Seo, Joo-Hyun; Park, Jihyang; Kim, Eun-Mi; Kim, Juhan; Joo, Keehyoung; Lee, Jooyoung; Kim, Byung-Gee
2014-02-01
Sequence subgrouping for a given sequence set can enable various informative tasks such as the functional discrimination of sequence subsets and the functional inference of unknown sequences. Because an identity threshold for sequence subgrouping may vary according to the given sequence set, it is highly desirable to construct a robust subgrouping algorithm which automatically identifies an optimal identity threshold and generates subgroups for a given sequence set. To meet this end, an automatic sequence subgrouping method, named 'Subgrouping Automata' was constructed. Firstly, tree analysis module analyzes the structure of tree and calculates the all possible subgroups in each node. Sequence similarity analysis module calculates average sequence similarity for all subgroups in each node. Representative sequence generation module finds a representative sequence using profile analysis and self-scoring for each subgroup. For all nodes, average sequence similarities are calculated and 'Subgrouping Automata' searches a node showing statistically maximum sequence similarity increase using Student's t-value. A node showing the maximum t-value, which gives the most significant differences in average sequence similarity between two adjacent nodes, is determined as an optimum subgrouping node in the phylogenetic tree. Further analysis showed that the optimum subgrouping node from SA prevents under-subgrouping and over-subgrouping. Copyright © 2013. Published by Elsevier Ltd.
SSAW: A new sequence similarity analysis method based on the stationary discrete wavelet transform.
Lin, Jie; Wei, Jing; Adjeroh, Donald; Jiang, Bing-Hua; Jiang, Yue
2018-05-02
Alignment-free sequence similarity analysis methods often lead to significant savings in computational time over alignment-based counterparts. A new alignment-free sequence similarity analysis method, called SSAW is proposed. SSAW stands for Sequence Similarity Analysis using the Stationary Discrete Wavelet Transform (SDWT). It extracts k-mers from a sequence, then maps each k-mer to a complex number field. Then, the series of complex numbers formed are transformed into feature vectors using the stationary discrete wavelet transform. After these steps, the original sequence is turned into a feature vector with numeric values, which can then be used for clustering and/or classification. Using two different types of applications, namely, clustering and classification, we compared SSAW against the the-state-of-the-art alignment free sequence analysis methods. SSAW demonstrates competitive or superior performance in terms of standard indicators, such as accuracy, F-score, precision, and recall. The running time was significantly better in most cases. These make SSAW a suitable method for sequence analysis, especially, given the rapidly increasing volumes of sequence data required by most modern applications.
Soares, René Arderius; Passaglia, Luciane Maria Pereira
2010-10-01
Bradyrhizobium elkanii is successfully used in the formulation of commercial inoculants and, together with B. japonicum, it fully supplies the plant nitrogen demands. Despite the similarity between B. japonicum and B. elkanii species, several works demonstrated genetic and physiological differences between them. In this work Representational Difference Analysis (RDA) was used for genomic comparison between B. elkanii SEMIA 587, a crop inoculant strain, and B. japonicum USDA 110, a reference strain. Two hundred sequences were obtained. From these, 46 sequences belonged exclusively to the genome of B. elkanii strain, and 154 showed similarity to sequences from B. japonicum genome. From the 46 sequences with no similarity to sequences from B. japonicum, 39 showed no similarity to sequences in public databases and seven showed similarity to sequences of genes coding for known proteins. These seven sequences were divided in three groups: similar to sequences from other Bradyrhizobium strains, similar to sequences from other nitrogen-fixing bacteria, and similar to sequences from non nitrogen-fixing bacteria. These new sequences could be used as DNA markers in order to investigate the rates of genetic material gain and loss in natural Bradyrhizobium strains.
Lactobacillus heilongjiangensis sp. nov., isolated from Chinese pickle.
Gu, Chun Tao; Li, Chun Yan; Yang, Li Jie; Huo, Gui Cheng
2013-11-01
A Gram-stain-positive bacterial strain, S4-3(T), was isolated from traditional pickle in Heilongjiang Province, China. The bacterium was characterized by a polyphasic approach, including 16S rRNA gene sequence analysis, pheS gene sequence analysis, rpoA gene sequence analysis, dnaK gene sequence analysis, fatty acid methyl ester (FAME) analysis, determination of DNA G+C content, DNA-DNA hybridization and an analysis of phenotypic features. Strain S4-3(T) showed 97.9-98.7 % 16S rRNA gene sequence similarities, 84.4-94.1 % pheS gene sequence similarities and 94.4-96.9 % rpoA gene sequence similarities to the type strains of Lactobacillus nantensis, Lactobacillus mindensis, Lactobacillus crustorum, Lactobacillus futsaii, Lactobacillus farciminis and Lactobacillus kimchiensis. dnaK gene sequence similarities between S4-3(T) and Lactobacillus nantensis LMG 23510(T), Lactobacillus mindensis LMG 21932(T), Lactobacillus crustorum LMG 23699(T), Lactobacillus futsaii JCM 17355(T) and Lactobacillus farciminis LMG 9200(T) were 95.4, 91.5, 90.4, 91.7 and 93.1 %, respectively. Based upon the data obtained in the present study, a novel species, Lactobacillus heilongjiangensis sp. nov., is proposed and the type strain is S4-3(T) ( = LMG 26166(T) = NCIMB 14701(T)).
String Mining in Bioinformatics
NASA Astrophysics Data System (ADS)
Abouelhoda, Mohamed; Ghanem, Moustafa
Sequence analysis is a major area in bioinformatics encompassing the methods and techniques for studying the biological sequences, DNA, RNA, and proteins, on the linear structure level. The focus of this area is generally on the identification of intra- and inter-molecular similarities. Identifying intra-molecular similarities boils down to detecting repeated segments within a given sequence, while identifying inter-molecular similarities amounts to spotting common segments among two or multiple sequences. From a data mining point of view, sequence analysis is nothing but string- or pattern mining specific to biological strings. For a long time, this point of view, however, has not been explicitly embraced neither in the data mining nor in the sequence analysis text books, which may be attributed to the co-evolution of the two apparently independent fields. In other words, although the word "data-mining" is almost missing in the sequence analysis literature, its basic concepts have been implicitly applied. Interestingly, recent research in biological sequence analysis introduced efficient solutions to many problems in data mining, such as querying and analyzing time series [49,53], extracting information from web pages [20], fighting spam mails [50], detecting plagiarism [22], and spotting duplications in software systems [14].
String Mining in Bioinformatics
NASA Astrophysics Data System (ADS)
Abouelhoda, Mohamed; Ghanem, Moustafa
Sequence analysis is a major area in bioinformatics encompassing the methods and techniques for studying the biological sequences, DNA, RNA, and proteins, on the linear structure level. The focus of this area is generally on the identification of intra- and inter-molecular similarities. Identifying intra-molecular similarities boils down to detecting repeated segments within a given sequence, while identifying inter-molecular similarities amounts to spotting common segments among two or multiple sequences. From a data mining point of view, sequence analysis is nothing but string- or pattern mining specific to biological strings. For a long time, this point of view, however, has not been explicitly embraced neither in the data mining nor in the sequence analysis text books, which may be attributed to the co-evolution of the two apparently independent fields. In other words, although the word “data-mining” is almost missing in the sequence analysis literature, its basic concepts have been implicitly applied. Interestingly, recent research in biological sequence analysis introduced efficient solutions to many problems in data mining, such as querying and analyzing time series [49,53], extracting information from web pages [20], fighting spam mails [50], detecting plagiarism [22], and spotting duplications in software systems [14].
Mackey, Aaron J; Pearson, William R
2004-10-01
Relational databases are designed to integrate diverse types of information and manage large sets of search results, greatly simplifying genome-scale analyses. Relational databases are essential for management and analysis of large-scale sequence analyses, and can also be used to improve the statistical significance of similarity searches by focusing on subsets of sequence libraries most likely to contain homologs. This unit describes using relational databases to improve the efficiency of sequence similarity searching and to demonstrate various large-scale genomic analyses of homology-related data. This unit describes the installation and use of a simple protein sequence database, seqdb_demo, which is used as a basis for the other protocols. These include basic use of the database to generate a novel sequence library subset, how to extend and use seqdb_demo for the storage of sequence similarity search results and making use of various kinds of stored search results to address aspects of comparative genomic analysis.
Using SQL Databases for Sequence Similarity Searching and Analysis.
Pearson, William R; Mackey, Aaron J
2017-09-13
Relational databases can integrate diverse types of information and manage large sets of similarity search results, greatly simplifying genome-scale analyses. By focusing on taxonomic subsets of sequences, relational databases can reduce the size and redundancy of sequence libraries and improve the statistical significance of homologs. In addition, by loading similarity search results into a relational database, it becomes possible to explore and summarize the relationships between all of the proteins in an organism and those in other biological kingdoms. This unit describes how to use relational databases to improve the efficiency of sequence similarity searching and demonstrates various large-scale genomic analyses of homology-related data. It also describes the installation and use of a simple protein sequence database, seqdb_demo, which is used as a basis for the other protocols. The unit also introduces search_demo, a database that stores sequence similarity search results. The search_demo database is then used to explore the evolutionary relationships between E. coli proteins and proteins in other organisms in a large-scale comparative genomic analysis. © 2017 by John Wiley & Sons, Inc. Copyright © 2017 John Wiley & Sons, Inc.
Schaeffer, E; Sninsky, J J
1984-01-01
Proteins that are related evolutionarily may have diverged at the level of primary amino acid sequence while maintaining similar secondary structures. Computer analysis has been used to compare the open reading frames of the hepatitis B virus to those of the woodchuck hepatitis virus at the level of amino acid sequence, and to predict the relative hydrophilic character and the secondary structure of putative polypeptides. Similarity is seen at the levels of relative hydrophilicity and secondary structure, in the absence of sequence homology. These data reinforce the proposal that these open reading frames encode viral proteins. Computer analysis of this type can be more generally used to establish structural similarities between proteins that do not share obvious sequence homology as well as to assess whether an open reading frame is fortuitous or codes for a protein. PMID:6585835
Analysis of xylem formation in pine by cDNA sequencing
NASA Technical Reports Server (NTRS)
Allona, I.; Quinn, M.; Shoop, E.; Swope, K.; St Cyr, S.; Carlis, J.; Riedl, J.; Retzel, E.; Campbell, M. M.; Sederoff, R.;
1998-01-01
Secondary xylem (wood) formation is likely to involve some genes expressed rarely or not at all in herbaceous plants. Moreover, environmental and developmental stimuli influence secondary xylem differentiation, producing morphological and chemical changes in wood. To increase our understanding of xylem formation, and to provide material for comparative analysis of gymnosperm and angiosperm sequences, ESTs were obtained from immature xylem of loblolly pine (Pinus taeda L.). A total of 1,097 single-pass sequences were obtained from 5' ends of cDNAs made from gravistimulated tissue from bent trees. Cluster analysis detected 107 groups of similar sequences, ranging in size from 2 to 20 sequences. A total of 361 sequences fell into these groups, whereas 736 sequences were unique. About 55% of the pine EST sequences show similarity to previously described sequences in public databases. About 10% of the recognized genes encode factors involved in cell wall formation. Sequences similar to cell wall proteins, most known lignin biosynthetic enzymes, and several enzymes of carbohydrate metabolism were found. A number of putative regulatory proteins also are represented. Expression patterns of several of these genes were studied in various tissues and organs of pine. Sequencing novel genes expressed during xylem formation will provide a powerful means of identifying mechanisms controlling this important differentiation pathway.
Impact of cultivation on characterisation of species composition of soil bacterial communities.
McCaig, A E.; Grayston, S J.; Prosser, J I.; Glover, L A.
2001-03-01
The species composition of culturable bacteria in Scottish grassland soils was investigated using a combination of Biolog and 16S rDNA analysis for characterisation of isolates. The inclusion of a molecular approach allowed direct comparison of sequences from culturable bacteria with sequences obtained during analysis of DNA extracted directly from the same soil samples. Bacterial strains were isolated on Pseudomonas isolation agar (PIA), a selective medium, and on tryptone soya agar (TSA), a general laboratory medium. In total, 12 and 21 morphologically different bacterial cultures were isolated on PIA and TSA, respectively. Biolog and sequencing placed PIA isolates in the same taxonomic groups, the majority of cultures belonging to the Pseudomonas (sensu stricto) group. However, analysis of 16S rDNA sequences proved more efficient than Biolog for characterising TSA isolates due to limitations of the Microlog database for identifying environmental bacteria. In general, 16S rDNA sequences from TSA isolates showed high similarities to cultured species represented in sequence databases, although TSA-8 showed only 92.5% similarity to the nearest relative, Bacillus insolitus. In general, there was very little overlap between the culturable and uncultured bacterial communities, although two sequences, PIA-2 and TSA-13, showed >99% similarity to soil clones. A cloning step was included prior to sequence analysis of two isolates, TSA-5 and TSA-14, and analysis of several clones confirmed that these cultures comprised at least four and three sequence types, respectively. All isolate clones were most closely related to uncultured bacteria, with clone TSA-5.1 showing 99.8% similarity to a sequence amplified directly from the same soil sample. Interestingly, one clone, TSA-5.4, clustered within a novel group comprising only uncultured sequences. This group, which is associated with the novel, deep-branching Acidobacterium capsulatum lineage, also included clones isolated during direct analysis of the same soil and from a wide range of other sample types studied elsewhere. The study demonstrates the value of fine-scale molecular analysis for identification of laboratory isolates and indicates the culturability of approximately 1% of the total population but under a restricted range of media and cultivation conditions.
Dai, Qi; Yang, Yanchun; Wang, Tianming
2008-10-15
Many proposed statistical measures can efficiently compare biological sequences to further infer their structures, functions and evolutionary information. They are related in spirit because all the ideas for sequence comparison try to use the information on the k-word distributions, Markov model or both. Motivated by adding k-word distributions to Markov model directly, we investigated two novel statistical measures for sequence comparison, called wre.k.r and S2.k.r. The proposed measures were tested by similarity search, evaluation on functionally related regulatory sequences and phylogenetic analysis. This offers the systematic and quantitative experimental assessment of our measures. Moreover, we compared our achievements with these based on alignment or alignment-free. We grouped our experiments into two sets. The first one, performed via ROC (receiver operating curve) analysis, aims at assessing the intrinsic ability of our statistical measures to search for similar sequences from a database and discriminate functionally related regulatory sequences from unrelated sequences. The second one aims at assessing how well our statistical measure is used for phylogenetic analysis. The experimental assessment demonstrates that our similarity measures intending to incorporate k-word distributions into Markov model are more efficient.
King, Brian R; Aburdene, Maurice; Thompson, Alex; Warres, Zach
2014-01-01
Digital signal processing (DSP) techniques for biological sequence analysis continue to grow in popularity due to the inherent digital nature of these sequences. DSP methods have demonstrated early success for detection of coding regions in a gene. Recently, these methods are being used to establish DNA gene similarity. We present the inter-coefficient difference (ICD) transformation, a novel extension of the discrete Fourier transformation, which can be applied to any DNA sequence. The ICD method is a mathematical, alignment-free DNA comparison method that generates a genetic signature for any DNA sequence that is used to generate relative measures of similarity among DNA sequences. We demonstrate our method on a set of insulin genes obtained from an evolutionarily wide range of species, and on a set of avian influenza viral sequences, which represents a set of highly similar sequences. We compare phylogenetic trees generated using our technique against trees generated using traditional alignment techniques for similarity and demonstrate that the ICD method produces a highly accurate tree without requiring an alignment prior to establishing sequence similarity.
Sequence Alignment to Predict Across Species Susceptibility ...
Conservation of a molecular target across species can be used as a line-of-evidence to predict the likelihood of chemical susceptibility. The web-based Sequence Alignment to Predict Across Species Susceptibility (SeqAPASS) tool was developed to simplify, streamline, and quantitatively assess protein sequence/structural similarity across taxonomic groups as a means to predict relative intrinsic susceptibility. The intent of the tool is to allow for evaluation of any potential protein target, so it is amenable to variable degrees of protein characterization, depending on available information about the chemical/protein interaction and the molecular target itself. To allow for flexibility in the analysis, a layered strategy was adopted for the tool. The first level of the SeqAPASS analysis compares primary amino acid sequences to a query sequence, calculating a metric for sequence similarity (including detection of candidate orthologs), the second level evaluates sequence similarity within selected domains (e.g., ligand-binding domain, DNA binding domain), and the third level of analysis compares individual amino acid residue positions identified as being of importance for protein conformation and/or ligand binding upon chemical perturbation. Each level of the SeqAPASS analysis provides increasing evidence to apply toward rapid, screening-level assessments of probable cross species susceptibility. Such analyses can support prioritization of chemicals for further ev
galaxie--CGI scripts for sequence identification through automated phylogenetic analysis.
Nilsson, R Henrik; Larsson, Karl-Henrik; Ursing, Björn M
2004-06-12
The prevalent use of similarity searches like BLAST to identify sequences and species implicitly assumes the reference database to be of extensive sequence sampling. This is often not the case, restraining the correctness of the outcome as a basis for sequence identification. Phylogenetic inference outperforms similarity searches in retrieving correct phylogenies and consequently sequence identities, and a project was initiated to design a freely available script package for sequence identification through automated Web-based phylogenetic analysis. Three CGI scripts were designed to facilitate qualified sequence identification from a Web interface. Query sequences are aligned to pre-made alignments or to alignments made by ClustalW with entries retrieved from a BLAST search. The subsequent phylogenetic analysis is based on the PHYLIP package for inferring neighbor-joining and parsimony trees. The scripts are highly configurable. A service installation and a version for local use are found at http://andromeda.botany.gu.se/galaxiewelcome.html and http://galaxie.cgb.ki.se
An improved model for whole genome phylogenetic analysis by Fourier transform.
Yin, Changchuan; Yau, Stephen S-T
2015-10-07
DNA sequence similarity comparison is one of the major steps in computational phylogenetic studies. The sequence comparison of closely related DNA sequences and genomes is usually performed by multiple sequence alignments (MSA). While the MSA method is accurate for some types of sequences, it may produce incorrect results when DNA sequences undergone rearrangements as in many bacterial and viral genomes. It is also limited by its computational complexity for comparing large volumes of data. Previously, we proposed an alignment-free method that exploits the full information contents of DNA sequences by Discrete Fourier Transform (DFT), but still with some limitations. Here, we present a significantly improved method for the similarity comparison of DNA sequences by DFT. In this method, we map DNA sequences into 2-dimensional (2D) numerical sequences and then apply DFT to transform the 2D numerical sequences into frequency domain. In the 2D mapping, the nucleotide composition of a DNA sequence is a determinant factor and the 2D mapping reduces the nucleotide composition bias in distance measure, and thus improving the similarity measure of DNA sequences. To compare the DFT power spectra of DNA sequences with different lengths, we propose an improved even scaling algorithm to extend shorter DFT power spectra to the longest length of the underlying sequences. After the DFT power spectra are evenly scaled, the spectra are in the same dimensionality of the Fourier frequency space, then the Euclidean distances of full Fourier power spectra of the DNA sequences are used as the dissimilarity metrics. The improved DFT method, with increased computational performance by 2D numerical representation, can be applicable to any DNA sequences of different length ranges. We assess the accuracy of the improved DFT similarity measure in hierarchical clustering of different DNA sequences including simulated and real datasets. The method yields accurate and reliable phylogenetic trees and demonstrates that the improved DFT dissimilarity measure is an efficient and effective similarity measure of DNA sequences. Due to its high efficiency and accuracy, the proposed DFT similarity measure is successfully applied on phylogenetic analysis for individual genes and large whole bacterial genomes. Copyright © 2015 Elsevier Ltd. All rights reserved.
Correlating low-similarity peptide sequences and allergenic epitopes.
Kanduc, D
2008-01-01
Although a high number of allergenic peptide epitopes has been experimentally identified and defined, the molecular basis and the precise mechanisms underlying peptide allergenicity are unknown. This issue was analyzed exploring the relationship between peptide allergenicity and sequence similarity to the human proteome. The structured analysis of the data reported in literature put into evidence that the most part of IgE-binding epitopes are (or harbor) pentapeptide unit(s) with no/low similarity to the human proteome, this way suggesting that no or low sequence similarity to the host proteome might represent a minimum common denominator identifying allergenic peptides. The present literature analysis might be of relevance in devising and designing short amino acid modules to be used for blocking pathogenic IgE.
Analysis of sequence repeats of proteins in the PDB.
Mary Rajathei, David; Selvaraj, Samuel
2013-12-01
Internal repeats in protein sequences play a significant role in the evolution of protein structure and function. Applications of different bioinformatics tools help in the identification and characterization of these repeats. In the present study, we analyzed sequence repeats in a non-redundant set of proteins available in the Protein Data Bank (PDB). We used RADAR for detecting internal repeats in a protein, PDBeFOLD for assessing structural similarity, PDBsum for finding functional involvement and Pfam for domain assignment of the repeats in a protein. Through the analysis of sequence repeats, we found that identity of the sequence repeats falls in the range of 20-40% and, the superimposed structures of the most of the sequence repeats maintain similar overall folding. Analysis sequence repeats at the functional level reveals that most of the sequence repeats are involved in the function of the protein through functionally involved residues in the repeat regions. We also found that sequence repeats in single and two domain proteins often contained conserved sequence motifs for the function of the domain. Copyright © 2013 Elsevier Ltd. All rights reserved.
GWFASTA: server for FASTA search in eukaryotic and microbial genomes.
Issac, Biju; Raghava, G P S
2002-09-01
Similarity searches are a powerful method for solving important biological problems such as database scanning, evolutionary studies, gene prediction, and protein structure prediction. FASTA is a widely used sequence comparison tool for rapid database scanning. Here we describe the GWFASTA server that was developed to assist the FASTA user in similarity searches against partially and/or completely sequenced genomes. GWFASTA consists of more than 60 microbial genomes, eight eukaryote genomes, and proteomes of annotatedgenomes. Infact, it provides the maximum number of databases for similarity searching from a single platform. GWFASTA allows the submission of more than one sequence as a single query for a FASTA search. It also provides integrated post-processing of FASTA output, including compositional analysis of proteins, multiple sequences alignment, and phylogenetic analysis. Furthermore, it summarizes the search results organism-wise for prokaryotes and chromosome-wise for eukaryotes. Thus, the integration of different tools for sequence analyses makes GWFASTA a powerful toolfor biologists.
Bruce, A. Gregory; Ryan, Jonathan T.; Thomas, Mathew J.; Peng, Xinxia; Grundhoff, Adam; Tsai, Che-Chung
2013-01-01
The complete sequence of retroperitoneal fibromatosis-associated herpesvirus Macaca nemestrina (RFHVMn), the pig-tailed macaque homolog of Kaposi's sarcoma-associated herpesvirus (KSHV), was determined by next-generation sequence analysis of a Kaposi's sarcoma (KS)-like macaque tumor. Colinearity of genes was observed with the KSHV genome, and the core herpesvirus genes had strong sequence homology to the corresponding KSHV genes. RFHVMn lacked homologs of open reading frame 11 (ORF11) and KSHV ORFs K5 and K6, which appear to have been generated by duplication of ORFs K3 and K4 after the divergence of KSHV and RFHV. RFHVMn contained positional homologs of all other unique KSHV genes, although some showed limited sequence similarity. RFHVMn contained a number of candidate microRNA genes. Although there was little sequence similarity with KSHV microRNAs, one candidate contained the same seed sequence as the positional homolog, kshv-miR-K12-10a, suggesting functional overlap. RNA transcript splicing was highly conserved between RFHVMn and KSHV, and strong sequence conservation was noted in specific promoters and putative origins of replication, predicting important functional similarities. Sequence comparisons indicated that RFHVMn and KSHV developed in long-term synchrony with the evolution of their hosts, and both viruses phylogenetically group within the RV1 lineage of Old World primate rhadinoviruses. RFHVMn is the closest homolog of KSHV to be completely sequenced and the first sequenced RV1 rhadinovirus homolog of KSHV from a nonhuman Old World primate. The strong genetic and sequence similarity between RFHVMn and KSHV, coupled with similarities in biology and pathology, demonstrate that RFHVMn infection in macaques offers an important and relevant model for the study of KSHV in humans. PMID:24109218
Valdez-Velázquez, Laura L; Quintero-Hernández, Verónica; Romero-Gutiérrez, Maria Teresa; Coronas, Fredy I V; Possani, Lourival D
2013-01-01
Centruroides tecomanus is a Mexican scorpion endemic of the State of Colima, that causes human fatalities. This communication describes a proteome analysis obtained from milked venom and a transcriptome analysis from a cDNA library constructed from two pairs of venom glands of this scorpion. High perfomance liquid chromatography separation of soluble venom produced 80 fractions, from which at least 104 individual components were identified by mass spectrometry analysis, showing to contain molecular masses from 259 to 44,392 Da. Most of these components are within the expected molecular masses for Na(+)- and K(+)-channel specific toxic peptides, supporting the clinical findings of intoxication, when humans are stung by this scorpion. From the cDNA library 162 clones were randomly chosen, from which 130 sequences of good quality were identified and were clustered in 28 contigs containing, each, two or more expressed sequence tags (EST) and 49 singlets with only one EST. Deduced amino acid sequence analysis from 53% of the total ESTs showed that 81% (24 sequences) are similar to known toxic peptides that affect Na(+)-channel activity, and 19% (7 unique sequences) are similar to K(+)-channel especific toxins. Out of the 31 sequences, at least 8 peptides were confirmed by direct Edman degradation, using components isolated directly from the venom. The remaining 19%, 4%, 4%, 15% and 5% of the ESTs correspond respectively to proteins involved in cellular processes, antimicrobial peptides, venom components, proteins without defined function and sequences without similarity in databases. Among the cloned genes are those similar to metalloproteinases.
SeqAPASS (Sequence Alignment to Predict Across Species Susceptibility) software and documentation
SeqAPASS is a software application facilitates rapid and streamlined, yet transparent, comparisons of the similarity of toxicologically-significant molecular targets across species. The present application facilitates analysis of primary amino acid sequence similarity (including ...
Jia, Lei; Li, Lin; Gui, Tao; Liu, Siyang; Li, Hanping; Han, Jingwan; Guo, Wei; Liu, Yongjian; Li, Jingyun
2016-09-21
With increasing data on HIV-1, a more relevant molecular model describing mechanism details of HIV-1 genetic recombination usually requires upgrades. Currently an incomplete structural understanding of the copy choice mechanism along with several other issues in the field that lack elucidation led us to perform an analysis of the correlation between breakpoint distributions and (1) the probability of base pairing, and (2) intersubtype genetic similarity to further explore structural mechanisms. Near full length sequences of URFs from Asia, Europe, and Africa (one sequence/patient), and representative sequences of worldwide CRFs were retrieved from the Los Alamos HIV database. Their recombination patterns were analyzed by jpHMM in detail. Then the relationships between breakpoint distributions and (1) the probability of base pairing, and (2) intersubtype genetic similarities were investigated. Pearson correlation test showed that all URF groups and the CRF group exhibit the same breakpoint distribution pattern. Additionally, the Wilcoxon two-sample test indicated a significant and inexplicable limitation of recombination in regions with high pairing probability. These regions have been found to be strongly conserved across distinct biological states (i.e., strong intersubtype similarity), and genetic similarity has been determined to be a very important factor promoting recombination. Thus, the results revealed an unexpected disagreement between intersubtype similarity and breakpoint distribution, which were further confirmed by genetic similarity analysis. Our analysis reveals a critical conflict between results from natural HIV-1 isolates and those from HIV-1-based assay vectors in which genetic similarity has been shown to be a very critical factor promoting recombination. These results indicate the region with high-pairing probabilities may be a more fundamental factor affecting HIV-1 recombination than sequence similarity in natural HIV-1 infections. Our findings will be relevant in furthering the understanding of HIV-1 recombination mechanisms.
Sirius PSB: a generic system for analysis of biological sequences.
Koh, Chuan Hock; Lin, Sharene; Jedd, Gregory; Wong, Limsoon
2009-12-01
Computational tools are essential components of modern biological research. For example, BLAST searches can be used to identify related proteins based on sequence homology, or when a new genome is sequenced, prediction models can be used to annotate functional sites such as transcription start sites, translation initiation sites and polyadenylation sites and to predict protein localization. Here we present Sirius Prediction Systems Builder (PSB), a new computational tool for sequence analysis, classification and searching. Sirius PSB has four main operations: (1) Building a classifier, (2) Deploying a classifier, (3) Search for proteins similar to query proteins, (4) Preliminary and post-prediction analysis. Sirius PSB supports all these operations via a simple and interactive graphical user interface. Besides being a convenient tool, Sirius PSB has also introduced two novelties in sequence analysis. Firstly, genetic algorithm is used to identify interesting features in the feature space. Secondly, instead of the conventional method of searching for similar proteins via sequence similarity, we introduced searching via features' similarity. To demonstrate the capabilities of Sirius PSB, we have built two prediction models - one for the recognition of Arabidopsis polyadenylation sites and another for the subcellular localization of proteins. Both systems are competitive against current state-of-the-art models based on evaluation of public datasets. More notably, the time and effort required to build each model is greatly reduced with the assistance of Sirius PSB. Furthermore, we show that under certain conditions when BLAST is unable to find related proteins, Sirius PSB can identify functionally related proteins based on their biophysical similarities. Sirius PSB and its related supplements are available at: http://compbio.ddns.comp.nus.edu.sg/~sirius.
EventThread: Visual Summarization and Stage Analysis of Event Sequence Data.
Guo, Shunan; Xu, Ke; Zhao, Rongwen; Gotz, David; Zha, Hongyuan; Cao, Nan
2018-01-01
Event sequence data such as electronic health records, a person's academic records, or car service records, are ordered series of events which have occurred over a period of time. Analyzing collections of event sequences can reveal common or semantically important sequential patterns. For example, event sequence analysis might reveal frequently used care plans for treating a disease, typical publishing patterns of professors, and the patterns of service that result in a well-maintained car. It is challenging, however, to visually explore large numbers of event sequences, or sequences with large numbers of event types. Existing methods focus on extracting explicitly matching patterns of events using statistical analysis to create stages of event progression over time. However, these methods fail to capture latent clusters of similar but not identical evolutions of event sequences. In this paper, we introduce a novel visualization system named EventThread which clusters event sequences into threads based on tensor analysis and visualizes the latent stage categories and evolution patterns by interactively grouping the threads by similarity into time-specific clusters. We demonstrate the effectiveness of EventThread through usage scenarios in three different application domains and via interviews with an expert user.
Mohkam, Milad; Nezafat, Navid; Berenjian, Aydin; Mobasher, Mohammad Ali; Ghasemi, Younes
2016-03-01
Some Bacillus species, especially Bacillus subtilis and Bacillus pumilus groups, have highly similar 16S rRNA gene sequences, which are hard to identify based on 16S rDNA sequence analysis. To conquer this drawback, rpoB, recA sequence analysis along with randomly amplified polymorphic (RAPD) fingerprinting was examined as an alternative method for differentiating Bacillus species. The 16S rRNA, rpoB and recA genes were amplified via a polymerase chain reaction using their specific primers. The resulted PCR amplicons were sequenced, and phylogenetic analysis was employed by MEGA 6 software. Identification based on 16S rRNA gene sequencing was underpinned by rpoB and recA gene sequencing as well as RAPD-PCR technique. Subsequently, concatenation and phylogenetic analysis showed that extent of diversity and similarity were better obtained by rpoB and recA primers, which are also reinforced by RAPD-PCR methods. However, in one case, these approaches failed to identify one isolate, which in combination with the phenotypical method offsets this issue. Overall, RAPD fingerprinting, rpoB and recA along with concatenated genes sequence analysis discriminated closely related Bacillus species, which highlights the significance of the multigenic method in more precisely distinguishing Bacillus strains. This research emphasizes the benefit of RAPD fingerprinting, rpoB and recA sequence analysis superior to 16S rRNA gene sequence analysis for suitable and effective identification of Bacillus species as recommended for probiotic products.
Complete Genome Sequence of Porcine Parvovirus 2 Recovered from Swine Sera
Kluge, M.; Franco, A. C.; Giongo, A.; Valdez, F. P.; Saddi, T. M.; Brito, W. M. E. D.; Roehe, P. M.
2016-01-01
A complete genomic sequence of porcine parvovirus 2 (PPV-2) was detected by viral metagenome analysis on swine sera. A phylogenetic analysis of this genome reveals that it is highly similar to previously reported North American PPV-2 genomes. The complete PPV-2 sequence is 5,426 nucleotides long. PMID:26823583
Fast discovery and visualization of conserved regions in DNA sequences using quasi-alignment
2013-01-01
Background Next Generation Sequencing techniques are producing enormous amounts of biological sequence data and analysis becomes a major computational problem. Currently, most analysis, especially the identification of conserved regions, relies heavily on Multiple Sequence Alignment and its various heuristics such as progressive alignment, whose run time grows with the square of the number and the length of the aligned sequences and requires significant computational resources. In this work, we present a method to efficiently discover regions of high similarity across multiple sequences without performing expensive sequence alignment. The method is based on approximating edit distance between segments of sequences using p-mer frequency counts. Then, efficient high-throughput data stream clustering is used to group highly similar segments into so called quasi-alignments. Quasi-alignments have numerous applications such as identifying species and their taxonomic class from sequences, comparing sequences for similarities, and, as in this paper, discovering conserved regions across related sequences. Results In this paper, we show that quasi-alignments can be used to discover highly similar segments across multiple sequences from related or different genomes efficiently and accurately. Experiments on a large number of unaligned 16S rRNA sequences obtained from the Greengenes database show that the method is able to identify conserved regions which agree with known hypervariable regions in 16S rRNA. Furthermore, the experiments show that the proposed method scales well for large data sets with a run time that grows only linearly with the number and length of sequences, whereas for existing multiple sequence alignment heuristics the run time grows super-linearly. Conclusion Quasi-alignment-based algorithms can detect highly similar regions and conserved areas across multiple sequences. Since the run time is linear and the sequences are converted into a compact clustering model, we are able to identify conserved regions fast or even interactively using a standard PC. Our method has many potential applications such as finding characteristic signature sequences for families of organisms and studying conserved and variable regions in, for example, 16S rRNA. PMID:24564200
Fast discovery and visualization of conserved regions in DNA sequences using quasi-alignment.
Nagar, Anurag; Hahsler, Michael
2013-01-01
Next Generation Sequencing techniques are producing enormous amounts of biological sequence data and analysis becomes a major computational problem. Currently, most analysis, especially the identification of conserved regions, relies heavily on Multiple Sequence Alignment and its various heuristics such as progressive alignment, whose run time grows with the square of the number and the length of the aligned sequences and requires significant computational resources. In this work, we present a method to efficiently discover regions of high similarity across multiple sequences without performing expensive sequence alignment. The method is based on approximating edit distance between segments of sequences using p-mer frequency counts. Then, efficient high-throughput data stream clustering is used to group highly similar segments into so called quasi-alignments. Quasi-alignments have numerous applications such as identifying species and their taxonomic class from sequences, comparing sequences for similarities, and, as in this paper, discovering conserved regions across related sequences. In this paper, we show that quasi-alignments can be used to discover highly similar segments across multiple sequences from related or different genomes efficiently and accurately. Experiments on a large number of unaligned 16S rRNA sequences obtained from the Greengenes database show that the method is able to identify conserved regions which agree with known hypervariable regions in 16S rRNA. Furthermore, the experiments show that the proposed method scales well for large data sets with a run time that grows only linearly with the number and length of sequences, whereas for existing multiple sequence alignment heuristics the run time grows super-linearly. Quasi-alignment-based algorithms can detect highly similar regions and conserved areas across multiple sequences. Since the run time is linear and the sequences are converted into a compact clustering model, we are able to identify conserved regions fast or even interactively using a standard PC. Our method has many potential applications such as finding characteristic signature sequences for families of organisms and studying conserved and variable regions in, for example, 16S rRNA.
PAQ: Partition Analysis of Quasispecies.
Baccam, P; Thompson, R J; Fedrigo, O; Carpenter, S; Cornette, J L
2001-01-01
The complexities of genetic data may not be accurately described by any single analytical tool. Phylogenetic analysis is often used to study the genetic relationship among different sequences. Evolutionary models and assumptions are invoked to reconstruct trees that describe the phylogenetic relationship among sequences. Genetic databases are rapidly accumulating large amounts of sequences. Newly acquired sequences, which have not yet been characterized, may require preliminary genetic exploration in order to build models describing the evolutionary relationship among sequences. There are clustering techniques that rely less on models of evolution, and thus may provide nice exploratory tools for identifying genetic similarities. Some of the more commonly used clustering methods perform better when data can be grouped into mutually exclusive groups. Genetic data from viral quasispecies, which consist of closely related variants that differ by small changes, however, may best be partitioned by overlapping groups. We have developed an intuitive exploratory program, Partition Analysis of Quasispecies (PAQ), which utilizes a non-hierarchical technique to partition sequences that are genetically similar. PAQ was used to analyze a data set of human immunodeficiency virus type 1 (HIV-1) envelope sequences isolated from different regions of the brain and another data set consisting of the equine infectious anemia virus (EIAV) regulatory gene rev. Analysis of the HIV-1 data set by PAQ was consistent with phylogenetic analysis of the same data, and the EIAV rev variants were partitioned into two overlapping groups. PAQ provides an additional tool which can be used to glean information from genetic data and can be used in conjunction with other tools to study genetic similarities and genetic evolution of viral quasispecies.
Campion, S R; Ameen, A S; Lai, L; King, J M; Munzenmaier, T N
2001-08-15
This report describes the application of a simple computational tool, AAPAIR.TAB, for the systematic analysis of the cysteine-rich EGF, Sushi, and Laminin motif/sequence families at the two-amino acid level. Automated dipeptide frequency/bias analysis detects preferences in the distribution of amino acids in established protein families, by determining which "ordered dipeptides" occur most frequently in comprehensive motif-specific sequence data sets. Graphic display of the dipeptide frequency/bias data revealed family-specific preferences for certain dipeptides, but more importantly detected a shared preference for employment of the ordered dipeptides Gly-Tyr (GY) and Gly-Phe (GF) in all three protein families. The dipeptide Asn-Gly (NG) also exhibited high-frequency and bias in the EGF and Sushi motif families, whereas Asn-Thr (NT) was distinguished in the Laminin family. Evaluation of the distribution of dipeptides identified by frequency/bias analysis subsequently revealed the highly restricted localization of the G(F/Y) and N(G/T) sequence elements at two separate sites of extreme conservation in the consensus sequence of all three sequence families. The similar employment of the high-frequency/bias dipeptides in three distinct protein sequence families was further correlated with the concurrence of these shared molecular determinants at similar positions within the distinctive scaffolds of three structurally divergent, but similarly employed, motif modules.
Madi, Asaf; Poran, Asaf; Shifrut, Eric; Reich-Zeliger, Shlomit; Greenstein, Erez; Zaretsky, Irena; Arnon, Tomer; Laethem, Francois Van; Singer, Alfred; Lu, Jinghua; Sun, Peter D; Cohen, Irun R; Friedman, Nir
2017-01-01
Diversity of T cell receptor (TCR) repertoires, generated by somatic DNA rearrangements, is central to immune system function. However, the level of sequence similarity of TCR repertoires within and between species has not been characterized. Using network analysis of high-throughput TCR sequencing data, we found that abundant CDR3-TCRβ sequences were clustered within networks generated by sequence similarity. We discovered a substantial number of public CDR3-TCRβ segments that were identical in mice and humans. These conserved public sequences were central within TCR sequence-similarity networks. Annotated TCR sequences, previously associated with self-specificities such as autoimmunity and cancer, were linked to network clusters. Mechanistically, CDR3 networks were promoted by MHC-mediated selection, and were reduced following immunization, immune checkpoint blockade or aging. Our findings provide a new view of T cell repertoire organization and physiology, and suggest that the immune system distributes its TCR sequences unevenly, attending to specific foci of reactivity. DOI: http://dx.doi.org/10.7554/eLife.22057.001 PMID:28731407
Identification of (R)-selective ω-aminotransferases by exploring evolutionary sequence space.
Kim, Eun-Mi; Park, Joon Ho; Kim, Byung-Gee; Seo, Joo-Hyun
2018-03-01
Several (R)-selective ω-aminotransferases (R-ωATs) have been reported. The existence of additional R-ωATs having different sequence characteristics from previous ones is highly expected. In addition, it is generally accepted that R-ωATs are variants of aminotransferase group III. Based on these backgrounds, sequences in RefSeq database were scored using family profiles of branched-chain amino acid aminotransferase (BCAT) and d-alanine aminotransferase (DAT) to predict and identify putative R-ωATs. Sequences with two profile analysis scores were plotted on two-dimensional score space. Candidates with relatively similar scores in both BCAT and DAT profiles (i.e., profile analysis score using BCAT profile was similar to profile analysis score using DAT profile) were selected. Experimental results for selected candidates showed that putative R-ωATs from Saccharopolyspora erythraea (R-ωAT_Sery), Bacillus cellulosilyticus (R-ωAT_Bcel), and Bacillus thuringiensis (R-ωAT_Bthu) had R-ωAT activity. Additional experiments revealed that R-ωAT_Sery also possessed DAT activity while R-ωAT_Bcel and R-ωAT_Bthu had BCAT activity. Selecting putative R-ωATs from regions with similar profile analysis scores identified potential R-ωATs. Therefore, R-ωATs could be efficiently identified by using simple family profile analysis and exploring evolutionary sequence space. Copyright © 2017 Elsevier Inc. All rights reserved.
Complete Genome Sequence of Porcine Parvovirus 2 Recovered from Swine Sera.
Campos, F S; Kluge, M; Franco, A C; Giongo, A; Valdez, F P; Saddi, T M; Brito, W M E D; Roehe, P M
2016-01-28
A complete genomic sequence of porcine parvovirus 2 (PPV-2) was detected by viral metagenome analysis on swine sera. A phylogenetic analysis of this genome reveals that it is highly similar to previously reported North American PPV-2 genomes. The complete PPV-2 sequence is 5,426 nucleotides long. Copyright © 2016 Campos et al.
Sequencing, Analysis, and Annotation of Expressed Sequence Tags for Camelus dromedarius
Al-Swailem, Abdulaziz M.; Shehata, Maher M.; Abu-Duhier, Faisel M.; Al-Yamani, Essam J.; Al-Busadah, Khalid A.; Al-Arawi, Mohammed S.; Al-Khider, Ali Y.; Al-Muhaimeed, Abdullah N.; Al-Qahtani, Fahad H.; Manee, Manee M.; Al-Shomrani, Badr M.; Al-Qhtani, Saad M.; Al-Harthi, Amer S.; Akdemir, Kadir C.; Otu, Hasan H.
2010-01-01
Despite its economical, cultural, and biological importance, there has not been a large scale sequencing project to date for Camelus dromedarius. With the goal of sequencing complete DNA of the organism, we first established and sequenced camel EST libraries, generating 70,272 reads. Following trimming, chimera check, repeat masking, cluster and assembly, we obtained 23,602 putative gene sequences, out of which over 4,500 potentially novel or fast evolving gene sequences do not carry any homology to other available genomes. Functional annotation of sequences with similarities in nucleotide and protein databases has been obtained using Gene Ontology classification. Comparison to available full length cDNA sequences and Open Reading Frame (ORF) analysis of camel sequences that exhibit homology to known genes show more than 80% of the contigs with an ORF>300 bp and ∼40% hits extending to the start codons of full length cDNAs suggesting successful characterization of camel genes. Similarity analyses are done separately for different organisms including human, mouse, bovine, and rat. Accompanying web portal, CAGBASE (http://camel.kacst.edu.sa/), hosts a relational database containing annotated EST sequences and analysis tools with possibility to add sequences from public domain. We anticipate our results to provide a home base for genomic studies of camel and other comparative studies enabling a starting point for whole genome sequencing of the organism. PMID:20502665
Arnold, Roland; Goldenberg, Florian; Mewes, Hans-Werner; Rattei, Thomas
2014-01-01
The Similarity Matrix of Proteins (SIMAP, http://mips.gsf.de/simap/) database has been designed to massively accelerate computationally expensive protein sequence analysis tasks in bioinformatics. It provides pre-calculated sequence similarities interconnecting the entire known protein sequence universe, complemented by pre-calculated protein features and domains, similarity clusters and functional annotations. SIMAP covers all major public protein databases as well as many consistently re-annotated metagenomes from different repositories. As of September 2013, SIMAP contains >163 million proteins corresponding to ∼70 million non-redundant sequences. SIMAP uses the sensitive FASTA search heuristics, the Smith–Waterman alignment algorithm, the InterPro database of protein domain models and the BLAST2GO functional annotation algorithm. SIMAP assists biologists by facilitating the interactive exploration of the protein sequence universe. Web-Service and DAS interfaces allow connecting SIMAP with any other bioinformatic tool and resource. All-against-all protein sequence similarity matrices of project-specific protein collections are generated on request. Recent improvements allow SIMAP to cover the rapidly growing sequenced protein sequence universe. New Web-Service interfaces enhance the connectivity of SIMAP. Novel tools for interactive extraction of protein similarity networks have been added. Open access to SIMAP is provided through the web portal; the portal also contains instructions and links for software access and flat file downloads. PMID:24165881
USDA-ARS?s Scientific Manuscript database
Contigs with sequence similarities to several nucleorhabdoviruses were identified by high-throughput sequencing analysis from a black currant (Ribes nigrum L.) cultivar. The complete genomic sequence of this new nucleorhabdovirus is 14,432 nucleotides. Its genomic organization is typical of nucleorh...
Wu, L-P; Yang, T; Liu, H-W; Postman, J; Li, R
2018-05-01
A large contig with sequence similarities to several nucleorhabdoviruses was identified by high-throughput sequencing analysis from a black currant (Ribes nigrum L.) cultivar. The complete genome sequence of this new nucleorhabdovirus is 14,432 nucleotides long. Its genomic organization is very similar to those of unsegmented plant rhabdoviruses, containing six open reading frames in the order 3'-N-P-P3-M-G-L-5. The virus, which is provisionally named "black currant-associated rhabdovirus", is 41-52% identical in its genome nucleotide sequence to other nucleorhabdoviruses and may represent a new species in the genus Nucleorhabdovirus.
Ensser, Armin; Großkopf, Anna K; Mätz-Rensing, Kerstin; Roos, Christian; Hahn, Alexander S
2018-06-02
SFVmmu-DPZ9524 represents the third completely sequenced rhesus macaque simian foamy virus (SFV) isolate, alongside SFVmmu_K3T with a similar SFV-1-type env, and R289HybAGM with a SFV-2-like env. Sequence analysis demonstrates that, in gag and pol, SFVmmu-DPZ9524 is more closely related to R289HybAGM than to SFVmmu_K3T, which, outside of env, is more similar to a Japanese macaque isolate than to the other two rhesus macaque isolates SFVmmu-DPZ9524 and R289HybAGM. Further, we identify bel as another recombinant locus in R289HybAGM, confirming that recombination contributes to sequence diversity in SFV.
Doss, C George Priya; Chakrabarty, Chiranjib; Debajyoti, C; Debottam, S
2014-11-01
Certain mysteries pointing toward their recruitment pathways, cell cycle regulation mechanisms, spindle checkpoint assembly, and chromosome segregation process are considered the centre of attraction in cancer research. In modern times, with the established databases, ranges of computational platforms have provided a platform to examine almost all the physiological and biochemical evidences in disease-associated phenotypes. Using existing computational methods, we have utilized the amino acid residues to understand the similarity within the evolutionary variance of different associated centromere proteins. This study related to sequence similarity, protein-protein networking, co-expression analysis, and evolutionary trajectory of centromere proteins will speed up the understanding about centromere biology and will create a road map for upcoming researchers who are initiating their work of clinical sequencing using centromere proteins.
Algorithm, applications and evaluation for protein comparison by Ramanujan Fourier transform.
Zhao, Jian; Wang, Jiasong; Hua, Wei; Ouyang, Pingkai
2015-12-01
The amino acid sequence of a protein determines its chemical properties, chain conformation and biological functions. Protein sequence comparison is of great importance to identify similarities of protein structures and infer their functions. Many properties of a protein correspond to the low-frequency signals within the sequence. Low frequency modes in protein sequences are linked to the secondary structures, membrane protein types, and sub-cellular localizations of the proteins. In this paper, we present Ramanujan Fourier transform (RFT) with a fast algorithm to analyze the low-frequency signals of protein sequences. The RFT method is applied to similarity analysis of protein sequences with the Resonant Recognition Model (RRM). The results show that the proposed fast RFT method on protein comparison is more efficient than commonly used discrete Fourier transform (DFT). RFT can detect common frequencies as significant feature for specific protein families, and the RFT spectrum heat-map of protein sequences demonstrates the information conservation in the sequence comparison. The proposed method offers a new tool for pattern recognition, feature extraction and structural analysis on protein sequences. Copyright © 2015 Elsevier Ltd. All rights reserved.
K2 and K2*: efficient alignment-free sequence similarity measurement based on Kendall statistics.
Lin, Jie; Adjeroh, Donald A; Jiang, Bing-Hua; Jiang, Yue
2018-05-15
Alignment-free sequence comparison methods can compute the pairwise similarity between a huge number of sequences much faster than sequence-alignment based methods. We propose a new non-parametric alignment-free sequence comparison method, called K2, based on the Kendall statistics. Comparing to the other state-of-the-art alignment-free comparison methods, K2 demonstrates competitive performance in generating the phylogenetic tree, in evaluating functionally related regulatory sequences, and in computing the edit distance (similarity/dissimilarity) between sequences. Furthermore, the K2 approach is much faster than the other methods. An improved method, K2*, is also proposed, which is able to determine the appropriate algorithmic parameter (length) automatically, without first considering different values. Comparative analysis with the state-of-the-art alignment-free sequence similarity methods demonstrates the superiority of the proposed approaches, especially with increasing sequence length, or increasing dataset sizes. The K2 and K2* approaches are implemented in the R language as a package and is freely available for open access (http://community.wvu.edu/daadjeroh/projects/K2/K2_1.0.tar.gz). yueljiang@163.com. Supplementary data are available at Bioinformatics online.
Mouse Vk gene classification by nucleic acid sequence similarity.
Strohal, R; Helmberg, A; Kroemer, G; Kofler, R
1989-01-01
Analyses of immunoglobulin (Ig) variable (V) region gene usage in the immune response, estimates of V gene germline complexity, and other nucleic acid hybridization-based studies depend on the extent to which such genes are related (i.e., sequence similarity) and their organization in gene families. While mouse Igh heavy chain V region (VH) gene families are relatively well-established, a corresponding systematic classification of Igk light chain V region (Vk) genes has not been reported. The present analysis, in the course of which we reviewed the known extent of the Vk germline gene repertoire and Vk gene usage in a variety of responses to foreign and self antigens, provides a classification of mouse Vk genes in gene families composed of members with greater than 80% overall nucleic acid sequence similarity. This classification differed in several aspects from that of VH genes: only some Vk gene families were as clearly separated (by greater than 25% sequence dissimilarity) as typical VH gene families; most Vk gene families were closely related and, in several instances, members from different families were very similar (greater than 80%) over large sequence portions; frequently, classification by nucleic acid sequence similarity diverged from existing classifications based on amino-terminal protein sequence similarity. Our data have implications for Vk gene analyses by nucleic acid hybridization and describe potentially important differences in sequence organization between VH and Vk genes.
Molecular evidence for piroplasms in wild Reeves' muntjac (Muntiacus reevesi) in China.
Yang, Ji-fei; Li, You-quan; Liu, Zhi-jie; Liu, Jun-long; Guan, Gui-quan; Chen, Ze; Luo, Jian-xun; Wang, Xiao-long; Yin, Hong
2014-10-01
DNA from liver samples of 17 free-ranging wild Reeves' muntjac (Muntiacus reevesi) was used for PCR amplification of piropalsm 18S rRNA gene. Of 17 samples, 14 (82.4%) showed a specific PCR product which were cloned and sequenced. BLAST analysis of the sequences obtained showed similarities to Babesia sp., Theileria capreoli, Theileria uilenbergi and Theileria sp. BO302-SE. Phylogenetic analysis showed that the Babesia sp. detected in the present study was distantly separated from known Babesia species of wild and domestic animals. Six sequences showed 100% similarity to T. capreoli while five sequences were separated from all known Theileria species and constituted an independent clade with Theileria sp. BO302-SE derived from roe deer in Italy; two sequences were close to T. uilenbergi with 97% similarity. This is the first description of hemoparasite infection in free-ranging wild Reeves' muntjac in China. Our results indicate that wild Reeves' muntjac may play an important reservoir role for hemoparasites. Crown Copyright © 2014. Published by Elsevier Ireland Ltd. All rights reserved.
Ali, M A; Al-Hemaid, F M; Lee, J; Hatamleh, A A; Gyulai, G; Rahman, M O
2015-10-02
The present study explored the systematic inventory of Echinops L. (Asteraceae) of Saudi Arabia, with special reference to the molecular typing of Echinops abuzinadianus Chaudhary, an endemic species to Saudi Arabia, based on the internal transcribed spacer (ITS) sequences (ITS1-5.8S-ITS2) of nuclear ribosomal DNA. A sequence similarity search using BLAST and a phylogenetic analysis of the ITS sequence of E. abuzinadianus revealed a high level of sequence similarity with E. glaberrimus DC. (section Ritropsis). The novel primary sequence and the secondary structure of ITS2 of E. abuzinadianus could potentially be used for molecular genotyping.
2010-01-01
Background Little genomic or trancriptomic information on Ganoderma lucidum (Lingzhi) is known. This study aims to discover the transcripts involved in secondary metabolite biosynthesis and developmental regulation of G. lucidum using an expressed sequence tag (EST) library. Methods A cDNA library was constructed from the G. lucidum fruiting body. Its high-quality ESTs were assembled into unique sequences with contigs and singletons. The unique sequences were annotated according to sequence similarities to genes or proteins available in public databases. The detection of simple sequence repeats (SSRs) was preformed by online analysis. Results A total of 1,023 clones were randomly selected from the G. lucidum library and sequenced, yielding 879 high-quality ESTs. These ESTs showed similarities to a diverse range of genes. The sequences encoding squalene epoxidase (SE) and farnesyl-diphosphate synthase (FPS) were identified in this EST collection. Several candidate genes, such as hydrophobin, MOB2, profilin and PHO84 were detected for the first time in G. lucidum. Thirteen (13) potential SSR-motif microsatellite loci were also identified. Conclusion The present study demonstrates a successful application of EST analysis in the discovery of transcripts involved in the secondary metabolite biosynthesis and the developmental regulation of G. lucidum. PMID:20230644
Kickoff to Conflict: A Sequence Analysis of Intra-State Conflict-Preceding Event Structures
D'Orazio, Vito; Yonamine, James E.
2015-01-01
While many studies have suggested or assumed that the periods preceding the onset of intra-state conflict are similar across time and space, few have empirically tested this proposition. Using the Integrated Crisis Early Warning System's domestic event data in Asia from 1998–2010, we subject this proposition to empirical analysis. We code the similarity of government-rebel interactions in sequences preceding the onset of intra-state conflict to those preceding further periods of peace using three different metrics: Euclidean, Levenshtein, and mutual information. These scores are then used as predictors in a bivariate logistic regression to forecast whether we are likely to observe conflict in neither, one, or both of the states. We find that our model accurately classifies cases where both sequences precede peace, but struggles to distinguish between cases in which one sequence escalates to conflict and where both sequences escalate to conflict. These findings empirically suggest that generalizable patterns exist between event sequences that precede peace. PMID:25951105
Haq, Saddef; Sameroff, Stephen; Howie, Stephen R. C.; Lipkin, W. Ian
2013-01-01
Coxsackieviruses (CV) A1, CV-A19 and CV-A22 have historically comprised a distinct phylogenetic clade within Enterovirus (EV) C. Several novel serotypes that are genetically similar to these three viruses have been recently discovered and characterized. Here, we report the coding sequence analysis of two genotypes of a previously uncharacterized serotype EV-C113 from Bangladesh and demonstrate that it is most similar to CV-A22 and EV-C116 within the capsid region. We sequenced novel genotypes of CV-A1, CV-A19 and CV-A22 from Bangladesh and observed a high rate of recombination within this group. We also report genomic analysis of the rarely reported EV-C104 circulating in the Gambia in 2009. All available EV-C104 sequences displayed a high degree of similarity within the structural genes but formed two clusters within the non-structural genes. One cluster included the recently reported EV-C117, suggesting an ancestral recombination between these two serotypes. Phylogenetic analysis of all available complete genome sequences indicated the existence of two subgroups within this distinct Enterovirus C clade: one has been exclusively recovered from gastrointestinal samples, while the other cluster has been implicated in respiratory disease. PMID:23761409
The HMMER Web Server for Protein Sequence Similarity Search.
Prakash, Ananth; Jeffryes, Matt; Bateman, Alex; Finn, Robert D
2017-12-08
Protein sequence similarity search is one of the most commonly used bioinformatics methods for identifying evolutionarily related proteins. In general, sequences that are evolutionarily related share some degree of similarity, and sequence-search algorithms use this principle to identify homologs. The requirement for a fast and sensitive sequence search method led to the development of the HMMER software, which in the latest version (v3.1) uses a combination of sophisticated acceleration heuristics and mathematical and computational optimizations to enable the use of profile hidden Markov models (HMMs) for sequence analysis. The HMMER Web server provides a common platform by linking the HMMER algorithms to databases, thereby enabling the search for homologs, as well as providing sequence and functional annotation by linking external databases. This unit describes three basic protocols and two alternate protocols that explain how to use the HMMER Web server using various input formats and user defined parameters. © 2017 by John Wiley & Sons, Inc. Copyright © 2017 John Wiley & Sons, Inc.
Rattei, Thomas; Tischler, Patrick; Götz, Stefan; Jehl, Marc-André; Hoser, Jonathan; Arnold, Roland; Conesa, Ana; Mewes, Hans-Werner
2010-01-01
The prediction of protein function as well as the reconstruction of evolutionary genesis employing sequence comparison at large is still the most powerful tool in sequence analysis. Due to the exponential growth of the number of known protein sequences and the subsequent quadratic growth of the similarity matrix, the computation of the Similarity Matrix of Proteins (SIMAP) becomes a computational intensive task. The SIMAP database provides a comprehensive and up-to-date pre-calculation of the protein sequence similarity matrix, sequence-based features and sequence clusters. As of September 2009, SIMAP covers 48 million proteins and more than 23 million non-redundant sequences. Novel features of SIMAP include the expansion of the sequence space by including databases such as ENSEMBL as well as the integration of metagenomes based on their consistent processing and annotation. Furthermore, protein function predictions by Blast2GO are pre-calculated for all sequences in SIMAP and the data access and query functions have been improved. SIMAP assists biologists to query the up-to-date sequence space systematically and facilitates large-scale downstream projects in computational biology. Access to SIMAP is freely provided through the web portal for individuals (http://mips.gsf.de/simap/) and for programmatic access through DAS (http://webclu.bio.wzw.tum.de/das/) and Web-Service (http://mips.gsf.de/webservices/services/SimapService2.0?wsdl).
[Detection and diversity analysis of rumen methanogens in the co-cultures with anaerobic fungi].
Cheng, Yan-fen; Mao, Sheng-yong; Pei, Cai-xia; Liu, Jian-xin; Zhu, Wei-yun
2006-12-01
Rumen methanogen diversity in the co-cultures with anaerobic fungi from goat rumen was analyzed. Mix-cultures of anaerobic fungi and methanogens were obtained from goat rumen using anaerobic fungal medium and the addition of penicillin and streptomycin and then subcultured 62 times by transferring cultures every 3 - 4d. Total DNA from the original rumen fluid and subcultured fungal cultures was used for PCR/DGGE and RFLP analysis. 16S rDNA of clones corresponding to representative OTUs were sequenced. Results showed that the diversity index (Shannon index) of the methanogens generated from DGGE profiles reduced from 1.32 to 0.99 from rumen fluid to fungal culture after 45 subculturing, with the lowest similarity of DGGE profiles at 34.7%. The Shannon index increased from 0.99 to 1.15 from the fungal culture after 45 subculturing to that after 62 subculturing, with the lowest similarity at 89.2% . A total of 5 OTUs were obtained from 69. clones using RFLP analysis and six clones representing the 5 OTUs respectively were sequenced. Of the 5 OTUs, three had their cloned 16S rDNA sequences most closely related to uncultured archaeal symbiont PA202 with the same similarity of 95 %, but had not closely related to any identified culturable methanogen. The rest two OTUs had their cloned 16S rDNA sequences sharing the same closest relative, uncultured rumen methanogen 956, with the same similarity of 97% .Their 16S rDNA sequences of these two OTUs also showed 97% similar to the closest identified culturable methanogen Methanobrevibacter sp. NT7. In conclusion, diverse yet unidentified rumen methanogen species exist in the co-cultures with anaerobic fungi isolated from the goat rumen.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wu, Liyou; Yi, T. Y.; Van Nostrand, Joy
Phylogenetic analyses were done for the Shewanella strains isolated from Baltic Sea (38 strains), US DOE Hanford Uranium bioremediation site [Hanford Reach of the Columbia River (HRCR), 11 strains], Pacific Ocean and Hawaiian sediments (8 strains), and strains from other resources (16 strains) with three out group strains, Rhodopseudomonas palustris, Clostridium cellulolyticum, and Thermoanaerobacter ethanolicus X514, using DNA relatedness derived from WCGA-based DNA-DNA hybridizations, sequence similarities of 16S rRNA gene and gyrB gene, and sequence similarities of 6 loci of Shewanella genome selected from a shared gene list of the Shewanella strains with whole genome sequenced based on the averagemore » nucleotide identity of them (ANI). The phylogenetic trees based on 16S rRNA and gyrB gene sequences, and DNA relatedness derived from WCGA hybridizations of the tested Shewanella strains share exactly the same sub-clusters with very few exceptions, in which the strains were basically grouped by species. However, the phylogenetic analysis based on DNA relatedness derived from WCGA hybridizations dramatically increased the differentiation resolution at species and strains level within Shewanella genus. When the tree based on DNA relatedness derived from WCGA hybridizations was compared to the tree based on the combined sequences of the selected functional genes (6 loci), we found that the resolutions of both methods are similar, but the clustering of the tree based on DNA relatedness derived from WMGA hybridizations was clearer. These results indicate that WCGA-based DNA-DNA hybridization is an idea alternative of conventional DNA-DNA hybridization methods and it is superior to the phylogenetics methods based on sequence similarities of single genes. Detailed analysis is being performed for the re-classification of the strains examined.« less
2011-01-01
The genomic DNA sequence of a novel enteric uncultured microphage, ΦCA82 from a turkey gastrointestinal system was determined utilizing metagenomics techniques. The entire circular, single-stranded nucleotide sequence of the genome was 5,514 nucleotides. The ΦCA82 genome is quite different from other microviruses as indicated by comparisons of nucleotide similarity, predicted protein similarity, and functional classifications. Only three genes showed significant similarity to microviral proteins as determined by local alignments using BLAST analysis. ORF1 encoded a predicted phage F capsid protein that was phylogenetically most similar to the Microviridae ΦMH2K member's major coat protein. The ΦCA82 genome also encoded a predicted minor capsid protein (ORF2) and putative replication initiation protein (ORF3) most similar to the microviral bacteriophage SpV4. The distant evolutionary relationship of ΦCA82 suggests that the divergence of this novel turkey microvirus from other microviruses may reflect unique evolutionary pressures encountered within the turkey gastrointestinal system. PMID:21714899
Postel, Alexander; Schmeiser, Stefanie; Zimmermann, Bernd; Becher, Paul
2016-01-01
Molecular epidemiology has become an indispensable tool in the diagnosis of diseases and in tracing the infection routes of pathogens. Due to advances in conventional sequencing and the development of high throughput technologies, the field of sequence determination is in the process of being revolutionized. Platforms for sharing sequence information and providing standardized tools for phylogenetic analyses are becoming increasingly important. The database (DB) of the European Union (EU) and World Organisation for Animal Health (OIE) Reference Laboratory for classical swine fever offers one of the world’s largest semi-public virus-specific sequence collections combined with a module for phylogenetic analysis. The classical swine fever (CSF) DB (CSF-DB) became a valuable tool for supporting diagnosis and epidemiological investigations of this highly contagious disease in pigs with high socio-economic impacts worldwide. The DB has been re-designed and now allows for the storage and analysis of traditionally used, well established genomic regions and of larger genomic regions including complete viral genomes. We present an application example for the analysis of highly similar viral sequences obtained in an endemic disease situation and introduce the new geographic “CSF Maps” tool. The concept of this standardized and easy-to-use DB with an integrated genetic typing module is suited to serve as a blueprint for similar platforms for other human or animal viruses. PMID:27827988
Ishikawa, Sohta A; Inagaki, Yuji; Hashimoto, Tetsuo
2012-01-01
In phylogenetic analyses of nucleotide sequences, 'homogeneous' substitution models, which assume the stationarity of base composition across a tree, are widely used, albeit individual sequences may bear distinctive base frequencies. In the worst-case scenario, a homogeneous model-based analysis can yield an artifactual union of two distantly related sequences that achieved similar base frequencies in parallel. Such potential difficulty can be countered by two approaches, 'RY-coding' and 'non-homogeneous' models. The former approach converts four bases into purine and pyrimidine to normalize base frequencies across a tree, while the heterogeneity in base frequency is explicitly incorporated in the latter approach. The two approaches have been applied to real-world sequence data; however, their basic properties have not been fully examined by pioneering simulation studies. Here, we assessed the performances of the maximum-likelihood analyses incorporating RY-coding and a non-homogeneous model (RY-coding and non-homogeneous analyses) on simulated data with parallel convergence to similar base composition. Both RY-coding and non-homogeneous analyses showed superior performances compared with homogeneous model-based analyses. Curiously, the performance of RY-coding analysis appeared to be significantly affected by a setting of the substitution process for sequence simulation relative to that of non-homogeneous analysis. The performance of a non-homogeneous analysis was also validated by analyzing a real-world sequence data set with significant base heterogeneity.
Community detection in sequence similarity networks based on attribute clustering
Chowdhary, Janamejaya; Loeffler, Frank E.; Smith, Jeremy C.
2017-07-24
Networks are powerful tools for the presentation and analysis of interactions in multi-component systems. A commonly studied mesoscopic feature of networks is their community structure, which arises from grouping together similar nodes into one community and dissimilar nodes into separate communities. Here in this paper, the community structure of protein sequence similarity networks is determined with a new method: Attribute Clustering Dependent Communities (ACDC). Sequence similarity has hitherto typically been quantified by the alignment score or its expectation value. However, pair alignments with the same score or expectation value cannot thus be differentiated. To overcome this deficiency, the method constructs,more » for pair alignments, an extended alignment metric, the link attribute vector, which includes the score and other alignment characteristics. Rescaling components of the attribute vectors qualitatively identifies a systematic variation of sequence similarity within protein superfamilies. The problem of community detection is then mapped to clustering the link attribute vectors, selection of an optimal subset of links and community structure refinement based on the partition density of the network. ACDC-predicted communities are found to be in good agreement with gold standard sequence databases for which the "ground truth" community structures (or families) are known. ACDC is therefore a community detection method for sequence similarity networks based entirely on pair similarity information. A serial implementation of ACDC is available from https://cmb.ornl.gov/resources/developments« less
Community detection in sequence similarity networks based on attribute clustering
DOE Office of Scientific and Technical Information (OSTI.GOV)
Chowdhary, Janamejaya; Loeffler, Frank E.; Smith, Jeremy C.
Networks are powerful tools for the presentation and analysis of interactions in multi-component systems. A commonly studied mesoscopic feature of networks is their community structure, which arises from grouping together similar nodes into one community and dissimilar nodes into separate communities. Here in this paper, the community structure of protein sequence similarity networks is determined with a new method: Attribute Clustering Dependent Communities (ACDC). Sequence similarity has hitherto typically been quantified by the alignment score or its expectation value. However, pair alignments with the same score or expectation value cannot thus be differentiated. To overcome this deficiency, the method constructs,more » for pair alignments, an extended alignment metric, the link attribute vector, which includes the score and other alignment characteristics. Rescaling components of the attribute vectors qualitatively identifies a systematic variation of sequence similarity within protein superfamilies. The problem of community detection is then mapped to clustering the link attribute vectors, selection of an optimal subset of links and community structure refinement based on the partition density of the network. ACDC-predicted communities are found to be in good agreement with gold standard sequence databases for which the "ground truth" community structures (or families) are known. ACDC is therefore a community detection method for sequence similarity networks based entirely on pair similarity information. A serial implementation of ACDC is available from https://cmb.ornl.gov/resources/developments« less
Biosequence Similarity Search on the Mercury System
Krishnamurthy, Praveen; Buhler, Jeremy; Chamberlain, Roger; Franklin, Mark; Gyang, Kwame; Jacob, Arpith; Lancaster, Joseph
2007-01-01
Biosequence similarity search is an important application in modern molecular biology. Search algorithms aim to identify sets of sequences whose extensional similarity suggests a common evolutionary origin or function. The most widely used similarity search tool for biosequences is BLAST, a program designed to compare query sequences to a database. Here, we present the design of BLASTN, the version of BLAST that searches DNA sequences, on the Mercury system, an architecture that supports high-volume, high-throughput data movement off a data store and into reconfigurable hardware. An important component of application deployment on the Mercury system is the functional decomposition of the application onto both the reconfigurable hardware and the traditional processor. Both the Mercury BLASTN application design and its performance analysis are described. PMID:18846267
Sul, Woo Jun; Cole, James R.; Jesus, Ederson da C.; Wang, Qiong; Farris, Ryan J.; Fish, Jordan A.; Tiedje, James M.
2011-01-01
High-throughput sequencing of 16S rRNA genes has increased our understanding of microbial community structure, but now even higher-throughput methods to the Illumina scale allow the creation of much larger datasets with more samples and orders-of-magnitude more sequences that swamp current analytic methods. We developed a method capable of handling these larger datasets on the basis of assignment of sequences into an existing taxonomy using a supervised learning approach (taxonomy-supervised analysis). We compared this method with a commonly used clustering approach based on sequence similarity (taxonomy-unsupervised analysis). We sampled 211 different bacterial communities from various habitats and obtained ∼1.3 million 16S rRNA sequences spanning the V4 hypervariable region by pyrosequencing. Both methodologies gave similar ecological conclusions in that β-diversity measures calculated by using these two types of matrices were significantly correlated to each other, as were the ordination configurations and hierarchical clustering dendrograms. In addition, our taxonomy-supervised analyses were also highly correlated with phylogenetic methods, such as UniFrac. The taxonomy-supervised analysis has the advantages that it is not limited by the exhaustive computation required for the alignment and clustering necessary for the taxonomy-unsupervised analysis, is more tolerant of sequencing errors, and allows comparisons when sequences are from different regions of the 16S rRNA gene. With the tremendous expansion in 16S rRNA data acquisition underway, the taxonomy-supervised approach offers the potential to provide more rapid and extensive community comparisons across habitats and samples. PMID:21873204
Comparative analysis of the feline immunoglobulin repertoire.
Steiniger, Sebastian C J; Glanville, Jacob; Harris, Douglas W; Wilson, Thomas L; Ippolito, Gregory C; Dunham, Steven A
2017-03-01
Next-Generation Sequencing combined with bioinformatics is a powerful tool for analyzing the large number of DNA sequences present in the expressed antibody repertoire and these data sets can be used to advance a number of research areas including antibody discovery and engineering. The accurate measurement of the immune repertoire sequence composition, diversity and abundance is important for understanding the repertoire response in infections, vaccinations and cancer immunology and could also be useful for elucidating novel molecular targets. In this study 4 individual domestic cats (Felis catus) were subjected to antibody repertoire sequencing with total number of sequences generated 1079863 for VH for IgG, 1050824 VH for IgM, 569518 for VK and 450195 for VL. Our analysis suggests that a similar VDJ expression patterns exists across all cats. Similar to the canine repertoire, the feline repertoire is dominated by a single subgroup, namely VH3. The antibody paratope of felines showed similar amino acid variation when compared to human, mouse and canine counterparts. All animals show a similarly skewed VH CDR-H3 profile and, when compared to canine, human and mouse, distinct differences are observed. Our study represents the first attempt to characterize sequence diversity in the expressed feline antibody repertoire and this demonstrates the utility of using NGS to elucidate entire antibody repertoires from individual animals. These data provide significant insight into understanding the feline immune system function. Copyright © 2017 International Alliance for Biological Standardization. Published by Elsevier Ltd. All rights reserved.
Ehlers, Claudia; Veit, Katharina; Gottschalk, Gerhard; Schmitz, Ruth A.
2002-01-01
The mesophilic methanogenic archaeon Methanosarcina mazei strain Gö1 is able to utilize molecular nitrogen (N2) as its sole nitrogen source. We have identified and characterized a single nitrogen fixation (nif) gene cluster in M. mazei Gö1 with an approximate length of 9 kbp. Sequence analysis revealed seven genes with sequence similarities to nifH, nifI1, nifI2, nifD, nifK, nifE and nifN, similar to other diazotrophic methanogens and certain bacteria such as Clostridium acetobutylicum, with the two glnB-like genes (nifI1 and nifI2) located between nifH and nifD. Phylogenetic analysis of deduced amino acid sequences for the nitrogenase structural genes of M. mazei Gö1 showed that they are most closely related to Methanosarcina barkeri nif2 genes, and also closely resemble those for the corresponding nif products of the gram-positive bacterium C. acetobutylicum. Northern blot analysis and reverse transcription PCR analysis demonstrated that the M. mazei nif genes constitute an operon transcribed only under nitrogen starvation as a single 8 kb transcript. Sequence analysis revealed a palindromic sequence at the transcriptional start site in front of the M. mazei nifH gene, which may have a function in transcriptional regulation of the nif operon. PMID:15803652
Kaplan, Oktay I; Berber, Burak; Hekim, Nezih; Doluca, Osman
2016-11-02
Many studies show that short non-coding sequences are widely conserved among regulatory elements. More and more conserved sequences are being discovered since the development of next generation sequencing technology. A common approach to identify conserved sequences with regulatory roles relies on topological changes such as hairpin formation at the DNA or RNA level. G-quadruplexes, non-canonical nucleic acid topologies with little established biological roles, are increasingly considered for conserved regulatory element discovery. Since the tertiary structure of G-quadruplexes is strongly dependent on the loop sequence which is disregarded by the generally accepted algorithm, we hypothesized that G-quadruplexes with similar topology and, indirectly, similar interaction patterns, can be determined using phylogenetic clustering based on differences in the loop sequences. Phylogenetic analysis of 52 G-quadruplex forming sequences in the Escherichia coli genome revealed two conserved G-quadruplex motifs with a potential regulatory role. Further analysis revealed that both motifs tend to form hairpins and G quadruplexes, as supported by circular dichroism studies. The phylogenetic analysis as described in this work can greatly improve the discovery of functional G-quadruplex structures and may explain unknown regulatory patterns. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.
DNA sequence analysis of the photosynthesis region of Rhodobacter sphaeroides 2.4.1.
Choudhary, M; Kaplan, S
2000-02-15
This paper describes the DNA sequence of the photosynthesis region of Rhodobacter sphaeroides 2.4.1 (T). The photosynthesis gene cluster is located within a approximately 73 kb Ase I genomic DNA fragment containing the puf, puhA, cycA and puc operons. A total of 65 open reading frames (ORFs) have been identified, of which 61 showed significant similarity to genes/proteins of other organisms while only four did not reveal any significant sequence similarity to any gene/protein sequences in the database. The data were compared with the corresponding genes/ORFs from a different strain of R.sphaeroides and Rhodobacter capsulatus, a close relative of R. sphaeroides. A detailed analysis of the gene organization in the photosynthesis region revealed a similar gene order in both species with some notable differences located to the pucBAC = cycA region. In addition, photosynthesis gene regulatory protein (PpsR, FNR, IHF) binding motifs in upstream sequences of a number of photosynthesis genes have been identified and shown to differ between these two species. The difference in gene organization relative to pucBAC and cycA suggests that this region originated independently of the photosynthesis gene cluster of R.sphaeroides.
GSP: A web-based platform for designing genome-specific primers in polyploids
USDA-ARS?s Scientific Manuscript database
The sequences among subgenomes in a polyploid species have high similarity. This makes difficult to design genome-specific primers for sequence analysis. We present a web-based platform named GSP for designing genome-specific primers to distinguish subgenome sequences in the polyploid genome backgr...
Gold, Nicola D; Jackson, Richard M
2006-02-03
The rapid growth in protein structural data and the emergence of structural genomics projects have increased the need for automatic structure analysis and tools for function prediction. Small molecule recognition is critical to the function of many proteins; therefore, determination of ligand binding site similarity is important for understanding ligand interactions and may allow their functional classification. Here, we present a binding sites database (SitesBase) that given a known protein-ligand binding site allows rapid retrieval of other binding sites with similar structure independent of overall sequence or fold similarity. However, each match is also annotated with sequence similarity and fold information to aid interpretation of structure and functional similarity. Similarity in ligand binding sites can indicate common binding modes and recognition of similar molecules, allowing potential inference of function for an uncharacterised protein or providing additional evidence of common function where sequence or fold similarity is already known. Alternatively, the resource can provide valuable information for detailed studies of molecular recognition including structure-based ligand design and in understanding ligand cross-reactivity. Here, we show examples of atomic similarity between superfamily or more distant fold relatives as well as between seemingly unrelated proteins. Assignment of unclassified proteins to structural superfamiles is also undertaken and in most cases substantiates assignments made using sequence similarity. Correct assignment is also possible where sequence similarity fails to find significant matches, illustrating the potential use of binding site comparisons for newly determined proteins.
A novel model for DNA sequence similarity analysis based on graph theory.
Qi, Xingqin; Wu, Qin; Zhang, Yusen; Fuller, Eddie; Zhang, Cun-Quan
2011-01-01
Determination of sequence similarity is one of the major steps in computational phylogenetic studies. As we know, during evolutionary history, not only DNA mutations for individual nucleotide but also subsequent rearrangements occurred. It has been one of major tasks of computational biologists to develop novel mathematical descriptors for similarity analysis such that various mutation phenomena information would be involved simultaneously. In this paper, different from traditional methods (eg, nucleotide frequency, geometric representations) as bases for construction of mathematical descriptors, we construct novel mathematical descriptors based on graph theory. In particular, for each DNA sequence, we will set up a weighted directed graph. The adjacency matrix of the directed graph will be used to induce a representative vector for DNA sequence. This new approach measures similarity based on both ordering and frequency of nucleotides so that much more information is involved. As an application, the method is tested on a set of 0.9-kb mtDNA sequences of twelve different primate species. All output phylogenetic trees with various distance estimations have the same topology, and are generally consistent with the reported results from early studies, which proves the new method's efficiency; we also test the new method on a simulated data set, which shows our new method performs better than traditional global alignment method when subsequent rearrangements happen frequently during evolutionary history.
Nowrousian, Minou; Würtz, Christian; Pöggeler, Stefanie; Kück, Ulrich
2004-03-01
One of the most challenging parts of large scale sequencing projects is the identification of functional elements encoded in a genome. Recently, studies of genomes of up to six different Saccharomyces species have demonstrated that a comparative analysis of genome sequences from closely related species is a powerful approach to identify open reading frames and other functional regions within genomes [Science 301 (2003) 71, Nature 423 (2003) 241]. Here, we present a comparison of selected sequences from Sordaria macrospora to their corresponding Neurospora crassa orthologous regions. Our analysis indicates that due to the high degree of sequence similarity and conservation of overall genomic organization, S. macrospora sequence information can be used to simplify the annotation of the N. crassa genome.
Takai, Ken; Horikoshi, Koki
1999-01-01
Molecular phylogenetic analysis of a naturally occurring microbial community in a deep-subsurface geothermal environment indicated that the phylogenetic diversity of the microbial population in the environment was extremely limited and that only hyperthermophilic archaeal members closely related to Pyrobaculum were present. All archaeal ribosomal DNA sequences contained intron-like sequences, some of which had open reading frames with repeated homing-endonuclease motifs. The sequence similarity analysis and the phylogenetic analysis of these homing endonucleases suggested the possible phylogenetic relationship among archaeal rRNA-encoded homing endonucleases. PMID:10584021
Chen, Honglin; Wang, Lixia; Liu, Xiaoyan; Hu, Liangliang; Wang, Suhua; Cheng, Xuzhen
2017-07-11
Cowpea [Vigna unguiculata (L.) Walp.] is one of the most important legumes in tropical and semi-arid regions. However, there is relatively little genomic information available for genetic research on and breeding of cowpea. The objectives of this study were to analyse the cowpea transcriptome and develop genic molecular markers for future genetic studies of this genus. Approximately 54 million high-quality cDNA sequence reads were obtained from cowpea based on Illumina paired-end sequencing technology and were de novo assembled to generate 47,899 unigenes with an N50 length of 1534 bp. Sequence similarity analysis revealed 36,289 unigenes (75.8%) with significant similarity to known proteins in the non-redundant (Nr) protein database, 23,471 unigenes (49.0%) with BLAST hits in the Swiss-Prot database, and 20,654 unigenes (43.1%) with high similarity in the Kyoto Encyclopedia of Genes and Genomes (KEGG) database. Further analysis identified 5560 simple sequence repeats (SSRs) as potential genic molecular markers. Validating a random set of 500 SSR markers yielded 54 polymorphic markers among 32 cowpea accessions. This transcriptomic analysis of cowpea provided a valuable set of genomic data for characterizing genes with important agronomic traits in Vigna unguiculata and a new set of genic SSR markers for further genetic studies and breeding in cowpea and related Vigna species.
Azospirillum zeae sp. nov., a diazotrophic bacterium isolated from rhizosphere soil of Zea mays.
Mehnaz, Samina; Weselowski, Brian; Lazarovits, George
2007-12-01
Two free-living nitrogen-fixing bacterial strains, N6 and N7(T), were isolated from corn rhizosphere. A polyphasic taxonomic approach, including morphological characterization, Biolog analysis, DNA-DNA hybridization, and 16S rRNA, cpn60 and nifH gene sequence analysis, was taken to analyse the two strains. 16S rRNA gene sequence analysis indicated that strains N6 and N7(T) both belonged to the genus Azospirillum and were closely related to Azospirillum oryzae (98.7 and 98.8 % similarity, respectively) and Azospirillum lipoferum (97.5 and 97.6 % similarity, respectively). DNA-DNA hybridization of strains N6 and N7(T) showed reassociation values of 48 and 37 %, respectively, with A. oryzae and 43 % with A. lipoferum. Sequences of the nifH and cpn60 genes of both strains showed 99 and approximately 95 % similarity, respectively, with those of A. oryzae. Chemotaxonomic characteristics (Q-10 as quinone system, 18 : 1omega7c as major fatty acid) and G+C content of the DNA (67.6 mol%) were also similar to those of members of the genus Azospirillum. Gene sequences and Biolog and fatty acid analysis showed that strains N6 and N7(T) differed from the closely related species A. lipoferum and A. oryzae. On the basis of these results, it is proposed that these nitrogen-fixing strains represent a novel species. The name Azospirillum zeae sp. nov. is suggested, with N7(T) (=NCCB 100147(T)=LMG 23989(T)) as the type strain.
RSAT 2015: Regulatory Sequence Analysis Tools
Medina-Rivera, Alejandra; Defrance, Matthieu; Sand, Olivier; Herrmann, Carl; Castro-Mondragon, Jaime A.; Delerce, Jeremy; Jaeger, Sébastien; Blanchet, Christophe; Vincens, Pierre; Caron, Christophe; Staines, Daniel M.; Contreras-Moreira, Bruno; Artufel, Marie; Charbonnier-Khamvongsa, Lucie; Hernandez, Céline; Thieffry, Denis; Thomas-Chollier, Morgane; van Helden, Jacques
2015-01-01
RSAT (Regulatory Sequence Analysis Tools) is a modular software suite for the analysis of cis-regulatory elements in genome sequences. Its main applications are (i) motif discovery, appropriate to genome-wide data sets like ChIP-seq, (ii) transcription factor binding motif analysis (quality assessment, comparisons and clustering), (iii) comparative genomics and (iv) analysis of regulatory variations. Nine new programs have been added to the 43 described in the 2011 NAR Web Software Issue, including a tool to extract sequences from a list of coordinates (fetch-sequences from UCSC), novel programs dedicated to the analysis of regulatory variants from GWAS or population genomics (retrieve-variation-seq and variation-scan), a program to cluster motifs and visualize the similarities as trees (matrix-clustering). To deal with the drastic increase of sequenced genomes, RSAT public sites have been reorganized into taxon-specific servers. The suite is well-documented with tutorials and published protocols. The software suite is available through Web sites, SOAP/WSDL Web services, virtual machines and stand-alone programs at http://www.rsat.eu/. PMID:25904632
Burkholderia cordobensis sp. nov., from agricultural soils.
Draghi, Walter O; Peeters, Charlotte; Cnockaert, Margo; Snauwaert, Cindy; Wall, Luis G; Zorreguieta, Angeles; Vandamme, Peter
2014-06-01
Two Gram-negative, rod-shaped bacteria were isolated from agricultural soils in Córdoba province in central Argentina. Their 16S rRNA gene sequences demonstrated that they belong to the genus Burkholderia, with Burkholderia zhejiangensis as most closely related formally named species; this relationship was confirmed through comparative gyrB sequence analysis. Whole-cell fatty acid analysis supported their assignment to the genus Burkholderia. Burkholderia sp. strain YI23, for which a whole-genome sequence is available, represents the same taxon, as demonstrated by its highly similar 16S rRNA (100% similarity) and gyrB (99.1-99.7%) gene sequences. The results of DNA-DNA hybridization experiments and physiological and biochemical characterization further substantiated the genotypic and phenotypic distinctiveness of the Argentinian soil isolates, for which the name Burkholderia cordobensis sp. nov. is proposed, with strain MMP81(T) ( = LMG 27620(T) = CCUG 64368(T)) as the type strain. © 2014 IUMS.
Bifidobacterium aquikefiri sp. nov., isolated from water kefir.
Laureys, David; Cnockaert, Margo; De Vuyst, Luc; Vandamme, Peter
2016-03-01
A novel Bifidobacterium , strain LMG 28769 T , was isolated from a household water kefir fermentation process. Cells were Gram-stain-positive, non-motile, non-spore-forming, catalase-negative, oxidase-negative and facultatively anaerobic short rods. Analysis of its 16S rRNA gene sequence revealed Bifidobacterium crudilactis and Bifidobacterium psychraerophilum (97.4 and 97.1 % similarity towards the respective type strain sequences) as nearest phylogenetic neighbours. Its assignment to the genus Bifidobacterium was confirmed by the presence of fructose 6-phosphate phosphoketolase activity. Analysis of the hsp60 gene sequence revealed very low similarity with nucleotide sequences in the NCBI nucleotide database. The genotypic and phenotypic analyses allowed the differentiation of strain LMG 28769 T from all recognized Bifidobacterium species. Strain LMG 28769 T ( = CCUG 67145 T = R 54638 T ) therefore represents a novel species, for which the name Bifidobacterium aquikefiri sp. nov. is proposed.
Cabrera, Ana R; Donohue, Kevin V; Khalil, Sayed M S; Scholl, Elizabeth; Opperman, Charles; Sonenshine, Daniel E; Roe, R Michael
2011-01-01
Many species of mites and ticks are of agricultural and medical importance. Much can be learned from the study of transcriptomes of acarines which can generate DNA-sequence information of potential target genes for the control of acarine pests. High throughput transcriptome sequencing can also yield sequences of genes critical during physiological processes poorly understood in acarines, i.e., the regulation of female reproduction in mites. The predatory mite, Phytoseiulus persimilis, was selected to conduct a transcriptome analysis using 454 pyrosequencing. The objective of this project was to obtain DNA-sequence information of expressed genes from P. persimilis with special interest in sequences corresponding to vitellogenin (Vg) and the vitellogenin receptor (VgR). These genes are critical to the understanding of vitellogenesis, and they will facilitate the study of the regulation of mite female reproduction. A total of 12,556 contiguous sequences (contigs) were assembled with an average size of 935bp. From these sequences, the putative translated peptides of 11 contigs were similar in amino acid sequences to other arthropod Vgs, while 6 were similar to VgRs. We selected some of these sequences to conduct stage-specific expression studies to further determine their function. 2010 Elsevier Ltd. All rights reserved.
Divide and Conquer (DC) BLAST: fast and easy BLAST execution within HPC environments
Yim, Won Cheol; Cushman, John C.
2017-07-22
Bioinformatics is currently faced with very large-scale data sets that lead to computational jobs, especially sequence similarity searches, that can take absurdly long times to run. For example, the National Center for Biotechnology Information (NCBI) Basic Local Alignment Search Tool (BLAST and BLAST+) suite, which is by far the most widely used tool for rapid similarity searching among nucleic acid or amino acid sequences, is highly central processing unit (CPU) intensive. While the BLAST suite of programs perform searches very rapidly, they have the potential to be accelerated. In recent years, distributed computing environments have become more widely accessible andmore » used due to the increasing availability of high-performance computing (HPC) systems. Therefore, simple solutions for data parallelization are needed to expedite BLAST and other sequence analysis tools. However, existing software for parallel sequence similarity searches often requires extensive computational experience and skill on the part of the user. In order to accelerate BLAST and other sequence analysis tools, Divide and Conquer BLAST (DCBLAST) was developed to perform NCBI BLAST searches within a cluster, grid, or HPC environment by using a query sequence distribution approach. Scaling from one (1) to 256 CPU cores resulted in significant improvements in processing speed. Thus, DCBLAST dramatically accelerates the execution of BLAST searches using a simple, accessible, robust, and parallel approach. DCBLAST works across multiple nodes automatically and it overcomes the speed limitation of single-node BLAST programs. DCBLAST can be used on any HPC system, can take advantage of hundreds of nodes, and has no output limitations. Thus, this freely available tool simplifies distributed computation pipelines to facilitate the rapid discovery of sequence similarities between very large data sets.« less
Divide and Conquer (DC) BLAST: fast and easy BLAST execution within HPC environments
DOE Office of Scientific and Technical Information (OSTI.GOV)
Yim, Won Cheol; Cushman, John C.
Bioinformatics is currently faced with very large-scale data sets that lead to computational jobs, especially sequence similarity searches, that can take absurdly long times to run. For example, the National Center for Biotechnology Information (NCBI) Basic Local Alignment Search Tool (BLAST and BLAST+) suite, which is by far the most widely used tool for rapid similarity searching among nucleic acid or amino acid sequences, is highly central processing unit (CPU) intensive. While the BLAST suite of programs perform searches very rapidly, they have the potential to be accelerated. In recent years, distributed computing environments have become more widely accessible andmore » used due to the increasing availability of high-performance computing (HPC) systems. Therefore, simple solutions for data parallelization are needed to expedite BLAST and other sequence analysis tools. However, existing software for parallel sequence similarity searches often requires extensive computational experience and skill on the part of the user. In order to accelerate BLAST and other sequence analysis tools, Divide and Conquer BLAST (DCBLAST) was developed to perform NCBI BLAST searches within a cluster, grid, or HPC environment by using a query sequence distribution approach. Scaling from one (1) to 256 CPU cores resulted in significant improvements in processing speed. Thus, DCBLAST dramatically accelerates the execution of BLAST searches using a simple, accessible, robust, and parallel approach. DCBLAST works across multiple nodes automatically and it overcomes the speed limitation of single-node BLAST programs. DCBLAST can be used on any HPC system, can take advantage of hundreds of nodes, and has no output limitations. Thus, this freely available tool simplifies distributed computation pipelines to facilitate the rapid discovery of sequence similarities between very large data sets.« less
Harper, B; McClain, S; Ganko, E W
2012-08-01
Global regulatory agencies require bioinformatic sequence analysis as part of their safety evaluation for transgenic crops. Analysis typically focuses on encoded proteins and adjacent endogenous flanking sequences. Recently, regulatory expectations have expanded to include all reading frames of the inserted DNA. The intent is to provide biologically relevant results that can be used in the overall assessment of safety. This paper evaluates the relevance of assessing the allergenic potential of all DNA reading frames found in common food genes using methods considered for the analysis of T-DNA sequences used in transgenic crops. FASTA and BLASTX algorithms were used to compare genes from maize, rice, soybean, cucumber, melon, watermelon, and tomato using international regulatory guidance. Results show that BLASTX for maize yielded 7254 alignments that exceeded allergen similarity thresholds and 210,772 alignments that matched eight or more consecutive amino acids with an allergen; other crops produced similar results. This analysis suggests that each nontransgenic crop has a much greater potential for allergenic risk than what has been observed clinically. We demonstrate that a meaningful safety assessment is unlikely to be provided by using methods with inherently high frequencies of false positive alignments when broadly applied to all reading frames of DNA sequence. Copyright © 2012 Elsevier Inc. All rights reserved.
Liang, Yunyun; Liu, Sanyang; Zhang, Shengli
2015-01-01
Prediction of protein structural classes for low-similarity sequences is useful for understanding fold patterns, regulation, functions, and interactions of proteins. It is well known that feature extraction is significant to prediction of protein structural class and it mainly uses protein primary sequence, predicted secondary structure sequence, and position-specific scoring matrix (PSSM). Currently, prediction solely based on the PSSM has played a key role in improving the prediction accuracy. In this paper, we propose a novel method called CSP-SegPseP-SegACP by fusing consensus sequence (CS), segmented PsePSSM, and segmented autocovariance transformation (ACT) based on PSSM. Three widely used low-similarity datasets (1189, 25PDB, and 640) are adopted in this paper. Then a 700-dimensional (700D) feature vector is constructed and the dimension is decreased to 224D by using principal component analysis (PCA). To verify the performance of our method, rigorous jackknife cross-validation tests are performed on 1189, 25PDB, and 640 datasets. Comparison of our results with the existing PSSM-based methods demonstrates that our method achieves the favorable and competitive performance. This will offer an important complementary to other PSSM-based methods for prediction of protein structural classes for low-similarity sequences.
Diversity of virus-host systems in hypersaline Lake Retba, Senegal.
Sime-Ngando, Télesphore; Lucas, Soizick; Robin, Agnès; Tucker, Kimberly Pause; Colombet, Jonathan; Bettarel, Yvan; Desmond, Elie; Gribaldo, Simonetta; Forterre, Patrick; Breitbart, Mya; Prangishvili, David
2011-08-01
Remarkable morphological diversity of virus-like particles was observed by transmission electron microscopy in a hypersaline water sample from Lake Retba, Senegal. The majority of particles morphologically resembled hyperthermophilic archaeal DNA viruses isolated from extreme geothermal environments. Some hypersaline viral morphotypes have not been previously observed in nature, and less than 1% of observed particles had a head-and-tail morphology, which is typical for bacterial DNA viruses. Culture-independent analysis of the microbial diversity in the sample suggested the dominance of extremely halophilic archaea. Few of the 16S sequences corresponded to known archeal genera (Haloquadratum, Halorubrum and Natronomonas), whereas the majority represented novel archaeal clades. Three sequences corresponded to a new basal lineage of the haloarchaea. Bacteria belonged to four major phyla, consistent with the known diversity in saline environments. Metagenomic sequencing of DNA from the purified virus-like particles revealed very few similarities to the NCBI non-redundant database at either the nucleotide or amino acid level. Some of the identifiable virus sequences were most similar to previously described haloarchaeal viruses, but no sequence similarities were found to archaeal viruses from extreme geothermal environments. A large proportion of the sequences had similarity to previously sequenced viral metagenomes from solar salterns. © 2010 Society for Applied Microbiology and Blackwell Publishing Ltd.
Caldwell, Rachel; Lin, Yan-Xia; Zhang, Ren
2015-01-01
There is a continuing interest in the analysis of gene architecture and gene expression to determine the relationship that may exist. Advances in high-quality sequencing technologies and large-scale resource datasets have increased the understanding of relationships and cross-referencing of expression data to the large genome data. Although a negative correlation between expression level and gene (especially transcript) length has been generally accepted, there have been some conflicting results arising from the literature concerning the impacts of different regions of genes, and the underlying reason is not well understood. The research aims to apply quantile regression techniques for statistical analysis of coding and noncoding sequence length and gene expression data in the plant, Arabidopsis thaliana, and fruit fly, Drosophila melanogaster, to determine if a relationship exists and if there is any variation or similarities between these species. The quantile regression analysis found that the coding sequence length and gene expression correlations varied, and similarities emerged for the noncoding sequence length (5′ and 3′ UTRs) between animal and plant species. In conclusion, the information described in this study provides the basis for further exploration into gene regulation with regard to coding and noncoding sequence length. PMID:26114098
Liu, Maoyan; Liu, Xiangning; Li, Xun; Zhang, Deyong; Dai, Liangyin; Tang, Qianjun
2016-03-01
The genome sequence of pepper vein yellows virus (PeVYV) (PeVYV-HN, accession number KP326573), isolated from pepper plants (Capsicum annuum L.) grown at the Hunan Vegetables Institute (Changsha, Hunan, China), was determined by deep sequencing of small RNAs. The PeVYV-HN genome consists of 6244 nucleotides, contains six open reading frames (ORFs), and is similar to that of an isolate (AB594828) from Japan. Its genomic organization is similar to that of members of the genus Polerovirus. Sequence analysis revealed that PeVYV-HN shared 92% sequence identity with the Japanese PeVYV genome at both the nucleotide and amino acid levels. Evolutionary analysis based on the coat protein (CP), movement protein (MP), and RNA-dependent RNA polymerase (RdRP) showed that PeVYV could be divided into two major lineages corresponding to their geographical origins. The Asian isolates have a higher population expansion frequency than the African isolates. Negative selection and genetic drift (founder effect) were found to be the potential drivers of the molecular evolution of PeVYV. Moreover, recombination was not the distinct cause of PeVYV evolution. This is the first report of a complete genomic sequence of PeVYV in China.
Santini, A C; Santos, H R M; Gross, E; Corrêa, R X
2013-03-11
The genus Burkholderia (β-Proteobacteria) currently comprises more than 60 species, including parasites, symbionts and free-living organisms. Several new species of Burkholderia have recently been described showing a great diversity of phenotypes. We examined the diversity of Burkholderia spp in environmental samples collected from Caatinga and Atlantic rainforest biomes of Bahia, Brazil. Legume nodules were collected from five locations, and 16S rDNA and recA genes of the isolated microorganisms were analyzed. Thirty-three contigs of 16S rRNA genes and four contigs of the recA gene related to the genus Burkholderia were obtained. The genetic dissimilarity of the strains ranged from 0 to 2.5% based on 16S rDNA analysis, indicating two main branches: one distinct branch of the dendrogram for the B. cepacia complex and another branch that rendered three major groups, partially reflecting host plants and locations. A dendrogram designed with sequences of this research and those designed with sequences of Burkholderia-type strains and the first hit BLAST had similar topologies. A dendrogram similar to that constructed by analysis of 16S rDNA was obtained using sequences of the fragment of the recA gene. The 16S rDNA sequences enabled sufficient identification of relevant similarities and groupings amongst isolates and the sequences that we obtained. Only 6 of the 33 isolates analyzed via 16S rDNA sequencing showed high similarity with the B. cepacia complex. Thus, over 3/4 of the isolates have potential for biotechnological applications.
The complete chloroplast genome sequence of the medicinal plant Salvia miltiorrhiza.
Qian, Jun; Song, Jingyuan; Gao, Huanhuan; Zhu, Yingjie; Xu, Jiang; Pang, Xiaohui; Yao, Hui; Sun, Chao; Li, Xian'en; Li, Chuyuan; Liu, Juyan; Xu, Haibin; Chen, Shilin
2013-01-01
Salvia miltiorrhiza is an important medicinal plant with great economic and medicinal value. The complete chloroplast (cp) genome sequence of Salvia miltiorrhiza, the first sequenced member of the Lamiaceae family, is reported here. The genome is 151,328 bp in length and exhibits a typical quadripartite structure of the large (LSC, 82,695 bp) and small (SSC, 17,555 bp) single-copy regions, separated by a pair of inverted repeats (IRs, 25,539 bp). It contains 114 unique genes, including 80 protein-coding genes, 30 tRNAs and four rRNAs. The genome structure, gene order, GC content and codon usage are similar to the typical angiosperm cp genomes. Four forward, three inverted and seven tandem repeats were detected in the Salvia miltiorrhiza cp genome. Simple sequence repeat (SSR) analysis among the 30 asterid cp genomes revealed that most SSRs are AT-rich, which contribute to the overall AT richness of these cp genomes. Additionally, fewer SSRs are distributed in the protein-coding sequences compared to the non-coding regions, indicating an uneven distribution of SSRs within the cp genomes. Entire cp genome comparison of Salvia miltiorrhiza and three other Lamiales cp genomes showed a high degree of sequence similarity and a relatively high divergence of intergenic spacers. Sequence divergence analysis discovered the ten most divergent and ten most conserved genes as well as their length variation, which will be helpful for phylogenetic studies in asterids. Our analysis also supports that both regional and functional constraints affect gene sequence evolution. Further, phylogenetic analysis demonstrated a sister relationship between Salvia miltiorrhiza and Sesamum indicum. The complete cp genome sequence of Salvia miltiorrhiza reported in this paper will facilitate population, phylogenetic and cp genetic engineering studies of this medicinal plant.
Konami, Y; Yamamoto, K; Osawa, T; Irimura, T
1995-04-01
The complete amino acid sequence of a lactose-binding Cytisus sessilifolius anti-H(O) lectin II (CSA-II) was determined using a protein sequencer. After digestion of CSA-II with endoproteinase Lys-C or Asp-N, the resulting peptides were purified by reversed-phase high performance liquid chromatography (HPLC) and then subjected to sequence analysis. Comparison of the complete amino acid sequence of CSA-II with the sequences of other leguminous seed lectins revealed regions of extensive homology. The amino acid sequence of a putative carbohydrate-binding domain of CSA-II was found to be similar to those of several anti-H(O) leguminous lectins, especially to that of the L-fucose-binding Ulex europaeus lectin I (UEA-I).
Investigating the long-term course of schizophrenia by sequence analysis.
An der Heiden, Wolfram; Häfner, Heinz
2015-08-30
In the present study we set out to explore the long-term clinical course of schizophrenia in a holistic manner by adopting sequence analysis. Our aim was to identify course types of illness by means of cluster analysis. The study was based on course and outcome data for 107 patients followed up over 134 months after first admission in the ABC Schizophrenia Study. Focusing on the main syndromes (positive, negative, depressive and unspecific symptoms) and their combinations we looked for similarities in individual illness courses using the 'optimal matching' method. A cluster analysis performed on the resulting similarity matrix yielded two main groups (a 'improving' and a 'chronic' group), which comprised a total of six different types of illness course. The course types differed in both quantitative (frequency of syndromes and syndrome combinations) and qualitative terms (clinical presentation, sequence of syndromes). Cluster membership was only rarely, but clearly associated with sociodemographic characteristics, treatment data and other illness variables. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.
EUGENE'HOM: A generic similarity-based gene finder using multiple homologous sequences.
Foissac, Sylvain; Bardou, Philippe; Moisan, Annick; Cros, Marie-Josée; Schiex, Thomas
2003-07-01
EUGENE'HOM is a gene prediction software for eukaryotic organisms based on comparative analysis. EUGENE'HOM is able to take into account multiple homologous sequences from more or less closely related organisms. It integrates the results of TBLASTX analysis, splice site and start codon prediction and a robust coding/non-coding probabilistic model which allows EUGENE'HOM to handle sequences from a variety of organisms. The current target of EUGENE'HOM is plant sequences. The EUGENE'HOM web site is available at http://genopole.toulouse.inra.fr/bioinfo/eugene/EuGeneHom/cgi-bin/EuGeneHom.pl.
FRESCO: Referential compression of highly similar sequences.
Wandelt, Sebastian; Leser, Ulf
2013-01-01
In many applications, sets of similar texts or sequences are of high importance. Prominent examples are revision histories of documents or genomic sequences. Modern high-throughput sequencing technologies are able to generate DNA sequences at an ever-increasing rate. In parallel to the decreasing experimental time and cost necessary to produce DNA sequences, computational requirements for analysis and storage of the sequences are steeply increasing. Compression is a key technology to deal with this challenge. Recently, referential compression schemes, storing only the differences between a to-be-compressed input and a known reference sequence, gained a lot of interest in this field. In this paper, we propose a general open-source framework to compress large amounts of biological sequence data called Framework for REferential Sequence COmpression (FRESCO). Our basic compression algorithm is shown to be one to two orders of magnitudes faster than comparable related work, while achieving similar compression ratios. We also propose several techniques to further increase compression ratios, while still retaining the advantage in speed: 1) selecting a good reference sequence; and 2) rewriting a reference sequence to allow for better compression. In addition,we propose a new way of further boosting the compression ratios by applying referential compression to already referentially compressed files (second-order compression). This technique allows for compression ratios way beyond state of the art, for instance,4,000:1 and higher for human genomes. We evaluate our algorithms on a large data set from three different species (more than 1,000 genomes, more than 3 TB) and on a collection of versions of Wikipedia pages. Our results show that real-time compression of highly similar sequences at high compression ratios is possible on modern hardware.
Brittnacher, Mitchell J; Heltshe, Sonya L; Hayden, Hillary S; Radey, Matthew C; Weiss, Eli J; Damman, Christopher J; Zisman, Timothy L; Suskind, David L; Miller, Samuel I
2016-01-01
Comparative analysis of gut microbiomes in clinical studies of human diseases typically rely on identification and quantification of species or genes. In addition to exploring specific functional characteristics of the microbiome and potential significance of species diversity or expansion, microbiome similarity is also calculated to study change in response to therapies directed at altering the microbiome. Established ecological measures of similarity can be constructed from species abundances, however methods for calculating these commonly used ecological measures of similarity directly from whole genome shotgun (WGS) metagenomic sequence are lacking. We present an alignment-free method for calculating similarity of WGS metagenomic sequences that is analogous to the Bray-Curtis index for species, implemented by the General Utility for Testing Sequence Similarity (GUTSS) software application. This method was applied to intestinal microbiomes of healthy young children to measure developmental changes toward an adult microbiome during the first 3 years of life. We also calculate similarity of donor and recipient microbiomes to measure establishment, or engraftment, of donor microbiota in fecal microbiota transplantation (FMT) studies focused on mild to moderate Crohn's disease. We show how a relative index of similarity to donor can be calculated as a measure of change in a patient's microbiome toward that of the donor in response to FMT. Because clinical efficacy of the transplant procedure cannot be fully evaluated without analysis methods to quantify actual FMT engraftment, we developed a method for detecting change in the gut microbiome that is independent of species identification and database bias, sensitive to changes in relative abundance of the microbial constituents, and can be formulated as an index for correlating engraftment success with clinical measures of disease. More generally, this method may be applied to clinical evaluation of human microbiomes and provide potential diagnostic determination of individuals who may be candidates for specific therapies directed at alteration of the microbiome.
Enterococcus Xinjiangensis sp. nov., Isolated from Yogurt of Xinjiang, China.
Ren, Xiaopu; Li, Mingyang; Guo, Dongqi
2016-09-01
A Gram-strain-positive bacterial strain 48(T) was isolated from traditional yogurt in Xinjiang Province, China. The bacterium was characterized by a polyphasic approach, including 16S rRNA gene sequence analysis, polymerase α subunit (rpoA) gene sequence analysis, determination of DNA G+C content, DNA-DNA hybridization with the type strain of Enterococcus ratti and analysis of phenotypic features. Strain 48(T) accounted for 96.1, 95.8, 95.8, and 95.7 % with Enterococcus faecium CGMCC 1.2136(T), Enterococcus hirae ATCC 9790(T), Enterococcus durans CECT 411(T), and E. ratti ATCC 700914(T) in the 16S rRNA gene sequence similarities, respectively. The sequence of rpoA gene showed similarities of 99.0, 96.0, 96.0, and 96 % with that of E. faecium ATCC 19434(T), Enterococcus villorum LMG12287, E. hirae ATCC 9790(T), and E. durans ATCC 19432(T), respectively. Based upon of polyphasic characterization data obtained in the study, a novel species, Enterococcus xinjiangensis sp. nov., was proposed and the type strain was 48(T)(=CCTCC AB 2014041(T) = JCM 30200(T)).
Genome Sequences of Akhmeta Virus, an Early Divergent Old World Orthopoxvirus.
Gao, Jinxin; Gigante, Crystal; Khmaladze, Ekaterine; Liu, Pengbo; Tang, Shiyuyun; Wilkins, Kimberly; Zhao, Kun; Davidson, Whitni; Nakazawa, Yoshinori; Maghlakelidze, Giorgi; Geleishvili, Marika; Kokhreidze, Maka; Carroll, Darin S; Emerson, Ginny; Li, Yu
2018-05-12
Annotated whole genome sequences of three isolates of the Akhmeta virus (AKMV), a novel species of orthopoxvirus (OPXV), isolated from the Akhmeta and Vani regions of the country Georgia, are presented and discussed. The AKMV genome is similar in genomic content and structure to that of the cowpox virus (CPXV), but a lower sequence identity was found between AKMV and Old World OPXVs than between other known species of Old World OPXVs. Phylogenetic analysis showed that AKMV diverged prior to other Old World OPXV. AKMV isolates formed a monophyletic clade in the OPXV phylogeny, yet the sequence variability between AKMV isolates was higher than between the monkeypox virus strains in the Congo basin and West Africa. An AKMV isolate from Vani contained approximately six kb sequence in the left terminal region that shared a higher similarity with CPXV than with other AKMV isolates, whereas the rest of the genome was most similar to AKMV, suggesting recombination between AKMV and CPXV in a region containing several host range and virulence genes.
Dynamic scanpaths: eye movement analysis methods
NASA Astrophysics Data System (ADS)
Blackmon, Theodore T.; Ho, Yeuk F.; Chernyak, Dimitri A.; Azzariti, Michela; Stark, Lawrence W.
1999-05-01
An eye movements sequence, or scanpath, during viewing of a stationary stimulus has been described as a set of fixations onto regions-of-interest, ROIs, and the saccades or transitions between them. Such scanpaths have high similarity for the same subject and stimulus both in the spatial loci of the ROIs and their sequence; scanpaths also take place during recollection of a previously viewed stimulus, suggesting that they play a similar role in visual memory and recall.
A Case-by-Case Evolutionary Analysis of Four Imprinted Retrogenes
McCole, Ruth B; Loughran, Noeleen B; Chahal, Mandeep; Fernandes, Luis P; Roberts, Roland G; Fraternali, Franca; O'Connell, Mary J; Oakey, Rebecca J
2011-01-01
Retroposition is a widespread phenomenon resulting in the generation of new genes that are initially related to a parent gene via very high coding sequence similarity. We examine the evolutionary fate of four retrogenes generated by such an event; mouse Inpp5f_v2, Mcts2, Nap1l5, and U2af1-rs1. These genes are all subject to the epigenetic phenomenon of parental imprinting. We first provide new data on the age of these retrogene insertions. Using codon-based models of sequence evolution, we show these retrogenes have diverse evolutionary trajectories, including divergence from the parent coding sequence under positive selection pressure, purifying selection pressure maintaining parent-retrogene similarity, and neutral evolution. Examination of the expression pattern of retrogenes shows an atypical, broad pattern across multiple tissues. Protein 3D structure modeling reveals that a positively selected residue in U2af1-rs1, not shared by its parent, may influence protein conformation. Our case-by-case analysis of the evolution of four imprinted retrogenes reveals that this interesting class of imprinted genes, while similar in regulation and sequence characteristics, follow very varied evolutionary paths. PMID:21166792
Jangid, Kamlesh; Kao, Ming-Hung; Lahamge, Aishwarya; Williams, Mark A; Rathbun, Stephen L; Whitman, William B
2016-01-01
K-shuff is a new algorithm for comparing the similarity of gene sequence libraries, providing measures of the structural and compositional diversity as well as the significance of the differences between these measures. Inspired by Ripley's K-function for spatial point pattern analysis, the Intra K-function or IKF measures the structural diversity, including both the richness and overall similarity of the sequences, within a library. The Cross K-function or CKF measures the compositional diversity between gene libraries, reflecting both the number of OTUs shared as well as the overall similarity in OTUs. A Monte Carlo testing procedure then enables statistical evaluation of both the structural and compositional diversity between gene libraries. For 16S rRNA gene libraries from complex bacterial communities such as those found in seawater, salt marsh sediments, and soils, K-shuff yields reproducible estimates of structural and compositional diversity with libraries greater than 50 sequences. Similarly, for pyrosequencing libraries generated from a glacial retreat chronosequence and Illumina® libraries generated from US homes, K-shuff required >300 and 100 sequences per sample, respectively. Power analyses demonstrated that K-shuff is sensitive to small differences in Sanger or Illumina® libraries. This extra sensitivity of K-shuff enabled examination of compositional differences at much deeper taxonomic levels, such as within abundant OTUs. This is especially useful when comparing communities that are compositionally very similar but functionally different. K-shuff will therefore prove beneficial for conventional microbiome analysis as well as specific hypothesis testing.
Kuhnert, Peter; Scholten, Edzard; Haefner, Stefan; Mayor, Désirée; Frey, Joachim
2010-01-01
Gram-negative, coccoid, non-motile bacteria that are catalase-, urease- and indole-negative, facultatively anaerobic and oxidase-positive were isolated from the bovine rumen using an improved selective medium for members of the Pasteurellaceae. All strains produced significant amounts of succinic acid under anaerobic conditions with glucose as substrate. Phenotypic characterization and multilocus sequence analysis (MLSA) using 16S rRNA, rpoB, infB and recN genes were performed on seven independent isolates. All four genes showed high sequence similarity to their counterparts in the genome sequence of the patent strain MBEL55E, but less than 95 % 16S rRNA gene sequence similarity to any other species of the Pasteurellaceae. Genetically these strains form a very homogeneous group in individual as well as combined phylogenetic trees, clearly separated from other genera of the family from which they can also be separated based on phenotypic markers. Genome relatedness as deduced from the recN gene showed high interspecies similarities, but again low similarity to any of the established genera of the family. No toxicity towards bovine, human or fish cells was observed and no RTX toxin genes were detected in members of the new taxon. Based on phylogenetic clustering in the MLSA analysis, the low genetic similarity to other genera and the phenotypic distinction, we suggest to classify these bovine rumen isolates as Basfia succiniciproducens gen. nov., sp. nov. The type strain is JF4016(T) (=DSM 22022(T) =CCUG 57335(T)).
Zhang, Bochao; Meng, Wenzhao; Prak, Eline T Luning; Hershberg, Uri
2015-12-01
Immune repertoires are collections of lymphocytes that express diverse antigen receptor gene rearrangements consisting of Variable (V), (Diversity (D) in the case of heavy chains) and Joining (J) gene segments. Clonally related cells typically share the same germline gene segments and have highly similar junctional sequences within their third complementarity determining regions. Identifying clonal relatedness of sequences is a key step in the analysis of immune repertoires. The V gene is the most important for clone identification because it has the longest sequence and the greatest number of sequence variants. However, accurate identification of a clone's germline V gene source is challenging because there is a high degree of similarity between different germline V genes. This difficulty is compounded in antibodies, which can undergo somatic hypermutation. Furthermore, high-throughput sequencing experiments often generate partial sequences and have significant error rates. To address these issues, we describe a novel method to estimate which germline V genes (or alleles) cannot be discriminated under different conditions (read lengths, sequencing errors or somatic hypermutation frequencies). Starting with any set of germline V genes, this method measures their similarity using different sequencing lengths and calculates their likelihood of unambiguous assignment under different levels of mutation. Hence, one can identify, under different experimental and biological conditions, the germline V genes (or alleles) that cannot be uniquely identified and bundle them together into groups of specific V genes with highly similar sequences. Copyright © 2015 Elsevier B.V. All rights reserved.
RSAT 2015: Regulatory Sequence Analysis Tools.
Medina-Rivera, Alejandra; Defrance, Matthieu; Sand, Olivier; Herrmann, Carl; Castro-Mondragon, Jaime A; Delerce, Jeremy; Jaeger, Sébastien; Blanchet, Christophe; Vincens, Pierre; Caron, Christophe; Staines, Daniel M; Contreras-Moreira, Bruno; Artufel, Marie; Charbonnier-Khamvongsa, Lucie; Hernandez, Céline; Thieffry, Denis; Thomas-Chollier, Morgane; van Helden, Jacques
2015-07-01
RSAT (Regulatory Sequence Analysis Tools) is a modular software suite for the analysis of cis-regulatory elements in genome sequences. Its main applications are (i) motif discovery, appropriate to genome-wide data sets like ChIP-seq, (ii) transcription factor binding motif analysis (quality assessment, comparisons and clustering), (iii) comparative genomics and (iv) analysis of regulatory variations. Nine new programs have been added to the 43 described in the 2011 NAR Web Software Issue, including a tool to extract sequences from a list of coordinates (fetch-sequences from UCSC), novel programs dedicated to the analysis of regulatory variants from GWAS or population genomics (retrieve-variation-seq and variation-scan), a program to cluster motifs and visualize the similarities as trees (matrix-clustering). To deal with the drastic increase of sequenced genomes, RSAT public sites have been reorganized into taxon-specific servers. The suite is well-documented with tutorials and published protocols. The software suite is available through Web sites, SOAP/WSDL Web services, virtual machines and stand-alone programs at http://www.rsat.eu/. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.
Can natural proteins designed with 'inverted' peptide sequences adopt native-like protein folds?
Sridhar, Settu; Guruprasad, Kunchur
2014-01-01
We have carried out a systematic computational analysis on a representative dataset of proteins of known three-dimensional structure, in order to evaluate whether it would possible to 'swap' certain short peptide sequences in naturally occurring proteins with their corresponding 'inverted' peptides and generate 'artificial' proteins that are predicted to retain native-like protein fold. The analysis of 3,967 representative proteins from the Protein Data Bank revealed 102,677 unique identical inverted peptide sequence pairs that vary in sequence length between 5-12 and 18 amino acid residues. Our analysis illustrates with examples that such 'artificial' proteins may be generated by identifying peptides with 'similar structural environment' and by using comparative protein modeling and validation studies. Our analysis suggests that natural proteins may be tolerant to accommodating such peptides.
The MIGenAS integrated bioinformatics toolkit for web-based sequence analysis
Rampp, Markus; Soddemann, Thomas; Lederer, Hermann
2006-01-01
We describe a versatile and extensible integrated bioinformatics toolkit for the analysis of biological sequences over the Internet. The web portal offers convenient interactive access to a growing pool of chainable bioinformatics software tools and databases that are centrally installed and maintained by the RZG. Currently, supported tasks comprise sequence similarity searches in public or user-supplied databases, computation and validation of multiple sequence alignments, phylogenetic analysis and protein–structure prediction. Individual tools can be seamlessly chained into pipelines allowing the user to conveniently process complex workflows without the necessity to take care of any format conversions or tedious parsing of intermediate results. The toolkit is part of the Max-Planck Integrated Gene Analysis System (MIGenAS) of the Max Planck Society available at (click ‘Start Toolkit’). PMID:16844980
Cloning and sequence analysis of a cDNA clone coding for the mouse GM2 activator protein.
Bellachioma, G; Stirling, J L; Orlacchio, A; Beccari, T
1993-01-01
A cDNA (1.1 kb) containing the complete coding sequence for the mouse GM2 activator protein was isolated from a mouse macrophage library using a cDNA for the human protein as a probe. There was a single ATG located 12 bp from the 5' end of the cDNA clone followed by an open reading frame of 579 bp. Northern blot analysis of mouse macrophage RNA showed that there was a single band with a mobility corresponding to a size of 2.3 kb. We deduce from this that the mouse mRNA, in common with the mRNA for the human GM2 activator protein, has a long 3' untranslated sequence of approx. 1.7 kb. Alignment of the mouse and human deduced amino acid sequences showed 68% identity overall and 75% identity for the sequence on the C-terminal side of the first 31 residues, which in the human GM2 activator protein contains the signal peptide. Hydropathicity plots showed great similarity between the mouse and human sequences even in regions of low sequence similarity. There is a single N-glycosylation site in the mouse GM2 activator protein sequence (Asn151-Phe-Thr) which differs in its location from the single site reported in the human GM2 activator protein sequence (Asn63-Val-Thr). Images Figure 1 PMID:7689829
Elrobh, Mohamed S.; Alanazi, Mohammad S.; Khan, Wajahatullah; Abduljaleel, Zainularifeen; Al-Amri, Abdullah; Bazzi, Mohammad D.
2011-01-01
Heat shock proteins are ubiquitous, induced under a number of environmental and metabolic stresses, with highly conserved DNA sequences among mammalian species. Camelus dromedaries (the Arabian camel) domesticated under semi-desert environments, is well adapted to tolerate and survive against severe drought and high temperatures for extended periods. This is the first report of molecular cloning and characterization of full length cDNA of encoding a putative stress-induced heat shock HSPA6 protein (also called HSP70B′) from Arabian camel. A full-length cDNA (2417 bp) was obtained by rapid amplification of cDNA ends (RACE) and cloned in pET-b expression vector. The sequence analysis of HSPA6 gene showed 1932 bp-long open reading frame encoding 643 amino acids. The complete cDNA sequence of the Arabian camel HSPA6 gene was submitted to NCBI GeneBank (accession number HQ214118.1). The BLAST analysis indicated that C. dromedaries HSPA6 gene nucleotides shared high similarity (77–91%) with heat shock gene nucleotide of other mammals. The deduced 643 amino acid sequences (accession number ADO12067.1) showed that the predicted protein has an estimated molecular weight of 70.5 kDa with a predicted isoelectric point (pI) of 6.0. The comparative analyses of camel HSPA6 protein sequences with other mammalian heat shock proteins (HSPs) showed high identity (80–94%). Predicted camel HSPA6 protein structure using Protein 3D structural analysis high similarities with human and mouse HSPs. Taken together, this study indicates that the cDNA sequences of HSPA6 gene and its amino acid and protein structure from the Arabian camel are highly conserved and have similarities with other mammalian species. PMID:21845074
Bacterial diversity in permanently cold and alkaline ikaite columns from Greenland.
Schmidt, Mariane; Priemé, Anders; Stougaard, Peter
2006-12-01
Bacterial diversity in alkaline (pH 10.4) and permanently cold (4 degrees C) ikaite tufa columns from the Ikka Fjord, SW Greenland, was investigated using growth characterization of cultured bacterial isolates with Terminal-restriction fragment length polymorphism (T-RFLP) and sequence analysis of bacterial 16S rRNA gene fragments. More than 200 bacterial isolates were characterized with respect to pH and temperature tolerance, and it was shown that the majority were cold-active alkaliphiles. T-RFLP analysis revealed distinct bacterial communities in different fractions of three ikaite columns, and, along with sequence analysis, it showed the presence of rich and diverse bacterial communities. Rarefaction analysis showed that the 109 sequenced clones in the 16S rRNA gene library represented between 25 and 65% of the predicted species richness in the three ikaite columns investigated. Phylogenetic analysis of the 16S rRNA gene sequences revealed many sequences with similarity to alkaliphilic or psychrophilic bacteria, and showed that 33% of the cloned sequences and 33% of the cultured bacteria showed less than 97% sequence identity to known sequences in databases, and may therefore represent yet unknown species.
Behera, Bijay Kumar; Kumari, Kavita; Baisvar, Vishwamitra Singh; Rout, Ajaya Kumar; Pakrashi, Sudip; Paria, Prasenjet; Jena, J K
2017-01-01
In the present study, the complete mitochondrial genome sequence of Labeo gonius is reported using PGM sequencer (Ion Torrent). The complete mitogenome of L. gonius is obtained by the de novo sequences assembly of genomic reads using the Torrent Mapping Alignment Program (TMAP) which is 16 614 bp in length. The mitogenome of L. gonius comprised of 13 protein-coding genes, 22 tRNAs, 2 rRNA genes, and D-loop as control region along with gene order and organization, being similar to most of other fish mitogenomes of NCBI databases. The mitogenome in the present study has 99% similarity to the complete mitogenome sequence of Labeo fimbriatus, as reported earlier. The phylogenetic analysis of Cypriniformes depicted that their mitogenomes are closely related to each other. The complete mitogenome sequence of L. gonius would be helpful in understanding the population genetics, phylogenetics, and evolution of Indian Carps.
NASA Astrophysics Data System (ADS)
Wang, Y.; Xia, Y.; Dong, H.; Dong, X.; Yang, K.; Dong, Z.; Huang, L.
2005-12-01
Microbial communities in the deep drill cores from the Chinese Continent Scientific Drilling were analyzed with culture-independent and dependent techniques. Genomic DNA was extracted from two metamorphic rocks: S1 from 430 and S13 from 1033 meters below the ground surface. The 16S rRNA gene was amplified by polymerase chain reaction (PCR) followed by cloning and sequencing. The total cell number was counted using the 4',6-diamidino-2-phenylindole (DAPI) staining and biomass of two specific bacteria were quantified using real-time PCR. Enrichment was set up for a rock from 3911 meters below the surface in medium for authotrophic methanogens (i.e., CO2 + H2). The total cell number in S13 was 1.0 × 104 cells per gram of rock. 16S rRNA gene analysis indicated that low G + C Gram positive sequences were dominant (50 percent of all 54 clone sequenced) followed by the alpha-, beta, and gamma-Proteobacteria. Within the low G + C Gram positive bacteria, most clone sequences were similar to species of Bacillus from various natural environments (deserts, rivers etc.). Within the Proteobacteria, our clone sequences were similar to species of Acinetobacter, Acidovorax, and Aeromonas. The RT-RCP results showed that biomass of two particular clone sequences (CCSD1305, similar to Aeromonas caviae and CCSD1307, similar to Acidovorax facilis) was 95 and 1258 cells/g, respectively. A bacterial isolate was obtained from the 3911-m rock in methanogenic medium. It was Gram negative with no flagella, immobile, and facultative anaerobic, and grows optimally at 65oC. Phylogenetic analysis indicated that it was closely related to the genus of Bacillus. Physiological tests further revealed that it was a strain of Bacillus caldotenax.
Zhang, Quanwei; Gong, Jishang; Wang, Xueying; Wu, Xiaohu; Li, Yalan; Ma, Youji; Zhang, Yong; Zhao, Xingxu
2014-01-01
The IGF family is essential for normal embryonic and postnatal development and plays important roles in the immune system, myogenesis, bone metabolism and other physiological functions, which makes the study of its structure and biological characteristics important. Tianzhu white yak (Bos grunniens) domesticated under alpine hypoxia environments, is well adapted to survive and grow against severe hypoxia and cold temperatures for extended periods. In this study, a full coding sequence of the IGF2 gene of Tianzhu white yak was amplified by reverse transcription PCR and rapid-amplification of cDNA ends (RACE) for the first time. The cDNA sequence revealed an open reading frame of 450 nucleotides, encoding a protein with 179 amino acids. Its expression in different tissues was also studied by Real time PCR. Phylogenetic tree analysis indicated that yak IGF2 was similar to Bos taurus, and 3D structure showed high similarity with the human IGF2. The putative full CDS of yak IGF2 was amplified by PCR in five tissues, and cDNA sequence analysis showed high homology to bovine IGF2. Moreover the super secondary structure prediction showed a similar 3D structure with human IGF2. Its conservation in sequence and structure has facilitated research on IGF2 and its physiological function in yak. PMID:24394317
USDA-ARS?s Scientific Manuscript database
Phylogenetic analyses of species of Streptomyces based on 16S rRNA gene sequences resulted in a statistically well-supported clade (100% bootstrap value) containing 8 species having very similar gross morphology. These species, including Streptomyces bambergiensis, Streptomyces chlorus, Streptomyces...
First report of the complete sequence of Sida golden yellow vein virus from Jamaica.
Stewart, Cheryl S; Kon, Tatsuya; Gilbertson, Robert L; Roye, Marcia E
2011-08-01
Begomoviruses are phytopathogens that threaten food security [18]. Sida spp. are ubiquitous weed species found in Jamaica. Sida samples were collected island-wide, DNA was extracted via a modified Dellaporta method, and the viral genome was amplified using degenerate and sequence-specific primers [2, 11]. The amplicons were cloned and sequenced. Sequence analysis revealed that a DNA-A molecule isolated from a plant in Liguanea, St. Andrew, was 90.9% similar to Sida golden yellow vein virus-[United States of America:Homestead:A11], making it a strain of SiGYVV. It was named Sida golden yellow vein virus-[Jamaica:Liguanea 2:2008] (SiGYVV-[JM:Lig2:08]). The cognate DNA-B, previously unreported, was successfully cloned and was most similar to that of Malvastrum yellow mosaic Jamaica virus (MaYMJV). Phylogenetic analysis suggested that this virus was most closely related to begomoviruses that infect malvaceous hosts in Jamaica, Cuba and Florida in the United States.
Liao, Ai-Jun; Su, Qi; Wang, Xun; Zeng, Bin; Shi, Wei
2008-01-01
AIM: To isolate and analyze the DNA sequences which are methylated differentially between gastric cancer and normal gastric mucosa. METHODS: The differentially methylated DNA sequences between gastric cancer and normal gastric mucosa were isolated by methylation-sensitive representational difference analysis (MS-RDA). Similarities between the separated fragments and the human genomic DNA were analyzed with Basic Local Alignment Search Tool (BLAST). RESULTS: Three differentially methylated DNA sequences were obtained, two of which have been accepted by GenBank. The accession numbers are AY887106 and AY887107. AY887107 was highly similar to the 11th exon of LOC440683 (98%), 3’ end of LOC440887 (99%), and promoter and exon regions of DRD5 (94%). AY887106 was consistent (98%) with a CpG island in ribosomal RNA isolated from colorectal cancer by Minoru Toyota in 1999. CONCLUSION: The methylation degree is different between gastric cancer and normal gastric mucosa. The differentially methylated DNA sequences can be isolated effectively by MS-RDA. PMID:18322944
Analysis of functional redundancies within the Arabidopsis TCP transcription factor family.
Danisman, Selahattin; van Dijk, Aalt D J; Bimbo, Andrea; van der Wal, Froukje; Hennig, Lars; de Folter, Stefan; Angenent, Gerco C; Immink, Richard G H
2013-12-01
Analyses of the functions of TEOSINTE-LIKE1, CYCLOIDEA, and PROLIFERATING CELL FACTOR1 (TCP) transcription factors have been hampered by functional redundancy between its individual members. In general, putative functionally redundant genes are predicted based on sequence similarity and confirmed by genetic analysis. In the TCP family, however, identification is impeded by relatively low overall sequence similarity. In a search for functionally redundant TCP pairs that control Arabidopsis leaf development, this work performed an integrative bioinformatics analysis, combining protein sequence similarities, gene expression data, and results of pair-wise protein-protein interaction studies for the 24 members of the Arabidopsis TCP transcription factor family. For this, the work completed any lacking gene expression and protein-protein interaction data experimentally and then performed a comprehensive prediction of potential functional redundant TCP pairs. Subsequently, redundant functions could be confirmed for selected predicted TCP pairs by genetic and molecular analyses. It is demonstrated that the previously uncharacterized class I TCP19 gene plays a role in the control of leaf senescence in a redundant fashion with TCP20. Altogether, this work shows the power of combining classical genetic and molecular approaches with bioinformatics predictions to unravel functional redundancies in the TCP transcription factor family.
Analysis of functional redundancies within the Arabidopsis TCP transcription factor family
Danisman, Selahattin; de Folter, Stefan; Immink, Richard G. H.
2013-01-01
Analyses of the functions of TEOSINTE-LIKE1, CYCLOIDEA, and PROLIFERATING CELL FACTOR1 (TCP) transcription factors have been hampered by functional redundancy between its individual members. In general, putative functionally redundant genes are predicted based on sequence similarity and confirmed by genetic analysis. In the TCP family, however, identification is impeded by relatively low overall sequence similarity. In a search for functionally redundant TCP pairs that control Arabidopsis leaf development, this work performed an integrative bioinformatics analysis, combining protein sequence similarities, gene expression data, and results of pair-wise protein–protein interaction studies for the 24 members of the Arabidopsis TCP transcription factor family. For this, the work completed any lacking gene expression and protein–protein interaction data experimentally and then performed a comprehensive prediction of potential functional redundant TCP pairs. Subsequently, redundant functions could be confirmed for selected predicted TCP pairs by genetic and molecular analyses. It is demonstrated that the previously uncharacterized class I TCP19 gene plays a role in the control of leaf senescence in a redundant fashion with TCP20. Altogether, this work shows the power of combining classical genetic and molecular approaches with bioinformatics predictions to unravel functional redundancies in the TCP transcription factor family. PMID:24129704
Acyl carrier protein structural classification and normal mode analysis
Cantu, David C; Forrester, Michael J; Charov, Katherine; Reilly, Peter J
2012-01-01
All acyl carrier protein primary and tertiary structures were gathered into the ThYme database. They are classified into 16 families by amino acid sequence similarity, with members of the different families having sequences with statistically highly significant differences. These classifications are supported by tertiary structure superposition analysis. Tertiary structures from a number of families are very similar, suggesting that these families may come from a single distant ancestor. Normal vibrational mode analysis was conducted on experimentally determined freestanding structures, showing greater fluctuations at chain termini and loops than in most helices. Their modes overlap more so within families than between different families. The tertiary structures of three acyl carrier protein families that lacked any known structures were predicted as well. PMID:22374859
Mikalová, Lenka; Strouhal, Michal; Oppelt, Jan; Grange, Philippe Alain; Janier, Michel; Benhaddou, Nadjet; Dupin, Nicolas; Šmajs, David
2017-01-01
Background Treponema pallidum subsp. endemicum (TEN) is the causative agent of endemic syphilis (bejel). An unusual human TEN 11q/j isolate was obtained from a syphilis-like primary genital lesion from a patient that returned to France from Pakistan. Methodology/Principal findings The TEN 11q/j isolate was characterized using nested PCR followed by Sanger sequencing and/or direct Illumina sequencing. Altogether, 44 chromosomal regions were analyzed. Overall, the 11q/j isolate clustered with TEN strains Bosnia A and Iraq B as expected from previous TEN classification of the 11q/j isolate. However, the 11q/j sequence in a 505 bp-long region at the TP0488 locus was similar to Treponema pallidum subsp. pallidum (TPA) strains, but not to TEN Bosnia A and Iraq B sequences, suggesting a recombination event at this locus. Similarly, the 11q/j sequence in a 613 bp-long region at the TP0548 locus was similar to Treponema pallidum subsp. pertenue (TPE) strains, but not to TEN sequences. Conclusions/Significance A detailed analysis of two recombinant loci found in the 11q/j clinical isolate revealed that the recombination event occurred just once, in the TP0488, with the donor sequence originating from a TPA strain. Since TEN Bosnia A and Iraq B were found to contain TPA-like sequences at the TP0548 locus, the recombination at TP0548 took place in a treponeme that was an ancestor to both TEN Bosnia A and Iraq B. The sequence of 11q/j isolate in TP0548 represents an ancestral TEN sequence that is similar to yaws-causing treponemes. In addition to the importance of the 11q/j isolate for reconstruction of the TEN phylogeny, this case emphasizes the possible role of TEN strains in development of syphilis-like lesions. PMID:28263990
Pattern similarity study of functional sites in protein sequences: lysozymes and cystatins
Nakai, Shuryo; Li-Chan, Eunice CY; Dou, Jinglie
2005-01-01
Background Although it is generally agreed that topography is more conserved than sequences, proteins sharing the same fold can have different functions, while there are protein families with low sequence similarity. An alternative method for profile analysis of characteristic conserved positions of the motifs within the 3D structures may be needed for functional annotation of protein sequences. Using the approach of quantitative structure-activity relationships (QSAR), we have proposed a new algorithm for postulating functional mechanisms on the basis of pattern similarity and average of property values of side-chains in segments within sequences. This approach was used to search for functional sites of proteins belonging to the lysozyme and cystatin families. Results Hydrophobicity and β-turn propensity of reference segments with 3–7 residues were used for the homology similarity search (HSS) for active sites. Hydrogen bonding was used as the side-chain property for searching the binding sites of lysozymes. The profiles of similarity constants and average values of these parameters as functions of their positions in the sequences could identify both active and substrate binding sites of the lysozyme of Streptomyces coelicolor, which has been reported as a new fold enzyme (Cellosyl). The same approach was successfully applied to cystatins, especially for postulating the mechanisms of amyloidosis of human cystatin C as well as human lysozyme. Conclusion Pattern similarity and average index values of structure-related properties of side chains in short segments of three residues or longer were, for the first time, successfully applied for predicting functional sites in sequences. This new approach may be applicable to studying functional sites in un-annotated proteins, for which complete 3D structures are not yet available. PMID:15904486
EUGÈNE'HOM: a generic similarity-based gene finder using multiple homologous sequences
Foissac, Sylvain; Bardou, Philippe; Moisan, Annick; Cros, Marie-Josée; Schiex, Thomas
2003-01-01
EUGÈNE'HOM is a gene prediction software for eukaryotic organisms based on comparative analysis. EUGÈNE'HOM is able to take into account multiple homologous sequences from more or less closely related organisms. It integrates the results of TBLASTX analysis, splice site and start codon prediction and a robust coding/non-coding probabilistic model which allows EUGÈNE'HOM to handle sequences from a variety of organisms. The current target of EUGÈNE'HOM is plant sequences. The EUGÈNE'HOM web site is available at http://genopole.toulouse.inra.fr/bioinfo/eugene/EuGeneHom/cgi-bin/EuGeneHom.pl. PMID:12824408
Random whole metagenomic sequencing for forensic discrimination of soils.
Khodakova, Anastasia S; Smith, Renee J; Burgoyne, Leigh; Abarno, Damien; Linacre, Adrian
2014-01-01
Here we assess the ability of random whole metagenomic sequencing approaches to discriminate between similar soils from two geographically distinct urban sites for application in forensic science. Repeat samples from two parklands in residential areas separated by approximately 3 km were collected and the DNA was extracted. Shotgun, whole genome amplification (WGA) and single arbitrarily primed DNA amplification (AP-PCR) based sequencing techniques were then used to generate soil metagenomic profiles. Full and subsampled metagenomic datasets were then annotated against M5NR/M5RNA (taxonomic classification) and SEED Subsystems (metabolic classification) databases. Further comparative analyses were performed using a number of statistical tools including: hierarchical agglomerative clustering (CLUSTER); similarity profile analysis (SIMPROF); non-metric multidimensional scaling (NMDS); and canonical analysis of principal coordinates (CAP) at all major levels of taxonomic and metabolic classification. Our data showed that shotgun and WGA-based approaches generated highly similar metagenomic profiles for the soil samples such that the soil samples could not be distinguished accurately. An AP-PCR based approach was shown to be successful at obtaining reproducible site-specific metagenomic DNA profiles, which in turn were employed for successful discrimination of visually similar soil samples collected from two different locations.
Microbial diversity in ikaite tufa columns: an alkaline, cold ecological niche in Greenland.
Stougaard, Peter; Jørgensen, Flemming; Johnsen, Mads G; Hansen, Ole C
2002-08-01
Ikaite tufa columns from the Ikka Fjord in south-western Greenland constitute a natural, stable environment at low temperature and with a pH ranging from neutral at the exterior to very alkaline (pH 10.4) at the interior of the column. Phylogenetic analysis of culturable organisms revealed ten different isolates representing three of the major bacterial divisions. Nine of the isolates showed 94-99% similarity to known sequences, whereas one isolate displayed a low degree of similarity (less than 90%) to a Cyclobacterium species. Seven of the isolates were shown to be cold active alkaliphiles, whereas three isolates showed optimal growth at neutral pH. Phylogenetic analysis of DNA isolated directly from the ikaite material demonstrated the presence of a microbial flora more diverse than the culturable isolates. Whereas approximately half of the phylotypes showed 90-99% similarity to known meso- or thermophilic alkaliphiles, the rest of the sequences displayed less than 90% similarity when compared to known 16S rRNA gene sequences in databases. Thus, in the present paper, we demonstrate that ikaite columns that host a specialized macroscopic flora and fauna also contain a unique, cold active, alkaliphilic microflora.
A statistical physics perspective on alignment-independent protein sequence comparison.
Chattopadhyay, Amit K; Nasiev, Diar; Flower, Darren R
2015-08-01
Within bioinformatics, the textual alignment of amino acid sequences has long dominated the determination of similarity between proteins, with all that implies for shared structure, function and evolutionary descent. Despite the relative success of modern-day sequence alignment algorithms, so-called alignment-free approaches offer a complementary means of determining and expressing similarity, with potential benefits in certain key applications, such as regression analysis of protein structure-function studies, where alignment-base similarity has performed poorly. Here, we offer a fresh, statistical physics-based perspective focusing on the question of alignment-free comparison, in the process adapting results from 'first passage probability distribution' to summarize statistics of ensemble averaged amino acid propensity values. In this article, we introduce and elaborate this approach. © The Author 2015. Published by Oxford University Press.
Sequencing and phylogenetic analysis of tobacco virus 2, a polerovirus from Nicotiana tabacum.
Zhou, Benguo; Wang, Fang; Zhang, Xuesong; Zhang, Lina; Lin, Huafeng
2017-07-01
The complete genome sequence of a new virus, provisionally named tobacco virus 2 (TV2), was determined and identified from leaves of tobacco (Nicotiana tabacum) exhibiting leaf mosaic, yellowing, and deformity, in Anhui Province, China. The genome sequence of TV2 comprises 5,979 nucleotides, with 87% nucleotide sequence identity to potato leafroll virus (PLRV). Its genome organization is similar to that of PLRV, containing six open reading frames (ORFs) that potentially encode proteins with putative functions in cell-to-cell movement and suppression of RNA silencing. Phylogenetic analysis of the nucleotide sequence placed TV2 alongside members of the genus Polerovirus in the family Luteoviridae. To the best our knowledge, this study is the first report of a complete genome sequence of a new polerovirus identified in tobacco.
Heinz, Eva; Stubenrauch, Christopher J.; Grinter, Rhys; Croft, Nathan P.; Purcell, Anthony W.; Strugnell, Richard A.; Dougan, Gordon; Lithgow, Trevor
2016-01-01
The bacterial cell surface proteins intimin and invasin are virulence factors that share a common domain structure and bind selectively to host cell receptors in the course of bacterial pathogenesis. The β-barrel domains of intimin and invasin show significant sequence and structural similarities. Conversely, a variety of proteins with sometimes limited sequence similarity have also been annotated as “intimin-like” and “invasin” in genome datasets, while other recent work on apparently unrelated virulence-associated proteins ultimately revealed similarities to intimin and invasin. Here we characterize the sequence and structural relationships across this complex protein family. Surprisingly, intimins and invasins represent a very small minority of the sequence diversity in what has been previously the “intimin/invasin protein family”. Analysis of the assembly pathway for expression of the classic intimin, EaeA, and a characteristic example of the most prevalent members of the group, FdeC, revealed a dependence on the translocation and assembly module as a common feature for both these proteins. While the majority of the sequences in the grouping are most similar to FdeC, a further and widespread group is two-partner secretion systems that use the β-barrel domain as the delivery device for secretion of a variety of virulence factors. This comprehensive analysis supports the adoption of the “inverse autotransporter protein family” as the most accurate nomenclature for the family and, in turn, has important consequences for our overall understanding of the Type V secretion systems of bacterial pathogens. PMID:27190006
A proteomic analysis of leaf sheaths from rice.
Shen, Shihua; Matsubae, Masami; Takao, Toshifumi; Tanaka, Naoki; Komatsu, Setsuko
2002-10-01
The proteins extracted from the leaf sheaths of rice seedlings were separated by 2-D PAGE, and analyzed by Edman sequencing and mass spectrometry, followed by database searching. Image analysis revealed 352 protein spots on 2-D PAGE after staining with Coomassie Brilliant Blue. The amino acid sequences of 44 of 84 proteins were determined; for 31 of these proteins, a clear function could be assigned, whereas for 12 proteins, no function could be assigned. Forty proteins did not yield amino acid sequence information, because they were N-terminally blocked, or the obtained sequences were too short and/or did not give unambiguous results. Fifty-nine proteins were analyzed by mass spectrometry; all of these proteins were identified by matching to the protein database. The amino acid sequences of 19 of 27 proteins analyzed by mass spectrometry were similar to the results of Edman sequencing. These results suggest that 2-D PAGE combined with Edman sequencing and mass spectrometry analysis can be effectively used to identify plant proteins.
What is a melody? On the relationship between pitch and brightness of timbre.
Cousineau, Marion; Carcagno, Samuele; Demany, Laurent; Pressnitzer, Daniel
2013-01-01
Previous studies showed that the perceptual processing of sound sequences is more efficient when the sounds vary in pitch than when they vary in loudness. We show here that sequences of sounds varying in brightness of timbre are processed with the same efficiency as pitch sequences. The sounds used consisted of two simultaneous pure tones one octave apart, and the listeners' task was to make same/different judgments on pairs of sequences varying in length (one, two, or four sounds). In one condition, brightness of timbre was varied within the sequences by changing the relative level of the two pure tones. In other conditions, pitch was varied by changing fundamental frequency, or loudness was varied by changing the overall level. In all conditions, only two possible sounds could be used in a given sequence, and these two sounds were equally discriminable. When sequence length increased from one to four, discrimination performance decreased substantially for loudness sequences, but to a smaller extent for brightness sequences and pitch sequences. In the latter two conditions, sequence length had a similar effect on performance. These results suggest that the processes dedicated to pitch and brightness analysis, when probed with a sequence-discrimination task, share unexpected similarities.
Adhesive Proteins of Stalked and Acorn Barnacles Display Homology with Low Sequence Similarities
Jonker, Jaimie-Leigh; Abram, Florence; Pires, Elisabete; Varela Coelho, Ana; Grunwald, Ingo; Power, Anne Marie
2014-01-01
Barnacle adhesion underwater is an important phenomenon to understand for the prevention of biofouling and potential biotechnological innovations, yet so far, identifying what makes barnacle glue proteins ‘sticky’ has proved elusive. Examination of a broad range of species within the barnacles may be instructive to identify conserved adhesive domains. We add to extensive information from the acorn barnacles (order Sessilia) by providing the first protein analysis of a stalked barnacle adhesive, Lepas anatifera (order Lepadiformes). It was possible to separate the L. anatifera adhesive into at least 10 protein bands using SDS-PAGE. Intense bands were present at approximately 30, 70, 90 and 110 kilodaltons (kDa). Mass spectrometry for protein identification was followed by de novo sequencing which detected 52 peptides of 7–16 amino acids in length. None of the peptides matched published or unpublished transcriptome sequences, but some amino acid sequence similarity was apparent between L. anatifera and closely-related Dosima fascicularis. Antibodies against two acorn barnacle proteins (ab-cp-52k and ab-cp-68k) showed cross-reactivity in the adhesive glands of L. anatifera. We also analysed the similarity of adhesive proteins across several barnacle taxa, including Pollicipes pollicipes (a stalked barnacle in the order Scalpelliformes). Sequence alignment of published expressed sequence tags clearly indicated that P. pollicipes possesses homologues for the 19 kDa and 100 kDa proteins in acorn barnacles. Homology aside, sequence similarity in amino acid and gene sequences tended to decline as taxonomic distance increased, with minimum similarities of 18–26%, depending on the gene. The results indicate that some adhesive proteins (e.g. 100 kDa) are more conserved within barnacles than others (20 kDa). PMID:25295513
Adhesive proteins of stalked and acorn barnacles display homology with low sequence similarities.
Jonker, Jaimie-Leigh; Abram, Florence; Pires, Elisabete; Varela Coelho, Ana; Grunwald, Ingo; Power, Anne Marie
2014-01-01
Barnacle adhesion underwater is an important phenomenon to understand for the prevention of biofouling and potential biotechnological innovations, yet so far, identifying what makes barnacle glue proteins 'sticky' has proved elusive. Examination of a broad range of species within the barnacles may be instructive to identify conserved adhesive domains. We add to extensive information from the acorn barnacles (order Sessilia) by providing the first protein analysis of a stalked barnacle adhesive, Lepas anatifera (order Lepadiformes). It was possible to separate the L. anatifera adhesive into at least 10 protein bands using SDS-PAGE. Intense bands were present at approximately 30, 70, 90 and 110 kilodaltons (kDa). Mass spectrometry for protein identification was followed by de novo sequencing which detected 52 peptides of 7-16 amino acids in length. None of the peptides matched published or unpublished transcriptome sequences, but some amino acid sequence similarity was apparent between L. anatifera and closely-related Dosima fascicularis. Antibodies against two acorn barnacle proteins (ab-cp-52k and ab-cp-68k) showed cross-reactivity in the adhesive glands of L. anatifera. We also analysed the similarity of adhesive proteins across several barnacle taxa, including Pollicipes pollicipes (a stalked barnacle in the order Scalpelliformes). Sequence alignment of published expressed sequence tags clearly indicated that P. pollicipes possesses homologues for the 19 kDa and 100 kDa proteins in acorn barnacles. Homology aside, sequence similarity in amino acid and gene sequences tended to decline as taxonomic distance increased, with minimum similarities of 18-26%, depending on the gene. The results indicate that some adhesive proteins (e.g. 100 kDa) are more conserved within barnacles than others (20 kDa).
Physical-chemical property based sequence motifs and methods regarding same
Braun, Werner [Friendswood, TX; Mathura, Venkatarajan S [Sarasota, FL; Schein, Catherine H [Friendswood, TX
2008-09-09
A data analysis system, program, and/or method, e.g., a data mining/data exploration method, using physical-chemical property motifs. For example, a sequence database may be searched for identifying segments thereof having physical-chemical properties similar to the physical-chemical property motifs.
Comparative phenotypic analysis of Gossypium raimondii with Upland cotton
USDA-ARS?s Scientific Manuscript database
Gossypium raimondii Ulbr., a wild species with a diploid genome, has been sequenced due to its small genome size and sequence similarity with the polyploidy cultivated Gossypium species. Accessibility of the G. raimondii genome has made the species a reference used extensively in cotton genomic and...
Tett, Adrian; Spiers, Andrew J; Crossman, Lisa C; Ager, Duane; Ciric, Lena; Dow, J Maxwell; Fry, John C; Harris, David; Lilley, Andrew; Oliver, Anna; Parkhill, Julian; Quail, Michael A; Rainey, Paul B; Saunders, Nigel J; Seeger, Kathy; Snyder, Lori AS; Squares, Rob; Thomas, Christopher M; Turner, Sarah L; Zhang, Xue-Xian; Field, Dawn; Bailey, Mark J
2009-01-01
The plasmid pQBR103 was found within Pseudomonas populations colonizing the leaf and root surfaces of sugar beet plants growing at Wytham, Oxfordshire, UK. At 425 kb it is the largest self-transmissible plasmid yet sequenced from the phytosphere. It is known to enhance the competitive fitness of its host, and parts of the plasmid are known to be actively transcribed in the plant environment. Analysis of the complete sequence of this plasmid predicts a coding sequence (CDS)-rich genome containing 478 CDSs and an exceptional degree of genetic novelty; 80% of predicted coding sequences cannot be ascribed a function and 60% are orphans. Of those to which function could be assigned, 40% bore greatest similarity to sequences from Pseudomonas spp, and the majority of the remainder showed similarity to other c-proteobacterial genera and plasmids. pQBR103 has identifiable regions presumed responsible for replication and partitioning, but despite being tra+ lacks the full complement of any previously described conjugal transfer functions. The DNA sequence provided few insights into the functional significance of plant-induced transcriptional regions, but suggests that 14% of CDSs may be expressed (11 CDSs with functional annotation and 54 without), further highlighting the ecological importance of these novel CDSs. Comparative analysis indicates that pQBR103 shares significant regions of sequence with other plasmids isolated from sugar beet plants grown at the same geographic location. These plasmid sequences indicate there is more novelty in the mobile DNA pool accessible to phytosphere pseudomonas than is currently appreciated or understood. PMID:18043644
Locke, John; Podemski, Lynn; Roy, Ken; Pilgrim, David; Hodgetts, Ross
1999-01-01
Chromosome 4 from Drosophila melanogaster has several unusual features that distinguish it from the other chromosomes. These include a diffuse appearance in salivary gland polytene chromosomes, an absence of recombination, and the variegated expression of P-element transgenes. As part of a larger project to understand these properties, we are assembling a physical map of this chromosome. Here we report the sequence of two cosmids representing ∼5% of the polytenized region. Both cosmid clones contain numerous repeated DNA sequences, as identified by cross hybridization with labeled genomic DNA, BLAST searches, and dot matrix analysis, which are positioned between and within the transcribed sequences. The repetitive sequences include three copies of the mobile element Hoppel, one copy of the mobile element HB, and 18 DINE repeats. DINE is a novel, short repeated sequence dispersed throughout both cosmid sequences. One cosmid includes the previously described cubitus interruptus (ci) gene and two new genes: that a gene with a predicted amino acid sequence similar to ribosomal protein S3a which is consistent with the Minute(4)101 locus thought to be in the region, and a novel member of the protein family that includes plexin and met–hepatocyte growth factor receptor. The other cosmid contains only the two short 5′-most exons from the zinc-finger-homolog-2 (zfh-2) gene. This is the first extensive sequence analysis of noncoding DNA from chromosome 4. The distribution of the various repeats suggests its organization is similar to the β-heterochromatic regions near the base of the major chromosome arms. Such a pattern may account for the diffuse banding of the polytene chromosome 4 and the variegation of many P-element transgenes on the chromosome. PMID:10022978
Overvoorde, P J; Chao, W S; Grimes, H D
1997-06-20
Photoaffinity labeling of a soybean cotyledon membrane fraction identified a sucrose-binding protein (SBP). Subsequent studies have shown that the SBP is a unique plasma membrane protein that mediates the linear uptake of sucrose in the presence of up to 30 mM external sucrose when ectopically expressed in yeast. Analysis of the SBP-deduced amino acid sequence indicates it lacks sequence similarity with other known transport proteins. Data presented here, however, indicate that the SBP shares significant sequence and structural homology with the vicilin-like seed storage proteins that organize into homotrimers. These similarities include a repeated sequence that forms the basis of the reiterated domain structure characteristic of the vicilin-like protein family. In addition, analytical ultracentrifugation and nonreducing SDS-polyacrylamide gel electrophoresis demonstrate that the SBP appears to be organized into oligomeric complexes with a Mr indicative of the existence of SBP homotrimers and homodimers. The structural similarity shared by the SBP and vicilin-like proteins provides a novel framework to explore the mechanistic basis of SBP-mediated sucrose uptake. Expression of the maize Glb protein (a vicilin-like protein closely related to the SBP) in yeast demonstrates that a closely related vicilin-like protein is unable to mediate sucrose uptake. Thus, despite sequence and structural similarities shared by the SBP and the vicilin-like protein family, the SBP is functionally divergent from other members of this group.
Kröber, Magdalena; Bekel, Thomas; Diaz, Naryttza N; Goesmann, Alexander; Jaenicke, Sebastian; Krause, Lutz; Miller, Dimitri; Runte, Kai J; Viehöver, Prisca; Pühler, Alfred; Schlüter, Andreas
2009-06-01
The phylogenetic structure of the microbial community residing in a fermentation sample from a production-scale biogas plant fed with maize silage, green rye and liquid manure was analysed by an integrated approach using clone library sequences and metagenome sequence data obtained by 454-pyrosequencing. Sequencing of 109 clones from a bacterial and an archaeal 16S-rDNA amplicon library revealed that the obtained nucleotide sequences are similar but not identical to 16S-rDNA database sequences derived from different anaerobic environments including digestors and bioreactors. Most of the bacterial 16S-rDNA sequences could be assigned to the phylum Firmicutes with the most abundant class Clostridia and to the class Bacteroidetes, whereas most archaeal 16S-rDNA sequences cluster close to the methanogen Methanoculleus bourgensis. Further sequences of the archaeal library most probably represent so far non-characterised species within the genus Methanoculleus. A similar result derived from phylogenetic analysis of mcrA clone sequences. The mcrA gene product encodes the alpha-subunit of methyl-coenzyme-M reductase involved in the final step of methanogenesis. BLASTn analysis applying stringent settings resulted in assignment of 16S-rDNA metagenome sequence reads to 62 16S-rDNA amplicon sequences thus enabling frequency of abundance estimations for 16S-rDNA clone library sequences. Ribosomal Database Project (RDP) Classifier processing of metagenome 16S-rDNA reads revealed abundance of the phyla Firmicutes, Bacteroidetes and Euryarchaeota and the orders Clostridiales, Bacteroidales and Methanomicrobiales. Moreover, a large fraction of 16S-rDNA metagenome reads could not be assigned to lower taxonomic ranks, demonstrating that numerous microorganisms in the analysed fermentation sample of the biogas plant are still unclassified or unknown.
Leuthaeuser, Janelle B; Knutson, Stacy T; Kumar, Kiran; Babbitt, Patricia C; Fetrow, Jacquelyn S
2015-09-01
The development of accurate protein function annotation methods has emerged as a major unsolved biological problem. Protein similarity networks, one approach to function annotation via annotation transfer, group proteins into similarity-based clusters. An underlying assumption is that the edge metric used to identify such clusters correlates with functional information. In this contribution, this assumption is evaluated by observing topologies in similarity networks using three different edge metrics: sequence (BLAST), structure (TM-Align), and active site similarity (active site profiling, implemented in DASP). Network topologies for four well-studied protein superfamilies (enolase, peroxiredoxin (Prx), glutathione transferase (GST), and crotonase) were compared with curated functional hierarchies and structure. As expected, network topology differs, depending on edge metric; comparison of topologies provides valuable information on structure/function relationships. Subnetworks based on active site similarity correlate with known functional hierarchies at a single edge threshold more often than sequence- or structure-based networks. Sequence- and structure-based networks are useful for identifying sequence and domain similarities and differences; therefore, it is important to consider the clustering goal before deciding appropriate edge metric. Further, conserved active site residues identified in enolase and GST active site subnetworks correspond with published functionally important residues. Extension of this analysis yields predictions of functionally determinant residues for GST subgroups. These results support the hypothesis that active site similarity-based networks reveal clusters that share functional details and lay the foundation for capturing functionally relevant hierarchies using an approach that is both automatable and can deliver greater precision in function annotation than current similarity-based methods. © 2015 The Authors Protein Science published by Wiley Periodicals, Inc. on behalf of The Protein Society.
Leuthaeuser, Janelle B; Knutson, Stacy T; Kumar, Kiran; Babbitt, Patricia C; Fetrow, Jacquelyn S
2015-01-01
The development of accurate protein function annotation methods has emerged as a major unsolved biological problem. Protein similarity networks, one approach to function annotation via annotation transfer, group proteins into similarity-based clusters. An underlying assumption is that the edge metric used to identify such clusters correlates with functional information. In this contribution, this assumption is evaluated by observing topologies in similarity networks using three different edge metrics: sequence (BLAST), structure (TM-Align), and active site similarity (active site profiling, implemented in DASP). Network topologies for four well-studied protein superfamilies (enolase, peroxiredoxin (Prx), glutathione transferase (GST), and crotonase) were compared with curated functional hierarchies and structure. As expected, network topology differs, depending on edge metric; comparison of topologies provides valuable information on structure/function relationships. Subnetworks based on active site similarity correlate with known functional hierarchies at a single edge threshold more often than sequence- or structure-based networks. Sequence- and structure-based networks are useful for identifying sequence and domain similarities and differences; therefore, it is important to consider the clustering goal before deciding appropriate edge metric. Further, conserved active site residues identified in enolase and GST active site subnetworks correspond with published functionally important residues. Extension of this analysis yields predictions of functionally determinant residues for GST subgroups. These results support the hypothesis that active site similarity-based networks reveal clusters that share functional details and lay the foundation for capturing functionally relevant hierarchies using an approach that is both automatable and can deliver greater precision in function annotation than current similarity-based methods. PMID:26073648
Wang, Chun Guo; Chen, Xiao Qiang; Li, Hui; Zhao, Qian Cheng; Sun, De Ling; Song, Wen Qin
2008-02-01
Analysis of ISSR (Inter-Simple Sequence Repeat) and DDRT-PCR (Differential Display Reverse Transcriptase Polymerase Chain Reaction) was performed between cytoplasmic male sterility cauliflower ogura-A and its corresponding maintainer line ogura-B. Totally, 306 detectable bands were obtained by ISSR using thirty oligonucleotide primers. Commonly, six to twelve bands were produced per primer. Among all these primers only the amplification of primer ISSR3 was polymorphic, an 1100 bp specific band was only detected in maintainer line, named ISSR3(1100). Analysis of this sequence indicated that ISSR3(1100) was high homologous with the corresponding sequences of mitochondrial genome in Brassica napus and Arabidopsis thaliana,which suggested that ISSR3(1100) may derive from mitochondrial genome in cauliflower. To carry out DDRT-PCR analysis, three anchor primers and fifteen random primers were selected to combine. Totally, 1122 bands from 1 000 bp to 50 bp were detected. However, only four bands, named ogura-A 205, ogura-A383, ogura-B307 and ogura-B352, were confirmed to be different display in both lines. This result was further identified by reverse Northern dot blotting analysis. Among these four bands, ogura-A205 and ogura-A383 only express in cytoplasmic male sterility line, while ogura-B307 and ogura-B352 were only detected in maintainer line. Analysis of these sequences indicated that it was the first time that these four sequences were reported in cauliflower. Interestingly, ogura-A205 and ogura-B307 did not exhibit any similarities to other reported sequences in other species, more investigations were required to obtain further information. ogura-A383 and ogura-B352 were also two new sequences, they showed high similarities to corresponding chloroplast sequences of Arabidopsis thaliana and Brassica rapa subsp. pekinensis. So we speculated that these two sequences may derive from chloroplast genome. All these results obtained in this study offer new and significant information to investigate the molecular mechanism of cytoplasmic male sterility and fertile maintenance in cauliflower.
Naser, Sabri M; Vancanneyt, Marc; Hoste, Bart; Snauwaert, Cindy; Swings, Jean
2006-07-01
The applicability of a multilocus sequence analysis (MLSA)-based identification system for lactobacilli was evaluated. Two housekeeping genes that code for the phenylalanyl-tRNA synthase alpha-subunit (pheS) and RNA polymerase alpha-subunit (rpoA) were sequenced and analysed for members of the Lactobacillus salivarius species group. The type strains of Lactobacillus acidipiscis and Lactobacillus cypricasei were investigated further using a third gene that encodes the alpha-subunit of ATP synthase (atpA). The MLSA data revealed close relatedness between L. acidipiscis and L. cypricasei, with 99.8-100 % pheS, rpoA and atpA gene sequence similarities. Comparison of the 16S rRNA gene sequences of the type strains of the two species confirmed the close relatedness (99.8 % gene sequence similarity) between the two taxa. Similar phenotypes and high DNA-DNA binding values in the range of 84 to 97.5 % confirmed that L. acidipiscis and L. cypricasei are synonymous species. On the basis of the present study, it is proposed that Lactobacillus cypricasei is a later heterotypic synonym of Lactobacillus acidipiscis.
Gu, Xuan; Zhang, Xiao-qin; Song, Xiao-na; Zang, Yi-mei; Li Yan-peng; Ma, Chang-hua; Zhao, Bai-xiao; Liu, Chun-sheng
2014-12-01
The fruit of Lycium ruthenicum is a common folk medicine in China. Now it is popular for its antioxidative effect and other medical functions. The adulterants of the herb confuse consumers. In order to identify a new adulterant of L. ruthenicum, a research was performed based on NCBI Nucleotide Database ITS Sequence, combined analysis of the origin and morphology of the adulterant to traceable varieties. Total genomic DNA was isolated from the materials, and nuclear DNA ITS sequences were amplified and sequenced; DNA fragments were collated and matched by using ContingExpress. Similarity identification of BLAST analysis was performed. Besides, the distribution of plant origin and morphology were considered to further identification and verification. Families and genera were identified by molecular identification method. The adulterant was identified as plant belonging to Berberis. Origin analysis narrowed the range of sample identification. Seven different kinds of plants in Berberis were potential sources of the sample. Adulterants variety was traced by morphological analysis. The united molecular identification-origin-morphology research proves to be a preceding way to medical herbs traceability with time-saving and economic advantages and the results showed the new adulterant of L. ruthenicum was B. kaschgarica. The main differences between B. kaschgarica and L. ruthenicum are as follows: in terms of the traits, the surface of B. kaschgarica is smooth and crispy, and that of L. ruthenicum is shrinkage, solid and hard. In microscopic characteristics, epicarp cells of B. aschgarica thickening like a string of beads, stone cells as the rectangle, and the stone cell walls of L. ruthenicum is wavy, obvious grain layer. In molecular sequences, the length of ITS sequence of B. kaschgarica is 606 bp, L. ruthenicum is 654 bp, the similarity of the two sequences is 53.32%.
Analysis of whole genome sequencing for the Escherichia coli O157:H7 typing phages.
Cowley, Lauren A; Beckett, Stephen J; Chase-Topping, Margo; Perry, Neil; Dallman, Tim J; Gally, David L; Jenkins, Claire
2015-04-08
Shiga toxin producing Escherichia coli O157 can cause severe bloody diarrhea and haemolytic uraemic syndrome. Phage typing of E. coli O157 facilitates public health surveillance and outbreak investigations, certain phage types are more likely to occupy specific niches and are associated with specific age groups and disease severity. The aim of this study was to analyse the genome sequences of 16 (fourteen T4 and two T7) E. coli O157 typing phages and to determine the genes responsible for the subtle differences in phage type profiles. The typing phages were sequenced using paired-end Illumina sequencing at The Genome Analysis Centre and the Animal Health and Veterinary Laboratories Agency and bioinformatics programs including Velvet, Brig and Easyfig were used to analyse them. A two-way Euclidian cluster analysis highlighted the associations between groups of phage types and typing phages. The analysis showed that the T7 typing phages (9 and 10) differed by only three genes and that the T4 typing phages formed three distinct groups of similar genomic sequences: Group 1 (1, 8, 11, 12 and 15, 16), Group 2 (3, 6, 7 and 13) and Group 3 (2, 4, 5 and 14). The E. coli O157 phage typing scheme exhibited a significantly modular network linked to the genetic similarity of each group showing that these groups are specialised to infect a subset of phage types. Sequencing the typing phage has enabled us to identify the variable genes within each group and to determine how this corresponds to changes in phage type.
Petruzziello, Filomena; Fouillen, Laetitia; Wadensten, Henrik; Kretz, Robert; Andren, Per E; Rainer, Gregor; Zhang, Xiaozhe
2012-02-03
Neuropeptidomics is used to characterize endogenous peptides in the brain of tree shrews (Tupaia belangeri). Tree shrews are small animals similar to rodents in size but close relatives of primates, and are excellent models for brain research. Currently, tree shrews have no complete proteome information available on which direct database search can be allowed for neuropeptide identification. To increase the capability in the identification of neuropeptides in tree shrews, we developed an integrated mass spectrometry (MS)-based approach that combines methods including data-dependent, directed, and targeted liquid chromatography (LC)-Fourier transform (FT)-tandem MS (MS/MS) analysis, database construction, de novo sequencing, precursor protein search, and homology analysis. Using this integrated approach, we identified 107 endogenous peptides that have sequences identical or similar to those from other mammalian species. High accuracy MS and tandem MS information, with BLAST analysis and chromatographic characteristics were used to confirm the sequences of all the identified peptides. Interestingly, further sequence homology analysis demonstrated that tree shrew peptides have a significantly higher degree of homology to equivalent sequences in humans than those in mice or rats, consistent with the close phylogenetic relationship between tree shrews and primates. Our results provide the first extensive characterization of the peptidome in tree shrews, which now permits characterization of their function in nervous and endocrine system. As the approach developed fully used the conservative properties of neuropeptides in evolution and the advantage of high accuracy MS, it can be portable for identification of neuropeptides in other species for which the fully sequenced genomes or proteomes are not available.
Panwar, Priyankar; Verma, A K; Dubey, Ashutosh
2018-05-01
Barnyard ( Echinochloa frumentacea ) and finger ( Eleusine coracana ) millet growing at northwestern Himalaya were explored for the α-amylase inhibitor (α-AI). The mature seeds of barnyard millet variety PRJ1 had maximum α-AI activity which increases in different developmental stage. α-AI was purified up to 22.25-fold from barnyard millet variety PRJ1. Semi-quantitative PCR of different developmental stages of barnyard millet seeds showed increased levels of the transcript from 7 to 28 days. Sequence analysis revealed that it contained 315 bp nucleotide which encodes 104 amino acid sequence with molecular weight 10.72 kDa. The predicted 3D structure of α-AI was 86.73% similar to a bifunctional inhibitor of ragi. In silico analysis of 71 α-AI protein sequences were carried out for biochemical features, homology search, multiple sequence alignment, phylogenetic tree construction, motif, and superfamily distribution of protein sequences. Analysis of multiple sequence alignment revealed the existence of conserved regions NPLP[S/G]CRWYVV[S/Q][Q/R]TCG[V/I] throughout sequences. Superfam analysis revealed that α-AI protein sequences were distributed among seven different superfamilies.
Jangid, Kamlesh; Kao, Ming-Hung; Lahamge, Aishwarya; Williams, Mark A.; Rathbun, Stephen L.; Whitman, William B.
2016-01-01
K-shuff is a new algorithm for comparing the similarity of gene sequence libraries, providing measures of the structural and compositional diversity as well as the significance of the differences between these measures. Inspired by Ripley’s K-function for spatial point pattern analysis, the Intra K-function or IKF measures the structural diversity, including both the richness and overall similarity of the sequences, within a library. The Cross K-function or CKF measures the compositional diversity between gene libraries, reflecting both the number of OTUs shared as well as the overall similarity in OTUs. A Monte Carlo testing procedure then enables statistical evaluation of both the structural and compositional diversity between gene libraries. For 16S rRNA gene libraries from complex bacterial communities such as those found in seawater, salt marsh sediments, and soils, K-shuff yields reproducible estimates of structural and compositional diversity with libraries greater than 50 sequences. Similarly, for pyrosequencing libraries generated from a glacial retreat chronosequence and Illumina® libraries generated from US homes, K-shuff required >300 and 100 sequences per sample, respectively. Power analyses demonstrated that K-shuff is sensitive to small differences in Sanger or Illumina® libraries. This extra sensitivity of K-shuff enabled examination of compositional differences at much deeper taxonomic levels, such as within abundant OTUs. This is especially useful when comparing communities that are compositionally very similar but functionally different. K-shuff will therefore prove beneficial for conventional microbiome analysis as well as specific hypothesis testing. PMID:27911946
Kinoti, Wycliff M; Constable, Fiona E; Nancarrow, Narelle; Plummer, Kim M; Rodoni, Brendan
2017-01-01
PCR amplicon next generation sequencing (NGS) analysis offers a broadly applicable and targeted approach to detect populations of both high- or low-frequency virus variants in one or more plant samples. In this study, amplicon NGS was used to explore the diversity of the tripartite genome virus, Prunus necrotic ringspot virus (PNRSV) from 53 PNRSV-infected trees using amplicons from conserved gene regions of each of PNRSV RNA1, RNA2 and RNA3. Sequencing of the amplicons from 53 PNRSV-infected trees revealed differing levels of polymorphism across the three different components of the PNRSV genome with a total number of 5040, 2083 and 5486 sequence variants observed for RNA1, RNA2 and RNA3 respectively. The RNA2 had the lowest diversity of sequences compared to RNA1 and RNA3, reflecting the lack of flexibility tolerated by the replicase gene that is encoded by this RNA component. Distinct PNRSV phylo-groups, consisting of closely related clusters of sequence variants, were observed in each of PNRSV RNA1, RNA2 and RNA3. Most plant samples had a single phylo-group for each RNA component. Haplotype network analysis showed that smaller clusters of PNRSV sequence variants were genetically connected to the largest sequence variant cluster within a phylo-group of each RNA component. Some plant samples had sequence variants occurring in multiple PNRSV phylo-groups in at least one of each RNA and these phylo-groups formed distinct clades that represent PNRSV genetic strains. Variants within the same phylo-group of each Prunus plant sample had ≥97% similarity and phylo-groups within a Prunus plant sample and between samples had less ≤97% similarity. Based on the analysis of diversity, a definition of a PNRSV genetic strain was proposed. The proposed definition was applied to determine the number of PNRSV genetic strains in each of the plant samples and the complexity in defining genetic strains in multipartite genome viruses was explored.
Role of indirect readout mechanism in TATA box binding protein-DNA interaction.
Mondal, Manas; Choudhury, Devapriya; Chakrabarti, Jaydeb; Bhattacharyya, Dhananjay
2015-03-01
Gene expression generally initiates from recognition of TATA-box binding protein (TBP) to the minor groove of DNA of TATA box sequence where the DNA structure is significantly different from B-DNA. We have carried out molecular dynamics simulation studies of TBP-DNA system to understand how the DNA structure alters for efficient binding. We observed rigid nature of the protein while the DNA of TATA box sequence has an inherent flexibility in terms of bending and minor groove widening. The bending analysis of the free DNA and the TBP bound DNA systems indicate presence of some similar structures. Principal coordinate ordination analysis also indicates some structural features of the protein bound and free DNA are similar. Thus we suggest that the DNA of TATA box sequence regularly oscillates between several alternate structures and the one suitable for TBP binding is induced further by the protein for proper complex formation.
Wolffe, E J; Gause, W C; Pelfrey, C M; Holland, S M; Steinberg, A D; August, J T
1990-01-05
We describe the isolation and sequencing of a cDNA encoding mouse Pgp-1. An oligonucleotide probe corresponding to the NH2-terminal sequence of the purified protein was synthesized by the polymerase chain reaction and used to screen a mouse macrophage lambda gt11 library. A cDNA clone with an insert of 1.2 kilobases was selected and sequenced. In Northern blot analysis, only cells expressing Pgp-1 contained mRNA species that hybridized with this Pgp-1 cDNA. The nucleotide sequence of the cDNA has a single open reading frame that yields a protein-coding sequence of 1076 base pairs followed by a 132-base pair 3'-untranslated sequence that includes a putative polyadenylation signal but no poly(A) tail. The translated sequence comprises a 13-amino acid signal peptide followed by a polypeptide core of 345 residues corresponding to an Mr of 37,800. Portions of the deduced amino acid sequence were identical to those obtained by amino acid sequence analysis from the purified glycoprotein, confirming that the cDNA encodes Pgp-1. The predicted structure of Pgp-1 includes an NH2-terminal extracellular domain (residues 14-265), a transmembrane domain (residues 266-286), and a cytoplasmic tail (residues 287-358). Portions of the mouse Pgp-1 sequence are highly similar to that of the human CD44 cell surface glycoprotein implicated in cell adhesion. The protein also shows sequence similarity to the proteoglycan tandem repeat sequences found in cartilage link protein and cartilage proteoglycan core protein which are thought to be involved in binding to hyaluronic acid.
Thomas, Lindsay H; Seryodkin, Ivan V; Goodrich, John M; Miquelle, Dale G; Birtles, Richard J; Lewis, John C M
2016-07-01
We collected 69 ticks from nine, free-ranging Amur tigers ( Panthera tigris altaica) between 2002 and 2011 and investigated them for tick-borne pathogens. DNA was extracted using alkaline digestion and PCR was performed to detect apicomplexan organisms. Partial 18S rDNA amplification products were obtained from 14 ticks from four tigers, of which 13 yielded unambiguous nucleotide sequence data. Comparative sequence analysis revealed all 13 partial 18S rDNA sequences were most similar to those belonging to strains of Hepatozoon felis (>564/572 base-pair identity, >99% sequence similarity). Although this tick-borne protozoon pathogen has been detected in wild felids from many parts of the world, this is the first record from the Russian Far East.
Borges, Juliana N; Cunha, Luiz F G; Miranda, Daniele F; Monteiro-Neto, Cassiano; Santos, Cláudia P
2015-12-01
Pseudoterranova larvae parasitizing cutlassfish Trichiurus lepturus and bluefish Pomatomus saltatrix from Southwest Atlantic coast of Brazil were studied in this work by morphological, ultrastructural and molecular approaches. The genetic analysis were performed for the ITS2 intergenic region specific for Pseudoterranova decipiens, the partial 28S (LSU) of ribosomal DNA and the mtDNA cox-1 region. We obtained results for the 28S region and mtDNA cox-1 that was amplified using the polymerase chain reaction and sequenced to evaluate the phylogenetic relationships between sequences of this study and sequences from the GenBank. The morphological profile indicated that all the nine specimens collected from both fish were L3 larvae of Pseudoterranova sp. The genetic profile confirmed the generic level but due to the absence of similar sequences for adult parasites on GenBank for the regions amplifyied, it was not possible to identify them to the species level. The sequences obtained presented 89% of similarity with Pseudoterranova decipiens (28S sequences) and Contracaecum osculatum B (mtDNA cox-1). The low similarity allied to the fact that the amplification with the specific primer for P. decipiens didn't occur, lead us to conclude that our sequences don't belong to P. decipiens complex.
Comprehensive comparison of three commercial human whole-exome capture platforms.
Asan; Xu, Yu; Jiang, Hui; Tyler-Smith, Chris; Xue, Yali; Jiang, Tao; Wang, Jiawei; Wu, Mingzhi; Liu, Xiao; Tian, Geng; Wang, Jun; Wang, Jian; Yang, Huangming; Zhang, Xiuqing
2011-09-28
Exome sequencing, which allows the global analysis of protein coding sequences in the human genome, has become an effective and affordable approach to detecting causative genetic mutations in diseases. Currently, there are several commercial human exome capture platforms; however, the relative performances of these have not been characterized sufficiently to know which is best for a particular study. We comprehensively compared three platforms: NimbleGen's Sequence Capture Array and SeqCap EZ, and Agilent's SureSelect. We assessed their performance in a variety of ways, including number of genes covered and capture efficacy. Differences that may impact on the choice of platform were that Agilent SureSelect covered approximately 1,100 more genes, while NimbleGen provided better flanking sequence capture. Although all three platforms achieved similar capture specificity of targeted regions, the NimbleGen platforms showed better uniformity of coverage and greater genotype sensitivity at 30- to 100-fold sequencing depth. All three platforms showed similar power in exome SNP calling, including medically relevant SNPs. Compared with genotyping and whole-genome sequencing data, the three platforms achieved a similar accuracy of genotype assignment and SNP detection. Importantly, all three platforms showed similar levels of reproducibility, GC bias and reference allele bias. We demonstrate key differences between the three platforms, particularly advantages of solutions over array capture and the importance of a large gene target set.
Gutiérrez, Pablo A; Alzate, Juan F; Montoya, Mauricio Marín
2015-06-01
Transcriptome analysis of a Cape gooseberry (Physalis peruviana) plant with leaf symptoms of a mild yellow mosaic typical of a viral disease revealed an infection with Potato virus X (PVX). The genome sequence of the PVX-Physalis isolate comprises 6435 nt and exhibits higher sequence similarity to members of the Eurasian group of PVX (~95 %) than to the American group (~77 %). Genome organization is similar to other PVX isolates with five open reading frames coding for proteins RdRp, TGBp1, TGBp2, TGBp3, and CP. 5' and 3' untranslated regions revealed all regulatory motifs typically found in PVX isolates. The PVX-Physalis genome is the only complete sequence available for a Potexvirus in Colombia and is a new addition to the restricted number of available sequences of PVX isolates infecting plant species different to potato.
REPPER—repeats and their periodicities in fibrous proteins
Gruber, Markus; Söding, Johannes; Lupas, Andrei N.
2005-01-01
REPPER (REPeats and their PERiodicities) is an integrated server that detects and analyzes regions with short gapless repeats in protein sequences or alignments. It finds periodicities by Fourier Transform (FTwin) and internal similarity analysis (REPwin). FTwin assigns numerical values to amino acids that reflect certain properties, for instance hydrophobicity, and gives information on corresponding periodicities. REPwin uses self-alignments and displays repeats that reveal significant internal similarities. Both programs use a sliding window to ensure that different periodic regions within the same protein are detected independently. FTwin and REPwin are complemented by secondary structure prediction (PSIPRED) and coiled coil prediction (COILS), making the server a versatile analysis tool for sequences of fibrous proteins. REPPER is available at . PMID:15980460
Tsuji, K; Tsien, H C; Hanson, R S; DePalma, S R; Scholtz, R; LaRoche, S
1990-01-01
16S ribosomal RNAs (rRNA) of 12 methylotrophic bacteria have been almost completely sequenced to establish their phylogenetic relationships. Methylotrophs that are physiologically related are phylogenetically diverse and are scattered among the purple eubacteria (class Proteobacteria). Group I methylotrophs can be classified in the beta- and the gamma-subdivisions and group II methylotrophs in the alpha-subdivision of the purple eubacteria, respectively. Pink-pigmented facultative and non-pigmented obligate group II methylotrophs form two distinctly separate branches within the alpha-subdivision. The secondary structures of the 16S rRNA sequences of 'Methylocystis parvus' strain OBBP, 'Methylosinus trichosporium' strain OB3b, 'Methylosporovibrio methanica' strain 81Z and Hyphomicrobium sp. strain DM2 are similar, and these non-pigmented obligate group II methylotrophs form one tight cluster in the alpha-subdivision. The pink-pigmented facultative methylotrophs, Methylobacterium extorquens strain AM1, Methylobacterium sp. strain DM4 and Methylobacterium organophilum strain XX form another cluster within the alpha-subdivision. Although similar in phenotypic characteristics, Methylobacterium organophilum strain XX and Methylobacterium extorquens strain AM1 are clearly distinguishable by their 16S rRNA sequences. The group I methylotrophs, Methylophilus methylotrophus strain AS1 and methylotrophic species DM11, which do not utilize methane, are similar in 16S rRNA sequence to bacteria in the beta-subdivision. The methane-utilizing, obligate group I methanotrophs, Methylococcus capsulatus strain BATH and Methylomonas methanica, are placed in the gamma-subdivision. The results demonstrate that it is possible to distinguish and classify the methylotrophic bacteria using 16S rRNA sequence analysis.
Identification of two allelic IgG1 C(H) coding regions (Cgamma1) of cat.
Kanai, T H; Ueda, S; Nakamura, T
2000-01-31
Two types of cDNA encoding IgG1 heavy chain (gamma1) were isolated from a single domestic short-hair cat. Sequence analysis indicated a higher level of similarity of these Cgamma1 sequences to human Cgamma1 sequence (76.9 and 77.0%) than to mouse sequence (70.0 and 69.7%) at the nucleotide level. Predicted primary structures of both the feline Cgamma1 genes, designated as Cgamma1a and Cgamma1b, were similar to that of human Cgamma1 gene, for instance, as to the size of constant domains, the presence of six conserved cysteine residues involved in formation of the domain structure, and the location of a conserved N-linked glycosylation site. Sequence comparison between the two alleles showed that 7 out of 10 nucleotide differences were within the C(H)3 domain coding region, all leading to nonsynonymous changes in amino acid residues. Partial sequence analysis of genomic clones showed three nucleotide substitutions between the two Cgamma1 alleles in the intron between the CH2 and C(H)3 domain coding regions. In 12 domestic short-hair cats used in this study, the frequency of Cgamma1a allele (62.5%) was higher than that of the Cgamma1b allele (37.5%).
NASA Technical Reports Server (NTRS)
Venkateswaran, Kasthuri; Kempf, Michael; Chen, Fei; Satomi, Masataka; Nicholson, Wayne; Kern, Roger
2003-01-01
One of the spore-formers isolated from a spacecraft-assembly facility, belonging to the genus Bacillus, is described on the basis of phenotypic characterization, 16S rDNA sequence analysis and DNA-DNA hybridization studies. It is a Gram-positive, facultatively anaerobic, rod-shaped eubacterium that produces endospores. The spores of this novel bacterial species exhibited resistance to UV, gamma-radiation, H2O2 and desiccation. The 18S rDNA sequence analysis revealed a clear affiliation between this strain and members of the low G+C Firmicutes. High 16S rDNA sequence similarity values were found with members of the genus Bacillus and this was supported by fatty acid profiles. The 16S rDNA sequence similarity between strain FO-92T and Bacillus benzoevorans DSM 5391T was very high. However, molecular characterizations employing small-subunit 16S rDNA sequences were at the limits of resolution for the differentiation of species in this genus, but DNA-DNA hybridization data support the proposal of FO-92T as Bacillus nealsonii sp. nov. (type strain is FO-92T =ATCC BAAM-519T =DSM 15077T).
Microbial Characterization of Qatari Barchan Sand Dunes
Chatziefthimiou, Aspassia D.; Nguyen, Hanh; Richer, Renee; Louge, Michel; Sultan, Ali A.; Schloss, Patrick; Hay, Anthony G.
2016-01-01
This study represents the first characterization of sand microbiota in migrating barchan sand dunes. Bacterial communities were studied through direct counts and cultivation, as well as 16S rRNA gene and metagenomic sequence analysis to gain an understanding of microbial abundance, diversity, and potential metabolic capabilities. Direct on-grain cell counts gave an average of 5.3 ± 0.4 x 105 cells g-1 of sand. Cultured isolates (N = 64) selected for 16S rRNA gene sequencing belonged to the phyla Actinobacteria (58%), Firmicutes (27%) and Proteobacteria (15%). Deep-sequencing of 16S rRNA gene amplicons from 18 dunes demonstrated a high relative abundance of Proteobacteria, particularly enteric bacteria, and a dune-specific-pattern of bacterial community composition that correlated with dune size. Shotgun metagenome sequences of two representative dunes were analyzed and found to have similar relative bacterial abundance, though the relative abundances of eukaryotic, viral and enterobacterial sequences were greater in sand from the dune closer to a camel-pen. Functional analysis revealed patterns similar to those observed in desert soils; however, the increased relative abundance of genes encoding sporulation and dormancy are consistent with the dune microbiome being well-adapted to the exceptionally hyper-arid Qatari desert. PMID:27655399
Shoguchi, Eiichi; Shinzato, Chuya; Hisata, Kanako; Satoh, Nori; Mungpakdee, Sutada
2015-01-01
Even though mitochondrial genomes, which characterize eukaryotic cells, were first discovered more than 50 years ago, mitochondrial genomics remains an important topic in molecular biology and genome sciences. The Phylum Alveolata comprises three major groups (ciliates, apicomplexans, and dinoflagellates), the mitochondrial genomes of which have diverged widely. Even though the gene content of dinoflagellate mitochondrial genomes is reportedly comparable to that of apicomplexans, the highly fragmented and rearranged genome structures of dinoflagellates have frustrated whole genomic analysis. Consequently, noncoding sequences and gene arrangements of dinoflagellate mitochondrial genomes have not been well characterized. Here we report that the continuous assembled genome (∼326 kb) of the dinoflagellate, Symbiodinium minutum, is AT-rich (∼64.3%) and that it contains three protein-coding genes. Based upon in silico analysis, the remaining 99% of the genome comprises transcriptomic noncoding sequences. RNA edited sites and unique, possible start and stop codons clarify conserved regions among dinoflagellates. Our massive transcriptome analysis shows that almost all regions of the genome are transcribed, including 27 possible fragmented ribosomal RNA genes and 12 uncharacterized small RNAs that are similar to mitochondrial RNA genes of the malarial parasite, Plasmodium falciparum. Gene map comparisons show that gene order is only slightly conserved between S. minutum and P. falciparum. However, small RNAs and intergenic sequences share sequence similarities with P. falciparum, suggesting that the function of noncoding sequences has been preserved despite development of very different genome structures. PMID:26199191
AlignMe—a membrane protein sequence alignment web server
Stamm, Marcus; Staritzbichler, René; Khafizov, Kamil; Forrest, Lucy R.
2014-01-01
We present a web server for pair-wise alignment of membrane protein sequences, using the program AlignMe. The server makes available two operational modes of AlignMe: (i) sequence to sequence alignment, taking two sequences in fasta format as input, combining information about each sequence from multiple sources and producing a pair-wise alignment (PW mode); and (ii) alignment of two multiple sequence alignments to create family-averaged hydropathy profile alignments (HP mode). For the PW sequence alignment mode, four different optimized parameter sets are provided, each suited to pairs of sequences with a specific similarity level. These settings utilize different types of inputs: (position-specific) substitution matrices, secondary structure predictions and transmembrane propensities from transmembrane predictions or hydrophobicity scales. In the second (HP) mode, each input multiple sequence alignment is converted into a hydrophobicity profile averaged over the provided set of sequence homologs; the two profiles are then aligned. The HP mode enables qualitative comparison of transmembrane topologies (and therefore potentially of 3D folds) of two membrane proteins, which can be useful if the proteins have low sequence similarity. In summary, the AlignMe web server provides user-friendly access to a set of tools for analysis and comparison of membrane protein sequences. Access is available at http://www.bioinfo.mpg.de/AlignMe PMID:24753425
Naz, Sadia; Ngo, Tony; Farooq, Umar
2017-01-01
Background The rapid increase in antibiotic resistance by various bacterial pathogens underlies the significance of developing new therapies and exploring different drug targets. A fraction of bacterial pathogens abbreviated as ESKAPE by the European Center for Disease Prevention and Control have been considered a major threat due to the rise in nosocomial infections. Here, we compared putative drug binding pockets of twelve essential and mostly conserved metabolic enzymes in numerous bacterial pathogens including those of the ESKAPE group and Mycobacterium tuberculosis. The comparative analysis will provide guidelines for the likelihood of transferability of the inhibitors from one species to another. Methods Nine bacterial species including six ESKAPE pathogens, Mycobacterium tuberculosis along with Mycobacterium smegmatis and Eschershia coli, two non-pathogenic bacteria, have been selected for drug binding pocket analysis of twelve essential enzymes. The amino acid sequences were obtained from Uniprot, aligned using ICM v3.8-4a and matched against the Pocketome encyclopedia. We used known co-crystal structures of selected target enzyme orthologs to evaluate the location of their active sites and binding pockets and to calculate a matrix of pairwise sequence identities across each target enzyme across the different species. This was used to generate sequence maps. Results High sequence identity of enzyme binding pockets, derived from experimentally determined co-crystallized structures, was observed among various species. Comparison at both full sequence level and for drug binding pockets of key metabolic enzymes showed that binding pockets are highly conserved (sequence similarity up to 100%) among various ESKAPE pathogens as well as Mycobacterium tuberculosis. Enzymes orthologs having conserved binding sites may have potential to interact with inhibitors in similar way and might be helpful for design of similar class of inhibitors for a particular species. The derived pocket alignments and distance-based maps provide guidelines for drug discovery and repurposing. In addition they also provide recommendations for the relevant model bacteria that may be used for initial drug testing. Discussion Comparing ligand binding sites through sequence identity calculation could be an effective approach to identify conserved orthologs as drug binding pockets have shown higher level of conservation among various species. By using this approach we could avoid the problems associated with full sequence comparison. We identified essential metabolic enzymes among ESKAPE pathogens that share high sequence identity in their putative drug binding pockets (up to 100%), of which known inhibitors can potentially antagonize these identical pockets in the various species in a similar manner. PMID:28948099
Naz, Sadia; Ngo, Tony; Farooq, Umar; Abagyan, Ruben
2017-01-01
The rapid increase in antibiotic resistance by various bacterial pathogens underlies the significance of developing new therapies and exploring different drug targets. A fraction of bacterial pathogens abbreviated as ESKAPE by the European Center for Disease Prevention and Control have been considered a major threat due to the rise in nosocomial infections. Here, we compared putative drug binding pockets of twelve essential and mostly conserved metabolic enzymes in numerous bacterial pathogens including those of the ESKAPE group and Mycobacterium tuberculosis . The comparative analysis will provide guidelines for the likelihood of transferability of the inhibitors from one species to another. Nine bacterial species including six ESKAPE pathogens, Mycobacterium tuberculosis along with Mycobacterium smegmatis and Eschershia coli , two non-pathogenic bacteria, have been selected for drug binding pocket analysis of twelve essential enzymes. The amino acid sequences were obtained from Uniprot, aligned using ICM v3.8-4a and matched against the Pocketome encyclopedia. We used known co-crystal structures of selected target enzyme orthologs to evaluate the location of their active sites and binding pockets and to calculate a matrix of pairwise sequence identities across each target enzyme across the different species. This was used to generate sequence maps. High sequence identity of enzyme binding pockets, derived from experimentally determined co-crystallized structures, was observed among various species. Comparison at both full sequence level and for drug binding pockets of key metabolic enzymes showed that binding pockets are highly conserved (sequence similarity up to 100%) among various ESKAPE pathogens as well as Mycobacterium tuberculosis . Enzymes orthologs having conserved binding sites may have potential to interact with inhibitors in similar way and might be helpful for design of similar class of inhibitors for a particular species. The derived pocket alignments and distance-based maps provide guidelines for drug discovery and repurposing. In addition they also provide recommendations for the relevant model bacteria that may be used for initial drug testing. Comparing ligand binding sites through sequence identity calculation could be an effective approach to identify conserved orthologs as drug binding pockets have shown higher level of conservation among various species. By using this approach we could avoid the problems associated with full sequence comparison. We identified essential metabolic enzymes among ESKAPE pathogens that share high sequence identity in their putative drug binding pockets (up to 100%), of which known inhibitors can potentially antagonize these identical pockets in the various species in a similar manner.
Universal sequence map (USM) of arbitrary discrete sequences
2002-01-01
Background For over a decade the idea of representing biological sequences in a continuous coordinate space has maintained its appeal but not been fully realized. The basic idea is that any sequence of symbols may define trajectories in the continuous space conserving all its statistical properties. Ideally, such a representation would allow scale independent sequence analysis – without the context of fixed memory length. A simple example would consist on being able to infer the homology between two sequences solely by comparing the coordinates of any two homologous units. Results We have successfully identified such an iterative function for bijective mappingψ of discrete sequences into objects of continuous state space that enable scale-independent sequence analysis. The technique, named Universal Sequence Mapping (USM), is applicable to sequences with an arbitrary length and arbitrary number of unique units and generates a representation where map distance estimates sequence similarity. The novel USM procedure is based on earlier work by these and other authors on the properties of Chaos Game Representation (CGR). The latter enables the representation of 4 unit type sequences (like DNA) as an order free Markov Chain transition table. The properties of USM are illustrated with test data and can be verified for other data by using the accompanying web-based tool:http://bioinformatics.musc.edu/~jonas/usm/. Conclusions USM is shown to enable a statistical mechanics approach to sequence analysis. The scale independent representation frees sequence analysis from the need to assume a memory length in the investigation of syntactic rules. PMID:11895567
Fast Dissemination of New HIV-1 CRF02/A1 Recombinants in Pakistan
Chen, Yue; Hora, Bhavna; DeMarco, Todd; Shah, Sharaf Ali; Ahmed, Manzoor; Sanchez, Ana M.; Su, Chang; Carter, Meredith; Stone, Mars; Hasan, Rumina; Hasan, Zahra; Busch, Michael P.; Denny, Thomas N.; Gao, Feng
2016-01-01
A number of HIV-1 subtypes are identified in Pakistan by characterization of partial viral gene sequences. Little is known whether new recombinants are generated and how they disseminate since whole genome sequences for these viruses have not been characterized. Near full-length genome (NFLG) sequences were obtained by amplifying two overlapping half genomes or next generation sequencing from 34 HIV-1-infected individuals in Pakistan. Phylogenetic tree analysis showed that the newly characterized sequences were 16 subtype As, one subtype C, and 17 A/G recombinants. Further analysis showed that all 16 subtype A1 sequences (47%), together with the vast majority of sequences from Pakistan from other studies, formed a tight subcluster (A1a) within the subtype A1 clade, suggesting that they were derived from a single introduction. More in-depth analysis of 17 A/G NFLG sequences showed that five shared similar recombination breakpoints as in CRF02 (15%) but were phylogenetically distinct from the prototype CRF02 by forming a tight subcluster (CRF02a) while 12 (38%) were new recombinants between CRF02a and A1a or a divergent A1b viruses. Unique recombination patterns among the majority of the newly characterized recombinants indicated ongoing recombination. Interestingly, recombination breakpoints in these CRF02/A1 recombinants were similar to those in prototype CRF02 viruses, indicating that recombination at these sites more likely generate variable recombinant viruses. The dominance and fast dissemination of new CRF02a/A1 recombinants over prototype CRF02 suggest that these recombinant have more adapted and may become major epidemic strains in Pakistan. PMID:27973597
Identification of Y-Chromosome Sequences in Turner Syndrome.
Silva-Grecco, Roseane Lopes da; Trovó-Marqui, Alessandra Bernadete; Sousa, Tiago Alves de; Croce, Lilian Da; Balarin, Marly Aparecida Spadotto
2016-05-01
To investigate the presence of Y-chromosome sequences and determine their frequency in patients with Turner syndrome. The study included 23 patients with Turner syndrome from Brazil, who gave written informed consent for participating in the study. Cytogenetic analyses were performed in peripheral blood lymphocytes, with 100 metaphases per patient. Genomic DNA was also extracted from peripheral blood lymphocytes, and gene sequences DYZ1, DYZ3, ZFY and SRY were amplified by Polymerase Chain Reaction. The cytogenetic analysis showed a 45,X karyotype in 9 patients (39.2 %) and a mosaic pattern in 14 (60.8 %). In 8.7 % (2 out of 23) of the patients, Y-chromosome sequences were found. This prevalence is very similar to those reported previously. The initial karyotype analysis of these patients did not reveal Y-chromosome material, but they were found positive for Y-specific sequences in the lymphocyte DNA analysis. The PCR technique showed that 2 (8.7 %) of the patients with Turner syndrome had Y-chromosome sequences, both presenting marker chromosomes on cytogenetic analysis.
Nath, B Surendra; Gupta, S K; Bajpai, A K
2012-12-01
The life cycle, spore morphology, pathogenicity, tissue specificity, mode of transmission and small subunit rRNA (SSU-rRNA) gene sequence analysis of the five new microsporidian isolates viz., NIWB-11bp, NIWB-12n, NIWB-13md, NIWB-14b and NIWB-15mb identified from the silkworm, Bombyx mori have been studied along with type species, NIK-1s_mys. The life cycle of the microsporidians identified exhibited the sequential developmental cycles that are similar to the general developmental cycle of the genus, Nosema. The spores showed considerable variations in their shape, length and width. The pathogenicity observed was dose-dependent and differed from each of the microsporidian isolates; the NIWB-15mb was found to be more virulent than other isolates. All of the microsporidians were found to infect most of the tissues examined and showed gonadal infection and transovarial transmission in the infected silkworms. SSU-rRNA sequence based phylogenetic tree placed NIWB-14b, NIWB-12n and NIWB-11bp in a separate branch along with other Nosema species and Nosema bombycis; while NIWB-15mb and NIWB-13md together formed another cluster along with other Nosema species. NIK-1s_mys revealed a signature sequence similar to standard type species, N. bombycis, indicating that NIK-1s_mys is similar to N. bombycis. Based on phylogenetic relationships, branch length information based on genetic distance and nucleotide differences, we conclude that the microsporidian isolates identified are distinctly different from the other known species and belonging to the genus, Nosema. This SSU-rRNA gene sequence analysis method is found to be more useful approach in detecting different and closely related microsporidians of this economically important domestic insect.
Sequence analysis of 497 mouse brain ESTs expressed in the substantia nigra
DOE Office of Scientific and Technical Information (OSTI.GOV)
Stewart, G.J.; Savioz, A.; Davies, R.W.
1997-01-15
The use of subtracted, region-specific cDNA libraries combined with single-pass cDNA sequencing allows the discovery of novel genes and facilitates molecular description of the tissue or region involved. We report the sequence of 497 mouse expressed sequence tags (ESTs) from two subtracted libraries enriched for cDNAs expressed in the substantia nigra, a brain region with important roles in movement control and Parkinson disease. Of these, 238 ESTs give no database matches and therefore derive from novel genes. A further 115 ESTs show sequence similarity to ESTs from other organisms, which themselves do not yield any significant database matches to genesmore » of known function. Fifty-six ESTs show sequence similarity to previously identified genes whose mouse homologues have not been reported. The total number of ESTs reported that are new for the mouse is 407, which, together with the 90 ESTs corresponding to known mouse genes or cDNAs, contributes to the molecular description of the substantia nigra. 21 refs., 4 tabs.« less
Reed, K M; Dorschner, M O; Todd, T N; Phillips, R B
1998-09-01
Sequence variation in the control region (D-loop) of the mitochondrial DNA (mtDNA) was examined to assess the genetic distinctiveness of the shortjaw cisco (Coregonus zenithicus). Individuals from within the Great Lakes Basin as well as inland lakes outside the basin were sampled. DNA fragments containing the entire D-loop were amplified by PCR from specimens of C. zenithicus and the related species C. artedi, C. hoyi, C. kiyi, and C. clupeaformis. DNA sequence analysis revealed high similarity within and among species and shared polymorphism for length variants. Based on this analysis, the shortjaw cisco is not genetically distinct from other cisco species.
Naddaf, Saied Reza; Ghazinezhad, Behnaz; Bahramali, Golnaz; Cutler, Sally Jane
2012-09-01
We report a role for Borrelia microti as a cause of relapsing fever in Iran supported by robust epidemiological evidence. The molecular identity of this spirochete and its relation with other relapsing fever borreliae have, until now, been poorly delineated. We analyzed an isolate of B. microti, obtained from Ornithodoros erraticus ticks, by sequencing four loci (16S rRNA, flaB, glpQ, intragenic spacer [IGS]) and comparing these sequences with those of other relapsing fever borreliae. Phylogenetic analysis using concatenated sequences of 16S rRNA, flaB, and glpQ grouped B. microti alongside three members of the African group, B. duttonii, B. recurrentis, and B. crocidurae, which are distinct from B. persica, the most prevalent established cause of tick-borne relapsing fever in Iran. The similarity values for 10 concatenated sequences totaling 2,437 nucleotides ranged from 92.11% to 99.84%, with the highest homologies being between B. duttonii and B. microti and between B. duttonii and B. recurrentis. Furthermore, the more discriminatory IGS sequence analysis corroborated the close similarity (97.76% to 99.56%) between B. microti and B. duttonii. These findings raise the possibility that both species may indeed be the same and further dispel the one-species, one-vector theory that has been the basis for classification of relapsing fever Borrelia for the last 100 years.
Shin, Dong-Ho; Webb, Barbara M; Nakao, Miki; Smith, Sylvia L
2009-07-01
Complement factor I is a crucial regulator of mammalian complement activity. Very little is known of complement regulators in non-mammalian species. We isolated and sequenced four highly similar complement factor I cDNAs from the liver of the nurse shark (Ginglymostoma cirratum), designated as GcIf-1, GcIf-2, GcIf-3 and GcIf-4 (previously referred to as nsFI-a, -b, -c and -d) which encode 689, 673, 673 and 657 amino acid residues, respectively. They share 95% (
Shin, Dong-Ho; Webb, Barbara M.; Nakao, Miki; Smith, Sylvia L.
2009-01-01
Complement factor I is a crucial regulator of mammalian complement activity. Very little is known of complement regulators in non-mammalian species. We isolated and sequenced four highly similar complement factor I cDNAs from the liver of the nurse shark (Ginglymostoma cirratum), designated as GcIf-1, GcIf-2, GcIf-3 and GcIf-4 (previously referred to as nsFI-a, -b, -c and –d) which encode 689, 673, 673 and 657 amino acid residues, respectively. They share 95% (≤) amino acid identities with each other, 35.4 ~ 39.6% and 62.8 ~ 65.9% with factor I of mammals and banded houndshark (Triakis scyllium), respectively. The modular structure of the GcIf is similar to that of mammals with one notable exception, the presence of a novel shark-specific sequence between the leader peptide (LP) and the factor I membrane attack complex (FIMAC) domain. The cDNA sequences differ only in the size and composition of the shark-specific region (SSR). Sequence analysis of each SSR has identified within the region two novel short sequences (SS1 and SS2) and three repeat sequences (RS1, 2 and 3). Genomic analysis has revealed the existence of three introns between the leader peptide and the FIMAC domain, tentatively designated intron 1, intron 2, and intron 3 which span 4067, 2293 and 2082 bp, respectively. Southern blot analysis suggests the presence of a single gene copy for each cDNA type. Phylogenetic analysis suggests that complement factor I of cartilaginous fish diverged prior to the emergence of mammals. All four GcIf cDNA species are expressed in four different tissues and the liver is the main tissue in which expression level of all four is high. This suggests that the expression of GcIf isotypes is tissue-dependent. PMID:19423168
Shewmaker, P L; Whitney, A M; Humrighouse, B W
2016-03-01
Phenotypic, genotypic, and antimicrobial characteristics of six phenotypically distinct human clinical isolates that most closely resembled the type strain of Streptococcus halichoeri isolated from a seal are presented. Sequencing of the 16S rRNA, rpoB, sodA, and recN genes; comparative whole-genome analysis; conventional biochemical and Rapid ID 32 Strep identification methods; and antimicrobial susceptibility testing were performed on the human isolates, the type strain of S. halichoeri, and type strains of closely related species. The six human clinical isolates were biochemically indistinguishable from each other and showed 100% 16S rRNA, rpoB, sodA, and recN gene sequence similarity. Comparative 16S rRNA gene sequencing analysis revealed 98.6% similarity to S. halichoeri CCUG 48324(T), 97.9% similarity to S. canis ATCC 43496(T), and 97.8% similarity to S. ictaluri ATCC BAA-1300(T). A 3,530-bp fragment of the rpoB gene was 98.8% similar to the S. halichoeri type strain, 84.6% to the S. canis type strain, and 83.8% to the S. ictaluri type strain. The S. halichoeri type strain and the human clinical isolates were susceptible to the antimicrobials tested based on CLSI guidelines for Streptococcus species viridans group with the exception of tetracycline and erythromycin. The human isolates were phenotypically distinct from the type strain isolated from a seal; comparative whole-genome sequence analysis confirmed that the human isolates were S. halichoeri. On the basis of these results, a novel subspecies, Streptococcus halichoeri subsp. hominis, is proposed for the human isolates and Streptococcus halichoeri subsp. halichoeri is proposed for the gray seal isolates. The type strain of the novel subspecies is SS1844(T) = CCUG 67100(T) = LMG 28801(T). Copyright © 2016, American Society for Microbiology. All Rights Reserved.
What is a melody? On the relationship between pitch and brightness of timbre
Cousineau, Marion; Carcagno, Samuele; Demany, Laurent; Pressnitzer, Daniel
2014-01-01
Previous studies showed that the perceptual processing of sound sequences is more efficient when the sounds vary in pitch than when they vary in loudness. We show here that sequences of sounds varying in brightness of timbre are processed with the same efficiency as pitch sequences. The sounds used consisted of two simultaneous pure tones one octave apart, and the listeners’ task was to make same/different judgments on pairs of sequences varying in length (one, two, or four sounds). In one condition, brightness of timbre was varied within the sequences by changing the relative level of the two pure tones. In other conditions, pitch was varied by changing fundamental frequency, or loudness was varied by changing the overall level. In all conditions, only two possible sounds could be used in a given sequence, and these two sounds were equally discriminable. When sequence length increased from one to four, discrimination performance decreased substantially for loudness sequences, but to a smaller extent for brightness sequences and pitch sequences. In the latter two conditions, sequence length had a similar effect on performance. These results suggest that the processes dedicated to pitch and brightness analysis, when probed with a sequence-discrimination task, share unexpected similarities. PMID:24478638
The partial 16S rDNA gene sequences of two thermophilic archaeal strains, TY and TYS, previously isolated from the Guaymas Basin hydrothermal vent site were determined. Lipid analyses and a comparative analysis performed with 16S rDNA sequences of similar thermophilic species sho...
Integrated databanks access and sequence/structure analysis services at the PBIL.
Perrière, Guy; Combet, Christophe; Penel, Simon; Blanchet, Christophe; Thioulouse, Jean; Geourjon, Christophe; Grassot, Julien; Charavay, Céline; Gouy, Manolo; Duret, Laurent; Deléage, Gilbert
2003-07-01
The World Wide Web server of the PBIL (Pôle Bioinformatique Lyonnais) provides on-line access to sequence databanks and to many tools of nucleic acid and protein sequence analyses. This server allows to query nucleotide sequence banks in the EMBL and GenBank formats and protein sequence banks in the SWISS-PROT and PIR formats. The query engine on which our data bank access is based is the ACNUC system. It allows the possibility to build complex queries to access functional zones of biological interest and to retrieve large sequence sets. Of special interest are the unique features provided by this system to query the data banks of gene families developed at the PBIL. The server also provides access to a wide range of sequence analysis methods: similarity search programs, multiple alignments, protein structure prediction and multivariate statistics. An originality of this server is the integration of these two aspects: sequence retrieval and sequence analysis. Indeed, thanks to the introduction of re-usable lists, it is possible to perform treatments on large sets of data. The PBIL server can be reached at: http://pbil.univ-lyon1.fr.
Quantiprot - a Python package for quantitative analysis of protein sequences.
Konopka, Bogumił M; Marciniak, Marta; Dyrka, Witold
2017-07-17
The field of protein sequence analysis is dominated by tools rooted in substitution matrices and alignments. A complementary approach is provided by methods of quantitative characterization. A major advantage of the approach is that quantitative properties defines a multidimensional solution space, where sequences can be related to each other and differences can be meaningfully interpreted. Quantiprot is a software package in Python, which provides a simple and consistent interface to multiple methods for quantitative characterization of protein sequences. The package can be used to calculate dozens of characteristics directly from sequences or using physico-chemical properties of amino acids. Besides basic measures, Quantiprot performs quantitative analysis of recurrence and determinism in the sequence, calculates distribution of n-grams and computes the Zipf's law coefficient. We propose three main fields of application of the Quantiprot package. First, quantitative characteristics can be used in alignment-free similarity searches, and in clustering of large and/or divergent sequence sets. Second, a feature space defined by quantitative properties can be used in comparative studies of protein families and organisms. Third, the feature space can be used for evaluating generative models, where large number of sequences generated by the model can be compared to actually observed sequences.
Koschmann, Jeannette; Machens, Fabian; Becker, Marlies; Niemeyer, Julia; Schulze, Jutta; Bülow, Lorenz; Stahl, Dietmar J.; Hehl, Reinhard
2012-01-01
A combination of bioinformatic tools, high-throughput gene expression profiles, and the use of synthetic promoters is a powerful approach to discover and evaluate novel cis-sequences in response to specific stimuli. With Arabidopsis (Arabidopsis thaliana) microarray data annotated to the PathoPlant database, 732 different queries with a focus on fungal and oomycete pathogens were performed, leading to 510 up-regulated gene groups. Using the binding site estimation suite of tools, BEST, 407 conserved sequence motifs were identified in promoter regions of these coregulated gene sets. Motif similarities were determined with STAMP, classifying the 407 sequence motifs into 37 families. A comparative analysis of these 37 families with the AthaMap, PLACE, and AGRIS databases revealed similarities to known cis-elements but also led to the discovery of cis-sequences not yet implicated in pathogen response. Using a parsley (Petroselinum crispum) protoplast system and a modified reporter gene vector with an internal transformation control, 25 elicitor-responsive cis-sequences from 10 different motif families were identified. Many of the elicitor-responsive cis-sequences also drive reporter gene expression in an Agrobacterium tumefaciens infection assay in Nicotiana benthamiana. This work significantly increases the number of known elicitor-responsive cis-sequences and demonstrates the successful integration of a diverse set of bioinformatic resources combined with synthetic promoter analysis for data mining and functional screening in plant-pathogen interaction. PMID:22744985
Ashburner, M; Misra, S; Roote, J; Lewis, S E; Blazej, R; Davis, T; Doyle, C; Galle, R; George, R; Harris, N; Hartzell, G; Harvey, D; Hong, L; Houston, K; Hoskins, R; Johnson, G; Martin, C; Moshrefi, A; Palazzolo, M; Reese, M G; Spradling, A; Tsang, G; Wan, K; Whitelaw, K; Celniker, S
1999-01-01
A contiguous sequence of nearly 3 Mb from the genome of Drosophila melanogaster has been sequenced from a series of overlapping P1 and BAC clones. This region covers 69 chromosome polytene bands on chromosome arm 2L, including the genetically well-characterized "Adh region." A computational analysis of the sequence predicts 218 protein-coding genes, 11 tRNAs, and 17 transposable element sequences. At least 38 of the protein-coding genes are arranged in clusters of from 2 to 6 closely related genes, suggesting extensive tandem duplication. The gene density is one protein-coding gene every 13 kb; the transposable element density is one element every 171 kb. Of 73 genes in this region identified by genetic analysis, 49 have been located on the sequence; P-element insertions have been mapped to 43 genes. Ninety-five (44%) of the known and predicted genes match a Drosophila EST, and 144 (66%) have clear similarities to proteins in other organisms. Genes known to have mutant phenotypes are more likely to be represented in cDNA libraries, and far more likely to have products similar to proteins of other organisms, than are genes with no known mutant phenotype. Over 650 chromosome aberration breakpoints map to this chromosome region, and their nonrandom distribution on the genetic map reflects variation in gene spacing on the DNA. This is the first large-scale analysis of the genome of D. melanogaster at the sequence level. In addition to the direct results obtained, this analysis has allowed us to develop and test methods that will be needed to interpret the complete sequence of the genome of this species.Before beginning a Hunt, it is wise to ask someone what you are looking for before you begin looking for it. Milne 1926 PMID:10471707
Gene Identification Algorithms Using Exploratory Statistical Analysis of Periodicity
NASA Astrophysics Data System (ADS)
Mukherjee, Shashi Bajaj; Sen, Pradip Kumar
2010-10-01
Studying periodic pattern is expected as a standard line of attack for recognizing DNA sequence in identification of gene and similar problems. But peculiarly very little significant work is done in this direction. This paper studies statistical properties of DNA sequences of complete genome using a new technique. A DNA sequence is converted to a numeric sequence using various types of mappings and standard Fourier technique is applied to study the periodicity. Distinct statistical behaviour of periodicity parameters is found in coding and non-coding sequences, which can be used to distinguish between these parts. Here DNA sequences of Drosophila melanogaster were analyzed with significant accuracy.
Pei, Haisheng; Chen, Zhou; Tan, Xiaoyan; Hu, Jing; Yang, Bin; Sun, Junshe
2017-01-01
Ganoderma lucidum is a typical polypore fungus used for traditional Chinese medical purposes. The taxonomic delimitation of Ganoderma lucidum is still debated. In this study, we sequenced seven internal transcribed spacer (ITS) sequences of Ganoderma lucidum strains and annotated the ITS1 and ITS2 regions. Phylogenetic analysis of ITS1 differentiated the strains into three geographic groups. Groups 1–3 were originated from Europe, tropical Asia, and eastern Asia, respectively. While ITS2 could only differentiate the strains into two groups in which Group 2 originated from tropical Asia gathered with Groups 1 and 3 originated from Europe and eastern Asia. By determining the secondary structures of the ITS1 sequences, these three groups exhibited similar structures with a conserved central core and differed helices. While compared to Group 2, Groups 1 and 3 of ITS2 sequences shared similar structures with the difference in helix 4. Large-scale evaluation of ITS1 and ITS2 both exhibited that the majority of subgroups in the same group shared the similar structures. Further Weblogo analysis of ITS1 sequences revealed two main variable regions located in helix 2 in which C/T or A/G substitutions frequently occurred and ITS1 exhibited more nucleotide variances compared to ITS2. ITS1 multi-alignment of seven spawn strains and culture tests indicated that a single-nucleotide polymorphism (SNP) site at position 180 correlated with strain antagonism. The HZ, TK and 203 fusion strains of Ganoderma lucidum had a T at position 180, whereas other strains exhibiting antagonism, including DB, RB, JQ, and YS, had a C. Taken together, compared to ITS2 region, ITS1 region could differentiated Ganoderma lucidum into three geographic originations based on phylogenetic analysis and secondary structure prediction. Besides, a SNP in ITS 1 could delineate Ganoderma lucidum strains at the intraspecific level. These findings will be implemented to improve species quality control in the Ganoderma industry. PMID:28056060
Zhang, Xiuqing; Xu, Zhangyang; Pei, Haisheng; Chen, Zhou; Tan, Xiaoyan; Hu, Jing; Yang, Bin; Sun, Junshe
2017-01-01
Ganoderma lucidum is a typical polypore fungus used for traditional Chinese medical purposes. The taxonomic delimitation of Ganoderma lucidum is still debated. In this study, we sequenced seven internal transcribed spacer (ITS) sequences of Ganoderma lucidum strains and annotated the ITS1 and ITS2 regions. Phylogenetic analysis of ITS1 differentiated the strains into three geographic groups. Groups 1-3 were originated from Europe, tropical Asia, and eastern Asia, respectively. While ITS2 could only differentiate the strains into two groups in which Group 2 originated from tropical Asia gathered with Groups 1 and 3 originated from Europe and eastern Asia. By determining the secondary structures of the ITS1 sequences, these three groups exhibited similar structures with a conserved central core and differed helices. While compared to Group 2, Groups 1 and 3 of ITS2 sequences shared similar structures with the difference in helix 4. Large-scale evaluation of ITS1 and ITS2 both exhibited that the majority of subgroups in the same group shared the similar structures. Further Weblogo analysis of ITS1 sequences revealed two main variable regions located in helix 2 in which C/T or A/G substitutions frequently occurred and ITS1 exhibited more nucleotide variances compared to ITS2. ITS1 multi-alignment of seven spawn strains and culture tests indicated that a single-nucleotide polymorphism (SNP) site at position 180 correlated with strain antagonism. The HZ, TK and 203 fusion strains of Ganoderma lucidum had a T at position 180, whereas other strains exhibiting antagonism, including DB, RB, JQ, and YS, had a C. Taken together, compared to ITS2 region, ITS1 region could differentiated Ganoderma lucidum into three geographic originations based on phylogenetic analysis and secondary structure prediction. Besides, a SNP in ITS 1 could delineate Ganoderma lucidum strains at the intraspecific level. These findings will be implemented to improve species quality control in the Ganoderma industry.
McDermott, Jason E.; Bruillard, Paul; Overall, Christopher C.; ...
2015-03-09
There are many examples of groups of proteins that have similar function, but the determinants of functional specificity may be hidden by lack of sequencesimilarity, or by large groups of similar sequences with different functions. Transporters are one such protein group in that the general function, transport, can be easily inferred from the sequence, but the substrate specificity can be impossible to predict from sequence with current methods. In this paper we describe a linguistic-based approach to identify functional patterns from groups of unaligned protein sequences and its application to predict multi-drug resistance transporters (MDRs) from bacteria. We first showmore » that our method can recreate known patterns from PROSITE for several motifs from unaligned sequences. We then show that the method, MDRpred, can predict MDRs with greater accuracy and positive predictive value than a collection of currently available family-based models from the Pfam database. Finally, we apply MDRpred to a large collection of protein sequences from an environmental microbiome study to make novel predictions about drug resistance in a potential environmental reservoir.« less
Mukherjee, Koel; Pandey, Dev Mani; Vidyarthi, Ambarish Saran
2015-02-06
Gaining access to sequence and structure information of telomere binding proteins helps in understanding the essential biological processes involve in conserved sequence specific interaction between DNA and the proteins. Rice telomere binding protein (RTBP1) and Nicotiana glutinosa telomere repeat binding factor (NgTRF1) are helix turn helix motif type of proteins that plays role in telomeric DNA protection and length regulation. Both the proteins share same type of domain but till now there is very less communication on the in silico studies of these complete proteins.Here we intend to do a comparative study between two proteins through modeling of the complete proteins, physiochemical characterization, MD simulation and DNA-protein docking. I-TASSER and CLC protein work bench was performed to find out the protein 3D structure as well as the different parameters to characterize the proteins. MD simulation was completed by GROMOS forcefield of GROMACS for 10 ns of time stretch. The simulated 3D structures were docked with template DNA (3D DNA modeled through 3D-DART) of TTTAGGG conserved sequence motif using HADDOCK web server.Digging up all the facts about the proteins it was reveled that around 120 amino acids in the tail part was showing a good sequence similarity between the proteins. Molecular modeling, sequence characterization and secondary structure prediction also indicates the similarity between the protein's structure and sequence. The result of MD simulation highlights on the RMSD, RMSF, Rg, PCA and Energy plots which also conveys the similar type of motional behavior between them. The best complex formation for both the proteins in docking result also indicates for the first interaction site which is mainly the helix3 region of the DNA binding domain. The overall computational analysis reveals that RTBP1 and NgTRF1 proteins display good amount of similarity in their physicochemical properties, structure, dynamics and binding mode.
Mukherjee, Koel; Pandey, Dev Mani; Vidyarthi, Ambarish Saran
2015-09-01
Gaining access to sequence and structure information of telomere-binding proteins helps in understanding the essential biological processes involve in conserved sequence-specific interaction between DNA and the proteins. Rice telomere-binding protein (RTBP1) and Nicotiana glutinosa telomere repeat binding factor (NgTRF1) are helix-turn-helix motif type of proteins that plays role in telomeric DNA protection and length regulation. Both the proteins share same type of domain, but till now there is very less communication on the in silico studies of these complete proteins. Here we intend to do a comparative study between two proteins through modeling of the complete proteins, physiochemical characterization, MD simulation and DNA-protein docking. I-TASSER and CLC protein work bench was performed to find out the protein 3D structure as well as the different parameters to characterize the proteins. MD simulation was completed by GROMOS forcefield of GROMACS for 10 ns of time stretch. The simulated 3D structures were docked with template DNA (3D DNA modeled through 3D-DART) of TTTAGGG conserved sequence motif using HADDOCK Web server. By digging up all the facts about the proteins, it was revealed that around 120 amino acids in the tail part were showing a good sequence similarity between the proteins. Molecular modeling, sequence characterization and secondary structure prediction also indicate the similarity between the protein's structure and sequence. The result of MD simulation highlights on the RMSD, RMSF, Rg, PCA and energy plots which also conveys the similar type of motional behavior between them. The best complex formation for both the proteins in docking result also indicates for the first interaction site which is mainly the helix3 region of the DNA-binding domain. The overall computational analysis reveals that RTBP1 and NgTRF1 proteins display good amount of similarity in their physicochemical properties, structure, dynamics and binding mode.
Yanagi, Tomohiro; Shirasawa, Kenta; Terachi, Mayuko; Isobe, Sachiko
2017-01-01
Cultivated strawberry ( Fragaria × ananassa Duch.) has homoeologous chromosomes because of allo-octoploidy. For example, two homoeologous chromosomes that belong to different sub-genome of allopolyploids have similar base sequences. Thus, when conducting de novo assembly of DNA sequences, it is difficult to determine whether these sequences are derived from the same chromosome. To avoid the difficulties associated with homoeologous chromosomes and demonstrate the possibility of sequencing allopolyploids using single chromosomes, we conducted sequence analysis using microdissected single somatic chromosomes of cultivated strawberry. Three hundred and ten somatic chromosomes of the Japanese octoploid strawberry 'Reiko' were individually selected under a light microscope using a microdissection system. DNA from 288 of the dissected chromosomes was successfully amplified using a DNA amplification kit. Using next-generation sequencing, we decoded the base sequences of the amplified DNA segments, and on the basis of mapping, we identified DNA sequences from 144 samples that were best matched to the reference genomes of the octoploid strawberry, F. × ananassa , and the diploid strawberry, F. vesca . The 144 samples were classified into seven pseudo-molecules of F. vesca . The coverage rates of the DNA sequences from the single chromosome onto all pseudo-molecular sequences varied from 3 to 29.9%. We demonstrated an efficient method for sequence analysis of allopolyploid plants using microdissected single chromosomes. On the basis of our results, we believe that whole-genome analysis of allopolyploid plants can be enhanced using methodology that employs microdissected single chromosomes.
Tu, Z; Hagedorn, H H
1997-02-01
Pyruvate carboxylase (PC, pyruvate: carbon dioxide ligase [ADP-forming], EC 6.4.1.1) was purified from the yellow fever mosquito, Aedes aegypti. The purified PC showed two polypeptides of similar M(r) (133 and 128 k). The N-terminal sequences of both polypeptides were shown to be very similar, if not identical. A polyclonal antiserum against the 133 kDa polypeptide cross-reacted strongly with the 128 kDa polypeptide. PC was found in all tissues examined. Using a semi-quantitative Western blot assay, PC was shown to be concentrated in the indirect flight muscles and fat body preparations. The ratios of the 133 to 128 kDa polypeptides were shown to differ in various tissues and an Aedes albopictus cell line. The indirect flight muscle was the only tissue in which the 128 kDa polypeptide was more abundant, while both the midgut and the cell line showed almost exclusively the 133 kDa polypeptide. Both peptides were present in varying amounts in brain, malpighian tubule, ovary and fat body preparation. The two isoforms of PC could play different roles in the flight muscle and other tissues. Clones covering a complete cDNA of PC of A. aegypti were obtained using a directional approach. The 3952 bp nucleotide sequence, including a 3585 bp coding region, was determined from these cDNA clones. The deduced 1195 amino acid sequence has a calculated M(r) of 132,200. A putative mitochondrial targeting sequence was determined by comparing the deduced amino acid sequence to the N-terminal sequences of the mature protein. The presence of a mitochondrial targeting sequence indicates that the mosquito PC encoded by the cloned cDNA may be localized in the mitochondria. After the targeting sequence, three functional domains were identified in the following order; biotin carboxylase (BC), carboxyltransferase (CT) and biotin carboxyl carrier protein (BCCP). The mosquito PC showed very high similarity to PCs from other sources (55.1-75.2% identity). Genomic Southern analysis indicated that there could be two similar PC genes or a single PC gene with allelic polymorphism in the A. aegypti genome. The evolutionary relationship of PCs among different organisms was consistent with the accepted evolutionary relationship of their host organisms. The evolution of the domain structures of the biotin-dependent carboxylases including PC was also investigated. This analysis indicates that biotin-dependent carboxylases evolved from a common origin. The analysis also provides evidence for early gene duplication events that shaped the family of biotin-dependent carboxylases. Clear evidence for the coevolution of BC and BCCP domains is presented, although they are associated with very different CT domains and the relative position of the three functional domains varies between members of the biotin-dependent carboxylases.
Solov'ev, V V; Kel', A E; Kolchanov, N A
1989-01-01
The factors, determining the presence of inverted and symmetrical repeats in genes coding for globular proteins, have been analysed. An interesting property of genetical code has been revealed in the analysis of symmetrical repeats: the pairs of symmetrical codons corresponded to pairs of amino acids with mostly similar physical-chemical parameters. This property may explain the presence of symmetrical repeats and palindromes only in genes coding for beta-structural proteins-polypeptides, where amino acids with similar physical-chemical properties occupy symmetrical positions. A stochastic model of evolution of polynucleotide sequences has been used for analysis of inverted repeats. The modelling demonstrated that only limiting of sequences (uneven frequencies of used codons) is enough for arising of nonrandom inverted repeats in genes.
Raventós, D; Jensen, A B; Rask, M B; Casacuberta, J M; Mundy, J; San Segundo, B
1995-01-01
Transient gene expression assays in barley aleurone protoplasts were used to identify a cis-regulatory element involved in the elicitor-responsive expression of the maize PRms gene. Analysis of transcriptional fusions between PRms 5' upstream sequences and a chloramphenicol acetyltransferase reporter gene, as well as chimeric promoters containing PRms promoter fragments or repeated oligonucleotides fused to a minimal promoter, delineated a 20 bp sequence which functioned as an elicitor-response element (ERE). This sequence contains a motif (-246 AATTGACC) similar to sequences found in promoters of other pathogen-responsive genes. The analysis also indicated that an enhancing sequence(s) between -397 and -296 is required for full PRms activation by elicitors. The protein kinase inhibitor staurosporine was found to completely block the transcriptional activation induced by elicitors. These data indicate that protein phosphorylation is involved in the signal transduction pathway leading to PRms expression.
Genomic analysis of WCP30 Phage of Weissella cibaria for Dairy Fermented Foods.
Lee, Young-Duck; Park, Jong-Hyun
2017-01-01
In this study, we report the morphogenetic analysis and genome sequence of a new WCP30 phage of Weissella cibaria , isolated from a fermented food. Based on its morphology, as observed by transmission electron microscopy, WCP30 phage belongs to the family Siphoviridae . Genomic analysis of WCP30 phage showed that it had a 33,697-bp double-stranded DNA genome with 41.2% G+C content. Bioinformatics analysis of the genome revealed 35 open reading frames. A BLASTN search showed that WCP30 phage had low sequence similarity compared to other phages infecting lactic acid bacteria. This is the first report of the morphological features and complete genome sequence of WCP30 phage, which may be useful for controlling the fermentation of dairy foods.
Open Reading Frame Phylogenetic Analysis on the Cloud
2013-01-01
Phylogenetic analysis has become essential in researching the evolutionary relationships between viruses. These relationships are depicted on phylogenetic trees, in which viruses are grouped based on sequence similarity. Viral evolutionary relationships are identified from open reading frames rather than from complete sequences. Recently, cloud computing has become popular for developing internet-based bioinformatics tools. Biocloud is an efficient, scalable, and robust bioinformatics computing service. In this paper, we propose a cloud-based open reading frame phylogenetic analysis service. The proposed service integrates the Hadoop framework, virtualization technology, and phylogenetic analysis methods to provide a high-availability, large-scale bioservice. In a case study, we analyze the phylogenetic relationships among Norovirus. Evolutionary relationships are elucidated by aligning different open reading frame sequences. The proposed platform correctly identifies the evolutionary relationships between members of Norovirus. PMID:23671843
Categorizing accident sequences in the external radiotherapy for risk analysis
2013-01-01
Purpose This study identifies accident sequences from the past accidents in order to help the risk analysis application to the external radiotherapy. Materials and Methods This study reviews 59 accidental cases in two retrospective safety analyses that have collected the incidents in the external radiotherapy extensively. Two accident analysis reports that accumulated past incidents are investigated to identify accident sequences including initiating events, failure of safety measures, and consequences. This study classifies the accidents by the treatments stages and sources of errors for initiating events, types of failures in the safety measures, and types of undesirable consequences and the number of affected patients. Then, the accident sequences are grouped into several categories on the basis of similarity of progression. As a result, these cases can be categorized into 14 groups of accident sequence. Results The result indicates that risk analysis needs to pay attention to not only the planning stage, but also the calibration stage that is committed prior to the main treatment process. It also shows that human error is the largest contributor to initiating events as well as to the failure of safety measures. This study also illustrates an event tree analysis for an accident sequence initiated in the calibration. Conclusion This study is expected to provide sights into the accident sequences for the prospective risk analysis through the review of experiences. PMID:23865005
Evaluating the protein coding potential of exonized transposable element sequences
Piriyapongsa, Jittima; Rutledge, Mark T; Patel, Sanil; Borodovsky, Mark; Jordan, I King
2007-01-01
Background Transposable element (TE) sequences, once thought to be merely selfish or parasitic members of the genomic community, have been shown to contribute a wide variety of functional sequences to their host genomes. Analysis of complete genome sequences have turned up numerous cases where TE sequences have been incorporated as exons into mRNAs, and it is widely assumed that such 'exonized' TEs encode protein sequences. However, the extent to which TE-derived sequences actually encode proteins is unknown and a matter of some controversy. We have tried to address this outstanding issue from two perspectives: i-by evaluating ascertainment biases related to the search methods used to uncover TE-derived protein coding sequences (CDS) and ii-through a probabilistic codon-frequency based analysis of the protein coding potential of TE-derived exons. Results We compared the ability of three classes of sequence similarity search methods to detect TE-derived sequences among data sets of experimentally characterized proteins: 1-a profile-based hidden Markov model (HMM) approach, 2-BLAST methods and 3-RepeatMasker. Profile based methods are more sensitive and more selective than the other methods evaluated. However, the application of profile-based search methods to the detection of TE-derived sequences among well-curated experimentally characterized protein data sets did not turn up many more cases than had been previously detected and nowhere near as many cases as recent genome-wide searches have. We observed that the different search methods used were complementary in the sense that they yielded largely non-overlapping sets of hits and differed in their ability to recover known cases of TE-derived CDS. The probabilistic analysis of TE-derived exon sequences indicates that these sequences have low protein coding potential on average. In particular, non-autonomous TEs that do not encode protein sequences, such as Alu elements, are frequently exonized but unlikely to encode protein sequences. Conclusion The exaptation of the numerous TE sequences found in exons as bona fide protein coding sequences may prove to be far less common than has been suggested by the analysis of complete genomes. We hypothesize that many exonized TE sequences actually function as post-transcriptional regulators of gene expression, rather than coding sequences, which may act through a variety of double stranded RNA related regulatory pathways. Indeed, their relatively high copy numbers and similarity to sequences dispersed throughout the genome suggests that exonized TE sequences could serve as master regulators with a wide scope of regulatory influence. Reviewers: This article was reviewed by Itai Yanai, Kateryna D. Makova, Melissa Wilson (nominated by Kateryna D. Makova) and Cedric Feschotte (nominated by John M. Logsdon Jr.). PMID:18036258
Hodgetts, Jennifer; Boonham, Neil; Mumford, Rick; Harrison, Nigel; Dickinson, Matthew
2008-08-01
Phytoplasma phylogenetics has focused primarily on sequences of the non-coding 16S rRNA gene and the 16S-23S rRNA intergenic spacer region (16-23S ISR), and primers that enable amplification of these regions from all phytoplasmas by PCR are well established. In this study, primers based on the secA gene have been developed into a semi-nested PCR assay that results in a sequence of the expected size (about 480 bp) from all 34 phytoplasmas examined, including strains representative of 12 16Sr groups. Phylogenetic analysis of secA gene sequences showed similar clustering of phytoplasmas when compared with clusters resolved by similar sequence analyses of a 16-23S ISR-23S rRNA gene contig or of the 16S rRNA gene alone. The main differences between trees were in the branch lengths, which were elongated in the 16-23S ISR-23S rRNA gene tree when compared with the 16S rRNA gene tree and elongated still further in the secA gene tree, despite this being a shorter sequence. The improved resolution in the secA gene-derived phylogenetic tree resulted in the 16SrII group splitting into two distinct clusters, while phytoplasmas associated with coconut lethal yellowing-type diseases split into three distinct groups, thereby supporting past proposals that they represent different candidate species within 'Candidatus Phytoplasma'. The ability to differentiate 16Sr groups and subgroups by virtual RFLP analysis of secA gene sequences suggests that this gene may provide an informative alternative molecular marker for pathogen identification and diagnosis of phytoplasma diseases.
The transcriptome of Lutzomyia longipalpis (Diptera: Psychodidae) male reproductive organs.
Azevedo, Renata V D M; Dias, Denise B S; Bretãs, Jorge A C; Mazzoni, Camila J; Souza, Nataly A; Albano, Rodolpho M; Wagner, Glauber; Davila, Alberto M R; Peixoto, Alexandre A
2012-01-01
It has been suggested that genes involved in the reproductive biology of insect disease vectors are potential targets for future alternative methods of control. Little is known about the molecular biology of reproduction in phlebotomine sand flies and there is no information available concerning genes that are expressed in male reproductive organs of Lutzomyia longipalpis, the main vector of American visceral leishmaniasis and a species complex. We generated 2678 high quality ESTs ("Expressed Sequence Tags") of L. longipalpis male reproductive organs that were grouped in 1391 non-redundant sequences (1136 singlets and 255 clusters). BLAST analysis revealed that only 57% of these sequences share similarity with a L. longipalpis female EST database. Although no more than 36% of the non-redundant sequences showed similarity to protein sequences deposited in databases, more than half of them presented the best-match hits with mosquito genes. Gene ontology analysis identified subsets of genes involved in biological processes such as protein biosynthesis and DNA replication, which are probably associated with spermatogenesis. A number of non-redundant sequences were also identified as putative male reproductive gland proteins (mRGPs), also known as male accessory gland protein genes (Acps). The transcriptome analysis of L. longipalpis male reproductive organs is one step further in the study of the molecular basis of the reproductive biology of this important species complex. It has allowed the identification of genes potentially involved in spermatogenesis as well as putative mRGPs sequences, which have been studied in many insect species because of their effects on female post-mating behavior and physiology and their potential role in sexual selection and speciation. These data open a number of new avenues for further research in the molecular and evolutionary reproductive biology of sand flies.
The Transcriptome of Lutzomyia longipalpis (Diptera: Psychodidae) Male Reproductive Organs
Bretãs, Jorge A. C.; Mazzoni, Camila J.; Souza, Nataly A.; Albano, Rodolpho M.; Wagner, Glauber; Davila, Alberto M. R.; Peixoto, Alexandre A.
2012-01-01
Background It has been suggested that genes involved in the reproductive biology of insect disease vectors are potential targets for future alternative methods of control. Little is known about the molecular biology of reproduction in phlebotomine sand flies and there is no information available concerning genes that are expressed in male reproductive organs of Lutzomyia longipalpis, the main vector of American visceral leishmaniasis and a species complex. Methods/Principal Findings We generated 2678 high quality ESTs (“Expressed Sequence Tags”) of L. longipalpis male reproductive organs that were grouped in 1391 non-redundant sequences (1136 singlets and 255 clusters). BLAST analysis revealed that only 57% of these sequences share similarity with a L. longipalpis female EST database. Although no more than 36% of the non-redundant sequences showed similarity to protein sequences deposited in databases, more than half of them presented the best-match hits with mosquito genes. Gene ontology analysis identified subsets of genes involved in biological processes such as protein biosynthesis and DNA replication, which are probably associated with spermatogenesis. A number of non-redundant sequences were also identified as putative male reproductive gland proteins (mRGPs), also known as male accessory gland protein genes (Acps). Conclusions The transcriptome analysis of L. longipalpis male reproductive organs is one step further in the study of the molecular basis of the reproductive biology of this important species complex. It has allowed the identification of genes potentially involved in spermatogenesis as well as putative mRGPs sequences, which have been studied in many insect species because of their effects on female post-mating behavior and physiology and their potential role in sexual selection and speciation. These data open a number of new avenues for further research in the molecular and evolutionary reproductive biology of sand flies. PMID:22496818
USDA-ARS?s Scientific Manuscript database
Previous phylogenetic analyses of species of Streptomyces based on 16S rRNA gene sequences resulted in a statistically well-supported clade (100% bootstrap value) containing 8 species that exhibited very similar gross morphology in producing open looped (Retinaculum-Apertum) to spiral (Spira) chains...
Cousins, Matthew M.; Ou, San-San; Wawer, Maria J.; Munshaw, Supriya; Swan, David; Magaret, Craig A.; Mullis, Caroline E.; Serwadda, David; Porcella, Stephen F.; Gray, Ronald H.; Quinn, Thomas C.; Donnell, Deborah; Eshleman, Susan H.
2012-01-01
Next-generation sequencing (NGS) has recently been used for analysis of HIV diversity, but this method is labor-intensive, costly, and requires complex protocols for data analysis. We compared diversity measures obtained using NGS data to those obtained using a diversity assay based on high-resolution melting (HRM) of DNA duplexes. The HRM diversity assay provides a single numeric score that reflects the level of diversity in the region analyzed. HIV gag and env from individuals in Rakai, Uganda, were analyzed in a previous study using NGS (n = 220 samples from 110 individuals). Three sequence-based diversity measures were calculated from the NGS sequence data (percent diversity, percent complexity, and Shannon entropy). The amplicon pools used for NGS were analyzed with the HRM diversity assay. HRM scores were significantly associated with sequence-based measures of HIV diversity for both gag and env (P < 0.001 for all measures). The level of diversity measured by the HRM diversity assay and NGS increased over time in both regions analyzed (P < 0.001 for all measures except for percent complexity in gag), and similar amounts of diversification were observed with both methods (P < 0.001 for all measures except for percent complexity in gag). Diversity measures obtained using the HRM diversity assay were significantly associated with those from NGS, and similar increases in diversity over time were detected by both methods. The HRM diversity assay is faster and less expensive than NGS, facilitating rapid analysis of large studies of HIV diversity and evolution. PMID:22785188
Shoguchi, Eiichi; Shinzato, Chuya; Hisata, Kanako; Satoh, Nori; Mungpakdee, Sutada
2015-07-20
Even though mitochondrial genomes, which characterize eukaryotic cells, were first discovered more than 50 years ago, mitochondrial genomics remains an important topic in molecular biology and genome sciences. The Phylum Alveolata comprises three major groups (ciliates, apicomplexans, and dinoflagellates), the mitochondrial genomes of which have diverged widely. Even though the gene content of dinoflagellate mitochondrial genomes is reportedly comparable to that of apicomplexans, the highly fragmented and rearranged genome structures of dinoflagellates have frustrated whole genomic analysis. Consequently, noncoding sequences and gene arrangements of dinoflagellate mitochondrial genomes have not been well characterized. Here we report that the continuous assembled genome (∼326 kb) of the dinoflagellate, Symbiodinium minutum, is AT-rich (∼64.3%) and that it contains three protein-coding genes. Based upon in silico analysis, the remaining 99% of the genome comprises transcriptomic noncoding sequences. RNA edited sites and unique, possible start and stop codons clarify conserved regions among dinoflagellates. Our massive transcriptome analysis shows that almost all regions of the genome are transcribed, including 27 possible fragmented ribosomal RNA genes and 12 uncharacterized small RNAs that are similar to mitochondrial RNA genes of the malarial parasite, Plasmodium falciparum. Gene map comparisons show that gene order is only slightly conserved between S. minutum and P. falciparum. However, small RNAs and intergenic sequences share sequence similarities with P. falciparum, suggesting that the function of noncoding sequences has been preserved despite development of very different genome structures. © The Author(s) 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.
The Gap Procedure: for the identification of phylogenetic clusters in HIV-1 sequence data.
Vrbik, Irene; Stephens, David A; Roger, Michel; Brenner, Bluma G
2015-11-04
In the context of infectious disease, sequence clustering can be used to provide important insights into the dynamics of transmission. Cluster analysis is usually performed using a phylogenetic approach whereby clusters are assigned on the basis of sufficiently small genetic distances and high bootstrap support (or posterior probabilities). The computational burden involved in this phylogenetic threshold approach is a major drawback, especially when a large number of sequences are being considered. In addition, this method requires a skilled user to specify the appropriate threshold values which may vary widely depending on the application. This paper presents the Gap Procedure, a distance-based clustering algorithm for the classification of DNA sequences sampled from individuals infected with the human immunodeficiency virus type 1 (HIV-1). Our heuristic algorithm bypasses the need for phylogenetic reconstruction, thereby supporting the quick analysis of large genetic data sets. Moreover, this fully automated procedure relies on data-driven gaps in sorted pairwise distances to infer clusters, thus no user-specified threshold values are required. The clustering results obtained by the Gap Procedure on both real and simulated data, closely agree with those found using the threshold approach, while only requiring a fraction of the time to complete the analysis. Apart from the dramatic gains in computational time, the Gap Procedure is highly effective in finding distinct groups of genetically similar sequences and obviates the need for subjective user-specified values. The clusters of genetically similar sequences returned by this procedure can be used to detect patterns in HIV-1 transmission and thereby aid in the prevention, treatment and containment of the disease.
Reed, Kent M.; Dorschner, Michael O.; Todd, Thomas N.; Phillips, Ruth B.
1998-01-01
Sequence variation in the control region (D-loop) of the mitochondrial DNA (mtDNA) was examined to assess the genetic distinctiveness of the shortjaw cisco (Coregonus zenithicus). Individuals from within the Great Lakes Basin as well as inland lakes outside the basin were sampled. DNA fragments containing the entire D-loop were amplified by PCR from specimens ofC. zenithicus and the related species C. artedi, C. hoyi, C. kiyi, and C. clupeaformis. DNA sequence analysis revealed high similarity within and among species and shared polymorphism for length variants. Based on this analysis, the shortjaw cisco is not genetically distinct from other cisco species.
Gene context analysis in the Integrated Microbial Genomes (IMG) data management system.
Mavromatis, Konstantinos; Chu, Ken; Ivanova, Natalia; Hooper, Sean D; Markowitz, Victor M; Kyrpides, Nikos C
2009-11-24
Computational methods for determining the function of genes in newly sequenced genomes have been traditionally based on sequence similarity to genes whose function has been identified experimentally. Function prediction methods can be extended using gene context analysis approaches such as examining the conservation of chromosomal gene clusters, gene fusion events and co-occurrence profiles across genomes. Context analysis is based on the observation that functionally related genes are often having similar gene context and relies on the identification of such events across phylogenetically diverse collection of genomes. We have used the data management system of the Integrated Microbial Genomes (IMG) as the framework to implement and explore the power of gene context analysis methods because it provides one of the largest available genome integrations. Visualization and search tools to facilitate gene context analysis have been developed and applied across all publicly available archaeal and bacterial genomes in IMG. These computations are now maintained as part of IMG's regular genome content update cycle. IMG is available at: http://img.jgi.doe.gov.
1981-03-01
Again E( XnX 1 Xn) Xn + (l-aB)/X PlXn-1 + (l-Pl)/x 2.11) and X0 E0 gives a stationary sequence. Thus the correla- tions and regressions are the...sequence, although the sample paths will tend to have runs-up. A similar analysis given in Lawrance and Lewis [5] shows that 1 1 + i a + au (3.7) E( XnX
Silva, A T; Paiva, L V; Andrade, A C; Barduche, D
2013-05-21
Brazil possesses the most modern and productive coffee growing farms in the world, but technological development is desired to cope with the increasing world demand. One way to increase Brazilian coffee growing productivity is wide scale production of clones with superior genotypes, which can be obtained with in vitro propagation technique, or from tissue culture. These procedures can generate thousands of clones. However, the methodologies for in vitro cultivation are genotype-dependent, which leads to an almost empirical development of specific protocols for each species. Therefore, molecular markers linked to the biochemical events of somatic embryogenesis would greatly facilitate the development of such protocols. In this context, sequences potentially involved in embryogenesis processes in the coffee plant were identified in silico from libraries generated by the Brazilian Coffee Genome Project. Through these in silico analyses, we identified 15 EST-contigs related to the embryogenesis process. Among these, 5 EST-contigs (3605, 9850, 13686, 17240, and 17265) could readily be associated with plant embryogenesis. Sequence analysis of EST-contig 3605, 9850, and 17265 revealed similarity to a polygalacturonase, to a cysteine-proteinase, and to an allergenine, respectively. Results also show that EST-contig 17265 sequences presented similarity to an expansin. Finally, analysis of EST-contig 17240 revealed similarity to a protein of unknown function, but it grouped in the similarity dendrogram with the WUSCHEL transcription factor. The data suggest that these EST-contigs are related to the embryogenic process and have potential as molecular markers to increase methodological efficiency in obtaining coffee plant embryogenic materials.
Deng, Peng; Tan, Xiaoqing; Wu, Ying; Bai, Qunhua; Jia, Yan; Xiao, Hong
2015-03-01
The ChrT gene encodes a chromate reductase enzyme which catalyzes the reduction of Cr(VI). The chromate reductase is also known as flavin mononucleotide (FMN) reductase (FMN_red). The aim of the present study was to clone the full-length ChrT DNA from Serratia sp. CQMUS2 and analyze the deduced amino acid sequence and three-dimensional structure. The putative ChrT gene fragment of Serratia sp. CQMUS2 was isolated by polymerase chain reaction (PCR), according to the known FMN_red gene sequence from Serratia sp. AS13. The flanking sequences of the ChrT gene were obtained by high efficiency TAIL-PCR, while the full-length gene of ChrT was cloned in Escherichia coli for subsequent sequencing. The nucleotide sequence of ChrT was submitted onto GenBank under the accession number, KF211434. Sequence analysis of the gene and amino acids was conducted using the Basic Local Alignment Search Tool, and open reading frame (ORF) analysis was performed using ORF Finder software. The ChrT gene was found to be an ORF of 567 bp that encodes a 188-amino acid enzyme with a calculated molecular weight of 20.4 kDa. In addition, the ChrT protein was hypothesized to be an NADPH-dependent FMN_red and a member of the flavodoxin-2 superfamily. The amino acid sequence of ChrT showed high sequence similarity to the FMN reductase genes of Klebsiella pneumonia and Raoultella ornithinolytica , which belong to the flavodoxin-2 superfamily. Furthermore, ChrT was shown to have a 85.6% similarity to the three-dimensional structure of Escherichia coli ChrR, sharing four common enzyme active sites for chromate reduction. Therefore, ChrT gene cloning and protein structure determination demonstrated the ability of the gene for chromate reduction. The results of the present study provide a basis for further studies on ChrT gene expression and protein function.
DENG, PENG; TAN, XIAOQING; WU, YING; BAI, QUNHUA; JIA, YAN; XIAO, HONG
2015-01-01
The ChrT gene encodes a chromate reductase enzyme which catalyzes the reduction of Cr(VI). The chromate reductase is also known as flavin mononucleotide (FMN) reductase (FMN_red). The aim of the present study was to clone the full-length ChrT DNA from Serratia sp. CQMUS2 and analyze the deduced amino acid sequence and three-dimensional structure. The putative ChrT gene fragment of Serratia sp. CQMUS2 was isolated by polymerase chain reaction (PCR), according to the known FMN_red gene sequence from Serratia sp. AS13. The flanking sequences of the ChrT gene were obtained by high efficiency TAIL-PCR, while the full-length gene of ChrT was cloned in Escherichia coli for subsequent sequencing. The nucleotide sequence of ChrT was submitted onto GenBank under the accession number, KF211434. Sequence analysis of the gene and amino acids was conducted using the Basic Local Alignment Search Tool, and open reading frame (ORF) analysis was performed using ORF Finder software. The ChrT gene was found to be an ORF of 567 bp that encodes a 188-amino acid enzyme with a calculated molecular weight of 20.4 kDa. In addition, the ChrT protein was hypothesized to be an NADPH-dependent FMN_red and a member of the flavodoxin-2 superfamily. The amino acid sequence of ChrT showed high sequence similarity to the FMN reductase genes of Klebsiella pneumonia and Raoultella ornithinolytica, which belong to the flavodoxin-2 superfamily. Furthermore, ChrT was shown to have a 85.6% similarity to the three-dimensional structure of Escherichia coli ChrR, sharing four common enzyme active sites for chromate reduction. Therefore, ChrT gene cloning and protein structure determination demonstrated the ability of the gene for chromate reduction. The results of the present study provide a basis for further studies on ChrT gene expression and protein function. PMID:25667630
Genomic Sequence around Butterfly Wing Development Genes: Annotation and Comparative Analysis
Conceição, Inês C.; Long, Anthony D.; Gruber, Jonathan D.; Beldade, Patrícia
2011-01-01
Background Analysis of genomic sequence allows characterization of genome content and organization, and access beyond gene-coding regions for identification of functional elements. BAC libraries, where relatively large genomic regions are made readily available, are especially useful for species without a fully sequenced genome and can increase genomic coverage of phylogenetic and biological diversity. For example, no butterfly genome is yet available despite the unique genetic and biological properties of this group, such as diversified wing color patterns. The evolution and development of these patterns is being studied in a few target species, including Bicyclus anynana, where a whole-genome BAC library allows targeted access to large genomic regions. Methodology/Principal Findings We characterize ∼1.3 Mb of genomic sequence around 11 selected genes expressed in B. anynana developing wings. Extensive manual curation of in silico predictions, also making use of a large dataset of expressed genes for this species, identified repetitive elements and protein coding sequence, and highlighted an expansion of Alcohol dehydrogenase genes. Comparative analysis with orthologous regions of the lepidopteran reference genome allowed assessment of conservation of fine-scale synteny (with detection of new inversions and translocations) and of DNA sequence (with detection of high levels of conservation of non-coding regions around some, but not all, developmental genes). Conclusions The general properties and organization of the available B. anynana genomic sequence are similar to the lepidopteran reference, despite the more than 140 MY divergence. Our results lay the groundwork for further studies of new interesting findings in relation to both coding and non-coding sequence: 1) the Alcohol dehydrogenase expansion with higher similarity between the five tandemly-repeated B. anynana paralogs than with the corresponding B. mori orthologs, and 2) the high conservation of non-coding sequence around the genes wingless and Ecdysone receptor, both involved in multiple developmental processes including wing pattern formation. PMID:21909358
PFAAT version 2.0: a tool for editing, annotating, and analyzing multiple sequence alignments.
Caffrey, Daniel R; Dana, Paul H; Mathur, Vidhya; Ocano, Marco; Hong, Eun-Jong; Wang, Yaoyu E; Somaroo, Shyamal; Caffrey, Brian E; Potluri, Shobha; Huang, Enoch S
2007-10-11
By virtue of their shared ancestry, homologous sequences are similar in their structure and function. Consequently, multiple sequence alignments are routinely used to identify trends that relate to function. This type of analysis is particularly productive when it is combined with structural and phylogenetic analysis. Here we describe the release of PFAAT version 2.0, a tool for editing, analyzing, and annotating multiple sequence alignments. Support for multiple annotations is a key component of this release as it provides a framework for most of the new functionalities. The sequence annotations are accessible from the alignment and tree, where they are typically used to label sequences or hyperlink them to related databases. Sequence annotations can be created manually or extracted automatically from UniProt entries. Once a multiple sequence alignment is populated with sequence annotations, sequences can be easily selected and sorted through a sophisticated search dialog. The selected sequences can be further analyzed using statistical methods that explicitly model relationships between the sequence annotations and residue properties. Residue annotations are accessible from the alignment viewer and are typically used to designate binding sites or properties for a particular residue. Residue annotations are also searchable, and allow one to quickly select alignment columns for further sequence analysis, e.g. computing percent identities. Other features include: novel algorithms to compute sequence conservation, mapping conservation scores to a 3D structure in Jmol, displaying secondary structure elements, and sorting sequences by residue composition. PFAAT provides a framework whereby end-users can specify knowledge for a protein family in the form of annotation. The annotations can be combined with sophisticated analysis to test hypothesis that relate to sequence, structure and function.
A high level interface to SCOP and ASTRAL implemented in python.
Casbon, James A; Crooks, Gavin E; Saqi, Mansoor A S
2006-01-10
Benchmarking algorithms in structural bioinformatics often involves the construction of datasets of proteins with given sequence and structural properties. The SCOP database is a manually curated structural classification which groups together proteins on the basis of structural similarity. The ASTRAL compendium provides non redundant subsets of SCOP domains on the basis of sequence similarity such that no two domains in a given subset share more than a defined degree of sequence similarity. Taken together these two resources provide a 'ground truth' for assessing structural bioinformatics algorithms. We present a small and easy to use API written in python to enable construction of datasets from these resources. We have designed a set of python modules to provide an abstraction of the SCOP and ASTRAL databases. The modules are designed to work as part of the Biopython distribution. Python users can now manipulate and use the SCOP hierarchy from within python programs, and use ASTRAL to return sequences of domains in SCOP, as well as clustered representations of SCOP from ASTRAL. The modules make the analysis and generation of datasets for use in structural genomics easier and more principled.
Satellite DNA Sequences in Canidae and Their Chromosome Distribution in Dog and Red Fox.
Vozdova, Miluse; Kubickova, Svatava; Cernohorska, Halina; Fröhlich, Jan; Rubes, Jiri
2016-01-01
Satellite DNA is a characteristic component of mammalian centromeric heterochromatin, and a comparative analysis of its evolutionary dynamics can be used for phylogenetic studies. We analysed satellite and satellite-like DNA sequences available in NCBI for 4 species of the family Canidae (red fox, Vulpes vulpes, VVU; domestic dog, Canis familiaris, CFA; arctic fox, Vulpes lagopus, VLA; raccoon dog, Nyctereutes procyonoides procyonoides, NPR) by comparative sequence analysis, which revealed 86-90% intraspecies and 76-79% interspecies similarity. Comparative fluorescence in situ hybridisation in the red fox and dog showed signals of the red fox satellite probe in canine and vulpine autosomal centromeres, on VVUY, B chromosomes, and in the distal parts of VVU9q and VVU10p which were shown to contain nucleolus organiser regions. The CFA satellite probe stained autosomal centromeres only in the dog. The CFA satellite-like DNA did not show any significant sequence similarity with the satellite DNA of any species analysed and was localised to the centromeres of 9 canine chromosome pairs. No significant heterochromatin block was detected on the B chromosomes of the red fox. Our results show extensive heterogeneity of satellite sequences among Canidae and prove close evolutionary relationships between the red and arctic fox. © 2017 S. Karger AG, Basel.
Butts, Carter T.; Bierma, Jan C.; Martin, Rachel W.
2016-01-01
In his 1875 monograph on insectivorous plants, Darwin described the feeding reactions of Drosera flypaper traps and predicted that their secretions contained a “ferment” similar to mammalian pepsin, an aspartic protease. Here we report a high-quality draft genome sequence for the cape sundew, Drosera capensis, the first genome of a carnivorous plant from order Caryophyllales, which also includes the Venus flytrap (Dionaea) and the tropical pitcher plants (Nepenthes). This species was selected in part for its hardiness and ease of cultivation, making it an excellent model organism for further investigations of plant carnivory. Analysis of predicted protein sequences yields genes encoding proteases homologous to those found in other plants, some of which display sequence and structural features that suggest novel functionalities. Because the sequence similarity to proteins of known structure is in most cases too low for traditional homology modeling, 3D structures of representative proteases are predicted using comparative modeling with all-atom refinement. Although the overall folds and active residues for these proteins are conserved, we find structural and sequence differences consistent with a diversity of substrate recognition patterns. Finally, we predict differences in substrate specificities using in silico experiments, providing targets for structure/function studies of novel enzymes with biological and technological significance. PMID:27353064
Finding similar nucleotide sequences using network BLAST searches.
Ladunga, Istvan
2009-06-01
The Basic Local Alignment Search Tool (BLAST) is a keystone of bioinformatics due to its performance and user-friendliness. Beginner and intermediate users will learn how to design and submit blastn and Megablast searches on the Web pages at the National Center for Biotechnology Information. We map nucleic acid sequences to genomes, find identical or similar mRNA, expressed sequence tag, and noncoding RNA sequences, and run Megablast searches, which are much faster than blastn. Understanding results is assisted by taxonomy reports, genomic views, and multiple alignments. We interpret expected frequency thresholds, biological significance, and statistical significance. Weak hits provide no evidence, but hints for further analyses. We find genes that may code for homologous proteins by translated BLAST. We reduce false positives by filtering out low-complexity regions. Parsed BLAST results can be integrated into analysis pipelines. Links in the output connect to Entrez, PUBMED, structural, sequence, interaction, and expression databases. This facilitates integration with a wide spectrum of biological knowledge.
Constable, Fiona E.; Nancarrow, Narelle; Plummer, Kim M.; Rodoni, Brendan
2017-01-01
PCR amplicon next generation sequencing (NGS) analysis offers a broadly applicable and targeted approach to detect populations of both high- or low-frequency virus variants in one or more plant samples. In this study, amplicon NGS was used to explore the diversity of the tripartite genome virus, Prunus necrotic ringspot virus (PNRSV) from 53 PNRSV-infected trees using amplicons from conserved gene regions of each of PNRSV RNA1, RNA2 and RNA3. Sequencing of the amplicons from 53 PNRSV-infected trees revealed differing levels of polymorphism across the three different components of the PNRSV genome with a total number of 5040, 2083 and 5486 sequence variants observed for RNA1, RNA2 and RNA3 respectively. The RNA2 had the lowest diversity of sequences compared to RNA1 and RNA3, reflecting the lack of flexibility tolerated by the replicase gene that is encoded by this RNA component. Distinct PNRSV phylo-groups, consisting of closely related clusters of sequence variants, were observed in each of PNRSV RNA1, RNA2 and RNA3. Most plant samples had a single phylo-group for each RNA component. Haplotype network analysis showed that smaller clusters of PNRSV sequence variants were genetically connected to the largest sequence variant cluster within a phylo-group of each RNA component. Some plant samples had sequence variants occurring in multiple PNRSV phylo-groups in at least one of each RNA and these phylo-groups formed distinct clades that represent PNRSV genetic strains. Variants within the same phylo-group of each Prunus plant sample had ≥97% similarity and phylo-groups within a Prunus plant sample and between samples had less ≤97% similarity. Based on the analysis of diversity, a definition of a PNRSV genetic strain was proposed. The proposed definition was applied to determine the number of PNRSV genetic strains in each of the plant samples and the complexity in defining genetic strains in multipartite genome viruses was explored. PMID:28632759
The Use of Weighted Graphs for Large-Scale Genome Analysis
Zhou, Fang; Toivonen, Hannu; King, Ross D.
2014-01-01
There is an acute need for better tools to extract knowledge from the growing flood of sequence data. For example, thousands of complete genomes have been sequenced, and their metabolic networks inferred. Such data should enable a better understanding of evolution. However, most existing network analysis methods are based on pair-wise comparisons, and these do not scale to thousands of genomes. Here we propose the use of weighted graphs as a data structure to enable large-scale phylogenetic analysis of networks. We have developed three types of weighted graph for enzymes: taxonomic (these summarize phylogenetic importance), isoenzymatic (these summarize enzymatic variety/redundancy), and sequence-similarity (these summarize sequence conservation); and we applied these types of weighted graph to survey prokaryotic metabolism. To demonstrate the utility of this approach we have compared and contrasted the large-scale evolution of metabolism in Archaea and Eubacteria. Our results provide evidence for limits to the contingency of evolution. PMID:24619061
Camicia, Federico; Paredes, Rodolfo; Chalar, Cora; Galanti, Norbel; Kamenetzky, Laura; Gutierrez, Ariana; Rosenzvit, Mara C
2008-03-31
We have sequenced and partially characterized an Echinococcus granulosus cDNA, termed egat1, from a protoscolex signal sequence trap (SST) cDNA library. The isolated 1627 bp long cDNA contains an ORF of 489 amino acids and shows an amino acid identity of 30% with neutral and excitatory amino acid transporters members of the Dicarboxylate/Amino Acid Na+ and/or H+ Cation Symporter family (DAACS) (TC 2.A.23). Additional bioinformatics analysis of EgAT1, confirmed the results obtained by similarity searches and showed the presence of 9 to 10 transmembrane domains, consensus sequences for N-glycosylation between the third and fourth transmembrane domain, a highly similar hydropathy profile with ASCT1 (a known member of DAACS family), high score with SDF (Sodium Dicarboxilate Family) and similar motifs with EDTRANSPORT, a fingerprint of excitatory amino acid transporters. The localization of the putative amino acid transporter was analyzed by in situ hybridization and immunofluorescence in protoscoleces and associated germinal layer. The in situ hybridization labelling indicates the distribution of egat1 mRNA throughout the tegument. EgAT1 protein, which showed in Western blots a molecular mass of approximately 60 kD, is localized in the subtegumental region of the metacestode, particularly around suckers and rostellum of protoscoleces and layers from brood capsules. The sequence and expression analyses of EgAT1 pave the way for functional analysis of amino acids transporters of E. granulosus and its evaluation as new drug targets against cystic echinococcosis.
Distinct Circular Single-Stranded DNA Viruses Exist in Different Soil Types
Swanson, Maud M.; Dawson, Lorna; Freitag, Thomas E.; Singh, Brajesh K.; Torrance, Lesley; Mushegian, Arcady R.
2015-01-01
The potential dependence of virus populations on soil types was examined by electron microscopy, and the total abundance of virus particles in four soil types was similar to that previously observed in soil samples. The four soil types examined differed in the relative abundances of four morphological groups of viruses. Machair, a unique type of coastal soil in western Scotland and Ireland, differed from the others tested in having a higher proportion of tailed bacteriophages. The other soils examined contained predominantly spherical and thin filamentous virus particles, but the Machair soil had a more even distribution of the virus types. As the first step in looking at differences in populations in detail, virus sequences from Machair and brown earth (agricultural pasture) soils were examined by metagenomic sequencing after enriching for circular Rep-encoding single-stranded DNA (ssDNA) (CRESS-DNA) virus genomes. Sequences from the family Microviridae (icosahedral viruses mainly infecting bacteria) of CRESS-DNA viruses were predominant in both soils. Phylogenetic analysis of Microviridae major coat protein sequences from the Machair viruses showed that they spanned most of the diversity of the subfamily Gokushovirinae, whose members mainly infect obligate intracellular parasites. The brown earth soil had a higher proportion of sequences that matched the morphologically similar family Circoviridae in BLAST searches. However, analysis of putative replicase proteins that were similar to those of viruses in the Circoviridae showed that they are a novel clade of Circoviridae-related CRESS-DNA viruses distinct from known Circoviridae genera. Different soils have substantially different taxonomic biodiversities even within ssDNA viruses, which may be driven by physicochemical factors. PMID:25841004
A global view of structure–function relationships in the tautomerase superfamily
Davidson, Rebecca; Baas, Bert-Jan; Akiva, Eyal; Holliday, Gemma L.; Polacco, Benjamin J.; LeVieux, Jake A.; Pullara, Collin R.; Zhang, Yan Jessie; Whitman, Christian P.
2018-01-01
The tautomerase superfamily (TSF) consists of more than 11,000 nonredundant sequences present throughout the biosphere. Characterized members have attracted much attention because of the unusual and key catalytic role of an N-terminal proline. These few characterized members catalyze a diverse range of chemical reactions, but the full scale of their chemical capabilities and biological functions remains unknown. To gain new insight into TSF structure–function relationships, we performed a global analysis of similarities across the entire superfamily and computed a sequence similarity network to guide classification into distinct subgroups. Our results indicate that TSF members are found in all domains of life, with most being present in bacteria. The eukaryotic members of the cis-3-chloroacrylic acid dehalogenase subgroup are limited to fungal species, whereas the macrophage migration inhibitory factor subgroup has wide eukaryotic representation (including mammals). Unexpectedly, we found that 346 TSF sequences lack Pro-1, of which 85% are present in the malonate semialdehyde decarboxylase subgroup. The computed network also enabled the identification of similarity paths, namely sequences that link functionally diverse subgroups and exhibit transitional structural features that may help explain reaction divergence. A structure-guided comparison of these linker proteins identified conserved transitions between them, and kinetic analysis paralleled these observations. Phylogenetic reconstruction of the linker set was consistent with these findings. Our results also suggest that contemporary TSF members may have evolved from a short 4-oxalocrotonate tautomerase–like ancestor followed by gene duplication and fusion. Our new linker-guided strategy can be used to enrich the discovery of sequence/structure/function transitions in other enzyme superfamilies. PMID:29184004
Malware analysis using visualized image matrices.
Han, KyoungSoo; Kang, BooJoong; Im, Eul Gyu
2014-01-01
This paper proposes a novel malware visual analysis method that contains not only a visualization method to convert binary files into images, but also a similarity calculation method between these images. The proposed method generates RGB-colored pixels on image matrices using the opcode sequences extracted from malware samples and calculates the similarities for the image matrices. Particularly, our proposed methods are available for packed malware samples by applying them to the execution traces extracted through dynamic analysis. When the images are generated, we can reduce the overheads by extracting the opcode sequences only from the blocks that include the instructions related to staple behaviors such as functions and application programming interface (API) calls. In addition, we propose a technique that generates a representative image for each malware family in order to reduce the number of comparisons for the classification of unknown samples and the colored pixel information in the image matrices is used to calculate the similarities between the images. Our experimental results show that the image matrices of malware can effectively be used to classify malware families both statically and dynamically with accuracy of 0.9896 and 0.9732, respectively.
Sequence-structure relationships in RNA loops: establishing the basis for loop homology modeling.
Schudoma, Christian; May, Patrick; Nikiforova, Viktoria; Walther, Dirk
2010-01-01
The specific function of RNA molecules frequently resides in their seemingly unstructured loop regions. We performed a systematic analysis of RNA loops extracted from experimentally determined three-dimensional structures of RNA molecules. A comprehensive loop-structure data set was created and organized into distinct clusters based on structural and sequence similarity. We detected clear evidence of the hallmark of homology present in the sequence-structure relationships in loops. Loops differing by <25% in sequence identity fold into very similar structures. Thus, our results support the application of homology modeling for RNA loop model building. We established a threshold that may guide the sequence divergence-based selection of template structures for RNA loop homology modeling. Of all possible sequences that are, under the assumption of isosteric relationships, theoretically compatible with actual sequences observed in RNA structures, only a small fraction is contained in the Rfam database of RNA sequences and classes implying that the actual RNA loop space may consist of a limited number of unique loop structures and conserved sequences. The loop-structure data sets are made available via an online database, RLooM. RLooM also offers functionalities for the modeling of RNA loop structures in support of RNA engineering and design efforts.
Lin, Lulu; Wang, Peikun; Yang, Yongli; Li, Haijuan; Huang, Teng; Wei, Ping
2017-12-01
Since 2014, cases of hemangioma associated with avian leukosis virus subgroup J (ALV-J) have been emerging in commercial chickens in Guangxi. In this study, four strains of the subgroup J avian leukosis virus (ALV-J), named GX14HG01, GX14HG04, GX14LT07, and GX14ZS14, were isolated from chickens with clinical hemangioma in 2014 by DF-1 cell culture and then identified with ELISA detection of ALV group specific antigen p27, the detection of subtype specific PCR and indirect immunofluorescence assay (IFA) with ALV-J specific monoclonal antibody. The complete genomes of the isolates were sequenced and it was found that the gag and pol were relatively conservative, while env was variable especially the gp85 gene. Homology analysis of the env gene sequences showed that the env gene of all the four isolates had higher similarities with the hemangioma (HE)-type reference strains than that of the myeloid leukosis (ML)-type strains, and moreover, the HE-type strains' specific deletion of 205-bp sequence covering the rTM and DR1 in 3'UTR fragment was also found in the four isolates. Further analysis on the sequences of subunits of env gene revealed an interesting finding: the gp85 of isolates GX14ZS14 and GX14HG04 had a higher similarity with HPRS-103 and much lower similarity with the HE-type reference strains resulting in GX14ZS14, GX14HG04, and HPRS-103 being clustered in the same branch, while gp37 had higher similarities with the HE-type reference strains when compared to that of HPRS-103, resulted in GX14ZS14, GX14HG04, and HE-type reference strains being clustered in the same branch. The results suggested that isolates GX14ZS14 and GX14HG04 may be the recombinant strains of the foreign strain HPRS-103 with the local epidemic HE-type strains of ALV-J.
Singh, Prashant; Singh, Satya Shila; Elster, Josef; Mishra, Arun Kumar
2013-06-01
In order to assess phylogeny, population genetics, and approximation of future course of cyanobacterial evolution based on nifH gene sequences, 41 heterocystous cyanobacterial strains collected from all over India have been used in the present study. NifH gene sequence analysis data confirm that the heterocystous cyanobacteria are monophyletic while the stigonematales show polyphyletic origin with grave intermixing. Further, analysis of nifH gene sequence data using intricate mathematical extrapolations revealed that the nucleotide diversity and recombination frequency is much greater in Nostocales than the Stigonematales. Similarly, DNA divergence studies showed significant values of divergence with greater gene conversion tracts in the unbranched (Nostocales) than the branched (Stigonematales) strains. Our data strongly support the origin of true branching cyanobacterial strains from the unbranched strains.
Xu, Jian-Hua; Narabu, Takashi; Li, Hong-Mei; Fu, Peng
2002-01-01
Meloidogyne javanica, reproducing by mitotic parthenogenesis, is an economically important pathogen of a wide range of crops. A pair of near-isogenic lines virulent and avirulent toward the tomato resistance gene Mi were prepared for M. javanica by continuously selecting an avirulent population on the resistant tomato cultivar Momotaro over 19 generations. Random amplified polymorphic DNA (RAPD) analysis with 102 primers revealed that RAPD patterns were highly conserved between the virulent and avirulent lines, confirming that the two lines were genomically very similar. Nevertheless, with one of the primers a distinct polymorphic fragment, specific for the avirulent lines, was amplified. Southern hybridization results indicated that the polymorphic fragment and its homologs were deleted from the genome of the virulent line during the process of virulence acquisition. Sequence analysis and homology searches of public data bases, however, revealed no published sequences significantly similar to the sequence of the fragment, precluding a prediction of the potential function of the sequence. The successful preparation of the near-isogenic Mi-virulent and avirulent lines laid a firm foundation for the further identification and isolation of virulence-related genes in M. javanica.
Guo, Yaqiong; Tang, Kevin; Rowe, Lori A; Li, Na; Roellig, Dawn M; Knipe, Kristine; Frace, Michael; Yang, Chunfu; Feng, Yaoyu; Xiao, Lihua
2015-04-18
Cryptosporidium hominis is a dominant species for human cryptosporidiosis. Within the species, IbA10G2 is the most virulent subtype responsible for all C. hominis-associated outbreaks in Europe and Australia, and is a dominant outbreak subtype in the United States. In recent yearsIaA28R4 is becoming a major new subtype in the United States. In this study, we sequenced the genomes of two field specimens from each of the two subtypes and conducted a comparative genomic analysis of the obtained sequences with those from the only fully sequenced Cryptosporidium parvum genome. Altogether, 8.59-9.05 Mb of Cryptosporidium sequences in 45-767 assembled contigs were obtained from the four specimens, representing 94.36-99.47% coverage of the expected genome. These genomes had complete synteny in gene organization and 96.86-97.0% and 99.72-99.83% nucleotide sequence similarities to the published genomes of C. parvum and C. hominis, respectively. Several major insertions and deletions were seen between C. hominis and C. parvum genomes, involving mostly members of multicopy gene families near telomeres. The four C. hominis genomes were highly similar to each other and divergent from the reference IaA25R3 genome in some highly polymorphic regions. Major sequence differences among the four specimens sequenced in this study were in the 5' and 3' ends of chromosome 6 and the gp60 region, largely the result of genetic recombination. The sequence similarity among specimens of the two dominant outbreak subtypes and genetic recombination in chromosome 6, especially around the putative virulence determinant gp60 region, suggest that genetic recombination plays a potential role in the emergence of hyper-transmissible C. hominis subtypes. The high sequence conservation between C. parvum and C. hominis genomes and significant differences in copy numbers of MEDLE family secreted proteins and insulinase-like proteases indicate that telomeric gene duplications could potentially contribute to host expansion in C. parvum.
Liu, Liyun; Hastings, J. Woodland
2007-01-01
Noctiluca scintillans, a heterotrophic unarmored unicellular bioluminescent dinoflagellate, occurs widely in the oceans, often as a bloom. Molecular phylogenetic analysis based on 18S ribosomal DNA sequences consistently has placed this species on the basal branch of dinoflagellates. Here, we report that the structural organization of its luciferase gene is strikingly different from that of the seven luminous species previously characterized, all of which are photosynthetic. The Noctiluca gene codes for a polypeptide that consists of two distinct but contiguous domains. One, which is located in the N-terminal portion, is shorter than but similar in sequence to the individual domains of the three-domain luciferases found in all other luminous dinoflagellates studied. The other, situated in the C-terminal part, has sequence similarity to the luciferin-binding protein of the luminous dinoflagellate Lingulodinium polyedrum, encoded there by a separate gene. Western analysis shows that the native protein has the same size (≈100 kDa) as the heterologously expressed polypeptide, indicating that it is not a polyprotein. Thus, sequences found in two proteins in the L. polyedrum bioluminescence system are present in a single polypeptide in Noctiluca. PMID:17130452
Streptococcus oriloxodontae sp. nov., isolated from the oral cavities of elephants.
Shinozaki-Kuwahara, Noriko; Saito, Masanori; Hirasawa, Masatomo; Takada, Kazuko
2014-11-01
Two strains were isolated from oral cavity samples of healthy elephants. The isolates were Gram-positive, catalase-negative, coccus-shaped organisms that were tentatively identified as a streptococcal species based on the results of biochemical tests. Comparative 16S rRNA gene sequence analysis suggested classification of these organisms in the genus Streptococcus with Streptococcus criceti ATCC 19642(T) and Streptococcus orisuis NUM 1001(T) as their closest phylogenetic neighbours with 98.2 and 96.9% gene sequence similarity, respectively. When multi-locus sequence analysis using four housekeeping genes, groEL, rpoB, gyrB and sodA, was carried out, similarity of concatenated sequences of the four housekeeping genes from the new isolates and Streptococcus mutans was 89.7%. DNA-DNA hybridization experiments suggested that the new isolates were distinct from S. criceti and other species of the genus Streptococcus. On the basis of genotypic and phenotypic differences, it is proposed that the novel isolates are classified in the genus Streptococcus as representatives of Streptococcus oriloxodontae sp. nov. The type strain of S. oriloxodontae is NUM 2101(T) ( =JCM 19285(T) =DSM 27377(T)). © 2014 IUMS.
Asamizu, E; Nakamura, Y; Sato, S; Tabata, S
2000-06-30
For comprehensive analysis of genes expressed in the model dicotyledonous plant, Arabidopsis thaliana, expressed sequence tags (ESTs) were accumulated. Normalized and size-selected cDNA libraries were constructed from aboveground organs, flower buds, roots, green siliques and liquid-cultured seedlings, respectively, and a total of 14,026 5'-end ESTs and 39,207 3'-end ESTs were obtained. The 3'-end ESTs could be clustered into 12,028 non-redundant groups. Similarity search of the non-redundant ESTs against the public non-redundant protein database indicated that 4816 groups show similarity to genes of known function, 1864 to hypothetical genes, and the remaining 5348 are novel sequences. Gene coverage by the non-redundant ESTs was analyzed using the annotated genomic sequences of approximately 10 Mb on chromosomes 3 and 5. A total of 923 regions were hit by at least one EST, among which only 499 regions were hit by the ESTs deposited in the public database. The result indicates that the EST source generated in this project complements the EST data in the public database and facilitates new gene discovery.
A Cyber-Attack Detection Model Based on Multivariate Analyses
NASA Astrophysics Data System (ADS)
Sakai, Yuto; Rinsaka, Koichiro; Dohi, Tadashi
In the present paper, we propose a novel cyber-attack detection model based on two multivariate-analysis methods to the audit data observed on a host machine. The statistical techniques used here are the well-known Hayashi's quantification method IV and cluster analysis method. We quantify the observed qualitative audit event sequence via the quantification method IV, and collect similar audit event sequence in the same groups based on the cluster analysis. It is shown in simulation experiments that our model can improve the cyber-attack detection accuracy in some realistic cases where both normal and attack activities are intermingled.
Borozan, Ivan; Watt, Stuart; Ferretti, Vincent
2015-05-01
Alignment-based sequence similarity searches, while accurate for some type of sequences, can produce incorrect results when used on more divergent but functionally related sequences that have undergone the sequence rearrangements observed in many bacterial and viral genomes. Here, we propose a classification model that exploits the complementary nature of alignment-based and alignment-free similarity measures with the aim to improve the accuracy with which DNA and protein sequences are characterized. Our model classifies sequences using a combined sequence similarity score calculated by adaptively weighting the contribution of different sequence similarity measures. Weights are determined independently for each sequence in the test set and reflect the discriminatory ability of individual similarity measures in the training set. Because the similarity between some sequences is determined more accurately with one type of measure rather than another, our classifier allows different sets of weights to be associated with different sequences. Using five different similarity measures, we show that our model significantly improves the classification accuracy over the current composition- and alignment-based models, when predicting the taxonomic lineage for both short viral sequence fragments and complete viral sequences. We also show that our model can be used effectively for the classification of reads from a real metagenome dataset as well as protein sequences. All the datasets and the code used in this study are freely available at https://collaborators.oicr.on.ca/vferretti/borozan_csss/csss.html. ivan.borozan@gmail.com Supplementary data are available at Bioinformatics online. © The Author 2015. Published by Oxford University Press.
Borozan, Ivan; Watt, Stuart; Ferretti, Vincent
2015-01-01
Motivation: Alignment-based sequence similarity searches, while accurate for some type of sequences, can produce incorrect results when used on more divergent but functionally related sequences that have undergone the sequence rearrangements observed in many bacterial and viral genomes. Here, we propose a classification model that exploits the complementary nature of alignment-based and alignment-free similarity measures with the aim to improve the accuracy with which DNA and protein sequences are characterized. Results: Our model classifies sequences using a combined sequence similarity score calculated by adaptively weighting the contribution of different sequence similarity measures. Weights are determined independently for each sequence in the test set and reflect the discriminatory ability of individual similarity measures in the training set. Because the similarity between some sequences is determined more accurately with one type of measure rather than another, our classifier allows different sets of weights to be associated with different sequences. Using five different similarity measures, we show that our model significantly improves the classification accuracy over the current composition- and alignment-based models, when predicting the taxonomic lineage for both short viral sequence fragments and complete viral sequences. We also show that our model can be used effectively for the classification of reads from a real metagenome dataset as well as protein sequences. Availability and implementation: All the datasets and the code used in this study are freely available at https://collaborators.oicr.on.ca/vferretti/borozan_csss/csss.html. Contact: ivan.borozan@gmail.com Supplementary information: Supplementary data are available at Bioinformatics online. PMID:25573913
Characterization of Powassan viruses from Far Eastern Russia.
Leonova, Galina N; Kondratov, Ilia G; Ternovoi, Vladimir A; Romanova, Elena V; Protopopova, Elena V; Chausov, Eugene V; Pavlenko, Elena V; Ryabchikova, Elena I; Belikov, Sergey I; Loktev, Valery B
2009-01-01
We report the isolation and detailed characterization of the novel strain, Partizansk/2006, of Powassan virus (POWV) from a human case of infection, which occurred in Primorsky krai, Russia, in 2006. Comparative complete genome sequence analysis of the Far Eastern strains Spassk-9 (1975), Nadezdinsk-1991 and Partizansk/2006 of POWV revealed that these strains are 99.8% similar to the LB strain, which was isolated in Canada in 1958. Phylogenetic analysis of 5' UTR sequences of five other strains of POWV isolated from 1972 to 1986 in Primorsky krai produced similar results. Presumably, Far Eastern POWV has common putative ancestor with LB strain POWV from North America, and the time of divergence of these POWVs is relatively short. We conclude that POWV has become endemic in Far Eastern Russia.
Gu, Chun Tao; Li, Chun Yan; Yang, Li Jie; Huo, Gui Cheng
2014-08-01
A Gram-stain-negative bacterial strain, 10-17(T), was isolated from traditional sourdough in Heilongjiang Province, China. The bacterium was characterized by a polyphasic approach, including 16S rRNA gene sequence analysis, RNA polymerase β subunit (rpoB) gene sequence analysis, DNA gyrase (gyrB) gene sequence analysis, initiation translation factor 2 (infB) gene sequence analysis, ATP synthase β subunit (atpD) gene sequence analysis, fatty acid methyl ester analysis, determination of DNA G+C content, DNA-DNA hybridization and an analysis of phenotypic features. Strain 10-17(T) was phylogenetically related to Enterobacter hormaechei CIP 103441(T), Enterobacter cancerogenus LMG 2693(T), Enterobacter asburiae JCM 6051(T), Enterobacter mori LMG 25706(T), Enterobacter ludwigii EN-119(T) and Leclercia adecarboxylata LMG 2803(T), having 99.5%, 99.3%, 98.7%, 98.5%, 98.4% and 98.4% 16S rRNA gene sequence similarity, respectively. On the basis of polyphasic characterization data obtained in the present study, a novel species, Enterobacter xiangfangensis sp. nov., is proposed and the type strain is 10-17(T) ( = LMG 27195(T) = NCIMB 14836(T) = CCUG 62994(T)). Enterobacter sacchari Zhu et al. 2013 was reclassified as Kosakonia sacchari comb. nov. on the basis of 16S rRNA, rpoB, gyrB, infB and atpD gene sequence analysis and the type strain is strain SP1(T)( = CGMCC 1.12102(T) = LMG 26783(T)). © 2014 IUMS.
Sheikh, Faruk G; Mukhopadhyay, Sudit S; Gupta, Prabhakar
2002-02-01
The PstI family of elements are short, highly repetitive DNA sequences interspersed throughout the genome of the Bovidae. We have cloned and sequenced some members of the PstI family from cattle, goat, and buffalo. These elements are approximately 500 bp, have a copy number of 2 x 10(5) - 4 x 10(5), and comprise about 4% of the haploid genome. Studies of nucleotide sequence homology indicate that the buffalo and goat PstI repeats (type II) are similar types of short interspersed nucleotide element (SINE) sequences, but the cattle PstI repeat (type I) is considerably more divergent. Additionally, the goat PstI sequence showed significant sequence homology with bovine serine tRNA, and is therefore likely derived from serine tRNA. Interestingly, Southern hybridization suggests that both types of SINEs (I and II) are present in all the species of Bovidae. Dendrogram analysis indicates that cattle PstI SINE is similar to bovine Alu-like SINEs. Goat and buffalo SINEs formed a separate cluster, suggesting that these two types of SINEs evolved separately in the genome of the Bovidae.
Jose, Jency; Jalali, S K; Shivalingaswamy, T M; Kumar, N K Krishna; Bhatnagar, R; Bandyopadhyay, A
2013-06-01
A PCR based method for detection of viral DNA in nucleopolyhedrovirus of three lepidopterans, Spodoptera litura, Amsacta albistriga and Helicoverpa armigera, was developed by employing the late expression factor-8 (lef-8) gene of three NPV using specific primers. The amplicons of 689, 699 and 665 bp were amplified, respectively, and the nucleotide sequences were submitted to GenBank and the accession numbers were obtained. The sequences of lef-8 gene of S. litura NPV and H. armigera NPV matched with those of their respective references in the GenBank database, thereby confirming their identity, however, the sequence of A. albistriga NPV was the first sequence submitted to the GenBank database. The sequence similarity analysis between the three lef-8 gene of NPV sequenced in the present study revealed that there was no significant similarity between them, however A. albistriga NPV and S. litura NPV were found to be closely related. CLUSTAL alignment of the sequences generated revealed general relatedness among NPVs lef-8 gene. The study confirmed that lef-8 gene can be used for quick and correct discriminatory identification of insect viruses.
Nomoto, R; Maruyama, F; Ishida, S; Tohya, M; Sekizaki, T; Osawa, Ro
2015-02-01
In order to clarify the taxonomic position of serotypes 20, 22 and 26 of Streptococcus suis, biochemical and molecular genetic studies were performed on isolates (SUT-7, SUT-286(T), SUT-319, SUT-328 and SUT-380) reacted with specific antisera of serotypes 20, 22 or 26 from the saliva of healthy pigs as well as reference strains of serotypes 20, 22 and 26. Comparative recN gene sequencing showed high genetic relatedness among our isolates, but marked differences from the type strain S. suis NCTC 10234(T), i.e. 74.8-75.7 % sequence similarity. The genomic relatedness between the isolates and other strains of species of the genus Streptococcus, including S. suis, was calculated using the average nucleotide identity values of whole genome sequences, which indicated that serotypes 20, 22 and 26 should be removed taxonomically from S. suis and treated as a novel genomic species. Comparative sequence analysis revealed 99.0-100 % sequence similarities for the 16S rRNA genes between the reference strains of serotypes 20, 22 and 26, and our isolates. Isolate STU-286(T) had relatively high 16S rRNA gene sequence similarity with S. suis NCTC 10234(T) (98.8 %). SUT-286(T) could be distinguished from S. suis and other closely related species of the genus Streptococcus using biochemical tests. Due to its phylogenetic and phenotypic similarities to S. suis we propose naming the novel species Streptococcus parasuis sp. nov., with SUT-286(T) ( = JCM 30273(T) = DSM 29126(T)) as the type strain. © 2015 IUMS.
Garland, Ellen C; Noad, Michael J; Goldizen, Anne W; Lilley, Matthew S; Rekdahl, Melinda L; Garrigue, Claire; Constantine, Rochelle; Daeschler Hauser, Nan; Poole, M Michael; Robbins, Jooke
2013-01-01
Humpback whales have a continually evolving vocal sexual display, or "song," that appears to undergo both evolutionary and "revolutionary" change. All males within a population adhere to the current content and arrangement of the song. Populations within an ocean basin share similarities in their songs; this sharing is complex as multiple variations of the song (song types) may be present within a region at any one time. To quantitatively investigate the similarity of song types, songs were compared at both the individual singer and population level using the Levenshtein distance technique and cluster analysis. The highly stereotyped sequences of themes from the songs of 211 individuals from populations within the western and central South Pacific region from 1998 through 2008 were grouped together based on the percentage of song similarity, and compared to qualitatively assigned song types. The analysis produced clusters of highly similar songs that agreed with previous qualitative assignments. Each cluster contained songs from multiple populations and years, confirming the eastward spread of song types and their progressive evolution through the study region. Quantifying song similarity and exchange will assist in understanding broader song dynamics and contribute to the use of vocal displays as population identifiers.
Zhang, Wenqiang; Lin, Xiaojuan; Jiang, Ping; Tao, Zexin; Liu, Xiaolin; Ji, Feng; Wang, Tongzhan; Wang, Suting; Lv, Hui; Xu, Aiqiang; Wang, Haiyan
2016-08-01
Coxsackievirus B3 (CV-B3) has frequently been associated with aseptic meningitis outbreaks in China. To identify sequence motifs related to aseptic meningitis and to construct an infectious clone, the genome sequence of 08TC170, a representative strain isolated from cerebrospinal fluid (CSF) samples from an outbreak in Shandong in 2008, was determined, and the coding regions for P1-P3 and VP1 were aligned. The first 21 and last 20 residues were "TTAAAACAGCCTGTGGGTTGT" and "ATTCTCCGCATTCGGTGCGG", respectively. The whole genome consisted of 7401 nucleotides, sharing 80.8 % identity with the prototype strain Nancy and low sequence similarity with members of clusters A-C. In contrast, 08TC170 showed high sequence similarity to members of cluster D. An especially high level of sequence identity (≥97.7 %) was found within a branch constituted by 08TC170 and four Chinese strains that clustered together in all of the P1-P3 phylogenic trees. In addition, 08TC170 also possessed a close relationship to the Hong Kong strain 26362/08 in VP1. Similarity plot analysis showed that 08TC170 was most similar to the Chinese CV-B3 strain SSM in P1 and the partial P2 coding region but to the CV-B5 or E-6 strain in 2C and following regions. A T277A mutation was found in 08TC170 and other strains isolated in 2008-2010, but not in strains isolated before 2008, which had high sequence similarity and formed the cluster A277. The results suggested that 08TC170 was the product of both intertypic recombination and point mutation, whose effects on viral neurovirulence will be investigated in a further study. The high homology between 08TC170 and other strains revealed their co-circulation in mainland China and Hong Kong and indicates that further surveillance is needed.
Molecular Characterization of Epiphytic Bacterial Communities on Charophycean Green Algae
Fisher, Madeline M.; Wilcox, Lee W.; Graham, Linda E.
1998-01-01
Epiphytic bacterial communities within the sheath material of three filamentous green algae, Desmidium grevillii, Hyalotheca dissiliens, and Spondylosium pulchrum (class Charophyceae, order Zygnematales), collected from a Sphagnum bog were characterized by PCR amplification, cloning, and sequencing of 16S ribosomal DNA. A total of 20 partial sequences and nine different sequence types were obtained, and one sequence type was recovered from the bacterial communities on all three algae. By phylogenetic analysis, the cloned sequences were placed into several major lineages of the Bacteria domain: the Flexibacter/Cytophaga/Bacteroides phylum and the α, β, and γ subdivisions of the phylum Proteobacteria. Analysis at the subphylum level revealed that the majority of our sequences were not closely affiliated with those of known, cultured taxa, although the estimated evolutionary distances between our sequences and their nearest neighbors were always less than 0.1 (i.e., greater than 90% similar). This result suggests that the majority of sequences obtained in this study represent as yet phenotypically undescribed bacterial species and that the range of bacterial-algal interactions that occur in nature has not yet been fully described. PMID:9797295
Complete cDNA sequence and amino acid analysis of a bovine ribonuclease K6 gene.
Pietrowski, D; Förster, M
2000-01-01
The complete cDNA sequence of a ribonuclease k6 gene of Bos Taurus has been determined. It codes for a protein with 154 amino acids and contains the invariant cysteine, histidine and lysine residues as well as the characteristic motifs specific to ribonuclease active sites. The deduced protein sequence is 27 residues longer than other known ribonucleases k6 and shows amino acids exchanges which could reflect a strain specificity or polymorphism within the bovine genome. Based on sequence similarity we have termed the identified gene bovine ribonuclease k6 b (brk6b).
Analysis of Magnitude Correlations in a Self-Similar model of Seismicity
NASA Astrophysics Data System (ADS)
Zambrano, A.; Joern, D.
2017-12-01
A recent model of seismicity that incorporates a self-similar Omori-Utsu relation, which is used to describe the temporal evolution of earthquake triggering, has been shown to provide a more accurate description of seismicity in Southern California when compared to epidemic type aftershock sequence models. Forecasting of earthquakes is an active research area where one of the debated points is whether magnitude correlations of earthquakes exist within real world seismic data. Prior to this work, the analysis of magnitude correlations of the aforementioned self-similar model had not been addressed. Here we present statistical properties of the magnitude correlations for the self-similar model along with an analytical analysis of the branching ratio and criticality parameters.
Domier, L L; Latorre, I J; Steinlage, T A; McCoppin, N; Hartman, G L
2003-10-01
The variability of North American and Asian strains and isolates of Soybean mosaic virus was investigated. First, polymerase chain reaction (PCR) products representing the coat protein (CP)-coding regions of 38 SMVs were analyzed for restriction fragment length polymorphisms (RFLP). Second, the nucleotide and predicted amino acid sequence variability of the P1-coding region of 18 SMVs and the helper component/protease (HC/Pro) and CP-coding regions of 25 SMVs were assessed. The CP nucleotide and predicted amino acid sequences were the most similar and predicted phylogenetic relationships similar to those obtained from RFLP analysis. Neither RFLP nor sequence analyses of the CP-coding regions grouped the SMVs by geographical origin. The P1 and HC/Pro sequences were more variable and separated the North American and Asian SMV isolates into two groups similar to previously reported differences in pathogenic diversity of the two sets of SMV isolates. The P1 region was the most informative of the three regions analyzed. To assess the biological relevance of the sequence differences in the HC/Pro and CP coding regions, the transmissibility of 14 SMV isolates by Aphis glycines was tested. All field isolates of SMV were transmitted efficiently by A. glycines, but the laboratory isolates analyzed were transmitted poorly. The amino acid sequences from most, but not all, of the poorly transmitted isolates contained mutations in the aphid transmission-associated DAG and/or KLSC amino acid sequence motifs of CP and HC/Pro, respectively.
Sharma, Parichit; Mantri, Shrikant S
2014-01-01
The function of a newly sequenced gene can be discovered by determining its sequence homology with known proteins. BLAST is the most extensively used sequence analysis program for sequence similarity search in large databases of sequences. With the advent of next generation sequencing technologies it has now become possible to study genes and their expression at a genome-wide scale through RNA-seq and metagenome sequencing experiments. Functional annotation of all the genes is done by sequence similarity search against multiple protein databases. This annotation task is computationally very intensive and can take days to obtain complete results. The program mpiBLAST, an open-source parallelization of BLAST that achieves superlinear speedup, can be used to accelerate large-scale annotation by using supercomputers and high performance computing (HPC) clusters. Although many parallel bioinformatics applications using the Message Passing Interface (MPI) are available in the public domain, researchers are reluctant to use them due to lack of expertise in the Linux command line and relevant programming experience. With these limitations, it becomes difficult for biologists to use mpiBLAST for accelerating annotation. No web interface is available in the open-source domain for mpiBLAST. We have developed WImpiBLAST, a user-friendly open-source web interface for parallel BLAST searches. It is implemented in Struts 1.3 using a Java backbone and runs atop the open-source Apache Tomcat Server. WImpiBLAST supports script creation and job submission features and also provides a robust job management interface for system administrators. It combines script creation and modification features with job monitoring and management through the Torque resource manager on a Linux-based HPC cluster. Use case information highlights the acceleration of annotation analysis achieved by using WImpiBLAST. Here, we describe the WImpiBLAST web interface features and architecture, explain design decisions, describe workflows and provide a detailed analysis.
Sharma, Parichit; Mantri, Shrikant S.
2014-01-01
The function of a newly sequenced gene can be discovered by determining its sequence homology with known proteins. BLAST is the most extensively used sequence analysis program for sequence similarity search in large databases of sequences. With the advent of next generation sequencing technologies it has now become possible to study genes and their expression at a genome-wide scale through RNA-seq and metagenome sequencing experiments. Functional annotation of all the genes is done by sequence similarity search against multiple protein databases. This annotation task is computationally very intensive and can take days to obtain complete results. The program mpiBLAST, an open-source parallelization of BLAST that achieves superlinear speedup, can be used to accelerate large-scale annotation by using supercomputers and high performance computing (HPC) clusters. Although many parallel bioinformatics applications using the Message Passing Interface (MPI) are available in the public domain, researchers are reluctant to use them due to lack of expertise in the Linux command line and relevant programming experience. With these limitations, it becomes difficult for biologists to use mpiBLAST for accelerating annotation. No web interface is available in the open-source domain for mpiBLAST. We have developed WImpiBLAST, a user-friendly open-source web interface for parallel BLAST searches. It is implemented in Struts 1.3 using a Java backbone and runs atop the open-source Apache Tomcat Server. WImpiBLAST supports script creation and job submission features and also provides a robust job management interface for system administrators. It combines script creation and modification features with job monitoring and management through the Torque resource manager on a Linux-based HPC cluster. Use case information highlights the acceleration of annotation analysis achieved by using WImpiBLAST. Here, we describe the WImpiBLAST web interface features and architecture, explain design decisions, describe workflows and provide a detailed analysis. PMID:24979410
Desjardin, Dennis E; Hemmes, Don E; Perry, Brian A
2014-01-01
Pseudobaeospora wipapatiae is described as new based on material collected in alien wet habitats on the island of Hawaii. Unique features of this beautiful species include deep ruby-colored basidiomes with two-spored basidia, amyloid cheilocystidia and a hymeniderm pileipellis with abundant pileocystidia that is initially deep ruby in KOH then changes to lilac gray. Phylogenetic analysis of nuclear large ribosomal subunit sequence data suggest a close relationship between Pseudobaeospora and Tricholoma. BLAST comparisons of internal transcribed spacer and 5.8S nuclear ribosomal subunit regions sequence data reveal greatest similarity with existing sequences of Pseudobaeospora species. A comprehensive description, color photograph, illustrations of salient micromorphological features and comparisons with phenetically similar taxa are provided. © 2014 by The Mycological Society of America.
SALAD database: a motif-based database of protein annotations for plant comparative genomics
Mihara, Motohiro; Itoh, Takeshi; Izawa, Takeshi
2010-01-01
Proteins often have several motifs with distinct evolutionary histories. Proteins with similar motifs have similar biochemical properties and thus related biological functions. We constructed a unique comparative genomics database termed the SALAD database (http://salad.dna.affrc.go.jp/salad/) from plant-genome-based proteome data sets. We extracted evolutionarily conserved motifs by MEME software from 209 529 protein-sequence annotation groups selected by BLASTP from the proteome data sets of 10 species: rice, sorghum, Arabidopsis thaliana, grape, a lycophyte, a moss, 3 algae, and yeast. Similarity clustering of each protein group was performed by pairwise scoring of the motif patterns of the sequences. The SALAD database provides a user-friendly graphical viewer that displays a motif pattern diagram linked to the resulting bootstrapped dendrogram for each protein group. Amino-acid-sequence-based and nucleotide-sequence-based phylogenetic trees for motif combination alignment, a logo comparison diagram for each clade in the tree, and a Pfam-domain pattern diagram are also available. We also developed a viewer named ‘SALAD on ARRAYs’ to view arbitrary microarray data sets of paralogous genes linked to the same dendrogram in a window. The SALAD database is a powerful tool for comparing protein sequences and can provide valuable hints for biological analysis. PMID:19854933
SALAD database: a motif-based database of protein annotations for plant comparative genomics.
Mihara, Motohiro; Itoh, Takeshi; Izawa, Takeshi
2010-01-01
Proteins often have several motifs with distinct evolutionary histories. Proteins with similar motifs have similar biochemical properties and thus related biological functions. We constructed a unique comparative genomics database termed the SALAD database (http://salad.dna.affrc.go.jp/salad/) from plant-genome-based proteome data sets. We extracted evolutionarily conserved motifs by MEME software from 209,529 protein-sequence annotation groups selected by BLASTP from the proteome data sets of 10 species: rice, sorghum, Arabidopsis thaliana, grape, a lycophyte, a moss, 3 algae, and yeast. Similarity clustering of each protein group was performed by pairwise scoring of the motif patterns of the sequences. The SALAD database provides a user-friendly graphical viewer that displays a motif pattern diagram linked to the resulting bootstrapped dendrogram for each protein group. Amino-acid-sequence-based and nucleotide-sequence-based phylogenetic trees for motif combination alignment, a logo comparison diagram for each clade in the tree, and a Pfam-domain pattern diagram are also available. We also developed a viewer named 'SALAD on ARRAYs' to view arbitrary microarray data sets of paralogous genes linked to the same dendrogram in a window. The SALAD database is a powerful tool for comparing protein sequences and can provide valuable hints for biological analysis.
Abdel-Rahman, Mohamed A; Quintero-Hernandez, Veronica; Possani, Lourival D
2013-11-01
Proteomic analysis of the scorpion venom Scorpio maurus palmatus was performed using reverse-phase HPLC separation followed by mass spectrometry determination. Sixty five components were identified with molecular masses varying from 413 to 14,009 Da. The high percentage of peptides (41.5%) was from 3 to 5 KDa which may represent linear antimicrobial peptides and KScTxs. Also, 155 expressed sequence tags (ESTs) were analyzed through construction the cDNA library prepared from a pair of venomous gland. About 77% of the ESTs correspond to toxin-like peptides and proteins with definite open reading frames. The cDNA sequencing results also show the presence of sequences whose putative products have sequence similarity with antimicrobial peptides (24%), insecticidal toxins, β-NaScTxs, κ-KScTxs, α-KScTxs, calcines and La1-like peptides. Also, we have obtained 23 atypical types of venom molecules not recorded in other scorpion species. Moreover, 9% of the total ESTs revealed significant similarities with proteins involved in the cellular processes of these scorpion venomous glands. This is the first set of molecular masses and transcripts described from this species, in which various venom molecules have been identified. They belong to either known or unassigned types of scorpion venom peptides and proteins, and provide valuable information for evolutionary analysis and venomics. Copyright © 2013 Elsevier Ltd. All rights reserved.
Snauwaert, Isabel; Papalexandratou, Zoi; De Vuyst, Luc; Vandamme, Peter
2013-05-01
Six facultatively anaerobic, non-motile lactic acid bacteria were isolated from spontaneous cocoa bean fermentations carried out in Brazil, Ecuador and Malaysia. Phylogenetic analysis revealed that one of these strains, designated M75(T), isolated from a Brazilian cocoa bean fermentation, had the highest 16S rRNA gene sequence similarity towards Weissella fabaria LMG 24289(T) (97.7%), W. ghanensis LMG 24286(T) (93.3%) and W. beninensis LMG 25373(T) (93.4%). The remaining lactic acid bacteria isolates, represented by strain M622, showed the highest 16S rRNA gene sequence similarity towards the type strain of Fructobacillus tropaeoli (99.9%), a recently described species isolated from a flower in South Africa. pheS gene sequence analysis indicated that the former strain represented a novel species, whereas pheS, rpoA and atpA gene sequence analysis indicated that the remaining five strains belonged to F. tropaeoli; these results were confirmed by DNA-DNA hybridization experiments towards their respective nearest phylogenetic neighbours. Additionally, matrix-assisted laser desorption/ionization time-of-flight mass spectrometry proved successful for the identification of species of the genera Weissella and Fructobacillus and for the recognition of the novel species. We propose to classify strain M75(T) ( = LMG 26217(T) = CCUG 61472(T)) as the type strain of the novel species Weissella fabalis sp. nov.
Emmenegger, E.J.; Kurath, G.
2002-01-01
Infectious hematopoietic necrosis virus (IHNV) is a pathogen that infects many Pacific salmonid stocks from the watersheds of North America. Previous studies have thoroughly characterized the genetic diversity of IHNV isolates from Alaska and the Hagerman Valley in Idaho. To enhance understanding of the evolution and viral transmission patterns of IHNV within the Pacific Northwest geographic range, we analyzed the G gene of IHNV isolates from the coastal watersheds of Washington State by ribonuclease protection assay (RPA) and nucleotide sequencing. The RPA analysis of 23 isolates indicated that the Skagit basin IHNV isolates were relatively homogeneous as a result of the dominance of one G gene haplotype (S). Sequence analysis of 303 bases in the middle of the G gene (midG region) of 61 isolates confirmed the high frequency of a Skagit River basin sequence and identified another sequence commonly found in isolates from the Lake Washington basin. Overall, both the RPA and sequence analysis showed that the Washington coastal IHNV isolates are genetically homogeneous and have little genetic diversity. This is similar to the genetic diversity pattern of IHNV from Alaska and contrasts sharply with the high genetic diversity demonstrated for IHNV isolates from fish farms along the Snake River in Idaho. The high degree of sequence and haplotype similarity between the Washington coastal IHNV isolates and those from Alaska and British Columbia suggests that they have a common viral ancestor. Phylogenetic analyses of the isolates we studied and those from different regions throughout the virus's geographic range confirms a conserved pattern of evolution of the virus in salmonid stocks north of the Columbia River, which forms Washington's southern border.
Peng, Chuanhua; Wang, Xiaoping; Li, Fei; Lin, Yongjun
2012-01-01
The rice stem borer, Chilo suppressalis (Walker) (Lepidoptera: Pyralidae), is one of the most detrimental pests affecting rice crops. The use of Bacillus thuringiensis (Bt) toxins has been explored as a means to control this pest, but the potential for C. suppressalis to develop resistance to Bt toxins makes this approach problematic. Few C. suppressalis gene sequences are known, which makes in-depth study of gene function difficult. Herein, we sequenced the midgut transcriptome of the rice stem borer. In total, 37,040 contigs were obtained, with a mean size of 497 bp. As expected, the transcripts of C. suppressalis shared high similarity with arthropod genes. Gene ontology and KEGG analysis were used to classify the gene functions in C. suppressalis. Using the midgut transcriptome data, we conducted a proteome analysis to identify proteins expressed abundantly in the brush border membrane vesicles (BBMV). Of the 100 top abundant proteins that were excised and subjected to mass spectrometry analysis, 74 share high similarity with known proteins. Among these proteins, Western blot analysis showed that Aminopeptidase N and EH domain-containing protein have the binding activities with Bt-toxin Cry1Ac. These data provide invaluable information about the gene sequences of C. suppressalis and the proteins that bind with Cry1Ac. PMID:22666467
Tang, Kai; Lin, Dan; Zheng, Qiang; Liu, Keshao; Yang, Yujie; Han, Yu; Jiao, Nianzhi
2017-06-27
Marine phages are spectacularly diverse in nature. Dozens of roseophages infecting members of Roseobacter clade bacteria were isolated and characterized, exhibiting a very high degree of genetic diversity. In the present study, the induction of two temperate bacteriophages, namely, vB_ThpS-P1 and vB_PeaS-P1, was performed in Roseobacter clade bacteria isolated from the deep-sea water, Thiobacimonas profunda JLT2016 and Pelagibaca abyssi JLT2014, respectively. Two novel phages in morphological, genomic and proteomic features were presented, and their phylogeny and evolutionary relationships were explored by bioinformatic analysis. Electron microscopy showed that the morphology of the two phages were similar to that of siphoviruses. Genome sequencing indicated that the two phages were similar in size, organization, and content, thereby suggesting that these shared a common ancestor. Despite the presence of Mu-like phage head genes, the phages are more closely related to Rhodobacter phage RC1 than Mu phages in terms of gene content and sequence similarity. Based on comparative genomic and phylogenetic analysis, we propose a Mu-like head phage group to allow for the inclusion of Mu-like phages and two newly phages. The sequences of the Mu-like head phage group were widespread, occurring in each investigated metagenomes. Furthermore, the horizontal exchange of genetic material within the Mu-like head phage group might have involved a gene that was associated with phage phenotypic characteristics. This study is the first report on the complete genome sequences of temperate phages that infect deep-sea roseobacters, belonging to the Mu-like head phage group. The Mu-like head phage group might represent a small but ubiquitous fraction of marine viral diversity.
HLA Diversity in the 1000 Genomes Dataset
Gourraud, Pierre-Antoine; Khankhanian, Pouya; Cereb, Nezih; Yang, Soo Young; Feolo, Michael; Maiers, Martin; D. Rioux, John; Hauser, Stephen; Oksenberg, Jorge
2014-01-01
The 1000 Genomes Project aims to provide a deep characterization of human genome sequence variation by sequencing at a level that should allow the genome-wide detection of most variants with frequencies as low as 1%. However, in the major histocompatibility complex (MHC), only the top 10 most frequent haplotypes are in the 1% frequency range whereas thousands of haplotypes are present at lower frequencies. Given the limitation of both the coverage and the read length of the sequences generated by the 1000 Genomes Project, the highly variable positions that define HLA alleles may be difficult to identify. We used classical Sanger sequencing techniques to type the HLA-A, HLA-B, HLA-C, HLA-DRB1 and HLA-DQB1 genes in the available 1000 Genomes samples and combined the results with the 103,310 variants in the MHC region genotyped by the 1000 Genomes Project. Using pairwise identity-by-descent distances between individuals and principal component analysis, we established the relationship between ancestry and genetic diversity in the MHC region. As expected, both the MHC variants and the HLA phenotype can identify the major ancestry lineage, informed mainly by the most frequent HLA haplotypes. To some extent, regions of the genome with similar genetic or similar recombination rate have similar properties. An MHC-centric analysis underlines departures between the ancestral background of the MHC and the genome-wide picture. Our analysis of linkage disequilibrium (LD) decay in these samples suggests that overestimation of pairwise LD occurs due to a limited sampling of the MHC diversity. This collection of HLA-specific MHC variants, available on the dbMHC portal, is a valuable resource for future analyses of the role of MHC in population and disease studies. PMID:24988075
HLA diversity in the 1000 genomes dataset.
Gourraud, Pierre-Antoine; Khankhanian, Pouya; Cereb, Nezih; Yang, Soo Young; Feolo, Michael; Maiers, Martin; Rioux, John D; Hauser, Stephen; Oksenberg, Jorge
2014-01-01
The 1000 Genomes Project aims to provide a deep characterization of human genome sequence variation by sequencing at a level that should allow the genome-wide detection of most variants with frequencies as low as 1%. However, in the major histocompatibility complex (MHC), only the top 10 most frequent haplotypes are in the 1% frequency range whereas thousands of haplotypes are present at lower frequencies. Given the limitation of both the coverage and the read length of the sequences generated by the 1000 Genomes Project, the highly variable positions that define HLA alleles may be difficult to identify. We used classical Sanger sequencing techniques to type the HLA-A, HLA-B, HLA-C, HLA-DRB1 and HLA-DQB1 genes in the available 1000 Genomes samples and combined the results with the 103,310 variants in the MHC region genotyped by the 1000 Genomes Project. Using pairwise identity-by-descent distances between individuals and principal component analysis, we established the relationship between ancestry and genetic diversity in the MHC region. As expected, both the MHC variants and the HLA phenotype can identify the major ancestry lineage, informed mainly by the most frequent HLA haplotypes. To some extent, regions of the genome with similar genetic or similar recombination rate have similar properties. An MHC-centric analysis underlines departures between the ancestral background of the MHC and the genome-wide picture. Our analysis of linkage disequilibrium (LD) decay in these samples suggests that overestimation of pairwise LD occurs due to a limited sampling of the MHC diversity. This collection of HLA-specific MHC variants, available on the dbMHC portal, is a valuable resource for future analyses of the role of MHC in population and disease studies.
A self-similar hierarchy of the Korean stock market
NASA Astrophysics Data System (ADS)
Lim, Gyuchang; Min, Seungsik; Yoo, Kun-Woo
2013-01-01
A scaling analysis is performed on market values of stocks listed on Korean stock exchanges such as the KOSPI and the KOSDAQ. Different from previous studies on price fluctuations, market capitalizations are dealt with in this work. First, we show that the sum of the two stock exchanges shows a clear rank-size distribution, i.e., the Zipf's law, just as each separate one does. Second, by abstracting Zipf's law as a γ-sequence, we define a self-similar hierarchy consisting of many levels, with the numbers of firms at each level forming a geometric sequence. We also use two exponential functions to describe the hierarchy and derive a scaling law from them. Lastly, we propose a self-similar hierarchical process and perform an empirical analysis on our data set. Based on our findings, we argue that all money invested in the stock market is distributed in a hierarchical way and that a slight difference exists between the two exchanges.
Buschmann, Tilo; Zhang, Rong; Brash, Douglas E; Bystrykh, Leonid V
2014-08-07
DNA barcodes are short unique sequences used to label DNA or RNA-derived samples in multiplexed deep sequencing experiments. During the demultiplexing step, barcodes must be detected and their position identified. In some cases (e.g., with PacBio SMRT), the position of the barcode and DNA context is not well defined. Many reads start inside the genomic insert so that adjacent primers might be missed. The matter is further complicated by coincidental similarities between barcode sequences and reference DNA. Therefore, a robust strategy is required in order to detect barcoded reads and avoid a large number of false positives or negatives.For mass inference problems such as this one, false discovery rate (FDR) methods are powerful and balanced solutions. Since existing FDR methods cannot be applied to this particular problem, we present an adapted FDR method that is suitable for the detection of barcoded reads as well as suggest possible improvements. In our analysis, barcode sequences showed high rates of coincidental similarities with the Mus musculus reference DNA. This problem became more acute when the length of the barcode sequence decreased and the number of barcodes in the set increased. The method presented in this paper controls the tail area-based false discovery rate to distinguish between barcoded and unbarcoded reads. This method helps to establish the highest acceptable minimal distance between reads and barcode sequences. In a proof of concept experiment we correctly detected barcodes in 83% of the reads with a precision of 89%. Sensitivity improved to 99% at 99% precision when the adjacent primer sequence was incorporated in the analysis. The analysis was further improved using a paired end strategy. Following an analysis of the data for sequence variants induced in the Atp1a1 gene of C57BL/6 murine melanocytes by ultraviolet light and conferring resistance to ouabain, we found no evidence of cross-contamination of DNA material between samples. Our method offers a proper quantitative treatment of the problem of detecting barcoded reads in a noisy sequencing environment. It is based on the false discovery rate statistics that allows a proper trade-off between sensitivity and precision to be chosen.
The nif Gene Operon of the Methanogenic Archaeon Methanococcus maripaludis
Kessler, Peter S.; Blank, Carrine; Leigh, John A.
1998-01-01
Nitrogen fixation occurs in two domains, Archaea and Bacteria. We have characterized a nif (nitrogen fixation) gene cluster in the methanogenic archaeon Methanococcus maripaludis. Sequence analysis revealed eight genes, six with sequence similarity to known nif genes and two with sequence similarity to glnB. The gene order, nifH, ORF105 (similar to glnB), ORF121 (similar to glnB), nifD, nifK, nifE, nifN, and nifX, was the same as that found in part in other diazotrophic methanogens and except for the presence of the glnB-like genes, also resembled the order found in many members of the Bacteria. Using transposon insertion mutagenesis, we determined that an 8-kb region required for nitrogen fixation corresponded to the nif gene cluster. Northern analysis revealed the presence of either a single 7.6-kb nif mRNA transcript or 10 smaller mRNA species containing portions of the large transcript. Polar effects of transposon insertions demonstrated that all of these mRNAs arose from a single promoter region, where transcription initiated 80 bp 5′ to nifH. Distinctive features of the nif gene cluster include the presence of the six primary nif genes in a single operon, the placement of the two glnB-like genes within the cluster, the apparent physical separation of the cluster from any other nif genes that might be in the genome, the fragmentation pattern of the mRNA, and the regulation of expression by a repression mechanism described previously. Our study and others with methanogenic archaea reporting multiple mRNAs arising from gene clusters with only a single putative promoter sequence suggest that mRNA processing following transcription may be a common occurrence in methanogens. PMID:9515920
Yasukawa, Hiro; Sato, Aya; Kita, Ayaka; Kodaira, Ken-Ichi; Iseki, Mineo; Takahashi, Tetsuo; Shibusawa, Mami; Watanabe, Masakatsu; Yagita, Kenji
2013-01-01
Complete genome sequencing of Naegleria gruberi has revealed that the organism encodes polypeptides similar to photoactivated adenylyl cyclases (PACs). Screening in the N. australiensis genome showed that the organism also encodes polypeptides similar to PACs. Each of the Naegleria proteins consists of a "sensors of blue-light using FAD" domain (BLUF domain) and an adenylyl cyclase domain (AC domain). PAC activity of the Naegleria proteins was assayed by comparing sensitivities of Escherichia coli cells heterologously expressing the proteins to antibiotics in a dark condition and a blue light-irradiated condition. Antibiotics used in the assays were fosfomycin and fosmidomycin. E. coli cells expressing the Naegleria proteins showed increased fosfomycin sensitivity and fosmidomycin sensitivity when incubated under blue light, indicating that the proteins functioned as PACs in the bacterial cells. Analysis of the N. fowleri genome revealed that the organism encodes a protein bearing an amino acid sequence similar to that of BLUF. A plasmid expressing a chimeric protein consisting of the BLUF-like sequence found in N. fowleri and the adenylyl cyclase domain of N. gruberi PAC was constructed to determine whether the BLUF-like sequence functioned as a sensor of blue light. E. coli cells expressing a chimeric protein showed increased fosfomycin sensitivity and fosmidomycin sensitivity when incubated under blue light. These experimental results indicated that the sequence similar to the BLUF domain found in N. fowleri functioned as a sensor of blue light.
Generation, annotation and analysis of ESTs from Trichoderma harzianum CECT 2413
Vizcaíno, Juan Antonio; González, Francisco Javier; Suárez, M Belén; Redondo, José; Heinrich, Julian; Delgado-Jarana, Jesús; Hermosa, Rosa; Gutiérrez, Santiago; Monte, Enrique; Llobell, Antonio; Rey, Manuel
2006-01-01
Background The filamentous fungus Trichoderma harzianum is used as biological control agent of several plant-pathogenic fungi. In order to study the genome of this fungus, a functional genomics project called "TrichoEST" was developed to give insights into genes involved in biological control activities using an approach based on the generation of expressed sequence tags (ESTs). Results Eight different cDNA libraries from T. harzianum strain CECT 2413 were constructed. Different growth conditions involving mainly different nutrient conditions and/or stresses were used. We here present the analysis of the 8,710 ESTs generated. A total of 3,478 unique sequences were identified of which 81.4% had sequence similarity with GenBank entries, using the BLASTX algorithm. Using the Gene Ontology hierarchy, we performed the annotation of 51.1% of the unique sequences and compared its distribution among the gene libraries. Additionally, the InterProScan algorithm was used in order to further characterize the sequences. The identification of the putatively secreted proteins was also carried out. Later, based on the EST abundance, we examined the highly expressed genes and a hydrophobin was identified as the gene expressed at the highest level. We compared our collection of ESTs with the previous collections obtained from Trichoderma species and we also compared our sequence set with different complete eukaryotic genomes from several animals, plants and fungi. Accordingly, the presence of similar sequences in different kingdoms was also studied. Conclusion This EST collection and its annotation provide a significant resource for basic and applied research on T. harzianum, a fungus with a high biotechnological interest. PMID:16872539
Molecular characterization of a wild poliovirus type 3 epidemic in The Netherlands (1992 and 1993).
Mulders, M N; van Loon, A M; van der Avoort, H G; Reimerink, J H; Ras, A; Bestebroer, T M; Drebot, M A; Kew, O M; Koopmans, M P
1995-01-01
An outbreak of poliomyelitis due to wild poliovirus type 3 (PV3) occurred in an unvaccinated community in The Netherlands between September 1992 and February 1993. The outbreak involved 71 patients. The aim of this study was to characterize the virus at the molecular level and to analyze the molecular evolution of the epidemic virus. Molecular analysis was carried out by sequencing the VP1/2A junction region (150 nucleotides) of 50 PV3 strains isolated in association with this outbreak and the entire VP1 gene of 14 strains. In addition, the sequence of the VP1/2A junction region of strains from geographical regions endemic for PV3 (Egypt, India, and Central Asia) was analyzed and compared with the nucleotide sequence of the epidemic strain from The Netherlands. The earliest isolate was obtained from river water sampled 3 weeks before diagnosis of the first poliomyelitis patient and was found by VP1/2A sequence analysis to be genetically identical to the strain isolated from the first patient. Sequence divergence among the strains from the epidemic in The Netherlands was less than 2%. The closest genetic similarity (97.3%) was found with an Indian isolate (New Delhi, December 1991), indicating the likely source of the virus. A more than 99% sequence similarity was found in the VP1/2A region. Finally, the sequence information was used to design primers for the specific and highly sensitive molecular detection of PV3 strains during the epidemic. PMID:8586711
Zhu, Haisheng; Liu, Jianting; Wen, Qingfang; Chen, Mindong; Wang, Bin; Zhang, Qianrong; Xue, Zhuzheng
2017-01-01
Fresh-cut luffa (Luffa cylindrica) fruits commonly undergo browning. However, little is known about the molecular mechanisms regulating this process. We used the RNA-seq technique to analyze the transcriptomic changes occurring during the browning of fresh-cut fruits from luffa cultivar 'Fusi-3'. Over 90 million high-quality reads were assembled into 58,073 Unigenes, and 60.86% of these were annotated based on sequences in four public databases. We detected 35,282 Unigenes with significant hits to sequences in the NCBInr database, and 24,427 Unigenes encoded proteins with sequences that were similar to those of known proteins in the Swiss-Prot database. Additionally, 20,546 and 13,021 Unigenes were similar to existing sequences in the Eukaryotic Orthologous Groups of proteins and Kyoto Encyclopedia of Genes and Genomes databases, respectively. Furthermore, 27,301 Unigenes were differentially expressed during the browning of fresh-cut luffa fruits (i.e., after 1-6 h). Moreover, 11 genes from five gene families (i.e., PPO, PAL, POD, CAT, and SOD) identified as potentially associated with enzymatic browning as well as four WRKY transcription factors were observed to be differentially regulated in fresh-cut luffa fruits. With the assistance of rapid amplification of cDNA ends technology, we obtained the full-length sequences of the 15 Unigenes. We also confirmed these Unigenes were expressed by quantitative real-time polymerase chain reaction analysis. This study provides a comprehensive transcriptome sequence resource, and may facilitate further studies aimed at identifying genes affecting luffa fruit browning for the exploitation of the underlying mechanism.
Pyrosequencing the Canine Faecal Microbiota: Breadth and Depth of Biodiversity
Hand, Daniel; Wallis, Corrin; Colyer, Alison; Penn, Charles W.
2013-01-01
Mammalian intestinal microbiota remain poorly understood despite decades of interest and investigation by culture-based and other long-established methodologies. Using high-throughput sequencing technology we now report a detailed analysis of canine faecal microbiota. The study group of animals comprised eleven healthy adult miniature Schnauzer dogs of mixed sex and age, some closely related and all housed in kennel and pen accommodation on the same premises with similar feeding and exercise regimes. DNA was extracted from faecal specimens and subjected to PCR amplification of 16S rDNA, followed by sequencing of the 5′ region that included variable regions V1 and V2. Barcoded amplicons were sequenced by Roche-454 FLX high-throughput pyrosequencing. Sequences were assigned to taxa using the Ribosomal Database Project Bayesian classifier and revealed dominance of Fusobacterium and Bacteroidetes phyla. Differences between animals in the proportions of different taxa, among 10,000 reads per animal, were clear and not supportive of the concept of a “core microbiota”. Despite this variability in prominent genera, littermates were shown to have a more similar faecal microbial composition than unrelated dogs. Diversity of the microbiota was also assessed by assignment of sequence reads into operational taxonomic units (OTUs) at the level of 97% sequence identity. The OTU data were then subjected to rarefaction analysis and determination of Chao1 richness estimates. The data indicated that faecal microbiota comprised possibly as many as 500 to 1500 OTUs. PMID:23382835
A generalized global alignment algorithm.
Huang, Xiaoqiu; Chao, Kun-Mao
2003-01-22
Homologous sequences are sometimes similar over some regions but different over other regions. Homologous sequences have a much lower global similarity if the different regions are much longer than the similar regions. We present a generalized global alignment algorithm for comparing sequences with intermittent similarities, an ordered list of similar regions separated by different regions. A generalized global alignment model is defined to handle sequences with intermittent similarities. A dynamic programming algorithm is designed to compute an optimal general alignment in time proportional to the product of sequence lengths and in space proportional to the sum of sequence lengths. The algorithm is implemented as a computer program named GAP3 (Global Alignment Program Version 3). The generalized global alignment model is validated by experimental results produced with GAP3 on both DNA and protein sequences. The GAP3 program extends the ability of standard global alignment programs to recognize homologous sequences of lower similarity. The GAP3 program is freely available for academic use at http://bioinformatics.iastate.edu/aat/align/align.html.
2013-01-01
Background Besides the development of comprehensive tools for high-throughput 16S ribosomal RNA amplicon sequence analysis, there exists a growing need for protocols emphasizing alternative phylogenetic markers such as those representing eukaryotic organisms. Results Here we introduce CloVR-ITS, an automated pipeline for comparative analysis of internal transcribed spacer (ITS) pyrosequences amplified from metagenomic DNA isolates and representing fungal species. This pipeline performs a variety of steps similar to those commonly used for 16S rRNA amplicon sequence analysis, including preprocessing for quality, chimera detection, clustering of sequences into operational taxonomic units (OTUs), taxonomic assignment (at class, order, family, genus, and species levels) and statistical analysis of sample groups of interest based on user-provided information. Using ITS amplicon pyrosequencing data from a previous human gastric fluid study, we demonstrate the utility of CloVR-ITS for fungal microbiota analysis and provide runtime and cost examples, including analysis of extremely large datasets on the cloud. We show that the largest fractions of reads from the stomach fluid samples were assigned to Dothideomycetes, Saccharomycetes, Agaricomycetes and Sordariomycetes but that all samples were dominated by sequences that could not be taxonomically classified. Representatives of the Candida genus were identified in all samples, most notably C. quercitrusa, while sequence reads assigned to the Aspergillus genus were only identified in a subset of samples. CloVR-ITS is made available as a pre-installed, automated, and portable software pipeline for cloud-friendly execution as part of the CloVR virtual machine package (http://clovr.org). Conclusion The CloVR-ITS pipeline provides fungal microbiota analysis that can be complementary to bacterial 16S rRNA and total metagenome sequence analysis allowing for more comprehensive studies of environmental and host-associated microbial communities. PMID:24451270
Tanaka, Mizuki; Sakai, Yoshifumi; Yamada, Osamu; Shintani, Takahiro; Gomi, Katsuya
2011-01-01
To investigate 3′-end-processing signals in Aspergillus oryzae, we created a nucleotide sequence data set of the 3′-untranslated region (3′ UTR) plus 100 nucleotides (nt) sequence downstream of the poly(A) site using A. oryzae expressed sequence tags and genomic sequencing data. This data set comprised 1065 sequences derived from 1042 unique genes. The average 3′ UTR length in A. oryzae was 241 nt, which is greater than that in yeast but similar to that in plants. The 3′ UTR and 100 nt sequence downstream of the poly(A) site is notably U-rich, while the region located 15–30 nt upstream of the poly(A) site is markedly A-rich. The most frequently found hexanucleotide in this A-rich region is AAUGAA, although this sequence accounts for only 6% of all transcripts. These data suggested that A. oryzae has no highly conserved sequence element equivalent to AAUAAA, a mammalian polyadenylation signal. We identified that putative 3′-end-processing signals in A. oryzae, while less well conserved than those in mammals, comprised four sequence elements: the furthest upstream U-rich element, A-rich sequence, cleavage site, and downstream U-rich element flanking the cleavage site. Although these putative 3′-end-processing signals are similar to those in yeast and plants, some notable differences exist between them. PMID:21586533
Fritz, Jan; Ahlawat, Shivani; Demehri, Shadpour; Thawait, Gaurav K; Raithel, Esther; Gilson, Wesley D; Nittka, Mathias
2016-10-01
The aim of this study was to prospectively test the hypothesis that a compressed sensing-based slice encoding for metal artifact correction (SEMAC) turbo spin echo (TSE) pulse sequence prototype facilitates high-resolution metal artifact reduction magnetic resonance imaging (MRI) of cobalt-chromium knee arthroplasty implants within acquisition times of less than 5 minutes, thereby yielding better image quality than high-bandwidth (BW) TSE of similar length and similar image quality than lengthier SEMAC standard of reference pulse sequences. This prospective study was approved by our institutional review board. Twenty asymptomatic subjects (12 men, 8 women; mean age, 56 years; age range, 44-82 years) with total knee arthroplasty implants underwent MRI of the knee using a commercially available, clinical 1.5 T MRI system. Two compressed sensing-accelerated SEMAC prototype pulse sequences with 8-fold undersampling and acquisition times of approximately 5 minutes each were compared with commercially available high-BW and SEMAC pulse sequences with acquisition times of approximately 5 minutes and 11 minutes, respectively. For each pulse sequence type, sagittal intermediate-weighted (TR, 3750-4120 milliseconds; TE, 26-28 milliseconds; voxel size, 0.5 × 0.5 × 3 mm) and short tau inversion recovery (TR, 4010 milliseconds; TE, 5.2-7.5 milliseconds; voxel size, 0.8 × 0.8 × 4 mm) were acquired. Outcome variables included image quality, display of the bone-implant interfaces and pertinent knee structures, artifact size, signal-to-noise ratio (SNR), and contrast-to-noise ratio (CNR). Statistical analysis included Friedman, repeated measures analysis of variances, and Cohen weighted k tests. Bonferroni-corrected P values of 0.005 and less were considered statistically significant. Image quality, bone-implant interfaces, anatomic structures, artifact size, SNR, and CNR parameters were statistically similar between the compressed sensing-accelerated SEMAC prototype and SEMAC commercial pulse sequences. There was mild blur on images of both SEMAC sequences when compared with high-BW images (P < 0.001), which however did not impair the assessment of knee structures. Metal artifact reduction and visibility of central knee structures and bone-implant interfaces were good to very good and significantly better on both types of SEMAC than on high-BW images (P < 0.004). All 3 pulse sequences showed peripheral structures similarly well. The implant artifact size was 46% to 51% larger on high-BW images when compared with both types of SEMAC images (P < 0.0001). Signal-to-noise ratios and CNRs of fat tissue, tendon tissue, muscle tissue, and fluid were statistically similar on intermediate-weighted MR images of all 3 pulse sequence types. On short tau inversion recovery images, the SNRs of tendon tissue and the CNRs of fat and fluid, fluid and muscle, as well as fluid and tendon were significantly higher on SEMAC and compressed sensing SEMAC images (P < 0.005, respectively). We accept the hypothesis that prospective compressed sensing acceleration of SEMAC is feasible for high-quality metal artifact reduction MRI of cobalt-chromium knee arthroplasty implants in less than 5 minutes and yields better quality than high-BW TSE and similarly high quality than lengthier SEMAC pulse sequences.
Abdel-Baki, Abdel-Azeem S; Al-Quraishy, Saleh; Zhang, J Y
2014-06-01
Hepatozoon garnhami n. comb. was redescribed from Schokari sand snakes (Psammophis schokari) collected from Riyadh city in Saudi Arabia. Gametocytes were found in the peripheral blood of 2 of 15 snakes examined. Based on the similar morphological and morphometric characteristics, the same host and a similar host habitat environment, it can be concluded for the first time that the present species is conspecific with Haemogregarina garnhami previously reported from Psammophis shokari aegyptius. To further characterize this parasite, the partial 18S rRNA gene was amplified and sequenced. The sequence analysis also showed that Haemogregarina garnhami should be reassigned into the genus Hepatozoon as Hepatozoon garnhami which has 99.5% (859/863 bp) sequence similarity to Hepatozoon ayorgbor, infecting the erythrocytes of Python regius in Ghana. Phylogenetic analysis showed that H. garnhami formed a mixed clade with Hepatozoon spp. from geckos, snakes and rodents and ophidian Hepatozoon spp. did not form a separated phylogenetic unit. Also, Psammophis schokari-infecting Hepatozoon contained several different genetic lineages. To our knowledge, the present work extends the geographic distribution of H. garnhami and is the first report of Hepatozoon infection in snakes from Saudi Arabia.
Association mining of dependency between time series
NASA Astrophysics Data System (ADS)
Hafez, Alaaeldin
2001-03-01
Time series analysis is considered as a crucial component of strategic control over a broad variety of disciplines in business, science and engineering. Time series data is a sequence of observations collected over intervals of time. Each time series describes a phenomenon as a function of time. Analysis on time series data includes discovering trends (or patterns) in a time series sequence. In the last few years, data mining has emerged and been recognized as a new technology for data analysis. Data Mining is the process of discovering potentially valuable patterns, associations, trends, sequences and dependencies in data. Data mining techniques can discover information that many traditional business analysis and statistical techniques fail to deliver. In this paper, we adapt and innovate data mining techniques to analyze time series data. By using data mining techniques, maximal frequent patterns are discovered and used in predicting future sequences or trends, where trends describe the behavior of a sequence. In order to include different types of time series (e.g. irregular and non- systematic), we consider past frequent patterns of the same time sequences (local patterns) and of other dependent time sequences (global patterns). We use the word 'dependent' instead of the word 'similar' for emphasis on real life time series where two time series sequences could be completely different (in values, shapes, etc.), but they still react to the same conditions in a dependent way. In this paper, we propose the Dependence Mining Technique that could be used in predicting time series sequences. The proposed technique consists of three phases: (a) for all time series sequences, generate their trend sequences, (b) discover maximal frequent trend patterns, generate pattern vectors (to keep information of frequent trend patterns), use trend pattern vectors to predict future time series sequences.
Li, Ying; Shi, Xiaohu; Liang, Yanchun; Xie, Juan; Zhang, Yu; Ma, Qin
2017-01-21
RNAs have been found to carry diverse functionalities in nature. Inferring the similarity between two given RNAs is a fundamental step to understand and interpret their functional relationship. The majority of functional RNAs show conserved secondary structures, rather than sequence conservation. Those algorithms relying on sequence-based features usually have limitations in their prediction performance. Hence, integrating RNA structure features is very critical for RNA analysis. Existing algorithms mainly fall into two categories: alignment-based and alignment-free. The alignment-free algorithms of RNA comparison usually have lower time complexity than alignment-based algorithms. An alignment-free RNA comparison algorithm was proposed, in which novel numerical representations RNA-TVcurve (triple vector curve representation) of RNA sequence and corresponding secondary structure features are provided. Then a multi-scale similarity score of two given RNAs was designed based on wavelet decomposition of their numerical representation. In support of RNA mutation and phylogenetic analysis, a web server (RNA-TVcurve) was designed based on this alignment-free RNA comparison algorithm. It provides three functional modules: 1) visualization of numerical representation of RNA secondary structure; 2) detection of single-point mutation based on secondary structure; and 3) comparison of pairwise and multiple RNA secondary structures. The inputs of the web server require RNA primary sequences, while corresponding secondary structures are optional. For the primary sequences alone, the web server can compute the secondary structures using free energy minimization algorithm in terms of RNAfold tool from Vienna RNA package. RNA-TVcurve is the first integrated web server, based on an alignment-free method, to deliver a suite of RNA analysis functions, including visualization, mutation analysis and multiple RNAs structure comparison. The comparison results with two popular RNA comparison tools, RNApdist and RNAdistance, showcased that RNA-TVcurve can efficiently capture subtle relationships among RNAs for mutation detection and non-coding RNA classification. All the relevant results were shown in an intuitive graphical manner, and can be freely downloaded from this server. RNA-TVcurve, along with test examples and detailed documents, are available at: http://ml.jlu.edu.cn/tvcurve/ .
Community analysis of a full-scale anaerobic bioreactor treating paper mill wastewater.
Roest, Kees; Heilig, Hans G H J; Smidt, Hauke; de Vos, Willem M; Stams, Alfons J M; Akkermans, Antoon D L
2005-03-01
To get insight into the microbial community of an Upflow Anaerobic Sludge Blanket reactor treating paper mill wastewater, conventional microbiological methods were combined with 16S rRNA gene analyses. Particular attention was paid to microorganisms able to degrade propionate or butyrate in the presence or absence of sulphate. Serial enrichment dilutions allowed estimating the number of microorganisms per ml sludge that could use butyrate with or without sulphate (10(5)), propionate without sulphate (10(6)), or propionate and sulphate (10(8)). Quantitative RNA dot-blot hybridisation indicated that Archaea were two-times more abundant in the microbial community of anaerobic sludge than Bacteria. The microbial community composition was further characterised by 16S rRNA-gene-targeted Denaturing Gradient Gel Electrophoresis (DGGE) fingerprinting, and via cloning and sequencing of dominant amplicons from the bacterial and archaeal patterns. Most of the nearly full length (approximately 1.45 kb) bacterial 16S rRNA gene sequences showed less than 97% similarity to sequences present in public databases, in contrast to the archaeal clones (approximately. 1.3 kb) that were highly similar to known sequences. While Methanosaeta was found as the most abundant genus, also Crenarchaeote-relatives were identified. The microbial community was relatively stable over a period of 3 years (samples taken in July 1999, May 2001, March 2002 and June 2002) as indicated by the high similarity index calculated from DGGE profiles (81.9+/-2.7% for Bacteria and 75.1+/-3.1% for Archaea). 16S rRNA gene sequence analysis indicated the presence of unknown and yet uncultured microorganisms, but also showed that known sulphate-reducing bacteria and syntrophic fatty acid-oxidising microorganisms dominated the enrichments.
Therapeutic change in interaction: conversation analysis of a transforming sequence.
Voutilainen, Liisa; Perakyla, Anssi; Ruusuvuori, Johanna
2011-05-01
A process of change within a single case of cognitive-constructivist therapy is analyzed by means of conversation analysis (CA). The focus is on a process of change in the sequences of interaction, which consist of the therapist's conclusion and the patient's response to it. In the conclusions, the therapist investigates and challenges the patient's tendency to transform her feelings of disappointment and anger into self-blame. Over the course of the therapy, the patient's responses to these conclusions are recast: from the patient first rejecting the conclusion, to then being ambivalent, and finally to agreeing with the therapist. On the basis of this case study, we suggest that an analysis that focuses on sequences of talk that are interactionally similar offers a sensitive method to investigate the manifestation of therapeutic change. It is suggested that this line of research can complement assimilation analysis and other methods of analyzing changes in a client's talk.
Sequence-similar, structure-dissimilar protein pairs in the PDB.
Kosloff, Mickey; Kolodny, Rachel
2008-05-01
It is often assumed that in the Protein Data Bank (PDB), two proteins with similar sequences will also have similar structures. Accordingly, it has proved useful to develop subsets of the PDB from which "redundant" structures have been removed, based on a sequence-based criterion for similarity. Similarly, when predicting protein structure using homology modeling, if a template structure for modeling a target sequence is selected by sequence alone, this implicitly assumes that all sequence-similar templates are equivalent. Here, we show that this assumption is often not correct and that standard approaches to create subsets of the PDB can lead to the loss of structurally and functionally important information. We have carried out sequence-based structural superpositions and geometry-based structural alignments of a large number of protein pairs to determine the extent to which sequence similarity ensures structural similarity. We find many examples where two proteins that are similar in sequence have structures that differ significantly from one another. The source of the structural differences usually has a functional basis. The number of such proteins pairs that are identified and the magnitude of the dissimilarity depend on the approach that is used to calculate the differences; in particular sequence-based structure superpositioning will identify a larger number of structurally dissimilar pairs than geometry-based structural alignments. When two sequences can be aligned in a statistically meaningful way, sequence-based structural superpositioning provides a meaningful measure of structural differences. This approach and geometry-based structure alignments reveal somewhat different information and one or the other might be preferable in a given application. Our results suggest that in some cases, notably homology modeling, the common use of nonredundant datasets, culled from the PDB based on sequence, may mask important structural and functional information. We have established a data base of sequence-similar, structurally dissimilar protein pairs that will help address this problem (http://luna.bioc.columbia.edu/rachel/seqsimstrdiff.htm).
Genetic Diversity of Crimean Congo Hemorrhagic Fever Virus Strains from Iran
Chinikar, Sadegh; Bouzari, Saeid; Shokrgozar, Mohammad Ali; Mostafavi, Ehsan; Jalali, Tahmineh; Khakifirouz, Sahar; Nowotny, Norbert; Fooks, Anthony R.; Shah-Hosseini, Nariman
2016-01-01
Background: Crimean Congo hemorrhagic fever virus (CCHFV) is a member of the Bunyaviridae family and Nairovirus genus. It has a negative-sense, single stranded RNA genome approximately 19.2 kb, containing the Small, Medium, and Large segments. CCHFVs are relatively divergent in their genome sequence and grouped in seven distinct clades based on S-segment sequence analysis and six clades based on M-segment sequences. Our aim was to obtain new insights into the molecular epidemiology of CCHFV in Iran. Methods: We analyzed partial and complete nucleotide sequences of the S and M segments derived from 50 Iranian patients. The extracted RNA was amplified using one-step RT-PCR and then sequenced. The sequences were analyzed using Mega5 software. Results: Phylogenetic analysis of partial S segment sequences demonstrated that clade IV-(Asia 1), clade IV-(Asia 2) and clade V-(Europe) accounted for 80 %, 4 % and 14 % of the circulating genomic variants of CCHFV in Iran respectively. However, one of the Iranian strains (Iran-Kerman/22) was associated with none of other sequences and formed a new clade (VII). The phylogenetic analysis of complete S-segment nucleotide sequences from selected Iranian CCHFV strains complemented with representative strains from GenBank revealed similar topology as partial sequences with eight major clusters. A partial M segment phylogeny positioned the Iranian strains in either association with clade III (Asia-Africa) or clade V (Europe). Conclusion: The phylogenetic analysis revealed subtle links between distant geographic locations, which we propose might originate either from international livestock trade or from long-distance carriage of CCHFV by infected ticks via bird migration. PMID:27308271
Myamoto, D T; Pidde-Queiroz, G; Pedroso, A; Gonçalves-de-Andrade, R M; van den Berg, C W; Tambourgi, D V
2016-09-01
A transcriptome analysis of the venom glands of the spider Loxosceles laeta, performed by our group, in a previous study (Fernandes-Pedrosa et al., 2008), revealed a transcript with a sequence similar to the human complement component C3. Here we present the analysis of this transcript. cDNA fragments encoding the C3 homologue (Lox-C3) were amplified from total RNA isolated from the venom glands of L. laeta by RACE-PCR. Lox-C3 is a 5178 bps cDNA sequence encoding a 190kDa protein, with a domain configuration similar to human C3. Multiple alignments of C3-like proteins revealed two processing sites, suggesting that Lox-C3 is composed of three chains. Furthermore, the amino acids consensus sequences for the thioester was found, in addition to putative sequences responsible for FB binding. The phylogenetic analysis showed that Lox-C3 belongs to the same group as two C3 isoforms from the spider Hasarius adansoni (Family Salcitidae), showing 53% homology with these. This is the first characterization of a Loxosceles cDNA sequence encoding a human C3 homologue, and this finding, together with our previous finding of the expression of a FB-like molecule, suggests that this spider species also has a complement system. This work will help to improve our understanding of the innate immune system in these spiders and the ancestral structure of C3. Copyright © 2016 Elsevier GmbH. All rights reserved.
Zhang, Xiujun; Parry, Ronald J.
2007-01-01
The pyrrolomycins are a family of polyketide antibiotics, some of which contain a nitro group. To gain insight into the nitration mechanism associated with the formation of these antibiotics, the pyrrolomycin biosynthetic gene cluster from Actinosporangium vitaminophilum was cloned. Sequencing of ca. 56 kb of A. vitaminophilum DNA revealed 35 open reading frames (ORFs). Sequence analysis revealed a clear relationship between some of these ORFs and the biosynthetic gene cluster for pyoluteorin, a structurally related antibiotic. Since a gene transfer system could not be devised for A. vitaminophilum, additional proof for the identity of the cloned gene cluster was sought by cloning the pyrrolomycin gene cluster from Streptomyces sp. strain UC 11065, a transformable pyrrolomycin producer. Sequencing of ca. 26 kb of UC 11065 DNA revealed the presence of 17 ORFs, 15 of which exhibit strong similarity to ORFs in the A. vitaminophilum cluster as well as a nearly identical organization. Single-crossover disruption of two genes in the UC 11065 cluster abolished pyrrolomycin production in both cases. These results confirm that the genetic locus cloned from UC 11065 is essential for pyrrolomycin production, and they also confirm that the highly similar locus in A. vitaminophilum encodes pyrrolomycin biosynthetic genes. Sequence analysis revealed that both clusters contain genes encoding the two components of an assimilatory nitrate reductase. This finding suggests that nitrite is required for the formation of the nitrated pyrrolomycins. However, sequence analysis did not provide additional insights into the nitration process, suggesting the operation of a novel nitration mechanism. PMID:17158935
Darville, Lancia N F; Merchant, Mark E; Maccha, Venkata; Siddavarapu, Vivekananda Reddy; Hasan, Azeem; Murray, Kermit K
2012-02-01
Mass spectrometry in conjunction with de novo sequencing was used to determine the amino acid sequence of a 35kDa lectin protein isolated from the serum of the American alligator that exhibits binding to mannose. The protein N-terminal sequence was determined using Edman degradation and enzymatic digestion with different proteases was used to generate peptide fragments for analysis by liquid chromatography tandem mass spectrometry (LC MS/MS). Separate analysis of the protein digests with multiple enzymes enhanced the protein sequence coverage. De novo sequencing was accomplished using MASCOT Distiller and PEAKS software and the sequences were searched against the NCBI database using MASCOT and BLAST to identify homologous peptides. MS analysis of the intact protein indicated that it is present primarily as monomer and dimer in vitro. The isolated 35kDa protein was ~98% sequenced and found to have 313 amino acids and nine cysteine residues and was identified as an alligator lectin. The alligator lectin sequence was aligned with other lectin sequences using DIALIGN and ClustalW software and was found to exhibit 58% and 59% similarity to both human and mouse intelectin-1. The alligator lectin exhibited strong binding affinities toward mannan and mannose as compared to other tested carbohydrates. Copyright © 2011 Elsevier Inc. All rights reserved.
Weissella fabaria sp. nov., from a Ghanaian cocoa fermentation.
De Bruyne, Katrien; Camu, Nicholas; De Vuyst, Luc; Vandamme, Peter
2010-09-01
Two lactic acid bacteria, strains 257(T) and 252, were isolated from traditional heap fermentations of Ghanaian cocoa beans. 16S rRNA gene sequence analysis of these strains allocated them to the genus Weissella, showing 99.5 % 16S rRNA gene sequence similarity towards Weissella ghanensis LMG 24286(T). Whole-cell protein electrophoresis, fluorescent amplified fragment length polymorphism fingerprinting of whole genomes and biochemical tests confirmed their unique taxonomic position. DNA-DNA hybridization experiments towards their nearest phylogenetic neighbour demonstrated that the two strains represent a novel species, for which we propose the name Weissella fabaria sp. nov., with strain 257(T) (=LMG 24289(T) =DSM 21416(T)) as the type strain. Additional sequence analysis using pheS gene sequences proved useful for identification of all Weissella-Leuconostoc-Oenococcus species and for the recognition of the novel species.
Zemla, Adam T; Lang, Dorothy M; Kostova, Tanya; Andino, Raul; Ecale Zhou, Carol L
2011-06-02
Most of the currently used methods for protein function prediction rely on sequence-based comparisons between a query protein and those for which a functional annotation is provided. A serious limitation of sequence similarity-based approaches for identifying residue conservation among proteins is the low confidence in assigning residue-residue correspondences among proteins when the level of sequence identity between the compared proteins is poor. Multiple sequence alignment methods are more satisfactory--still, they cannot provide reliable results at low levels of sequence identity. Our goal in the current work was to develop an algorithm that could help overcome these difficulties by facilitating the identification of structurally (and possibly functionally) relevant residue-residue correspondences between compared protein structures. Here we present StralSV (structure-alignment sequence variability), a new algorithm for detecting closely related structure fragments and quantifying residue frequency from tight local structure alignments. We apply StralSV in a study of the RNA-dependent RNA polymerase of poliovirus, and we demonstrate that the algorithm can be used to determine regions of the protein that are relatively unique, or that share structural similarity with proteins that would be considered distantly related. By quantifying residue frequencies among many residue-residue pairs extracted from local structural alignments, one can infer potential structural or functional importance of specific residues that are determined to be highly conserved or that deviate from a consensus. We further demonstrate that considerable detailed structural and phylogenetic information can be derived from StralSV analyses. StralSV is a new structure-based algorithm for identifying and aligning structure fragments that have similarity to a reference protein. StralSV analysis can be used to quantify residue-residue correspondences and identify residues that may be of particular structural or functional importance, as well as unusual or unexpected residues at a given sequence position. StralSV is provided as a web service at http://proteinmodel.org/AS2TS/STRALSV/.
Litwin, Christine M.; Byrne, Burke L.
1998-01-01
Vibrio vulnificus is a halophilic, marine pathogen that has been associated with septicemia and serious wound infections in patients with iron overload and preexisting liver disease. For V. vulnificus, the ability to acquire iron from the host has been shown to correlate with virulence. V. vulnificus is able to use host iron sources such as hemoglobin and heme. We previously constructed a fur mutant of V. vulnificus which constitutively expresses at least two iron-regulated outer membrane proteins, of 72 and 77 kDa. The N-terminal amino acid sequence of the 77-kDa protein purified from the V. vulnificus fur mutant had 67% homology with the first 15 amino acids of the mature protein of the Vibrio cholerae heme receptor, HutA. In this report, we describe the cloning, DNA sequence, mutagenesis, and analysis of transcriptional regulation of the structural gene for HupA, the heme receptor of V. vulnificus. DNA sequencing of hupA demonstrated a single open reading frame of 712 amino acids that was 50% identical and 66% similar to the sequence of V. cholerae HutA and similar to those of other TonB-dependent outer membrane receptors. Primer extension analysis localized one promoter for the V. vulnificus hupA gene. Analysis of the promoter region of V. vulnificus hupA showed a sequence homologous to the consensus Fur box. Northern blot analysis showed that the transcript was strongly regulated by iron. An internal deletion in the V. vulnificus hupA gene, done by using marker exchange, resulted in the loss of expression of the 77-kDa protein and the loss of the ability to use hemin or hemoglobin as a source of iron. The hupA deletion mutant of V. vulnificus will be helpful in future studies of the role of heme iron in V. vulnificus pathogenesis. PMID:9632577
Genome analysis and identification of gelatinase encoded gene in Enterobacter aerogenes
NASA Astrophysics Data System (ADS)
Shahimi, Safiyyah; Mutalib, Sahilah Abdul; Khalid, Rozida Abdul; Repin, Rul Aisyah Mat; Lamri, Mohd Fadly; Bakar, Mohd Faizal Abu; Isa, Mohd Noor Mat
2016-11-01
In this study, bioinformatic analysis towards genome sequence of E. aerogenes was done to determine gene encoded for gelatinase. Enterobacter aerogenes was isolated from hot spring water and gelatinase species-specific bacterium to porcine and fish gelatin. This bacterium offers the possibility of enzymes production which is specific to both species gelatine, respectively. Enterobacter aerogenes was partially genome sequenced resulting in 5.0 mega basepair (Mbp) total size of sequence. From pre-process pipeline, 87.6 Mbp of total reads, 68.8 Mbp of total high quality reads and 78.58 percent of high quality percentage was determined. Genome assembly produced 120 contigs with 67.5% of contigs over 1 kilo base pair (kbp), 124856 bp of N50 contig length and 55.17 % of GC base content percentage. About 4705 protein gene was identified from protein prediction analysis. Two candidate genes selected have highest similarity identity percentage against gelatinase enzyme available in Swiss-Prot and NCBI online database. They were NODE_9_length_26866_cov_148.013245_12 containing 1029 base pair (bp) sequence with 342 amino acid sequence and NODE_24_length_155103_cov_177.082458_62 which containing 717 bp sequence with 238 amino acid sequence, respectively. Thus, two paired of primers (forward and reverse) were designed, based on the open reading frame (ORF) of selected genes. Genome analysis of E. aerogenes resulting genes encoded gelatinase were identified.
Genomic and molecular analysis of phage CMP1 from Clavibacter michiganensis subspecies michiganensis
Wittmann, Johannes; Gartemann, Karl-Heinz; Eichenlaub, Rudolf
2011-01-01
Bacteriophage CMP1 is a member of the Siphoviridae family that infects specifically the plant-pathogen Clavibacter michiganensis subsp. michiganensis. The linear double- stranded DNA is terminally redundant and not circularly permuted. The complete nucleotide sequence of the bacteriophage CMP1 genome consists of 58,652 bp including the terminal redundant ends of 791 bp. The G+C content of the phage (57%) is significantly lower than that of its host (72.66%). 74 potential open reading frames were identified and annotated by different bioinformatic tools. Two large clusters which encode the early and the late functions could be identified which are divergently transcribed. There are only a few hypothetical gene products with conserved domains and significant similarity to sequences from the databases. Functional analyses confirmed the activity of four gene products, an endonuclease, an exonuclease, a single-stranded DNA binding protein and a thymidylate synthase. Partial genomic sequences of CN77, a phage of Clavibacter michiganensis subsp. nebraskensis, revealed a similar genome structure and significant similarities on the level of deduced amino acid sequences. An endolysin with peptidase activity has been identified for both phages, which may be good tools for disease control of tomato plants against Clavibacter infections. PMID:21687530
Wittmann, Johannes; Gartemann, Karl-Heinz; Eichenlaub, Rudolf; Dreiseikelmann, Brigitte
2011-01-01
Bacteriophage CMP1 is a member of the Siphoviridae family that infects specifically the plant-pathogen Clavibacter michiganensis subsp. michiganensis. The linear double- stranded DNA is terminally redundant and not circularly permuted. The complete nucleotide sequence of the bacteriophage CMP1 genome consists of 58,652 bp including the terminal redundant ends of 791 bp. The G+C content of the phage (57%) is significantly lower than that of its host (72.66%). 74 potential open reading frames were identified and annotated by different bioinformatic tools. Two large clusters which encode the early and the late functions could be identified which are divergently transcribed. There are only a few hypothetical gene products with conserved domains and significant similarity to sequences from the databases. Functional analyses confirmed the activity of four gene products, an endonuclease, an exonuclease, a single-stranded DNA binding protein and a thymidylate synthase. Partial genomic sequences of CN77, a phage of Clavibacter michiganensis subsp. nebraskensis, revealed a similar genome structure and significant similarities on the level of deduced amino acid sequences. An endolysin with peptidase activity has been identified for both phages, which may be good tools for disease control of tomato plants against Clavibacter infections.
Shotgun metagenomic data streams: surfing without fear
DOE Office of Scientific and Technical Information (OSTI.GOV)
Berendzen, Joel R
2010-12-06
Timely information about bio-threat prevalence, consequence, propagation, attribution, and mitigation is needed to support decision-making, both routinely and in a crisis. One DNA sequencer can stream 25 Gbp of information per day, but sampling strategies and analysis techniques are needed to turn raw sequencing power into actionable knowledge. Shotgun metagenomics can enable biosurveillance at the level of a single city, hospital, or airplane. Metagenomics characterizes viruses and bacteria from complex environments such as soil, air filters, or sewage. Unlike targeted-primer-based sequencing, shotgun methods are not blind to sequences that are truly novel, and they can measure absolute prevalence. Shotgun metagenomicmore » sampling can be non-invasive, efficient, and inexpensive while being informative. We have developed analysis techniques for shotgun metagenomic sequencing that rely upon phylogenetic signature patterns. They work by indexing local sequence patterns in a manner similar to web search engines. Our methods are laptop-fast and favorable scaling properties ensure they will be sustainable as sequencing methods grow. We show examples of application to soil metagenomic samples.« less
Proels, Reinhard K; Roitsch, Thomas
2006-03-01
Very few CACTA transposon-like sequences have been described in Solanaceae species. Sequence information has been restricted to partial transposase (TPase)-like fragments, and no target gene of CACTA-like transposon insertion has been described in tomato to date. In this manuscript, we report on a CACTA transposon-like insertion in intron I of tomato (Lycopersicon esculentum) invertase gene Lin5 and TPase-like sequences of several Solanaceae species. Consensus primers deduced from the TPase region of the tomato CACTA transposon-like element allowed the amplification of similar sequences from various Solanaceae species of different subfamilies including Solaneae (Solanum tuberosum), Cestreae (Nicotiana tabacum) and Datureae (Datura stramonium). This demonstrates the ubiquitous presence of CACTA-like elements in Solanaceae genomes. The obtained partial sequences are highly conserved, and allow further detection and detailed analysis of CACTA-like transposons throughout Solanaceae species. CACTA-like transposon sequences make possible the evaluation of their use for genome analysis, functional studies of genes and the evolutionary relationships between plant species.
Bondre, Vijay P; Sankararaman, Vasudha; Andhare, Vijaysinh; Tupekar, Manisha; Sapkal, Gajanan N
2016-11-01
Human herpes simplex virus 1 (HSV-1) is the most common cause of sporadic encephalitis in humans that contributes to >10 per cent of the encephalitis cases occurring worldwide. Availability of limited full genome sequences from a small number of isolates resulted in poor understanding of host and viral factors responsible for variable clinical outcome. In this study genetic relationship, extent and source of recombination using full-length genome sequence derived from a newly isolated HSV-1 isolate was studied in comparison with those sampled from patients with varied clinical outcome. Full genome sequence of HSV-1 isolated from cerebrospinal fluid (CSF) of a patient with acute encephalitis syndrome (AES) by inoculation in baby hamster kidney-21 (BHK-21) cells was determined using next-generation sequencing (NGS) technology. Phylogenetic analysis of the newly generated sequence in comparison with 33 additional full-length genomes defined genetic relationship with worldwide distributed strains. The bootscan and similarity plot analysis defined recombination crossovers and similarities between newly isolated Indian HSV-1 with six Asian and a total of 34 worldwide isolated strains. Mapping of 376,332 reads amplified from HSV-1 DNA by NGS generated full-length genome of 151,024 bp from newly isolated Indian HSV-1. Phylogenetic analysis classified worldwide distributed strains into three major evolutionary lineages correlating to their geographic distribution. Lineage 1 containing strains were isolated from America and Europe; lineage 2 contained all the strains from Asian countries along with the North American KOS and RE strains whereas the South African isolates were distributed into two groups under lineage 3. Recombination analysis confirmed events of recombination in Indian HSV-1 genome resulting from mixing of different strains evolved in Asian countries. Our results showed that the full-length genome sequence generated from an Indian HSV-1 isolate shared close genetic relationship with the American KOS and Chinese CR38 strains which belonged to the Asian genetic lineage. Recombination analysis of Indian isolate demonstrated multiple recombination crossover points throughout the genome. This full-length genome sequence amplified from the Indian isolate would be helpful to study HSV evolution, genetic basis of differential pathogenesis, host-virus interactions and viral factors contributing towards differential clinical outcome in human infections.
Bondre, Vijay P.; Sankararaman, Vasudha; Andhare, Vijaysinh; Tupekar, Manisha; Sapkal, Gajanan N.
2016-01-01
Background & objectives: Human herpes simplex virus 1 (HSV-1) is the most common cause of sporadic encephalitis in humans that contributes to >10 per cent of the encephalitis cases occurring worldwide. Availability of limited full genome sequences from a small number of isolates resulted in poor understanding of host and viral factors responsible for variable clinical outcome. In this study genetic relationship, extent and source of recombination using full-length genome sequence derived from a newly isolated HSV-1 isolate was studied in comparison with those sampled from patients with varied clinical outcome. Methods: Full genome sequence of HSV-1 isolated from cerebrospinal fluid (CSF) of a patient with acute encephalitis syndrome (AES) by inoculation in baby hamster kidney-21 (BHK-21) cells was determined using next-generation sequencing (NGS) technology. Phylogenetic analysis of the newly generated sequence in comparison with 33 additional full-length genomes defined genetic relationship with worldwide distributed strains. The bootscan and similarity plot analysis defined recombination crossovers and similarities between newly isolated Indian HSV-1 with six Asian and a total of 34 worldwide isolated strains. Results: Mapping of 376,332 reads amplified from HSV-1 DNA by NGS generated full-length genome of 151,024 bp from newly isolated Indian HSV-1. Phylogenetic analysis classified worldwide distributed strains into three major evolutionary lineages correlating to their geographic distribution. Lineage 1 containing strains were isolated from America and Europe; lineage 2 contained all the strains from Asian countries along with the North American KOS and RE strains whereas the South African isolates were distributed into two groups under lineage 3. Recombination analysis confirmed events of recombination in Indian HSV-1 genome resulting from mixing of different strains evolved in Asian countries. Interpretation & conclusions: Our results showed that the full-length genome sequence generated from an Indian HSV-1 isolate shared close genetic relationship with the American KOS and Chinese CR38 strains which belonged to the Asian genetic lineage. Recombination analysis of Indian isolate demonstrated multiple recombination crossover points throughout the genome. This full-length genome sequence amplified from the Indian isolate would be helpful to study HSV evolution, genetic basis of differential pathogenesis, host-virus interactions and viral factors contributing towards differential clinical outcome in human infections. PMID:28361829
The Swiss-Army-Knife Approach to the Nearly Automatic Analysis for Microearthquake Sequences.
NASA Astrophysics Data System (ADS)
Kraft, T.; Simon, V.; Tormann, T.; Diehl, T.; Herrmann, M.
2017-12-01
Many Swiss earthquake sequence have been studied using relative location techniques, which often allowed to constrain the active fault planes and shed light on the tectonic processes that drove the seismicity. Yet, in the majority of cases the number of located earthquakes was too small to infer the details of the space-time evolution of the sequences, or their statistical properties. Therefore, it has mostly been impossible to resolve clear patterns in the seismicity of individual sequences, which are needed to improve our understanding of the mechanisms behind them. Here we present a nearly automatic workflow that combines well-established seismological analysis techniques and allows to significantly improve the completeness of detected and located earthquakes of a sequence. We start from the manually timed routine catalog of the Swiss Seismological Service (SED), which contains the larger events of a sequence. From these well-analyzed earthquakes we dynamically assemble a template set and perform a matched filter analysis on the station with: the best SNR for the sequence; and a recording history of at least 10-15 years, our typical analysis period. This usually allows us to detect events several orders of magnitude below the SED catalog detection threshold. The waveform similarity of the events is then further exploited to derive accurate and consistent magnitudes. The enhanced catalog is then analyzed statistically to derive high-resolution time-lines of the a- and b-value and consequently the occurrence probability of larger events. Many of the detected events are strong enough to be located using double-differences. No further manual interaction is needed; we simply time-shift the arrival-time pattern of the detecting template to the associated detection. Waveform similarity assures a good approximation of the expected arrival-times, which we use to calculate event-pair arrival-time differences by cross correlation. After a SNR and cycle-skipping quality check these are directly fed into hypoDD. Using this procedure we usually improve the number of well-relocated events by a factor 2-5. We demonstrate the successful application of the workflow at the example of natural sequences in Switzerland and present first results of the advanced analysis the was possible with the enhanced catalogs.
A simple procedure for parallel sequence analysis of both strands of 5'-labeled DNA.
Razvi, F; Gargiulo, G; Worcel, A
1983-08-01
Ligation of a 5'-labeled DNA restriction fragment results in a circular DNA molecule carrying the two 32Ps at the reformed restriction site. Double digestions of the circular DNA with the original enzyme and a second restriction enzyme cleavage near the labeled site allows direct chemical sequencing of one 5'-labeled DNA strand. Similar double digestions, using an isoschizomer that cleaves differently at the 32P-labeled site, allows direct sequencing of the now 3'-labeled complementary DNA strand. It is possible to directly sequence both strands of cloned DNA inserts by using the above protocol and a multiple cloning site vector that provides the necessary restriction sites. The simultaneous and parallel visualization of both DNA strands eliminates sequence ambiguities. In addition, the labeled circular molecules are particularly useful for single-hit DNA cleavage studies and DNA footprint analysis. As an example, we show here an analysis of the micrococcal nuclease-induced breaks on the two strands of the somatic 5S RNA gene of Xenopus borealis, which suggests that the enzyme may recognize and cleave small AT-containing palindromes along the DNA helix.
Wu, Zongfu; Wang, Weixue; Tang, Min; Shao, Jing; Dai, Chen; Zhang, Wei; Fan, Hongjie; Yao, Huochun; Zong, Jie; Chen, Dai; Wang, Junning; Lu, Chengping
2014-02-10
Streptococcus suis (SS) is an important swine pathogen worldwide that occasionally causes serious infections in humans. SS infection may result in meningitis in pigs and humans. The pathogenic mechanisms of SS are poorly understood. Here, we provide the complete genome sequence of S. suis serotype 2 (SS2) strain SC070731 isolated from a pig with meningitis. The chromosome is 2,138,568bp in length. There are 1933 predicted protein coding sequences and 96.7% (57/59) of the known virulence-associated genes are present in the genome. Strain SC070731 showed similar virulence with SS2 virulent strains HA9801 and ZY05719, but was more virulent than SS2 virulent strain P1/7 in the zebrafish infection model. Comparative genomic analysis revealed a unique 105K genomic island in strain SC070731 that is absent in seven other sequenced SS2 strains. Further analysis of the 105K genomic island indicated that it contained a complete nisin locus similar to the nisin U locus in S. uberis strain 42, a prophage similar to S. oralis phage PH10 and several antibiotic resistance genes. Several proteins in the 105K genomic island, including nisin and RelBE toxin-antitoxin system, contribute to the bacterial fitness and virulence in other pathogenic bacteria. Further investigation of newly identified gene products, including four putative new virulence-associated surface proteins, will improve our understanding of SS pathogenesis. Copyright © 2013 Elsevier B.V. All rights reserved.
Species classifier choice is a key consideration when analysing low-complexity food microbiome data.
Walsh, Aaron M; Crispie, Fiona; O'Sullivan, Orla; Finnegan, Laura; Claesson, Marcus J; Cotter, Paul D
2018-03-20
The use of shotgun metagenomics to analyse low-complexity microbial communities in foods has the potential to be of considerable fundamental and applied value. However, there is currently no consensus with respect to choice of species classification tool, platform, or sequencing depth. Here, we benchmarked the performances of three high-throughput short-read sequencing platforms, the Illumina MiSeq, NextSeq 500, and Ion Proton, for shotgun metagenomics of food microbiota. Briefly, we sequenced six kefir DNA samples and a mock community DNA sample, the latter constructed by evenly mixing genomic DNA from 13 food-related bacterial species. A variety of bioinformatic tools were used to analyse the data generated, and the effects of sequencing depth on these analyses were tested by randomly subsampling reads. Compositional analysis results were consistent between the platforms at divergent sequencing depths. However, we observed pronounced differences in the predictions from species classification tools. Indeed, PERMANOVA indicated that there was no significant differences between the compositional results generated by the different sequencers (p = 0.693, R 2 = 0.011), but there was a significant difference between the results predicted by the species classifiers (p = 0.01, R 2 = 0.127). The relative abundances predicted by the classifiers, apart from MetaPhlAn2, were apparently biased by reference genome sizes. Additionally, we observed varying false-positive rates among the classifiers. MetaPhlAn2 had the lowest false-positive rate, whereas SLIMM had the greatest false-positive rate. Strain-level analysis results were also similar across platforms. Each platform correctly identified the strains present in the mock community, but accuracy was improved slightly with greater sequencing depth. Notably, PanPhlAn detected the dominant strains in each kefir sample above 500,000 reads per sample. Again, the outputs from functional profiling analysis using SUPER-FOCUS were generally accordant between the platforms at different sequencing depths. Finally, and expectedly, metagenome assembly completeness was significantly lower on the MiSeq than either on the NextSeq (p = 0.03) or the Proton (p = 0.011), and it improved with increased sequencing depth. Our results demonstrate a remarkable similarity in the results generated by the three sequencing platforms at different sequencing depths, and, in fact, the choice of bioinformatics methodology had a more evident impact on results than the choice of sequencer did.
Behera, Bijay Kumar; Baisvar, Vishwamitra Singh; Kumari, Kavita; Rout, Ajaya Kumar; Pakrashi, Sudip; Paria, Prasenjet; Rao, A R; Rai, Anil
2017-03-01
In the present study, the complete mitochondrial genome sequence of Anabas testudineusis reported using PGM sequencer (Ion Torrent, Life Technologies, La Jolla, CA). The complete mitogenome of climbing perch, A. testudineusis obtained by the de novo sequences assembly of genomic reads using the Torrent Mapping Alignment Program (TMAP), which is 16 603 bp in length. The mitogenome of A. testudineus composed of 13 protein- coding genes, two rRNA, and 22 tRNAs. Here, 20 tRNAs genes showed typical clover leaf model, and D-Loop as the control region along with gene order and organization, being closely similar to Osphronemidae and most of other Perciformes fish mitogenomes of NCBI databases. The mitogenome in the present study has 99% similarity to the complete mitogenome sequence of earlier reported A. testudineus. The phylogenetic analysis of Anabantidae depicted that their mitogenomes are closely related to each other. The complete mitogenome sequence of A. testudineus would be helpful in understanding the population genetics, phylogenetics, and evolution of Anabantidae.
Villacreses, Javier; Rojas-Herrera, Marcelo; Sánchez, Carolina; Hewstone, Nicole; Undurraga, Soledad F.; Alzate, Juan F.; Manque, Patricio; Maracaja-Coutinho, Vinicius; Polanco, Victor
2015-01-01
Here, we report the genome sequence and evidence for transcriptional activity of a virus-like element in the native Chilean berry tree Aristotelia chilensis. We propose to name the endogenous sequence as Aristotelia chilensis Virus 1 (AcV1). High-throughput sequencing of the genome of this tree uncovered an endogenous viral element, with a size of 7122 bp, corresponding to the complete genome of AcV1. Its sequence contains three open reading frames (ORFs): ORFs 1 and 2 shares 66%–73% amino acid similarity with members of the Caulimoviridae virus family, especially the Petunia vein clearing virus (PVCV), Petuvirus genus. ORF1 encodes a movement protein (MP); ORF2 a Reverse Transcriptase (RT) and a Ribonuclease H (RNase H) domain; and ORF3 showed no amino acid sequence similarity with any other known virus proteins. Analogous to other known endogenous pararetrovirus sequences (EPRVs), AcV1 is integrated in the genome of Maqui Berry and showed low viral transcriptional activity, which was detected by deep sequencing technology (DNA and RNA-seq). Phylogenetic analysis of AcV1 and other pararetroviruses revealed a closer resemblance with Petuvirus. Overall, our data suggests that AcV1 could be a new member of Caulimoviridae family, genus Petuvirus, and the first evidence of this kind of virus in a fruit plant. PMID:25855242
Angly, Florent E; Willner, Dana; Prieto-Davó, Alejandra; Edwards, Robert A; Schmieder, Robert; Vega-Thurber, Rebecca; Antonopoulos, Dionysios A; Barott, Katie; Cottrell, Matthew T; Desnues, Christelle; Dinsdale, Elizabeth A; Furlan, Mike; Haynes, Matthew; Henn, Matthew R; Hu, Yongfei; Kirchman, David L; McDole, Tracey; McPherson, John D; Meyer, Folker; Miller, R Michael; Mundt, Egbert; Naviaux, Robert K; Rodriguez-Mueller, Beltran; Stevens, Rick; Wegley, Linda; Zhang, Lixin; Zhu, Baoli; Rohwer, Forest
2009-12-01
Metagenomic studies characterize both the composition and diversity of uncultured viral and microbial communities. BLAST-based comparisons have typically been used for such analyses; however, sampling biases, high percentages of unknown sequences, and the use of arbitrary thresholds to find significant similarities can decrease the accuracy and validity of estimates. Here, we present Genome relative Abundance and Average Size (GAAS), a complete software package that provides improved estimates of community composition and average genome length for metagenomes in both textual and graphical formats. GAAS implements a novel methodology to control for sampling bias via length normalization, to adjust for multiple BLAST similarities by similarity weighting, and to select significant similarities using relative alignment lengths. In benchmark tests, the GAAS method was robust to both high percentages of unknown sequences and to variations in metagenomic sequence read lengths. Re-analysis of the Sargasso Sea virome using GAAS indicated that standard methodologies for metagenomic analysis may dramatically underestimate the abundance and importance of organisms with small genomes in environmental systems. Using GAAS, we conducted a meta-analysis of microbial and viral average genome lengths in over 150 metagenomes from four biomes to determine whether genome lengths vary consistently between and within biomes, and between microbial and viral communities from the same environment. Significant differences between biomes and within aquatic sub-biomes (oceans, hypersaline systems, freshwater, and microbialites) suggested that average genome length is a fundamental property of environments driven by factors at the sub-biome level. The behavior of paired viral and microbial metagenomes from the same environment indicated that microbial and viral average genome sizes are independent of each other, but indicative of community responses to stressors and environmental conditions.
Li, Hong; Guan, Rui; Sun, Jinghua; Hou, Benxiang
2014-10-01
The entire microbial population and predominant microflora of root canals (RCs) and adjacent periodontal pockets (PPs) from teeth with combined periodontal-endodontic lesions were determined and compared. Pooled RC and PP samples were collected from the molars of 20 patients diagnosed with combined periodontal-endodontic lesions. DNA was extracted for polymerase chain reaction-based denaturing gradient gel electrophoresis (PCR-DGGE), cloning, and sequence analysis. A coefficient of similarity (Cs) was used to determine the similarity of the bacterial profiles from RCs and PPs. Significantly fewer bands were produced by PCR-DGGE from RCs (5.9 ± 1.7) than from PPs (8.0 ± 1.8) (P <0.001). The average Cs of the RC and PP samples was 93.81% ± 10.26%. Overall, 60 genera/species were identified by sequencing. Of these, the predominant genera in RCs were Porphyromonas sp. (13.9%), Filifactor sp. (12.5%), and Parvimonas sp. (11.1%), similar to the genera obtained from PP samples. In total, 43 genera/species were common to the RC and PP samples. The most prevalent bacteria in both the RC and PP samples were (in descending order) Filifactor alocis, Parvimonas micra, Porphyromonas gingivalis, and Tannerella forsythia. The high similarity in the sets of organisms present in both RC and PP samples in this study suggests that the pocket could be a source of RC infection. The data also demonstrate that combined periodontal-endodontic lesions consist of a diverse and complex microbial community.
Wittmann-Liebold, B; Geissler, A W; Lin, A; Wool, I G
1979-01-01
The sequence of the amino-terminal region of eleven rat liver ribosomal proteins--S4, S6, S8, L6, L7a, L18, L27, L30, L37a, and L39--was determined. The analysis confirmed the homogeneity of the proteins and suggests that they are unique, since no extensive common sequences were found. The N-terminal regions of the rat liver proteins were compared with amino acid sequences in Saccharomyces cerevisiae and in Escherichia coli ribosomal proteins. It seems likely that the proteins L37 from rat liver and Y55 from yeast ribosomes are homologous. It is possible that rat liver L7a or L37a or both are related to S cerevisiae Y44, although the similar sequences are at the amino-terminus of the rat liver proteins and in an internal region of Y44. A number of similarities in the sequences of rat liver and E coli ribosomal proteins have been found; however, it is not yet possible to say whether they connote a common ancestry.
NaderiSoorki, Maryam; Galehdari, Hamid; Baradaran, Masomeh; Jalali, Amir
2016-09-15
Scorpion venom contains mixture of biologic molecules including selective toxins with medical capability. Odonthubuthus doriae (O. doriae) belonged to Buthidae family of scorpions and gained more interest among Iranian dangerous scorpion since 2005. We constructed the first cDNA library to explore the transcriptomic composition of this Iranian scorpiontelson. Then by used of bioinformatic software each expression sequence taq (EST) from the library analyzed and its quiddity was clear. Analysis showed that toxins (42%) had more venom transcript than other component such as antimicrobial peptides, venom peptides and cell proteins. Over 16% of transcripts didn't have any open reading frames (ORF), however their sequences showed similarity by other scorpion sequences. One EST didn't have any similarity by known scorpion peptides. For the first time; we report a comprehensive study of an Iranian scorpion with interesting and novel findings. We characterized a new putative sodium channel modifier in scorpions by some bioinformatics software, and then predicted its structure and function. Copyright © 2016. Published by Elsevier Ltd.
Nagamine, Claude M; Shen, Zeli; Luong, Richard H; McKeon, Gabriel P; Ruby, Norman F; Fox, James G
2015-05-01
We report the isolation of a novel helicobacter isolated from the caecum of the Siberian hamster (Phodopus sungorus). Sequence analysis showed 97% sequence similarity to Helicobacter ganmani. In addition, we report the co-infection of these Siberian hamsters with a Campylobacter sp. and a second Helicobacter sp. with 99% sequence similarity to Helicobacter sp. flexispira taxon 8 (Helicobacter bilis), a species isolated previously from patients with bacteraemia. Gross necropsy and histopathology did not reveal any overt pathological lesions of the liver and gastrointestinal tract that could be attributed to the Helicobacter or Campylobacter spp. infections. This is the first helicobacter to be identified in the Siberian hamster and the first report of co-infection of Helicobacter spp. and Campylobacter sp. in asymptomatic Siberian hamsters. © 2015 The Authors.
Shen, Zeli; Luong, Richard H.; McKeon, Gabriel P.; Ruby, Norman F.; Fox, James G.
2015-01-01
We report the isolation of a novel helicobacter isolated from the caecum of the Siberian hamster (Phodopus sungorus). Sequence analysis showed 97 % sequence similarity to Helicobacter ganmani. In addition, we report the co-infection of these Siberian hamsters with a Campylobacter sp. and a second Helicobacter sp. with 99 % sequence similarity to Helicobacter sp. flexispira taxon 8 (Helicobacter bilis), a species isolated previously from patients with bacteraemia. Gross necropsy and histopathology did not reveal any overt pathological lesions of the liver and gastrointestinal tract that could be attributed to the Helicobacter or Campylobacter spp. infections. This is the first helicobacter to be identified in the Siberian hamster and the first report of co-infection of Helicobacter spp. and Campylobacter sp. in asymptomatic Siberian hamsters. PMID:25752854
Sharma, Monika; Devi, Kangjam Rekha; Sehgal, Rakesh; Narain, Kanwar; Mahanta, Jagadish; Malla, Nancy
2014-01-01
Taenia solium taeniasis/cysticercosis is a major public health problem in developing countries. This study reports genotypic analysis of T. solium cysticerci collected from two different endemic areas of North (Chandigarh) and North East India (Dibrugarh) by the sequencing of mitochondrial cytochrome c oxidase subunit 1 (cox1) gene. The variation in cox1 sequences of samples collected from these two different geographical regions located at a distance of 2585 km was minimal. Alignment of the nucleotide sequences with different species of Taenia showed the similarity with Asian genotype of T. solium. Among 50 isolates, 6 variant nucleotide positions (0.37% of total length) were detected. These results suggest that population in these geographical areas are homogenous. Copyright © 2013 Elsevier B.V. All rights reserved.
Mayer, Jens; Tsangaras, Kyriakos; Heeger, Felix; Avila-Arcos, María; Stenglein, Mark D; Chen, Wei; Sun, Wei; Mazzoni, Camila J; Osterrieder, Nikolaus; Greenwood, Alex D
2013-08-15
Transcriptome analysis of polar bears (Ursus maritimus) yielded sequences with highest similarity to the human endogenous retrovirus group HERV-K(HML-2). Further analysis of the polar bear draft genome identified an endogenous betaretrovirus group comprising 26 proviral copies and 231 solo LTRs. Molecular dating indicates the group originated before the divergence of bears from a common ancestor but is not present in all carnivores. Closely related sequences were identified in the giant panda (Ailuropoda melanoleuca) and characterized from its genome. We have designated the polar bear and giant panda sequences U. maritimus endogenous retrovirus (UmaERV) and A. melanoleuca endogenous retrovirus (AmeERV), respectively. Phylogenetic analysis demonstrated that the bear virus group is nested within the HERV-K supergroup among bovine and bat endogenous retroviruses suggesting a complex evolutionary history within the HERV-K group. All individual remnants of proviral sequences contain numerous frameshifts and stop codons and thus, the virus is likely non-infectious. Copyright © 2013 Elsevier Inc. All rights reserved.
Mayer, Jens; Tsangaras, Kyriakos; Heeger, Felix; Ávila-Arcos, Maria; Stenglein, Mark D.; Chen, Wei; Sun, Wei; Mazzoni, Camila; Osterrieder, Nikolaus; Greenwood, Alex D.
2013-01-01
Transcriptome analysis of polar bears (Ursus maritimus) yielded sequences with highest similarity to the human endogenous retrovirus group HERV-K(HML-2). Further analysis of the polar bear draft genome identified an endogenous betaretrovirus group comprising 26 proviral copies and 231 solo LTRs. Molecular dating indicates the group originated before the divergence of bears from a common ancestor but is not present in all carnivores. Closely related sequences were identified in the giant panda (Ailuropoda melanoleuca) and characterized from its genome. We have designated the polar bear and giant panda sequences Ursus maritimus endogenous retrovirus (UmaERV) and Ailuropoda melanoleuca endogenous retrovirus (AmeERV), respectively. Phylogenetic analysis demonstrated that the bear virus group is nested within the HERV-K supergroup among bovine and bat endogenous retroviruses suggesting a complex evolutionary history within the HERV-K group. All individual remnants of proviral sequences contain numerous frameshifts and stop codons and thus, the virus is likely non-infectious. PMID:23725819
Analysis of expressed sequence tags generated from full-length enriched cDNA libraries of melon
2011-01-01
Background Melon (Cucumis melo), an economically important vegetable crop, belongs to the Cucurbitaceae family which includes several other important crops such as watermelon, cucumber, and pumpkin. It has served as a model system for sex determination and vascular biology studies. However, genomic resources currently available for melon are limited. Result We constructed eleven full-length enriched and four standard cDNA libraries from fruits, flowers, leaves, roots, cotyledons, and calluses of four different melon genotypes, and generated 71,577 and 22,179 ESTs from full-length enriched and standard cDNA libraries, respectively. These ESTs, together with ~35,000 ESTs available in public domains, were assembled into 24,444 unigenes, which were extensively annotated by comparing their sequences to different protein and functional domain databases, assigning them Gene Ontology (GO) terms, and mapping them onto metabolic pathways. Comparative analysis of melon unigenes and other plant genomes revealed that 75% to 85% of melon unigenes had homologs in other dicot plants, while approximately 70% had homologs in monocot plants. The analysis also identified 6,972 gene families that were conserved across dicot and monocot plants, and 181, 1,192, and 220 gene families specific to fleshy fruit-bearing plants, the Cucurbitaceae family, and melon, respectively. Digital expression analysis identified a total of 175 tissue-specific genes, which provides a valuable gene sequence resource for future genomics and functional studies. Furthermore, we identified 4,068 simple sequence repeats (SSRs) and 3,073 single nucleotide polymorphisms (SNPs) in the melon EST collection. Finally, we obtained a total of 1,382 melon full-length transcripts through the analysis of full-length enriched cDNA clones that were sequenced from both ends. Analysis of these full-length transcripts indicated that sizes of melon 5' and 3' UTRs were similar to those of tomato, but longer than many other dicot plants. Codon usages of melon full-length transcripts were largely similar to those of Arabidopsis coding sequences. Conclusion The collection of melon ESTs generated from full-length enriched and standard cDNA libraries is expected to play significant roles in annotating the melon genome. The ESTs and associated analysis results will be useful resources for gene discovery, functional analysis, marker-assisted breeding of melon and closely related species, comparative genomic studies and for gaining insights into gene expression patterns. PMID:21599934
Azab, Marwa Mohamed; Fayyad, Dalia Mukhtar
2018-01-01
The use of high throughput next generation technologies has allowed more comprehensive analysis than traditional Sanger sequencing. The specific aim of this study was to investigate the microbial diversity of primary endodontic infections using Illumina MiSeq sequencing platform in Egyptian patients. Samples were collected from 19 patients in Suez Canal University Hospital (Endodontic Department) using sterile # 15K file and paper points. DNA was extracted using Mo Bio power soil DNA isolation extraction kit followed by PCR amplification and agarose gel electrophoresis. The microbiome was characterized on the basis of the V3 and V4 hypervariable region of the 16S rRNA gene by using paired-end sequencing on Illumina MiSeq device. MOTHUR software was used in sequence filtration and analysis of sequenced data. A total of 1858 operational taxonomic units at 97% similarity were assigned to 26 phyla, 245 families, and 705 genera. Four main phyla Firmicutes, Bacteroidetes, Proteobacteria, and Synergistetes were predominant in all samples. At genus level, Prevotella, Bacillus, Porphyromonas, Streptococcus, and Bacteroides were the most abundant. Illumina MiSeq platform sequencing can be used to investigate oral microbiome composition of endodontic infections. Elucidating the ecology of endodontic infections is a necessary step in developing effective intracanal antimicrobials. PMID:29849646
Chromosome-Encoded Broad-Spectrum Ambler Class A β-Lactamase RUB-1 from Serratia rubidaea
Didi, Jennifer; Ergani, Ayla; Lima, Sandra
2016-01-01
ABSTRACT Whole-genome sequencing of Serratia rubidaea CIP 103234T revealed a chromosomally located Ambler class A β-lactamase gene. The gene was cloned, and the β-lactamase, RUB-1, was characterized. RUB-1 displayed 74% and 73% amino acid sequence identity with the GIL-1 and TEM-1 penicillinases, respectively, and its substrate profile was similar to that of the latter β-lactamases. Analysis by 5′ rapid amplification of cDNA ends revealed promoter sequences highly divergent from the Escherichia coli σ70 consensus sequence. This work further illustrates the heterogeneity of β-lactamases among Serratia spp. PMID:27956418
Chromosome-Encoded Broad-Spectrum Ambler Class A β-Lactamase RUB-1 from Serratia rubidaea.
Bonnin, Rémy A; Didi, Jennifer; Ergani, Ayla; Lima, Sandra; Naas, Thierry
2017-02-01
Whole-genome sequencing of Serratia rubidaea CIP 103234 T revealed a chromosomally located Ambler class A β-lactamase gene. The gene was cloned, and the β-lactamase, RUB-1, was characterized. RUB-1 displayed 74% and 73% amino acid sequence identity with the GIL-1 and TEM-1 penicillinases, respectively, and its substrate profile was similar to that of the latter β-lactamases. Analysis by 5' rapid amplification of cDNA ends revealed promoter sequences highly divergent from the Escherichia coli σ 70 consensus sequence. This work further illustrates the heterogeneity of β-lactamases among Serratia spp. Copyright © 2017 American Society for Microbiology.
Large-Scale Concatenation cDNA Sequencing
Yu, Wei; Andersson, Björn; Worley, Kim C.; Muzny, Donna M.; Ding, Yan; Liu, Wen; Ricafrente, Jennifer Y.; Wentland, Meredith A.; Lennon, Greg; Gibbs, Richard A.
1997-01-01
A total of 100 kb of DNA derived from 69 individual human brain cDNA clones of 0.7–2.0 kb were sequenced by concatenated cDNA sequencing (CCS), whereby multiple individual DNA fragments are sequenced simultaneously in a single shotgun library. The method yielded accurate sequences and a similar efficiency compared with other shotgun libraries constructed from single DNA fragments (>20 kb). Computer analyses were carried out on 65 cDNA clone sequences and their corresponding end sequences to examine both nucleic acid and amino acid sequence similarities in the databases. Thirty-seven clones revealed no DNA database matches, 12 clones generated exact matches (≥98% identity), and 16 clones generated nonexact matches (57%–97% identity) to either known human or other species genes. Of those 28 matched clones, 8 had corresponding end sequences that failed to identify similarities. In a protein similarity search, 27 clone sequences displayed significant matches, whereas only 20 of the end sequences had matches to known protein sequences. Our data indicate that full-length cDNA insert sequences provide significantly more nucleic acid and protein sequence similarity matches than expressed sequence tags (ESTs) for database searching. [All 65 cDNA clone sequences described in this paper have been submitted to the GenBank data library under accession nos. U79240–U79304.] PMID:9110174
Brown, D P; Idler, K B; Katz, L
1990-01-01
The 18.1-kilobase plasmid pSE211 integrates into the chromosome of Saccharopolyspora erythraea at a specific attB site. Restriction analysis of the integrated plasmid, pSE211int, and adjacent chromosomal sequences allowed identification of attP, the plasmid attachment site. Nucleotide sequencing of attP, attB, attL, and attR revealed a 57-base-pair sequence common to all sites with no duplications of adjacent plasmid or chromosomal sequences in the integrated state, indicating that integration takes place through conservative, reciprocal strand exchange. An analysis of the sequences indicated the presence of a putative gene for Phe-tRNA at attB which is preserved at attL after integration has occurred. A comparison of the attB site for a number of actinomycete plasmids is presented. Integration at attB was also observed when a 2.4-kilobase segment of pSE211 containing attP and the adjacent plasmid sequence was used to transform a pSE211- host. Nucleotide sequencing of this segment revealed the presence of two complete open reading frames (ORFs) and a segment of a third ORF. The ORF adjacent to attP encodes a putative polypeptide 437 amino acids in length that shows similarity, at its C-terminal domain, to sequences of site-specific recombinases of the integrase family. The adjacent ORF encodes a putative 98-amino-acid basic polypeptide that contains a helix-turn-helix motif at its N terminus which corresponds to domains in the Xis proteins of a number of bacteriophages. A proposal for the function of this polypeptide is presented. The deduced amino acid sequence of the third ORF did not reveal similarities to polypeptide sequences in the current data banks. Images FIG. 2 FIG. 3 PMID:2180909
Witsenboer, H; Michelmore, R W; Vogel, J
1997-12-01
Selectively amplified microsatellite polymorphic locus (SAMPL) analysis is a method of amplifying microsatellite loci using generic PCR primers. SAMPL analysis uses one AFLP primer in combination with a primer complementary to microsatellite sequences. SAMPL primers based on compound microsatellite sequences provided the clearest amplification patterns. We explored the potential of SAMPL analysis in lettuce to detect PCR-based codominant microsatellite markers. Fifty-eight SAMPLs were identified and placed on the genetic map. Seventeen were codominant. SAMPLs were dispersed with RFLP markers on 11 of the 12 main linkage groups in lettuce, indicating that they have a similar genomic distribution. Some but not all fragments amplified by SAMPL analysis were confirmed to contain microsatellite sequences by Southern hybridization. Forty-five cultivars of lettuce and five wild species of Lactuca were analyzed to determine the allelic diversity for codominant SAMPLs. From 3 to 11 putative alleles were found for each SAMPL; 2-6 alleles were found within Lactuca sativa and 1-3 alleles were found among the crisphead genotypes, the most genetically homogeneous plant type of L. sativa. This allelic diversity is greater than that found for RFLP markers. Numerous new alleles were observed in the wild species; however, there were frequent null alleles. Therefore, SAMPL analysis is more applicable to intraspecific than to interspecific comparisons. A phenetic analysis based on SAMPLs resulted in a dendrogram similar to those based on RFLP and AFLP markers.
Ebolavirus comparative genomics
Jun, Se-Ran; Leuze, Michael R.; Nookaew, Intawat; ...
2015-07-14
The 2014 Ebola outbreak in West Africa is the largest documented for this virus. We examine the dynamics of this genome, comparing more than one hundred currently available ebolavirus genomes to each other and to other viral genomes. Based on oligomer frequency analysis, the family Filoviridae forms a distinct group from all other sequenced viral genomes. All filovirus genomes sequenced to date encode proteins with similar functions and gene order, although there is considerable divergence in sequences between the three genera Ebolavirus, Cuevavirus, and Marburgvirus within the family Filoviridae. Whereas all ebolavirus genomes are quite similar (multiple sequences of themore » same strain are often identical), variation is most common in the intergenic regions and within specific areas of the genes encoding the glycoprotein (GP), nucleoprotein (NP), and polymerase (L). We predict regions that could contain epitope-binding sites, which might be good vaccine targets. In conclusion, this information, combined with glycosylation sites and experimentally determined epitopes, can identify the most promising regions for the development of therapeutic strategies.« less
Palanga, Essowè; Martin, Darren P; Galzi, Serge; Zabré, Jean; Bouda, Zakaria; Neya, James Bouma; Sawadogo, Mahamadou; Traore, Oumar; Peterschmitt, Michel; Roumagnac, Philippe; Filloux, Denis
2017-07-01
The full-length genome sequences of two novel poleroviruses found infecting cowpea plants, cowpea polerovirus 1 (CPPV1) and cowpea polerovirus 2 (CPPV2), were determined using overlapping RT-PCR and RACE-PCR. Whereas the 5845-nt CPPV1 genome was most similar to chickpea chlorotic stunt virus (73% identity), the 5945-nt CPPV2 genome was most similar to phasey bean mild yellow virus (86% identity). The CPPV1 and CPPV2 genomes both have a typical polerovirus genome organization. Phylogenetic analysis of the inferred P1-P2 and P3 amino acid sequences confirmed that CPPV1 and CPPV2 are indeed poleroviruses. Four apparently unique recombination events were detected within a dataset of 12 full polerovirus genome sequences, including two events in the CPPV2 genome. Based on the current species demarcation criteria for the family Luteoviridae, we tentatively propose that CPPV1 and CPPV2 should be considered members of novel polerovirus species.
NASA Technical Reports Server (NTRS)
Cai, X.; Henry, R. L.; Takemoto, L. J.; Guikema, J. A.; Wong, P. P.; Spooner, B. S. (Principal Investigator)
1992-01-01
The amino acid sequences of the beta and gamma subunit polypeptides of glutamine synthetase from bean (Phaseolus vulgaris L.) root nodules are very similar. However, there are small regions within the sequences that are significantly different between the two polypeptides. The sequences between amino acids 2 and 9 and between 264 and 274 are examples. Three peptides (gamma 2-9, gamma 264-274, and beta 264-274) corresponding to these sequences were synthesized. Antibodies against these peptides were raised in rabbits and purified with corresponding peptide-Sepharose affinity chromatography. Western blot analysis of polyacrylamide gel electrophoresis of bean nodule proteins demonstrated that the anti-beta 264-274 antibodies reacted specifically with the beta polypeptide and the anti-gamma 264-274 and anti-gamma 2-9 antibodies reacted specifically with the gamma polypeptide of the native and denatured glutamine synthetase. These results showed the feasibility of using synthetic peptides in developing antibodies that are capable of distinguishing proteins with similar primary structures.
Genome sequence analysis of predicted polyprenol reductase gene from mangrove plant kandelia obovata
NASA Astrophysics Data System (ADS)
Basyuni, M.; Sagami, H.; Baba, S.; Oku, H.
2018-03-01
It has been previously reported that dolichols but not polyprenols were predominated in mangrove leaves and roots. Therefore, the occurrence of larger amounts of dolichol in leaves of mangrove plants implies that polyprenol reductase is responsible for the conversion of polyprenol to dolichol may be active in mangrove leaves. Here we report the early assessment of probably polyprenol reductase gene from genome sequence of mangrove plant Kandelia obovata. The functional assignment of the gene was based on a homology search of the sequences against the non-redundant (nr) peptide database of NCBI using Blastx. The degree of sequence identity between DNA sequence and known polyprenol reductase was confirmed using the Blastx probability E-value, total score, and identity. The genome sequence data resulted in three partial sequences, termed c23157 (700 bp), c23901 (960 bp), and c24171 (531 bp). The c23157 gene showed the highest similarity (61%) to predicted polyprenol reductase 2- like from Gossypium raimondii with E-value 2e-100. The second gene was c23901 to exhibit high similarity (78%) to the steroid 5-alpha-reductase Det2 from J. curcas with E-value 2e-140. Furthermore, the c24171 gene depicted highest similarity (79%) to the polyprenol reductase 2 isoform X1 from Jatropha curcas with E- value 7e-21.The present study suggested that the c23157, c23901, and c24171, genes may encode predicted polyprenol reductase. The c23157, c23901, c24171 are therefore the new type of predicted polyprenol reductase from K. obovata.
Graph pyramids for protein function prediction
2015-01-01
Background Uncovering the hidden organizational characteristics and regularities among biological sequences is the key issue for detailed understanding of an underlying biological phenomenon. Thus pattern recognition from nucleic acid sequences is an important affair for protein function prediction. As proteins from the same family exhibit similar characteristics, homology based approaches predict protein functions via protein classification. But conventional classification approaches mostly rely on the global features by considering only strong protein similarity matches. This leads to significant loss of prediction accuracy. Methods Here we construct the Protein-Protein Similarity (PPS) network, which captures the subtle properties of protein families. The proposed method considers the local as well as the global features, by examining the interactions among 'weakly interacting proteins' in the PPS network and by using hierarchical graph analysis via the graph pyramid. Different underlying properties of the protein families are uncovered by operating the proposed graph based features at various pyramid levels. Results Experimental results on benchmark data sets show that the proposed hierarchical voting algorithm using graph pyramid helps to improve computational efficiency as well the protein classification accuracy. Quantitatively, among 14,086 test sequences, on an average the proposed method misclassified only 21.1 sequences whereas baseline BLAST score based global feature matching method misclassified 362.9 sequences. With each correctly classified test sequence, the fast incremental learning ability of the proposed method further enhances the training model. Thus it has achieved more than 96% protein classification accuracy using only 20% per class training data. PMID:26044522
Graph pyramids for protein function prediction.
Sandhan, Tushar; Yoo, Youngjun; Choi, Jin; Kim, Sun
2015-01-01
Uncovering the hidden organizational characteristics and regularities among biological sequences is the key issue for detailed understanding of an underlying biological phenomenon. Thus pattern recognition from nucleic acid sequences is an important affair for protein function prediction. As proteins from the same family exhibit similar characteristics, homology based approaches predict protein functions via protein classification. But conventional classification approaches mostly rely on the global features by considering only strong protein similarity matches. This leads to significant loss of prediction accuracy. Here we construct the Protein-Protein Similarity (PPS) network, which captures the subtle properties of protein families. The proposed method considers the local as well as the global features, by examining the interactions among 'weakly interacting proteins' in the PPS network and by using hierarchical graph analysis via the graph pyramid. Different underlying properties of the protein families are uncovered by operating the proposed graph based features at various pyramid levels. Experimental results on benchmark data sets show that the proposed hierarchical voting algorithm using graph pyramid helps to improve computational efficiency as well the protein classification accuracy. Quantitatively, among 14,086 test sequences, on an average the proposed method misclassified only 21.1 sequences whereas baseline BLAST score based global feature matching method misclassified 362.9 sequences. With each correctly classified test sequence, the fast incremental learning ability of the proposed method further enhances the training model. Thus it has achieved more than 96% protein classification accuracy using only 20% per class training data.
Bürckert, Jean-Philippe; Dubois, Axel R S X; Faison, William J; Farinelle, Sophie; Charpentier, Emilie; Sinner, Regina; Wienecke-Baldacchino, Anke; Muller, Claude P
2017-01-01
The identification and tracking of antigen-specific immunoglobulin (Ig) sequences within total Ig repertoires is central to high-throughput sequencing (HTS) studies of infections or vaccinations. In this context, public Ig sequences shared by different individuals exposed to the same antigen could be valuable markers for tracing back infections, measuring vaccine immunogenicity, and perhaps ultimately allow the reconstruction of the immunological history of an individual. Here, we immunized groups of transgenic rats expressing human Ig against tetanus toxoid (TT), Modified Vaccinia virus Ankara (MVA), measles virus hemagglutinin and fusion proteins expressed on MVA, and the environmental carcinogen benzo[a]pyrene, coupled to TT. We showed that these antigens impose a selective pressure causing the Ig heavy chain (IgH) repertoires of the rats to converge toward the expression of antibodies with highly similar IgH CDR3 amino acid sequences. We present a computational approach, similar to differential gene expression analysis, that selects for clusters of CDR3s with 80% similarity, significantly overrepresented within the different groups of immunized rats. These IgH clusters represent antigen-induced IgH signatures exhibiting stereotypic amino acid patterns including previously described TT- and measles-specific IgH sequences. Our data suggest that with the presented methodology, transgenic Ig rats can be utilized as a model to identify antigen-induced, human IgH signatures to a variety of different antigens.
Silveira, Júlia A G; Rabelo, Elida M L; Lacerda, Ana C R; Borges, Paulo A L; Tomás, Walfrido M; Pellegrin, Aiesca O; Tomich, Renata G P; Ribeiro, Múcio F B
2013-06-01
Hemoparasites were surveyed in 60 free-living pampas deer Ozotoceros bezoarticus from the central area of the Pantanal, known as Nhecolândia, State of Mato Grosso do Sul, Brazil, through the analysis of nested PCR assays and nucleotide sequencing. Blood samples were tested for Babesia/Theileria, Anaplasma spp., and Trypanosoma spp. using nPCR assays and sequencing of the 18S rRNA, msp4, ITS, and cathepsin L genes. The identity of each sequence was confirmed by comparison with sequences from GenBank using BLAST software. Forty-six (77%) pampas deer were positive for at least one hemoparasite, according to PCR assays. Co-infection occurred in 13 (22%) animals. Based on the sequencing results, 29 (48%) tested positive for A. marginale. Babesia/Theileria were detected in 23 (38%) samples, and according to the sequencing results 52% (12/23) of the samples were similar to T. cervi, 13% (3/23) were similar to Babesia bovis, and 9% (2/23) were similar to B. bigemina. No samples were amplified with the primers for T. vivax, while 11 (18%) were amplified with the ITS primers for T. evansi. The results showed pampas deer to be co-infected with several hemoparasites, including species that may cause serious disease in cattle. Pampas deer is an endangered species in Brazil, and the consequences of these infections to their health are poorly understood. Copyright © 2013 Elsevier GmbH. All rights reserved.
Hayashimoto, Nobuhito; Ueno, Masami; Tkakura, Akira; Itoh, Toshio
2007-06-01
Phylogenetic analysis based on 16S rRNA sequences with sequence data of some bacterial species of Pasteurellaceae related to rodents deposited in GenBank was performed along with biochemical characterization for the 20 strains of V-factor dependent members of Pasteurellaceae derived from laboratory rats to obtain basic information and to investigate the taxonomic positions. The results of biochemical tests for all strains were identical except for three tests, the ornithine decarboxylase test, and fermentation tests of D(+) mannose and D(+) xylose. The biochemical properties of 8 of 20 strains that showed negative results for the fermentation test of D(+) xylose agreed with those of Haemophilus parainfluenzae complex. By phylogenetic analysis, the strains were divided into two clusters that agreed with the results of the fermentation test of xylose (group I: negative reaction for xylose, group II: positive reaction for xylose). The clusters were independent of other bacterial species of Pasteurellaceae tested. The sequences of the strains in group I showed 99.7-99.8% similarity and the strains in group II showed 99.3-99.7% similarity. None of the strains in group I had a close relation with Haemophilus parainfluenzae by phylogenetic analysis, although they showed the same biochemical properties. In conclusion, the strains had characteristic biochemical properties and formed two independent groups within the "rodent cluster" of Pasteurellaceae that differed in the results of the fermentation test of xylose. Therefore, they seemed to be hitherto undescribed taxa in Pasteurellaceae.
Phylogenetic analysis of several Thermus strains from Rehai of Tengchong, Yunnan, China.
Lin, Lianbing; Zhang, Jie; Wei, Yunlin; Chen, Chaoyin; Peng, Qian
2005-10-01
Several Thermus strains were isolated from 10 hot springs of the Rehai geothermal area in Tengchong, Yunnan province. The diversity of Thermus strains was examined by sequencing the 16S rRNA genes and comparing their sequences. Phylogenetic analysis showed that the 16S rDNA sequences from the Rehai geothermal isolates form four branches in the phylogenetic tree and had greater than 95.9% similarity in the phylogroup. Secondary structure comparison also indicated that the 16S rRNA from the Rehai geothermal isolates have unique secondary structure characteristics in helix 6, helix 9, and helix 10 (reference to Escherichia coli). This research is the first attempt to reveal the diversity of Thermus strains that are distributed in the Rehai geothermal area.
Acceleration of convergence of vector sequences
NASA Technical Reports Server (NTRS)
Sidi, A.; Ford, W. F.; Smith, D. A.
1983-01-01
A general approach to the construction of convergence acceleration methods for vector sequence is proposed. Using this approach, one can generate some known methods, such as the minimal polynomial extrapolation, the reduced rank extrapolation, and the topological epsilon algorithm, and also some new ones. Some of the new methods are easier to implement than the known methods and are observed to have similar numerical properties. The convergence analysis of these new methods is carried out, and it is shown that they are especially suitable for accelerating the convergence of vector sequences that are obtained when one solves linear systems of equations iteratively. A stability analysis is also given, and numerical examples are provided. The convergence and stability properties of the topological epsilon algorithm are likewise given.
Pramono, Ajeng K.; Kuwahara, Hirokazu; Itoh, Takehiko; Toyoda, Atsushi; Yamada, Akinori; Hongoh, Yuichi
2017-01-01
Termites depend nutritionally on their gut microbes, and protistan, bacterial, and archaeal gut communities have been extensively studied. However, limited information is available on viruses in the termite gut. We herein report the complete genome sequence (99,517 bp) of a phage obtained during a genome analysis of “Candidatus Azobacteroides pseudotrichonymphae” phylotype ProJPt-1, which is an obligate intracellular symbiont of the cellulolytic protist Pseudotrichonympha sp. in the gut of the termite Prorhinotermes japonicus. The genome of the phage, designated ProJPt-Bp1, was circular or circularly permuted, and was not integrated into the two circular chromosomes or five circular plasmids composing the host ProJPt-1 genome. The phage was putatively affiliated with the order Caudovirales based on sequence similarities with several phage-related genes; however, most of the 52 protein-coding sequences had no significant homology to sequences in the databases. The phage genome contained a tRNA-Gln (CAG) gene, which showed the highest sequence similarity to the tRNA-Gln (CAA) gene of the host “Ca. A. pseudotrichonymphae” phylotype ProJPt-1. Since the host genome lacked a tRNA-Gln (CAG) gene, the phage tRNA gene may compensate for differences in codon usage bias between the phage and host genomes. The phage genome also contained a non-coding region with high nucleotide sequence similarity to a region in one of the host plasmids. No other phage-related sequences were found in the host ProJPt-1 genome. To the best of our knowledge, this is the first report of a phage from an obligate, mutualistic endosymbiont permanently associated with eukaryotic cells. PMID:28321010
Near-Complete Genome Sequence of a Novel Single-Stranded RNA Virus Discovered in Indoor Air
2018-01-01
ABSTRACT Viral metagenomic analysis of heating, ventilation, and air conditioning (HVAC) filters recovered the near-complete genome sequence of a novel virus, named HVAC-associated RNA virus 1 (HVAC-RV1). The HVAC-RV1 genome is most similar to those of picorna-like viruses identified in arthropods but encodes a small domain observed only in negative-sense single-stranded RNA viruses. PMID:29567746
Opening Up Architectures of Software-Intensive Systems: A First Prototype Implementation
2007-11-01
9 4.1.2 Sequence Diagram Viewer NetBeans Module .................................. 11 4.1.3 Limitations of Static Analysis...Viewer NetBeans module [18]. Note that there exist other tools which can statically reverse engineer sequence diagrams such as Borland Together [19...and the NetBeans UML Modeling module [20]. The reason those are not presented in this document is because their functionalities are very similar
Malware Analysis Using Visualized Image Matrices
Im, Eul Gyu
2014-01-01
This paper proposes a novel malware visual analysis method that contains not only a visualization method to convert binary files into images, but also a similarity calculation method between these images. The proposed method generates RGB-colored pixels on image matrices using the opcode sequences extracted from malware samples and calculates the similarities for the image matrices. Particularly, our proposed methods are available for packed malware samples by applying them to the execution traces extracted through dynamic analysis. When the images are generated, we can reduce the overheads by extracting the opcode sequences only from the blocks that include the instructions related to staple behaviors such as functions and application programming interface (API) calls. In addition, we propose a technique that generates a representative image for each malware family in order to reduce the number of comparisons for the classification of unknown samples and the colored pixel information in the image matrices is used to calculate the similarities between the images. Our experimental results show that the image matrices of malware can effectively be used to classify malware families both statically and dynamically with accuracy of 0.9896 and 0.9732, respectively. PMID:25133202
Unusual RNA plant virus integration in the soybean genome leads to the production of small RNAs.
da Fonseca, Guilherme Cordenonsi; de Oliveira, Luiz Felipe Valter; de Morais, Guilherme Loss; Abdelnor, Ricardo Vilela; Nepomuceno, Alexandre Lima; Waterhouse, Peter M; Farinelli, Laurent; Margis, Rogerio
2016-05-01
Horizontal gene transfer (HGT) is known to be a major force in genome evolution. The acquisition of genes from viruses by eukaryotic genomes is a well-studied example of HGT, including rare cases of non-retroviral RNA virus integration. The present study describes the integration of cucumber mosaic virus RNA-1 into soybean genome. After an initial metatranscriptomic analysis of small RNAs derived from soybean, the de novo assembly resulted a 3029-nt contig homologous to RNA-1. The integration of this sequence in the soybean genome was confirmed by DNA deep sequencing. The locus where the integration occurred harbors the full RNA-1 sequence followed by the partial sequence of an endogenous mRNA and another sequence of RNA-1 as an inverted repeat and allowing the formation of a hairpin structure. This region recombined into a retrotransposon located inside an exon of a soybean gene. The nucleotide similarity of the integrated sequence compared to other Cucumber mosaic virus sequences indicates that the integration event occurred recently. We described a rare event of non-retroviral RNA virus integration in soybean that leads to the production of a double-stranded RNA in a similar fashion to virus resistance RNAi plants. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.
Radl, Viviane; Simões-Araújo, Jean Luiz; Leite, Jakson; Passos, Samuel Ribeiro; Martins, Lindete Míria Vieira; Xavier, Gustavo Ribeiro; Rumjanek, Norma Gouvêa; Baldani, José Ivo; Zilli, Jerri Edson
2014-03-01
16S rRNA gene sequence analysis of eight strains (BR 3299(T), BR 3296, BR 10192, BR 10193, BR 10194, BR 10195, BR 10196 and BR 10197) isolated from nodules of cowpea collected from a semi-arid region of Brazil showed 97 % similarity to sequences of recently described rhizobial species of the genus Microvirga. Phylogenetic analyses of four housekeeping genes (gyrB, recA, dnaK and rpoB), DNA-DNA relatedness and AFLP further indicated that these strains belong to a novel species within the genus Microvirga. Our data support the hypothesis that genes related to nitrogen fixation were obtained via horizontal gene transfer, as sequences of nifH genes were very similar to those found in members of the genera Rhizobium and Mesorhizobium, which are not immediate relatives of the genus Microvirga, as shown by 16S rRNA gene sequence analysis. Phenotypic traits, such as host range and carbon utilization, differentiate the novel strains from the most closely related species, Microvirga lotononidis, Microvirga zambiensis and Microvirga lupini. Therefore, these symbiotic nitrogen-fixing bacteria are proposed to be representatives of a novel species, for which the name Microvirga vignae sp. nov. is suggested. The type strain is BR3299(T) ( = HAMBI 3457(T)).
Singh, Pradip Kumar; Chittpurna; Ashish; Sharma, Vikas; Patil, Prabhu B.; Korpole, Suresh
2012-01-01
Background Bacteriocins are antimicrobial peptides that are produced by bacteria as a defense mechanism in complex environments. Identification and characterization of novel bacteriocins in novel strains of bacteria is one of the important fields in bacteriology. Methodology/Findings The strain GI-9 was identified as Brevibacillus sp. by 16 S rRNA gene sequence analysis. The bacteriocin produced by strain GI-9, namely, laterosporulin was purified from supernatant of the culture grown under optimal conditions using hydrophobic interaction chromatography and reverse-phase HPLC. The bacteriocin was active against a wide range of Gram-positive and Gram-negative bacteria. MALDI-TOF experiments determined the precise molecular mass of the peptide to be of 5.6 kDa and N-terminal sequencing of the thermo-stable peptide revealed low similarity with existing antimicrobial peptides. The putative open reading frame (ORF) encoding laterosporulin and its surrounding genomic region was fished out from the draft genome sequence of GI-9. Sequence analysis of the putative bacteriocin gene did not show significant similarity to any reported bacteriocin producing genes in database. Conclusions We have identified a bacteriocin producing strain GI-9, belonging to the genus Brevibacillus sp. Biochemical and genomic characterization of laterosporulin suggests it as a novel bacteriocin with broad spectrum antibacterial activity. PMID:22403615
Singh, Pradip Kumar; Chittpurna; Ashish; Sharma, Vikas; Patil, Prabhu B; Korpole, Suresh
2012-01-01
Bacteriocins are antimicrobial peptides that are produced by bacteria as a defense mechanism in complex environments. Identification and characterization of novel bacteriocins in novel strains of bacteria is one of the important fields in bacteriology. The strain GI-9 was identified as Brevibacillus sp. by 16 S rRNA gene sequence analysis. The bacteriocin produced by strain GI-9, namely, laterosporulin was purified from supernatant of the culture grown under optimal conditions using hydrophobic interaction chromatography and reverse-phase HPLC. The bacteriocin was active against a wide range of Gram-positive and Gram-negative bacteria. MALDI-TOF experiments determined the precise molecular mass of the peptide to be of 5.6 kDa and N-terminal sequencing of the thermo-stable peptide revealed low similarity with existing antimicrobial peptides. The putative open reading frame (ORF) encoding laterosporulin and its surrounding genomic region was fished out from the draft genome sequence of GI-9. Sequence analysis of the putative bacteriocin gene did not show significant similarity to any reported bacteriocin producing genes in database. We have identified a bacteriocin producing strain GI-9, belonging to the genus Brevibacillus sp. Biochemical and genomic characterization of laterosporulin suggests it as a novel bacteriocin with broad spectrum antibacterial activity.
Comparative Analysis of Vertebrate Dystrophin Loci Indicate Intron Gigantism as a Common Feature
Pozzoli, Uberto; Elgar, Greg; Cagliani, Rachele; Riva, Laura; Comi, Giacomo P.; Bresolin, Nereo; Bardoni, Alessandra; Sironi, Manuela
2003-01-01
The human DMD gene is the largest known to date, spanning > 2000 kb on the X chromosome. The gene size is mainly accounted for by huge intronic regions. We sequenced 190 kb of Fugu rubripes (pufferfish) genomic DNA corresponding to the complete dystrophin gene (FrDMD) and provide the first report of gene structure and sequence comparison among dystrophin genomic sequences from different vertebrate organisms. Almost all intron positions and phases are conserved between FrDMD and its mammalian counterparts, and the predicted protein product of the Fugu gene displays 55% identity and 71% similarity to human dystrophin. In analogy to the human gene, FrDMD presents several-fold longer than average intronic regions. Analysis of intron sequences of the human and murine genes revealed that they are extremely conserved in size and that a similar fraction of total intron length is represented by repetitive elements; moreover, our data indicate that intron expansion through repeat accumulation in the two orthologs is the result of independent insertional events. The hypothesis that intron length might be functionally relevant to the DMD gene regulation is proposed and substantiated by the finding that dystrophin intron gigantism is common to the three vertebrate genes. [Supplemental material is available online at www.genome.org.] PMID:12727896
Streptococcus ovuberis sp. nov., isolated from a subcutaneous abscess in the udder of a sheep.
Zamora, Leydis; Pérez-Sancho, Marta; Fernández-Garayzábal, Jose Francisco; Orden, Jose Antonio; Domínguez-Bernal, Gustavo; de la Fuente, Ricardo; Domínguez, Lucas; Vela, Ana Isabel
2017-11-01
One unidentified, Gram-stain-positive, catalase-negative coccus-shaped organism was recovered from a subcutaneous abscess of the udder of a sheep and subjected to a polyphasic taxonomic analysis. Based on cellular morphology and biochemical criteria, the isolate was tentatively assigned to the genus Streptococcus, although the organism did not appear to match any recognized species. 16S rRNA gene sequence comparison studies confirmed its identification as a member of the genus Streptococcus and showed that the nearest phylogenetic relatives of the unknown coccus corresponded to Streptococcus moroccensis and Streptococcus cameli (95.9 % 16S rRNA gene sequence similarity). The sodA sequence analysis showed less than 89.3 % sequence similarity with the currently recognized species of the genus Streptococcus. The novel bacterial isolate was distinguished from close relatives of the genus Streptococcusby using biochemical tests. A mass spectrometry profile was also obtained for the novel isolate using matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS). Based on both phenotypic and phylogenetic findings, it is proposed that the unknown bacterium be classified as a representative of a novel species of the genus Streptococcus, Streptococcus ovuberis sp. nov. The type strain of Streptococcus ovuberissp. nov. is VB15-00779 T (=CECT 9179 T =CCUG 69612 T ).
Passos-Castilho, Ana Maria; Granato, Celso Francisco Hernandes
Hepatitis E virus is responsible for acute and chronic liver infections worldwide. Swine hepatitis E virus has been isolated in Brazil, and a probable zoonotic transmission has been described, although data are still scarce. The aim of this study was to investigate the frequency of hepatitis E virus infection in pigs from a small-scale farm in the rural area of Paraná State, South Brazil. Fecal samples were collected from 170 pigs and screened for hepatitis E virus RNA using a duplex real-time RT-PCR targeting a highly conserved 70nt long sequence within overlapping parts of ORF2 and ORF3 as well as a 113nt sequence of ORF2. Positive samples with high viral loads were subjected to direct sequencing and phylogenetic analysis. hepatitis E virus RNA was detected in 34 (20.0%) of the 170 pigs following positive results in at least one set of screening real-time RT-PCR primers and probes. The swine hepatitis E virus strains clustered with the genotype hepatitis E virus-3b reference sequences in the phylogenetic analysis and showed close similarity to human hepatitis E virus isolates previously reported in Brazil. Copyright © 2017 Sociedade Brasileira de Microbiologia. Published by Elsevier Editora Ltda. All rights reserved.
eShadow: A tool for comparing closely related sequences
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ovcharenko, Ivan; Boffelli, Dario; Loots, Gabriela G.
2004-01-15
Primate sequence comparisons are difficult to interpret due to the high degree of sequence similarity shared between such closely related species. Recently, a novel method, phylogenetic shadowing, has been pioneered for predicting functional elements in the human genome through the analysis of multiple primate sequence alignments. We have expanded this theoretical approach to create a computational tool, eShadow, for the identification of elements under selective pressure in multiple sequence alignments of closely related genomes, such as in comparisons of human to primate or mouse to rat DNA. This tool integrates two different statistical methods and allows for the dynamic visualizationmore » of the resulting conservation profile. eShadow also includes a versatile optimization module capable of training the underlying Hidden Markov Model to differentially predict functional sequences. This module grants the tool high flexibility in the analysis of multiple sequence alignments and in comparing sequences with different divergence rates. Here, we describe the eShadow comparative tool and its potential uses for analyzing both multiple nucleotide and protein alignments to predict putative functional elements. The eShadow tool is publicly available at http://eshadow.dcode.org/« less
Azospirillum canadense sp. nov., a nitrogen-fixing bacterium isolated from corn rhizosphere.
Mehnaz, Samina; Weselowski, Brian; Lazarovits, George
2007-03-01
A free-living diazotrophic strain, DS2(T), was isolated from corn rhizosphere. Polyphasic taxonomy was performed including morphological characterization, Biolog analysis, and 16S rRNA, cpn60 and nifH gene sequence analyses. 16S rRNA gene sequence analysis indicated that strain DS2(T) was closely related to the genus Azospirillum (96 % similarity). Chemotaxonomic characteristics (DNA G+C content 67.9 mol%; Q-10 quinone system; major fatty acid 18 : 1omega7c) were also similar to those of the genus Azospirillum. In all the analyses, including phenotypic characterization using Biolog analysis and comparison of cellular fatty acids, this isolate was found to be different from the closely related species Azospirillum lipoferum, Azospirillum oryzae and Azospirillum brasilense. On the basis of these results, a novel species is proposed for this nitrogen-fixing strain. The name Azospirillum canadense sp. nov. is suggested with the type strain DS2(T) (=NCCB 100108(T)=LMG 23617(T)).
Cross species analysis of microarray expression data
Lu, Yong; Huggins, Peter; Bar-Joseph, Ziv
2009-01-01
Motivation: Many biological systems operate in a similar manner across a large number of species or conditions. Cross-species analysis of sequence and interaction data is often applied to determine the function of new genes. In contrast to these static measurements, microarrays measure the dynamic, condition-specific response of complex biological systems. The recent exponential growth in microarray expression datasets allows researchers to combine expression experiments from multiple species to identify genes that are not only conserved in sequence but also operated in a similar way in the different species studied. Results: In this review we discuss the computational and technical challenges associated with these studies, the approaches that have been developed to address these challenges and the advantages of cross-species analysis of microarray data. We show how successful application of these methods lead to insights that cannot be obtained when analyzing data from a single species. We also highlight current open problems and discuss possible ways to address them. Contact: zivbj@cs.cmu.edu PMID:19357096
The nucleotide sequence and genome organization of Plasmopara halstedii virus.
Heller-Dohmen, Marion; Göpfert, Jens C; Pfannstiel, Jens; Spring, Otmar
2011-03-17
Only very few viruses of Oomycetes have been studied in detail. Isometric virions were found in different isolates of the oomycete Plasmopara halstedii, the downy mildew pathogen of sunflower. However, complete nucleotide sequences and data on the genome organization were lacking. Viral RNA of different P. halstedii isolates was subjected to nucleotide sequencing and analysis of the viral genome. The N-terminal sequence of the viral coat protein was determined using Top-Down MALDI-TOF analysis. The complete nucleotide sequences of both single-stranded RNA segments (RNA1 and RNA2) were established. RNA1 consisted of 2793 nucleotides (nt) exclusive its 3' poly(A) tract and a single open-reading frame (ORF1) of 2745 nt. ORF1 was framed by a 5' untranslated region (5' UTR) of 18 nt and a 3' untranslated region (3' UTR) of 30 nt. ORF1 contained motifs of RNA-dependent RNA polymerases (RdRp) and showed similarities to RdRp of Scleropthora macrospora virus A (SmV A) and viruses within the Nodaviridae family. RNA2 consisted of 1526 nt exclusive its 3' poly(A) tract and a second ORF (ORF2) of 1128 nt. ORF2 coded for the single viral coat protein (CP) and was framed by a 5' UTR of 164 nt and a 3' UTR of 234 nt. The deduced amino acid sequence of ORF2 was verified by nano-LC-ESI-MS/MS experiments. Top-Down MALDI-TOF analysis revealed the N-terminal sequence of the CP. The N-terminal sequence represented a region within ORF2 suggesting a proteolytic processing of the CP in vivo. The CP showed similarities to CP of SmV A and viruses within the Tombusviridae family. Fragments of RNA1 (ca. 1.9 kb) and RNA2 (ca. 1.4 kb) were used to analyze the nucleotide sequence variation of virions in different P. halstedii isolates. Viral sequence variation was 0.3% or less regardless of their host's pathotypes, the geographical origin and the sensitivity towards the fungicide metalaxyl. The results showed the presence of a single and new virus type in different P. halstedii isolates. Insignificant viral sequence variation indicated that the virus did not account for differences in pathogenicity of the oomycete P. halstedii.
SPARSE: quadratic time simultaneous alignment and folding of RNAs without sequence-based heuristics.
Will, Sebastian; Otto, Christina; Miladi, Milad; Möhl, Mathias; Backofen, Rolf
2015-08-01
RNA-Seq experiments have revealed a multitude of novel ncRNAs. The gold standard for their analysis based on simultaneous alignment and folding suffers from extreme time complexity of [Formula: see text]. Subsequently, numerous faster 'Sankoff-style' approaches have been suggested. Commonly, the performance of such methods relies on sequence-based heuristics that restrict the search space to optimal or near-optimal sequence alignments; however, the accuracy of sequence-based methods breaks down for RNAs with sequence identities below 60%. Alignment approaches like LocARNA that do not require sequence-based heuristics, have been limited to high complexity ([Formula: see text] quartic time). Breaking this barrier, we introduce the novel Sankoff-style algorithm 'sparsified prediction and alignment of RNAs based on their structure ensembles (SPARSE)', which runs in quadratic time without sequence-based heuristics. To achieve this low complexity, on par with sequence alignment algorithms, SPARSE features strong sparsification based on structural properties of the RNA ensembles. Following PMcomp, SPARSE gains further speed-up from lightweight energy computation. Although all existing lightweight Sankoff-style methods restrict Sankoff's original model by disallowing loop deletions and insertions, SPARSE transfers the Sankoff algorithm to the lightweight energy model completely for the first time. Compared with LocARNA, SPARSE achieves similar alignment and better folding quality in significantly less time (speedup: 3.7). At similar run-time, it aligns low sequence identity instances substantially more accurate than RAF, which uses sequence-based heuristics. © The Author 2015. Published by Oxford University Press.
Unconventional P-35S sequence identified in genetically modified maize
Al-Hmoud, Nisreen; Al-Husseini, Nawar; Ibrahim-Alobaide, Mohammed A; Kübler, Eric; Farfoura, Mahmoud; Alobydi, Hytham; Al-Rousan, Hiyam
2014-01-01
The Cauliflower Mosaic Virus 35S promoter sequence, CaMV P-35S, is one of several commonly used genetic targets to detect genetically modified maize and is found in most GMOs. In this research we report the finding of an alternative P-35S sequence and its incidence in GM maize marketed in Jordan. The primer pair normally used to amplify a 123 bp DNA fragment of the CaMV P-35S promoter in GMOs also amplified a previously undetected alternative sequence of CaMV P-35S in GM maize samples which we term V3. The amplified V3 sequence comprises 386 base pairs and was not found in the standard wild-type maize, MON810 and MON 863 GM maize. The identified GM maize samples carrying the V3 sequence were found free of CaMV when compared with CaMV infected brown mustard sample. The data of sequence alignment analysis of the V3 genetic element showed 90% similarity with the matching P-35S sequence of the cauliflower mosaic virus isolate CabbB-JI and 99% similarity with matching P-35S sequences found in several binary plant vectors, of which the binary vector locus JQ693018 is one example. The current study showed an increase of 44% in the incidence of the identified 386 bp sequence in GM maize sold in Jordan’s markets during the period 2009 and 2012. PMID:24495911
Model-free aftershock forecasts constructed from similar sequences in the past
NASA Astrophysics Data System (ADS)
van der Elst, N.; Page, M. T.
2017-12-01
The basic premise behind aftershock forecasting is that sequences in the future will be similar to those in the past. Forecast models typically use empirically tuned parametric distributions to approximate past sequences, and project those distributions into the future to make a forecast. While parametric models do a good job of describing average outcomes, they are not explicitly designed to capture the full range of variability between sequences, and can suffer from over-tuning of the parameters. In particular, parametric forecasts may produce a high rate of "surprises" - sequences that land outside the forecast range. Here we present a non-parametric forecast method that cuts out the parametric "middleman" between training data and forecast. The method is based on finding past sequences that are similar to the target sequence, and evaluating their outcomes. We quantify similarity as the Poisson probability that the observed event count in a past sequence reflects the same underlying intensity as the observed event count in the target sequence. Event counts are defined in terms of differential magnitude relative to the mainshock. The forecast is then constructed from the distribution of past sequences outcomes, weighted by their similarity. We compare the similarity forecast with the Reasenberg and Jones (RJ95) method, for a set of 2807 global aftershock sequences of M≥6 mainshocks. We implement a sequence-specific RJ95 forecast using a global average prior and Bayesian updating, but do not propagate epistemic uncertainty. The RJ95 forecast is somewhat more precise than the similarity forecast: 90% of observed sequences fall within a factor of two of the median RJ95 forecast value, whereas the fraction is 85% for the similarity forecast. However, the surprise rate is much higher for the RJ95 forecast; 10% of observed sequences fall in the upper 2.5% of the (Poissonian) forecast range. The surprise rate is less than 3% for the similarity forecast. The similarity forecast may be useful to emergency managers and non-specialists when confidence or expertise in parametric forecasting may be lacking. The method makes over-tuning impossible, and minimizes the rate of surprises. At the least, this forecast constitutes a useful benchmark for more precisely tuned parametric forecasts.
Unusual Intron Conservation near Tissue-Regulated Exons Found by Splicing Microarrays
Sugnet, Charles W; Srinivasan, Karpagam; Clark, Tyson A; O'Brien, Georgeann; Cline, Melissa S; Wang, Hui; Williams, Alan; Kulp, David; Blume, John E; Haussler, David; Ares, Manuel
2006-01-01
Alternative splicing contributes to both gene regulation and protein diversity. To discover broad relationships between regulation of alternative splicing and sequence conservation, we applied a systems approach, using oligonucleotide microarrays designed to capture splicing information across the mouse genome. In a set of 22 adult tissues, we observe differential expression of RNA containing at least two alternative splice junctions for about 40% of the 6,216 alternative events we could detect. Statistical comparisons identify 171 cassette exons whose inclusion or skipping is different in brain relative to other tissues and another 28 exons whose splicing is different in muscle. A subset of these exons is associated with unusual blocks of intron sequence whose conservation in vertebrates rivals that of protein-coding exons. By focusing on sets of exons with similar regulatory patterns, we have identified new sequence motifs implicated in brain and muscle splicing regulation. Of note is a motif that is strikingly similar to the branchpoint consensus but is located downstream of the 5′ splice site of exons included in muscle. Analysis of three paralogous membrane-associated guanylate kinase genes reveals that each contains a paralogous tissue-regulated exon with a similar tissue inclusion pattern. While the intron sequences flanking these exons remain highly conserved among mammalian orthologs, the paralogous flanking intron sequences have diverged considerably, suggesting unusually complex evolution of the regulation of alternative splicing in multigene families. PMID:16424921
Lelliottia aquatilis sp. nov., isolated from drinking water.
Kämpfer, Peter; Glaeser, Stefanie P; Packroff, Gabriele; Behringer, Katja; Exner, Martin; Chakraborty, Trinad; Schmithausen, Ricarda M; Doijad, Swapnil
2018-06-22
Five beige-pigmented, oxidase-negative bacterial isolates, 6331-17 T , 6332-17, 6333-17, 6334-17 and 9827-07, isolated either from a drinking water storage reservoir or drinking water in 2006 and 2017 in Germany, were examined in detail applying by a polyphasic taxonomic approach. Cells of the isolates were rod-shaped and Gram-stain-negative. Comparison of the 16S rRNA gene sequences of these five isolates showed highest sequence similarities to Lelliottia amnigena (99.98 %) and Lelliottia nimipressuralis (99.99 %). Multilocus sequence analyses based on concatenated partial rpoB, gyrB, infB and atpD sequences confirmed the clustering of these isolates with Lelliottia species, but also revealed a clear distinction to the closest related type strains. Analysis of the genome sequences of these isolates indicated >70 % in silico DNA-DNA hybridization and high average nucleotide identities between strains. Nevertheless, they showed only <70 and <95 % similarity to the type strains of these two Lelliottia species. The fatty acid profiles of these isolates were very similar and consisted of the major fatty acids C16:0, C17 : 0cyclo, C15 : 0iso 2-OH/C16 : 1ω7c and C18 : 1ω7c. In addition, physiological/biochemical tests revealed high phenotypic similarity to each other. These cumulative data indicate that these isolates represent a novel Lelliottia species, for which the name Lelliottia aquatilis sp. nov. is proposed, with strain 6331-17 T (=CCM 8846 T =CIP 111609 T =LMG 30560 T ) as the type strain.
Enterobacter muelleri sp. nov., isolated from the rhizosphere of Zea mays.
Kämpfer, Peter; McInroy, John A; Glaeser, Stefanie P
2015-11-01
A beige-pigmented, oxidase-negative bacterial strain (JM-458T), isolated from a rhizosphere sample, was studied using a polyphasic taxonomic approach. Cells of the isolate were rod-shaped and stained Gram-negative. A comparison of the 16S rRNA gene sequence of strain JM-458T with sequences of the type strains of closely related species of the genus Enterobacter showed that it shared highest sequence similarity with Enterobacter mori (98.7 %), Enterobacter hormaechei (98.3 %), Enterobacter cloacae subsp. dissolvens, Enterobacter ludwigii and Enterobacter asburiae (all 98.2 %). 16S rRNA gene sequence similarities to all other Enterobacter species were below 98 %. Multilocus sequence analysis based on concatenated partial rpoB, gyrB, infB and atpD gene sequences showed a clear distinction of strain JM-458T from its closest related type strains. The fatty acid profile of the strain consisted of C16 : 0, C17 : 0 cyclo, iso-C15 : 0 2-OH/C16 : 1ω7c and C18 : 1ω7c as major components. DNA-DNA hybridizations between strain JM-458T and the type strains of E. mori, E. hormaechei and E. ludwigii resulted in relatedness values of 29 % (reciprocal 25 %), 24 % (reciprocal 43 %) and 16 % (reciprocal 17 %), respectively. DNA-DNA hybridization results together with multilocus sequence analysis results and differential biochemical and chemotaxonomic properties showed that strain JM-458T represents a novel species of the genus Enterobacter, for which the name Enterobacter muelleri sp. nov. is proposed. The type strain is JM-458T ( = DSM 29346T = CIP 110826T = LMG 28480T = CCM 8546T).
Kerschner, Joseph E; Erdos, Geza; Hu, Fen Ze; Burrows, Amy; Cioffi, Joseph; Khampang, Pawjai; Dahlgren, Margaret; Hayes, Jay; Keefe, Randy; Janto, Benjamin; Post, J Christopher; Ehrlich, Garth D
2010-04-01
We sought to construct and partially characterize complementary DNA (cDNA) libraries prepared from the middle ear mucosa (MEM) of chinchillas to better understand pathogenic aspects of infection and inflammation, particularly with respect to leukotriene biogenesis and response. Chinchilla MEM was harvested from controls and after middle ear inoculation with nontypeable Haemophilus influenzae. RNA was extracted to generate cDNA libraries. Randomly selected clones were subjected to sequence analysis to characterize the libraries and to provide DNA sequence for phylogenetic analyses. Reverse transcription-polymerase chain reaction of the RNA pools was used to generate cDNA sequences corresponding to genes associated with leukotriene biosynthesis and metabolism. Sequence analysis of 921 randomly selected clones from the uninfected MEM cDNA library produced approximately 250,000 nucleotides of almost entirely novel sequence data. Searches of the GenBank database with the Basic Local Alignment Search Tool provided for identification of 515 unique genes expressed in the MEM and not previously described in chinchillas. In almost all cases, the chinchilla cDNA sequences displayed much greater homology to human or other primate genes than with rodent species. Genes associated with leukotriene metabolism were present in both normal and infected MEM. Based on both phylogenetic comparisons and gene expression similarities with humans, chinchilla MEM appears to be an excellent model for the study of middle ear inflammation and infection. The higher degree of sequence similarity between chinchillas and humans compared to chinchillas and rodents was unexpected. The cDNA libraries from normal and infected chinchilla MEM will serve as useful molecular tools in the study of otitis media and should yield important information with respect to middle ear pathogenesis.
Kerschner, Joseph E.; Erdos, Geza; Hu, Fen Ze; Burrows, Amy; Cioffi, Joseph; Khampang, Pawjai; Dahlgren, Margaret; Hayes, Jay; Keefe, Randy; Janto, Benjamin; Post, J. Christopher; Ehrlich, Garth D.
2010-01-01
Objectives We sought to construct and partially characterize complementary DNA (cDNA) libraries prepared from the middle ear mucosa (MEM) of chinchillas to better understand pathogenic aspects of infection and inflammation, particularly with respect to leukotriene biogenesis and response. Methods Chinchilla MEM was harvested from controls and after middle ear inoculation with nontypeable Haemophilus influenzae. RNA was extracted to generate cDNA libraries. Randomly selected clones were subjected to sequence analysis to characterize the libraries and to provide DNA sequence for phylogenetic analyses. Reverse transcription–polymerase chain reaction of the RNA pools was used to generate cDNA sequences corresponding to genes associated with leukotriene biosynthesis and metabolism. Results Sequence analysis of 921 randomly selected clones from the uninfected MEM cDNA library produced approximately 250,000 nucleotides of almost entirely novel sequence data. Searches of the GenBank database with the Basic Local Alignment Search Tool provided for identification of 515 unique genes expressed in the MEM and not previously described in chinchillas. In almost all cases, the chinchilla cDNA sequences displayed much greater homology to human or other primate genes than with rodent species. Genes associated with leukotriene metabolism were present in both normal and infected MEM. Conclusions Based on both phylogenetic comparisons and gene expression similarities with humans, chinchilla MEM appears to be an excellent model for the study of middle ear inflammation and infection. The higher degree of sequence similarity between chinchillas and humans compared to chinchillas and rodents was unexpected. The cDNA libraries from normal and infected chinchilla MEM will serve as useful molecular tools in the study of otitis media and should yield important information with respect to middle ear pathogenesis. PMID:20433028
Rojas-Cartagena, Carmencita; Ortíz-Pineda, Pablo; Ramírez-Gómez, Francisco; Suárez-Castillo, Edna C.; Matos-Cruz, Vanessa; Rodríguez, Carlos; Ortíz-Zuazaga, Humberto; García-Arrarás, José E.
2010-01-01
Repair and regeneration are key processes for tissue maintenance, and their disruption may lead to disease states. Little is known about the molecular mechanisms that underline the repair and regeneration of the digestive tract. The sea cucumber Holothuria glaberrima represents an excellent model to dissect and characterize the molecular events during intestinal regeneration. To study the gene expression profile, cDNA libraries were constructed from normal, 3-day, and 7-day regenerating intestines of H. glaberrima. Clones were randomly sequenced and queried against the nonredundant protein database at the National Center for Biotechnology Information. RT-PCR analyses were made of several genes to determine their expression profile during intestinal regeneration. A total of 5,173 sequences from three cDNA libraries were obtained. About 46.2, 35.6, and 26.2% of the sequences for the normal, 3-days, and 7-days cDNA libraries, respectively, shared significant similarity with known sequences in the protein database of GenBank but only present 10% of similarity among them. Analysis of the libraries in terms of functional processes, protein domains, and most common sequences suggests that a differential expression profile is taking place during the regeneration process. Further examination of the expressed sequence tag dataset revealed that 12 putative genes are differentially expressed at significant level (R > 6). Experimental validation by RT-PCR analysis reveals that at least three genes (unknown C-4677-1, melanotransferrin, and centaurin) present a differential expression during regeneration. These findings strongly suggest that the gene expression profile varies among regeneration stages and provide evidence for the existence of differential gene expression. PMID:17579180
Chen, Mindong; Wang, Bin; Zhang, Qianrong; Xue, Zhuzheng
2017-01-01
Fresh-cut luffa (Luffa cylindrica) fruits commonly undergo browning. However, little is known about the molecular mechanisms regulating this process. We used the RNA-seq technique to analyze the transcriptomic changes occurring during the browning of fresh-cut fruits from luffa cultivar ‘Fusi-3’. Over 90 million high-quality reads were assembled into 58,073 Unigenes, and 60.86% of these were annotated based on sequences in four public databases. We detected 35,282 Unigenes with significant hits to sequences in the NCBInr database, and 24,427 Unigenes encoded proteins with sequences that were similar to those of known proteins in the Swiss-Prot database. Additionally, 20,546 and 13,021 Unigenes were similar to existing sequences in the Eukaryotic Orthologous Groups of proteins and Kyoto Encyclopedia of Genes and Genomes databases, respectively. Furthermore, 27,301 Unigenes were differentially expressed during the browning of fresh-cut luffa fruits (i.e., after 1–6 h). Moreover, 11 genes from five gene families (i.e., PPO, PAL, POD, CAT, and SOD) identified as potentially associated with enzymatic browning as well as four WRKY transcription factors were observed to be differentially regulated in fresh-cut luffa fruits. With the assistance of rapid amplification of cDNA ends technology, we obtained the full-length sequences of the 15 Unigenes. We also confirmed these Unigenes were expressed by quantitative real-time polymerase chain reaction analysis. This study provides a comprehensive transcriptome sequence resource, and may facilitate further studies aimed at identifying genes affecting luffa fruit browning for the exploitation of the underlying mechanism. PMID:29145430
Seo, H S; Kim, H Y; Jeong, J Y; Lee, S Y; Cho, M J; Bahk, J D
1995-03-01
A cDNA clone, RGA1, was isolated by using a GPA1 cDNA clone of Arabidopsis thaliana G protein alpha subunit as a probe from a rice (Oryza sativa L. IR-36) seedling cDNA library from roots and leaves. Sequence analysis of genomic clone reveals that the RGA1 gene has 14 exons and 13 introns, and encodes a polypeptide of 380 amino acid residues with a calculated molecular weight of 44.5 kDa. The encoded protein exhibits a considerable degree of amino acid sequence similarity to all the other known G protein alpha subunits. A putative TATA sequence (ATATGA), a potential CAAT box sequence (AGCAATAC), and a cis-acting element, CCACGTGG (ABRE), known to be involved in ABA induction are found in the promoter region. The RGA1 protein contains all the consensus regions of G protein alpha subunits except the cysteine residue near the C-terminus for ADP-ribosylation by pertussis toxin. The RGA1 polypeptide expressed in Escherichia coli was, however, ADP-ribosylated by 10 microM [adenylate-32P] NAD and activated cholera toxin. Southern analysis indicates that there are no other genes similar to the RGA1 gene in the rice genome. Northern analysis reveals that the RGA1 mRNA is 1.85 kb long and expressed in vegetative tissues, including leaves and roots, and that its expression is regulated by light.
Muangkram, Yuttamol; Amano, Akira; Wajjwalku, Worawidh; Pinyopummintr, Tanu; Thongtip, Nikorn; Kaolim, Nongnid; Sukmak, Manakorn; Kamolnorranath, Sumate; Siriaroonrat, Boripat; Tipkantha, Wanlaya; Maikaew, Umaporn; Thomas, Warisara; Polsrila, Kanda; Dongsaard, Kwanreaun; Sanannu, Saowaphang; Wattananorrasate, Anuwat
2017-07-01
The Asian tapir (Tapirus indicus) has been classified as Endangered on the IUCN Red List of Threatened Species (2008). Genetic diversity data provide important information for the management of captive breeding and conservation of this species. We analyzed mitochondrial control region (CR) sequences from 37 captive Asian tapirs in Thailand. Multiple alignments of the full-length CR sequences sized 1268 bp comprised three domains as described in other mammal species. Analysis of 16 parsimony-informative variable sites revealed 11 haplotypes. Furthermore, the phylogenetic analysis using median-joining network clearly showed three clades correlated with our earlier cytochrome b gene study in this endangered species. The repetitive motif is located between first and second conserved sequence blocks, similar to the Brazilian tapir. The highest polymorphic site was located in the extended termination associated sequences domain. The results could be applied for future genetic management based in captivity and wild that shows stable populations.
Computational Analysis of Mouse piRNA Sequence and Biogenesis
Betel, Doron; Sheridan, Robert; Marks, Debora S; Sander, Chris
2007-01-01
The recent discovery of a new class of 30-nucleotide long RNAs in mammalian testes, called PIWI-interacting RNA (piRNA), with similarities to microRNAs and repeat-associated small interfering RNAs (rasiRNAs), has raised puzzling questions regarding their biogenesis and function. We report a comparative analysis of currently available piRNA sequence data from the pachytene stage of mouse spermatogenesis that sheds light on their sequence diversity and mechanism of biogenesis. We conclude that (i) there are at least four times as many piRNAs in mouse testes than currently known; (ii) piRNAs, which originate from long precursor transcripts, are generated by quasi-random enzymatic processing that is guided by a weak sequence signature at the piRNA 5′ends resulting in a large number of distinct sequences; and (iii) many of the piRNA clusters contain inverted repeats segments capable of forming double-strand RNA fold-back segments that may initiate piRNA processing analogous to transposon silencing. PMID:17997596
Genetic and phylogenetic analysis of a novel parvovirus isolated from chickens in Guangxi, China.
Feng, Bin; Xie, Zhixun; Deng, Xianwen; Xie, Liji; Xie, Zhiqin; Huang, Li; Fan, Qin; Luo, Sisi; Huang, Jiaoling; Zhang, Yanfang; Zeng, Tingting; Wang, Sheng; Wang, Leyi
2016-11-01
A previously unidentified chicken parvovirus (ChPV) strain, associated with runting-stunting syndrome (RSS), is now endemic among chickens in China. To explore the genetic diversity of ChPV strains, we determined the first complete genome sequence of a novel ChPV isolate (GX-CH-PV-7) identified in chickens in Guang Xi, China, and showed moderate genome sequence similarity to reference strains. Analysis showed that the viral genome sequence is 86.4 %-93.9 % identical to those of other ChPVs. Genetic and phylogenetic analyses showed that this newly emergent GX-CH-PV-7 is closely related to Gallus gallus enteric parvovirus isolate ChPV 798 from the USA, indicating that they may share a common ancestor. The complete DNA sequence is 4612 bp long with an A+T content of 56.66 %. We determined the first complete genome sequence of a previously unidentified ChPV strain to elucidate its origin and evolutionary status.
Wang, Yunsheng; Zhou, Lijuan; Li, Dazhi; Dai, Liangying; Lawton-Rauh, Amy; Srimani, Pradip K.; Duan, Yongping; Luo, Feng
2015-01-01
In this study, we identified and compared nucleotide-binding site (NBS) domain-containing genes from three Citrus genomes (C. clementina, C. sinensis from USA and C. sinensis from China). Phylogenetic analysis of all Citrus NBS genes across these three genomes revealed that there are three approximately evenly numbered groups: one group contains the Toll-Interleukin receptor (TIR) domain and two different Non-TIR groups in which most of proteins contain the Coiled Coil (CC) domain. Motif analysis confirmed that the two groups of CC-containing NBS genes are from different evolutionary origins. We partitioned NBS genes into clades using NBS domain sequence distances and found most clades include NBS genes from all three Citrus genomes. This suggests that three Citrus genomes have similar numbers and types of NBS genes. We also mapped the re-sequenced reads of three pomelo and three mandarin genomes onto the C. sinensis genome. We found that most NBS genes of the hybrid C. sinensis genome have corresponding homologous genes in both pomelo and mandarin genomes. The homologous NBS genes in pomelo and mandarin suggest that the parental species of C. sinensis may contain similar types of NBS genes. This explains why the hybrid C. sinensis and original C. clementina have similar types of NBS genes in this study. Furthermore, we found that sequence variation amongst Citrus NBS genes were shaped by multiple independent and shared accelerated mutation accumulation events among different groups of NBS genes and in different Citrus genomes. Our comparative analyses yield valuable insight into the structure, organization and evolution of NBS genes in Citrus genomes. Furthermore, our comprehensive analysis showed that the non-TIR NBS genes can be divided into two groups that come from different evolutionary origins. This provides new insights into non-TIR genes, which have not received much attention. PMID:25811466
Wang, Yunsheng; Zhou, Lijuan; Li, Dazhi; Dai, Liangying; Lawton-Rauh, Amy; Srimani, Pradip K; Duan, Yongping; Luo, Feng
2015-01-01
In this study, we identified and compared nucleotide-binding site (NBS) domain-containing genes from three Citrus genomes (C. clementina, C. sinensis from USA and C. sinensis from China). Phylogenetic analysis of all Citrus NBS genes across these three genomes revealed that there are three approximately evenly numbered groups: one group contains the Toll-Interleukin receptor (TIR) domain and two different Non-TIR groups in which most of proteins contain the Coiled Coil (CC) domain. Motif analysis confirmed that the two groups of CC-containing NBS genes are from different evolutionary origins. We partitioned NBS genes into clades using NBS domain sequence distances and found most clades include NBS genes from all three Citrus genomes. This suggests that three Citrus genomes have similar numbers and types of NBS genes. We also mapped the re-sequenced reads of three pomelo and three mandarin genomes onto the C. sinensis genome. We found that most NBS genes of the hybrid C. sinensis genome have corresponding homologous genes in both pomelo and mandarin genomes. The homologous NBS genes in pomelo and mandarin suggest that the parental species of C. sinensis may contain similar types of NBS genes. This explains why the hybrid C. sinensis and original C. clementina have similar types of NBS genes in this study. Furthermore, we found that sequence variation amongst Citrus NBS genes were shaped by multiple independent and shared accelerated mutation accumulation events among different groups of NBS genes and in different Citrus genomes. Our comparative analyses yield valuable insight into the structure, organization and evolution of NBS genes in Citrus genomes. Furthermore, our comprehensive analysis showed that the non-TIR NBS genes can be divided into two groups that come from different evolutionary origins. This provides new insights into non-TIR genes, which have not received much attention.
Winnowing DNA for rare sequences: highly specific sequence and methylation based enrichment.
Thompson, Jason D; Shibahara, Gosuke; Rajan, Sweta; Pel, Joel; Marziali, Andre
2012-01-01
Rare mutations in cell populations are known to be hallmarks of many diseases and cancers. Similarly, differential DNA methylation patterns arise in rare cell populations with diagnostic potential such as fetal cells circulating in maternal blood. Unfortunately, the frequency of alleles with diagnostic potential, relative to wild-type background sequence, is often well below the frequency of errors in currently available methods for sequence analysis, including very high throughput DNA sequencing. We demonstrate a DNA preparation and purification method that through non-linear electrophoretic separation in media containing oligonucleotide probes, achieves 10,000 fold enrichment of target DNA with single nucleotide specificity, and 100 fold enrichment of unmodified methylated DNA differing from the background by the methylation of a single cytosine residue.
Chen, Wei-Hua; Wang, Xue-Xia; Lin, Wei; He, Xiao-Wei; Wu, Zhen-Qiang; Lin, Ying; Hu, Song-Nian; Wang, Xiao-Ning
2006-01-01
Background The cynomolgus monkey (Macaca fascicularis) is one of the most widely used surrogate animal models for an increasing number of human diseases and vaccines, especially immune-system-related ones. Towards a better understanding of the gene expression background upon its immunogenetics, we constructed a cDNA library from Epstein-Barr virus (EBV)-transformed B lymphocytes of a cynomolgus monkey and sequenced 10,000 randomly picked clones. Results After processing, 8,312 high-quality expressed sequence tags (ESTs) were generated and assembled into 3,728 unigenes. Annotations of these uniquely expressed transcripts demonstrated that out of the 2,524 open reading frame (ORF) positive unigenes (mitochondrial and ribosomal sequences were not included), 98.8% shared significant similarities (E-value less than 1e-10) with the NCBI nucleotide (nt) database, while only 67.7% (E-value less than 1e-5) did so with the NCBI non-redundant protein (nr) database. Further analysis revealed that 90.0% of the unigenes that shared no similarities to the nr database could be assigned to human chromosomes, in which 75 did not match significantly to any cynomolgus monkey and human ESTs. The mapping regions to known human genes on the human genome were described in detail. The protein family and domain analysis revealed that the first, second and fourth of the most abundantly expressed protein families were all assigned to immunoglobulin and major histocompatibility complex (MHC)-related proteins. The expression profiles of these genes were compared with that of homologous genes in human blood, lymph nodes and a RAMOS cell line, which demonstrated expression changes after transformation with EBV. The degree of sequence similarity of the MHC class I and II genes to the human reference sequences was evaluated. The results indicated that class I molecules showed weak amino acid identities (<90%), while class II showed slightly higher ones. Conclusion These results indicated that the genes expressed in the cynomolgus monkey could be used to identify novel protein-coding genes and revise those incomplete or incorrect annotations in the human genome by comparative methods, since the old world monkeys and humans share high similarities at the molecular level, especially within coding regions. The identification of multiple genes involved in the immune response, their sequence variations to the human homologues, and their responses to EBV infection could provide useful information to improve our understanding of the cynomolgus monkey immune system. PMID:16618371
Divergence and evolution of homologous regions of Bombyx mori nuclear polyhedrosis virus.
Majima, K; Kobara, R; Maeda, S
1993-01-01
Homologous regions (hrs) (hr1,hr2-left,hr2-right,hr3,hr4-left,hr 4-right, and hr5) similar to those found in the Autographa californica nuclear polyhedrosis virus (AcNPV) genome were found in the Bombyx mori NPV (BmNPV) genome. The BmNPV hrs contained two to eight repeats of a homologous nucleotide sequence which were on average about 75 bp long. All of these homologous sequence repeats contained a 26-bp-long palindrome motif with an EcoRI or EcoRI-like site at its core. The consensus sequence of the BmNPV hrs showed 95% conservation with respect to those found in AcNPV. Nucleotide sequence analysis indicated that hr2-left and hr2-right of BmNPV evolved from an ancestor similar to hr2 of AcNPV by inversion, cleavage, and ligation. The polarities of the BmNPV and AcNPV hrs were conserved except for that of hr4-left. Within hr4-right of BmNPV, four repeats of a previously underscribed palindrome motif were found. Bmhr5D, a BmNPV mutant which lacked hr5, replicated at a rate similar to that of wild-type BmNPV in BmN cells and silkworm larvae, indicating that hr5 was not essential for viral replication. After ten passages of Bmhr5D in BmN cells, no detectable changes in its genome were observed by restriction endonuclease analysis. The evolution and divergence of the BmNPV genome are also discussed. Images PMID:8230471
Li, H C; Lu, H B; Yang, F Y; Liu, S J; Bai, C J; Zhang, Y W
2015-03-31
Sucrose phosphate synthase (SPS) is an enzyme used by higher plants for sucrose synthesis. In this study, three primer sets were designed on the basis of known SPS sequences from maize (GenBank: NM_001112224.1) and sugarcane (GenBank: JN584485.1), and five novel SPS genes were identified by RT-PCR from the genomes of Pennisetum spp (the hybrid P. americanum x P. purpureum, P. purpureum Schum., P. purpureum Schum. cv. Red, P. purpureum Schum. cv. Taiwan, and P. purpureum Schum. cv. Mott). The cloned sequences showed 99.9% identity and 80-88% similarity to the SPS sequences of other plants. The SPS gene of hybrid Pennisetum had one nucleotide and four amino acid polymorphisms compared to the other four germplasms, and cluster analysis was performed to assess genetic diversity in this species. Additional characterization of the SPS gene product can potentially allow Pennisetum to be exploited as a biofuel source.
Chen, Jianchi; Civerolo, Edwin L; Jarret, Robert L; Van Sluys, Marie-Anne; de Oliveira, Mariana C
2005-02-01
Xylella fastidiosa causes many important plant diseases including Pierce's disease (PD) in grape and almond leaf scorch disease (ALSD). DNA-based methodologies, such as randomly amplified polymorphic DNA (RAPD) analysis, have been playing key roles in genetic information collection of the bacterium. This study further analyzed the nucleotide sequences of selected RAPDs from X. fastidiosa strains in conjunction with the available genome sequence databases and unveiled several previously unknown novel genetic traits. These include a sequence highly similar to those in the phage family of Podoviridae. Genome comparisons among X. fastidiosa strains suggested that the "phage" is currently active. Two other RAPDs were also related to horizontal gene transfer: one was part of a broadly distributed cryptic plasmid and the other was associated with conjugal transfer. One RAPD inferred a genomic rearrangement event among X. fastidiosa PD strains and another identified a single nucleotide polymorphism of evolutionary value.
Cutaneous Granulomas in Dolphins Caused by Novel Uncultivated Paracoccidioides brasiliensis
Vilela, Raquel; Bossart, Gregory D.; St. Leger, Judy A.; Dalton, Leslie M.; Reif, John S.; Schaefer, Adam M.; McCarthy, Peter J.; Fair, Patricia A.
2016-01-01
Cutaneous granulomas in dolphins were believed to be caused by Lacazia loboi, which also causes a similar disease in humans. This hypothesis was recently challenged by reports that fungal DNA sequences from dolphins grouped this pathogen with Paracoccidioides brasiliensis. We conducted phylogenetic analysis of fungi from 6 bottlenose dolphins (Tursiops truncatus) with cutaneous granulomas and chains of yeast cells in infected tissues. Kex gene sequences of P. brasiliensis from dolphins showed 100% homology with sequences from cultivated P. brasiliensis, 73% with those of L. loboi, and 93% with those of P. lutzii. Parsimony analysis placed DNA sequences from dolphins within a cluster with human P. brasiliensis strains. This cluster was the sister taxon to P. lutzii and L. loboi. Our molecular data support previous findings and suggest that a novel uncultivated strain of P. brasiliensis restricted to cutaneous lesions in dolphins is probably the cause of lacaziosis/lobomycosis, herein referred to as paracoccidioidomycosis ceti. PMID:27869614
Cutaneous Granulomas in Dolphins Caused by Novel Uncultivated Paracoccidioides brasiliensis.
Vilela, Raquel; Bossart, Gregory D; St Leger, Judy A; Dalton, Leslie M; Reif, John S; Schaefer, Adam M; McCarthy, Peter J; Fair, Patricia A; Mendoza, Leonel
2016-12-01
Cutaneous granulomas in dolphins were believed to be caused by Lacazia loboi, which also causes a similar disease in humans. This hypothesis was recently challenged by reports that fungal DNA sequences from dolphins grouped this pathogen with Paracoccidioides brasiliensis. We conducted phylogenetic analysis of fungi from 6 bottlenose dolphins (Tursiops truncatus) with cutaneous granulomas and chains of yeast cells in infected tissues. Kex gene sequences of P. brasiliensis from dolphins showed 100% homology with sequences from cultivated P. brasiliensis, 73% with those of L. loboi, and 93% with those of P. lutzii. Parsimony analysis placed DNA sequences from dolphins within a cluster with human P. brasiliensis strains. This cluster was the sister taxon to P. lutzii and L. loboi. Our molecular data support previous findings and suggest that a novel uncultivated strain of P. brasiliensis restricted to cutaneous lesions in dolphins is probably the cause of lacaziosis/lobomycosis, herein referred to as paracoccidioidomycosis ceti.
Complete Amino Acid Sequence of a Copper/Zinc-Superoxide Dismutase from Ginger Rhizome.
Nishiyama, Yuki; Fukamizo, Tamo; Yoneda, Kazunari; Araki, Tomohiro
2017-04-01
Superoxide dismutase (SOD) is an antioxidant enzyme protecting cells from oxidative stress. Ginger (Zingiber officinale) is known for its antioxidant properties, however, there are no data on SODs from ginger rhizomes. In this study, we purified SOD from the rhizome of Z. officinale (Zo-SOD) and determined its complete amino acid sequence using N terminal sequencing, amino acid analysis, and de novo sequencing by tandem mass spectrometry. Zo-SOD consists of 151 amino acids with two signature Cu/Zn-SOD motifs and has high similarity to other plant Cu/Zn-SODs. Multiple sequence alignment showed that Cu/Zn-binding residues and cysteines forming a disulfide bond, which are highly conserved in Cu/Zn-SODs, are also present in Zo-SOD. Phylogenetic analysis revealed that plant Cu/Zn-SODs clustered into distinct chloroplastic, cytoplasmic, and intermediate groups. Among them, only chloroplastic enzymes carried amino acid substitutions in the region functionally important for enzymatic activity, suggesting that chloroplastic SODs may have a function distinct from those of SODs localized in other subcellular compartments. The nucleotide sequence of the Zo-SOD coding region was obtained by reverse-translation, and the gene was synthesized, cloned, and expressed. The recombinant Zo-SOD demonstrated pH stability in the range of 5-10, which is similar to other reported Cu/Zn-SODs, and thermal stability in the range of 10-60 °C, which is higher than that for most plant Cu/Zn-SODs but lower compared to the enzyme from a Z. officinale relative Curcuma aromatica.
Ikram, Najmul; Qadir, Muhammad Abdul; Afzal, Muhammad Tanvir
2018-01-01
Sequence similarity is a commonly used measure to compare proteins. With the increasing use of ontologies, semantic (function) similarity is getting importance. The correlation between these measures has been applied in the evaluation of new semantic similarity methods, and in protein function prediction. In this research, we investigate the relationship between the two similarity methods. The results suggest absence of a strong correlation between sequence and semantic similarities. There is a large number of proteins with low sequence similarity and high semantic similarity. We observe that Pearson's correlation coefficient is not sufficient to explain the nature of this relationship. Interestingly, the term semantic similarity values above 0 and below 1 do not seem to play a role in improving the correlation. That is, the correlation coefficient depends only on the number of common GO terms in proteins under comparison, and the semantic similarity measurement method does not influence it. Semantic similarity and sequence similarity have a distinct behavior. These findings are of significant effect for future works on protein comparison, and will help understand the semantic similarity between proteins in a better way.
Wang, Haibin; Jiang, Jiafu; Chen, Sumei; Qi, Xiangyu; Peng, Hui; Li, Pirui; Song, Aiping; Guan, Zhiyong; Fang, Weimin; Liao, Yuan; Chen, Fadi
2013-01-01
Background Simple sequence repeats (SSRs) are ubiquitous in eukaryotic genomes. Chrysanthemum is one of the largest genera in the Asteraceae family. Only few Chrysanthemum expressed sequence tag (EST) sequences have been acquired to date, so the number of available EST-SSR markers is very low. Methodology/Principal Findings Illumina paired-end sequencing technology produced over 53 million sequencing reads from C. nankingense mRNA. The subsequent de novo assembly yielded 70,895 unigenes, of which 45,789 (64.59%) unigenes showed similarity to the sequences in NCBI database. Out of 45,789 sequences, 107 have hits to the Chrysanthemum Nr protein database; 679 and 277 sequences have hits to the database of Helianthus and Lactuca species, respectively. MISA software identified a large number of putative EST-SSRs, allowing 1,788 primer pairs to be designed from the de novo transcriptome sequence and a further 363 from archival EST sequence. Among 100 primer pairs randomly chosen, 81 markers have amplicons and 20 are polymorphic for genotypes analysis in Chrysanthemum. The results showed that most (but not all) of the assays were transferable across species and that they exposed a significant amount of allelic diversity. Conclusions/Significance SSR markers acquired by transcriptome sequencing are potentially useful for marker-assisted breeding and genetic analysis in the genus Chrysanthemum and its related genera. PMID:23626799
Johansson, Anders; Aspan, Anna; Bagge, Elisabeth; Båverud, Viveca; Engström, Björn E; Johansson, Karl-Erik
2006-01-01
Background Clostridium perfringens, a serious pathogen, causes enteric diseases in domestic animals and food poisoning in humans. The epidemiological relationship between C. perfringens isolates from the same source has previously been investigated chiefly by pulsed-field gel electrophoresis (PFGE). In this study the genetic diversity of C. perfringens isolated from various animals, from food poisoning outbreaks and from sludge was investigated. Results We used PFGE to examine the genetic diversity of 95 C. perfringens type A isolates from eight different sources. The isolates were also examined for the presence of the beta2 toxin gene (cpb2) and the enterotoxin gene (cpe). The cpb2 gene from the 28 cpb2-positive isolates was also partially sequenced (519 bp, corresponding to positions 188 to 706 in the consensus cpb2 sequence). The results of PFGE revealed a wide genetic diversity among the C. perfringens type A isolates. The genetic relatedness of the isolates ranged from 58 to 100% and 56 distinct PFGE types were identified. Almost all clusters with similar patterns comprised isolates with a known epidemiological correlation. Most of the isolates from pig, horse and sheep carried the cpb2 gene. All isolates originating from food poisoning outbreaks carried the cpe gene and three of these also carried cpb2. Two evolutionary different populations were identified by sequence analysis of the partially sequenced cpb2 genes from our study and cpb2 sequences previously deposited in GenBank. Conclusion As revealed by PFGE, there was a wide genetic diversity among C. perfringens isolates from different sources. Epidemiologically related isolates showed a high genetic similarity, as expected, while isolates with no obvious epidemiological relationship expressed a lesser degree of genetic similarity. The wide diversity revealed by PFGE was not reflected in the 16S rRNA sequences, which had a considerable degree of sequence similarity. Sequence comparison of the partially sequenced cpb2 gene revealed two genetically different populations. This is to our knowledge the first study in which the genetic diversity of C. perfringens isolates both from different animals species, from food poisoning outbreaks and from sludge has been investigated. PMID:16737528
Multifractal analysis of 2001 Mw 7 . 7 Bhuj earthquake sequence in Gujarat, Western India
NASA Astrophysics Data System (ADS)
Aggarwal, Sandeep Kumar; Pastén, Denisse; Khan, Prosanta Kumar
2017-12-01
The 2001 Mw 7 . 7 Bhuj mainshock seismic sequence in the Kachchh area, occurring during 2001 to 2012, has been analyzed using mono-fractal and multi-fractal dimension spectrum analysis technique. This region was characterized by frequent moderate shocks of Mw ≥ 5 . 0 for more than a decade since the occurrence of 2001 Bhuj earthquake. The present study is therefore important for precursory analysis using this sequence. The selected long-sequence has been investigated first time for completeness magnitude Mc 3.0 using the maximum curvature method. Multi-fractal Dq spectrum (Dq ∼ q) analysis was carried out using effective window-length of 200 earthquakes with a moving window of 20 events overlapped by 180 events. The robustness of the analysis has been tested by considering the magnitude completeness correction term of 0.2 to Mc 3.0 as Mc 3.2 and we have tested the error in the calculus of Dq for each magnitude threshold. On the other hand, the stability of the analysis has been investigated down to the minimum magnitude of Mw ≥ 2 . 6 in the sequence. The analysis shows the multi-fractal dimension spectrum Dq decreases with increasing of clustering of events with time before a moderate magnitude earthquake in the sequence, which alternatively accounts for non-randomness in the spatial distribution of epicenters and its self-organized criticality. Similar behavior is ubiquitous elsewhere around the globe, and warns for proximity of a damaging seismic event in an area. OS: Please confirm math roman or italics in abs.
De Pittà, Cristiano; Bertolucci, Cristiano; Mazzotta, Gabriella M; Bernante, Filippo; Rizzo, Giorgia; De Nardi, Barbara; Pallavicini, Alberto; Lanfranchi, Gerolamo; Costa, Rodolfo
2008-01-01
Background Little is known about the genome sequences of Euphausiacea (krill) although these crustaceans are abundant components of the pelagic ecosystems in all oceans and used for aquaculture and pharmaceutical industry. This study reports the results of an expressed sequence tag (EST) sequencing project from different tissues of Euphausia superba (the Antarctic krill). Results We have constructed and sequenced five cDNA libraries from different Antarctic krill tissues: head, abdomen, thoracopods and photophores. We have identified 1.770 high-quality ESTs which were assembled into 216 overlapping clusters and 801 singletons resulting in a total of 1.017 non-redundant sequences. Quantitative RT-PCR analysis was performed to quantify and validate the expression levels of ten genes presenting different EST countings in krill tissues. In addition, bioinformatic screening of the non-redundant E. superba sequences identified 69 microsatellite containing ESTs. Clusters, consensuses and related similarity and gene ontology searches were organized in a dedicated E. superba database . Conclusion We defined the first tissue transcriptional signatures of E. superba based on functional categorization among the examined tissues. The analyses of annotated transcripts showed a higher similarity with genes from insects with respect to Malacostraca possibly as an effect of the limited number of Malacostraca sequences in the public databases. Our catalogue provides for the first time a genomic tool to investigate the biology of the Antarctic krill. PMID:18226200
Analysis of expressed sequence tags for Frankliniella occidentalis, the western flower thrips.
Rotenberg, D; Whitfield, A E
2010-08-01
Thrips are members of the insect order Thysanoptera and Frankliniella occidentalis (the western flower thrips) is the most economically important pest within this order. F. occidentalis is both a direct pest of crops and an efficient vector of plant viruses, including Tomato spotted wilt virus (TSWV). Despite the world-wide importance of thrips in agriculture, there is little knowledge of the F. occidentalis genome or gene functions at this time. A normalized cDNA library was constructed from first instar thrips and 13 839 expressed sequence tags (ESTs) were obtained. Our EST data assembled into 894 contigs and 11 806 singletons (12 700 nonredundant sequences). We found that 31% of these sequences had significant similarity (E< or = 10(-10)) to protein sequences in the National Center for Biotechnology Information nonredundant (nr) protein database, and 25% were functionally annotated using Blast 2GO. We identified 74 sequences with putative homology to proteins associated with insect innate immunity. Sixteen sequences had significant similarity to proteins associated with small RNA-mediated gene silencing pathways (RNA interference; RNAi), including the antiviral pathway (short interfering RNA-mediated pathway). Our EST collection provides new sequence resources for characterizing gene functions in F. occidentalis and other thrips species with regards to vital biological processes, studying the mechanism of interactions with the viruses harboured and transmitted by the vector, and identifying new insect gene-centred targets for plant disease and insect control.
Estrada-Gómez, Sebastian; Vargas-Muñoz, Leidy Johana; Saldarriaga-Córdoba, Mónica; Cifuentes, Yeimy; Perafan, Carlos
2017-04-01
Theraphosidae spider venoms are well known for possess a complex mixture of protein and non-protein compounds in their venom. The objective of this study was to report and identify different proteins translated from the venom gland DNA information of the recently described Theraphosidae spider Pamphobeteus verdolaga. Using a venom gland transcriptomic analysis, we reported a set of the first complete sequences of seven different proteins of the recenlty described Theraphosidae spider P. verdolaga. Protein analysis indicates the presence of different proteins on the venom composition of this new spider, some of them uncommon in the Theraphosidae family. MS/MS analysis of P. verdolaga showed different fragments matching sphingomyelinases (sicaritoxin), barytoxins, hexatoxins, latroinsectotoxins, and linear (zadotoxins) peptides. Only four of the MS/MS fragments showed 100% sequence similarity with one of the transcribed proteins. Transcriptomic analysis showed the presence of different groups of proteins like phospholipases, hyaluronidases, inhibitory cysteine knots (ICK) peptides among others. The three database of protein domains used in this study (Pfam, SMART and CDD) showed congruency in the search of unique conserved protein domain for only four of the translated proteins. Those proteins matched with EF-hand proteins, cysteine rich secretory proteins, jingzhaotoxins, theraphotoxins and hexatoxins, from different Mygalomorphae spiders belonging to the families Theraphosidae, Barychelidae and Hexathelidae. None of the analyzed sequences showed a complete 100% similarity. Copyright © 2017 Elsevier Ltd. All rights reserved.
Congruence analysis of point clouds from unstable stereo image sequences
NASA Astrophysics Data System (ADS)
Jepping, C.; Bethmann, F.; Luhmann, T.
2014-06-01
This paper deals with the correction of exterior orientation parameters of stereo image sequences over deformed free-form surfaces without control points. Such imaging situation can occur, for example, during photogrammetric car crash test recordings where onboard high-speed stereo cameras are used to measure 3D surfaces. As a result of such measurements 3D point clouds of deformed surfaces are generated for a complete stereo sequence. The first objective of this research focusses on the development and investigation of methods for the detection of corresponding spatial and temporal tie points within the stereo image sequences (by stereo image matching and 3D point tracking) that are robust enough for a reliable handling of occlusions and other disturbances that may occur. The second objective of this research is the analysis of object deformations in order to detect stable areas (congruence analysis). For this purpose a RANSAC-based method for congruence analysis has been developed. This process is based on the sequential transformation of randomly selected point groups from one epoch to another by using a 3D similarity transformation. The paper gives a detailed description of the congruence analysis. The approach has been tested successfully on synthetic and real image data.
An abundance analysis of Tau Herculis, B5 IV
NASA Technical Reports Server (NTRS)
Adelman, S. J.
1977-01-01
An abundance analysis of the sharp-lined star Tau Herculis (B5 IV) has been performed using a fully line-blanketed model atmosphere. The derived abundances are similar to those of the sun and the normal main-sequence B stars Iota Her (B3 V) and Nu Cap (B9 V).
Lei, Yong-Liang; Wang, Xiao-Guang; Tao, Xiao-Yan; Li, Hao; Meng, Sheng-Li; Chen, Xiu-Ying; Liu, Fu-Ming; Ye, Bi-Feng; Tang, Qing
2010-01-01
Based on sequencing the full-length genomes of four Chinese Ferret-Badger and dog, we analyze the properties of rabies viruses genetic variation in molecular level, get the information about rabies viruses prevalence and variation in Zhejiang, and enrich the genome database of rabies viruses street strains isolated from China. Rabies viruses in suckling mice were isolated, overlapped fragments were amplified by RT-PCR and full-length genomes were assembled to analyze the nucleotide and deduced protein similarities and phylogenetic analyses from Chinese Ferret-Badger, dog, sika deer, vole, used vaccine strain were determined. The four full-length genomes were sequenced completely and had the same genetic structure with the length of 11, 923 nts or 11, 925 nts including 58 nts-Leader, 1353 nts-NP, 894 nts-PP, 609 nts-MP, 1575 nts-GP, 6386 nts-LP, and 2, 5, 5 nts- intergenic regions(IGRs), 423 nts-Pseudogene-like sequence (psi), 70 nts-Trailer. The four full-length genomes were in accordance with the properties of Rhabdoviridae Lyssa virus by BLAST and multi-sequence alignment. The nucleotide and amino acid sequences among Chinese strains had the highest similarity, especially among animals of the same species. Of the four full-length genomes, the similarity in amino acid level was dramatically higher than that in nucleotide level, so the nucleotide mutations happened in these four genomes were most synonymous mutations. Compared with the reference rabies viruses, the lengths of the five protein coding regions had no change, no recombination, only with a few point mutations. It was evident that the five proteins appeared to be stable. The variation sites and types of the four genomes were similar to the reference vaccine or street strains. And the four strains were genotype 1 according to the multi-sequence and phylogenetic analyses, which possessed the distinct district characteristics of China. Therefore, these four rabies viruses are likely to be street viruses already existing in the natural world.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zemla, A; Lang, D; Kostova, T
2010-11-29
Most of the currently used methods for protein function prediction rely on sequence-based comparisons between a query protein and those for which a functional annotation is provided. A serious limitation of sequence similarity-based approaches for identifying residue conservation among proteins is the low confidence in assigning residue-residue correspondences among proteins when the level of sequence identity between the compared proteins is poor. Multiple sequence alignment methods are more satisfactory - still, they cannot provide reliable results at low levels of sequence identity. Our goal in the current work was to develop an algorithm that could overcome these difficulties and facilitatemore » the identification of structurally (and possibly functionally) relevant residue-residue correspondences between compared protein structures. Here we present StralSV, a new algorithm for detecting closely related structure fragments and quantifying residue frequency from tight local structure alignments. We apply StralSV in a study of the RNA-dependent RNA polymerase of poliovirus and demonstrate that the algorithm can be used to determine regions of the protein that are relatively unique or that shared structural similarity with structures that are distantly related. By quantifying residue frequencies among many residue-residue pairs extracted from local alignments, one can infer potential structural or functional importance of specific residues that are determined to be highly conserved or that deviate from a consensus. We further demonstrate that considerable detailed structural and phylogenetic information can be derived from StralSV analyses. StralSV is a new structure-based algorithm for identifying and aligning structure fragments that have similarity to a reference protein. StralSV analysis can be used to quantify residue-residue correspondences and identify residues that may be of particular structural or functional importance, as well as unusual or unexpected residues at a given sequence position.« less
Lara-Ramírez, Edgar E.; Salazar, Ma Isabel; López-López, María de Jesús; Salas-Benito, Juan Santiago; Sánchez-Varela, Alejandro
2014-01-01
The increasing number of dengue virus (DENV) genome sequences available allows identifying the contributing factors to DENV evolution. In the present study, the codon usage in serotypes 1–4 (DENV1–4) has been explored for 3047 sequenced genomes using different statistics methods. The correlation analysis of total GC content (GC) with GC content at the three nucleotide positions of codons (GC1, GC2, and GC3) as well as the effective number of codons (ENC, ENCp) versus GC3 plots revealed mutational bias and purifying selection pressures as the major forces influencing the codon usage, but with distinct pressure on specific nucleotide position in the codon. The correspondence analysis (CA) and clustering analysis on relative synonymous codon usage (RSCU) within each serotype showed similar clustering patterns to the phylogenetic analysis of nucleotide sequences for DENV1–4. These clustering patterns are strongly related to the virus geographic origin. The phylogenetic dependence analysis also suggests that stabilizing selection acts on the codon usage bias. Our analysis of a large scale reveals new feature on DENV genomic evolution. PMID:25136631
Sequence Analysis and Domain Motifs in the Porcine Skin Decorin Glycosaminoglycan Chain*
Zhao, Xue; Yang, Bo; Solakylidirim, Kemal; Joo, Eun Ji; Toida, Toshihiko; Higashi, Kyohei; Linhardt, Robert J.; Li, Lingyun
2013-01-01
Decorin proteoglycan is comprised of a core protein containing a single O-linked dermatan sulfate/chondroitin sulfate glycosaminoglycan (GAG) chain. Although the sequence of the decorin core protein is determined by the gene encoding its structure, the structure of its GAG chain is determined in the Golgi. The recent application of modern MS to bikunin, a far simpler chondroitin sulfate proteoglycans, suggests that it has a single or small number of defined sequences. On this basis, a similar approach to sequence the decorin of porcine skin much larger and more structurally complex dermatan sulfate/chondroitin sulfate GAG chain was undertaken. This approach resulted in information on the consistency/variability of its linkage region at the reducing end of the GAG chain, its iduronic acid-rich domain, glucuronic acid-rich domain, and non-reducing end. A general motif for the porcine skin decorin GAG chain was established. A single small decorin GAG chain was sequenced using MS/MS analysis. The data obtained in the study suggest that the decorin GAG chain has a small or a limited number of sequences. PMID:23423381
Anomaly Detection in Large Sets of High-Dimensional Symbol Sequences
NASA Technical Reports Server (NTRS)
Budalakoti, Suratna; Srivastava, Ashok N.; Akella, Ram; Turkov, Eugene
2006-01-01
This paper addresses the problem of detecting and describing anomalies in large sets of high-dimensional symbol sequences. The approach taken uses unsupervised clustering of sequences using the normalized longest common subsequence (LCS) as a similarity measure, followed by detailed analysis of outliers to detect anomalies. As the LCS measure is expensive to compute, the first part of the paper discusses existing algorithms, such as the Hunt-Szymanski algorithm, that have low time-complexity. We then discuss why these algorithms often do not work well in practice and present a new hybrid algorithm for computing the LCS that, in our tests, outperforms the Hunt-Szymanski algorithm by a factor of five. The second part of the paper presents new algorithms for outlier analysis that provide comprehensible indicators as to why a particular sequence was deemed to be an outlier. The algorithms provide a coherent description to an analyst of the anomalies in the sequence, compared to more normal sequences. The algorithms we present are general and domain-independent, so we discuss applications in related areas such as anomaly detection.
Baraúna, Alexandre C; Rouws, Luc F M; Simoes-Araujo, Jean L; Dos Reis Junior, Fábio B; Iannetta, Pietro P M; Maluk, Marta; Goi, Silvia R; Reis, Veronica M; James, Euan K; Zilli, Jerri E
2016-10-01
Root nodule bacteria were isolated from nodules on Mimosa pudica L. growing in neutral-alkaline soils from the Distrito Federal in central Brazil. The 16S rRNA gene sequence analysis of 10 strains placed them into the genus Rhizobium with the closest neighbouring species (each with 99 % similarity) being Rhizobium grahamii, Rhizobium cauense, Rhizobium mesoamericanum and Rhizobium tibeticum. This high similarity, however, was not confirmed by multi-locus sequence analysis (MLSA) using three housekeeping genes (recA, glnII and rpoB), which revealed R. mesoamericanum CCGE 501T to be the closest type strain (92 % sequence similarity or less). Chemotaxonomic data, including fatty acid profiles [with majority being C19 : 0 cyclo ω8c and summed feature 8 (C18 : 1ω7c/C18 : 1ω6c)], DNA G+C content (57.6 mol%), and carbon compound utilization patterns supported the placement of the novel strains in the genus Rhizobium. Results of average nucleotide identity (ANI) differentiated the novel strains from the closest species of the genus Rhizobium, R. mesoamericanum, R. grahamii and R. tibeticum with 89.0, 88.1 and 87.8 % similarity, respectively. The symbiotic genes essential for nodulation (nodC) and nitrogen fixation (nifH) were most similar (99-100 %) to those of R. mesoamericanum, another Mimosa-nodulating species. Based on the current data, these 10 strains represent a novel species of the genus Rhizobium for which the name Rhizobium altiplani sp. nov. is proposed. The type strain is BR 10423T (=HAMBI 3664T).
The Alveolate Perkinsus marinus: Biological Insights from EST Gene Discovery
2010-01-01
Background Perkinsus marinus, a protozoan parasite of the eastern oyster Crassostrea virginica, has devastated natural and farmed oyster populations along the Atlantic and Gulf coasts of the United States. It is classified as a member of the Perkinsozoa, a recently established phylum considered close to the ancestor of ciliates, dinoflagellates, and apicomplexans, and a key taxon for understanding unique adaptations (e.g. parasitism) within the Alveolata. Despite intense parasite pressure, no disease-resistant oysters have been identified and no effective therapies have been developed to date. Results To gain insight into the biological basis of the parasite's virulence and pathogenesis mechanisms, and to identify genes encoding potential targets for intervention, we generated >31,000 5' expressed sequence tags (ESTs) derived from four trophozoite libraries generated from two P. marinus strains. Trimming and clustering of the sequence tags yielded 7,863 unique sequences, some of which carry a spliced leader. Similarity searches revealed that 55% of these had hits in protein sequence databases, of which 1,729 had their best hit with proteins from the chromalveolates (E-value ≤ 1e-5). Some sequences are similar to those proven to be targets for effective intervention in other protozoan parasites, and include not only proteases, antioxidant enzymes, and heat shock proteins, but also those associated with relict plastids, such as acetyl-CoA carboxylase and methyl erythrithol phosphate pathway components, and those involved in glycan assembly, protein folding/secretion, and parasite-host interactions. Conclusions Our transcriptome analysis of P. marinus, the first for any member of the Perkinsozoa, contributes new insight into its biology and taxonomic position. It provides a very informative, albeit preliminary, glimpse into the expression of genes encoding functionally relevant proteins as potential targets for chemotherapy, and evidence for the presence of a relict plastid. Further, although P. marinus sequences display significant similarity to those from both apicomplexans and dinoflagellates, the presence of trans-spliced transcripts confirms the previously established affinities with the latter. The EST analysis reported herein, together with the recently completed sequence of the P. marinus genome and the development of transfection methodology, should result in improved intervention strategies against dermo disease. PMID:20374649
Wettstein, P J; States, J S
1986-01-01
The extent of polymorphism and the rate of divergence of class I and class II sequences mapping to the mammalian major histocompatibility complex (MHC) have been the subject of experimentation and speculation. To provide further insight into the evolution of the MHC we have initiated the analysis of two geographically isolated subspecies of tassel-eared squirrels. In the preceding communication we described the number and polymorphism of TSLA class I and class II sequences in Kaibab squirrels (S. aberti kaibabensis), which live north of the Grand Canyon. In this report we present a parallel analysis of Abert squirrels (S. aberti aberti), which live south of the Grand Canyon in northern Arizona. Genomic DNA from 12 Abert squirrels was digested with restriction enzymes, electrophoresed, blotted, and hybridized with DR alpha, DR beta, DQ alpha, DQ beta, and HLA-B7 probes. The results of these hybridizations were remarkably similar to those obtained in Kaibab squirrels. The majority of class I and class II bands were identical in size and number, suggesting that Abert and Kaibab squirrels have not significantly diverged in the TSLA complex despite their geographical separation. Relative polymorphism of class II sequences was similar to that observed with Kaibab squirrels: beta sequences exhibited higher polymorphism than alpha sequences. As in Kaibab squirrels, a number of alpha and beta sequences were apparently carried on the same fragments. In comparison to class II beta sequences, there was limited polymorphism in class I sequences, although a diverse number of class I genotypes were observed. Attempts to identify segregating TSLA haplotypes were futile in that the only families of sequences with concordant distributions were DQ alpha and DQ beta. These observations and those obtained with Kaibab squirrels suggest that the present-day TSLA haplotypes of both subspecies are derived from a limited number of common, progenitor haplotypes through repeated intra-TSLA recombination.
Genetic diversity studies in pea (Pisum sativum L.) using simple sequence repeat markers.
Kumari, P; Basal, N; Singh, A K; Rai, V P; Srivastava, C P; Singh, P K
2013-03-13
The genetic diversity among 28 pea (Pisum sativum L.) genotypes was analyzed using 32 simple sequence repeat markers. A total of 44 polymorphic bands, with an average of 2.1 bands per primer, were obtained. The polymorphism information content ranged from 0.657 to 0.309 with an average of 0.493. The variation in genetic diversity among these cultivars ranged from 0.11 to 0.73. Cluster analysis based on Jaccard's similarity coefficient using the unweighted pair-group method with arithmetic mean (UPGMA) revealed 2 distinct clusters, I and II, comprising 6 and 22 genotypes, respectively. Cluster II was further differentiated into 2 subclusters, IIA and IIB, with 12 and 10 genotypes, respectively. Principal component (PC) analysis revealed results similar to those of UPGMA. The first, second, and third PCs contributed 21.6, 16.1, and 14.0% of the variation, respectively; cumulative variation of the first 3 PCs was 51.7%.
Erfan, Ahmed M; Selim, Abdullah A; Naguib, Mahmoud M
2018-06-02
Chicken anemia virus (CAV) is one of the commercially important diseases of poultry worldwide. In Egypt, CAV has been reported to be a potential threat to the commercial poultry sectors. Hence, this study was aimed at isolation and full genomic analysis of CAVs circulating in chicken populations in different geographical location in Egypt. A total of 42 samples were collected from broiler chicken flocks in 9 governorates in Egypt from 12 to 42 days of age. The mortality rate observed among chickens was ranging from 3% to 22%. Nineteen out of 42 farms were found positive for the CAV genome by polymerase chain reaction (PCR). Full genome sequencing was conducted for 18 positive samples. Genetic analysis revealed a high similarity of >99% in 11 viruses with the vaccine strain Del-Ros; while the other seven samples shared close similarity to CAV field strains isolated from China, Taiwan, and Brazil. The data also indicated Q139 and Q144 amino acids substitutions among the VP1 of Egyptian field strains, which are known to be important in virus replication and spread. Phylogenetic analysis of the sequenced viruses (n = 18) based on either the full gene nucleotide sequence or VP1 coding sequence, suggested the circulation of four distinct genotypes in Egypt designated as group A, B, C and D. Moreover, evidence of recombination was detected among four Egyptian CAVs located within group A. The findings of this study succeeded to elucidate the epidemiological and genetic features of CAVs circulating in Egypt, and underscores the important of CAVs surveillance. Copyright © 2018 Elsevier B.V. All rights reserved.
Lee, Hwan Young; Song, Injee; Ha, Eunho; Cho, Sung-Bae; Yang, Woo Ick; Shin, Kyoung-Jin
2008-01-01
Background For the past few years, scientific controversy has surrounded the large number of errors in forensic and literature mitochondrial DNA (mtDNA) data. However, recent research has shown that using mtDNA phylogeny and referring to known mtDNA haplotypes can be useful for checking the quality of sequence data. Results We developed a Web-based bioinformatics resource "mtDNAmanager" that offers a convenient interface supporting the management and quality analysis of mtDNA sequence data. The mtDNAmanager performs computations on mtDNA control-region sequences to estimate the most-probable mtDNA haplogroups and retrieves similar sequences from a selected database. By the phased designation of the most-probable haplogroups (both expected and estimated haplogroups), mtDNAmanager enables users to systematically detect errors whilst allowing for confirmation of the presence of clear key diagnostic mutations and accompanying mutations. The query tools of mtDNAmanager also facilitate database screening with two options of "match" and "include the queried nucleotide polymorphism". In addition, mtDNAmanager provides Web interfaces for users to manage and analyse their own data in batch mode. Conclusion The mtDNAmanager will provide systematic routines for mtDNA sequence data management and analysis via easily accessible Web interfaces, and thus should be very useful for population, medical and forensic studies that employ mtDNA analysis. mtDNAmanager can be accessed at . PMID:19014619
Method and apparatus for biological sequence comparison
Marr, T.G.; Chang, W.I.
1997-12-23
A method and apparatus are disclosed for comparing biological sequences from a known source of sequences, with a subject (query) sequence. The apparatus takes as input a set of target similarity levels (such as evolutionary distances in units of PAM), and finds all fragments of known sequences that are similar to the subject sequence at each target similarity level, and are long enough to be statistically significant. The invention device filters out fragments from the known sequences that are too short, or have a lower average similarity to the subject sequence than is required by each target similarity level. The subject sequence is then compared only to the remaining known sequences to find the best matches. The filtering member divides the subject sequence into overlapping blocks, each block being sufficiently large to contain a minimum-length alignment from a known sequence. For each block, the filter member compares the block with every possible short fragment in the known sequences and determines a best match for each comparison. The determined set of short fragment best matches for the block provide an upper threshold on alignment values. Regions of a certain length from the known sequences that have a mean alignment value upper threshold greater than a target unit score are concatenated to form a union. The current block is compared to the union and provides an indication of best local alignment with the subject sequence. 5 figs.
Method and apparatus for biological sequence comparison
Marr, Thomas G.; Chang, William I-Wei
1997-01-01
A method and apparatus for comparing biological sequences from a known source of sequences, with a subject (query) sequence. The apparatus takes as input a set of target similarity levels (such as evolutionary distances in units of PAM), and finds all fragments of known sequences that are similar to the subject sequence at each target similarity level, and are long enough to be statistically significant. The invention device filters out fragments from the known sequences that are too short, or have a lower average similarity to the subject sequence than is required by each target similarity level. The subject sequence is then compared only to the remaining known sequences to find the best matches. The filtering member divides the subject sequence into overlapping blocks, each block being sufficiently large to contain a minimum-length alignment from a known sequence. For each block, the filter member compares the block with every possible short fragment in the known sequences and determines a best match for each comparison. The determined set of short fragment best matches for the block provide an upper threshold on alignment values. Regions of a certain length from the known sequences that have a mean alignment value upper threshold greater than a target unit score are concatenated to form a union. The current block is compared to the union and provides an indication of best local alignment with the subject sequence.
NASA Astrophysics Data System (ADS)
Radev, Dimitar; Lokshina, Izabella
2010-11-01
The paper examines self-similar (or fractal) properties of real communication network traffic data over a wide range of time scales. These self-similar properties are very different from the properties of traditional models based on Poisson and Markov-modulated Poisson processes. Advanced fractal models of sequentional generators and fixed-length sequence generators, and efficient algorithms that are used to simulate self-similar behavior of IP network traffic data are developed and applied. Numerical examples are provided; and simulation results are obtained and analyzed.
Allali, Imane; Arnold, Jason W; Roach, Jeffrey; Cadenas, Maria Belen; Butz, Natasha; Hassan, Hosni M; Koci, Matthew; Ballou, Anne; Mendoza, Mary; Ali, Rizwana; Azcarate-Peril, M Andrea
2017-09-13
Advancements in Next Generation Sequencing (NGS) technologies regarding throughput, read length and accuracy had a major impact on microbiome research by significantly improving 16S rRNA amplicon sequencing. As rapid improvements in sequencing platforms and new data analysis pipelines are introduced, it is essential to evaluate their capabilities in specific applications. The aim of this study was to assess whether the same project-specific biological conclusions regarding microbiome composition could be reached using different sequencing platforms and bioinformatics pipelines. Chicken cecum microbiome was analyzed by 16S rRNA amplicon sequencing using Illumina MiSeq, Ion Torrent PGM, and Roche 454 GS FLX Titanium platforms, with standard and modified protocols for library preparation. We labeled the bioinformatics pipelines included in our analysis QIIME1 and QIIME2 (de novo OTU picking [not to be confused with QIIME version 2 commonly referred to as QIIME2]), QIIME3 and QIIME4 (open reference OTU picking), UPARSE1 and UPARSE2 (each pair differs only in the use of chimera depletion methods), and DADA2 (for Illumina data only). GS FLX+ yielded the longest reads and highest quality scores, while MiSeq generated the largest number of reads after quality filtering. Declines in quality scores were observed starting at bases 150-199 for GS FLX+ and bases 90-99 for MiSeq. Scores were stable for PGM-generated data. Overall microbiome compositional profiles were comparable between platforms; however, average relative abundance of specific taxa varied depending on sequencing platform, library preparation method, and bioinformatics analysis. Specifically, QIIME with de novo OTU picking yielded the highest number of unique species and alpha diversity was reduced with UPARSE and DADA2 compared to QIIME. The three platforms compared in this study were capable of discriminating samples by treatment, despite differences in diversity and abundance, leading to similar biological conclusions. Our results demonstrate that while there were differences in depth of coverage and phylogenetic diversity, all workflows revealed comparable treatment effects on microbial diversity. To increase reproducibility and reliability and to retain consistency between similar studies, it is important to consider the impact on data quality and relative abundance of taxa when selecting NGS platforms and analysis tools for microbiome studies.
Pryde, S E; Richardson, A J; Stewart, C S; Flint, H J
1999-12-01
Random clones of 16S ribosomal DNA gene sequences were isolated after PCR amplification with eubacterial primers from total genomic DNA recovered from samples of the colonic lumen, colonic wall, and cecal lumen from a pig. Sequences were also obtained for cultures isolated anaerobically from the same colonic-wall sample. Phylogenetic analysis showed that many sequences were related to those of Lactobacillus or Streptococcus spp. or fell into clusters IX, XIVa, and XI of gram-positive bacteria. In addition, 59% of randomly cloned sequences showed less than 95% similarity to database entries or sequences from cultivated organisms. Cultivation bias is also suggested by the fact that the majority of isolates (54%) recovered from the colon wall by culturing were related to Lactobacillus and Streptococcus, whereas this group accounted for only one-third of the sequence variation for the same sample from random cloning. The remaining cultured isolates were mainly Selenomonas related. A higher proportion of Lactobacillus reuteri-related sequences than of Lactobacillus acidophilus- and Lactobacillus amylovorus-related sequences were present in the colonic-wall sample. Since the majority of bacterial ribosomal sequences recovered from the colon wall are less than 95% related to known organisms, the roles of many of the predominant wall-associated bacteria remain to be defined.
Pryde, Susan E.; Richardson, Anthony J.; Stewart, Colin S.; Flint, Harry J.
1999-01-01
Random clones of 16S ribosomal DNA gene sequences were isolated after PCR amplification with eubacterial primers from total genomic DNA recovered from samples of the colonic lumen, colonic wall, and cecal lumen from a pig. Sequences were also obtained for cultures isolated anaerobically from the same colonic-wall sample. Phylogenetic analysis showed that many sequences were related to those of Lactobacillus or Streptococcus spp. or fell into clusters IX, XIVa, and XI of gram-positive bacteria. In addition, 59% of randomly cloned sequences showed less than 95% similarity to database entries or sequences from cultivated organisms. Cultivation bias is also suggested by the fact that the majority of isolates (54%) recovered from the colon wall by culturing were related to Lactobacillus and Streptococcus, whereas this group accounted for only one-third of the sequence variation for the same sample from random cloning. The remaining cultured isolates were mainly Selenomonas related. A higher proportion of Lactobacillus reuteri-related sequences than of Lactobacillus acidophilus- and Lactobacillus amylovorus-related sequences were present in the colonic-wall sample. Since the majority of bacterial ribosomal sequences recovered from the colon wall are less than 95% related to known organisms, the roles of many of the predominant wall-associated bacteria remain to be defined. PMID:10583991
Huang, Chunqiong; Liu, Guodao; Bai, Changjun; Wang, Wenqiang
2014-10-21
Although Cynodon dactylon (C. dactylon) is widely distributed in China, information on its genetic diversity within the germplasm pool is limited. The objective of this study was to reveal the genetic variation and relationships of 430 C. dactylon accessions collected from 22 Chinese provinces using sequence-related amplified polymorphism (SRAP) markers. Fifteen primer pairs were used to amplify specific C. dactylon genomic sequences. A total of 481 SRAP fragments were generated, with fragment sizes ranging from 260-1800 base pairs (bp). Genetic similarity coefficients (GSC) among the 430 accessions averaged 0.72 and ranged from 0.53-0.96. Cluster analysis conducted by two methods, namely the unweighted pair-group method with arithmetic averages (UPGMA) and principle coordinate analysis (PCoA), separated the accessions into eight distinct groups. Our findings verify that Chinese C. dactylon germplasms have rich genetic diversity, which is an excellent basis for C. dactylon breeding for new cultivars.
Canine Lat1: molecular structure, distribution and its expression in cancer samples.
Ochiai, Hideharu; Morishita, Taiki; Onda, Ken; Sugiyama, Hiroki; Maruo, Takuya
2012-07-01
A full-length cDNA sequence of canine L-type amino acid transporter 1 (Lat1) was determined from a canine brain. The sequence was 1828 bp long and was predicted to encode 485 amino acid polypeptides. The deduced amino acid sequence of canine Lat1 showed 93.2% and 91.1% similarities to those of humans and rats, respectively. Northern blot analysis detected Lat1 expression in the cerebellum at 4 kb, and Western blot analysis showed a single band at 40 kDa. RT-PCR analysis revealed a distinct expression of Lat1 in the pancreas and testis in addition to the cerebrum and cerebellum. Notably, Lat1 expression was observed in the tissues of thyroid cancer, melanoma and hemangiopericytoma. Although the cancer samples examined were not enough, Lat1 may serve as a useful biomarker of cancer cells in veterinary clinic.
Molecular and Physiological Analysis of a Heat-Shock Response in Wheat 1
McElwain, Elizabeth F.; Spiker, Steven
1992-01-01
We have isolated two cDNA clones from wheat (Triticum aestivum L. var Stephens), designated WHSP16.8 and WHSP16.9, that are highly similar in sequence to the low molecular weight heat-shock protein genes previously isolated from soybean. RNA blot analysis confirms that these sequences are present in heat-shocked wheat seedlings, but not in control tissues. The WHSP16.8 and WHSP16.9 cDNAs were isolated by screening a lambda gt11 expression library with antibodies to HMGc (a chromosomal protein of wheat). Immunoblot analysis has demonstrated that the antibodies raised against HMGc also recognize a group of proteins that are induced by heat shock and have molecular weights (estimated by sodium dodecyl sulfate electrophoresis) consistent with the molecular weights of the proteins deduced from the sequences of the cDNAs. ImagesFigure 3Figure 4Figure 5 PMID:16669058
Analysis of Neuronal Sequences Using Pairwise Biases
2015-08-27
semantic memory (knowledge of facts) and implicit memory (e.g., how to ride a bike ). Evidence for the participation of the hippocampus in the formation of...hippocampal formation in an attempt to be cured of severe epileptic seizures. Although the surgery was successful in regards to reducing the frequency and...very different from each other in many ways including duration and number of spikes. Still, these sequences share a similar trend in the general order
Structure-Based Phylogenetic Analysis of the Lipocalin Superfamily.
Lakshmi, Balasubramanian; Mishra, Madhulika; Srinivasan, Narayanaswamy; Archunan, Govindaraju
2015-01-01
Lipocalins constitute a superfamily of extracellular proteins that are found in all three kingdoms of life. Although very divergent in their sequences and functions, they show remarkable similarity in 3-D structures. Lipocalins bind and transport small hydrophobic molecules. Earlier sequence-based phylogenetic studies of lipocalins highlighted that they have a long evolutionary history. However the molecular and structural basis of their functional diversity is not completely understood. The main objective of the present study is to understand functional diversity of the lipocalins using a structure-based phylogenetic approach. The present study with 39 protein domains from the lipocalin superfamily suggests that the clusters of lipocalins obtained by structure-based phylogeny correspond well with the functional diversity. The detailed analysis on each of the clusters and sub-clusters reveals that the 39 lipocalin domains cluster based on their mode of ligand binding though the clustering was performed on the basis of gross domain structure. The outliers in the phylogenetic tree are often from single member families. Also structure-based phylogenetic approach has provided pointers to assign putative function for the domains of unknown function in lipocalin family. The approach employed in the present study can be used in the future for the functional identification of new lipocalin proteins and may be extended to other protein families where members show poor sequence similarity but high structural similarity.
A generalized association test based on U statistics.
Wei, Changshuai; Lu, Qing
2017-07-01
Second generation sequencing technologies are being increasingly used for genetic association studies, where the main research interest is to identify sets of genetic variants that contribute to various phenotypes. The phenotype can be univariate disease status, multivariate responses and even high-dimensional outcomes. Considering the genotype and phenotype as two complex objects, this also poses a general statistical problem of testing association between complex objects. We here proposed a similarity-based test, generalized similarity U (GSU), that can test the association between complex objects. We first studied the theoretical properties of the test in a general setting and then focused on the application of the test to sequencing association studies. Based on theoretical analysis, we proposed to use Laplacian Kernel-based similarity for GSU to boost power and enhance robustness. Through simulation, we found that GSU did have advantages over existing methods in terms of power and robustness. We further performed a whole genome sequencing (WGS) scan for Alzherimer's disease neuroimaging initiative data, identifying three genes, APOE , APOC1 and TOMM40 , associated with imaging phenotype. We developed a C ++ package for analysis of WGS data using GSU. The source codes can be downloaded at https://github.com/changshuaiwei/gsu . weichangshuai@gmail.com ; qlu@epi.msu.edu. Supplementary data are available at Bioinformatics online. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com
GeneBee-net: Internet-based server for analyzing biopolymers
DOE Office of Scientific and Technical Information (OSTI.GOV)
Brodsky, L.I.; Ivanov, V.V.; Nikolaev, V.K.
This work describes a network server for searching databanks of biopolymer structures and performing other biocomputing procedures; it is available via direct Internet connection. Basic server procedures are dedicated to homology (similarity) search of sequence and 3D structure of proteins. The homologies found could be used to build multiple alignments, predict protein and RNA secondary structure, and construct phylogenetic trees. In addition to traditional methods of sequence similarity search, the authors propose {open_quotes}non-matrix{close_quotes} (correlational) search. An analogous approach is used to identify regions of similar tertiary structure of proteins. Algorithm concepts and usage examples are presented for new methods. Servicemore » logic is based upon interaction of a client program and server procedures. The client program allows the compilation of queries and the processing of results of an analysis.« less
Grau, Jan; Reschke, Maik; Erkes, Annett; Streubel, Jana; Morgan, Richard D.; Wilson, Geoffrey G.; Koebnik, Ralf; Boch, Jens
2016-01-01
Transcription activator-like effectors (TALEs) are virulence factors, produced by the bacterial plant-pathogen Xanthomonas, that function as gene activators inside plant cells. Although the contribution of individual TALEs to infectivity has been shown, the specific roles of most TALEs, and the overall TALE diversity in Xanthomonas spp. is not known. TALEs possess a highly repetitive DNA-binding domain, which is notoriously difficult to sequence. Here, we describe an improved method for characterizing TALE genes by the use of PacBio sequencing. We present ‘AnnoTALE’, a suite of applications for the analysis and annotation of TALE genes from Xanthomonas genomes, and for grouping similar TALEs into classes. Based on these classes, we propose a unified nomenclature for Xanthomonas TALEs that reveals similarities pointing to related functionalities. This new classification enables us to compare related TALEs and to identify base substitutions responsible for the evolution of TALE specificities. PMID:26876161
Comparative Analysis of Expressed Genes from Cacao Meristems Infected by Moniliophthora perniciosa
Gesteira, Abelmon S.; Micheli, Fabienne; Carels, Nicolas; Da Silva, Aline C.; Gramacho, Karina P.; Schuster, Ivan; Macêdo, Joci N.; Pereira, Gonçalo A. G.; Cascardo, Júlio C. M.
2007-01-01
Background and Aims Witches' broom disease is caused by the hemibiotrophic basidiomycete Moniliophthora perniciosa, and is one of the most important diseases of cacao in the western hemisphere. Because very little is known about the global process of such disease development, expressed sequence tags (ESTs) were used to identify genes expressed during the Theobroma cacao–Moniliophthora perniciosa interaction. Methods Two cDNA libraries corresponding to the resistant (RT) and susceptible (SP) cacao–M. perniciosa interactions were constructed from total RNA, using the DB SMART Creator cDNA library kit (Clontech). Clones were randomly selected, sequenced from the 5′ end and analysed using bioinformatics tools including in silico analysis of the differential gene expression. Key Results A total of 6884 ESTs were generated from the RT and SP cDNA libraries. These ESTs were composed of 2585 singlets and 341 contigs for a total of 2926 non-redundant sequences. The redundancy of the libraries was low and their specificity high when compared with the few other cacao libraries already published. Sequence analysis allowed the assignment of a putative functional category for 54 % of sequences, whereas approx. 22 % of sequences corresponded to unknown function and approx. 24 % of sequences did not show any significant similarity with other proteins present in the database. Despite the similar overall distribution of the sequences in functional categories between the two libraries, qualitative differences were observed. Genes involved during the defence response to pathogen infection or in programmed cell death were identified, such as pathogenesis related-proteins, trypsin inhibitor or oxalate oxidase, and some of them showed an in silico differential expression between the resistant and the susceptible interactions. Conclusions As far as is known this is the first EST resource from the cacao–M. perniciosa interaction and it is believed that it will provide a significant contribution to the understanding of the molecular mechanisms of the resistance and susceptibility of cacao to M. perniciosa, to develop strategies to control witches broom, and as a source of polymorphism for molecular marker development and marker-assisted selection. PMID:17557832
Characterization of tannase protein sequences of bacteria and fungi: an in silico study.
Banerjee, Amrita; Jana, Arijit; Pati, Bikash R; Mondal, Keshab C; Das Mohapatra, Pradeep K
2012-04-01
The tannase protein sequences of 149 bacteria and 36 fungi were retrieved from NCBI database. Among them only 77 bacterial and 31 fungal tannase sequences were taken which have different amino acid compositions. These sequences were analysed for different physical and chemical properties, superfamily search, multiple sequence alignment, phylogenetic tree construction and motif finding to find out the functional motif and the evolutionary relationship among them. The superfamily search for these tannase exposed the occurrence of proline iminopeptidase-like, biotin biosynthesis protein BioH, O-acetyltransferase, carboxylesterase/thioesterase 1, carbon-carbon bond hydrolase, haloperoxidase, prolyl oligopeptidase, C-terminal domain and mycobacterial antigens families and alpha/beta hydrolase superfamily. Some bacterial and fungal sequence showed similarity with different families individually. The multiple sequence alignment of these tannase protein sequences showed conserved regions at different stretches with maximum homology from amino acid residues 389-469 and 482-523 which could be used for designing degenerate primers or probes specific for tannase producing bacterial and fungal species. Phylogenetic tree showed two different clusters; one has only bacteria and another have both fungi and bacteria showing some relationship between these different genera. Although in second cluster near about all fungal species were found together in a corner which indicates the sequence level similarity among fungal genera. The distributions of fourteen motifs analysis revealed Motif 1 with a signature amino acid sequence of 29 amino acids, i.e. GCSTGGREALKQAQRWPHDYDGIIANNPA, was uniformly observed in 83.3 % of studied tannase sequences representing its participation with the structure and enzymatic function.
It's all relative: ranking the diversity of aquatic bacterial communities.
Shaw, Allison K; Halpern, Aaron L; Beeson, Karen; Tran, Bao; Venter, J Craig; Martiny, Jennifer B H
2008-09-01
The study of microbial diversity patterns is hampered by the enormous diversity of microbial communities and the lack of resources to sample them exhaustively. For many questions about richness and evenness, however, one only needs to know the relative order of diversity among samples rather than total diversity. We used 16S libraries from the Global Ocean Survey to investigate the ability of 10 diversity statistics (including rarefaction, non-parametric, parametric, curve extrapolation and diversity indices) to assess the relative diversity of six aquatic bacterial communities. Overall, we found that the statistics yielded remarkably similar rankings of the samples for a given sequence similarity cut-off. This correspondence, despite the different underlying assumptions of the statistics, suggests that diversity statistics are a useful tool for ranking samples of microbial diversity. In addition, sequence similarity cut-off influenced the diversity ranking of the samples, demonstrating that diversity statistics can also be used to detect differences in phylogenetic structure among microbial communities. Finally, a subsampling analysis suggests that further sequencing from these particular clone libraries would not have substantially changed the richness rankings of the samples.
Improving protein complex classification accuracy using amino acid composition profile.
Huang, Chien-Hung; Chou, Szu-Yu; Ng, Ka-Lok
2013-09-01
Protein complex prediction approaches are based on the assumptions that complexes have dense protein-protein interactions and high functional similarity between their subunits. We investigated those assumptions by studying the subunits' interaction topology, sequence similarity and molecular function for human and yeast protein complexes. Inclusion of amino acids' physicochemical properties can provide better understanding of protein complex properties. Principal component analysis is carried out to determine the major features. Adopting amino acid composition profile information with the SVM classifier serves as an effective post-processing step for complexes classification. Improvement is based on primary sequence information only, which is easy to obtain. Copyright © 2013 Elsevier Ltd. All rights reserved.
Primary and secondary structural analyses of glutathione S-transferase pi from human placenta.
Ahmad, H; Wilson, D E; Fritz, R R; Singh, S V; Medh, R D; Nagle, G T; Awasthi, Y C; Kurosky, A
1990-05-01
The primary structure of glutathione S-transferase (GST) pi from a single human placenta was determined. The structure was established by chemical characterization of tryptic and cyanogen bromide peptides as well as automated sequence analysis of the intact enzyme. The structural analysis indicated that the protein is comprised of 209 amino acid residues and gave no evidence of post-translational modifications. The amino acid sequence differed from that of the deduced amino acid sequence determined by nucleotide sequence analysis of a cDNA clone (Kano, T., Sakai, M., and Muramatsu, M., 1987, Cancer Res. 47, 5626-5630) at position 104 which contained both valine and isoleucine whereas the deduced sequence from nucleotide sequence analysis identified only isoleucine at this position. These results demonstrated that in the one individual placenta studied at least two GST pi genes are coexpressed, probably as a result of allelomorphism. Computer assisted consensus sequence evaluation identified a hydrophobic region in GST pi (residues 155-181) that was predicted to be either a buried transmembrane helical region or a signal sequence region. The significance of this hydrophobic region was interpreted in relation to the mode of action of the enzyme especially in regard to the potential involvement of a histidine in the active site mechanism. A comparison of the chemical similarity of five known human GST complete enzyme structures, one of pi, one of mu, two of alpha, and one microsomal, gave evidence that all five enzymes have evolved by a divergent evolutionary process after gene duplication, with the microsomal enzyme representing the most divergent form.
Dialog detection in narrative video by shot and face analysis
NASA Astrophysics Data System (ADS)
Kroon, B.; Nesvadba, J.; Hanjalic, A.
2007-01-01
The proliferation of captured personal and broadcast content in personal consumer archives necessitates comfortable access to stored audiovisual content. Intuitive retrieval and navigation solutions require however a semantic level that cannot be reached by generic multimedia content analysis alone. A fusion with film grammar rules can help to boost the reliability significantly. The current paper describes the fusion of low-level content analysis cues including face parameters and inter-shot similarities to segment commercial content into film grammar rule-based entities and subsequently classify those sequences into so-called shot reverse shots, i.e. dialog sequences. Moreover shot reverse shot specific mid-level cues are analyzed augmenting the shot reverse shot information with dialog specific descriptions.
Hughes, Paul; Deng, Wenjie; Olson, Scott C; Coombs, Robert W; Chung, Michael H; Frenkel, Lisa M
2016-03-01
Accurate analysis of minor populations of drug-resistant HIV requires analysis of a sufficient number of viral templates. We assessed the effect of experimental conditions on the analysis of HIV pol 454 pyrosequences generated from plasma using (1) the "Insertion-deletion (indel) and Carry Forward Correction" (ICC) pipeline, which clusters sequence reads using a nonsubstitution approach and can correct for indels and carry forward errors, and (2) the "Primer Identification (ID)" method, which facilitates construction of a consensus sequence to correct for sequencing errors and allelic skewing. The Primer ID and ICC methods produced similar estimates of viral diversity, but differed in the number of sequence variants generated. Sequence preparation for ICC was comparably simple, but was limited by an inability to assess the number of templates analyzed and allelic skewing. The more costly Primer ID method corrected for allelic skewing and provided the number of viral templates analyzed, which revealed that amplifiable HIV templates varied across specimens and did not correlate with clinical viral load. This latter observation highlights the value of the Primer ID method, which by determining the number of templates amplified, enables more accurate assessment of minority species in the virus population, which may be relevant to prescribing effective antiretroviral therapy.
Sequence information signal processor
Peterson, John C.; Chow, Edward T.; Waterman, Michael S.; Hunkapillar, Timothy J.
1999-01-01
An electronic circuit is used to compare two sequences, such as genetic sequences, to determine which alignment of the sequences produces the greatest similarity. The circuit includes a linear array of series-connected processors, each of which stores a single element from one of the sequences and compares that element with each successive element in the other sequence. For each comparison, the processor generates a scoring parameter that indicates which segment ending at those two elements produces the greatest degree of similarity between the sequences. The processor uses the scoring parameter to generate a similar scoring parameter for a comparison between the stored element and the next successive element from the other sequence. The processor also delivers the scoring parameter to the next processor in the array for use in generating a similar scoring parameter for another pair of elements. The electronic circuit determines which processor and alignment of the sequences produce the scoring parameter with the highest value.
Analysis of Ribosome Inactivating Protein (RIP): A Bioinformatics Approach
NASA Astrophysics Data System (ADS)
Jothi, G. Edward Gnana; Majilla, G. Sahaya Jose; Subhashini, D.; Deivasigamani, B.
2012-10-01
In spite of the medical advances in recent years, the world is in need of different sources to encounter certain health issues.Ribosome Inactivating Proteins (RIPs) were found to be one among them. In order to get easy access about RIPs, there is a need to analyse RIPs towards constructing a database on RIPs. Also, multiple sequence alignment was done towards screening for homologues of significant RIPs from rare sources against RIPs from easily available sources in terms of similarity. Protein sequences were retrieved from SWISS-PROT and are further analysed using pair wise and multiple sequence alignment.Analysis shows that, 151 RIPs have been characterized to date. Amongst them, there are 87 type I, 37 type II, 1 type III and 25 unknown RIPs. The sequence length information of various RIPs about the availability of full or partial sequence was also found. The multiple sequence alignment of 37 type I RIP using the online server Multalin, indicates the presence of 20 conserved residues. Pairwise alignment and multiple sequence alignment of certain selected RIPs in two groups namely Group I and Group II were carried out and the consensus level was found to be 98%, 98% and 90% respectively.
Bartho, Joseph D.; Bellini, Dom; Wuerges, Jochen; Demitri, Nicola; Toccafondi, Mirco; Schmitt, Armin O.; Zhao, Youfu; Walsh, Martin A.
2017-01-01
AmyR is a stress and virulence associated protein from the plant pathogenic Enterobacteriaceae species Erwinia amylovora, and is a functionally conserved ortholog of YbjN from Escherichia coli. The crystal structure of E. amylovora AmyR reveals a class I type III secretion chaperone-like fold, despite the lack of sequence similarity between these two classes of protein and lacking any evidence of a secretion-associated role. The results indicate that AmyR, and YbjN proteins in general, function through protein-protein interactions without any enzymatic action. The YbjN proteins of Enterobacteriaceae show remarkably low sequence similarity with other members of the YbjN protein family in Eubacteria, yet a high level of structural conservation is observed. Across the YbjN protein family sequence conservation is limited to residues stabilising the protein core and dimerization interface, while interacting regions are only conserved between closely related species. This study presents the first structure of a YbjN protein from Enterobacteriaceae, the most highly divergent and well-studied subgroup of YbjN proteins, and an in-depth sequence and structural analysis of this important but poorly understood protein family. PMID:28426806
Bartho, Joseph D; Bellini, Dom; Wuerges, Jochen; Demitri, Nicola; Toccafondi, Mirco; Schmitt, Armin O; Zhao, Youfu; Walsh, Martin A; Benini, Stefano
2017-01-01
AmyR is a stress and virulence associated protein from the plant pathogenic Enterobacteriaceae species Erwinia amylovora, and is a functionally conserved ortholog of YbjN from Escherichia coli. The crystal structure of E. amylovora AmyR reveals a class I type III secretion chaperone-like fold, despite the lack of sequence similarity between these two classes of protein and lacking any evidence of a secretion-associated role. The results indicate that AmyR, and YbjN proteins in general, function through protein-protein interactions without any enzymatic action. The YbjN proteins of Enterobacteriaceae show remarkably low sequence similarity with other members of the YbjN protein family in Eubacteria, yet a high level of structural conservation is observed. Across the YbjN protein family sequence conservation is limited to residues stabilising the protein core and dimerization interface, while interacting regions are only conserved between closely related species. This study presents the first structure of a YbjN protein from Enterobacteriaceae, the most highly divergent and well-studied subgroup of YbjN proteins, and an in-depth sequence and structural analysis of this important but poorly understood protein family.
Yasuno, Rie; Wada, Hajime
1998-01-01
Lipoic acid is a coenzyme that is essential for the activity of enzyme complexes such as those of pyruvate dehydrogenase and glycine decarboxylase. We report here the isolation and characterization of LIP1 cDNA for lipoic acid synthase of Arabidopsis. The Arabidopsis LIP1 cDNA was isolated using an expressed sequence tag homologous to the lipoic acid synthase of Escherichia coli. This cDNA was shown to code for Arabidopsis lipoic acid synthase by its ability to complement a lipA mutant of E. coli defective in lipoic acid synthase. DNA-sequence analysis of the LIP1 cDNA revealed an open reading frame predicting a protein of 374 amino acids. Comparisons of the deduced amino acid sequence with those of E. coli and yeast lipoic acid synthase homologs showed a high degree of sequence similarity and the presence of a leader sequence presumably required for import into the mitochondria. Southern-hybridization analysis suggested that LIP1 is a single-copy gene in Arabidopsis. Western analysis with an antibody against lipoic acid synthase demonstrated that this enzyme is located in the mitochondrial compartment in Arabidopsis cells as a 43-kD polypeptide. PMID:9808738
Barony, Gustavo M; Tavares, Guilherme C; Pereira, Felipe L; Carvalho, Alex F; Dorella, Fernanda A; Leal, Carlos A G; Figueiredo, Henrique C P
2017-10-19
Streptococcus agalactiae is a major pathogen and a hindrance on tilapia farming worldwide. The aims of this work were to analyze the genomic evolution of Brazilian strains of S. agalactiae and to establish spatial and temporal relations between strains isolated from different outbreaks of streptococcosis. A total of 39 strains were obtained from outbreaks and their whole genomes were sequenced and annotated for comparative analysis of multilocus sequence typing, genomic similarity and whole genome multilocus sequence typing (wgMLST). The Brazilian strains presented two sequence types, including a newly described ST, and a non-typeable lineage. The use of wgMLST could differentiate each strain in a single clone and was used to establish temporal and geographical correlations among strains. Bayesian phylogenomic analysis suggests that the studied Brazilian population was co-introduced in the country with their host, approximately 60 years ago. Brazilian strains of S. agalactiae were shown to be heterogeneous in their genome sequences and were distributed in different regions of the country according to their genotype, which allowed the use of wgMLST analysis to track each outbreak event individually.
The complete nucleotide sequence of RNA 3 of a peach isolate of Prunus necrotic ringspot virus.
Hammond, R W; Crosslin, J M
1995-04-01
The complete nucleotide sequence of RNA 3 of the PE-5 peach isolate of Prunus necrotic ringspot ilarvirus (PNRSV) was obtained from cloned cDNA. The RNA sequence is 1941 nucleotides and contains two open reading frames (ORFs). ORF 1 consisted of 284 amino acids with a calculated molecular weight of 31,729 Da and ORF 2 contained 224 amino acids with a calculated molecular weight of 25,018 Da. ORF 2 corresponds to the coat protein gene. Expression of ORF 2 engineered into a pTrcHis vector in Escherichia coli results in a fusion polypeptide of approximately 28 kDa which cross-reacts with PNRSV polyclonal antiserum. Analysis of the coat protein amino acid sequence reveals a putative "zinc-finger" domain at the amino-terminal portion of the protein. Two tetranucleotide AUGC motifs occur in the 3'-UTR of the RNA and may function in coat protein binding and genome activation. ORF 1 homologies to other ilarviruses and alfalfa mosaic virus are confined to limited regions of conserved amino acids. The translated amino acid sequence of the coat protein gene shows 92% similarity to one isolate of apple mosaic virus, a closely related member of the ilarvirus group of plant viruses, but only 66% similarity to the amino acid sequence of the coat protein gene of a second isolate. These relationships are also reflected at the nucleotide sequence level. These results in one instance confirm the close similarities observed at the biophysical and serological levels between these two viruses, but on the other hand call into question the nomenclature used to describe these viruses.
Beccari, T; Hoade, J; Orlacchio, A; Stirling, J L
1992-01-01
cDNAs encoding the mouse beta-N-acetylhexosaminidase alpha-subunit were isolated from a mouse testis library. The longest of these (1.7 kb) was sequenced and showed 83% similarity with the human alpha-subunit cDNA sequence. The 5' end of the coding sequence was obtained from a genomic DNA clone. Alignment of the human and mouse sequences showed that all three putative N-glycosylation sites are conserved, but that the mouse alpha-subunit has an additional site towards the C-terminus. All eight cysteines in the human sequence are conserved in the mouse. There are an additional two cysteines in the mouse alpha-subunit signal peptide. All amino acids affected in Tay-Sachs-disease mutations are conserved in the mouse. Images Fig. 1. PMID:1379046
Deciphering the genomic targets of alkylating polyamide conjugates using high-throughput sequencing
Chandran, Anandhakumar; Syed, Junetha; Taylor, Rhys D.; Kashiwazaki, Gengo; Sato, Shinsuke; Hashiya, Kaori; Bando, Toshikazu; Sugiyama, Hiroshi
2016-01-01
Chemically engineered small molecules targeting specific genomic sequences play an important role in drug development research. Pyrrole-imidazole polyamides (PIPs) are a group of molecules that can bind to the DNA minor-groove and can be engineered to target specific sequences. Their biological effects rely primarily on their selective DNA binding. However, the binding mechanism of PIPs at the chromatinized genome level is poorly understood. Herein, we report a method using high-throughput sequencing to identify the DNA-alkylating sites of PIP-indole-seco-CBI conjugates. High-throughput sequencing analysis of conjugate 2 showed highly similar DNA-alkylating sites on synthetic oligos (histone-free DNA) and on human genomes (chromatinized DNA context). To our knowledge, this is the first report identifying alkylation sites across genomic DNA by alkylating PIP conjugates using high-throughput sequencing. PMID:27098039
Garland, Ellen C.; Rendell, Luke; Lamoni, Luca; Poole, M. Michael; Noad, Michael J.
2017-01-01
Cultural processes occur in a wide variety of animal taxa, from insects to cetaceans. The songs of humpback whales are one of the most striking examples of the transmission of a cultural trait and social learning in any nonhuman animal. To understand how songs are learned, we investigate rare cases of song hybridization, where parts of an existing song are spliced with a new one, likely before an individual totally adopts the new song. Song unit sequences were extracted from over 9,300 phrases recorded during two song revolutions across the South Pacific Ocean, allowing fine-scale analysis of composition and sequencing. In hybrid songs the current and new songs were spliced together in two specific ways: (i) singers placed a single hybrid phrase, in which content from both songs were combined, between the two song types when transitioning from one to the other, and/or (ii) singers spliced complete themes from the revolutionary song into the current song. Sequence analysis indicated that both processes were governed by structural similarity rules. Hybrid phrases or theme substitutions occurred at points in the songs where both songs contained “similar sounds arranged in a similar pattern.” Songs appear to be learned as segments (themes/phrase types), akin to birdsong and human language acquisition, and these can be combined in predictable ways if the underlying structural pattern is similar. These snapshots of song change provide insights into the mechanisms underlying song learning in humpback whales, and comparative perspectives on the evolution of human language and culture. PMID:28739940
Garland, Ellen C; Rendell, Luke; Lamoni, Luca; Poole, M Michael; Noad, Michael J
2017-07-24
Cultural processes occur in a wide variety of animal taxa, from insects to cetaceans. The songs of humpback whales are one of the most striking examples of the transmission of a cultural trait and social learning in any nonhuman animal. To understand how songs are learned, we investigate rare cases of song hybridization, where parts of an existing song are spliced with a new one, likely before an individual totally adopts the new song. Song unit sequences were extracted from over 9,300 phrases recorded during two song revolutions across the South Pacific Ocean, allowing fine-scale analysis of composition and sequencing. In hybrid songs the current and new songs were spliced together in two specific ways: ( i ) singers placed a single hybrid phrase, in which content from both songs were combined, between the two song types when transitioning from one to the other, and/or ( ii ) singers spliced complete themes from the revolutionary song into the current song. Sequence analysis indicated that both processes were governed by structural similarity rules. Hybrid phrases or theme substitutions occurred at points in the songs where both songs contained "similar sounds arranged in a similar pattern." Songs appear to be learned as segments (themes/phrase types), akin to birdsong and human language acquisition, and these can be combined in predictable ways if the underlying structural pattern is similar. These snapshots of song change provide insights into the mechanisms underlying song learning in humpback whales, and comparative perspectives on the evolution of human language and culture.
Huh, T L; Ryu, J H; Huh, J W; Sung, H C; Oh, I U; Song, B J; Veech, R L
1993-01-01
Mitochondrial NADP(+)-specific isocitrate dehydrogenase (IDP) was co-purified with the pyruvate dehydrogenase complex from bovine kidney mitochondria. The determination of its N-terminal 16-amino-acid sequence revealed that it is highly similar to the IDP from yeast. A cDNA clone (1.8 kb long) encoding this protein was isolated from a bovine kidney lambda gt11 cDNA library using a synthetic oligodeoxynucleotide. The deduced protein sequence of this cDNA clone rendered a precursor protein of 452 amino-acid residues (50,830 Da) and a mature protein of 413 amino-acid residues (46,519 Da). It is 100% identical to the internal tryptic peptide sequences of the autologous form from pig heart and 62% similar to that from yeast. However, it shares little similarity with the mitochondrial NAD(+)-specific isoenzyme from yeast. Structural analyses of the deduced proteins of IDP isoenzymes from different species indicated that similarity exists in certain regions, which may represent the common domains for the active sites or coenzyme-binding sites. In Northern-blot analysis, one species of mRNA (about 2.2 kb for both bovine and human) was hybridized with a 32P-labelled cDNA probe. Southern-blot analysis of genomic DNAs verified simple patterns of hybridization with this cDNA. These results strongly indicate that the mitochondrial IDP may be derived from a single gene family which does not appear to be closely related to that of the NAD(+)-specific isoenzyme. Images Figure 1 Figure 3 Figure 4 Figure 5 PMID:8318002
Mucosal and Cutaneous Human Papillomaviruses Detected in Raw Sewages
La Rosa, Giuseppina; Fratini, Marta; Accardi, Luisa; D'Oro, Graziana; Della Libera, Simonetta; Muscillo, Michele; Di Bonito, Paola
2013-01-01
Epitheliotropic viruses can find their way into sewage. The aim of the present study was to investigate the occurrence, distribution, and genetic diversity of Human Papillomaviruses (HPVs) in urban wastewaters. Sewage samples were collected from treatment plants distributed throughout Italy. The DNA extracted from these samples was analyzed by PCR using five PV-specific sets of primers targeting the L1 (GP5/GP6, MY09/MY11, FAP59/64, SKF/SKR) and E1 regions (PM-A/PM-B), according to the protocols previously validated for the detection of mucosal and cutaneous HPV genotypes. PCR products underwent sequencing analysis and the sequences were aligned to reference genomes from the Papillomavirus Episteme database. Phylogenetic analysis was then performed to assess the genetic relationships among the different sequences and between the sequences of the samples and those of the prototype strains. A broad spectrum of sequences related to mucosal and cutaneous HPV types was detected in 81% of the sewage samples analyzed. Surprisingly, sequences related to the anogenital HPV6 and 11 were detected in 19% of the samples, and sequences related to the “high risk” oncogenic HPV16 were identified in two samples. Sequences related to HPV9, HPV20, HPV25, HPV76, HPV80, HPV104, HPV110, HPV111, HPV120 and HPV145 beta Papillomaviruses were detected in 76% of the samples. In addition, similarity searches and phylogenetic analysis of some sequences suggest that they could belong to putative new genotypes of the beta genus. In this study, for the first time, the presence of HPV viruses strongly related to human cancer is reported in sewage samples. Our data increases the knowledge of HPV genomic diversity and suggests that virological analysis of urban sewage can provide key information useful in supporting epidemiological studies. PMID:23341898
Synthesis of labeled meropenem for the analysis of M. tuberculosis transpeptidases.
Kastrinsky, David B; Barry, Clifton E
2010-01-01
A concise synthesis of (14)C labeled meropenem prepared from (14)C dimethylamine hydrochloride is described. Using a similar reaction sequence, the meropenem nucleus was also attached to biotin providing a probe for protein interaction studies.
Gulitz, A; Stadie, J; Ehrmann, M A; Ludwig, W; Vogel, R F
2013-04-01
The aim of this study was to analyse the bacterial microbiota of water kefir using culture-independent methods. We compared four water kefirs of different origins using 16S rDNA amplicon sequencing and ARDRA. The microbiota consisted of different proportions of the genera Lactobacillus (Lact.), Leuconostoc (Leuc.), Acetobacter (Acet.) and Gluconobacter. Surprisingly, varying but consistently high numbers of sequences representing members of the genus Bifidobacterium (Bif.) were found in all kefirs. Whereas part of the bifidobacterial sequences could be assigned to Bifidobacterium psychraerophilum, a majority of sequences identical to each other could not be assigned to any known species. A nearly full-length sequence of the latter exhibited a beyond-species similarity (96.4%) with the sequence from the closest relative species Bif. psychraerophilum. A Bifidobacterium-specific ARDRA analysis reflected the abundance of the novel Bifidobacterium species by revealing its unique MboI restriction profile. Attempts to isolate the bifidobacteria were successful for Bif. psychraerophilum only. The complexity of the water kefir microbiota has been underestimated in previously studies. The occurrence of bifidobacteria as part of the consortium is novel. These data give new insights into the understanding of the complexity of food fermentations and underline the need for approaches detecting noncultivable organisms. © 2013 The Society for Applied Microbiology.
CMSA: a heterogeneous CPU/GPU computing system for multiple similar RNA/DNA sequence alignment.
Chen, Xi; Wang, Chen; Tang, Shanjiang; Yu, Ce; Zou, Quan
2017-06-24
The multiple sequence alignment (MSA) is a classic and powerful technique for sequence analysis in bioinformatics. With the rapid growth of biological datasets, MSA parallelization becomes necessary to keep its running time in an acceptable level. Although there are a lot of work on MSA problems, their approaches are either insufficient or contain some implicit assumptions that limit the generality of usage. First, the information of users' sequences, including the sizes of datasets and the lengths of sequences, can be of arbitrary values and are generally unknown before submitted, which are unfortunately ignored by previous work. Second, the center star strategy is suited for aligning similar sequences. But its first stage, center sequence selection, is highly time-consuming and requires further optimization. Moreover, given the heterogeneous CPU/GPU platform, prior studies consider the MSA parallelization on GPU devices only, making the CPUs idle during the computation. Co-run computation, however, can maximize the utilization of the computing resources by enabling the workload computation on both CPU and GPU simultaneously. This paper presents CMSA, a robust and efficient MSA system for large-scale datasets on the heterogeneous CPU/GPU platform. It performs and optimizes multiple sequence alignment automatically for users' submitted sequences without any assumptions. CMSA adopts the co-run computation model so that both CPU and GPU devices are fully utilized. Moreover, CMSA proposes an improved center star strategy that reduces the time complexity of its center sequence selection process from O(mn 2 ) to O(mn). The experimental results show that CMSA achieves an up to 11× speedup and outperforms the state-of-the-art software. CMSA focuses on the multiple similar RNA/DNA sequence alignment and proposes a novel bitmap based algorithm to improve the center star strategy. We can conclude that harvesting the high performance of modern GPU is a promising approach to accelerate multiple sequence alignment. Besides, adopting the co-run computation model can maximize the entire system utilization significantly. The source code is available at https://github.com/wangvsa/CMSA .
Silva, F.V.; Simões-Araújo, J.L.; Silva Júnior, J.P.; Xavier, G.R.; Rumjanek, N.G.
2012-01-01
The aim of this work was to characterize rhizobia isolated from the root nodules of cowpea (Vigna unguiculata) plants cultivated in Amazon soils samples by means of ARDRA (Amplified rDNA Restriction Analysis) and sequencing analysis, to know their phylogenetic relationships. The 16S rRNA gene of rhizobia was amplified by PCR (polymerase chain reaction) using universal primers Y1 and Y3. The amplification products were analyzed by the restriction enzymes HinfI, MspI and DdeI and also sequenced with Y1, Y3 and six intermediate primers. The clustering analysis based on ARDRA profiles separated the Amazon isolates in three subgroups, which formed a group apart from the reference isolates of Bradyrhizobium japonicum and Bradyrhizobium elkanii. The clustering analysis of 16S rRNA gene sequences showed that the fast-growing isolates had similarity with Enterobacter, Rhizobium, Klebsiella and Bradyrhizobium and all the slow-growing clustered close to Bradyrhizobium. PMID:24031880
Rapid Identification of Sequences for Orphan Enzymes to Power Accurate Protein Annotation
Ojha, Sunil; Watson, Douglas S.; Bomar, Martha G.; Galande, Amit K.; Shearer, Alexander G.
2013-01-01
The power of genome sequencing depends on the ability to understand what those genes and their proteins products actually do. The automated methods used to assign functions to putative proteins in newly sequenced organisms are limited by the size of our library of proteins with both known function and sequence. Unfortunately this library grows slowly, lagging well behind the rapid increase in novel protein sequences produced by modern genome sequencing methods. One potential source for rapidly expanding this functional library is the “back catalog” of enzymology – “orphan enzymes,” those enzymes that have been characterized and yet lack any associated sequence. There are hundreds of orphan enzymes in the Enzyme Commission (EC) database alone. In this study, we demonstrate how this orphan enzyme “back catalog” is a fertile source for rapidly advancing the state of protein annotation. Starting from three orphan enzyme samples, we applied mass-spectrometry based analysis and computational methods (including sequence similarity networks, sequence and structural alignments, and operon context analysis) to rapidly identify the specific sequence for each orphan while avoiding the most time- and labor-intensive aspects of typical sequence identifications. We then used these three new sequences to more accurately predict the catalytic function of 385 previously uncharacterized or misannotated proteins. We expect that this kind of rapid sequence identification could be efficiently applied on a larger scale to make enzymology’s “back catalog” another powerful tool to drive accurate genome annotation. PMID:24386392
Rapid identification of sequences for orphan enzymes to power accurate protein annotation.
Ramkissoon, Kevin R; Miller, Jennifer K; Ojha, Sunil; Watson, Douglas S; Bomar, Martha G; Galande, Amit K; Shearer, Alexander G
2013-01-01
The power of genome sequencing depends on the ability to understand what those genes and their proteins products actually do. The automated methods used to assign functions to putative proteins in newly sequenced organisms are limited by the size of our library of proteins with both known function and sequence. Unfortunately this library grows slowly, lagging well behind the rapid increase in novel protein sequences produced by modern genome sequencing methods. One potential source for rapidly expanding this functional library is the "back catalog" of enzymology--"orphan enzymes," those enzymes that have been characterized and yet lack any associated sequence. There are hundreds of orphan enzymes in the Enzyme Commission (EC) database alone. In this study, we demonstrate how this orphan enzyme "back catalog" is a fertile source for rapidly advancing the state of protein annotation. Starting from three orphan enzyme samples, we applied mass-spectrometry based analysis and computational methods (including sequence similarity networks, sequence and structural alignments, and operon context analysis) to rapidly identify the specific sequence for each orphan while avoiding the most time- and labor-intensive aspects of typical sequence identifications. We then used these three new sequences to more accurately predict the catalytic function of 385 previously uncharacterized or misannotated proteins. We expect that this kind of rapid sequence identification could be efficiently applied on a larger scale to make enzymology's "back catalog" another powerful tool to drive accurate genome annotation.
Estimation of pairwise sequence similarity of mammalian enhancers with word neighbourhood counts.
Göke, Jonathan; Schulz, Marcel H; Lasserre, Julia; Vingron, Martin
2012-03-01
The identity of cells and tissues is to a large degree governed by transcriptional regulation. A major part is accomplished by the combinatorial binding of transcription factors at regulatory sequences, such as enhancers. Even though binding of transcription factors is sequence-specific, estimating the sequence similarity of two functionally similar enhancers is very difficult. However, a similarity measure for regulatory sequences is crucial to detect and understand functional similarities between two enhancers and will facilitate large-scale analyses like clustering, prediction and classification of genome-wide datasets. We present the standardized alignment-free sequence similarity measure N2, a flexible framework that is defined for word neighbourhoods. We explore the usefulness of adding reverse complement words as well as words including mismatches into the neighbourhood. On simulated enhancer sequences as well as functional enhancers in mouse development, N2 is shown to outperform previous alignment-free measures. N2 is flexible, faster than competing methods and less susceptible to single sequence noise and the occurrence of repetitive sequences. Experiments on the mouse enhancers reveal that enhancers active in different tissues can be separated by pairwise comparison using N2. N2 represents an improvement over previous alignment-free similarity measures without compromising speed, which makes it a good candidate for large-scale sequence comparison of regulatory sequences. The software is part of the open-source C++ library SeqAn (www.seqan.de) and a compiled version can be downloaded at http://www.seqan.de/projects/alf.html. Supplementary data are available at Bioinformatics online.
The siRNA Non-seed Region and Its Target Sequences Are Auxiliary Determinants of Off-Target Effects.
Kamola, Piotr J; Nakano, Yuko; Takahashi, Tomoko; Wilson, Paul A; Ui-Tei, Kumiko
2015-12-01
RNA interference (RNAi) is a powerful tool for post-transcriptional gene silencing. However, the siRNA guide strand may bind unintended off-target transcripts via partial sequence complementarity by a mechanism closely mirroring micro RNA (miRNA) silencing. To better understand these off-target effects, we investigated the correlation between sequence features within various subsections of siRNA guide strands, and its corresponding target sequences, with off-target activities. Our results confirm previous reports that strength of base-pairing in the siRNA seed region is the primary factor determining the efficiency of off-target silencing. However, the degree of downregulation of off-target transcripts with shared seed sequence is not necessarily similar, suggesting that there are additional auxiliary factors that influence the silencing potential. Here, we demonstrate that both the melting temperature (Tm) in a subsection of siRNA non-seed region, and the GC contents of its corresponding target sequences, are negatively correlated with the efficiency of off-target effect. Analysis of experimentally validated miRNA targets demonstrated a similar trend, indicating a putative conserved mechanistic feature of seed region-dependent targeting mechanism. These observations may prove useful as parameters for off-target prediction algorithms and improve siRNA 'specificity' design rules.
Extensive concerted evolution of rice paralogs and the road to regaining independence.
Wang, Xiyin; Tang, Haibao; Bowers, John E; Feltus, Frank A; Paterson, Andrew H
2007-11-01
Many genes duplicated by whole-genome duplications (WGDs) are more similar to one another than expected. We investigated whether concerted evolution through conversion and crossing over, well-known to affect tandem gene clusters, also affects dispersed paralogs. Genome sequences for two Oryza subspecies reveal appreciable gene conversion in the approximately 0.4 MY since their divergence, with a gradual progression toward independent evolution of older paralogs. Since divergence from subspecies indica, approximately 8% of japonica paralogs produced 5-7 MYA on chromosomes 11 and 12 have been affected by gene conversion and several reciprocal exchanges of chromosomal segments, while approximately 70-MY-old "paleologs" resulting from a genome duplication (GD) show much less conversion. Sequence similarity analysis in proximal gene clusters also suggests more conversion between younger paralogs. About 8% of paleologs may have been converted since rice-sorghum divergence approximately 41 MYA. Domain-encoding sequences are more frequently converted than nondomain sequences, suggesting a sort of circularity--that sequences conserved by selection may be further conserved by relatively frequent conversion. The higher level of concerted evolution in the 5-7 MY-old segmental duplication may reflect the behavior of many genomes within the first few million years after duplication or polyploidization.
Kraatz, Mareike; Wallace, R John; Svensson, Liselott
2011-04-01
Strain A2 is an anaerobic, variably Gram-stain-positive, non-spore-forming, small and irregularly rod-shaped bacterium from the ruminal fluid of a sheep that has been described informally as a representative of 'Olsenella (basonym Atopobium) oviles'. Three phenotypically similar bacterial strains (lac15, lac16 and lac31(T)) were isolated in concert with Veillonella magna lac18(T) from the mucosal jejunum of a pig. A phylogenetic analysis based on 16S rRNA gene sequences revealed that strains A2, lac15, lac16 and lac31(T) formed a genetically coherent group (100 % interstrain sequence similarity) within the bigeneric Olsenella-Atopobium branch of the family Coriobacteriaceae, class Actinobacteria. This group was most closely related to the type strains of the two recognized Olsenella species, namely Olsenella uli (sequence similarity of 96.85 %) and Olsenella profusa (sequence similarity of 97.20 %). The sequence similarity to the type strain of Atopobium minutum, the type species of the genus Atopobium, was 92.33 %. Unlike those of O. uli and O. profusa, outgrown colonies of strains A2, lac15, lac16 and lac31(T) were opaque and greyish-white with an umbonate elevation on solid culture media. The four novel strains were characterized as being well-adapted and presumably indigenous to the gastrointestinal tract of homoeothermic vertebrates: they were mesophilic, microaerotolerant, neutrophilic and acidotolerant, bile-resistant, mucin-utilizing and markedly peptidolytic lactic acid bacteria. The results of DNA-DNA hybridizations, cellular fatty acid analysis and other differential phenotypic (physiological and biochemical) tests confirmed that strains A2, lac15, lac16 and lac31(T) represent a novel species of the genus Olsenella. On the basis of the genotypic and phenotypic results, we therefore describe Olsenella umbonata sp. nov., with lac31(T) ( = CCUG 58604(T) = DSM 22620(T) = JCM 16156(T)) as the type strain and A2 ( = CCUG 58212 = DSM 22619 = JCM 16157) as an additionally available reference strain. Also, based on our data, we propose emended descriptions of the genus Olsenella and the species Olsenella uli and Olsenella profusa.
Fuller, Nicholas J.; Wilson, William H.; Joint, Ian R.; Mann, Nicholas H.
1998-01-01
Viruses are ubiquitous components of marine ecosystems and are known to infect unicellular phycoerythrin-containing cyanobacteria belonging to the genus Synechococcus. A conserved region from the cyanophage genome was identified in three genetically distinct cyanomyoviruses, and a sequence analysis revealed that this region exhibited significant similarity to a gene encoding a capsid assembly protein (gp20) from the enteric coliphage T4. The results of a comparison of gene 20 sequences from three cyanomyoviruses and T4 allowed us to design two degenerate PCR primers, CPS1 and CPS2, which specifically amplified a 165-bp region from the majority of cyanomyoviruses tested. A competitive PCR (cPCR) analysis revealed that cyanomyovirus strains could be accurately enumerated, and it was demonstrated that quantification was log-linear over ca. 3 orders of magnitude. Different calibration curves were obtained for each of the three cyanomyovirus strains tested; consequently, cPCR performed with primers CPS1 and CPS2 could lead to substantial inaccuracies in estimates of phage abundance in natural assemblages. Further sequence analysis of cyanomyovirus gene 20 homologs would be necessary in order to design primers which do not exhibit phage-to-phage variability in priming efficiency. It was demonstrated that PCR products of the correct size could be amplified from seawater samples following 100× concentration and even directly without any prior concentration. Hence, the use of degenerate primers in PCR analyses of cyanophage populations should provide valuable data on the diversity of cyanophages in natural assemblages. Further optimization of procedures may ultimately lead to a sensitive assay which can be used to analyze natural cyanophage populations both quantitatively (by cPCR) and qualitatively following phylogenetic analysis of amplified products. PMID:9603813
2015-01-01
Abstract Trees contribute to enormous plant oil reserves because many trees contain 50%–80% of oil (triacylglycerols, TAGs) in the fruits and kernels. TAGs accumulate in subcellular structures called oil bodies/droplets, in which TAGs are covered by low-molecular-mass hydrophobic proteins called oleosins (OLEs). The OLEs/TAGs ratio determines the size and shape of intracellular oil bodies. There is a lack of comprehensive sequence analysis and structural information of OLEs among diverse trees. The objectives of this study were to identify OLEs from 22 tree species (e.g., tung tree, tea-oil tree, castor bean), perform genome-wide analysis of OLEs, classify OLEs, identify conserved sequence motifs and amino acid residues, and predict secondary and three-dimensional structures in tree OLEs and OLE subfamilies. Data mining identified 65 OLEs with perfect conservation of the “proline knot” motif (PX5SPX3P) from 19 trees. These OLEs contained >40% hydrophobic amino acid residues. They displayed similar properties and amino acid composition. Genome-wide phylogenetic analysis and multiple sequence alignment demonstrated that these proteins could be classified into five OLE subfamilies. There were distinct patterns of sequence conservation among the OLE subfamilies and within individual tree species. Computational modeling indicated that OLEs were composed of at least three α-helixes connected with short coils without any β-strand and that they exhibited distinct 3D structures and ligand binding sites. These analyses provide fundamental information in the similarity and specificity of diverse OLE isoforms within the same subfamily and among the different species, which should facilitate studying the structure-function relationship and identify critical amino acid residues in OLEs for metabolic engineering of tree TAGs. PMID:26258573
Cao, Heping
2015-09-01
Trees contribute to enormous plant oil reserves because many trees contain 50%-80% of oil (triacylglycerols, TAGs) in the fruits and kernels. TAGs accumulate in subcellular structures called oil bodies/droplets, in which TAGs are covered by low-molecular-mass hydrophobic proteins called oleosins (OLEs). The OLEs/TAGs ratio determines the size and shape of intracellular oil bodies. There is a lack of comprehensive sequence analysis and structural information of OLEs among diverse trees. The objectives of this study were to identify OLEs from 22 tree species (e.g., tung tree, tea-oil tree, castor bean), perform genome-wide analysis of OLEs, classify OLEs, identify conserved sequence motifs and amino acid residues, and predict secondary and three-dimensional structures in tree OLEs and OLE subfamilies. Data mining identified 65 OLEs with perfect conservation of the "proline knot" motif (PX5SPX3P) from 19 trees. These OLEs contained >40% hydrophobic amino acid residues. They displayed similar properties and amino acid composition. Genome-wide phylogenetic analysis and multiple sequence alignment demonstrated that these proteins could be classified into five OLE subfamilies. There were distinct patterns of sequence conservation among the OLE subfamilies and within individual tree species. Computational modeling indicated that OLEs were composed of at least three α-helixes connected with short coils without any β-strand and that they exhibited distinct 3D structures and ligand binding sites. These analyses provide fundamental information in the similarity and specificity of diverse OLE isoforms within the same subfamily and among the different species, which should facilitate studying the structure-function relationship and identify critical amino acid residues in OLEs for metabolic engineering of tree TAGs.
Pallavi, Tokala; Chandra, Rampalli Viswa; Reddy, Aileni Amarender; Reddy, Bavigadda Harish; Naveen, Anumala
2016-01-01
Context: The inflammatory processes involved in chronic periodontitis and coronary artery diseases (CADs) are similar and produce reactive oxygen species that may result in similar somatic mutations in mitochondrial deoxyribonucleic acid (mtDNA). Aims: The aims of the present study were to identify somatic mtDNA mutations in periodontal and cardiac tissues from subjects undergoing coronary artery bypass surgery and determine what fraction was identical and unique to these tissues. Settings and Design: The study population consisted of 30 chronic periodontitis subjects who underwent coronary artery surgery after an angiogram had indicated CAD. Materials and Methods: Gingival tissue samples were taken from the site with deepest probing depth; coronary artery tissue samples were taken during the coronary artery bypass grafting procedures, and blood samples were drawn during this surgical procedure. These samples were stored under aseptic conditions and later transported for mtDNA analysis. Statistical Analysis Used: Complete mtDNA sequences were obtained and aligned with the revised Cambridge reference sequence (NC_012920) using sequence analysis and auto assembler tools. Results: Among the complete mtDNA sequences, a total of 162 variations were spread across the whole mitochondrial genome and present only in the coronary artery and the gingival tissue samples but not in the blood samples. Among the 162 variations, 12 were novel and four of the 12 novel variations were found in mitochondrial NADH dehydrogenase subunit 5 complex I gene (33.3%). Conclusions: Analysis of mtDNA mutations indicated 162 variants unique to periodontitis and CAD. Of these, 12 were novel and may have resulted from destructive oxidative forces common to these two diseases. PMID:27041832
2014-01-01
Background Osteopontin (Eta, secreted sialoprotein 1, opn) is secreted from different cell types including cancer cells. Three splice variant forms namely osteopontin-a, osteopontin-b and osteopontin-c have been identified. The main astonishing feature is that osteopontin-c is found to be elevated in almost all types of cancer cells. This was the vital point to consider it for sequence analysis and structure predictions which provide ample chances for prognostic, therapeutic and preventive cancer research. Methods Osteopontin-c gene sequence was determined from Breast Cancer sample and was translated to protein sequence. It was then analyzed using various software and web tools for binding pockets, docking and druggability analysis. Due to the lack of homological templates, tertiary structure was predicted using ab-initio method server – I-TASSER and was evaluated after refinement using web tools. Refined structure was compared with known bone sialoprotein electron microscopic structure and docked with CD44 for binding analysis and binding pockets were identified for drug designing. Results Signal sequence of about sixteen amino acid residues was identified using signal sequence prediction servers. Due to the absence of known structures of similar proteins, three dimensional structure of osteopontin-c was predicted using I-TASSER server. The predicted structure was refined with the help of SUMMA server and was validated using SAVES server. Molecular dynamic analysis was carried out using GROMACS software. The final model was built and was used for docking with CD44. Druggable pockets were identified using pocket energies. Conclusions The tertiary structure of osteopontin-c was predicted successfully using the ab-initio method and the predictions showed that osteopontin-c is of fibrous nature comparable to firbronectin. Docking studies showed the significant similarities of QSAET motif in the interaction of CD44 and osteopontins between the normal and splice variant forms of osteopontins and binding pockets analyses revealed several pockets which paved the way to the identification of a druggable pocket. PMID:24401206
Chryseobacterium chaponense sp. nov., isolated from farmed Atlantic salmon (Salmo salar).
Kämpfer, Peter; Fallschissel, Kerstin; Avendaño-Herrera, Ruben
2011-03-01
Two bacterial strains, designated Sa 1147-06(T) and Sa 1143-06, were isolated from Atlantic salmon (Salmo salar) farmed in Lake Chapo, Chile, and were studied using a polyphasic approach. Both isolates were very similar; cells were rod-shaped, formed yellow-pigmented colonies and were Gram-reaction-negative. Based on 16S rRNA gene sequence analysis, strains Sa 1147-06(T) and Sa 1143-06 shared 100 % sequence similarity and showed 98.9 and 97.5 % sequence similarity to Chryseobacterium jeonii AT1047(T) and Chryseobacterium antarcticum AT1013(T), respectively. Sequence similarities to all other members of the genus Chryseobacterium were below 97.3 %. The major fatty acids of strain Sa 1147-06(T) were iso-C₁₃:₀, iso-C₁₅:₀, anteiso-C₁₅:₀ and iso-C₁₇:₁ω9c, with iso-C₁₅:₀ 3-OH, iso-C₁₆:₀ 3-OH and iso-C₁₇:₀ 3-OH constituting the major hydroxylated fatty acids. DNA-DNA hybridizations with C. jeonii JMSNU 14049(T) and C. antarcticum JMNSU 14040(T) gave relatedness values of 20.7 % (reciprocal 15.1 %) and 15.7 % (reciprocal 25.7 %), respectively. Together, the DNA-DNA hybridization results and differentiating biochemical properties showed that strains Sa 1147-06(T) and Sa 1143-06 represent a novel species, for which the name Chryseobacterium chaponense sp. nov. is proposed. The type strain is Sa 1147-06(T) (=DSM 23145(T) =CCM 7737(T)).
Is the phonological similarity effect in working memory due to proactive interference?
Baddeley, Alan D; Hitch, Graham J; Quinlan, Philip T
2018-04-12
Immediate serial recall of verbal material is highly sensitive to impairment attributable to phonological similarity. Although this has traditionally been interpreted as a within-sequence similarity effect, Engle (2007) proposed an interpretation based on interference from prior sequences, a phenomenon analogous to that found in the Peterson short-term memory (STM) task. We use the method of serial reconstruction to test this in an experiment contrasting the standard paradigm in which successive sequences are drawn from the same set of phonologically similar or dissimilar words and one in which the vowel sound on which similarity is based is switched from trial to trial, a manipulation analogous to that producing release from PI in the Peterson task. A substantial similarity effect occurs under both conditions although there is a small advantage from switching across similar sequences. There is, however, no evidence for the suggestion that the similarity effect will be absent from the very first sequence tested. Our results support the within-sequence similarity rather than a between-list PI interpretation. Reasons for the contrast with the classic Peterson short-term forgetting task are briefly discussed. (PsycINFO Database Record (c) 2018 APA, all rights reserved).
Genetic characterization of K13965, a strain of Oak Vale virus from Western Australia
Quan, Phenix-Lan; Williams, David T.; Johansen, Cheryl A.; Jain, Komal; Petrosov, Alexandra; Diviney, Sinead M.; Tashmukhamedova, Alla; Hutchison, Stephen K.; Tesh, Robert B.; Mackenzie, John S.; Briese, Thomas; Lipkin, W. Ian
2011-01-01
K13965, an uncharacterized virus, was isolated in 1993 from Anopheles annulipes mosquitoes collected in the Kimberley region of northern Western Australia. Here, we report its genomic sequence, identify it as a rhabdovirus, and characterize its phylogenetic relationships. The genome comprises a P′ (C) and SH protein similar to the recently characterized Tupaia and Durham viruses, and shows overlap between G and L genes. Comparison of K13965 genome sequence to other rhabdoviruses identified K13965 as a strain of the unclassified Australian Oak Vale rhabdovirus, whose complete genome sequence we also determined. Phylogenetic analysis of N and L sequences indicated genetic relationship to a recently proposed Sandjima virus clade, although the Oak Vale virus sequences form a branch separate from the African members of that group. PMID:21740935
Winnowing DNA for Rare Sequences: Highly Specific Sequence and Methylation Based Enrichment
Thompson, Jason D.; Shibahara, Gosuke; Rajan, Sweta; Pel, Joel; Marziali, Andre
2012-01-01
Rare mutations in cell populations are known to be hallmarks of many diseases and cancers. Similarly, differential DNA methylation patterns arise in rare cell populations with diagnostic potential such as fetal cells circulating in maternal blood. Unfortunately, the frequency of alleles with diagnostic potential, relative to wild-type background sequence, is often well below the frequency of errors in currently available methods for sequence analysis, including very high throughput DNA sequencing. We demonstrate a DNA preparation and purification method that through non-linear electrophoretic separation in media containing oligonucleotide probes, achieves 10,000 fold enrichment of target DNA with single nucleotide specificity, and 100 fold enrichment of unmodified methylated DNA differing from the background by the methylation of a single cytosine residue. PMID:22355378
de Vries, G E; Arfman, N; Terpstra, P; Dijkhuizen, L
1992-01-01
The gene (mdh) coding for methanol dehydrogenase (MDH) of thermotolerant, methylotroph Bacillus methanolicus C1 has been cloned and sequenced. The deduced amino acid sequence of the mdh gene exhibited similarity to those of five other alcohol dehydrogenase (type III) enzymes, which are distinct from the long-chain zinc-containing (type I) or short-chain zinc-lacking (type II) enzymes. Highly efficient expression of the mdh gene in Escherichia coli was probably driven from its own promoter sequence. After purification of MDH from E. coli, the kinetic and biochemical properties of the enzyme were investigated. The physiological effect of MDH synthesis in E. coli and the role of conserved sequence patterns in type III alcohol dehydrogenases have been analyzed and are discussed. Images PMID:1644761
srRNA evolution and phylogenetic relationships of the genus Naegleria (Protista: Rhizopoda).
Baverstock, P R; Illana, S; Christy, P E; Robinson, B S; Johnson, A M
1989-05-01
A rapid RNA sequencing technique was used to partially sequence the small-subunit ribosomal RNA (srRNA) of four species of the amoeboid genus Naegleria. The extent of nucleotide sequence divergence between the two most divergent species was roughly similar to that found between mammals and frogs. However, the pattern of variation among the Naegleria species was quite different from that found for those species of tetrapods characterized to date. A phylogenetic analysis of the consensus Naegleria sequence showed that Naegleria was not monophyletic with either Acanthamoeba castellanii or Dictyostelium discoideum, two other amoebas for which sequences were available. It was shown that the semiconserved regions of the srRNA molecule evolve in a clocklike fashion and that the clock is time dependent rather than generation dependent.
Albayrak, Levent; Khanipov, Kamil; Pimenova, Maria; Golovko, George; Rojas, Mark; Pavlidis, Ioannis; Chumakov, Sergei; Aguilar, Gerardo; Chávez, Arturo; Widger, William R; Fofanov, Yuriy
2016-12-12
Low-abundance mutations in mitochondrial populations (mutations with minor allele frequency ≤ 1%), are associated with cancer, aging, and neurodegenerative disorders. While recent progress in high-throughput sequencing technology has significantly improved the heteroplasmy identification process, the ability of this technology to detect low-abundance mutations can be affected by the presence of similar sequences originating from nuclear DNA (nDNA). To determine to what extent nDNA can cause false positive low-abundance heteroplasmy calls, we have identified mitochondrial locations of all subsequences that are common or similar (one mismatch allowed) between nDNA and mitochondrial DNA (mtDNA). Performed analysis revealed up to a 25-fold variation in the lengths of longest common and longest similar (one mismatch allowed) subsequences across the mitochondrial genome. The size of the longest subsequences shared between nDNA and mtDNA in several regions of the mitochondrial genome were found to be as low as 11 bases, which not only allows using these regions to design new, very specific PCR primers, but also supports the hypothesis of the non-random introduction of mtDNA into the human nuclear DNA. Analysis of the mitochondrial locations of the subsequences shared between nDNA and mtDNA suggested that even very short (36 bases) single-end sequencing reads can be used to identify low-abundance variation in 20.4% of the mitochondrial genome. For longer (76 and 150 bases) reads, the proportion of the mitochondrial genome where nDNA presence will not interfere found to be 44.5 and 67.9%, when low-abundance mutations at 100% of locations can be identified using 417 bases long single reads. This observation suggests that the analysis of low-abundance variations in mitochondria population can be extended to a variety of large data collections such as NCBI Sequence Read Archive, European Nucleotide Archive, The Cancer Genome Atlas, and International Cancer Genome Consortium.
Kobayashi, Michie; Hiraka, Yukie; Abe, Akira; Yaegashi, Hiroki; Natsume, Satoshi; Kikuchi, Hideko; Takagi, Hiroki; Saitoh, Hiromasa; Win, Joe; Kamoun, Sophien; Terauchi, Ryohei
2017-11-22
Downy mildew, caused by the oomycete pathogen Sclerospora graminicola, is an economically important disease of Gramineae crops including foxtail millet (Setaria italica). Plants infected with S. graminicola are generally stunted and often undergo a transformation of flower organs into leaves (phyllody or witches' broom), resulting in serious yield loss. To establish the molecular basis of downy mildew disease in foxtail millet, we carried out whole-genome sequencing and an RNA-seq analysis of S. graminicola. Sequence reads were generated from S. graminicola using an Illumina sequencing platform and assembled de novo into a draft genome sequence comprising approximately 360 Mbp. Of this sequence, 73% comprised repetitive elements, and a total of 16,736 genes were predicted from the RNA-seq data. The predicted genes included those encoding effector-like proteins with high sequence similarity to those previously identified in other oomycete pathogens. Genes encoding jacalin-like lectin-domain-containing secreted proteins were enriched in S. graminicola compared to other oomycetes. Of a total of 1220 genes encoding putative secreted proteins, 91 significantly changed their expression levels during the infection of plant tissues compared to the sporangia and zoospore stages of the S. graminicola lifecycle. We established the draft genome sequence of a downy mildew pathogen that infects Gramineae plants. Based on this sequence and our transcriptome analysis, we generated a catalog of in planta-induced candidate effector genes, providing a solid foundation from which to identify the effectors causing phyllody.
BM-Map: Bayesian Mapping of Multireads for Next-Generation Sequencing Data
Ji, Yuan; Xu, Yanxun; Zhang, Qiong; Tsui, Kam-Wah; Yuan, Yuan; Norris, Clift; Liang, Shoudan; Liang, Han
2011-01-01
Summary Next-generation sequencing (NGS) technology generates millions of short reads, which provide valuable information for various aspects of cellular activities and biological functions. A key step in NGS applications (e.g., RNA-Seq) is to map short reads to correct genomic locations within the source genome. While most reads are mapped to a unique location, a significant proportion of reads align to multiple genomic locations with equal or similar numbers of mismatches; these are called multireads. The ambiguity in mapping the multireads may lead to bias in downstream analyses. Currently, most practitioners discard the multireads in their analysis, resulting in a loss of valuable information, especially for the genes with similar sequences. To refine the read mapping, we develop a Bayesian model that computes the posterior probability of mapping a multiread to each competing location. The probabilities are used for downstream analyses, such as the quantification of gene expression. We show through simulation studies and RNA-Seq analysis of real life data that the Bayesian method yields better mapping than the current leading methods. We provide a C++ program for downloading that is being packaged into a user-friendly software. PMID:21517792
Naqvi, Ahmad Abu Turab; Ahmad, Faizan; Hassan, Md Imtaiyaz
2015-01-01
Mycobacterium leprae is an intracellular obligate parasite that causes leprosy in humans, and it leads to the destruction of peripheral nerves and skin deformation. Here, we report an extensive analysis of the hypothetical proteins (HPs) from M. leprae strain Br4923, assigning their functions to better understand the mechanism of pathogenesis and to search for potential therapeutic interventions. The genome of M. leprae encodes 1604 proteins, of which the functions of 632 are not known (HPs). In this paper, we predicted the probable functions of 312 HPs. First, we classified all HPs into families and subfamilies on the basis of sequence similarity, followed by domain assignment, which provides many clues for their possible function. However, the functions of 320 proteins were not predicted because of low sequence similarity with proteins of known function. Annotated HPs were categorized into enzymes, binding proteins, transporters, and proteins involved in cellular processes. We found several novel proteins whose functions were unknown for M. leprae. These proteins have a requisite association with bacterial virulence and pathogenicity. Finally, our sequence-based analysis will be helpful for further validation and the search for potential drug targets while developing effective drugs to cure leprosy.
Novel FAM20A mutation causes autosomal recessive amelogenesis imperfecta.
Volodarsky, Michael; Zilberman, Uri; Birk, Ohad S
2015-06-01
To relate the peculiar phenotype of amelogenesis imperfecta in a large Bedouin family to the genotype determined by whole genome linkage analysis. Amelogenesis imperfecta (AI) is a broad group of inherited pathologies affecting enamel formation, characterized by variability in phenotypes, causing mutations and modes of inheritance. Autosomal recessive or compound heterozygous mutations in FAM20A, encoding sequence similarity 20, member A, have been shown to cause several AI phenotypes. Five members from a large consanguineous Bedouin family presented with hypoplastic amelogenesis imperfecta with unerupted and resorbed permanent molars. Following Soroka Medical Center IRB approval and informed consent, blood samples were obtained from six affected offspring, five obligatory carriers and two unaffected siblings. Whole genome linkage analysis was performed followed by Sanger sequencing of FAM20A. The sequencing unravelled a novel homozygous deletion mutation in exon 11 (c.1523delC), predicted to insert a premature stop codon (p.Thr508Lysfs*6). We provide an interesting case of novel mutation in this rare disorder, in which the affected kindred is unique in the large number of family members sharing a similar phenotype. Copyright © 2015 Elsevier Ltd. All rights reserved.
Whale song analyses using bioinformatics sequence analysis approaches
NASA Astrophysics Data System (ADS)
Chen, Yian A.; Almeida, Jonas S.; Chou, Lien-Siang
2005-04-01
Animal songs are frequently analyzed using discrete hierarchical units, such as units, themes and songs. Because animal songs and bio-sequences may be understood as analogous, bioinformatics analysis tools DNA/protein sequence alignment and alignment-free methods are proposed to quantify the theme similarities of the songs of false killer whales recorded off northeast Taiwan. The eighteen themes with discrete units that were identified in an earlier study [Y. A. Chen, masters thesis, University of Charleston, 2001] were compared quantitatively using several distance metrics. These metrics included the scores calculated using the Smith-Waterman algorithm with the repeated procedure; the standardized Euclidian distance and the angle metrics based on word frequencies. The theme classifications based on different metrics were summarized and compared in dendrograms using cluster analyses. The results agree with earlier classifications derived by human observation qualitatively. These methods further quantify the similarities among themes. These methods could be applied to the analyses of other animal songs on a larger scale. For instance, these techniques could be used to investigate song evolution and cultural transmission quantifying the dissimilarities of humpback whale songs across different seasons, years, populations, and geographic regions. [Work supported by SC Sea Grant, and Ilan County Government, Taiwan.
Genotyping-by-sequencing enables linkage mapping in three octoploid cultivated strawberry families
Salinas, Natalia; Tennessen, Jacob A.; Zurn, Jason D.; Sargent, Daniel James; Hancock, James; Bassil, Nahla V.
2017-01-01
Genotyping-by-sequencing (GBS) was used to survey genome-wide single-nucleotide polymorphisms (SNPs) in three biparental strawberry (Fragaria × ananassa) populations with the goal of evaluating this technique in a species with a complex octoploid genome. GBS sequence data were aligned to the F. vesca ‘Fvb’ reference genome in order to call SNPs. Numbers of polymorphic SNPs per population ranged from 1,163 to 3,190. Linkage maps consisting of 30–65 linkage groups were produced from the SNP sets derived from each parent. The linkage groups covered 99% of the Fvb reference genome, with three to seven linkage groups from a given parent aligned to any particular chromosome. A phylogenetic analysis performed using the POLiMAPS pipeline revealed linkage groups that were most similar to ancestral species F. vesca for each chromosome. Linkage groups that were most similar to a second ancestral species, F. iinumae, were only resolved for Fvb 4. The quantity of missing data and heterogeneity in genome coverage inherent in GBS complicated the analysis, but POLiMAPS resolved F. × ananassa chromosomal regions derived from diploid ancestor F. vesca. PMID:28875078
Sheu, Shih-Yi; Chou, Jui-Hsing; Bontemps, Cyril; Elliott, Geoffrey N; Gross, Eduardo; James, Euan K; Sprent, Janet I; Young, J Peter W; Chen, Wen-Ming
2012-09-01
Four strains, designated JPY-345(T), JPY-347, JPY-366 and JPY-581, were isolated from nitrogen-fixing nodules on the roots of two species of Mimosa, Mimosa cordistipula and Mimosa misera, that are native to North East Brazil, and their taxonomic positions were investigated by using a polyphasic approach. All four strains grew at 15-43 °C (optimum 35 °C), at pH 4-7 (optimum pH 5) and with 0-2 % (w/v) NaCl (optimum 0 % NaCl). On the basis of 16S rRNA gene sequence analysis, strain JPY-345(T) showed 97.3 % sequence similarity to the closest related species Burkholderia soli GP25-8(T), 97.3 % sequence similarity to Burkholderia caryophylli ATCC25418(T) and 97.1 % sequence similarity to Burkholderia kururiensis KP23(T). The predominant fatty acids of the strains were C(18 : 1)ω7c (36.1 %), C(16 : 0) (19.8 %) and summed feature 3, comprising C(16 : 1)ω7c and/or C(16 : 1)ω6c (11.5 %). The major isoprenoid quinone was Q-8 and the DNA G+C content of the strains was 64.2-65.7 mol%. The polar lipid profile consisted of a mixture of phosphatidylethanolamine, phosphatidylglycerol, diphosphatidylglycerol and several uncharacterized aminophospholipids and phospholipids. DNA-DNA hybridizations between the novel strain and recognized species of the genus Burkholderia yielded relatedness values of <51.8 %. On the basis of 16S rRNA and recA gene sequence similarities and chemotaxonomic and phenotypic data, the four strains represent a novel species in the genus Burkholderia, for which the name Burkholderia symbiotica sp. nov. is proposed. The type strain is JPY-345(T) (= LMG 26032(T) = BCRC 80258(T) = KCTC 23309(T)).
Rajendran, Senthilnathan; Jothi, Arunachalam
2018-05-16
The Three-dimensional structure of a protein depends on the interaction between their amino acid residues. These interactions are in turn influenced by various biophysical properties of the amino acids. There are several examples of proteins that share the same fold but are very dissimilar at the sequence level. For proteins to share a common fold some crucial interactions should be maintained despite insignificant sequence similarity. Since the interactions are because of the biophysical properties of the amino acids, we should be able to detect descriptive patterns for folds at such a property level. In this line, the main focus of our research is to analyze such proteins and to characterize them in terms of their biophysical properties. Protein structures with sequence similarity lesser than 40% were selected for ten different subfolds from three different mainfolds (according to CATH classification) and were used for this analysis. We used the normalized values of the 49 physio-chemical, energetic and conformational properties of amino acids. We characterize the folds based on the average biophysical property values. We also observed a fold specific correlational behavior of biophysical properties despite a very low sequence similarity in our data. We further trained three different binary classification models (Naive Bayes-NB, Support Vector Machines-SVM and Bayesian Generalized Linear Model-BGLM) which could discriminate mainfold based on the biophysical properties. We also show that among the three generated models, the BGLM classifier model was able to discriminate protein sequences coming under all beta category with 81.43% accuracy and all alpha, alpha-beta proteins with 83.37% accuracy. Copyright © 2018 Elsevier Ltd. All rights reserved.
Grissa, Ibtissem; Vergnaud, Gilles; Pourcel, Christine
2007-01-01
Background In Archeae and Bacteria, the repeated elements called CRISPRs for "clustered regularly interspaced short palindromic repeats" are believed to participate in the defence against viruses. Short sequences called spacers are stored in-between repeated elements. In the current model, motifs comprising spacers and repeats may target an invading DNA and lead to its degradation through a proposed mechanism similar to RNA interference. Analysis of intra-species polymorphism shows that new motifs (one spacer and one repeated element) are added in a polarised fashion. Although their principal characteristics have been described, a lot remains to be discovered on the way CRISPRs are created and evolve. As new genome sequences become available it appears necessary to develop automated scanning tools to make available CRISPRs related information and to facilitate additional investigations. Description We have produced a program, CRISPRFinder, which identifies CRISPRs and extracts the repeated and unique sequences. Using this software, a database is constructed which is automatically updated monthly from newly released genome sequences. Additional tools were created to allow the alignment of flanking sequences in search for similarities between different loci and to build dictionaries of unique sequences. To date, almost six hundred CRISPRs have been identified in 475 published genomes. Two Archeae out of thirty-seven and about half of Bacteria do not possess a CRISPR. Fine analysis of repeated sequences strongly supports the current view that new motifs are added at one end of the CRISPR adjacent to the putative promoter. Conclusion It is hoped that availability of a public database, regularly updated and which can be queried on the web will help in further dissecting and understanding CRISPR structure and flanking sequences evolution. Subsequent analyses of the intra-species CRISPR polymorphism will be facilitated by CRISPRFinder and the dictionary creator. CRISPRdb is accessible at PMID:17521438
Whitfield, A E; Rotenberg, D; Aritua, V; Hogenhout, S A
2011-04-01
The corn planthopper, Peregrinus maidis, causes direct feeding damage to plants and transmits Maize mosaic rhabdovirus (MMV) in a persistent-propagative manner. MMV must cross several insect tissue layers for successful transmission to occur, and the gut serves as an important barrier for rhabdovirus transmission. In order to facilitate the identification of proteins that may interact with MMV either by facilitating acquisition or responding to virus infection, we generated and analysed the gut transcriptome of P. maidis. From two normalized cDNA libraries, we generated a P. maidis gut transcriptome composed of 20,771 expressed sequence tags (ESTs). Assembly of the sequences yielded 1860 contigs and 14,032 singletons, and biological roles were assigned to 5793 (36%). Comparison of P. maidis ESTs with other insect amino acid sequences revealed that P. maidis shares greatest sequence similarity with another hemipteran, the brown planthopper Nilaparvata lugens. We identified 202 P. maidis transcripts with putative homology to proteins associated with insect innate immunity, including those implicated in the Toll, Imd, JAK/STAT, Jnk and the small-interfering RNA-mediated pathways. Sequence comparisons between our P. maidis gut EST collection and the currently available National Center for Biotechnology Information EST database collection for Ni. lugens revealed that a pathogen recognition receptor in the Imd pathway, peptidoglycan recognition protein-long class (PGRP-LC), is present in these two members of the family Delphacidae; however, these recognition receptors are lacking in the model hemipteran Acyrthosiphon pisum. In addition, we identified sequences in the P. maidis gut transcriptome that share significant amino acid sequence similarities with the rhabdovirus receptor molecule, acetylcholine receptor (AChR), found in other hosts. This EST analysis sheds new light on immune response pathways in hemipteran guts that will be useful for further dissecting innate defence response pathways to rhabdovirus infection. © 2011 The Authors. Insect Molecular Biology © 2011 The Royal Entomological Society.
Dombrovsky, Aviv; Glanz, Eyal; Lachman, Oded; Sela, Noa; Doron-Faigenboim, Adi; Antignus, Yehezkel
2013-01-01
We determined the complete sequence and organization of the genome of a putative member of the genus Polerovirus tentatively named Pepper yellow leaf curl virus (PYLCV). PYLCV has a wider host range than Tobacco vein-distorting virus (TVDV) and has a close serological relationship with Cucurbit aphid-borne yellows virus (CABYV) (both poleroviruses). The extracted viral RNA was subjected to SOLiD next-generation sequence analysis and used as a template for reverse transcription synthesis, which was followed by PCR amplification. The ssRNA genome of PYLCV includes 6,028 nucleotides encoding six open reading frames (ORFs), which is typical of the genus Polerovirus. Comparisons of the deduced amino acid sequences of the PYLCV ORFs 2-4 and ORF5, indicate that there are high levels of similarity between these sequences to ORFs 2-4 of TVDV (84-93%) and to ORF5 of CABYV (87%). Both PYLCV and Pepper vein yellowing virus (PeVYV) contain sequences that point to a common ancestral polerovirus. The recombination breakpoint which is located at CABYV ORF3, which encodes the viral coat protein (CP), may explain the CABYV-like sequences found in the genomes of the pepper infecting viruses PYLCV and PeVYV. Two additional regions unique to PYLCV (PY1 and PY2) were identified between nucleotides 4,962 and 5,061 (ORF 5) and between positions 5,866 and 6,028 in the 3' NCR. Sequence analysis of the pepper-infecting PeVYV revealed three unique regions (Pe1-Pe3) with no similarity to other members of the genus Polerovirus. Genomic analyses of PYLCV and PeVYV suggest that the speciation of these viruses occurred through putative recombination event(s) between poleroviruses co-infecting a common host(s), resulting in the emergence of PYLCV, a novel pathogen with a wider host range. PMID:23936244
Dombrovsky, Aviv; Glanz, Eyal; Lachman, Oded; Sela, Noa; Doron-Faigenboim, Adi; Antignus, Yehezkel
2013-01-01
We determined the complete sequence and organization of the genome of a putative member of the genus Polerovirus tentatively named Pepper yellow leaf curl virus (PYLCV). PYLCV has a wider host range than Tobacco vein-distorting virus (TVDV) and has a close serological relationship with Cucurbit aphid-borne yellows virus (CABYV) (both poleroviruses). The extracted viral RNA was subjected to SOLiD next-generation sequence analysis and used as a template for reverse transcription synthesis, which was followed by PCR amplification. The ssRNA genome of PYLCV includes 6,028 nucleotides encoding six open reading frames (ORFs), which is typical of the genus Polerovirus. Comparisons of the deduced amino acid sequences of the PYLCV ORFs 2-4 and ORF5, indicate that there are high levels of similarity between these sequences to ORFs 2-4 of TVDV (84-93%) and to ORF5 of CABYV (87%). Both PYLCV and Pepper vein yellowing virus (PeVYV) contain sequences that point to a common ancestral polerovirus. The recombination breakpoint which is located at CABYV ORF3, which encodes the viral coat protein (CP), may explain the CABYV-like sequences found in the genomes of the pepper infecting viruses PYLCV and PeVYV. Two additional regions unique to PYLCV (PY1 and PY2) were identified between nucleotides 4,962 and 5,061 (ORF 5) and between positions 5,866 and 6,028 in the 3' NCR. Sequence analysis of the pepper-infecting PeVYV revealed three unique regions (Pe1-Pe3) with no similarity to other members of the genus Polerovirus. Genomic analyses of PYLCV and PeVYV suggest that the speciation of these viruses occurred through putative recombination event(s) between poleroviruses co-infecting a common host(s), resulting in the emergence of PYLCV, a novel pathogen with a wider host range.
Hidalgo, A R; Akond, M A; Kita, K; Kataoka, M; Shimizu, S
2001-12-01
Two conjugated polyketone reductases (CPRs) were isolated from Candida parapsilosis IFO 0708. The primary structures of CPRs (C1 and C2) were analyzed by amino acid sequencing. The amino acid sequences of both enzymes had high similarity to those of several proteins of the aldo-keto-reductase (AKR) superfamily. However, several amino acid residues in the putative active sites of AKRs were not conserved in CPRs-C1 and -C2.
Near-Complete Genome Sequence of a Novel Single-Stranded RNA Virus Discovered in Indoor Air.
Rosario, Karyna; Fierer, Noah; Breitbart, Mya
2018-03-22
Viral metagenomic analysis of heating, ventilation, and air conditioning (HVAC) filters recovered the near-complete genome sequence of a novel virus, named HVAC-associated R NA v irus 1 (HVAC-RV1). The HVAC-RV1 genome is most similar to those of picorna-like viruses identified in arthropods but encodes a small domain observed only in negative-sense single-stranded RNA viruses. Copyright © 2018 Rosario et al.
New Erwinia-Like Organism Causing Cervical Lymphadenitis▿
Shin, Sang Yop; Lee, Mi Young; Song, Jae-Hoon; Ko, Kwan Soo
2008-01-01
The first case of cervical lymphadenitis due to infection by a new Erwinia-like organism is reported. The organism was identified initially as Pantoea sp. by a Vitek 2-based assessment but was finally identified as a member of the genus Erwinia by 16S rRNA gene sequence analysis. The isolate displayed 98.9% 16S rRNA gene sequence similarity to that of E. tasmaniensis and showed phenotypic characteristics that were different from other Erwinia species. PMID:18614665
Massively parallel sequencing-enabled mixture analysis of mitochondrial DNA samples.
Churchill, Jennifer D; Stoljarova, Monika; King, Jonathan L; Budowle, Bruce
2018-02-22
The mitochondrial genome has a number of characteristics that provide useful information to forensic investigations. Massively parallel sequencing (MPS) technologies offer improvements to the quantitative analysis of the mitochondrial genome, specifically the interpretation of mixed mitochondrial samples. Two-person mixtures with nuclear DNA ratios of 1:1, 5:1, 10:1, and 20:1 of individuals from different and similar phylogenetic backgrounds and three-person mixtures with nuclear DNA ratios of 1:1:1 and 5:1:1 were prepared using the Precision ID mtDNA Whole Genome Panel and Ion Chef, and sequenced on the Ion PGM or Ion S5 sequencer (Thermo Fisher Scientific, Waltham, MA, USA). These data were used to evaluate whether and to what degree MPS mixtures could be deconvolved. Analysis was effective in identifying the major contributor in each instance, while SNPs from the minor contributor's haplotype only were identified in the 1:1, 5:1, and 10:1 two-person mixtures. While the major contributor was identified from the 5:1:1 mixture, analysis of the three-person mixtures was more complex, and the mixed haplotypes could not be completely parsed. These results indicate that mixed mitochondrial DNA samples may be interpreted with the use of MPS technologies.
Bystrykh, L V; Vonck, J; van Bruggen, E F; van Beeumen, J; Samyn, B; Govorukhina, N I; Arfman, N; Duine, J A; Dijkhuizen, L
1993-01-01
The quaternary protein structure of two methanol:N,N'-dimethyl-4-nitrosoaniline (NDMA) oxidoreductases purified from Amycolatopsis methanolica and Mycobacterium gastri MB19 was analyzed by electron microscopy and image processing. The enzymes are decameric proteins (displaying fivefold symmetry) with estimated molecular masses of 490 to 500 kDa based on their subunit molecular masses of 49 to 50 kDa. Both methanol:NDMA oxidoreductases possess a tightly but noncovalently bound NADP(H) cofactor at an NADPH-to-subunit molar ratio of 0.7. These cofactors are redox active toward alcohol and aldehyde substrates. Both enzymes contain significant amounts of Zn2+ and Mg2+ ions. The primary amino acid sequences of the A. methanolica and M. gastri MB19 methanol:NDMA oxidoreductases share a high degree of identity, as indicated by N-terminal sequence analysis (63% identity among the first 27 N-terminal amino acids), internal peptide sequence analysis, and overall amino acid composition. The amino acid sequence analysis also revealed significant similarity to a decameric methanol dehydrogenase of Bacillus methanolicus C1. Images PMID:8449887
Huang, Xiao-Yan; Li, Ming-Li; Xu, Juan; Gao, Yue-Dong; Wang, Wen-Guang; Yin, An-Guo; Li, Xiao-Fei; Sun, Xiao-Mei; Xia, Xue-Shan; Dai, Jie-Jie
2013-04-01
While the tree shrew (Tupaia belangeri chinensis) is an excellent animal model for studying the mechanisms of human diseases, but few studies examine interleukin-2 (IL-2), an important immune factor in disease model evaluation. In this study, a 465 bp of the full-length IL-2 cDNA encoding sequence was cloned from the RNA of tree shrew spleen lymphocytes, which were then cultivated and stimulated with ConA (concanavalin). Clustal W 2.0 was used to compare and analyze the sequence and molecular characteristics, and establish the similarity of the overall structure of IL-2 between tree shrews and other mammals. The homology of the IL-2 nucleotide sequence between tree shrews and humans was 93%, and the amino acid homology was 80%. The phylogenetic tree results, derived through the Neighbour-Joining method using MEGA5.0, indicated a close genetic relationship between tree shrews, Homo sapiens, and Macaca mulatta. The three-dimensional structure analysis showed that the surface charges in most regions of tree shrew IL-2 were similar to between tree shrews and humans; however, the N-glycosylation sites and local structures were different, which may affect antibody binding. These results provide a fundamental basis for the future study of IL-2 monoclonal antibody in tree shrews, thereby improving their utility as a model.
Cloning, sequencing, and characterization of the Bacillus subtilis biotin biosynthetic operon.
Bower, S; Perkins, J B; Yocum, R R; Howitt, C L; Rahaim, P; Pero, J
1996-07-01
A 10-kb region of the Bacillus subtilis genome that contains genes involved in biotin-biosynthesis was cloned and sequenced. DNA sequence analysis indicated that B. subtilis contains homologs of the Escherichia coli and Bacillus sphaericus bioA, bioB, bioD, and bioF genes. These four genes and a homolog of the B. sphaericus bioW gene are arranged in a single operon in the order bioWAFDR and are followed by two additional genes, bioI and orf2. bioI and orf2 show no similarity to any other known biotin biosynthetic genes. The bioI gene encodes a protein with similarity to cytochrome P-450s and was able to complement mutations in either bioC or bioH of E. coli. Mutations in bioI caused B. subtilis to grow poorly in the absence of biotin. The bradytroph phenotype of bioI mutants was overcome by pimelic acid, suggesting that the product of bioI functions at a step prior to pimelic acid synthesis. The B. subtilis bio operon is preceded by a putative vegetative promoter sequence and contains just downstream a region of dyad symmetry with homology to the bio regulatory region of B. sphaericus. Analysis of a bioW-lacZ translational fusion indicated that expression of the biotin operon is regulated by biotin and the B. subtilis birA gene.
Cloning, sequencing, and characterization of the Bacillus subtilis biotin biosynthetic operon.
Bower, S; Perkins, J B; Yocum, R R; Howitt, C L; Rahaim, P; Pero, J
1996-01-01
A 10-kb region of the Bacillus subtilis genome that contains genes involved in biotin-biosynthesis was cloned and sequenced. DNA sequence analysis indicated that B. subtilis contains homologs of the Escherichia coli and Bacillus sphaericus bioA, bioB, bioD, and bioF genes. These four genes and a homolog of the B. sphaericus bioW gene are arranged in a single operon in the order bioWAFDR and are followed by two additional genes, bioI and orf2. bioI and orf2 show no similarity to any other known biotin biosynthetic genes. The bioI gene encodes a protein with similarity to cytochrome P-450s and was able to complement mutations in either bioC or bioH of E. coli. Mutations in bioI caused B. subtilis to grow poorly in the absence of biotin. The bradytroph phenotype of bioI mutants was overcome by pimelic acid, suggesting that the product of bioI functions at a step prior to pimelic acid synthesis. The B. subtilis bio operon is preceded by a putative vegetative promoter sequence and contains just downstream a region of dyad symmetry with homology to the bio regulatory region of B. sphaericus. Analysis of a bioW-lacZ translational fusion indicated that expression of the biotin operon is regulated by biotin and the B. subtilis birA gene. PMID:8763940
Du, Wuying; Hu, Fengyu; Yang, Yabo; Hu, Dong; Hu, Xuchu; Yu, Xinbing; Xu, Jin; Dai, Jialin; Liao, Xinjiang; Huang, Jiang
2011-09-01
Two novel genes encoding lactate dehydrogenase A (LDHA) and B (LDHB) homologues, respectively, were identified from the cDNA libraries of adult Taenia solium (T. solium). The two deduced amino acid sequences both show more than 50% identity to the homologues for Danio rerio, Xenopus laevis, Schistosoma japonicum, Sus scrofa, Homo sapiens, et al. The identity of the amino acid sequence between TsLDHA and TsLDHB is 57.4%, and that of the nucleotide sequence is 61.5%. Recombinant TsLDHA homologue (rTsLDHA) and TsLDHB homologue (rTsLDHB) were expressed in Escherichia coli BL21/DE3 and purified. Though there were some differences in the sequence, the two LDH isozyme homologues show similarity in the conserved LDH domain, topological structure, primary immunological traits, localization on the tegument of T. solium adult, and partial physicochemical properties. The linear B-cell epitope analysis of TsLDHA and TsLDHB discovered a TsLDHA specific epitope. The purified rTsLDHA and rTsLDHB could be recognized by rat immuno-sera, serum from swine, or a patient infected with T. solium, respectively, but Western blot analysis showed cross-reactions, not only between these two LDH members but also with other common human tapeworms or helminths. The results suggested that the two LDH homologues are similar in the characteristics of LDH family, and they are not specific antigens for immunodiagnosis.
Explosion Source Similarity Analysis via SVD
NASA Astrophysics Data System (ADS)
Yedlin, Matthew; Ben Horin, Yochai; Margrave, Gary
2016-04-01
An important seismological ingredient for establishing a regional seismic nuclear discriminant is the similarity analysis of a sequence of explosion sources. To investigate source similarity, we are fortunate to have access to a sequence of 1805 three-component recordings of quarry blasts, shot from March 2002 to January 2015. The centroid of these blasts has an estimated location 36.3E and 29.9N. All blasts were detonated by JPMC (Jordan Phosphate Mines Co.) All data were recorded at the Israeli NDC, HFRI, located at 30.03N and 35.03E. Data were first winnowed based on the distribution of maximum amplitudes in the neighborhood of the P-wave arrival. The winnowed data were then detrended using the algorithm of Cleveland et al (1990). The detrended data were bandpass filtered between .1 to 12 Hz using an eighth order Butterworth filter. Finally, data were sorted based on maximum trace amplitude. Two similarity analysis approaches were used. First, for each component, the entire suite of traces was decomposed into its eigenvector representation, by employing singular-valued decomposition (SVD). The data were then reconstructed using 10 percent of the singular values, with the resulting enhancement of the S-wave and surface wave arrivals. The results of this first method are then compared to the second analysis method based on the eigenface decomposition analysis of Turk and Pentland (1991). While both methods yield similar results in enhancement of data arrivals and reduction of data redundancy, more analysis is required to calibrate the recorded data to charge size, a quantity that was not available for the current study. References Cleveland, R. B., Cleveland, W. S., McRae, J. E., and Terpenning, I., Stl: A seasonal-trend decomposition procedure based on loess, Journal of Official Statistics, 6, No. 1, 3-73, 1990. Turk, M. and Pentland, A., Eigenfaces for recognition. Journal of cognitive neuroscience, 3(1), 71-86, 1991.
Gopal, J; Yebra, M J; Bhagwat, A S
1994-01-01
The methyltransferase (MTase) in the DsaV restriction--modification system methylates within 5'-CCNGG sequences. We have cloned the gene for this MTase and determined its sequence. The predicted sequence of the MTase protein contains sequence motifs conserved among all cytosine-5 MTases and is most similar to other MTases that methylate CCNGG sequences, namely M.ScrFI and M.SsoII. All three MTases methylate the internal cytosine within their recognition sequence. The 'variable' region within the three enzymes that methylate CCNGG can be aligned with the sequences of two enzymes that methylate CCWGG sequences. Remarkably, two segments within this region contain significant similarity with the region of M.HhaI that is known to contact DNA bases. These alignments suggest that many cytosine-5 MTases are likely to interact with DNA using a similar structural framework. Images PMID:7971279
GobyWeb: Simplified Management and Analysis of Gene Expression and DNA Methylation Sequencing Data
Dorff, Kevin C.; Chambwe, Nyasha; Zeno, Zachary; Simi, Manuele; Shaknovich, Rita; Campagne, Fabien
2013-01-01
We present GobyWeb, a web-based system that facilitates the management and analysis of high-throughput sequencing (HTS) projects. The software provides integrated support for a broad set of HTS analyses and offers a simple plugin extension mechanism. Analyses currently supported include quantification of gene expression for messenger and small RNA sequencing, estimation of DNA methylation (i.e., reduced bisulfite sequencing and whole genome methyl-seq), or the detection of pathogens in sequenced data. In contrast to previous analysis pipelines developed for analysis of HTS data, GobyWeb requires significantly less storage space, runs analyses efficiently on a parallel grid, scales gracefully to process tens or hundreds of multi-gigabyte samples, yet can be used effectively by researchers who are comfortable using a web browser. We conducted performance evaluations of the software and found it to either outperform or have similar performance to analysis programs developed for specialized analyses of HTS data. We found that most biologists who took a one-hour GobyWeb training session were readily able to analyze RNA-Seq data with state of the art analysis tools. GobyWeb can be obtained at http://gobyweb.campagnelab.org and is freely available for non-commercial use. GobyWeb plugins are distributed in source code and licensed under the open source LGPL3 license to facilitate code inspection, reuse and independent extensions http://github.com/CampagneLaboratory/gobyweb2-plugins. PMID:23936070
BLAST and FASTA similarity searching for multiple sequence alignment.
Pearson, William R
2014-01-01
BLAST, FASTA, and other similarity searching programs seek to identify homologous proteins and DNA sequences based on excess sequence similarity. If two sequences share much more similarity than expected by chance, the simplest explanation for the excess similarity is common ancestry-homology. The most effective similarity searches compare protein sequences, rather than DNA sequences, for sequences that encode proteins, and use expectation values, rather than percent identity, to infer homology. The BLAST and FASTA packages of sequence comparison programs provide programs for comparing protein and DNA sequences to protein databases (the most sensitive searches). Protein and translated-DNA comparisons to protein databases routinely allow evolutionary look back times from 1 to 2 billion years; DNA:DNA searches are 5-10-fold less sensitive. BLAST and FASTA can be run on popular web sites, but can also be downloaded and installed on local computers. With local installation, target databases can be customized for the sequence data being characterized. With today's very large protein databases, search sensitivity can also be improved by searching smaller comprehensive databases, for example, a complete protein set from an evolutionarily neighboring model organism. By default, BLAST and FASTA use scoring strategies target for distant evolutionary relationships; for comparisons involving short domains or queries, or searches that seek relatively close homologs (e.g. mouse-human), shallower scoring matrices will be more effective. Both BLAST and FASTA provide very accurate statistical estimates, which can be used to reliably identify protein sequences that diverged more than 2 billion years ago.
Sekizuka, Tsuyoshi; Yokoi, Taeko; Murayama, Ohoshi; Millar, B Cherie; Moore, Johne; Matsuda, Motoo
2005-08-01
A newly constructed primer pair (lari-Af/lari-Ar) designed to generate a product of the flagellin (flaA) gene for urease-negative Campylobacter lari produced a PCR amplicon of about 1700 bp for 16 isolates from 7 seagulls, 5 humans, 3 food animals and one mussel in Japan and Northern Ireland. Nucleotide sequencing and alignments of the flaA amplicons from these isolates demonstrated that the deduced amino acid sequences of the possible open reading frame were 564-572 amino acid residues in length with calculated molecular weights of 58,804 to 59,463. The deduced amino acid sequence similarity analysis strongly suggested that the ORF of the flaA from the 16 isolates showed 70-75% sequence similarities to those of Campylobacter jejuni isolates. The approximate Mr of the flagellin purified from some of the isolates of urease-negative C. lari was estimated to range from 59.6 to 61.8 kDa. Thus, flagellin from the isolates of urease-negative C. lari was shown for the first time to have a molecular size similar to those of C. jejuni and Campylobacter coli isolates, but to be different from the shorter flaA and smaller flagellin of urease-positive thermophilic Campylobacter (UPTC) isolates. Flagellins from C. lari spp., consisting of the two representative taxa of urease-negative C. lari and UPTC, thus show genotypic and phenotypic diversity.
Nishiyama, Minako; Yamamoto, Shuichi; Kurosawa, Norio
2013-08-01
Ibusuki hot spring is located on the coastline of Kagoshima Bay, Japan. The hot spring water is characterized by high salinity, high temperature, and neutral pH. The hot spring is covered by the sea during high tide, which leads to severe fluctuations in several environmental variables. A combination of molecular- and culture-based techniques was used to determine the bacterial and archaeal diversity of the hot spring. A total of 48 thermophilic bacterial strains were isolated from two sites (Site 1: 55.6°C; Site 2: 83.1°C) and they were categorized into six groups based on their 16S rRNA gene sequence similarity. Two groups (including 32 isolates) demonstrated low sequence similarity with published species, suggesting that they might represent novel taxa. The 148 clones from the Site 1 bacterial library included 76 operational taxonomy units (OTUs; 97% threshold), while 132 clones from the Site 2 bacterial library included 31 OTUs. Proteobacteria, Bacteroidetes, and Firmicutes were frequently detected in both clone libraries. The clones were related to thermophilic, mesophilic and psychrophilic bacteria. Approximately half of the sequences in bacterial clone libraries shared <92% sequence similarity with their closest sequences in a public database, suggesting that the Ibusuki hot spring may harbor a unique and novel bacterial community. By contrast, 77 clones from the Site 2 archaeal library contained only three OTUs, most of which were affiliated with Thaumarchaeota.
Krishnamurthi, S; Ruckmani, A; Pukall, R; Chakrabarti, T
2010-11-01
The taxonomic status of three Bacillus species, Bacillus insolitus, B. psychrodurans and B. psychrotolerans was reexamined using a polyphasic approach. In our analysis, these three Bacillus species formed a cluster separate from other members of Bacillus rRNA group 2 [5] and from Bacillus sensu stricto. These three species shared high 16S rRNA gene sequence similarities between them (97.8-99.7%) and showed closest sequence similarity (95.3-96.3%) to Paenisporosarcina quisquiliarum gen. nov., sp. nov. [18]. Sequence similarities with other related genera ranged between 90.9% and 94.5%. Phylogenetic coherence of the three species was supported by phenotypic characteristics, such as growth at low temperatures, negative oxidation and assimilation of many carbohydrates, MK8 as the major isoprenoid quinine and broadly similar polar lipid profiles. All three species had a similar peptidoglycan type of the variation A4β and similar genomic G+C contents (35.7-36.6 mol% [1]). Genomic relatedness among them was shown to be less than 70% and justified their separate species status [1]. These three species could be differentiated from each other and from related taxa on the basis of phenotypic, including chemotaxonomic, characteristics and ribotype patterns. On the basis of our analysis, we propose a new genus Psychrobacillus gen. nov. and to transfer B. insolitus, B. psychrodurans and B. psychrotolerans to the new genus as Psychrobacillus insolitus comb. nov. (type species of the genus; type strain W16B(T)=DSM 5(T)), P. psychrodurans comb. nov. (type strain 68E3(T)=DSM 11713(T)) and P. psychrotolerans comb. nov. (type strain 3H1(T)=DSM 11706(T)). Copyright © 2010 Elsevier GmbH. All rights reserved.
Chaves, Guilherme M; Terçarioli, Gisela R; Padovan, Ana Carolina B; Rosas, Robert C; Ferreira, Renata C; Melo, Analy S A; Colombo, Arnaldo L
2013-04-01
Candida rugosa is a yeast species that is emerging as a causative agent of invasive infection, particularly in Latin America. Recently, C. pseudorugosa was proposed as a new species closely related to C. rugosa. We evaluated in this investigation the genetic heterogeneity within the C. rugosa species complex. All clinical isolates used in this study were identified phenotypically as C. rugosa but were genotypically different from the C. rugosa type, ATCC 10571. RAPD marker analysis revealed less than 83% similarity between our clinical isolates and the C. rugosa type strain. The D1/D2 region sequences of our clinical isolates showed 98% identity with C. rugosa but only 94-95% identity with C. pseudorugosa. The ITS rDNA sequences of the Brazilian isolates showed 91% identity with the C. rugosa ATCC 10571 ITS sequence. Network and Bayesian analyses of ITS and housekeeping gene sequences separated our clinical isolates into different branches from C. rugosa type strain. These differences are sufficient to reassign our isolates to a distinct species, named C. mesorugosa.
Juhasz, E.; Muller, P.; Toth-Makk, A.; Hamor, T.; Farkas-Bulla, J.; Suto-Szentai, M.; Phillips, R.L.; Ricketts, B.
1996-01-01
Detailed sedimentological and paleontological analyses were carried out on more than 13,000 m of core from ten boreholes in the Late Neogene sediments of the Pannonian Basin, Hungary. These data provide the basis for determining the character of high-order depositional cycles and their stacking patterns. In the Late Neogene sediments of the Pannonian Basin there are two third-order sequences: the Late Miocene and the Pliocene ones. The Miocene sequence shows a regressive, upward-coarsening trend. There are four distinguishable sedimentary units in this sequence: the basal transgressive, the lower aggradational, the progradational and the upper aggradational units. The Pliocene sequence is also of aggradational character. The progradation does not coincide in time in the wells within the basin. The character of the relative water-level curves is similar throughout the basin but shows only very faint similarity to the sea-level curve. Therefore, it is unlikely that eustasy played any significant role in the pattern of basin filling. Rather, the dominant controls were the rapidly changing basin subsidence and high sedimentation rates, together with possible climatic factors.
Synthesis of labeled meropenem for the analysis of M. tuberculosis transpeptidases
Kastrinsky, David B.; Barry, Clifton E.
2009-01-01
A concise synthesis of 14C labeled meropenem prepared from 14C dimethylamine hydrochloride is described. Using a similar reaction sequence, the meropenem nucleus was also attached to biotin providing a probe for protein interaction studies. PMID:20161438
NASA Astrophysics Data System (ADS)
Uthicke, S.; McGuire, K.
2007-03-01
Bacterial communities in eight 16S rDNA clone libraries from calcareous sediments were investigated to provide an assessment of the bacterial diversity on sediments of the Great Barrier Reef (GBR) and to investigate differences due to decreased water quality. Sample effort was spread across two locations on each of four coral reefs, with two reefs located nearshore and two reefs on the outer shelf to allow robust statistical comparison of nearshore reefs (subjected to enhanced runoff) and outer shelf reefs (pristine conditions). Out of 221 non-chimeric sequences, 189 (85.5%) were unique and only one sequence occurred in more than one library. Rarefaction analyses and coverage calculations indicated that only a small fraction of the diversity was sampled. Cluster analyses and comparison to published sequences indicated that sequences retrieved belonged to the α, γ and δ subdivision of the Proteobacteria (6.8, 29.4 and 13.6% of the total, respectively), Cytophaga-Flavobacteria-Bacteroidetes (CFB) group (20.4%), Cyanobacteria (5.4%), Planctomycetaceae (7.7%), Verrucomicrobiaceae (6.8%), Acidobacteriaceae (2.7%). Analysis of Similarity (ANOSIM, based on grouping all retrieved sequences into 9 phylogenetic groups) indicated that subtle differences do exist in the community composition between nearshore and outer shelf reefs. Similarity percentage analysis (SIMPER) indicated that Acidobacteriaceae and Cyanobacteriaceae were the main contributors to the dissimilarity. A significant difference between bacteria on nearshore and outer shelf reefs also existed on the molecular level ( FST = 0.008, p = 0.007 for all samples, 0.006, p = 0.022 when repeated sequences within libraries were removed). Thus, bacterial communities on carbonate sediments investigated were highly diverse and differences in community composition may provide important leads for the search for indicator species or communities for water quality differences.
Tani, Akio; Sahin, Nurettin; Matsuyama, Yumiko; Enomoto, Takashi; Nishimura, Naoki; Yokota, Akira; Kimbara, Kazuhide
2012-01-01
Methylobacterium species are ubiquitous α-proteobacteria that reside in the phyllosphere and are fed by methanol that is emitted from plants. In this study, we applied whole-cell matrix-assisted laser desorption/ionization time-of-flight mass spectrometry analysis (WC-MS) to evaluate the diversity of Methylobacterium species collected from a variety of plants. The WC-MS spectrum was reproducible through two weeks of cultivation on different media. WC-MS spectrum peaks of M. extorquens strain AM1 cells were attributed to ribosomal proteins, but those were not were also found. We developed a simple method for rapid identification based on spectra similarity. Using all available type strains of Methylobacterium species, the method provided a certain threshold similarity value for species-level discrimination, although the genus contains some type strains that could not be easily discriminated solely by 16S rRNA gene sequence similarity. Next, we evaluated the WC-MS data of approximately 200 methylotrophs isolated from various plants with MALDI Biotyper software (Bruker Daltonics). Isolates representing each cluster were further identified by 16S rRNA gene sequencing. In most cases, the identification by WC-MS matched that by sequencing, and isolates with unique spectra represented possible novel species. The strains belonging to M. extorquens, M. adhaesivum, M. marchantiae, M. komagatae, M. brachiatum, M. radiotolerans, and novel lineages close to M. adhaesivum, many of which were isolated from bryophytes, were found to be the most frequent phyllospheric colonizers. The WC-MS technique provides emerging high-throughputness in the identification of known/novel species of bacteria, enabling the selection of novel species in a library and identification without 16S rRNA gene sequencing. PMID:22808262
Li, Ying Hong; Xu, Jing Yu; Tao, Lin; Li, Xiao Feng; Li, Shuang; Zeng, Xian; Chen, Shang Ying; Zhang, Peng; Qin, Chu; Zhang, Cheng; Chen, Zhe; Zhu, Feng; Chen, Yu Zong
2016-01-01
Knowledge of protein function is important for biological, medical and therapeutic studies, but many proteins are still unknown in function. There is a need for more improved functional prediction methods. Our SVM-Prot web-server employed a machine learning method for predicting protein functional families from protein sequences irrespective of similarity, which complemented those similarity-based and other methods in predicting diverse classes of proteins including the distantly-related proteins and homologous proteins of different functions. Since its publication in 2003, we made major improvements to SVM-Prot with (1) expanded coverage from 54 to 192 functional families, (2) more diverse protein descriptors protein representation, (3) improved predictive performances due to the use of more enriched training datasets and more variety of protein descriptors, (4) newly integrated BLAST analysis option for assessing proteins in the SVM-Prot predicted functional families that were similar in sequence to a query protein, and (5) newly added batch submission option for supporting the classification of multiple proteins. Moreover, 2 more machine learning approaches, K nearest neighbor and probabilistic neural networks, were added for facilitating collective assessment of protein functions by multiple methods. SVM-Prot can be accessed at http://bidd2.nus.edu.sg/cgi-bin/svmprot/svmprot.cgi.
Cryptic diversity in European bats.
Mayer, F.; von Helversen, O.
2001-01-01
Different species of bat can be morphologically very similar. In order to estimate the amount of cryptic diversity among European bats we screened the intra- and interspecific genetic variation in 26 European vespertilionid bat species. We sequenced the DNA of subunit 1 of the mitochondrial protein NADH dehydrogenase (ND1) from several individuals of a species, which were sampled in a variety of geographical regions. A phylogeny based on the mitochondrial (mt) DNA data is in good agreement with the current classification in the family. Highly divergent mitochondrial lineages were found in two taxa, which differed in at least 11% of their ND1 sequence. The two mtDNA lineages in Plecotus austriacus correlated with the two subspecies Plecotus austriacus austriacus and Plecotus austriacus kolombatovici. The two mtDNA lineages in Myotis mystacinus were partitioned among two morphotypes. The evidence for two new bat species within Europe is discussed. Convergent adaptive evolution might have contributed to the morphological similarity among distantly related species if they occupy similar ecological niches. Closely related species may differ in their ecology but not necessarily in their morphology. On the other hand, two morphologically clearly different species (Eptesicus serotinus and Eptesicus nilssonii) were found to be genetically very similar. Neither morphological nor mitochondrial DNA sequence analysis alone can be guaranteed to identify species. PMID:11522202
Marinospirillum insulare sp. nov., a novel halophilic helical bacterium isolated from kusaya gravy.
Satomi, M; Kimura, B; Hayashi, M; Okuzumi, M; Fujii, T
2004-01-01
A novel species that belongs to the genus Marinospirillum is described on the basis of phenotypic characteristics, phylogenetic analysis of 16S rRNA and gyrB gene sequences and DNA-DNA hybridization. Four strains of helical, halophilic, Gram-negative, heterotrophic bacteria were isolated from kusaya gravy, which is fermented brine that is used for the production of traditional dried fish in the Izu Islands of Japan. All of the new isolates were motile by means of bipolar tuft flagella, of small cell size, coccoid-body-forming and aerophilic; it was concluded that they belong to the same bacterial species, based on DNA-DNA hybridization values (>70% DNA relatedness). DNA G+C contents of the new strains were 42-43 mol% and they had isoprenoid quinone Q-8 as the major component. Phylogenetic analysis of 16S rRNA gene sequences indicated that the new isolates were members of the genus Marinospirillum; sequence similarity of the new isolates to Marinospirillum minutulum, Marinospirillum megaterium and Marinospirillum alkaliphilum was 98.5, 98.2 and 95.2%, respectively. Phylogenetic analysis based on the gyrB gene indicated that the new isolates had enough phylogenetic distance from M. minutulum and M. megaterium to be regarded as different species, with 84.7 and 78.7% sequence similarity, respectively. DNA-DNA hybridization showed that the new isolates had <36% DNA relatedness to M. minutulum and M. megaterium, supporting the phylogenetic conclusion. Thus, a novel species is proposed: Marinospirillum insulare sp. nov. (type strain, KT=LMG 21802T=NBRC 100033T).
Bayesian Correlation Analysis for Sequence Count Data
Lau, Nelson; Perkins, Theodore J.
2016-01-01
Evaluating the similarity of different measured variables is a fundamental task of statistics, and a key part of many bioinformatics algorithms. Here we propose a Bayesian scheme for estimating the correlation between different entities’ measurements based on high-throughput sequencing data. These entities could be different genes or miRNAs whose expression is measured by RNA-seq, different transcription factors or histone marks whose expression is measured by ChIP-seq, or even combinations of different types of entities. Our Bayesian formulation accounts for both measured signal levels and uncertainty in those levels, due to varying sequencing depth in different experiments and to varying absolute levels of individual entities, both of which affect the precision of the measurements. In comparison with a traditional Pearson correlation analysis, we show that our Bayesian correlation analysis retains high correlations when measurement confidence is high, but suppresses correlations when measurement confidence is low—especially for entities with low signal levels. In addition, we consider the influence of priors on the Bayesian correlation estimate. Perhaps surprisingly, we show that naive, uniform priors on entities’ signal levels can lead to highly biased correlation estimates, particularly when different experiments have widely varying sequencing depths. However, we propose two alternative priors that provably mitigate this problem. We also prove that, like traditional Pearson correlation, our Bayesian correlation calculation constitutes a kernel in the machine learning sense, and thus can be used as a similarity measure in any kernel-based machine learning algorithm. We demonstrate our approach on two RNA-seq datasets and one miRNA-seq dataset. PMID:27701449
2013-01-01
Background MicroRNAs (miRNAs) are small non-coding RNAs that play critical roles in regulating post transcriptional gene expression. Gall midges encompass a large group of insects that are of economic importance and also possess fascinating biological traits. The gall midge Mayetiola destructor, commonly known as the Hessian fly, is a destructive pest of wheat and model organism for studying gall midge biology and insect – host plant interactions. Results In this study, we systematically analyzed miRNAs from the Hessian fly. Deep-sequencing a Hessian fly larval transcriptome led to the identification of 89 miRNA species that are either identical or very similar to known miRNAs from other insects, and 184 novel miRNAs that have not been reported from other species. A genome-wide search through a draft Hessian fly genome sequence identified a total of 611 putative miRNA-encoding genes based on sequence similarity and the existence of a stem-loop structure for miRNA precursors. Analysis of the 611 putative genes revealed a striking feature: the dramatic expansion of several miRNA gene families. The largest family contained 91 genes that encoded 20 different miRNAs. Microarray analyses revealed the expression of miRNA genes was strictly regulated during Hessian fly larval development and abundance of many miRNA genes were affected by host genotypes. Conclusion The identification of a large number of miRNAs for the first time from a gall midge provides a foundation for further studies of miRNA functions in gall midge biology and behavior. The dramatic expansion of identical or similar miRNAs provides a unique system to study functional relations among miRNA iso-genes as well as changes in sequence specificity due to small changes in miRNAs and in their mRNA targets. These results may also facilitate the identification of miRNA genes for potential pest control through transgenic approaches. PMID:23496979
Pirooznia, Mehdi; Gong, Ping; Guan, Xin; Inouye, Laura S; Yang, Kuan; Perkins, Edward J; Deng, Youping
2007-01-01
Background Eisenia fetida, commonly known as red wiggler or compost worm, belongs to the Lumbricidae family of the Annelida phylum. Little is known about its genome sequence although it has been extensively used as a test organism in terrestrial ecotoxicology. In order to understand its gene expression response to environmental contaminants, we cloned 4032 cDNAs or expressed sequence tags (ESTs) from two E. fetida libraries enriched with genes responsive to ten ordnance related compounds using suppressive subtractive hybridization-PCR. Results A total of 3144 good quality ESTs (GenBank dbEST accession number EH669363–EH672369 and EL515444–EL515580) were obtained from the raw clone sequences after cleaning. Clustering analysis yielded 2231 unique sequences including 448 contigs (from 1361 ESTs) and 1783 singletons. Comparative genomic analysis showed that 743 or 33% of the unique sequences shared high similarity with existing genes in the GenBank nr database. Provisional function annotation assigned 830 Gene Ontology terms to 517 unique sequences based on their homology with the annotated genomes of four model organisms Drosophila melanogaster, Mus musculus, Saccharomyces cerevisiae, and Caenorhabditis elegans. Seven percent of the unique sequences were further mapped to 99 Kyoto Encyclopedia of Genes and Genomes pathways based on their matching Enzyme Commission numbers. All the information is stored and retrievable at a highly performed, web-based and user-friendly relational database called EST model database or ESTMD version 2. Conclusion The ESTMD containing the sequence and annotation information of 4032 E. fetida ESTs is publicly accessible at . PMID:18047730
A small test of a sequence-based typing method: definition of the B*1520 allele.
Domena, J D; Little, A M; Arnett, K L; Adams, E J; Marsh, S G; Parham, P
1994-10-01
Santamaria et al. (Human Immunology 1993 37: 39-50) describe a method of sequence-based typing (SBT) for HLA-A, B and C alleles said to give "unambiguous typing of any sample, heterozygous or homozygous, without requiring additional typing information". From SBT analysis, which involves determination of partial sequences of mixed alleles, these investigators reported that cell lines KT17 (HLA-B35,62) and OLGA (HLA-B62) from the reference panel of the 10th International Histocompatibility Workshop express novel variants of HLA-B15 (B1501-MN6) and HLA-B35 (B3501-MN7) respectively. To study further the novel alleles, we cloned and sequenced full-length HLA-B cDNA clones isolated from the KT17 and OLGA cell lines. We find that KT17 expresses B*3501, as assigned by SBT, and B*1501, the common allele encoding the B62 antigen. We were unable to confirm that KT17 expresses the novel B1501-MN6 variant identified by SBT. For OLGA our analysis confirms the partial sequences obtained by SBT. Thus OLGA expresses B*1501 and a novel HLA-B allele. The complete sequence of the latter shows it is a hybrid having exons 1 and 2 in common with B*1501 and other B15 subtypes and exons 3-7 in common with B*3501 and related molecules including B*5301 and B*5801. The novel allele has been designated B*1520 because of its sequence similarity with the B15 group; furthermore, serological analysis shows that the B*1520 product does not express epitopes in common with either B35, B53 or B58. The B*1520 heavy chain has a similar isoelectric point to A*3101; B*1520 was undetected by previous applications of isoelectric focusing because B*1520 and A31 are both expressed by OLGA. In conclusion, HLA-B typing of two cell lines by cDNA cloning and sequencing gives concordant results with SBT for three of the four alleles. The cause of the discrepancy for the fourth allele is unknown, however, this finding indicates that the novel HLA-A, B and C sequences emerging from SBT studies need independent verification.
Rapid identification of oral Actinomyces species cultivated from subgingival biofilm by MALDI-TOF-MS
Stingu, Catalina S.; Borgmann, Toralf; Rodloff, Arne C.; Vielkind, Paul; Jentsch, Holger; Schellenberger, Wolfgang; Eschrich, Klaus
2015-01-01
Background Actinomyces are a common part of the residential flora of the human intestinal tract, genitourinary system and skin. Isolation and identification of Actinomyces by conventional methods is often difficult and time consuming. In recent years, matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF-MS) has become a rapid and simple method to identify bacteria. Objective The present study evaluated a new in-house algorithm using MALDI-TOF-MS for rapid identification of different species of oral Actinomyces cultivated from subgingival biofilm. Design Eleven reference strains and 674 clinical strains were used in this study. All the strains were preliminarily identified using biochemical methods and then subjected to MALDI-TOF-MS analysis using both similarity-based analysis and classification methods (support vector machine [SVM]). The genotype of the reference strains and of 232 clinical strains was identified by sequence analysis of the 16S ribosomal RNA (rRNA). Results The sequence analysis of the 16S rRNA gene of all references strains confirmed their previous identification. The MALDI-TOF-MS spectra obtained from the reference strains and the other clinical strains undoubtedly identified as Actinomyces by 16S rRNA sequencing were used to create the mass spectra reference database. Already a visual inspection of the mass spectra of different species reveals both similarities and differences. However, the differences between them are not large enough to allow a reliable differentiation by similarity analysis. Therefore, classification methods were applied as an alternative approach for differentiation and identification of Actinomyces at the species level. A cross-validation of the reference database representing 14 Actinomyces species yielded correct results for all species which were represented by more than two strains in the database. Conclusions Our results suggest that a combination of MALDI-TOF-MS with powerful classification algorithms, such as SVMs, provide a useful tool for the differentiation and identification of oral Actinomyces. PMID:25597306
CLAST: CUDA implemented large-scale alignment search tool.
Yano, Masahiro; Mori, Hiroshi; Akiyama, Yutaka; Yamada, Takuji; Kurokawa, Ken
2014-12-11
Metagenomics is a powerful methodology to study microbial communities, but it is highly dependent on nucleotide sequence similarity searching against sequence databases. Metagenomic analyses with next-generation sequencing technologies produce enormous numbers of reads from microbial communities, and many reads are derived from microbes whose genomes have not yet been sequenced, limiting the usefulness of existing sequence similarity search tools. Therefore, there is a clear need for a sequence similarity search tool that can rapidly detect weak similarity in large datasets. We developed a tool, which we named CLAST (CUDA implemented large-scale alignment search tool), that enables analyses of millions of reads and thousands of reference genome sequences, and runs on NVIDIA Fermi architecture graphics processing units. CLAST has four main advantages over existing alignment tools. First, CLAST was capable of identifying sequence similarities ~80.8 times faster than BLAST and 9.6 times faster than BLAT. Second, CLAST executes global alignment as the default (local alignment is also an option), enabling CLAST to assign reads to taxonomic and functional groups based on evolutionarily distant nucleotide sequences with high accuracy. Third, CLAST does not need a preprocessed sequence database like Burrows-Wheeler Transform-based tools, and this enables CLAST to incorporate large, frequently updated sequence databases. Fourth, CLAST requires <2 GB of main memory, making it possible to run CLAST on a standard desktop computer or server node. CLAST achieved very high speed (similar to the Burrows-Wheeler Transform-based Bowtie 2 for long reads) and sensitivity (equal to BLAST, BLAT, and FR-HIT) without the need for extensive database preprocessing or a specialized computing platform. Our results demonstrate that CLAST has the potential to be one of the most powerful and realistic approaches to analyze the massive amount of sequence data from next-generation sequencing technologies.
Eisenberg, Tobias; Glaeser, Stefanie P; Ewers, Christa; Semmler, Torsten; Nicklas, Werner; Rau, Jörg; Mauder, Norman; Hofmann, Nicola; Imaoka, Koichi; Kimura, Masanobu; Kämpfer, Peter
2015-12-01
A pleomorphic, Gram-negative, rod-shaped, indole-, oxidase- and catalase-negative, non-spore-forming, non-motile bacterium was isolated in 1979 from the heart of a spinifex hopping mouse (Notomys alexis Thomas, 1922) with septicaemia and stored as Streptobacillus moniliformis in the strain collection of the Animal Health Laboratory, South Perth, Western Australia (AHL 370-1), as well as under CCUG 12425. On the basis of 16SrRNA gene sequence analyses, the strain was assigned to the genus Streptobacillus, with 99.4 % sequence similarity to the type strain of Streptobacillus moniliformis, 95.6 %sequence similarity to the type strain of Streptobacillus hongkongensis and 99.0 %sequence similarity to the type strain of Streptobacillus felis. The clear differentiation of strain AHL 370-1T from Streptobacillus moniliformis, Streptobacillus hongkongensis and Streptobacillus felis was also supported by rpoB, groEL and recA nucleotide and amino acid sequence analysis. Average nucleotide identity was 87.16 % between strain AHL 370-1T and Streptobacillus moniliformis DSM 12112T. Physiological data confirmed the allocation of strain AHL 370-1T to the family Leptotrichiaceae, considering the very similar profiles of enzyme activities and fatty acids compared to closely related species. Within the genus Streptobacillus,isolate AHL 370-1T could also be separated unambiguously from the type strains of Streptobacillus moniliformis, Streptobacillus hongkongensis and Streptobacillus felis by MALDI-TOF mass spectrometry. Two further strains (KWG2 and KWG24) isolated from asymptomatic black rats in Japan were highly similar to AHL 370-1T. On the basis of these data, we propose the novel species Streptobacillus notomytis sp. nov., with the type strain AHL370-1T (=CCUG 12425T=DSM 100026T=CCM 8593T=EF 12425T).
Okuda, A; Imagawa, M; Maeda, Y; Sakai, M; Muramatsu, M
1989-10-05
We have recently identified a typical enhancer, termed GPEI, located about 2.5 kilobases upstream from the transcription initiation site of the rat glutathione transferase P gene. Analyses of 5' and 3' deletion mutants revealed that the cis-acting sequence of GPEI contained the phorbol 12-O-tetradecanoate 13-acetate responsive element (TRE)-like sequence in it. For the maximal activity, however, GPEI required an adjacent upstream sequence of about 19 base pairs in addition to the TRE-like sequence. With the DNA binding gel-shift assay, we could detect protein(s) that specifically binds to the TRE-like sequence of GPEI fragment, which was possibly c-jun.c-fos complex or a similar protein complex. The sequence immediately upstream of the TRE-like sequence did not have any activity by itself, but augmented the latter activity by about 5-fold.
A Novel Cylindrical Representation for Characterizing Intrinsic Properties of Protein Sequences.
Yu, Jia-Feng; Dou, Xiang-Hua; Wang, Hong-Bo; Sun, Xiao; Zhao, Hui-Ying; Wang, Ji-Hua
2015-06-22
The composition and sequence order of amino acid residues are the two most important characteristics to describe a protein sequence. Graphical representations facilitate visualization of biological sequences and produce biologically useful numerical descriptors. In this paper, we propose a novel cylindrical representation by placing the 20 amino acid residue types in a circle and sequence positions along the z axis. This representation allows visualization of the composition and sequence order of amino acids at the same time. Ten numerical descriptors and one weighted numerical descriptor have been developed to quantitatively describe intrinsic properties of protein sequences on the basis of the cylindrical model. Their applications to similarity/dissimilarity analysis of nine ND5 proteins indicated that these numerical descriptors are more effective than several classical numerical matrices. Thus, the cylindrical representation obtained here provides a new useful tool for visualizing and charactering protein sequences. An online server is available at http://biophy.dzu.edu.cn:8080/CNumD/input.jsp .
Sanchez, Daniel J.; Gobel, Eric W.; Reber, Paul J.
2015-01-01
Memory-impaired patients express intact implicit perceptual–motor sequence learning, but it has been difficult to obtain a similarly clear dissociation in healthy participants. When explicit memory is intact, participants acquire some explicit knowledge and performance improvements from implicit learning may be subtle. Therefore, it is difficult to determine whether performance exceeds what could be expected on the basis of the concomitant explicit knowledge. Using a challenging new sequence-learning task, robust implicit learning was found in healthy participants with virtually no associated explicit knowledge. Participants trained on a repeating sequence that was selected randomly from a set of five. On a performance test of all five sequences, performance was best on the trained sequence, and two-thirds of the participants exhibited individually reliable improvement (by chi-square analysis). Participants could not reliably indicate which sequence had been trained by either recognition or recall. Only by expressing their knowledge via performance were participants able to indicate which sequence they had learned. PMID:21169570
Genome and Transcriptome Sequencing of the Ostreid herpesvirus 1 From Tomales Bay, California
NASA Astrophysics Data System (ADS)
Burge, C. A.; Langevin, S.; Closek, C. J.; Roberts, S. B.; Friedman, C. S.
2016-02-01
Mass mortalities of larval and seed bivalve molluscs attributed to the Ostreid herpesvirus 1 (OsHV-1) occur globally. OsHV-1 was fully sequenced and characterized as a member of the Family Malacoherpesviridae. Multiple strains of OsHV-1 exist and may vary in virulence, i.e. OsHV-1 µvar. For most global variants of OsHV-1, sequence data is limited to PCR-based sequencing of segments, including two recent genomes. In the United States, OsHV-1 is limited to detection in adjacent embayments in California, Tomales and Drakes bays. Limited DNA sequence data of OsHV-1 infecting oysters in Tomales Bay indicates the virus detected in Tomales Bay is similar but not identical to any one global variant of OsHV-1. In order to better understand both strain variation and virulence of OsHV-1 infecting oysters in Tomales Bay, we used genomic and transcriptomic sequencing. Meta-genomic sequencing (Illumina MiSeq) was conducted from infected oysters (n=4 per year) collected in 2003, 2007, and 2014, where full OsHV-1 genome sequences and low overall microbial diversity were achieved from highly infected oysters. Increased microbial diversity was detected in three of four samples sequenced from 2003, where qPCR based genome copy numbers of OsHV-1 were lower. Expression analysis (SOLiD RNA sequencing) of OsHV-1 genes expressed in oyster larvae at 24 hours post exposure revealed a nearly complete transcriptome, with several highly expressed genes, which are similar to recent transcriptomic analyses of other OsHV-1 variants. Taken together, our results indicate that genome and transcriptome sequencing may be powerful tools in understanding both strain variation and virulence of non-culturable marine viruses.
Windsor, Aaron J.; Schranz, M. Eric; Formanová, Nataša; Gebauer-Jung, Steffi; Bishop, John G.; Schnabelrauch, Domenica; Kroymann, Juergen; Mitchell-Olds, Thomas
2006-01-01
Comparative genomics provides insight into the evolutionary dynamics that shape discrete sequences as well as whole genomes. To advance comparative genomics within the Brassicaceae, we have end sequenced 23,136 medium-sized insert clones from Boechera stricta, a wild relative of Arabidopsis (Arabidopsis thaliana). A significant proportion of these sequences, 18,797, are nonredundant and display highly significant similarity (BLASTn e-value ≤ 10−30) to low copy number Arabidopsis genomic regions, including more than 9,000 annotated coding sequences. We have used this dataset to identify orthologous gene pairs in the two species and to perform a global comparison of DNA regions 5′ to annotated coding regions. On average, the 500 nucleotides upstream to coding sequences display 71.4% identity between the two species. In a similar analysis, 61.4% identity was observed between 5′ noncoding sequences of Brassica oleracea and Arabidopsis, indicating that regulatory regions are not as diverged among these lineages as previously anticipated. By mapping the B. stricta end sequences onto the Arabidopsis genome, we have identified nearly 2,000 conserved blocks of microsynteny (bracketing 26% of the Arabidopsis genome). A comparison of fully sequenced B. stricta inserts to their homologous Arabidopsis genomic regions indicates that indel polymorphisms >5 kb contribute substantially to the genome size difference observed between the two species. Further, we demonstrate that microsynteny inferred from end-sequence data can be applied to the rapid identification and cloning of genomic regions of interest from nonmodel species. These results suggest that among diploid relatives of Arabidopsis, small- to medium-scale shotgun sequencing approaches can provide rapid and cost-effective benefits to evolutionary and/or functional comparative genomic frameworks. PMID:16607030
Genotype diversity of hepatitis C virus (HCV) in HCV-associated liver disease patients in Indonesia.
Utama, Andi; Tania, Navessa Padma; Dhenni, Rama; Gani, Rino Alvani; Hasan, Irsan; Sanityoso, Andri; Lelosutan, Syafruddin A R; Martamala, Ruswhandi; Lesmana, Laurentius Adrianus; Sulaiman, Ali; Tai, Susan
2010-09-01
Hepatitis C virus (HCV) genotype distribution in Indonesia has been reported. However, the identification of HCV genotype was based on 5'-UTR or NS5B sequence. This study was aimed to observe HCV core sequence variation among HCV-associated liver disease patients in Jakarta, and to analyse the HCV genotype diversity based on the core sequence. Sixty-eight chronic hepatitis (CH), 48 liver cirrhosis (LC) and 34 hepatocellular carcinoma (HCC) were included in this study. HCV core variation was analysed by direct sequencing. Alignment of HCV core sequences demonstrated that the core sequence was relatively varied among the genotype. Indeed, 237 bases of the core sequence could classify the HCV subtype; however, 236 bases failed to differentiate several subtypes. Based on 237 bases of the core sequences, the HCV strains were classified into genotypes 1 (subtypes 1a, 1b and 1c), 2 (subtypes 2a, 2e and 2f) and 3 (subtypes 3a and 3k). The HCV 1b (47.3%) was the most prevalent, followed by subtypes 1c (18.7%), 3k (10.7%), 2a (10.0%), 1a (6.7%), 2e (5.3%), 2f (0.7%) and 3a (0.7%). HCV 1b was the most common in all patients, and the prevalence increased with the severity of liver disease (36.8% in CH, 54.2% in LC and 58.8% in HCC). These results were similar to a previous report based on NS5B sequence analysis. Hepatitis C virus core sequence (237 bases) could identify the HCV subtype and the prevalence of HCV subtype based on core sequence was similar to those based on the NS5B region.
Bricheux, G; Brugerolle, G
1997-08-01
The parasitic protozoan Trichomonas vaginalis is known to contain the ubiquitous and highly conserved protein actin. A genomic library and a cDNA library have been screened to identify and clone the actin gene(s) of T. vaginalis. The nucleotide sequence of one gene and its flanking regions have been determined. The open reading frame encodes a protein of 376 amino acids. The sequence is not interrupted by any introns and the promoter could be represented by a 10 bp motif close to a consensus motif also found upstream of most sequenced T. vaginalis genes. The five different clones isolated from the cDNA library have similar sequences and encode three actin proteins differing only by one or two amino acids. A phylogenetic analysis of 31 actin sequences by distance matrix and parsimony methods, using centractin as outgroup, gives congruent trees with Parabasala branching above Diplomonadida.
2011-01-01
Background Common carp is one of the most important aquaculture teleost fish in the world. Common carp and other closely related Cyprinidae species provide over 30% aquaculture production in the world. However, common carp genomic resources are still relatively underdeveloped. BAC end sequences (BES) are important resources for genome research on BAC-anchored genetic marker development, linkage map and physical map integration, and whole genome sequence assembling and scaffolding. Result To develop such valuable resources in common carp (Cyprinus carpio), a total of 40,224 BAC clones were sequenced on both ends, generating 65,720 clean BES with an average read length of 647 bp after sequence processing, representing 42,522,168 bp or 2.5% of common carp genome. The first survey of common carp genome was conducted with various bioinformatics tools. The common carp genome contains over 17.3% of repetitive elements with GC content of 36.8% and 518 transposon ORFs. To identify and develop BAC-anchored microsatellite markers, a total of 13,581 microsatellites were detected from 10,355 BES. The coding region of 7,127 genes were recognized from 9,443 BES on 7,453 BACs, with 1,990 BACs have genes on both ends. To evaluate the similarity to the genome of closely related zebrafish, BES of common carp were aligned against zebrafish genome. A total of 39,335 BES of common carp have conserved homologs on zebrafish genome which demonstrated the high similarity between zebrafish and common carp genomes, indicating the feasibility of comparative mapping between zebrafish and common carp once we have physical map of common carp. Conclusion BAC end sequences are great resources for the first genome wide survey of common carp. The repetitive DNA was estimated to be approximate 28% of common carp genome, indicating the higher complexity of the genome. Comparative analysis had mapped around 40,000 BES to zebrafish genome and established over 3,100 microsyntenies, covering over 50% of the zebrafish genome. BES of common carp are tremendous tools for comparative mapping between the two closely related species, zebrafish and common carp, which should facilitate both structural and functional genome analysis in common carp. PMID:21492448
MytiBase: a knowledgebase of mussel (M. galloprovincialis) transcribed sequences
Venier, Paola; De Pittà, Cristiano; Bernante, Filippo; Varotto, Laura; De Nardi, Barbara; Bovo, Giuseppe; Roch, Philippe; Novoa, Beatriz; Figueras, Antonio; Pallavicini, Alberto; Lanfranchi, Gerolamo
2009-01-01
Background Although Bivalves are among the most studied marine organisms due to their ecological role, economic importance and use in pollution biomonitoring, very little information is available on the genome sequences of mussels. This study reports the functional analysis of a large-scale Expressed Sequence Tag (EST) sequencing from different tissues of Mytilus galloprovincialis (the Mediterranean mussel) challenged with toxic pollutants, temperature and potentially pathogenic bacteria. Results We have constructed and sequenced seventeen cDNA libraries from different Mediterranean mussel tissues: gills, digestive gland, foot, anterior and posterior adductor muscle, mantle and haemocytes. A total of 24,939 clones were sequenced from these libraries generating 18,788 high-quality ESTs which were assembled into 2,446 overlapping clusters and 4,666 singletons resulting in a total of 7,112 non-redundant sequences. In particular, a high-quality normalized cDNA library (Nor01) was constructed as determined by the high rate of gene discovery (65.6%). Bioinformatic screening of the non-redundant M. galloprovincialis sequences identified 159 microsatellite-containing ESTs. Clusters, consensuses, related similarities and gene ontology searches have been organized in a dedicated, searchable database . Conclusion We defined the first species-specific catalogue of M. galloprovincialis ESTs including 7,112 unique transcribed sequences. Putative microsatellite markers were identified. This annotated catalogue represents a valuable platform for expression studies, marker validation and genetic linkage analysis for investigations in the biology of Mediterranean mussels. PMID:19203376
A kinematic analysis of the modified flight telerobotic servicer manipulator system
NASA Technical Reports Server (NTRS)
Crane, Carl; Carnahan, Tim; Duffy, Joseph
1992-01-01
A reverse kinematic analysis is presented of a six-DOF subchain of a modified seven-DOF flight telerobotic servicer manipulator system. The six-DOF subchain is designated as a TR-RT chain, which describes the sequence of manipulator joints beginning with the first grounded hook joint (universal joint) T, where the sequence R-R designates a pair of revolute joints with parallel axes. At the outset, it had been thought that the reverse kinematic analysis would be similar to a TTT manipulator previously analyzed, in which the third and fourth joints intersected at a finite point. However, this is shown not the case, and a 16th-degree tan-half-angle polynomial is derived for the TR-RT manipulator.
Asamizu, Erika; Nakamura, Yasukazu; Sato, Shusei; Tabata, Satoshi
2004-02-01
To perform a comprehensive analysis of genes expressed in a model legume, Lotus japonicus, a total of 74472 3'-end expressed sequence tags (EST) were generated from cDNA libraries produced from six different organs. Clustering of sequences was performed with an identity criterion of 95% for 50 bases, and a total of 20457 non-redundant sequences, 8503 contigs and 11954 singletons were generated. EST sequence coverage was analyzed by using the annotated L. japonicus genomic sequence and 1093 of the 1889 predicted protein-encoding genes (57.9%) were hit by the EST sequence(s). Gene content was compared to several plant species. Among the 8503 contigs, 471 were identified as sequences conserved only in leguminous species and these included several disease resistance-related genes. This suggested that in legumes, these genes may have evolved specifically to resist pathogen attack. The rate of gene sequence divergence was assessed by comparing similarity level and functional category based on the Gene Ontology (GO) annotation of Arabidopsis genes. This revealed that genes encoding ribosomal proteins, as well as those related to translation, photosynthesis, and cellular structure were more abundantly represented in the highly conserved class, and that genes encoding transcription factors and receptor protein kinases were abundantly represented in the less conserved class. To make the sequence information and the cDNA clones available to the research community, a Web database with useful services was created at http://www.kazusa.or.jp/en/plant/lotus/EST/.
Srinivas, T N R; Aditya, S; Bhumika, V; Kumar, P Anil
2014-02-01
Novel pinkish-orange pigmented, Gram-negative staining, half-moon shaped, non-motile, strictly aerobic strains designated AK24(T) and AK26 were isolated from water and sediment samples of Lonar Lake, Buldhana district, Maharahstra, India. Both strains were positive for oxidase, catalase and β-galactosidase activities. The predominant fatty acids were iso-C15:0 (41.5%), anteiso-C15:0 (9.7%), iso-C17:0 3OH (9.6%), iso-C17:1 ω9c (10.2%) and C16:1 ω7c/C16:1 ω6c/iso-C15:0 2OH (summed feature 3) (14.4%). The strains contained MK-7 as the major respiratory quinone, and phosphatidylethanolamine and five unidentified lipids as the polar lipids. Blast analysis of the 16S rRNA gene sequence of strain AK24(T) showed that it was closely related to Aquiflexum balticum, with a pair-wise sequence similarity of 91.6%, as well as to Fontibacter ferrireducens, Belliella baltica and Indibacter alkaliphilus (91.3, 91.2 and 91.2% pair-wise sequence similarity, respectively), but it only had between 88.6 and 91.0% pair-wise sequence similarity to the rest of the family members. The MALDI-TOF assay reported no significant similarities for AK24(T) and AK26, since they potentially represented a new species. A MALDI MSP dendrogram showed close similarity between the two strains, but they maintained a distance from their phylogenetic neighbors. The genome of AK24(T) showed the presence of heavy metal tolerance genes, including the genes providing resistance to arsenic, cadmium, cobalt and zinc. A cluster of heat shock resistance genes was also found in the genome. Two lantibiotic producing genes, LanR and LasB, were also found in the genome of AK24(T). Strains AK24(T) and AK26 were very closely related to each other with 99.5% pair-wise sequence similarity. Phylogenetic analysis indicated that the strains were members of the family Cyclobacteriaceae and they clustered with the genus Mariniradius, as well as with the genera Aquiflexum, Cecembia, Fontibacter, Indibacter, and Shivajiella. DNA-DNA hybridization between strains AK24(T) and AK26 showed a relatedness of 82% and their rep-PCR banding patterns were very similar. Based on data from the current polyphasic study, it is proposed that the isolates be placed in a new genus and species with the name Lunatimonas lonarensis gen. nov., sp. nov. The type strain of Lunatimonas lonarensis is AK24(T) (=JCM 18822(T)=MTCC 11627(T)). Copyright © 2013 Elsevier GmbH. All rights reserved.
MotionFlow: Visual Abstraction and Aggregation of Sequential Patterns in Human Motion Tracking Data.
Jang, Sujin; Elmqvist, Niklas; Ramani, Karthik
2016-01-01
Pattern analysis of human motions, which is useful in many research areas, requires understanding and comparison of different styles of motion patterns. However, working with human motion tracking data to support such analysis poses great challenges. In this paper, we propose MotionFlow, a visual analytics system that provides an effective overview of various motion patterns based on an interactive flow visualization. This visualization formulates a motion sequence as transitions between static poses, and aggregates these sequences into a tree diagram to construct a set of motion patterns. The system also allows the users to directly reflect the context of data and their perception of pose similarities in generating representative pose states. We provide local and global controls over the partition-based clustering process. To support the users in organizing unstructured motion data into pattern groups, we designed a set of interactions that enables searching for similar motion sequences from the data, detailed exploration of data subsets, and creating and modifying the group of motion patterns. To evaluate the usability of MotionFlow, we conducted a user study with six researchers with expertise in gesture-based interaction design. They used MotionFlow to explore and organize unstructured motion tracking data. Results show that the researchers were able to easily learn how to use MotionFlow, and the system effectively supported their pattern analysis activities, including leveraging their perception and domain knowledge.
Functional metagenomics reveals novel β-galactosidases not predictable from gene sequences.
Cheng, Jiujun; Romantsov, Tatyana; Engel, Katja; Doxey, Andrew C; Rose, David R; Neufeld, Josh D; Charles, Trevor C
2017-01-01
The techniques of metagenomics have allowed researchers to access the genomic potential of uncultivated microbes, but there remain significant barriers to determination of gene function based on DNA sequence alone. Functional metagenomics, in which DNA is cloned and expressed in surrogate hosts, can overcome these barriers, and make important contributions to the discovery of novel enzymes. In this study, a soil metagenomic library carried in an IncP cosmid was used for functional complementation for β-galactosidase activity in both Sinorhizobium meliloti (α-Proteobacteria) and Escherichia coli (γ-Proteobacteria) backgrounds. One β-galactosidase, encoded by six overlapping clones that were selected in both hosts, was identified as a member of glycoside hydrolase family 2. We could not identify ORFs obviously encoding possible β-galactosidases in 19 other sequenced clones that were only able to complement S. meliloti. Based on low sequence identity to other known glycoside hydrolases, yet not β-galactosidases, three of these ORFs were examined further. Biochemical analysis confirmed that all three encoded β-galactosidase activity. Lac36W_ORF11 and Lac161_ORF7 had conserved domains, but lacked similarities to known glycoside hydrolases. Lac161_ORF10 had neither conserved domains nor similarity to known glycoside hydrolases. Bioinformatic and structural modeling implied that Lac161_ORF10 protein represented a novel enzyme family with a five-bladed propeller glycoside hydrolase domain. By discovering founding members of three novel β-galactosidase families, we have reinforced the value of functional metagenomics for isolating novel genes that could not have been predicted from DNA sequence analysis alone.
Molecular analysis in true hermaphrodites with different karyotypes and similar phenotypes
DOE Office of Scientific and Technical Information (OSTI.GOV)
Torres, L.; Cervantes, A.; Kofman-Alfaro, S.
1996-05-17
True hermaphroditism is characterized by the development of ovarian and testicular tissue in the same individual. Muellerian and Wolffian structures are usually present, and external genitalia are often ambiguous. The most frequent karyotype in these patients is 46,XX or various forms of mosaicism, whereas 46,XY is very rarely found. The phenotype in all these subjects is similar. We studied 10 true hermaphrodites. Six of them had a 46,XX chromosomal complement: 3 had been reared as males and 3 as females. The other 4 patients were mosaics: 3 were 46,XX/46,XY and one had a 46,XX/47,XXY karyotype. One of the 46,XX/46,XY mosaicsmore » was reared as a female, whereas the other 3 mosaics were reared as males. The sex of assignment in the 10 patients depended only on labio-scrotal differentiation. Molecular studies in 46,XX subjects documented the absence of Y centromeric sequences in all cases, arguing against hidden mosaicism. One patient presented Yp sequences (ZFY+, SRY+), which contrast with South African black 46,XX true hermaphrodites in whom no Y sequences were found. Molecular analysis in the subjects with mosaicism demonstrated the presence of Y centromeric and Yp sequences confirming the presence of a Y chromosome. Gonadal development, endocrine function, and phenotype in the 10 patients did not correlate with the presence of a Y chromosome or Y-derived sequences in the genome, confirming that true hermaphroditism is a heterogeneous condition. Both Mexican and non-South African 46,XX true hermaphrodites may be SRY positive. 51 refs., 3 figs., 2 tabs.« less
Motevalli Haghi, A; Nateghpour, M; Edrissian, Ghh; Sepehrizadeh, Z; Mohebali, M; Khoramizade, Mr; Shahrbabak, S Sabouri; Moghimi, H
2012-01-01
Plasmodium vivax is responsible for approximately 80 million malaria cases in the world. Apical membrane antigen1 (AMA-1) is a type I integral membrane protein present in all Plasmodium species. AMA-1 interferes in critical steps of invasion of human hepatocytes by sporozoites and red blood cells by merozoites and is one of the most immunodominant antigens for eliciting a protective immune response in human. It is considered as a promising antigen for inclusion in a vaccine against P. vivax. Since more knowledge is needed to lighten the scope of such antigen we compared genetic variation in P. vivax AMA-1from an Iranian isolate with those reported from some of the other malarious countries so far. P. vivax genomic DNA was extracted from the whole blood of an Iranian patient with patent P. vivax infection. The nucleotide sequence for 446 amino acid (AA) residues (42-488 of PvAMA-1) was amplified by PCR and cloned in pUC19 vector for sequencing. Sequence analysis of the antigen showed a high degree of identity (99%) with strong homology to the PvAMA-1 gene of P. vivax S3 and SKO814 isolates from India and Korea (Asian isolates) respectively, and 96% similarity with P. vivax Sal-1 AMA-1 gene from El Salvador. We cloned and characterized three domains of PvAMA-1 gene from an Iranian patient. Predicted protein sequence of this gene showed some discrepancies in corresponding protein in comparing with similar genes reported from other malarious countries.
MHC class I loci of the Bar-Headed goose (Anser indicus)
2010-01-01
MHC class I proteins mediate functions in anti-pathogen defense. MHC diversity has already been investigated by many studies in model avian species, but here we chose the bar-headed goose, a worldwide migrant bird, as a non-model avian species. Sequences from exons encoding the peptide-binding region (PBR) of MHC class I molecules were isolated from liver genomic DNA, to investigate variation in these genes. These are the first MHC class I partial sequences of the bar-headed goose to be reported. A preliminary analysis suggests the presence of at least four MHC class I genes, which share great similarity with those of the goose and duck. A phylogenetic analysis of bar-headed goose, goose and duck MHC class I sequences using the NJ method supports the idea that they all cluster within the anseriforms clade. PMID:21637434
Comparative sequence analysis suggests a conserved gating mechanism for TRP channels
Palovcak, Eugene; Delemotte, Lucie; Klein, Michael L.
2015-01-01
The transient receptor potential (TRP) channel superfamily plays a central role in transducing diverse sensory stimuli in eukaryotes. Although dissimilar in sequence and domain organization, all known TRP channels act as polymodal cellular sensors and form tetrameric assemblies similar to those of their distant relatives, the voltage-gated potassium (Kv) channels. Here, we investigated the related questions of whether the allosteric mechanism underlying polymodal gating is common to all TRP channels, and how this mechanism differs from that underpinning Kv channel voltage sensitivity. To provide insight into these questions, we performed comparative sequence analysis on large, comprehensive ensembles of TRP and Kv channel sequences, contextualizing the patterns of conservation and correlation observed in the TRP channel sequences in light of the well-studied Kv channels. We report sequence features that are specific to TRP channels and, based on insight from recent TRPV1 structures, we suggest a model of TRP channel gating that differs substantially from the one mediating voltage sensitivity in Kv channels. The common mechanism underlying polymodal gating involves the displacement of a defect in the H-bond network of S6 that changes the orientation of the pore-lining residues at the hydrophobic gate. PMID:26078053
Endosymbiotic Microbiota of the Bamboo Pseudococcid Antonina crawii (Insecta, Homoptera)
Fukatsu, Takema; Nikoh, Naruo
2000-01-01
We characterized the intracellular symbiotic microbiota of the bamboo pseudococcid Antonina crawii by performing a molecular phylogenetic analysis in combination with in situ hybridization. Almost the entire length of the bacterial 16S rRNA gene was amplified and cloned from A. crawii whole DNA. Restriction fragment length polymorphism analysis revealed that the clones obtained included three distinct types of sequences. Nucleotide sequences of the three types were determined and subjected to a molecular phylogenetic analysis. The first sequence was a member of the γ subdivision of the division Proteobacteria (γ-Proteobacteria) to which no sequences in the database were closely related, although the sequences of endosymbionts of other homopterans, such as psyllids and aphids, were distantly related. The second sequence was a β-Proteobacteria sequence and formed a monophyletic group with the sequences of endosymbionts from other pseudococcids. The third sequence exhibited a high level of similarity to sequences of Spiroplasma spp. from ladybird beetles and a tick. Localization of the endosymbionts was determined by using tissue sections of A. crawii and in situ hybridization with specific oligonucleotide probes. The γ- and β-Proteobacteria symbionts were packed in the cytoplasm of the same mycetocytes (or bacteriocytes) and formed a large mycetome (or bacteriome) in the abdomen. The spiroplasma symbionts were also present intracellularly in various tissues at a low density. We observed that the anterior poles of developing eggs in the ovaries were infected by the γ- and β-Proteobacteria symbionts in a systematic way, which ensured vertical transmission. Five representative pseudococcids were examined by performing diagnostic PCR experiments with specific primers; the β-Proteobacteria symbiont was detected in all five pseudococcids, the γ-Proteobacteria symbiont was found in three, and the spiroplasma symbiont was detected only in A. crawii. PMID:10653730
2013-01-01
A need for a genomic species definition is emerging from several independent studies worldwide. In this commentary paper, we discuss recent studies on the genomic taxonomy of diverse microbial groups and a unified species definition based on genomics. Accordingly, strains from the same microbial species share >95% Average Amino Acid Identity (AAI) and Average Nucleotide Identity (ANI), >95% identity based on multiple alignment genes, <10 in Karlin genomic signature, and > 70% in silico Genome-to-Genome Hybridization similarity (GGDH). Species of the same genus will form monophyletic groups on the basis of 16S rRNA gene sequences, Multilocus Sequence Analysis (MLSA) and supertree analysis. In addition to the established requirements for species descriptions, we propose that new taxa descriptions should also include at least a draft genome sequence of the type strain in order to obtain a clear outlook on the genomic landscape of the novel microbe. The application of the new genomic species definition put forward here will allow researchers to use genome sequences to define simultaneously coherent phenotypic and genomic groups. PMID:24365132
Genomic characterization of two new enterovirus types, EV-A114 and EV-A121.
Deshpande, Jagadish M; Sharma, Deepa K; Saxena, Vinay K; Shetty, Sushmitha A; Qureshi, Tarique Husain I H; Nalavade, Uma P
2016-12-01
Enteroviruses cause a variety of illnesses of the gastrointestinal tract, central nervous system and cardiovascular system. Phylogenetic analysis of VP1 sequences has identified 106 different human enteroviruses classified into four enterovirus species within the genus Enterovirus of the family Picornaviridae. It is likely that not all enterovirus types have been discovered. Between September 2013 and October 2014, stool samples of 6274 apparently healthy children of up to 5 years of age residing in Gorakhpur district, Uttar Pradesh, India were screened for enteroviruses. Virus isolates obtained in RD and Hep-2c cells were identified by complete VP1 sequencing. Enteroviruses were isolated from 3042 samples. A total of 87 different enterovirus types were identified. Two isolates with 71 and 74 % nucleotide sequence similarity to all other known enteroviruses were recognized as novel types. In this paper we report identification and complete genome sequence analysis of these two isolates classified as EV-A114 and EV-A121.
Arndt, E; Scholzen, T; Krömer, W; Hatakeyama, T; Kimura, M
1991-06-01
Approximately 40 ribosomal proteins from each Halobacterium marismortui and Bacillus stearothermophilus have been sequenced either by direct protein sequence analysis or by DNA sequence analysis of the appropriate genes. The comparison of the amino acid sequences from the archaebacterium H marismortui with the available ribosomal proteins from the eubacterial and eukaryotic kingdoms revealed four different groups of proteins: 24 proteins are related to both eubacterial as well as eukaryotic proteins. Eleven proteins are exclusively related to eukaryotic counterparts. For three proteins only eubacterial relatives-and for another three proteins no counterpart-could be found. The similarities of the halobacterial ribosomal proteins are in general somewhat higher to their eukaryotic than to their eubacterial counterparts. The comparison of B stearothermophilus proteins with their E coli homologues showed that the proteins evolved at different rates. Some proteins are highly conserved with 64-76% identity, others are poorly conserved with only 25-34% identical amino acid residues.
Rodríguez, Javier M; Moreno, Leticia Tais; Alejo, Alí; Lacasta, Anna; Rodríguez, Fernando; Salas, María L
2015-01-01
The strain BA71V has played a key role in African swine fever virus (ASFV) research. It was the first genome sequenced, and remains the only genome completely determined. A large part of the studies on the function of ASFV genes, viral transcription, replication, DNA repair and morphogenesis, has been performed using this model. This avirulent strain was obtained by adaptation to grow in Vero cells of the highly virulent BA71 strain. We report here the analysis of the genome sequence of BA71 in comparison with that of BA71V. They possess the smallest genomes for a virulent or an attenuated ASFV, and are essentially identical except for a relatively small number of changes. We discuss the possible contribution of these changes to virulence. Analysis of the BA71 sequence allowed us to identify new similarities among ASFV proteins, and with database proteins including two ASFV proteins that could function as a two-component signaling network.
Collart, F R; Osipiuk, J; Trent, J; Olsen, G J; Huberman, E
1996-10-03
We have cloned and characterized the gene encoding inosine monophosphate dehydrogenase (IMPDH) from Pyrococcus furiosus (Pf), a hyperthermophillic archeon. Sequence analysis of the Pf gene indicated an open reading frame specifying a protein of 485 amino acids (aa) with a calculated M(r) of 52900. Canonical Archaea promoter elements, Box A and Box B, are located -49 and -17 nucleotides (nt), respectively, upstream of the putative start codon. The sequence of the putative active-site region conforms to the IMPDH signature motif and contains a putative active-site cysteine. Phylogenetic relationships derived by using all available IMPDH sequences are consistent with trees developed for other molecules; they do not precisely resolve the history of Pf IMPDH but indicate a close similarity to bacterial IMPDH proteins. The phylogenetic analysis indicates that a gene duplication occurred prior to the division between rodents and humans, accounting for the Type I and II isoforms identified in mice and humans.
Bidin, M; Lojkić, I; Bidin, Z; Tiljar, M; Majnarić, D
2011-12-01
Phylogenetic diversity of parvovirus detected in commercial chicken and turkey flocks is described. Nine chicken and six turkey flocks from Croatian farms were tested for parvovirus presence. Intestinal samples from one turkey and seven chicken flocks were found positive, and were sequenced. Natural parvovirus infection was more frequently detected in chickens than in turkeys examined in this study. Sequence analysis of 400 nucleotide fragments of the nonstructural gene (NS) showed that our sequences had more similarity with chicken parvovirus (ChPV) (92.3%-99.7%) than turkey parvovirus (TuPV) (89.5%-98.9%) strains. Phylogenetic analysis grouped our sequences in two clades. Also, the higher prevalence of ChPV than TuPV in tested flocks was defined. The necropsy findings suggested a malabsorption syndrome followed by a preascitic condition. Further research of parvovirus infection, pathogenesis, and the possibility of its association with poult enteritis and mortality syndrome (PEMS) and runting and stunting syndrome (RSS) is needed to clarify its significance as an agent of enteric disease.
Ellis, Crystal N.; Schuster, Brian M.; Striplin, Megan J.; Jones, Stephen H.; Whistler, Cheryl A.
2012-01-01
Risk of gastric infection with Vibrio parahaemolyticus increases with favorable environmental conditions and population shifts that increase prevalence of infective strains. Genetic analysis of New Hampshire strains revealed a unique population with some isolates similar to outbreak-causing strains and high-level diversity that increased as waters warmed. PMID:22407686
Ellis, Crystal N; Schuster, Brian M; Striplin, Megan J; Jones, Stephen H; Whistler, Cheryl A; Cooper, Vaughn S
2012-05-01
Risk of gastric infection with Vibrio parahaemolyticus increases with favorable environmental conditions and population shifts that increase prevalence of infective strains. Genetic analysis of New Hampshire strains revealed a unique population with some isolates similar to outbreak-causing strains and high-level diversity that increased as waters warmed.
Computational Functional Analysis of Lipid Metabolic Enzymes.
Bagnato, Carolina; Have, Arjen Ten; Prados, María B; Beligni, María V
2017-01-01
The computational analysis of enzymes that participate in lipid metabolism has both common and unique challenges when compared to the whole protein universe. Some of the hurdles that interfere with the functional annotation of lipid metabolic enzymes that are common to other pathways include the definition of proper starting datasets, the construction of reliable multiple sequence alignments, the definition of appropriate evolutionary models, and the reconstruction of phylogenetic trees with high statistical support, particularly for large datasets. Most enzymes that take part in lipid metabolism belong to complex superfamilies with many members that are not involved in lipid metabolism. In addition, some enzymes that do not have sequence similarity catalyze similar or even identical reactions. Some of the challenges that, albeit not unique, are more specific to lipid metabolism refer to the high compartmentalization of the routes, the catalysis in hydrophobic environments and, related to this, the function near or in biological membranes.In this work, we provide guidelines intended to assist in the proper functional annotation of lipid metabolic enzymes, based on previous experiences related to the phospholipase D superfamily and the annotation of the triglyceride synthesis pathway in algae. We describe a pipeline that starts with the definition of an initial set of sequences to be used in similarity-based searches and ends in the reconstruction of phylogenies. We also mention the main issues that have to be taken into consideration when using tools to analyze subcellular localization, hydrophobicity patterns, or presence of transmembrane domains in lipid metabolic enzymes.
Lares-Jiménez, Luis Fernando; Booton, Gregory C; Lares-Villa, Fernando; Velázquez-Contreras, Carlos Arturo; Fuerst, Paul A
2014-11-01
Since the first report of Balamuthia mandrillaris as a causative agent of granulomatous amoebic encephalitis in humans, the environmental niche of this amoeba was assumed to be restricted to soil and dust. A single isolation from water was recently made independently by us from Northern Mexico. Now we report the isolation of 8 new strains of B. mandrillaris from Mexico. This continues the pattern of an excess of isolates from North America, compared to other parts of the world. All of the new isolates are environmental isolates, 7 from water samples and one from soil. The identity of each isolate was confirmed by PCR and by examining the sequences of the mitochondrial 16S-like rRNA gene. Success in amplification was determined using comparisons of amplifications of DNA from the strain CDC: V039 and the water strain (ITSON-BM1) as positive controls. The DNA sequences of the new isolates were compared to older strains from clinical cases using phylogenetic analysis, showing very high sequence similarity. The similarity among the new isolates and with previous clinical and environmental isolates of B. mandrillaris was also examined using biochemical and immunological studies. High homogeneity of total protein products, and similarity in antigenic moiety among the eight new isolates and two controls was found. Taken together, the molecular and biochemical studies indicate very low levels of genetic variation within B. mandrillaris. Copyright © 2014 Elsevier Inc. All rights reserved.
The Construction of Impossibility: A Logic-Based Analysis of Conjuring Tricks
Smith, Wally; Dignum, Frank; Sonenberg, Liz
2016-01-01
Psychologists and cognitive scientists have long drawn insights and evidence from stage magic about human perceptual and attentional errors. We present a complementary analysis of conjuring tricks that seeks to understand the experience of impossibility that they produce. Our account is first motivated by insights about the constructional aspects of conjuring drawn from magicians' instructional texts. A view is then presented of the logical nature of impossibility as an unresolvable contradiction between a perception-supported belief about a situation and a memory-supported expectation. We argue that this condition of impossibility is constructed not simply through misperceptions and misattentions, but rather it is an outcome of a trick's whole structure of events. This structure is conceptualized as two parallel event sequences: an effect sequence that the spectator is intended to believe; and a method sequence that the magician understands as happening. We illustrate the value of this approach through an analysis of a simple close-up trick, Martin Gardner's Turnabout. A formalism called propositional dynamic logic is used to describe some of its logical aspects. This elucidates the nature and importance of the relationship between a trick's effect sequence and its method sequence, characterized by the careful arrangement of four evidence relationships: similarity, perceptual equivalence, structural equivalence, and congruence. The analysis further identifies two characteristics of magical apparatus that enable the construction of apparent impossibility: substitutable elements and stable occlusion. PMID:27378959
Goda, Sayed K; Elsayed, Iman E; Khodair, Taha A; El-Sayed, Walaa; Mohamed, Mervat E
2010-11-01
Five malathion-degrading bacterial strains were enriched and isolated from soil samples collected from different agricultural sites in Cairo, Egypt. Malathion was used as a sole source of carbon (50 mg/l) to enumerate malathion degraders, which were designated as IS1, IS2, IS3, IS4, and IS5. They were identified, based on their morphological and biochemical characteristics, as Pseudomonas sp., Pseudomonas putida, Micrococcus lylae, Pseudomonas aureofaciens, and Acetobacter liquefaciens, respectively. IS1 and IS2, which showed the highest degrading activity, were selected for further identification by partial sequence analysis of their 16S rRNA genes. The 16S rRNA gene of IS1 shared 99% similarity with that of Alphaprotoebacterium BAL284, while IS2 scored 100% similarity with that of Pseudomonas putida 32zhy. Malathion residues almost completely disappeared within 6 days of incubation in IS2 liquid cultures. LC/ESI-MS analysis confirmed the degradation of malathion to malathion monocarboxylic and dicarboxylic acids, which formed as a result of carboxylesterase activity. A carboxylesterase gene (CE) was amplified from the IS2 genome by using specifically designed PCR primers. The sequence analysis showed a significant similarity to a known CE gene in different Pseudomonas sp. We report here the isolation of a new malathion-degrading bacteria from soils in Egypt that may be very well adapted to the climatic and environmental conditions of the country. We also report the partial cloning of a new CE gene. Due to their high biodegradation activity, the bacteria isolated from this work merit further study as potential biological agents for the remediation of soil, water, or crops contaminated with the pesticide malathion.
Archaeal Shikimate Kinase, a New Member of the GHMP-Kinase Family
Daugherty, Matthew; Vonstein, Veronika; Overbeek, Ross; Osterman, Andrei
2001-01-01
Shikimate kinase (EC 2.7.1.71) is a committed enzyme in the seven-step biosynthesis of chorismate, a major precursor of aromatic amino acids and many other aromatic compounds. Genes for all enzymes of the chorismate pathway except shikimate kinase are found in archaeal genomes by sequence homology to their bacterial counterparts. In this study, a conserved archaeal gene (gi|1500322 in Methanococcus jannaschii) was identified as the best candidate for the missing shikimate kinase gene by the analysis of chromosomal clustering of chorismate biosynthetic genes. The encoded hypothetical protein, with no sequence similarity to bacterial and eukaryotic shikimate kinases, is distantly related to homoserine kinases (EC 2.7.1.39) of the GHMP-kinase superfamily. The latter functionality in M. jannaschii is assigned to another gene (gi|1591748), in agreement with sequence similarity and chromosomal clustering analysis. Both archaeal proteins, overexpressed in Escherichia coli and purified to homogeneity, displayed activity of the predicted type, with steady-state kinetic parameters similar to those of the corresponding bacterial kinases: Km,shikimate = 414 ± 33 μM, Km,ATP = 48 ± 4 μM, and kcat = 57 ± 2 s−1 for the predicted shikimate kinase and Km,homoserine = 188 ± 37 μM, Km,ATP = 101 ± 7 μM, and kcat = 28 ± 1 s−1 for the homoserine kinase. No overlapping activity could be detected between shikimate kinase and homoserine kinase, both revealing a >1,000-fold preference for their own specific substrates. The case of archaeal shikimate kinase illustrates the efficacy of techniques based on reconstruction of metabolism from genomic data and analysis of gene clustering on chromosomes in finding missing genes. PMID:11114929
Pervaiz, Tariq; Sun, Xin; Zhang, Yanyi; Tao, Ran; Zhang, Junhuan; Fang, Jinggui
2015-01-16
The nuclear DNA is conventionally used to assess the diversity and relatedness among different species, but variations at the DNA genome level has also been used to study the relationship among different organisms. In most species, mitochondrial and chloroplast genomes are inherited maternally; therefore it is anticipated that organelle DNA remains completely associated. Many research studies were conducted simultaneously on organelle genome. The objectives of this study was to analyze the genetic relationship between chloroplast and mitochondrial DNA in three Chinese Prunus genotypes viz., Prunus persica, Prunus domestica, and Prunus avium. We investigated the genetic diversity of Prunus genotypes using simple sequence repeat (SSR) markers relevant to the chloroplast and mitochondria. Most of the genotypes were genetically similar as revealed by phylogenetic analysis. The Y2 Wu Xing (Cherry) and L2 Hong Xin Li (Plum) genotypes have a high similarity index (0.89), followed by Zi Ye Li (0.85), whereas; L1 Tai Yang Li (plum) has the lowest genetic similarity (0.35). In case of cpSSR, Hong Tao (Peach) and L1 Tai Yang Li (Plum) genotypes demonstrated similarity index of 0.85 and Huang Tao has the lowest similarity index of 0.50. The mtSSR nucleotide sequence analysis revealed that each genotype has similar amplicon length (509 bp) except M5Y1 i.e., 505 bp with CCB256 primer; while in case of NAD6 primer, all genotypes showed different sizes. The MEHO (Peach), MEY1 (Cherry), MEL2 (Plum) and MEL1 (Plum) have 586 bps; while MEY2 (Cherry), MEZI (Plum) and MEHU (Peach) have 585, 584 and 566 bp, respectively. The CCB256 primer showed highly conserved sequences and minute single polymorphic nucleotides with no deletion or mutation. The cpSSR (ARCP511) microsatellites showed the harmonious amplicon length. The CZI (Plum), CHO (Peach) and CL1 (Plum) showed 182 bp; whileCHU (Peach), CY2 (Cherry), CL2 (Plum) and CY1 (Cherry) showed 181 bp amplicon lengths. These results demonstrated high conservation in chloroplast and mitochondrial genome among Prunus species during the evolutionary process. These findings are valuable to study the organelle DNA diversity in different species and genotypes of Prunus to provide in depth insight in to the mitochondrial and chloroplast genomes.
Sequence analysis of Leukemia DNA
NASA Astrophysics Data System (ADS)
Nacong, Nasria; Lusiyanti, Desy; Irawan, Muhammad. Isa
2018-03-01
Cancer is a very deadly disease, one of which is leukemia disease or better known as blood cancer. The cancer cell can be detected by taking DNA in laboratory test. This study focused on local alignment of leukemia and non leukemia data resulting from NCBI in the form of DNA sequences by using Smith-Waterman algorithm. SmithWaterman algorithm was invented by TF Smith and MS Waterman in 1981. These algorithms try to find as much as possible similarity of a pair of sequences, by giving a negative value to the unequal base pair (mismatch), and positive values on the same base pair (match). So that will obtain the maximum positive value as the end of the alignment, and the minimum value as the initial alignment. This study will use sequences of leukemia and 3 sequences of non leukemia.
Genetic characterization of K13965, a strain of Oak Vale virus from Western Australia.
Quan, Phenix-Lan; Williams, David T; Johansen, Cheryl A; Jain, Komal; Petrosov, Alexandra; Diviney, Sinead M; Tashmukhamedova, Alla; Hutchison, Stephen K; Tesh, Robert B; Mackenzie, John S; Briese, Thomas; Lipkin, W Ian
2011-09-01
K13965, an uncharacterized virus, was isolated in 1993 from Anopheles annulipes mosquitoes collected in the Kimberley region of northern Western Australia. Here, we report its genomic sequence, identify it as a rhabdovirus, and characterize its phylogenetic relationships. The genome comprises a P' (C) and SH protein similar to the recently characterized Tupaia and Durham viruses, and shows overlap between G and L genes. Comparison of K13965 genome sequence to other rhabdoviruses identified K13965 as a strain of the unclassified Australian Oak Vale rhabdovirus, whose complete genome sequence we also determined. Phylogenetic analysis of N and L sequences indicated genetic relationship to a recently proposed Sandjima virus clade, although the Oak Vale virus sequences form a branch separate from the African members of that group. Copyright © 2011 Elsevier B.V. All rights reserved.