well as novel sequences obtained in this study, will provide a valuable resource for future studies on this new class of phytase. The observed diversity of microbial phytases in the rumen may account for the ability of ruminants to derive a significant proportion of their phosphorus requirements from phytate.
Wu, Lucia R.; Chen, Sherry X.; Wu, Yalei; Patel, Abhijit A.; Zhang, David Yu
2018-01-01
Rare DNA-sequence variants hold important clinical and biological information, but existing detection techniques are expensive, complex, allele-specific, or don’t allow for significant multiplexing. Here, we report a temperature-robust polymerase-chain-reaction method, which we term blocker displacement amplification (BDA), that selectively amplifies all sequence variants, including single-nucleotide variants (SNVs), within a roughly 20-nucleotide window by 1,000-fold over wild-type sequences. This allows for easy detection and quantitation of hundreds of potential variants originally at ≤0.1% in allele frequency. BDA is compatible with inexpensive thermocycler instrumentation and employs a rationally designed competitive hybridization reaction to achieve comparable enrichment performance across annealing temperatures ranging from 56 °C to 64 °C. To show the sequence generality of BDA, we demonstrate enrichment of 156 SNVs and the reliable detection of single-digit copies. We also show that the BDA detection of rare driver mutations in cell-free DNA samples extracted from the blood plasma of lung-cancer patients is highly consistent with deep sequencing using molecular lineage tags, with a receiver operator characteristic accuracy of 95%. PMID:29805844
Detection of Plasmodium sp. in capybara.
dos Santos, Leonilda Correia; Curotto, Sandra Mara Rotter; de Moraes, Wanderlei; Cubas, Zalmir Silvino; Costa-Nascimento, Maria de Jesus; de Barros Filho, Ivan Roque; Biondo, Alexander Welker; Kirchgatter, Karin
2009-07-07
In the present study, we have microscopically and molecularly surveyed blood samples from 11 captive capybaras (Hydrochaeris hydrochaeris) from the Sanctuary Zoo for Plasmodium sp. infection. One animal presented positive on blood smear by light microscopy. Polymerase chain reaction was carried out accordingly using a nested genus-specific protocol, which uses oligonucleotides from conserved sequences flanking a variable sequence region in the small subunit ribosomal RNA (ssrRNA) of all Plasmodium organisms. This revealed three positive animals. Products from two samples were purified and sequenced. The results showed less than 1% divergence between the two capybara sequences. When compared with GenBank sequences, a 55% similarity was obtained to Toxoplasma gondii and a higher similarity (73-77.2%) was found to ssrRNAs from Plasmodium species that infect reptile, avian, rodents, and human beings. The most similar Plasmodium sequence was from Plasmodium mexicanum that infects lizards of North America, where around 78% identity was found. This work is the first report of Plasmodium in capybaras, and due to the low similarity with other Plasmodium species, we suggest it is a new species, which, in the future could be denominated "Plasmodium hydrochaeri".
Identification of Y-Chromosome Sequences in Turner Syndrome.
Silva-Grecco, Roseane Lopes da; Trovó-Marqui, Alessandra Bernadete; Sousa, Tiago Alves de; Croce, Lilian Da; Balarin, Marly Aparecida Spadotto
2016-05-01
To investigate the presence of Y-chromosome sequences and determine their frequency in patients with Turner syndrome. The study included 23 patients with Turner syndrome from Brazil, who gave written informed consent for participating in the study. Cytogenetic analyses were performed in peripheral blood lymphocytes, with 100 metaphases per patient. Genomic DNA was also extracted from peripheral blood lymphocytes, and gene sequences DYZ1, DYZ3, ZFY and SRY were amplified by Polymerase Chain Reaction. The cytogenetic analysis showed a 45,X karyotype in 9 patients (39.2 %) and a mosaic pattern in 14 (60.8 %). In 8.7 % (2 out of 23) of the patients, Y-chromosome sequences were found. This prevalence is very similar to those reported previously. The initial karyotype analysis of these patients did not reveal Y-chromosome material, but they were found positive for Y-specific sequences in the lymphocyte DNA analysis. The PCR technique showed that 2 (8.7 %) of the patients with Turner syndrome had Y-chromosome sequences, both presenting marker chromosomes on cytogenetic analysis.
Large scale analysis of the mutational landscape in HT-SELEX improves aptamer discovery
Hoinka, Jan; Berezhnoy, Alexey; Dao, Phuong; Sauna, Zuben E.; Gilboa, Eli; Przytycka, Teresa M.
2015-01-01
High-Throughput (HT) SELEX combines SELEX (Systematic Evolution of Ligands by EXponential Enrichment), a method for aptamer discovery, with massively parallel sequencing technologies. This emerging technology provides data for a global analysis of the selection process and for simultaneous discovery of a large number of candidates but currently lacks dedicated computational approaches for their analysis. To close this gap, we developed novel in-silico methods to analyze HT-SELEX data and utilized them to study the emergence of polymerase errors during HT-SELEX. Rather than considering these errors as a nuisance, we demonstrated their utility for guiding aptamer discovery. Our approach builds on two main advancements in aptamer analysis: AptaMut—a novel technique allowing for the identification of polymerase errors conferring an improved binding affinity relative to the ‘parent’ sequence and AptaCluster—an aptamer clustering algorithm which is to our best knowledge, the only currently available tool capable of efficiently clustering entire aptamer pools. We applied these methods to an HT-SELEX experiment developing aptamers against Interleukin 10 receptor alpha chain (IL-10RA) and experimentally confirmed our predictions thus validating our computational methods. PMID:25870409
Fuentes-Pananá, Ezequiel M; Larios-Serrato, Violeta; Méndez-Tenorio, Alfonso; Morales-Sánchez, Abigail; Arias, Carlos F; Torres, Javier
2016-01-01
Gastric (GC) and breast (BrC) cancer are two of the most common and deadly tumours. Different lines of evidence suggest a possible causative role of viral infections for both GC and BrC. Wide genome sequencing (WGS) technologies allow searching for viral agents in tissues of patients with cancer. These technologies have already contributed to establish virus-cancer associations as well as to discovery new tumour viruses. The objective of this study was to document possible associations of viral infection with GC and BrC in Mexican patients. In order to gain idea about cost effective conditions of experimental sequencing, we first carried out an in silico simulation of WGS. The next-generation-platform IlluminaGallx was then used to sequence GC and BrC tumour samples. While we did not find viral sequences in tissues from BrC patients, multiple reads matching Epstein-Barr virus (EBV) sequences were found in GC tissues. An end-point polymerase chain reaction confirmed an enrichment of EBV sequences in one of the GC samples sequenced, validating the next-generation sequencing-bioinformatics pipeline. PMID:26910355
Fuentes-Pananá, Ezequiel M; Larios-Serrato, Violeta; Méndez-Tenorio, Alfonso; Morales-Sánchez, Abigail; Arias, Carlos F; Torres, Javier
2016-03-01
Gastric (GC) and breast (BrC) cancer are two of the most common and deadly tumours. Different lines of evidence suggest a possible causative role of viral infections for both GC and BrC. Wide genome sequencing (WGS) technologies allow searching for viral agents in tissues of patients with cancer. These technologies have already contributed to establish virus-cancer associations as well as to discovery new tumour viruses. The objective of this study was to document possible associations of viral infection with GC and BrC in Mexican patients. In order to gain idea about cost effective conditions of experimental sequencing, we first carried out an in silico simulation of WGS. The next-generation-platform IlluminaGallx was then used to sequence GC and BrC tumour samples. While we did not find viral sequences in tissues from BrC patients, multiple reads matching Epstein-Barr virus (EBV) sequences were found in GC tissues. An end-point polymerase chain reaction confirmed an enrichment of EBV sequences in one of the GC samples sequenced, validating the next-generation sequencing-bioinformatics pipeline.
Timmermans, M J T N; Dodsworth, S; Culverwell, C L; Bocak, L; Ahrens, D; Littlewood, D T J; Pons, J; Vogler, A P
2010-11-01
Mitochondrial genome sequences are important markers for phylogenetics but taxon sampling remains sporadic because of the great effort and cost required to acquire full-length sequences. Here, we demonstrate a simple, cost-effective way to sequence the full complement of protein coding mitochondrial genes from pooled samples using the 454/Roche platform. Multiplexing was achieved without the need for expensive indexing tags ('barcodes'). The method was trialled with a set of long-range polymerase chain reaction (PCR) fragments from 30 species of Coleoptera (beetles) sequenced in a 1/16th sector of a sequencing plate. Long contigs were produced from the pooled sequences with sequencing depths ranging from ∼10 to 100× per contig. Species identity of individual contigs was established via three 'bait' sequences matching disparate parts of the mitochondrial genome obtained by conventional PCR and Sanger sequencing. This proved that assembly of contigs from the sequencing pool was correct. Our study produced sequences for 21 nearly complete and seven partial sets of protein coding mitochondrial genes. Combined with existing sequences for 25 taxa, an improved estimate of basal relationships in Coleoptera was obtained. The procedure could be employed routinely for mitochondrial genome sequencing at the species level, to provide improved species 'barcodes' that currently use the cox1 gene only.
Chen, Qilei; Hu, Youjia; Zhao, Wenjie; Zhu, Chunbao; Zhu, Baoquan
2010-01-01
A gene encoding a novel (S)-specific NADH-dependent alcohol dehydrogenase (LK-ADH) was isolated from the genomic DNA of Lactobacillus kefir DSM 20587 by thermal asymmetric interlaced-polymerase chain reaction. The nucleotide sequence of (S)-LK-ADH gene (adhS) was determined, which consists of an open reading frame of 1,044 bp, coding for 347 amino acids with a molecular mass of 37.065 kDa. After a BLAST similarity search in GenBank database, the amino acid sequence of (S)-LK-ADH showed some homologies to several zinc containing medium-chain alcohol dehydrogenases. This novel gene was deposited into GenBank with the accession number of EU877965. adhS gene was subcloned into plasmid pET-28a(+), and recombinant (S)-LK-ADH was successfully expressed in E. coli BL21(DE3) by isopropyl-beta-D-1-thiogalactopyranoside induction. Purified enzyme showed a high enantioselectivity in the reduction of acetophenone to (S)-phenylethanol with an ee value of 99.4%. The substrate specificity and cofactor preference of recombinant (S)-LK-ADH were also tested.
Evolution of sequence-defined highly functionalized nucleic acid polymers
NASA Astrophysics Data System (ADS)
Chen, Zhen; Lichtor, Phillip A.; Berliner, Adrian P.; Chen, Jonathan C.; Liu, David R.
2018-03-01
The evolution of sequence-defined synthetic polymers made of building blocks beyond those compatible with polymerase enzymes or the ribosome has the potential to generate new classes of receptors, catalysts and materials. Here we describe a ligase-mediated DNA-templated polymerization and in vitro selection system to evolve highly functionalized nucleic acid polymers (HFNAPs) made from 32 building blocks that contain eight chemically diverse side chains on a DNA backbone. Through iterated cycles of polymer translation, selection and reverse translation, we discovered HFNAPs that bind proprotein convertase subtilisin/kexin type 9 (PCSK9) and interleukin-6, two protein targets implicated in human diseases. Mutation and reselection of an active PCSK9-binding polymer yielded evolved polymers with high affinity (KD = 3 nM). This evolved polymer potently inhibited the binding between PCSK9 and the low-density lipoprotein receptor. Structure-activity relationship studies revealed that specific side chains at defined positions in the polymers are required for binding to their respective targets. Our findings expand the chemical space of evolvable polymers to include densely functionalized nucleic acids with diverse, researcher-defined chemical repertoires.
Generation and reactivation of T-cell receptor A joining region pseudogenes in primates
DOE Office of Scientific and Technical Information (OSTI.GOV)
Thiel, C.; Lanchbury, J.S.; Otting, N.
1996-06-01
Tandemly duplicated T-cell receptor (Tcr) AJ (J{alpha}) segments contribute significantly to TCRA chain junctional region diversity in mammals. Since only limited data exists on TCRA diversity in nonhuman primates, we examined the TCRAJ regions of 37 chimpanzee and 71 rhesus macaque TCRA cDNA clones derived from inverse polymerase chain reaction on peripheral blood mononuclear cell cDNA of healthy animals. Twenty-five different TCRAJ regions were characterized in the chimpanzee and 36 in the rhesus macaque. Each bears a close structural relationship to an equivalent human TCRAJ region. Conserved amino acid motifs are shared between all three species. There are indications thatmore » differences between nonhuman primates and humans exist in the generation of TCRAJ pseudogenes. The nucleotide and amino acid sequences of the various characterized TCRAJ of each species are reported and we compare our results to the available information on human genomic sequences. Although we provide evidence of dynamic processes modifying TCRAJ segments during primate evolution, their repertoire and primary structure appears to be relatively conserved. 21 refs., 2 figs.« less
The U.S. Environmental Protection Agency (EPA) has provided recommended beach advisory values in its 2012 recreational water quality criteria (RWQC) for states wishing to use quantitative polymerase chain reaction (qPCR) for the monitoring of Enterococcus fecal indicator bacteria...
Detection of Listeria monocytogenes by using the polymerase chain reaction
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bessesen, M.T.; Luo, Q.; Blaser, M.J.
1990-09-01
A method was developed for detection of Listeria monocytogens by polymerase chain reaction amplification followed by agarose gel electrophoresis or dot blot analysis with {sup 32}P-labeled internal probe. The technique identified 95 of 95 L. monocytogenes strains, 0 of 12 Listeria strains of other species, and 0 of 12 non-Listeria strains.
Alcantara, David; Guo, Yanyan; Yuan, Hushan; Goergen, Craig J; Chen, Howard H; Cho, Hoonsung; Sosnovik, David E; Josephson, Lee
2012-07-09
Easy to find: magnetic nanoparticles bearing fluorochromes (red) that intercalate with DNA (green) form microaggregates with DNA generated by the polymerase chain reaction (PCR). These aggregates can be detected at low cycle numbers by magnetic resonance (MR). Copyright © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
9 CFR 145.33 - Terminology and classification; flocks and products.
Code of Federal Regulations, 2010 CFR
2010-01-01
.... Such action shall not be taken until a thorough investigation has been made by the Service and the.... gallisepticum as provided in § 145.14(b), or by a polymerase chain reaction (PCR)-based procedure approved by...(b) or by a polymerase chain reaction (PCR)-based procedure approved by the Department. If fewer than...
Switchable photosystem-II designer algae for photobiological hydrogen production
Lee, James Weifu
2010-01-05
A switchable photosystem-II designer algae for photobiological hydrogen production. The designer transgenic algae includes at least two transgenes for enhanced photobiological H.sub.2 production wherein a first transgene serves as a genetic switch that can controls photosystem II (PSII) oxygen evolution and a second transgene encodes for creation of free proton channels in the algal photosynthetic membrane. In one embodiment, the algae includes a DNA construct having polymerase chain reaction forward primer (302), a inducible promoter (304), a PSII-iRNA sequence (306), a terminator (308), and a PCR reverse primer (310). In other embodiments, the PSII-iRNA sequence (306) is replaced with a CF.sub.1-iRNA sequence (312), a streptomycin-production gene (314), a targeting sequence (316) followed by a proton-channel producing gene (318), or a PSII-producing gene (320). In one embodiment, a photo-bioreactor and gas-product separation and utilization system produce photobiological H.sub.2 from the switchable PSII designer alga.
Smeele, Zoe E; Ainley, David G; Varsani, Arvind
2018-01-02
The Antarctic, sub-Antarctic islands and surrounding sea-ice provide a unique environment for the existence of organisms. Nonetheless, birds and seals of a variety of species inhabit them, particularly during their breeding seasons. Early research on Antarctic wildlife health, using serology-based assays, showed exposure to viruses in the families Birnaviridae, Flaviviridae, Herpesviridae, Orthomyxoviridae and Paramyxoviridae circulating in seals (Phocidae), penguins (Spheniscidae), petrels (Procellariidae) and skuas (Stercorariidae). It is only during the last decade or so that polymerase chain reaction-based assays have been used to characterize viruses associated with Antarctic animals. Furthermore, it is only during the last five years that full/whole genomes of viruses (adenoviruses, anelloviruses, orthomyxoviruses, a papillomavirus, paramyoviruses, polyomaviruses and a togavirus) have been sequenced using Sanger sequencing or high throughput sequencing (HTS) approaches. This review summaries the knowledge of animal Antarctic virology and discusses potential future directions with the advent of HTS in virus discovery and ecology. Copyright © 2017 Elsevier B.V. All rights reserved.
Hu, Yuhua; Xu, Xueqin; Liu, Qionghua; Wang, Ling; Lin, Zhenyu; Chen, Guonan
2014-09-02
A simple, ultrasensitive, and specific electrochemical biosensor was designed to determine the given DNA sequence of Bacillus subtilis by coupling target-induced strand displacement and nicking endonuclease signal amplification. The target DNA (TD, the DNA sequence from the hypervarient region of 16S rDNA of Bacillus subtilis) could be detected by the differential pulse voltammetry (DPV) in a range from 0.1 fM to 20 fM with the detection limit down to 0.08 fM at the 3s(blank) level. This electrochemical biosensor exhibits high distinction ability to single-base mismatch, double-bases mismatch, and noncomplementary DNA sequence, which may be expected to detect single-base mismatch and single nucleotide polymorphisms (SNPs). Moreover, the applicability of the designed biosensor for detecting the given DNA sequence from Bacillus subtilis was investigated. The result obtained by electrochemical method is approximately consistent with that by a real-time quantitative polymerase chain reaction detecting system (QPCR) with SYBR Green.
2014-01-01
Background A rare neuro-ichthyotic disorder characterized by ichthyosis, spastic quadriplegia and intellectual disability and caused by recessive mutations in ELOVL4, encoding elongase-4 protein has recently been described. The objective of the study was to search for sequence variants in the gene ELOVL4 in three affected individuals of a consanguineous Pakistani family exhibiting features of neuro-ichthyotic disorder. Methods Linkage in the family was searched by genotyping microsatellite markers linked to the gene ELOVL4, mapped at chromosome 6p14.1. Exons and splice junction sites of the gene ELOVL4 were polymerase chain reaction amplified and sequenced in an automated DNA sequencer. Results DNA sequence analysis revealed a novel homozygous nonsense mutation (c.78C > G; p.Tyr26*). Conclusions Our report further confirms the recently described ELOVL4-related neuro-ichthyosis and shows that the neurological phenotype can be absent in some individuals. PMID:24571530
Genotyping of Giardia lamblia isolates from humans in China and Korea using ribosomal DNA Sequences.
Yong, T S; Park, S J; Hwang, U W; Yang, H W; Lee, K W; Min, D Y; Rim, H J; Wang, Y; Zheng, F
2000-08-01
Genetic characterization of a total of 15 Giardia lamblia isolates, 8 from Anhui Province, China (all from purified cysts) and 7 from Seoul, Korea (2 from axenic cultures and 5 from purified cysts), was performed by polymerase chain reaction amplification and sequencing of a 295-bp region near the 5' end of the small subunit ribosomal DNA (eukaryotic 16S rDNA). Phylogenetic analyses were subsequently conducted using sequence data obtained in this study, as well as sequences published from other Giardia isolates. The maximum parsimony method revealed that G. lamblia isolates from humans in China and Korea are divided into 2 major lineages, assemblages A and B. All 7 Korean isolates were grouped into assemblage A, whereas 4 Chinese isolates were grouped into assemblage A and 4 into assemblage B. Two Giardia microti isolates and 2 dog-derived Giardia isolates also grouped into assemblage B, whereas Giardia ardeae and Giardia muris were unique.
Matsuo, Kumihiro; Tanahashi, Yusuke; Mukai, Tokuo; Suzuki, Shigeru; Tajima, Toshihiro; Azuma, Hiroshi; Fujieda, Kenji
2016-07-01
Dual oxidase 2 (DUOX2) mutations are a cause of dyshormonogenesis (DH) and have been identified in patients with permanent congenital hypothyroidism (PH) and with transient hypothyroidism (TH). We aimed to elucidate the prevalence and phenotypical variations of DUOX2 mutations. Forty-eight Japanese DH patients were enroled and analysed for sequence variants of DUOX2, DUOXA2, and TPO using polymerase chain reaction-amplified direct sequencing. Fourteen sequence variants of DUOX2, including 10 novel variants, were identified in 11 patients. DUOX2 variants were more prevalent (11/48, 22.9%) than TPO (3/48, 6.3%) (p=0.020). The prevalence of DUOX2 variants in TH was slightly, but not significantly, higher than in PH. Furthermore, one patient had digenic heterozygous sequence variants of both DUOX2 and TPO. Our results suggest that DUOX2 mutations might be the most common cause of both PH and TH, and that phenotypes of these mutations might be milder than those of other causes.
Luo, C; Zhang, Q L; Luo, Z R
2014-04-16
Oriental persimmon (Diospyros kaki Thunb.) (2n = 6x = 90) is a major commercial and deciduous fruit tree that is believed to have originated in China. However, rare transcriptomic and genomic information on persimmon is available. Using Roche 454 sequencing technology, the transcriptome from RNA of the flowers of D. kaki was analyzed. A total of 1,250,893 reads were generated and 83,898 unigenes were assembled. A total of 42,711 SSR loci were identified from 23,494 unigenes and 289 polymerase chain reaction primer pairs were designed. Of these 289 primers, 155 (53.6%) showed robust PCR amplification and 98 revealed polymorphism between 15 persimmon genotypes, indicating a polymorphic rate of 63.23% of the productive primers for characterization and genotyping of the genus Diospyros. Transcriptome sequence data generated from next-generation sequencing technology to identify microsatellite loci appears to be rapid and cost-efficient, particularly for species with no genomic sequence information available.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Mullinax, R.L.; Gross, E.A.; Amberg, J.R.
1990-10-01
The authors have applied a molecular biology approach to the identification of human monoclonal antibodies. Human peripheral blood lymphocyte mRNA was converted to cDNA and a select subset was amplified by the polymerase chain reaction. These products, containing coding sequences for numerous immunoglobulin heavy- and {kappa} light-chain variable and constant region domains, were inserted into modified bacteriophase {lambda} expression vectors and introduced into Escherichia coli by infection to yield a combinatorial immunoexpression library. Clones with binding activity to tetanus toxoid were identified by filter hybridization with radiolabeled antigen and appeared at a frequency of 0.2{percent} in the library. These humanmore » antigen binding fragments, consisting of a heavy-chain fragment covalently linked to a light chain, displayed high affinity of binding to tetanus toxoid with equilibrium constants in the nanomolar range but did not cross-react with other proteins tested. They estimate that this human immunoexpression library contains 20,000 clones with high affinity and specificity to our chosen antigen.« less
Furutani, Shunsuke; Naruishi, Nahoko; Hagihara, Yoshihisa; Nagai, Hidenori
2016-08-01
On-site quantitative analyses of microorganisms (including viruses) by the polymerase chain reaction (PCR) system are significantly influencing medical and biological research. We have developed a remarkably rapid and portable real-time PCR system that is based on microfluidic approaches. Real-time PCR using TaqMan probes consists of a complex reaction. Therefore, in a rapid real-time PCR, the optimum DNA polymerase must be estimated by using actual real-time PCR conditions. In this study, we compared the performance of three DNA polymerases in actual PCR conditions using our rapid real-time PCR system. Although KAPA2G Fast HS DNA Polymerase has the highest enzymatic activity among them, SpeedSTAR HS DNA Polymerase exhibited better performance to rapidly increase the fluorescence signal in an actual real-time PCR using TaqMan probes. Furthermore, we achieved rapid detection of Escherichia coli in 7 min by using SpeedSTAR HS DNA Polymerase with the same sensitivity as that of a conventional thermal cycler.
Nagai, Haruka; Tomioka, Kanji; Okumura, Shiro
2018-06-26
We have been developing quick and simple system for detecting food-poisoning bacteria using a combination of an asymmetric PCR and a portable surface plasmon resonance (SPR) sensor. The system would be suitable for point-of-care detection of food-poisoning bacteria in the field of food industry. In this study, we established a novel method for quantifying the amplified forward (F) and reverse (R) chains of Staphylococcus aureus separately by high-performance liquid chromatography (HPLC). The concentration of single-stranded DNA amplicon excessively amplified, which is crucial for the system, could be calculated as the difference between those of the F- and R-chains. For the R-chain, a correction based on the F-chain concentration in the sample was used to obtain a more accurate value, because the determination of the R-chain concentration was affected by that of the coexisting F-chain. The concentration values were also determined by fluorescence imaging for electrophoresis gels of amplicons with FITC- or Cy5-conjugated primers, and they were in good agreement with the values by the HPLC. The measured concentration of the single-strand F-chain correlated well with the value of the SPR response against the probe that was a complementary sequence of the F-chain, immobilized on the sensor chip of the SPR sensor.
Non-lethal sampling for the detection of Myxobolus cerebralis in asymptomatic rainbow trout
Schill, Bane; Waldrop, Thomas; Densmore, Christine; Blazer, Vicki
1999-01-01
We have described in previous reports (Schill et al., 1998) the development of a polymerase chain reaction (PCR) amplification of 18S ribosomal RNA for the detection of Myxozoan parasites. Oligonucleotide primers were developed by multiple alignment of Myxozoan sequence information and analysis by a custom-written computer program (PRIM). Candidate pairs of primer sequences were then analyzed for specificity by BLAST (Basic Local Alignment Search Tool). From these, a set of promising primers (MYXFWD and MYXREV) was chosen for further testing. These were chosen because they should direct detection of a number of Myxozoan species (Table 1). PCR using MXYFWD and MYXREV proved to be robust and relatively free of artifact products. Further, we were able to routinely detect Myxobolus cerebralis in fish tissues (Figure 1).
GATA3 mutation in a family with hypoparathyroidism, deafness and renal dysplasia syndrome.
Zhu, Zi-Yang; Zhou, Qiao-Li; Ni, Shi-Ning; Gu, Wei
2014-08-01
The hypoparathyroidism, deafness and renal dysplasia (HDR) syndrome is an autosomal dominant disorder primarily caused by GATA3 gene mutation. We report here a case that both of a Chinese boy and his father had HDR syndrome which caused by a novel mutation of GATA3. Polymerase chain reaction and DNA sequencing was performed to detect the exons of the GATA3 gene for mutation analysis. Sequence analysis of GATA3 revealed a heterozygous nonsense mutation in this family: a mutation of GATA3 at exon 2 (c.515C >A) that resulted in a premature stop at codon 172 (p.S172X) with a loss of two zinc finger domains. We identified a novel nonsense mutation which will expand the spectrum of HDR-associated GATA3 mutations.
Aoyagi, K; Beyou, A; Moon, K; Fang, L; Ulrich, T
1993-01-01
The enzyme 3-hydroxy-3-methylglutaryl coenzyme A reductase (HMGR, EC 1.1.1.34) is a key enzyme in the isoprenoid biosynthetic pathway. We have isolated partial cDNAs from wheat (Triticum aestivum) using the polymerase chain reaction. Comparison of deduced amino acid sequences of these cDNAs shows that they represent a small family of genes that share a high degree of sequence homology among themselves as well as among genes from other organisms including tomato, Arabidopsis, hamster, human, Drosophila, and yeast. Southern blot analysis reveals the presence of at least four genes. Our results concerning the tissue-specific expression as well as developmental regulation of these HMGR cDNAs highlight the important role of this enzyme in the growth and development of wheat. PMID:8108513
Siadenovirus infection in two psittacine bird species.
Wellehan, James F X; Greenacre, Cheryl B; Fleming, Gregory J; Stetter, Mark D; Childress, April L; Terrell, Scott P
2009-10-01
Consensus polymerase chain reaction was used to identify a novel adenovirus from two psittacine birds: a plum-headed parakeet (Psittacula cyanocephala) with lethargy, weight loss, and marked leukocytosis; and an umbrella cockatoo (Cacatua alba) with lethargy, weight loss, and feather abnormalities. Phylogenetic and comparative sequence analysis suggested that this virus is a member of the genus Siadenovirus, and is here termed psittacine adenovirus 2. This extends the characterized adenoviruses of psittacine birds beyond Aviadenovirus to include the genus Siadenovirus. Identification and further study of adenoviral types and species will provide useful diagnostic, prognostic, and epidemiologic information for the clinician. Like other known members of the genus Siadenovirus, Psittacine adenovirus 2 is AT-rich over the region sequenced, and it is hypothesized that this may be associated with shorter host-virus evolutionary association.
Gold nanoparticles for high-throughput genotyping of long-range haplotypes
NASA Astrophysics Data System (ADS)
Chen, Peng; Pan, Dun; Fan, Chunhai; Chen, Jianhua; Huang, Ke; Wang, Dongfang; Zhang, Honglu; Li, You; Feng, Guoyin; Liang, Peiji; He, Lin; Shi, Yongyong
2011-10-01
Completion of the Human Genome Project and the HapMap Project has led to increasing demands for mapping complex traits in humans to understand the aetiology of diseases. Identifying variations in the DNA sequence, which affect how we develop disease and respond to pathogens and drugs, is important for this purpose, but it is difficult to identify these variations in large sample sets. Here we show that through a combination of capillary sequencing and polymerase chain reaction assisted by gold nanoparticles, it is possible to identify several DNA variations that are associated with age-related macular degeneration and psoriasis on significant regions of human genomic DNA. Our method is accurate and promising for large-scale and high-throughput genetic analysis of susceptibility towards disease and drug resistance.
Rapid detection of Mannheimia haemolytica in lung tissues of sheep and from bacterial culture.
Kumar, Jyoti; Dixit, Shivendra Kumar; Kumar, Rajiv
2015-09-01
This study was aimed to detect Mannheimia haemolytica in lung tissues of sheep and from a bacterial culture. M. haemolytica is one of the most important and well-established etiological agents of pneumonia in sheep and other ruminants throughout the world. Accurate diagnosis of M. haemolytica primarily relies on bacteriological examination, biochemical characteristics and, biotyping and serotyping of the isolates. In an effort to facilitate rapid M. haemolytica detection, polymerase chain reaction assay targeting Pasteurella haemolytica serotype-1 specific antigens (PHSSA), Rpt2 and 12S ribosomal RNA (rRNA) genes were used to detect M. haemolytica directly from lung tissues and from bacterial culture. A total of 12 archived lung tissues from sheep that died of pneumonia on an organized farm were used. A multiplex polymerase chain reaction (mPCR) based on two-amplicons targeted PHSSA and Rpt2 genes of M. haemolytica were used for identification of M. haemolytica isolates in culture from the lung samples. All the 12 lung tissue samples were tested for the presence M. haemolytica by PHSSA and Rpt2 genes based PCR and its confirmation by sequencing of the amplicons. All the 12 lung tissue samples tested for the presence of PHSSA and Rpt2 genes of M. haemolytica by mPCR were found to be positive. Amplification of 12S rRNA gene fragment as internal amplification control was obtained with each mPCR reaction performed from DNA extracted directly from lung tissue samples. All the M. haemolytica were also positive for mPCR. No amplified DNA bands were observed for negative control reactions. All the three nucleotide sequences were deposited in NCBI GenBank (Accession No. KJ534629, KJ534630 and KJ534631). Sequencing of the amplified products revealed the identity of 99-100%, with published sequence of PHSSA and Rpt2 genes of M. haemolytica available in the NCBI database. Sheep specific mitochondrial 12S rRNA gene sequence also revealed the identity of 98% with published sequences in the NCBI database. The present study emphasized the PCR as a valuable tool for rapid detection of M. haemolytica in clinical samples from animals. In addition, it offers the opportunity to perform large-scale epidemiological studies regarding the role of M. haemolytica in clinical cases of pneumonia and other disease manifestations in sheep and other ruminants, thereby providing the basis for effective preventive strategies.
Bhat, Somanath; McLaughlin, Jacob L H; Emslie, Kerry R
2011-02-21
Digital polymerase chain reaction (dPCR) has the potential to enable accurate quantification of target DNA copy number provided that all target DNA molecules are successfully amplified. Following duplex dPCR analysis from a linear DNA target sequence that contains single copies of two independent template sequences, we have observed that amplification of both templates in a single partition does not always occur. To investigate this finding, we heated the target DNA solution to 95 °C for increasing time intervals and then immediately chilled on ice prior to preparing the dPCR mix. We observed an exponential decline in estimated copy number (R(2)≥ 0.98) of the two template sequences when amplified from either a linearized plasmid or a 388 base pair (bp) amplicon containing the same two template sequences. The distribution of amplifiable templates and the final concentration (copies per µL) were both affected by heat treatment of the samples at 95 °C from 0 s to 30 min. The proportion of target sequences from which only one of the two templates was amplified in a single partition (either 1507 or hmg only) increased over time, while the proportion of target sequences where both templates were amplified (1507 and hmg) in each individual partition declined rapidly from 94% to 52% (plasmid) and 88% to 31% (388 bp amplicon) suggesting an increase in number of targets from which both templates no longer amplify. A 10 min incubation at 95 °C reduced the initial amplifiable template concentration of the plasmid and the 388 bp amplicon by 59% and 91%, respectively. To determine if a similar decrease in amplifiable target occurs during the default pre-activation step of typical PCR amplification protocol, we used mastermixes with a 20 s or 10 min hot-start. The choice of mastermix and consequent pre-activation time did not affect the estimated plasmid concentration. Therefore, we conclude that prolonged exposure of this DNA template to elevated temperatures could lead to significant bias in dPCR measurements. However, care must be taken when designing PCR and non-PCR based experiments by reducing exposure of the DNA template to sustained elevated temperatures in order to improve accuracy in copy number estimation and concentration determination.
Labeling milk along its production chain with DNA encapsulated in silica.
Bloch, Madeleine S; Paunescu, Daniela; Stoessel, Philipp R; Mora, Carlos A; Stark, Wendelin J; Grass, Robert N
2014-10-29
The capability of tracing a food product along its production chain is important to ensure food safety and product authenticity. For this purpose and as an application example, recently developed Silica Particles with Encapsulated DNA (SPED) were added to milk at concentrations ranging from 0.1 to 100 ppb (μg per kg milk). Thereby the milk, as well as the milk-derived products yoghurt and cheese, could be uniquely labeled with a DNA tag. Procedures for the extraction of the DNA tags from the food matrixes were elaborated and allowed identification and quantification of previously marked products by quantitative polymerase chain reaction (qPCR) with detection limits below 1 ppb of added particles. The applicability of synthetic as well as naturally occurring DNA sequences was shown. The usage of approved food additives as DNA carrier (silica = E551) and the low cost of the technology (<0.1 USD per ton of milk labeled with 10 ppb of SPED) display the technical applicability of this food labeling technology.
Chang, Chia-Hao; Shao, Kwang-Tsao; Lin, Yeong-Shin; Liao, Yun-Chih
2013-12-01
The complete mitochondrial genome of the three-spot seahorse was sequenced using a polymerase chain reaction-based method. The total length of mitochondrial DNA is 16,535 bp and includes 13 protein-coding genes, 2 ribosomal RNA genes, 22 transfer RNA genes, and a control region. The mitochondrial gene order of the three-spot seahorse also conforms to the distinctive vertebrate mitochondrial gene order. The base composition of the genome is A (32.7%), T (29.3%), C (23.4%), and G (14.6%) with an A + T-rich hallmark as that of other vertebrate mitochondrial genomes.
Chang, Chia-Hao; Lin, Han-Yang; Jang-Liaw, Nian-Hong; Shao, Kwang-Tsao; Lin, Yeong-Shin; Ho, Hsuan-Ching
2013-06-01
The complete mitochondrial genome of the tiger tail seahorse was sequenced using a polymerase chain reaction-based method. The total length of mitochondrial DNA is 16,525 bp and includes 13 protein-coding genes, 2 ribosomal RNA, 22 transfer RNA genes, and a control region. The mitochondrial gene arrangement of the tiger tail seahorse is also matching the one observed in the most vertebrate creatures. Base composition of the genome is A (32.8%), T (29.8%), C (23.0%), and G (14.4%) with an A+T-rich hallmark as that of other vertebrate mitochondrial genomes.
Zhang, Huixian; Zhang, Yanhong; Lin, Qiang
2015-01-01
The complete mitochondrial genome sequence of the pacific seahorse Hippocampus ingens was determined using long polymerase chain reactions. The total length of H. ingens mitogenome is 16,526 bp and consists of 13 protein-coding genes, 2 rRNA genes, 22 tRNA genes and a control region. The gene order and composition of H. ingens were similar to those of most other vertebrates. The overall base composition of H. ingens is 32.6% A, 29.3% T, 23.5% G and 14.6% C, with a slight A+T rich feature (61.9%).
Etard, Christelle; Joshi, Swarnima; Stegmaier, Johannes; Mikut, Ralf; Strähle, Uwe
2017-12-01
A bottleneck in CRISPR/Cas9 genome editing is variable efficiencies of in silico-designed gRNAs. We evaluated the sensitivity of the TIDE method (Tracking of Indels by DEcomposition) introduced by Brinkman et al. in 2014 for assessing the cutting efficiencies of gRNAs in zebrafish. We show that this simple method, which involves bulk polymerase chain reaction amplification and Sanger sequencing, is highly effective in tracking well-performing gRNAs in pools of genomic DNA derived from injected embryos. The method is equally effective for tracing INDELs in heterozygotes.
Andes Virus and First Case Report of Bermejo Virus Causing Fatal Pulmonary Syndrome
Della Valle, Marcelo González; Alai, María Garcia; Cortada, Pedro; Villagra, Mario; Gianella, Alberto
2002-01-01
Two suspected hantavirus pulmonary syndrome (HPS) cases from Bolivia were confirmed by enzyme-linked immunosorbent assay. (ELISA)-ANDES was performed using N-Andes recombinant antigen serology in May and July 2000. Clot RNAs from the two patients were subjected to reverse transcription–polymerase chain reaction (PCR) amplification and sequencing. We describe two characterized cases of HPS. One was caused by infection with Bermejo virus and the other with Andes Nort viral lineage, both previously obtained from Oligoryzomys species. This is the first report of molecular identification of a human hantavirus associated with Bermejo virus. PMID:11971782
Maternally inherited Leigh syndrome: an unusual cause of infantile apnea.
Shuk-kuen Chau, Christy; Kwok, Ka-li; Ng, Daniel K; Lam, Ching-Wan; Tong, Sui-Fan; Chan, Yan-Wo; Siu, Wai-Kwan; Yuen, Yuet-Ping
2010-06-01
Leigh Syndrome is an uncommon cause of infantile apnea. We report a 5-month-old girl with sudden respiratory arrest followed by episodic hyper- and hypo-ventilation, encephalopathy, and persistent lactic acidosis. Computed tomography of the brain revealed symmetric low densities over the basal ganglia, internal capsule, thalami, and midbrain. Cardiac echocardiogram was suggestive of hypertrophic cardiomyopathy. Diagnosis of Leigh syndrome due to T8993G mutation was confirmed with polymerase chain reaction and direct DNA sequencing of mitochondrial genome. To our knowledge, this is the first report of proven maternally inherited Leigh syndrome in Hong Kong.
Nucleic acid amplification using modular branched primers
Ulanovsky, Levy; Raja, Mugasimangalam C.
2001-01-01
Methods and compositions expand the options for making primers for use in amplifying nucleic acid segments. The invention eliminates the step of custom synthesis of primers for Polymerase Chain Reactions (PCR). Instead of being custom-synthesized, a primer is replaced by a combination of several oligonucleotide modules selected from a pre-synthesized library. A modular combination of just a few oligonucleotides essentially mimics the performance of a conventional, custom-made primer by matching the sequence of the priming site in the template. Each oligonucleotide module has a segment that matches one of the stretches within the priming site.
Genetic study of KIR and HLA ligands in 235 individuals from Northeastern Thailand.
Chaisri, Suwit; Leelayuwat, Chanvit; Romphruk, Amornrat
The diversity of 17 KIR and HLA ligands (HLA-C1, C2, Bw4, A11) were investigated in two hundred and thirty-five unrelated healthy donors in Northeastern Thais (NETs) by the polymerase chain reaction with sequence-specific primer (PCR-SSP) method. The Hardy-Weinberg Equilibrium (HWE) was used to verify genotyping method for dimorphic KIR and HLA. They were in HWE (p>0.05). KIR and HLA ligands frequencies, genotypes, haplotypes and linkage disequilibrium (LD) were presented. The genetic data are available in allele Frequencies Net Database. Copyright © 2017. Published by Elsevier Inc.
Dunham, S P; Onions, D E
2001-06-21
A cDNA encoding feline granulocyte colony stimulating factor (fG-CSF) was cloned from alveolar macrophages using the reverse transcriptase-polymerase chain reaction. The cDNA is 949 bp in length and encodes a predicted mature protein of 174 amino acids. Recombinant fG-CSF was expressed as a glutathione S-transferase fusion and purified by affinity chromatography. Biological activity of the recombinant protein was demonstrated using the murine myeloblastic cell line GNFS-60, which showed an ED50 for fG-CSF of approximately 2 ng/ml. Copyright 2001 Academic Press.
Litvintseva, Anastasia P; Marsden-Haug, Nicola; Hurst, Steven; Hill, Heather; Gade, Lalitha; Driebe, Elizabeth M; Ralston, Cindy; Roe, Chandler; Barker, Bridget M; Goldoft, Marcia; Keim, Paul; Wohrle, Ron; Thompson, George R; Engelthaler, David M; Brandt, Mary E; Chiller, Tom
2015-01-01
We used real-time polymerase chain reaction and culture to demonstrate persistent colonization of soils by Coccidioides immitis, an agent of valley fever, in Washington State linked to recent human infections and located outside the endemic range. Whole-genome sequencing confirmed genetic identity between isolates from soil and one of the case-patients. Published by Oxford University Press on behalf of the Infectious Diseases Society of America 2014. This work is written by (a) US Government employee(s) and is in the public domain in the US.
A polymorphism in the bovine gamma-S-crystallin gene revealed by allele-specific amplification.
Kemp, S J; Maillard, J C; Teale, A J
1993-04-01
A polymorphism was detected in the 3' untranslated region of the bovine gamma-S-crystallin gene by direct sequencing of polymerase chain reaction (PCR) products from genomic DNA of an N'Dama bull and a Boran cow. A set of three PCR primers was designed to detect this difference and thus give allele-specific amplification. The two allele-specific primers differ in length by 20 nucleotides so that the allelic products may be distinguished by simple agarose gel electrophoresis following a single PCR reaction. This provides a simple and rapid assay for this polymorphism.
Engineered Polymerases Enable Novel Sequencing Applications (7th Annual SFAF Meeting, 2012)
Appel, Maryke
2018-01-15
Maryke Appel on "Engineered polymerases provide improved NGS library amplification and enable novel sequencing applications" at the 2012 Sequencing, Finishing, Analysis in the Future Meeting held June 5-7, 2012 in Santa Fe, New Mexico.
Krsticevic, Flavia J.; Schrago, Carlos G.; Carvalho, A. Bernardo
2015-01-01
The autosomal gene Mst77F of Drosophila melanogaster is essential for male fertility. In 2010, Krsticevic et al. (Genetics 184: 295−307) found 18 Y-linked copies of Mst77F (“Mst77Y”), which collectively account for 20% of the functional Mst77F-like mRNA. The Mst77Y genes were severely misassembled in the then-available genome assembly and were identified by cloning and sequencing polymerase chain reaction products. The genomic structure of the Mst77Y region and the possible existence of additional copies remained unknown. The recent publication of two long-read assemblies of D. melanogaster prompted us to reinvestigate this challenging region of the Y chromosome. We found that the Illumina Synthetic Long Reads assembly failed in the Mst77Y region, most likely because of its tandem duplication structure. The PacBio MHAP assembly of the Mst77Y region seems to be very accurate, as revealed by comparisons with the previously found Mst77Y genes, a bacterial artificial chromosome sequence, and Illumina reads of the same strain. We found that the Mst77Y region spans 96 kb and originated from a 3.4-kb transposition from chromosome 3L to the Y chromosome, followed by tandem duplications inside the Y chromosome and invasion of transposable elements, which account for 48% of its length. Twelve of the 18 Mst77Y genes found in 2010 were confirmed in the PacBio assembly, the remaining six being polymerase chain reaction−induced artifacts. There are several identical copies of some Mst77Y genes, coincidentally bringing the total copy number to 18. Besides providing a detailed picture of the Mst77Y region, our results highlight the utility of PacBio technology in assembling difficult genomic regions such as tandemly repeated genes. PMID:25858959
Hiramatsu, K; Harada, K; Tsuneyama, K; Sasaki, M; Fujita, S; Hashimoto, T; Kaneko, S; Kobayashi, K; Nakanuma, Y
2000-07-01
The etiopathogenesis of bile duct lesion in primary biliary cirrhosis is unknown, though the participation of bacteria and/or their components and products is suspected. In this study, we tried to detect and identify bacteria in the bile of patients with primary biliary cirrhosis by polymerase chain reaction using universal bacterial primers of the 16S ribosomal RNA gene. Gallbladder bile samples from 15 patients with primary biliary cirrhosis, 5 with primary sclerosing cholangitis, 5 with hepatitis C virus-related liver cirrhosis, 11 with cholecystolithiasis, and from 12 normal adult gallbladders were used. In addition to the culture study, partial bacterial 16S ribosomal RNA gene was amplified by polymerase chain reaction (PCR) taking advantage of universal primers that can amplify the gene of almost all bacterial species, and the amplicons were cloned and sequenced. Sequence homology with specific bacterial species was analyzed by database research. Bacterial contamination at every step of the bile sampling, DNA extraction and PCR study was avoided. Furthermore, to confirm whether bacterial DNA is detectable in liver explants, the same analysis was performed using 10 liver explants of patients with primary biliary cirrhosis. In primary biliary cirrhosis, 75% (p<0.0001) of 100 clones were identified as so-called gram-positive cocci while these cocci were positive in only 5% in cholecystolithiasis (p<0.0001). In cholecystolithiasis gram-negative rods were predominant instead. One bacterial species detected in a normal adult was not related to those detected in primary biliary cirrhosis and cholecystolithiasis patients. No bacterial DNA was detected by PCR amplification in 10 liver explants of patients with primary biliary cirrhosis. The present results raise several possible roles of gram-positive bacteria in bile in the etiopathogenesis of primary biliary cirrhosis. However, these results could also reflect an epiphenomenon due to decreased bile flow in the patients with primary biliary cirrhosis at an advanced stage.
Li, Xiang; Pan, Liangwen; Li, Junyi; Zhang, Qigang; Zhang, Shuya; Lv, Rong; Yang, Litao
2011-12-28
For implementation of the issued regulations and labeling policies for genetically modified organism (GMO) supervision, the polymerase chain reaction (PCR) method has been widely used due to its high specificity and sensitivity. In particular, use of the event-specific PCR method based on the flanking sequence of transgenes has become the primary trend. In this study, both qualitative and quantitative PCR methods were established on the basis of the 5' flanking sequence of transgenic soybean A2704-12 and the 3' flanking sequence of transgenic soybean A5547-127, respectively. In qualitative PCR assays, the limits of detection (LODs) were 10 copies of haploid soybean genomic DNA for both A2704-12 and A5547-127. In quantitative real-time PCR assays, the LODs were 5 copies of haploid soybean genomic DNA for both A2704-12 and A5547-127, and the limits of quantification (LOQs) were 10 copies for both. Low bias and acceptable SD and RSD values were also achieved in quantification of four blind samples using the developed real-time PCR assays. In addition, the developed PCR assays for the two transgenic soybean events were used for routine analysis of soybean samples imported to Shanghai in a 6 month period from October 2010 to March 2011. A total of 27 lots of soybean from the United States and Argentina were analyzed: 8 lots from the Unites States were found to have the GM soybean A2704-12 event, and the GM contents were <1.5% in all eight analyzed lots. On the contrary, no GM soybean A5547-127 content was found in any of the eight lots. These results demonstrated that the established event-specific qualitative and quantitative PCR methods could be used effectively in routine identification and quantification of GM soybeans A2704-12 and A5547-127 and their derived products.
Boonyawat, Boonchai; Monsereenusorn, Chalinee; Traivaree, Chanchai
2014-01-01
Background Beta-thalassemia is one of the most common genetic disorders in Thailand. Clinical phenotype ranges from silent carrier to clinically manifested conditions including severe beta-thalassemia major and mild beta-thalassemia intermedia. Objective This study aimed to characterize the spectrum of beta-globin gene mutations in pediatric patients who were followed-up in Phramongkutklao Hospital. Patients and methods Eighty unrelated beta-thalassemia patients were enrolled in this study including 57 with beta-thalassemia/hemoglobin E, eight with homozygous beta-thalassemia, and 15 with heterozygous beta-thalassemia. Mutation analysis was performed by multiplex amplification refractory mutation system (M-ARMS), direct DNA sequencing of beta-globin gene, and gap polymerase chain reaction for 3.4 kb deletion detection, respectively. Results A total of 13 different beta-thalassemia mutations were identified among 88 alleles. The most common mutation was codon 41/42 (-TCTT) (37.5%), followed by codon 17 (A>T) (26.1%), IVS-I-5 (G>C) (8%), IVS-II-654 (C>T) (6.8%), IVS-I-1 (G>T) (4.5%), and codon 71/72 (+A) (2.3%), and all these six common mutations (85.2%) were detected by M-ARMS. Six uncommon mutations (10.2%) were identified by DNA sequencing including 4.5% for codon 35 (C>A) and 1.1% initiation codon mutation (ATG>AGG), codon 15 (G>A), codon 19 (A>G), codon 27/28 (+C), and codon 123/124/125 (-ACCCCACC), respectively. The 3.4 kb deletion was detected at 4.5%. The most common genotype of beta-thalassemia major patients was codon 41/42 (-TCTT)/codon 26 (G>A) or betaE accounting for 40%. Conclusion All of the beta-thalassemia alleles have been characterized by a combination of techniques including M-ARMS, DNA sequencing, and gap polymerase chain reaction for 3.4 kb deletion detection. Thirteen mutations account for 100% of the beta-thalassemia genes among the pediatric patients in our study. PMID:25525381
Xu, X G; He, J; He, Y M; Tao, S D; Ying, Y L; Zhu, F M; Lv, H J; Yan, L X
2011-04-01
The Diego blood group system plays an important role in transfusion medicine. Genotyping of DI1 and DI2 alleles is helpful for the investigation into haemolytic disease of the newborn (HDN) and for the development of rare blood group databases. Here, we set up a polymerase chain reaction sequence-based typing (PCR-SBT) method for genotyping of Diego blood group alleles. Specific primers for exon 19 of the solute carrier family 4, anion exchanger, member1 (SLC4A1) gene were designed, and our PCR-SBT method was established and optimized for Diego genotyping. A total of 1053 samples from the Chinese Han population and the family members of a rare proband with DI1/DI1 genotype were investigated by the PCR-SBT method. An allele-specific primer PCR (PCR-ASP) was used to verify the reliability of the PCR-SBT method. The frequencies of DI1 and DI2 alleles in the Chinese Han population were 0.0247 and 0.9753, respectively. Six new single nucleotide polymorphisms (SNPs) were found in the sequenced regions of the SLC4A1 gene, and four novel SNPs located in the exon 19, in which one SNP could cause an amino acid alteration of Ala858Ser on erythrocyte anion exchanger protein 1. The genotypes for Diego blood group were identical among 41 selected samples with PCR-ASP and PCR-SBT. The PCR-SBT method can be used in Diego genotyping as a substitute of serological technique when the antisera is lacking and was suitable for screening large numbers of donors in rare blood group databases. © 2010 The Author(s). Vox Sanguinis © 2010 International Society of Blood Transfusion.
USDA-ARS?s Scientific Manuscript database
Two hundred samples collected from Anseriformes, Charadriiformes, Gruiformes, and Galliformes were assayed using real-time reverse transcriptase polymerase chain reaction (RRT-PCR) for presence of avian influenza virus and avian paramyxovirus-1. Virus isolation using embryonating chicken eggs, embr...
This study is part of a larger project for the development of bacterial indicators of stream sanitary and ecological condition. Here we report preliminary research on the use of Length Heterogeneity Polymerase Chain Reaction (LH-PCR), which discriminates among 16S rRNA genes bas...
Polymerase Chain Reaction/Rapid Methods Are Gaining a Foothold in Developing Countries.
Ragheb, Suzan Mohammed; Jimenez, Luis
Detection of microbial contamination in pharmaceutical raw materials and finished products is a critical factor to guarantee their safety, stability, and potency. Rapid microbiological methods-such as polymerase chain reaction-have been widely applied to clinical and food quality control analysis. However, polymerase chain reaction applications to pharmaceutical quality control have been rather slow and sporadic. Successful implementation of these methods in pharmaceutical companies in developing countries requires important considerations to provide sensitive and robust assays that will comply with good manufacturing practices. In recent years several publications have encouraged the application of molecular techniques in the microbiological assessment of pharmaceuticals. One of these techniques is polymerase chain reaction (PCR). The successful application of PCR in the pharmaceutical industry in developing countries is governed by considerable factors and requirements. These factors include the setting up of a PCR laboratory and the choice of appropriate equipment and reagents. In addition, the presence of well-trained analysts and establishment of quality control and quality assurance programs are important requirements. The pharmaceutical firms should take into account these factors to allow better chances for regulatory acceptance and wide application of this technique. © PDA, Inc. 2014.
Sil'veĭstrova, O Iu; Domonova, É A; Shipulina, O Iu
2014-04-01
The validation of kit of reagents destined to detection and quantitative evaluation of DNA of human cytomegalovirus in biological material using polymerase chain reaction technique in real time operation mode was implemented. The comparison was made against international WHO standard--The first WHO international standard for human cytomegalovirus to implement measures the kit of reagents "AmpliSens CMV-screen/monitor-FL" and standard sample of enterprise DNA HCMV (The central research institute of epidemiology of Rospotrebnadzor) was applied. The fivefold dilution of international WHO standard and standard sample of enterprise were carried out in concentrations of DNA HCMV from 106 to 102. The arrangement of polymerase chain reaction and analysis of results were implemented using programed amplifier with system of detection of fluorescent signal in real-time mode "Rotor-Gene Q" ("Qiagen", Germany). In the total of three series of experiments, all stages of polymerase chain reaction study included, the coefficient of translation of quantitative evaluation of DNA HCMV from copy/ml to ME/ml equal to 0.6 was introduced for this kit of reagents.
Phutikanit, Nawapen; Suwimonteerabutr, Junpen; Harrison, Dion; D'Occhio, Michael; Carroll, Bernie; Techakumphu, Mongkol
2010-03-05
The purpose of this study was to apply an arbitrarily primed methylation sensitive polymerase chain reaction (PCR) assay called Amplified Methylation Polymorphism Polymerase Chain Reaction (AMP PCR) to investigate the methylation profiles of somatic and germ cells obtained from Holstein bulls. Genomic DNA was extracted from sperm, leukocytes and fibroblasts obtained from three bulls and digested with a methylation sensitive endonuclease (HpaII). The native genomic and enzyme treated DNA samples were used as templates in an arbitrarily primed-PCR assay with 30 sets of single short oligonucleotide primer. The PCR products were separated on silver stained denaturing polyacrylamide gels. Three types of PCR markers; digestion resistant-, digestion sensitive-, and digestion dependent markers, were analyzed based on the presence/absence polymorphism of the markers between the two templates. Approximately 1,000 PCR markers per sample were produced from 27 sets of primer and most of them (>90%) were digestion resistant markers. The highest percentage of digestion resistant markers was found in leukocytic DNA (94.8%) and the lowest in fibroblastic DNA (92.3%, P < or = 0.05). Spermatozoa contained a higher number of digestion sensitive markers when compared with the others (3.6% vs. 2.2% and 2.6% in leukocytes and fibroblasts respectively, P < or = 0.05). The powerfulness of the AMP PCR assay was the generation of methylation-associated markers without any prior knowledge of the genomic sequence. The data obtained from different primers provided an overview of genome wide DNA methylation content in different cell types. By using this technique, we found that DNA methylation profile is tissue-specific. Male germ cells were hypomethylated at the HpaII locations when compared with somatic cells, while the chromatin of the well-characterized somatic cells was heavily methylated when compared with that of the versatile somatic cells.
Choudhary, Nandlal; Wei, G; Govindarajulu, A; Roy, Avijit; Li, Wenbin; Picton, Deric D; Nakhla, M K; Levy, L; Brlansky, R H
2015-11-01
Citrus leprosis virus C (CiLV-C), a causal agent of the leprosis disease in citrus, is mostly present in the South and Central America and spreading toward the North America. To enable better diagnosis and inhibit the further spread of this re-emerging virus a quantitative (q) real-time reverse transcription polymerase chain reaction (qRT-PCR) assay is needed for early detection of CiLV-C when the virus is present in low titer in citrus leprosis samples. Using the genomic sequence of CiLV-C, specific primers and probe were designed and synthesized to amplify a 73 nt amplicon from the movement protein (MP) gene. A standard curve of the 73 nt amplicon MP gene was developed using known 10(10)-10(1) copies of in vitro synthesized RNA transcript to estimate the copy number of RNA transcript in the citrus leprosis samples. The one-step qRT-PCR detection assays for CiLV-C were determined to be 1000 times more sensitive when compared to the one-step conventional reverse transcription polymerase chain reaction (RT-PCR) CiLV-C detection method. To evaluate the quality of the total RNA extracts, NADH dehydrogenase gene specific primers (nad5) and probe were included in reactions as an internal control. The one-step qRT-PCR specificity was successfully validated by testing for the presence of CiLV-C in the total RNA extracts of the citrus leprosis samples collected from Belize, Costa Rica, Mexico and Panama. Implementation of the one-step qRT-PCR assays for CiLV-C diagnosis should assist regulatory agencies in surveillance activities to monitor the distribution pattern of CiLV-C in countries where it is present and to prevent further dissemination into citrus growing countries where there is no report of CiLV-C presence. Published by Elsevier B.V.
Panda, S; Martín, J P; Aguinagalde, I
2003-04-01
A population genetic analysis of chloroplast and nuclear DNA was performed covering nine wild populations of Brassica oleracea. Three members of the n = 9 group, all close to B. oleracea, Brassica alboglabra Bailey, Brassica bourgeaui (Webb) O. Kuntze and Brassica montana Pourret, were also studied to better understand their relationship with B. oleracea. Chloroplast DNA was analysed using the PCR-RFLP (polymerase chain reaction - restriction fragment length polymorphism) method. The ISSR-PCR (inter-simple sequence repeat - polymerase chain reaction) technique was adopted to study nuclear DNA. Twelve primer pairs of chloroplast DNA showed very good amplification. The amplified product of each primer pair, digested by three restriction enzymes, revealed no variation of cpDNA among the taxa studied. This indicates they may have the same chloroplast genotype. Seven selected ISSR primers have detected genetic variation, both within and among the populations/taxa surveyed. The information obtained on the intra- and inter-populational genetic diversity of wild populations of B. oleracea neatly defined the individual plants. It could provide important guidelines for backing management and conservation strategies in this species. The study confirms a close relationship between B. alboglabra, B. bourgeaui and B. montana, which is parallel to their morphological similitude.
Treml, Diana; Venturelli, Gustavo L; Brod, Fábio C A; Faria, Josias C; Arisi, Ana C M
2014-12-10
A genetically modified (GM) common bean event, namely Embrapa 5.1, resistant to the bean golden mosaic virus (BGMV), was approved for commercialization in Brazil. Brazilian regulation for genetically modified organism (GMO) labeling requires that any food containing more than 1% GMO be labeled. The event-specific polymerase chain reaction (PCR) method has been the primary trend for GMO identification and quantitation because of its high specificity based on the flanking sequence. This work reports the development of an event-specific assay, named FGM, for Embrapa 5.1 detection and quantitation by use of SYBR Green or hydrolysis probe. The FGM assay specificity was tested for Embrapa 2.3 event (a noncommercial GM common bean also resistant to BGMV), 46 non-GM common bean varieties, and other crop species including maize, GM maize, soybean, and GM soybean. The FGM assay showed high specificity to detect the Embrapa 5.1 event. Standard curves for the FGM assay presented a mean efficiency of 95% and a limit of detection (LOD) of 100 genome copies in the presence of background DNA. The primers and probe developed are suitable for the detection and quantitation of Embrapa 5.1.
Kim, Hyun-Joong; Ryu, Ji-Oh; Song, Ji-Yeon; Kim, Hae-Yeong
2017-07-01
In the detection of Shigella species using molecular biological methods, previously known genetic markers for Shigella species were not sufficient to discriminate between Shigella species and diarrheagenic Escherichia coli. The purposes of this study were to screen for genetic markers of the Shigella genus and four Shigella species through comparative genomics and develop a multiplex polymerase chain reaction (PCR) for the detection of shigellae and Shigella species. A total of seven genomic DNA sequences from Shigella species were subjected to comparative genomics for the screening of genetic markers of shigellae and each Shigella species. The primer sets were designed from the screened genetic markers and evaluated using PCR with genomic DNAs from Shigella and other bacterial strains in Enterobacteriaceae. A novel Shigella quintuplex PCR, designed for the detection of Shigella genus, S. dysenteriae, S. boydii, S. flexneri, and S. sonnei, was developed from the evaluated primer sets, and its performance was demonstrated with specifically amplified results from each Shigella species. This Shigella multiplex PCR is the first to be reported with novel genetic markers developed through comparative genomics and may be a useful tool for the accurate detection of the Shigella genus and species from closely related bacteria in clinical microbiology and food safety.
Trombley, Adrienne R.; Wachter, Leslie; Garrison, Jeffrey; Buckley-Beason, Valerie A.; Jahrling, Jordan; Hensley, Lisa E.; Schoepp, Randal J.; Norwood, David A.; Goba, Augustine; Fair, Joseph N.; Kulesh, David A.
2010-01-01
Viral hemorrhagic fever is caused by a diverse group of single-stranded, negative-sense or positive-sense RNA viruses belonging to the families Filoviridae (Ebola and Marburg), Arenaviridae (Lassa, Junin, Machupo, Sabia, and Guanarito), and Bunyaviridae (hantavirus). Disease characteristics in these families mark each with the potential to be used as a biological threat agent. Because other diseases have similar clinical symptoms, specific laboratory diagnostic tests are necessary to provide the differential diagnosis during outbreaks and for instituting acceptable quarantine procedures. We designed 48 TaqMan™-based polymerase chain reaction (PCR) assays for specific and absolute quantitative detection of multiple hemorrhagic fever viruses. Forty-six assays were determined to be virus-specific, and two were designated as pan assays for Marburg virus. The limit of detection for the assays ranged from 10 to 0.001 plaque-forming units (PFU)/PCR. Although these real-time hemorrhagic fever virus assays are qualitative (presence of target), they are also quantitative (measure a single DNA/RNA target sequence in an unknown sample and express the final results as an absolute value (e.g., viral load, PFUs, or copies/mL) on the basis of concentration of standard samples and can be used in viral load, vaccine, and antiviral drug studies. PMID:20439981
Vázquez-Martínez, Osvaldo T; González-Betancourt, Anajulia; Barboza-Cerda, María Carmen; González-González, Sergio E; Lugo-Trampe, Ángel; Welsh, Oliverio; Rojas-Martínez, Augusto; Martínez-Rodríguez, Herminia G; Ocampo-Candiani, Jorge; Ortiz-López, Rocío
2016-07-01
Pyogenic granuloma is a non-neoplastic lesion that frequently occurs in the skin and mucous membranes of children and pregnant women. The anatomical sites of pyogenic granulomas overlap with those of wart infections caused by the human papillomavirus (HPV). This study assessed the presence of HPV DNA in pyogenic granuloma samples by polymerase chain reaction. Eighteen pyogenic granuloma biopsies from patients without a clinical history or evidence of verruca in the studied area were tested for the presence of the HPV genome. The presence of HPV DNA was screened by three independent polymerase chain reaction reactions using standard consensus primer sets targeted to the L1 or E1 consensus regions of HPV genome. The HPV DNA-positive samples were genotyped using methodologies enabling the identification of up to 30 HPVs, including oncogenic, nononcogenic, and cutaneous viral types. The HPV DNA was detected in 44.4% (eight of 18) of the samples, with HPV-2 being the only type in the eight HPV DNA-positive samples. Contamination with HPV-2 sequences throughout the entire process was reliably eliminated. This report is the first to suggest an association between HPV-2 and pyogenic granuloma. This relationship is similar to that observed between HPV-2 and nongenital warts. © 2015 The International Society of Dermatology.
Layman, Lawrence C.; Ullmann, Reinhard; Shen, Yiping; Ha, Kyungsoo; Rehman, Khurram; Looney, Stephen; McDonough, Paul G.; Kim, Hyung-Goo; Carr, Bruce R.
2014-01-01
Background 46,XY sex reversal is a rare disorder and familial cases are even more rare. The purpose of the present study was to determine the molecular basis for a family with three affected siblings who had 46,XY sex reversal. Methods DNA was extracted from three females with 46,XY sex reversal, two normal sisters, and both unaffected parents. All protein coding exons of the SRY and NR5A1 genes were subjected to PCR-based DNA sequencing. In addition, array comparative genomic hybridization was performed on DNA from all seven family members. A deletion was confirmed using quantitative polymerase chain reaction. Expression of SOX9 gene was quantified using reverse transcriptase polymerase chain reaction. Results A 349kb heterozygous deletion located 353kb upstream of the SOX9 gene on the long arm of chromosome 17 was discovered in the father and three affected siblings, but not in the mother. The expression of SOX9 was significantly decreased in the affected siblings. Two of three affected sisters had gonadoblastomas. Conclusion This is the first report of 46,XY sex reversal in three siblings who have a paternally inherited deletion upstream of SOX9 associated with reduced SOX9 mRNA expression. PMID:24907458
Tian, Ruiyuan; Chen, Xiuhua; Chang, Jianmei; Zhang, Na; Tan, Yanhong; Xu, Zhifang; Ren, Fanggang; Zhao, Junxia; Pan, Jie; Guo, Haixiu; Wang, Xiaojuan; Wang, Hongwei
2015-07-01
To identify the MPL L391-V392ins12 spliceosome and analyze its frequencies in patients with myeloproliferative neoplasms (MPN). MPL aberrant spliceosome was identified through reverse transcription polymerase chain reaction (RT-PCR)combined with cloning sequencing. The mutation of this spliceosome in 248 MPN patients and 200 normal people was determined by allele-specific polymerase chain reaction (AS-PCR). A novel aberrant spliceosome of MPL gene (MPL L391-V392ins12)was identified, i.e. 36 bp intron was retained between exon7 and exon8, and there were 12 amino acids (EGLKLLPADIPV)inserted. MPL L391-V392ins12 mutation was detected in 19 (7.66%)of the 248 patients with MPN, including 1 (1.92%) of 52 patients with PV, 14 (9.66%) of 145 with ET, and 4 (7.84%) of 51 with PMF. And the mutation was not detected in the group of 200 normal people. MPL L391-V392ins12 spliceosome is an aberrant spliceosome present in the MPN. It can be detected in PV, ET and PMF, and more frequently in ET and PMF. This mutation may play an important role in the process of MPN.
Ryu, Tae Kwon; Lee, Gunsup; Rhee, Yong; Park, Heung-Sik; Chang, Man; Lee, Sukchan; Lee, Jaean; Lee, Taek-Kyun
2012-10-01
Bioassays and biomarkers have been previously developed to assess the effects of heavy metal contaminants on the early life stages of the sea urchin. In this study, malformation in the early developmental processes was observed in sea urchin (Strongylocentrotus intermedius) larvae exposed to 10 ppm Ni for over 30 h. The most critical stage at which the triggering of nickel effects takes place is thought to be the blastula stage, which occurs after fertilization in larval development. To investigate the molecular-level responses of sea urchin exposed to heavy metal stress and to explore the differentially expressed genes that are induced or repressed by nickel, differential display polymerase chain reaction (DD-PCR) was used with sea urchin mRNAs. The malformation-related genes expressed in the early life stages of the sea urchin were cloned from larvae exposed to 10 ppm of nickel for 15 h, and accessed via DD-PCR. Sequence analysis results revealed that each of the genes evidenced high homology with EGF2, PCSK9, serine/threonine protein kinase, apolipophorin precursor protein, and MGC80921 protein/transcript variant 2. This result may prove useful in the development of novel biomarkers for the assessment of heavy metal stresses on sea urchin embryos. Copyright © 2012 Elsevier Inc. All rights reserved.
Standardisation of polymerase chain reaction for the detection of Salmonella typhi in typhoid fever.
Chaudhry, R; Laxmi, B V; Nisar, N; Ray, K; Kumar, D
1997-01-01
To improve the diagnosis of Salmonella typhi infection, a polymerase chain reaction (PCR) assay was developed for the amplification of the dH flagellin gene of S typhi. Primers were designed from dH flagellin gene sequence which will give an amplification product of 486 base pairs. In tests to study the specificity of the assay, no amplification was seen in non-salmonella strains or salmonella strains with flagellar gene other than "d". Sensitivity tests determined that 28 pg of S typhi target DNA or 3 x 10(2) target bacteria could be detected by the PCR assay. Subsequently, the PCR technique was used for detection of S typhi in blood or clot cultures from 84 patients clinically suspected of having typhoid fever, and from 20 healthy control subjects. Twenty five of 84 samples from clinically suspected cases were positive by PCR; four of which were culture negative. No amplification was seen in samples from patients who were culture positive for organisms other than S typhi or from controls. The time taken for each sample for PCR analysis was less than 48 hours compared with three to five days for blood or clot culture. PCR appeared to be a promising diagnostic test for typhoid fever. Images PMID:9215131
Bentley-Hewitt, Kerry L; Hedderley, Duncan I; Monro, John; Martell, Sheridan; Smith, Hannah; Mishra, Suman
2016-05-25
Experimental methods are constantly being improved by new technology. Recently a new technology, NanoString®, has been introduced to the market for the analysis of gene expression. Our experiments used adipose and liver samples collected from a rat feeding trial to explore gene expression changes resulting from a diet of 7.5% seaweed. Both quantitative real-time polymerase chain reaction (qPCR) and NanoString methods were employed to look at expression of genes related to fat and glucose metabolism and this paper compares results from both methods. We conclude that NanoString offers a valuable alternative to qPCR and our data suggest that results are more accurate because of the reduced sample handling and direct quantification of gene copy number without the need for enzymatic amplification. However, we have highlighted a potential challenge for both methods, which needs to be addressed when designing primers or probes. We suggest a literature search for known splice variants of a particular gene to be completed so that primers or probes can be designed that do not span exons which may be affected by alternative gene sequences. Copyright © 2016 Elsevier B.V. All rights reserved.