Sample records for sequence secondary structure

  1. A semi-supervised learning approach for RNA secondary structure prediction.

    PubMed

    Yonemoto, Haruka; Asai, Kiyoshi; Hamada, Michiaki

    2015-08-01

    RNA secondary structure prediction is a key technology in RNA bioinformatics. Most algorithms for RNA secondary structure prediction use probabilistic models, in which the model parameters are trained with reliable RNA secondary structures. Because of the difficulty of determining RNA secondary structures by experimental procedures, such as NMR or X-ray crystal structural analyses, there are still many RNA sequences that could be useful for training whose secondary structures have not been experimentally determined. In this paper, we introduce a novel semi-supervised learning approach for training parameters in a probabilistic model of RNA secondary structures in which we employ not only RNA sequences with annotated secondary structures but also ones with unknown secondary structures. Our model is based on a hybrid of generative (stochastic context-free grammars) and discriminative models (conditional random fields) that has been successfully applied to natural language processing. Computational experiments indicate that the accuracy of secondary structure prediction is improved by incorporating RNA sequences with unknown secondary structures into training. To our knowledge, this is the first study of a semi-supervised learning approach for RNA secondary structure prediction. This technique will be useful when the number of reliable structures is limited. Copyright © 2015 Elsevier Ltd. All rights reserved.

  2. Secondary Structure Predictions for Long RNA Sequences Based on Inversion Excursions and MapReduce.

    PubMed

    Yehdego, Daniel T; Zhang, Boyu; Kodimala, Vikram K R; Johnson, Kyle L; Taufer, Michela; Leung, Ming-Ying

    2013-05-01

    Secondary structures of ribonucleic acid (RNA) molecules play important roles in many biological processes including gene expression and regulation. Experimental observations and computing limitations suggest that we can approach the secondary structure prediction problem for long RNA sequences by segmenting them into shorter chunks, predicting the secondary structures of each chunk individually using existing prediction programs, and then assembling the results to give the structure of the original sequence. The selection of cutting points is a crucial component of the segmenting step. Noting that stem-loops and pseudoknots always contain an inversion, i.e., a stretch of nucleotides followed closely by its inverse complementary sequence, we developed two cutting methods for segmenting long RNA sequences based on inversion excursions: the centered and optimized method. Each step of searching for inversions, chunking, and predictions can be performed in parallel. In this paper we use a MapReduce framework, i.e., Hadoop, to extensively explore meaningful inversion stem lengths and gap sizes for the segmentation and identify correlations between chunking methods and prediction accuracy. We show that for a set of long RNA sequences in the RFAM database, whose secondary structures are known to contain pseudoknots, our approach predicts secondary structures more accurately than methods that do not segment the sequence, when the latter predictions are possible computationally. We also show that, as sequences exceed certain lengths, some programs cannot computationally predict pseudoknots while our chunking methods can. Overall, our predicted structures still retain the accuracy level of the original prediction programs when compared with known experimental secondary structure.

  3. RNA-SSPT: RNA Secondary Structure Prediction Tools.

    PubMed

    Ahmad, Freed; Mahboob, Shahid; Gulzar, Tahsin; Din, Salah U; Hanif, Tanzeela; Ahmad, Hifza; Afzal, Muhammad

    2013-01-01

    The prediction of RNA structure is useful for understanding evolution for both in silico and in vitro studies. Physical methods like NMR studies to predict RNA secondary structure are expensive and difficult. Computational RNA secondary structure prediction is easier. Comparative sequence analysis provides the best solution. But secondary structure prediction of a single RNA sequence is challenging. RNA-SSPT is a tool that computationally predicts secondary structure of a single RNA sequence. Most of the RNA secondary structure prediction tools do not allow pseudoknots in the structure or are unable to locate them. Nussinov dynamic programming algorithm has been implemented in RNA-SSPT. The current studies shows only energetically most favorable secondary structure is required and the algorithm modification is also available that produces base pairs to lower the total free energy of the secondary structure. For visualization of RNA secondary structure, NAVIEW in C language is used and modified in C# for tool requirement. RNA-SSPT is built in C# using Dot Net 2.0 in Microsoft Visual Studio 2005 Professional edition. The accuracy of RNA-SSPT is tested in terms of Sensitivity and Positive Predicted Value. It is a tool which serves both secondary structure prediction and secondary structure visualization purposes.

  4. RNA-SSPT: RNA Secondary Structure Prediction Tools

    PubMed Central

    Ahmad, Freed; Mahboob, Shahid; Gulzar, Tahsin; din, Salah U; Hanif, Tanzeela; Ahmad, Hifza; Afzal, Muhammad

    2013-01-01

    The prediction of RNA structure is useful for understanding evolution for both in silico and in vitro studies. Physical methods like NMR studies to predict RNA secondary structure are expensive and difficult. Computational RNA secondary structure prediction is easier. Comparative sequence analysis provides the best solution. But secondary structure prediction of a single RNA sequence is challenging. RNA-SSPT is a tool that computationally predicts secondary structure of a single RNA sequence. Most of the RNA secondary structure prediction tools do not allow pseudoknots in the structure or are unable to locate them. Nussinov dynamic programming algorithm has been implemented in RNA-SSPT. The current studies shows only energetically most favorable secondary structure is required and the algorithm modification is also available that produces base pairs to lower the total free energy of the secondary structure. For visualization of RNA secondary structure, NAVIEW in C language is used and modified in C# for tool requirement. RNA-SSPT is built in C# using Dot Net 2.0 in Microsoft Visual Studio 2005 Professional edition. The accuracy of RNA-SSPT is tested in terms of Sensitivity and Positive Predicted Value. It is a tool which serves both secondary structure prediction and secondary structure visualization purposes. PMID:24250115

  5. Rtools: a web server for various secondary structural analyses on single RNA sequences.

    PubMed

    Hamada, Michiaki; Ono, Yukiteru; Kiryu, Hisanori; Sato, Kengo; Kato, Yuki; Fukunaga, Tsukasa; Mori, Ryota; Asai, Kiyoshi

    2016-07-08

    The secondary structures, as well as the nucleotide sequences, are the important features of RNA molecules to characterize their functions. According to the thermodynamic model, however, the probability of any secondary structure is very small. As a consequence, any tool to predict the secondary structures of RNAs has limited accuracy. On the other hand, there are a few tools to compensate the imperfect predictions by calculating and visualizing the secondary structural information from RNA sequences. It is desirable to obtain the rich information from those tools through a friendly interface. We implemented a web server of the tools to predict secondary structures and to calculate various structural features based on the energy models of secondary structures. By just giving an RNA sequence to the web server, the user can get the different types of solutions of the secondary structures, the marginal probabilities such as base-paring probabilities, loop probabilities and accessibilities of the local bases, the energy changes by arbitrary base mutations as well as the measures for validations of the predicted secondary structures. The web server is available at http://rtools.cbrc.jp, which integrates software tools, CentroidFold, CentroidHomfold, IPKnot, CapR, Raccess, Rchange and RintD. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  6. A statistical learning approach to the modeling of chromatographic retention of oligonucleotides incorporating sequence and secondary structure data

    PubMed Central

    Sturm, Marc; Quinten, Sascha; Huber, Christian G.; Kohlbacher, Oliver

    2007-01-01

    We propose a new model for predicting the retention time of oligonucleotides. The model is based on ν support vector regression using features derived from base sequence and predicted secondary structure of oligonucleotides. Because of the secondary structure information, the model is applicable even at relatively low temperatures where the secondary structure is not suppressed by thermal denaturing. This makes the prediction of oligonucleotide retention time for arbitrary temperatures possible, provided that the target temperature lies within the temperature range of the training data. We describe different possibilities of feature calculation from base sequence and secondary structure, present the results and compare our model to existing models. PMID:17567619

  7. Free energy minimization to predict RNA secondary structures and computational RNA design.

    PubMed

    Churkin, Alexander; Weinbrand, Lina; Barash, Danny

    2015-01-01

    Determining the RNA secondary structure from sequence data by computational predictions is a long-standing problem. Its solution has been approached in two distinctive ways. If a multiple sequence alignment of a collection of homologous sequences is available, the comparative method uses phylogeny to determine conserved base pairs that are more likely to form as a result of billions of years of evolution than by chance. In the case of single sequences, recursive algorithms that compute free energy structures by using empirically derived energy parameters have been developed. This latter approach of RNA folding prediction by energy minimization is widely used to predict RNA secondary structure from sequence. For a significant number of RNA molecules, the secondary structure of the RNA molecule is indicative of its function and its computational prediction by minimizing its free energy is important for its functional analysis. A general method for free energy minimization to predict RNA secondary structures is dynamic programming, although other optimization methods have been developed as well along with empirically derived energy parameters. In this chapter, we introduce and illustrate by examples the approach of free energy minimization to predict RNA secondary structures.

  8. Protein Interaction Profile Sequencing (PIP-seq).

    PubMed

    Foley, Shawn W; Gregory, Brian D

    2016-10-10

    Every eukaryotic RNA transcript undergoes extensive post-transcriptional processing from the moment of transcription up through degradation. This regulation is performed by a distinct cohort of RNA-binding proteins which recognize their target transcript by both its primary sequence and secondary structure. Here, we describe protein interaction profile sequencing (PIP-seq), a technique that uses ribonuclease-based footprinting followed by high-throughput sequencing to globally assess both protein-bound RNA sequences and RNA secondary structure. PIP-seq utilizes single- and double-stranded RNA-specific nucleases in the absence of proteins to infer RNA secondary structure. These libraries are also compared to samples that undergo nuclease digestion in the presence of proteins in order to find enriched protein-bound sequences. Combined, these four libraries provide a comprehensive, transcriptome-wide view of RNA secondary structure and RNA protein interaction sites from a single experimental technique. © 2016 by John Wiley & Sons, Inc. Copyright © 2016 John Wiley & Sons, Inc.

  9. Predicted secondary structure similarity in the absence of primary amino acid sequence homology: hepatitis B virus open reading frames.

    PubMed Central

    Schaeffer, E; Sninsky, J J

    1984-01-01

    Proteins that are related evolutionarily may have diverged at the level of primary amino acid sequence while maintaining similar secondary structures. Computer analysis has been used to compare the open reading frames of the hepatitis B virus to those of the woodchuck hepatitis virus at the level of amino acid sequence, and to predict the relative hydrophilic character and the secondary structure of putative polypeptides. Similarity is seen at the levels of relative hydrophilicity and secondary structure, in the absence of sequence homology. These data reinforce the proposal that these open reading frames encode viral proteins. Computer analysis of this type can be more generally used to establish structural similarities between proteins that do not share obvious sequence homology as well as to assess whether an open reading frame is fortuitous or codes for a protein. PMID:6585835

  10. Evolutionary optimization of biopolymers and sequence structure maps

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Reidys, C.M.; Kopp, S.; Schuster, P.

    1996-06-01

    Searching for biopolymers having a predefined function is a core problem of biotechnology, biochemistry and pharmacy. On the level of RNA sequences and their corresponding secondary structures we show that this problem can be analyzed mathematically. The strategy will be to study the properties of the RNA sequence to secondary structure mapping that is essential for the understanding of the search process. We show that to each secondary structure s there exists a neutral network consisting of all sequences folding into s. This network can be modeled as a random graph and has the following generic properties: it is densemore » and has a giant component within the graph of compatible sequences. The neutral network percolates sequence space and any two neutral nets come close in terms of Hamming distance. We investigate the distribution of the orders of neutral nets and show that above a certain threshold the topology of neutral nets allows to find practically all frequent secondary structures.« less

  11. JNSViewer—A JavaScript-based Nucleotide Sequence Viewer for DNA/RNA secondary structures

    PubMed Central

    Dong, Min; Graham, Mitchell; Yadav, Nehul

    2017-01-01

    Many tools are available for visualizing RNA or DNA secondary structures, but there is scarce implementation in JavaScript that provides seamless integration with the increasingly popular web computational platforms. We have developed JNSViewer, a highly interactive web service, which is bundled with several popular tools for DNA/RNA secondary structure prediction and can provide precise and interactive correspondence among nucleotides, dot-bracket data, secondary structure graphs, and genic annotations. In JNSViewer, users can perform RNA secondary structure predictions with different programs and settings, add customized genic annotations in GFF format to structure graphs, search for specific linear motifs, and extract relevant structure graphs of sub-sequences. JNSViewer also allows users to choose a transcript or specific segment of Arabidopsis thaliana genome sequences and predict the corresponding secondary structure. Popular genome browsers (i.e., JBrowse and BrowserGenome) were integrated into JNSViewer to provide powerful visualizations of chromosomal locations, genic annotations, and secondary structures. In addition, we used StructureFold with default settings to predict some RNA structures for Arabidopsis by incorporating in vivo high-throughput RNA structure profiling data and stored the results in our web server, which might be a useful resource for RNA secondary structure studies in plants. JNSViewer is available at http://bioinfolab.miamioh.edu/jnsviewer/index.html. PMID:28582416

  12. Prediction of protein secondary structure content for the twilight zone sequences.

    PubMed

    Homaeian, Leila; Kurgan, Lukasz A; Ruan, Jishou; Cios, Krzysztof J; Chen, Ke

    2007-11-15

    Secondary protein structure carries information about local structural arrangements, which include three major conformations: alpha-helices, beta-strands, and coils. Significant majority of successful methods for prediction of the secondary structure is based on multiple sequence alignment. However, multiple alignment fails to provide accurate results when a sequence comes from the twilight zone, that is, it is characterized by low (<30%) homology. To this end, we propose a novel method for prediction of secondary structure content through comprehensive sequence representation, called PSSC-core. The method uses a multiple linear regression model and introduces a comprehensive feature-based sequence representation to predict amount of helices and strands for sequences from the twilight zone. The PSSC-core method was tested and compared with two other state-of-the-art prediction methods on a set of 2187 twilight zone sequences. The results indicate that our method provides better predictions for both helix and strand content. The PSSC-core is shown to provide statistically significantly better results when compared with the competing methods, reducing the prediction error by 5-7% for helix and 7-9% for strand content predictions. The proposed feature-based sequence representation uses a comprehensive set of physicochemical properties that are custom-designed for each of the helix and strand content predictions. It includes composition and composition moment vectors, frequency of tetra-peptides associated with helical and strand conformations, various property-based groups like exchange groups, chemical groups of the side chains and hydrophobic group, auto-correlations based on hydrophobicity, side-chain masses, hydropathy, and conformational patterns for beta-sheets. The PSSC-core method provides an alternative for predicting the secondary structure content that can be used to validate and constrain results of other structure prediction methods. At the same time, it also provides useful insight into design of successful protein sequence representations that can be used in developing new methods related to prediction of different aspects of the secondary protein structure. (c) 2007 Wiley-Liss, Inc.

  13. Modeling repetitive, non‐globular proteins

    PubMed Central

    Basu, Koli; Campbell, Robert L.; Guo, Shuaiqi; Sun, Tianjun

    2016-01-01

    Abstract While ab initio modeling of protein structures is not routine, certain types of proteins are more straightforward to model than others. Proteins with short repetitive sequences typically exhibit repetitive structures. These repetitive sequences can be more amenable to modeling if some information is known about the predominant secondary structure or other key features of the protein sequence. We have successfully built models of a number of repetitive structures with novel folds using knowledge of the consensus sequence within the sequence repeat and an understanding of the likely secondary structures that these may adopt. Our methods for achieving this success are reviewed here. PMID:26914323

  14. Secondary structure prediction and structure-specific sequence analysis of single-stranded DNA.

    PubMed

    Dong, F; Allawi, H T; Anderson, T; Neri, B P; Lyamichev, V I

    2001-08-01

    DNA sequence analysis by oligonucleotide binding is often affected by interference with the secondary structure of the target DNA. Here we describe an approach that improves DNA secondary structure prediction by combining enzymatic probing of DNA by structure-specific 5'-nucleases with an energy minimization algorithm that utilizes the 5'-nuclease cleavage sites as constraints. The method can identify structural differences between two DNA molecules caused by minor sequence variations such as a single nucleotide mutation. It also demonstrates the existence of long-range interactions between DNA regions separated by >300 nt and the formation of multiple alternative structures by a 244 nt DNA molecule. The differences in the secondary structure of DNA molecules revealed by 5'-nuclease probing were used to design structure-specific probes for mutation discrimination that target the regions of structural, rather than sequence, differences. We also demonstrate the performance of structure-specific 'bridge' probes complementary to non-contiguous regions of the target molecule. The structure-specific probes do not require the high stringency binding conditions necessary for methods based on mismatch formation and permit mutation detection at temperatures from 4 to 37 degrees C. Structure-specific sequence analysis is applied for mutation detection in the Mycobacterium tuberculosis katG gene and for genotyping of the hepatitis C virus.

  15. A generalized analysis of hydrophobic and loop clusters within globular protein sequences

    PubMed Central

    Eudes, Richard; Le Tuan, Khanh; Delettré, Jean; Mornon, Jean-Paul; Callebaut, Isabelle

    2007-01-01

    Background Hydrophobic Cluster Analysis (HCA) is an efficient way to compare highly divergent sequences through the implicit secondary structure information directly derived from hydrophobic clusters. However, its efficiency and application are currently limited by the need of user expertise. In order to help the analysis of HCA plots, we report here the structural preferences of hydrophobic cluster species, which are frequently encountered in globular domains of proteins. These species are characterized only by their hydrophobic/non-hydrophobic dichotomy. This analysis has been extended to loop-forming clusters, using an appropriate loop alphabet. Results The structural behavior of hydrophobic cluster species, which are typical of protein globular domains, was investigated within banks of experimental structures, considered at different levels of sequence redundancy. The 294 more frequent hydrophobic cluster species were analyzed with regard to their association with the different secondary structures (frequencies of association with secondary structures and secondary structure propensities). Hydrophobic cluster species are predominantly associated with regular secondary structures, and a large part (60 %) reveals preferences for α-helices or β-strands. Moreover, the analysis of the hydrophobic cluster amino acid composition generally allows for finer prediction of the regular secondary structure associated with the considered cluster within a cluster species. We also investigated the behavior of loop forming clusters, using a "PGDNS" alphabet. These loop clusters do not overlap with hydrophobic clusters and are highly associated with coils. Finally, the structural information contained in the hydrophobic structural words, as deduced from experimental structures, was compared to the PSI-PRED predictions, revealing that β-strands and especially α-helices are generally over-predicted within the limits of typical β and α hydrophobic clusters. Conclusion The dictionary of hydrophobic clusters described here can help the HCA user to interpret and compare the HCA plots of globular protein sequences, as well as provides an original fundamental insight into the structural bricks of protein folds. Moreover, the novel loop cluster analysis brings additional information for secondary structure prediction on the whole sequence through a generalized cluster analysis (GCA), and not only on regular secondary structures. Such information lays the foundations for developing a new and original tool for secondary structure prediction. PMID:17210072

  16. RDNAnalyzer: A tool for DNA secondary structure prediction and sequence analysis.

    PubMed

    Afzal, Muhammad; Shahid, Ahmad Ali; Shehzadi, Abida; Nadeem, Shahid; Husnain, Tayyab

    2012-01-01

    RDNAnalyzer is an innovative computer based tool designed for DNA secondary structure prediction and sequence analysis. It can randomly generate the DNA sequence or user can upload the sequences of their own interest in RAW format. It uses and extends the Nussinov dynamic programming algorithm and has various application for the sequence analysis. It predicts the DNA secondary structure and base pairings. It also provides the tools for routinely performed sequence analysis by the biological scientists such as DNA replication, reverse compliment generation, transcription, translation, sequence specific information as total number of nucleotide bases, ATGC base contents along with their respective percentages and sequence cleaner. RDNAnalyzer is a unique tool developed in Microsoft Visual Studio 2008 using Microsoft Visual C# and Windows Presentation Foundation and provides user friendly environment for sequence analysis. It is freely available. http://www.cemb.edu.pk/sw.html RDNAnalyzer - Random DNA Analyser, GUI - Graphical user interface, XAML - Extensible Application Markup Language.

  17. An Adaptive Defect Weighted Sampling Algorithm to Design Pseudoknotted RNA Secondary Structures

    PubMed Central

    Zandi, Kasra; Butler, Gregory; Kharma, Nawwaf

    2016-01-01

    Computational design of RNA sequences that fold into targeted secondary structures has many applications in biomedicine, nanotechnology and synthetic biology. An RNA molecule is made of different types of secondary structure elements and an important RNA element named pseudoknot plays a key role in stabilizing the functional form of the molecule. However, due to the computational complexities associated with characterizing pseudoknotted RNA structures, most of the existing RNA sequence designer algorithms generally ignore this important structural element and therefore limit their applications. In this paper we present a new algorithm to design RNA sequences for pseudoknotted secondary structures. We use NUPACK as the folding algorithm to compute the equilibrium characteristics of the pseudoknotted RNAs, and describe a new adaptive defect weighted sampling algorithm named Enzymer to design low ensemble defect RNA sequences for targeted secondary structures including pseudoknots. We used a biological data set of 201 pseudoknotted structures from the Pseudobase library to benchmark the performance of our algorithm. We compared the quality characteristics of the RNA sequences we designed by Enzymer with the results obtained from the state of the art MODENA and antaRNA. Our results show our method succeeds more frequently than MODENA and antaRNA do, and generates sequences that have lower ensemble defect, lower probability defect and higher thermostability. Finally by using Enzymer and by constraining the design to a naturally occurring and highly conserved Hammerhead motif, we designed 8 sequences for a pseudoknotted cis-acting Hammerhead ribozyme. Enzymer is available for download at https://bitbucket.org/casraz/enzymer. PMID:27499762

  18. RNAstructure: software for RNA secondary structure prediction and analysis.

    PubMed

    Reuter, Jessica S; Mathews, David H

    2010-03-15

    To understand an RNA sequence's mechanism of action, the structure must be known. Furthermore, target RNA structure is an important consideration in the design of small interfering RNAs and antisense DNA oligonucleotides. RNA secondary structure prediction, using thermodynamics, can be used to develop hypotheses about the structure of an RNA sequence. RNAstructure is a software package for RNA secondary structure prediction and analysis. It uses thermodynamics and utilizes the most recent set of nearest neighbor parameters from the Turner group. It includes methods for secondary structure prediction (using several algorithms), prediction of base pair probabilities, bimolecular structure prediction, and prediction of a structure common to two sequences. This contribution describes new extensions to the package, including a library of C++ classes for incorporation into other programs, a user-friendly graphical user interface written in JAVA, and new Unix-style text interfaces. The original graphical user interface for Microsoft Windows is still maintained. The extensions to RNAstructure serve to make RNA secondary structure prediction user-friendly. The package is available for download from the Mathews lab homepage at http://rna.urmc.rochester.edu/RNAstructure.html.

  19. RNACompress: Grammar-based compression and informational complexity measurement of RNA secondary structure.

    PubMed

    Liu, Qi; Yang, Yu; Chen, Chun; Bu, Jiajun; Zhang, Yin; Ye, Xiuzi

    2008-03-31

    With the rapid emergence of RNA databases and newly identified non-coding RNAs, an efficient compression algorithm for RNA sequence and structural information is needed for the storage and analysis of such data. Although several algorithms for compressing DNA sequences have been proposed, none of them are suitable for the compression of RNA sequences with their secondary structures simultaneously. This kind of compression not only facilitates the maintenance of RNA data, but also supplies a novel way to measure the informational complexity of RNA structural data, raising the possibility of studying the relationship between the functional activities of RNA structures and their complexities, as well as various structural properties of RNA based on compression. RNACompress employs an efficient grammar-based model to compress RNA sequences and their secondary structures. The main goals of this algorithm are two fold: (1) present a robust and effective way for RNA structural data compression; (2) design a suitable model to represent RNA secondary structure as well as derive the informational complexity of the structural data based on compression. Our extensive tests have shown that RNACompress achieves a universally better compression ratio compared with other sequence-specific or common text-specific compression algorithms, such as Gencompress, winrar and gzip. Moreover, a test of the activities of distinct GTP-binding RNAs (aptamers) compared with their structural complexity shows that our defined informational complexity can be used to describe how complexity varies with activity. These results lead to an objective means of comparing the functional properties of heteropolymers from the information perspective. A universal algorithm for the compression of RNA secondary structure as well as the evaluation of its informational complexity is discussed in this paper. We have developed RNACompress, as a useful tool for academic users. Extensive tests have shown that RNACompress is a universally efficient algorithm for the compression of RNA sequences with their secondary structures. RNACompress also serves as a good measurement of the informational complexity of RNA secondary structure, which can be used to study the functional activities of RNA molecules.

  20. RNACompress: Grammar-based compression and informational complexity measurement of RNA secondary structure

    PubMed Central

    Liu, Qi; Yang, Yu; Chen, Chun; Bu, Jiajun; Zhang, Yin; Ye, Xiuzi

    2008-01-01

    Background With the rapid emergence of RNA databases and newly identified non-coding RNAs, an efficient compression algorithm for RNA sequence and structural information is needed for the storage and analysis of such data. Although several algorithms for compressing DNA sequences have been proposed, none of them are suitable for the compression of RNA sequences with their secondary structures simultaneously. This kind of compression not only facilitates the maintenance of RNA data, but also supplies a novel way to measure the informational complexity of RNA structural data, raising the possibility of studying the relationship between the functional activities of RNA structures and their complexities, as well as various structural properties of RNA based on compression. Results RNACompress employs an efficient grammar-based model to compress RNA sequences and their secondary structures. The main goals of this algorithm are two fold: (1) present a robust and effective way for RNA structural data compression; (2) design a suitable model to represent RNA secondary structure as well as derive the informational complexity of the structural data based on compression. Our extensive tests have shown that RNACompress achieves a universally better compression ratio compared with other sequence-specific or common text-specific compression algorithms, such as Gencompress, winrar and gzip. Moreover, a test of the activities of distinct GTP-binding RNAs (aptamers) compared with their structural complexity shows that our defined informational complexity can be used to describe how complexity varies with activity. These results lead to an objective means of comparing the functional properties of heteropolymers from the information perspective. Conclusion A universal algorithm for the compression of RNA secondary structure as well as the evaluation of its informational complexity is discussed in this paper. We have developed RNACompress, as a useful tool for academic users. Extensive tests have shown that RNACompress is a universally efficient algorithm for the compression of RNA sequences with their secondary structures. RNACompress also serves as a good measurement of the informational complexity of RNA secondary structure, which can be used to study the functional activities of RNA molecules. PMID:18373878

  1. Analysis of sequencing data for probing RNA secondary structures and protein-RNA binding in studying posttranscriptional regulations.

    PubMed

    Hu, Xihao; Wu, Yang; Lu, Zhi John; Yip, Kevin Y

    2016-11-01

    High-throughput sequencing has been used to study posttranscriptional regulations, where the identification of protein-RNA binding is a major and fast-developing sub-area, which is in turn benefited by the sequencing methods for whole-transcriptome probing of RNA secondary structures. In the study of RNA secondary structures using high-throughput sequencing, bases are modified or cleaved according to their structural features, which alter the resulting composition of sequencing reads. In the study of protein-RNA binding, methods have been proposed to immuno-precipitate (IP) protein-bound RNA transcripts in vitro or in vivo By sequencing these transcripts, the protein-RNA interactions and the binding locations can be identified. For both types of data, read counts are affected by a combination of confounding factors, including expression levels of transcripts, sequence biases, mapping errors and the probing or IP efficiency of the experimental protocols. Careful processing of the sequencing data and proper extraction of important features are fundamentally important to a successful analysis. Here we review and compare different experimental methods for probing RNA secondary structures and binding sites of RNA-binding proteins (RBPs), and the computational methods proposed for analyzing the corresponding sequencing data. We suggest how these two types of data should be integrated to study the structural properties of RBP binding sites as a systematic way to better understand posttranscriptional regulations. © The Author 2015. Published by Oxford University Press. For Permissions, please email: journals.permissions@oup.com.

  2. RDNAnalyzer: A tool for DNA secondary structure prediction and sequence analysis

    PubMed Central

    Afzal, Muhammad; Shahid, Ahmad Ali; Shehzadi, Abida; Nadeem, Shahid; Husnain, Tayyab

    2012-01-01

    RDNAnalyzer is an innovative computer based tool designed for DNA secondary structure prediction and sequence analysis. It can randomly generate the DNA sequence or user can upload the sequences of their own interest in RAW format. It uses and extends the Nussinov dynamic programming algorithm and has various application for the sequence analysis. It predicts the DNA secondary structure and base pairings. It also provides the tools for routinely performed sequence analysis by the biological scientists such as DNA replication, reverse compliment generation, transcription, translation, sequence specific information as total number of nucleotide bases, ATGC base contents along with their respective percentages and sequence cleaner. RDNAnalyzer is a unique tool developed in Microsoft Visual Studio 2008 using Microsoft Visual C# and Windows Presentation Foundation and provides user friendly environment for sequence analysis. It is freely available. Availability http://www.cemb.edu.pk/sw.html Abbreviations RDNAnalyzer - Random DNA Analyser, GUI - Graphical user interface, XAML - Extensible Application Markup Language. PMID:23055611

  3. Metamorphic Proteins: Emergence of Dual Protein Folds from One Primary Sequence.

    PubMed

    Lella, Muralikrishna; Mahalakshmi, Radhakrishnan

    2017-06-20

    Every amino acid exhibits a different propensity for distinct structural conformations. Hence, decoding how the primary amino acid sequence undergoes the transition to a defined secondary structure and its final three-dimensional fold is presently considered predictable with reasonable certainty. However, protein sequences that defy the first principles of secondary structure prediction (they attain two different folds) have recently been discovered. Such proteins, aptly named metamorphic proteins, decrease the conformational constraint by increasing flexibility in the secondary structure and thereby result in efficient functionality. In this review, we discuss the major factors driving the conformational switch related both to protein sequence and to structure using illustrative examples. We discuss the concept of an evolutionary transition in sequence and structure, the functional impact of the tertiary fold, and the pressure of intrinsic and external factors that give rise to metamorphic proteins. We mainly focus on the major components of protein architecture, namely, the α-helix and β-sheet segments, which are involved in conformational switching within the same or highly similar sequences. These chameleonic sequences are widespread in both cytosolic and membrane proteins, and these folds are equally important for protein structure and function. We discuss the implications of metamorphic proteins and chameleonic peptide sequences in de novo peptide design.

  4. Insights into the phylogenetic positions of photosynthetic bacteria obtained from 5S rRNA and 16S rRNA sequence data

    NASA Technical Reports Server (NTRS)

    Fox, G. E.

    1985-01-01

    Comparisons of complete 16S ribosomal ribonucleic acid (rRNA) sequences established that the secondary structure of these molecules is highly conserved. Earlier work with 5S rRNA secondary structure revealed that when structural conservation exists the alignment of sequences is straightforward. The constancy of structure implies minimal functional change. Under these conditions a uniform evolutionary rate can be expected so that conditions are favorable for phylogenetic tree construction.

  5. Predicting residue-wise contact orders in proteins by support vector regression.

    PubMed

    Song, Jiangning; Burrage, Kevin

    2006-10-03

    The residue-wise contact order (RWCO) describes the sequence separations between the residues of interest and its contacting residues in a protein sequence. It is a new kind of one-dimensional protein structure that represents the extent of long-range contacts and is considered as a generalization of contact order. Together with secondary structure, accessible surface area, the B factor, and contact number, RWCO provides comprehensive and indispensable important information to reconstructing the protein three-dimensional structure from a set of one-dimensional structural properties. Accurately predicting RWCO values could have many important applications in protein three-dimensional structure prediction and protein folding rate prediction, and give deep insights into protein sequence-structure relationships. We developed a novel approach to predict residue-wise contact order values in proteins based on support vector regression (SVR), starting from primary amino acid sequences. We explored seven different sequence encoding schemes to examine their effects on the prediction performance, including local sequence in the form of PSI-BLAST profiles, local sequence plus amino acid composition, local sequence plus molecular weight, local sequence plus secondary structure predicted by PSIPRED, local sequence plus molecular weight and amino acid composition, local sequence plus molecular weight and predicted secondary structure, and local sequence plus molecular weight, amino acid composition and predicted secondary structure. When using local sequences with multiple sequence alignments in the form of PSI-BLAST profiles, we could predict the RWCO distribution with a Pearson correlation coefficient (CC) between the predicted and observed RWCO values of 0.55, and root mean square error (RMSE) of 0.82, based on a well-defined dataset with 680 protein sequences. Moreover, by incorporating global features such as molecular weight and amino acid composition we could further improve the prediction performance with the CC to 0.57 and an RMSE of 0.79. In addition, combining the predicted secondary structure by PSIPRED was found to significantly improve the prediction performance and could yield the best prediction accuracy with a CC of 0.60 and RMSE of 0.78, which provided at least comparable performance compared with the other existing methods. The SVR method shows a prediction performance competitive with or at least comparable to the previously developed linear regression-based methods for predicting RWCO values. In contrast to support vector classification (SVC), SVR is very good at estimating the raw value profiles of the samples. The successful application of the SVR approach in this study reinforces the fact that support vector regression is a powerful tool in extracting the protein sequence-structure relationship and in estimating the protein structural profiles from amino acid sequences.

  6. Structural diversity of domain superfamilies in the CATH database.

    PubMed

    Reeves, Gabrielle A; Dallman, Timothy J; Redfern, Oliver C; Akpor, Adrian; Orengo, Christine A

    2006-07-14

    The CATH database of domain structures has been used to explore the structural variation of homologous domains in 294 well populated domain structure superfamilies, each containing at least three sequence diverse relatives. Our analyses confirm some previously detected trends relating sequence divergence to structural variation but for a much larger dataset and in some superfamilies the new data reveal exceptional structural variation. Use of a new algorithm (2DSEC) to analyse variability in secondary structure compositions across a superfamily sheds new light on how structures evolve. 2DSEC detects inserted secondary structures that embellish the core of conserved secondary structures found throughout the superfamily. Analysis showed that for 56% of highly populated superfamilies (>9 sequence diverse relatives), there are twofold or more increases in the numbers of secondary structures in some relatives. In some families fivefold increases occur, sometimes modifying the fold of the domain. Manual inspection of secondary structure insertions or embellishments in 48 particularly variable superfamilies revealed that although these insertions were usually discontiguous in the sequence they were often co-located in 3D resulting in a larger structural motif that often modified the geometry of the active site or the surface conformation promoting diverse domain partnerships and protein interactions. These observations, supported by automatic analysis of all well populated CATH families, suggest that accretion of small secondary structure insertions may provide a simple mechanism for evolving new functions in diverse relatives. Some layered domain architectures (e.g. mainly-beta and alpha-beta sandwiches) that recur highly in the genomes more frequently exploit these types of embellishments to modify function. In these architectures, aggregation occurs most often at the edges, top or bottom of the beta-sheets. Information on structural variability across domain superfamilies has been made available through the CATH Dictionary of Homologous Structures (DHS).

  7. ITS2 data corroborate a monophyletic chlorophycean DO-group (Sphaeropleales)

    PubMed Central

    2008-01-01

    Background Within Chlorophyceae the ITS2 secondary structure shows an unbranched helix I, except for the 'Hydrodictyon' and the 'Scenedesmus' clade having a ramified first helix. The latter two are classified within the Sphaeropleales, characterised by directly opposed basal bodies in their flagellar apparatuses (DO-group). Previous studies could not resolve the taxonomic position of the 'Sphaeroplea' clade within the Chlorophyceae without ambiguity and two pivotal questions remain open: (1) Is the DO-group monophyletic and (2) is a branched helix I an apomorphic feature of the DO-group? In the present study we analysed the secondary structure of three newly obtained ITS2 sequences classified within the 'Sphaeroplea' clade and resolved sphaeroplealean relationships by applying different phylogenetic approaches based on a combined sequence-structure alignment. Results The newly obtained ITS2 sequences of Ankyra judayi, Atractomorpha porcata and Sphaeroplea annulina of the 'Sphaeroplea' clade do not show any branching in the secondary structure of their helix I. All applied phylogenetic methods highly support the 'Sphaeroplea' clade as a sister group to the 'core Sphaeropleales'. Thus, the DO-group is monophyletic. Furthermore, based on characteristics in the sequence-structure alignment one is able to distinguish distinct lineages within the green algae. Conclusion In green algae, a branched helix I in the secondary structure of the ITS2 evolves past the 'Sphaeroplea' clade. A branched helix I is an apomorph characteristic within the monophyletic DO-group. Our results corroborate the fundamental relevance of including the secondary structure in sequence analysis and phylogenetics. PMID:18655698

  8. The predicted secondary structures of class I fructose-bisphosphate aldolases.

    PubMed Central

    Sawyer, L; Fothergill-Gilmore, L A; Freemont, P S

    1988-01-01

    The results of several secondary-structure prediction programs were combined to produce an estimate of the regions of alpha-helix, beta-sheet and reverse turns for fructose-bisphosphate aldolases from human and rat muscle and liver, from Trypanosoma brucei and from Drosophila melanogaster. All the aldolase sequences gave essentially the same pattern of secondary-structure predictions despite having sequences up to 50% different. One exception to this pattern was an additional strongly predicted helix in the rat liver and Drosophila enzymes. Regions of relatively high sequence variation generally were predicted as reverse turns, and probably occur as surface loops. Most of the positions corresponding to exon boundaries are located between regions predicted to have secondary-structural elements consistent with a compact structure. The predominantly alternating alpha/beta structure predicted is consistent with the alpha/beta-barrel structure indicated by preliminary high-resolution X-ray diffraction studies on rabbit muscle aldolase [Sygusch, Beaudry & Allaire (1986) Biophys. J. 49, 287a]. Images Fig. 1. (cont.) Fig. 1. PMID:3128269

  9. PARTS: Probabilistic Alignment for RNA joinT Secondary structure prediction

    PubMed Central

    Harmanci, Arif Ozgun; Sharma, Gaurav; Mathews, David H.

    2008-01-01

    A novel method is presented for joint prediction of alignment and common secondary structures of two RNA sequences. The joint consideration of common secondary structures and alignment is accomplished by structural alignment over a search space defined by the newly introduced motif called matched helical regions. The matched helical region formulation generalizes previously employed constraints for structural alignment and thereby better accommodates the structural variability within RNA families. A probabilistic model based on pseudo free energies obtained from precomputed base pairing and alignment probabilities is utilized for scoring structural alignments. Maximum a posteriori (MAP) common secondary structures, sequence alignment and joint posterior probabilities of base pairing are obtained from the model via a dynamic programming algorithm called PARTS. The advantage of the more general structural alignment of PARTS is seen in secondary structure predictions for the RNase P family. For this family, the PARTS MAP predictions of secondary structures and alignment perform significantly better than prior methods that utilize a more restrictive structural alignment model. For the tRNA and 5S rRNA families, the richer structural alignment model of PARTS does not offer a benefit and the method therefore performs comparably with existing alternatives. For all RNA families studied, the posterior probability estimates obtained from PARTS offer an improvement over posterior probability estimates from a single sequence prediction. When considering the base pairings predicted over a threshold value of confidence, the combination of sensitivity and positive predictive value is superior for PARTS than for the single sequence prediction. PARTS source code is available for download under the GNU public license at http://rna.urmc.rochester.edu. PMID:18304945

  10. bpRNA: large-scale automated annotation and analysis of RNA secondary structure.

    PubMed

    Danaee, Padideh; Rouches, Mason; Wiley, Michelle; Deng, Dezhong; Huang, Liang; Hendrix, David

    2018-05-09

    While RNA secondary structure prediction from sequence data has made remarkable progress, there is a need for improved strategies for annotating the features of RNA secondary structures. Here, we present bpRNA, a novel annotation tool capable of parsing RNA structures, including complex pseudoknot-containing RNAs, to yield an objective, precise, compact, unambiguous, easily-interpretable description of all loops, stems, and pseudoknots, along with the positions, sequence, and flanking base pairs of each such structural feature. We also introduce several new informative representations of RNA structure types to improve structure visualization and interpretation. We have further used bpRNA to generate a web-accessible meta-database, 'bpRNA-1m', of over 100 000 single-molecule, known secondary structures; this is both more fully and accurately annotated and over 20-times larger than existing databases. We use a subset of the database with highly similar (≥90% identical) sequences filtered out to report on statistical trends in sequence, flanking base pairs, and length. Both the bpRNA method and the bpRNA-1m database will be valuable resources both for specific analysis of individual RNA molecules and large-scale analyses such as are useful for updating RNA energy parameters for computational thermodynamic predictions, improving machine learning models for structure prediction, and for benchmarking structure-prediction algorithms.

  11. Knowledge-based computational intelligence development for predicting protein secondary structures from sequences.

    PubMed

    Shen, Hong-Bin; Yi, Dong-Liang; Yao, Li-Xiu; Yang, Jie; Chou, Kuo-Chen

    2008-10-01

    In the postgenomic age, with the avalanche of protein sequences generated and relatively slow progress in determining their structures by experiments, it is important to develop automated methods to predict the structure of a protein from its sequence. The membrane proteins are a special group in the protein family that accounts for approximately 30% of all proteins; however, solved membrane protein structures only represent less than 1% of known protein structures to date. Although a great success has been achieved for developing computational intelligence techniques to predict secondary structures in both globular and membrane proteins, there is still much challenging work in this regard. In this review article, we firstly summarize the recent progress of automation methodology development in predicting protein secondary structures, especially in membrane proteins; we will then give some future directions in this research field.

  12. RNA-TVcurve: a Web server for RNA secondary structure comparison based on a multi-scale similarity of its triple vector curve representation.

    PubMed

    Li, Ying; Shi, Xiaohu; Liang, Yanchun; Xie, Juan; Zhang, Yu; Ma, Qin

    2017-01-21

    RNAs have been found to carry diverse functionalities in nature. Inferring the similarity between two given RNAs is a fundamental step to understand and interpret their functional relationship. The majority of functional RNAs show conserved secondary structures, rather than sequence conservation. Those algorithms relying on sequence-based features usually have limitations in their prediction performance. Hence, integrating RNA structure features is very critical for RNA analysis. Existing algorithms mainly fall into two categories: alignment-based and alignment-free. The alignment-free algorithms of RNA comparison usually have lower time complexity than alignment-based algorithms. An alignment-free RNA comparison algorithm was proposed, in which novel numerical representations RNA-TVcurve (triple vector curve representation) of RNA sequence and corresponding secondary structure features are provided. Then a multi-scale similarity score of two given RNAs was designed based on wavelet decomposition of their numerical representation. In support of RNA mutation and phylogenetic analysis, a web server (RNA-TVcurve) was designed based on this alignment-free RNA comparison algorithm. It provides three functional modules: 1) visualization of numerical representation of RNA secondary structure; 2) detection of single-point mutation based on secondary structure; and 3) comparison of pairwise and multiple RNA secondary structures. The inputs of the web server require RNA primary sequences, while corresponding secondary structures are optional. For the primary sequences alone, the web server can compute the secondary structures using free energy minimization algorithm in terms of RNAfold tool from Vienna RNA package. RNA-TVcurve is the first integrated web server, based on an alignment-free method, to deliver a suite of RNA analysis functions, including visualization, mutation analysis and multiple RNAs structure comparison. The comparison results with two popular RNA comparison tools, RNApdist and RNAdistance, showcased that RNA-TVcurve can efficiently capture subtle relationships among RNAs for mutation detection and non-coding RNA classification. All the relevant results were shown in an intuitive graphical manner, and can be freely downloaded from this server. RNA-TVcurve, along with test examples and detailed documents, are available at: http://ml.jlu.edu.cn/tvcurve/ .

  13. Prediction of Spontaneous Protein Deamidation from Sequence-Derived Secondary Structure and Intrinsic Disorder.

    PubMed

    Lorenzo, J Ramiro; Alonso, Leonardo G; Sánchez, Ignacio E

    2015-01-01

    Asparagine residues in proteins undergo spontaneous deamidation, a post-translational modification that may act as a molecular clock for the regulation of protein function and turnover. Asparagine deamidation is modulated by protein local sequence, secondary structure and hydrogen bonding. We present NGOME, an algorithm able to predict non-enzymatic deamidation of internal asparagine residues in proteins in the absence of structural data, using sequence-based predictions of secondary structure and intrinsic disorder. Compared to previous algorithms, NGOME does not require three-dimensional structures yet yields better predictions than available sequence-only methods. Four case studies of specific proteins show how NGOME may help the user identify deamidation-prone asparagine residues, often related to protein gain of function, protein degradation or protein misfolding in pathological processes. A fifth case study applies NGOME at a proteomic scale and unveils a correlation between asparagine deamidation and protein degradation in yeast. NGOME is freely available as a webserver at the National EMBnet node Argentina, URL: http://www.embnet.qb.fcen.uba.ar/ in the subpage "Protein and nucleic acid structure and sequence analysis".

  14. RNA Secondary Structure Prediction by Using Discrete Mathematics: An Interdisciplinary Research Experience for Undergraduate Students

    ERIC Educational Resources Information Center

    Ellington, Roni; Wachira, James; Nkwanta, Asamoah

    2010-01-01

    The focus of this Research Experience for Undergraduates (REU) project was on RNA secondary structure prediction by using a lattice walk approach. The lattice walk approach is a combinatorial and computational biology method used to enumerate possible secondary structures and predict RNA secondary structure from RNA sequences. The method uses…

  15. Evaluation of sequence alignments and oligonucleotide probes with respect to three-dimensional structure of ribosomal RNA using ARB software package

    PubMed Central

    Kumar, Yadhu; Westram, Ralf; Kipfer, Peter; Meier, Harald; Ludwig, Wolfgang

    2006-01-01

    Background Availability of high-resolution RNA crystal structures for the 30S and 50S ribosomal subunits and the subsequent validation of comparative secondary structure models have prompted the biologists to use three-dimensional structure of ribosomal RNA (rRNA) for evaluating sequence alignments of rRNA genes. Furthermore, the secondary and tertiary structural features of rRNA are highly useful and successfully employed in designing rRNA targeted oligonucleotide probes intended for in situ hybridization experiments. RNA3D, a program to combine sequence alignment information with three-dimensional structure of rRNA was developed. Integration into ARB software package, which is used extensively by the scientific community for phylogenetic analysis and molecular probe designing, has substantially extended the functionality of ARB software suite with 3D environment. Results Three-dimensional structure of rRNA is visualized in OpenGL 3D environment with the abilities to change the display and overlay information onto the molecule, dynamically. Phylogenetic information derived from the multiple sequence alignments can be overlaid onto the molecule structure in a real time. Superimposition of both statistical and non-statistical sequence associated information onto the rRNA 3D structure can be done using customizable color scheme, which is also applied to a textual sequence alignment for reference. Oligonucleotide probes designed by ARB probe design tools can be mapped onto the 3D structure along with the probe accessibility models for evaluation with respect to secondary and tertiary structural conformations of rRNA. Conclusion Visualization of three-dimensional structure of rRNA in an intuitive display provides the biologists with the greater possibilities to carry out structure based phylogenetic analysis. Coupled with secondary structure models of rRNA, RNA3D program aids in validating the sequence alignments of rRNA genes and evaluating probe target sites. Superimposition of the information derived from the multiple sequence alignment onto the molecule dynamically allows the researchers to observe any sequence inherited characteristics (phylogenetic information) in real-time environment. The extended ARB software package is made freely available for the scientific community via . PMID:16672074

  16. Novel Approach to Analyzing MFE of Noncoding RNA Sequences

    PubMed Central

    George, Tina P.; Thomas, Tessamma

    2016-01-01

    Genomic studies have become noncoding RNA (ncRNA) centric after the study of different genomes provided enormous information on ncRNA over the past decades. The function of ncRNA is decided by its secondary structure, and across organisms, the secondary structure is more conserved than the sequence itself. In this study, the optimal secondary structure or the minimum free energy (MFE) structure of ncRNA was found based on the thermodynamic nearest neighbor model. MFE of over 2600 ncRNA sequences was analyzed in view of its signal properties. Mathematical models linking MFE to the signal properties were found for each of the four classes of ncRNA analyzed. MFE values computed with the proposed models were in concordance with those obtained with the standard web servers. A total of 95% of the sequences analyzed had deviation of MFE values within ±15% relative to those obtained from standard web servers. PMID:27695341

  17. Novel Approach to Analyzing MFE of Noncoding RNA Sequences.

    PubMed

    George, Tina P; Thomas, Tessamma

    2016-01-01

    Genomic studies have become noncoding RNA (ncRNA) centric after the study of different genomes provided enormous information on ncRNA over the past decades. The function of ncRNA is decided by its secondary structure, and across organisms, the secondary structure is more conserved than the sequence itself. In this study, the optimal secondary structure or the minimum free energy (MFE) structure of ncRNA was found based on the thermodynamic nearest neighbor model. MFE of over 2600 ncRNA sequences was analyzed in view of its signal properties. Mathematical models linking MFE to the signal properties were found for each of the four classes of ncRNA analyzed. MFE values computed with the proposed models were in concordance with those obtained with the standard web servers. A total of 95% of the sequences analyzed had deviation of MFE values within ±15% relative to those obtained from standard web servers.

  18. Translocation and gross deletion breakpoints in human inherited disease and cancer II: Potential involvement of repetitive sequence elements in secondary structure formation between DNA ends.

    PubMed

    Chuzhanova, Nadia; Abeysinghe, Shaun S; Krawczak, Michael; Cooper, David N

    2003-09-01

    Translocations and gross deletions are responsible for a significant proportion of both cancer and inherited disease. Although such gene rearrangements are nonuniformly distributed in the human genome, the underlying mutational mechanisms remain unclear. We have studied the potential involvement of various types of repetitive sequence elements in the formation of secondary structure intermediates between the single-stranded DNA ends that recombine during rearrangements. Complexity analysis was used to assess the potential of these ends to form secondary structures, the maximum decrease in complexity consequent to a gross rearrangement being used as an indicator of the type of repeat and the specific DNA ends involved. A total of 175 pairs of deletion/translocation breakpoint junction sequences available from the Gross Rearrangement Breakpoint Database [GRaBD; www.uwcm.ac.uk/uwcm/mg/grabd/grabd.html] were analyzed. Potential secondary structure was noted between the 5' flanking sequence of the first breakpoint and the 3' flanking sequence of the second breakpoint in 49% of rearrangements and between the 5' flanking sequence of the second breakpoint and the 3' flanking sequence of the first breakpoint in 36% of rearrangements. Inverted repeats, inversions of inverted repeats, and symmetric elements were found in association with gross rearrangements at approximately the same frequency. However, inverted repeats and inversions of inverted repeats accounted for the vast majority (83%) of deletions plus small insertions, symmetric elements for one-half of all antigen receptor-mediated translocations, while direct repeats appear only to be involved in mediating simple deletions. These findings extend our understanding of illegitimate recombination by highlighting the importance of secondary structure formation between single-stranded DNA ends at breakpoint junctions. Copyright 2003 Wiley-Liss, Inc.

  19. PSS-3D1D: an improved 3D1D profile method of protein fold recognition for the annotation of twilight zone sequences.

    PubMed

    Ganesan, K; Parthasarathy, S

    2011-12-01

    Annotation of any newly determined protein sequence depends on the pairwise sequence identity with known sequences. However, for the twilight zone sequences which have only 15-25% identity, the pair-wise comparison methods are inadequate and the annotation becomes a challenging task. Such sequences can be annotated by using methods that recognize their fold. Bowie et al. described a 3D1D profile method in which the amino acid sequences that fold into a known 3D structure are identified by their compatibility to that known 3D structure. We have improved the above method by using the predicted secondary structure information and employ it for fold recognition from the twilight zone sequences. In our Protein Secondary Structure 3D1D (PSS-3D1D) method, a score (w) for the predicted secondary structure of the query sequence is included in finding the compatibility of the query sequence to the known fold 3D structures. In the benchmarks, the PSS-3D1D method shows a maximum of 21% improvement in predicting correctly the α + β class of folds from the sequences with twilight zone level of identity, when compared with the 3D1D profile method. Hence, the PSS-3D1D method could offer more clues than the 3D1D method for the annotation of twilight zone sequences. The web based PSS-3D1D method is freely available in the PredictFold server at http://bioinfo.bdu.ac.in/servers/ .

  20. Finding the target sites of RNA-binding proteins

    PubMed Central

    Li, Xiao; Kazan, Hilal; Lipshitz, Howard D; Morris, Quaid D

    2014-01-01

    RNA–protein interactions differ from DNA–protein interactions because of the central role of RNA secondary structure. Some RNA-binding domains (RBDs) recognize their target sites mainly by their shape and geometry and others are sequence-specific but are sensitive to secondary structure context. A number of small- and large-scale experimental approaches have been developed to measure RNAs associated in vitro and in vivo with RNA-binding proteins (RBPs). Generalizing outside of the experimental conditions tested by these assays requires computational motif finding. Often RBP motif finding is done by adapting DNA motif finding methods; but modeling secondary structure context leads to better recovery of RBP-binding preferences. Genome-wide assessment of mRNA secondary structure has recently become possible, but these data must be combined with computational predictions of secondary structure before they add value in predicting in vivo binding. There are two main approaches to incorporating structural information into motif models: supplementing primary sequence motif models with preferred secondary structure contexts (e.g., MEMERIS and RNAcontext) and directly modeling secondary structure recognized by the RBP using stochastic context-free grammars (e.g., CMfinder and RNApromo). The former better reconstruct known binding preferences for sequence-specific RBPs but are not suitable for modeling RBPs that recognize shape and geometry of RNAs. Future work in RBP motif finding should incorporate interactions between multiple RBDs and multiple RBPs in binding to RNA. WIREs RNA 2014, 5:111–130. doi: 10.1002/wrna.1201 PMID:24217996

  1. Principles for Predicting RNA Secondary Structure Design Difficulty.

    PubMed

    Anderson-Lee, Jeff; Fisker, Eli; Kosaraju, Vineet; Wu, Michelle; Kong, Justin; Lee, Jeehyung; Lee, Minjae; Zada, Mathew; Treuille, Adrien; Das, Rhiju

    2016-02-27

    Designing RNAs that form specific secondary structures is enabling better understanding and control of living systems through RNA-guided silencing, genome editing and protein organization. Little is known, however, about which RNA secondary structures might be tractable for downstream sequence design, increasing the time and expense of design efforts due to inefficient secondary structure choices. Here, we present insights into specific structural features that increase the difficulty of finding sequences that fold into a target RNA secondary structure, summarizing the design efforts of tens of thousands of human participants and three automated algorithms (RNAInverse, INFO-RNA and RNA-SSD) in the Eterna massive open laboratory. Subsequent tests through three independent RNA design algorithms (NUPACK, DSS-Opt and MODENA) confirmed the hypothesized importance of several features in determining design difficulty, including sequence length, mean stem length, symmetry and specific difficult-to-design motifs such as zigzags. Based on these results, we have compiled an Eterna100 benchmark of 100 secondary structure design challenges that span a large range in design difficulty to help test future efforts. Our in silico results suggest new routes for improving computational RNA design methods and for extending these insights to assess "designability" of single RNA structures, as well as of switches for in vitro and in vivo applications. Copyright © 2015 The Authors. Published by Elsevier Ltd.. All rights reserved.

  2. Correlations of nucleotide substitution rates and base composition of mammalian coding sequences with protein structure.

    PubMed

    Chiusano, M L; D'Onofrio, G; Alvarez-Valin, F; Jabbari, K; Colonna, G; Bernardi, G

    1999-09-30

    We investigated the relationships between the nucleotide substitution rates and the predicted secondary structures in the three states representation (alpha-helix, beta-sheet, and coil). The analysis was carried out on 34 alignments, each of which comprised sequences belonging to at least four different mammalian orders. The rates of synonymous substitution were found to be significantly different in regions predicted to be alpha-helix, beta-sheet, or coil. Likewise, the nonsynonymous rates also differ, although expectedly at a lower extent, in the three types of secondary structure, suggesting that different selective constraints associated with the different structures are affecting in a similar way the synonymous and nonsynonymous rates. Moreover, the base composition of the third codon positions is different in coding sequence regions corresponding to different secondary structures of proteins.

  3. Identification of GATC- and CCGG- recognizing Type II REases and their putative specificity-determining positions using Scan2S—a novel motif scan algorithm with optional secondary structure constraints

    PubMed Central

    Niv, Masha Y.; Skrabanek, Lucy; Roberts, Richard J.; Scheraga, Harold A.; Weinstein, Harel

    2008-01-01

    Restriction endonucleases (REases) are DNA-cleaving enzymes that have become indispensable tools in molecular biology. Type II REases are highly divergent in sequence despite their common structural core, function and, in some cases, common specificities towards DNA sequences. This makes it difficult to identify and classify them functionally based on sequence, and has hampered the efforts of specificity-engineering. Here, we define novel REase sequence motifs, which extend beyond the PD-(D/E)XK hallmark, and incorporate secondary structure information. The automated search using these motifs is carried out with a newly developed fast regular expression matching algorithm that accommodates long patterns with optional secondary structure constraints. Using this new tool, named Scan2S, motifs derived from REases with specificity towards GATC- and CGGG-containing DNA sequences successfully identify REases of the same specificity. Notably, some of these sequences are not identified by standard sequence detection tools. The new motifs highlight potential specificity-determining positions that do not fully overlap for the GATC- and the CCGG-recognizing REases and are candidates for specificity re-engineering. PMID:17972284

  4. Identification of GATC- and CCGG-recognizing Type II REases and their putative specificity-determining positions using Scan2S--a novel motif scan algorithm with optional secondary structure constraints.

    PubMed

    Niv, Masha Y; Skrabanek, Lucy; Roberts, Richard J; Scheraga, Harold A; Weinstein, Harel

    2008-05-01

    Restriction endonucleases (REases) are DNA-cleaving enzymes that have become indispensable tools in molecular biology. Type II REases are highly divergent in sequence despite their common structural core, function and, in some cases, common specificities towards DNA sequences. This makes it difficult to identify and classify them functionally based on sequence, and has hampered the efforts of specificity-engineering. Here, we define novel REase sequence motifs, which extend beyond the PD-(D/E)XK hallmark, and incorporate secondary structure information. The automated search using these motifs is carried out with a newly developed fast regular expression matching algorithm that accommodates long patterns with optional secondary structure constraints. Using this new tool, named Scan2S, motifs derived from REases with specificity towards GATC- and CGGG-containing DNA sequences successfully identify REases of the same specificity. Notably, some of these sequences are not identified by standard sequence detection tools. The new motifs highlight potential specificity-determining positions that do not fully overlap for the GATC- and the CCGG-recognizing REases and are candidates for specificity re-engineering.

  5. Modular prediction of protein structural classes from sequences of twilight-zone identity with predicting sequences.

    PubMed

    Mizianty, Marcin J; Kurgan, Lukasz

    2009-12-13

    Knowledge of structural class is used by numerous methods for identification of structural/functional characteristics of proteins and could be used for the detection of remote homologues, particularly for chains that share twilight-zone similarity. In contrast to existing sequence-based structural class predictors, which target four major classes and which are designed for high identity sequences, we predict seven classes from sequences that share twilight-zone identity with the training sequences. The proposed MODular Approach to Structural class prediction (MODAS) method is unique as it allows for selection of any subset of the classes. MODAS is also the first to utilize a novel, custom-built feature-based sequence representation that combines evolutionary profiles and predicted secondary structure. The features quantify information relevant to the definition of the classes including conservation of residues and arrangement and number of helix/strand segments. Our comprehensive design considers 8 feature selection methods and 4 classifiers to develop Support Vector Machine-based classifiers that are tailored for each of the seven classes. Tests on 5 twilight-zone and 1 high-similarity benchmark datasets and comparison with over two dozens of modern competing predictors show that MODAS provides the best overall accuracy that ranges between 80% and 96.7% (83.5% for the twilight-zone datasets), depending on the dataset. This translates into 19% and 8% error rate reduction when compared against the best performing competing method on two largest datasets. The proposed predictor provides accurate predictions at 58% accuracy for membrane proteins class, which is not considered by majority of existing methods, in spite that this class accounts for only 2% of the data. Our predictive model is analyzed to demonstrate how and why the input features are associated with the corresponding classes. The improved predictions stem from the novel features that express collocation of the secondary structure segments in the protein sequence and that combine evolutionary and secondary structure information. Our work demonstrates that conservation and arrangement of the secondary structure segments predicted along the protein chain can successfully predict structural classes which are defined based on the spatial arrangement of the secondary structures. A web server is available at http://biomine.ece.ualberta.ca/MODAS/.

  6. Modular prediction of protein structural classes from sequences of twilight-zone identity with predicting sequences

    PubMed Central

    2009-01-01

    Background Knowledge of structural class is used by numerous methods for identification of structural/functional characteristics of proteins and could be used for the detection of remote homologues, particularly for chains that share twilight-zone similarity. In contrast to existing sequence-based structural class predictors, which target four major classes and which are designed for high identity sequences, we predict seven classes from sequences that share twilight-zone identity with the training sequences. Results The proposed MODular Approach to Structural class prediction (MODAS) method is unique as it allows for selection of any subset of the classes. MODAS is also the first to utilize a novel, custom-built feature-based sequence representation that combines evolutionary profiles and predicted secondary structure. The features quantify information relevant to the definition of the classes including conservation of residues and arrangement and number of helix/strand segments. Our comprehensive design considers 8 feature selection methods and 4 classifiers to develop Support Vector Machine-based classifiers that are tailored for each of the seven classes. Tests on 5 twilight-zone and 1 high-similarity benchmark datasets and comparison with over two dozens of modern competing predictors show that MODAS provides the best overall accuracy that ranges between 80% and 96.7% (83.5% for the twilight-zone datasets), depending on the dataset. This translates into 19% and 8% error rate reduction when compared against the best performing competing method on two largest datasets. The proposed predictor provides accurate predictions at 58% accuracy for membrane proteins class, which is not considered by majority of existing methods, in spite that this class accounts for only 2% of the data. Our predictive model is analyzed to demonstrate how and why the input features are associated with the corresponding classes. Conclusions The improved predictions stem from the novel features that express collocation of the secondary structure segments in the protein sequence and that combine evolutionary and secondary structure information. Our work demonstrates that conservation and arrangement of the secondary structure segments predicted along the protein chain can successfully predict structural classes which are defined based on the spatial arrangement of the secondary structures. A web server is available at http://biomine.ece.ualberta.ca/MODAS/. PMID:20003388

  7. Structator: fast index-based search for RNA sequence-structure patterns

    PubMed Central

    2011-01-01

    Background The secondary structure of RNA molecules is intimately related to their function and often more conserved than the sequence. Hence, the important task of searching databases for RNAs requires to match sequence-structure patterns. Unfortunately, current tools for this task have, in the best case, a running time that is only linear in the size of sequence databases. Furthermore, established index data structures for fast sequence matching, like suffix trees or arrays, cannot benefit from the complementarity constraints introduced by the secondary structure of RNAs. Results We present a novel method and readily applicable software for time efficient matching of RNA sequence-structure patterns in sequence databases. Our approach is based on affix arrays, a recently introduced index data structure, preprocessed from the target database. Affix arrays support bidirectional pattern search, which is required for efficiently handling the structural constraints of the pattern. Structural patterns like stem-loops can be matched inside out, such that the loop region is matched first and then the pairing bases on the boundaries are matched consecutively. This allows to exploit base pairing information for search space reduction and leads to an expected running time that is sublinear in the size of the sequence database. The incorporation of a new chaining approach in the search of RNA sequence-structure patterns enables the description of molecules folding into complex secondary structures with multiple ordered patterns. The chaining approach removes spurious matches from the set of intermediate results, in particular of patterns with little specificity. In benchmark experiments on the Rfam database, our method runs up to two orders of magnitude faster than previous methods. Conclusions The presented method's sublinear expected running time makes it well suited for RNA sequence-structure pattern matching in large sequence databases. RNA molecules containing several stem-loop substructures can be described by multiple sequence-structure patterns and their matches are efficiently handled by a novel chaining method. Beyond our algorithmic contributions, we provide with Structator a complete and robust open-source software solution for index-based search of RNA sequence-structure patterns. The Structator software is available at http://www.zbh.uni-hamburg.de/Structator. PMID:21619640

  8. COOLAIR Antisense RNAs Form Evolutionarily Conserved Elaborate Secondary Structures

    DOE PAGES

    Hawkes, Emily J.; Hennelly, Scott P.; Novikova, Irina V.; ...

    2016-09-20

    There is considerable debate about the functionality of long non-coding RNAs (lncRNAs). Lack of sequence conservation has been used to argue against functional relevance. Here, we investigated antisense lncRNAs, called COOLAIR, at the A. thaliana FLC locus and experimentally determined their secondary structure. The major COOLAIR variants are highly structured, organized by exon. The distally polyadenylated transcript has a complex multi-domain structure, altered by a single non-coding SNP defining a functionally distinct A. thaliana FLC haplotype. The A. thaliana COOLAIR secondary structure was used to predict COOLAIR exons in evolutionarily divergent Brassicaceae species. These predictions were validated through chemical probingmore » and cloning. Despite the relatively low nucleotide sequence identity, the structures, including multi-helix junctions, show remarkable evolutionary conservation. In a number of places, the structure is conserved through covariation of a non-contiguous DNA sequence. This structural conservation supports a functional role for COOLAIR transcripts rather than, or in addition to, antisense transcription.« less

  9. COOLAIR Antisense RNAs Form Evolutionarily Conserved Elaborate Secondary Structures

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hawkes, Emily J.; Hennelly, Scott P.; Novikova, Irina V.

    There is considerable debate about the functionality of long non-coding RNAs (lncRNAs). Lack of sequence conservation has been used to argue against functional relevance. Here, we investigated antisense lncRNAs, called COOLAIR, at the A. thaliana FLC locus and experimentally determined their secondary structure. The major COOLAIR variants are highly structured, organized by exon. The distally polyadenylated transcript has a complex multi-domain structure, altered by a single non-coding SNP defining a functionally distinct A. thaliana FLC haplotype. The A. thaliana COOLAIR secondary structure was used to predict COOLAIR exons in evolutionarily divergent Brassicaceae species. These predictions were validated through chemical probingmore » and cloning. Despite the relatively low nucleotide sequence identity, the structures, including multi-helix junctions, show remarkable evolutionary conservation. In a number of places, the structure is conserved through covariation of a non-contiguous DNA sequence. This structural conservation supports a functional role for COOLAIR transcripts rather than, or in addition to, antisense transcription.« less

  10. Secondary structure model of the RNA recognized by the reverse transcriptase from the R2 retrotransposable element.

    PubMed Central

    Mathews, D H; Banerjee, A R; Luan, D D; Eickbush, T H; Turner, D H

    1997-01-01

    RNA transcripts corresponding to the 250-nt 3' untranslated region of the R2 non-LTR retrotransposable element are recognized by the R2 reverse transcriptase and are sufficient to serve as templates in the target DNA-primed reverse transcription (TPRT) reaction. The R2 protein encoded by the Bombyx mori R2 can recognize this region from both the B. mori and Drosophila melanogaster R2 elements even though these regions show little nucleotide sequence identity. A model for the RNA secondary structure of the 3' untranslated region of the D. melanogaster R2 retrotransposon was developed by sequence comparison of 10 species aided by free energy minimization. Chemical modification experiments are consistent with this prediction. A secondary structure model for the 3' untranslated region of R2 RNA from the R2 element from B. mori was obtained by a combination of chemical modification data and free energy minimization. These two secondary structure models, found independently, share several common sites. This study shows the utility of combining free energy minimization, sequence comparison, and chemical modification to model an RNA secondary structure. PMID:8990394

  11. Secondary structure prediction for complete rDNA sequences (18S, 5.8S, and 28S rDNA) of Demodex folliculorum, and comparison of divergent domains structures across Acari.

    PubMed

    Zhao, Ya-E; Wang, Zheng-Hang; Xu, Yang; Wu, Li-Ping; Hu, Li

    2013-10-01

    According to base pairing, the rRNA folds into corresponding secondary structures, which contain additional phylogenetic information. On the basis of sequencing for complete rDNA sequences (18S, ITS1, 5.8S, ITS2 and 28S rDNA) of Demodex, we predicted the secondary structure of the complete rDNA sequence (18S, 5.8S, and 28S rDNA) of Demodex folliculorum, which was in concordance with that of the main arthropod lineages in past studies. And together with the sequence data from GenBank, we also predicted the secondary structures of divergent domains in SSU rRNA of 51 species and in LSU rRNA of 43 species from four superfamilies in Acari (Cheyletoidea, Tetranychoidea, Analgoidea and Ixodoidea). The multiple alignment among the four superfamilies in Acari showed that, insertions from Tetranychoidea SSU rRNA formed two newly proposed helixes, and helix c3-2b of LSU rRNA was absent in Demodex (Cheyletoidea) taxa. Generally speaking, LSU rRNA presented more remarkable differences than SSU rRNA did, mainly in D2, D3, D5, D7a, D7b, D8 and D10. Copyright © 2013 Elsevier Inc. All rights reserved.

  12. Secondary structural analyses of ITS1 in Paramecium.

    PubMed

    Hoshina, Ryo

    2010-01-01

    The nuclear ribosomal RNA gene operon is interrupted by internal transcribed spacer (ITS) 1 and ITS2. Although the secondary structure of ITS2 has been widely investigated, less is known about ITS1 and its structure. In this study, the secondary structure of ITS1 sequences for Paramecium and other ciliates was predicted. Each Paramecium ITS1 forms an open loop with three helices, A through C. Helix B was highly conserved among Paramecium, and similar helices were found in other ciliates. A phylogenetic analysis using the ITS1 sequences showed high-resolution, implying that ITS1 is a good tool for species-level analyses.

  13. Stem-Loop RNA Hairpins in Giant Viruses: Invading rRNA-Like Repeats and a Template Free RNA

    PubMed Central

    Seligmann, Hervé; Raoult, Didier

    2018-01-01

    We examine the hypothesis that de novo template-free RNAs still form spontaneously, as they did at the origins of life, invade modern genomes, contribute new genetic material. Previously, analyses of RNA secondary structures suggested that some RNAs resembling ancestral (t)RNAs formed recently de novo, other parasitic sequences cluster with rRNAs. Here positive control analyses of additional RNA secondary structures confirm ancestral and de novo statuses of RNA grouped according to secondary structure. Viroids with branched stems resemble de novo RNAs, rod-shaped viroids resemble rRNA secondary structures, independently of GC contents. 5′ UTR leading regions of West Nile and Dengue flavivirid viruses resemble de novo and rRNA structures, respectively. An RNA homologous with Megavirus, Dengue and West Nile genomes, copperhead snake microsatellites and levant cotton repeats, not templated by Mimivirus' genome, persists throughout Mimivirus' infection. Its secondary structure clusters with candidate de novo RNAs. The saltatory phyletic distribution and secondary structure of Mimivirus' peculiar RNA suggest occasional template-free polymerization of this sequence, rather than noncanonical transcriptions (swinger polymerization, posttranscriptional editing). PMID:29449833

  14. Sequence and structure determinants of Drosophila Hsp70 mRNA translation: 5'UTR secondary structure specifically inhibits heat shock protein mRNA translation.

    PubMed Central

    Hess, M A; Duncan, R F

    1996-01-01

    Preferential translation of Drosophila heat shock protein 70 (Hsp70) mRNA requires only the 5'-untranslated region (5'-UTR). The sequence of this region suggests that it has relatively little secondary structure, which may facilitate efficient protein synthesis initiation. To determine whether minimal 5'-UTR secondary structure is required for preferential translation during heat shock, the effect of introducing stem-loops into the Hsp70 mRNA 5'-UTR was measured. Stem-loops of -11 kcal/mol abolished translation during heat shock, but did not reduce translation in non-heat shocked cells. A -22 kcal/mol stem-loop was required to comparably inhibit translation during growth at normal temperatures. To investigate whether specific sequence elements are also required for efficient preferential translation, deletion and mutation analyses were conducted in a truncated Hsp70 5'-UTR containing only the cap-proximal and AUG-proximal segments. Linker-scanner mutations in the cap-proximal segment (+1 to +37) did not impair translation. Re-ordering the segments reduced mRNA translational efficiency by 50%. Deleting the AUG-proximal segment severely inhibited translation. A 5-extension of the full-length leader specifically impaired heat shock translation. These results indicate that heat shock reduces the capacity to unwind 5-UTR secondary structure, allowing only mRNAs with minimal 5'-UTR secondary structure to be efficiently translated. A function for specific sequences is also suggested. PMID:8710519

  15. Prediction of RNA secondary structures: from theory to models and real molecules

    NASA Astrophysics Data System (ADS)

    Schuster, Peter

    2006-05-01

    RNA secondary structures are derived from RNA sequences, which are strings built form the natural four letter nucleotide alphabet, {AUGC}. These coarse-grained structures, in turn, are tantamount to constrained strings over a three letter alphabet. Hence, the secondary structures are discrete objects and the number of sequences always exceeds the number of structures. The sequences built from two letter alphabets form perfect structures when the nucleotides can form a base pair, as is the case with {GC} or {AU}, but the relation between the sequences and structures differs strongly from the four letter alphabet. A comprehensive theory of RNA structure is presented, which is based on the concepts of sequence space and shape space, being a space of structures. It sets the stage for modelling processes in ensembles of RNA molecules like evolutionary optimization or kinetic folding as dynamical phenomena guided by mappings between the two spaces. The number of minimum free energy (mfe) structures is always smaller than the number of sequences, even for two letter alphabets. Folding of RNA molecules into mfe energy structures constitutes a non-invertible mapping from sequence space onto shape space. The preimage of a structure in sequence space is defined as its neutral network. Similarly the set of suboptimal structures is the preimage of a sequence in shape space. This set represents the conformation space of a given sequence. The evolutionary optimization of structures in populations is a process taking place in sequence space, whereas kinetic folding occurs in molecular ensembles that optimize free energy in conformation space. Efficient folding algorithms based on dynamic programming are available for the prediction of secondary structures for given sequences. The inverse problem, the computation of sequences for predefined structures, is an important tool for the design of RNA molecules with tailored properties. Simultaneous folding or cofolding of two or more RNA molecules can be modelled readily at the secondary structure level and allows prediction of the most stable (mfe) conformations of complexes together with suboptimal states. Cofolding algorithms are important tools for efficient and highly specific primer design in the polymerase chain reaction (PCR) and help to explain the mechanisms of small interference RNA (si-RNA) molecules in gene regulation. The evolutionary optimization of RNA structures is illustrated by the search for a target structure and mimics aptamer selection in evolutionary biotechnology. It occurs typically in steps consisting of short adaptive phases interrupted by long epochs of little or no obvious progress in optimization. During these quasi-stationary epochs the populations are essentially confined to neutral networks where they search for sequences that allow a continuation of the adaptive process. Modelling RNA evolution as a simultaneous process in sequence and shape space provides answers to questions of the optimal population size and mutation rates. Kinetic folding is a stochastic process in conformation space. Exact solutions are derived by direct simulation in the form of trajectory sampling or by solving the master equation. The exact solutions can be approximated straightforwardly by Arrhenius kinetics on barrier trees, which represent simplified versions of conformational energy landscapes. The existence of at least one sequence forming any arbitrarily chosen pair of structures is granted by the intersection theorem. Folding kinetics is the key to understanding and designing multistable RNA molecules or RNA switches. These RNAs form two or more long lived conformations, and conformational changes occur either spontaneously or are induced through binding of small molecules or other biopolymers. RNA switches are found in nature where they act as elements in genetic and metabolic regulation. The reliability of RNA secondary structure prediction is limited by the accuracy with which the empirical parameters can be determined and by principal deficiencies, for example by the lack of energy contributions resulting from tertiary interactions. In addition, native structures may be determined by folding kinetics rather than by thermodynamics. We address the first problem by considering base pair probabilities or base pairing entropies, which are derived from the partition function of conformations. A high base pair probability corresponding to a low pairing entropy is taken as an indicator of a high reliability of prediction. Pseudoknots are discussed as an example of a tertiary interaction that is highly important for RNA function. Moreover, pseudoknot formation is readily incorporated into structure prediction algorithms. Some examples of experimental data on RNA secondary structures that are readily explained using the landscape concept are presented. They deal with (i) properties of RNA molecules with random sequences, (ii) RNA molecules from restricted alphabets, (iii) existence of neutral networks, (iv) shape space covering, (v) riboswitches and (vi) evolution of non-coding RNAs as an example of evolution restricted to neutral networks.

  16. [Comparative analysis of clustered regularly interspaced short palindromic repeats (CRISPRs) loci in the genomes of halophilic archaea].

    PubMed

    Zhang, Fan; Zhang, Bing; Xiang, Hua; Hu, Songnian

    2009-11-01

    Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) is a widespread system that provides acquired resistance against phages in bacteria and archaea. Here we aim to genome-widely analyze the CRISPR in extreme halophilic archaea, of which the whole genome sequences are available at present time. We used bioinformatics methods including alignment, conservation analysis, GC content and RNA structure prediction to analyze the CRISPR structures of 7 haloarchaeal genomes. We identified the CRISPR structures in 5 halophilic archaea and revealed a conserved palindromic motif in the flanking regions of these CRISPR structures. In addition, we found that the repeat sequences of large CRISPR structures in halophilic archaea were greatly conserved, and two types of predicted RNA secondary structures derived from the repeat sequences were likely determined by the fourth base of the repeat sequence. Our results support the proposal that the leader sequence may function as recognition site by having palindromic structures in flanking regions, and the stem-loop secondary structure formed by repeat sequences may function in mediating the interaction between foreign genetic elements and CAS-encoded proteins.

  17. Improved Model for Predicting the Free Energy Contribution of Dinucleotide Bulges to RNA Duplex Stability.

    PubMed

    Tomcho, Jeremy C; Tillman, Magdalena R; Znosko, Brent M

    2015-09-01

    Predicting the secondary structure of RNA is an intermediate in predicting RNA three-dimensional structure. Commonly, determining RNA secondary structure from sequence uses free energy minimization and nearest neighbor parameters. Current algorithms utilize a sequence-independent model to predict free energy contributions of dinucleotide bulges. To determine if a sequence-dependent model would be more accurate, short RNA duplexes containing dinucleotide bulges with different sequences and nearest neighbor combinations were optically melted to derive thermodynamic parameters. These data suggested energy contributions of dinucleotide bulges were sequence-dependent, and a sequence-dependent model was derived. This model assigns free energy penalties based on the identity of nucleotides in the bulge (3.06 kcal/mol for two purines, 2.93 kcal/mol for two pyrimidines, 2.71 kcal/mol for 5'-purine-pyrimidine-3', and 2.41 kcal/mol for 5'-pyrimidine-purine-3'). The predictive model also includes a 0.45 kcal/mol penalty for an A-U pair adjacent to the bulge and a -0.28 kcal/mol bonus for a G-U pair adjacent to the bulge. The new sequence-dependent model results in predicted values within, on average, 0.17 kcal/mol of experimental values, a significant improvement over the sequence-independent model. This model and new experimental values can be incorporated into algorithms that predict RNA stability and secondary structure from sequence.

  18. R-chie: a web server and R package for visualizing RNA secondary structures

    PubMed Central

    Lai, Daniel; Proctor, Jeff R.; Zhu, Jing Yun A.; Meyer, Irmtraud M.

    2012-01-01

    Visually examining RNA structures can greatly aid in understanding their potential functional roles and in evaluating the performance of structure prediction algorithms. As many functional roles of RNA structures can already be studied given the secondary structure of the RNA, various methods have been devised for visualizing RNA secondary structures. Most of these methods depict a given RNA secondary structure as a planar graph consisting of base-paired stems interconnected by roundish loops. In this article, we present an alternative method of depicting RNA secondary structure as arc diagrams. This is well suited for structures that are difficult or impossible to represent as planar stem-loop diagrams. Arc diagrams can intuitively display pseudo-knotted structures, as well as transient and alternative structural features. In addition, they facilitate the comparison of known and predicted RNA secondary structures. An added benefit is that structure information can be displayed in conjunction with a corresponding multiple sequence alignments, thereby highlighting structure and primary sequence conservation and variation. We have implemented the visualization algorithm as a web server R-chie as well as a corresponding R package called R4RNA, which allows users to run the software locally and across a range of common operating systems. PMID:22434875

  19. A weighted sampling algorithm for the design of RNA sequences with targeted secondary structure and nucleotide distribution.

    PubMed

    Reinharz, Vladimir; Ponty, Yann; Waldispühl, Jérôme

    2013-07-01

    The design of RNA sequences folding into predefined secondary structures is a milestone for many synthetic biology and gene therapy studies. Most of the current software uses similar local search strategies (i.e. a random seed is progressively adapted to acquire the desired folding properties) and more importantly do not allow the user to control explicitly the nucleotide distribution such as the GC-content in their sequences. However, the latter is an important criterion for large-scale applications as it could presumably be used to design sequences with better transcription rates and/or structural plasticity. In this article, we introduce IncaRNAtion, a novel algorithm to design RNA sequences folding into target secondary structures with a predefined nucleotide distribution. IncaRNAtion uses a global sampling approach and weighted sampling techniques. We show that our approach is fast (i.e. running time comparable or better than local search methods), seedless (we remove the bias of the seed in local search heuristics) and successfully generates high-quality sequences (i.e. thermodynamically stable) for any GC-content. To complete this study, we develop a hybrid method combining our global sampling approach with local search strategies. Remarkably, our glocal methodology overcomes both local and global approaches for sampling sequences with a specific GC-content and target structure. IncaRNAtion is available at csb.cs.mcgill.ca/incarnation/. Supplementary data are available at Bioinformatics online.

  20. RNA design using simulated SHAPE data.

    PubMed

    Lotfi, Mohadeseh; Zare-Mirakabad, Fatemeh; Montaseri, Soheila

    2018-05-03

    It has long been established that in addition to being involved in protein translation, RNA plays essential roles in numerous other cellular processes, including gene regulation and DNA replication. Such roles are known to be dictated by higher-order structures of RNA molecules. It is therefore of prime importance to find an RNA sequence that can fold to acquire a particular function that is desirable for use in pharmaceuticals and basic research. The challenge of finding an RNA sequence for a given structure is known as the RNA design problem. Although there are several algorithms to solve this problem, they mainly consider hard constraints, such as minimum free energy, to evaluate the predicted sequences. Recently, SHAPE data has emerged as a new soft constraint for RNA secondary structure prediction. To take advantage of this new experimental constraint, we report here a new method for accurate design of RNA sequences based on their secondary structures using SHAPE data as pseudo-free energy. We then compare our algorithm with four others: INFO-RNA, ERD, MODENA and RNAifold 2.0. Our algorithm precisely predicts 26 out of 29 new sequences for the structures extracted from the Rfam dataset, while the other four algorithms predict no more than 22 out of 29. The proposed algorithm is comparable to the above algorithms on RNA-SSD datasets, where they can predict up to 33 appropriate sequences for RNA secondary structures out of 34.

  1. CompaRNA: a server for continuous benchmarking of automated methods for RNA secondary structure prediction

    PubMed Central

    Puton, Tomasz; Kozlowski, Lukasz P.; Rother, Kristian M.; Bujnicki, Janusz M.

    2013-01-01

    We present a continuous benchmarking approach for the assessment of RNA secondary structure prediction methods implemented in the CompaRNA web server. As of 3 October 2012, the performance of 28 single-sequence and 13 comparative methods has been evaluated on RNA sequences/structures released weekly by the Protein Data Bank. We also provide a static benchmark generated on RNA 2D structures derived from the RNAstrand database. Benchmarks on both data sets offer insight into the relative performance of RNA secondary structure prediction methods on RNAs of different size and with respect to different types of structure. According to our tests, on the average, the most accurate predictions obtained by a comparative approach are generated by CentroidAlifold, MXScarna, RNAalifold and TurboFold. On the average, the most accurate predictions obtained by single-sequence analyses are generated by CentroidFold, ContextFold and IPknot. The best comparative methods typically outperform the best single-sequence methods if an alignment of homologous RNA sequences is available. This article presents the results of our benchmarks as of 3 October 2012, whereas the rankings presented online are continuously updated. We will gladly include new prediction methods and new measures of accuracy in the new editions of CompaRNA benchmarks. PMID:23435231

  2. PreSSAPro: a software for the prediction of secondary structure by amino acid properties.

    PubMed

    Costantini, Susan; Colonna, Giovanni; Facchiano, Angelo M

    2007-10-01

    PreSSAPro is a software, available to the scientific community as a free web service designed to provide predictions of secondary structures starting from the amino acid sequence of a given protein. Predictions are based on our recently published work on the amino acid propensities for secondary structures in either large but not homogeneous protein data sets, as well as in smaller but homogeneous data sets corresponding to protein structural classes, i.e. all-alpha, all-beta, or alpha-beta proteins. Predictions result improved by the use of propensities evaluated for the right protein class. PreSSAPro predicts the secondary structure according to the right protein class, if known, or gives a multiple prediction with reference to the different structural classes. The comparison of these predictions represents a novel tool to evaluate what sequence regions can assume different secondary structures depending on the structural class assignment, in the perspective of identifying proteins able to fold in different conformations. The service is available at the URL http://bioinformatica.isa.cnr.it/PRESSAPRO/.

  3. Deciphering the shape and deformation of secondary structures through local conformation analysis

    PubMed Central

    2011-01-01

    Background Protein deformation has been extensively analysed through global methods based on RMSD, torsion angles and Principal Components Analysis calculations. Here we use a local approach, able to distinguish among the different backbone conformations within loops, α-helices and β-strands, to address the question of secondary structures' shape variation within proteins and deformation at interface upon complexation. Results Using a structural alphabet, we translated the 3 D structures of large sets of protein-protein complexes into sequences of structural letters. The shape of the secondary structures can be assessed by the structural letters that modeled them in the structural sequences. The distribution analysis of the structural letters in the three protein compartments (surface, core and interface) reveals that secondary structures tend to adopt preferential conformations that differ among the compartments. The local description of secondary structures highlights that curved conformations are preferred on the surface while straight ones are preferred in the core. Interfaces display a mixture of local conformations either preferred in core or surface. The analysis of the structural letters transition occurring between protein-bound and unbound conformations shows that the deformation of secondary structure is tightly linked to the compartment preference of the local conformations. Conclusion The conformation of secondary structures can be further analysed and detailed thanks to a structural alphabet which allows a better description of protein surface, core and interface in terms of secondary structures' shape and deformation. Induced-fit modification tendencies described here should be valuable information to identify and characterize regions under strong structural constraints for functional reasons. PMID:21284872

  4. Deciphering the shape and deformation of secondary structures through local conformation analysis.

    PubMed

    Baussand, Julie; Camproux, Anne-Claude

    2011-02-01

    Protein deformation has been extensively analysed through global methods based on RMSD, torsion angles and Principal Components Analysis calculations. Here we use a local approach, able to distinguish among the different backbone conformations within loops, α-helices and β-strands, to address the question of secondary structures' shape variation within proteins and deformation at interface upon complexation. Using a structural alphabet, we translated the 3 D structures of large sets of protein-protein complexes into sequences of structural letters. The shape of the secondary structures can be assessed by the structural letters that modeled them in the structural sequences. The distribution analysis of the structural letters in the three protein compartments (surface, core and interface) reveals that secondary structures tend to adopt preferential conformations that differ among the compartments. The local description of secondary structures highlights that curved conformations are preferred on the surface while straight ones are preferred in the core. Interfaces display a mixture of local conformations either preferred in core or surface. The analysis of the structural letters transition occurring between protein-bound and unbound conformations shows that the deformation of secondary structure is tightly linked to the compartment preference of the local conformations. The conformation of secondary structures can be further analysed and detailed thanks to a structural alphabet which allows a better description of protein surface, core and interface in terms of secondary structures' shape and deformation. Induced-fit modification tendencies described here should be valuable information to identify and characterize regions under strong structural constraints for functional reasons.

  5. SMARTIV: combined sequence and structure de-novo motif discovery for in-vivo RNA binding data.

    PubMed

    Polishchuk, Maya; Paz, Inbal; Yakhini, Zohar; Mandel-Gutfreund, Yael

    2018-05-25

    Gene expression regulation is highly dependent on binding of RNA-binding proteins (RBPs) to their RNA targets. Growing evidence supports the notion that both RNA primary sequence and its local secondary structure play a role in specific Protein-RNA recognition and binding. Despite the great advance in high-throughput experimental methods for identifying sequence targets of RBPs, predicting the specific sequence and structure binding preferences of RBPs remains a major challenge. We present a novel webserver, SMARTIV, designed for discovering and visualizing combined RNA sequence and structure motifs from high-throughput RNA-binding data, generated from in-vivo experiments. The uniqueness of SMARTIV is that it predicts motifs from enriched k-mers that combine information from ranked RNA sequences and their predicted secondary structure, obtained using various folding methods. Consequently, SMARTIV generates Position Weight Matrices (PWMs) in a combined sequence and structure alphabet with assigned P-values. SMARTIV concisely represents the sequence and structure motif content as a single graphical logo, which is informative and easy for visual perception. SMARTIV was examined extensively on a variety of high-throughput binding experiments for RBPs from different families, generated from different technologies, showing consistent and accurate results. Finally, SMARTIV is a user-friendly webserver, highly efficient in run-time and freely accessible via http://smartiv.technion.ac.il/.

  6. Molecular phylogeny of 21 tropical bamboo species reconstructed by integrating non-coding internal transcribed spacer (ITS1 and 2) sequences and their consensus secondary structure.

    PubMed

    Ghosh, Jayadri Sekhar; Bhattacharya, Samik; Pal, Amita

    2017-06-01

    The unavailability of the reproductive structure and unpredictability of vegetative characters for the identification and phylogenetic study of bamboo prompted the application of molecular techniques for greater resolution and consensus. We first employed internal transcribed spacer (ITS1, 5.8S rRNA and ITS2) sequences to construct the phylogenetic tree of 21 tropical bamboo species. While the sequence alone could grossly reconstruct the traditional phylogeny amongst the 21-tropical species studied, some anomalies were encountered that prompted a further refinement of the phylogenetic analyses. Therefore, we integrated the secondary structure of the ITS sequences to derive individual sequence-structure matrix to gain more resolution on the phylogenetic reconstruction. The results showed that ITS sequence-structure is the reliable alternative to the conventional phenotypic method for the identification of bamboo species. The best-fit topology obtained by the sequence-structure based phylogeny over the sole sequence based one underscores closer clustering of all the studied Bambusa species (Sub-tribe Bambusinae), while Melocanna baccifera, which belongs to Sub-Tribe Melocanneae, disjointedly clustered as an out-group within the consensus phylogenetic tree. In this study, we demonstrated the dependability of the combined (ITS sequence+structure-based) approach over the only sequence-based analysis for phylogenetic relationship assessment of bamboo.

  7. Information-Theoretic Uncertainty of SCFG-Modeled Folding Space of The Non-coding RNA

    PubMed Central

    Manzourolajdad, Amirhossein; Wang, Yingfeng; Shaw, Timothy I.; Malmberg, Russell L.

    2012-01-01

    RNA secondary structure ensembles define probability distributions for alternative equilibrium secondary structures of an RNA sequence. Shannon’s Entropy is a measure for the amount of diversity present in any ensemble. In this work, Shannon’s entropy of the SCFG ensemble on an RNA sequence is derived and implemented in polynomial time for both structurally ambiguous and unambiguous grammars. Micro RNA sequences generally have low folding entropy, as previously discovered. Surprisingly, signs of significantly high folding entropy were observed in certain ncRNA families. More effective models coupled with targeted randomization tests can lead to a better insight into folding features of these families. PMID:23160142

  8. An improved divergent synthesis of comb-type branched oligodeoxyribonucleotides (bDNA) containing multiple secondary sequences.

    PubMed

    Horn, T; Chang, C A; Urdea, M S

    1997-12-01

    The divergent synthesis of branched DNA (bDNA) comb structures is described. This new type of bDNA contains one unique oligonucleotide, the primary sequence, covalently attached through a comb-like branch network to many identical copies of a different oligonucleotide, the secondary sequence. The bDNA comb structures were assembled on a solid support and several synthesis parameters were investigated and optimized. The bDNA comb molecules were characterized by polyacrylamide gel electrophoretic methods and by controlled cleavage at periodate-cleavable moieties incorporated during synthesis. The developed chemistry allows synthesis of bDNA comb molecules containing multiple secondary sequences. In the accompanying article we describe the synthesis and characterization of large bDNA combs containing all four deoxynucleotides for use as signal amplifiers in nucleic acid quantification assays.

  9. An improved divergent synthesis of comb-type branched oligodeoxyribonucleotides (bDNA) containing multiple secondary sequences.

    PubMed Central

    Horn, T; Chang, C A; Urdea, M S

    1997-01-01

    The divergent synthesis of branched DNA (bDNA) comb structures is described. This new type of bDNA contains one unique oligonucleotide, the primary sequence, covalently attached through a comb-like branch network to many identical copies of a different oligonucleotide, the secondary sequence. The bDNA comb structures were assembled on a solid support and several synthesis parameters were investigated and optimized. The bDNA comb molecules were characterized by polyacrylamide gel electrophoretic methods and by controlled cleavage at periodate-cleavable moieties incorporated during synthesis. The developed chemistry allows synthesis of bDNA comb molecules containing multiple secondary sequences. In the accompanying article we describe the synthesis and characterization of large bDNA combs containing all four deoxynucleotides for use as signal amplifiers in nucleic acid quantification assays. PMID:9365265

  10. Epitaxial Nucleation on Rationally Designed Peptide Functionalized Interface

    DTIC Science & Technology

    2011-07-19

    of 17 amino acid peptides. In this report, we focus on the findings from several variants of these sequences, including the role of charge...separation and histidine-gold coordination. We find that these 17 amino acid peptide sequences behave robustly, where periodicity appears to dominate the...26,27 Secondary structure propensity refers to the intrinsic inclination of individual amino acids to a given secondary structure, where side-group

  11. Role of DNA secondary structures in fragile site breakage along human chromosome 10

    PubMed Central

    Dillon, Laura W.; Pierce, Levi C. T.; Ng, Maggie C. Y.; Wang, Yuh-Hwa

    2013-01-01

    The formation of alternative DNA secondary structures can result in DNA breakage leading to cancer and other diseases. Chromosomal fragile sites, which are regions of the genome that exhibit chromosomal breakage under conditions of mild replication stress, are predicted to form stable DNA secondary structures. DNA breakage at fragile sites is associated with regions that are deleted, amplified or rearranged in cancer. Despite the correlation, unbiased examination of the ability to form secondary structures has not been evaluated in fragile sites. Here, using the Mfold program, we predict potential DNA secondary structure formation on the human chromosome 10 sequence, and utilize this analysis to compare fragile and non-fragile DNA. We found that aphidicolin (APH)-induced common fragile sites contain more sequence segments with potential high secondary structure-forming ability, and these segments clustered more densely than those in non-fragile DNA. Additionally, using a threshold of secondary structure-forming ability, we refined legitimate fragile sites within the cytogenetically defined boundaries, and identified potential fragile regions within non-fragile DNA. In vitro detection of alternative DNA structure formation and a DNA breakage cell assay were used to validate the computational predictions. Many of the regions identified by our analysis coincide with genes mutated in various diseases and regions of copy number alteration in cancer. This study supports the role of DNA secondary structures in common fragile site instability, provides a systematic method for their identification and suggests a mechanism by which DNA secondary structures can lead to human disease. PMID:23297364

  12. Order within disorder: Aggrecan chondroitin sulphate-attachment region provides new structural insights into protein sequences classified as disordered

    PubMed Central

    Jowitt, Thomas A; Murdoch, Alan D; Baldock, Clair; Berry, Richard; Day, Joanna M; Hardingham, Timothy E

    2010-01-01

    Structural investigation of proteins containing large stretches of sequences without predicted secondary structure is the focus of much increased attention. Here, we have produced an unglycosylated 30 kDa peptide from the chondroitin sulphate (CS)-attachment region of human aggrecan (CS-peptide), which was predicted to be intrinsically disordered and compared its structure with the adjacent aggrecan G3 domain. Biophysical analyses, including analytical ultracentrifugation, light scattering, and circular dichroism showed that the CS-peptide had an elongated and stiffened conformation in contrast to the globular G3 domain. The results suggested that it contained significant secondary structure, which was sensitive to urea, and we propose that the CS-peptide forms an elongated wormlike molecule based on a dynamic range of energetically equivalent secondary structures stabilized by hydrogen bonds. The dimensions of the structure predicted from small-angle X-ray scattering analysis were compatible with EM images of fully glycosylated aggrecan and a partly glycosylated aggrecan CS2-G3 construct. The semiordered structure identified in CS-peptide was not predicted by common structural algorithms and identified a potentially distinct class of semiordered structure within sequences currently identified as disordered. Sequence comparisons suggested some evidence for comparable structures in proteins encoded by other genes (PRG4, MUC5B, and CBP). The function of these semiordered sequences may serve to spatially position attached folded modules and/or to present polypeptides for modification, such as glycosylation, and to provide templates for the multiple pleiotropic interactions proposed for disordered proteins. Proteins 2010. © 2010 Wiley-Liss, Inc. PMID:20806220

  13. Inferences from structural comparison: flexibility, secondary structure wobble and sequence alignment optimization.

    PubMed

    Zhang, Gaihua; Su, Zhen

    2012-01-01

    Work on protein structure prediction is very useful in biological research. To evaluate their accuracy, experimental protein structures or their derived data are used as the 'gold standard'. However, as proteins are dynamic molecular machines with structural flexibility such a standard may be unreliable. To investigate the influence of the structure flexibility, we analysed 3,652 protein structures of 137 unique sequences from 24 protein families. The results showed that (1) the three-dimensional (3D) protein structures were not rigid: the root-mean-square deviation (RMSD) of the backbone Cα of structures with identical sequences was relatively large, with the average of the maximum RMSD from each of the 137 sequences being 1.06 Å; (2) the derived data of the 3D structure was not constant, e.g. the highest ratio of the secondary structure wobble site was 60.69%, with the sequence alignments from structural comparisons of two proteins in the same family sometimes being completely different. Proteins may have several stable conformations and the data derived from resolved structures as a 'gold standard' should be optimized before being utilized as criteria to evaluate the prediction methods, e.g. sequence alignment from structural comparison. Helix/β-sheet transition exists in normal free proteins. The coil ratio of the 3D structure could affect its resolution as determined by X-ray crystallography.

  14. RNAfbinv: an interactive Java application for fragment-based design of RNA sequences.

    PubMed

    Weinbrand, Lina; Avihoo, Assaf; Barash, Danny

    2013-11-15

    In RNA design problems, it is plausible to assume that the user would be interested in preserving a particular RNA secondary structure motif, or fragment, for biological reasons. The preservation could be in structure or sequence, or both. Thus, the inverse RNA folding problem could benefit from considering fragment constraints. We have developed a new interactive Java application called RNA fragment-based inverse that allows users to insert an RNA secondary structure in dot-bracket notation. It then performs sequence design that conforms to the shape of the input secondary structure, the specified thermodynamic stability, the specified mutational robustness and the user-selected fragment after shape decomposition. In this shape-based design approach, specific RNA structural motifs with known biological functions are strictly enforced, while others can possess more flexibility in their structure in favor of preserving physical attributes and additional constraints. RNAfbinv is freely available for download on the web at http://www.cs.bgu.ac.il/~RNAexinv/RNAfbinv. The site contains a help file with an explanation regarding the exact use.

  15. Topological Structure of the Space of Phenotypes: The Case of RNA Neutral Networks

    PubMed Central

    Aguirre, Jacobo; Buldú, Javier M.; Stich, Michael; Manrubia, Susanna C.

    2011-01-01

    The evolution and adaptation of molecular populations is constrained by the diversity accessible through mutational processes. RNA is a paradigmatic example of biopolymer where genotype (sequence) and phenotype (approximated by the secondary structure fold) are identified in a single molecule. The extreme redundancy of the genotype-phenotype map leads to large ensembles of RNA sequences that fold into the same secondary structure and can be connected through single-point mutations. These ensembles define neutral networks of phenotypes in sequence space. Here we analyze the topological properties of neutral networks formed by 12-nucleotides RNA sequences, obtained through the exhaustive folding of sequence space. A total of 412 sequences fragments into 645 subnetworks that correspond to 57 different secondary structures. The topological analysis reveals that each subnetwork is far from being random: it has a degree distribution with a well-defined average and a small dispersion, a high clustering coefficient, and an average shortest path between nodes close to its minimum possible value, i.e. the Hamming distance between sequences. RNA neutral networks are assortative due to the correlation in the composition of neighboring sequences, a feature that together with the symmetries inherent to the folding process explains the existence of communities. Several topological relationships can be analytically derived attending to structural restrictions and generic properties of the folding process. The average degree of these phenotypic networks grows logarithmically with their size, such that abundant phenotypes have the additional advantage of being more robust to mutations. This property prevents fragmentation of neutral networks and thus enhances the navigability of sequence space. In summary, RNA neutral networks show unique topological properties, unknown to other networks previously described. PMID:22028856

  16. Accelerating calculations of RNA secondary structure partition functions using GPUs

    PubMed Central

    2013-01-01

    Background RNA performs many diverse functions in the cell in addition to its role as a messenger of genetic information. These functions depend on its ability to fold to a unique three-dimensional structure determined by the sequence. The conformation of RNA is in part determined by its secondary structure, or the particular set of contacts between pairs of complementary bases. Prediction of the secondary structure of RNA from its sequence is therefore of great interest, but can be computationally expensive. In this work we accelerate computations of base-pair probababilities using parallel graphics processing units (GPUs). Results Calculation of the probabilities of base pairs in RNA secondary structures using nearest-neighbor standard free energy change parameters has been implemented using CUDA to run on hardware with multiprocessor GPUs. A modified set of recursions was introduced, which reduces memory usage by about 25%. GPUs are fastest in single precision, and for some hardware, restricted to single precision. This may introduce significant roundoff error. However, deviations in base-pair probabilities calculated using single precision were found to be negligible compared to those resulting from shifting the nearest-neighbor parameters by a random amount of magnitude similar to their experimental uncertainties. For large sequences running on our particular hardware, the GPU implementation reduces execution time by a factor of close to 60 compared with an optimized serial implementation, and by a factor of 116 compared with the original code. Conclusions Using GPUs can greatly accelerate computation of RNA secondary structure partition functions, allowing calculation of base-pair probabilities for large sequences in a reasonable amount of time, with a negligible compromise in accuracy due to working in single precision. The source code is integrated into the RNAstructure software package and available for download at http://rna.urmc.rochester.edu. PMID:24180434

  17. A Method for WD40 Repeat Detection and Secondary Structure Prediction

    PubMed Central

    Wang, Yang; Jiang, Fan; Zhuo, Zhu; Wu, Xian-Hui; Wu, Yun-Dong

    2013-01-01

    WD40-repeat proteins (WD40s), as one of the largest protein families in eukaryotes, play vital roles in assembling protein-protein/DNA/RNA complexes. WD40s fold into similar β-propeller structures despite diversified sequences. A program WDSP (WD40 repeat protein Structure Predictor) has been developed to accurately identify WD40 repeats and predict their secondary structures. The method is designed specifically for WD40 proteins by incorporating both local residue information and non-local family-specific structural features. It overcomes the problem of highly diversified protein sequences and variable loops. In addition, WDSP achieves a better prediction in identifying multiple WD40-domain proteins by taking the global combination of repeats into consideration. In secondary structure prediction, the average Q3 accuracy of WDSP in jack-knife test reaches 93.7%. A disease related protein LRRK2 was used as a representive example to demonstrate the structure prediction. PMID:23776530

  18. SFESA: a web server for pairwise alignment refinement by secondary structure shifts.

    PubMed

    Tong, Jing; Pei, Jimin; Grishin, Nick V

    2015-09-03

    Protein sequence alignment is essential for a variety of tasks such as homology modeling and active site prediction. Alignment errors remain the main cause of low-quality structure models. A bioinformatics tool to refine alignments is needed to make protein alignments more accurate. We developed the SFESA web server to refine pairwise protein sequence alignments. Compared to the previous version of SFESA, which required a set of 3D coordinates for a protein, the new server will search a sequence database for the closest homolog with an available 3D structure to be used as a template. For each alignment block defined by secondary structure elements in the template, SFESA evaluates alignment variants generated by local shifts and selects the best-scoring alignment variant. A scoring function that combines the sequence score of profile-profile comparison and the structure score of template-derived contact energy is used for evaluation of alignments. PROMALS pairwise alignments refined by SFESA are more accurate than those produced by current advanced alignment methods such as HHpred and CNFpred. In addition, SFESA also improves alignments generated by other software. SFESA is a web-based tool for alignment refinement, designed for researchers to compute, refine, and evaluate pairwise alignments with a combined sequence and structure scoring of alignment blocks. To our knowledge, the SFESA web server is the only tool that refines alignments by evaluating local shifts of secondary structure elements. The SFESA web server is available at http://prodata.swmed.edu/sfesa.

  19. Inability of Prevotella bryantii to Form a Functional Shine-Dalgarno Interaction Reflects Unique Evolution of Ribosome Binding Sites in Bacteroidetes

    PubMed Central

    Accetto, Tomaž; Avguštin, Gorazd

    2011-01-01

    The Shine-Dalgarno (SD) sequence is a key element directing the translation to initiate at the authentic start codons and also enabling translation initiation to proceed in 5′ untranslated mRNA regions (5′-UTRs) containing moderately strong secondary structures. Bioinformatic analysis of almost forty genomes from the major bacterial phylum Bacteroidetes revealed, however, a general absence of SD sequence, drop in GC content and consequently reduced tendency to form secondary structures in 5′-UTRs. The experiments using the Prevotella bryantii TC1-1 expression system were in agreement with these findings: neither addition nor omission of SD sequence in the unstructured 5′-UTR affected the level of the reporter protein, non-specific nuclease NucB. Further, NucB level in P. bryantii TC1-1, contrary to hMGFP level in Escherichia coli, was five times lower when SD sequence formed part of the secondary structure with a folding energy -5,2 kcal/mol. Also, the extended SD sequences did not affect protein levels as in E. coli. It seems therefore that a functional SD interaction does not take place during the translation initiation in P. bryanttii TC1-1 and possibly other members of phylum Bacteroidetes although the anti SD sequence is present in 16S rRNA genes of their genomes. We thus propose that in the absence of the SD sequence interaction, the selection of genuine start codons in Bacteroidetes is accomplished by binding of ribosomal protein S1 to unstructured 5′-UTR as opposed to coding region which is inaccessible due to mRNA secondary structure. Additionally, we found that sequence logos of region preceding the start codons may be used as taxonomical markers. Depending on whether complete sequence logo or only part of it, such as information content and base proportion at specific positions, is used, bacterial genera or families and in some cases even bacterial phyla can be distinguished. PMID:21857964

  20. RaptorX server: a resource for template-based protein structure modeling.

    PubMed

    Källberg, Morten; Margaryan, Gohar; Wang, Sheng; Ma, Jianzhu; Xu, Jinbo

    2014-01-01

    Assigning functional properties to a newly discovered protein is a key challenge in modern biology. To this end, computational modeling of the three-dimensional atomic arrangement of the amino acid chain is often crucial in determining the role of the protein in biological processes. We present a community-wide web-based protocol, RaptorX server ( http://raptorx.uchicago.edu ), for automated protein secondary structure prediction, template-based tertiary structure modeling, and probabilistic alignment sampling.Given a target sequence, RaptorX server is able to detect even remotely related template sequences by means of a novel nonlinear context-specific alignment potential and probabilistic consistency algorithm. Using the protocol presented here it is thus possible to obtain high-quality structural models for many target protein sequences when only distantly related protein domains have experimentally solved structures. At present, RaptorX server can perform secondary and tertiary structure prediction of a 200 amino acid target sequence in approximately 30 min.

  1. Thermodynamics of RNA structures by Wang–Landau sampling

    PubMed Central

    Lou, Feng; Clote, Peter

    2010-01-01

    Motivation: Thermodynamics-based dynamic programming RNA secondary structure algorithms have been of immense importance in molecular biology, where applications range from the detection of novel selenoproteins using expressed sequence tag (EST) data, to the determination of microRNA genes and their targets. Dynamic programming algorithms have been developed to compute the minimum free energy secondary structure and partition function of a given RNA sequence, the minimum free-energy and partition function for the hybridization of two RNA molecules, etc. However, the applicability of dynamic programming methods depends on disallowing certain types of interactions (pseudoknots, zig-zags, etc.), as their inclusion renders structure prediction an nondeterministic polynomial time (NP)-complete problem. Nevertheless, such interactions have been observed in X-ray structures. Results: A non-Boltzmannian Monte Carlo algorithm was designed by Wang and Landau to estimate the density of states for complex systems, such as the Ising model, that exhibit a phase transition. In this article, we apply the Wang-Landau (WL) method to compute the density of states for secondary structures of a given RNA sequence, and for hybridizations of two RNA sequences. Our method is shown to be much faster than existent software, such as RNAsubopt. From density of states, we compute the partition function over all secondary structures and over all pseudoknot-free hybridizations. The advantage of the WL method is that by adding a function to evaluate the free energy of arbitary pseudoknotted structures and of arbitrary hybridizations, we can estimate thermodynamic parameters for situations known to be NP-complete. This extension to pseudoknots will be made in the sequel to this article; in contrast, the current article describes the WL algorithm applied to pseudoknot-free secondary structures and hybridizations. Availability: The WL RNA hybridization web server is under construction at http://bioinformatics.bc.edu/clotelab/. Contact: clote@bc.edu PMID:20529917

  2. RNAmutants: a web server to explore the mutational landscape of RNA secondary structures

    PubMed Central

    Waldispühl, Jerome; Devadas, Srinivas; Berger, Bonnie; Clote, Peter

    2009-01-01

    The history and mechanism of molecular evolution in DNA have been greatly elucidated by contributions from genetics, probability theory and bioinformatics—indeed, mathematical developments such as Kimura's neutral theory, Kingman's coalescent theory and efficient software such as BLAST, ClustalW, Phylip, etc., provide the foundation for modern population genetics. In contrast to DNA, the function of most noncoding RNA depends on tertiary structure, experimentally known to be largely determined by secondary structure, for which dynamic programming can efficiently compute the minimum free energy secondary structure. For this reason, understanding the effect of pointwise mutations in RNA secondary structure could reveal fundamental properties of structural RNA molecules and improve our understanding of molecular evolution of RNA. The web server RNAmutants provides several efficient tools to compute the ensemble of low-energy secondary structures for all k-mutants of a given RNA sequence, where k is bounded by a user-specified upper bound. As we have previously shown, these tools can be used to predict putative deleterious mutations and to analyze regulatory sequences from the hepatitis C and human immunodeficiency genomes. Web server is available at http://bioinformatics.bc.edu/clotelab/RNAmutants/, and downloadable binaries at http://rnamutants.csail.mit.edu/. PMID:19531740

  3. Nucleotide sequence and proposed secondary structure of Columnea latent viroid: a natural mosaic of viroid sequences.

    PubMed Central

    Hammond, R; Smith, D R; Diener, T O

    1989-01-01

    The Columnea latent viroid (CLV) occurs latently in certain Columnea erythrophae plants grown commercially. In potato and tomato, CLV causes potato spindle tuber viroid (PSTV)-like symptoms. Its nucleotide sequence and proposed secondary structure reveal that CLV consists of a single-stranded circular RNA of 370 nucleotides which can assume a rod-like structure with extensive base-pairing characteristic of all known viroids. The electrophoretic mobility of circular CLV under nondenaturing conditions suggests a potential tertiary structure. CLV contains extensive sequence homologies to the PSTV group of viroids but contains a central conserved region identical to that of hop stunt viroid (HSV). CLV also shares some biological properties with each of the two types of viroids. Most probably, CLV is the result of intracellular RNA recombination between an HSV-type and one or more PSTV-type viroids replicating in the same plant. Images PMID:2602114

  4. Relationship between mRNA secondary structure and sequence variability in Chloroplast genes: possible life history implications.

    PubMed

    Krishnan, Neeraja M; Seligmann, Hervé; Rao, Basuthkar J

    2008-01-28

    Synonymous sites are freer to vary because of redundancy in genetic code. Messenger RNA secondary structure restricts this freedom, as revealed by previous findings in mitochondrial genes that mutations at third codon position nucleotides in helices are more selected against than those in loops. This motivated us to explore the constraints imposed by mRNA secondary structure on evolutionary variability at all codon positions in general, in chloroplast systems. We found that the evolutionary variability and intrinsic secondary structure stability of these sequences share an inverse relationship. Simulations of most likely single nucleotide evolution in Psilotum nudum and Nephroselmis olivacea mRNAs, indicate that helix-forming propensities of mutated mRNAs are greater than those of the natural mRNAs for short sequences and vice-versa for long sequences. Moreover, helix-forming propensity estimated by the percentage of total mRNA in helices increases gradually with mRNA length, saturating beyond 1000 nucleotides. Protection levels of functionally important sites vary across plants and proteins: r-strategists minimize mutation costs in large genes; K-strategists do the opposite. Mrna length presumably predisposes shorter mRNAs to evolve under different constraints than longer mRNAs. The positive correlation between secondary structure protection and functional importance of sites suggests that some sites might be conserved due to packing-protection constraints at the nucleic acid level in addition to protein level constraints. Consequently, nucleic acid secondary structure a priori biases mutations. The converse (exposure of conserved sites) apparently occurs in a smaller number of cases, indicating a different evolutionary adaptive strategy in these plants. The differences between the protection levels of functionally important sites for r- and K-strategists reflect their respective molecular adaptive strategies. These converge with increasing domestication levels of K-strategists, perhaps because domestication increases reproductive output.

  5. RNA folding kinetics using Monte Carlo and Gillespie algorithms.

    PubMed

    Clote, Peter; Bayegan, Amir H

    2018-04-01

    RNA secondary structure folding kinetics is known to be important for the biological function of certain processes, such as the hok/sok system in E. coli. Although linear algebra provides an exact computational solution of secondary structure folding kinetics with respect to the Turner energy model for tiny ([Formula: see text]20 nt) RNA sequences, the folding kinetics for larger sequences can only be approximated by binning structures into macrostates in a coarse-grained model, or by repeatedly simulating secondary structure folding with either the Monte Carlo algorithm or the Gillespie algorithm. Here we investigate the relation between the Monte Carlo algorithm and the Gillespie algorithm. We prove that asymptotically, the expected time for a K-step trajectory of the Monte Carlo algorithm is equal to [Formula: see text] times that of the Gillespie algorithm, where [Formula: see text] denotes the Boltzmann expected network degree. If the network is regular (i.e. every node has the same degree), then the mean first passage time (MFPT) computed by the Monte Carlo algorithm is equal to MFPT computed by the Gillespie algorithm multiplied by [Formula: see text]; however, this is not true for non-regular networks. In particular, RNA secondary structure folding kinetics, as computed by the Monte Carlo algorithm, is not equal to the folding kinetics, as computed by the Gillespie algorithm, although the mean first passage times are roughly correlated. Simulation software for RNA secondary structure folding according to the Monte Carlo and Gillespie algorithms is publicly available, as is our software to compute the expected degree of the network of secondary structures of a given RNA sequence-see http://bioinformatics.bc.edu/clote/RNAexpNumNbors .

  6. Structural protein descriptors in 1-dimension and their sequence-based predictions.

    PubMed

    Kurgan, Lukasz; Disfani, Fatemeh Miri

    2011-09-01

    The last few decades observed an increasing interest in development and application of 1-dimensional (1D) descriptors of protein structure. These descriptors project 3D structural features onto 1D strings of residue-wise structural assignments. They cover a wide-range of structural aspects including conformation of the backbone, burying depth/solvent exposure and flexibility of residues, and inter-chain residue-residue contacts. We perform first-of-its-kind comprehensive comparative review of the existing 1D structural descriptors. We define, review and categorize ten structural descriptors and we also describe, summarize and contrast over eighty computational models that are used to predict these descriptors from the protein sequences. We show that the majority of the recent sequence-based predictors utilize machine learning models, with the most popular being neural networks, support vector machines, hidden Markov models, and support vector and linear regressions. These methods provide high-throughput predictions and most of them are accessible to a non-expert user via web servers and/or stand-alone software packages. We empirically evaluate several recent sequence-based predictors of secondary structure, disorder, and solvent accessibility descriptors using a benchmark set based on CASP8 targets. Our analysis shows that the secondary structure can be predicted with over 80% accuracy and segment overlap (SOV), disorder with over 0.9 AUC, 0.6 Matthews Correlation Coefficient (MCC), and 75% SOV, and relative solvent accessibility with PCC of 0.7 and MCC of 0.6 (0.86 when homology is used). We demonstrate that the secondary structure predicted from sequence without the use of homology modeling is as good as the structure extracted from the 3D folds predicted by top-performing template-based methods.

  7. MUFOLD-SS: New deep inception-inside-inception networks for protein secondary structure prediction.

    PubMed

    Fang, Chao; Shang, Yi; Xu, Dong

    2018-05-01

    Protein secondary structure prediction can provide important information for protein 3D structure prediction and protein functions. Deep learning offers a new opportunity to significantly improve prediction accuracy. In this article, a new deep neural network architecture, named the Deep inception-inside-inception (Deep3I) network, is proposed for protein secondary structure prediction and implemented as a software tool MUFOLD-SS. The input to MUFOLD-SS is a carefully designed feature matrix corresponding to the primary amino acid sequence of a protein, which consists of a rich set of information derived from individual amino acid, as well as the context of the protein sequence. Specifically, the feature matrix is a composition of physio-chemical properties of amino acids, PSI-BLAST profile, and HHBlits profile. MUFOLD-SS is composed of a sequence of nested inception modules and maps the input matrix to either eight states or three states of secondary structures. The architecture of MUFOLD-SS enables effective processing of local and global interactions between amino acids in making accurate prediction. In extensive experiments on multiple datasets, MUFOLD-SS outperformed the best existing methods and other deep neural networks significantly. MUFold-SS can be downloaded from http://dslsrv8.cs.missouri.edu/~cf797/MUFoldSS/download.html. © 2018 Wiley Periodicals, Inc.

  8. Predicting disulfide connectivity from protein sequence using multiple sequence feature vectors and secondary structure.

    PubMed

    Song, Jiangning; Yuan, Zheng; Tan, Hao; Huber, Thomas; Burrage, Kevin

    2007-12-01

    Disulfide bonds are primary covalent crosslinks between two cysteine residues in proteins that play critical roles in stabilizing the protein structures and are commonly found in extracy-toplasmatic or secreted proteins. In protein folding prediction, the localization of disulfide bonds can greatly reduce the search in conformational space. Therefore, there is a great need to develop computational methods capable of accurately predicting disulfide connectivity patterns in proteins that could have potentially important applications. We have developed a novel method to predict disulfide connectivity patterns from protein primary sequence, using a support vector regression (SVR) approach based on multiple sequence feature vectors and predicted secondary structure by the PSIPRED program. The results indicate that our method could achieve a prediction accuracy of 74.4% and 77.9%, respectively, when averaged on proteins with two to five disulfide bridges using 4-fold cross-validation, measured on the protein and cysteine pair on a well-defined non-homologous dataset. We assessed the effects of different sequence encoding schemes on the prediction performance of disulfide connectivity. It has been shown that the sequence encoding scheme based on multiple sequence feature vectors coupled with predicted secondary structure can significantly improve the prediction accuracy, thus enabling our method to outperform most of other currently available predictors. Our work provides a complementary approach to the current algorithms that should be useful in computationally assigning disulfide connectivity patterns and helps in the annotation of protein sequences generated by large-scale whole-genome projects. The prediction web server and Supplementary Material are accessible at http://foo.maths.uq.edu.au/~huber/disulfide

  9. The conservation and function of RNA secondary structure in plants

    PubMed Central

    Vandivier, Lee E.; Anderson, Stephen J.; Foley, Shawn W.; Gregory, Brian D.

    2016-01-01

    RNA transcripts fold into secondary structures via intricate patterns of base pairing. These secondary structures impart catalytic, ligand binding, and scaffolding functions to a wide array of RNAs, forming a critical node of biological regulation. Among their many functions, RNA structural elements modulate epigenetic marks, alter mRNA stability and translation, regulate alternative splicing, transduce signals, and scaffold large macromolecular complexes. Thus, the study of RNA secondary structure is critical to understanding the function and regulation of RNA transcripts. Here, we review the origins, form, and function of RNA secondary structure, focusing on plants. We then provide an overview of methods for probing secondary structure, from physical methods such as X-ray crystallography and nuclear magnetic resonance imaging (NMR) to chemical and nuclease probing methods. Marriage with high-throughput sequencing has enabled these latter methods to scale across whole transcriptomes, yielding tremendous new insights into the form and function of RNA secondary structure. PMID:26865341

  10. Indel PDB: a database of structural insertions and deletions derived from sequence alignments of closely related proteins.

    PubMed

    Hsing, Michael; Cherkasov, Artem

    2008-06-25

    Insertions and deletions (indels) represent a common type of sequence variations, which are less studied and pose many important biological questions. Recent research has shown that the presence of sizable indels in protein sequences may be indicative of protein essentiality and their role in protein interaction networks. Examples of utilization of indels for structure-based drug design have also been recently demonstrated. Nonetheless many structural and functional characteristics of indels remain less researched or unknown. We have created a web-based resource, Indel PDB, representing a structural database of insertions/deletions identified from the sequence alignments of highly similar proteins found in the Protein Data Bank (PDB). Indel PDB utilized large amounts of available structural information to characterize 1-, 2- and 3-dimensional features of indel sites. Indel PDB contains 117,266 non-redundant indel sites extracted from 11,294 indel-containing proteins. Unlike loop databases, Indel PDB features more indel sequences with secondary structures including alpha-helices and beta-sheets in addition to loops. The insertion fragments have been characterized by their sequences, lengths, locations, secondary structure composition, solvent accessibility, protein domain association and three dimensional structures. By utilizing the data available in Indel PDB, we have studied and presented here several sequence and structural features of indels. We anticipate that Indel PDB will not only enable future functional studies of indels, but will also assist protein modeling efforts and identification of indel-directed drug binding sites.

  11. Exact calculation of loop formation probability identifies folding motifs in RNA secondary structures

    PubMed Central

    Sloma, Michael F.; Mathews, David H.

    2016-01-01

    RNA secondary structure prediction is widely used to analyze RNA sequences. In an RNA partition function calculation, free energy nearest neighbor parameters are used in a dynamic programming algorithm to estimate statistical properties of the secondary structure ensemble. Previously, partition functions have largely been used to estimate the probability that a given pair of nucleotides form a base pair, the conditional stacking probability, the accessibility to binding of a continuous stretch of nucleotides, or a representative sample of RNA structures. Here it is demonstrated that an RNA partition function can also be used to calculate the exact probability of formation of hairpin loops, internal loops, bulge loops, or multibranch loops at a given position. This calculation can also be used to estimate the probability of formation of specific helices. Benchmarking on a set of RNA sequences with known secondary structures indicated that loops that were calculated to be more probable were more likely to be present in the known structure than less probable loops. Furthermore, highly probable loops are more likely to be in the known structure than the set of loops predicted in the lowest free energy structures. PMID:27852924

  12. A Case Study into Microbial Genome Assembly Gap Sequences and Finishing Strategies.

    PubMed

    Utturkar, Sagar M; Klingeman, Dawn M; Hurt, Richard A; Brown, Steven D

    2017-01-01

    This study characterized regions of DNA which remained unassembled by either PacBio and Illumina sequencing technologies for seven bacterial genomes. Two genomes were manually finished using bioinformatics and PCR/Sanger sequencing approaches and regions not assembled by automated software were analyzed. Gaps present within Illumina assemblies mostly correspond to repetitive DNA regions such as multiple rRNA operon sequences. PacBio gap sequences were evaluated for several properties such as GC content, read coverage, gap length, ability to form strong secondary structures, and corresponding annotations. Our hypothesis that strong secondary DNA structures blocked DNA polymerases and contributed to gap sequences was not accepted. PacBio assemblies had few limitations overall and gaps were explained as cumulative effect of lower than average sequence coverage and repetitive sequences at contig termini. An important aspect of the present study is the compilation of biological features that interfered with assembly and included active transposons, multiple plasmid sequences, phage DNA integration, and large sequence duplication. Our targeted genome finishing approach and systematic evaluation of the unassembled DNA will be useful for others looking to close, finish, and polish microbial genome sequences.

  13. SVM-PB-Pred: SVM based protein block prediction method using sequence profiles and secondary structures.

    PubMed

    Suresh, V; Parthasarathy, S

    2014-01-01

    We developed a support vector machine based web server called SVM-PB-Pred, to predict the Protein Block for any given amino acid sequence. The input features of SVM-PB-Pred include i) sequence profiles (PSSM) and ii) actual secondary structures (SS) from DSSP method or predicted secondary structures from NPS@ and GOR4 methods. There were three combined input features PSSM+SS(DSSP), PSSM+SS(NPS@) and PSSM+SS(GOR4) used to test and train the SVM models. Similarly, four datasets RS90, DB433, LI1264 and SP1577 were used to develop the SVM models. These four SVM models developed were tested using three different benchmarking tests namely; (i) self consistency, (ii) seven fold cross validation test and (iii) independent case test. The maximum possible prediction accuracy of ~70% was observed in self consistency test for the SVM models of both LI1264 and SP1577 datasets, where PSSM+SS(DSSP) input features was used to test. The prediction accuracies were reduced to ~53% for PSSM+SS(NPS@) and ~43% for PSSM+SS(GOR4) in independent case test, for the SVM models of above two same datasets. Using our method, it is possible to predict the protein block letters for any query protein sequence with ~53% accuracy, when the SP1577 dataset and predicted secondary structure from NPS@ server were used. The SVM-PB-Pred server can be freely accessed through http://bioinfo.bdu.ac.in/~svmpbpred.

  14. An efficient method for the prediction of deleterious multiple-point mutations in the secondary structure of RNAs using suboptimal folding solutions

    PubMed Central

    Churkin, Alexander; Barash, Danny

    2008-01-01

    Background RNAmute is an interactive Java application which, given an RNA sequence, calculates the secondary structure of all single point mutations and organizes them into categories according to their similarity to the predicted structure of the wild type. The secondary structure predictions are performed using the Vienna RNA package. A more efficient implementation of RNAmute is needed, however, to extend from the case of single point mutations to the general case of multiple point mutations, which may often be desired for computational predictions alongside mutagenesis experiments. But analyzing multiple point mutations, a process that requires traversing all possible mutations, becomes highly expensive since the running time is O(nm) for a sequence of length n with m-point mutations. Using Vienna's RNAsubopt, we present a method that selects only those mutations, based on stability considerations, which are likely to be conformational rearranging. The approach is best examined using the dot plot representation for RNA secondary structure. Results Using RNAsubopt, the suboptimal solutions for a given wild-type sequence are calculated once. Then, specific mutations are selected that are most likely to cause a conformational rearrangement. For an RNA sequence of about 100 nts and 3-point mutations (n = 100, m = 3), for example, the proposed method reduces the running time from several hours or even days to several minutes, thus enabling the practical application of RNAmute to the analysis of multiple-point mutations. Conclusion A highly efficient addition to RNAmute that is as user friendly as the original application but that facilitates the practical analysis of multiple-point mutations is presented. Such an extension can now be exploited prior to site-directed mutagenesis experiments by virologists, for example, who investigate the change of function in an RNA virus via mutations that disrupt important motifs in its secondary structure. A complete explanation of the application, called MultiRNAmute, is available at [1]. PMID:18445289

  15. DNA Secondary Structure at Chromosomal Fragile Sites in Human Disease

    PubMed Central

    Thys, Ryan G; Lehman, Christine E; Pierce, Levi C. T; Wang, Yuh-Hwa

    2015-01-01

    DNA has the ability to form a variety of secondary structures that can interfere with normal cellular processes, and many of these structures have been associated with neurological diseases and cancer. Secondary structure-forming sequences are often found at chromosomal fragile sites, which are hotspots for sister chromatid exchange, chromosomal translocations, and deletions. Structures formed at fragile sites can lead to instability by disrupting normal cellular processes such as DNA replication and transcription. The instability caused by disruption of replication and transcription can lead to DNA breakage, resulting in gene rearrangements and deletions that cause disease. In this review, we discuss the role of DNA secondary structure at fragile sites in human disease. PMID:25937814

  16. Prediction of cis/trans isomerization in proteins using PSI-BLAST profiles and secondary structure information.

    PubMed

    Song, Jiangning; Burrage, Kevin; Yuan, Zheng; Huber, Thomas

    2006-03-09

    The majority of peptide bonds in proteins are found to occur in the trans conformation. However, for proline residues, a considerable fraction of Prolyl peptide bonds adopt the cis form. Proline cis/trans isomerization is known to play a critical role in protein folding, splicing, cell signaling and transmembrane active transport. Accurate prediction of proline cis/trans isomerization in proteins would have many important applications towards the understanding of protein structure and function. In this paper, we propose a new approach to predict the proline cis/trans isomerization in proteins using support vector machine (SVM). The preliminary results indicated that using Radial Basis Function (RBF) kernels could lead to better prediction performance than that of polynomial and linear kernel functions. We used single sequence information of different local window sizes, amino acid compositions of different local sequences, multiple sequence alignment obtained from PSI-BLAST and the secondary structure information predicted by PSIPRED. We explored these different sequence encoding schemes in order to investigate their effects on the prediction performance. The training and testing of this approach was performed on a newly enlarged dataset of 2424 non-homologous proteins determined by X-Ray diffraction method using 5-fold cross-validation. Selecting the window size 11 provided the best performance for determining the proline cis/trans isomerization based on the single amino acid sequence. It was found that using multiple sequence alignments in the form of PSI-BLAST profiles could significantly improve the prediction performance, the prediction accuracy increased from 62.8% with single sequence to 69.8% and Matthews Correlation Coefficient (MCC) improved from 0.26 with single local sequence to 0.40. Furthermore, if coupled with the predicted secondary structure information by PSIPRED, our method yielded a prediction accuracy of 71.5% and MCC of 0.43, 9% and 0.17 higher than the accuracy achieved based on the singe sequence information, respectively. A new method has been developed to predict the proline cis/trans isomerization in proteins based on support vector machine, which used the single amino acid sequence with different local window sizes, the amino acid compositions of local sequence flanking centered proline residues, the position-specific scoring matrices (PSSMs) extracted by PSI-BLAST and the predicted secondary structures generated by PSIPRED. The successful application of SVM approach in this study reinforced that SVM is a powerful tool in predicting proline cis/trans isomerization in proteins and biological sequence analysis.

  17. Sequence and Secondary Structure of the Mitochondrial Small-Subunit rRNA V4, V6, and V9 Domains Reveal Highly Species-Specific Variations within the Genus Agrocybe

    PubMed Central

    Gonzalez, Patrice; Labarère, Jacques

    1998-01-01

    A comparative study of variable domains V4, V6, and V9 of the mitochondrial small-subunit (SSU) rRNA was carried out with the genus Agrocybe by PCR amplification of 42 wild isolates belonging to 10 species, Agrocybe aegerita, Agrocybe dura, Agrocybe chaxingu, Agrocybe erebia, Agrocybe firma, Agrocybe praecox, Agrocybe paludosa, Agrocybe pediades, Agrocybe alnetorum, and Agrocybe vervacti. Sequencing of the PCR products showed that the three domains in the isolates belonging to the same species were the same length and had the same sequence, while variations were found among the 10 species. Alignment of the sequences showed that nucleotide motifs encountered in the smallest sequence of each variable domain were also found in the largest sequence, indicating that the sequences evolved by insertion-deletion events. Determination of the secondary structure of each domain revealed that the insertion-deletion events commonly occurred in regions not directly involved in the secondary structure (i.e., the loops). Moreover, conserved sequences ranging from 4 to 25 nucleotides long were found at the beginning and end of each domain and could constitute genus-specific sequences. Comparisons of the V4, V6, and V9 secondary structures resulted in identification of the following four groups: (i) group I, which was characterized by the presence of additional P23-1 and P23-3 helices in the V4 domain and the lack of the P49-1 helix in V9 and included A. aegerita, A. chaxingu, and A. erebia; (ii) group II, which had the P23-3 helix in V4 and the P49-1 helix in V9 and included A. pediades; (iii) group III, which did not have additional helices in V4, had the P49-1 helix in V9 and included A. paludosa, A. firma, A. alnetorum, and A. praecox; and (iv) group IV, which lacked both the V4 additional helices and the P49-1 helix in V9 and included A. vervacti and A. dura. This grouping of species was supported by the structure of a consensus tree based on the variable domain sequences. The conservation of the sequences of the V4, V6, and V9 domains of the mitochondrial SSU rRNA within species and the high degree of interspecific variation found in the Agrocybe species studied open the way for these sequences to be used as specific molecular markers of the Basidiomycota. PMID:9797259

  18. Sequence and secondary structure of the mitochondrial small-subunit rRNA V4, V6, and V9 domains reveal highly species-specific variations within the genus Agrocybe.

    PubMed

    Gonzalez, P; Labarère, J

    1998-11-01

    A comparative study of variable domains V4, V6, and V9 of the mitochondrial small-subunit (SSU) rRNA was carried out with the genus Agrocybe by PCR amplification of 42 wild isolates belonging to 10 species, Agrocybe aegerita, Agrocybe dura, Agrocybe chaxingu, Agrocybe erebia, Agrocybe firma, Agrocybe praecox, Agrocybe paludosa, Agrocybe pediades, Agrocybe alnetorum, and Agrocybe vervacti. Sequencing of the PCR products showed that the three domains in the isolates belonging to the same species were the same length and had the same sequence, while variations were found among the 10 species. Alignment of the sequences showed that nucleotide motifs encountered in the smallest sequence of each variable domain were also found in the largest sequence, indicating that the sequences evolved by insertion-deletion events. Determination of the secondary structure of each domain revealed that the insertion-deletion events commonly occurred in regions not directly involved in the secondary structure (i.e., the loops). Moreover, conserved sequences ranging from 4 to 25 nucleotides long were found at the beginning and end of each domain and could constitute genus-specific sequences. Comparisons of the V4, V6, and V9 secondary structures resulted in identification of the following four groups: (i) group I, which was characterized by the presence of additional P23-1 and P23-3 helices in the V4 domain and the lack of the P49-1 helix in V9 and included A. aegerita, A. chaxingu, and A. erebia; (ii) group II, which had the P23-3 helix in V4 and the P49-1 helix in V9 and included A. pediades; (iii) group III, which did not have additional helices in V4, had the P49-1 helix in V9 and included A. paludosa, A. firma, A. alnetorum, and A. praecox; and (iv) group IV, which lacked both the V4 additional helices and the P49-1 helix in V9 and included A. vervacti and A. dura. This grouping of species was supported by the structure of a consensus tree based on the variable domain sequences. The conservation of the sequences of the V4, V6, and V9 domains of the mitochondrial SSU rRNA within species and the high degree of interspecific variation found in the Agrocybe species studied open the way for these sequences to be used as specific molecular markers of the Basidiomycota.

  19. RNA secondary structure prediction using soft computing.

    PubMed

    Ray, Shubhra Sankar; Pal, Sankar K

    2013-01-01

    Prediction of RNA structure is invaluable in creating new drugs and understanding genetic diseases. Several deterministic algorithms and soft computing-based techniques have been developed for more than a decade to determine the structure from a known RNA sequence. Soft computing gained importance with the need to get approximate solutions for RNA sequences by considering the issues related with kinetic effects, cotranscriptional folding, and estimation of certain energy parameters. A brief description of some of the soft computing-based techniques, developed for RNA secondary structure prediction, is presented along with their relevance. The basic concepts of RNA and its different structural elements like helix, bulge, hairpin loop, internal loop, and multiloop are described. These are followed by different methodologies, employing genetic algorithms, artificial neural networks, and fuzzy logic. The role of various metaheuristics, like simulated annealing, particle swarm optimization, ant colony optimization, and tabu search is also discussed. A relative comparison among different techniques, in predicting 12 known RNA secondary structures, is presented, as an example. Future challenging issues are then mentioned.

  20. Evolutionary conservation of sequence and secondary structures inCRISPR repeats

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kunin, Victor; Sorek, Rotem; Hugenholtz, Philip

    Clustered Regularly Interspaced Palindromic Repeats (CRISPRs) are a novel class of direct repeats, separated by unique spacer sequences of similar length, that are present in {approx}40% of bacterial and all archaeal genomes analyzed to date. More than 40 gene families, called CRISPR-associated sequences (CAS), appear in conjunction with these repeats and are thought to be involved in the propagation and functioning of CRISPRs. It has been proposed that the CRISPR/CAS system samples, maintains a record of, and inactivates invasive DNA that the cell has encountered, and therefore constitutes a prokaryotic analog of an immune system. Here we analyze CRISPR repeatsmore » identified in 195 microbial genomes and show that they can be organized into multiple clusters based on sequence similarity. All individual repeats in any given cluster were inferred to form characteristic RNA secondary structure, ranging from non-existent to pronounced. Stable secondary structures included G:U base pairs and exhibited multiple compensatory base changes in the stem region, indicating evolutionary conservation and functional importance. We also show that the repeat-based classification corresponds to, and expands upon, a previously reported CAS gene-based classification including specific relationships between CRISPR and CAS subtypes.« less

  1. Characterization and visualization of RNA secondary structure Boltzmann ensemble via information theory.

    PubMed

    Lin, Luan; McKerrow, Wilson H; Richards, Bryce; Phonsom, Chukiat; Lawrence, Charles E

    2018-03-05

    The nearest neighbor model and associated dynamic programming algorithms allow for the efficient estimation of the RNA secondary structure Boltzmann ensemble. However because a given RNA secondary structure only contains a fraction of the possible helices that could form from a given sequence, the Boltzmann ensemble is multimodal. Several methods exist for clustering structures and finding those modes. However less focus is given to exploring the underlying reasons for this multimodality: the presence of conflicting basepairs. Information theory, or more specifically mutual information, provides a method to identify those basepairs that are key to the secondary structure. To this end we find most informative basepairs and visualize the effect of these basepairs on the secondary structure. Knowing whether a most informative basepair is present tells us not only the status of the particular pair but also provides a large amount of information about which other pairs are present or not present. We find that a few basepairs account for a large amount of the structural uncertainty. The identification of these pairs indicates small changes to sequence or stability that will have a large effect on structure. We provide a novel algorithm that uses mutual information to identify the key basepairs that lead to a multimodal Boltzmann distribution. We then visualize the effect of these pairs on the overall Boltzmann ensemble.

  2. Simulations Using Random-Generated DNA and RNA Sequences

    ERIC Educational Resources Information Center

    Bryce, C. F. A.

    1977-01-01

    Using a very simple computer program written in BASIC, a very large number of random-generated DNA or RNA sequences are obtained. Students use these sequences to predict complementary sequences and translational products, evaluate base compositions, determine frequencies of particular triplet codons, and suggest possible secondary structures.…

  3. ITS2 sequence-structure phylogeny reveals diverse endophytic Pseudocercospora fungi on poplars.

    PubMed

    Yan, Dong-Hui; Gao, Qian; Sun, Xiaoming; Song, Xiaoyu; Li, Hongchang

    2018-04-01

    For matching the new fungal nomenclature to abolish pleomorphic names for a fungus, a genus Pseudocercospora s. str. was suggested to host holomorphic Pseudocercosproa fungi. But the Pseudocercosproa fungi need extra phylogenetic loci to clarify their taxonomy and diversity for their existing and coming species. Internal transcribed spacer 2 (ITS2) secondary structures have been promising in charactering species phylogeny in plants, animals and fungi. In present study, a conserved model of ITS2 secondary structures was confirmed on fungi in Pseudocercospora s. str. genus using RNAshape program. The model has a typical eukaryotic four-helix ITS2 secondary structure. But a single U base occurred in conserved motif of U-U mismatch in Helix 2, and a UG emerged in UGGU motif in Helix 3 to Pseudocercospora fungi. The phylogeny analyses based on the ITS2 sequence-secondary structures with compensatory base change characterizations are able to delimit more species for Pseudocercospora s. str. than phylogenic inferences of traditional multi-loci alignments do. The model was employed to explore the diversity of endophytic Pseudocercospora fungi in poplar trees. The analysis results also showed that endophytic Pseudocercospora fungi were diverse in species and evolved a specific lineage in poplar trees. This work suggested that ITS2 sequence-structures could become as additionally significant loci for species phylogenetic and taxonomic studies on Pseudocerospora fungi, and that Pseudocercospora endophytes could be important roles to Pseudocercospora fungi's evolution and function in ecology.

  4. Quantitation of base substitutions in eukaryotic 5S rRNA: selection for the maintenance of RNA secondary structure.

    PubMed

    Curtiss, W C; Vournakis, J N

    1984-01-01

    Eukaryotic 5S rRNA sequences from 34 diverse species were compared by the following method: (1) The sequences were aligned; (2) the positions of substitutions were located by comparison of all possible pairs of sequences; (3) the substitution sites were mapped to an assumed general base pairing model; and (4) the R-Y model of base stacking was used to study stacking pattern relationships in the structure. An analysis of the sequence and structure variability in each region of the molecule is presented. It was found that the degree of base substitution varies over a wide range, from absolute conservation to occurrence of over 90% of the possible observable substitutions. The substitutions are located primarily in stem regions of the 5S rRNA secondary structure. More than 88% of the substitutions in helical regions maintain base pairing. The disruptive substitutions are primarily located at the edges of helical regions, resulting in shortening of the helical regions and lengthening of the adjacent nonpaired regions. Base stacking patterns determined by the R-Y model are mapped onto the general secondary structure. Intrastrand and interstrand stacking could stabilize alternative coaxial structures and limit the conformational flexibility of nonpaired regions. Two short contiguous regions are 100% conserved in all species. This may reflect evolutionary constraints imposed at the DNA level by the requirement for binding of a 5S gene transcription initiation factor during gene expression.

  5. QUASAR--scoring and ranking of sequence-structure alignments.

    PubMed

    Birzele, Fabian; Gewehr, Jan E; Zimmer, Ralf

    2005-12-15

    Sequence-structure alignments are a common means for protein structure prediction in the fields of fold recognition and homology modeling, and there is a broad variety of programs that provide such alignments based on sequence similarity, secondary structure or contact potentials. Nevertheless, finding the best sequence-structure alignment in a pool of alignments remains a difficult problem. QUASAR (quality of sequence-structure alignments ranking) provides a unifying framework for scoring sequence-structure alignments that aids finding well-performing combinations of well-known and custom-made scoring schemes. Those scoring functions can be benchmarked against widely accepted quality scores like MaxSub, TMScore, Touch and APDB, thus enabling users to test their own alignment scores against 'standard-of-truth' structure-based scores. Furthermore, individual score combinations can be optimized with respect to benchmark sets based on known structural relationships using QUASAR's in-built optimization routines.

  6. Exact calculation of loop formation probability identifies folding motifs in RNA secondary structures.

    PubMed

    Sloma, Michael F; Mathews, David H

    2016-12-01

    RNA secondary structure prediction is widely used to analyze RNA sequences. In an RNA partition function calculation, free energy nearest neighbor parameters are used in a dynamic programming algorithm to estimate statistical properties of the secondary structure ensemble. Previously, partition functions have largely been used to estimate the probability that a given pair of nucleotides form a base pair, the conditional stacking probability, the accessibility to binding of a continuous stretch of nucleotides, or a representative sample of RNA structures. Here it is demonstrated that an RNA partition function can also be used to calculate the exact probability of formation of hairpin loops, internal loops, bulge loops, or multibranch loops at a given position. This calculation can also be used to estimate the probability of formation of specific helices. Benchmarking on a set of RNA sequences with known secondary structures indicated that loops that were calculated to be more probable were more likely to be present in the known structure than less probable loops. Furthermore, highly probable loops are more likely to be in the known structure than the set of loops predicted in the lowest free energy structures. © 2016 Sloma and Mathews; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

  7. Computational prediction and biochemical characterization of novel RNA aptamers to Rift Valley fever virus nucleocapsid protein.

    PubMed

    Ellenbecker, Mary; St Goddard, Jeremy; Sundet, Alec; Lanchy, Jean-Marc; Raiford, Douglas; Lodmell, J Stephen

    2015-10-01

    Rift Valley fever virus (RVFV) is a potent human and livestock pathogen endemic to sub-Saharan Africa and the Arabian Peninsula that has potential to spread to other parts of the world. Although there is no proven effective and safe treatment for RVFV infections, a potential therapeutic target is the virally encoded nucleocapsid protein (N). During the course of infection, N binds to viral RNA, and perturbation of this interaction can inhibit viral replication. To gain insight into how N recognizes viral RNA specifically, we designed an algorithm that uses a distance matrix and multidimensional scaling to compare the predicted secondary structures of known N-binding RNAs, or aptamers, that were isolated and characterized in previous in vitro evolution experiment. These aptamers did not exhibit overt sequence or predicted structure similarity, so we employed bioinformatic methods to propose novel aptamers based on analysis and clustering of secondary structures. We screened and scored the predicted secondary structures of novel randomly generated RNA sequences in silico and selected several of these putative N-binding RNAs whose secondary structures were similar to those of known N-binding RNAs. We found that overall the in silico generated RNA sequences bound well to N in vitro. Furthermore, introduction of these RNAs into cells prior to infection with RVFV inhibited viral replication in cell culture. This proof of concept study demonstrates how the predictive power of bioinformatics and the empirical power of biochemistry can be jointly harnessed to discover, synthesize, and test new RNA sequences that bind tightly to RVFV N protein. The approach would be easily generalizable to other applications. Copyright © 2015 Elsevier Ltd. All rights reserved.

  8. Unraveling the sequence and structure of the protein osteocalcin from a 42 ka fossil horse

    NASA Astrophysics Data System (ADS)

    Ostrom, Peggy H.; Gandhi, Hasand; Strahler, John R.; Walker, Angela K.; Andrews, Philip C.; Leykam, Joseph; Stafford, Thomas W.; Kelly, Robert L.; Walker, Danny N.; Buckley, Mike; Humpula, James

    2006-04-01

    We report the first complete amino acid sequence and evidence of secondary structure for osteocalcin from a temperate fossil. The osteocalcin derives from a 42 ka equid bone excavated from Juniper Cave, Wyoming. Results were determined by matrix-assisted laser desorption ionization time-of-flight mass spectrometry (MALDI-MS) and Edman sequencing with independent confirmation of the sequence in two laboratories. The ancient sequence was compared to that of three modern taxa: horse ( Equus caballus), zebra ( Equus grevyi), and donkey ( Equus asinus). Although there was no difference in sequence among modern taxa, MALDI-MS and Edman sequencing show that residues 48 and 49 of our modern horse are Thr, Ala rather than Pro, Val as previously reported (Carstanjen B., Wattiez, R., Armory, H., Lepage, O.M., Remy, B., 2002. Isolation and characterization of equine osteocalcin. Ann. Med. Vet.146(1), 31-38). MALDI-MS and Edman sequencing data indicate that the osteocalcin sequence of the 42 ka fossil is similar to that of modern horse. Previously inaccessible structural attributes for ancient osteocalcin were observed. Glu 39 rather than Gln 39 is consistent with deamidation, a process known to occur during fossilization and aging. Two post-translational modifications were documented: Hyp 9 and a disulfide bridge. The latter suggests at least partial retention of secondary structure. As has been done for ancient DNA research, we recommend standards for preparation and criteria for authenticating results of ancient protein sequencing.

  9. SCPRED: accurate prediction of protein structural class for sequences of twilight-zone similarity with predicting sequences.

    PubMed

    Kurgan, Lukasz; Cios, Krzysztof; Chen, Ke

    2008-05-01

    Protein structure prediction methods provide accurate results when a homologous protein is predicted, while poorer predictions are obtained in the absence of homologous templates. However, some protein chains that share twilight-zone pairwise identity can form similar folds and thus determining structural similarity without the sequence similarity would be desirable for the structure prediction. The folding type of a protein or its domain is defined as the structural class. Current structural class prediction methods that predict the four structural classes defined in SCOP provide up to 63% accuracy for the datasets in which sequence identity of any pair of sequences belongs to the twilight-zone. We propose SCPRED method that improves prediction accuracy for sequences that share twilight-zone pairwise similarity with sequences used for the prediction. SCPRED uses a support vector machine classifier that takes several custom-designed features as its input to predict the structural classes. Based on extensive design that considers over 2300 index-, composition- and physicochemical properties-based features along with features based on the predicted secondary structure and content, the classifier's input includes 8 features based on information extracted from the secondary structure predicted with PSI-PRED and one feature computed from the sequence. Tests performed with datasets of 1673 protein chains, in which any pair of sequences shares twilight-zone similarity, show that SCPRED obtains 80.3% accuracy when predicting the four SCOP-defined structural classes, which is superior when compared with over a dozen recent competing methods that are based on support vector machine, logistic regression, and ensemble of classifiers predictors. The SCPRED can accurately find similar structures for sequences that share low identity with sequence used for the prediction. The high predictive accuracy achieved by SCPRED is attributed to the design of the features, which are capable of separating the structural classes in spite of their low dimensionality. We also demonstrate that the SCPRED's predictions can be successfully used as a post-processing filter to improve performance of modern fold classification methods.

  10. SCPRED: Accurate prediction of protein structural class for sequences of twilight-zone similarity with predicting sequences

    PubMed Central

    Kurgan, Lukasz; Cios, Krzysztof; Chen, Ke

    2008-01-01

    Background Protein structure prediction methods provide accurate results when a homologous protein is predicted, while poorer predictions are obtained in the absence of homologous templates. However, some protein chains that share twilight-zone pairwise identity can form similar folds and thus determining structural similarity without the sequence similarity would be desirable for the structure prediction. The folding type of a protein or its domain is defined as the structural class. Current structural class prediction methods that predict the four structural classes defined in SCOP provide up to 63% accuracy for the datasets in which sequence identity of any pair of sequences belongs to the twilight-zone. We propose SCPRED method that improves prediction accuracy for sequences that share twilight-zone pairwise similarity with sequences used for the prediction. Results SCPRED uses a support vector machine classifier that takes several custom-designed features as its input to predict the structural classes. Based on extensive design that considers over 2300 index-, composition- and physicochemical properties-based features along with features based on the predicted secondary structure and content, the classifier's input includes 8 features based on information extracted from the secondary structure predicted with PSI-PRED and one feature computed from the sequence. Tests performed with datasets of 1673 protein chains, in which any pair of sequences shares twilight-zone similarity, show that SCPRED obtains 80.3% accuracy when predicting the four SCOP-defined structural classes, which is superior when compared with over a dozen recent competing methods that are based on support vector machine, logistic regression, and ensemble of classifiers predictors. Conclusion The SCPRED can accurately find similar structures for sequences that share low identity with sequence used for the prediction. The high predictive accuracy achieved by SCPRED is attributed to the design of the features, which are capable of separating the structural classes in spite of their low dimensionality. We also demonstrate that the SCPRED's predictions can be successfully used as a post-processing filter to improve performance of modern fold classification methods. PMID:18452616

  11. Robust prediction of consensus secondary structures using averaged base pairing probability matrices.

    PubMed

    Kiryu, Hisanori; Kin, Taishin; Asai, Kiyoshi

    2007-02-15

    Recent transcriptomic studies have revealed the existence of a considerable number of non-protein-coding RNA transcripts in higher eukaryotic cells. To investigate the functional roles of these transcripts, it is of great interest to find conserved secondary structures from multiple alignments on a genomic scale. Since multiple alignments are often created using alignment programs that neglect the special conservation patterns of RNA secondary structures for computational efficiency, alignment failures can cause potential risks of overlooking conserved stem structures. We investigated the dependence of the accuracy of secondary structure prediction on the quality of alignments. We compared three algorithms that maximize the expected accuracy of secondary structures as well as other frequently used algorithms. We found that one of our algorithms, called McCaskill-MEA, was more robust against alignment failures than others. The McCaskill-MEA method first computes the base pairing probability matrices for all the sequences in the alignment and then obtains the base pairing probability matrix of the alignment by averaging over these matrices. The consensus secondary structure is predicted from this matrix such that the expected accuracy of the prediction is maximized. We show that the McCaskill-MEA method performs better than other methods, particularly when the alignment quality is low and when the alignment consists of many sequences. Our model has a parameter that controls the sensitivity and specificity of predictions. We discussed the uses of that parameter for multi-step screening procedures to search for conserved secondary structures and for assigning confidence values to the predicted base pairs. The C++ source code that implements the McCaskill-MEA algorithm and the test dataset used in this paper are available at http://www.ncrna.org/papers/McCaskillMEA/. Supplementary data are available at Bioinformatics online.

  12. Optimal packaging of FIV genomic RNA depends upon a conserved long-range interaction and a palindromic sequence within gag.

    PubMed

    Rizvi, Tahir A; Kenyon, Julia C; Ali, Jahabar; Aktar, Suriya J; Phillip, Pretty S; Ghazawi, Akela; Mustafa, Farah; Lever, Andrew M L

    2010-10-15

    The feline immunodeficiency virus (FIV) is a lentivirus that is related to human immunodeficiency virus (HIV), causing a similar pathology in cats. It is a potential small animal model for AIDS and the FIV-based vectors are also being pursued for human gene therapy. Previous studies have mapped the FIV packaging signal (ψ) to two or more discontinuous regions within the 5' 511 nt of the genomic RNA and structural analyses have determined its secondary structure. The 5' and 3' sequences within ψ region interact through extensive long-range interactions (LRIs), including a conserved heptanucleotide interaction between R/U5 and gag. Other secondary structural elements identified include a conserved 150 nt stem-loop (SL2) and a small palindromic stem-loop within gag open reading frame that might act as a viral dimerization initiation site. We have performed extensive mutational analysis of these sequences and structures and ascertained their importance in FIV packaging using a trans-complementation assay. Disrupting the conserved heptanucleotide LRI to prevent base pairing between R/U5 and gag reduced packaging by 2.8-5.5 fold. Restoration of pairing using an alternative, non-wild type (wt) LRI sequence restored RNA packaging and propagation to wt levels, suggesting that it is the structure of the LRI, rather than its sequence, that is important for FIV packaging. Disrupting the palindrome within gag reduced packaging by 1.5-3-fold, but substitution with a different palindromic sequence did not restore packaging completely, suggesting that the sequence of this region as well as its palindromic nature is important. Mutation of individual regions of SL2 did not have a pronounced effect on FIV packaging, suggesting that either it is the structure of SL2 as a whole that is necessary for optimal packaging, or that there is redundancy within this structure. The mutational analysis presented here has further validated the previously predicted RNA secondary structure of FIV ψ. Copyright © 2010 Elsevier Ltd. All rights reserved.

  13. A Case Study into Microbial Genome Assembly Gap Sequences and Finishing Strategies

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Utturkar, Sagar M.; Klingeman, Dawn M.; Hurt, Jr., Richard A.

    This study characterized regions of DNA which remained unassembled by either PacBio and Illumina sequencing technologies for seven bacterial genomes. Two genomes were manually finished using bioinformatics and PCR/Sanger sequencing approaches and regions not assembled by automated software were analyzed. Gaps present within Illumina assemblies mostly correspond to repetitive DNA regions such as multiple rRNA operon sequences. PacBio gap sequences were evaluated for several properties such as GC content, read coverage, gap length, ability to form strong secondary structures, and corresponding annotations. Our hypothesis that strong secondary DNA structures blocked DNA polymerases and contributed to gap sequences was not accepted.more » PacBio assemblies had few limitations overall and gaps were explained as cumulative effect of lower than average sequence coverage and repetitive sequences at contig termini. An important aspect of the present study is the compilation of biological features that interfered with assembly and included active transposons, multiple plasmid sequences, phage DNA integration, and large sequence duplication. Furthermore, our targeted genome finishing approach and systematic evaluation of the unassembled DNA will be useful for others looking to close, finish, and polish microbial genome sequences.« less

  14. A Case Study into Microbial Genome Assembly Gap Sequences and Finishing Strategies

    DOE PAGES

    Utturkar, Sagar M.; Klingeman, Dawn M.; Hurt, Jr., Richard A.; ...

    2017-07-18

    This study characterized regions of DNA which remained unassembled by either PacBio and Illumina sequencing technologies for seven bacterial genomes. Two genomes were manually finished using bioinformatics and PCR/Sanger sequencing approaches and regions not assembled by automated software were analyzed. Gaps present within Illumina assemblies mostly correspond to repetitive DNA regions such as multiple rRNA operon sequences. PacBio gap sequences were evaluated for several properties such as GC content, read coverage, gap length, ability to form strong secondary structures, and corresponding annotations. Our hypothesis that strong secondary DNA structures blocked DNA polymerases and contributed to gap sequences was not accepted.more » PacBio assemblies had few limitations overall and gaps were explained as cumulative effect of lower than average sequence coverage and repetitive sequences at contig termini. An important aspect of the present study is the compilation of biological features that interfered with assembly and included active transposons, multiple plasmid sequences, phage DNA integration, and large sequence duplication. Furthermore, our targeted genome finishing approach and systematic evaluation of the unassembled DNA will be useful for others looking to close, finish, and polish microbial genome sequences.« less

  15. A Case Study into Microbial Genome Assembly Gap Sequences and Finishing Strategies

    PubMed Central

    Utturkar, Sagar M.; Klingeman, Dawn M.; Hurt, Richard A.; Brown, Steven D.

    2017-01-01

    This study characterized regions of DNA which remained unassembled by either PacBio and Illumina sequencing technologies for seven bacterial genomes. Two genomes were manually finished using bioinformatics and PCR/Sanger sequencing approaches and regions not assembled by automated software were analyzed. Gaps present within Illumina assemblies mostly correspond to repetitive DNA regions such as multiple rRNA operon sequences. PacBio gap sequences were evaluated for several properties such as GC content, read coverage, gap length, ability to form strong secondary structures, and corresponding annotations. Our hypothesis that strong secondary DNA structures blocked DNA polymerases and contributed to gap sequences was not accepted. PacBio assemblies had few limitations overall and gaps were explained as cumulative effect of lower than average sequence coverage and repetitive sequences at contig termini. An important aspect of the present study is the compilation of biological features that interfered with assembly and included active transposons, multiple plasmid sequences, phage DNA integration, and large sequence duplication. Our targeted genome finishing approach and systematic evaluation of the unassembled DNA will be useful for others looking to close, finish, and polish microbial genome sequences. PMID:28769883

  16. Predicting turns in proteins with a unified model.

    PubMed

    Song, Qi; Li, Tonghua; Cong, Peisheng; Sun, Jiangming; Li, Dapeng; Tang, Shengnan

    2012-01-01

    Turns are a critical element of the structure of a protein; turns play a crucial role in loops, folds, and interactions. Current prediction methods are well developed for the prediction of individual turn types, including α-turn, β-turn, and γ-turn, etc. However, for further protein structure and function prediction it is necessary to develop a uniform model that can accurately predict all types of turns simultaneously. In this study, we present a novel approach, TurnP, which offers the ability to investigate all the turns in a protein based on a unified model. The main characteristics of TurnP are: (i) using newly exploited features of structural evolution information (secondary structure and shape string of protein) based on structure homologies, (ii) considering all types of turns in a unified model, and (iii) practical capability of accurate prediction of all turns simultaneously for a query. TurnP utilizes predicted secondary structures and predicted shape strings, both of which have greater accuracy, based on innovative technologies which were both developed by our group. Then, sequence and structural evolution features, which are profile of sequence, profile of secondary structures and profile of shape strings are generated by sequence and structure alignment. When TurnP was validated on a non-redundant dataset (4,107 entries) by five-fold cross-validation, we achieved an accuracy of 88.8% and a sensitivity of 71.8%, which exceeded the most state-of-the-art predictors of certain type of turn. Newly determined sequences, the EVA and CASP9 datasets were used as independent tests and the results we achieved were outstanding for turn predictions and confirmed the good performance of TurnP for practical applications.

  17. Predicting Turns in Proteins with a Unified Model

    PubMed Central

    Song, Qi; Li, Tonghua; Cong, Peisheng; Sun, Jiangming; Li, Dapeng; Tang, Shengnan

    2012-01-01

    Motivation Turns are a critical element of the structure of a protein; turns play a crucial role in loops, folds, and interactions. Current prediction methods are well developed for the prediction of individual turn types, including α-turn, β-turn, and γ-turn, etc. However, for further protein structure and function prediction it is necessary to develop a uniform model that can accurately predict all types of turns simultaneously. Results In this study, we present a novel approach, TurnP, which offers the ability to investigate all the turns in a protein based on a unified model. The main characteristics of TurnP are: (i) using newly exploited features of structural evolution information (secondary structure and shape string of protein) based on structure homologies, (ii) considering all types of turns in a unified model, and (iii) practical capability of accurate prediction of all turns simultaneously for a query. TurnP utilizes predicted secondary structures and predicted shape strings, both of which have greater accuracy, based on innovative technologies which were both developed by our group. Then, sequence and structural evolution features, which are profile of sequence, profile of secondary structures and profile of shape strings are generated by sequence and structure alignment. When TurnP was validated on a non-redundant dataset (4,107 entries) by five-fold cross-validation, we achieved an accuracy of 88.8% and a sensitivity of 71.8%, which exceeded the most state-of-the-art predictors of certain type of turn. Newly determined sequences, the EVA and CASP9 datasets were used as independent tests and the results we achieved were outstanding for turn predictions and confirmed the good performance of TurnP for practical applications. PMID:23144872

  18. Fluorescence energy transfer as a probe for nucleic acid structures and sequences.

    PubMed Central

    Mergny, J L; Boutorine, A S; Garestier, T; Belloc, F; Rougée, M; Bulychev, N V; Koshkin, A A; Bourson, J; Lebedev, A V; Valeur, B

    1994-01-01

    The primary or secondary structure of single-stranded nucleic acids has been investigated with fluorescent oligonucleotides, i.e., oligonucleotides covalently linked to a fluorescent dye. Five different chromophores were used: 2-methoxy-6-chloro-9-amino-acridine, coumarin 500, fluorescein, rhodamine and ethidium. The chemical synthesis of derivatized oligonucleotides is described. Hybridization of two fluorescent oligonucleotides to adjacent nucleic acid sequences led to fluorescence excitation energy transfer between the donor and the acceptor dyes. This phenomenon was used to probe primary and secondary structures of DNA fragments and the orientation of oligodeoxynucleotides synthesized with the alpha-anomers of nucleoside units. Fluorescence energy transfer can be used to reveal the formation of hairpin structures and the translocation of genes between two chromosomes. PMID:8152922

  19. Multicore and GPU algorithms for Nussinov RNA folding

    PubMed Central

    2014-01-01

    Background One segment of a RNA sequence might be paired with another segment of the same RNA sequence due to the force of hydrogen bonds. This two-dimensional structure is called the RNA sequence's secondary structure. Several algorithms have been proposed to predict an RNA sequence's secondary structure. These algorithms are referred to as RNA folding algorithms. Results We develop cache efficient, multicore, and GPU algorithms for RNA folding using Nussinov's algorithm. Conclusions Our cache efficient algorithm provides a speedup between 1.6 and 3.0 relative to a naive straightforward single core code. The multicore version of the cache efficient single core algorithm provides a speedup, relative to the naive single core algorithm, between 7.5 and 14.0 on a 6 core hyperthreaded CPU. Our GPU algorithm for the NVIDIA C2050 is up to 1582 times as fast as the naive single core algorithm and between 5.1 and 11.2 times as fast as the fastest previously known GPU algorithm for Nussinov RNA folding. PMID:25082539

  20. Phylogenetic analysis of several Thermus strains from Rehai of Tengchong, Yunnan, China.

    PubMed

    Lin, Lianbing; Zhang, Jie; Wei, Yunlin; Chen, Chaoyin; Peng, Qian

    2005-10-01

    Several Thermus strains were isolated from 10 hot springs of the Rehai geothermal area in Tengchong, Yunnan province. The diversity of Thermus strains was examined by sequencing the 16S rRNA genes and comparing their sequences. Phylogenetic analysis showed that the 16S rDNA sequences from the Rehai geothermal isolates form four branches in the phylogenetic tree and had greater than 95.9% similarity in the phylogroup. Secondary structure comparison also indicated that the 16S rRNA from the Rehai geothermal isolates have unique secondary structure characteristics in helix 6, helix 9, and helix 10 (reference to Escherichia coli). This research is the first attempt to reveal the diversity of Thermus strains that are distributed in the Rehai geothermal area.

  1. Principles of protein folding--a perspective from simple exact models.

    PubMed Central

    Dill, K. A.; Bromberg, S.; Yue, K.; Fiebig, K. M.; Yee, D. P.; Thomas, P. D.; Chan, H. S.

    1995-01-01

    General principles of protein structure, stability, and folding kinetics have recently been explored in computer simulations of simple exact lattice models. These models represent protein chains at a rudimentary level, but they involve few parameters, approximations, or implicit biases, and they allow complete explorations of conformational and sequence spaces. Such simulations have resulted in testable predictions that are sometimes unanticipated: The folding code is mainly binary and delocalized throughout the amino acid sequence. The secondary and tertiary structures of a protein are specified mainly by the sequence of polar and nonpolar monomers. More specific interactions may refine the structure, rather than dominate the folding code. Simple exact models can account for the properties that characterize protein folding: two-state cooperativity, secondary and tertiary structures, and multistage folding kinetics--fast hydrophobic collapse followed by slower annealing. These studies suggest the possibility of creating "foldable" chain molecules other than proteins. The encoding of a unique compact chain conformation may not require amino acids; it may require only the ability to synthesize specific monomer sequences in which at least one monomer type is solvent-averse. PMID:7613459

  2. Web-Beagle: a web server for the alignment of RNA secondary structures.

    PubMed

    Mattei, Eugenio; Pietrosanto, Marco; Ferrè, Fabrizio; Helmer-Citterich, Manuela

    2015-07-01

    Web-Beagle (http://beagle.bio.uniroma2.it) is a web server for the pairwise global or local alignment of RNA secondary structures. The server exploits a new encoding for RNA secondary structure and a substitution matrix of RNA structural elements to perform RNA structural alignments. The web server allows the user to compute up to 10 000 alignments in a single run, taking as input sets of RNA sequences and structures or primary sequences alone. In the latter case, the server computes the secondary structure prediction for the RNAs on-the-fly using RNAfold (free energy minimization). The user can also compare a set of input RNAs to one of five pre-compiled RNA datasets including lncRNAs and 3' UTRs. All types of comparison produce in output the pairwise alignments along with structural similarity and statistical significance measures for each resulting alignment. A graphical color-coded representation of the alignments allows the user to easily identify structural similarities between RNAs. Web-Beagle can be used for finding structurally related regions in two or more RNAs, for the identification of homologous regions or for functional annotation. Benchmark tests show that Web-Beagle has lower computational complexity, running time and better performances than other available methods. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  3. Sequence to Structure (S2S): display, manipulate and interconnect RNA data from sequence to structure.

    PubMed

    Jossinet, Fabrice; Westhof, Eric

    2005-08-01

    Efficient RNA sequence manipulations (such as multiple alignments) need to be constrained by rules of RNA structure folding. The structural knowledge has increased dramatically in the last years with the accumulation of several large RNA structures similar to those of the bacterial ribosome subunits. However, no tool in the RNA community provides an easy way to link and integrate progress made at the sequence level using the available three-dimensional information. Sequence to Structure (S2S) proposes a framework in which an user can easily display, manipulate and interconnect heterogeneous RNA data, such as multiple sequence alignments, secondary and tertiary structures. S2S has been implemented using the Java language and has been developed and tested under UNIX systems, such as Linux and MacOSX. S2S is available at http://bioinformatics.org/S2S/.

  4. The carbohydrate-binding module (CBM)-like sequence is crucial for rice CWA1/BC1 function in proper assembly of secondary cell wall materials.

    PubMed

    Sato, Kanna; Ito, Sachiko; Fujii, Takeo; Suzuki, Ryu; Takenouchi, Sachi; Nakaba, Satoshi; Funada, Ryo; Sano, Yuzou; Kajita, Shinya; Kitano, Hidemi; Katayama, Yoshihiro

    2010-11-01

    We recently reported that the cwa1 mutation disturbed the deposition and assembly of secondary cell wall materials in the cortical fiber of rice internodes. Genetic analysis revealed that cwa1 is allelic to bc1, which encodes glycosylphosphatidylinositol (GPI)-anchored COBRA-like protein with the highest homology to Arabidopsis COBRA-like 4 (COBL4) and maize Brittle Stalk 2 (Bk2). Our results suggested that CWA1/BC1 plays a role in assembling secondary cell wall materials at appropriate sites, enabling synthesis of highly ordered secondary cell wall structure with solid and flexible internodes in rice. The N-terminal amino acid sequence of CWA1/BC1, as well as its orthologs (COBL4, Bk2) and other BC1-like proteins in rice, shows weak similarity to a family II carbohydrate-binding module (CBM2) of several bacterial cellulases. To investigate the importance of the CBM-like sequence of CWA1/BC1 in the assembly of secondary cell wall materials, Trp residues in the CBM-like sequence, which is important for carbohydrate binding, were substituted for Val residues and introduced into the cwa1 mutant. CWA1/BC1 with the mutated sequence did not complement the abnormal secondary cell walls seen in the cwa1 mutant, indicating that the CBM-like sequence is essential for the proper function of CWA1/BC1, including assembly of secondary cell wall materials.

  5. A parallel strategy for predicting the secondary structure of polycistronic microRNAs.

    PubMed

    Han, Dianwei; Tang, Guiliang; Zhang, Jun

    2013-01-01

    The biogenesis of a functional microRNA is largely dependent on the secondary structure of the microRNA precursor (pre-miRNA). Recently, it has been shown that microRNAs are present in the genome as the form of polycistronic transcriptional units in plants and animals. It will be important to design efficient computational methods to predict such structures for microRNA discovery and its applications in gene silencing. In this paper, we propose a parallel algorithm based on the master-slave architecture to predict the secondary structure from an input sequence. We conducted some experiments to verify the effectiveness of our parallel algorithm. The experimental results show that our algorithm is able to produce the optimal secondary structure of polycistronic microRNAs.

  6. Sequence of the chloroplast 16S rRNA gene and its surrounding regions of Chlamydomonas reinhardii.

    PubMed Central

    Dron, M; Rahire, M; Rochaix, J D

    1982-01-01

    The sequence of a 2 kb DNA fragment containing the chloroplast 16S ribosomal RNA gene from Chlamydomonas reinhardii and its flanking regions has been determined. The algal 16S rRNA sequence (1475 nucleotides) and secondary structure are highly related to those found in bacteria and in the chloroplasts of higher plants. In contrast, the flanking regions are very different. In C. reinhardii the 16S rRNA gene is surrounded by AT rich segments of about 180 bases, which are followed by a long stretch of complementary bases separated from each other by 1833 nucleotides. It is likely that these structures play an important role in the folding and processing of the precursor of 16S rRNA. The primary and secondary structures of the binding sites of two ribosomal proteins in the 16SrRNAs of E. coli and C. reinhardii are considerably related. Images PMID:6296784

  7. Systematically frameshifting by deletion of every 4th or 4th and 5th nucleotides during mitochondrial transcription: RNA self-hybridization regulates delRNA expression.

    PubMed

    Seligmann, Hervé

    2016-01-01

    In mitochondria, secondary structures punctuate post-transcriptional RNA processing. Recently described transcripts match the human mitogenome after systematic deletions of every 4th, respectively every 4th and 5th nucleotides, called delRNAs. Here I explore predicted stem-loop hairpin formation by delRNAs, and their associations with delRNA transcription and detected peptides matching their translation. Despite missing 25, respectively 40% of the nucleotides in the original sequence, del-transformed sequences form significantly more secondary structures than corresponding randomly shuffled sequences, indicating biological function, independently of, and in combination with, previously detected delRNA and thereof translated peptides. Self-hybridization decreases delRNA abundances, indicating downregulation. Systematic deletions of the human mitogenome reveal new, unsuspected coding and structural informations. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  8. The compositional transition of vertebrate genomes: an analysis of the secondary structure of the proteins encoded by human genes.

    PubMed

    D'Onofrio, Giuseppe; Ghosh, Tapash Chandra

    2005-01-17

    Fluctuations and increments of both C(3) and G(3) levels along the human coding sequences were investigated comparing two sets of Xenopus/human orthologous genes. The first set of genes shows minor differences of the GC(3) levels, the second shows considerable increments of the GC(3) levels in the human genes. In both data sets, the fluctuations of C(3) and G(3) levels along the coding sequences correlated with the secondary structures of the encoded proteins. The human genes that underwent the compositional transition showed a different increment of the C(3) and G(3) levels within and among the structural units of the proteins. The relative synonymous codon usage (RSCU) of several amino acids were also affected during the compositional transition, showing that there exists a correlation between RSCU and protein secondary structures in human genes. The importance of natural selection for the formation of isochore organization of the human genome has been discussed on the basis of these results.

  9. Staufen1 senses overall transcript secondary structure to regulate translation

    PubMed Central

    Ricci, Emiliano P; Kucukural, Alper; Cenik, Can; Mercier, Blandine C; Singh, Guramrit; Heyer, Erin E; Ashar-Patel, Ami; Peng, Lingtao; Moore, Melissa J

    2015-01-01

    Human Staufen1 (Stau1) is a double-stranded RNA (dsRNA)-binding protein implicated in multiple post-transcriptional gene-regulatory processes. Here we combined RNA immunoprecipitation in tandem (RIPiT) with RNase footprinting, formaldehyde cross-linking, sonication-mediated RNA fragmentation and deep sequencing to map Staufen1-binding sites transcriptome wide. We find that Stau1 binds complex secondary structures containing multiple short helices, many of which are formed by inverted Alu elements in annotated 3′ untranslated regions (UTRs) or in ‘strongly distal’ 3′ UTRs. Stau1 also interacts with actively translating ribosomes and with mRNA coding sequences (CDSs) and 3′ UTRs in proportion to their GC content and propensity to form internal secondary structure. On mRNAs with high CDS GC content, higher Stau1 levels lead to greater ribosome densities, thus suggesting a general role for Stau1 in modulating translation elongation through structured CDS regions. Our results also indicate that Stau1 regulates translation of transcription-regulatory proteins. PMID:24336223

  10. Approximate matching of structured motifs in DNA sequences.

    PubMed

    El-Mabrouk, Nadia; Raffinot, Mathieu; Duchesne, Jean-Eudes; Lajoie, Mathieu; Luc, Nicolas

    2005-04-01

    Several methods have been developed for identifying more or less complex RNA structures in a genome. All these methods are based on the search for conserved primary and secondary sub-structures. In this paper, we present a simple formal representation of a helix, which is a combination of sequence and folding constraints, as a constrained regular expression. This representation allows us to develop a well-founded algorithm that searches for all approximate matches of a helix in a genome. The algorithm is based on an alignment graph constructed from several copies of a pushdown automaton, arranged one on top of another. This is a first attempt to take advantage of the possibilities of pushdown automata in the context of approximate matching. The worst time complexity is O(krpn), where k is the error threshold, n the size of the genome, p the size of the secondary expression, and r its number of union symbols. We then extend the algorithm to search for pseudo-knots and secondary structures containing an arbitrary number of helices.

  11. Protein secondary structure prediction using modular reciprocal bidirectional recurrent neural networks.

    PubMed

    Babaei, Sepideh; Geranmayeh, Amir; Seyyedsalehi, Seyyed Ali

    2010-12-01

    The supervised learning of recurrent neural networks well-suited for prediction of protein secondary structures from the underlying amino acids sequence is studied. Modular reciprocal recurrent neural networks (MRR-NN) are proposed to model the strong correlations between adjacent secondary structure elements. Besides, a multilayer bidirectional recurrent neural network (MBR-NN) is introduced to capture the long-range intramolecular interactions between amino acids in formation of the secondary structure. The final modular prediction system is devised based on the interactive integration of the MRR-NN and the MBR-NN structures to arbitrarily engage the neighboring effects of the secondary structure types concurrent with memorizing the sequential dependencies of amino acids along the protein chain. The advanced combined network augments the percentage accuracy (Q₃) to 79.36% and boosts the segment overlap (SOV) up to 70.09% when tested on the PSIPRED dataset in three-fold cross-validation. Copyright © 2010 Elsevier Ireland Ltd. All rights reserved.

  12. Alt a 1 allergen homologs from Alternaria and related taxa: analysis of phylogenetic content and secondary structure.

    PubMed

    Hong, Soon Gyu; Cramer, Robert A; Lawrence, Christopher B; Pryor, Barry M

    2005-02-01

    A gene for the Alternaria major allergen, Alt a 1, was amplified from 52 species of Alternaria and related genera, and sequence information was used for phylogenetic study. Alt a 1 gene sequences evolved 3.8 times faster and contained 3.5 times more parsimony-informative sites than glyceraldehyde-3-phosphate dehydrogenase (gpd) sequences. Analyses of Alt a 1 gene and gpd exon sequences strongly supported grouping of Alternaria spp. and related taxa into several species-groups described in previous studies, especially the infectoria, alternata, porri, brassicicola, and radicina species-groups and the Embellisia group. The sonchi species-group was newly suggested in this study. Monophyly of the Nimbya group was moderately supported, and monophyly of the Ulocladium group was weakly supported. Relationships among species-groups and among closely related species of the same species-group were not fully resolved. However, higher resolution could be obtained using Alt a 1 sequences or a combined dataset than using gpd sequences alone. Despite high levels of variation in amino acid sequences, results of in silico prediction of protein secondary structure for Alt a 1 demonstrated a high degree of structural similarity for most of the species suggesting a conservation of function.

  13. Dissecting the relationship between protein structure and sequence variation

    NASA Astrophysics Data System (ADS)

    Shahmoradi, Amir; Wilke, Claus; Wilke Lab Team

    2015-03-01

    Over the past decade several independent works have shown that some structural properties of proteins are capable of predicting protein evolution. The strength and significance of these structure-sequence relations, however, appear to vary widely among different proteins, with absolute correlation strengths ranging from 0 . 1 to 0 . 8 . Here we present the results from a comprehensive search for the potential biophysical and structural determinants of protein evolution by studying more than 200 structural and evolutionary properties in a dataset of 209 monomeric enzymes. We discuss the main protein characteristics responsible for the general patterns of protein evolution, and identify sequence divergence as the main determinant of the strengths of virtually all structure-evolution relationships, explaining ~ 10 - 30 % of observed variation in sequence-structure relations. In addition to sequence divergence, we identify several protein structural properties that are moderately but significantly coupled with the strength of sequence-structure relations. In particular, proteins with more homogeneous back-bone hydrogen bond energies, large fractions of helical secondary structures and low fraction of beta sheets tend to have the strongest sequence-structure relation. BEACON-NSF center for the study of evolution in action.

  14. K-Partite RNA Secondary Structures

    NASA Astrophysics Data System (ADS)

    Jiang, Minghui; Tejada, Pedro J.; Lasisi, Ramoni O.; Cheng, Shanhong; Fechser, D. Scott

    RNA secondary structure prediction is a fundamental problem in structural bioinformatics. The prediction problem is difficult because RNA secondary structures may contain pseudoknots formed by crossing base pairs. We introduce k-partite secondary structures as a simple classification of RNA secondary structures with pseudoknots. An RNA secondary structure is k-partite if it is the union of k pseudoknot-free sub-structures. Most known RNA secondary structures are either bipartite or tripartite. We show that there exists a constant number k such that any secondary structure can be modified into a k-partite secondary structure with approximately the same free energy. This offers a partial explanation of the prevalence of k-partite secondary structures with small k. We give a complete characterization of the computational complexities of recognizing k-partite secondary structures for all k ≥ 2, and show that this recognition problem is essentially the same as the k-colorability problem on circle graphs. We present two simple heuristics, iterated peeling and first-fit packing, for finding k-partite RNA secondary structures. For maximizing the number of base pair stackings, our iterated peeling heuristic achieves a constant approximation ratio of at most k for 2 ≤ k ≤ 5, and at most frac6{1-(1-6/k)^k} le frac6{1-e^{-6}} < 6.01491 for k ≥ 6. Experiment on sequences from PseudoBase shows that our first-fit packing heuristic outperforms the leading method HotKnots in predicting RNA secondary structures with pseudoknots. Source code, data set, and experimental results are available at http://www.cs.usu.edu/ mjiang/rna/kpartite/.

  15. DNA secondary structures: stability and function of G-quadruplex structures

    PubMed Central

    Bochman, Matthew L.; Paeschke, Katrin; Zakian, Virginia A.

    2013-01-01

    In addition to the canonical double helix, DNA can fold into various other inter- and intramolecular secondary structures. Although many such structures were long thought to be in vitro artefacts, bioinformatics demonstrates that DNA sequences capable of forming these structures are conserved throughout evolution, suggesting the existence of non-B-form DNA in vivo. In addition, genes whose products promote formation or resolution of these structures are found in diverse organisms, and a growing body of work suggests that the resolution of DNA secondary structures is critical for genome integrity. This Review focuses on emerging evidence relating to the characteristics of G-quadruplex structures and the possible influence of such structures on genomic stability and cellular processes, such as transcription. PMID:23032257

  16. Conservative secondary structure motifs already present in early-stage folding (in silico) as found in serpines family.

    PubMed

    Brylinski, Michal; Konieczny, Leszek; Kononowicz, Andrzej; Roterman, Irena

    2008-03-21

    The well-known procedure implemented in ClustalW oriented on the sequence comparison was applied to structure comparison. The consensus sequence as well as consensus structure has been defined for proteins belonging to serpine family. The structure of early stage intermediate was the object for similarity search. The high values of W(sequence) appeared to be accordant with high values of W(structure) making possible structure comparison using common criteria for sequence and structure comparison. Since the early stage structural form has been created according to limited conformational sub-space which does not include the beta-structure (this structure is mediated by C7eq structural form), is particularly important to see, that the C7eq structural form may be treated as the seed for beta-structure present in the final native structure of protein. The applicability of ClustalW procedure to structure comparison makes these two comparisons unified.

  17. Genetic diversity based on 28S rDNA sequences among populations of Culex quinquefasciatus collected at different locations in Tamil Nadu, India.

    PubMed

    Sakthivelkumar, S; Ramaraj, P; Veeramani, V; Janarthanan, S

    2015-09-01

    The basis of the present study was to distinguish the existence of any genetic variability among populations of Culex quinquefasciatus which would be a valuable tool in the management of mosquito control programmes. In the present study, population of Cx. quinquefasciatus collected at different locations in Tamil Nadu were analyzed for their genetic variation based on 28S rDNA D2 region nucleotide sequences. A high degree of genetic polymorphism was detected in the sequences of D2 region of 28S rDNA on the predicted secondary structures in spite of high nucleotide sequence similarity. The findings based on secondary structure using rDNA sequences suggested the existence of a complex genotypic diversity of Cx. quinquefasciatus population collected at different locations of Tamil Nadu, India. This complexity in genetic diversity in a single mosquito population collected at different locations is considered an important issue towards their influence and nature of vector potential of these mosquitoes.

  18. NNvPDB: Neural Network based Protein Secondary Structure Prediction with PDB Validation.

    PubMed

    Sakthivel, Seethalakshmi; S K M, Habeeb

    2015-01-01

    The predicted secondary structural states are not cross validated by any of the existing servers. Hence, information on the level of accuracy for every sequence is not reported by the existing servers. This was overcome by NNvPDB, which not only reported greater Q3 but also validates every prediction with the homologous PDB entries. NNvPDB is based on the concept of Neural Network, with a new and different approach of training the network every time with five PDB structures that are similar to query sequence. The average accuracy for helix is 76%, beta sheet is 71% and overall (helix, sheet and coil) is 66%. http://bit.srmuniv.ac.in/cgi-bin/bit/cfpdb/nnsecstruct.pl.

  19. Pairwise amino acid secondary structural propensities

    NASA Astrophysics Data System (ADS)

    Chemmama, Ilan E.; Chapagain, Prem P.; Gerstman, Bernard S.

    2015-04-01

    We investigate the propensities for amino acids to form a specific secondary structure when they are paired with other amino acids. Our investigations use molecular dynamics (MD) computer simulations, and we compare the results to those from the Protein Data Bank (PDB). Proper comparison requires weighting of the MD results in a manner consistent with the relative frequency of appearance in the PDB of each possible pair of amino acids. We find that the propensity for an amino acid to assume a secondary structure varies dramatically depending on the amino acid that is before or after it in the primary sequence. This cooperative effect means that when selecting amino acids to facilitate the formation of a secondary structure in peptide engineering experiments, the adjacent amino acids must be considered. We also examine the preference for a secondary structure in bacterial proteins and compare the results to those of human proteins.

  20. CSI 3.0: a web server for identifying secondary and super-secondary structure in proteins using NMR chemical shifts

    PubMed Central

    Hafsa, Noor E.; Arndt, David; Wishart, David S.

    2015-01-01

    The Chemical Shift Index or CSI 3.0 (http://csi3.wishartlab.com) is a web server designed to accurately identify the location of secondary and super-secondary structures in protein chains using only nuclear magnetic resonance (NMR) backbone chemical shifts and their corresponding protein sequence data. Unlike earlier versions of CSI, which only identified three types of secondary structure (helix, β-strand and coil), CSI 3.0 now identifies total of 11 types of secondary and super-secondary structures, including helices, β-strands, coil regions, five common β-turns (type I, II, I′, II′ and VIII), β hairpins as well as interior and edge β-strands. CSI 3.0 accepts experimental NMR chemical shift data in multiple formats (NMR Star 2.1, NMR Star 3.1 and SHIFTY) and generates colorful CSI plots (bar graphs) and secondary/super-secondary structure assignments. The output can be readily used as constraints for structure determination and refinement or the images may be used for presentations and publications. CSI 3.0 uses a pipeline of several well-tested, previously published programs to identify the secondary and super-secondary structures in protein chains. Comparisons with secondary and super-secondary structure assignments made via standard coordinate analysis programs such as DSSP, STRIDE and VADAR on high-resolution protein structures solved by X-ray and NMR show >90% agreement between those made with CSI 3.0. PMID:25979265

  1. A palindrome-mediated mechanism distinguishes translocations involving LCR-B of chromosome 22q11.2.

    PubMed

    Gotter, Anthony L; Shaikh, Tamim H; Budarf, Marcia L; Rhodes, C Harker; Emanuel, Beverly S

    2004-01-01

    Two known recurrent constitutional translocations, t(11;22) and t(17;22), as well as a non-recurrent t(4;22), display derivative chromosomes that have joined to a common site within the low copy repeat B (LCR-B) region of 22q11.2. This breakpoint is located between two AT-rich inverted repeats that form a nearly perfect palindrome. Breakpoints within the 11q23, 17q11 and 4q35 partner chromosomes also fall near the center of palindromic sequences. In the present work the breakpoints of a fourth translocation involving LCR-B, a balanced ependymoma-associated t(1;22), were characterized not only to localize this junction relative to known genes, but also to further understand the mechanism underlying these rearrangements. FISH mapping was used to localize the 22q11.2 breakpoint to LCR-B and the 1p21 breakpoint to single BAC clones. STS mapping narrowed the 1p21.2 breakpoint to a 1990 bp AT-rich region, and junction fragments were amplified by nested PCR. Junction fragment-derived sequence indicates that the 1p21.2 breakpoint splits a 278 nt palindrome capable of forming stem-loop secondary structure. In contrast, the 1p21.2 reference genomic sequence from clones in the database does not exhibit this configuration, suggesting a predisposition for regional genomic instability perhaps etiologic for this rearrangement. Given its similarity to known chromosomal fragile site (FRA) sequences, this polymorphic 1p21.2 sequence may represent one of the FRA1 loci. Comparative analysis of the secondary structure of sequences surrounding translocation breakpoints that involve LCR-B with those not involving this region indicate a unique ability of the former to form stem-loop structures. The relative likelihood of forming these configurations appears to be related to the rate of translocation occurrence. Further analysis suggests that constitutional translocations in general occur between sequences of similar melting temperature and propensity for secondary structure.

  2. A palindrome-mediated mechanism distinguishes translocations involving LCR-B of chromosome 22q11.2

    PubMed Central

    Gotter, Anthony L.; Shaikh, Tamim H.; Budarf, Marcia L.; Rhodes, C. Harker; Emanuel, Beverly S.

    2010-01-01

    Two known recurrent constitutional translocations, t(11;22) and t(17;22), as well as a non-recurrent t(4;22), display derivative chromosomes that have joined to a common site within the low copy repeat B (LCR-B) region of 22q11.2. This breakpoint is located between two AT-rich inverted repeats that form a nearly perfect palindrome. Breakpoints within the 11q23, 17q11 and 4q35 partner chromosomes also fall near the center of palindromic sequences. In the present work the breakpoints of a fourth translocation involving LCR-B, a balanced ependymoma-associated t(1;22), were characterized not only to localize this junction relative to known genes, but also to further understand the mechanism underlying these rearrangements. FISH mapping was used to localize the 22q11.2 breakpoint to LCR-B and the 1p21 breakpoint to single BAC clones. STS mapping narrowed the 1p21.2 breakpoint to a 1990 bp AT-rich region, and junction fragments were amplified by nested PCR. Junction fragment-derived sequence indicates that the 1p21.2 breakpoint splits a 278 nt palindrome capable of forming stem–loop secondary structure. In contrast, the 1p21.2 reference genomic sequence from clones in the database does not exhibit this configuration, suggesting a predisposition for regional genomic instability perhaps etiologic for this rearrangement. Given its similarity to known chromosomal fragile site (FRA) sequences, this polymorphic 1p21.2 sequence may represent one of the FRA1 loci. Comparative analysis of the secondary structure of sequences surrounding translocation breakpoints that involve LCR-B with those not involving this region indicate a unique ability of the former to form stem–loop structures. The relative likelihood of forming these configurations appears to be related to the rate of translocation occurrence. Further analysis suggests that constitutional translocations in general occur between sequences of similar melting temperature and propensity for secondary structure. PMID:14613967

  3. Correlation of RNA secondary structure statistics with thermodynamic stability and applications to folding.

    PubMed

    Wu, Johnny C; Gardner, David P; Ozer, Stuart; Gutell, Robin R; Ren, Pengyu

    2009-08-28

    The accurate prediction of the secondary and tertiary structure of an RNA with different folding algorithms is dependent on several factors, including the energy functions. However, an RNA higher-order structure cannot be predicted accurately from its sequence based on a limited set of energy parameters. The inter- and intramolecular forces between this RNA and other small molecules and macromolecules, in addition to other factors in the cell such as pH, ionic strength, and temperature, influence the complex dynamics associated with transition of a single stranded RNA to its secondary and tertiary structure. Since all of the factors that affect the formation of an RNAs 3D structure cannot be determined experimentally, statistically derived potential energy has been used in the prediction of protein structure. In the current work, we evaluate the statistical free energy of various secondary structure motifs, including base-pair stacks, hairpin loops, and internal loops, using their statistical frequency obtained from the comparative analysis of more than 50,000 RNA sequences stored in the RNA Comparative Analysis Database (rCAD) at the Comparative RNA Web (CRW) Site. Statistical energy was computed from the structural statistics for several datasets. While the statistical energy for a base-pair stack correlates with experimentally derived free energy values, suggesting a Boltzmann-like distribution, variation is observed between different molecules and their location on the phylogenetic tree of life. Our statistical energy values calculated for several structural elements were utilized in the Mfold RNA-folding algorithm. The combined statistical energy values for base-pair stacks, hairpins and internal loop flanks result in a significant improvement in the accuracy of secondary structure prediction; the hairpin flanks contribute the most.

  4. Computing the Partition Function for Kinetically Trapped RNA Secondary Structures

    PubMed Central

    Lorenz, William A.; Clote, Peter

    2011-01-01

    An RNA secondary structure is locally optimal if there is no lower energy structure that can be obtained by the addition or removal of a single base pair, where energy is defined according to the widely accepted Turner nearest neighbor model. Locally optimal structures form kinetic traps, since any evolution away from a locally optimal structure must involve energetically unfavorable folding steps. Here, we present a novel, efficient algorithm to compute the partition function over all locally optimal secondary structures of a given RNA sequence. Our software, RNAlocopt runs in time and space. Additionally, RNAlocopt samples a user-specified number of structures from the Boltzmann subensemble of all locally optimal structures. We apply RNAlocopt to show that (1) the number of locally optimal structures is far fewer than the total number of structures – indeed, the number of locally optimal structures approximately equal to the square root of the number of all structures, (2) the structural diversity of this subensemble may be either similar to or quite different from the structural diversity of the entire Boltzmann ensemble, a situation that depends on the type of input RNA, (3) the (modified) maximum expected accuracy structure, computed by taking into account base pairing frequencies of locally optimal structures, is a more accurate prediction of the native structure than other current thermodynamics-based methods. The software RNAlocopt constitutes a technical breakthrough in our study of the folding landscape for RNA secondary structures. For the first time, locally optimal structures (kinetic traps in the Turner energy model) can be rapidly generated for long RNA sequences, previously impossible with methods that involved exhaustive enumeration. Use of locally optimal structure leads to state-of-the-art secondary structure prediction, as benchmarked against methods involving the computation of minimum free energy and of maximum expected accuracy. Web server and source code available at http://bioinformatics.bc.edu/clotelab/RNAlocopt/. PMID:21297972

  5. CHANGES IN EARTHWORM DENSITY AND COMMUNITY STRUCTURE DURING SECONDARY SUCCESSION IN ABANDONED TROPICAL PASTURES

    Treesearch

    Xiaoming Zou; Grizelle Gonzalez

    1997-01-01

    Plant community succession alters the quantity and chemistry of organic inputs to soils. These differences in organic input may trigger changes in soil fertility and fauna1 activity. We examined earthworm density and community structure along a successional sequence of plant communities in abandoned tropical pastures in Puerto Rico. The chronological sequence of these...

  6. Fine-tuning structural RNA alignments in the twilight zone.

    PubMed

    Bremges, Andreas; Schirmer, Stefanie; Giegerich, Robert

    2010-04-30

    A widely used method to find conserved secondary structure in RNA is to first construct a multiple sequence alignment, and then fold the alignment, optimizing a score based on thermodynamics and covariance. This method works best around 75% sequence similarity. However, in a "twilight zone" below 55% similarity, the sequence alignment tends to obscure the covariance signal used in the second phase. Therefore, while the overall shape of the consensus structure may still be found, the degree of conservation cannot be estimated reliably. Based on a combination of available methods, we present a method named planACstar for improving structure conservation in structural alignments in the twilight zone. After constructing a consensus structure by alignment folding, planACstar abandons the original sequence alignment, refolds the sequences individually, but consistent with the consensus, aligns the structures, irrespective of sequence, by a pure structure alignment method, and derives an improved sequence alignment from the alignment of structures, to be re-submitted to alignment folding, etc.. This circle may be iterated as long as structural conservation improves, but normally, one step suffices. Employing the tools ClustalW, RNAalifold, and RNAforester, we find that for sequences with 30-55% sequence identity, structural conservation can be improved by 10% on average, with a large variation, measured in terms of RNAalifold's own criterion, the structure conservation index.

  7. Prediction of pi-turns in proteins using PSI-BLAST profiles and secondary structure information.

    PubMed

    Wang, Yan; Xue, Zhi-Dong; Shi, Xiao-Hong; Xu, Jin

    2006-09-01

    Due to the structural and functional importance of tight turns, some methods have been proposed to predict gamma-turns, beta-turns, and alpha-turns in proteins. In the past, studies of pi-turns were made, but not a single prediction approach has been developed so far. It will be useful to develop a method for identifying pi-turns in a protein sequence. In this paper, the support vector machine (SVM) method has been introduced to predict pi-turns from the amino acid sequence. The training and testing of this approach is performed with a newly collected data set of 640 non-homologous protein chains containing 1931 pi-turns. Different sequence encoding schemes have been explored in order to investigate their effects on the prediction performance. With multiple sequence alignment and predicted secondary structure, the final SVM model yields a Matthews correlation coefficient (MCC) of 0.556 by a 7-fold cross-validation. A web server implementing the prediction method is available at the following URL: http://210.42.106.80/piturn/.

  8. An in-silico insight into the characteristics of β-propeller phytase.

    PubMed

    Mathew, Akash; Verma, Anukriti; Gaur, Smriti

    2014-06-01

    Phytase is an enzyme that is found extensively in the plant kingdom and in some species of bacteria and fungi. This paper identifies and analyses the available full length sequences of β-propeller phytases (BPP). BPP was chosen due to its potential applicability in the field of aquaculture. The sequences were obtained from the Uniprot database and subject to various online bioinformatics tools to elucidate the physio-chemical characteristics, secondary structures and active site compositions of BPP. Protparam and SOPMA were used to analyse the physiochemical and secondary structure characteristics, while the Expasy online modelling tool and CASTp were used to model the 3-D structure and identify the active sites of the BPP sequences. The amino acid compositions of the four sequences were compared and composed in a graphical format to identify similarities and highlight the potentially important amino acids that form the active site of BPP. This study aims to analyse BPP and contribute to the clarification of the molecular mechanism involved in the enzyme activity of BPP and contribute in part to the possibility of constructing a synthetic version of BPP.

  9. Learning of pitch and time structures in an artificial grammar setting.

    PubMed

    Prince, Jon B; Stevens, Catherine J; Jones, Mari Riess; Tillmann, Barbara

    2018-04-12

    Despite the empirical evidence for the power of the cognitive capacity of implicit learning of structures and regularities in several modalities and materials, it remains controversial whether implicit learning extends to the learning of temporal structures and regularities. We investigated whether (a) an artificial grammar can be learned equally well when expressed in duration sequences as when expressed in pitch sequences, (b) learning of the artificial grammar in either duration or pitch (as the primary dimension) sequences can be influenced by the properties of the secondary dimension (invariant vs. randomized), and (c) learning can be boosted when the artificial grammar is expressed in both pitch and duration. After an exposure phase with grammatical sequences, learning in a subsequent test phase was assessed in a grammaticality judgment task. Participants in both the pitch and duration conditions showed incidental (not fully implicit) learning of the artificial grammar when the secondary dimension was invariant, but randomizing the pitch sequence prevented learning of the artificial grammar in duration sequences. Expressing the artificial grammar in both pitch and duration resulted in disproportionately better performance, suggesting an interaction between the learning of pitch and temporal structure. The findings are relevant to research investigating the learning of temporal structures and the learning of structures presented simultaneously in 2 dimensions (e.g., space and time, space and objects). By investigating learning, the findings provide further insight into the potential specificity of pitch and time processing, and their integrated versus independent processing, as previously debated in music cognition research. (PsycINFO Database Record (c) 2018 APA, all rights reserved).

  10. Intraspecific Variation and Phylogenetic Relationships Are Revealed by ITS1 Secondary Structure Analysis and Single-Nucleotide Polymorphism in Ganoderma lucidum

    PubMed Central

    Pei, Haisheng; Chen, Zhou; Tan, Xiaoyan; Hu, Jing; Yang, Bin; Sun, Junshe

    2017-01-01

    Ganoderma lucidum is a typical polypore fungus used for traditional Chinese medical purposes. The taxonomic delimitation of Ganoderma lucidum is still debated. In this study, we sequenced seven internal transcribed spacer (ITS) sequences of Ganoderma lucidum strains and annotated the ITS1 and ITS2 regions. Phylogenetic analysis of ITS1 differentiated the strains into three geographic groups. Groups 1–3 were originated from Europe, tropical Asia, and eastern Asia, respectively. While ITS2 could only differentiate the strains into two groups in which Group 2 originated from tropical Asia gathered with Groups 1 and 3 originated from Europe and eastern Asia. By determining the secondary structures of the ITS1 sequences, these three groups exhibited similar structures with a conserved central core and differed helices. While compared to Group 2, Groups 1 and 3 of ITS2 sequences shared similar structures with the difference in helix 4. Large-scale evaluation of ITS1 and ITS2 both exhibited that the majority of subgroups in the same group shared the similar structures. Further Weblogo analysis of ITS1 sequences revealed two main variable regions located in helix 2 in which C/T or A/G substitutions frequently occurred and ITS1 exhibited more nucleotide variances compared to ITS2. ITS1 multi-alignment of seven spawn strains and culture tests indicated that a single-nucleotide polymorphism (SNP) site at position 180 correlated with strain antagonism. The HZ, TK and 203 fusion strains of Ganoderma lucidum had a T at position 180, whereas other strains exhibiting antagonism, including DB, RB, JQ, and YS, had a C. Taken together, compared to ITS2 region, ITS1 region could differentiated Ganoderma lucidum into three geographic originations based on phylogenetic analysis and secondary structure prediction. Besides, a SNP in ITS 1 could delineate Ganoderma lucidum strains at the intraspecific level. These findings will be implemented to improve species quality control in the Ganoderma industry. PMID:28056060

  11. Intraspecific Variation and Phylogenetic Relationships Are Revealed by ITS1 Secondary Structure Analysis and Single-Nucleotide Polymorphism in Ganoderma lucidum.

    PubMed

    Zhang, Xiuqing; Xu, Zhangyang; Pei, Haisheng; Chen, Zhou; Tan, Xiaoyan; Hu, Jing; Yang, Bin; Sun, Junshe

    2017-01-01

    Ganoderma lucidum is a typical polypore fungus used for traditional Chinese medical purposes. The taxonomic delimitation of Ganoderma lucidum is still debated. In this study, we sequenced seven internal transcribed spacer (ITS) sequences of Ganoderma lucidum strains and annotated the ITS1 and ITS2 regions. Phylogenetic analysis of ITS1 differentiated the strains into three geographic groups. Groups 1-3 were originated from Europe, tropical Asia, and eastern Asia, respectively. While ITS2 could only differentiate the strains into two groups in which Group 2 originated from tropical Asia gathered with Groups 1 and 3 originated from Europe and eastern Asia. By determining the secondary structures of the ITS1 sequences, these three groups exhibited similar structures with a conserved central core and differed helices. While compared to Group 2, Groups 1 and 3 of ITS2 sequences shared similar structures with the difference in helix 4. Large-scale evaluation of ITS1 and ITS2 both exhibited that the majority of subgroups in the same group shared the similar structures. Further Weblogo analysis of ITS1 sequences revealed two main variable regions located in helix 2 in which C/T or A/G substitutions frequently occurred and ITS1 exhibited more nucleotide variances compared to ITS2. ITS1 multi-alignment of seven spawn strains and culture tests indicated that a single-nucleotide polymorphism (SNP) site at position 180 correlated with strain antagonism. The HZ, TK and 203 fusion strains of Ganoderma lucidum had a T at position 180, whereas other strains exhibiting antagonism, including DB, RB, JQ, and YS, had a C. Taken together, compared to ITS2 region, ITS1 region could differentiated Ganoderma lucidum into three geographic originations based on phylogenetic analysis and secondary structure prediction. Besides, a SNP in ITS 1 could delineate Ganoderma lucidum strains at the intraspecific level. These findings will be implemented to improve species quality control in the Ganoderma industry.

  12. SSMART: Sequence-structure motif identification for RNA-binding proteins.

    PubMed

    Munteanu, Alina; Mukherjee, Neelanjan; Ohler, Uwe

    2018-06-11

    RNA-binding proteins (RBPs) regulate every aspect of RNA metabolism and function. There are hundreds of RBPs encoded in the eukaryotic genomes, and each recognize its RNA targets through a specific mixture of RNA sequence and structure properties. For most RBPs, however, only a primary sequence motif has been determined, while the structure of the binding sites is uncharacterized. We developed SSMART, an RNA motif finder that simultaneously models the primary sequence and the structural properties of the RNA targets sites. The sequence-structure motifs are represented as consensus strings over a degenerate alphabet, extending the IUPAC codes for nucleotides to account for secondary structure preferences. Evaluation on synthetic data showed that SSMART is able to recover both sequence and structure motifs implanted into 3'UTR-like sequences, for various degrees of structured/unstructured binding sites. In addition, we successfully used SSMART on high-throughput in vivo and in vitro data, showing that we not only recover the known sequence motif, but also gain insight into the structural preferences of the RBP. Availability: SSMART is freely available at https://ohlerlab.mdc-berlin.de/software/SSMART_137/. Supplementary data are available at Bioinformatics online.

  13. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Man, Viet Hoang; Pan, Feng; Sagui, Celeste, E-mail: sagui@ncsu.edu

    We explore the use of a fast laser melting simulation approach combined with atomistic molecular dynamics simulations in order to determine the melting and healing responses of B-DNA and Z-DNA dodecamers with the same d(5′-CGCGCGCGCGCG-3′){sub 2} sequence. The frequency of the laser pulse is specifically tuned to disrupt Watson-Crick hydrogen bonds, thus inducing melting of the DNA duplexes. Subsequently, the structures relax and partially refold, depending on the field strength. In addition to the inherent interest of the nonequilibrium melting process, we propose that fast melting by an infrared laser pulse could be used as a technique for a fastmore » comparison of relative stabilities of same-sequence oligonucleotides with different secondary structures with full atomistic detail of the structures and solvent. This could be particularly useful for nonstandard secondary structures involving non-canonical base pairs, mismatches, etc.« less

  14. Evaluation of the authenticity of a highly novel environmental sequence from boreal forest soil using ribosomal RNA secondary structure modeling

    Treesearch

    D.J. Glass; N. Takebayashi; L. Olson; D.L. Taylor

    2013-01-01

    The number of sequences from both formally described taxa and uncultured environmental DNA deposited in the International Nucleotide Sequence Databases has increased substantially over the last two decades. Although the majority of these sequences represent authentic gene copies, there is evidence of DNA artifacts in these databases as well. These include lab artifacts...

  15. A high-throughput approach to profile RNA structure.

    PubMed

    Delli Ponti, Riccardo; Marti, Stefanie; Armaos, Alexandros; Tartaglia, Gian Gaetano

    2017-03-17

    Here we introduce the Computational Recognition of Secondary Structure (CROSS) method to calculate the structural profile of an RNA sequence (single- or double-stranded state) at single-nucleotide resolution and without sequence length restrictions. We trained CROSS using data from high-throughput experiments such as Selective 2΄-Hydroxyl Acylation analyzed by Primer Extension (SHAPE; Mouse and HIV transcriptomes) and Parallel Analysis of RNA Structure (PARS; Human and Yeast transcriptomes) as well as high-quality NMR/X-ray structures (PDB database). The algorithm uses primary structure information alone to predict experimental structural profiles with >80% accuracy, showing high performances on large RNAs such as Xist (17 900 nucleotides; Area Under the ROC Curve AUC of 0.75 on dimethyl sulfate (DMS) experiments). We integrated CROSS in thermodynamics-based methods to predict secondary structure and observed an increase in their predictive power by up to 30%. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  16. Unfolding/Refolding Study on Collagen from Sea Cucumber Based on 2D Fourier Transform Infrared Spectroscopy.

    PubMed

    Qin, Lei; Bi, Jing-Ran; Li, Dong-Mei; Dong, Meng; Zhao, Zi-Yuan; Dong, Xiu-Ping; Zhou, Da-Yong; Zhu, Bei-Wei

    2016-11-16

    We aimed to explore the differences of thermal behaviors between insoluble collagen fibrils (ICFs) and pepsin-solubilized collagens (PSCs) from sea cucumber Stichopus japonicus . The unfolding/refolding sequences of secondary structures of ICFs and PSCs during the heating and cooling cycle (5 → 70 → 5 °C) were identified by Fourier transform infrared spectrometry combined with curve-fitting and 2D correlation techniques. ICFs showed a higher proportion of α-helical structures and higher thermostability than PSCs, and thus had more-stable triple helical structures. The sequences of changes affecting the secondary structures during heating were essentially the same between ICFs and PSCs. In all cases, α-helix structure was the most important conformation and it disappeared to form a β-sheet structure. In the cooling cycle, ICFs showed a partially refolding ability, and the proportion of β-sheet structure rose before the increasing proportion of α-helix structure. PSCs did not obviously refold during the cooling stage.

  17. A Folding Zone in the Ribosomal Exit Tunnel for Kv1.3 Helix Formation

    PubMed Central

    Tu, LiWei; Deutsch, Carol

    2010-01-01

    SUMMARY Although it is now clear that protein secondary structure can be acquired early, while the nascent peptide resides within the ribosomal exit tunnel, the principles governing folding of native polytopic proteins have not yet been elucidated. We now report an extensive investigation of native Kv1.3, a voltage-gated K+ channel, including transmembrane and linker segments synthesized in sequence. These native segments form helices vectorially (N- to C-terminus) only in a permissive vestibule located in the last 20Å of the tunnel. Native linker sequences similarly fold in this vestibule. Finally, secondary structure acquired in the ribosome is retained in the translocon. These findings emerge from accessibility studies of a diversity of native transmembrane and linker sequences and may therefore be applicable to protein biogenesis in general. PMID:20060838

  18. Unique phylogenetic position of Diplomonadida based on the complete small subunit ribosomal RNA sequence of Giardia ardeae, G. muris, G. duodenalis and Hexamita sp.

    PubMed

    van Keulen, H; Gutell, R R; Gates, M A; Campbell, S R; Erlandsen, S L; Jarroll, E L; Kulda, J; Meyer, E A

    1993-01-01

    Complete small-subunit rRNA (SSU-rRNA) coding region sequences were determined for two species of the intestinal parasite Giardia: G. ardeae and G. muris, both belonging to the order Diplomonadida, and a free-living member of this order, Hexamita sp. These sequences were compared to published SSU-rDNA sequences from a third member of the genus Giardia, G. duodenalis (often called G. intestinalis or G. lamblia) and various representative organisms from other taxa. Of the three Giardia sequences analyzed, the SSU-rRNA from G. muris is the smallest (1432 bases as compared to 1435 and 1453 for G. ardeae and G. duodenalis, respectively) and has the lowest G+C content (58.9%). The Hexamita SSU-rRNA is the largest in this group, containing 1550 bases. Because the sizes of the SSU-rRNA are prokaryotic rather than typically eukaryotic, the secondary structures of the SSU-rRNAs were constructed. These structures show a number of typically eukaryotic signature sequences. Sequence alignments based on constraints imposed by secondary structure were used for construction of a phylogenetic tree for these four taxa. The results show that of the four diplomonads represented, the Giardia species form a distinct group. The other diplomonad Hexamita and the microsporidium Vairimorpha necatrix appear to be distinct from Giardia.

  19. A search for H/ACA snoRNAs in yeast using MFE secondary structure prediction.

    PubMed

    Edvardsson, Sverker; Gardner, Paul P; Poole, Anthony M; Hendy, Michael D; Penny, David; Moulton, Vincent

    2003-05-01

    Noncoding RNA genes produce functional RNA molecules rather than coding for proteins. One such family is the H/ACA snoRNAs. Unlike the related C/D snoRNAs these have resisted automated detection to date. We develop an algorithm to screen the yeast genome for novel H/ACA snoRNAs. To achieve this, we introduce some new methods for facilitating the search for noncoding RNAs in genomic sequences which are based on properties of predicted minimum free-energy (MFE) secondary structures. The algorithm has been implemented and can be generalized to enable screening of other eukaryote genomes. We find that use of primary sequence alone is insufficient for identifying novel H/ACA snoRNAs. Only the use of secondary structure filters reduces the number of candidates to a manageable size. From genomic context, we identify three strong H/ACA snoRNA candidates. These together with a further 47 candidates obtained by our analysis are being experimentally screened.

  20. An Evolution-Based Approach to De Novo Protein Design and Case Study on Mycobacterium tuberculosis

    PubMed Central

    Brender, Jeffrey R.; Czajka, Jeff; Marsh, David; Gray, Felicia; Cierpicki, Tomasz; Zhang, Yang

    2013-01-01

    Computational protein design is a reverse procedure of protein folding and structure prediction, where constructing structures from evolutionarily related proteins has been demonstrated to be the most reliable method for protein 3-dimensional structure prediction. Following this spirit, we developed a novel method to design new protein sequences based on evolutionarily related protein families. For a given target structure, a set of proteins having similar fold are identified from the PDB library by structural alignments. A structural profile is then constructed from the protein templates and used to guide the conformational search of amino acid sequence space, where physicochemical packing is accommodated by single-sequence based solvation, torsion angle, and secondary structure predictions. The method was tested on a computational folding experiment based on a large set of 87 protein structures covering different fold classes, which showed that the evolution-based design significantly enhances the foldability and biological functionality of the designed sequences compared to the traditional physics-based force field methods. Without using homologous proteins, the designed sequences can be folded with an average root-mean-square-deviation of 2.1 Å to the target. As a case study, the method is extended to redesign all 243 structurally resolved proteins in the pathogenic bacteria Mycobacterium tuberculosis, which is the second leading cause of death from infectious disease. On a smaller scale, five sequences were randomly selected from the design pool and subjected to experimental validation. The results showed that all the designed proteins are soluble with distinct secondary structure and three have well ordered tertiary structure, as demonstrated by circular dichroism and NMR spectroscopy. Together, these results demonstrate a new avenue in computational protein design that uses knowledge of evolutionary conservation from protein structural families to engineer new protein molecules of improved fold stability and biological functionality. PMID:24204234

  1. Using structure to explore the sequence alignment space of remote homologs.

    PubMed

    Kuziemko, Andrew; Honig, Barry; Petrey, Donald

    2011-10-01

    Protein structure modeling by homology requires an accurate sequence alignment between the query protein and its structural template. However, sequence alignment methods based on dynamic programming (DP) are typically unable to generate accurate alignments for remote sequence homologs, thus limiting the applicability of modeling methods. A central problem is that the alignment that is "optimal" in terms of the DP score does not necessarily correspond to the alignment that produces the most accurate structural model. That is, the correct alignment based on structural superposition will generally have a lower score than the optimal alignment obtained from sequence. Variations of the DP algorithm have been developed that generate alternative alignments that are "suboptimal" in terms of the DP score, but these still encounter difficulties in detecting the correct structural alignment. We present here a new alternative sequence alignment method that relies heavily on the structure of the template. By initially aligning the query sequence to individual fragments in secondary structure elements and combining high-scoring fragments that pass basic tests for "modelability", we can generate accurate alignments within a small ensemble. Our results suggest that the set of sequences that can currently be modeled by homology can be greatly extended.

  2. CSI 3.0: a web server for identifying secondary and super-secondary structure in proteins using NMR chemical shifts.

    PubMed

    Hafsa, Noor E; Arndt, David; Wishart, David S

    2015-07-01

    The Chemical Shift Index or CSI 3.0 (http://csi3.wishartlab.com) is a web server designed to accurately identify the location of secondary and super-secondary structures in protein chains using only nuclear magnetic resonance (NMR) backbone chemical shifts and their corresponding protein sequence data. Unlike earlier versions of CSI, which only identified three types of secondary structure (helix, β-strand and coil), CSI 3.0 now identifies total of 11 types of secondary and super-secondary structures, including helices, β-strands, coil regions, five common β-turns (type I, II, I', II' and VIII), β hairpins as well as interior and edge β-strands. CSI 3.0 accepts experimental NMR chemical shift data in multiple formats (NMR Star 2.1, NMR Star 3.1 and SHIFTY) and generates colorful CSI plots (bar graphs) and secondary/super-secondary structure assignments. The output can be readily used as constraints for structure determination and refinement or the images may be used for presentations and publications. CSI 3.0 uses a pipeline of several well-tested, previously published programs to identify the secondary and super-secondary structures in protein chains. Comparisons with secondary and super-secondary structure assignments made via standard coordinate analysis programs such as DSSP, STRIDE and VADAR on high-resolution protein structures solved by X-ray and NMR show >90% agreement between those made with CSI 3.0. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  3. Protein 8-class secondary structure prediction using conditional neural fields.

    PubMed

    Wang, Zhiyong; Zhao, Feng; Peng, Jian; Xu, Jinbo

    2011-10-01

    Compared with the protein 3-class secondary structure (SS) prediction, the 8-class prediction gains less attention and is also much more challenging, especially for proteins with few sequence homologs. This paper presents a new probabilistic method for 8-class SS prediction using conditional neural fields (CNFs), a recently invented probabilistic graphical model. This CNF method not only models the complex relationship between sequence features and SS, but also exploits the interdependency among SS types of adjacent residues. In addition to sequence profiles, our method also makes use of non-evolutionary information for SS prediction. Tested on the CB513 and RS126 data sets, our method achieves Q8 accuracy of 64.9 and 64.7%, respectively, which are much better than the SSpro8 web server (51.0 and 48.0%, respectively). Our method can also be used to predict other structure properties (e.g. solvent accessibility) of a protein or the SS of RNA. Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  4. A range of complex probabilistic models for RNA secondary structure prediction that includes the nearest-neighbor model and more.

    PubMed

    Rivas, Elena; Lang, Raymond; Eddy, Sean R

    2012-02-01

    The standard approach for single-sequence RNA secondary structure prediction uses a nearest-neighbor thermodynamic model with several thousand experimentally determined energy parameters. An attractive alternative is to use statistical approaches with parameters estimated from growing databases of structural RNAs. Good results have been reported for discriminative statistical methods using complex nearest-neighbor models, including CONTRAfold, Simfold, and ContextFold. Little work has been reported on generative probabilistic models (stochastic context-free grammars [SCFGs]) of comparable complexity, although probabilistic models are generally easier to train and to use. To explore a range of probabilistic models of increasing complexity, and to directly compare probabilistic, thermodynamic, and discriminative approaches, we created TORNADO, a computational tool that can parse a wide spectrum of RNA grammar architectures (including the standard nearest-neighbor model and more) using a generalized super-grammar that can be parameterized with probabilities, energies, or arbitrary scores. By using TORNADO, we find that probabilistic nearest-neighbor models perform comparably to (but not significantly better than) discriminative methods. We find that complex statistical models are prone to overfitting RNA structure and that evaluations should use structurally nonhomologous training and test data sets. Overfitting has affected at least one published method (ContextFold). The most important barrier to improving statistical approaches for RNA secondary structure prediction is the lack of diversity of well-curated single-sequence RNA secondary structures in current RNA databases.

  5. A range of complex probabilistic models for RNA secondary structure prediction that includes the nearest-neighbor model and more

    PubMed Central

    Rivas, Elena; Lang, Raymond; Eddy, Sean R.

    2012-01-01

    The standard approach for single-sequence RNA secondary structure prediction uses a nearest-neighbor thermodynamic model with several thousand experimentally determined energy parameters. An attractive alternative is to use statistical approaches with parameters estimated from growing databases of structural RNAs. Good results have been reported for discriminative statistical methods using complex nearest-neighbor models, including CONTRAfold, Simfold, and ContextFold. Little work has been reported on generative probabilistic models (stochastic context-free grammars [SCFGs]) of comparable complexity, although probabilistic models are generally easier to train and to use. To explore a range of probabilistic models of increasing complexity, and to directly compare probabilistic, thermodynamic, and discriminative approaches, we created TORNADO, a computational tool that can parse a wide spectrum of RNA grammar architectures (including the standard nearest-neighbor model and more) using a generalized super-grammar that can be parameterized with probabilities, energies, or arbitrary scores. By using TORNADO, we find that probabilistic nearest-neighbor models perform comparably to (but not significantly better than) discriminative methods. We find that complex statistical models are prone to overfitting RNA structure and that evaluations should use structurally nonhomologous training and test data sets. Overfitting has affected at least one published method (ContextFold). The most important barrier to improving statistical approaches for RNA secondary structure prediction is the lack of diversity of well-curated single-sequence RNA secondary structures in current RNA databases. PMID:22194308

  6. Using secondary structure to identify ribosomal numts: cautionary examples from the human genome.

    PubMed

    Olson, Link E; Yoder, Anne D

    2002-01-01

    The identification of inadvertently sequenced mitochondrial pseudogenes (numts) is critical to any study employing mitochondrial DNA sequence data. Failure to discriminate numts correctly can confound phylogenetic reconstruction and studies of molecular evolution. This is especially problematic for ribosomal mtDNA genes. Unlike protein-coding loci, whose pseudogenes tend to accumulate diagnostic frameshift or premature stop mutations, functional ribosomal genes are not constrained to maintain a reading frame and can accumulate insertion-deletion events of varying length, particularly in nonpairing regions. Several authors have advocated using structural features of the transcribed rRNA molecule to differentiate functional mitochondrial rRNA genes from their nuclear paralogs. We explored this approach using the mitochondrial 12S rRNA gene and three known 12S numts from the human genome in the context of anthropoid phylogeny and the inferred secondary structure of primate 12S rRNA. Contrary to expectation, each of the three human numts exhibits striking concordance with secondary structure models, with little, if any, indication of their pseudogene status, and would likely escape detection based on structural criteria alone. Furthermore, we show that the unwitting inclusion of a particularly ancient (18-25 Myr old) and surprisingly cryptic human numt in a phylogenetic analysis would yield a well-supported but dramatically incorrect conclusion regarding anthropoid relationships. Though we endorse the use of secondary structure models for inferring positional homology wholeheartedly, we caution against reliance on structural criteria for the discrimination of rRNA numts, given the potential fallibility of this approach.

  7. Opposite consequences of two transcription pauses caused by an intrinsic terminator oligo(U): antitermination versus termination by bacteriophage T7 RNA polymerase.

    PubMed

    Lee, Sooncheol; Kang, Changwon

    2011-05-06

    The RNA oligo(U) sequence, along with an immediately preceding RNA hairpin structure, is an essential cis-acting element for bacterial class I intrinsic termination. This sequence not only causes a pause in transcription during the beginning of the termination process but also facilitates transcript release at the end of the process. In this study, the oligo(U) sequence of the bacteriophage T7 intrinsic terminator Tφ, rather than the hairpin structure, induced pauses of phage T7 RNA polymerase not only at the termination site, triggering a termination process, but also 3 bp upstream, exerting an antitermination effect. The upstream pause presumably allowed RNA to form a thermodynamically more stable secondary structure rather than a terminator hairpin and to persist because the 5'-half of the terminator hairpin-forming sequence could be sequestered by a farther upstream sequence via sequence-specific hybridization, prohibiting formation of the terminator hairpin and termination. The putative antiterminator RNA structure lacked several base pairs essential for termination when probed using RNases A, T1, and V1. When the antiterminator was destabilized by incorporation of IMP into nascent RNA at G residue positions, antitermination was abolished. Furthermore, antitermination strength increased with more stable antiterminator secondary structures and longer pauses. Thus, the oligo(U)-mediated pause prior to the termination site can exert a cis-acting antitermination activity on intrinsic terminator Tφ, and the termination efficiency depends primarily on the termination-interfering pause that precedes the termination-facilitating pause at the termination site.

  8. A global sampling approach to designing and reengineering RNA secondary structures.

    PubMed

    Levin, Alex; Lis, Mieszko; Ponty, Yann; O'Donnell, Charles W; Devadas, Srinivas; Berger, Bonnie; Waldispühl, Jérôme

    2012-11-01

    The development of algorithms for designing artificial RNA sequences that fold into specific secondary structures has many potential biomedical and synthetic biology applications. To date, this problem remains computationally difficult, and current strategies to address it resort to heuristics and stochastic search techniques. The most popular methods consist of two steps: First a random seed sequence is generated; next, this seed is progressively modified (i.e. mutated) to adopt the desired folding properties. Although computationally inexpensive, this approach raises several questions such as (i) the influence of the seed; and (ii) the efficiency of single-path directed searches that may be affected by energy barriers in the mutational landscape. In this article, we present RNA-ensign, a novel paradigm for RNA design. Instead of taking a progressive adaptive walk driven by local search criteria, we use an efficient global sampling algorithm to examine large regions of the mutational landscape under structural and thermodynamical constraints until a solution is found. When considering the influence of the seeds and the target secondary structures, our results show that, compared to single-path directed searches, our approach is more robust, succeeds more often and generates more thermodynamically stable sequences. An ensemble approach to RNA design is thus well worth pursuing as a complement to existing approaches. RNA-ensign is available at http://csb.cs.mcgill.ca/RNAensign.

  9. A global sampling approach to designing and reengineering RNA secondary structures

    PubMed Central

    Levin, Alex; Lis, Mieszko; Ponty, Yann; O’Donnell, Charles W.; Devadas, Srinivas; Berger, Bonnie; Waldispühl, Jérôme

    2012-01-01

    The development of algorithms for designing artificial RNA sequences that fold into specific secondary structures has many potential biomedical and synthetic biology applications. To date, this problem remains computationally difficult, and current strategies to address it resort to heuristics and stochastic search techniques. The most popular methods consist of two steps: First a random seed sequence is generated; next, this seed is progressively modified (i.e. mutated) to adopt the desired folding properties. Although computationally inexpensive, this approach raises several questions such as (i) the influence of the seed; and (ii) the efficiency of single-path directed searches that may be affected by energy barriers in the mutational landscape. In this article, we present RNA-ensign, a novel paradigm for RNA design. Instead of taking a progressive adaptive walk driven by local search criteria, we use an efficient global sampling algorithm to examine large regions of the mutational landscape under structural and thermodynamical constraints until a solution is found. When considering the influence of the seeds and the target secondary structures, our results show that, compared to single-path directed searches, our approach is more robust, succeeds more often and generates more thermodynamically stable sequences. An ensemble approach to RNA design is thus well worth pursuing as a complement to existing approaches. RNA-ensign is available at http://csb.cs.mcgill.ca/RNAensign. PMID:22941632

  10. Prelude and Fugue, predicting local protein structure, early folding regions and structural weaknesses.

    PubMed

    Kwasigroch, Jean Marc; Rooman, Marianne

    2006-07-15

    Prelude&Fugue are bioinformatics tools aiming at predicting the local 3D structure of a protein from its amino acid sequence in terms of seven backbone torsion angle domains, using database-derived potentials. Prelude(&Fugue) computes all lowest free energy conformations of a protein or protein region, ranked by increasing energy, and possibly satisfying some interresidue distance constraints specified by the user. (Prelude&)Fugue detects sequence regions whose predicted structure is significantly preferred relative to other conformations in the absence of tertiary interactions. These programs can be used for predicting secondary structure, tertiary structure of short peptides, flickering early folding sequences and peptides that adopt a preferred conformation in solution. They can also be used for detecting structural weaknesses, i.e. sequence regions that are not optimal with respect to the tertiary fold. http://babylone.ulb.ac.be/Prelude_and_Fugue.

  11. Fine-tuning structural RNA alignments in the twilight zone

    PubMed Central

    2010-01-01

    Background A widely used method to find conserved secondary structure in RNA is to first construct a multiple sequence alignment, and then fold the alignment, optimizing a score based on thermodynamics and covariance. This method works best around 75% sequence similarity. However, in a "twilight zone" below 55% similarity, the sequence alignment tends to obscure the covariance signal used in the second phase. Therefore, while the overall shape of the consensus structure may still be found, the degree of conservation cannot be estimated reliably. Results Based on a combination of available methods, we present a method named planACstar for improving structure conservation in structural alignments in the twilight zone. After constructing a consensus structure by alignment folding, planACstar abandons the original sequence alignment, refolds the sequences individually, but consistent with the consensus, aligns the structures, irrespective of sequence, by a pure structure alignment method, and derives an improved sequence alignment from the alignment of structures, to be re-submitted to alignment folding, etc.. This circle may be iterated as long as structural conservation improves, but normally, one step suffices. Conclusions Employing the tools ClustalW, RNAalifold, and RNAforester, we find that for sequences with 30-55% sequence identity, structural conservation can be improved by 10% on average, with a large variation, measured in terms of RNAalifold's own criterion, the structure conservation index. PMID:20433706

  12. Efficient algorithms for probing the RNA mutation landscape.

    PubMed

    Waldispühl, Jérôme; Devadas, Srinivas; Berger, Bonnie; Clote, Peter

    2008-08-08

    The diversity and importance of the role played by RNAs in the regulation and development of the cell are now well-known and well-documented. This broad range of functions is achieved through specific structures that have been (presumably) optimized through evolution. State-of-the-art methods, such as McCaskill's algorithm, use a statistical mechanics framework based on the computation of the partition function over the canonical ensemble of all possible secondary structures on a given sequence. Although secondary structure predictions from thermodynamics-based algorithms are not as accurate as methods employing comparative genomics, the former methods are the only available tools to investigate novel RNAs, such as the many RNAs of unknown function recently reported by the ENCODE consortium. In this paper, we generalize the McCaskill partition function algorithm to sum over the grand canonical ensemble of all secondary structures of all mutants of the given sequence. Specifically, our new program, RNAmutants, simultaneously computes for each integer k the minimum free energy structure MFE(k) and the partition function Z(k) over all secondary structures of all k-point mutants, even allowing the user to specify certain positions required not to mutate and certain positions required to base-pair or remain unpaired. This technically important extension allows us to study the resilience of an RNA molecule to pointwise mutations. By computing the mutation profile of a sequence, a novel graphical representation of the mutational tendency of nucleotide positions, we analyze the deleterious nature of mutating specific nucleotide positions or groups of positions. We have successfully applied RNAmutants to investigate deleterious mutations (mutations that radically modify the secondary structure) in the Hepatitis C virus cis-acting replication element and to evaluate the evolutionary pressure applied on different regions of the HIV trans-activation response element. In particular, we show qualitative agreement between published Hepatitis C and HIV experimental mutagenesis studies and our analysis of deleterious mutations using RNAmutants. Our work also predicts other deleterious mutations, which could be verified experimentally. Finally, we provide evidence that the 3' UTR of the GB RNA virus C has been optimized to preserve evolutionarily conserved stem regions from a deleterious effect of pointwise mutations. We hope that there will be long-term potential applications of RNAmutants in de novo RNA design and drug design against RNA viruses. This work also suggests potential applications for large-scale exploration of the RNA sequence-structure network. Binary distributions are available at http://RNAmutants.csail.mit.edu/.

  13. SOV_refine: A further refined definition of segment overlap score and its significance for protein structure similarity.

    PubMed

    Liu, Tong; Wang, Zheng

    2018-01-01

    The segment overlap score (SOV) has been used to evaluate the predicted protein secondary structures, a sequence composed of helix (H), strand (E), and coil (C), by comparing it with the native or reference secondary structures, another sequence of H, E, and C. SOV's advantage is that it can consider the size of continuous overlapping segments and assign extra allowance to longer continuous overlapping segments instead of only judging from the percentage of overlapping individual positions as Q3 score does. However, we have found a drawback from its previous definition, that is, it cannot ensure increasing allowance assignment when more residues in a segment are further predicted accurately. A new way of assigning allowance has been designed, which keeps all the advantages of the previous SOV score definitions and ensures that the amount of allowance assigned is incremental when more elements in a segment are predicted accurately. Furthermore, our improved SOV has achieved a higher correlation with the quality of protein models measured by GDT-TS score and TM-score, indicating its better abilities to evaluate tertiary structure quality at the secondary structure level. We analyzed the statistical significance of SOV scores and found the threshold values for distinguishing two protein structures (SOV_refine  > 0.19) and indicating whether two proteins are under the same CATH fold (SOV_refine > 0.94 and > 0.90 for three- and eight-state secondary structures respectively). We provided another two example applications, which are when used as a machine learning feature for protein model quality assessment and comparing different definitions of topologically associating domains. We proved that our newly defined SOV score resulted in better performance. The SOV score can be widely used in bioinformatics research and other fields that need to compare two sequences of letters in which continuous segments have important meanings. We also generalized the previous SOV definitions so that it can work for sequences composed of more than three states (e.g., it can work for the eight-state definition of protein secondary structures). A standalone software package has been implemented in Perl with source code released. The software can be downloaded from http://dna.cs.miami.edu/SOV/.

  14. Building a knowledge-based statistical potential by capturing high-order inter-residue interactions and its applications in protein secondary structure assessment.

    PubMed

    Li, Yaohang; Liu, Hui; Rata, Ionel; Jakobsson, Eric

    2013-02-25

    The rapidly increasing number of protein crystal structures available in the Protein Data Bank (PDB) has naturally made statistical analyses feasible in studying complex high-order inter-residue correlations. In this paper, we report a context-based secondary structure potential (CSSP) for assessing the quality of predicted protein secondary structures generated by various prediction servers. CSSP is a sequence-position-specific knowledge-based potential generated based on the potentials of mean force approach, where high-order inter-residue interactions are taken into consideration. The CSSP potential is effective in identifying secondary structure predictions with good quality. In 56% of the targets in the CB513 benchmark, the optimal CSSP potential is able to recognize the native secondary structure or a prediction with Q3 accuracy higher than 90% as best scored in the predicted secondary structures generated by 10 popularly used secondary structure prediction servers. In more than 80% of the CB513 targets, the predicted secondary structures with the lowest CSSP potential values yield higher than 80% Q3 accuracy. Similar performance of CSSP is found on the CASP9 targets as well. Moreover, our computational results also show that the CSSP potential using triplets outperforms the CSSP potential using doublets and is currently better than the CSSP potential using quartets.

  15. The nucleotide sequence of 5S rRNA from a cellular slime mold Dictyostelium discoideum.

    PubMed Central

    Hori, H; Osawa, S; Iwabuchi, M

    1980-01-01

    The nucleotide sequence of ribosomal 5S rRNA from a cellular slime mold Dictyostelium discoideum is GUAUACGGCCAUACUAGGUUGGAAACACAUCAUCCCGUUCGAUCUGAUA AGUAAAUCGACCUCAGGCCUUCCAAGUACUCUGGUUGGAGACAACAGGGGAACAUAGGGUGCUGUAUACU. A model for the secondary structure of this 5S rRNA is proposed. The sequence is more similar to those of animals (62% similarity on the average) rather than those of yeasts (56%). Images PMID:7465421

  16. Genomic platform for efficient identification of fungal secondary metabolism genes

    USDA-ARS?s Scientific Manuscript database

    Fungal secondary metabolites (SMs) are structurally diverse natural compounds, which are thought to have great potential not only for medical industry but also for chemical and environmental industries. Since expansion of sequencing microbial genomes in 1990’s, it has been known that SM genes are ex...

  17. [Bioinformatics Analysis of Clustered Regularly Interspaced Short Palindromic Repeats in the Genomes of Shigella].

    PubMed

    Wang, Pengfei; Wang, Yingfang; Duan, Guangcai; Xue, Zerun; Wang, Linlin; Guo, Xiangjiao; Yang, Haiyan; Xi, Yuanlin

    2015-04-01

    This study was aimed to explore the features of clustered regularly interspaced short palindromic repeats (CRISPR) structures in Shigella by using bioinformatics. We used bioinformatics methods, including BLAST, alignment and RNA structure prediction, to analyze the CRISPR structures of Shigella genomes. The results showed that the CRISPRs existed in the four groups of Shigella, and the flanking sequences of upstream CRISPRs could be classified into the same group with those of the downstream. We also found some relatively conserved palindromic motifs in the leader sequences. Repeat sequences had the same group with corresponding flanking sequences, and could be classified into two different types by their RNA secondary structures, which contain "stem" and "ring". Some spacers were found to homologize with part sequences of plasmids or phages. The study indicated that there were correlations between repeat sequences and flanking sequences, and the repeats might act as a kind of recognition mechanism to mediate the interaction between foreign genetic elements and Cas proteins.

  18. Rose spring dwarf-associated virus has RNA structural and gene-expression features like those of Barley yellow dwarf virus

    PubMed Central

    Salem, Nida’ M.; Miller, W. Allen; Rowhani, Adib; Golino, Deborah A.; Moyne, Anne-Laure; Falk, Bryce W.

    2015-01-01

    We determined the complete nucleotide sequence of the Rose spring dwarf-associated virus (RSDaV) genomic RNA (GenBank accession no. EU024678) and compared its predicted RNA structural characteristics affecting gene expression. A cDNA library was derived from RSDaV double-stranded RNAs (dsRNAs) purified from infected tissue. Nucleotide sequence analysis of the cloned cDNAs, plus for clones generated by 5′- and 3′-RACE showed the RSDaV genomic RNA to be 5,808 nucleotides. The genomic RNA contains five major open reading frames (ORFs), and three small ORFs in the 3′-terminal 800 nucleotides, typical for viruses of genus Luteovirus in the family Luteoviridae. Northern blot hybridization analysis revealed the genomic RNA and two prominent subgenomic RNAs of approximately 3 kb and 1 kb. Putative 5′ ends of the sgRNAs were predicted by identification of conserved sequences and secondary structures which resembled the Barley yellow dwarf virus (BYDV) genomic RNA 5′ end and subgenomic RNA promoter sequences. Secondary structures of the BYDV-like ribosomal frameshift elements and cap-independent translation elements, including long-distance base pairing spanning four kb were identified. These contain similarities but also informative differences with the BYDV structures, including a strikingly different structure predicted for the 3′ cap-independent translation element. These analyses of the RSDaV genomic RNA show more complexity for the RNA structural elements for members of the Luteoviridae. PMID:18329064

  19. Rose spring dwarf-associated virus has RNA structural and gene-expression features like those of Barley yellow dwarf virus.

    PubMed

    Salem, Nida' M; Miller, W Allen; Rowhani, Adib; Golino, Deborah A; Moyne, Anne-Laure; Falk, Bryce W

    2008-06-05

    We determined the complete nucleotide sequence of the Rose spring dwarf-associated virus (RSDaV) genomic RNA (GenBank accession no. EU024678) and compared its predicted RNA structural characteristics affecting gene expression. A cDNA library was derived from RSDaV double-stranded RNAs (dsRNAs) purified from infected tissue. Nucleotide sequence analysis of the cloned cDNAs, plus for clones generated by 5'- and 3'-RACE showed the RSDaV genomic RNA to be 5808 nucleotides. The genomic RNA contains five major open reading frames (ORFs), and three small ORFs in the 3'-terminal 800 nucleotides, typical for viruses of genus Luteovirus in the family Luteoviridae. Northern blot hybridization analysis revealed the genomic RNA and two prominent subgenomic RNAs of approximately 3 kb and 1 kb. Putative 5' ends of the sgRNAs were predicted by identification of conserved sequences and secondary structures which resembled the Barley yellow dwarf virus (BYDV) genomic RNA 5' end and subgenomic RNA promoter sequences. Secondary structures of the BYDV-like ribosomal frameshift elements and cap-independent translation elements, including long-distance base pairing spanning four kb were identified. These contain similarities but also informative differences with the BYDV structures, including a strikingly different structure predicted for the 3' cap-independent translation element. These analyses of the RSDaV genomic RNA show more complexity for the RNA structural elements for members of the Luteoviridae.

  20. Compilation of small ribosomal subunit RNA structures.

    PubMed Central

    Neefs, J M; Van de Peer, Y; De Rijk, P; Chapelle, S; De Wachter, R

    1993-01-01

    The database on small ribosomal subunit RNA structure contained 1804 nucleotide sequences on April 23, 1993. This number comprises 365 eukaryotic, 65 archaeal, 1260 bacterial, 30 plastidial, and 84 mitochondrial sequences. These are stored in the form of an alignment in order to facilitate the use of the database as input for comparative studies on higher-order structure and for reconstruction of phylogenetic trees. The elements of the postulated secondary structure for each molecule are indicated by special symbols. The database is available on-line directly from the authors by ftp and can also be obtained from the EMBL nucleotide sequence library by electronic mail, ftp, and on CD ROM disk. PMID:8332525

  1. Rapid and reliable protein structure determination via chemical shift threading.

    PubMed

    Hafsa, Noor E; Berjanskii, Mark V; Arndt, David; Wishart, David S

    2018-01-01

    Protein structure determination using nuclear magnetic resonance (NMR) spectroscopy can be both time-consuming and labor intensive. Here we demonstrate how chemical shift threading can permit rapid, robust, and accurate protein structure determination using only chemical shift data. Threading is a relatively old bioinformatics technique that uses a combination of sequence information and predicted (or experimentally acquired) low-resolution structural data to generate high-resolution 3D protein structures. The key motivations behind using NMR chemical shifts for protein threading lie in the fact that they are easy to measure, they are available prior to 3D structure determination, and they contain vital structural information. The method we have developed uses not only sequence and chemical shift similarity but also chemical shift-derived secondary structure, shift-derived super-secondary structure, and shift-derived accessible surface area to generate a high quality protein structure regardless of the sequence similarity (or lack thereof) to a known structure already in the PDB. The method (called E-Thrifty) was found to be very fast (often < 10 min/structure) and to significantly outperform other shift-based or threading-based structure determination methods (in terms of top template model accuracy)-with an average TM-score performance of 0.68 (vs. 0.50-0.62 for other methods). Coupled with recent developments in chemical shift refinement, these results suggest that protein structure determination, using only NMR chemical shifts, is becoming increasingly practical and reliable. E-Thrifty is available as a web server at http://ethrifty.ca .

  2. Parallel computation of genome-scale RNA secondary structure to detect structural constraints on human genome.

    PubMed

    Kawaguchi, Risa; Kiryu, Hisanori

    2016-05-06

    RNA secondary structure around splice sites is known to assist normal splicing by promoting spliceosome recognition. However, analyzing the structural properties of entire intronic regions or pre-mRNA sequences has been difficult hitherto, owing to serious experimental and computational limitations, such as low read coverage and numerical problems. Our novel software, "ParasoR", is designed to run on a computer cluster and enables the exact computation of various structural features of long RNA sequences under the constraint of maximal base-pairing distance. ParasoR divides dynamic programming (DP) matrices into smaller pieces, such that each piece can be computed by a separate computer node without losing the connectivity information between the pieces. ParasoR directly computes the ratios of DP variables to avoid the reduction of numerical precision caused by the cancellation of a large number of Boltzmann factors. The structural preferences of mRNAs computed by ParasoR shows a high concordance with those determined by high-throughput sequencing analyses. Using ParasoR, we investigated the global structural preferences of transcribed regions in the human genome. A genome-wide folding simulation indicated that transcribed regions are significantly more structural than intergenic regions after removing repeat sequences and k-mer frequency bias. In particular, we observed a highly significant preference for base pairing over entire intronic regions as compared to their antisense sequences, as well as to intergenic regions. A comparison between pre-mRNAs and mRNAs showed that coding regions become more accessible after splicing, indicating constraints for translational efficiency. Such changes are correlated with gene expression levels, as well as GC content, and are enriched among genes associated with cytoskeleton and kinase functions. We have shown that ParasoR is very useful for analyzing the structural properties of long RNA sequences such as mRNAs, pre-mRNAs, and long non-coding RNAs whose lengths can be more than a million bases in the human genome. In our analyses, transcribed regions including introns are indicated to be subject to various types of structural constraints that cannot be explained from simple sequence composition biases. ParasoR is freely available at https://github.com/carushi/ParasoR .

  3. ssHMM: extracting intuitive sequence-structure motifs from high-throughput RNA-binding protein data

    PubMed Central

    Krestel, Ralf; Ohler, Uwe; Vingron, Martin; Marsico, Annalisa

    2017-01-01

    Abstract RNA-binding proteins (RBPs) play an important role in RNA post-transcriptional regulation and recognize target RNAs via sequence-structure motifs. The extent to which RNA structure influences protein binding in the presence or absence of a sequence motif is still poorly understood. Existing RNA motif finders either take the structure of the RNA only partially into account, or employ models which are not directly interpretable as sequence-structure motifs. We developed ssHMM, an RNA motif finder based on a hidden Markov model (HMM) and Gibbs sampling which fully captures the relationship between RNA sequence and secondary structure preference of a given RBP. Compared to previous methods which output separate logos for sequence and structure, it directly produces a combined sequence-structure motif when trained on a large set of sequences. ssHMM’s model is visualized intuitively as a graph and facilitates biological interpretation. ssHMM can be used to find novel bona fide sequence-structure motifs of uncharacterized RBPs, such as the one presented here for the YY1 protein. ssHMM reaches a high motif recovery rate on synthetic data, it recovers known RBP motifs from CLIP-Seq data, and scales linearly on the input size, being considerably faster than MEMERIS and RNAcontext on large datasets while being on par with GraphProt. It is freely available on Github and as a Docker image. PMID:28977546

  4. Secondary structural entropy in RNA switch (Riboswitch) identification.

    PubMed

    Manzourolajdad, Amirhossein; Arnold, Jonathan

    2015-04-28

    RNA regulatory elements play a significant role in gene regulation. Riboswitches, a widespread group of regulatory RNAs, are vital components of many bacterial genomes. These regulatory elements generally function by forming a ligand-induced alternative fold that controls access to ribosome binding sites or other regulatory sites in RNA. Riboswitch-mediated mechanisms are ubiquitous across bacterial genomes. A typical class of riboswitch has its own unique structural and biological complexity, making de novo riboswitch identification a formidable task. Traditionally, riboswitches have been identified through comparative genomics based on sequence and structural homology. The limitations of structural-homology-based approaches, coupled with the assumption that there is a great diversity of undiscovered riboswitches, suggests the need for alternative methods for riboswitch identification, possibly based on features intrinsic to their structure. As of yet, no such reliable method has been proposed. We used structural entropy of riboswitch sequences as a measure of their secondary structural dynamics. Entropy values of a diverse set of riboswitches were compared to that of their mutants, their dinucleotide shuffles, and their reverse complement sequences under different stochastic context-free grammar folding models. Significance of our results was evaluated by comparison to other approaches, such as the base-pairing entropy and energy landscapes dynamics. Classifiers based on structural entropy optimized via sequence and structural features were devised as riboswitch identifiers and tested on Bacillus subtilis, Escherichia coli, and Synechococcus elongatus as an exploration of structural entropy based approaches. The unusually long untranslated region of the cotH in Bacillus subtilis, as well as upstream regions of certain genes, such as the sucC genes were associated with significant structural entropy values in genome-wide examinations. Various tests show that there is in fact a relationship between higher structural entropy and the potential for the RNA sequence to have alternative structures, within the limitations of our methodology. This relationship, though modest, is consistent across various tests. Understanding the behavior of structural entropy as a fairly new feature for RNA conformational dynamics, however, may require extensive exploratory investigation both across RNA sequences and folding models.

  5. Prediction of beta-turns at over 80% accuracy based on an ensemble of predicted secondary structures and multiple alignments.

    PubMed

    Zheng, Ce; Kurgan, Lukasz

    2008-10-10

    beta-turn is a secondary protein structure type that plays significant role in protein folding, stability, and molecular recognition. To date, several methods for prediction of beta-turns from protein sequences were developed, but they are characterized by relatively poor prediction quality. The novelty of the proposed sequence-based beta-turn predictor stems from the usage of a window based information extracted from four predicted three-state secondary structures, which together with a selected set of position specific scoring matrix (PSSM) values serve as an input to the support vector machine (SVM) predictor. We show that (1) all four predicted secondary structures are useful; (2) the most useful information extracted from the predicted secondary structure includes the structure of the predicted residue, secondary structure content in a window around the predicted residue, and features that indicate whether the predicted residue is inside a secondary structure segment; (3) the PSSM values of Asn, Asp, Gly, Ile, Leu, Met, Pro, and Val were among the top ranked features, which corroborates with recent studies. The Asn, Asp, Gly, and Pro indicate potential beta-turns, while the remaining four amino acids are useful to predict non-beta-turns. Empirical evaluation using three nonredundant datasets shows favorable Q total, Q predicted and MCC values when compared with over a dozen of modern competing methods. Our method is the first to break the 80% Q total barrier and achieves Q total = 80.9%, MCC = 0.47, and Q predicted higher by over 6% when compared with the second best method. We use feature selection to reduce the dimensionality of the feature vector used as the input for the proposed prediction method. The applied feature set is smaller by 86, 62 and 37% when compared with the second and two third-best (with respect to MCC) competing methods, respectively. Experiments show that the proposed method constitutes an improvement over the competing prediction methods. The proposed prediction model can better discriminate between beta-turns and non-beta-turns due to obtaining lower numbers of false positive predictions. The prediction model and datasets are freely available at http://biomine.ece.ualberta.ca/BTNpred/BTNpred.html.

  6. Prediction of beta-turns at over 80% accuracy based on an ensemble of predicted secondary structures and multiple alignments

    PubMed Central

    Zheng, Ce; Kurgan, Lukasz

    2008-01-01

    Background β-turn is a secondary protein structure type that plays significant role in protein folding, stability, and molecular recognition. To date, several methods for prediction of β-turns from protein sequences were developed, but they are characterized by relatively poor prediction quality. The novelty of the proposed sequence-based β-turn predictor stems from the usage of a window based information extracted from four predicted three-state secondary structures, which together with a selected set of position specific scoring matrix (PSSM) values serve as an input to the support vector machine (SVM) predictor. Results We show that (1) all four predicted secondary structures are useful; (2) the most useful information extracted from the predicted secondary structure includes the structure of the predicted residue, secondary structure content in a window around the predicted residue, and features that indicate whether the predicted residue is inside a secondary structure segment; (3) the PSSM values of Asn, Asp, Gly, Ile, Leu, Met, Pro, and Val were among the top ranked features, which corroborates with recent studies. The Asn, Asp, Gly, and Pro indicate potential β-turns, while the remaining four amino acids are useful to predict non-β-turns. Empirical evaluation using three nonredundant datasets shows favorable Qtotal, Qpredicted and MCC values when compared with over a dozen of modern competing methods. Our method is the first to break the 80% Qtotal barrier and achieves Qtotal = 80.9%, MCC = 0.47, and Qpredicted higher by over 6% when compared with the second best method. We use feature selection to reduce the dimensionality of the feature vector used as the input for the proposed prediction method. The applied feature set is smaller by 86, 62 and 37% when compared with the second and two third-best (with respect to MCC) competing methods, respectively. Conclusion Experiments show that the proposed method constitutes an improvement over the competing prediction methods. The proposed prediction model can better discriminate between β-turns and non-β-turns due to obtaining lower numbers of false positive predictions. The prediction model and datasets are freely available at . PMID:18847492

  7. Free energy determinants of secondary structure formation: III. beta-turns and their role in protein folding.

    PubMed

    Yang, A S; Hitz, B; Honig, B

    1996-06-21

    The stability of beta-turns is calculated as a function of sequence and turn type with a Monte Carlo sampling technique. The conformational energy of four internal hydrogen-bonded turn types, I, I', II and II', is obtained by evaluating their gas phase energy with the CHARMM force field and accounting for solvation effects with the Finite Difference Poisson-Boltzmann (FDPB) method. All four turn types are found to be less stable than the coil state, independent of the sequence in the turn. The free-energy penalties associated with turn formation vary between 1.6 kcal/mol and 7.7 kcal/mol, depending on the sequence and turn type. Differences in turn stability arise mainly from intraresidue interactions within the two central residues of the turn. For each combination of the two central residues, except for -Gly-Gly-, the most stable beta-turn type is always found to occur most commonly in native proteins. The fact that a model based on local interactions accounts for the observed preference of specific sequences suggests that long-range tertiary interactions tend to play a secondary role in determining turn conformation. In contrast, for beta-hairpins, long-range interactions appear to dominate. Specifically, due to the right-handed twist of beta-strands, type I' turns for -Gly-Gly- are found to occur with high frequency, even when local energetics would dictate otherwise. The fact that any combination of two residues is found able to adopt a relatively low-energy turn structure explains why the amino acid sequence in turns is highly variable. The calculated free-energy cost of turn formation, when combined with related numbers obtained for alpha-helices and beta-sheets, suggests a model for the initiation of protein folding based on metastable fragments of secondary structure.

  8. Protein Secondary Structure Prediction Using Deep Convolutional Neural Fields.

    PubMed

    Wang, Sheng; Peng, Jian; Ma, Jianzhu; Xu, Jinbo

    2016-01-11

    Protein secondary structure (SS) prediction is important for studying protein structure and function. When only the sequence (profile) information is used as input feature, currently the best predictors can obtain ~80% Q3 accuracy, which has not been improved in the past decade. Here we present DeepCNF (Deep Convolutional Neural Fields) for protein SS prediction. DeepCNF is a Deep Learning extension of Conditional Neural Fields (CNF), which is an integration of Conditional Random Fields (CRF) and shallow neural networks. DeepCNF can model not only complex sequence-structure relationship by a deep hierarchical architecture, but also interdependency between adjacent SS labels, so it is much more powerful than CNF. Experimental results show that DeepCNF can obtain ~84% Q3 accuracy, ~85% SOV score, and ~72% Q8 accuracy, respectively, on the CASP and CAMEO test proteins, greatly outperforming currently popular predictors. As a general framework, DeepCNF can be used to predict other protein structure properties such as contact number, disorder regions, and solvent accessibility.

  9. Protein Secondary Structure Prediction Using Deep Convolutional Neural Fields

    NASA Astrophysics Data System (ADS)

    Wang, Sheng; Peng, Jian; Ma, Jianzhu; Xu, Jinbo

    2016-01-01

    Protein secondary structure (SS) prediction is important for studying protein structure and function. When only the sequence (profile) information is used as input feature, currently the best predictors can obtain ~80% Q3 accuracy, which has not been improved in the past decade. Here we present DeepCNF (Deep Convolutional Neural Fields) for protein SS prediction. DeepCNF is a Deep Learning extension of Conditional Neural Fields (CNF), which is an integration of Conditional Random Fields (CRF) and shallow neural networks. DeepCNF can model not only complex sequence-structure relationship by a deep hierarchical architecture, but also interdependency between adjacent SS labels, so it is much more powerful than CNF. Experimental results show that DeepCNF can obtain ~84% Q3 accuracy, ~85% SOV score, and ~72% Q8 accuracy, respectively, on the CASP and CAMEO test proteins, greatly outperforming currently popular predictors. As a general framework, DeepCNF can be used to predict other protein structure properties such as contact number, disorder regions, and solvent accessibility.

  10. Diversity of Secondary Structure in Catalytic Peptides with β-Turn-Biased Sequences

    PubMed Central

    2016-01-01

    X-ray crystallography has been applied to the structural analysis of a series of tetrapeptides that were previously assessed for catalytic activity in an atroposelective bromination reaction. Common to the series is a central Pro-Xaa sequence, where Pro is either l- or d-proline, which was chosen to favor nucleation of canonical β-turn secondary structures. Crystallographic analysis of 35 different peptide sequences revealed a range of conformational states. The observed differences appear not only in cases where the Pro-Xaa loop-region is altered, but also when seemingly subtle alterations to the flanking residues are introduced. In many instances, distinct conformers of the same sequence were observed, either as symmetry-independent molecules within the same unit cell or as polymorphs. Computational studies using DFT provided additional insight into the analysis of solid-state structural features. Select X-ray crystal structures were compared to the corresponding solution structures derived from measured proton chemical shifts, 3J-values, and 1H–1H-NOESY contacts. These findings imply that the conformational space available to simple peptide-based catalysts is more diverse than precedent might suggest. The direct observation of multiple ground state conformations for peptides of this family, as well as the dynamic processes associated with conformational equilibria, underscore not only the challenge of designing peptide-based catalysts, but also the difficulty in predicting their accessible transition states. These findings implicate the advantages of low-barrier interconversions between conformations of peptide-based catalysts for multistep, enantioselective reactions. PMID:28029251

  11. Sequence and conformational preferences at termini of α-helices in membrane proteins: role of the helix environment.

    PubMed

    Shelar, Ashish; Bansal, Manju

    2014-12-01

    α-Helices are amongst the most common secondary structural elements seen in membrane proteins and are packed in the form of helix bundles. These α-helices encounter varying external environments (hydrophobic, hydrophilic) that may influence the sequence preferences at their N and C-termini. The role of the external environment in stabilization of the helix termini in membrane proteins is still unknown. Here we analyze α-helices in a high-resolution dataset of integral α-helical membrane proteins and establish that their sequence and conformational preferences differ from those in globular proteins. We specifically examine these preferences at the N and C-termini in helices initiating/terminating inside the membrane core as well as in linkers connecting these transmembrane helices. We find that the sequence preferences and structural motifs at capping (Ncap and Ccap) and near-helical (N' and C') positions are influenced by a combination of features including the membrane environment and the innate helix initiation and termination property of residues forming structural motifs. We also find that a large number of helix termini which do not form any particular capping motif are stabilized by formation of hydrogen bonds and hydrophobic interactions contributed from the neighboring helices in the membrane protein. We further validate the sequence preferences obtained from our analysis with data from an ultradeep sequencing study that identifies evolutionarily conserved amino acids in the rat neurotensin receptor. The results from our analysis provide insights for the secondary structure prediction, modeling and design of membrane proteins. © 2014 Wiley Periodicals, Inc.

  12. SwiSpot: modeling riboswitches by spotting out switching sequences.

    PubMed

    Barsacchi, Marco; Novoa, Eva Maria; Kellis, Manolis; Bechini, Alessio

    2016-11-01

    Riboswitches are cis-regulatory elements in mRNA, mostly found in Bacteria, which exhibit two main secondary structure conformations. Although one of them prevents the gene from being expressed, the other conformation allows its expression, and this switching process is typically driven by the presence of a specific ligand. Although there are a handful of known riboswitches, our knowledge in this field has been greatly limited due to our inability to identify their alternate structures from their sequences. Indeed, current methods are not able to predict the presence of the two functionally distinct conformations just from the knowledge of the plain RNA nucleotide sequence. Whether this would be possible, for which cases, and what prediction accuracy can be achieved, are currently open questions. Here we show that the two alternate secondary structures of riboswitches can be accurately predicted once the 'switching sequence' of the riboswitch has been properly identified. The proposed SwiSpot approach is capable of identifying the switching sequence inside a putative, complete riboswitch sequence, on the basis of pairing behaviors, which are evaluated on proper sets of configurations. Moreover, it is able to model the switching behavior of riboswitches whose generated ensemble covers both alternate configurations. Beyond structural predictions, the approach can also be paired to homology-based riboswitch searches. SwiSpot software, along with the reference dataset files, is available at: http://www.iet.unipi.it/a.bechini/swispot/Supplementary information: Supplementary data are available at Bioinformatics online. a.bechini@ing.unipi.it. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  13. Impact of target mRNA structure on siRNA silencing efficiency: A large-scale study.

    PubMed

    Gredell, Joseph A; Berger, Angela K; Walton, S Patrick

    2008-07-01

    The selection of active siRNAs is generally based on identifying siRNAs with certain sequence and structural properties. However, the efficiency of RNA interference has also been shown to depend on the structure of the target mRNA, primarily through studies using exogenous transcripts with well-defined secondary structures in the vicinity of the target sequence. While these studies provide a means for examining the impact of target sequence and structure independently, the predicted secondary structures for these transcripts are often not reflective of structures that form in full-length, native mRNAs where interactions can occur between relatively remote segments of the mRNAs. Here, using a combination of experimental results and analysis of a large dataset, we demonstrate that the accessibility of certain local target structures on the mRNA is an important determinant in the gene silencing ability of siRNAs. siRNAs targeting the enhanced green fluorescent protein were chosen using a minimal siRNA selection algorithm followed by classification based on the predicted minimum free energy structures of the target transcripts. Transfection into HeLa and HepG2 cells revealed that siRNAs targeting regions of the mRNA predicted to have unpaired 5'- and 3'-ends resulted in greater gene silencing than regions predicted to have other types of secondary structure. These results were confirmed by analysis of gene silencing data from previously published siRNAs, which showed that mRNA target regions unpaired at either the 5'-end or 3'-end were silenced, on average, approximately 10% more strongly than target regions unpaired in the center or primarily paired throughout. We found this effect to be independent of the structure of the siRNA guide strand. Taken together, these results suggest minimal requirements for nucleation of hybridization between the siRNA guide strand and mRNA and that both mRNA and guide strand structure should be considered when choosing candidate siRNAs. (c) 2008 Wiley Periodicals, Inc.

  14. Impact of target mRNA structure on siRNA silencing efficiency: a large-scale study

    PubMed Central

    Gredell, Joseph A.; Berger, Angela K.; Walton, S. Patrick

    2009-01-01

    The selection of active siRNAs is generally based on identifying siRNAs with certain sequence and structural properties. However, the efficiency of RNA interference has also been shown to depend on the structure of the target mRNA, primarily through studies using exogenous transcripts with well-defined secondary structures in the vicinity of the target sequence. While these studies provide a means for examining the impact of target sequence and structure independently, the predicted secondary structures for these transcripts are often not reflective of structures that form in full-length, native mRNAs where interactions can occur between relatively remote segments of the mRNAs. Here, using a combination of experimental results and analysis of a large dataset, we demonstrate that the accessibility of certain local target structures on the mRNA is an important determinant in the gene silencing ability of siRNAs. siRNAs targeting the enhanced green fluorescent protein were chosen using a minimal siRNA selection algorithm followed by classification based on the predicted minimum free energy structures of the target transcripts. Transfection into HeLa and HepG2 cells revealed that siRNAs targeting regions of the mRNA predicted to have unpaired 5’- and 3’-ends resulted in greater gene silencing than regions predicted to have other types of secondary structure. These results were confirmed by analysis of gene silencing data from previously published siRNAs, which showed that mRNA target regions unpaired at either the 5’-end or 3’-end were silenced, on average, ~10% more strongly than target regions unpaired in the center or primarily paired throughout. We found this effect to be independent of the structure of the siRNA guide strand. Taken together, these results suggest minimal requirements for nucleation of hybridization between the siRNA guide strand and mRNA and that both mRNA and guide strand structure should be considered when choosing candidate siRNAs. PMID:18306428

  15. Hop stunt viroid: molecular cloning and nucleotide sequence of the complete cDNA copy.

    PubMed Central

    Ohno, T; Takamatsu, N; Meshi, T; Okada, Y

    1983-01-01

    The complete cDNA of hop stunt viroid (HSV) has been cloned by the method of Okayama and Berg (Mol.Cell.Biol.2,161-170. (1982] and the complete nucleotide sequence has been established. The covalently closed circular single-stranded HSV RNA consists of 297 nucleotides. The secondary structure predicted for HSV contains 67% of its residues base-paired. The native HSV can possess an extended rod-like structure characteristic of viroids previously established. The central region of the native HSV has a similar structure to the conserved region found in all viroids sequenced so far except for avocado sunblotch viroid. The sequence homologous to the 5'-end of U1a RNA is also found in the sequence of HSV but not in the central conserved region. Images PMID:6312412

  16. The G-quadruplex augments translation in the 5' untranslated region of transforming growth factor β2.

    PubMed

    Agarwala, Prachi; Pandey, Satyaprakash; Mapa, Koyeli; Maiti, Souvik

    2013-03-05

    Transforming growth factor β2 (TGFβ2) is a versatile cytokine with a prominent role in cell migration, invasion, cellular development, and immunomodulation. TGFβ2 promotes the malignancy of tumors by inducing epithelial-mesenchymal transition, angiogenesis, and immunosuppression. As it is well-documented that nucleic acid secondary structure can regulate gene expression, we assessed whether any secondary motif regulates its expression at the post-transcriptional level. Bioinformatics analysis predicts an existence of a 23-nucleotide putative G-quadruplex sequence (PG4) in the 5' untranslated region (UTR) of TGFβ2 mRNA. The ability of this stretch of sequence to form a highly stable, intramolecular parallel quadruplex was demonstrated using ultraviolet and circular dichroism spectroscopy. Footprinting studies further validated its existence in the presence of a neighboring nucleotide sequence. Following structural characterization, we evaluated the biological relevance of this secondary motif using a dual luciferase assay. Although PG4 inhibits the expression of the reporter gene, its presence in the context of the entire 5' UTR sequence interestingly enhances gene expression. Mutation or removal of the G-quadruplex sequence from the 5' UTR of the gene diminished the level of expression of this gene at the translational level. Thus, here we highlight an activating role of the G-quadruplex in modulating gene expression of TGFβ2 at the translational level and its potential to be used as a target for the development of therapeutics against cancer.

  17. 1H and 15N NMR resonance assignments and secondary structure of titin type I domains.

    PubMed

    Muhle-Goll, C; Nilges, M; Pastore, A

    1997-01-01

    Titin/connectin is a giant muscle protein with a highly modular architecture consisting of multiple repeats of two sequence motifs, named type I and type II. Type I modules have been suggested to be intracellular members of the fibronectin type III (Fn3) domain family. Along the titin sequence they are exclusively present in the region of the molecule located in the sarcomere A-band. This region has been shown to interact with myosin and C-protein. One of the most noticeable features of type I modules is that they are particularly rich in semiconserved prolines, since these residues account for about 8% of their sequence. We have determined the secondary structure of a representative type I domain (A71) by 15N and 1H NMR. We show that the type I domains of titin have the Fn3 fold as proposed, consisting of a three- and a four-stranded beta-sheet. When the two sheets are placed on top of each other to form the beta-sandwich characteristic of the Fn3 fold, 8 out of 10 prolines are found on the same side of the molecule and form an exposed hydrophobic patch. This suggests that the semiconserved prolines might be relevant for the function of type I modules, providing a surface for binding to other A-band proteins. The secondary structure of A71 was structurally aligned to other extracellular Fn3 modules of known 3D structure. The alignment shows that titin type I modules have closest similarity to the first Fn3 domain of Drosophila neuroglian.

  18. Secondary structure of the 3'-noncoding region of flavivirus genomes: comparative analysis of base pairing probabilities.

    PubMed

    Rauscher, S; Flamm, C; Mandl, C W; Heinz, F X; Stadler, P F

    1997-07-01

    The prediction of the complete matrix of base pairing probabilities was applied to the 3' noncoding region (NCR) of flavivirus genomes. This approach identifies not only well-defined secondary structure elements, but also regions of high structural flexibility. Flaviviruses, many of which are important human pathogens, have a common genomic organization, but exhibit a significant degree of RNA sequence diversity in the functionally important 3'-NCR. We demonstrate the presence of secondary structures shared by all flaviviruses, as well as structural features that are characteristic for groups of viruses within the genus reflecting the established classification scheme. The significance of most of the predicted structures is corroborated by compensatory mutations. The availability of infectious clones for several flaviviruses will allow the assessment of these structural elements in processes of the viral life cycle, such as replication and assembly.

  19. Investigating the microstructure of keratin extracted from wool: peptide sequence (MALDI-TOF/TOF) and protein conformation (FTIR)

    USDA-ARS?s Scientific Manuscript database

    Keratin was extracted from wool by reduction with 2-mercaptoethanol. It was isolated as intact keratin and characterized by its similar molecular weight, protein composition, and secondary structure to native keratin. Gel electrophoresis patterns and MALDI-TOF/TOF peptide sequences provided the ide...

  20. Exact calculation of distributions on integers, with application to sequence alignment.

    PubMed

    Newberg, Lee A; Lawrence, Charles E

    2009-01-01

    Computational biology is replete with high-dimensional discrete prediction and inference problems. Dynamic programming recursions can be applied to several of the most important of these, including sequence alignment, RNA secondary-structure prediction, phylogenetic inference, and motif finding. In these problems, attention is frequently focused on some scalar quantity of interest, a score, such as an alignment score or the free energy of an RNA secondary structure. In many cases, score is naturally defined on integers, such as a count of the number of pairing differences between two sequence alignments, or else an integer score has been adopted for computational reasons, such as in the test of significance of motif scores. The probability distribution of the score under an appropriate probabilistic model is of interest, such as in tests of significance of motif scores, or in calculation of Bayesian confidence limits around an alignment. Here we present three algorithms for calculating the exact distribution of a score of this type; then, in the context of pairwise local sequence alignments, we apply the approach so as to find the alignment score distribution and Bayesian confidence limits.

  1. Topological Constraints and Their Conformational Entropic Penalties on RNA Folds.

    PubMed

    Mak, Chi H; Phan, Ethan N H

    2018-05-08

    Functional RNAs can fold into intricate structures using a number of different secondary and tertiary structural motifs. Many factors contribute to the overall free energy of the target fold. This study aims at quantifying the entropic costs coming from the loss of conformational freedom when the sugar-phosphate backbone is subjected to constraints imposed by secondary and tertiary contacts. Motivated by insights from topology theory, we design a diagrammatic scheme to represent different types of RNA structures so that constraints associated with a folded structure may be segregated into mutually independent subsets, enabling the total conformational entropy loss to be easily calculated as a sum of independent terms. We used high-throughput Monte Carlo simulations to simulate large ensembles of single-stranded RNA sequences in solution to validate the assumptions behind our diagrammatic scheme, examining the entropic costs for hairpin initiation and formation of many multiway junctions. Our diagrammatic scheme aids in the factorization of secondary/tertiary constraints into distinct topological classes and facilitates the discovery of interrelationships among multiple constraints on RNA folds. This perspective, which to our knowledge is novel, leads to useful insights into the inner workings of some functional RNA sequences, demonstrating how they might operate by transforming their structures among different topological classes. Copyright © 2018 Biophysical Society. Published by Elsevier Inc. All rights reserved.

  2. Evaluation of the effect of non-B DNA structures on plasmid integrity via accelerated stability studies.

    PubMed

    Ribeiro, S C; Monteiro, G A; Prazeres, D M F

    2009-04-01

    Plasmid biopharmaceuticals are a new class of medicines with an enormous potential. Attempts to increase the physical stability of highly purified supercoiled (SC) plasmid DNA in pharmaceutical aqueous solutions have relied on: (i) changing the DNA sequence, (ii) improving manufacturing to reduce deleterious impurities and initial DNA damage, and (iii) controlling the storage medium characteristics. In this work we analyzed the role of secondary structures on the degradation of plasmid molecules. Accelerated stability experiments were performed with SC, open circular (OC) and linear (L) isoforms of three plasmids which differed only in the "single-strandlike" content of their polyadenylation (poly A) signals. We have proved that the presence of more altered or interrupted (non-B) DNA secondary structures did not directly translate into an easier strand scission of the SC isoforms. Rather, those unusual structures imposed a lower degree of SC in the plasmids, leading to an increase in their resistance to thermal degradation. However, this behavior was reversed when the relaxed or L isoforms were tested, in which case the absence of SC rendered the plasmids essentially double-stranded. Overall, this work suggests that plasmid DNA sequence and secondary structures should be taken into account in future investigations of plasmid stability during prolonged storage.

  3. Method of identifying hairpin DNA probes by partial fold analysis

    DOEpatents

    Miller, Benjamin L [Penfield, NY; Strohsahl, Christopher M [Saugerties, NY

    2009-10-06

    Method of identifying molecular beacons in which a secondary structure prediction algorithm is employed to identify oligonucleotide sequences within a target gene having the requisite hairpin structure. Isolated oligonucleotides, molecular beacons prepared from those oligonucleotides, and their use are also disclosed.

  4. Method of identifying hairpin DNA probes by partial fold analysis

    DOEpatents

    Miller, Benjamin L.; Strohsahl, Christopher M.

    2008-10-28

    Methods of identifying molecular beacons in which a secondary structure prediction algorithm is employed to identify oligonucleotide sequences within a target gene having the requisite hairpin structure. Isolated oligonucleotides, molecular beacons prepared from those oligonucleotides, and their use are also disclosed.

  5. Sixty-five years of the long march in protein secondary structure prediction: the final stretch?

    PubMed Central

    Yang, Yuedong; Gao, Jianzhao; Wang, Jihua; Heffernan, Rhys; Hanson, Jack; Paliwal, Kuldip; Zhou, Yaoqi

    2018-01-01

    Abstract Protein secondary structure prediction began in 1951 when Pauling and Corey predicted helical and sheet conformations for protein polypeptide backbone even before the first protein structure was determined. Sixty-five years later, powerful new methods breathe new life into this field. The highest three-state accuracy without relying on structure templates is now at 82–84%, a number unthinkable just a few years ago. These improvements came from increasingly larger databases of protein sequences and structures for training, the use of template secondary structure information and more powerful deep learning techniques. As we are approaching to the theoretical limit of three-state prediction (88–90%), alternative to secondary structure prediction (prediction of backbone torsion angles and Cα-atom-based angles and torsion angles) not only has more room for further improvement but also allows direct prediction of three-dimensional fragment structures with constantly improved accuracy. About 20% of all 40-residue fragments in a database of 1199 non-redundant proteins have <6 Å root-mean-squared distance from the native conformations by SPIDER2. More powerful deep learning methods with improved capability of capturing long-range interactions begin to emerge as the next generation of techniques for secondary structure prediction. The time has come to finish off the final stretch of the long march towards protein secondary structure prediction. PMID:28040746

  6. RNA 3D Modules in Genome-Wide Predictions of RNA 2D Structure

    PubMed Central

    Theis, Corinna; Zirbel, Craig L.; zu Siederdissen, Christian Höner; Anthon, Christian; Hofacker, Ivo L.; Nielsen, Henrik; Gorodkin, Jan

    2015-01-01

    Recent experimental and computational progress has revealed a large potential for RNA structure in the genome. This has been driven by computational strategies that exploit multiple genomes of related organisms to identify common sequences and secondary structures. However, these computational approaches have two main challenges: they are computationally expensive and they have a relatively high false discovery rate (FDR). Simultaneously, RNA 3D structure analysis has revealed modules composed of non-canonical base pairs which occur in non-homologous positions, apparently by independent evolution. These modules can, for example, occur inside structural elements which in RNA 2D predictions appear as internal loops. Hence one question is if the use of such RNA 3D information can improve the prediction accuracy of RNA secondary structure at a genome-wide level. Here, we use RNAz in combination with 3D module prediction tools and apply them on a 13-way vertebrate sequence-based alignment. We find that RNA 3D modules predicted by metaRNAmodules and JAR3D are significantly enriched in the screened windows compared to their shuffled counterparts. The initially estimated FDR of 47.0% is lowered to below 25% when certain 3D module predictions are present in the window of the 2D prediction. We discuss the implications and prospects for further development of computational strategies for detection of RNA 2D structure in genomic sequence. PMID:26509713

  7. SimRNA: a coarse-grained method for RNA folding simulations and 3D structure prediction.

    PubMed

    Boniecki, Michal J; Lach, Grzegorz; Dawson, Wayne K; Tomala, Konrad; Lukasz, Pawel; Soltysinski, Tomasz; Rother, Kristian M; Bujnicki, Janusz M

    2016-04-20

    RNA molecules play fundamental roles in cellular processes. Their function and interactions with other biomolecules are dependent on the ability to form complex three-dimensional (3D) structures. However, experimental determination of RNA 3D structures is laborious and challenging, and therefore, the majority of known RNAs remain structurally uncharacterized. Here, we present SimRNA: a new method for computational RNA 3D structure prediction, which uses a coarse-grained representation, relies on the Monte Carlo method for sampling the conformational space, and employs a statistical potential to approximate the energy and identify conformations that correspond to biologically relevant structures. SimRNA can fold RNA molecules using only sequence information, and, on established test sequences, it recapitulates secondary structure with high accuracy, including correct prediction of pseudoknots. For modeling of complex 3D structures, it can use additional restraints, derived from experimental or computational analyses, including information about secondary structure and/or long-range contacts. SimRNA also can be used to analyze conformational landscapes and identify potential alternative structures. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  8. The structural analysis of the mitochondrial SSUrRNA implies a close phylogenetic relationship between mitochondria from plants and from the heterotrophic alga Prototheca wickerhamii.

    PubMed

    Wolff, G; Kück, U

    1990-04-01

    The gene for the mitochondrial small subunit rRNA (SSUrRNA) from the heterotrophic alga Prototheca wickerhamii has been isolated from a gene library of extranuclear DNA. Sequence and structural analyses allow the determination of a secondary structure model for this rRNA. In addition, several sequence motifs are present which are typically found in SSUrRNAs of various mitochondrial origins. Unexpectedly, the Prototheca RNA sequence has more features in common with mitochondrial SSUrRNAs from plants than with that from the green alga Chlamydomonas reinhardtii. The phylogenetic relationship between mitochondria from plants and algae is discussed.

  9. Nine Optical Black-Box Experiments for Lower-Secondary Students

    ERIC Educational Resources Information Center

    Rode, Henning; Friege, Gunnar

    2017-01-01

    In this paper a sequence of nine, easy to manufacture optical black-box experiments with increasing levels of difficulty, and supportive frameworks for physics classes are introduced. They have been evaluated in a lower-secondary school at the end of optics lessons. A black-box is a kind of experimental task where the inner structure is not…

  10. Hot spot of structural ambivalence in prion protein revealed by secondary structure principal component analysis.

    PubMed

    Yamamoto, Norifumi

    2014-08-21

    The conformational conversion of proteins into an aggregation-prone form is a common feature of various neurodegenerative disorders including Alzheimer's, Huntington's, Parkinson's, and prion diseases. In the early stage of prion diseases, secondary structure conversion in prion protein (PrP) causing β-sheet expansion facilitates the formation of a pathogenic isoform with a high content of β-sheets and strong aggregation tendency to form amyloid fibrils. Herein, we propose a straightforward method to extract essential information regarding the secondary structure conversion of proteins from molecular simulations, named secondary structure principal component analysis (SSPCA). The definite existence of a PrP isoform with an increased β-sheet structure was confirmed in a free-energy landscape constructed by mapping protein structural data into a reduced space according to the principal components determined by the SSPCA. We suggest a "spot" of structural ambivalence in PrP-the C-terminal part of helix 2-that lacks a strong intrinsic secondary structure, thus promoting a partial α-helix-to-β-sheet conversion. This result is important to understand how the pathogenic conformational conversion of PrP is initiated in prion diseases. The SSPCA has great potential to solve various challenges in studying highly flexible molecular systems, such as intrinsically disordered proteins, structurally ambivalent peptides, and chameleon sequences.

  11. A novel Multi-Agent Ada-Boost algorithm for predicting protein structural class with the information of protein secondary structure.

    PubMed

    Fan, Ming; Zheng, Bin; Li, Lihua

    2015-10-01

    Knowledge of the structural class of a given protein is important for understanding its folding patterns. Although a lot of efforts have been made, it still remains a challenging problem for prediction of protein structural class solely from protein sequences. The feature extraction and classification of proteins are the main problems in prediction. In this research, we extended our earlier work regarding these two aspects. In protein feature extraction, we proposed a scheme by calculating the word frequency and word position from sequences of amino acid, reduced amino acid, and secondary structure. For an accurate classification of the structural class of protein, we developed a novel Multi-Agent Ada-Boost (MA-Ada) method by integrating the features of Multi-Agent system into Ada-Boost algorithm. Extensive experiments were taken to test and compare the proposed method using four benchmark datasets in low homology. The results showed classification accuracies of 88.5%, 96.0%, 88.4%, and 85.5%, respectively, which are much better compared with the existing methods. The source code and dataset are available on request.

  12. Hydrophobic cluster analysis of G protein-coupled receptors: a powerful tool to derive structural and functional information from 2D-representation of protein sequences.

    PubMed

    Lentes, K U; Mathieu, E; Bischoff, R; Rasmussen, U B; Pavirani, A

    1993-01-01

    Current methods for comparative analyses of protein sequences are 1D-alignments of amino acid sequences based on the maximization of amino acid identity (homology) and the prediction of secondary structure elements. This method has a major drawback once the amino acid identity drops below 20-25%, since maximization of a homology score does not take into account any structural information. A new technique called Hydrophobic Cluster Analysis (HCA) has been developed by Lemesle-Varloot et al. (Biochimie 72, 555-574), 1990). This consists of comparing several sequences simultaneously and combining homology detection with secondary structure analysis. HCA is primarily based on the detection and comparison of structural segments constituting the hydrophobic core of globular protein domains, with or without transmembrane domains. We have applied HCA to the analysis of different families of G-protein coupled receptors, such as catecholamine receptors as well as peptide hormone receptors. Utilizing HCA the thrombin receptor, a new and as yet unique member of the family of G-protein coupled receptors, can be clearly classified as being closely related to the family of neuropeptide receptors rather than to the catecholamine receptors for which the shape of the hydrophobic clusters and the length of their third cytoplasmic loop are very different. Furthermore, the potential of HCA to predict relationships between new putative and already characterized members of this family of receptors will be presented.

  13. Advances in the understanding and use of the genomic base of microbial secondary metabolite biosynthesis for the discovery of new natural products.

    PubMed

    McAlpine, James B

    2009-03-27

    Over the past decade major changes have occurred in the access to genome sequences that encode the enzymes responsible for the biosynthesis of secondary metabolites, knowledge of how those sequences translate into the final structure of the metabolite, and the ability to alter the sequence to obtain predicted products via both homologous and heterologous expression. Novel genera have been discovered leading to new chemotypes, but more surprisingly several instances have been uncovered where the apparently general rules of modular translation have not applied. Several new biosynthetic pathways have been unearthed, and our general knowledge grows rapidly. This review aims to highlight some of the more striking discoveries and advances of the decade.

  14. Algorithm, applications and evaluation for protein comparison by Ramanujan Fourier transform.

    PubMed

    Zhao, Jian; Wang, Jiasong; Hua, Wei; Ouyang, Pingkai

    2015-12-01

    The amino acid sequence of a protein determines its chemical properties, chain conformation and biological functions. Protein sequence comparison is of great importance to identify similarities of protein structures and infer their functions. Many properties of a protein correspond to the low-frequency signals within the sequence. Low frequency modes in protein sequences are linked to the secondary structures, membrane protein types, and sub-cellular localizations of the proteins. In this paper, we present Ramanujan Fourier transform (RFT) with a fast algorithm to analyze the low-frequency signals of protein sequences. The RFT method is applied to similarity analysis of protein sequences with the Resonant Recognition Model (RRM). The results show that the proposed fast RFT method on protein comparison is more efficient than commonly used discrete Fourier transform (DFT). RFT can detect common frequencies as significant feature for specific protein families, and the RFT spectrum heat-map of protein sequences demonstrates the information conservation in the sequence comparison. The proposed method offers a new tool for pattern recognition, feature extraction and structural analysis on protein sequences. Copyright © 2015 Elsevier Ltd. All rights reserved.

  15. Chromatin accessibility and guide sequence secondary structure affect CRISPR-Cas9 gene editing efficiency.

    PubMed

    Jensen, Kristopher Torp; Fløe, Lasse; Petersen, Trine Skov; Huang, Jinrong; Xu, Fengping; Bolund, Lars; Luo, Yonglun; Lin, Lin

    2017-07-01

    Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)-associated protein 9 (CRISPR-Cas9) systems have emerged as the method of choice for genome editing, but large variations in on-target efficiencies continue to limit their applicability. Here, we investigate the effect of chromatin accessibility on Cas9-mediated gene editing efficiency for 20 gRNAs targeting 10 genomic loci in HEK293T cells using both SpCas9 and the eSpCas9(1.1) variant. Our study indicates that gene editing is more efficient in euchromatin than in heterochromatin, and we validate this finding in HeLa cells and in human fibroblasts. Furthermore, we investigate the gRNA sequence determinants of CRISPR-Cas9 activity using a surrogate reporter system and find that the efficiency of Cas9-mediated gene editing is dependent on guide sequence secondary structure formation. This knowledge can aid in the further improvement of tools for gRNA design. © 2017 Federation of European Biochemical Societies.

  16. Bioinformatic Analysis of the Contribution of Primer Sequences to Aptamer Structures

    PubMed Central

    Ellington, Andrew D.

    2009-01-01

    Aptamers are nucleic acid molecules selected in vitro to bind a particular ligand. While numerous experimental studies have examined the sequences, structures, and functions of individual aptamers, considerably fewer studies have applied bioinformatics approaches to try to infer more general principles from these individual studies. We have used a large Aptamer Database to parse the contributions of both random and constant regions to the secondary structures of more than 2000 aptamers. We find that the constant, primer-binding regions do not, in general, contribute significantly to aptamer structures. These results suggest that (a) binding function is not contributed to nor constrained by constant regions; (b) in consequence, the landscape of functional binding sequences is sparse but robust, favoring scenarios for short, functional nucleic acid sequences near origins; and (c) many pool designs for the selection of aptamers are likely to prove robust. PMID:18594898

  17. Covariant Evolutionary Event Analysis for Base Interaction Prediction Using a Relational Database Management System for RNA.

    PubMed

    Xu, Weijia; Ozer, Stuart; Gutell, Robin R

    2009-01-01

    With an increasingly large amount of sequences properly aligned, comparative sequence analysis can accurately identify not only common structures formed by standard base pairing but also new types of structural elements and constraints. However, traditional methods are too computationally expensive to perform well on large scale alignment and less effective with the sequences from diversified phylogenetic classifications. We propose a new approach that utilizes coevolutional rates among pairs of nucleotide positions using phylogenetic and evolutionary relationships of the organisms of aligned sequences. With a novel data schema to manage relevant information within a relational database, our method, implemented with a Microsoft SQL Server 2005, showed 90% sensitivity in identifying base pair interactions among 16S ribosomal RNA sequences from Bacteria, at a scale 40 times bigger and 50% better sensitivity than a previous study. The results also indicated covariation signals for a few sets of cross-strand base stacking pairs in secondary structure helices, and other subtle constraints in the RNA structure.

  18. Covariant Evolutionary Event Analysis for Base Interaction Prediction Using a Relational Database Management System for RNA

    PubMed Central

    Xu, Weijia; Ozer, Stuart; Gutell, Robin R.

    2010-01-01

    With an increasingly large amount of sequences properly aligned, comparative sequence analysis can accurately identify not only common structures formed by standard base pairing but also new types of structural elements and constraints. However, traditional methods are too computationally expensive to perform well on large scale alignment and less effective with the sequences from diversified phylogenetic classifications. We propose a new approach that utilizes coevolutional rates among pairs of nucleotide positions using phylogenetic and evolutionary relationships of the organisms of aligned sequences. With a novel data schema to manage relevant information within a relational database, our method, implemented with a Microsoft SQL Server 2005, showed 90% sensitivity in identifying base pair interactions among 16S ribosomal RNA sequences from Bacteria, at a scale 40 times bigger and 50% better sensitivity than a previous study. The results also indicated covariation signals for a few sets of cross-strand base stacking pairs in secondary structure helices, and other subtle constraints in the RNA structure. PMID:20502534

  19. An Image Processing Approach to Computing Distances Between RNA Secondary Structures Dot Plots (PREPRINT)

    DTIC Science & Technology

    2007-03-01

    the P5abc subdomain of the tetrahymena thermophila ribozyme that was studied by Wu and Tinoco [24]. The results for the second sequence are found in...virus ribozyme that was studied by Lazinski et al. [25], for its regulation of self-cleavage activity. The results for the third sequence are found...mention the existence of eight possible mutations that provide the desired non-linear effect in the ribozyme structure, and this may explain the

  20. Peptoid architectures: elaboration, actuation, and application.

    PubMed

    Yoo, Barney; Kirshenbaum, Kent

    2008-12-01

    Peptoids are peptidomimetic oligomers composed of N-substituted glycine units. Their convenient synthesis enables strict control over the sequence of highly diverse monomers and is capable of generating extensive compound libraries. Recent studies are beginning to explore the relationship between peptoid sequence, structure and function. We describe new approaches to direct the conformation of the peptoid backbone, leading to secondary structures such as helices, loops, and turns. These advances are enabling the discovery of bioactive peptoids and will establish modules for the design and assembly of protein mimetics.

  1. Fluorescent DNA-templated silver nanoclusters

    NASA Astrophysics Data System (ADS)

    Lin, Ruoqian

    Because of the ultra-small size and biocompatibility of silver nanoclusters, they have attracted much research interest for their applications in biolabeling. Among the many ways of synthesizing silver nanoclusters, DNA templated method is particularly attractive---the high tunability of DNA sequences provides another degree of freedom for controlling the chemical and photophysical properties. However, systematic studies about how DNA sequences and concentrations are controlling the photophysical properties are still lacking. The aim of this thesis is to investigate the binding mechanisms of silver clusters binding and single stranded DNAs. Here in this thesis, we report synthesis and characterization of DNA-templated silver nanoclusters and provide a systematic interrogation of the effects of DNA concentrations and sequences, including lengths and secondary structures. We performed a series of syntheses utilizing five different sequences to explore the optimal synthesis condition. By characterizing samples with UV-vis and fluorescence spectroscopy, we achieved the most proper reactants ratio and synthesis conditions. Two of them were chosen for further concentration dependence studies and sequence dependence studies. We found that cytosine-rich sequences are more likely to produce silver nanoclusters with stronger fluorescence signals; however, sequences with hairpin secondary structures are more capable in stabilizing silver nanoclusters. In addition, the fluorescence peak emission intensities and wavelengths of the DNA templated silver clusters have sequence dependent fingerprints. This potentially can be applied to sequence sensing in the future. However all the current conclusions are not warranted; there is still difficulty in formulating general rules in DNA strand design and silver nanocluster production. Further investigation of more sequences could solve these questions in the future.

  2. Secondary Moments due to Prestressing with Different Bond at the Ultimate Limit State

    NASA Astrophysics Data System (ADS)

    Halvoník, Jaroslav; Pažma, Peter; Vida, Radoslav

    2018-03-01

    Secondary effects of prestressing develop in statically indeterminate structures (e.g., continuous beams) due to the restraint of deformations imposed by hyperstatic restraints. These effects may significantly influence internal forces and stresses in prestressed structures. Secondary effects are influenced by the redundancy of a structural system, which raises the question of whether they will remain constant after a change in the structural system, e.g., due to the development of plastic hinge(s) in a critical cross-section(s) or after the development of a kinematic mechanism, or if they will disappear when the structure changes into a sequence of simply supported beams. The paper deals with an investigation of the behavior of continuous post-tensioned beams subjected to an ultimate load with significant secondary effects from prestressing. A total of 6 two-span beams prestressed by tendons with different bonds were tested in a laboratory with a load that changed their structural system into a kinematic mechanism. The internal forces and secondary effects of the prestressing were controlled through measurements of the reactions in all the supports. The results revealed that the secondary effects remained as a permanent part of the action on the experimental beams, even after the development of the kinematic mechanism. The results obtained confirmed that secondary effects should be included in all combinations of actions for verifications of ultimate limit states (ULS).

  3. Revisiting and re-engineering the classical zinc finger peptide: consensus peptide-1 (CP-1).

    PubMed

    Besold, Angelique N; Widger, Leland R; Namuswe, Frances; Michalek, Jamie L; Michel, Sarah L J; Goldberg, David P

    2016-04-01

    Zinc plays key structural and catalytic roles in biology. Structural zinc sites are often referred to as zinc finger (ZF) sites, and the classical ZF contains a Cys2His2 motif that is involved in coordinating Zn(II). An optimized Cys2His2 ZF, named consensus peptide 1 (CP-1), was identified more than 20 years ago using a limited set of sequenced proteins. We have reexamined the CP-1 sequence, using our current, much larger database of sequenced proteins that have been identified from high-throughput sequencing methods, and found the sequence to be largely unchanged. The CCHH ligand set of CP-1 was then altered to a CAHH motif to impart hydrolytic activity. This ligand set mimics the His2Cys ligand set of peptide deformylase (PDF), a hydrolytically active M(II)-centered (M = Zn or Fe) protein. The resultant peptide [CP-1(CAHH)] was evaluated for its ability to coordinate Zn(II) and Co(II) ions, adopt secondary structure, and promote hydrolysis. CP-1(CAHH) was found to coordinate Co(II) and Zn(II) and a pentacoordinate geometry for Co(II)-CP-1(CAHH) was implicated from UV-vis data. This suggests a His2Cys(H2O)2 environment at the metal center. The Zn(II)-bound CP-1(CAHH) was shown to adopt partial secondary structure by 1-D (1)H NMR spectroscopy. Both Zn(II)-CP-1(CAHH) and Co(II)-CP-1(CAHH) show good hydrolytic activity toward the test substrate 4-nitrophenyl acetate, exhibiting faster rates than most active synthetic Zn(II) complexes.

  4. Transitive homology-guided structural studies lead to discovery of Cro proteins with 40% sequence identity but different folds

    PubMed Central

    Roessler, Christian G.; Hall, Branwen M.; Anderson, William J.; Ingram, Wendy M.; Roberts, Sue A.; Montfort, William R.; Cordes, Matthew H. J.

    2008-01-01

    Proteins that share common ancestry may differ in structure and function because of divergent evolution of their amino acid sequences. For a typical diverse protein superfamily, the properties of a few scattered members are known from experiment. A satisfying picture of functional and structural evolution in relation to sequence changes, however, may require characterization of a larger, well chosen subset. Here, we employ a “stepping-stone” method, based on transitive homology, to target sequences intermediate between two related proteins with known divergent properties. We apply the approach to the question of how new protein folds can evolve from preexisting folds and, in particular, to an evolutionary change in secondary structure and oligomeric state in the Cro family of bacteriophage transcription factors, initially identified by sequence-structure comparison of distant homologs from phages P22 and λ. We report crystal structures of two Cro proteins, Xfaso 1 and Pfl 6, with sequences intermediate between those of P22 and λ. The domains show 40% sequence identity but differ by switching of α-helix to β-sheet in a C-terminal region spanning ≈25 residues. Sedimentation analysis also suggests a correlation between helix-to-sheet conversion and strengthened dimerization. PMID:18227506

  5. Complete genomic sequence of Powassan virus: evaluation of genetic elements in tick-borne versus mosquito-borne flaviviruses.

    PubMed

    Mandl, C W; Holzmann, H; Kunz, C; Heinz, F X

    1993-05-01

    The complete nucleotide sequence of the positive-stranded RNA genome of the tick-borne flavivirus Powassan (10,839 nucleotides) was elucidated and the amino acid sequence of all viral proteins was derived. Based on this sequence as well as serological data, Powassan virus represents the most divergent member of the tick-borne serocomplex within the genus flaviviruses, family Flaviviridae. The primary nucleotide sequence and potential RNA secondary structures of the Powassan virus genome as well as the protein sequences and the reactivities of the virion with a panel of monoclonal antibodies were compared to other tick-borne and mosquito-borne flaviviruses. These analyses corroborated significant differences between tick-borne and mosquito-borne flaviviruses, but also emphasized structural elements that are conserved among both vector groups. The comparisons among tick-borne flaviviruses revealed conserved sequence elements that might represent important determinants of the tick-borne flavivirus phenotype.

  6. Interspecific variation in mitochondrial serine transfer RNA (UCN) in Euptychiina butterflies (Lepidoptera: Satyrinae): structure and alignment.

    PubMed

    Marín, Mario Alejandro; López, Andrés; Uribe, Sandra Inés

    2012-06-01

    The nucleotide variation and structural patterns of mitochondrial RNA molecule have been proposed as useful tools in molecular systematics; however, their usefulness is always subject to a proper assessment of homology in the sequence alignment. The present study describes the secondary structure of mitochondrial tRNA for the amino acid serine (UCN) on 13 Euptychiina species and the evaluation of its potential use for evolutionary studies in this group of butterflies. The secondary structure of tRNAs showed variation among the included species except between Hermeuptychia sp1 and sp2. Variation was concentrated in the ribotimidina-pseudouridine-cystosine (TψC), dihydrouridine (DHU) and variable loops and in the DHU and TψC arms. These results suggest this region as a potential marker useful for taxonomic differentiation of species in this group and also confirm the importance of including information from the secondary structure of tRNA to optimize the alignments.

  7. Internal and external relationships of the Cnidaria: implications of primary and predicted secondary structure of the 5'-end of the 23S-like rDNA.

    PubMed Central

    Odorico, D M; Miller, D J

    1997-01-01

    Since both internal (class-level) and external relationships of the Cnidaria remain unclear on the basis of analyses of 18S and (partial) 16S rDNA sequence data, we examined the informativeness of the 5'-end of the 23S-like rDNA. Here we describe analyses of both primary and predicted secondary structure data for this region from the ctenophore Bolinopsis sp., the placozoan Trichoplax adhaerens, the sponge Hymeniacidon heliophila, and representatives of all four cnidarian classes. Primary sequence analyses clearly resolved the Cnidaria from other lower Metazoa, supported sister group relationships between the Scyphozoa and Cubozoa and between the Ctenophora and the Placozoa, and confirmed the basal status of the Anthozoa within the Cnidaria. Additionally, in the ctenophore, placozoan and sponge, non-canonical base pairing is required to maintain the secondary structure of the B12 region, whereas amongst the Cnidaria this is not the case. Although the phylogenetic significance of this molecular character is unclear, our analyses do not support the close relationship between Cnidaria and Placozoa suggested by previous studies. PMID:9061962

  8. Long non-coding RNA discovery across the genus anopheles reveals conserved secondary structures within and beyond the Gambiae complex.

    PubMed

    Jenkins, Adam M; Waterhouse, Robert M; Muskavitch, Marc A T

    2015-04-23

    Long non-coding RNAs (lncRNAs) have been defined as mRNA-like transcripts longer than 200 nucleotides that lack significant protein-coding potential, and many of them constitute scaffolds for ribonucleoprotein complexes with critical roles in epigenetic regulation. Various lncRNAs have been implicated in the modulation of chromatin structure, transcriptional and post-transcriptional gene regulation, and regulation of genomic stability in mammals, Caenorhabditis elegans, and Drosophila melanogaster. The purpose of this study is to identify the lncRNA landscape in the malaria vector An. gambiae and assess the evolutionary conservation of lncRNAs and their secondary structures across the Anopheles genus. Using deep RNA sequencing of multiple Anopheles gambiae life stages, we have identified 2,949 lncRNAs and more than 300 previously unannotated putative protein-coding genes. The lncRNAs exhibit differential expression profiles across life stages and adult genders. We find that across the genus Anopheles, lncRNAs display much lower sequence conservation than protein-coding genes. Additionally, we find that lncRNA secondary structure is highly conserved within the Gambiae complex, but diverges rapidly across the rest of the genus Anopheles. This study offers one of the first lncRNA secondary structure analyses in vector insects. Our description of lncRNAs in An. gambiae offers the most comprehensive genome-wide insights to date into lncRNAs in this vector mosquito, and defines a set of potential targets for the development of vector-based interventions that may further curb the human malaria burden in disease-endemic countries.

  9. Secondary Mathematics Course Trajectories: Understanding Accumulated Disadvantages in Mathematics in Grades 9-12

    ERIC Educational Resources Information Center

    Schiller, Kathryn S.; Hunt, Donald J.

    2011-01-01

    Schools are institutions in which students' course taking creates series of linked learning opportunities continually shaped by not only curricular structures but demographic and academic backgrounds. In contrast to a seven-step normative course sequence reflecting the conventional hierarchical structure of mathematics, analysis of more than…

  10. In silico study of breast cancer associated gene 3 using LION Target Engine and other tools.

    PubMed

    León, Darryl A; Cànaves, Jaume M

    2003-12-01

    Sequence analysis of individual targets is an important step in annotation and validation. As a test case, we investigated human breast cancer associated gene 3 (BCA3) with LION Target Engine and with other bioinformatics tools. LION Target Engine confirmed that the BCA3 gene is located on 11p15.4 and that the two most likely splice variants (lacking exon 3 and exons 3 and 5, respectively) exist. Based on our manual curation of sequence data, it is proposed that an additional variant (missing only exon 5) published in a public sequence repository, is a prediction artifact. A significant number of new orthologs were also identified, and these were the basis for a high-quality protein secondary structure prediction. Moreover, our research confirmed several distinct functional domains as described in earlier reports. Sequence conservation from multiple sequence alignments, splice variant identification, secondary structure predictions, and predicted phosphorylation sites suggest that the removal of interaction sites through alternative splicing might play a modulatory role in BCA3. This in silico approach shows the depth and relevance of an analysis that can be accomplished by including a variety of publicly available tools with an integrated and customizable life science informatics platform.

  11. Consistent global structures of complex RNA states through multidimensional chemical mapping

    PubMed Central

    Cheng, Clarence Yu; Chou, Fang-Chieh; Kladwang, Wipapat; Tian, Siqi; Cordero, Pablo; Das, Rhiju

    2015-01-01

    Accelerating discoveries of non-coding RNA (ncRNA) in myriad biological processes pose major challenges to structural and functional analysis. Despite progress in secondary structure modeling, high-throughput methods have generally failed to determine ncRNA tertiary structures, even at the 1-nm resolution that enables visualization of how helices and functional motifs are positioned in three dimensions. We report that integrating a new method called MOHCA-seq (Multiplexed •OH Cleavage Analysis with paired-end sequencing) with mutate-and-map secondary structure inference guides Rosetta 3D modeling to consistent 1-nm accuracy for intricately folded ncRNAs with lengths up to 188 nucleotides, including a blind RNA-puzzle challenge, the lariat-capping ribozyme. This multidimensional chemical mapping (MCM) pipeline resolves unexpected tertiary proximities for cyclic-di-GMP, glycine, and adenosylcobalamin riboswitch aptamers without their ligands and a loose structure for the recently discovered human HoxA9D internal ribosome entry site regulon. MCM offers a sequencing-based route to uncovering ncRNA 3D structure, applicable to functionally important but potentially heterogeneous states. DOI: http://dx.doi.org/10.7554/eLife.07600.001 PMID:26035425

  12. The gene coding for small ribosomal subunit RNA in the basidiomycete Ustilago maydis contains a group I intron.

    PubMed Central

    De Wachter, R; Neefs, J M; Goris, A; Van de Peer, Y

    1992-01-01

    The nucleotide sequence of the gene coding for small ribosomal subunit RNA in the basidiomycete Ustilago maydis was determined. It revealed the presence of a group I intron with a length of 411 nucleotides. This is the third occurrence of such an intron discovered in a small subunit rRNA gene encoded by a eukaryotic nuclear genome. The other two occurrences are in Pneumocystis carinii, a fungus of uncertain taxonomic status, and Ankistrodesmus stipitatus, a green alga. The nucleotides of the conserved core structure of 101 group I intron sequences present in different genes and genome types were aligned and their evolutionary relatedness was examined. This revealed a cluster including all group I introns hitherto found in eukaryotic nuclear genes coding for small and large subunit rRNAs. A secondary structure model was designed for the area of the Ustilago maydis small ribosomal subunit RNA precursor where the intron is situated. It shows that the internal guide sequence pairing with the intron boundaries fits between two helices of the small subunit rRNA, and that minimal rearrangement of base pairs suffices to achieve the definitive secondary structure of the 18S rRNA upon splicing. PMID:1561081

  13. Double-stranded RNA interferes in a sequence-specific manner with the infection of representative members of the two viroid families

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Carbonell, Alberto; Martinez de Alba, Angel-Emilio; Flores, Ricardo

    2008-02-05

    Infection by viroids, non-protein-coding circular RNAs, occurs with the accumulation of 21-24 nt viroid-derived small RNAs (vd-sRNAs) with characteristic properties of small interfering RNAs (siRNAs) associated to RNA silencing. The vd-sRNAs most likely derive from dicer-like (DCL) enzymes acting on viroid-specific dsRNA, the key elicitor of RNA silencing, or on the highly structured genomic RNA. Previously, viral dsRNAs delivered mechanically or agroinoculated have been shown to interfere with virus infection in a sequence-specific manner. Here, we report similar results with members of the two families of nuclear- and chloroplast-replicating viroids. Moreover, homologous vd-sRNAs co-delivered mechanically also interfered with one ofmore » the viroids examined. The interference was sequence-specific, temperature-dependent and, in some cases, also dependent on the dose of the co-inoculated dsRNA or vd-sRNAs. The sequence-specific nature of these effects suggests the involvement of the RNA induced silencing complex (RISC), which provides sequence specificity to RNA silencing machinery. Therefore, viroid titer in natural infections might be regulated by the concerted action of DCL and RISC. Viroids could have evolved their secondary structure as a compromise between resistance to DCL and RISC, which act preferentially against RNAs with compact and relaxed secondary structures, respectively. In addition, compartmentation, association with proteins or active replication might also help viroids to elude their host RNA silencing machinery.« less

  14. Structural analysis of the human U3 ribonucleoprotein particle reveal a conserved sequence available for base pairing with pre-rRNA.

    PubMed Central

    Parker, K A; Steitz, J A

    1987-01-01

    The human U3 ribonucleoprotein (RNP) has been analyzed to determine its protein constituents, sites of protein-RNA interaction, and RNA secondary structure. By using anti-U3 RNP antibodies and extracts prepared from HeLa cells labeled in vivo, the RNP was found to contain four nonphosphorylated proteins of 36, 30, 13, and 12.5 kilodaltons and two phosphorylated proteins of 74 and 59 kilodaltons. U3 nucleotides 72-90, 106-121, 154-166, and 190-217 must contain sites that interact with proteins since these regions are immunoprecipitated after treatment of the RNP with RNase A or T1. The secondary structure was probed with specific nucleases and by chemical modification with single-strand-specific reagents that block subsequent reverse transcription. Regions that are single stranded (and therefore potentially able to interact with a substrate RNA) include an evolutionarily conserved sequence at nucleotides 104-112 and nonconserved sequences at nucleotides 65-74, 80-84, and 88-93. Nucleotides 159-168 do not appear to be highly accessible, thus making it unlikely that this U3 sequence base pairs with sequences near the 5.8S rRNA-internal transcribed spacer II junction, as previously proposed. Alternative functions of the U3 RNP are discussed, including the possibility that U3 may participate in a processing event near the 3' end of 28S rRNA. Images PMID:2959855

  15. A transcriptome-wide, organ-specific regulatory map of Dendrobium officinale, an important traditional Chinese orchid herb

    PubMed Central

    Meng, Yijun; Yu, Dongliang; Xue, Jie; Lu, Jiangjie; Feng, Shangguo; Shen, Chenjia; Wang, Huizhong

    2016-01-01

    Dendrobium officinale is an important traditional Chinese herb. Here, we did a transcriptome-wide, organ-specific study on this valuable plant by combining RNA, small RNA (sRNA) and degradome sequencing. RNA sequencing of four organs (flower, root, leaf and stem) of Dendrobium officinale enabled us to obtain 536,558 assembled transcripts, from which 2,645, 256, 42 and 54 were identified to be highly expressed in the four organs respectively. Based on sRNA sequencing, 2,038, 2, 21 and 24 sRNAs were identified to be specifically accumulated in the four organs respectively. A total of 1,047 mature microRNA (miRNA) candidates were detected. Based on secondary structure predictions and sequencing, tens of potential miRNA precursors were identified from the assembled transcripts. Interestingly, phase-distributed sRNAs with degradome-based processing evidences were discovered on the long-stem structures of two precursors. Target identification was performed for the 1,047 miRNA candidates, resulting in the discovery of 1,257 miRNA--target pairs. Finally, some biological meaningful subnetworks involving hormone signaling, development, secondary metabolism and Argonaute 1-related regulation were established. All of the sequencing data sets are available at NCBI Sequence Read Archive (http://www.ncbi.nlm.nih.gov/sra/). Summarily, our study provides a valuable resource for the in-depth molecular and functional studies on this important Chinese orchid herb. PMID:26732614

  16. Distribution of genotype network sizes in sequence-to-structure genotype-phenotype maps.

    PubMed

    Manrubia, Susanna; Cuesta, José A

    2017-04-01

    An essential quantity to ensure evolvability of populations is the navigability of the genotype space. Navigability, understood as the ease with which alternative phenotypes are reached, relies on the existence of sufficiently large and mutually attainable genotype networks. The size of genotype networks (e.g. the number of RNA sequences folding into a particular secondary structure or the number of DNA sequences coding for the same protein structure) is astronomically large in all functional molecules investigated: an exhaustive experimental or computational study of all RNA folds or all protein structures becomes impossible even for moderately long sequences. Here, we analytically derive the distribution of genotype network sizes for a hierarchy of models which successively incorporate features of increasingly realistic sequence-to-structure genotype-phenotype maps. The main feature of these models relies on the characterization of each phenotype through a prototypical sequence whose sites admit a variable fraction of letters of the alphabet. Our models interpolate between two limit distributions: a power-law distribution, when the ordering of sites in the prototypical sequence is strongly constrained, and a lognormal distribution, as suggested for RNA, when different orderings of the same set of sites yield different phenotypes. Our main result is the qualitative and quantitative identification of those features of sequence-to-structure maps that lead to different distributions of genotype network sizes. © 2017 The Author(s).

  17. Structural variant of the intergenic internal ribosome entry site elements in dicistroviruses and computational search for their counterparts

    PubMed Central

    HATAKEYAMA, YOSHINORI; SHIBUYA, NORIHIRO; NISHIYAMA, TAKASHI; NAKASHIMA, NOBUHIKO

    2004-01-01

    The intergenic region (IGR) located upstream of the capsid protein gene in dicistroviruses contains an internal ribosome entry site (IRES). Translation initiation mediated by the IRES does not require initiator methionine tRNA. Comparison of the IGRs among dicistroviruses suggested that Taura syndrome virus (TSV) and acute bee paralysis virus have an extra side stem loop in the predicted IRES. We examined whether the side stem is responsible for translation activity mediated by the IGR using constructs with compensatory mutations. In vitro translation analysis showed that TSV has an IGR-IRES that is structurally distinct from those previously described. Because IGR-IRES elements determine the translation initiation site by virtue of their own tertiary structure formation, the discovery of this initiation mechanism suggests the possibility that eukaryotic mRNAs might have more extensive coding regions than previously predicted. To test this hypothesis, we searched full-length cDNA databases and whole genome sequences of eukaryotes using the pattern matching program, Scan For Matches, with parameters that can extract sequences containing secondary structure elements resembling those of IGR-IRES. Our search yielded several sequences, but their predicted secondary structures were suggested to be unstable in comparison to those of dicistroviruses. These results suggest that RNAs structurally similar to dicistroviruses are not common. If some eukaryotic mRNAs are translated independently of an initiator methionine tRNA, their structures are likely to be significantly distinct from those of dicistroviruses. PMID:15100433

  18. Recognition of chimeric small-subunit ribosomal DNAs composed of genes from uncultivated microorganisms

    NASA Technical Reports Server (NTRS)

    Kopczynski, E. D.; Bateson, M. M.; Ward, D. M.

    1994-01-01

    When PCR was used to recover small-subunit (SSU) rRNA genes from a hot spring cyanobacterial mat community, chimeric SSU rRNA sequences which exhibited little or no secondary structural abnormality were recovered. They were revealed as chimeras of SSU rRNA genes of uncultivated species through separate phylogenetic analysis of short sequence domains.

  19. Use of conserved key amino acid positions to morph protein folds.

    PubMed

    Reddy, Boojala V B; Li, Wilfred W; Bourne, Philip E

    2002-07-15

    By using three-dimensional (3D) structure alignments and a previously published method to determine Conserved Key Amino Acid Positions (CKAAPs) we propose a theoretical method to design mutations that can be used to morph the protein folds. The original Paracelsus challenge, met by several groups, called for the engineering of a stable but different structure by modifying less than 50% of the amino acid residues. We have used the sequences from the Protein Data Bank (PDB) identifiers 1ROP, and 2CRO, which were previously used in the Paracelsus challenge by those groups, and suggest mutation to CKAAPs to morph the protein fold. The total number of mutations suggested is less than 40% of the starting sequence theoretically improving the challenge results. From secondary structure prediction experiments of the proposed mutant sequence structures, we observe that each of the suggested mutant protein sequences likely folds to a different, non-native potentially stable target structure. These results are an early indicator that analyses using structure alignments leading to CKAAPs of a given structure are of value in protein engineering experiments. Copyright 2002 Wiley Periodicals, Inc.

  20. Native aggregation as a cause of origin of temporary cellular structures needed for all forms of cellular activity, signaling and transformations.

    PubMed

    Matveev, Vladimir V

    2010-06-09

    According to the hypothesis explored in this paper, native aggregation is genetically controlled (programmed) reversible aggregation that occurs when interacting proteins form new temporary structures through highly specific interactions. It is assumed that Anfinsen's dogma may be extended to protein aggregation: composition and amino acid sequence determine not only the secondary and tertiary structure of single protein, but also the structure of protein aggregates (associates). Cell function is considered as a transition between two states (two states model), the resting state and state of activity (this applies to the cell as a whole and to its individual structures). In the resting state, the key proteins are found in the following inactive forms: natively unfolded and globular. When the cell is activated, secondary structures appear in natively unfolded proteins (including unfolded regions in other proteins), and globular proteins begin to melt and their secondary structures become available for interaction with the secondary structures of other proteins. These temporary secondary structures provide a means for highly specific interactions between proteins. As a result, native aggregation creates temporary structures necessary for cell activity."One of the principal objects of theoretical research in any department of knowledge is to find the point of view from which the subject appears in its greatest simplicity."Josiah Willard Gibbs (1839-1903).

  1. Computation of statistical secondary structure of nucleic acids.

    PubMed Central

    Yamamoto, K; Kitamura, Y; Yoshikura, H

    1984-01-01

    This paper presents a computer analysis of statistical secondary structure of nucleic acids. For a given single stranded nucleic acid, we generated "structure map" which included all the annealing structures in the sequence. The map was transformed into "energy map" by rough approximation; here, the energy level of every pairing structure consisting of more than 2 successive nucleic acid pairs was calculated. By using the "energy map", the probability of occurrence of each annealed structure was computed, i.e., the structure was computed statistically. The basis of computation was the 8-queen problem in the chess game. The validity of our computer programme was checked by computing tRNA structure which has been well established. Successful application of this programme to small nuclear RNAs of various origins is demonstrated. PMID:6198622

  2. DWARF – a data warehouse system for analyzing protein families

    PubMed Central

    Fischer, Markus; Thai, Quan K; Grieb, Melanie; Pleiss, Jürgen

    2006-01-01

    Background The emerging field of integrative bioinformatics provides the tools to organize and systematically analyze vast amounts of highly diverse biological data and thus allows to gain a novel understanding of complex biological systems. The data warehouse DWARF applies integrative bioinformatics approaches to the analysis of large protein families. Description The data warehouse system DWARF integrates data on sequence, structure, and functional annotation for protein fold families. The underlying relational data model consists of three major sections representing entities related to the protein (biochemical function, source organism, classification to homologous families and superfamilies), the protein sequence (position-specific annotation, mutant information), and the protein structure (secondary structure information, superimposed tertiary structure). Tools for extracting, transforming and loading data from public available resources (ExPDB, GenBank, DSSP) are provided to populate the database. The data can be accessed by an interface for searching and browsing, and by analysis tools that operate on annotation, sequence, or structure. We applied DWARF to the family of α/β-hydrolases to host the Lipase Engineering database. Release 2.3 contains 6138 sequences and 167 experimentally determined protein structures, which are assigned to 37 superfamilies 103 homologous families. Conclusion DWARF has been designed for constructing databases of large structurally related protein families and for evaluating their sequence-structure-function relationships by a systematic analysis of sequence, structure and functional annotation. It has been applied to predict biochemical properties from sequence, and serves as a valuable tool for protein engineering. PMID:17094801

  3. Prediction of Protein Structural Classes for Low-Similarity Sequences Based on Consensus Sequence and Segmented PSSM.

    PubMed

    Liang, Yunyun; Liu, Sanyang; Zhang, Shengli

    2015-01-01

    Prediction of protein structural classes for low-similarity sequences is useful for understanding fold patterns, regulation, functions, and interactions of proteins. It is well known that feature extraction is significant to prediction of protein structural class and it mainly uses protein primary sequence, predicted secondary structure sequence, and position-specific scoring matrix (PSSM). Currently, prediction solely based on the PSSM has played a key role in improving the prediction accuracy. In this paper, we propose a novel method called CSP-SegPseP-SegACP by fusing consensus sequence (CS), segmented PsePSSM, and segmented autocovariance transformation (ACT) based on PSSM. Three widely used low-similarity datasets (1189, 25PDB, and 640) are adopted in this paper. Then a 700-dimensional (700D) feature vector is constructed and the dimension is decreased to 224D by using principal component analysis (PCA). To verify the performance of our method, rigorous jackknife cross-validation tests are performed on 1189, 25PDB, and 640 datasets. Comparison of our results with the existing PSSM-based methods demonstrates that our method achieves the favorable and competitive performance. This will offer an important complementary to other PSSM-based methods for prediction of protein structural classes for low-similarity sequences.

  4. Identifying novel sequence variants of RNA 3D motifs

    PubMed Central

    Zirbel, Craig L.; Roll, James; Sweeney, Blake A.; Petrov, Anton I.; Pirrung, Meg; Leontis, Neocles B.

    2015-01-01

    Predicting RNA 3D structure from sequence is a major challenge in biophysics. An important sub-goal is accurately identifying recurrent 3D motifs from RNA internal and hairpin loop sequences extracted from secondary structure (2D) diagrams. We have developed and validated new probabilistic models for 3D motif sequences based on hybrid Stochastic Context-Free Grammars and Markov Random Fields (SCFG/MRF). The SCFG/MRF models are constructed using atomic-resolution RNA 3D structures. To parameterize each model, we use all instances of each motif found in the RNA 3D Motif Atlas and annotations of pairwise nucleotide interactions generated by the FR3D software. Isostericity relations between non-Watson–Crick basepairs are used in scoring sequence variants. SCFG techniques model nested pairs and insertions, while MRF ideas handle crossing interactions and base triples. We use test sets of randomly-generated sequences to set acceptance and rejection thresholds for each motif group and thus control the false positive rate. Validation was carried out by comparing results for four motif groups to RMDetect. The software developed for sequence scoring (JAR3D) is structured to automatically incorporate new motifs as they accumulate in the RNA 3D Motif Atlas when new structures are solved and is available free for download. PMID:26130723

  5. A protein block based fold recognition method for the annotation of twilight zone sequences.

    PubMed

    Suresh, V; Ganesan, K; Parthasarathy, S

    2013-03-01

    The description of protein backbone was recently improved with a group of structural fragments called Structural Alphabets instead of the regular three states (Helix, Sheet and Coil) secondary structure description. Protein Blocks is one of the Structural Alphabets used to describe each and every region of protein backbone including the coil. According to de Brevern (2000) the Protein Blocks has 16 structural fragments and each one has 5 residues in length. Protein Blocks fragments are highly informative among the available Structural Alphabets and it has been used for many applications. Here, we present a protein fold recognition method based on Protein Blocks for the annotation of twilight zone sequences. In our method, we align the predicted Protein Blocks of a query amino acid sequence with a library of assigned Protein Blocks of 953 known folds using the local pair-wise alignment. The alignment results with z-value ≥ 2.5 and P-value ≤ 0.08 are predicted as possible folds. Our method is able to recognize the possible folds for nearly 35.5% of the twilight zone sequences with their predicted Protein Block sequence obtained by pb_prediction, which is available at Protein Block Export server.

  6. Structural elucidation and molecular characterization of Marinobacter sp. α-amylase.

    PubMed

    Kumar, Sumit; Khan, Rizwan Hasan; Khare, S K

    2016-01-01

    Halophiles have been perceived as potential source of novel enzymes in recent years. The interest emanates from their ability to catalyze efficiently under high salt and organic solvents. Marinobacter sp. EMB8 α-amylase was found to be active and stable in salt and organic solvents. A study was carried out using circular dichroism (CD), fluorescence spectroscopy, and bioinformatics analysis of similar protein sequence to ascertain molecular basis of salt and solvent adaptability of α-amylase. Structural changes recorded in the presence of varying amounts of NaCl exhibited an increase in negative ellipticity as a function of salt, confirming that salt stabilizes the protein and increases the secondary structure, making it catalytically functional. The data of intrinsic and extrinsic fluorescence (using 1-anilinonaphthalene 8-sulfonate [ANS] as probe) further confirmed the role of salt. The α-amylase was active in the presence of nonpolar solvents, namely, hexane and decane, but inactivated by ethanol. The decrease in the activity was correlated with the loss of tertiary structure in the presence of ethanol. Guanidine hydrochloride and pH denaturation indicated the molten globule state at pH 4.0. Partial N-terminal amino acid sequence of the purified α-amylase revealed the relatedness to Pseudoalteromonas sp. α-amylase. "FVHLFEW" was found as the N-terminal signature sequence. Bioinformatics analysis was done using M. algicola α-amylase protein having the same N-terminal signature sequence. The three-dimensional structure of Marinobacter α-amylase was deduced using the I-TASSER server, which reflected the enrichment of acidic amino acids on the surface, imparting the stability in the presence of salt. Our study clearly indicate that salt is necessary for maintaining the secondary and tertiary structure of halophilic protein, which is a necessary prerequisite for catalysis.

  7. Probing Xist RNA Structure in Cells Using Targeted Structure-Seq

    PubMed Central

    Rutenberg-Schoenberg, Michael; Simon, Matthew D.

    2015-01-01

    The long non-coding RNA (lncRNA) Xist is a master regulator of X-chromosome inactivation in mammalian cells. Models for how Xist and other lncRNAs function depend on thermodynamically stable secondary and higher-order structures that RNAs can form in the context of a cell. Probing accessible RNA bases can provide data to build models of RNA conformation that provide insight into RNA function, molecular evolution, and modularity. To study the structure of Xist in cells, we built upon recent advances in RNA secondary structure mapping and modeling to develop Targeted Structure-Seq, which combines chemical probing of RNA structure in cells with target-specific massively parallel sequencing. By enriching for signals from the RNA of interest, Targeted Structure-Seq achieves high coverage of the target RNA with relatively few sequencing reads, thus providing a targeted and scalable approach to analyze RNA conformation in cells. We use this approach to probe the full-length Xist lncRNA to develop new models for functional elements within Xist, including the repeat A element in the 5’-end of Xist. This analysis also identified new structural elements in Xist that are evolutionarily conserved, including a new element proximal to the C repeats that is important for Xist function. PMID:26646615

  8. GeneSilico protein structure prediction meta-server.

    PubMed

    Kurowski, Michal A; Bujnicki, Janusz M

    2003-07-01

    Rigorous assessments of protein structure prediction have demonstrated that fold recognition methods can identify remote similarities between proteins when standard sequence search methods fail. It has been shown that the accuracy of predictions is improved when refined multiple sequence alignments are used instead of single sequences and if different methods are combined to generate a consensus model. There are several meta-servers available that integrate protein structure predictions performed by various methods, but they do not allow for submission of user-defined multiple sequence alignments and they seldom offer confidentiality of the results. We developed a novel WWW gateway for protein structure prediction, which combines the useful features of other meta-servers available, but with much greater flexibility of the input. The user may submit an amino acid sequence or a multiple sequence alignment to a set of methods for primary, secondary and tertiary structure prediction. Fold-recognition results (target-template alignments) are converted into full-atom 3D models and the quality of these models is uniformly assessed. A consensus between different FR methods is also inferred. The results are conveniently presented on-line on a single web page over a secure, password-protected connection. The GeneSilico protein structure prediction meta-server is freely available for academic users at http://genesilico.pl/meta.

  9. GeneSilico protein structure prediction meta-server

    PubMed Central

    Kurowski, Michal A.; Bujnicki, Janusz M.

    2003-01-01

    Rigorous assessments of protein structure prediction have demonstrated that fold recognition methods can identify remote similarities between proteins when standard sequence search methods fail. It has been shown that the accuracy of predictions is improved when refined multiple sequence alignments are used instead of single sequences and if different methods are combined to generate a consensus model. There are several meta-servers available that integrate protein structure predictions performed by various methods, but they do not allow for submission of user-defined multiple sequence alignments and they seldom offer confidentiality of the results. We developed a novel WWW gateway for protein structure prediction, which combines the useful features of other meta-servers available, but with much greater flexibility of the input. The user may submit an amino acid sequence or a multiple sequence alignment to a set of methods for primary, secondary and tertiary structure prediction. Fold-recognition results (target-template alignments) are converted into full-atom 3D models and the quality of these models is uniformly assessed. A consensus between different FR methods is also inferred. The results are conveniently presented on-line on a single web page over a secure, password-protected connection. The GeneSilico protein structure prediction meta-server is freely available for academic users at http://genesilico.pl/meta. PMID:12824313

  10. Sequencing proteins with transverse ionic transport in nanochannels.

    PubMed

    Boynton, Paul; Di Ventra, Massimiliano

    2016-05-03

    De novo protein sequencing is essential for understanding cellular processes that govern the function of living organisms and all sequence modifications that occur after a protein has been constructed from its corresponding DNA code. By obtaining the order of the amino acids that compose a given protein one can then determine both its secondary and tertiary structures through structure prediction, which is used to create models for protein aggregation diseases such as Alzheimer's Disease. Here, we propose a new technique for de novo protein sequencing that involves translocating a polypeptide through a synthetic nanochannel and measuring the ionic current of each amino acid through an intersecting perpendicular nanochannel. We find that the distribution of ionic currents for each of the 20 proteinogenic amino acids encoded by eukaryotic genes is statistically distinct, showing this technique's potential for de novo protein sequencing.

  11. Evaluating the accuracy of SHAPE-directed RNA secondary structure predictions

    PubMed Central

    Sükösd, Zsuzsanna; Swenson, M. Shel; Kjems, Jørgen; Heitsch, Christine E.

    2013-01-01

    Recent advances in RNA structure determination include using data from high-throughput probing experiments to improve thermodynamic prediction accuracy. We evaluate the extent and nature of improvements in data-directed predictions for a diverse set of 16S/18S ribosomal sequences using a stochastic model of experimental SHAPE data. The average accuracy for 1000 data-directed predictions always improves over the original minimum free energy (MFE) structure. However, the amount of improvement varies with the sequence, exhibiting a correlation with MFE accuracy. Further analysis of this correlation shows that accurate MFE base pairs are typically preserved in a data-directed prediction, whereas inaccurate ones are not. Thus, the positive predictive value of common base pairs is consistently higher than the directed prediction accuracy. Finally, we confirm sequence dependencies in the directability of thermodynamic predictions and investigate the potential for greater accuracy improvements in the worst performing test sequence. PMID:23325843

  12. RNA Secondary Structure Prediction by Using Discrete Mathematics: An Interdisciplinary Research Experience for Undergraduate Students

    PubMed Central

    Ellington, Roni; Wachira, James

    2010-01-01

    The focus of this Research Experience for Undergraduates (REU) project was on RNA secondary structure prediction by using a lattice walk approach. The lattice walk approach is a combinatorial and computational biology method used to enumerate possible secondary structures and predict RNA secondary structure from RNA sequences. The method uses discrete mathematical techniques and identifies specified base pairs as parameters. The goal of the REU was to introduce upper-level undergraduate students to the principles and challenges of interdisciplinary research in molecular biology and discrete mathematics. At the beginning of the project, students from the biology and mathematics departments of a mid-sized university received instruction on the role of secondary structure in the function of eukaryotic RNAs and RNA viruses, RNA related to combinatorics, and the National Center for Biotechnology Information resources. The student research projects focused on RNA secondary structure prediction on a regulatory region of the yellow fever virus RNA genome and on an untranslated region of an mRNA of a gene associated with the neurological disorder epilepsy. At the end of the project, the REU students gave poster and oral presentations, and they submitted written final project reports to the program director. The outcome of the REU was that the students gained transferable knowledge and skills in bioinformatics and an awareness of the applications of discrete mathematics to biological research problems. PMID:20810968

  13. RNA secondary structure prediction by using discrete mathematics: an interdisciplinary research experience for undergraduate students.

    PubMed

    Ellington, Roni; Wachira, James; Nkwanta, Asamoah

    2010-01-01

    The focus of this Research Experience for Undergraduates (REU) project was on RNA secondary structure prediction by using a lattice walk approach. The lattice walk approach is a combinatorial and computational biology method used to enumerate possible secondary structures and predict RNA secondary structure from RNA sequences. The method uses discrete mathematical techniques and identifies specified base pairs as parameters. The goal of the REU was to introduce upper-level undergraduate students to the principles and challenges of interdisciplinary research in molecular biology and discrete mathematics. At the beginning of the project, students from the biology and mathematics departments of a mid-sized university received instruction on the role of secondary structure in the function of eukaryotic RNAs and RNA viruses, RNA related to combinatorics, and the National Center for Biotechnology Information resources. The student research projects focused on RNA secondary structure prediction on a regulatory region of the yellow fever virus RNA genome and on an untranslated region of an mRNA of a gene associated with the neurological disorder epilepsy. At the end of the project, the REU students gave poster and oral presentations, and they submitted written final project reports to the program director. The outcome of the REU was that the students gained transferable knowledge and skills in bioinformatics and an awareness of the applications of discrete mathematics to biological research problems.

  14. Common folds and transport mechanisms of secondary active transporters.

    PubMed

    Shi, Yigong

    2013-01-01

    Secondary active transporters exploit the electrochemical potential of solutes to shuttle specific substrate molecules across biological membranes, usually against their concentration gradient. Transporters of different functional families with little sequence similarity have repeatedly been found to exhibit similar folds, exemplified by the MFS, LeuT, and NhaA folds. Observations of multiple conformational states of the same transporter, represented by the LeuT superfamily members Mhp1, AdiC, vSGLT, and LeuT, led to proposals that structural changes are associated with substrate binding and transport. Despite recent biochemical and structural advances, our understanding of substrate recognition and energy coupling is rather preliminary. This review focuses on the common folds and shared transport mechanisms of secondary active transporters. Available structural information generally supports the alternating access model for substrate transport, with variations and extensions made by emerging structural, biochemical, and computational evidence.

  15. Two-dimensional sup 1 H NMR studies on HPr protein from Staphylococcus aureus: Complete sequential assignments and secondary structure

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kalbitzer, H.R.; Neidig, K.P.; Hengstenberg, W.

    1991-11-19

    Complete sequence-specific assignments of the {sup 1}H NMR spectrum of HPr protein from Staphylococcus aureus were obtained by two-dimensional NMR methods. Important secondary structure elements that can be derived from the observed nuclear Overhauser effects are a large antiparallel {beta}-pleated sheet consisting of four strands, A, B, C, D, a segment S{sub AB} consisting of an extended region around the active-center histidine (His-15) and an {alpha}-helix, a half-turn between strands B and C, a segment S{sub CD} which shows no typical secondary structure, and the {alpha}-helical, C-terminal segment S{sub term}. These general structural features are similar to those found earliermore » in HPr proteins from different microorganisms such as Escherichia coli, Bacillus subtilis, and Streptococcus faecalis.« less

  16. Efficient pairwise RNA structure prediction using probabilistic alignment constraints in Dynalign

    PubMed Central

    2007-01-01

    Background Joint alignment and secondary structure prediction of two RNA sequences can significantly improve the accuracy of the structural predictions. Methods addressing this problem, however, are forced to employ constraints that reduce computation by restricting the alignments and/or structures (i.e. folds) that are permissible. In this paper, a new methodology is presented for the purpose of establishing alignment constraints based on nucleotide alignment and insertion posterior probabilities. Using a hidden Markov model, posterior probabilities of alignment and insertion are computed for all possible pairings of nucleotide positions from the two sequences. These alignment and insertion posterior probabilities are additively combined to obtain probabilities of co-incidence for nucleotide position pairs. A suitable alignment constraint is obtained by thresholding the co-incidence probabilities. The constraint is integrated with Dynalign, a free energy minimization algorithm for joint alignment and secondary structure prediction. The resulting method is benchmarked against the previous version of Dynalign and against other programs for pairwise RNA structure prediction. Results The proposed technique eliminates manual parameter selection in Dynalign and provides significant computational time savings in comparison to prior constraints in Dynalign while simultaneously providing a small improvement in the structural prediction accuracy. Savings are also realized in memory. In experiments over a 5S RNA dataset with average sequence length of approximately 120 nucleotides, the method reduces computation by a factor of 2. The method performs favorably in comparison to other programs for pairwise RNA structure prediction: yielding better accuracy, on average, and requiring significantly lesser computational resources. Conclusion Probabilistic analysis can be utilized in order to automate the determination of alignment constraints for pairwise RNA structure prediction methods in a principled fashion. These constraints can reduce the computational and memory requirements of these methods while maintaining or improving their accuracy of structural prediction. This extends the practical reach of these methods to longer length sequences. The revised Dynalign code is freely available for download. PMID:17445273

  17. The primary structure of rat liver ribosomal protein L37. Homology with yeast and bacterial ribosomal proteins.

    PubMed

    Lin, A; McNally, J; Wool, I G

    1983-09-10

    The covalent structure of the rat liver 60 S ribosomal subunit protein L37 was determined. Twenty-four tryptic peptides were purified and the sequence of each was established; they accounted for all 111 residues of L37. The sequence of the first 30 residues of L37, obtained previously by automated Edman degradation of the intact protein, provided the alignment of the first 9 tryptic peptides. Three peptides (CN1, CN2, and CN3) were produced by cleavage of protein L37 with cyanogen bromide. The sequence of CN1 (65 residues) was established from the sequence of secondary peptides resulting from cleavage with trypsin and chymotrypsin. The sequence of CN1 in turn served to order tryptic peptides 1 through 14. The sequence of CN2 (15 residues) was determined entirely by a micromanual procedure and allowed the alignment of tryptic peptides 14 through 18. The sequence of the NH2-terminal 28 amino acids of CN3 (31 residues) was determined; in addition the complete sequences of the secondary tryptic and chymotryptic peptides were done. The sequence of CN3 provided the order of tryptic peptides 18 through 24. Thus the sequence of the three cyanogen bromide peptides also accounted for the 111 residues of protein L37. The carboxyl-terminal amino acids were identified after carboxypeptidase A treatment. There is a disulfide bridge between half-cystinyl residues at positions 40 and 69. Rat liver ribosomal protein L37 is homologous with yeast YP55 and with Escherichia coli L34. Moreover, there is a segment of 17 residues in rat L37 that occurs, albeit with modifications, in yeast YP55 and in E. coli S4, L20, and L34.

  18. StrBioLib: a Java library for development of custom computational structural biology applications.

    PubMed

    Chandonia, John-Marc

    2007-08-01

    StrBioLib is a library of Java classes useful for developing software for computational structural biology research. StrBioLib contains classes to represent and manipulate protein structures, biopolymer sequences, sets of biopolymer sequences, and alignments between biopolymers based on either sequence or structure. Interfaces are provided to interact with commonly used bioinformatics applications, including (psi)-blast, modeller, muscle and Primer3, and tools are provided to read and write many file formats used to represent bioinformatic data. The library includes a general-purpose neural network object with multiple training algorithms, the Hooke and Jeeves non-linear optimization algorithm, and tools for efficient C-style string parsing and formatting. StrBioLib is the basis for the Pred2ary secondary structure prediction program, is used to build the astral compendium for sequence and structure analysis, and has been extensively tested through use in many smaller projects. Examples and documentation are available at the site below. StrBioLib may be obtained under the terms of the GNU LGPL license from http://strbio.sourceforge.net/

  19. Special Focus

    PubMed Central

    Nawrocki, Eric P.; Burge, Sarah W.

    2013-01-01

    The development of RNA bioinformatic tools began more than 30 y ago with the description of the Nussinov and Zuker dynamic programming algorithms for single sequence RNA secondary structure prediction. Since then, many tools have been developed for various RNA sequence analysis problems such as homology search, multiple sequence alignment, de novo RNA discovery, read-mapping, and many more. In this issue, we have collected a sampling of reviews and original research that demonstrate some of the many ways bioinformatics is integrated with current RNA biology research. PMID:23948768

  20. The Influence of Primary and Secondary DNA Structure in Deletion and Duplication between Direct Repeats in Escherichia Coli

    PubMed Central

    Trinh, T. Q.; Sinden, R. R.

    1993-01-01

    We describe a system to measure the frequency of both deletions and duplications between direct repeats. Short 17- and 18-bp palindromic and nonpalindromic DNA sequences were cloned into the EcoRI site within the chloramphenicol acetyltransferase gene of plasmids pBR325 and pJT7. This creates an insert between direct repeated EcoRI sites and results in a chloramphenicol-sensitive phenotype. Selection for chloramphenicol resistance was utilized to select chloramphenicol resistant revertants that included those with precise deletion of the insert from plasmid pBR325 and duplication of the insert in plasmid pJT7. The frequency of deletion or duplication varied more than 500-fold depending on the sequence of the short sequence inserted into the EcoRI site. For the nonpalindromic inserts, multiple internal direct repeats and the length of the direct repeats appear to influence the frequency of deletion. Certain palindromic DNA sequences with the potential to form DNA hairpin structures that might stabilize the misalignment of direct repeats had a high frequency of deletion. Other DNA sequences with the potential to form structures that might destabilize misalignment of direct repeats had a very low frequency of deletion. Duplication mutations occurred at the highest frequency when the DNA between the direct repeats contained no direct or inverted repeats. The presence of inverted repeats dramatically reduced the frequency of duplications. The results support the slippage-misalignment model, suggesting that misalignment occurring during DNA replication leads to deletion and duplication mutations. The results also support the idea that the formation of DNA secondary structures during DNA replication can facilitate and direct specific mutagenic events. PMID:8325478

  1. Identification and cloning of four riboswitches from Burkholderia pseudomallei strain K96243

    NASA Astrophysics Data System (ADS)

    Munyati-Othman, Noor; Fatah, Ahmad Luqman Abdul; Piji, Mohd Al Akmarul Fizree Bin Md; Ramlan, Effirul Ikhwan; Raih, Mohd Firdaus

    2015-09-01

    Structured RNAs referred as riboswitches have been predicted to be present in the genome sequence of Burkholderia pseudomallei strain K96243. Four of the riboswitches were identified and analyzed through BLASTN, Rfam search and multiple sequence alignment. The RNA aptamers belong to the following riboswitch classifications: glycine riboswitch, cobalamin riboswitch, S-adenosyl-(L)-homocysteine (SAH) riboswitch and flavin mononucleotide (FMN) riboswitch. The conserved nucleotides for each aptamer were identified and were marked on the secondary structure generated by RNAfold. These riboswitches were successfully amplified and cloned for further study.

  2. High-Throughput, Data-Rich Cellular RNA Device Engineering

    PubMed Central

    Townshend, Brent; Kennedy, Andrew B.; Xiang, Joy S.; Smolke, Christina D.

    2015-01-01

    Methods for rapidly assessing sequence-structure-function landscapes and developing conditional gene-regulatory devices are critical to our ability to manipulate and interface with biology. We describe a framework for engineering RNA devices from preexisting aptamers that exhibit ligand-responsive ribozyme tertiary interactions. Our methodology utilizes cell sorting, high-throughput sequencing, and statistical data analyses to enable parallel measurements of the activities of hundreds of thousands of sequences from RNA device libraries in the absence and presence of ligands. Our tertiary interaction RNA devices exhibit improved performance in terms of gene silencing, activation ratio, and ligand sensitivity as compared to optimized RNA devices that rely on secondary structure changes. We apply our method to building biosensors for diverse ligands and determine consensus sequences that enable ligand-responsive tertiary interactions. These methods advance our ability to develop broadly applicable genetic tools and to elucidate understanding of the underlying sequence-structure-function relationships that empower rational design of complex biomolecules. PMID:26258292

  3. Template-based protein structure modeling using the RaptorX web server.

    PubMed

    Källberg, Morten; Wang, Haipeng; Wang, Sheng; Peng, Jian; Wang, Zhiyong; Lu, Hui; Xu, Jinbo

    2012-07-19

    A key challenge of modern biology is to uncover the functional role of the protein entities that compose cellular proteomes. To this end, the availability of reliable three-dimensional atomic models of proteins is often crucial. This protocol presents a community-wide web-based method using RaptorX (http://raptorx.uchicago.edu/) for protein secondary structure prediction, template-based tertiary structure modeling, alignment quality assessment and sophisticated probabilistic alignment sampling. RaptorX distinguishes itself from other servers by the quality of the alignment between a target sequence and one or multiple distantly related template proteins (especially those with sparse sequence profiles) and by a novel nonlinear scoring function and a probabilistic-consistency algorithm. Consequently, RaptorX delivers high-quality structural models for many targets with only remote templates. At present, it takes RaptorX ~35 min to finish processing a sequence of 200 amino acids. Since its official release in August 2011, RaptorX has processed ~6,000 sequences submitted by ~1,600 users from around the world.

  4. Template-based protein structure modeling using the RaptorX web server

    PubMed Central

    Källberg, Morten; Wang, Haipeng; Wang, Sheng; Peng, Jian; Wang, Zhiyong; Lu, Hui; Xu, Jinbo

    2016-01-01

    A key challenge of modern biology is to uncover the functional role of the protein entities that compose cellular proteomes. To this end, the availability of reliable three-dimensional atomic models of proteins is often crucial. This protocol presents a community-wide web-based method using RaptorX (http://raptorx.uchicago.edu/) for protein secondary structure prediction, template-based tertiary structure modeling, alignment quality assessment and sophisticated probabilistic alignment sampling. RaptorX distinguishes itself from other servers by the quality of the alignment between a target sequence and one or multiple distantly related template proteins (especially those with sparse sequence profiles) and by a novel nonlinear scoring function and a probabilistic-consistency algorithm. Consequently, RaptorX delivers high-quality structural models for many targets with only remote templates. At present, it takes RaptorX ~35 min to finish processing a sequence of 200 amino acids. Since its official release in August 2011, RaptorX has processed ~6,000 sequences submitted by ~1,600 users from around the world. PMID:22814390

  5. PFAAT version 2.0: a tool for editing, annotating, and analyzing multiple sequence alignments.

    PubMed

    Caffrey, Daniel R; Dana, Paul H; Mathur, Vidhya; Ocano, Marco; Hong, Eun-Jong; Wang, Yaoyu E; Somaroo, Shyamal; Caffrey, Brian E; Potluri, Shobha; Huang, Enoch S

    2007-10-11

    By virtue of their shared ancestry, homologous sequences are similar in their structure and function. Consequently, multiple sequence alignments are routinely used to identify trends that relate to function. This type of analysis is particularly productive when it is combined with structural and phylogenetic analysis. Here we describe the release of PFAAT version 2.0, a tool for editing, analyzing, and annotating multiple sequence alignments. Support for multiple annotations is a key component of this release as it provides a framework for most of the new functionalities. The sequence annotations are accessible from the alignment and tree, where they are typically used to label sequences or hyperlink them to related databases. Sequence annotations can be created manually or extracted automatically from UniProt entries. Once a multiple sequence alignment is populated with sequence annotations, sequences can be easily selected and sorted through a sophisticated search dialog. The selected sequences can be further analyzed using statistical methods that explicitly model relationships between the sequence annotations and residue properties. Residue annotations are accessible from the alignment viewer and are typically used to designate binding sites or properties for a particular residue. Residue annotations are also searchable, and allow one to quickly select alignment columns for further sequence analysis, e.g. computing percent identities. Other features include: novel algorithms to compute sequence conservation, mapping conservation scores to a 3D structure in Jmol, displaying secondary structure elements, and sorting sequences by residue composition. PFAAT provides a framework whereby end-users can specify knowledge for a protein family in the form of annotation. The annotations can be combined with sophisticated analysis to test hypothesis that relate to sequence, structure and function.

  6. The respective roles of polar/nonpolar binary patterns and amino acid composition in protein regular secondary structures explored exhaustively using hydrophobic cluster analysis.

    PubMed

    Rebehmed, Joseph; Quintus, Flavien; Mornon, Jean-Paul; Callebaut, Isabelle

    2016-05-01

    Several studies have highlighted the leading role of the sequence periodicity of polar and nonpolar amino acids (binary patterns) in the formation of regular secondary structures (RSS). However, these were based on the analysis of only a few simple cases, with no direct mean to correlate binary patterns with the limits of RSS. Here, HCA-derived hydrophobic clusters (HC) which are conditioned binary patterns whose positions fit well those of RSS, were considered. All the HC types, defined by unique binary patterns, which were commonly observed in three-dimensional (3D) structures of globular domains, were analyzed. The 180 HC types with preferences for either α-helices or β-strands distinctly contain basic binary units typical of these RSS. Therefore a general trend supporting the "binary pattern preference" assumption was observed. HC for which observed RSS are in disagreement with their expected behavior (discordant HC) were also examined. They were separated in HC types with moderate preferences for RSS, having "weak" binary patterns and versatile RSS and HC types with high preferences for RSS, having "strong" binary patterns and then displaying nonpolar amino acids at the protein surface. It was shown that in both cases, discordant HC could be distinguished from concordant ones by well-differentiated amino acid compositions. The obtained results could, thus, help to complement the currently available methods for the accurate prediction of secondary structures in proteins from the only information of a single amino acid sequence. This can be especially useful for characterizing orphan sequences and for assisting protein engineering and design. © 2016 Wiley Periodicals, Inc.

  7. Structurally complex and highly active RNA ligases derived from random RNA sequences

    NASA Technical Reports Server (NTRS)

    Ekland, E. H.; Szostak, J. W.; Bartel, D. P.

    1995-01-01

    Seven families of RNA ligases, previously isolated from random RNA sequences, fall into three classes on the basis of secondary structure and regiospecificity of ligation. Two of the three classes of ribozymes have been engineered to act as true enzymes, catalyzing the multiple-turnover transformation of substrates into products. The most complex of these ribozymes has a minimal catalytic domain of 93 nucleotides. An optimized version of this ribozyme has a kcat exceeding one per second, a value far greater than that of most natural RNA catalysts and approaching that of comparable protein enzymes. The fact that such a large and complex ligase emerged from a very limited sampling of sequence space implies the existence of a large number of distinct RNA structures of equivalent complexity and activity.

  8. RAG-3D: A search tool for RNA 3D substructures

    DOE PAGES

    Zahran, Mai; Sevim Bayrak, Cigdem; Elmetwaly, Shereef; ...

    2015-08-24

    In this study, to address many challenges in RNA structure/function prediction, the characterization of RNA's modular architectural units is required. Using the RNA-As-Graphs (RAG) database, we have previously explored the existence of secondary structure (2D) submotifs within larger RNA structures. Here we present RAG-3D—a dataset of RNA tertiary (3D) structures and substructures plus a web-based search tool—designed to exploit graph representations of RNAs for the goal of searching for similar 3D structural fragments. The objects in RAG-3D consist of 3D structures translated into 3D graphs, cataloged based on the connectivity between their secondary structure elements. Each graph is additionally describedmore » in terms of its subgraph building blocks. The RAG-3D search tool then compares a query RNA 3D structure to those in the database to obtain structurally similar structures and substructures. This comparison reveals conserved 3D RNA features and thus may suggest functional connections. Though RNA search programs based on similarity in sequence, 2D, and/or 3D structural elements are available, our graph-based search tool may be advantageous for illuminating similarities that are not obvious; using motifs rather than sequence space also reduces search times considerably. Ultimately, such substructuring could be useful for RNA 3D structure prediction, structure/function inference and inverse folding.« less

  9. RAG-3D: a search tool for RNA 3D substructures

    PubMed Central

    Zahran, Mai; Sevim Bayrak, Cigdem; Elmetwaly, Shereef; Schlick, Tamar

    2015-01-01

    To address many challenges in RNA structure/function prediction, the characterization of RNA's modular architectural units is required. Using the RNA-As-Graphs (RAG) database, we have previously explored the existence of secondary structure (2D) submotifs within larger RNA structures. Here we present RAG-3D—a dataset of RNA tertiary (3D) structures and substructures plus a web-based search tool—designed to exploit graph representations of RNAs for the goal of searching for similar 3D structural fragments. The objects in RAG-3D consist of 3D structures translated into 3D graphs, cataloged based on the connectivity between their secondary structure elements. Each graph is additionally described in terms of its subgraph building blocks. The RAG-3D search tool then compares a query RNA 3D structure to those in the database to obtain structurally similar structures and substructures. This comparison reveals conserved 3D RNA features and thus may suggest functional connections. Though RNA search programs based on similarity in sequence, 2D, and/or 3D structural elements are available, our graph-based search tool may be advantageous for illuminating similarities that are not obvious; using motifs rather than sequence space also reduces search times considerably. Ultimately, such substructuring could be useful for RNA 3D structure prediction, structure/function inference and inverse folding. PMID:26304547

  10. RAG-3D: A search tool for RNA 3D substructures

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zahran, Mai; Sevim Bayrak, Cigdem; Elmetwaly, Shereef

    In this study, to address many challenges in RNA structure/function prediction, the characterization of RNA's modular architectural units is required. Using the RNA-As-Graphs (RAG) database, we have previously explored the existence of secondary structure (2D) submotifs within larger RNA structures. Here we present RAG-3D—a dataset of RNA tertiary (3D) structures and substructures plus a web-based search tool—designed to exploit graph representations of RNAs for the goal of searching for similar 3D structural fragments. The objects in RAG-3D consist of 3D structures translated into 3D graphs, cataloged based on the connectivity between their secondary structure elements. Each graph is additionally describedmore » in terms of its subgraph building blocks. The RAG-3D search tool then compares a query RNA 3D structure to those in the database to obtain structurally similar structures and substructures. This comparison reveals conserved 3D RNA features and thus may suggest functional connections. Though RNA search programs based on similarity in sequence, 2D, and/or 3D structural elements are available, our graph-based search tool may be advantageous for illuminating similarities that are not obvious; using motifs rather than sequence space also reduces search times considerably. Ultimately, such substructuring could be useful for RNA 3D structure prediction, structure/function inference and inverse folding.« less

  11. Exploring codon context bias for synthetic gene design of a thermostable invertase in Escherichia coli.

    PubMed

    Pek, Han Bin; Klement, Maximilian; Ang, Kok Siong; Chung, Bevan Kai-Sheng; Ow, Dave Siak-Wei; Lee, Dong-Yup

    2015-01-01

    Various isoforms of invertases from prokaryotes, fungi, and higher plants has been expressed in Escherichia coli, and codon optimisation is a widely-adopted strategy for improvement of heterologous enzyme expression. Successful synthetic gene design for recombinant protein expression can be done by matching its translational elongation rate against heterologous host organisms via codon optimization. Amongst the various design parameters considered for the gene synthesis, codon context bias has been relatively overlooked compared to individual codon usage which is commonly adopted in most of codon optimization tools. In addition, matching the rates of transcription and translation based on secondary structure may lead to enhanced protein folding. In this study, we evaluated codon context fitness as design criterion for improving the expression of thermostable invertase from Thermotoga maritima in Escherichia coli and explored the relevance of secondary structure regions for folding and expression. We designed three coding sequences by using (1) a commercial vendor optimized gene algorithm, (2) codon context for the whole gene, and (3) codon context based on the secondary structure regions. Then, the codon optimized sequences were transformed and expressed in E. coli. From the resultant enzyme activities and protein yield data, codon context fitness proved to have the highest activity as compared to the wild-type control and other criteria while secondary structure-based strategy is comparable to the control. Codon context bias was shown to be a relevant parameter for enhancing enzyme production in Escherichia coli by codon optimization. Thus, we can effectively design synthetic genes within heterologous host organisms using this criterion. Copyright © 2015 Elsevier Inc. All rights reserved.

  12. High-throughput determination of RNA structure by proximity ligation.

    PubMed

    Ramani, Vijay; Qiu, Ruolan; Shendure, Jay

    2015-09-01

    We present an unbiased method to globally resolve RNA structures through pairwise contact measurements between interacting regions. RNA proximity ligation (RPL) uses proximity ligation of native RNA followed by deep sequencing to yield chimeric reads with ligation junctions in the vicinity of structurally proximate bases. We apply RPL in both baker's yeast (Saccharomyces cerevisiae) and human cells and generate contact probability maps for ribosomal and other abundant RNAs, including yeast snoRNAs, the RNA subunit of the signal recognition particle and the yeast U2 spliceosomal RNA homolog. RPL measurements correlate with established secondary structures for these RNA molecules, including stem-loop structures and long-range pseudoknots. We anticipate that RPL will complement the current repertoire of computational and experimental approaches in enabling the high-throughput determination of secondary and tertiary RNA structures.

  13. Secondary structure and phylogeny of Staphylococcus and Micrococcus 5S rRNAs.

    PubMed Central

    Dekio, S; Yamasaki, R; Jidoi, J; Hori, H; Osawa, S

    1984-01-01

    Nucleotide sequences of 5S rRNAs from four bacteria, Staphylococcus aureus Smith (diffuse), Staphylococcus epidermidis ATCC 14990, Micrococcus luteus ATCC 9341 and Micrococcus luteus ATCC 4698, were determined. The secondary structural models of S. aureus and S. epidermidis sequences showed characteristics of the gram-positive bacterial 5S rRNA (116-N type [H. Hori and S. Osawa, Proc. Natl. Acad. Sci. U.S.A. 76:381-385, 1979]). Those of M. luteus ATCC 9341 and M. luteus ATCC 4698 together with that of Streptomyces griseus (A. Simoncsits, Nucleic Acids Res. 8:4111-4124, 1980) showed intermediary characteristics between the gram-positive and gram-negative (120-N type [H. Hori and S. Osawa, 1979]) 5S rRNAs. This and previous studies revealed that there exist at least three major groups of eubacteria having distinct 5S rRNA and belonging to different stems in the 5S rRNA phylogenic tree. PMID:6735981

  14. SL1 revisited: functional analysis of the structure and conformation of HIV-1 genome RNA.

    PubMed

    Sakuragi, Sayuri; Yokoyama, Masaru; Shioda, Tatsuo; Sato, Hironori; Sakuragi, Jun-Ichi

    2016-11-11

    The dimer initiation site/dimer linkage sequence (DIS/DLS) region of HIV is located on the 5' end of the viral genome and suggested to form complex secondary/tertiary structures. Within this structure, stem-loop 1 (SL1) is believed to be most important and an essential key to dimerization, since the sequence and predicted secondary structure of SL1 are highly stable and conserved among various virus subtypes. In particular, a six-base palindromic sequence is always present at the hairpin loop of SL1 and the formation of kissing-loop structure at this position between the two strands of genomic RNA is suggested to trigger dimerization. Although the higher-order structure model of SL1 is well accepted and perhaps even undoubted lately, there could be stillroom for consideration to depict the functional SL1 structure while in vivo (in virion or cell). In this study, we performed several analyses to identify the nucleotides and/or basepairing within SL1 which are necessary for HIV-1 genome dimerization, encapsidation, recombination and infectivity. We unexpectedly found that some nucleotides that are believed to contribute the formation of the stem do not impact dimerization or infectivity. On the other hand, we found that one G-C basepair involved in stem formation may serve as an alternative dimer interactive site. We also report on our further investigation of the roles of the palindromic sequences on viral replication. Collectively, we aim to assemble a more-comprehensive functional map of SL1 on the HIV-1 viral life cycle. We discovered several possibilities for a novel structure of SL1 in HIV-1 DLS. The newly proposed structure model suggested that the hairpin loop of SL1 appeared larger, and genome dimerization process might consist of more complicated mechanism than previously understood. Further investigations would be still required to fully understand the genome packaging and dimerization of HIV.

  15. Hepatitis Delta Antigen Requires a Flexible Quasi-Double-Stranded RNA Structure To Bind and Condense Hepatitis Delta Virus RNA in a Ribonucleoprotein Complex

    PubMed Central

    Griffin, Brittany L.; Chasovskikh, Sergey; Dritschilo, Anatoly

    2014-01-01

    ABSTRACT The circular genome and antigenome RNAs of hepatitis delta virus (HDV) form characteristic unbranched, quasi-double-stranded RNA secondary structures in which short double-stranded helical segments are interspersed with internal loops and bulges. The ribonucleoprotein complexes (RNPs) formed by these RNAs with the virus-encoded protein hepatitis delta antigen (HDAg) perform essential roles in the viral life cycle, including viral replication and virion formation. Little is understood about the formation and structure of these complexes and how they function in these key processes. Here, the specific RNA features required for HDAg binding and the topology of the complexes formed were investigated. Selective 2′OH acylation analyzed by primer extension (SHAPE) applied to free and HDAg-bound HDV RNAs indicated that the characteristic secondary structure of the RNA is preserved when bound to HDAg. Notably, the analysis indicated that predicted unpaired positions in the RNA remained dynamic in the RNP. Analysis of the in vitro binding activity of RNAs in which internal loops and bulges were mutated and of synthetically designed RNAs demonstrated that the distinctive secondary structure, not the primary RNA sequence, is the major determinant of HDAg RNA binding specificity. Atomic force microscopy analysis of RNPs formed in vitro revealed complexes in which the HDV RNA is substantially condensed by bending or wrapping. Our results support a model in which the internal loops and bulges in HDV RNA contribute flexibility to the quasi-double-stranded structure that allows RNA bending and condensing by HDAg. IMPORTANCE RNA-protein complexes (RNPs) formed by the hepatitis delta virus RNAs and protein, HDAg, perform critical roles in virus replication. Neither the structures of these RNPs nor the RNA features required to form them have been characterized. HDV RNA is unusual in that it forms an unbranched quasi-double-stranded structure in which short base-paired segments are interspersed with internal loops and bulges. We analyzed the role of the HDV RNA sequence and secondary structure in the formation of a minimal RNP and visualized the structure of this RNP using atomic force microscopy. Our results indicate that HDAg does not recognize the primary sequence of the RNA; rather, the principle contribution of unpaired bases in HDV RNA to HDAg binding is to allow flexibility in the unbranched quasi-double-stranded RNA structure. Visualization of RNPs by atomic force microscopy indicated that the RNA is significantly bent or condensed in the complex. PMID:24741096

  16. Control of Helical Chirality of Ferrocene-Dipeptide Conjugates by the Secondary Structure of Dipeptide Chains.

    PubMed

    Moriuchi, Toshiyuki; Nishiyama, Taiki; Nobu, Masaki; Hirao, Toshikazu

    2017-09-18

    Controlling helical chirality and creating protein secondary structures in cyclic/acyclic ferrocene-dipeptide bioorganometallic conjugates were achieved by adjusting the conformational flexibility of the dipeptide chains. In systems reported to date, the helical chirality of a conjugate was determined by the absolute configuration of the adjacent amino acid reside. In contrast, it was possible to induce both M- and P-helical chirality, even when the configuration of the adjacent amino acid was the same. It is particularly interesting to note that M-helical chirality was produced in a cyclic ferrocene-dipeptide conjugate composed of the l-Ala-d-Pro-cystamine-d-Pro-l-Ala dipeptide sequence (1), in which a type II β-turn-like secondary structure was established. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  17. Protein structure and the sequential structure of mRNA: alpha-helix and beta-sheet signals at the nucleotide level.

    PubMed

    Brunak, S; Engelbrecht, J

    1996-06-01

    A direct comparison of experimentally determined protein structures and their corresponding protein coding mRNA sequences has been performed. We examine whether real world data support the hypothesis that clusters of rare codons correlate with the location of structural units in the resulting protein. The degeneracy of the genetic code allows for a biased selection of codons which may control the translational rate of the ribosome, and may thus in vivo have a catalyzing effect on the folding of the polypeptide chain. A complete search for GenBank nucleotide sequences coding for structural entries in the Brookhaven Protein Data Bank produced 719 protein chains with matching mRNA sequence, amino acid sequence, and secondary structure assignment. By neural network analysis, we found strong signals in mRNA sequence regions surrounding helices and sheets. These signals do not originate from the clustering of rare codons, but from the similarity of codons coding for very abundant amino acid residues at the N- and C-termini of helices and sheets. No correlation between the positioning of rare codons and the location of structural units was found. The mRNA signals were also compared with conserved nucleotide features of 16S-like ribosomal RNA sequences and related to mechanisms for maintaining the correct reading frame by the ribosome.

  18. A new model for approximating RNA folding trajectories and population kinetics

    NASA Astrophysics Data System (ADS)

    Kirkpatrick, Bonnie; Hajiaghayi, Monir; Condon, Anne

    2013-01-01

    RNA participates both in functional aspects of the cell and in gene regulation. The interactions of these molecules are mediated by their secondary structure which can be viewed as a planar circle graph with arcs for all the chemical bonds between pairs of bases in the RNA sequence. The problem of predicting RNA secondary structure, specifically the chemically most probable structure, has many useful and efficient algorithms. This leaves RNA folding, the problem of predicting the dynamic behavior of RNA structure over time, as the main open problem. RNA folding is important for functional understanding because some RNA molecules change secondary structure in response to interactions with the environment. The full RNA folding model on at most O(3n) secondary structures is the gold standard. We present a new subset approximation model for the full model, give methods to analyze its accuracy and discuss the relative merits of our model as compared with a pre-existing subset approximation. The main advantage of our model is that it generates Monte Carlo folding pathways with the same probabilities with which they are generated under the full model. The pre-existing subset approximation does not have this property.

  19. Interactive computer programs for the graphic analysis of nucleotide sequence data.

    PubMed Central

    Luckow, V A; Littlewood, R K; Rownd, R H

    1984-01-01

    A group of interactive computer programs have been developed which aid in the collection and graphical analysis of nucleotide and protein sequence data. The programs perform the following basic functions: a) enter, edit, list, and rearrange sequence data; b) permit automatic entry of nucleotide sequence data directly from an autoradiograph into the computer; c) search for restriction sites or other specified patterns and plot a linear or circular restriction map, or print their locations; d) plot base composition; e) analyze homology between sequences by plotting a two-dimensional graphic matrix; and f) aid in plotting predicted secondary structures of RNA molecules. PMID:6546437

  20. Deep sequencing of foot-and-mouth disease virus reveals RNA sequences involved in genome packaging.

    PubMed

    Logan, Grace; Newman, Joseph; Wright, Caroline F; Lasecka-Dykes, Lidia; Haydon, Daniel T; Cottam, Eleanor M; Tuthill, Tobias J

    2017-10-18

    Non-enveloped viruses protect their genomes by packaging them into an outer shell or capsid of virus-encoded proteins. Packaging and capsid assembly in RNA viruses can involve interactions between capsid proteins and secondary structures in the viral genome as exemplified by the RNA bacteriophage MS2 and as proposed for other RNA viruses of plants, animals and human. In the picornavirus family of non-enveloped RNA viruses, the requirements for genome packaging remain poorly understood. Here we show a novel and simple approach to identify predicted RNA secondary structures involved in genome packaging in the picornavirus foot-and-mouth disease virus (FMDV). By interrogating deep sequencing data generated from both packaged and unpackaged populations of RNA we have determined multiple regions of the genome with constrained variation in the packaged population. Predicted secondary structures of these regions revealed stem loops with conservation of structure and a common motif at the loop. Disruption of these features resulted in attenuation of virus growth in cell culture due to a reduction in assembly of mature virions. This study provides evidence for the involvement of predicted RNA structures in picornavirus packaging and offers a readily transferable methodology for identifying packaging requirements in many other viruses. Importance In order to transmit their genetic material to a new host, non-enveloped viruses must protect their genomes by packaging them into an outer shell or capsid of virus-encoded proteins. For many non-enveloped RNA viruses the requirements for this critical part of the viral life cycle remain poorly understood. We have identified RNA sequences involved in genome packaging of the picornavirus foot-and-mouth disease virus. This virus causes an economically devastating disease of livestock affecting both the developed and developing world. The experimental methods developed to carry out this work are novel, simple and transferable to the study of packaging signals in other RNA viruses. Improved understanding of RNA packaging may lead to novel vaccine approaches or targets for antiviral drugs with broad spectrum activity. Copyright © 2017 Logan et al.

  1. [Correlation of codon biases and potential secondary structures with mRNA translation efficiency in unicellular organisms].

    PubMed

    Vladimirov, N V; Likhoshvaĭ, V A; Matushkin, Iu G

    2007-01-01

    Gene expression is known to correlate with degree of codon bias in many unicellular organisms. However, such correlation is absent in some organisms. Recently we demonstrated that inverted complementary repeats within coding DNA sequence must be considered for proper estimation of translation efficiency, since they may form secondary structures that obstruct ribosome movement. We have developed a program for estimation of potential coding DNA sequence expression in defined unicellular organism using its genome sequence. The program computes elongation efficiency index. Computation is based on estimation of coding DNA sequence elongation efficiency, taking into account three key factors: codon bias, average number of inverted complementary repeats, and free energy of potential stem-loop structures formed by the repeats. The influence of these factors on translation is numerically estimated. An optimal proportion of these factors is computed for each organism individually. Quantitative translational characteristics of 384 unicellular organisms (351 bacteria, 28 archaea, 5 eukaryota) have been computed using their annotated genomes from NCBI GenBank. Five potential evolutionary strategies of translational optimization have been determined among studied organisms. A considerable difference of preferred translational strategies between Bacteria and Archaea has been revealed. Significant correlations between elongation efficiency index and gene expression levels have been shown for two organisms (S. cerevisiae and H. pylori) using available microarray data. The proposed method allows to estimate numerically the coding DNA sequence translation efficiency and to optimize nucleotide composition of heterologous genes in unicellular organisms. http://www.mgs.bionet.nsc.ru/mgs/programs/eei-calculator/.

  2. Relative stability of major types of beta-turns as a function of amino acid composition: a study based on Ab initio energetic and natural abundance data.

    PubMed

    Perczel, András; Jákli, Imre; McAllister, Michael A; Csizmadia, Imre G

    2003-06-06

    Folding properties of small globular proteins are determined by their amino acid sequence (primary structure). This holds both for local (secondary structure) and for global conformational features of linear polypeptides and proteins composed from natural amino acid derivatives. It thus provides the rational basis of structure prediction algorithms. The shortest secondary structure element, the beta-turn, most typically adopts either a type I or a type II form, depending on the amino acid composition. Herein we investigate the sequence-dependent folding stability of both major types of beta-turns using simple dipeptide models (-Xxx-Yyy-). Gas-phase ab initio properties of 16 carefully selected and suitably protected dipeptide models (for example Val-Ser, Ala-Gly, Ser-Ser) were studied. For each backbone fold most probable side-chain conformers were considered. Fully optimized 321G RHF molecular structures were employed in medium level [B3LYP/6-311++G(d,p)//RHF/3-21G] energy calculations to estimate relative populations of the different backbone conformers. Our results show that the preference for beta-turn forms as calculated by quantum mechanics and observed in Xray determined proteins correlates significantly.

  3. Unraveling systematic inventory of Echinops (Asteraceae) with special reference to nrDNA ITS sequence-based molecular typing of Echinops abuzinadianus.

    PubMed

    Ali, M A; Al-Hemaid, F M; Lee, J; Hatamleh, A A; Gyulai, G; Rahman, M O

    2015-10-02

    The present study explored the systematic inventory of Echinops L. (Asteraceae) of Saudi Arabia, with special reference to the molecular typing of Echinops abuzinadianus Chaudhary, an endemic species to Saudi Arabia, based on the internal transcribed spacer (ITS) sequences (ITS1-5.8S-ITS2) of nuclear ribosomal DNA. A sequence similarity search using BLAST and a phylogenetic analysis of the ITS sequence of E. abuzinadianus revealed a high level of sequence similarity with E. glaberrimus DC. (section Ritropsis). The novel primary sequence and the secondary structure of ITS2 of E. abuzinadianus could potentially be used for molecular genotyping.

  4. Molecular gene organisation and secondary structure of the mitochondrial large subunit ribosomal RNA from the cultivated Basidiomycota Agrocybe aegerita: a 13 kb gene possessing six unusual nucleotide extensions and eight introns.

    PubMed

    Gonzalez, P; Barroso, G; Labarère, J

    1999-04-01

    The complete gene sequence and secondary structure of the mitochondrial LSU rRNA from the cultivated Basidiomycota Agrocybe aegerita was derived by chromosome walking. The A.aegerita LSU rRNA gene (13 526 nt) represents, to date, the longest described, due to the highest number of introns (eight) and the occurrence of six long nucleotidic extensions. Seven introns belong to group I, while the intronic sequence i5 constitutes the first typical group II intron reported in a fungal mitochondrial LSU rDNA. As with most fungal LSU rDNA introns reported to date, four introns (i5-i8) are distributed in domain V associated with the peptidyl-transferase activity. One intron (i1) is located in domain I, and three (i2-i4) in domain II. The introns i2-i8 possess homologies with other fungal, algal or protozoan introns located at the same position in LSU rDNAs. One of them (i6) is located at the same insertion site as most Ascomycota or algae LSU introns, suggesting a possible inheritance from a common ancestor. On the contrary, intron i1 is located at a so-far unreported insertion site. Among the six unusual nucleotide extensions, five are located in domain I and one in domain V. This is the first report of a mitochondrial LSU rRNA gene sequence and secondary structure for the whole Basidiomycota division.

  5. Mapping the Geometric Evolution of Protein Folding Motor.

    PubMed

    Jerath, Gaurav; Hazam, Prakash Kishore; Shekhar, Shashi; Ramakrishnan, Vibin

    2016-01-01

    Polypeptide chain has an invariant main-chain and a variant side-chain sequence. How the side-chain sequence determines fold in terms of its chemical constitution has been scrutinized extensively and verified periodically. However, a focussed investigation on the directive effect of side-chain geometry may provide important insights supplementing existing algorithms in mapping the geometrical evolution of protein chains and its structural preferences. Geometrically, folding of protein structure may be envisaged as the evolution of its geometric variables: ϕ, and ψ dihedral angles of polypeptide main-chain directed by χ1, and χ2 of side chain. In this work, protein molecule is metaphorically modelled as a machine with 4 rotors ϕ, ψ, χ1 and χ2, with its evolution to the functional fold is directed by combinations of its rotor directions. We observe that differential rotor motions lead to different secondary structure formations and the combinatorial pattern is unique and consistent for particular secondary structure type. Further, we found that combination of rotor geometries of each amino acid is unique which partly explains how different amino acid sequence combinations have unique structural evolution and functional adaptation. Quantification of these amino acid rotor preferences, resulted in the generation of 3 substitution matrices, which later on plugged in the BLAST tool, for evaluating their efficiency in aligning sequences. We have employed BLOSUM62 and PAM30 as standard for primary evaluation. Generation of substitution matrices is a logical extension of the conceptual framework we attempted to build during the development of this work. Optimization of matrices following the conventional routines and possible application with biologically relevant data sets are beyond the scope of this manuscript, though it is a part of the larger project design.

  6. Characterization of microRNAs Expressed during Secondary Wall Biosynthesis in Acacia mangium

    PubMed Central

    Ong, Seong Siang; Wickneswari, Ratnam

    2012-01-01

    MicroRNAs (miRNAs) play critical regulatory roles by acting as sequence specific guide during secondary wall formation in woody and non-woody species. Although thousands of plant miRNAs have been sequenced, there is no comprehensive view of miRNA mediated gene regulatory network to provide profound biological insights into the regulation of xylem development. Herein, we report the involvement of six highly conserved amg-miRNA families (amg-miR166, amg-miR172, amg-miR168, amg-miR159, amg-miR394, and amg-miR156) as the potential regulatory sequences of secondary cell wall biosynthesis. Within this highly conserved amg-miRNA family, only amg-miR166 exhibited strong differences in expression between phloem and xylem tissue. The functional characterization of amg-miR166 targets in various tissues revealed three groups of HD-ZIP III: ATHB8, ATHB15, and REVOLUTA which play pivotal roles in xylem development. Although these three groups vary in their functions, -psRNA target analysis indicated that miRNA target sequences of the nine different members of HD-ZIP III are always conserved. We found that precursor structures of amg-miR166 undergo exhaustive sequence variation even within members of the same family. Gene expression analysis showed three key lignin pathway genes: C4H, CAD, and CCoAOMT were upregulated in compression wood where a cascade of miRNAs was downregulated. This study offers a comprehensive analysis on the involvement of highly conserved miRNAs implicated in the secondary wall formation of woody plants. PMID:23251324

  7. INFO-RNA--a fast approach to inverse RNA folding.

    PubMed

    Busch, Anke; Backofen, Rolf

    2006-08-01

    The structure of RNA molecules is often crucial for their function. Therefore, secondary structure prediction has gained much interest. Here, we consider the inverse RNA folding problem, which means designing RNA sequences that fold into a given structure. We introduce a new algorithm for the inverse folding problem (INFO-RNA) that consists of two parts; a dynamic programming method for good initial sequences and a following improved stochastic local search that uses an effective neighbor selection method. During the initialization, we design a sequence that among all sequences adopts the given structure with the lowest possible energy. For the selection of neighbors during the search, we use a kind of look-ahead of one selection step applying an additional energy-based criterion. Afterwards, the pre-ordered neighbors are tested using the actual optimization criterion of minimizing the structure distance between the target structure and the mfe structure of the considered neighbor. We compared our algorithm to RNAinverse and RNA-SSD for artificial and biological test sets. Using INFO-RNA, we performed better than RNAinverse and in most cases, we gained better results than RNA-SSD, the probably best inverse RNA folding tool on the market. www.bioinf.uni-freiburg.de?Subpages/software.html.

  8. Exploring Connectivity in Sequence Space of Functional RNA

    NASA Technical Reports Server (NTRS)

    Wei, Chenyu; Pohorille, Andrzej; Popovic, Milena; Ditzler, Mark

    2017-01-01

    Emergence of replicable genetic molecules was one of the marking points in the origin of life, evolution of which can be conceptualized as a walk through the space of all possible sequences. A theoretical concept of fitness landscape helps to understand evolutionary processes through assigning a value of fitness to each genotype. Then, evolution of a phenotype is viewed as a series of consecutive, single-point mutations. Natural selection biases evolution toward peaks of high fitness and away from valleys of low fitness. whereas neutral drift occurs in the sequence space without direction as mutations are introduced at random. Large networks of neutral or near-neutral mutations on a fitness landscape, especially for sufficiently long genomes, are possible or even inevitable. Their detection in experiments, however, has been elusive. Although a few near-neutral evolutionary pathways have been found, recent experimental evidence indicates landscapes consist of largely isolated islands. The generality of these results, however, is not clear, as the genome length or the fraction of functional molecules in the genotypic space might have been insufficient for the emergence of large, neutral networks. Thorough investigation on the structure of the fitness landscape is essential to understand the mechanisms of evolution of early genomes. RNA molecules are commonly assumed to play the pivotal role in the origin of genetic systems. They are widely believed to be early, if not the earliest, genetic and catalytic molecules, with abundant biochemical activities as aptamers and ribozymes, i.e. RNA molecules capable, respectively, to bind small molecules or catalyze chemical reactions. Here, we present results of our recent studies on the structure of the sequence space of RNA ligase ribozymes selected through in vitro evolution. Several hundred thousands of sequences active to a different degree were obtained by way of deep sequencing. Analysis of these sequences revealed several large clusters defined such that every sequence in a cluster can be reached from any other sequence in the same cluster through a series of single point mutations. Sequences in a single cluster appear to adopt more than one secondary structure. The mechanism of refolding within a single cluster was examined. To shed light on possible evolutionary paths in the space of ribozymes, the connectivity between clusters was investigated. The effect of length of RNA molecules on the structure of the fitness landscape and possible evolutionary paths was examined by way of comparing functional sequences of 20 and 80 nucleobases in length. It was found that sequences of different lengths shared secondary structure motifs that were presumed responsible for catalytic activity, with increasing complexity and global structural rearrangements emerging in longer molecules.

  9. Thermodynamic heuristics with case-based reasoning: combined insights for RNA pseudoknot secondary structure.

    PubMed

    Al-Khatib, Ra'ed M; Rashid, Nur'Aini Abdul; Abdullah, Rosni

    2011-08-01

    The secondary structure of RNA pseudoknots has been extensively inferred and scrutinized by computational approaches. Experimental methods for determining RNA structure are time consuming and tedious; therefore, predictive computational approaches are required. Predicting the most accurate and energy-stable pseudoknot RNA secondary structure has been proven to be an NP-hard problem. In this paper, a new RNA folding approach, termed MSeeker, is presented; it includes KnotSeeker (a heuristic method) and Mfold (a thermodynamic algorithm). The global optimization of this thermodynamic heuristic approach was further enhanced by using a case-based reasoning technique as a local optimization method. MSeeker is a proposed algorithm for predicting RNA pseudoknot structure from individual sequences, especially long ones. This research demonstrates that MSeeker improves the sensitivity and specificity of existing RNA pseudoknot structure predictions. The performance and structural results from this proposed method were evaluated against seven other state-of-the-art pseudoknot prediction methods. The MSeeker method had better sensitivity than the DotKnot, FlexStem, HotKnots, pknotsRG, ILM, NUPACK and pknotsRE methods, with 79% of the predicted pseudoknot base-pairs being correct.

  10. Tertiary alphabet for the observable protein structural universe.

    PubMed

    Mackenzie, Craig O; Zhou, Jianfu; Grigoryan, Gevorg

    2016-11-22

    Here, we systematically decompose the known protein structural universe into its basic elements, which we dub tertiary structural motifs (TERMs). A TERM is a compact backbone fragment that captures the secondary, tertiary, and quaternary environments around a given residue, comprising one or more disjoint segments (three on average). We seek the set of universal TERMs that capture all structure in the Protein Data Bank (PDB), finding remarkable degeneracy. Only ∼600 TERMs are sufficient to describe 50% of the PDB at sub-Angstrom resolution. However, more rare geometries also exist, and the overall structural coverage grows logarithmically with the number of TERMs. We go on to show that universal TERMs provide an effective mapping between sequence and structure. We demonstrate that TERM-based statistics alone are sufficient to recapitulate close-to-native sequences given either NMR or X-ray backbones. Furthermore, sequence variability predicted from TERM data agrees closely with evolutionary variation. Finally, locations of TERMs in protein chains can be predicted from sequence alone based on sequence signatures emergent from TERM instances in the PDB. For multisegment motifs, this method identifies spatially adjacent fragments that are not contiguous in sequence-a major bottleneck in structure prediction. Although all TERMs recur in diverse proteins, some appear specialized for certain functions, such as interface formation, metal coordination, or even water binding. Structural biology has benefited greatly from previously observed degeneracies in structure. The decomposition of the known structural universe into a finite set of compact TERMs offers exciting opportunities toward better understanding, design, and prediction of protein structure.

  11. Aromatic claw: A new fold with high aromatic content that evades structural prediction: Aromatic Claw

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sachleben, Joseph R.; Adhikari, Aashish N.; Gawlak, Grzegorz

    2016-11-10

    We determined the NMR structure of a highly aromatic (13%) protein of unknown function, Aq1974 from Aquifex aeolicus (PDB ID: 5SYQ). The unusual sequence of this protein has a tryptophan content five times the normal (six tryptophan residues of 114 or 5.2% while the average tryptophan content is 1.0%) with the tryptophans occurring in a WXW motif. It has no detectable sequence homology with known protein structures. Although its NMR spectrum suggested that the protein was rich in β-sheet, upon resonance assignment and solution structure determination, the protein was found to be primarily α-helical with a small two-stranded β-sheet withmore » a novel fold that we have termed an Aromatic Claw. As this fold was previously unknown and the sequence unique, we submitted the sequence to CASP10 as a target for blind structural prediction. At the end of the competition, the sequence was classified a hard template based model; the structural relationship between the template and the experimental structure was small and the predictions all failed to predict the structure. CSRosetta was found to predict the secondary structure and its packing; however, it was found that there was little correlation between CSRosetta score and the RMSD between the CSRosetta structure and the NMR determined one. This work demonstrates that even in relatively small proteins, we do not yet have the capacity to accurately predict the fold for all primary sequences. The experimental discovery of new folds helps guide the improvement of structural prediction methods.« less

  12. R2R--software to speed the depiction of aesthetic consensus RNA secondary structures.

    PubMed

    Weinberg, Zasha; Breaker, Ronald R

    2011-01-04

    With continuing identification of novel structured noncoding RNAs, there is an increasing need to create schematic diagrams showing the consensus features of these molecules. RNA structural diagrams are typically made either with general-purpose drawing programs like Adobe Illustrator, or with automated or interactive programs specific to RNA. Unfortunately, the use of applications like Illustrator is extremely time consuming, while existing RNA-specific programs produce figures that are useful, but usually not of the same aesthetic quality as those produced at great cost in Illustrator. Additionally, most existing RNA-specific applications are designed for drawing single RNA molecules, not consensus diagrams. We created R2R, a computer program that facilitates the generation of aesthetic and readable drawings of RNA consensus diagrams in a fraction of the time required with general-purpose drawing programs. Since the inference of a consensus RNA structure typically requires a multiple-sequence alignment, the R2R user annotates the alignment with commands directing the layout and annotation of the RNA. R2R creates SVG or PDF output that can be imported into Adobe Illustrator, Inkscape or CorelDRAW. R2R can be used to create consensus sequence and secondary structure models for novel RNA structures or to revise models when new representatives for known RNA classes become available. Although R2R does not currently have a graphical user interface, it has proven useful in our efforts to create 100 schematic models of distinct noncoding RNA classes. R2R makes it possible to obtain high-quality drawings of the consensus sequence and structural models of many diverse RNA structures with a more practical amount of effort. R2R software is available at http://breaker.research.yale.edu/R2R and as an Additional file.

  13. Human immunodeficiency virus type 1 LTR TATA and TAR region sequences required for transcriptional regulation.

    PubMed Central

    Garcia, J A; Harrich, D; Soultanakis, E; Wu, F; Mitsuyasu, R; Gaynor, R B

    1989-01-01

    The human immunodeficiency virus (HIV) type 1 LTR is regulated at the transcriptional level by both cellular and viral proteins. Using HeLa cell extracts, multiple regions of the HIV LTR were found to serve as binding sites for cellular proteins. An untranslated region binding protein UBP-1 has been purified and fractions containing this protein bind to both the TAR and TATA regions. To investigate the role of cellular proteins binding to both the TATA and TAR regions and their potential interaction with other HIV DNA binding proteins, oligonucleotide-directed mutagenesis of both these regions was performed followed by DNase I footprinting and transient expression assays. In the TATA region, two direct repeats TC/AAGC/AT/AGCTGC surround the TATA sequence. Mutagenesis of both of these direct repeats or of the TATA sequence interrupted binding over the TATA region on the coding strand, but only a mutation of the TATA sequence affected in vivo assays for tat-activation. In addition to TAR serving as the site of binding of cellular proteins, RNA transcribed from TAR is capable of forming a stable stem-loop structure. To determine the relative importance of DNA binding proteins as compared to secondary structure, oligonucleotide-directed mutations in the TAR region were studied. Local mutations that disrupted either the stem or loop structure were defective in gene expression. However, compensatory mutations which restored base pairing in the stem resulted in complete tat-activation. This indicated a significant role for the stem-loop structure in HIV gene expression. To determine the role of TAR binding proteins, mutations were constructed which extensively changed the primary structure of the TAR region, yet left stem base pairing, stem energy and the loop sequence intact. These mutations resulted in decreased protein binding to TAR DNA and defects in tat-activation, and revealed factor binding specifically to the loop DNA sequence. Further mutagenesis which inverted this stem and loop mutation relative to the HIV LTR mRNA start site resulted in even larger decreases in tat-activation. This suggests that multiple determinants, including protein binding, the loop sequence, and RNA or DNA secondary structure, are important in tat-activation and suggests that tat may interact with cellular proteins binding to DNA to increase HIV gene expression. Images PMID:2721501

  14. Translation-coupling systems

    DOEpatents

    Pfleger, Brian; Mendez-Perez, Daniel

    2013-11-05

    Disclosed are systems and methods for coupling translation of a target gene to a detectable response gene. A version of the invention includes a translation-coupling cassette. The translation-coupling cassette includes a target gene, a response gene, a response-gene translation control element, and a secondary structure-forming sequence that reversibly forms a secondary structure masking the response-gene translation control element. Masking of the response-gene translation control element inhibits translation of the response gene. Full translation of the target gene results in unfolding of the secondary structure and consequent translation of the response gene. Translation of the target gene is determined by detecting presence of the response-gene protein product. The invention further includes RNA transcripts of the translation-coupling cassettes, vectors comprising the translation-coupling cassettes, hosts comprising the translation-coupling cassettes, methods of using the translation-coupling cassettes, and gene products produced with the translation-coupling cassettes.

  15. Availability: A Metric for Nucleic Acid Strand Displacement Systems.

    PubMed

    Olson, Xiaoping; Kotani, Shohei; Padilla, Jennifer E; Hallstrom, Natalya; Goltry, Sara; Lee, Jeunghoon; Yurke, Bernard; Hughes, William L; Graugnard, Elton

    2017-01-20

    DNA strand displacement systems have transformative potential in synthetic biology. While powerful examples have been reported in DNA nanotechnology, such systems are plagued by leakage, which limits network stability, sensitivity, and scalability. An approach to mitigate leakage in DNA nanotechnology, which is applicable to synthetic biology, is to introduce mismatches to complementary fuel sequences at key locations. However, this method overlooks nuances in the secondary structure of the fuel and substrate that impact the leakage reaction kinetics in strand displacement systems. In an effort to quantify the impact of secondary structure on leakage, we introduce the concepts of availability and mutual availability and demonstrate their utility for network analysis. Our approach exposes vulnerable locations on the substrate and quantifies the secondary structure of fuel strands. Using these concepts, a 4-fold reduction in leakage has been achieved. The result is a rational design process that efficiently suppresses leakage and provides new insight into dynamic nucleic acid networks.

  16. Translation-coupling systems

    DOEpatents

    Pfleger, Brian; Mendez-Perez, Daniel

    2015-05-19

    Disclosed are systems and methods for coupling translation of a target gene to a detectable response gene. A version of the invention includes a translation-coupling cassette. The translation-coupling cassette includes a target gene, a response gene, a response-gene translation control element, and a secondary structure-forming sequence that reversibly forms a secondary structure masking the response-gene translation control element. Masking of the response-gene translation control element inhibits translation of the response gene. Full translation of the target gene results in unfolding of the secondary structure and consequent translation of the response gene. Translation of the target gene is determined by detecting presence of the response-gene protein product. The invention further includes RNA transcripts of the translation-coupling cassettes, vectors comprising the translation-coupling cassettes, hosts comprising the translation-coupling cassettes, methods of using the translation-coupling cassettes, and gene products produced with the translation-coupling cassettes.

  17. RNAiFold: a web server for RNA inverse folding and molecular design.

    PubMed

    Garcia-Martin, Juan Antonio; Clote, Peter; Dotu, Ivan

    2013-07-01

    Synthetic biology and nanotechnology are poised to make revolutionary contributions to the 21st century. In this article, we describe a new web server to support in silico RNA molecular design. Given an input target RNA secondary structure, together with optional constraints, such as requiring GC-content to lie within a certain range, requiring the number of strong (GC), weak (AU) and wobble (GU) base pairs to lie in a certain range, the RNAiFold web server determines one or more RNA sequences, whose minimum free-energy secondary structure is the target structure. RNAiFold provides access to two servers: RNA-CPdesign, which applies constraint programming, and RNA-LNSdesign, which applies the large neighborhood search heuristic; hence, it is suitable for larger input structures. Both servers can also solve the RNA inverse hybridization problem, i.e. given a representation of the desired hybridization structure, RNAiFold returns two sequences, whose minimum free-energy hybridization is the input target structure. The web server is publicly accessible at http://bioinformatics.bc.edu/clotelab/RNAiFold, which provides access to two specialized servers: RNA-CPdesign and RNA-LNSdesign. Source code for the underlying algorithms, implemented in COMET and supported on linux, can be downloaded at the server website.

  18. Smoothness within ruggedness: the role of neutrality in adaptation.

    PubMed Central

    Huynen, M A; Stadler, P F; Fontana, W

    1996-01-01

    RNA secondary structure folding algorithms predict the existence of connected networks of RNA sequences with identical structure. On such networks, evolving populations split into subpopulations, which diffuse independently in sequence space. This demands a distinction between two mutation thresholds: one at which genotypic information is lost and one at which phenotypic information is lost. In between, diffusion enables the search of vast areas in genotype space while still preserving the dominant phenotype. By this dynamic the success of phenotypic adaptation becomes much less sensitive to the initial conditions in genotype space. Images Fig. 2 PMID:8552647

  19. Sequence swapping does not result in conformation swapping for the beta4/beta5 and beta8/beta9 beta-hairpin turns in human acidic fibroblast growth factor.

    PubMed

    Kim, Jaewon; Lee, Jihun; Brych, Stephen R; Logan, Timothy M; Blaber, Michael

    2005-02-01

    The beta-turn is the most common type of nonrepetitive structure in globular proteins, comprising ~25% of all residues; however, a detailed understanding of effects of specific residues upon beta-turn stability and conformation is lacking. Human acidic fibroblast growth factor (FGF-1) is a member of the beta-trefoil superfold and contains a total of five beta-hairpin structures (antiparallel beta-sheets connected by a reverse turn). beta-Turns related by the characteristic threefold structural symmetry of this superfold exhibit different primary structures, and in some cases, different secondary structures. As such, they represent a useful system with which to study the role that turn sequences play in determining structure, stability, and folding of the protein. Two turns related by the threefold structural symmetry, the beta4/beta5 and beta8/beta9 turns, were subjected to both sequence-swapping and poly-glycine substitution mutations, and the effects upon stability, folding, and structure were investigated. In the wild-type protein these turns are of identical length, but exhibit different conformations. These conformations were observed to be retained during sequence-swapping and glycine substitution mutagenesis. The results indicate that the beta-turn structure at these positions is not determined by the turn sequence. Structural analysis suggests that residues flanking the turn are a primary structural determinant of the conformation within the turn.

  20. Investigation of mRNA quadruplex formation in Escherichia coli.

    PubMed

    Wieland, Markus; Hartig, Jörg S

    2009-01-01

    The protocol presented here allows for the investigation of the formation of unusual nucleic acid structures in the 5'-untranslated region (UTR) of bacteria by correlating gene expression levels to the in vitro stability of the respective structure. In particular, we describe the introduction of G-quadruplex forming sequences close to the ribosome-binding site (RBS) on the mRNA of a reporter gene and the subsequent read-out of the expression levels. Insertion of a stable secondary structure results in the cloaking of RBS and eventually reduced gene expression levels. The structures and stability of the introduced sequences are further characterized by circular dichroism (CD) spectroscopy and thermal melting experiments. The extent of inhibition is then correlated to the stability of the respective quadruplex structure, allowing judgement of whether factors other than thermodynamic stability affect the formation of a given quadruplex sequence in vivo. Measuring gene expression levels takes 2 d including cloning; CD experiments take 5 hours per experiment.

  1. Molecular Characterization and Antimicrobial Activity of an Endolichenic Fungus, Aspergillus sp. Isolated from Parmelia caperata of Similipal Biosphere Reserve, India.

    PubMed

    Padhi, Srichandan; Das, Devaranjan; Panja, Suraj; Tayung, Kumananda

    2017-06-01

    Endolichenic fungi are microbes that inhabit healthy inner lichen tissues without any disease symptoms. They have been reported to produce new and interesting bioactive metabolites. In the present study, an endolichenic fungus frequently isolated from surface-sterilized lichen thallus of Parmelia caperata has been described. The fungus was identified as Aspergillus tubingensis based on morphological traits and ITS rDNA sequence. Crude metabolites extracted from the culture broth exhibited considerable antimicrobial activity against a panel of clinically significant human pathogens. The fungus showed optimum antimicrobial activity in PDB medium in day 7 of incubation period. PDB medium amended with 1 % NaCl and at alkaline pH was found to be optimal for antimicrobial metabolites production. Enhanced activity was observed when the fungus was exposed briefly to a heat shock of 60 °C during incubation. The metabolites showed optimum λ-max at 214 nm with an absorbance value of 1.589. Molecular characterization of the isolate was carried out by ITS phylogeny and ITS2 secondary structure analyses. The phylogenetic trees based on both ITS rDNA and ITS2 sequences showed the isolate within the clade A. tubingensis. Considering the ubiquity and ambiguity in identifying Aspergillus species of different lifestyles, a method to differentiate pathogenic and endophytic Aspergillus at species level was developed using ITS2 secondary structure analysis. The results showed common folding pattern in the secondary structures with a helix and a 5' dangling end found to be highly conserved. Certain features in the secondary structure like multi-bulges and a symmetric interior loop were observed to be unique which distinguish our isolate from other A. tubingensis.

  2. MollDE: a homology modeling framework you can click with.

    PubMed

    Canutescu, Adrian A; Dunbrack, Roland L

    2005-06-15

    Molecular Integrated Development Environment (MolIDE) is an integrated application designed to provide homology modeling tools and protocols under a uniform, user-friendly graphical interface. Its main purpose is to combine the most frequent modeling steps in a semi-automatic, interactive way, guiding the user from the target protein sequence to the final three-dimensional protein structure. The typical basic homology modeling process is composed of building sequence profiles of the target sequence family, secondary structure prediction, sequence alignment with PDB structures, assisted alignment editing, side-chain prediction and loop building. All of these steps are available through a graphical user interface. MolIDE's user-friendly and streamlined interactive modeling protocol allows the user to focus on the important modeling questions, hiding from the user the raw data generation and conversion steps. MolIDE was designed from the ground up as an open-source, cross-platform, extensible framework. This allows developers to integrate additional third-party programs to MolIDE. http://dunbrack.fccc.edu/molide/molide.php rl_dunbrack@fccc.edu.

  3. The rRNA evolution and procaryotic phylogeny

    NASA Technical Reports Server (NTRS)

    Fox, G. E.

    1986-01-01

    Studies of ribosomal RNA primary structure allow reconstruction of phylogenetic trees for prokaryotic organisms. Such studies reveal major dichotomy among the bacteria that separates them into eubacteria and archaebacteria. Both groupings are further segmented into several major divisions. The results obtained from 5S rRNA sequences are essentially the same as those obtained with the 16S rRNA data. In the case of Gram negative bacteria the ribosomal RNA sequencing results can also be directly compared with hybridization studies and cytochrome c sequencing studies. There is again excellent agreement among the several methods. It seems likely then that the overall picture of microbial phylogeny that is emerging from the RNA sequence studies is a good approximation of the true history of these organisms. The RNA data allow examination of the evolutionary process in a semi-quantitative way. The secondary structures of these RNAs are largely established. As a result it is possible to recognize examples of local structural evolution. Evolutionary pathways accounting for these events can be proposed and their probability can be assessed.

  4. The complete amino acid sequence of human skeletal-muscle fructose-bisphosphate aldolase.

    PubMed Central

    Freemont, P S; Dunbar, B; Fothergill-Gilmore, L A

    1988-01-01

    The complete amino acid sequence of human skeletal-muscle fructose-bisphosphate aldolase, comprising 363 residues, was determined. The sequence was deduced by automated sequencing of CNBr-cleavage, o-iodosobenzoic acid-cleavage, trypsin-digest and staphylococcal-proteinase-digest fragments. Comparison of the sequence with other class I aldolase sequences shows that the mammalian muscle isoenzyme is one of the most highly conserved enzymes known, with only about 2% of the residues changing per 100 million years. Non-mammalian aldolases appear to be evolving at the same rate as other glycolytic enzymes, with about 4% of the residues changing per 100 million years. Secondary-structure predictions are analysed in an accompanying paper [Sawyer, Fothergill-Gilmore & Freemont (1988) Biochem. J. 249, 789-793]. PMID:3355497

  5. Structures of the transmembrane helices of the G-protein coupled receptor, rhodopsin.

    PubMed

    Katragadda, M; Chopra, A; Bennett, M; Alderfer, J L; Yeagle, P L; Albert, A D

    2001-07-01

    An hypothesis is tested that individual peptides corresponding to the transmembrane helices of the membrane protein, rhodopsin, would form helices in solution similar to those in the native protein. Peptides containing the sequences of helices 1, 4 and 5 of rhodopsin were synthesized. Two peptides, with overlapping sequences at their termini, were synthesized to cover each of the helices. The peptides from helix 1 and helix 4 were helical throughout most of their length. The N- and C-termini of all the peptides were disordered and proline caused opening of the helical structure in both helix 1 and helix 4. The peptides from helix 5 were helical in the middle segment of each peptide, with larger disordered regions in the N- and C-termini than for helices 1 and 4. These observations show that there is a strong helical propensity in the amino acid sequences corresponding to the transmembrane domain of this G-protein coupled receptor. In the case of the peptides from helix 4, it was possible to superimpose the structures of the overlapping sequences to produce a construct covering the whole of the sequence of helix 4 of rhodopsin. As similar superposition for the peptides from helix 1 also produced a construct, but somewhat less successfully because of the disordering in the region of sequence overlap. This latter problem was more severe for helix 5 and therefore a single peptide was synthesized for the entire sequence of this helix, and its structure determined. It proved to be helical throughout. Comparison of all these structures with the recent crystal structure of rhodopsin revealed that the peptide structures mimicked the structures seen in the whole protein. Thus similar studies of peptides may provide useful information on the secondary structure of other transmembrane proteins built around helical bundles.

  6. Prediction of β-turns in proteins from multiple alignment using neural network

    PubMed Central

    Kaur, Harpreet; Raghava, Gajendra Pal Singh

    2003-01-01

    A neural network-based method has been developed for the prediction of β-turns in proteins by using multiple sequence alignment. Two feed-forward back-propagation networks with a single hidden layer are used where the first-sequence structure network is trained with the multiple sequence alignment in the form of PSI-BLAST–generated position-specific scoring matrices. The initial predictions from the first network and PSIPRED-predicted secondary structure are used as input to the second structure-structure network to refine the predictions obtained from the first net. A significant improvement in prediction accuracy has been achieved by using evolutionary information contained in the multiple sequence alignment. The final network yields an overall prediction accuracy of 75.5% when tested by sevenfold cross-validation on a set of 426 nonhomologous protein chains. The corresponding Qpred, Qobs, and Matthews correlation coefficient values are 49.8%, 72.3%, and 0.43, respectively, and are the best among all the previously published β-turn prediction methods. The Web server BetaTPred2 (http://www.imtech.res.in/raghava/betatpred2/) has been developed based on this approach. PMID:12592033

  7. Influence of genome-scale RNA structure disruption on the replication of murine norovirus—similar replication kinetics in cell culture but attenuation of viral fitness in vivo

    PubMed Central

    McFadden, Nora; Arias, Armando; Dry, Inga; Bailey, Dalan; Witteveldt, Jeroen; Evans, David J.; Goodfellow, Ian; Simmonds, Peter

    2013-01-01

    Mechanisms by which certain RNA viruses, such as hepatitis C virus, establish persistent infections and cause chronic disease are of fundamental importance in viral pathogenesis. Mammalian positive-stranded RNA viruses establishing persistence typically possess genome-scale ordered RNA secondary structure (GORS) in their genomes. Murine norovirus (MNV) persists in immunocompetent mice and provides an experimental model to functionally characterize GORS. Substitution mutants were constructed with coding sequences in NS3/4- and NS6/7-coding regions replaced with sequences with identical coding and (di-)nucleotide composition but disrupted RNA secondary structure (F1, F2, F1/F2 mutants). Mutants replicated with similar kinetics to wild-type (WT) MNV3 in RAW264.7 cells and primary macrophages, exhibited similar (highly restricted) induction and susceptibility to interferon-coupled cellular responses and equal replication fitness by serial passaging of co-cultures. In vivo, both WT and F1/F2 mutant viruses persistently infected mice, although F1, F2 and F1/F2 mutant viruses were rapidly eliminated 1–7 days post-inoculation in competition experiments with WT. F1/F2 mutants recovered from tissues at 9 months showed higher synonymous substitution rates than WT and nucleotide substitutions that potentially restored of RNA secondary structure. GORS plays no role in basic replication of MNV but potentially contributes to viral fitness and persistence in vivo. PMID:23630317

  8. Assessing the 5S ribosomal RNA heterogeneity in Arabidopsis thaliana using short RNA next generation sequencing data.

    PubMed

    Szymanski, Maciej; Karlowski, Wojciech M

    2016-01-01

    In eukaryotes, ribosomal 5S rRNAs are products of multigene families organized within clusters of tandemly repeated units. Accumulation of genomic data obtained from a variety of organisms demonstrated that the potential 5S rRNA coding sequences show a large number of variants, often incompatible with folding into a correct secondary structure. Here, we present results of an analysis of a large set of short RNA sequences generated by the next generation sequencing techniques, to address the problem of heterogeneity of the 5S rRNA transcripts in Arabidopsis and identification of potentially functional rRNA-derived fragments.

  9. Statistical Evaluation of the Rodin–Ohno Hypothesis: Sense/Antisense Coding of Ancestral Class I and II Aminoacyl-tRNA Synthetases

    PubMed Central

    Chandrasekaran, Srinivas Niranj; Yardimci, Galip Gürkan; Erdogan, Ozgün; Roach, Jeffrey; Carter, Charles W.

    2013-01-01

    We tested the idea that ancestral class I and II aminoacyl-tRNA synthetases arose on opposite strands of the same gene. We assembled excerpted 94-residue Urgenes for class I tryptophanyl-tRNA synthetase (TrpRS) and class II Histidyl-tRNA synthetase (HisRS) from a diverse group of species, by identifying and catenating three blocks coding for secondary structures that position the most highly conserved, active-site residues. The codon middle-base pairing frequency was 0.35 ± 0.0002 in all-by-all sense/antisense alignments for 211 TrpRS and 207 HisRS sequences, compared with frequencies between 0.22 ± 0.0009 and 0.27 ± 0.0005 for eight different representations of the null hypothesis. Clustering algorithms demonstrate further that profiles of middle-base pairing in the synthetase antisense alignments are correlated along the sequences from one species-pair to another, whereas this is not the case for similar operations on sets representing the null hypothesis. Most probable reconstructed sequences for ancestral nodes of maximum likelihood trees show that middle-base pairing frequency increases to approximately 0.42 ± 0.002 as bacterial trees approach their roots; ancestral nodes from trees including archaeal sequences show a less pronounced increase. Thus, contemporary and reconstructed sequences all validate important bioinformatic predictions based on descent from opposite strands of the same ancestral gene. They further provide novel evidence for the hypothesis that bacteria lie closer than archaea to the origin of translation. Moreover, the inverse polarity of genetic coding, together with a priori α-helix propensities suggest that in-frame coding on opposite strands leads to similar secondary structures with opposite polarity, as observed in TrpRS and HisRS crystal structures. PMID:23576570

  10. miRCat2: accurate prediction of plant and animal microRNAs from next-generation sequencing datasets

    PubMed Central

    Paicu, Claudia; Mohorianu, Irina; Stocks, Matthew; Xu, Ping; Coince, Aurore; Billmeier, Martina; Dalmay, Tamas; Moulton, Vincent; Moxon, Simon

    2017-01-01

    Abstract Motivation MicroRNAs are a class of ∼21–22 nt small RNAs which are excised from a stable hairpin-like secondary structure. They have important gene regulatory functions and are involved in many pathways including developmental timing, organogenesis and development in eukaryotes. There are several computational tools for miRNA detection from next-generation sequencing datasets. However, many of these tools suffer from high false positive and false negative rates. Here we present a novel miRNA prediction algorithm, miRCat2. miRCat2 incorporates a new entropy-based approach to detect miRNA loci, which is designed to cope with the high sequencing depth of current next-generation sequencing datasets. It has a user-friendly interface and produces graphical representations of the hairpin structure and plots depicting the alignment of sequences on the secondary structure. Results We test miRCat2 on a number of animal and plant datasets and present a comparative analysis with miRCat, miRDeep2, miRPlant and miReap. We also use mutants in the miRNA biogenesis pathway to evaluate the predictions of these tools. Results indicate that miRCat2 has an improved accuracy compared with other methods tested. Moreover, miRCat2 predicts several new miRNAs that are differentially expressed in wild-type versus mutants in the miRNA biogenesis pathway. Availability and Implementation miRCat2 is part of the UEA small RNA Workbench and is freely available from http://srna-workbench.cmp.uea.ac.uk/. Contact v.moulton@uea.ac.uk or s.moxon@uea.ac.uk Supplementary information Supplementary data are available at Bioinformatics online. PMID:28407097

  11. BEAM web server: a tool for structural RNA motif discovery.

    PubMed

    Pietrosanto, Marco; Adinolfi, Marta; Casula, Riccardo; Ausiello, Gabriele; Ferrè, Fabrizio; Helmer-Citterich, Manuela

    2018-03-15

    RNA structural motif finding is a relevant problem that becomes computationally hard when working on high-throughput data (e.g. eCLIP, PAR-CLIP), often represented by thousands of RNA molecules. Currently, the BEAM server is the only web tool capable to handle tens of thousands of RNA in input with a motif discovery procedure that is only limited by the current secondary structure prediction accuracies. The recently developed method BEAM (BEAr Motifs finder) can analyze tens of thousands of RNA molecules and identify RNA secondary structure motifs associated to a measure of their statistical significance. BEAM is extremely fast thanks to the BEAR encoding that transforms each RNA secondary structure in a string of characters. BEAM also exploits the evolutionary knowledge contained in a substitution matrix of secondary structure elements, extracted from the RFAM database of families of homologous RNAs. The BEAM web server has been designed to streamline data pre-processing by automatically handling folding and encoding of RNA sequences, giving users a choice for the preferred folding program. The server provides an intuitive and informative results page with the list of secondary structure motifs identified, the logo of each motif, its significance, graphic representation and information about its position in the RNA molecules sharing it. The web server is freely available at http://beam.uniroma2.it/ and it is implemented in NodeJS and Python with all major browsers supported. marco.pietrosanto@uniroma2.it. Supplementary data are available at Bioinformatics online.

  12. DNA sequence analysis of simian virus 40 mutants with deletions mapping in the leader region of the late viral mRNA's: mutants with deletions similar in size and position exhibit varied phenotypes.

    PubMed

    Barkan, A; Mertz, J E

    1981-02-01

    The nucleotide sequences of 10 viable yet partially defective deletion mutants of simian virus 40 were determined. The deletions mapped within, and, in many cases, 5' to, the predominant leader sequence of the late viral mRNA's. They ranged from 74 to 187 nucleotide pairs in length. Six of the mutants had lost the sequence that corresponds to the "cap" site (5' terminus) of the most abundant class of 16S mRNA's. One of these mutants had a deletion that extended 103 nucleotide pairs into the region preceding this primary cap site and, therefore, was missing many secondary cap sites as well. A seventh mutant lacked the entire major 16S leader sequence except for the first six nucleotides at its 5' end and the last nine at its 3' end. Although these mutants differed in the size and position of their deletions, we were unable to discover any simple correlations between their growth characteristics and their DNA sequences. This finding indicates that the secondary structures of the RNA transcripts may play a more important role than the exact nucleotide sequence of the RNAs in determining how they function within the cell.

  13. Palingol: a declarative programming language to describe nucleic acids' secondary structures and to scan sequence database.

    PubMed Central

    Billoud, B; Kontic, M; Viari, A

    1996-01-01

    At the DNA/RNA level, biological signals are defined by a combination of spatial structures and sequence motifs. Until now, few attempts had been made in writing general purpose search programs that take into account both sequence and structure criteria. Indeed, the most successful structure scanning programs are usually dedicated to particular structures and are written using general purpose programming languages through a complex and time consuming process where the biological problem of defining the structure and the computer engineering problem of looking for it are intimately intertwined. In this paper, we describe a general representation of structures, suitable for database scanning, together with a programming language, Palingol, designed to manipulate it. Palingol has specific data types, corresponding to structural elements-basically helices-that can be arranged in any way to form a complex structure. As a consequence of the declarative approach used in Palingol, the user should only focus on 'what to search for' while the language engine takes care of 'how to look for it'. Therefore, it becomes simpler to write a scanning program and the structural constraints that define the required structure are more clearly identified. PMID:8628670

  14. Identification of a novel bovine enterovirus possessing highly divergent amino acid sequences in capsid protein.

    PubMed

    Tsuchiaka, Shinobu; Rahpaya, Sayed Samim; Otomaru, Konosuke; Aoki, Hiroshi; Kishimoto, Mai; Naoi, Yuki; Omatsu, Tsutomu; Sano, Kaori; Okazaki-Terashima, Sachiko; Katayama, Yukie; Oba, Mami; Nagai, Makoto; Mizutani, Tetsuya

    2017-01-17

    Bovine enterovirus (BEV) belongs to the species Enterovirus E or F, genus Enterovirus and family Picornaviridae. Although numerous studies have identified BEVs in the feces of cattle with diarrhea, the pathogenicity of BEVs remains unclear. Previously, we reported the detection of novel kobu-like virus in calf feces, by metagenomics analysis. In the present study, we identified a novel BEV in diarrheal feces collected for that survey. Complete genome sequences were determined by deep sequencing in feces. Secondary RNA structure analysis of the 5' untranslated region (UTR), phylogenetic tree construction and pairwise identity analysis were conducted. The complete genome sequences of BEV were genetically distant from other EVs and the VP1 coding region contained novel and unique amino acid sequences. We named this strain as BEV AN12/Bos taurus/JPN/2014 (referred to as BEV-AN12). According to genome analysis, the genome length of this virus is 7414 nucleotides excluding the poly (A) tail and its genome consists of a 5'UTR, open reading frame encoding a single polyprotein, and 3'UTR. The results of secondary RNA structure analysis showed that in the 5'UTR, BEV-AN12 had an additional clover leaf structure and small stem loop structure, similarly to other BEVs. In pairwise identity analysis, BEV-AN12 showed high amino acid (aa) identities to Enterovirus F in the polyprotein, P2 and P3 regions (aa identity ≥82.4%). Therefore, BEV-AN12 is closely related to Enterovirus F. However, aa sequences in the capsid protein regions, particularly the VP1 encoding region, showed significantly low aa identity to other viruses in genus Enterovirus (VP1 aa identity ≤58.6%). In addition, BEV-AN12 branched separately from Enterovirus E and F in phylogenetic trees based on the aa sequences of P1 and VP1, although it clustered with Enterovirus F in trees based on sequences in the P2 and P3 genome region. We identified novel BEV possessing highly divergent aa sequences in the VP1 coding region in Japan. According to species definition, we proposed naming this strain as "Enterovirus K", which is a novel species within genus Enterovirus. Further genomic studies are needed to understand the pathogenicity of BEVs.

  15. Implications of Secondary Aftershocks for Failure Processes

    NASA Astrophysics Data System (ADS)

    Gross, S. J.

    2001-12-01

    When a seismic sequence with more than one mainshock or an unusually large aftershock occurs, there is a compound aftershock sequence. The secondary aftershocks need not have exactly the same decay as the primary sequence, with the differences having implications for the failure process. When the stress step from the secondary mainshock is positive but not large enough to cause immediate failure of all the remaining primary aftershocks, failure processes which involve accelerating slip will produce secondary aftershocks that decay more rapidly than primary aftershocks. This is because the primary aftershocks are an accelerated version of the background seismicity, and secondary aftershocks are an accelerated version of the primary aftershocks. Real stress perturbations may be negative, and heterogeneities in mainshock stress fields mean that the real world situation is quite complicated. I will first describe and verify my picture of secondary aftershock decay with reference to a simple numerical model of slipping faults which obeys rate and state dependent friction and lacks stress heterogeneity. With such a model, it is possible to generate secondary aftershock sequences with perturbed decay patterns, quantify those patterns, and develop an analysis technique capable of correcting for the effect in real data. The secondary aftershocks are defined in terms of frequency linearized time s(T), which is equal to the number of primary aftershocks expected by a time T, $ s ≡ ∫ t=0T n(t) dt, where the start time t=0 is the time of the primary aftershock, and the primary aftershock decay function n(t) is extrapolated forward to the times of the secondary aftershocks. In the absence of secondary sequences the function s(T)$ re-scales the time so that approximately one event occurs per new time unit; the aftershock sequence is gone. If this rescaling is applied in the presence of a secondary sequence, the secondary sequence is shaped like a primary aftershock sequence, and can be fit by the same modeling techniques applied to simple sequences. The later part of the presentation will concern the decay of Hector Mine aftershocks as influenced by the Landers aftershocks. Although attempts to predict the abundance of Hector aftershocks based on stress overlap analysis are not very successful, the analysis does do a good job fitting the decay of secondary sequences.

  16. Transposable elements and G-quadruplexes.

    PubMed

    Kejnovsky, Eduard; Tokan, Viktor; Lexa, Matej

    2015-09-01

    A significant part of eukaryotic genomes is formed by transposable elements (TEs) containing not only genes but also regulatory sequences. Some of the regulatory sequences located within TEs can form secondary structures like hairpins or three-stranded (triplex DNA) and four-stranded (quadruplex DNA) conformations. This review focuses on recent evidence showing that G-quadruplex-forming sequences in particular are often present in specific parts of TEs in plants and humans. We discuss the potential role of these structures in the TE life cycle as well as the impact of G-quadruplexes on replication, transcription, translation, chromatin status, and recombination. The aim of this review is to emphasize that TEs may serve as vehicles for the genomic spread of G-quadruplexes. These non-canonical DNA structures and their conformational switches may constitute another regulatory system that, together with small and long non-coding RNA molecules and proteins, contribute to the complex cellular network resulting in the large diversity of eukaryotes.

  17. Compilation of mRNA Polyadenylation Signals in Arabidopsis Revealed a New Signal Element and Potential Secondary Structures1[w

    PubMed Central

    Loke, Johnny C.; Stahlberg, Eric A.; Strenski, David G.; Haas, Brian J.; Wood, Paul Chris; Li, Qingshun Quinn

    2005-01-01

    Using a novel program, SignalSleuth, and a database containing authenticated polyadenylation [poly(A)] sites, we analyzed the composition of mRNA poly(A) signals in Arabidopsis (Arabidopsis thaliana), and reevaluated previously described cis-elements within the 3′-untranslated (UTR) regions, including near upstream elements and far upstream elements. As predicted, there are absences of high-consensus signal patterns. The AAUAAA signal topped the near upstream elements patterns and was found within the predicted location to only approximately 10% of 3′-UTRs. More importantly, we identified a new set, named cleavage elements, of poly(A) signals flanking both sides of the cleavage site. These cis-elements were not previously revealed by conventional mutagenesis and are contemplated as a cluster of signals for cleavage site recognition. Moreover, a single-nucleotide profile scan on the 3′-UTR regions unveiled a distinct arrangement of alternate stretches of U and A nucleotides, which led to a prediction of the formation of secondary structures. Using an RNA secondary structure prediction program, mFold, we identified three main types of secondary structures on the sequences analyzed. Surprisingly, these observed secondary structures were all interrupted in previously constructed mutations in these regions. These results will enable us to revise the current model of plant poly(A) signals and to develop tools to predict 3′-ends for gene annotation. PMID:15965016

  18. A frequency-based linguistic approach to protein decoding and design: Simple concepts, diverse applications, and the SCS Package

    PubMed Central

    Motomura, Kenta; Nakamura, Morikazu; Otaki, Joji M.

    2013-01-01

    Protein structure and function information is coded in amino acid sequences. However, the relationship between primary sequences and three-dimensional structures and functions remains enigmatic. Our approach to this fundamental biochemistry problem is based on the frequencies of short constituent sequences (SCSs) or words. A protein amino acid sequence is considered analogous to an English sentence, where SCSs are equivalent to words. Availability scores, which are defined as real SCS frequencies in the non-redundant amino acid database relative to their probabilistically expected frequencies, demonstrate the biological usage bias of SCSs. As a result, this frequency-based linguistic approach is expected to have diverse applications, such as secondary structure specifications by structure-specific SCSs and immunological adjuvants with rare or non-existent SCSs. Linguistic similarities (e.g., wide ranges of scale-free distributions) and dissimilarities (e.g., behaviors of low-rank samples) between proteins and the natural English language have been revealed in the rank-frequency relationships of SCSs or words. We have developed a web server, the SCS Package, which contains five applications for analyzing protein sequences based on the linguistic concept. These tools have the potential to assist researchers in deciphering structurally and functionally important protein sites, species-specific sequences, and functional relationships between SCSs. The SCS Package also provides researchers with a tool to construct amino acid sequences de novo based on the idiomatic usage of SCSs. PMID:24688703

  19. A frequency-based linguistic approach to protein decoding and design: Simple concepts, diverse applications, and the SCS Package.

    PubMed

    Motomura, Kenta; Nakamura, Morikazu; Otaki, Joji M

    2013-01-01

    Protein structure and function information is coded in amino acid sequences. However, the relationship between primary sequences and three-dimensional structures and functions remains enigmatic. Our approach to this fundamental biochemistry problem is based on the frequencies of short constituent sequences (SCSs) or words. A protein amino acid sequence is considered analogous to an English sentence, where SCSs are equivalent to words. Availability scores, which are defined as real SCS frequencies in the non-redundant amino acid database relative to their probabilistically expected frequencies, demonstrate the biological usage bias of SCSs. As a result, this frequency-based linguistic approach is expected to have diverse applications, such as secondary structure specifications by structure-specific SCSs and immunological adjuvants with rare or non-existent SCSs. Linguistic similarities (e.g., wide ranges of scale-free distributions) and dissimilarities (e.g., behaviors of low-rank samples) between proteins and the natural English language have been revealed in the rank-frequency relationships of SCSs or words. We have developed a web server, the SCS Package, which contains five applications for analyzing protein sequences based on the linguistic concept. These tools have the potential to assist researchers in deciphering structurally and functionally important protein sites, species-specific sequences, and functional relationships between SCSs. The SCS Package also provides researchers with a tool to construct amino acid sequences de novo based on the idiomatic usage of SCSs.

  20. A Sequence-Independent, Unstructured Internal Ribosome Entry Site Is Responsible for Internal Expression of the Coat Protein of Turnip Crinkle Virus

    PubMed Central

    May, Jared; Johnson, Philip; Saleem, Huma

    2017-01-01

    ABSTRACT To maximize the coding potential of viral genomes, internal ribosome entry sites (IRES) can be used to bypass the traditional requirement of a 5′ cap and some/all of the associated translation initiation factors. Although viral IRES typically contain higher-order RNA structure, an unstructured sequence of about 84 nucleotides (nt) immediately upstream of the Turnip crinkle virus (TCV) coat protein (CP) open reading frame (ORF) has been found to promote internal expression of the CP from the genomic RNA (gRNA) both in vitro and in vivo. An absence of extensive RNA structure was predicted using RNA folding algorithms and confirmed by selective 2′-hydroxyl acylation analyzed by primer extension (SHAPE) RNA structure probing. Analysis of the IRES region in vitro by use of both the TCV gRNA and reporter constructs did not reveal any sequence-specific elements but rather suggested that an overall lack of structure was an important feature for IRES activity. The CP IRES is A-rich, independent of orientation, and strongly conserved among viruses in the same genus. The IRES was dependent on eIF4G, but not eIF4E, for activity. Low levels of CP accumulated in vivo in the absence of detectable TCV subgenomic RNAs, strongly suggesting that the IRES was active in the gRNA in vivo. Since the TCV CP also serves as the viral silencing suppressor, early translation of the CP from the viral gRNA is likely important for countering host defenses. Cellular mRNA IRES also lack extensive RNA structures or sequence conservation, suggesting that this viral IRES and cellular IRES may have similar strategies for internal translation initiation. IMPORTANCE Cap-independent translation is a common strategy among positive-sense, single-stranded RNA viruses for bypassing the host cell requirement of a 5′ cap structure. Viral IRES, in general, contain extensive secondary structure that is critical for activity. In contrast, we demonstrate that a region of viral RNA devoid of extensive secondary structure has IRES activity and produces low levels of viral coat protein in vitro and in vivo. Our findings may be applicable to cellular mRNA IRES that also have little or no sequences/structures in common. PMID:28179526

  1. Selective 2'-hydroxyl acylation analyzed by primer extension and mutational profiling (SHAPE-MaP) for direct, versatile and accurate RNA structure analysis.

    PubMed

    Smola, Matthew J; Rice, Greggory M; Busan, Steven; Siegfried, Nathan A; Weeks, Kevin M

    2015-11-01

    Selective 2'-hydroxyl acylation analyzed by primer extension (SHAPE) chemistries exploit small electrophilic reagents that react with 2'-hydroxyl groups to interrogate RNA structure at single-nucleotide resolution. Mutational profiling (MaP) identifies modified residues by using reverse transcriptase to misread a SHAPE-modified nucleotide and then counting the resulting mutations by massively parallel sequencing. The SHAPE-MaP approach measures the structure of large and transcriptome-wide systems as accurately as can be done for simple model RNAs. This protocol describes the experimental steps, implemented over 3 d, that are required to perform SHAPE probing and to construct multiplexed SHAPE-MaP libraries suitable for deep sequencing. Automated processing of MaP sequencing data is accomplished using two software packages. ShapeMapper converts raw sequencing files into mutational profiles, creates SHAPE reactivity plots and provides useful troubleshooting information. SuperFold uses these data to model RNA secondary structures, identify regions with well-defined structures and visualize probable and alternative helices, often in under 1 d. SHAPE-MaP can be used to make nucleotide-resolution biophysical measurements of individual RNA motifs, rare components of complex RNA ensembles and entire transcriptomes.

  2. Accelerated probabilistic inference of RNA structure evolution

    PubMed Central

    Holmes, Ian

    2005-01-01

    Background Pairwise stochastic context-free grammars (Pair SCFGs) are powerful tools for evolutionary analysis of RNA, including simultaneous RNA sequence alignment and secondary structure prediction, but the associated algorithms are intensive in both CPU and memory usage. The same problem is faced by other RNA alignment-and-folding algorithms based on Sankoff's 1985 algorithm. It is therefore desirable to constrain such algorithms, by pre-processing the sequences and using this first pass to limit the range of structures and/or alignments that can be considered. Results We demonstrate how flexible classes of constraint can be imposed, greatly reducing the computational costs while maintaining a high quality of structural homology prediction. Any score-attributed context-free grammar (e.g. energy-based scoring schemes, or conditionally normalized Pair SCFGs) is amenable to this treatment. It is now possible to combine independent structural and alignment constraints of unprecedented general flexibility in Pair SCFG alignment algorithms. We outline several applications to the bioinformatics of RNA sequence and structure, including Waterman-Eggert N-best alignments and progressive multiple alignment. We evaluate the performance of the algorithm on test examples from the RFAM database. Conclusion A program, Stemloc, that implements these algorithms for efficient RNA sequence alignment and structure prediction is available under the GNU General Public License. PMID:15790387

  3. Optical Crystals

    ERIC Educational Resources Information Center

    Bergsten, Ronald

    1974-01-01

    Discusses the production and structure of a sequence of optical crystals which can serve as one-, two-, and three-dimensional diffraction plates to illustrate diffraction patterns by using light rather than x-rays or particles. Applications to qualitative presentations of Laue theory at the secondary and college levels are recommended. (CC)

  4. The structure of cell adhesion molecule uvomorulin. Insights into the molecular mechanism of Ca2+-dependent cell adhesion.

    PubMed Central

    Ringwald, M; Schuh, R; Vestweber, D; Eistetter, H; Lottspeich, F; Engel, J; Dölz, R; Jähnig, F; Epplen, J; Mayer, S

    1987-01-01

    We have determined the amino acid sequence of the Ca2+-dependent cell adhesion molecule uvomorulin as it appears on the cell surface. The extracellular part of the molecule exhibits three internally repeated domains of 112 residues which are most likely generated by gene duplication. Each of the repeated domains contains two highly conserved units which could represent putative Ca2+-binding sites. Secondary structure predictions suggest that the putative Ca2+-binding units are located in external loops at the surface of the protein. The protein sequence exhibits a single membrane-spanning region and a cytoplasmic domain. Sequence comparison reveals extensive homology to the chicken L-CAM. Both uvomorulin and L-CAM are identical in 65% of their entire amino acid sequence suggesting a common origin for both CAMs. Images Fig. 1. Fig. 4. Fig. 7. PMID:3501370

  5. A TALE-inspired computational screen for proteins that contain approximate tandem repeats.

    PubMed

    Perycz, Malgorzata; Krwawicz, Joanna; Bochtler, Matthias

    2017-01-01

    TAL (transcription activator-like) effectors (TALEs) are bacterial proteins that are secreted from bacteria to plant cells to act as transcriptional activators. TALEs and related proteins (RipTALs, BurrH, MOrTL1 and MOrTL2) contain approximate tandem repeats that differ in conserved positions that define specificity. Using PERL, we screened ~47 million protein sequences for TALE-like architecture characterized by approximate tandem repeats (between 30 and 43 amino acids in length) and sequence variability in conserved positions, without requiring sequence similarity to TALEs. Candidate proteins were scored according to their propensity for nuclear localization, secondary structure, repeat sequence complexity, as well as covariation and predicted structural proximity of variable residues. Biological context was tentatively inferred from co-occurrence of other domains and interactome predictions. Approximate repeats with TALE-like features that merit experimental characterization were found in a protein of chestnut blight fungus, a eukaryotic plant pathogen.

  6. A TALE-inspired computational screen for proteins that contain approximate tandem repeats

    PubMed Central

    Krwawicz, Joanna

    2017-01-01

    TAL (transcription activator-like) effectors (TALEs) are bacterial proteins that are secreted from bacteria to plant cells to act as transcriptional activators. TALEs and related proteins (RipTALs, BurrH, MOrTL1 and MOrTL2) contain approximate tandem repeats that differ in conserved positions that define specificity. Using PERL, we screened ~47 million protein sequences for TALE-like architecture characterized by approximate tandem repeats (between 30 and 43 amino acids in length) and sequence variability in conserved positions, without requiring sequence similarity to TALEs. Candidate proteins were scored according to their propensity for nuclear localization, secondary structure, repeat sequence complexity, as well as covariation and predicted structural proximity of variable residues. Biological context was tentatively inferred from co-occurrence of other domains and interactome predictions. Approximate repeats with TALE-like features that merit experimental characterization were found in a protein of chestnut blight fungus, a eukaryotic plant pathogen. PMID:28617832

  7. X-Ray Crystal Structure of the passenger domain of Plasmid encoded toxin(Pet), an Autotransporter Enterotoxin from enteroaggregative Escherichia coli (EAEC)

    PubMed Central

    Meza-Aguilar, J. Domingo; Fromme, Petra; Torres-Larios, Alfredo; Mendoza-Hernández, Guillermo; Hernandez-Chiñas, Ulises; Monteros, Roberto A. Arreguin-Espinosa de los; Campos, Carlos A. Eslava; Fromme, Raimund

    2014-01-01

    Autotransporters (ATs) represent a superfamily of proteins produced by a variety of pathogenic bacteria, which include the pathogenic groups of Escherichia coli (E. coli) associated with gastrointestinal and urinary tract infections. We present the first X-ray structure of the passenger domain from the Plasmid-encoded toxin (Pet) a 100 kDa protein at 2.3 Å resolution which is a cause of acute diarrhea in both developing and industrialized countries. Pet is a cytoskeleton-altering toxin that induces loss of actin stress fibers. While Pet (pdb code: 4OM9) shows only a sequence identity of 50 % compared to the closest related protein sequence, extracellular serine protease plasmid (EspP) the structural features of both proteins are conserved. A closer structural look reveals that Pet contains a β-pleaded sheet at the sequence region of residues 181-190, the corresponding structural domain in EspP consists of a coiled loop. Secondary, the Pet passenger domain features a more pronounced beta sheet between residues 135-143 compared to the structure of EspP. PMID:24530907

  8. Fast online and index-based algorithms for approximate search of RNA sequence-structure patterns

    PubMed Central

    2013-01-01

    Background It is well known that the search for homologous RNAs is more effective if both sequence and structure information is incorporated into the search. However, current tools for searching with RNA sequence-structure patterns cannot fully handle mutations occurring on both these levels or are simply not fast enough for searching large sequence databases because of the high computational costs of the underlying sequence-structure alignment problem. Results We present new fast index-based and online algorithms for approximate matching of RNA sequence-structure patterns supporting a full set of edit operations on single bases and base pairs. Our methods efficiently compute semi-global alignments of structural RNA patterns and substrings of the target sequence whose costs satisfy a user-defined sequence-structure edit distance threshold. For this purpose, we introduce a new computing scheme to optimally reuse the entries of the required dynamic programming matrices for all substrings and combine it with a technique for avoiding the alignment computation of non-matching substrings. Our new index-based methods exploit suffix arrays preprocessed from the target database and achieve running times that are sublinear in the size of the searched sequences. To support the description of RNA molecules that fold into complex secondary structures with multiple ordered sequence-structure patterns, we use fast algorithms for the local or global chaining of approximate sequence-structure pattern matches. The chaining step removes spurious matches from the set of intermediate results, in particular of patterns with little specificity. In benchmark experiments on the Rfam database, our improved online algorithm is faster than the best previous method by up to factor 45. Our best new index-based algorithm achieves a speedup of factor 560. Conclusions The presented methods achieve considerable speedups compared to the best previous method. This, together with the expected sublinear running time of the presented index-based algorithms, allows for the first time approximate matching of RNA sequence-structure patterns in large sequence databases. Beyond the algorithmic contributions, we provide with RaligNAtor a robust and well documented open-source software package implementing the algorithms presented in this manuscript. The RaligNAtor software is available at http://www.zbh.uni-hamburg.de/ralignator. PMID:23865810

  9. Primary and secondary structural analyses of glutathione S-transferase pi from human placenta.

    PubMed

    Ahmad, H; Wilson, D E; Fritz, R R; Singh, S V; Medh, R D; Nagle, G T; Awasthi, Y C; Kurosky, A

    1990-05-01

    The primary structure of glutathione S-transferase (GST) pi from a single human placenta was determined. The structure was established by chemical characterization of tryptic and cyanogen bromide peptides as well as automated sequence analysis of the intact enzyme. The structural analysis indicated that the protein is comprised of 209 amino acid residues and gave no evidence of post-translational modifications. The amino acid sequence differed from that of the deduced amino acid sequence determined by nucleotide sequence analysis of a cDNA clone (Kano, T., Sakai, M., and Muramatsu, M., 1987, Cancer Res. 47, 5626-5630) at position 104 which contained both valine and isoleucine whereas the deduced sequence from nucleotide sequence analysis identified only isoleucine at this position. These results demonstrated that in the one individual placenta studied at least two GST pi genes are coexpressed, probably as a result of allelomorphism. Computer assisted consensus sequence evaluation identified a hydrophobic region in GST pi (residues 155-181) that was predicted to be either a buried transmembrane helical region or a signal sequence region. The significance of this hydrophobic region was interpreted in relation to the mode of action of the enzyme especially in regard to the potential involvement of a histidine in the active site mechanism. A comparison of the chemical similarity of five known human GST complete enzyme structures, one of pi, one of mu, two of alpha, and one microsomal, gave evidence that all five enzymes have evolved by a divergent evolutionary process after gene duplication, with the microsomal enzyme representing the most divergent form.

  10. PredictProtein—an open resource for online prediction of protein structural and functional features

    PubMed Central

    Yachdav, Guy; Kloppmann, Edda; Kajan, Laszlo; Hecht, Maximilian; Goldberg, Tatyana; Hamp, Tobias; Hönigschmid, Peter; Schafferhans, Andrea; Roos, Manfred; Bernhofer, Michael; Richter, Lothar; Ashkenazy, Haim; Punta, Marco; Schlessinger, Avner; Bromberg, Yana; Schneider, Reinhard; Vriend, Gerrit; Sander, Chris; Ben-Tal, Nir; Rost, Burkhard

    2014-01-01

    PredictProtein is a meta-service for sequence analysis that has been predicting structural and functional features of proteins since 1992. Queried with a protein sequence it returns: multiple sequence alignments, predicted aspects of structure (secondary structure, solvent accessibility, transmembrane helices (TMSEG) and strands, coiled-coil regions, disulfide bonds and disordered regions) and function. The service incorporates analysis methods for the identification of functional regions (ConSurf), homology-based inference of Gene Ontology terms (metastudent), comprehensive subcellular localization prediction (LocTree3), protein–protein binding sites (ISIS2), protein–polynucleotide binding sites (SomeNA) and predictions of the effect of point mutations (non-synonymous SNPs) on protein function (SNAP2). Our goal has always been to develop a system optimized to meet the demands of experimentalists not highly experienced in bioinformatics. To this end, the PredictProtein results are presented as both text and a series of intuitive, interactive and visually appealing figures. The web server and sources are available at http://ppopen.rostlab.org. PMID:24799431

  11. Ebola virus RNA editing depends on the primary editing site sequence and an upstream secondary structure.

    PubMed

    Mehedi, Masfique; Hoenen, Thomas; Robertson, Shelly; Ricklefs, Stacy; Dolan, Michael A; Taylor, Travis; Falzarano, Darryl; Ebihara, Hideki; Porcella, Stephen F; Feldmann, Heinz

    2013-01-01

    Ebolavirus (EBOV), the causative agent of a severe hemorrhagic fever and a biosafety level 4 pathogen, increases its genome coding capacity by producing multiple transcripts encoding for structural and nonstructural glycoproteins from a single gene. This is achieved through RNA editing, during which non-template adenosine residues are incorporated into the EBOV mRNAs at an editing site encoding for 7 adenosine residues. However, the mechanism of EBOV RNA editing is currently not understood. In this study, we report for the first time that minigenomes containing the glycoprotein gene editing site can undergo RNA editing, thereby eliminating the requirement for a biosafety level 4 laboratory to study EBOV RNA editing. Using a newly developed dual-reporter minigenome, we have characterized the mechanism of EBOV RNA editing, and have identified cis-acting sequences that are required for editing, located between 9 nt upstream and 9 nt downstream of the editing site. Moreover, we show that a secondary structure in the upstream cis-acting sequence plays an important role in RNA editing. EBOV RNA editing is glycoprotein gene-specific, as a stretch encoding for 7 adenosine residues located in the viral polymerase gene did not serve as an editing site, most likely due to an absence of the necessary cis-acting sequences. Finally, the EBOV protein VP30 was identified as a trans-acting factor for RNA editing, constituting a novel function for this protein. Overall, our results provide novel insights into the RNA editing mechanism of EBOV, further understanding of which might result in novel intervention strategies against this viral pathogen.

  12. Structure of Lmaj006129AAA, a hypothetical protein from Leishmania major

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Arakaki, Tracy; Le Trong, Isolde; Structural Genomics of Pathogenic Protozoa

    2006-03-01

    The crystal structure of a conserved hypothetical protein from L. major, Pfam sequence family PF04543, structural genomics target ID Lmaj006129AAA, has been determined at a resolution of 1.6 Å. The gene product of structural genomics target Lmaj006129 from Leishmania major codes for a 164-residue protein of unknown function. When SeMet expression of the full-length gene product failed, several truncation variants were created with the aid of Ginzu, a domain-prediction method. 11 truncations were selected for expression, purification and crystallization based upon secondary-structure elements and disorder. The structure of one of these variants, Lmaj006129AAH, was solved by multiple-wavelength anomalous diffraction (MAD)more » using ELVES, an automatic protein crystal structure-determination system. This model was then successfully used as a molecular-replacement probe for the parent full-length target, Lmaj006129AAA. The final structure of Lmaj006129AAA was refined to an R value of 0.185 (R{sub free} = 0.229) at 1.60 Å resolution. Structure and sequence comparisons based on Lmaj006129AAA suggest that proteins belonging to Pfam sequence families PF04543 and PF01878 may share a common ligand-binding motif.« less

  13. Base pair probability estimates improve the prediction accuracy of RNA non-canonical base pairs

    PubMed Central

    2017-01-01

    Prediction of RNA tertiary structure from sequence is an important problem, but generating accurate structure models for even short sequences remains difficult. Predictions of RNA tertiary structure tend to be least accurate in loop regions, where non-canonical pairs are important for determining the details of structure. Non-canonical pairs can be predicted using a knowledge-based model of structure that scores nucleotide cyclic motifs, or NCMs. In this work, a partition function algorithm is introduced that allows the estimation of base pairing probabilities for both canonical and non-canonical interactions. Pairs that are predicted to be probable are more likely to be found in the true structure than pairs of lower probability. Pair probability estimates can be further improved by predicting the structure conserved across multiple homologous sequences using the TurboFold algorithm. These pairing probabilities, used in concert with prior knowledge of the canonical secondary structure, allow accurate inference of non-canonical pairs, an important step towards accurate prediction of the full tertiary structure. Software to predict non-canonical base pairs and pairing probabilities is now provided as part of the RNAstructure software package. PMID:29107980

  14. Tertiary alphabet for the observable protein structural universe

    PubMed Central

    Mackenzie, Craig O.; Zhou, Jianfu; Grigoryan, Gevorg

    2016-01-01

    Here, we systematically decompose the known protein structural universe into its basic elements, which we dub tertiary structural motifs (TERMs). A TERM is a compact backbone fragment that captures the secondary, tertiary, and quaternary environments around a given residue, comprising one or more disjoint segments (three on average). We seek the set of universal TERMs that capture all structure in the Protein Data Bank (PDB), finding remarkable degeneracy. Only ∼600 TERMs are sufficient to describe 50% of the PDB at sub-Angstrom resolution. However, more rare geometries also exist, and the overall structural coverage grows logarithmically with the number of TERMs. We go on to show that universal TERMs provide an effective mapping between sequence and structure. We demonstrate that TERM-based statistics alone are sufficient to recapitulate close-to-native sequences given either NMR or X-ray backbones. Furthermore, sequence variability predicted from TERM data agrees closely with evolutionary variation. Finally, locations of TERMs in protein chains can be predicted from sequence alone based on sequence signatures emergent from TERM instances in the PDB. For multisegment motifs, this method identifies spatially adjacent fragments that are not contiguous in sequence—a major bottleneck in structure prediction. Although all TERMs recur in diverse proteins, some appear specialized for certain functions, such as interface formation, metal coordination, or even water binding. Structural biology has benefited greatly from previously observed degeneracies in structure. The decomposition of the known structural universe into a finite set of compact TERMs offers exciting opportunities toward better understanding, design, and prediction of protein structure. PMID:27810958

  15. GOBASE—a database of mitochondrial and chloroplast information

    PubMed Central

    O'Brien, Emmet A.; Badidi, Elarbi; Barbasiewicz, Ania; deSousa, Cristina; Lang, B. Franz; Burger, Gertraud

    2003-01-01

    GOBASE is a relational database containing integrated sequence, RNA secondary structure and biochemical and taxonomic information about organelles. GOBASE release 6 (summer 2002) contains over 130 000 mitochondrial sequences, an increase of 37% over the previous release, and more than 30 000 chloroplast sequences in a new auxiliary database. To handle this flood of new data, we have designed and implemented GOpop, a Java system for population and verification of the database. We have also implemented a more powerful and flexible user interface using the PHP programming language. http://megasun.bch.umontreal.ca/gobase/gobase.html. PMID:12519975

  16. Mitochondrial genome of the African lion Panthera leo leo.

    PubMed

    Ma, Yue-ping; Wang, Shuo

    2015-01-01

    In this study, the complete mitochondrial genome sequence of the African lion P. leo leo was reported. The total length of the mitogenome was 17,054 bp. It contained the typical mitochondrial structure, including 13 protein-coding genes, 22 transfer RNA genes, 2 ribosomal RNA genes and 1 control region; 21 of the tRNA genes folded into typical cloverleaf secondary structure except for tRNASe. The overall composition of the mitogenome was A (32.0%), G (14.5%), C (26.5%) and T (27.0%). The new sequence will provide molecular genetic information for conservation genetics study of this important large carnivore.

  17. Functional Biomimetic Architectures

    NASA Astrophysics Data System (ADS)

    Levine, Paul M.

    N-substituted glycine oligomers, or 'peptoids,' are a class of sequence--specific foldamers composed of tertiary amide linkages, engendering proteolytic stability and enhanced cellular permeability. Peptoids are notable for their facile synthesis, sequence diversity, and ability to fold into distinct secondary structures. In an effort to establish new functional peptoid architectures, we utilize the copper-catalyzed azide-alkyne [3+2] cycloaddition (CuAAC) reaction to generate peptidomimetic assemblies bearing bioactive ligands that specifically target and modulate Androgen Receptor (AR) activity, a major therapeutic target for prostate cancer. Additionally, we explore chemical ligation protocols to generate semi-synthetic hybrid biomacromolecules capable of exhibiting novel structures and functions not accessible to fully biosynthesized proteins.

  18. IMG-ABC: A Knowledge Base To Fuel Discovery of Biosynthetic Gene Clusters and Novel Secondary Metabolites.

    PubMed

    Hadjithomas, Michalis; Chen, I-Min Amy; Chu, Ken; Ratner, Anna; Palaniappan, Krishna; Szeto, Ernest; Huang, Jinghua; Reddy, T B K; Cimermančič, Peter; Fischbach, Michael A; Ivanova, Natalia N; Markowitz, Victor M; Kyrpides, Nikos C; Pati, Amrita

    2015-07-14

    In the discovery of secondary metabolites, analysis of sequence data is a promising exploration path that remains largely underutilized due to the lack of computational platforms that enable such a systematic approach on a large scale. In this work, we present IMG-ABC (https://img.jgi.doe.gov/abc), an atlas of biosynthetic gene clusters within the Integrated Microbial Genomes (IMG) system, which is aimed at harnessing the power of "big" genomic data for discovering small molecules. IMG-ABC relies on IMG's comprehensive integrated structural and functional genomic data for the analysis of biosynthetic gene clusters (BCs) and associated secondary metabolites (SMs). SMs and BCs serve as the two main classes of objects in IMG-ABC, each with a rich collection of attributes. A unique feature of IMG-ABC is the incorporation of both experimentally validated and computationally predicted BCs in genomes as well as metagenomes, thus identifying BCs in uncultured populations and rare taxa. We demonstrate the strength of IMG-ABC's focused integrated analysis tools in enabling the exploration of microbial secondary metabolism on a global scale, through the discovery of phenazine-producing clusters for the first time in Alphaproteobacteria. IMG-ABC strives to fill the long-existent void of resources for computational exploration of the secondary metabolism universe; its underlying scalable framework enables traversal of uncovered phylogenetic and chemical structure space, serving as a doorway to a new era in the discovery of novel molecules. IMG-ABC is the largest publicly available database of predicted and experimental biosynthetic gene clusters and the secondary metabolites they produce. The system also includes powerful search and analysis tools that are integrated with IMG's extensive genomic/metagenomic data and analysis tool kits. As new research on biosynthetic gene clusters and secondary metabolites is published and more genomes are sequenced, IMG-ABC will continue to expand, with the goal of becoming an essential component of any bioinformatic exploration of the secondary metabolism world. Copyright © 2015 Hadjithomas et al.

  19. The influence of ignoring secondary structure on divergence time estimates from ribosomal RNA genes.

    PubMed

    Dohrmann, Martin

    2014-02-01

    Genes coding for ribosomal RNA molecules (rDNA) are among the most popular markers in molecular phylogenetics and evolution. However, coevolution of sites that code for pairing regions (stems) in the RNA secondary structure can make it challenging to obtain accurate results from such loci. While the influence of ignoring secondary structure on multiple sequence alignment and tree topology has been investigated in numerous studies, its effect on molecular divergence time estimates is still poorly known. Here, I investigate this issue in Bayesian Markov Chain Monte Carlo (BMCMC) and penalized likelihood (PL) frameworks, using empirical datasets from dragonflies (Odonata: Anisoptera) and glass sponges (Porifera: Hexactinellida). My results indicate that highly biased inferences under substitution models that ignore secondary structure only occur if maximum-likelihood estimates of branch lengths are used as input to PL dating, whereas in a BMCMC framework and in PL dating based on Bayesian consensus branch lengths, the effect is far less severe. I conclude that accounting for coevolution of paired sites in molecular dating studies is not as important as previously suggested, as long as the estimates are based on Bayesian consensus branch lengths instead of ML point estimates. This finding is especially relevant for studies where computational limitations do not allow the use of secondary-structure specific substitution models, or where accurate consensus structures cannot be predicted. I also found that the magnitude and direction (over- vs. underestimating node ages) of bias in age estimates when secondary structure is ignored was not distributed randomly across the nodes of the phylogenies, a phenomenon that requires further investigation. Copyright © 2013 Elsevier Inc. All rights reserved.

  20. Chemical synthesis and characterization of branched oligodeoxyribonucleotides (bDNA) for use as signal amplifiers in nucleic acid quantification assays.

    PubMed

    Horn, T; Chang, C A; Urdea, M S

    1997-12-01

    The divergent synthesis of bDNA structures is described. This new type of branched DNA contains one unique oligonucleotide, the primary sequence, covalently attached through a comb-like branching network to many identical copies of a different oligonucleotide, the secondary sequence. The bDNA comb molecules were assembled on a solid support using parameters optimized for bDNA synthesis. The chemistry was used to synthesize bDNA comb molecules containing 15 secondary sequences. The bDNA comb molecules were elaborated by enzymatic ligation into branched amplification multimers, large bDNA molecules (a total of 1068 nt) containing an average of 36 repeated DNA oligomer sequences, each capable of hybridizing specifically to an alkaline phosphatase-labeled oligonucleotide. The bDNA comb molecules were characterized by electrophoretic methods and by controlled cleavage at periodate-cleavable moieties incorporated during synthesis. The branched amplification multimers have been used as signal amplifiers in nucleic acid quantification assays for detection of viral infection. It is possible to detect as few as 50 molecules with bDNA technology.

  1. Chemical synthesis and characterization of branched oligodeoxyribonucleotides (bDNA) for use as signal amplifiers in nucleic acid quantification assays.

    PubMed Central

    Horn, T; Chang, C A; Urdea, M S

    1997-01-01

    The divergent synthesis of bDNA structures is described. This new type of branched DNA contains one unique oligonucleotide, the primary sequence, covalently attached through a comb-like branching network to many identical copies of a different oligonucleotide, the secondary sequence. The bDNA comb molecules were assembled on a solid support using parameters optimized for bDNA synthesis. The chemistry was used to synthesize bDNA comb molecules containing 15 secondary sequences. The bDNA comb molecules were elaborated by enzymatic ligation into branched amplification multimers, large bDNA molecules (a total of 1068 nt) containing an average of 36 repeated DNA oligomer sequences, each capable of hybridizing specifically to an alkaline phosphatase-labeled oligonucleotide. The bDNA comb molecules were characterized by electrophoretic methods and by controlled cleavage at periodate-cleavable moieties incorporated during synthesis. The branched amplification multimers have been used as signal amplifiers in nucleic acid quantification assays for detection of viral infection. It is possible to detect as few as 50 molecules with bDNA technology. PMID:9365266

  2. Solving the Secondary Structure Matching Problem in Cryo-EM De Novo Modeling Using a Constrained K-Shortest Path Graph Algorithm.

    PubMed

    Al Nasr, Kamal; Ranjan, Desh; Zubair, Mohammad; Chen, Lin; He, Jing

    2014-01-01

    Electron cryomicroscopy is becoming a major experimental technique in solving the structures of large molecular assemblies. More and more three-dimensional images have been obtained at the medium resolutions between 5 and 10 Å. At this resolution range, major α-helices can be detected as cylindrical sticks and β-sheets can be detected as plain-like regions. A critical question in de novo modeling from cryo-EM images is to determine the match between the detected secondary structures from the image and those on the protein sequence. We formulate this matching problem into a constrained graph problem and present an O(Δ(2)N(2)2(N)) algorithm to this NP-Hard problem. The algorithm incorporates the dynamic programming approach into a constrained K-shortest path algorithm. Our method, DP-TOSS, has been tested using α-proteins with maximum 33 helices and α-β proteins up to five helices and 12 β-strands. The correct match was ranked within the top 35 for 19 of the 20 α-proteins and all nine α-β proteins tested. The results demonstrate that DP-TOSS improves accuracy, time and memory space in deriving the topologies of the secondary structure elements for proteins with a large number of secondary structures and a complex skeleton.

  3. Structural and Sequence Stratigraphic Analysis of the Onshore Nile Delta, Egypt.

    NASA Astrophysics Data System (ADS)

    Barakat, Moataz; Dominik, Wilhelm

    2010-05-01

    The Nile Delta is considered the earliest known delta in the world. It was already described by Herodotus in the 5th Century AC. Nowadays; the Nile Delta is an emerging giant gas province in the Middle East with proven gas reserves which have more than doubled in size in the last years. The Nile Delta basin contains a thick sedimentary sequence inferred to extend from Jurassic to recent time. Structural styles and depositional environments varied during this period. Facies architecture and sequence stratigraphy of the Nile Delta are resolved using seismic stratigraphy based on (2D seismic lines) including synthetic seismograms and tying in well log data. Synthetic seismograms were constructed using sonic and density logs. The combination of structural interpretation and sequence stratigraphy of the development of the basin was resolved. Seven chrono-stratigraphic boundaries have been identified and correlated on seismic and well log data. Several unconformity boundaries also identified on seismic lines range from angular to disconformity type. Furthermore, time structure maps, velocity maps, depth structure maps as well as Isopach maps were constructed using seismic lines and log data. Several structural features were identified: normal faults, growth faults, listric faults, secondary antithetic faults and large rotated fault blocks of manly Miocene age. In some cases minor rollover structures could be identified. Sedimentary features such as paleo-channels were distinctively recognized. Typical Sequence stratigraphic features such as incised valley, clinoforms, topsets, offlaps and onlaps are identified and traced on the seismic lines allowing a good insight into sequence stratigraphic history of the Nile Delta most especially in the Miocene to Pliocene clastic sedimentary succession.

  4. Sequencing intractable DNA to close microbial genomes.

    PubMed

    Hurt, Richard A; Brown, Steven D; Podar, Mircea; Palumbo, Anthony V; Elias, Dwayne A

    2012-01-01

    Advancement in high throughput DNA sequencing technologies has supported a rapid proliferation of microbial genome sequencing projects, providing the genetic blueprint for in-depth studies. Oftentimes, difficult to sequence regions in microbial genomes are ruled "intractable" resulting in a growing number of genomes with sequence gaps deposited in databases. A procedure was developed to sequence such problematic regions in the "non-contiguous finished" Desulfovibrio desulfuricans ND132 genome (6 intractable gaps) and the Desulfovibrio africanus genome (1 intractable gap). The polynucleotides surrounding each gap formed GC rich secondary structures making the regions refractory to amplification and sequencing. Strand-displacing DNA polymerases used in concert with a novel ramped PCR extension cycle supported amplification and closure of all gap regions in both genomes. The developed procedures support accurate gene annotation, and provide a step-wise method that reduces the effort required for genome finishing.

  5. FANCJ promotes DNA synthesis through G-quadruplex structures

    PubMed Central

    Castillo Bosch, Pau; Segura-Bayona, Sandra; Koole, Wouter; van Heteren, Jane T; Dewar, James M; Tijsterman, Marcel; Knipscheer, Puck

    2014-01-01

    Our genome contains many G-rich sequences, which have the propensity to fold into stable secondary DNA structures called G4 or G-quadruplex structures. These structures have been implicated in cellular processes such as gene regulation and telomere maintenance. However, G4 sequences are prone to mutations particularly upon replication stress or in the absence of specific helicases. To investigate how G-quadruplex structures are resolved during DNA replication, we developed a model system using ssDNA templates and Xenopus egg extracts that recapitulates eukaryotic G4 replication. Here, we show that G-quadruplex structures form a barrier for DNA replication. Nascent strand synthesis is blocked at one or two nucleotides from the G4. After transient stalling, G-quadruplexes are efficiently unwound and replicated. In contrast, depletion of the FANCJ/BRIP1 helicase causes persistent replication stalling at G-quadruplex structures, demonstrating a vital role for this helicase in resolving these structures. FANCJ performs this function independently of the classical Fanconi anemia pathway. These data provide evidence that the G4 sequence instability in FANCJ−/− cells and Fancj/dog1 deficient C. elegans is caused by replication stalling at G-quadruplexes. PMID:25193968

  6. VITAL NMR: Using Chemical Shift Derived Secondary Structure Information for a Limited Set of Amino Acids to Assess Homology Model Accuracy

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Brothers, Michael C; Nesbitt, Anna E; Hallock, Michael J

    2011-01-01

    Homology modeling is a powerful tool for predicting protein structures, whose success depends on obtaining a reasonable alignment between a given structural template and the protein sequence being analyzed. In order to leverage greater predictive power for proteins with few structural templates, we have developed a method to rank homology models based upon their compliance to secondary structure derived from experimental solid-state NMR (SSNMR) data. Such data is obtainable in a rapid manner by simple SSNMR experiments (e.g., (13)C-(13)C 2D correlation spectra). To test our homology model scoring procedure for various amino acid labeling schemes, we generated a library ofmore » 7,474 homology models for 22 protein targets culled from the TALOS+/SPARTA+ training set of protein structures. Using subsets of amino acids that are plausibly assigned by SSNMR, we discovered that pairs of the residues Val, Ile, Thr, Ala and Leu (VITAL) emulate an ideal dataset where all residues are site specifically assigned. Scoring the models with a predicted VITAL site-specific dataset and calculating secondary structure with the Chemical Shift Index resulted in a Pearson correlation coefficient (-0.75) commensurate to the control (-0.77), where secondary structure was scored site specifically for all amino acids (ALL 20) using STRIDE. This method promises to accelerate structure procurement by SSNMR for proteins with unknown folds through guiding the selection of remotely homologous protein templates and assessing model quality.« less

  7. Inverted repeat Alu elements in the human lincRNA-p21 adopt a conserved secondary structure that regulates RNA function

    PubMed Central

    Chillón, Isabel; Pyle, Anna M.

    2016-01-01

    LincRNA-p21 is a long intergenic non-coding RNA (lincRNA) involved in the p53-mediated stress response. We sequenced the human lincRNA-p21 (hLincRNA-p21) and found that it has a single exon that includes inverted repeat Alu elements (IRAlus). Sense and antisense Alu elements fold independently of one another into a secondary structure that is conserved in lincRNA-p21 among primates. Moreover, the structures formed by IRAlus are involved in the localization of hLincRNA-p21 in the nucleus, where hLincRNA-p21 colocalizes with paraspeckles. Our results underscore the importance of IRAlus structures for the function of hLincRNA-p21 during the stress response. PMID:27378782

  8. Amino acid sequence analysis of the annexin super-gene family of proteins.

    PubMed

    Barton, G J; Newman, R H; Freemont, P S; Crumpton, M J

    1991-06-15

    The annexins are a widespread family of calcium-dependent membrane-binding proteins. No common function has been identified for the family and, until recently, no crystallographic data existed for an annexin. In this paper we draw together 22 available annexin sequences consisting of 88 similar repeat units, and apply the techniques of multiple sequence alignment, pattern matching, secondary structure prediction and conservation analysis to the characterisation of the molecules. The analysis clearly shows that the repeats cluster into four distinct families and that greatest variation occurs within the repeat 3 units. Multiple alignment of the 88 repeats shows amino acids with conserved physicochemical properties at 22 positions, with only Gly at position 23 being absolutely conserved in all repeats. Secondary structure prediction techniques identify five conserved helices in each repeat unit and patterns of conserved hydrophobic amino acids are consistent with one face of a helix packing against the protein core in predicted helices a, c, d, e. Helix b is generally hydrophobic in all repeats, but contains a striking pattern of repeat-specific residue conservation at position 31, with Arg in repeats 4 and Glu in repeats 2, but unconserved amino acids in repeats 1 and 3. This suggests repeats 2 and 4 may interact via a buried saltbridge. The loop between predicted helices a and b of repeat 3 shows features distinct from the equivalent loop in repeats 1, 2 and 4, suggesting an important structural and/or functional role for this region. No compelling evidence emerges from this study for uteroglobin and the annexins sharing similar tertiary structures, or for uteroglobin representing a derivative of a primordial one-repeat structure that underwent duplication to give the present day annexins. The analyses performed in this paper are re-evaluated in the Appendix, in the light of the recently published X-ray structure for human annexin V. The structure confirms most of the predictions and shows the power of techniques for the determination of tertiary structural information from the amino acid sequences of an aligned protein family.

  9. Comparative modeling without implicit sequence alignments.

    PubMed

    Kolinski, Andrzej; Gront, Dominik

    2007-10-01

    The number of known protein sequences is about thousand times larger than the number of experimentally solved 3D structures. For more than half of the protein sequences a close or distant structural analog could be identified. The key starting point in a classical comparative modeling is to generate the best possible sequence alignment with a template or templates. With decreasing sequence similarity, the number of errors in the alignments increases and these errors are the main causes of the decreasing accuracy of the molecular models generated. Here we propose a new approach to comparative modeling, which does not require the implicit alignment - the model building phase explores geometric, evolutionary and physical properties of a template (or templates). The proposed method requires prior identification of a template, although the initial sequence alignment is ignored. The model is built using a very efficient reduced representation search engine CABS to find the best possible superposition of the query protein onto the template represented as a 3D multi-featured scaffold. The criteria used include: sequence similarity, predicted secondary structure consistency, local geometric features and hydrophobicity profile. For more difficult cases, the new method qualitatively outperforms existing schemes of comparative modeling. The algorithm unifies de novo modeling, 3D threading and sequence-based methods. The main idea is general and could be easily combined with other efficient modeling tools as Rosetta, UNRES and others.

  10. Prediction of beta-turns and beta-turn types by a novel bidirectional Elman-type recurrent neural network with multiple output layers (MOLEBRNN).

    PubMed

    Kirschner, Andreas; Frishman, Dmitrij

    2008-10-01

    Prediction of beta-turns from amino acid sequences has long been recognized as an important problem in structural bioinformatics due to their frequent occurrence as well as their structural and functional significance. Because various structural features of proteins are intercorrelated, secondary structure information has been often employed as an additional input for machine learning algorithms while predicting beta-turns. Here we present a novel bidirectional Elman-type recurrent neural network with multiple output layers (MOLEBRNN) capable of predicting multiple mutually dependent structural motifs and demonstrate its efficiency in recognizing three aspects of protein structure: beta-turns, beta-turn types, and secondary structure. The advantage of our method compared to other predictors is that it does not require any external input except for sequence profiles because interdependencies between different structural features are taken into account implicitly during the learning process. In a sevenfold cross-validation experiment on a standard test dataset our method exhibits the total prediction accuracy of 77.9% and the Mathew's Correlation Coefficient of 0.45, the highest performance reported so far. It also outperforms other known methods in delineating individual turn types. We demonstrate how simultaneous prediction of multiple targets influences prediction performance on single targets. The MOLEBRNN presented here is a generic method applicable in a variety of research fields where multiple mutually depending target classes need to be predicted. http://webclu.bio.wzw.tum.de/predator-web/.

  11. Predicting backbone Cα angles and dihedrals from protein sequences by stacked sparse auto-encoder deep neural network.

    PubMed

    Lyons, James; Dehzangi, Abdollah; Heffernan, Rhys; Sharma, Alok; Paliwal, Kuldip; Sattar, Abdul; Zhou, Yaoqi; Yang, Yuedong

    2014-10-30

    Because a nearly constant distance between two neighbouring Cα atoms, local backbone structure of proteins can be represented accurately by the angle between C(αi-1)-C(αi)-C(αi+1) (θ) and a dihedral angle rotated about the C(αi)-C(αi+1) bond (τ). θ and τ angles, as the representative of structural properties of three to four amino-acid residues, offer a description of backbone conformations that is complementary to φ and ψ angles (single residue) and secondary structures (>3 residues). Here, we report the first machine-learning technique for sequence-based prediction of θ and τ angles. Predicted angles based on an independent test have a mean absolute error of 9° for θ and 34° for τ with a distribution on the θ-τ plane close to that of native values. The average root-mean-square distance of 10-residue fragment structures constructed from predicted θ and τ angles is only 1.9Å from their corresponding native structures. Predicted θ and τ angles are expected to be complementary to predicted ϕ and ψ angles and secondary structures for using in model validation and template-based as well as template-free structure prediction. The deep neural network learning technique is available as an on-line server called Structural Property prediction with Integrated DEep neuRal network (SPIDER) at http://sparks-lab.org. Copyright © 2014 Wiley Periodicals, Inc.

  12. Increasing Clinical Severity during a Dengue Virus Type 3 Cuban Epidemic: Deep Sequencing of Evolving Viral Populations

    PubMed Central

    Blanc, Hervé; Bordería, Antonio V.; Díaz, Gisell; Henningsson, Rasmus; Gonzalez, Daniel; Santana, Emidalys; Alvarez, Mayling; Castro, Osvaldo; Fontes, Magnus; Vignuzzi, Marco; Guzman, Maria G.

    2016-01-01

    ABSTRACT During the dengue virus type 3 (DENV-3) epidemic that occurred in Havana in 2001 to 2002, severe disease was associated with the infection sequence DENV-1 followed by DENV-3 (DENV-1/DENV-3), while the sequence DENV-2/DENV-3 was associated with mild/asymptomatic infections. To determine the role of the virus in the increasing severity demonstrated during the epidemic, serum samples collected at different time points were studied. A total of 22 full-length sequences were obtained using a deep-sequencing approach. Bayesian phylogenetic analysis of consensus sequences revealed that two DENV-3 lineages were circulating in Havana at that time, both grouped within genotype III. The predominant lineage is closely related to Peruvian and Ecuadorian strains, while the minor lineage is related to Venezuelan strains. According to consensus sequences, relatively few nonsynonymous mutations were observed; only one was fixed during the epidemic at position 4380 in the NS2B gene. Intrahost genetic analysis indicated that a significant minor population was selected and became predominant toward the end of the epidemic. In conclusion, greater variability was detected during the epidemic's progression in terms of significant minority variants, particularly in the nonstructural genes. An increasing trend of genetic diversity toward the end of the epidemic was observed only for synonymous variant allele rates, with higher variability in secondary cases. Remarkably, significant intrahost genetic variation was demonstrated within the same patient during the course of secondary infection with DENV-1/DENV-3, including changes in the structural proteins premembrane (PrM) and envelope (E). Therefore, the dynamic of evolving viral populations in the context of heterotypic antibodies could be related to the increasing clinical severity observed during the epidemic. IMPORTANCE Based on the evidence that DENV fitness is context dependent, our research has focused on the study of viral factors associated with intraepidemic increasing severity in a unique epidemiological setting. Here, we investigated the intrahost genetic diversity in acute human samples collected at different time points during the DENV-3 epidemic that occurred in Cuba in 2001 to 2002 using a deep-sequencing approach. We concluded that greater variability in significant minor populations occurred as the epidemic progressed, particularly in the nonstructural genes, with higher variability observed in secondary infection cases. Remarkably, for the first time significant intrahost genetic variation was demonstrated within the same patient during the course of secondary infection with DENV-1/DENV-3, including changes in structural proteins. These findings indicate that high-resolution approaches are needed to unravel molecular mechanisms involved in dengue pathogenesis. PMID:26889031

  13. RaptorX-Property: a web server for protein structure property prediction.

    PubMed

    Wang, Sheng; Li, Wei; Liu, Shiwang; Xu, Jinbo

    2016-07-08

    RaptorX Property (http://raptorx2.uchicago.edu/StructurePropertyPred/predict/) is a web server predicting structure property of a protein sequence without using any templates. It outperforms other servers, especially for proteins without close homologs in PDB or with very sparse sequence profile (i.e. carries little evolutionary information). This server employs a powerful in-house deep learning model DeepCNF (Deep Convolutional Neural Fields) to predict secondary structure (SS), solvent accessibility (ACC) and disorder regions (DISO). DeepCNF not only models complex sequence-structure relationship by a deep hierarchical architecture, but also interdependency between adjacent property labels. Our experimental results show that, tested on CASP10, CASP11 and the other benchmarks, this server can obtain ∼84% Q3 accuracy for 3-state SS, ∼72% Q8 accuracy for 8-state SS, ∼66% Q3 accuracy for 3-state solvent accessibility, and ∼0.89 area under the ROC curve (AUC) for disorder prediction. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  14. SHAPE Selection (SHAPES) enrich for RNA structure signal in SHAPE sequencing-based probing data

    PubMed Central

    Poulsen, Line Dahl; Kielpinski, Lukasz Jan; Salama, Sofie R.; Krogh, Anders; Vinther, Jeppe

    2015-01-01

    Selective 2′ Hydroxyl Acylation analyzed by Primer Extension (SHAPE) is an accurate method for probing of RNA secondary structure. In existing SHAPE methods, the SHAPE probing signal is normalized to a no-reagent control to correct for the background caused by premature termination of the reverse transcriptase. Here, we introduce a SHAPE Selection (SHAPES) reagent, N-propanone isatoic anhydride (NPIA), which retains the ability of SHAPE reagents to accurately probe RNA structure, but also allows covalent coupling between the SHAPES reagent and a biotin molecule. We demonstrate that SHAPES-based selection of cDNA–RNA hybrids on streptavidin beads effectively removes the large majority of background signal present in SHAPE probing data and that sequencing-based SHAPES data contain the same amount of RNA structure data as regular sequencing-based SHAPE data obtained through normalization to a no-reagent control. Moreover, the selection efficiently enriches for probed RNAs, suggesting that the SHAPES strategy will be useful for applications with high-background and low-probing signal such as in vivo RNA structure probing. PMID:25805860

  15. Import of a major mitochondrial enzyme depends on synergy between two distinct helices of its presequence

    USDA-ARS?s Scientific Manuscript database

    The human mitochondrial glutamate dehydrogenase isozymes (hGDH1 and 2) are abundant matrix-localized proteins encoded by nuclear genes. The proteins are synthesized in the cytoplasm, with an atypically long N-terminal mitochondrial targeting sequence (MTS). The results of secondary structure predi...

  16. Availability: A Metric for Nucleic Acid Strand Displacement Systems

    PubMed Central

    2016-01-01

    DNA strand displacement systems have transformative potential in synthetic biology. While powerful examples have been reported in DNA nanotechnology, such systems are plagued by leakage, which limits network stability, sensitivity, and scalability. An approach to mitigate leakage in DNA nanotechnology, which is applicable to synthetic biology, is to introduce mismatches to complementary fuel sequences at key locations. However, this method overlooks nuances in the secondary structure of the fuel and substrate that impact the leakage reaction kinetics in strand displacement systems. In an effort to quantify the impact of secondary structure on leakage, we introduce the concepts of availability and mutual availability and demonstrate their utility for network analysis. Our approach exposes vulnerable locations on the substrate and quantifies the secondary structure of fuel strands. Using these concepts, a 4-fold reduction in leakage has been achieved. The result is a rational design process that efficiently suppresses leakage and provides new insight into dynamic nucleic acid networks. PMID:26875531

  17. The crystal structure of the Sox4 HMG domain-DNA complex suggests a mechanism for positional interdependence in DNA recognition.

    PubMed

    Jauch, Ralf; Ng, Calista K L; Narasimhan, Kamesh; Kolatkar, Prasanna R

    2012-04-01

    It has recently been proposed that the sequence preferences of DNA-binding TFs (transcription factors) can be well described by models that include the positional interdependence of the nucleotides of the target sites. Such binding models allow for multiple motifs to be invoked, such as principal and secondary motifs differing at two or more nucleotide positions. However, the structural mechanisms underlying the accommodation of such variant motifs by TFs remain elusive. In the present study we examine the crystal structure of the HMG (high-mobility group) domain of Sox4 [Sry (sex-determining region on the Y chromosome)-related HMG box 4] bound to DNA. By comparing this structure with previously solved structures of Sox17 and Sox2, we observed subtle conformational differences at the DNA-binding interface. Furthermore, using quantitative electrophoretic mobility-shift assays we validated the positional interdependence of two nucleotides and the presence of a secondary Sox motif in the affinity landscape of Sox4. These results suggest that a concerted rearrangement of two interface amino acids enables Sox4 to accommodate primary and secondary motifs. The structural adaptations lead to altered dinucleotide preferences that mutually reinforce each other. These analyses underline the complexity of the DNA recognition by TFs and provide an experimental validation for the conceptual framework of positional interdependence and secondary binding motifs.

  18. Genomic structure of two ras family genes in the slime mold Physarum polycephalum.

    PubMed

    Trzcińska-Danielewicz, Joanna; Kozlowski, Piotr; Gierdal, Katarzyna; Wiejak, Jolanta; Jagielski, Adam; Toczko, Kazimierz; Fronk, Jan

    2002-08-01

    Genomic structure of two Physarum polycephalum ras family genes, Ppras2 and Pprap1, has been determined, including the upstream region of the latter. The genes are interrupted by three and four introns, respectively. The first intron of Ppras2 has the same location within the coding sequence as the first intron in another ras homolog from this organism, Ppras1 [Trzcińska-Danielewicz, J., Kozlowski, P., and Toczko, K. (1996). "Cloning and genomic sequence of the Physarum polycephalum Ppras1 gene, a homologue of the ras protooncogene", Gene 169, pp. 143-144]. All introns, ranging from 53 to ca. 460 base pairs, have the canonical 5' and 3' ends, are greatly enriched in pyrimidines in the coding strand and have frequent pyrimidines-only tracts. These latter features seem to be responsible for the difficulties in cloning and sequencing of parts of these genes. Short sequences shared with P. polycephalum transposon-like repeats are common in the introns, indicating a possible role of transposition in intron evolution. In all three ras family genes phase zero introns are located mostly between sequences coding for regular protein secondary structure elements.

  19. A Systematic Analysis of the Structures of Heterologously Expressed Proteins and Those from Their Native Hosts in the RCSB PDB Archive.

    PubMed

    Zhou, Ren-Bin; Lu, Hui-Meng; Liu, Jie; Shi, Jian-Yu; Zhu, Jing; Lu, Qin-Qin; Yin, Da-Chuan

    2016-01-01

    Recombinant expression of proteins has become an indispensable tool in modern day research. The large yields of recombinantly expressed proteins accelerate the structural and functional characterization of proteins. Nevertheless, there are literature reported that the recombinant proteins show some differences in structure and function as compared with the native ones. Now there have been more than 100,000 structures (from both recombinant and native sources) publicly available in the Protein Data Bank (PDB) archive, which makes it possible to investigate if there exist any proteins in the RCSB PDB archive that have identical sequence but have some difference in structures. In this paper, we present the results of a systematic comparative study of the 3D structures of identical naturally purified versus recombinantly expressed proteins. The structural data and sequence information of the proteins were mined from the RCSB PDB archive. The combinatorial extension (CE), FATCAT-flexible and TM-Align methods were employed to align the protein structures. The root-mean-square distance (RMSD), TM-score, P-value, Z-score, secondary structural elements and hydrogen bonds were used to assess the structure similarity. A thorough analysis of the PDB archive generated five-hundred-seventeen pairs of native and recombinant proteins that have identical sequence. There were no pairs of proteins that had the same sequence and significantly different structural fold, which support the hypothesis that expression in a heterologous host usually could fold correctly into their native forms.

  20. A Systematic Analysis of the Structures of Heterologously Expressed Proteins and Those from Their Native Hosts in the RCSB PDB Archive

    PubMed Central

    Zhou, Ren-Bin; Lu, Hui-Meng; Liu, Jie; Shi, Jian-Yu; Zhu, Jing; Lu, Qin-Qin; Yin, Da-Chuan

    2016-01-01

    Recombinant expression of proteins has become an indispensable tool in modern day research. The large yields of recombinantly expressed proteins accelerate the structural and functional characterization of proteins. Nevertheless, there are literature reported that the recombinant proteins show some differences in structure and function as compared with the native ones. Now there have been more than 100,000 structures (from both recombinant and native sources) publicly available in the Protein Data Bank (PDB) archive, which makes it possible to investigate if there exist any proteins in the RCSB PDB archive that have identical sequence but have some difference in structures. In this paper, we present the results of a systematic comparative study of the 3D structures of identical naturally purified versus recombinantly expressed proteins. The structural data and sequence information of the proteins were mined from the RCSB PDB archive. The combinatorial extension (CE), FATCAT-flexible and TM-Align methods were employed to align the protein structures. The root-mean-square distance (RMSD), TM-score, P-value, Z-score, secondary structural elements and hydrogen bonds were used to assess the structure similarity. A thorough analysis of the PDB archive generated five-hundred-seventeen pairs of native and recombinant proteins that have identical sequence. There were no pairs of proteins that had the same sequence and significantly different structural fold, which support the hypothesis that expression in a heterologous host usually could fold correctly into their native forms. PMID:27517583

  1. DMS-MaPseq for genome-wide or targeted RNA structure probing in vivo.

    PubMed

    Zubradt, Meghan; Gupta, Paromita; Persad, Sitara; Lambowitz, Alan M; Weissman, Jonathan S; Rouskin, Silvi

    2017-01-01

    Coupling of structure-specific in vivo chemical modification to next-generation sequencing is transforming RNA secondary structure studies in living cells. The dominant strategy for detecting in vivo chemical modifications uses reverse transcriptase truncation products, which introduce biases and necessitate population-average assessments of RNA structure. Here we present dimethyl sulfate (DMS) mutational profiling with sequencing (DMS-MaPseq), which encodes DMS modifications as mismatches using a thermostable group II intron reverse transcriptase. DMS-MaPseq yields a high signal-to-noise ratio, can report multiple structural features per molecule, and allows both genome-wide studies and focused in vivo investigations of even low-abundance RNAs. We apply DMS-MaPseq for the first analysis of RNA structure within an animal tissue and to identify a functional structure involved in noncanonical translation initiation. Additionally, we use DMS-MaPseq to compare the in vivo structure of pre-mRNAs with their mature isoforms. These applications illustrate DMS-MaPseq's capacity to dramatically expand in vivo analysis of RNA structure.

  2. Genome sequencing reveals complex secondary metabolome in themarine actinomycete Salinispora tropica

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Udwary, Daniel W.; Zeigler, Lisa; Asolkar, Ratnakar

    2007-05-01

    Recent fermentation studies have identified actinomycetes ofthe marine-dwelling genus Salinispora as prolific natural productproducers. To further evaluate their biosynthetic potential, we analyzedall identifiable secondary natural product gene clusters from therecently sequenced 5,184,724 bp S. tropica CNB-440 circular genome. Ouranalysis shows that biosynthetic potential meets or exceeds that shown byprevious Streptomyces genome sequences as well as other naturalproduct-producing actinomycetes. The S. tropica genome features ninepolyketide synthase systems of every known formally classified family,non-ribosomal peptide synthetases and several hybrid clusters. While afew clusters appear to encode molecules previously identified inStreptomyces species,the majority of the 15 biosynthetic loci are novel.Specific chemical information aboutmore » putative and observed natural productmolecules is presented and discussed. In addition, our bioinformaticanalysis was critical for the structure elucidation of the novelpolyenemacrolactam salinilactam A. This study demonstrates the potentialfor genomic analysis to complement and strengthen traditional naturalproduct isolation studies and firmly establishes the genus Salinispora asa rich source of novel drug-like molecules.« less

  3. Isolation and in silico analysis of a novel H+-pyrophosphatase gene orthologue from the halophytic grass Leptochloa fusca

    NASA Astrophysics Data System (ADS)

    Rauf, Muhammad; Saeed, Nasir A.; Habib, Imran; Ahmed, Moddassir; Shahzad, Khurram; Mansoor, Shahid; Ali, Rashid

    2017-02-01

    Structure prediction can provide information about function and active sites of protein which helps to design new functional proteins. H+-pyrophosphatase is transmembrane protein involved in establishing proton motive force for active transport of Na+ across membrane by Na+/H+ antiporters. A full length novel H+-pyrophosphatase gene was isolated from halophytic grass Leptochloa fusca using RT-PCR and RACE method. Full length LfVP1 gene sequence of 2292 nucleotides encodes protein of 764 amino acids. DNA and protein sequences were used for characterization using bioinformatics tools. Various important potential sites were predicted by PROSITE webserver. Primary structural analysis showed LfVP1 as stable protein and Grand average hydropathy (GRAVY) indicated that LfVP1 protein has good hydrosolubility. Secondary structure analysis showed that LfVP1 protein sequence contains significant proportion of alpha helix and random coil. Protein membrane topology suggested the presence of 14 transmembrane domains and presence of catalytic domain in TM3. Three dimensional structure from LfVP1 protein sequence also indicated the presence of 14 transmembrane domains and hydrophobicity surface model showed amino acid hydrophobicity. Ramachandran plot showed that 98% amino acid residues were predicted in the favored region.

  4. There is Diversity in Disorder-"In all Chaos there is a Cosmos, in all Disorder a Secret Order".

    PubMed

    Nielsen, Jakob T; Mulder, Frans A A

    2016-01-01

    The protein universe consists of a continuum of structures ranging from full order to complete disorder. As the structured part of the proteome has been intensively studied, stably folded proteins are increasingly well documented and understood. However, proteins that are fully, or in large part, disordered are much less well characterized. Here we collected NMR chemical shifts in a small database for 117 protein sequences that are known to contain disorder. We demonstrate that NMR chemical shift data can be brought to bear as an exquisite judge of protein disorder at the residue level, and help in validation. With the help of secondary chemical shift analysis we demonstrate that the proteins in the database span the full spectrum of disorder, but still, largely segregate into two classes; disordered with small segments of order scattered along the sequence, and structured with small segments of disorder inserted between the different structured regions. A detailed analysis reveals that the distribution of order/disorder along the sequence shows a complex and asymmetric distribution, that is highly protein-dependent. Access to ratified training data further suggests an avenue to improving prediction of disorder from sequence.

  5. Conserved structures formed by heterogeneous RNA sequences drive silencing of an inflammation responsive post-transcriptional operon

    PubMed Central

    Basu, Abhijit; Jain, Niyati; Tolbert, Blanton S.; Komar, Anton A.

    2017-01-01

    Abstract RNA–protein interactions with physiological outcomes usually rely on conserved sequences within the RNA element. By contrast, activity of the diverse gamma-interferon-activated inhibitor of translation (GAIT)-elements relies on the conserved RNA folding motifs rather than the conserved sequence motifs. These elements drive the translational silencing of a group of chemokine (CC/CXC) and chemokine receptor (CCR) mRNAs, thereby helping to resolve physiological inflammation. Despite sequence dissimilarity, these RNA elements adopt common secondary structures (as revealed by 2D-1H NMR spectroscopy), providing a basis for their interaction with the RNA-binding GAIT complex. However, many of these elements (e.g. those derived from CCL22, CXCL13, CCR4 and ceruloplasmin (Cp) mRNAs) have substantially different affinities for GAIT complex binding. Toeprinting analysis shows that different positions within the overall conserved GAIT element structure contribute to differential affinities of the GAIT protein complex towards the elements. Thus, heterogeneity of GAIT elements may provide hierarchical fine-tuning of the resolution of inflammation. PMID:29069516

  6. A de novo redesign of the WW domain

    PubMed Central

    Kraemer-Pecore, Christina M.; Lecomte, Juliette T.J.; Desjarlais, John R.

    2003-01-01

    We have used a sequence prediction algorithm and a novel sampling method to design protein sequences for the WW domain, a small β-sheet motif. The procedure, referred to as SPANS, designs sequences to be compatible with an ensemble of closely related polypeptide backbones, mimicking the inherent flexibility of proteins. Two designed sequences (termed SPANS-WW1 and SPANS-WW2), using only naturally occurring l-amino acids, were selected for study and the corresponding polypeptides were prepared in Escherichia coli. Circular dichroism data suggested that both purified polypeptides adopted secondary structure features related to those of the target without the aid of disulfide bridges or bound cofactors. The structure exhibited by SPANS-WW2 melted cooperatively by raising the temperature of the solution. Further analysis of this polypeptide by proton nuclear magnetic resonance spectroscopy demonstrated that at 5°C, it folds into a structure closely resembling a natural WW domain. This achievement constitutes one of a small number of successful de novo protein designs through fully automated computational methods and highlights the feasibility of including backbone flexibility in the design strategy. PMID:14500877

  7. A de novo redesign of the WW domain.

    PubMed

    Kraemer-Pecore, Christina M; Lecomte, Juliette T J; Desjarlais, John R

    2003-10-01

    We have used a sequence prediction algorithm and a novel sampling method to design protein sequences for the WW domain, a small beta-sheet motif. The procedure, referred to as SPANS, designs sequences to be compatible with an ensemble of closely related polypeptide backbones, mimicking the inherent flexibility of proteins. Two designed sequences (termed SPANS-WW1 and SPANS-WW2), using only naturally occurring L-amino acids, were selected for study and the corresponding polypeptides were prepared in Escherichia coli. Circular dichroism data suggested that both purified polypeptides adopted secondary structure features related to those of the target without the aid of disulfide bridges or bound cofactors. The structure exhibited by SPANS-WW2 melted cooperatively by raising the temperature of the solution. Further analysis of this polypeptide by proton nuclear magnetic resonance spectroscopy demonstrated that at 5 degrees C, it folds into a structure closely resembling a natural WW domain. This achievement constitutes one of a small number of successful de novo protein designs through fully automated computational methods and highlights the feasibility of including backbone flexibility in the design strategy.

  8. Insights into Structural and Mechanistic Features of Viral IRES Elements

    PubMed Central

    Martinez-Salas, Encarnacion; Francisco-Velilla, Rosario; Fernandez-Chamorro, Javier; Embarek, Azman M.

    2018-01-01

    Internal ribosome entry site (IRES) elements are cis-acting RNA regions that promote internal initiation of protein synthesis using cap-independent mechanisms. However, distinct types of IRES elements present in the genome of various RNA viruses perform the same function despite lacking conservation of sequence and secondary RNA structure. Likewise, IRES elements differ in host factor requirement to recruit the ribosomal subunits. In spite of this diversity, evolutionarily conserved motifs in each family of RNA viruses preserve sequences impacting on RNA structure and RNA–protein interactions important for IRES activity. Indeed, IRES elements adopting remarkable different structural organizations contain RNA structural motifs that play an essential role in recruiting ribosomes, initiation factors and/or RNA-binding proteins using different mechanisms. Therefore, given that a universal IRES motif remains elusive, it is critical to understand how diverse structural motifs deliver functions relevant for IRES activity. This will be useful for understanding the molecular mechanisms beyond cap-independent translation, as well as the evolutionary history of these regulatory elements. Moreover, it could improve the accuracy to predict IRES-like motifs hidden in genome sequences. This review summarizes recent advances on the diversity and biological relevance of RNA structural motifs for viral IRES elements. PMID:29354113

  9. Substrate sequence selectivity of APOBEC3A implicates intra-DNA interactions.

    PubMed

    Silvas, Tania V; Hou, Shurong; Myint, Wazo; Nalivaika, Ellen; Somasundaran, Mohan; Kelch, Brian A; Matsuo, Hiroshi; Kurt Yilmaz, Nese; Schiffer, Celia A

    2018-05-14

    The APOBEC3 (A3) family of human cytidine deaminases is renowned for providing a first line of defense against many exogenous and endogenous retroviruses. However, the ability of these proteins to deaminate deoxycytidines in ssDNA makes A3s a double-edged sword. When overexpressed, A3s can mutate endogenous genomic DNA resulting in a variety of cancers. Although the sequence context for mutating DNA varies among A3s, the mechanism for substrate sequence specificity is not well understood. To characterize substrate specificity of A3A, a systematic approach was used to quantify the affinity for substrate as a function of sequence context, length, secondary structure, and solution pH. We identified the A3A ssDNA binding motif as (T/C)TC(A/G), which correlated with enzymatic activity. We also validated that A3A binds RNA in a sequence specific manner. A3A bound tighter to substrate binding motif within a hairpin loop compared to linear oligonucleotide, suggesting A3A affinity is modulated by substrate structure. Based on these findings and previously published A3A-ssDNA co-crystal structures, we propose a new model with intra-DNA interactions for the molecular mechanism underlying A3A sequence preference. Overall, the sequence and structural preferences identified for A3A leads to a new paradigm for identifying A3A's involvement in mutation of endogenous or exogenous DNA.

  10. Secondary structure in solution of two anti-HIV-1 hammerhead ribozymes as investigated by two-dimensional 1H 500 MHz NMR spectroscopy in water

    NASA Technical Reports Server (NTRS)

    Sarma, R. H.; Sarma, M. H.; Rein, R.; Shibata, M.; Setlik, R. S.; Ornstein, R. L.; Kazim, A. L.; Cairo, A.; Tomasi, T. B.

    1995-01-01

    Two hammerhead chimeric RNA/DNA ribozymes (HRz) were synthesized in pure form. Both were 30 nucleotides long, and the sequences were such that they could be targeted to cleave the HIV-1 gag RNA. Named HRz-W and HRz-M, the former had its invariable core region conserved, the latter had a uridine in the invariable region replaced by a guanine. Their secodary structures were determined by 2D NOESY 1H 500 MHz NMR spectroscopy in 90% water and 10% D2(0), following the imino protons. The data show that both HRz-M and HRz-W form identical secondary structures with stem regions consisting of continuous stacks of AT and GT pairs. An energy minimized computer model of this stem region is provided. The results suggest that the loss of catalytic activity that is known to result when an invariant core residue is replaced is not related to the secondary structure of the ribozymes in the absence of substrate.

  11. Classification of the Pospiviroidae based on their structural hallmarks.

    PubMed

    Giguère, Tamara; Perreault, Jean-Pierre

    2017-01-01

    The simplest known plant pathogens are the viroids. Because of their non-coding single-stranded circular RNA genome, they depend on both their sequence and their structure for both a successful infection and their replication. In the recent years, important progress in the elucidation of their structures was achieved using an adaptation of the selective 2'-hydroxyl acylation analyzed by primer extension (SHAPE) protocol in order to probe viroid structures in solution. Previously, SHAPE has been adapted to elucidate the structures of all of the members of the family Avsunviroidae, as well as those of a few members of the family Pospiviroidae. In this study, with the goal of providing an entire compendium of the secondary structures of the various viroid species, a total of thirteen new Pospiviroidae members were probed in solution using the SHAPE protocol. More specifically, the secondary structures of eleven species for which the genus was previously known were initially elucidated. At this point, considering all of the SHAPE elucidated secondary structures, a classification system for viroids in their respective genera was proposed. On the basis of the structural classification reported here, the probings of both the Grapevine latent viroid and the Dahlia latent viroid provide sound arguments for the determination of their respective genera, which appear to be Apscaviroid and Hostuviroid, respectively. More importantly, this study provides the complete repertoire of the secondary structures, mapped in solution, of all of the accepted viroid species reported thus far. In addition, a classification scheme based on structural hallmarks, an important tool for many biological studies, is proposed.

  12. Classification of the Pospiviroidae based on their structural hallmarks

    PubMed Central

    Giguère, Tamara

    2017-01-01

    The simplest known plant pathogens are the viroids. Because of their non-coding single-stranded circular RNA genome, they depend on both their sequence and their structure for both a successful infection and their replication. In the recent years, important progress in the elucidation of their structures was achieved using an adaptation of the selective 2’-hydroxyl acylation analyzed by primer extension (SHAPE) protocol in order to probe viroid structures in solution. Previously, SHAPE has been adapted to elucidate the structures of all of the members of the family Avsunviroidae, as well as those of a few members of the family Pospiviroidae. In this study, with the goal of providing an entire compendium of the secondary structures of the various viroid species, a total of thirteen new Pospiviroidae members were probed in solution using the SHAPE protocol. More specifically, the secondary structures of eleven species for which the genus was previously known were initially elucidated. At this point, considering all of the SHAPE elucidated secondary structures, a classification system for viroids in their respective genera was proposed. On the basis of the structural classification reported here, the probings of both the Grapevine latent viroid and the Dahlia latent viroid provide sound arguments for the determination of their respective genera, which appear to be Apscaviroid and Hostuviroid, respectively. More importantly, this study provides the complete repertoire of the secondary structures, mapped in solution, of all of the accepted viroid species reported thus far. In addition, a classification scheme based on structural hallmarks, an important tool for many biological studies, is proposed. PMID:28783761

  13. GeneBee-net: Internet-based server for analyzing biopolymers

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Brodsky, L.I.; Ivanov, V.V.; Nikolaev, V.K.

    This work describes a network server for searching databanks of biopolymer structures and performing other biocomputing procedures; it is available via direct Internet connection. Basic server procedures are dedicated to homology (similarity) search of sequence and 3D structure of proteins. The homologies found could be used to build multiple alignments, predict protein and RNA secondary structure, and construct phylogenetic trees. In addition to traditional methods of sequence similarity search, the authors propose {open_quotes}non-matrix{close_quotes} (correlational) search. An analogous approach is used to identify regions of similar tertiary structure of proteins. Algorithm concepts and usage examples are presented for new methods. Servicemore » logic is based upon interaction of a client program and server procedures. The client program allows the compilation of queries and the processing of results of an analysis.« less

  14. Structure-Related Roles for the Conservation of the HIV-1 Fusion Peptide Sequence Revealed by Nuclear Magnetic Resonance.

    PubMed

    Serrano, Soraya; Huarte, Nerea; Rujas, Edurne; Andreu, David; Nieva, José L; Jiménez, María Angeles

    2017-10-17

    Despite extensive characterization of the human immunodeficiency virus type 1 (HIV-1) hydrophobic fusion peptide (FP), the structure-function relationships underlying its extraordinary degree of conservation remain poorly understood. Specifically, the fact that the tandem repeat of the FLGFLG tripeptide is absolutely conserved suggests that high hydrophobicity may not suffice to unleash FP function. Here, we have compared the nuclear magnetic resonance (NMR) structures adopted in nonpolar media by two FP surrogates, wtFP-tag and scrFP-tag, which had equal hydrophobicity but contained wild-type and scrambled core sequences LFLGFLG and FGLLGFL, respectively. In addition, these peptides were tagged at their C-termini with an epitope sequence that folded independently, thereby allowing Western blot detection without interfering with FP structure. We observed similar α-helical FP conformations for both specimens dissolved in the low-polarity medium 25% (v/v) 1,1,1,3,3,3-hexafluoro-2-propanol (HFIP), but important differences in contact with micelles of the membrane mimetic dodecylphosphocholine (DPC). Thus, whereas wtFP-tag preserved a helix displaying a Gly-rich ridge, the scrambled sequence lost in great part the helical structure upon being solubilized in DPC. Western blot analyses further revealed the capacity of wtFP-tag to assemble trimers in membranes, whereas membrane oligomers were not observed in the case of the scrFP-tag sequence. We conclude that, beyond hydrophobicity, preserving sequence order is an important feature for defining the secondary structures and oligomeric states adopted by the HIV FP in membranes.

  15. Barcode ITS2: a useful tool for identifying Trachelospermum jasminoides and a good monitor for medicine market.

    PubMed

    Yu, Ning; Wei, Yu-Long; Zhang, Xin; Zhu, Ning; Wang, Yan-Li; Zhu, Yue; Zhang, Hai-Ping; Li, Fen-Mei; Yang, Lan; Sun, Jia-Qi; Sun, Ai-Dong

    2017-07-11

    Trachelospermum jasminoides is commonly used in traditional Chinese medicine. However, the use of the plant's local alternatives is frequent, causing potential clinical problems. The T. jasminoides sold in the medicine market is commonly dried and sliced, making traditional identification methods difficult. In this study, the ITS2 region was evaluated on 127 sequences representing T. jasminoides and its local alternatives according to PCR and sequencing rates, intra- and inter-specific divergences, secondary structure, and discrimination capacity. Results indicated the 100% success rates of PCR and sequencing and the obvious presence of a barcoding gap. Results of BLAST 1, nearest distance and neighbor-joining tree methods showed that barcode ITS2 could successfully identify all the texted samples. The secondary structures of the ITS2 region provided another dimensionality for species identification. Two-dimensional images were obtained for better and easier identification. Previous studies on DNA barcoding concentrated more on the same family, genus, or species. However, an ideal barcode should be variable enough to identify closely related species. Meanwhile, the barcodes should also be conservative in identifying distantly related species. This study highlights the application of barcode ITS2 in solving practical problems in the distantly related local alternatives of medical plants.

  16. New insights into the promoterless transcription of DNA coligo templates by RNA polymerase III.

    PubMed

    Lama, Lodoe; Seidl, Christine I; Ryan, Kevin

    2014-01-01

    Chemically synthesized DNA can carry small RNA sequence information but converting that information into small RNA is generally thought to require large double-stranded promoters in the context of plasmids, viruses and genes. We previously found evidence that circularized oligodeoxynucleotides (coligos) containing certain sequences and secondary structures can template the synthesis of small RNA by RNA polymerase III in vitro and in human cells. By using immunoprecipitated RNA polymerase III we now report corroborating evidence that this enzyme is the sole polymerase responsible for coligo transcription. The immobilized polymerase enabled experiments showing that coligo transcripts can be formed through transcription termination without subsequent 3' end trimming. To better define the determinants of productive transcription, a structure-activity relationship study was performed using over 20 new coligos. The results show that unpaired nucleotides in the coligo stem facilitate circumtranscription, but also that internal loops and bulges should be kept small to avoid secondary transcription initiation sites. A polymerase termination sequence embedded in the double-stranded region of a hairpin-encoding coligo stem can antagonize transcription. Using lessons learned from new and old coligos, we demonstrate how to convert poorly transcribed coligos into productive templates. Our findings support the possibility that coligos may prove useful as chemically synthesized vectors for the ectopic expression of small RNA in human cells.

  17. Fuzzy cluster analysis of simple physicochemical properties of amino acids for recognizing secondary structure in proteins.

    PubMed Central

    Mocz, G.

    1995-01-01

    Fuzzy cluster analysis has been applied to the 20 amino acids by using 65 physicochemical properties as a basis for classification. The clustering products, the fuzzy sets (i.e., classical sets with associated membership functions), have provided a new measure of amino acid similarities for use in protein folding studies. This work demonstrates that fuzzy sets of simple molecular attributes, when assigned to amino acid residues in a protein's sequence, can predict the secondary structure of the sequence with reasonable accuracy. An approach is presented for discriminating standard folding states, using near-optimum information splitting in half-overlapping segments of the sequence of assigned membership functions. The method is applied to a nonredundant set of 252 proteins and yields approximately 73% matching for correctly predicted and correctly rejected residues with approximately 60% overall success rate for the correctly recognized ones in three folding states: alpha-helix, beta-strand, and coil. The most useful attributes for discriminating these states appear to be related to size, polarity, and thermodynamic factors. Van der Waals volume, apparent average thickness of surrounding molecular free volume, and a measure of dimensionless surface electron density can explain approximately 95% of prediction results. hydrogen bonding and hydrophobicity induces do not yet enable clear clustering and prediction. PMID:7549882

  18. Genome-wide identification of conserved intronic non-coding sequences using a Bayesian segmentation approach.

    PubMed

    Algama, Manjula; Tasker, Edward; Williams, Caitlin; Parslow, Adam C; Bryson-Richardson, Robert J; Keith, Jonathan M

    2017-03-27

    Computational identification of non-coding RNAs (ncRNAs) is a challenging problem. We describe a genome-wide analysis using Bayesian segmentation to identify intronic elements highly conserved between three evolutionarily distant vertebrate species: human, mouse and zebrafish. We investigate the extent to which these elements include ncRNAs (or conserved domains of ncRNAs) and regulatory sequences. We identified 655 deeply conserved intronic sequences in a genome-wide analysis. We also performed a pathway-focussed analysis on genes involved in muscle development, detecting 27 intronic elements, of which 22 were not detected in the genome-wide analysis. At least 87% of the genome-wide and 70% of the pathway-focussed elements have existing annotations indicative of conserved RNA secondary structure. The expression of 26 of the pathway-focused elements was examined using RT-PCR, providing confirmation that they include expressed ncRNAs. Consistent with previous studies, these elements are significantly over-represented in the introns of transcription factors. This study demonstrates a novel, highly effective, Bayesian approach to identifying conserved non-coding sequences. Our results complement previous findings that these sequences are enriched in transcription factors. However, in contrast to previous studies which suggest the majority of conserved sequences are regulatory factor binding sites, the majority of conserved sequences identified using our approach contain evidence of conserved RNA secondary structures, and our laboratory results suggest most are expressed. Functional roles at DNA and RNA levels are not mutually exclusive, and many of our elements possess evidence of both. Moreover, ncRNAs play roles in transcriptional and post-transcriptional regulation, and this may contribute to the over-representation of these elements in introns of transcription factors. We attribute the higher sensitivity of the pathway-focussed analysis compared to the genome-wide analysis to improved alignment quality, suggesting that enhanced genomic alignments may reveal many more conserved intronic sequences.

  19. A phase transition in energy-filtered RNA secondary structures.

    PubMed

    Han, Hillary S W; Reidys, Christian M

    2012-10-01

    In this article we study the effect of energy parameters on minimum free energy (mfe) RNA secondary structures. Employing a simplified combinatorial energy model that is only dependent on the diagram representation and is not sequence-specific, we prove the following dichotomy result. Mfe structures derived via the Turner energy parameters contain only finitely many complex irreducible substructures, and just minor parameter changes produce a class of mfe structures that contain a large number of small irreducibles. We localize the exact point at which the distribution of irreducibles experiences this phase transition from a discrete limit to a central limit distribution and, subsequently, put our result into the context of quantifying the effect of sparsification of the folding of these respective mfe structures. We show that the sparsification of realistic mfe structures leads to a constant time and space reduction, and that the sparsification of the folding of structures with modified parameters leads to a linear time and space reduction. We, furthermore, identify the limit distribution at the phase transition as a Rayleigh distribution.

  20. Peptoid nanosheets exhibit a new secondary-structure motif.

    PubMed

    Mannige, Ranjan V; Haxton, Thomas K; Proulx, Caroline; Robertson, Ellen J; Battigelli, Alessia; Butterfoss, Glenn L; Zuckermann, Ronald N; Whitelam, Stephen

    2015-10-15

    A promising route to the synthesis of protein-mimetic materials that are capable of complex functions, such as molecular recognition and catalysis, is provided by sequence-defined peptoid polymers--structural relatives of biologically occurring polypeptides. Peptoids, which are relatively non-toxic and resistant to degradation, can fold into defined structures through a combination of sequence-dependent interactions. However, the range of possible structures that are accessible to peptoids and other biological mimetics is unknown, and our ability to design protein-like architectures from these polymer classes is limited. Here we use molecular-dynamics simulations, together with scattering and microscopy data, to determine the atomic-resolution structure of the recently discovered peptoid nanosheet, an ordered supramolecular assembly that extends macroscopically in only two dimensions. Our simulations show that nanosheets are structurally and dynamically heterogeneous, can be formed only from peptoids of certain lengths, and are potentially porous to water and ions. Moreover, their formation is enabled by the peptoids' adoption of a secondary structure that is not seen in the natural world. This structure, a zigzag pattern that we call a Σ('sigma')-strand, results from the ability of adjacent backbone monomers to adopt opposed rotational states, thereby allowing the backbone to remain linear and untwisted. Linear backbones tiled in a brick-like way form an extended two-dimensional nanostructure, the Σ-sheet. The binary rotational-state motif of the Σ-strand is not seen in regular protein structures, which are usually built from one type of rotational state. We also show that the concept of building regular structures from multiple rotational states can be generalized beyond the peptoid nanosheet system.

  1. INFO-RNA--a server for fast inverse RNA folding satisfying sequence constraints.

    PubMed

    Busch, Anke; Backofen, Rolf

    2007-07-01

    INFO-RNA is a new web server for designing RNA sequences that fold into a user given secondary structure. Furthermore, constraints on the sequence can be specified, e.g. one can restrict sequence positions to a fixed nucleotide or to a set of nucleotides. Moreover, the user can allow violations of the constraints at some positions, which can be advantageous in complicated cases. The INFO-RNA web server allows biologists to design RNA sequences in an automatic manner. It is clearly and intuitively arranged and easy to use. The procedure is fast, as most applications are completed within seconds and it proceeds better and faster than other existing tools. The INFO-RNA web server is freely available at http://www.bioinf.uni-freiburg.de/Software/INFO-RNA/

  2. INFO-RNA—a server for fast inverse RNA folding satisfying sequence constraints

    PubMed Central

    Busch, Anke; Backofen, Rolf

    2007-01-01

    INFO-RNA is a new web server for designing RNA sequences that fold into a user given secondary structure. Furthermore, constraints on the sequence can be specified, e.g. one can restrict sequence positions to a fixed nucleotide or to a set of nucleotides. Moreover, the user can allow violations of the constraints at some positions, which can be advantageous in complicated cases. The INFO-RNA web server allows biologists to design RNA sequences in an automatic manner. It is clearly and intuitively arranged and easy to use. The procedure is fast, as most applications are completed within seconds and it proceeds better and faster than other existing tools. The INFO-RNA web server is freely available at http://www.bioinf.uni-freiburg.de/Software/INFO-RNA/ PMID:17452349

  3. R2R - software to speed the depiction of aesthetic consensus RNA secondary structures

    PubMed Central

    2011-01-01

    Background With continuing identification of novel structured noncoding RNAs, there is an increasing need to create schematic diagrams showing the consensus features of these molecules. RNA structural diagrams are typically made either with general-purpose drawing programs like Adobe Illustrator, or with automated or interactive programs specific to RNA. Unfortunately, the use of applications like Illustrator is extremely time consuming, while existing RNA-specific programs produce figures that are useful, but usually not of the same aesthetic quality as those produced at great cost in Illustrator. Additionally, most existing RNA-specific applications are designed for drawing single RNA molecules, not consensus diagrams. Results We created R2R, a computer program that facilitates the generation of aesthetic and readable drawings of RNA consensus diagrams in a fraction of the time required with general-purpose drawing programs. Since the inference of a consensus RNA structure typically requires a multiple-sequence alignment, the R2R user annotates the alignment with commands directing the layout and annotation of the RNA. R2R creates SVG or PDF output that can be imported into Adobe Illustrator, Inkscape or CorelDRAW. R2R can be used to create consensus sequence and secondary structure models for novel RNA structures or to revise models when new representatives for known RNA classes become available. Although R2R does not currently have a graphical user interface, it has proven useful in our efforts to create 100 schematic models of distinct noncoding RNA classes. Conclusions R2R makes it possible to obtain high-quality drawings of the consensus sequence and structural models of many diverse RNA structures with a more practical amount of effort. R2R software is available at http://breaker.research.yale.edu/R2R and as an Additional file. PMID:21205310

  4. Computational RNomics of Drosophilids

    PubMed Central

    Rose, Dominic; Hackermüller, Jörg; Washietl, Stefan; Reiche, Kristin; Hertel, Jana; Findeiß, Sven; Stadler, Peter F; Prohaska, Sonja J

    2007-01-01

    Background Recent experimental and computational studies have provided overwhelming evidence for a plethora of diverse transcripts that are unrelated to protein-coding genes. One subclass consists of those RNAs that require distinctive secondary structure motifs to exert their biological function and hence exhibit distinctive patterns of sequence conservation characteristic for positive selection on RNA secondary structure. The deep-sequencing of 12 drosophilid species coordinated by the NHGRI provides an ideal data set of comparative computational approaches to determine those genomic loci that code for evolutionarily conserved RNA motifs. This class of loci includes the majority of the known small ncRNAs as well as structured RNA motifs in mRNAs. We report here on a genome-wide survey using RNAz. Results We obtain 16 000 high quality predictions among which we recover the majority of the known ncRNAs. Taking a pessimistically estimated false discovery rate of 40% into account, this implies that at least some ten thousand loci in the Drosophila genome show the hallmarks of stabilizing selection action of RNA structure, and hence are most likely functional at the RNA level. A subset of RNAz predictions overlapping with TRF1 and BRF binding sites [Isogai et al., EMBO J. 26: 79–89 (2007)], which are plausible candidates of Pol III transcripts, have been studied in more detail. Among these sequences we identify several "clusters" of ncRNA candidates with striking structural similarities. Conclusion The statistical evaluation of the RNAz predictions in comparison with a similar analysis of vertebrate genomes [Washietl et al., Nat. Biotech. 23: 1383–1390 (2005)] shows that qualitatively similar fractions of structured RNAs are found in introns, UTRs, and intergenic regions. The intergenic RNA structures, however, are concentrated much more closely around known protein-coding loci, suggesting that flies have significantly smaller complement of independent structured ncRNAs compared to mammals. PMID:17996037

  5. ``Sequence space soup'' of proteins and copolymers

    NASA Astrophysics Data System (ADS)

    Chan, Hue Sun; Dill, Ken A.

    1991-09-01

    To study the protein folding problem, we use exhaustive computer enumeration to explore ``sequence space soup,'' an imaginary solution containing the ``native'' conformations (i.e., of lowest free energy) under folding conditions, of every possible copolymer sequence. The model is of short self-avoiding chains of hydrophobic (H) and polar (P) monomers configured on the two-dimensional square lattice. By exhaustive enumeration, we identify all native structures for every possible sequence. We find that random sequences of H/P copolymers will bear striking resemblance to known proteins: Most sequences under folding conditions will be approximately as compact as known proteins, will have considerable amounts of secondary structure, and it is most probable that an arbitrary sequence will fold to a number of lowest free energy conformations that is of order one. In these respects, this simple model shows that proteinlike behavior should arise simply in copolymers in which one monomer type is highly solvent averse. It suggests that the structures and uniquenesses of native proteins are not consequences of having 20 different monomer types, or of unique properties of amino acid monomers with regard to special packing or interactions, and thus that simple copolymers might be designable to collapse to proteinlike structures and properties. A good strategy for designing a sequence to have a minimum possible number of native states is to strategically insert many P monomers. Thus known proteins may be marginally stable due to a balance: More H residues stabilize the desired native state, but more P residues prevent simultaneous stabilization of undesired native states.

  6. Terminal sequence importance of de novo proteins from binary-patterned library: stable artificial proteins with 11- or 12-amino acid alphabet.

    PubMed

    Okura, Hiromichi; Takahashi, Tsuyoshi; Mihara, Hisakazu

    2012-06-01

    Successful approaches of de novo protein design suggest a great potential to create novel structural folds and to understand natural rules of protein folding. For these purposes, smaller and simpler de novo proteins have been developed. Here, we constructed smaller proteins by removing the terminal sequences from stable de novo vTAJ proteins and compared stabilities between mutant and original proteins. vTAJ proteins were screened from an α3β3 binary-patterned library which was designed with polar/ nonpolar periodicities of α-helix and β-sheet. vTAJ proteins have the additional terminal sequences due to the method of constructing the genetically repeated library sequences. By removing the parts of the sequences, we successfully obtained the stable smaller de novo protein mutants with fewer amino acid alphabets than the originals. However, these mutants showed the differences on ANS binding properties and stabilities against denaturant and pH change. The terminal sequences, which were designed just as flexible linkers not as secondary structure units, sufficiently affected these physicochemical details. This study showed implications for adjusting protein stabilities by designing N- and C-terminal sequences.

  7. Regions flanking ori sequences affect the replication efficiency of the mitochondrial genome of ori+ petite mutants from yeast.

    PubMed

    Rayko, E; Goursot, R; Cherif-Zahar, B; Melis, R; Bernardi, G

    1988-03-31

    The mitochondrial genomes of progenies from 26 crosses between 17 cytoplasmic, spontaneous, suppressive, ori+ petite mutants of Saccharomyces cerevisiae have been studied by electrophoresis of restriction fragments. Only parental genomes (or occasionally, genomes derived from them by secondary excisions) were found in the progenies of the almost 500 diploids investigated; no evidence for illegitimate, site-specific mitochondrial recombination was detected. One of the parental genomes was always found to be predominate over the other one, although to different extents in different crosses. This predominance appears to be due to a higher replication efficiency, which is correlated with a greater density of ori sequences on the mitochondrial genome (and with a shorter repeat unit size of the latter). Exceptions to the 'repeat-unit-size rule' were found, however, even when the parental mitochondrial genomes carried the same ori sequence. This indicates that noncoding, intergenic sequences outside ori sequences also play a role in modulating replication efficiency. Since in different petites such sequences differ in primary structure, size, and position relative to ori sequences, this modulation is likely to take place through an indirect effect on DNA and nucleoid structure.

  8. Single-molecule analysis of DNA cross-links using nanopore technology

    NASA Astrophysics Data System (ADS)

    Wolna, Anna H.

    The alpha-hemolysin (alpha-HL) protein ion channel is a potential next-generation sequencing platform that has been extensively used to study nucleic acids at a single-molecule level. After applying a potential across a lipid bilayer, the imbedded alpha-HL allows monitoring of the duration and current levels of DNA translocation and immobilization. Because this method does not require DNA amplification prior to sequencing, all the DNA damage present in the cell at any given time will be present during the sequencing experiment. The goal of this research is to determine if these damage sites give distinguishable current levels beyond those observed for the canonical nucleobases. Because DNA cross-links are one of the most prevalent types of DNA damage occurring in vivo, the blockage current levels were determined for thymine-dimers, guanine(C8)-thymine(N3) cross-links and platinum adducts. All of these cross-links give a different blockage current level compared to the undamaged strands when immobilized in the ion channel, and they all can easily translocate across the alpha-HL channel. Additionally, the alpha-HL nanopore technique presents a unique opportunity to study the effects of DNA cross-links, such as thymine-dimers, on the secondary structure of DNA G-quadruplexes folded from the human telomere sequence. Using this single-molecule nanopore technique we can detect subtle structural differences that cannot be easily addressed using conventional methods. The human telomere plays crucial roles in maintaining genome stability. In the presence of suitable cations, the repetitive 5'-TTAGGG human telomere sequence can fold into G-quadruplexes that adopt the hybrid fold in vivo. The telomere sequence is hypersensitive to UV-induced thymine-dimer (T=T) formation, and yet the presence of thymine dimers does not cause telomere shortening. The potential structural disruption and thermodynamic stability of the T=T-containing natural telomere sequences were studied to understand how this damage is tolerated in telomeric DNA. The alpha-HL experiments determined that T=Ts disrupt double-chain reversal loop formation but are well tolerated in edgewise and diagonal loops of the hybrid G-quadruplexes. These studies demonstrated the power of the alpha-HL ion channel to analyze DNA modifications and secondary structures at a single-molecule level.

  9. microRNA-122 target sites in the hepatitis C virus RNA NS5B coding region and 3' untranslated region: function in replication and influence of RNA secondary structure.

    PubMed

    Gerresheim, Gesche K; Dünnes, Nadia; Nieder-Röhrmann, Anika; Shalamova, Lyudmila A; Fricke, Markus; Hofacker, Ivo; Höner Zu Siederdissen, Christian; Marz, Manja; Niepmann, Michael

    2017-02-01

    We have analyzed the binding of the liver-specific microRNA-122 (miR-122) to three conserved target sites of hepatitis C virus (HCV) RNA, two in the non-structural protein 5B (NS5B) coding region and one in the 3' untranslated region (3'UTR). miR-122 binding efficiency strongly depends on target site accessibility under conditions when the range of flanking sequences available for the formation of local RNA secondary structures changes. Our results indicate that the particular sequence feature that contributes most to the correlation between target site accessibility and binding strength varies between different target sites. This suggests that the dynamics of miRNA/Ago2 binding not only depends on the target site itself but also on flanking sequence context to a considerable extent, in particular in a small viral genome in which strong selection constraints act on coding sequence and overlapping cis-signals and model the accessibility of cis-signals. In full-length genomes, single and combination mutations in the miR-122 target sites reveal that site 5B.2 is positively involved in regulating overall genome replication efficiency, whereas mutation of site 5B.3 showed a weaker effect. Mutation of the 3'UTR site and double or triple mutants showed no significant overall effect on genome replication, whereas in a translation reporter RNA, the 3'UTR target site inhibits translation directed by the HCV 5'UTR. Thus, the miR-122 target sites in the 3'-region of the HCV genome are involved in a complex interplay in regulating different steps of the HCV replication cycle.

  10. Degenerate RNA packaging signals in the genome of Satellite Tobacco Necrosis Virus: implications for the assembly of a T=1 capsid.

    PubMed

    Bunka, David H J; Lane, Stephen W; Lane, Claire L; Dykeman, Eric C; Ford, Robert J; Barker, Amy M; Twarock, Reidun; Phillips, Simon E V; Stockley, Peter G

    2011-10-14

    Using a recombinant, T=1 Satellite Tobacco Necrosis Virus (STNV)-like particle expressed in Escherichia coli, we have established conditions for in vitro disassembly and reassembly of the viral capsid. In vivo assembly is dependent on the presence of the coat protein (CP) N-terminal region, and in vitro assembly requires RNA. Using immobilised CP monomers under reassembly conditions with "free" CP subunits, we have prepared a range of partially assembled CP species for RNA aptamer selection. SELEX directed against the RNA-binding face of the STNV CP resulted in the isolation of several clones, one of which (B3) matches the STNV-1 genome in 16 out of 25 nucleotide positions, including across a statistically significant 10/10 stretch. This 10-base region folds into a stem-loop displaying the motif ACAA and has been shown to bind to STNV CP. Analysis of the other aptamer sequences reveals that the majority can be folded into stem-loops displaying versions of this motif. Using a sequence and secondary structure search motif to analyse the genomic sequence of STNV-1, we identified 30 stem-loops displaying the sequence motif AxxA. The implication is that there are many stem-loops in the genome carrying essential recognition features for binding STNV CP. Secondary structure predictions of the genomic RNA using Mfold showed that only 8 out of 30 of these stem-loops would be formed in the lowest-energy structure. These results are consistent with an assembly mechanism based on kinetically driven folding of the RNA. Copyright © 2011 Elsevier Ltd. All rights reserved.

  11. On the Sequence-Directed Nature of Human Gene Mutation: The Role of Genomic Architecture and the Local DNA Sequence Environment in Mediating Gene Mutations Underlying Human Inherited Disease

    PubMed Central

    Cooper, David N.; Bacolla, Albino; Férec, Claude; Vasquez, Karen M.; Kehrer-Sawatzki, Hildegard; Chen, Jian-Min

    2011-01-01

    Different types of human gene mutation may vary in size, from structural variants (SVs) to single base-pair substitutions, but what they all have in common is that their nature, size and location are often determined either by specific characteristics of the local DNA sequence environment or by higher-order features of the genomic architecture. The human genome is now recognized to contain ‘pervasive architectural flaws’ in that certain DNA sequences are inherently mutation-prone by virtue of their base composition, sequence repetitivity and/or epigenetic modification. Here we explore how the nature, location and frequency of different types of mutation causing inherited disease are shaped in large part, and often in remarkably predictable ways, by the local DNA sequence environment. The mutability of a given gene or genomic region may also be influenced indirectly by a variety of non-canonical (non-B) secondary structures whose formation is facilitated by the underlying DNA sequence. Since these non-B DNA structures can interfere with subsequent DNA replication and repair, and may serve to increase mutation frequencies in generalized fashion (i.e. both in the context of subtle mutations and SVs), they have the potential to serve as a unifying concept in studies of mutational mechanisms underlying human inherited disease. PMID:21853507

  12. PAT: predictor for structured units and its application for the optimization of target molecules for the generation of synthetic antibodies.

    PubMed

    Jeon, Jouhyun; Arnold, Roland; Singh, Fateh; Teyra, Joan; Braun, Tatjana; Kim, Philip M

    2016-04-01

    The identification of structured units in a protein sequence is an important first step for most biochemical studies. Importantly for this study, the identification of stable structured region is a crucial first step to generate novel synthetic antibodies. While many approaches to find domains or predict structured regions exist, important limitations remain, such as the optimization of domain boundaries and the lack of identification of non-domain structured units. Moreover, no integrated tool exists to find and optimize structural domains within protein sequences. Here, we describe a new tool, PAT ( http://www.kimlab.org/software/pat ) that can efficiently identify both domains (with optimized boundaries) and non-domain putative structured units. PAT automatically analyzes various structural properties, evaluates the folding stability, and reports possible structural domains in a given protein sequence. For reliability evaluation of PAT, we applied PAT to identify antibody target molecules based on the notion that soluble and well-defined protein secondary and tertiary structures are appropriate target molecules for synthetic antibodies. PAT is an efficient and sensitive tool to identify structured units. A performance analysis shows that PAT can characterize structurally well-defined regions in a given sequence and outperforms other efforts to define reliable boundaries of domains. Specially, PAT successfully identifies experimentally confirmed target molecules for antibody generation. PAT also offers the pre-calculated results of 20,210 human proteins to accelerate common queries. PAT can therefore help to investigate large-scale structured domains and improve the success rate for synthetic antibody generation.

  13. The structure of the human interferon alpha/beta receptor gene.

    PubMed

    Lutfalla, G; Gardiner, K; Proudhon, D; Vielh, E; Uzé, G

    1992-02-05

    Using the cDNA coding for the human interferon alpha/beta receptor (IFNAR), the IFNAR gene has been physically mapped relative to the other loci of the chromosome 21q22.1 region. 32,906 base pairs covering the IFNAR gene have been cloned and sequenced. Primer extension and solution hybridization-ribonuclease protection have been used to determine that the transcription of the gene is initiated in a broad region of 20 base pairs. Some aspects of the polymorphism of the gene, including noncoding sequences, have been analyzed; some are allelic differences in the coding sequence that induce amino acid variations in the resulting protein. The exon structure of the IFNAR gene and of that of the available genes for the receptors of the cytokine/growth hormone/prolactin/interferon receptor family have been compared with the predictions for the secondary structure of those receptors. From this analysis, we postulate a common origin and propose an hypothesis for the divergence from the immunoglobulin superfamily.

  14. The complete mitochondrial genome of the common sea slater, Ligia oceanica (Crustacea, Isopoda) bears a novel gene order and unusual control region features

    PubMed Central

    Kilpert, Fabian; Podsiadlowski, Lars

    2006-01-01

    Background Sequence data and other characters from mitochondrial genomes (gene translocations, secondary structure of RNA molecules) are useful in phylogenetic studies among metazoan animals from population to phylum level. Moreover, the comparison of complete mitochondrial sequences gives valuable information about the evolution of small genomes, e.g. about different mechanisms of gene translocation, gene duplication and gene loss, or concerning nucleotide frequency biases. The Peracarida (gammarids, isopods, etc.) comprise about 21,000 species of crustaceans, living in many environments from deep sea floor to arid terrestrial habitats. Ligia oceanica is a terrestrial isopod living at rocky seashores of the european North Sea and Atlantic coastlines. Results The study reveals the first complete mitochondrial DNA sequence from a peracarid crustacean. The mitochondrial genome of Ligia oceanica is a circular double-stranded DNA molecule, with a size of 15,289 bp. It shows several changes in mitochondrial gene order compared to other crustacean species. An overview about mitochondrial gene order of all crustacean taxa yet sequenced is also presented. The largest non-coding part (the putative mitochondrial control region) of the mitochondrial genome of Ligia oceanica is unexpectedly not AT-rich compared to the remainder of the genome. It bears two repeat regions (4× 10 bp and 3× 64 bp), and a GC-rich hairpin-like secondary structure. Some of the transfer RNAs show secondary structures which derive from the usual cloverleaf pattern. While some tRNA genes are putative targets for RNA editing, trnR could not be localized at all. Conclusion Gene order is not conserved among Peracarida, not even among isopods. The two isopod species Ligia oceanica and Idotea baltica show a similarly derived gene order, compared to the arthropod ground pattern and to the amphipod Parhyale hawaiiensis, suggesting that most of the translocation events were already present the last common ancestor of these isopods. Beyond that, the positions of three tRNA genes differ in the two isopod species. Strand bias in nucleotide frequency is reversed in both isopod species compared to other Malacostraca. This is probably due to a reversal of the replication origin, which is further supported by the fact that the hairpin structure typically found in the control region shows a reversed orientation in the isopod species, compared to other crustaceans. PMID:16987408

  15. Sequence characterization of 5S ribosomal RNA from eight gram positive procaryotes

    NASA Technical Reports Server (NTRS)

    Woese, C. R.; Luehrsen, K. R.; Pribula, C. D.; Fox, G. E.

    1976-01-01

    Complete nucleotide sequences are presented for 5S rRNA from Bacillus subtilis, B. firmus, B. pasteurii, B. brevis, Lactobacillus brevis, and Streptococcus faecalis, and 5S rRNA oligonucleotide catalogs and partial sequence data are given for B. cereus and Sporosarcina ureae. These data demonstrate a striking consistency of 5S rRNA primary and secondary structure within a given bacterial grouping. An exception is B. brevis, in which the 5S rRNA sequence varies significantly from that of other bacilli in the tuned helix and the procaryotic loop. The localization of these variations suggests that B. brevis occupies an ecological niche that selects such changes. It is noted that this organism produces antibiotics which affect ribosome function.

  16. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wemmer, D.E.; Kumar, N.V.; Metrione, R.M.

    Toxin II from Radianthus paumotensis (Rp/sub II/) has been investigated by high-resolution NMR and chemical sequencing methods. Resonance assignments have been obtained for this protein by the sequential approach. NMR assignments could not be made consistent with the previously reported primary sequence for this protein, and chemical methods have been used to determine a sequence with which the NMR data are consistent. Analysis of the 2D NOE spectra shows that the protein secondary structure is comprised of two sequences of ..beta..-sheet, probably joined into a distorted continuous sheet, connected by turns and extended loops, without any regular ..cap alpha..-helical segments.more » The residues previously implicated in activity in this class of proteins, D8 and R13, occur in a loop region.« less

  17. Sequencing rare marine actinomycete genomes reveals high density of unique natural product biosynthetic gene clusters.

    PubMed

    Schorn, Michelle A; Alanjary, Mohammad M; Aguinaldo, Kristen; Korobeynikov, Anton; Podell, Sheila; Patin, Nastassia; Lincecum, Tommie; Jensen, Paul R; Ziemert, Nadine; Moore, Bradley S

    2016-12-01

    Traditional natural product discovery methods have nearly exhausted the accessible diversity of microbial chemicals, making new sources and techniques paramount in the search for new molecules. Marine actinomycete bacteria have recently come into the spotlight as fruitful producers of structurally diverse secondary metabolites, and remain relatively untapped. In this study, we sequenced 21 marine-derived actinomycete strains, rarely studied for their secondary metabolite potential and under-represented in current genomic databases. We found that genome size and phylogeny were good predictors of biosynthetic gene cluster diversity, with larger genomes rivalling the well-known marine producers in the Streptomyces and Salinispora genera. Genomes in the Micrococcineae suborder, however, had consistently the lowest number of biosynthetic gene clusters. By networking individual gene clusters into gene cluster families, we were able to computationally estimate the degree of novelty each genus contributed to the current sequence databases. Based on the similarity measures between all actinobacteria in the Joint Genome Institute's Atlas of Biosynthetic gene Clusters database, rare marine genera show a high degree of novelty and diversity, with Corynebacterium, Gordonia, Nocardiopsis, Saccharomonospora and Pseudonocardia genera representing the highest gene cluster diversity. This research validates that rare marine actinomycetes are important candidates for exploration, as they are relatively unstudied, and their relatives are historically rich in secondary metabolites.

  18. Sequencing rare marine actinomycete genomes reveals high density of unique natural product biosynthetic gene clusters

    PubMed Central

    Schorn, Michelle A.; Alanjary, Mohammad M.; Aguinaldo, Kristen; Korobeynikov, Anton; Podell, Sheila; Patin, Nastassia; Lincecum, Tommie; Jensen, Paul R.; Ziemert, Nadine

    2016-01-01

    Traditional natural product discovery methods have nearly exhausted the accessible diversity of microbial chemicals, making new sources and techniques paramount in the search for new molecules. Marine actinomycete bacteria have recently come into the spotlight as fruitful producers of structurally diverse secondary metabolites, and remain relatively untapped. In this study, we sequenced 21 marine-derived actinomycete strains, rarely studied for their secondary metabolite potential and under-represented in current genomic databases. We found that genome size and phylogeny were good predictors of biosynthetic gene cluster diversity, with larger genomes rivalling the well-known marine producers in the Streptomyces and Salinispora genera. Genomes in the Micrococcineae suborder, however, had consistently the lowest number of biosynthetic gene clusters. By networking individual gene clusters into gene cluster families, we were able to computationally estimate the degree of novelty each genus contributed to the current sequence databases. Based on the similarity measures between all actinobacteria in the Joint Genome Institute's Atlas of Biosynthetic gene Clusters database, rare marine genera show a high degree of novelty and diversity, with Corynebacterium, Gordonia, Nocardiopsis, Saccharomonospora and Pseudonocardia genera representing the highest gene cluster diversity. This research validates that rare marine actinomycetes are important candidates for exploration, as they are relatively unstudied, and their relatives are historically rich in secondary metabolites. PMID:27902408

  19. The Purine Bias of Coding Sequences is Determined by Physicochemical Constraints on Proteins.

    PubMed

    Ponce de Leon, Miguel; de Miranda, Antonio Basilio; Alvarez-Valin, Fernando; Carels, Nicolas

    2014-01-01

    For this report, we analyzed protein secondary structures in relation to the statistics of three nucleotide codon positions. The purpose of this investigation was to find which properties of the ribosome, tRNA or protein level, could explain the purine bias (Rrr) as it is observed in coding DNA. We found that the Rrr pattern is the consequence of a regularity (the codon structure) resulting from physicochemical constraints on proteins and thermodynamic constraints on ribosomal machinery. The physicochemical constraints on proteins mainly come from the hydropathy and molecular weight (MW) of secondary structures as well as the energy cost of amino acid synthesis. These constraints appear through a network of statistical correlations, such as (i) the cost of amino acid synthesis, which is in favor of a higher level of guanine in the first codon position, (ii) the constructive contribution of hydropathy alternation in proteins, (iii) the spatial organization of secondary structure in proteins according to solvent accessibility, (iv) the spatial organization of secondary structure according to amino acid hydropathy, (v) the statistical correlation of MW with protein secondary structures and their overall hydropathy, (vi) the statistical correlation of thymine in the second codon position with hydropathy and the energy cost of amino acid synthesis, and (vii) the statistical correlation of adenine in the second codon position with amino acid complexity and the MW of secondary protein structures. Amino acid physicochemical properties and functional constraints on proteins constitute a code that is translated into a purine bias within the coding DNA via tRNAs. In that sense, the Rrr pattern within coding DNA is the effect of information transfer on nucleotide composition from protein to DNA by selection according to the codon positions. Thus, coding DNA structure and ribosomal machinery co-evolved to minimize the energy cost of protein coding given the functional constraints on proteins.

  20. Revisiting Robustness and Evolvability: Evolution in Weighted Genotype Spaces

    PubMed Central

    Partha, Raghavendran; Raman, Karthik

    2014-01-01

    Robustness and evolvability are highly intertwined properties of biological systems. The relationship between these properties determines how biological systems are able to withstand mutations and show variation in response to them. Computational studies have explored the relationship between these two properties using neutral networks of RNA sequences (genotype) and their secondary structures (phenotype) as a model system. However, these studies have assumed every mutation to a sequence to be equally likely; the differences in the likelihood of the occurrence of various mutations, and the consequence of probabilistic nature of the mutations in such a system have previously been ignored. Associating probabilities to mutations essentially results in the weighting of genotype space. We here perform a comparative analysis of weighted and unweighted neutral networks of RNA sequences, and subsequently explore the relationship between robustness and evolvability. We show that assuming an equal likelihood for all mutations (as in an unweighted network), underestimates robustness and overestimates evolvability of a system. In spite of discarding this assumption, we observe that a negative correlation between sequence (genotype) robustness and sequence evolvability persists, and also that structure (phenotype) robustness promotes structure evolvability, as observed in earlier studies using unweighted networks. We also study the effects of base composition bias on robustness and evolvability. Particularly, we explore the association between robustness and evolvability in a sequence space that is AU-rich – sequences with an AU content of 80% or higher, compared to a normal (unbiased) sequence space. We find that evolvability of both sequences and structures in an AU-rich space is lesser compared to the normal space, and robustness higher. We also observe that AU-rich populations evolving on neutral networks of phenotypes, can access less phenotypic variation compared to normal populations evolving on neutral networks. PMID:25390641

  1. Genome-Wide Prediction of Intrinsic Disorder; Sequence Alignment of Intrinsically Disordered Proteins

    ERIC Educational Resources Information Center

    Midic, Uros

    2012-01-01

    Intrinsic disorder (ID) is defined as a lack of stable tertiary and/or secondary structure under physiological conditions in vitro. Intrinsically disordered proteins (IDPs) are highly abundant in nature. IDPs possess a number of crucial biological functions, being involved in regulation, recognition, signaling and control, e.g. their functional…

  2. XML schemas for common bioinformatic data types and their application in workflow systems

    PubMed Central

    Seibel, Philipp N; Krüger, Jan; Hartmeier, Sven; Schwarzer, Knut; Löwenthal, Kai; Mersch, Henning; Dandekar, Thomas; Giegerich, Robert

    2006-01-01

    Background Today, there is a growing need in bioinformatics to combine available software tools into chains, thus building complex applications from existing single-task tools. To create such workflows, the tools involved have to be able to work with each other's data – therefore, a common set of well-defined data formats is needed. Unfortunately, current bioinformatic tools use a great variety of heterogeneous formats. Results Acknowledging the need for common formats, the Helmholtz Open BioInformatics Technology network (HOBIT) identified several basic data types used in bioinformatics and developed appropriate format descriptions, formally defined by XML schemas, and incorporated them in a Java library (BioDOM). These schemas currently cover sequence, sequence alignment, RNA secondary structure and RNA secondary structure alignment formats in a form that is independent of any specific program, thus enabling seamless interoperation of different tools. All XML formats are available at , the BioDOM library can be obtained at . Conclusion The HOBIT XML schemas and the BioDOM library simplify adding XML support to newly created and existing bioinformatic tools, enabling these tools to interoperate seamlessly in workflow scenarios. PMID:17087823

  3. Empirical analysis of RNA robustness and evolution using high-throughput sequencing of ribozyme reactions.

    PubMed

    Hayden, Eric J

    2016-08-15

    RNA molecules provide a realistic but tractable model of a genotype to phenotype relationship. This relationship has been extensively investigated computationally using secondary structure prediction algorithms. Enzymatic RNA molecules, or ribozymes, offer access to genotypic and phenotypic information in the laboratory. Advancements in high-throughput sequencing technologies have enabled the analysis of sequences in the lab that now rivals what can be accomplished computationally. This has motivated a resurgence of in vitro selection experiments and opened new doors for the analysis of the distribution of RNA functions in genotype space. A body of computational experiments has investigated the persistence of specific RNA structures despite changes in the primary sequence, and how this mutational robustness can promote adaptations. This article summarizes recent approaches that were designed to investigate the role of mutational robustness during the evolution of RNA molecules in the laboratory, and presents theoretical motivations, experimental methods and approaches to data analysis. Copyright © 2016 Elsevier Inc. All rights reserved.

  4. CRF: detection of CRISPR arrays using random forest.

    PubMed

    Wang, Kai; Liang, Chun

    2017-01-01

    CRISPRs (clustered regularly interspaced short palindromic repeats) are particular repeat sequences found in wide range of bacteria and archaea genomes. Several tools are available for detecting CRISPR arrays in the genomes of both domains. Here we developed a new web-based CRISPR detection tool named CRF (CRISPR Finder by Random Forest). Different from other CRISPR detection tools, a random forest classifier was used in CRF to filter out invalid CRISPR arrays from all putative candidates and accordingly enhanced detection accuracy. In CRF, particularly, triplet elements that combine both sequence content and structure information were extracted from CRISPR repeats for classifier training. The classifier achieved high accuracy and sensitivity. Moreover, CRF offers a highly interactive web interface for robust data visualization that is not available among other CRISPR detection tools. After detection, the query sequence, CRISPR array architecture, and the sequences and secondary structures of CRISPR repeats and spacers can be visualized for visual examination and validation. CRF is freely available at http://bioinfolab.miamioh.edu/crf/home.php.

  5. Selective 2′-hydroxyl acylation analyzed by primer extension and mutational profiling (SHAPE-MaP) for direct, versatile, and accurate RNA structure analysis

    PubMed Central

    Smola, Matthew J.; Rice, Greggory M.; Busan, Steven; Siegfried, Nathan A.; Weeks, Kevin M.

    2016-01-01

    SHAPE chemistries exploit small electrophilic reagents that react with the 2′-hydroxyl group to interrogate RNA structure at single-nucleotide resolution. Mutational profiling (MaP) identifies modified residues based on the ability of reverse transcriptase to misread a SHAPE-modified nucleotide and then counting the resulting mutations by massively parallel sequencing. The SHAPE-MaP approach measures the structure of large and transcriptome-wide systems as accurately as for simple model RNAs. This protocol describes the experimental steps, implemented over three days, required to perform SHAPE probing and construct multiplexed SHAPE-MaP libraries suitable for deep sequencing. These steps include RNA folding and SHAPE structure probing, mutational profiling by reverse transcription, library construction, and sequencing. Automated processing of MaP sequencing data is accomplished using two software packages. ShapeMapper converts raw sequencing files into mutational profiles, creates SHAPE reactivity plots, and provides useful troubleshooting information, often within an hour. SuperFold uses these data to model RNA secondary structures, identify regions with well-defined structures, and visualize probable and alternative helices, often in under a day. We illustrate these algorithms with the E. coli thiamine pyrophosphate riboswitch, E. coli 16S rRNA, and HIV-1 genomic RNAs. SHAPE-MaP can be used to make nucleotide-resolution biophysical measurements of individual RNA motifs, rare components of complex RNA ensembles, and entire transcriptomes. The straightforward MaP strategy greatly expands the number, length, and complexity of analyzable RNA structures. PMID:26426499

  6. How the Sequence of a Gene Specifies Structural Symmetry in Proteins

    PubMed Central

    Shen, Xiaojuan; Huang, Tongcheng; Wang, Guanyu; Li, Guanglin

    2015-01-01

    Internal symmetry is commonly observed in the majority of fundamental protein folds. Meanwhile, sufficient evidence suggests that nascent polypeptide chains of proteins have the potential to start the co-translational folding process and this process allows mRNA to contain additional information on protein structure. In this paper, we study the relationship between gene sequences and protein structures from the viewpoint of symmetry to explore how gene sequences code for structural symmetry in proteins. We found that, for a set of two-fold symmetric proteins from left-handed beta-helix fold, intragenic symmetry always exists in their corresponding gene sequences. Meanwhile, codon usage bias and local mRNA structure might be involved in modulating translation speed for the formation of structural symmetry: a major decrease of local codon usage bias in the middle of the codon sequence can be identified as a common feature; and major or consecutive decreases in local mRNA folding energy near the boundaries of the symmetric substructures can also be observed. The results suggest that gene duplication and fusion may be an evolutionarily conserved process for this protein fold. In addition, the usage of rare codons and the formation of higher order of secondary structure near the boundaries of symmetric substructures might have coevolved as conserved mechanisms to slow down translation elongation and to facilitate effective folding of symmetric substructures. These findings provide valuable insights into our understanding of the mechanisms of translation and its evolution, as well as the design of proteins via symmetric modules. PMID:26641668

  7. Computational design of RNAs with complex energy landscapes.

    PubMed

    Höner zu Siederdissen, Christian; Hammer, Stefan; Abfalter, Ingrid; Hofacker, Ivo L; Flamm, Christoph; Stadler, Peter F

    2013-12-01

    RNA has become an integral building material in synthetic biology. Dominated by their secondary structures, which can be computed efficiently, RNA molecules are amenable not only to in vitro and in vivo selection, but also to rational, computation-based design. While the inverse folding problem of constructing an RNA sequence with a prescribed ground-state structure has received considerable attention for nearly two decades, there have been few efforts to design RNAs that can switch between distinct prescribed conformations. We introduce a user-friendly tool for designing RNA sequences that fold into multiple target structures. The underlying algorithm makes use of a combination of graph coloring and heuristic local optimization to find sequences whose energy landscapes are dominated by the prescribed conformations. A flexible interface allows the specification of a wide range of design goals. We demonstrate that bi- and tri-stable "switches" can be designed easily with moderate computational effort for the vast majority of compatible combinations of desired target structures. RNAdesign is freely available under the GPL-v3 license. Copyright © 2013 Wiley Periodicals, Inc.

  8. Nuclear Species-Diagnostic SNP Markers Mined from 454 Amplicon Sequencing Reveal Admixture Genomic Structure of Modern Citrus Varieties

    PubMed Central

    Curk, Franck; Ancillo, Gema; Ollitrault, Frédérique; Perrier, Xavier; Jacquemoud-Collet, Jean-Pierre; Garcia-Lor, Andres; Navarro, Luis; Ollitrault, Patrick

    2015-01-01

    Most cultivated Citrus species originated from interspecific hybridisation between four ancestral taxa (C. reticulata, C. maxima, C. medica, and C. micrantha) with limited further interspecific recombination due to vegetative propagation. This evolution resulted in admixture genomes with frequent interspecific heterozygosity. Moreover, a major part of the phenotypic diversity of edible citrus results from the initial differentiation between these taxa. Deciphering the phylogenomic structure of citrus germplasm is therefore essential for an efficient utilization of citrus biodiversity in breeding schemes. The objective of this work was to develop a set of species-diagnostic single nucleotide polymorphism (SNP) markers for the four Citrus ancestral taxa covering the nine chromosomes, and to use these markers to infer the phylogenomic structure of secondary species and modern cultivars. Species-diagnostic SNPs were mined from 454 amplicon sequencing of 57 gene fragments from 26 genotypes of the four basic taxa. Of the 1,053 SNPs mined from 28,507 kb sequence, 273 were found to be highly diagnostic for a single basic taxon. Species-diagnostic SNP markers (105) were used to analyse the admixture structure of varieties and rootstocks. This revealed C. maxima introgressions in most of the old and in all recent selections of mandarins, and suggested that C. reticulata × C. maxima reticulation and introgression processes were important in edible mandarin domestication. The large range of phylogenomic constitutions between C. reticulata and C. maxima revealed in mandarins, tangelos, tangors, sweet oranges, sour oranges, grapefruits, and orangelos is favourable for genetic association studies based on phylogenomic structures of the germplasm. Inferred admixture structures were in agreement with previous hypotheses regarding the origin of several secondary species and also revealed the probable origin of several acid citrus varieties. The developed species-diagnostic SNP marker set will be useful for systematic estimation of admixture structure of citrus germplasm and for diverse genetic studies. PMID:25973611

  9. Nuclear species-diagnostic SNP markers mined from 454 amplicon sequencing reveal admixture genomic structure of modern citrus varieties.

    PubMed

    Curk, Franck; Ancillo, Gema; Ollitrault, Frédérique; Perrier, Xavier; Jacquemoud-Collet, Jean-Pierre; Garcia-Lor, Andres; Navarro, Luis; Ollitrault, Patrick

    2015-01-01

    Most cultivated Citrus species originated from interspecific hybridisation between four ancestral taxa (C. reticulata, C. maxima, C. medica, and C. micrantha) with limited further interspecific recombination due to vegetative propagation. This evolution resulted in admixture genomes with frequent interspecific heterozygosity. Moreover, a major part of the phenotypic diversity of edible citrus results from the initial differentiation between these taxa. Deciphering the phylogenomic structure of citrus germplasm is therefore essential for an efficient utilization of citrus biodiversity in breeding schemes. The objective of this work was to develop a set of species-diagnostic single nucleotide polymorphism (SNP) markers for the four Citrus ancestral taxa covering the nine chromosomes, and to use these markers to infer the phylogenomic structure of secondary species and modern cultivars. Species-diagnostic SNPs were mined from 454 amplicon sequencing of 57 gene fragments from 26 genotypes of the four basic taxa. Of the 1,053 SNPs mined from 28,507 kb sequence, 273 were found to be highly diagnostic for a single basic taxon. Species-diagnostic SNP markers (105) were used to analyse the admixture structure of varieties and rootstocks. This revealed C. maxima introgressions in most of the old and in all recent selections of mandarins, and suggested that C. reticulata × C. maxima reticulation and introgression processes were important in edible mandarin domestication. The large range of phylogenomic constitutions between C. reticulata and C. maxima revealed in mandarins, tangelos, tangors, sweet oranges, sour oranges, grapefruits, and orangelos is favourable for genetic association studies based on phylogenomic structures of the germplasm. Inferred admixture structures were in agreement with previous hypotheses regarding the origin of several secondary species and also revealed the probable origin of several acid citrus varieties. The developed species-diagnostic SNP marker set will be useful for systematic estimation of admixture structure of citrus germplasm and for diverse genetic studies.

  10. Tree decomposition based fast search of RNA structures including pseudoknots in genomes.

    PubMed

    Song, Yinglei; Liu, Chunmei; Malmberg, Russell; Pan, Fangfang; Cai, Liming

    2005-01-01

    Searching genomes for RNA secondary structure with computational methods has become an important approach to the annotation of non-coding RNAs. However, due to the lack of efficient algorithms for accurate RNA structure-sequence alignment, computer programs capable of fast and effectively searching genomes for RNA secondary structures have not been available. In this paper, a novel RNA structure profiling model is introduced based on the notion of a conformational graph to specify the consensus structure of an RNA family. Tree decomposition yields a small tree width t for such conformation graphs (e.g., t = 2 for stem loops and only a slight increase for pseudo-knots). Within this modelling framework, the optimal alignment of a sequence to the structure model corresponds to finding a maximum valued isomorphic subgraph and consequently can be accomplished through dynamic programming on the tree decomposition of the conformational graph in time O(k(t)N(2)), where k is a small parameter; and N is the size of the projiled RNA structure. Experiments show that the application of the alignment algorithm to search in genomes yields the same search accuracy as methods based on a Covariance model with a significant reduction in computation time. In particular; very accurate searches of tmRNAs in bacteria genomes and of telomerase RNAs in yeast genomes can be accomplished in days, as opposed to months required by other methods. The tree decomposition based searching tool is free upon request and can be downloaded at our site h t t p ://w.uga.edu/RNA-informatics/software/index.php.

  11. Specific binding of a HeLa cell nuclear protein to RNA sequences in the human immunodeficiency virus transactivating region.

    PubMed Central

    Gaynor, R; Soultanakis, E; Kuwabara, M; Garcia, J; Sigman, D S

    1989-01-01

    The transactivator protein, tat, encoded by the human immunodeficiency virus is a key regulator of viral transcription. Activation by the tat protein requires sequences downstream of the transcription initiation site called the transactivating region (TAR). RNA derived from the TAR is capable of forming a stable stem-loop structure and the maintenance of both the stem structure and the loop sequences located between +19 and +44 is required for complete in vivo activation by tat. Gel retardation assays with RNA from both wild-type and mutant TAR constructs generated in vitro with SP6 polymerase indicated specific binding of HeLa nuclear proteins to the TAR. To characterize this RNA-protein interaction, a method of chemical "imprinting" has been developed using photoactivated uranyl acetate as the nucleolytic agent. This reagent nicks RNA under physiological conditions at all four nucleotides in a reaction that is independent of sequence and secondary structure. Specific interaction of cellular proteins with TAR RNA could be detected by enhanced cleavages or imprints surrounding the loop region. Mutations that either disrupted stem base-pairing or extensively changed the primary sequence resulted in alterations in the cleavage pattern of the TAR RNA. Structural features of the TAR RNA stem-loop essential for tat activation are also required for specific binding of the HeLa cell nuclear protein. Images PMID:2544877

  12. Global Organization of a Positive-strand RNA Virus Genome

    PubMed Central

    Wu, Baodong; Grigull, Jörg; Ore, Moriam O.; Morin, Sylvie; White, K. Andrew

    2013-01-01

    The genomes of plus-strand RNA viruses contain many regulatory sequences and structures that direct different viral processes. The traditional view of these RNA elements are as local structures present in non-coding regions. However, this view is changing due to the discovery of regulatory elements in coding regions and functional long-range intra-genomic base pairing interactions. The ∼4.8 kb long RNA genome of the tombusvirus tomato bushy stunt virus (TBSV) contains these types of structural features, including six different functional long-distance interactions. We hypothesized that to achieve these multiple interactions this viral genome must utilize a large-scale organizational strategy and, accordingly, we sought to assess the global conformation of the entire TBSV genome. Atomic force micrographs of the genome indicated a mostly condensed structure composed of interconnected protrusions extending from a central hub. This configuration was consistent with the genomic secondary structure model generated using high-throughput selective 2′-hydroxyl acylation analysed by primer extension (i.e. SHAPE), which predicted different sized RNA domains originating from a central region. Known RNA elements were identified in both domain and inter-domain regions, and novel structural features were predicted and functionally confirmed. Interestingly, only two of the six long-range interactions known to form were present in the structural model. However, for those interactions that did not form, complementary partner sequences were positioned relatively close to each other in the structure, suggesting that the secondary structure level of viral genome structure could provide a basic scaffold for the formation of different long-range interactions. The higher-order structural model for the TBSV RNA genome provides a snapshot of the complex framework that allows multiple functional components to operate in concert within a confined context. PMID:23717202

  13. Alternative polyadenylation of the gene transcripts encoding a rat DNA polymerase beta.

    PubMed

    Konopiński, R; Nowak, R; Siedlecki, J A

    1996-10-17

    Rat cells produce two different transcripts of DNA polymerase beta (beta-Pol). The low-molecular-weight transcript (1.4 kb) was already sequenced. We report here the cloning and sequencing of the full-length cDNA, corresponding to the high-molecular-weight (HMW) transcript (4.0 kb) of beta-Pol. Sequence data strongly suggest that both transcripts are produced from a single gene by alternative polyadenylation. The HMW transcript contains the entire 1.4 kb transcript sequence and additional 2.2 kb on the 3' end. The 3' UTR of the HMW transcript contains some regulatory sequences which are not present in the 1.4-kb transcript. The A + U-rich fragment and (GU)21 sequence are believed to influence the stability of the mRNA. The functional significance of the A-rich region locally destabilizing double-stranded secondary structure remains unknown.

  14. Application of the Ramanujan Fourier Transform for the analysis of secondary structure content in amino acid sequences.

    PubMed

    Mainardi, L T; Pattini, L; Cerutti, S

    2007-01-01

    A novel method is presented for the investigation of protein properties of sequences using Ramanujan Fourier Transform (RFT). The new methodology involves the preprocessing of protein sequence data by numerically encoding it and then applying the RFT. The RFT is based on projecting the obtained numerical series on a set of basis functions constituted by Ramanujan sums (RS). In RS components, periodicities of finite integer length, rather than frequency, (as in classical harmonic analysis) are considered. The potential of the new approach is documented by a few examples in the analysis of hydrophobic profiles of proteins in two classes including abundance of alpha-helices (group A) or beta-strands (group B). Different patterns are provided as evidence. RFT can be used to characterize the structural properties of proteins and integrate complementary information provided by other signal processing transforms.

  15. The nucleotide sequence of Beneckea harveyi 5S rRNA. [bioluminescent marine bacterium

    NASA Technical Reports Server (NTRS)

    Luehrsen, K. R.; Fox, G. E.

    1981-01-01

    The primary sequence of the 5S ribosomal RNA isolated from the free-living bioluminescent marine bacterium Beneckea harveyi is reported and discussed in regard to indications of phylogenetic relationships with the bacteria Escherichia coli and Photobacterium phosphoreum. Sequences were determined for oligonucleotide products generated by digestion with ribonuclease T1, pancreatic ribonuclease and ribonuclease T2. The presence of heterogeneity is indicated for two sites. The B. harveyi sequence can be arranged into the same four helix secondary structures as E. coli and other prokaryotic 5S rRNAs. Examination of the 5S-RNS sequences of the three bacteria indicates that B. harveyi and P. phosphoreum are specifically related and share a common ancestor which diverged from an ancestor of E. coli at a somewhat earlier time, consistent with previous studies.

  16. IMG-ABC. A knowledge base to fuel discovery of biosynthetic gene clusters and novel secondary metabolites

    DOE PAGES

    Hadjithomas, Michalis; Chen, I-Min Amy; Chu, Ken; ...

    2015-07-14

    In the discovery of secondary metabolites, analysis of sequence data is a promising exploration path that remains largely underutilized due to the lack of computational platforms that enable such a systematic approach on a large scale. In this work, we present IMG-ABC (https://img.jgi.doe.gov/abc), an atlas of biosynthetic gene clusters within the Integrated Microbial Genomes (IMG) system, which is aimed at harnessing the power of “big” genomic data for discovering small molecules. IMG-ABC relies on IMG’s comprehensive integrated structural and functional genomic data for the analysis of biosynthetic gene clusters (BCs) and associated secondary metabolites (SMs). SMs and BCs serve asmore » the two main classes of objects in IMG-ABC, each with a rich collection of attributes. A unique feature of IMG-ABC is the incorporation of both experimentally validated and computationally predicted BCs in genomes as well as metagenomes, thus identifying BCs in uncultured populations and rare taxa. We demonstrate the strength of IMG-ABC’s focused integrated analysis tools in enabling the exploration of microbial secondary metabolism on a global scale, through the discovery of phenazine-producing clusters for the first time in lphaproteobacteria. IMG-ABC strives to fill the long-existent void of resources for computational exploration of the secondary metabolism universe; its underlying scalable framework enables traversal of uncovered phylogenetic and chemical structure space, serving as a doorway to a new era in the discovery of novel molecules. IMG-ABC is the largest publicly available database of predicted and experimental biosynthetic gene clusters and the secondary metabolites they produce. The system also includes powerful search and analysis tools that are integrated with IMG’s extensive genomic/metagenomic data and analysis tool kits. As new research on biosynthetic gene clusters and secondary metabolites is published and more genomes are sequenced, IMG-ABC will continue to expand, with the goal of becoming an essential component of any bioinformatic exploration of the secondary metabolism world.« less

  17. Sequence Determinants of Compaction in Intrinsically Disordered Proteins

    PubMed Central

    Marsh, Joseph A.; Forman-Kay, Julie D.

    2010-01-01

    Abstract Intrinsically disordered proteins (IDPs), which lack folded structure and are disordered under nondenaturing conditions, have been shown to perform important functions in a large number of cellular processes. These proteins have interesting structural properties that deviate from the random-coil-like behavior exhibited by chemically denatured proteins. In particular, IDPs are often observed to exhibit significant compaction. In this study, we have analyzed the hydrodynamic radii of a number of IDPs to investigate the sequence determinants of this compaction. Net charge and proline content are observed to be strongly correlated with increased hydrodynamic radii, suggesting that these are the dominant contributors to compaction. Hydrophobicity and secondary structure, on the other hand, appear to have negligible effects on compaction, which implies that the determinants of structure in folded and intrinsically disordered proteins are profoundly different. Finally, we observe that polyhistidine tags seem to increase IDP compaction, which suggests that these tags have significant perturbing effects and thus should be removed before any structural characterizations of IDPs. Using the relationships observed in this analysis, we have developed a sequence-based predictor of hydrodynamic radius for IDPs that shows substantial improvement over a simple model based upon chain length alone. PMID:20483348

  18. Unique Structural Features and Sequence Motifs of Proline Utilization A (PutA)

    PubMed Central

    Singh, Ranjan K.; Tanner, John J.

    2013-01-01

    Proline utilization A proteins (PutAs) are bifunctional enzymes that catalyze the oxidation of proline to glutamate using spatially separated proline dehydrogenase and pyrroline-5-carboxylate dehydrogenase active sites. Here we use the crystal structure of the minimalist PutA from Bradyrhizobium japonicum (BjPutA) along with sequence analysis to identify unique structural features of PutAs. This analysis shows that PutAs have secondary structural elements and domains not found in the related monofunctional enzymes. Some of these extra features are predicted to be important for substrate channeling in BjPutA. Multiple sequence alignment analysis shows that some PutAs have a 17-residue conserved motif in the C-terminal 20–30 residues of the polypeptide chain. The BjPutA structure shows that this motif helps seal the internal substrate-channeling cavity from the bulk medium. Finally, it is shown that some PutAs have a 100–200 residue domain of unknown function in the C-terminus that is not found in minimalist PutAs. Remote homology detection suggests that this domain is homologous to the oligomerization beta-hairpin and Rossmann fold domain of BjPutA. PMID:22201760

  19. Introduction to bioinformatics.

    PubMed

    Can, Tolga

    2014-01-01

    Bioinformatics is an interdisciplinary field mainly involving molecular biology and genetics, computer science, mathematics, and statistics. Data intensive, large-scale biological problems are addressed from a computational point of view. The most common problems are modeling biological processes at the molecular level and making inferences from collected data. A bioinformatics solution usually involves the following steps: Collect statistics from biological data. Build a computational model. Solve a computational modeling problem. Test and evaluate a computational algorithm. This chapter gives a brief introduction to bioinformatics by first providing an introduction to biological terminology and then discussing some classical bioinformatics problems organized by the types of data sources. Sequence analysis is the analysis of DNA and protein sequences for clues regarding function and includes subproblems such as identification of homologs, multiple sequence alignment, searching sequence patterns, and evolutionary analyses. Protein structures are three-dimensional data and the associated problems are structure prediction (secondary and tertiary), analysis of protein structures for clues regarding function, and structural alignment. Gene expression data is usually represented as matrices and analysis of microarray data mostly involves statistics analysis, classification, and clustering approaches. Biological networks such as gene regulatory networks, metabolic pathways, and protein-protein interaction networks are usually modeled as graphs and graph theoretic approaches are used to solve associated problems such as construction and analysis of large-scale networks.

  20. ConSurf 2016: an improved methodology to estimate and visualize evolutionary conservation in macromolecules

    PubMed Central

    Ashkenazy, Haim; Abadi, Shiran; Martz, Eric; Chay, Ofer; Mayrose, Itay; Pupko, Tal; Ben-Tal, Nir

    2016-01-01

    The degree of evolutionary conservation of an amino acid in a protein or a nucleic acid in DNA/RNA reflects a balance between its natural tendency to mutate and the overall need to retain the structural integrity and function of the macromolecule. The ConSurf web server (http://consurf.tau.ac.il), established over 15 years ago, analyses the evolutionary pattern of the amino/nucleic acids of the macromolecule to reveal regions that are important for structure and/or function. Starting from a query sequence or structure, the server automatically collects homologues, infers their multiple sequence alignment and reconstructs a phylogenetic tree that reflects their evolutionary relations. These data are then used, within a probabilistic framework, to estimate the evolutionary rates of each sequence position. Here we introduce several new features into ConSurf, including automatic selection of the best evolutionary model used to infer the rates, the ability to homology-model query proteins, prediction of the secondary structure of query RNA molecules from sequence, the ability to view the biological assembly of a query (in addition to the single chain), mapping of the conservation grades onto 2D RNA models and an advanced view of the phylogenetic tree that enables interactively rerunning ConSurf with the taxa of a sub-tree. PMID:27166375

  1. Transcriptome-Wide Analysis of UTRs in Non-Small Cell Lung Cancer Reveals Cancer-Related Genes with SNV-Induced Changes on RNA Secondary Structure and miRNA Target Sites

    PubMed Central

    Novotny, Peter; Tang, Xiaojia; Kalari, Krishna R.; Gorodkin, Jan

    2014-01-01

    Traditional mutation assessment methods generally focus on predicting disruptive changes in protein-coding regions rather than non-coding regulatory regions like untranslated regions (UTRs) of mRNAs. The UTRs, however, are known to have many sequence and structural motifs that can regulate translational and transcriptional efficiency and stability of mRNAs through interaction with RNA-binding proteins and other non-coding RNAs like microRNAs (miRNAs). In a recent study, transcriptomes of tumor cells harboring mutant and wild-type KRAS (V-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog) genes in patients with non-small cell lung cancer (NSCLC) have been sequenced to identify single nucleotide variations (SNVs). About 40% of the total SNVs (73,717) identified were mapped to UTRs, but omitted in the previous analysis. To meet this obvious demand for analysis of the UTRs, we designed a comprehensive pipeline to predict the effect of SNVs on two major regulatory elements, secondary structure and miRNA target sites. Out of 29,290 SNVs in 6462 genes, we predict 472 SNVs (in 408 genes) affecting local RNA secondary structure, 490 SNVs (in 447 genes) affecting miRNA target sites and 48 that do both. Together these disruptive SNVs were present in 803 different genes, out of which 188 (23.4%) were previously known to be cancer-associated. Notably, this ratio is significantly higher (one-sided Fisher's exact test p-value = 0.032) than the ratio (20.8%) of known cancer-associated genes (n = 1347) in our initial data set (n = 6462). Network analysis shows that the genes harboring disruptive SNVs were involved in molecular mechanisms of cancer, and the signaling pathways of LPS-stimulated MAPK, IL-6, iNOS, EIF2 and mTOR. In conclusion, we have found hundreds of SNVs which are highly disruptive with respect to changes in the secondary structure and miRNA target sites within UTRs. These changes hold the potential to alter the expression of known cancer genes or genes linked to cancer-associated pathways. PMID:24416147

  2. Transcriptome-wide analysis of UTRs in non-small cell lung cancer reveals cancer-related genes with SNV-induced changes on RNA secondary structure and miRNA target sites.

    PubMed

    Sabarinathan, Radhakrishnan; Wenzel, Anne; Novotny, Peter; Tang, Xiaojia; Kalari, Krishna R; Gorodkin, Jan

    2014-01-01

    Traditional mutation assessment methods generally focus on predicting disruptive changes in protein-coding regions rather than non-coding regulatory regions like untranslated regions (UTRs) of mRNAs. The UTRs, however, are known to have many sequence and structural motifs that can regulate translational and transcriptional efficiency and stability of mRNAs through interaction with RNA-binding proteins and other non-coding RNAs like microRNAs (miRNAs). In a recent study, transcriptomes of tumor cells harboring mutant and wild-type KRAS (V-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog) genes in patients with non-small cell lung cancer (NSCLC) have been sequenced to identify single nucleotide variations (SNVs). About 40% of the total SNVs (73,717) identified were mapped to UTRs, but omitted in the previous analysis. To meet this obvious demand for analysis of the UTRs, we designed a comprehensive pipeline to predict the effect of SNVs on two major regulatory elements, secondary structure and miRNA target sites. Out of 29,290 SNVs in 6462 genes, we predict 472 SNVs (in 408 genes) affecting local RNA secondary structure, 490 SNVs (in 447 genes) affecting miRNA target sites and 48 that do both. Together these disruptive SNVs were present in 803 different genes, out of which 188 (23.4%) were previously known to be cancer-associated. Notably, this ratio is significantly higher (one-sided Fisher's exact test p-value = 0.032) than the ratio (20.8%) of known cancer-associated genes (n = 1347) in our initial data set (n = 6462). Network analysis shows that the genes harboring disruptive SNVs were involved in molecular mechanisms of cancer, and the signaling pathways of LPS-stimulated MAPK, IL-6, iNOS, EIF2 and mTOR. In conclusion, we have found hundreds of SNVs which are highly disruptive with respect to changes in the secondary structure and miRNA target sites within UTRs. These changes hold the potential to alter the expression of known cancer genes or genes linked to cancer-associated pathways.

  3. Predicting RNA 3D structure using a coarse-grain helix-centered model

    PubMed Central

    Kerpedjiev, Peter; Höner zu Siederdissen, Christian; Hofacker, Ivo L.

    2015-01-01

    A 3D model of RNA structure can provide information about its function and regulation that is not possible with just the sequence or secondary structure. Current models suffer from low accuracy and long running times and either neglect or presume knowledge of the long-range interactions which stabilize the tertiary structure. Our coarse-grained, helix-based, tertiary structure model operates with only a few degrees of freedom compared with all-atom models while preserving the ability to sample tertiary structures given a secondary structure. It strikes a balance between the precision of an all-atom tertiary structure model and the simplicity and effectiveness of a secondary structure representation. It provides a simplified tool for exploring global arrangements of helices and loops within RNA structures. We provide an example of a novel energy function relying only on the positions of stems and loops. We show that coupling our model to this energy function produces predictions as good as or better than the current state of the art tools. We propose that given the wide range of conformational space that needs to be explored, a coarse-grain approach can explore more conformations in less iterations than an all-atom model coupled to a fine-grain energy function. Finally, we emphasize the overarching theme of providing an ensemble of predicted structures, something which our tool excels at, rather than providing a handful of the lowest energy structures. PMID:25904133

  4. Differential structural status of the RNA counterpart of an undecamer quasi-palindromic DNA sequence present in LCR of human β-globin gene cluster.

    PubMed

    Kaushik, Mahima; Kukreti, Shrikant

    2015-01-01

    Our previous work on structural polymorphism shown at a single nucleotide polymorphism (SNP) (A → G) site located on HS4 region of locus control region (LCR) of β-globin gene has established a hairpin → duplex equilibrium corresponding to A → B like DNA transition (Kaushik M, Kukreti, R., Grover, D., Brahmachari, S.K. and Kukreti S. Nucleic Acids Res. 2003; Kaushik M, Kukreti S. Nucleic Acids Res. 2006). The G-allele of A → G SNP has been shown to be significantly associated with the occurrence of β-thalassemia. Considering the significance of this 11-nt long quasi-palindromic sequence [5'-TGGGG(G/A)CCCCA; HP(G/A)11] of β-globin gene LCR, we further explored the differential behavior of the same DNA sequence with its RNA counterpart, using various biophysical and biochemical techniques. In contrast to its DNA counterpart exhibiting a A → B structural transition and an equilibrium between duplex and hairpin forms, the studied RNA oligonucleotide sequence [5'-UGGGG(G/A)CCCCA; RHP(G/A)11] existed only in duplex form (A-conformation) and did not form hairpin. The single residue difference from A to G led to the unusual thermal stability of the RNA structure formed by the studied sequence. Since, naturally occurring mutations and various SNP sites may stabilize or destabilize the local DNA/RNA secondary structures, these structural transitions may affect the gene expression by a change in the protein-DNA recognition patterns.

  5. Characterizing the Secondary Protein Structure of Black Widow Dragline Silk Using Solid-State NMR & X-ray Diffraction

    PubMed Central

    Jenkins, Janelle E.; Sampath, Sujatha; Butler, Emily; Kim, Jihyun; Henning, Robert W.; Holland, Gregory P.; Yarger, Jeffery L.

    2013-01-01

    This study provides a detailed secondary structural characterization of major ampullate dragline silk from Latrodectus hesperus (black widow) spiders. X-ray diffraction results show that the structure of black widow major ampullate silk fibers is comprised of stacked β-sheet nanocrystallites oriented parallel to the fiber axis and an amorphous region with oriented (anisotropic) and isotropic components. The combination of two-dimensional (2D) 13C-13C through-space and through-bond solid-state NMR experiments provide chemical shifts that are used to determine detailed information about amino acid motif secondary structure in black widow spider dragline silk. Individual amino acids are incorporated into different repetitive motifs that make up the majority of this protein-based biopolymer. From the solid-state NMR measurements, we assign distinct secondary conformations to each repetitive amino acid motif and hence to the amino acids that make up the motifs. Specifically, alanine is incorporated in β-sheet (poly(Alan) and poly(Gly-Ala)), 31-helix (poly(Gly-Gly-Xaa), and α-helix (poly(Gln-Gln-Ala-Tyr)) components. Glycine is determined to be in β-sheet (poly(Gly-Ala)) and 31-helical (poly(Gly-Gly-Xaa)) regions, while serine is present in β-sheet (poly(Gly-Ala-Ser)), 31-helix (poly(Gly-Gly-Ser)), and β-turn (poly(Gly-Pro-Ser)) structures. These various motif-specific secondary structural elements are quantitatively correlated to the primary amino acid sequence of major ampullate spidroin 1 and 2 (MaSp1 and MaSp2) and are shown to form a self-consistent model for black widow dragline silk. PMID:24024617

  6. Structure and function of small heat shock/alpha-crystallin proteins: established concepts and emerging ideas.

    PubMed

    MacRae, T H

    2000-06-01

    Small heat shock/alpha-crystallin proteins are defined by conserved sequence of approximately 90 amino acid residues, termed the alpha-crystallin domain, which is bounded by variable amino- and carboxy-terminal extensions. These proteins form oligomers, most of uncertain quaternary structure, and oligomerization is prerequisite to their function as molecular chaperones. Sequence modelling and physical analyses show that the secondary structure of small heat shock/alpha-crystallin proteins is predominately beta-pleated sheet. Crystallography, site-directed spin-labelling and yeast two-hybrid selection demonstrate regions of secondary structure within the alpha-crystallin domain that interact during oligomer assembly, a process also dependent on the amino terminus. Oligomers are dynamic, exhibiting subunit exchange and organizational plasticity, perhaps leading to functional diversity. Exposure of hydrophobic residues by structural modification facilitates chaperoning where denaturing proteins in the molten globule state associate with oligomers. The flexible carboxy-terminal extension contributes to chaperone activity by enhancing the solubility of small heat shock/alpha-crystallin proteins. Site-directed mutagenesis has yielded proteins where the effect of the change on structure and function depends upon the residue modified, the organism under study and the analytical techniques used. Most revealing, substitution of a conserved arginine residue within the alpha-crystallin domain has a major impact on quaternary structure and chaperone action probably through realignment of beta-sheets. These mutations are linked to inherited diseases. Oligomer size is regulated by a stress-responsive cascade including MAPKAP kinase 2/3 and p38. Phosphorylation of small heat shock/alpha-crystallin proteins has important consequences within stressed cells, especially for microfilaments.

  7. DMS-MaPseq for genome-wide or targeted RNA structure probing in vivo

    PubMed Central

    Zubradt, Meghan; Gupta, Paromita; Persad, Sitara; Lambowitz, Alan M.; Weissman, Jonathan S.; Rouskin, Silvi

    2017-01-01

    Coupling structure-specific in vivo chemical modification to next-generation sequencing is transforming RNA secondary structural studies in living cells. The dominant strategy for detecting in vivo chemical modifications uses reverse transcriptase truncation products, which introduces biases and necessitates population-average assessments of RNA structure. Here we present dimethyl sulfate mutational profiling with sequencing (DMS-MaPseq), which encodes DMS modifications as mismatches using a thermostable group II intron reverse transcriptase (TGIRT). DMS-MaPseq yields a high signal-to-noise ratio, can report multiple structural features per molecule, and allows both genome-wide studies and focused in vivo investigations of even low abundance RNAs. We apply DMS-MaPseq for the first analysis of RNA structure within an animal tissue and to identify a functional structure involved in non-canonical translation initiation. Additionally, we use DMS-MaPseq to compare the in vivo structure of pre-mRNAs to their mature isoforms. These applications illustrate DMS-MaPseq’s capacity to dramatically expand in vivo analysis of RNA structure. PMID:27819661

  8. DNA secondary structures are associated with recombination in major Plasmodium falciparum variable surface antigen gene families

    PubMed Central

    Sander, Adam F.; Lavstsen, Thomas; Rask, Thomas S.; Lisby, Michael; Salanti, Ali; Fordyce, Sarah L.; Jespersen, Jakob S.; Carter, Richard; Deitsch, Kirk W.; Theander, Thor G.; Pedersen, Anders Gorm; Arnot, David E.

    2014-01-01

    Many bacterial, viral and parasitic pathogens undergo antigenic variation to counter host immune defense mechanisms. In Plasmodium falciparum, the most lethal of human malaria parasites, switching of var gene expression results in alternating expression of the adhesion proteins of the Plasmodium falciparum-erythrocyte membrane protein 1 class on the infected erythrocyte surface. Recombination clearly generates var diversity, but the nature and control of the genetic exchanges involved remain unclear. By experimental and bioinformatic identification of recombination events and genome-wide recombination hotspots in var genes, we show that during the parasite’s sexual stages, ectopic recombination between isogenous var paralogs occurs near low folding free energy DNA 50-mers and that these sequences are heavily concentrated at the boundaries of regions encoding individual Plasmodium falciparum-erythrocyte membrane protein 1 structural domains. The recombinogenic potential of these 50-mers is not parasite-specific because these sequences also induce recombination when transferred to the yeast Saccharomyces cerevisiae. Genetic cross data suggest that DNA secondary structures (DSS) act as inducers of recombination during DNA replication in P. falciparum sexual stages, and that these DSS-regulated genetic exchanges generate functional and diverse P. falciparum adhesion antigens. DSS-induced recombination may represent a common mechanism for optimizing the evolvability of virulence gene families in pathogens. PMID:24253306

  9. Predicting β-turns and their types using predicted backbone dihedral angles and secondary structures

    PubMed Central

    2010-01-01

    Background β-turns are secondary structure elements usually classified as coil. Their prediction is important, because of their role in protein folding and their frequent occurrence in protein chains. Results We have developed a novel method that predicts β-turns and their types using information from multiple sequence alignments, predicted secondary structures and, for the first time, predicted dihedral angles. Our method uses support vector machines, a supervised classification technique, and is trained and tested on three established datasets of 426, 547 and 823 protein chains. We achieve a Matthews correlation coefficient of up to 0.49, when predicting the location of β-turns, the highest reported value to date. Moreover, the additional dihedral information improves the prediction of β-turn types I, II, IV, VIII and "non-specific", achieving correlation coefficients up to 0.39, 0.33, 0.27, 0.14 and 0.38, respectively. Our results are more accurate than other methods. Conclusions We have created an accurate predictor of β-turns and their types. Our method, called DEBT, is available online at http://comp.chem.nottingham.ac.uk/debt/. PMID:20673368

  10. Predicting beta-turns and their types using predicted backbone dihedral angles and secondary structures.

    PubMed

    Kountouris, Petros; Hirst, Jonathan D

    2010-07-31

    Beta-turns are secondary structure elements usually classified as coil. Their prediction is important, because of their role in protein folding and their frequent occurrence in protein chains. We have developed a novel method that predicts beta-turns and their types using information from multiple sequence alignments, predicted secondary structures and, for the first time, predicted dihedral angles. Our method uses support vector machines, a supervised classification technique, and is trained and tested on three established datasets of 426, 547 and 823 protein chains. We achieve a Matthews correlation coefficient of up to 0.49, when predicting the location of beta-turns, the highest reported value to date. Moreover, the additional dihedral information improves the prediction of beta-turn types I, II, IV, VIII and "non-specific", achieving correlation coefficients up to 0.39, 0.33, 0.27, 0.14 and 0.38, respectively. Our results are more accurate than other methods. We have created an accurate predictor of beta-turns and their types. Our method, called DEBT, is available online at http://comp.chem.nottingham.ac.uk/debt/.

  11. Complete mitochondrial genome of the giant African snail, Achatina fulica (Mollusca: Achatinidae): a novel location of putative control regions (CR) in the mitogenome within Pulmonate species.

    PubMed

    He, Zhang-Ping; Dai, Xia-Bin; Zhang, Shuai; Zhi, Ting-Ting; Lun, Zhao-Rong; Wu, Zhong-Dao; Yang, Ting-Bao

    2016-01-01

    The whole sequence (15,057 bp) of the mitochondrial DNA (mtDNA) of the terrestrial snail Achatina fulica (order Stylommatophora) was determined. The mitogenome, as the typical metazoan mtDNA, contains 13 protein-coding genes (PCG), 2 ribosomal RNA genes (rRNA) and 22 transfer RNA genes (tRNA). The tRNA genes include two trnS without standard secondary structure. Interestingly, among the known mitogenomes of Pulmonata species, we firstly characterized an unassigned lengthy sequence (551 bp) between the cox1 and the trnV which may be the CR for the sake of its AT bases usage bias (65.70%) and potential hairpin structure.

  12. PB1-F2 Influenza A Virus Protein Adopts a β-Sheet Conformation and Forms Amyloid Fibers in Membrane Environments

    PubMed Central

    Chevalier, Christophe; Al Bazzal, Ali; Vidic, Jasmina; Février, Vincent; Bourdieu, Christiane; Bouguyon, Edwige; Le Goffic, Ronan; Vautherot, Jean-François; Bernard, Julie; Moudjou, Mohammed; Noinville, Sylvie; Chich, Jean-François; Da Costa, Bruno; Rezaei, Human; Delmas, Bernard

    2010-01-01

    The influenza A virus PB1-F2 protein, encoded by an alternative reading frame in the PB1 polymerase gene, displays a high sequence polymorphism and is reported to contribute to viral pathogenesis in a sequence-specific manner. To gain insights into the functions of PB1-F2, the molecular structure of several PB1-F2 variants produced in Escherichia coli was investigated in different environments. Circular dichroism spectroscopy shows that all variants have a random coil secondary structure in aqueous solution. When incubated in trifluoroethanol polar solvent, all PB1-F2 variants adopt an α-helix-rich structure, whereas incubated in acetonitrile, a solvent of medium polarity mimicking the membrane environment, they display β-sheet secondary structures. Incubated with asolectin liposomes and SDS micelles, PB1-F2 variants also acquire a β-sheet structure. Dynamic light scattering revealed that the presence of β-sheets is correlated with an oligomerization/aggregation of PB1-F2. Electron microscopy showed that PB1-F2 forms amorphous aggregates in acetonitrile. In contrast, at low concentrations of SDS, PB1-F2 variants exhibited various abilities to form fibers that were evidenced as amyloid fibers in a thioflavin T assay. Using a recombinant virus and its PB1-F2 knock-out mutant, we show that PB1-F2 also forms amyloid structures in infected cells. Functional membrane permeabilization assays revealed that the PB1-F2 variants can perforate membranes at nanomolar concentrations but with activities found to be sequence-dependent and not obviously correlated with their differential ability to form amyloid fibers. All of these observations suggest that PB1-F2 could be involved in physiological processes through different pathways, permeabilization of cellular membranes, and amyloid fiber formation. PMID:20172856

  13. PB1-F2 influenza A virus protein adopts a beta-sheet conformation and forms amyloid fibers in membrane environments.

    PubMed

    Chevalier, Christophe; Al Bazzal, Ali; Vidic, Jasmina; Février, Vincent; Bourdieu, Christiane; Bouguyon, Edwige; Le Goffic, Ronan; Vautherot, Jean-François; Bernard, Julie; Moudjou, Mohammed; Noinville, Sylvie; Chich, Jean-François; Da Costa, Bruno; Rezaei, Human; Delmas, Bernard

    2010-04-23

    The influenza A virus PB1-F2 protein, encoded by an alternative reading frame in the PB1 polymerase gene, displays a high sequence polymorphism and is reported to contribute to viral pathogenesis in a sequence-specific manner. To gain insights into the functions of PB1-F2, the molecular structure of several PB1-F2 variants produced in Escherichia coli was investigated in different environments. Circular dichroism spectroscopy shows that all variants have a random coil secondary structure in aqueous solution. When incubated in trifluoroethanol polar solvent, all PB1-F2 variants adopt an alpha-helix-rich structure, whereas incubated in acetonitrile, a solvent of medium polarity mimicking the membrane environment, they display beta-sheet secondary structures. Incubated with asolectin liposomes and SDS micelles, PB1-F2 variants also acquire a beta-sheet structure. Dynamic light scattering revealed that the presence of beta-sheets is correlated with an oligomerization/aggregation of PB1-F2. Electron microscopy showed that PB1-F2 forms amorphous aggregates in acetonitrile. In contrast, at low concentrations of SDS, PB1-F2 variants exhibited various abilities to form fibers that were evidenced as amyloid fibers in a thioflavin T assay. Using a recombinant virus and its PB1-F2 knock-out mutant, we show that PB1-F2 also forms amyloid structures in infected cells. Functional membrane permeabilization assays revealed that the PB1-F2 variants can perforate membranes at nanomolar concentrations but with activities found to be sequence-dependent and not obviously correlated with their differential ability to form amyloid fibers. All of these observations suggest that PB1-F2 could be involved in physiological processes through different pathways, permeabilization of cellular membranes, and amyloid fiber formation.

  14. Automated 3D structure composition for large RNAs

    PubMed Central

    Popenda, Mariusz; Szachniuk, Marta; Antczak, Maciej; Purzycka, Katarzyna J.; Lukasiak, Piotr; Bartol, Natalia; Blazewicz, Jacek; Adamiak, Ryszard W.

    2012-01-01

    Understanding the numerous functions that RNAs play in living cells depends critically on knowledge of their three-dimensional structure. Due to the difficulties in experimentally assessing structures of large RNAs, there is currently great demand for new high-resolution structure prediction methods. We present the novel method for the fully automated prediction of RNA 3D structures from a user-defined secondary structure. The concept is founded on the machine translation system. The translation engine operates on the RNA FRABASE database tailored to the dictionary relating the RNA secondary structure and tertiary structure elements. The translation algorithm is very fast. Initial 3D structure is composed in a range of seconds on a single processor. The method assures the prediction of large RNA 3D structures of high quality. Our approach needs neither structural templates nor RNA sequence alignment, required for comparative methods. This enables the building of unresolved yet native and artificial RNA structures. The method is implemented in a publicly available, user-friendly server RNAComposer. It works in an interactive mode and a batch mode. The batch mode is designed for large-scale modelling and accepts atomic distance restraints. Presently, the server is set to build RNA structures of up to 500 residues. PMID:22539264

  15. Local neutral networks help maintain inaccurately replicating ribozymes.

    PubMed

    Szilágyi, András; Kun, Ádám; Szathmáry, Eörs

    2014-01-01

    The error threshold of replication limits the selectively maintainable genome size against recurrent deleterious mutations for most fitness landscapes. In the context of RNA replication a distinction between the genotypic and the phenotypic error threshold has been made; where the latter concerns the maintenance of secondary structure rather than sequence. RNA secondary structure is treated as a proxy for function. The phenotypic error threshold allows higher per digit mutation rates than its genotypic counterpart, and is known to increase with the frequency of neutral mutations in sequence space. Here we show that the degree of neutrality, i.e. the frequency of nearest-neighbour (one-step) neutral mutants is a remarkably accurate proxy for the overall frequency of such mutants in an experimentally verifiable formula for the phenotypic error threshold; this we achieve by the full numerical solution for the concentration of all sequences in mutation-selection balance up to length 16. We reinforce our previous result that currently known ribozymes could be selectively maintained by the accuracy known from the best available polymerase ribozymes. Furthermore, we show that in silico stabilizing selection can increase the mutational robustness of ribozymes due to the fact that they were produced by artificial directional selection in the first place. Our finding offers a better understanding of the error threshold and provides further insight into the plausibility of an ancient RNA world.

  16. New insights into the promoterless transcription of DNA coligo templates by RNA polymerase III

    PubMed Central

    Lama, Lodoe; Seidl, Christine I; Ryan, Kevin

    2014-01-01

    Chemically synthesized DNA can carry small RNA sequence information but converting that information into small RNA is generally thought to require large double-stranded promoters in the context of plasmids, viruses and genes. We previously found evidence that circularized oligodeoxynucleotides (coligos) containing certain sequences and secondary structures can template the synthesis of small RNA by RNA polymerase III in vitro and in human cells. By using immunoprecipitated RNA polymerase III we now report corroborating evidence that this enzyme is the sole polymerase responsible for coligo transcription. The immobilized polymerase enabled experiments showing that coligo transcripts can be formed through transcription termination without subsequent 3′ end trimming. To better define the determinants of productive transcription, a structure-activity relationship study was performed using over 20 new coligos. The results show that unpaired nucleotides in the coligo stem facilitate circumtranscription, but also that internal loops and bulges should be kept small to avoid secondary transcription initiation sites. A polymerase termination sequence embedded in the double-stranded region of a hairpin-encoding coligo stem can antagonize transcription. Using lessons learned from new and old coligos, we demonstrate how to convert poorly transcribed coligos into productive templates. Our findings support the possibility that coligos may prove useful as chemically synthesized vectors for the ectopic expression of small RNA in human cells. PMID:25764216

  17. Determination of protein folding kinetic types using sequence and predicted secondary structure and solvent accessibility.

    PubMed

    Zhang, Hua; Zhang, Tuo; Gao, Jianzhao; Ruan, Jishou; Shen, Shiyi; Kurgan, Lukasz

    2012-01-01

    Proteins fold through a two-state (TS), with no visible intermediates, or a multi-state (MS), via at least one intermediate, process. We analyze sequence-derived factors that determine folding types by introducing a novel sequence-based folding type predictor called FOKIT. This method implements a logistic regression model with six input features which hybridize information concerning amino acid composition and predicted secondary structure and solvent accessibility. FOKIT provides predictions with average Matthews correlation coefficient (MCC) between 0.58 and 0.91 measured using out-of-sample tests on four benchmark datasets. These results are shown to be competitive or better than results of four modern predictors. We also show that FOKIT outperforms these methods when predicting chains that share low similarity with the chains used to build the model, which is an important advantage given the limited number of annotated chains. We demonstrate that inclusion of solvent accessibility helps in discrimination of the folding kinetic types and that three of the features constitute statistically significant markers that differentiate TS and MS folders. We found that the increased content of exposed Trp and buried Leu are indicative of the MS folding, which implies that the exposure/burial of certain hydrophobic residues may play important role in the formation of the folding intermediates. Our conclusions are supported by two case studies.

  18. A novel serine protease with human fibrino(geno)lytic activities from Artocarpus heterophyllus latex.

    PubMed

    Siritapetawee, Jaruwan; Thumanu, Kanjana; Sojikul, Punchapat; Thammasirirak, Sompong

    2012-07-01

    A protease was isolated and purified from Artocarpus heterophyllus (jackfruit) latex and designated as a 48-kDa antimicrobial protease (AMP48) in a previous publication. In this work, the enzyme was characterized for more biochemical and medicinal properties. Enzyme activity of AMP48 was strongly inhibited by phenylmethanesulfonyl fluoride and soybean trypsin inhibitor, indicating that the enzyme was a plant serine protease. The N-terminal amino acid sequences (A-Q-E-G-G-K-D-D-D-G-G) of AMP48 had no sequence similarity matches with any sequence databases of BLAST search and other plant serine protease. The secondary structure of this enzyme was composed of high α-helix (51%) and low β-sheet (9%). AMP48 had fibrinogenolytic activity with maximal activity between 55 and 60°C at pH 8. The enzyme efficiently hydrolyzed α followed by partially hydrolyzed β and γ subunits of human fibrinogen. In addition, the fibrinolytic activity was observed through the degradation products by SDS-PAGE and emphasized its activity by monitoring the alteration of secondary structure of fibrin clot after enzyme digestion using ATR-FTIR spectroscopy. This study presented the potential role to use AMP48 as antithrombotic for treatment thromboembolic disorders such as strokes, pulmonary emboli and deep vein thrombosis. Copyright © 2012 Elsevier B.V. All rights reserved.

  19. Molecular Cloning, Bioinformatics Analysis and Expression of Insulin-Like Growth Factor 2 from Tianzhu White Yak, Bos grunniens

    PubMed Central

    Zhang, Quanwei; Gong, Jishang; Wang, Xueying; Wu, Xiaohu; Li, Yalan; Ma, Youji; Zhang, Yong; Zhao, Xingxu

    2014-01-01

    The IGF family is essential for normal embryonic and postnatal development and plays important roles in the immune system, myogenesis, bone metabolism and other physiological functions, which makes the study of its structure and biological characteristics important. Tianzhu white yak (Bos grunniens) domesticated under alpine hypoxia environments, is well adapted to survive and grow against severe hypoxia and cold temperatures for extended periods. In this study, a full coding sequence of the IGF2 gene of Tianzhu white yak was amplified by reverse transcription PCR and rapid-amplification of cDNA ends (RACE) for the first time. The cDNA sequence revealed an open reading frame of 450 nucleotides, encoding a protein with 179 amino acids. Its expression in different tissues was also studied by Real time PCR. Phylogenetic tree analysis indicated that yak IGF2 was similar to Bos taurus, and 3D structure showed high similarity with the human IGF2. The putative full CDS of yak IGF2 was amplified by PCR in five tissues, and cDNA sequence analysis showed high homology to bovine IGF2. Moreover the super secondary structure prediction showed a similar 3D structure with human IGF2. Its conservation in sequence and structure has facilitated research on IGF2 and its physiological function in yak. PMID:24394317

  20. The Transcriptomics of Secondary Growth and Wood Formation in Conifers

    PubMed Central

    Carvalho, Ana; Paiva, Jorge; Louzada, José; Lima-Brito, José

    2013-01-01

    In the last years, forestry scientists have adapted genomics and next-generation sequencing (NGS) technologies to the search for candidate genes related to the transcriptomics of secondary growth and wood formation in several tree species. Gymnosperms, in particular, the conifers, are ecologically and economically important, namely, for the production of wood and other forestry end products. Until very recently, no whole genome sequencing of a conifer genome was available. Due to the gradual improvement of the NGS technologies and inherent bioinformatics tools, two draft assemblies of the whole genomes sequence of Picea abies and Picea glauca arose in the current year. These draft genome assemblies will bring new insights about the structure, content, and evolution of the conifer genomes. Furthermore, new directions in the forestry, breeding and research of conifers will be discussed in the following. The identification of genes associated with the xylem transcriptome and the knowledge of their regulatory mechanisms will provide less time-consuming breeding cycles and a high accuracy for the selection of traits related to wood production and quality. PMID:24288610

  1. Comprehensive analysis of RNA-protein interactions by high-throughput sequencing-RNA affinity profiling.

    PubMed

    Tome, Jacob M; Ozer, Abdullah; Pagano, John M; Gheba, Dan; Schroth, Gary P; Lis, John T

    2014-06-01

    RNA-protein interactions play critical roles in gene regulation, but methods to quantitatively analyze these interactions at a large scale are lacking. We have developed a high-throughput sequencing-RNA affinity profiling (HiTS-RAP) assay by adapting a high-throughput DNA sequencer to quantify the binding of fluorescently labeled protein to millions of RNAs anchored to sequenced cDNA templates. Using HiTS-RAP, we measured the affinity of mutagenized libraries of GFP-binding and NELF-E-binding aptamers to their respective targets and identified critical regions of interaction. Mutations additively affected the affinity of the NELF-E-binding aptamer, whose interaction depended mainly on a single-stranded RNA motif, but not that of the GFP aptamer, whose interaction depended primarily on secondary structure.

  2. Variation analysis of the severe acute respiratory syndrome coronavirus putative non-structural protein 2 gene and construction of three-dimensional model.

    PubMed

    Lu, Jia-hai; Zhang, Ding-mei; Wang, Guo-ling; Guo, Zhong-min; Zhang, Chuan-hai; Tan, Bing-yan; Ouyang, Li-ping; Lin, Li; Liu, Yi-min; Chen, Wei-qing; Ling, Wen-hua; Yu, Xin-bing; Zhong, Nan-shan

    2005-05-05

    The rapid transmission and high mortality rate made severe acute respiratory syndrome (SARS) a global threat for which no efficacious therapy is available now. Without sufficient knowledge about the SARS coronavirus (SARS-CoV), it is impossible to define the candidate for the anti-SARS targets. The putative non-structural protein 2 (nsp2) (3CL(pro), following the nomenclature by Gao et al, also known as nsp5 in Snidjer et al) of SARS-CoV plays an important role in viral transcription and replication, and is an attractive target for anti-SARS drug development, so we carried on this study to have an insight into putative polymerase nsp2 of SARS-CoV Guangdong (GD) strain. The SARS-CoV strain was isolated from a SARS patient in Guangdong, China, and cultured in Vero E6 cells. The nsp2 gene was amplified by reverse transcription-polymerase chain reaction (RT-PCR) and cloned into eukaryotic expression vector pCI-neo (pCI-neo/nsp2). Then the recombinant eukaryotic expression vector pCI-neo/nsp2 was transfected into COS-7 cells using lipofectin reagent to express the nsp2 protein. The expressive protein of SARS-CoV nsp2 was analyzed by 7% sodium dodecylsulfate polyacrylamide gel electrophoresis (SDS-PAGE). The nucleotide sequence and protein sequence of GD nsp2 were compared with that of other SARS-CoV strains by nucleotide-nucleotide basic local alignment search tool (BLASTN) and protein-protein basic local alignment search tool (BLASTP) to investigate its variance trend during the transmission. The secondary structure of GD strain and that of other strains were predicted by Garnier-Osguthorpe-Robson (GOR) Secondary Structure Prediction. Three-dimensional-PSSM Protein Fold Recognition (Threading) Server was employed to construct the three-dimensional model of the nsp2 protein. The putative polymerase nsp2 gene of GD strain was amplified by RT-PCR. The eukaryotic expression vector (pCI-neo/nsp2) was constructed and expressed the protein in COS-7 cells successfully. The result of sequencing and sequence comparison with other SARS-CoV strains showed that nsp2 gene was relatively conservative during the transmission and total five base sites mutated in about 100 strains investigated, three of which in the early and middle phases caused synonymous mutation, and another two base sites variation in the late phase resulted in the amino acid substitutions and secondary structure changes. The three-dimensional structure of the nsp2 protein was successfully constructed. The results suggest that polymerase nsp2 is relatively stable during the phase of epidemic. The amino acid and secondary structure change may be important for viral infection. The fact that majority of single nucleotide variations (SNVs) are predicted to cause synonymous, as well as the result of low mutation rate of nsp2 gene in the epidemic variations, indicates that the nsp2 is conservative and could be a target for anti-SARS drugs. The three-dimensional structure result indicates that the nsp2 protein of GD strain is high homologous with 3CL(pro) of SARS-CoV urbani strain, 3CL(pro) of transmissible gastroenteritis virus and 3CL(pro) of human coronavirus 229E strain, which further suggests that nsp2 protein of GD strain possesses the activity of 3CL(pro).

  3. In silico structural analysis of group 3, 6 and 9 allergens from Dermatophagoides farinae.

    PubMed

    Teng, Feixiang; Yu, Lili; Bian, Yonghua; Sun, Jinxia; Wu, Juansong; Ling, Cunbao; Yang, Li; Wang, Yungang; Cui, Yubao

    2015-05-01

    Dermatophagoides farinae (Hughes; Acari: Pyroglyphidae) are the predominant source of dust mite allergens, which provoke allergic diseases, such as rhinitis, asthma and eczema. Of the 30 allergen groups produced by D. farinae, the Der f 3, Der f 6 and Der f 9 allergens are all trypsin‑associated proteins, however little else is currently known about them. The present study used in silico tools to compare the amino acid sequences, and predict the secondary and tertiary structures of Der f 3, Der f 6 and Der f 9 allergens. Protein sequence alignment detected ~46% identity between Der f 3, Der f 6 and Der f 9. Furthermore, each protein was shown to contain three active sites and two highly conserved trypsin functional domains. Predictions of the secondary and tertiary structure identified α‑helices, β‑sheets and random coils. The active sites of the three proteins appeared to fold onto each other in a three‑dimensional model, constituting the active site of the enzyme. Epitope analysis demonstrated that Der f 3, Der f 6 and Der f 9 have 4‑5 potential epitopes located in random coils, and the epitope sequences of Der f 3, Der f 6 and Der f 9 were shown to overlap in two domains (at amino acids 83‑87 and 179‑180); however the residues in these two domains were not identical. The present study aimed to conduct a biochemical and genetic analysis of these three allergens, and to potentially contribute to the development of vaccines for allergen‑specific immunotherapy.

  4. CPU-GPU hybrid accelerating the Zuker algorithm for RNA secondary structure prediction applications.

    PubMed

    Lei, Guoqing; Dou, Yong; Wan, Wen; Xia, Fei; Li, Rongchun; Ma, Meng; Zou, Dan

    2012-01-01

    Prediction of ribonucleic acid (RNA) secondary structure remains one of the most important research areas in bioinformatics. The Zuker algorithm is one of the most popular methods of free energy minimization for RNA secondary structure prediction. Thus far, few studies have been reported on the acceleration of the Zuker algorithm on general-purpose processors or on extra accelerators such as Field Programmable Gate-Array (FPGA) and Graphics Processing Units (GPU). To the best of our knowledge, no implementation combines both CPU and extra accelerators, such as GPUs, to accelerate the Zuker algorithm applications. In this paper, a CPU-GPU hybrid computing system that accelerates Zuker algorithm applications for RNA secondary structure prediction is proposed. The computing tasks are allocated between CPU and GPU for parallel cooperate execution. Performance differences between the CPU and the GPU in the task-allocation scheme are considered to obtain workload balance. To improve the hybrid system performance, the Zuker algorithm is optimally implemented with special methods for CPU and GPU architecture. Speedup of 15.93× over optimized multi-core SIMD CPU implementation and performance advantage of 16% over optimized GPU implementation are shown in the experimental results. More than 14% of the sequences are executed on CPU in the hybrid system. The system combining CPU and GPU to accelerate the Zuker algorithm is proven to be promising and can be applied to other bioinformatics applications.

  5. Predicting helix orientation for coiled-coil dimers

    PubMed Central

    Apgar, James R.; Gutwin, Karl N.; Keating, Amy E.

    2008-01-01

    The alpha-helical coiled coil is a structurally simple protein oligomerization or interaction motif consisting of two or more alpha helices twisted into a supercoiled bundle. Coiled coils can differ in their stoichiometry, helix orientation and axial alignment. Because of the near degeneracy of many of these variants, coiled coils pose a challenge to fold recognition methods for structure prediction. Whereas distinctions between some protein folds can be discriminated on the basis of hydrophobic/polar patterning or secondary structure propensities, the sequence differences that encode important details of coiled-coil structure can be subtle. This is emblematic of a larger problem in the field of protein structure and interaction prediction: that of establishing specificity between closely similar structures. We tested the behavior of different computational models on the problem of recognizing the correct orientation - parallel vs. antiparallel - of pairs of alpha helices that can form a dimeric coiled coil. For each of 131 examples of known structure, we constructed a large number of both parallel and antiparallel structural models and used these to asses the ability of five energy functions to recognize the correct fold. We also developed and tested three sequenced-based approaches that make use of varying degrees of implicit structural information. The best structural methods performed similarly to the best sequence methods, correctly categorizing ∼81% of dimers. Steric compatibility with the fold was important for some coiled coils we investigated. For many examples, the correct orientation was determined by smaller energy differences between parallel and antiparallel structures distributed over many residues and energy components. Prediction methods that used structure but incorporated varying approximations and assumptions showed quite different behaviors when used to investigate energetic contributions to orientation preference. Sequence based methods were sensitive to the choice of residue-pair interactions scored. PMID:18506779

  6. X-ray crystal structure of the passenger domain of plasmid encoded toxin(Pet), an autotransporter enterotoxin from enteroaggregative Escherichia coli (EAEC)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Domingo Meza-Aguilar, J.; Laboratorio de Patogenicidad Bacteriana, Unidad de Hemato Oncología e Investigación, Hospital Infantil de México Federico Gómez 06720, D.F.; Fromme, Petra

    Highlights: • X-ray crystal structure of the passenger domain of Plasmid encoded toxin at 2.3 Å. • Structural differences between Pet passenger domain and EspP protein are described. • High flexibility of the C-terminal beta helix is structurally assigned. - Abstract: Autotransporters (ATs) represent a superfamily of proteins produced by a variety of pathogenic bacteria, which include the pathogenic groups of Escherichia coli (E. coli) associated with gastrointestinal and urinary tract infections. We present the first X-ray structure of the passenger domain from the Plasmid-encoded toxin (Pet) a 100 kDa protein at 2.3 Å resolution which is a cause ofmore » acute diarrhea in both developing and industrialized countries. Pet is a cytoskeleton-altering toxin that induces loss of actin stress fibers. While Pet (pdb code: 4OM9) shows only a sequence identity of 50% compared to the closest related protein sequence, extracellular serine protease plasmid (EspP) the structural features of both proteins are conserved. A closer structural look reveals that Pet contains a β-pleaded sheet at the sequence region of residues 181–190, the corresponding structural domain in EspP consists of a coiled loop. Secondary, the Pet passenger domain features a more pronounced beta sheet between residues 135 and 143 compared to the structure of EspP.« less

  7. Protein Structure Prediction by Protein Threading

    NASA Astrophysics Data System (ADS)

    Xu, Ying; Liu, Zhijie; Cai, Liming; Xu, Dong

    The seminal work of Bowie, Lüthy, and Eisenberg (Bowie et al., 1991) on "the inverse protein folding problem" laid the foundation of protein structure prediction by protein threading. By using simple measures for fitness of different amino acid types to local structural environments defined in terms of solvent accessibility and protein secondary structure, the authors derived a simple and yet profoundly novel approach to assessing if a protein sequence fits well with a given protein structural fold. Their follow-up work (Elofsson et al., 1996; Fischer and Eisenberg, 1996; Fischer et al., 1996a,b) and the work by Jones, Taylor, and Thornton (Jones et al., 1992) on protein fold recognition led to the development of a new brand of powerful tools for protein structure prediction, which we now term "protein threading." These computational tools have played a key role in extending the utility of all the experimentally solved structures by X-ray crystallography and nuclear magnetic resonance (NMR), providing structural models and functional predictions for many of the proteins encoded in the hundreds of genomes that have been sequenced up to now.

  8. sup 1 H assignments and secondary structure determination of the soybean trypsin/chymotrypsin Bowman-Birk inhibitor

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Werner, M.H.; Wemmer, D.E.

    1991-04-09

    The {sup 1}H resonance assignments and secondary structure of the trypsin/chymotrypsin Bowman-Birk inhibitor from soybeans were determined by nuclear magnetic resonance spectroscopy (NMR) at 600 MHz in an 18% acetonitrile-d{sub 3}/aqueous cosolvent. Resonances from 69 to 71 amino acids were assigned sequence specifically. Residues Q11-T15 form an antiparallel {beta}-sheet with residues Q21-S25 in the tryptic inhibitory domain and an analogous region of antiparallel sheet forms between residues S38-A42 and Q48-V52 in the chymotryptic inhibitory domain. The inhibitory sites of each fragment (K16-S17 for trypsin, L43-S44 for chymotrypsin) are each part of a type VI like turn at one end ofmore » their respective region of the antiparallel {beta}-sheet. These structural elements are compared to those found in other Bowman-Birk inhibitors.« less

  9. A general method for the purification of synthetic oligodeoxyribonucleotides containing strong secondary structure by reversed-phase high-performance liquid chromatography on PRP-1 resin.

    PubMed

    Germann, M W; Pon, R T; van de Sande, J H

    1987-09-01

    Synthetic 5'-dimethoxytritylated oligodeoxyribonucleotides, which contained strong secondary structure, were satisfactorily denatured and purified by reversed-phase HPLC on PRP-1 columns when strongly alkaline conditions (0.05 M NaOH) were employed. This procedure was suitable for the purification of hairpin structures, e.g., d(CG)nT4(CG)n (n = 4, 5, 6), and oligo(dG) sequences, e.g., d(G)24, as well as oligodeoxyribonucleotide probes which contained degenerate base sites. Oligodeoxyribonucleotides as long as 50 bases in length were purified. Recovery of injected oligonucleotides was typically 90% or better. The high capacity of the PRP-1 resin also allowed purification to be performed on a preparative scale (2-8 mg per injection). Enzymatic degradation and HPLC analysis indicated that no modification of the heterocyclic bases occurred under the alkaline conditions described.

  10. Conserved and variable domains of RNase MRP RNA.

    PubMed

    Dávila López, Marcela; Rosenblad, Magnus Alm; Samuelsson, Tore

    2009-01-01

    Ribonuclease MRP is a eukaryotic ribonucleoprotein complex consisting of one RNA molecule and 7-10 protein subunits. One important function of MRP is to catalyze an endonucleolytic cleavage during processing of rRNA precursors. RNase MRP is evolutionary related to RNase P which is critical for tRNA processing. A large number of MRP RNA sequences that now are available have been used to identify conserved primary and secondary structure features of the molecule. MRP RNA has structural features in common with P RNA such as a conserved catalytic core, but it also has unique features and is characterized by a domain highly variable between species. Information regarding primary and secondary structure features is of interest not only in basic studies of the function of MRP RNA, but also because mutations in the RNA give rise to human genetic diseases such as cartilage-hair hypoplasia.

  11. Characterization of the amino acid contribution to the folding degree of proteins.

    PubMed

    Estrada, Ernesto

    2004-03-01

    The folding degree index (Estrada, Bioinformatics 2002;18:697-704) is extended to account for the contribution of amino acids to folding. First, the mathematical formalism for extending the folding degree index is presented. Then, the amino acid contributions to folding degree of several proteins are used to analyze its relation to secondary structure. The possibilities of using these contributions in helping or checking the assignation of secondary structure to amino acids are also introduced. The influence of external factors to the amino acids contribution to folding degree is studied through the temperature effect on ribonuclease A. Finally, the analysis of 3D protein similarity through the use of amino acid contributions to folding degree is studied by selecting a series of lysozymes. These results are compared to that obtained by sequence alignment (2D similarity) and 3D superposition of the structures, showing the uniqueness of the current approach. Copyright 2004 Wiley-Liss, Inc.

  12. Unraveling the meaning of chemical shifts in protein NMR.

    PubMed

    Berjanskii, Mark V; Wishart, David S

    2017-11-01

    Chemical shifts are among the most informative parameters in protein NMR. They provide wealth of information about protein secondary and tertiary structure, protein flexibility, and protein-ligand binding. In this report, we review the progress in interpreting and utilizing protein chemical shifts that has occurred over the past 25years, with a particular focus on the large body of work arising from our group and other Canadian NMR laboratories. More specifically, this review focuses on describing, assessing, and providing some historical context for various chemical shift-based methods to: (1) determine protein secondary and super-secondary structure; (2) derive protein torsion angles; (3) assess protein flexibility; (4) predict residue accessible surface area; (5) refine 3D protein structures; (6) determine 3D protein structures and (7) characterize intrinsically disordered proteins. This review also briefly covers some of the methods that we previously developed to predict chemical shifts from 3D protein structures and/or protein sequence data. It is hoped that this review will help to increase awareness of the considerable utility of NMR chemical shifts in structural biology and facilitate more widespread adoption of chemical-shift based methods by the NMR spectroscopists, structural biologists, protein biophysicists, and biochemists worldwide. This article is part of a Special Issue entitled: Biophysics in Canada, edited by Lewis Kay, John Baenziger, Albert Berghuis and Peter Tieleman. Copyright © 2017 Elsevier B.V. All rights reserved.

  13. Topological constraints are major determinants of tRNA tertiary structure and dynamics and provide basis for tertiary folding cooperativity

    PubMed Central

    Mustoe, Anthony M.; Brooks, Charles L.; Al-Hashimi, Hashim M.

    2014-01-01

    Recent studies have shown that basic steric and connectivity constraints encoded at the secondary structure level are key determinants of 3D structure and dynamics in simple two-way RNA junctions. However, the role of these topological constraints in higher order RNA junctions remains poorly understood. Here, we use a specialized coarse-grained molecular dynamics model to directly probe the thermodynamic contributions of topological constraints in defining the 3D architecture and dynamics of transfer RNA (tRNA). Topological constraints alone restrict tRNA's allowed conformational space by over an order of magnitude and strongly discriminate against formation of non-native tertiary contacts, providing a sequence independent source of folding specificity. Topological constraints also give rise to long-range correlations between the relative orientation of tRNA's helices, which in turn provides a mechanism for encoding thermodynamic cooperativity between distinct tertiary interactions. These aspects of topological constraints make it such that only several tertiary interactions are needed to confine tRNA to its native global structure and specify functionally important 3D dynamics. We further show that topological constraints are conserved across tRNA's different naturally occurring secondary structures. Taken together, our results emphasize the central role of secondary-structure-encoded topological constraints in defining RNA 3D structure, dynamics and folding. PMID:25217593

  14. Differential Targeting of Unpaired Bases within Duplex DNA by the Natural Compound Clerocidin: A Valuable Tool to Dissect DNA Secondary Structure

    PubMed Central

    Nadai, Matteo; Palù, Giorgio; Palumbo, Manlio; Richter, Sara N.

    2012-01-01

    Non-canonical DNA structures have been postulated to mediate protein-nucleic acid interactions and to function as intermediates in the generation of frame-shift mutations when errors in DNA replication occur, which result in a variety of diseases and cancers. Compounds capable of binding to non-canonical DNA conformations may thus have significant diagnostic and therapeutic potential. Clerocidin is a natural diterpenoid which has been shown to selectively react with single-stranded bases without targeting the double helix. Here we performed a comprehensive analysis on several non-canonical DNA secondary structures, namely mismatches, nicks, bulges, hairpins, with sequence variations in both the single-stranded region and the double-stranded flanking segment. By analysis of clerocidin reactivity, we were able to identify the exposed reactive residues which provided information on both the secondary structure and the accessibility of the non-paired sites. Mismatches longer than 1 base were necessary to be reached by clerocidin reactive groups, while 1-base nicks were promptly targeted by clerocidin; in hairpins, clerocidin reactivity increased with the length of the hairpin loop, while, interestingly, reactivity towards bulges reached a maximum in 3-base-long bulges and declined in longer bulges. Electrophoretic mobility shift analysis demonstrated that bulges longer than 3 bases (i.e. 5- and 7-bases) folded or stacked on the duplex region therefore being less accessible by the compound. Clerocidin thus represents a new valuable diagnostic tool to dissect DNA secondary structures. PMID:23285245

  15. Differential targeting of unpaired bases within duplex DNA by the natural compound clerocidin: a valuable tool to dissect DNA secondary structure.

    PubMed

    Nadai, Matteo; Palù, Giorgio; Palumbo, Manlio; Richter, Sara N

    2012-01-01

    Non-canonical DNA structures have been postulated to mediate protein-nucleic acid interactions and to function as intermediates in the generation of frame-shift mutations when errors in DNA replication occur, which result in a variety of diseases and cancers. Compounds capable of binding to non-canonical DNA conformations may thus have significant diagnostic and therapeutic potential. Clerocidin is a natural diterpenoid which has been shown to selectively react with single-stranded bases without targeting the double helix. Here we performed a comprehensive analysis on several non-canonical DNA secondary structures, namely mismatches, nicks, bulges, hairpins, with sequence variations in both the single-stranded region and the double-stranded flanking segment. By analysis of clerocidin reactivity, we were able to identify the exposed reactive residues which provided information on both the secondary structure and the accessibility of the non-paired sites. Mismatches longer than 1 base were necessary to be reached by clerocidin reactive groups, while 1-base nicks were promptly targeted by clerocidin; in hairpins, clerocidin reactivity increased with the length of the hairpin loop, while, interestingly, reactivity towards bulges reached a maximum in 3-base-long bulges and declined in longer bulges. Electrophoretic mobility shift analysis demonstrated that bulges longer than 3 bases (i.e. 5- and 7-bases) folded or stacked on the duplex region therefore being less accessible by the compound. Clerocidin thus represents a new valuable diagnostic tool to dissect DNA secondary structures.

  16. nextPARS: parallel probing of RNA structures in Illumina

    PubMed Central

    Saus, Ester; Willis, Jesse R.; Pryszcz, Leszek P.; Hafez, Ahmed; Llorens, Carlos; Himmelbauer, Heinz

    2018-01-01

    RNA molecules play important roles in virtually every cellular process. These functions are often mediated through the adoption of specific structures that enable RNAs to interact with other molecules. Thus, determining the secondary structures of RNAs is central to understanding their function and evolution. In recent years several sequencing-based approaches have been developed that allow probing structural features of thousands of RNA molecules present in a sample. Here, we describe nextPARS, a novel Illumina-based implementation of in vitro parallel probing of RNA structures. Our approach achieves comparable accuracy to previous implementations, while enabling higher throughput and sample multiplexing. PMID:29358234

  17. Transcription blockage by stable H-DNA analogs in vitro

    PubMed Central

    Pandey, Shristi; Ogloblina, Anna M.; Belotserkovskii, Boris P.; Dolinnaya, Nina G.; Yakubovskaya, Marianna G.; Mirkin, Sergei M.; Hanawalt, Philip C.

    2015-01-01

    DNA sequences that can form unusual secondary structures are implicated in regulating gene expression and causing genomic instability. H-palindromes are an important class of such DNA sequences that can form an intramolecular triplex structure, H-DNA. Within an H-palindrome, the H-DNA and canonical B-DNA are in a dynamic equilibrium that shifts toward H-DNA with increased negative supercoiling. The interplay between H- and B-DNA and the fact that the process of transcription affects supercoiling makes it difficult to elucidate the effects of H-DNA upon transcription. We constructed a stable structural analog of H-DNA that cannot flip into B-DNA, and studied the effects of this structure on transcription by T7 RNA polymerase in vitro. We found multiple transcription blockage sites adjacent to and within sequences engaged in this triplex structure. Triplex-mediated transcription blockage varied significantly with changes in ambient conditions: it was exacerbated in the presence of Mn2+ or by increased concentrations of K+ and Li+. Analysis of the detailed pattern of the blockage suggests that RNA polymerase is sterically hindered by H-DNA and has difficulties in unwinding triplex DNA. The implications of these findings for the biological roles of triple-stranded DNA structures are discussed. PMID:26101261

  18. Computer-Aided Design of RNA Origami Structures.

    PubMed

    Sparvath, Steffen L; Geary, Cody W; Andersen, Ebbe S

    2017-01-01

    RNA nanostructures can be used as scaffolds to organize, combine, and control molecular functionalities, with great potential for applications in nanomedicine and synthetic biology. The single-stranded RNA origami method allows RNA nanostructures to be folded as they are transcribed by the RNA polymerase. RNA origami structures provide a stable framework that can be decorated with functional RNA elements such as riboswitches, ribozymes, interaction sites, and aptamers for binding small molecules or protein targets. The rich library of RNA structural and functional elements combined with the possibility to attach proteins through aptamer-based binding creates virtually limitless possibilities for constructing advanced RNA-based nanodevices.In this chapter we provide a detailed protocol for the single-stranded RNA origami design method using a simple 2-helix tall structure as an example. The first step involves 3D modeling of a double-crossover between two RNA double helices, followed by decoration with tertiary motifs. The second step deals with the construction of a 2D blueprint describing the secondary structure and sequence constraints that serves as the input for computer programs. In the third step, computer programs are used to design RNA sequences that are compatible with the structure, and the resulting outputs are evaluated and converted into DNA sequences to order.

  19. Molecular Phylogenetics and Systematics of the Bivalve Family Ostreidae Based on rRNA Sequence-Structure Models and Multilocus Species Tree

    PubMed Central

    Salvi, Daniele; Macali, Armando; Mariottini, Paolo

    2014-01-01

    The bivalve family Ostreidae has a worldwide distribution and includes species of high economic importance. Phylogenetics and systematic of oysters based on morphology have proved difficult because of their high phenotypic plasticity. In this study we explore the phylogenetic information of the DNA sequence and secondary structure of the nuclear, fast-evolving, ITS2 rRNA and the mitochondrial 16S rRNA genes from the Ostreidae and we implemented a multi-locus framework based on four loci for oyster phylogenetics and systematics. Sequence-structure rRNA models aid sequence alignment and improved accuracy and nodal support of phylogenetic trees. In agreement with previous molecular studies, our phylogenetic results indicate that none of the currently recognized subfamilies, Crassostreinae, Ostreinae, and Lophinae, is monophyletic. Single gene trees based on Maximum likelihood (ML) and Bayesian (BA) methods and on sequence-structure ML were congruent with multilocus trees based on a concatenated (ML and BA) and coalescent based (BA) approaches and consistently supported three main clades: (i) Crassostrea, (ii) Saccostrea, and (iii) an Ostreinae-Lophinae lineage. Therefore, the subfamily Crassotreinae (including Crassostrea), Saccostreinae subfam. nov. (including Saccostrea and tentatively Striostrea) and Ostreinae (including Ostreinae and Lophinae taxa) are recognized. Based on phylogenetic and biogeographical evidence the Asian species of Crassostrea from the Pacific Ocean are assigned to Magallana gen. nov., whereas an integrative taxonomic revision is required for the genera Ostrea and Dendostrea. This study pointed out the suitability of the ITS2 marker for DNA barcoding of oyster and the relevance of using sequence-structure rRNA models and features of the ITS2 folding in molecular phylogenetics and taxonomy. The multilocus approach allowed inferring a robust phylogeny of Ostreidae providing a broad molecular perspective on their systematics. PMID:25250663

  20. Molecular phylogenetics and systematics of the bivalve family Ostreidae based on rRNA sequence-structure models and multilocus species tree.

    PubMed

    Salvi, Daniele; Macali, Armando; Mariottini, Paolo

    2014-01-01

    The bivalve family Ostreidae has a worldwide distribution and includes species of high economic importance. Phylogenetics and systematic of oysters based on morphology have proved difficult because of their high phenotypic plasticity. In this study we explore the phylogenetic information of the DNA sequence and secondary structure of the nuclear, fast-evolving, ITS2 rRNA and the mitochondrial 16S rRNA genes from the Ostreidae and we implemented a multi-locus framework based on four loci for oyster phylogenetics and systematics. Sequence-structure rRNA models aid sequence alignment and improved accuracy and nodal support of phylogenetic trees. In agreement with previous molecular studies, our phylogenetic results indicate that none of the currently recognized subfamilies, Crassostreinae, Ostreinae, and Lophinae, is monophyletic. Single gene trees based on Maximum likelihood (ML) and Bayesian (BA) methods and on sequence-structure ML were congruent with multilocus trees based on a concatenated (ML and BA) and coalescent based (BA) approaches and consistently supported three main clades: (i) Crassostrea, (ii) Saccostrea, and (iii) an Ostreinae-Lophinae lineage. Therefore, the subfamily Crassostreinae (including Crassostrea), Saccostreinae subfam. nov. (including Saccostrea and tentatively Striostrea) and Ostreinae (including Ostreinae and Lophinae taxa) are recognized [corrected]. Based on phylogenetic and biogeographical evidence the Asian species of Crassostrea from the Pacific Ocean are assigned to Magallana gen. nov., whereas an integrative taxonomic revision is required for the genera Ostrea and Dendostrea. This study pointed out the suitability of the ITS2 marker for DNA barcoding of oyster and the relevance of using sequence-structure rRNA models and features of the ITS2 folding in molecular phylogenetics and taxonomy. The multilocus approach allowed inferring a robust phylogeny of Ostreidae providing a broad molecular perspective on their systematics.

  1. fRMSDPred: Predicting Local RMSD Between Structural Fragments Using Sequence Information

    DTIC Science & Technology

    2007-04-04

    machine learning approaches for estimating the RMSD value of a pair of protein fragments. These estimated fragment-level RMSD values can be used to construct the alignment, assess the quality of an alignment, and identify high-quality alignment segments. We present algorithms to solve this fragment-level RMSD prediction problem using a supervised learning framework based on support vector regression and classification that incorporates protein profiles, predicted secondary structure, effective information encoding schemes, and novel second-order pairwise exponential kernel

  2. Phylogenetic Analysis of Myobia musculi (Schranck, 1781) by Using the 18S Small Ribosomal Subunit Sequence

    PubMed Central

    Feldman, Sanford H; Ntenda, Abraham M

    2011-01-01

    We used high-fidelity PCR to amplify 2 overlapping regions of the ribosomal gene complex from the rodent fur mite Myobia musculi. The amplicons encompassed a large portion of the mite's ribosomal gene complex spanning 3128 nucleotides containing the entire 18S rRNA, internal transcribed spacer (ITS) 1, 5.8S rRNA, ITS2, and a portion of the 5′-end of the 28S rRNA. M. musculi’s 179-nucleotide 5.8S rRNA nucleotide sequence was not conserved, so this region was identified by conservation of rRNA secondary structure. Maximum likelihood and Bayesian inference phylogenetic analyses were performed by using multiple sequence alignment consisting of 1524 nucleotides of M. musculi 18S rRNA and homologous sequences from 42 prostigmatid mites and the tick Dermacentor andersoni. The phylograms produced by both methods were in agreement regarding terminal, secondary, and some tertiary phylogenetic relationships among mites. Bayesian inference discriminated most infraordinal relationships between Eleutherengona and Parasitengona mites in the suborder Anystina. Basal relationships between suborders Anystina and Eupodina historically determined by comparing differences in anatomic characteristics were less well-supported by our molecular analysis. Our results recapitulated similar 18S rRNA sequence analyses recently reported. Our study supports M. musculi as belonging to the suborder Anystina, infraorder Eleutherenona, and superfamily Cheyletoidea. PMID:22330574

  3. Re-examination of population structure and phylogeography of hawksbill turtles in the wider Caribbean using longer mtDNA sequences.

    PubMed

    Leroux, Robin A; Dutton, Peter H; Abreu-Grobois, F Alberto; Lagueux, Cynthia J; Campbell, Cathi L; Delcroix, Eric; Chevalier, Johan; Horrocks, Julia A; Hillis-Starr, Zandy; Troëng, Sebastian; Harrison, Emma; Stapleton, Seth

    2012-01-01

    Management of the critically endangered hawksbill turtle in the Wider Caribbean (WC) has been hampered by knowledge gaps regarding stock structure. We carried out a comprehensive stock structure re-assessment of 11 WC hawksbill rookeries using longer mtDNA sequences, larger sample sizes (N = 647), and additional rookeries compared to previous surveys. Additional variation detected by 740 bp sequences between populations allowed us to differentiate populations such as Barbados-Windward and Guadeloupe (F (st) = 0.683, P < 0.05) that appeared genetically indistinguishable based on shorter 380 bp sequences. POWSIM analysis showed that longer sequences improved power to detect population structure and that when N < 30, increasing the variation detected was as effective in increasing power as increasing sample size. Geographic patterns of genetic variation suggest a model of periodic long-distance colonization coupled with region-wide dispersal and subsequent secondary contact within the WC. Mismatch analysis results for individual clades suggest a general population expansion in the WC following a historic bottleneck about 100 000-300 000 years ago. We estimated an effective female population size (N (ef)) of 6000-9000 for the WC, similar to the current estimated numbers of breeding females, highlighting the importance of these regional rookeries to maintaining genetic diversity in hawksbills. Our results provide a basis for standardizing future work to 740 bp sequence reads and establish a more complete baseline for determining stock boundaries in this migratory marine species. Finally, our findings illustrate the value of maintaining an archive of specimens for re-analysis as new markers become available.

  4. Identification of a new Apscaviroid from Japanese persimmon.

    PubMed

    Nakaune, Ryoji; Nakano, Masaaki

    2008-01-01

    Three viroid-like sequences were detected from Japanese persimmon (Diospyrus kaki Thunb.) by RT-PCR using primers specific for members of the genus Apscaviroid. Based on the sequences, we determined the complete genomic sequences. Two had 92.1-94.3% sequence identity with citrus viroid OS (CVd-OS) and 91.4-96.3% identity with apple fruit crinkle viroid (AFCVd), respectively. Another one, tentatively named persimmon viroid (PVd), had 396 nucleotides and less than 70% sequence identity with known viroids. The secondary structure of PVd is proposed to be rod-like with extensive base pairing and contains the terminal conserved region and the central conserved region characteristic of the genus Apscaviroid. Moreover, we confirmed that the viroids, including PVd, are graft transmissible from persimmon to persimmon and that persimmon is a natural host of these viroids. According to its molecular and biological properties, PVd should be considered a member of a new species in the genus Apscaviroid.

  5. FPGA accelerator for protein secondary structure prediction based on the GOR algorithm

    PubMed Central

    2011-01-01

    Background Protein is an important molecule that performs a wide range of functions in biological systems. Recently, the protein folding attracts much more attention since the function of protein can be generally derived from its molecular structure. The GOR algorithm is one of the most successful computational methods and has been widely used as an efficient analysis tool to predict secondary structure from protein sequence. However, the execution time is still intolerable with the steep growth in protein database. Recently, FPGA chips have emerged as one promising application accelerator to accelerate bioinformatics algorithms by exploiting fine-grained custom design. Results In this paper, we propose a complete fine-grained parallel hardware implementation on FPGA to accelerate the GOR-IV package for 2D protein structure prediction. To improve computing efficiency, we partition the parameter table into small segments and access them in parallel. We aggressively exploit data reuse schemes to minimize the need for loading data from external memory. The whole computation structure is carefully pipelined to overlap the sequence loading, computing and back-writing operations as much as possible. We implemented a complete GOR desktop system based on an FPGA chip XC5VLX330. Conclusions The experimental results show a speedup factor of more than 430x over the original GOR-IV version and 110x speedup over the optimized version with multi-thread SIMD implementation running on a PC platform with AMD Phenom 9650 Quad CPU for 2D protein structure prediction. However, the power consumption is only about 30% of that of current general-propose CPUs. PMID:21342582

  6. Phylogenetic Reconstruction of the Calosphaeriales and Togniniales Using Five Genes and Predicted RNA Secondary Structures of ITS, and Flabellascus tenuirostris gen. et sp. nov.

    PubMed Central

    Réblová, Martina; Jaklitsch, Walter M.; Réblová, Kamila; Štěpánek, Václav

    2015-01-01

    The Calosphaeriales is revisited with new collection data, living cultures, morphological studies of ascoma centrum, secondary structures of the internal transcribed spacer (ITS) rDNA and phylogeny based on novel DNA sequences of five nuclear ribosomal and protein-coding loci. Morphological features, molecular evidence and information from predicted RNA secondary structures of ITS converged upon robust phylogenies of the Calosphaeriales and Togniniales. The current concept of the Calosphaeriales includes the Calosphaeriaceae and Pleurostomataceae encompassing five monophyletic genera, Calosphaeria, Flabellascus gen. nov., Jattaea, Pleurostoma and Togniniella, strongly supported by Bayesian and Maximum Likelihood methods. The structural elements of ITS1 form characteristic patterns that are phylogenetically conserved, corroborate observations based on morphology and have a high predictive value at the generic level. Three major clades containing 44 species of Phaeoacremonium were recovered in the closely related Togniniales based on ITS, actin and β-tubulin sequences. They are newly characterized by sexual and RNA structural characters and ecology. This approach is a first step towards understanding of the molecular systematics of Phaeoacremonium and possibly its new classification. In the Calosphaeriales, Jattaea aphanospora sp. nov. and J. ribicola sp. nov. are introduced, Calosphaeria taediosa is combined in Jattaea and epitypified. The sexual morph of Phaeoacremonium cinereum was encountered for the first time on decaying wood and obtained in vitro. In order to achieve a single nomenclature, the genera of asexual morphs linked with the Calosphaeriales are transferred to synonymy of their sexual morphs following the principle of priority, i.e. Calosphaeriophora to Calosphaeria, Phaeocrella to Togniniella and Pleurostomophora to Pleurostoma. Three new combinations are proposed, i.e. Pleurostoma ochraceum comb. nov., P. repens comb. nov. and P. richardsiae comb. nov. The morphology-based key is provided to facilitate identification of genera accepted in the Calosphaeriales. PMID:26699541

  7. [Isolation and structural elucidation of secondary metabolites from marine Streptomyces sp. SCSIO 1934].

    PubMed

    Niu, Siwen; Li, Sumei; Tian, Xinpeng; Hu, Tao; Ju, Jianhua; Ynag, Xiaohong; Zhang, Si; Zhang, Changsheng

    2011-07-01

    Marine Actinobacteria are emerging as new resources for bioactive natural products with promise in novel drug discovery. In recent years, the richness and diversity of marine Actinobacteria from the South China Sea and their ability in producing bioactive products have been investigated. The objective of this work is to isolate and identify bioactive secondary metabolites from a marine actinobacterium SCSIO 1934 derived from sediments of South China Sea. The strain was identified as a Streptomyces spieces by analyzing its 16S rDNA sequence. Streptomyces sp. SCSIO 1934 was fermented under optimized conditions and seven bioactive secondary metabolites were isolated and purified by chromatographic methods including colum chromatography over silica gel and Sephadex LH-20. Their structures were elucidated as 17-O-demethylgeldanamycin (1), lebstatin (2), 17-O-demethyllebstatin (3), nigericin (4), nigericin sodium salt (5), abierixin (6), respectively, by detailed NMR spectroscopic data (1H, 13C, COSY, HSQC and HMBC). This work provided a new marine actinobacterium Streptomyces sp. SCSIO 1934, capable of producing diverse bioactive natural products.

  8. Towards Long-Range RNA Structure Prediction in Eukaryotic Genes.

    PubMed

    Pervouchine, Dmitri D

    2018-06-15

    The ability to form an intramolecular structure plays a fundamental role in eukaryotic RNA biogenesis. Proximate regions in the primary transcripts fold into a local secondary structure, which is then hierarchically assembled into a tertiary structure that is stabilized by RNA-binding proteins and long-range intramolecular base pairings. While the local RNA structure can be predicted reasonably well for short sequences, long-range structure at the scale of eukaryotic genes remains problematic from the computational standpoint. The aim of this review is to list functional examples of long-range RNA structures, to summarize current comparative methods of structure prediction, and to highlight their advances and limitations in the context of long-range RNA structures. Most comparative methods implement the “first-align-then-fold” principle, i.e., they operate on multiple sequence alignments, while functional RNA structures often reside in non-conserved parts of the primary transcripts. The opposite “first-fold-then-align” approach is currently explored to a much lesser extent. Developing novel methods in both directions will improve the performance of comparative RNA structure analysis and help discover novel long-range structures, their higher-order organization, and RNA⁻RNA interactions across the transcriptome.

  9. Search for 5'-leader regulatory RNA structures based on gene annotation aided by the RiboGap database.

    PubMed

    Naghdi, Mohammad Reza; Smail, Katia; Wang, Joy X; Wade, Fallou; Breaker, Ronald R; Perreault, Jonathan

    2017-03-15

    The discovery of noncoding RNAs (ncRNAs) and their importance for gene regulation led us to develop bioinformatics tools to pursue the discovery of novel ncRNAs. Finding ncRNAs de novo is challenging, first due to the difficulty of retrieving large numbers of sequences for given gene activities, and second due to exponential demands on calculation needed for comparative genomics on a large scale. Recently, several tools for the prediction of conserved RNA secondary structure were developed, but many of them are not designed to uncover new ncRNAs, or are too slow for conducting analyses on a large scale. Here we present various approaches using the database RiboGap as a primary tool for finding known ncRNAs and for uncovering simple sequence motifs with regulatory roles. This database also can be used to easily extract intergenic sequences of eubacteria and archaea to find conserved RNA structures upstream of given genes. We also show how to extend analysis further to choose the best candidate ncRNAs for experimental validation. Copyright © 2017 Elsevier Inc. All rights reserved.

  10. The yeast Pif1 helicase prevents genomic instability caused by G-quadruplex-forming CEB1 sequences in vivo.

    PubMed

    Ribeyre, Cyril; Lopes, Judith; Boulé, Jean-Baptiste; Piazza, Aurèle; Guédin, Aurore; Zakian, Virginia A; Mergny, Jean-Louis; Nicolas, Alain

    2009-05-01

    In budding yeast, the Pif1 DNA helicase is involved in the maintenance of both nuclear and mitochondrial genomes, but its role in these processes is still poorly understood. Here, we provide evidence for a new Pif1 function by demonstrating that its absence promotes genetic instability of alleles of the G-rich human minisatellite CEB1 inserted in the Saccharomyces cerevisiae genome, but not of other tandem repeats. Inactivation of other DNA helicases, including Sgs1, had no effect on CEB1 stability. In vitro, we show that CEB1 repeats formed stable G-quadruplex (G4) secondary structures and the Pif1 protein unwinds these structures more efficiently than regular B-DNA. Finally, synthetic CEB1 arrays in which we mutated the potential G4-forming sequences were no longer destabilized in pif1Delta cells. Hence, we conclude that CEB1 instability in pif1Delta cells depends on the potential to form G-quadruplex structures, suggesting that Pif1 could play a role in the metabolism of G4-forming sequences.

  11. Interaction of the p85 subunit of PI 3-kinase and its N-terminal SH2 domain with a PDGF receptor phosphorylation site: structural features and analysis of conformational changes.

    PubMed Central

    Panayotou, G; Bax, B; Gout, I; Federwisch, M; Wroblowski, B; Dhand, R; Fry, M J; Blundell, T L; Wollmer, A; Waterfield, M D

    1992-01-01

    Circular dichroism and fluorescence spectroscopy were used to investigate the structure of the p85 alpha subunit of the PI 3-kinase, a closely related p85 beta protein, and a recombinant SH2 domain-containing fragment of p85 alpha. Significant spectral changes, indicative of a conformational change, were observed on formation of a complex with a 17 residue peptide containing a phosphorylated tyrosine residue. The sequence of this peptide is identical to the sequence surrounding Tyr751 in the kinase-insert region of the platelet-derived growth factor beta-receptor (beta PDGFR). The rotational correlation times measured by fluorescence anisotropy decay indicated that phosphopeptide binding changed the shape of the SH2 domain-containing fragment. The CD and fluorescence spectroscopy data support the secondary structure prediction based on sequence analysis and provide evidence for flexible linker regions between the various domains of the p85 proteins. The significance of these results for SH2 domain-containing proteins is discussed. Images PMID:1330535

  12. A Three-Dimensional Approach and Open Source Structure for the Design and Experimentation of Teaching-Learning Sequences: The case of friction

    NASA Astrophysics Data System (ADS)

    Besson, Ugo; Borghi, Lidia; De Ambrosis, Anna; Mascheretti, Paolo

    2010-07-01

    We have developed a teaching-learning sequence (TLS) on friction based on a preliminary study involving three dimensions: an analysis of didactic research on the topic, an overview of usual approaches, and a critical analysis of the subject, considered also in its historical development. We found that mostly the usual presentations do not take into account the complexity of friction as it emerges from scientific research, may reinforce some inaccurate students' conceptions, and favour a limited vision of friction phenomena. The TLS we propose begins by considering a wide range of friction phenomena to favour an initial motivation and a broader view of the topic and then develops a path of interrelated observations, experiments, and theoretical aspects. It proposes the use of structural models, involving visual representations and stimulating intuition, aimed at helping students build mental models of friction mechanisms. To facilitate the reproducibility in school contexts, the sequence is designed as an open source structure, with a core of contents, conceptual correlations and methodological choices, and a cloud of elements that can be re-designed by teachers. The sequence has been tested in teacher education and in upper secondary school, and has shown positive results in overcoming student difficulties and stimulating richer reasoning based on the structural models we suggested. The proposed path has modified the teachers' view of the topic, producing a motivation to change their traditional presentations. The open structure of the sequence has facilitated its implementation by teachers in school in coherence with the rationale of the proposal.

  13. Effect of Anions on Nanofiber Formation of β-sheet Propensity Amphiphile Peptide

    NASA Astrophysics Data System (ADS)

    Shamsudeen, H.; Tan, H. L.; Eshak, Z.

    2018-05-01

    Peptide self-assembly forms different nanostructures under simple alteration in the solution environment. Understanding the mechanism of the assembly will help us to control and tailor functional nanomaterials. This study aims to investigate the influence of anions on the self-assembly morphology and shape using a synthetic peptide of FFFFKK. Circular Dichoism (CD) and Environmental Scanning Electron Microscope (ESEM) were used to determine the secondary structure and self-assembly morphology, while Image J imaging software was used to measure diameter size. In the absence of anion, FFFFKK formed anti-parallel β-sheet that adopted sizeable fibrillar structure with a minimal increment over the first 7 hours of assembly. Irregular structure was observed in the presence of Iodide ion (I-) with a less stable secondary structure such as β-turn and β-loop. In the presence of perchlorate ion (ClO4 -), needle-like structure was observed with predominantly β-sheet structure. Our study showed that peptide morphology can be controlled by using different anions with careful selection of amino acid residues in peptide sequence.

  14. Substrate-bound outward-open state of the betaine transporter BetP provides insights into Na+ coupling

    NASA Astrophysics Data System (ADS)

    Perez, Camilo; Faust, Belinda; Mehdipour, Ahmad Reza; Francesconi, Kevin A.; Forrest, Lucy R.; Ziegler, Christine

    2014-07-01

    The Na+-coupled betaine symporter BetP shares a highly conserved fold with other sequence unrelated secondary transporters, for example, with neurotransmitter symporters. Recently, we obtained atomic structures of BetP in distinct conformational states, which elucidated parts of its alternating-access mechanism. Here, we report a structure of BetP in a new outward-open state in complex with an anomalous scattering substrate, adding a fundamental piece to an unprecedented set of structural snapshots for a secondary transporter. In combination with molecular dynamics simulations these structural data highlight important features of the sequential formation of the substrate and sodium-binding sites, in which coordinating water molecules play a crucial role. We observe a strictly interdependent binding of betaine and sodium ions during the coupling process. All three sites undergo progressive reshaping and dehydration during the alternating-access cycle, with the most optimal coordination of all substrates found in the closed state.

  15. Exploring the Sequence-based Prediction of Folding Initiation Sites in Proteins.

    PubMed

    Raimondi, Daniele; Orlando, Gabriele; Pancsa, Rita; Khan, Taushif; Vranken, Wim F

    2017-08-18

    Protein folding is a complex process that can lead to disease when it fails. Especially poorly understood are the very early stages of protein folding, which are likely defined by intrinsic local interactions between amino acids close to each other in the protein sequence. We here present EFoldMine, a method that predicts, from the primary amino acid sequence of a protein, which amino acids are likely involved in early folding events. The method is based on early folding data from hydrogen deuterium exchange (HDX) data from NMR pulsed labelling experiments, and uses backbone and sidechain dynamics as well as secondary structure propensities as features. The EFoldMine predictions give insights into the folding process, as illustrated by a qualitative comparison with independent experimental observations. Furthermore, on a quantitative proteome scale, the predicted early folding residues tend to become the residues that interact the most in the folded structure, and they are often residues that display evolutionary covariation. The connection of the EFoldMine predictions with both folding pathway data and the folded protein structure suggests that the initial statistical behavior of the protein chain with respect to local structure formation has a lasting effect on its subsequent states.

  16. Critical Features of Fragment Libraries for Protein Structure Prediction

    PubMed Central

    dos Santos, Karina Baptista

    2017-01-01

    The use of fragment libraries is a popular approach among protein structure prediction methods and has proven to substantially improve the quality of predicted structures. However, some vital aspects of a fragment library that influence the accuracy of modeling a native structure remain to be determined. This study investigates some of these features. Particularly, we analyze the effect of using secondary structure prediction guiding fragments selection, different fragments sizes and the effect of structural clustering of fragments within libraries. To have a clearer view of how these factors affect protein structure prediction, we isolated the process of model building by fragment assembly from some common limitations associated with prediction methods, e.g., imprecise energy functions and optimization algorithms, by employing an exact structure-based objective function under a greedy algorithm. Our results indicate that shorter fragments reproduce the native structure more accurately than the longer. Libraries composed of multiple fragment lengths generate even better structures, where longer fragments show to be more useful at the beginning of the simulations. The use of many different fragment sizes shows little improvement when compared to predictions carried out with libraries that comprise only three different fragment sizes. Models obtained from libraries built using only sequence similarity are, on average, better than those built with a secondary structure prediction bias. However, we found that the use of secondary structure prediction allows greater reduction of the search space, which is invaluable for prediction methods. The results of this study can be critical guidelines for the use of fragment libraries in protein structure prediction. PMID:28085928

  17. Critical Features of Fragment Libraries for Protein Structure Prediction.

    PubMed

    Trevizani, Raphael; Custódio, Fábio Lima; Dos Santos, Karina Baptista; Dardenne, Laurent Emmanuel

    2017-01-01

    The use of fragment libraries is a popular approach among protein structure prediction methods and has proven to substantially improve the quality of predicted structures. However, some vital aspects of a fragment library that influence the accuracy of modeling a native structure remain to be determined. This study investigates some of these features. Particularly, we analyze the effect of using secondary structure prediction guiding fragments selection, different fragments sizes and the effect of structural clustering of fragments within libraries. To have a clearer view of how these factors affect protein structure prediction, we isolated the process of model building by fragment assembly from some common limitations associated with prediction methods, e.g., imprecise energy functions and optimization algorithms, by employing an exact structure-based objective function under a greedy algorithm. Our results indicate that shorter fragments reproduce the native structure more accurately than the longer. Libraries composed of multiple fragment lengths generate even better structures, where longer fragments show to be more useful at the beginning of the simulations. The use of many different fragment sizes shows little improvement when compared to predictions carried out with libraries that comprise only three different fragment sizes. Models obtained from libraries built using only sequence similarity are, on average, better than those built with a secondary structure prediction bias. However, we found that the use of secondary structure prediction allows greater reduction of the search space, which is invaluable for prediction methods. The results of this study can be critical guidelines for the use of fragment libraries in protein structure prediction.

  18. Distinct population structure for co-occurring Anopheles goeldii and Anopheles triannulatus in Amazonian Brazil

    PubMed Central

    McKeon, Sascha Naomi; Moreno, Marta; Sallum, Maria Anise; Povoa, Marinete Marins; Conn, Jan Evelyn

    2013-01-01

    To evaluate whether environmental heterogeneity contributes to the genetic heterogeneity in Anopheles triannulatus, larval habitat characteristics across the Brazilian states of Roraima and Pará and genetic sequences were examined. A comparison with Anopheles goeldii was utilised to determine whether high genetic diversity was unique to An. triannulatus. Student t test and analysis of variance found no differences in habitat characteristics between the species. Analysis of population structure of An. triannulatus and An. goeldii revealed distinct demographic histories in a largely overlapping geographic range. Cytochrome oxidase I sequence parsimony networks found geographic clustering for both species; however nuclear marker networks depicted An. triannulatus with a more complex history of fragmentation, secondary contact and recent divergence. Evidence of Pleistocene expansions suggests both species are more likely to be genetically structured by geographic and ecological barriers than demography. We hypothesise that niche partitioning is a driving force for diversity, particularly in An. triannulatus. PMID:23903977

  19. Protein denaturation in vacuo: intrinsic unfolding pathways associated with the native tertiary structure of lysozyme

    NASA Astrophysics Data System (ADS)

    Arteca, Gustavo A.; Tapia, O.

    Using computer-simulated molecular dynamics, we study the effect of sequence mutation on the unfolding mechanism of a native fold. The system considered is the native fold of hen egg-white lysozyme, exposed to centrifugal unfolding in vacuo. This unfolding bias elicits configurational transitions that imitate the behaviour of anhydrous proteins diffusing after electrospraying from neutral-pH solutions. By changing the sequences threaded onto the native fold of lysozyme, we probe the role of disulfide bridges and the effect of a global mutation. We find that the initial denaturing steps share common characteristics for the tested sequences. Recurrent features are: (i) the presence of dumbbell conformers with significant residual secondary structure, (ii) the ubiquitous formation of hairpins and two-stranded β-sheets regardless of disulfide bridges, and (iii) an unfolding pattern where the reduction in folding complexity is highly correlated with the decrease in chain compactness. These findings appear to be intrinsic to the shape of the native fold, suggesting that similar unfolding pathways may be accessible to many protein sequences.

  20. A Multidimensional Strategy to Detect Polypharmacological Targets in the Absence of Structural and Sequence Homology

    PubMed Central

    Durrant, Jacob D.; Amaro, Rommie E.; Xie, Lei; Urbaniak, Michael D.; Ferguson, Michael A. J.; Haapalainen, Antti; Chen, Zhijun; Di Guilmi, Anne Marie; Wunder, Frank; Bourne, Philip E.; McCammon, J. Andrew

    2010-01-01

    Conventional drug design embraces the “one gene, one drug, one disease” philosophy. Polypharmacology, which focuses on multi-target drugs, has emerged as a new paradigm in drug discovery. The rational design of drugs that act via polypharmacological mechanisms can produce compounds that exhibit increased therapeutic potency and against which resistance is less likely to develop. Additionally, identifying multiple protein targets is also critical for side-effect prediction. One third of potential therapeutic compounds fail in clinical trials or are later removed from the market due to unacceptable side effects often caused by off-target binding. In the current work, we introduce a multidimensional strategy for the identification of secondary targets of known small-molecule inhibitors in the absence of global structural and sequence homology with the primary target protein. To demonstrate the utility of the strategy, we identify several targets of 4,5-dihydroxy-3-(1-naphthyldiazenyl)-2,7-naphthalenedisulfonic acid, a known micromolar inhibitor of Trypanosoma brucei RNA editing ligase 1. As it is capable of identifying potential secondary targets, the strategy described here may play a useful role in future efforts to reduce drug side effects and/or to increase polypharmacology. PMID:20098496

  1. XML schemas for common bioinformatic data types and their application in workflow systems.

    PubMed

    Seibel, Philipp N; Krüger, Jan; Hartmeier, Sven; Schwarzer, Knut; Löwenthal, Kai; Mersch, Henning; Dandekar, Thomas; Giegerich, Robert

    2006-11-06

    Today, there is a growing need in bioinformatics to combine available software tools into chains, thus building complex applications from existing single-task tools. To create such workflows, the tools involved have to be able to work with each other's data--therefore, a common set of well-defined data formats is needed. Unfortunately, current bioinformatic tools use a great variety of heterogeneous formats. Acknowledging the need for common formats, the Helmholtz Open BioInformatics Technology network (HOBIT) identified several basic data types used in bioinformatics and developed appropriate format descriptions, formally defined by XML schemas, and incorporated them in a Java library (BioDOM). These schemas currently cover sequence, sequence alignment, RNA secondary structure and RNA secondary structure alignment formats in a form that is independent of any specific program, thus enabling seamless interoperation of different tools. All XML formats are available at http://bioschemas.sourceforge.net, the BioDOM library can be obtained at http://biodom.sourceforge.net. The HOBIT XML schemas and the BioDOM library simplify adding XML support to newly created and existing bioinformatic tools, enabling these tools to interoperate seamlessly in workflow scenarios.

  2. Robust Translation of the Nucleoid Protein Fis Requires a Remote Upstream AU Element and Is Enhanced by RNA Secondary Structure

    PubMed Central

    Nafissi, Maryam; Chau, Jeannette; Xu, Jimin

    2012-01-01

    Synthesis of the Fis nucleoid protein rapidly increases in response to nutrient upshifts, and Fis is one of the most abundant DNA binding proteins in Escherichia coli under nutrient-rich growth conditions. Previous work has shown that control of Fis synthesis occurs at transcription initiation of the dusB-fis operon. We show here that while translation of the dihydrouridine synthase gene dusB is low, unusual mechanisms operate to enable robust translation of fis. At least two RNA sequence elements located within the dusB coding region are responsible for high fis translation. The most important is an AU element centered 35 nucleotides (nt) upstream of the fis AUG, which may function as a binding site for ribosomal protein S1. In addition, a 44-nt segment located upstream of the AU element and predicted to form a stem-loop secondary structure plays a prominent role in enhancing fis translation. On the other hand, mutations close to the AUG, including over a potential Shine-Dalgarno sequence, have little effect on Fis protein levels. The AU element and stem-loop regions are phylogenetically conserved within dusB-fis operons of representative enteric bacteria. PMID:22389479

  3. Chromosomal translocations and palindromic AT-rich repeats

    PubMed Central

    Kato, Takema; Kurahashi, Hiroki; Emanuel1, Beverly S.

    2012-01-01

    Repetitive DNA sequences constitute 30% of the human genome, and are often sites of genomic rearrangement. Recently, it has been found that several constitutional translocations, especially those that involve chromosome 22, take place utilizing palindromic sequences on 22q11 and on the partner chromosome. Analysis of translocation junction fragments shows that the breakpoints of such palindrome-mediated translocations are localized at the center of palindromic AT-rich repeats (PATRRs). The presence of PATRRs at the breakpoints, indicates a palindrome-mediated mechanism involved in the generation of these constitutional translocations. Identification of these PATRR-mediated translocations suggests a universal pathway for gross chromosomal rearrangement in the human genome. De novo occurrences of PATRR-mediated translocations can be detected by PCR in normal sperm samples but not somatic cells. Polymorphisms of various PATRRs influence their propensity for adopting a secondary structure, which in turn affects de novo translocation frequency. We propose that the PATRRs form an unstable secondary structure, which leads to double-strand breaks at the center of the PATRR. The double-strand breaks appear to be followed by a non-homologous end-joining repair pathway, ultimately leading to the translocations. This review considers recent findings concerning the mechanism of meiosis-specific, PATRR-mediated translocations. PMID:22402448

  4. Predicting the transmembrane secondary structure of ligand-gated ion channels.

    PubMed

    Bertaccini, E; Trudell, J R

    2002-06-01

    Recent mutational analyses of ligand-gated ion channels (LGICs) have demonstrated a plausible site of anesthetic action within their transmembrane domains. Although there is a consensus that the transmembrane domain is formed from four membrane-spanning segments, the secondary structure of these segments is not known. We utilized 10 state-of-the-art bioinformatics techniques to predict the transmembrane topology of the tetrameric regions within six members of the LGIC family that are relevant to anesthetic action. They are the human forms of the GABA alpha 1 receptor, the glycine alpha 1 receptor, the 5HT3 serotonin receptor, the nicotinic AChR alpha 4 and alpha 7 receptors and the Torpedo nAChR alpha 1 receptor. The algorithms utilized were HMMTOP, TMHMM, TMPred, PHDhtm, DAS, TMFinder, SOSUI, TMAP, MEMSAT and TOPPred2. The resulting predictions were superimposed on to a multiple sequence alignment of the six amino acid sequences created using the CLUSTAL W algorithm. There was a clear statistical consensus for the presence of four alpha helices in those regions experimentally thought to span the membrane. The consensus of 10 topology prediction techniques supports the hypothesis that the transmembrane subunits of the LGICs are tetrameric bundles of alpha helices.

  5. A multidimensional strategy to detect polypharmacological targets in the absence of structural and sequence homology.

    PubMed

    Durrant, Jacob D; Amaro, Rommie E; Xie, Lei; Urbaniak, Michael D; Ferguson, Michael A J; Haapalainen, Antti; Chen, Zhijun; Di Guilmi, Anne Marie; Wunder, Frank; Bourne, Philip E; McCammon, J Andrew

    2010-01-22

    Conventional drug design embraces the "one gene, one drug, one disease" philosophy. Polypharmacology, which focuses on multi-target drugs, has emerged as a new paradigm in drug discovery. The rational design of drugs that act via polypharmacological mechanisms can produce compounds that exhibit increased therapeutic potency and against which resistance is less likely to develop. Additionally, identifying multiple protein targets is also critical for side-effect prediction. One third of potential therapeutic compounds fail in clinical trials or are later removed from the market due to unacceptable side effects often caused by off-target binding. In the current work, we introduce a multidimensional strategy for the identification of secondary targets of known small-molecule inhibitors in the absence of global structural and sequence homology with the primary target protein. To demonstrate the utility of the strategy, we identify several targets of 4,5-dihydroxy-3-(1-naphthyldiazenyl)-2,7-naphthalenedisulfonic acid, a known micromolar inhibitor of Trypanosoma brucei RNA editing ligase 1. As it is capable of identifying potential secondary targets, the strategy described here may play a useful role in future efforts to reduce drug side effects and/or to increase polypharmacology.

  6. DNASynth: a software application to optimization of artificial gene synthesis

    NASA Astrophysics Data System (ADS)

    Muczyński, Jan; Nowak, Robert M.

    2017-08-01

    DNASynth is a client-server software application in which the client runs in a web browser. The aim of this program is to support and optimize process of artificial gene synthesizing using Ligase Chain Reaction. Thanks to LCR it is possible to obtain DNA strand coding defined by user peptide. The DNA sequence is calculated by optimization algorithm that consider optimal codon usage, minimal energy of secondary structures and minimal number of required LCR. Additionally absence of sequences characteristic for defined by user set of restriction enzymes is guaranteed. The presented software was tested on synthetic and real data.

  7. Protein functional features are reflected in the patterns of mRNA translation speed.

    PubMed

    López, Daniel; Pazos, Florencio

    2015-07-09

    The degeneracy of the genetic code makes it possible for the same amino acid string to be coded by different messenger RNA (mRNA) sequences. These "synonymous mRNAs" may differ largely in a number of aspects related to their overall translational efficiency, such as secondary structure content and availability of the encoded transfer RNAs (tRNAs). Consequently, they may render different yields of the translated polypeptides. These mRNA features related to translation efficiency are also playing a role locally, resulting in a non-uniform translation speed along the mRNA, which has been previously related to some protein structural features and also used to explain some dramatic effects of "silent" single-nucleotide-polymorphisms (SNPs). In this work we perform the first large scale analysis of the relationship between three experimental proxies of mRNA local translation efficiency and the local features of the corresponding encoded proteins. We found that a number of protein functional and structural features are reflected in the patterns of ribosome occupancy, secondary structure and tRNA availability along the mRNA. One or more of these proxies of translation speed have distinctive patterns around the mRNA regions coding for certain protein local features. In some cases the three patterns follow a similar trend. We also show specific examples where these patterns of translation speed point to the protein's important structural and functional features. This support the idea that the genome not only codes the protein functional features as sequences of amino acids, but also as subtle patterns of mRNA properties which, probably through local effects on the translation speed, have some consequence on the final polypeptide. These results open the possibility of predicting a protein's functional regions based on a single genomic sequence, and have implications for heterologous protein expression and fine-tuning protein function.

  8. Structural architecture of the human long non-coding RNA, steroid receptor RNA activator

    PubMed Central

    Novikova, Irina V.; Hennelly, Scott P.; Sanbonmatsu, Karissa Y.

    2012-01-01

    While functional roles of several long non-coding RNAs (lncRNAs) have been determined, the molecular mechanisms are not well understood. Here, we report the first experimentally derived secondary structure of a human lncRNA, the steroid receptor RNA activator (SRA), 0.87 kB in size. The SRA RNA is a non-coding RNA that coactivates several human sex hormone receptors and is strongly associated with breast cancer. Coding isoforms of SRA are also expressed to produce proteins, making the SRA gene a unique bifunctional system. Our experimental findings (SHAPE, in-line, DMS and RNase V1 probing) reveal that this lncRNA has a complex structural organization, consisting of four domains, with a variety of secondary structure elements. We examine the coevolution of the SRA gene at the RNA structure and protein structure levels using comparative sequence analysis across vertebrates. Rapid evolutionary stabilization of RNA structure, combined with frame-disrupting mutations in conserved regions, suggests that evolutionary pressure preserves the RNA structural core rather than its translational product. We perform similar experiments on alternatively spliced SRA isoforms to assess their structural features. PMID:22362738

  9. Analysis of full-length sequences of two Citrus yellow mosaic badnavirus isolates infecting Citrus jambhiri (Rough Lemon) and Citrus sinensis L. Osbeck (Sweet Orange) from a nursery in India.

    PubMed

    Anthony Johnson, A M; Borah, B K; Sai Gopal, D V R; Dasgupta, I

    2012-12-01

    Citrus yellow mosaic badna virus (CMBV), a member of the Family Caulimoviridae, Genus Badnavirus is the causative agent of mosaic disease among Citrus species in southern India. Despite its reported prevalence in several citrus species, complete information on clear functional genomics or functional information of full-length genomes from all the CMBV isolates infecting citrus species are not available in publicly accessible databases. CMBV isolates from Rough Lemon and Sweet Orange collected from a nursery were cloned and sequenced. The analysis revealed high sequence homology of the two CMBV isolates with previously reported CMBV sequences implying that they represent new variants. Based on computational analysis of the predicted secondary structures, the possible functions of some CMBV proteins have been analyzed.

  10. Cloning and bioinformatic analysis of lovastatin biosynthesis regulatory gene lovE.

    PubMed

    Huang, Xin; Li, Hao-ming

    2009-08-05

    Lovastatin is an effective drug for treatment of hyperlipidemia. This study aimed to clone lovastatin biosynthesis regulatory gene lovE and analyze the structure and function of its encoding protein. According to the lovastatin synthase gene sequence from genebank, primers were designed to amplify and clone the lovastatin biosynthesis regulatory gene lovE from Aspergillus terrus genomic DNA. Bioinformatic analysis of lovE and its encoding animo acid sequence was performed through internet resources and software like DNAMAN. Target fragment lovE, almost 1500 bp in length, was amplified from Aspergillus terrus genomic DNA and the secondary and three-dimensional structures of LovE protein were predicted. In the lovastatin biosynthesis process lovE is a regulatory gene and LovE protein is a GAL4-like transcriptional factor.

  11. Translocation and deletion breakpoints in cancer genomes are associated with potential non-B DNA-forming sequences.

    PubMed

    Bacolla, Albino; Tainer, John A; Vasquez, Karen M; Cooper, David N

    2016-07-08

    Gross chromosomal rearrangements (including translocations, deletions, insertions and duplications) are a hallmark of cancer genomes and often create oncogenic fusion genes. An obligate step in the generation of such gross rearrangements is the formation of DNA double-strand breaks (DSBs). Since the genomic distribution of rearrangement breakpoints is non-random, intrinsic cellular factors may predispose certain genomic regions to breakage. Notably, certain DNA sequences with the potential to fold into secondary structures [potential non-B DNA structures (PONDS); e.g. triplexes, quadruplexes, hairpin/cruciforms, Z-DNA and single-stranded looped-out structures with implications in DNA replication and transcription] can stimulate the formation of DNA DSBs. Here, we tested the postulate that these DNA sequences might be found at, or in close proximity to, rearrangement breakpoints. By analyzing the distribution of PONDS-forming sequences within ±500 bases of 19 947 translocation and 46 365 sequence-characterized deletion breakpoints in cancer genomes, we find significant association between PONDS-forming repeats and cancer breakpoints. Specifically, (AT)n, (GAA)n and (GAAA)n constitute the most frequent repeats at translocation breakpoints, whereas A-tracts occur preferentially at deletion breakpoints. Translocation breakpoints near PONDS-forming repeats also recur in different individuals and patient tumor samples. Hence, PONDS-forming sequences represent an intrinsic risk factor for genomic rearrangements in cancer genomes. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  12. Conservation of the sequence of the Alzheimer's disease amyloid peptide in dog, polar bear and five other mammals by cross-species polymerase chain reaction analysis.

    PubMed

    Johnstone, E M; Chaney, M O; Norris, F H; Pascual, R; Little, S P

    1991-07-01

    Neuritic plaque and cerebrovascular amyloid deposits have been detected in the aged monkey, dog, and polar bear and have rarely been found in aged rodents (Biochem. Biophy. Res. Commun., 12 (1984) 885-890; Proc. Natl. Acad. Sci. U.S.A., 82 (1985) 4245-4249). To determine if the primary structure of the 42-43 residue amyloid peptide is conserved in species that accumulate plaques, the region of the amyloid precursor protein (APP) cDNA that encodes the peptide region was amplified by the polymerase chain reaction and sequenced. The deduced amino acid sequence was compared to those species where amyloid accumulation has not been detected. The DNA sequences of dog, polar bear, rabbit, cow, sheep, pig and guinea pig were compared and a phylogenetic tree was generated. We conclude that the amino acid sequence of dog and polar bear and other mammals which may form amyloid plaques is conserved and the species where amyloid has not been detected (mouse, rat) may be evolutionarily a distinct group. In addition, the predicted secondary structure of mouse and rat amyloid that differs from that of amyloid bearing species is its lack of propensity to form a beta sheeted structure. Thus, a cross-species examination of the amyloid peptide may suggest what is essential for amyloid deposition.

  13. Remarkable sequence conservation of the last intron in the PKD1 gene.

    PubMed

    Rodova, Marianna; Islam, M Rafiq; Peterson, Kenneth R; Calvet, James P

    2003-10-01

    The last intron of the PKD1 gene (intron 45) was found to have exceptionally high sequence conservation across four mammalian species: human, mouse, rat, and dog. This conservation did not extend to the comparable intron in pufferfish. Pairwise comparisons for intron 45 showed 91% identity (human vs. dog) to 100% identity (mouse vs. rat) for an average for all four species of 94% identity. In contrast, introns 43 and 44 of the PKD1 gene had average pairwise identities of 57% and 54%, and exons 43, 44, and 45 and the coding region of exon 46 had average pairwise identities of 80%, 84%, 82%, and 80%. Intron 45 is 90 to 95 bp in length, with the major region of sequence divergence being in a central 4-bp to 9-bp variable region. RNA secondary structure analysis of intron 45 predicts a branching stem-loop structure in which the central variable region lies in one loop and the putative branch point sequence lies in another loop, suggesting that the intron adopts a specific stem-loop structure that may be important for its removal. Although intron 45 appears to conform to the class of small, G-triplet-containing introns that are spliced by a mechanism utilizing intron definition, its high sequence conservation may be a reflection of constraints imposed by a unique mechanism that coordinates splicing of this last PKD1 intron with polyadenylation.

  14. Dynamic Energy Landscapes of Riboswitches Help Interpret Conformational Rearrangements and Function

    PubMed Central

    Quarta, Giulio; Sin, Ken; Schlick, Tamar

    2012-01-01

    Riboswitches are RNAs that modulate gene expression by ligand-induced conformational changes. However, the way in which sequence dictates alternative folding pathways of gene regulation remains unclear. In this study, we compute energy landscapes, which describe the accessible secondary structures for a range of sequence lengths, to analyze the transcriptional process as a given sequence elongates to full length. In line with experimental evidence, we find that most riboswitch landscapes can be characterized by three broad classes as a function of sequence length in terms of the distribution and barrier type of the conformational clusters: low-barrier landscape with an ensemble of different conformations in equilibrium before encountering a substrate; barrier-free landscape in which a direct, dominant “downhill” pathway to the minimum free energy structure is apparent; and a barrier-dominated landscape with two isolated conformational states, each associated with a different biological function. Sharing concepts with the “new view” of protein folding energy landscapes, we term the three sequence ranges above as the sensing, downhill folding, and functional windows, respectively. We find that these energy landscape patterns are conserved in various riboswitch classes, though the order of the windows may vary. In fact, the order of the three windows suggests either kinetic or thermodynamic control of ligand binding. These findings help understand riboswitch structure/function relationships and open new avenues to riboswitch design. PMID:22359488

  15. RNAdualPF: software to compute the dual partition function with sample applications in molecular evolution theory.

    PubMed

    Garcia-Martin, Juan Antonio; Bayegan, Amir H; Dotu, Ivan; Clote, Peter

    2016-10-19

    RNA inverse folding is the problem of finding one or more sequences that fold into a user-specified target structure s 0 , i.e. whose minimum free energy secondary structure is identical to the target s 0 . Here we consider the ensemble of all RNA sequences that have low free energy with respect to a given target s 0 . We introduce the program RNAdualPF, which computes the dual partition function Z ∗ , defined as the sum of Boltzmann factors exp(-E(a,s 0 )/RT) of all RNA nucleotide sequences a compatible with target structure s 0 . Using RNAdualPF, we efficiently sample RNA sequences that approximately fold into s 0 , where additionally the user can specify IUPAC sequence constraints at certain positions, and whether to include dangles (energy terms for stacked, single-stranded nucleotides). Moreover, since we also compute the dual partition function Z ∗ (k) over all sequences having GC-content k, the user can require that all sampled sequences have a precise, specified GC-content. Using Z ∗ , we compute the dual expected energy 〈E ∗ 〉, and use it to show that natural RNAs from the Rfam 12.0 database have higher minimum free energy than expected, thus suggesting that functional RNAs are under evolutionary pressure to be only marginally thermodynamically stable. We show that C. elegans precursor microRNA (pre-miRNA) is significantly non-robust with respect to mutations, by comparing the robustness of each wild type pre-miRNA sequence with 2000 [resp. 500] sequences of the same GC-content generated by RNAdualPF, which approximately [resp. exactly] fold into the wild type target structure. We confirm and strengthen earlier findings that precursor microRNAs and bacterial small noncoding RNAs display plasticity, a measure of structural diversity. We describe RNAdualPF, which rapidly computes the dual partition function Z ∗ and samples sequences having low energy with respect to a target structure, allowing sequence constraints and specified GC-content. Using different inverse folding software, another group had earlier shown that pre-miRNA is mutationally robust, even controlling for compositional bias. Our opposite conclusion suggests a cautionary note that computationally based insights into molecular evolution may heavily depend on the software used. C/C++-software for RNAdualPF is available at http://bioinformatics.bc.edu/clotelab/RNAdualPF .

  16. Improved systematic tRNA gene annotation allows new insights into the evolution of mitochondrial tRNA structures and into the mechanisms of mitochondrial genome rearrangements

    PubMed Central

    Jühling, Frank; Pütz, Joern; Bernt, Matthias; Donath, Alexander; Middendorf, Martin; Florentz, Catherine; Stadler, Peter F.

    2012-01-01

    Transfer RNAs (tRNAs) are present in all types of cells as well as in organelles. tRNAs of animal mitochondria show a low level of primary sequence conservation and exhibit ‘bizarre’ secondary structures, lacking complete domains of the common cloverleaf. Such sequences are hard to detect and hence frequently missed in computational analyses and mitochondrial genome annotation. Here, we introduce an automatic annotation procedure for mitochondrial tRNA genes in Metazoa based on sequence and structural information in manually curated covariance models. The method, applied to re-annotate 1876 available metazoan mitochondrial RefSeq genomes, allows to distinguish between remaining functional genes and degrading ‘pseudogenes’, even at early stages of divergence. The subsequent analysis of a comprehensive set of mitochondrial tRNA genes gives new insights into the evolution of structures of mitochondrial tRNA sequences as well as into the mechanisms of genome rearrangements. We find frequent losses of tRNA genes concentrated in basal Metazoa, frequent independent losses of individual parts of tRNA genes, particularly in Arthropoda, and wide-spread conserved overlaps of tRNAs in opposite reading direction. Direct evidence for several recent Tandem Duplication-Random Loss events is gained, demonstrating that this mechanism has an impact on the appearance of new mitochondrial gene orders. PMID:22139921

  17. RNA2DMut: a web tool for the design and analysis of RNA structure mutations.

    PubMed

    Moss, Walter N

    2018-03-01

    With the widespread application of high-throughput sequencing, novel RNA sequences are being discovered at an astonishing rate. The analysis of function, however, lags behind. In both the cis - and trans -regulatory functions of RNA, secondary structure (2D base-pairing) plays essential regulatory roles. In order to test RNA function, it is essential to be able to design and analyze mutations that can affect structure. This was the motivation for the creation of the RNA2DMut web tool. With RNA2DMut, users can enter in RNA sequences to analyze, constrain mutations to specific residues, or limit changes to purines/pyrimidines. The sequence is analyzed at each base to determine the effect of every possible point mutation on 2D structure. The metrics used in RNA2DMut rely on the calculation of the Boltzmann structure ensemble and do not require a robust 2D model of RNA structure for designing mutations. This tool can facilitate a wide array of uses involving RNA: for example, in designing and evaluating mutants for biological assays, interrogating RNA-protein interactions, identifying key regions to alter in SELEX experiments, and improving RNA folding and crystallization properties for structural biology. Additional tools are available to help users introduce other mutations (e.g., indels and substitutions) and evaluate their effects on RNA structure. Example calculations are shown for five RNAs that require 2D structure for their function: the MALAT1 mascRNA, an influenza virus splicing regulatory motif, the EBER2 viral noncoding RNA, the Xist lncRNA repA region, and human Y RNA 5. RNA2DMut can be accessed at https://rna2dmut.bb.iastate.edu/. © 2018 Moss; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

  18. Structural Analysis of HMGD-DNA Complexes Reveal Influence of Intercalation on Sequence Selectivity and DNA Bending

    PubMed Central

    Churchill, Mair E.A.; Klass, Janet; Zoetewey, David L.

    2010-01-01

    The ubiquitous eukaryotic High-Mobility-Group-Box (HMGB) chromosomal proteins promote many chromatin-mediated cellular activities through their non-sequence-specific binding and bending of DNA. Minor groove DNA binding by the HMG box results in substantial DNA bending toward the major groove owing to electrostatic interactions, shape complementarity and DNA intercalation that occurs at two sites. Here, the structures of the complexes formed with DNA by a partially DNA intercalation-deficient mutant of Drosophila melanogaster HMGD have been determined by X-ray crystallography at a resolution of 2.85 Å. The six proteins and fifty base pairs of DNA in the crystal structure revealed a variety of bound conformations. All of the proteins bound in the minor groove, bridging DNA molecules, presumably because these DNA regions are easily deformed. The loss of the primary site of DNA intercalation decreased overall DNA bending and shape complementarity. However, DNA bending at the secondary site of intercalation was retained and most protein-DNA contacts were preserved. The mode of binding resembles the HMGB1-boxA-cisplatin-DNA complex, which also lacks a primary intercalating residue. This study provides new insights into the binding mechanisms used by HMG boxes to recognize varied DNA structures and sequences as well as modulate DNA structure and DNA bending. PMID:20800069

  19. The roll-up and merging of coherent structures in shallow mixing layers

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lam, M. Y., E-mail: celmy@connect.ust.hk; Ghidaoui, M. S.; Kolyshkin, A. A.

    2016-09-15

    The current study seeks a fundamental explanation to the development of two-dimensional coherent structures (2DCSs) in shallow mixing layers. A nonlinear numerical model based on the depth-averaged shallow water equations is used to investigate the temporal evolution of shallow mixing layers, where the mapping from temporal to spatial results is made using the velocity at the center of the mixing layers. The flow is periodic in the streamwise direction. Transmissive boundary conditions are used in the cross-stream boundaries to prevent reflections. Numerical results are compared to linear stability analysis, mean-field theory, and secondary stability analysis. Results suggest that the onsetmore » and development of 2DCS in shallow mixing layers are the result of a sequence of instabilities governed by linear theory, mean-field theory, and secondary stability theory. The linear instability of the shearing velocity gradient gives the onset of 2DCS. When the perturbations reach a certain amplitude, the flow field of the perturbations changes from a wavy shape to a vortical (2DCS) structure because of nonlinearity. The development of the vertical 2DCS does not appear to follow weakly nonlinear theory; instead, it follows mean-field theory. After the formation of 2DCS, separate 2DCSs merge to form larger 2DCS. In this way, 2DCSs grow and shallow mixing layers develop and grow in scale. The merging of 2DCS in shallow mixing layers is shown to be caused by the secondary instability of the 2DCS. Eventually 2DCSs are dissipated by bed friction. The sequence of instabilities can cause the upscaling of the turbulent kinetic energy in shallow mixing layers.« less

  20. Variability in secondary structure of 18S ribosomal RNA as topological marker for identification of Paramecium species.

    PubMed

    Shakoori, Farah R; Tasneem, Fareeda; Al-Ghanim, K; Mahboob, S; Al-Misned, F; Jahan, Nusrat; Shakoori, Abdul Rauf

    2014-12-01

    Besides cytological and molecular applications, Paramecium is being used in water quality assessment and for determination of saprobic levels. An unambiguous identification of these unicellular eukaryotes is not only essential, but its ecological diversity must also be explored in the local environment. 18SrRNA genes of all the strains of Paramecium species isolated from waste water were amplified, cloned and sequenced. Phylogenetic comparison of the nucleotide sequences of these strains with 23 closely related Paramecium species from GenBank Database enabled identification of Paramecium multimicronucleatum and Paramecium jenningsi. Some isolates did not show significant close association with other Paramecium species, and because of their unique position in the phylogenetic tree, they were considered new to the field. In the present report, these isolates are being designated as Paramecium caudatum pakistanicus. In this article, secondary structure of 18SrRNA has also been analyzed as an additional and perhaps more reliable topological marker for species discrimination and for determining possible phylogenetic relationship between the ciliate species. On the basis of comparison of secondary structure of 18SrRNA of various isolated Paramacium strains, and among Paramecium caudatum pakistanicus, Tetrahymena thermophila, Drosophila melanogaster, and Homo sapiens, it can be deduced that variable regions are more helpful in differentiating the species at interspecific level rather than at intraspecific level. It was concluded that V3 was the least variable region in all the organisms, V2 and V7 were the longest expansion segments of D. melanogaster and there was continuous mutational bias towards G.C base pairing in H. sapiens. © 2014 Wiley Periodicals, Inc.

Top