Method and apparatus for biological sequence comparison
Marr, T.G.; Chang, W.I.
1997-12-23
A method and apparatus are disclosed for comparing biological sequences from a known source of sequences, with a subject (query) sequence. The apparatus takes as input a set of target similarity levels (such as evolutionary distances in units of PAM), and finds all fragments of known sequences that are similar to the subject sequence at each target similarity level, and are long enough to be statistically significant. The invention device filters out fragments from the known sequences that are too short, or have a lower average similarity to the subject sequence than is required by each target similarity level. The subject sequence is then compared only to the remaining known sequences to find the best matches. The filtering member divides the subject sequence into overlapping blocks, each block being sufficiently large to contain a minimum-length alignment from a known sequence. For each block, the filter member compares the block with every possible short fragment in the known sequences and determines a best match for each comparison. The determined set of short fragment best matches for the block provide an upper threshold on alignment values. Regions of a certain length from the known sequences that have a mean alignment value upper threshold greater than a target unit score are concatenated to form a union. The current block is compared to the union and provides an indication of best local alignment with the subject sequence. 5 figs.
Method and apparatus for biological sequence comparison
Marr, Thomas G.; Chang, William I-Wei
1997-01-01
A method and apparatus for comparing biological sequences from a known source of sequences, with a subject (query) sequence. The apparatus takes as input a set of target similarity levels (such as evolutionary distances in units of PAM), and finds all fragments of known sequences that are similar to the subject sequence at each target similarity level, and are long enough to be statistically significant. The invention device filters out fragments from the known sequences that are too short, or have a lower average similarity to the subject sequence than is required by each target similarity level. The subject sequence is then compared only to the remaining known sequences to find the best matches. The filtering member divides the subject sequence into overlapping blocks, each block being sufficiently large to contain a minimum-length alignment from a known sequence. For each block, the filter member compares the block with every possible short fragment in the known sequences and determines a best match for each comparison. The determined set of short fragment best matches for the block provide an upper threshold on alignment values. Regions of a certain length from the known sequences that have a mean alignment value upper threshold greater than a target unit score are concatenated to form a union. The current block is compared to the union and provides an indication of best local alignment with the subject sequence.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lan, Yemin; Rosen, Gail; Hershberg, Ruth
The 16s rRNA gene is so far the most widely used marker for taxonomical classification and separation of prokaryotes. Since it is universally conserved among prokaryotes, it is possible to use this gene to classify a broad range of prokaryotic organisms. At the same time, it has often been noted that the 16s rRNA gene is too conserved to separate between prokaryotes at finer taxonomic levels. In this paper, we examine how well levels of similarity of 16s rRNA and 73 additional universal or nearly universal marker genes correlate with genome-wide levels of gene sequence similarity. We demonstrate that themore » percent identity of 16s rRNA predicts genome-wide levels of similarity very well for distantly related prokaryotes, but not for closely related ones. In closely related prokaryotes, we find that there are many other marker genes for which levels of similarity are much more predictive of genome-wide levels of gene sequence similarity. Finally, we show that the identities of the markers that are most useful for predicting genome-wide levels of similarity within closely related prokaryotic lineages vary greatly between lineages. However, the most useful markers are always those that are least conserved in their sequences within each lineage. In conclusion, our results show that by choosing markers that are less conserved in their sequences within a lineage of interest, it is possible to better predict genome-wide gene sequence similarity between closely related prokaryotes than is possible using the 16s rRNA gene. We point readers towards a database we have created (POGO-DB) that can be used to easily establish which markers show lowest levels of sequence conservation within different prokaryotic lineages.« less
Lan, Yemin; Rosen, Gail; Hershberg, Ruth
2016-05-03
The 16s rRNA gene is so far the most widely used marker for taxonomical classification and separation of prokaryotes. Since it is universally conserved among prokaryotes, it is possible to use this gene to classify a broad range of prokaryotic organisms. At the same time, it has often been noted that the 16s rRNA gene is too conserved to separate between prokaryotes at finer taxonomic levels. In this paper, we examine how well levels of similarity of 16s rRNA and 73 additional universal or nearly universal marker genes correlate with genome-wide levels of gene sequence similarity. We demonstrate that themore » percent identity of 16s rRNA predicts genome-wide levels of similarity very well for distantly related prokaryotes, but not for closely related ones. In closely related prokaryotes, we find that there are many other marker genes for which levels of similarity are much more predictive of genome-wide levels of gene sequence similarity. Finally, we show that the identities of the markers that are most useful for predicting genome-wide levels of similarity within closely related prokaryotic lineages vary greatly between lineages. However, the most useful markers are always those that are least conserved in their sequences within each lineage. In conclusion, our results show that by choosing markers that are less conserved in their sequences within a lineage of interest, it is possible to better predict genome-wide gene sequence similarity between closely related prokaryotes than is possible using the 16s rRNA gene. We point readers towards a database we have created (POGO-DB) that can be used to easily establish which markers show lowest levels of sequence conservation within different prokaryotic lineages.« less
Schaeffer, E; Sninsky, J J
1984-01-01
Proteins that are related evolutionarily may have diverged at the level of primary amino acid sequence while maintaining similar secondary structures. Computer analysis has been used to compare the open reading frames of the hepatitis B virus to those of the woodchuck hepatitis virus at the level of amino acid sequence, and to predict the relative hydrophilic character and the secondary structure of putative polypeptides. Similarity is seen at the levels of relative hydrophilicity and secondary structure, in the absence of sequence homology. These data reinforce the proposal that these open reading frames encode viral proteins. Computer analysis of this type can be more generally used to establish structural similarities between proteins that do not share obvious sequence homology as well as to assess whether an open reading frame is fortuitous or codes for a protein. PMID:6585835
Sequence Alignment to Predict Across Species Susceptibility ...
Conservation of a molecular target across species can be used as a line-of-evidence to predict the likelihood of chemical susceptibility. The web-based Sequence Alignment to Predict Across Species Susceptibility (SeqAPASS) tool was developed to simplify, streamline, and quantitatively assess protein sequence/structural similarity across taxonomic groups as a means to predict relative intrinsic susceptibility. The intent of the tool is to allow for evaluation of any potential protein target, so it is amenable to variable degrees of protein characterization, depending on available information about the chemical/protein interaction and the molecular target itself. To allow for flexibility in the analysis, a layered strategy was adopted for the tool. The first level of the SeqAPASS analysis compares primary amino acid sequences to a query sequence, calculating a metric for sequence similarity (including detection of candidate orthologs), the second level evaluates sequence similarity within selected domains (e.g., ligand-binding domain, DNA binding domain), and the third level of analysis compares individual amino acid residue positions identified as being of importance for protein conformation and/or ligand binding upon chemical perturbation. Each level of the SeqAPASS analysis provides increasing evidence to apply toward rapid, screening-level assessments of probable cross species susceptibility. Such analyses can support prioritization of chemicals for further ev
Wen, B; Rikihisa, Y; Fuerst, P A; Chaichanasiriwithaya, W
1995-04-01
Ehrlichia risticii is the causative agent of Potomac horse fever. Variations among the major antigens of different local E. risticii strains have been detected previously. To further assess genetic variability in this species or species complex, the sequences of the 16S rRNA genes of several isolates obtained from sick horses diagnosed as having Potomac horse fever were determined. The sequences of six isolates obtained from Ohio and three isolates obtained from Kentucky were amplified by PCR. Three groups of sequences were identified. The sequences of five of the Ohio isolates were identical to the sequence of the type strain of E. risticii, the Illinois strain. The sequence of one Ohio isolate, isolate 081, was unique; this sequence differed in 10 nucleotides from the sequence of the type strain (level of similarity, 99.3%). The sequences of the three Kentucky isolates were identical to each other, but differed by five bases from the sequence of the type strain (level of similarity, 99.6%). The levels of sequence similarity of isolate 081, the Kentucky isolates, and the type strain to the next most closely related Ehrlichia sp., Ehrlichia sennetsu, were 99.3, 99.2, and 99.2%, respectively. On the basis of the distinct antigenic profiles and the levels of 16S rRNA sequence divergence, isolate 081 is as divergent from the type strain of E. risticii as E. sennetsu is. Therefore, we suggest that strain 081 and the Kentucky isolates may represent two new distinct Ehrlichia species.
Gao, Xiang; Lin, Huaiying; Revanna, Kashi; Dong, Qunfeng
2017-05-10
Species-level classification for 16S rRNA gene sequences remains a serious challenge for microbiome researchers, because existing taxonomic classification tools for 16S rRNA gene sequences either do not provide species-level classification, or their classification results are unreliable. The unreliable results are due to the limitations in the existing methods which either lack solid probabilistic-based criteria to evaluate the confidence of their taxonomic assignments, or use nucleotide k-mer frequency as the proxy for sequence similarity measurement. We have developed a method that shows significantly improved species-level classification results over existing methods. Our method calculates true sequence similarity between query sequences and database hits using pairwise sequence alignment. Taxonomic classifications are assigned from the species to the phylum levels based on the lowest common ancestors of multiple database hits for each query sequence, and further classification reliabilities are evaluated by bootstrap confidence scores. The novelty of our method is that the contribution of each database hit to the taxonomic assignment of the query sequence is weighted by a Bayesian posterior probability based upon the degree of sequence similarity of the database hit to the query sequence. Our method does not need any training datasets specific for different taxonomic groups. Instead only a reference database is required for aligning to the query sequences, making our method easily applicable for different regions of the 16S rRNA gene or other phylogenetic marker genes. Reliable species-level classification for 16S rRNA or other phylogenetic marker genes is critical for microbiome research. Our software shows significantly higher classification accuracy than the existing tools and we provide probabilistic-based confidence scores to evaluate the reliability of our taxonomic classification assignments based on multiple database matches to query sequences. Despite its higher computational costs, our method is still suitable for analyzing large-scale microbiome datasets for practical purposes. Furthermore, our method can be applied for taxonomic classification of any phylogenetic marker gene sequences. Our software, called BLCA, is freely available at https://github.com/qunfengdong/BLCA .
Comparison of the Heme Iron Utilization Systems of Pathogenic Vibrios
O’Malley, S. M.; Mouton, S. L.; Occhino, D. A.; Deanda, M. T.; Rashidi, J. R.; Fuson, K. L.; Rashidi, C. E.; Mora, M. Y.; Payne, S. M.; Henderson, D. P.
1999-01-01
Vibrio alginolyticus, Vibrio fluvialis, and Vibrio parahaemolyticus utilized heme and hemoglobin as iron sources and contained chromosomal DNA similar to several Vibrio cholerae heme iron utilization genes. A V. parahaemolyticus gene that performed the function of V. cholerae hutA was isolated. A portion of the tonB1 locus of V. parahaemolyticus was sequenced and found to encode proteins similar in amino acid sequence to V. cholerae HutW, TonB1, and ExbB1. A recombinant plasmid containing the V. cholerae tonB1 and exbB1D1 genes complemented a V. alginolyticus heme utilization mutant. These data suggest that the heme iron utilization systems of the pathogenic vibrios tested, particularly V. parahaemolyticus and V. alginolyticus, are similar at the DNA level, the functional level, and, in the case of V. parahaemolyticus, the amino acid sequence or protein level to that of V. cholerae. PMID:10348876
Madi, Asaf; Poran, Asaf; Shifrut, Eric; Reich-Zeliger, Shlomit; Greenstein, Erez; Zaretsky, Irena; Arnon, Tomer; Laethem, Francois Van; Singer, Alfred; Lu, Jinghua; Sun, Peter D; Cohen, Irun R; Friedman, Nir
2017-01-01
Diversity of T cell receptor (TCR) repertoires, generated by somatic DNA rearrangements, is central to immune system function. However, the level of sequence similarity of TCR repertoires within and between species has not been characterized. Using network analysis of high-throughput TCR sequencing data, we found that abundant CDR3-TCRβ sequences were clustered within networks generated by sequence similarity. We discovered a substantial number of public CDR3-TCRβ segments that were identical in mice and humans. These conserved public sequences were central within TCR sequence-similarity networks. Annotated TCR sequences, previously associated with self-specificities such as autoimmunity and cancer, were linked to network clusters. Mechanistically, CDR3 networks were promoted by MHC-mediated selection, and were reduced following immunization, immune checkpoint blockade or aging. Our findings provide a new view of T cell repertoire organization and physiology, and suggest that the immune system distributes its TCR sequences unevenly, attending to specific foci of reactivity. DOI: http://dx.doi.org/10.7554/eLife.22057.001 PMID:28731407
Messmer, Bradley T; Raphael, Benjamin J; Aerni, Sarah J; Widhopf, George F; Rassenti, Laura Z; Gribben, John G; Kay, Neil E; Kipps, Thomas J
2009-01-01
The leukemia cells of unrelated patients with chronic lymphocytic leukemia (CLL) display a restricted repertoire of immunoglobulin (Ig) gene rearrangements with preferential usage of certain Ig gene segments. We developed a computational method to rigorously quantify biases in Ig sequence similarity in large patient databases and to identify groups of patients with unusual levels of sequence similarity. We applied our method to sequences from 1577 CLL patients through the CLL Research Consortium (CRC), and identified 67 similarity groups into which roughly 20% of all patients could be assigned. Immunoglobulin light chain class was highly correlated within all groups and light chain gene usage was similar within sets. Surprisingly, over 40% of the identified groups were composed of somatically mutated genes. This study significantly expands the evidence that antigen selection shapes the Ig repertoire in CLL. PMID:18640719
Messmer, Bradley T; Raphael, Benjamin J; Aerni, Sarah J; Widhopf, George F; Rassenti, Laura Z; Gribben, John G; Kay, Neil E; Kipps, Thomas J
2009-03-01
The leukemia cells of unrelated patients with chronic lymphocytic leukemia (CLL) display a restricted repertoire of immunoglobulin (Ig) gene rearrangements with preferential usage of certain Ig gene segments. We developed a computational method to rigorously quantify biases in Ig sequence similarity in large patient databases and to identify groups of patients with unusual levels of sequence similarity. We applied our method to sequences from 1577 CLL patients through the CLL Research Consortium (CRC), and identified 67 similarity groups into which roughly 20% of all patients could be assigned. Immunoglobulin light chain class was highly correlated within all groups and light chain gene usage was similar within sets. Surprisingly, over 40% of the identified groups were composed of somatically mutated genes. This study significantly expands the evidence that antigen selection shapes the Ig repertoire in CLL.
What is a melody? On the relationship between pitch and brightness of timbre.
Cousineau, Marion; Carcagno, Samuele; Demany, Laurent; Pressnitzer, Daniel
2013-01-01
Previous studies showed that the perceptual processing of sound sequences is more efficient when the sounds vary in pitch than when they vary in loudness. We show here that sequences of sounds varying in brightness of timbre are processed with the same efficiency as pitch sequences. The sounds used consisted of two simultaneous pure tones one octave apart, and the listeners' task was to make same/different judgments on pairs of sequences varying in length (one, two, or four sounds). In one condition, brightness of timbre was varied within the sequences by changing the relative level of the two pure tones. In other conditions, pitch was varied by changing fundamental frequency, or loudness was varied by changing the overall level. In all conditions, only two possible sounds could be used in a given sequence, and these two sounds were equally discriminable. When sequence length increased from one to four, discrimination performance decreased substantially for loudness sequences, but to a smaller extent for brightness sequences and pitch sequences. In the latter two conditions, sequence length had a similar effect on performance. These results suggest that the processes dedicated to pitch and brightness analysis, when probed with a sequence-discrimination task, share unexpected similarities.
Amino terminal sequence of heavy and light chains from ratfish immunoglobulin.
De Ioannes, A E; Aguila, H L
1989-01-01
The ratfish, Callorhinchus callorhinchus, a representative of the Holocephali, has a natural serum hemagglutinin (Mr 960,000), composed of heavy (Mr 71,000), light (Mr 22,500), and J (Mr 16,000) chains. To approach the mechanisms that generate diversity at this level of evolution, the amino terminal sequence of the heavy and light chains was determined by automated microsequencing. The chains are unblocked and have modest internal sequence heterogeneity. The heavy chains show sequence similarity with the terminal region of the heavy chain from the horned shark, Heterodontus francisci, and other species. In contrast to the heavy chain, the ratfish light chains display low sequence similarity with their shark kappa counterparts. However, their similarity with the variable region of the chicken lambda light chains is about 75%.
Borges, Juliana N; Cunha, Luiz F G; Miranda, Daniele F; Monteiro-Neto, Cassiano; Santos, Cláudia P
2015-12-01
Pseudoterranova larvae parasitizing cutlassfish Trichiurus lepturus and bluefish Pomatomus saltatrix from Southwest Atlantic coast of Brazil were studied in this work by morphological, ultrastructural and molecular approaches. The genetic analysis were performed for the ITS2 intergenic region specific for Pseudoterranova decipiens, the partial 28S (LSU) of ribosomal DNA and the mtDNA cox-1 region. We obtained results for the 28S region and mtDNA cox-1 that was amplified using the polymerase chain reaction and sequenced to evaluate the phylogenetic relationships between sequences of this study and sequences from the GenBank. The morphological profile indicated that all the nine specimens collected from both fish were L3 larvae of Pseudoterranova sp. The genetic profile confirmed the generic level but due to the absence of similar sequences for adult parasites on GenBank for the regions amplifyied, it was not possible to identify them to the species level. The sequences obtained presented 89% of similarity with Pseudoterranova decipiens (28S sequences) and Contracaecum osculatum B (mtDNA cox-1). The low similarity allied to the fact that the amplification with the specific primer for P. decipiens didn't occur, lead us to conclude that our sequences don't belong to P. decipiens complex.
Ali, M A; Al-Hemaid, F M; Lee, J; Hatamleh, A A; Gyulai, G; Rahman, M O
2015-10-02
The present study explored the systematic inventory of Echinops L. (Asteraceae) of Saudi Arabia, with special reference to the molecular typing of Echinops abuzinadianus Chaudhary, an endemic species to Saudi Arabia, based on the internal transcribed spacer (ITS) sequences (ITS1-5.8S-ITS2) of nuclear ribosomal DNA. A sequence similarity search using BLAST and a phylogenetic analysis of the ITS sequence of E. abuzinadianus revealed a high level of sequence similarity with E. glaberrimus DC. (section Ritropsis). The novel primary sequence and the secondary structure of ITS2 of E. abuzinadianus could potentially be used for molecular genotyping.
What is a melody? On the relationship between pitch and brightness of timbre
Cousineau, Marion; Carcagno, Samuele; Demany, Laurent; Pressnitzer, Daniel
2014-01-01
Previous studies showed that the perceptual processing of sound sequences is more efficient when the sounds vary in pitch than when they vary in loudness. We show here that sequences of sounds varying in brightness of timbre are processed with the same efficiency as pitch sequences. The sounds used consisted of two simultaneous pure tones one octave apart, and the listeners’ task was to make same/different judgments on pairs of sequences varying in length (one, two, or four sounds). In one condition, brightness of timbre was varied within the sequences by changing the relative level of the two pure tones. In other conditions, pitch was varied by changing fundamental frequency, or loudness was varied by changing the overall level. In all conditions, only two possible sounds could be used in a given sequence, and these two sounds were equally discriminable. When sequence length increased from one to four, discrimination performance decreased substantially for loudness sequences, but to a smaller extent for brightness sequences and pitch sequences. In the latter two conditions, sequence length had a similar effect on performance. These results suggest that the processes dedicated to pitch and brightness analysis, when probed with a sequence-discrimination task, share unexpected similarities. PMID:24478638
Identification of Mycobacterium spp. of veterinary importance using rpoB gene sequencing
2011-01-01
Background Studies conducted on Mycobacterium spp. isolated from human patients indicate that sequencing of a 711 bp portion of the rpoB gene can be useful in assigning a species identity, particularly for members of the Mycobacterium avium complex (MAC). Given that MAC are important pathogens in livestock, companion animals, and zoo/exotic animals, we were interested in evaluating the use of rpoB sequencing for identification of Mycobacterium isolates of veterinary origin. Results A total of 386 isolates, collected over 2008 - June 2011 from 378 animals (amphibians, reptiles, birds, and mammals) underwent PCR and sequencing of a ~ 711 bp portion of the rpoB gene; 310 isolates (80%) were identified to the species level based on similarity at ≥ 98% with a reference sequence. The remaining 76 isolates (20%) displayed < 98% similarity with reference sequences and were assigned to a clade based on their location in a neighbor-joining tree containing reference sequences. For a subset of 236 isolates that received both 16S rRNA and rpoB sequencing, 167 (70%) displayed a similar species/clade assignation for both sequencing methods. For the remaining 69 isolates, species/clade identities were different with each sequencing method. Mycobacterium avium subsp. hominissuis was the species most frequently isolated from specimens from pigs, cervids, companion animals, cattle, and exotic/zoo animals. Conclusions rpoB sequencing proved useful in identifying Mycobacterium isolates of veterinary origin to clade, species, or subspecies levels, particularly for assemblages (such as the MAC) where 16S rRNA sequencing alone is not adequate to demarcate these taxa. rpoB sequencing can represent a cost-effective identification tool suitable for routine use in the veterinary diagnostic laboratory. PMID:22118247
Lei, Yong-Liang; Wang, Xiao-Guang; Tao, Xiao-Yan; Li, Hao; Meng, Sheng-Li; Chen, Xiu-Ying; Liu, Fu-Ming; Ye, Bi-Feng; Tang, Qing
2010-01-01
Based on sequencing the full-length genomes of four Chinese Ferret-Badger and dog, we analyze the properties of rabies viruses genetic variation in molecular level, get the information about rabies viruses prevalence and variation in Zhejiang, and enrich the genome database of rabies viruses street strains isolated from China. Rabies viruses in suckling mice were isolated, overlapped fragments were amplified by RT-PCR and full-length genomes were assembled to analyze the nucleotide and deduced protein similarities and phylogenetic analyses from Chinese Ferret-Badger, dog, sika deer, vole, used vaccine strain were determined. The four full-length genomes were sequenced completely and had the same genetic structure with the length of 11, 923 nts or 11, 925 nts including 58 nts-Leader, 1353 nts-NP, 894 nts-PP, 609 nts-MP, 1575 nts-GP, 6386 nts-LP, and 2, 5, 5 nts- intergenic regions(IGRs), 423 nts-Pseudogene-like sequence (psi), 70 nts-Trailer. The four full-length genomes were in accordance with the properties of Rhabdoviridae Lyssa virus by BLAST and multi-sequence alignment. The nucleotide and amino acid sequences among Chinese strains had the highest similarity, especially among animals of the same species. Of the four full-length genomes, the similarity in amino acid level was dramatically higher than that in nucleotide level, so the nucleotide mutations happened in these four genomes were most synonymous mutations. Compared with the reference rabies viruses, the lengths of the five protein coding regions had no change, no recombination, only with a few point mutations. It was evident that the five proteins appeared to be stable. The variation sites and types of the four genomes were similar to the reference vaccine or street strains. And the four strains were genotype 1 according to the multi-sequence and phylogenetic analyses, which possessed the distinct district characteristics of China. Therefore, these four rabies viruses are likely to be street viruses already existing in the natural world.
Budiman, Muhammad A.; Mao, Long; Wood, Todd C.; Wing, Rod A.
2000-01-01
Recently a new strategy using BAC end sequences as sequence-tagged connectors (STCs) was proposed for whole-genome sequencing projects. In this study, we present the construction and detailed characterization of a 15.0 haploid genome equivalent BAC library for the cultivated tomato, Lycopersicon esculentum cv. Heinz 1706. The library contains 129,024 clones with an average insert size of 117.5 kb and a chloroplast content of 1.11%. BAC end sequences from 1490 ends were generated and analyzed as a preliminary evaluation for using this library to develop an STC framework to sequence the tomato genome. A total of 1205 BAC end sequences (80.9%) were obtained, with an average length of 360 high-quality bases, and were searched against the GenBank database. Using a cutoff expectation value of <10−6, and combining the results from BLASTN, BLASTX, and TBLASTX searches, 24.3% of the BAC end sequences were similar to known sequences, of which almost half (48.7%) share sequence similarities to retrotransposons and 7% to known genes. Some of the transposable element sequences were the first reported in tomato, such as sequences similar to maize transposon Activator (Ac) ORF and tobacco pararetrovirus-like sequences. Interestingly, there were no BAC end sequences similar to the highly repeated TGRI and TGRII elements. However, the majority (70.3%) of STCs did not share significant sequence similarities to any sequences in GenBank at either the DNA or predicted protein levels, indicating that a large portion of the tomato genome is still unknown. Our data demonstrate that this BAC library is suitable for developing an STC database to sequence the tomato genome. The advantages of developing an STC framework for whole-genome sequencing of tomato are discussed. [The BAC end sequences described in this paper have been deposited in the GenBank data library under accession nos. AQ367111–AQ368361.] PMID:10645957
França, Luís; Simões, Catarina; Taborda, Marco; Diogo, Catarina; da Costa, Milton S.
2015-01-01
Over a period of ten months a total of 5618 cord blood units (CBU) were screened for microbial contamination under routine conditions. The antibiotic resistance profile for all isolates was also examined using ATB strips. The detection rate for culture positive units was 7.5%, corresponding to 422 samples.16S rRNA sequence analysis and identification with API test system were used to identify the culturable aerobic, microaerophilic and anaerobic bacteria from CBUs. From these samples we recovered 485 isolates (84 operational taxonomic units, OTUs) assigned to the classes Bacteroidia, Actinobacteria, Clostridia, Bacilli, Betaproteobacteria and primarily to the Gammaproteobacteria. Sixty-nine OTUs, corresponding to 447 isolates, showed 16S rRNA sequence similarities above 99.0% with known cultured bacteria. However, 14 OTUs had 16S rRNA sequence similarities between 95 and 99% in support of genus level identification and one OTU with 16S rRNA sequence similarity of 90.3% supporting a family level identification only. The phenotypic identification formed 29 OTUs that could be identified to the species level and 9 OTUs that could be identified to the genus level by API test system. We failed to obtain identification for 14 OTUs, while 32 OTUs comprised organisms producing mixed identifications. Forty-two OTUs covered species not included in the API system databases. The API test system Rapid ID 32 Strep and Rapid ID 32 E showed the highest proportion of identifications to the species level, the lowest ratio of unidentified results and the highest agreement to the results of 16S rRNA assignments. Isolates affiliated to the Bacilli and Bacteroidia showed the highest antibiotic multi-resistance indices and microorganisms of the Clostridia displayed the most antibiotic sensitive phenotypes. PMID:26512991
França, Luís; Simões, Catarina; Taborda, Marco; Diogo, Catarina; da Costa, Milton S
2015-01-01
Over a period of ten months a total of 5618 cord blood units (CBU) were screened for microbial contamination under routine conditions. The antibiotic resistance profile for all isolates was also examined using ATB strips. The detection rate for culture positive units was 7.5%, corresponding to 422 samples.16S rRNA sequence analysis and identification with API test system were used to identify the culturable aerobic, microaerophilic and anaerobic bacteria from CBUs. From these samples we recovered 485 isolates (84 operational taxonomic units, OTUs) assigned to the classes Bacteroidia, Actinobacteria, Clostridia, Bacilli, Betaproteobacteria and primarily to the Gammaproteobacteria. Sixty-nine OTUs, corresponding to 447 isolates, showed 16S rRNA sequence similarities above 99.0% with known cultured bacteria. However, 14 OTUs had 16S rRNA sequence similarities between 95 and 99% in support of genus level identification and one OTU with 16S rRNA sequence similarity of 90.3% supporting a family level identification only. The phenotypic identification formed 29 OTUs that could be identified to the species level and 9 OTUs that could be identified to the genus level by API test system. We failed to obtain identification for 14 OTUs, while 32 OTUs comprised organisms producing mixed identifications. Forty-two OTUs covered species not included in the API system databases. The API test system Rapid ID 32 Strep and Rapid ID 32 E showed the highest proportion of identifications to the species level, the lowest ratio of unidentified results and the highest agreement to the results of 16S rRNA assignments. Isolates affiliated to the Bacilli and Bacteroidia showed the highest antibiotic multi-resistance indices and microorganisms of the Clostridia displayed the most antibiotic sensitive phenotypes.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Davidson, J.
Relative and absolute populations of 19 levels in beam-foil--excited neutral helium at 0.275 MeV have been measured. The singlet angular-momentum sequences show dependences on principal quantum number consistent with n$sup -3$, but the triplet sequences do not. Singlet and triplet angular-momentum sequences show similar dependences on level excitation energy. Excitation functions for six representative levels were measured in the range 0.160 to 0.500 MeV. The absolute level populations increase with energy, whereas the neutral fraction of the beam decreases with energy. Further, the P angular-momentum levels are found to be overpopulated with respect to the S and D levels. Themore » overpopulation decreases with increasing principal quantum number.« less
Salis, R. K.; Bruder, A.; Piggott, J. J.; Summerfield, T. C.; Matthaei, C. D.
2017-01-01
Disentangling the individual and interactive effects of multiple stressors on microbial communities is a key challenge to our understanding and management of ecosystems. Advances in molecular techniques allow studying microbial communities in situ and with high taxonomic resolution. However, the taxonomic level which provides the best trade-off between our ability to detect multiple-stressor effects versus the goal of studying entire communities remains unknown. We used outdoor mesocosms simulating small streams to investigate the effects of four agricultural stressors (nutrient enrichment, the nitrification inhibitor dicyandiamide (DCD), fine sediment and flow velocity reduction) on stream bacteria (phyla, orders, genera, and species represented by Operational Taxonomic Units with 97% sequence similarity). Community composition was assessed using amplicon sequencing (16S rRNA gene, V3-V4 region). DCD was the most pervasive stressor, affecting evenness and most abundant taxa, followed by sediment and flow velocity. Stressor pervasiveness was similar across taxonomic levels and lower levels did not perform better in detecting stressor effects. Community coverage decreased from 96% of all sequences for abundant phyla to 28% for species. Order-level responses were generally representative of responses of corresponding genera and species, suggesting that this level may represent the best compromise between stressor sensitivity and coverage of bacterial communities. PMID:28327636
Relative and absolute level populations in beam-foil-excited neutral helium
NASA Technical Reports Server (NTRS)
Davidson, J.
1975-01-01
Relative and absolute populations of 19 levels in beam-foil-excited neutral helium at 0.275 MeV have been measured. The singlet angular-momentum sequences show dependences on principal quantum number consistent with n to the -3rd power, but the triplet sequences do not. Singlet and triplet angular-momentum sequences show similar dependences on level excitation energy. Excitation functions for six representative levels were measured in the range from 0.160 to 0.500 MeV. The absolute level populations increase with energy, whereas the neutral fraction of the beam decreases with energy. Further, the P angular-momentum levels are found to be overpopulated with respect to the S and D levels. The overpopulation decreases with increasing principal quantum number.
Cloud, Joann L; Harmsen, Dag; Iwen, Peter C; Dunn, James J; Hall, Gerri; Lasala, Paul Rocco; Hoggan, Karen; Wilson, Deborah; Woods, Gail L; Mellmann, Alexander
2010-04-01
Correct identification of nonfermenting Gram-negative bacilli (NFB) is crucial for patient management. We compared phenotypic identifications of 96 clinical NFB isolates with identifications obtained by 5' 16S rRNA gene sequencing. Sequencing identified 88 isolates (91.7%) with >99% similarity to a sequence from the assigned species; 61.5% of sequencing results were concordant with phenotypic results, indicating the usability of sequencing to identify NFB.
NASA Technical Reports Server (NTRS)
Paster, B. J.; Russell, J. B.; Yang, C. M.; Chow, J. M.; Woese, C. R.; Tanner, R.
1993-01-01
In previous studies, gram-positive bacteria which grew rapidly with peptides or an amino acid as the sole energy source were isolated from bovine rumina. Three isolates, strains C, FT (T = type strain), and SR, were considered to be ecologically important since they produced up to 20-fold more ammonia than other ammonia-producing ruminal bacteria. On the basis of phenotypic criteria, the taxonomic position of these new isolates was uncertain. In this study, the 16S rRNA sequences of these isolates and related bacteria were determined to establish the phylogenetic positions of the organisms. The sequences of strains C, FT, and SR and reference strains of Peptostreptococcus anaerobius, Clostridium sticklandii, Clostridium coccoides, Clostridium aminovalericum, Acetomaculum ruminis, Clostridium leptum, Clostridium lituseburense, Clostridium acidiurici, and Clostridium barkeri were determined by using a modified Sanger dideoxy chain termination method. Strain C, a large coccus purported to belong to the genus Peptostreptococcus, was closely related to P. anaerobius, with a level of sequence similarity of 99.6%. Strain SR, a heat-resistant, short, rod-shaped organism, was closely related to C. sticklandii, with a level of sequence similarity of 99.9%. However, strain FT, a heat-resistant, pleomorphic, rod-shaped organism, was only distantly related to some clostridial species and P. anaerobius. On the basis of the sequence data, it was clear that strain FT warranted designation as a separate species. The closest known relative of strain FT was C. coccoides (level of similarity, only 90.6%). Additional strains that are phenotypically similar to strain FT were isolated in this study.(ABSTRACT TRUNCATED AT 250 WORDS).
Singhal, Dinesh K; Singhal, Raxita; Malik, Hruda N; Kumar, Surender; Kumar, Sudarshan; Mohanty, Ashok K; Kaushik, Jai K; Malakar, Dhruba
2014-01-01
Nanog is a homeodomain containing protein which plays important roles in regulation of signaling pathways for maintenance and induction of pluripotency in stem cells. Because of its unique expression in stem cells it is also regarded as pluripotency marker. In this study goat Nanog (gNanog) gene has been amplified, cloned and characterized at sequence level with successful over-expression in CHO-K1 cell line using a lentiviral based system. gNanog ORF is 903 bp long which codes for Nanog protein of size 300 amino acids (aas). Complete nucleotide sequence shows some evolutionary mutation in goat in comparision to other species. Protein sequence of goat is highly similar to other species. Overall, gNanog nucleotide sequence and predicted protein sequence showed high similarity and minimum divergence with cattle (96 % identity/4 % divergence) and buffalo (94/5 %) while low similarity and high divergence with pig (84/15 %), human (81/23 %) and mouse (69/40 %) indicating evolutionary closeness of gNanog to cattle and buffalo. gNanog lentiviral expression construct was prepared for over-expression of Nanog gene in adult goat fibroblast cells. Lentiviral expression construct of Nanog enabled continuous protein expression for induction and maintenance of pluripotency. Western blotting revealed the expression of Nanog gene at protein level which supported that the lentiviral expression system is highly promising for Nanog protein expression in differentiated goat cell.
Characterization of kinetoplast DNA from Phytomonas serpens.
Sá-Carvalho, D; Perez-Morga, D; Traub-Cseko, Y M
1993-01-01
The restriction enzyme digestion of kinetoplast DNA from four Phytomonas serpens isolates shows an overall similar band pattern. One minicircle from isolate 30T was cloned and sequenced, showing low levels of homology but the same general features and organization as described for minicircles of other trypanosomatids. Extensive regions of the minicircle are composed by G and T on the H strand. These regions are very repetitive and similar to regions in a minicircle of Crithidia oncopelti and to telomeric sequences of Saccharomyces cerevisiae. Conserved Sequence Block 3, present in all trypanosomatids, is one nucleotide different from the consensus in P. serpens and provides a basis to differentiate P. serpens from other trypanosomatids. Electron microscopy of kinetoplast DNA evidenced a network with organization similar to other trypanosomatids and the measurement of minicircles confirmed the size of about 1.45 kb of the sequenced minicircle.
Utility of 16S rDNA Sequencing for Identification of Rare Pathogenic Bacteria.
Loong, Shih Keng; Khor, Chee Sieng; Jafar, Faizatul Lela; AbuBakar, Sazaly
2016-11-01
Phenotypic identification systems are established methods for laboratory identification of bacteria causing human infections. Here, the utility of phenotypic identification systems was compared against 16S rDNA identification method on clinical isolates obtained during a 5-year study period, with special emphasis on isolates that gave unsatisfactory identification. One hundred and eighty-seven clinical bacteria isolates were tested with commercial phenotypic identification systems and 16S rDNA sequencing. Isolate identities determined using phenotypic identification systems and 16S rDNA sequencing were compared for similarity at genus and species level, with 16S rDNA sequencing as the reference method. Phenotypic identification systems identified ~46% (86/187) of the isolates with identity similar to that identified using 16S rDNA sequencing. Approximately 39% (73/187) and ~15% (28/187) of the isolates showed different genus identity and could not be identified using the phenotypic identification systems, respectively. Both methods succeeded in determining the species identities of 55 isolates; however, only ~69% (38/55) of the isolates matched at species level. 16S rDNA sequencing could not determine the species of ~20% (37/187) of the isolates. The 16S rDNA sequencing is a useful method over the phenotypic identification systems for the identification of rare and difficult to identify bacteria species. The 16S rDNA sequencing method, however, does have limitation for species-level identification of some bacteria highlighting the need for better bacterial pathogen identification tools. © 2016 Wiley Periodicals, Inc.
Williams, Tony D.; Ames, Caroline E.; Kiparissis, Yiannis; Wynne-Edwards, Katherine E.
2005-01-01
We investigated the relationship between plasma and yolk oestrogens in laying female zebra finches (Taeniopygia guttata) by manipulating plasma oestradiol (E2) levels, via injection of oestradiol-17β, in a sequence-specific manner to maintain chronically high plasma levels for later-developing eggs (contrasting with the endogenous pattern of decreasing plasma E2 concentrations during laying). We report systematic variation in yolk oestrogen concentrations, in relation to laying sequence, similar to that widely reported for androgenic steroids. In sham-manipulated females, yolk E2 concentrations decreased with laying sequence. However, in E2-treated females plasma E2 levels were higher during the period of rapid yolk development of later-laid eggs, compared with control females. As a consequence, we reversed the laying-sequence-specific pattern of yolk E2: in E2-treated females, yolk E2 concentrations increased with laying-sequence. In general therefore, yolk E2 levels were a direct reflection of plasma E2 levels. However, in control females there was some inter-individual variability in the endogenous pattern of plasma E2 levels through the laying cycle which could generate variation in sequence-specific patterns of yolk hormone levels even if these primarily reflect circulating steroid levels. PMID:15695208
Diversity of virus-host systems in hypersaline Lake Retba, Senegal.
Sime-Ngando, Télesphore; Lucas, Soizick; Robin, Agnès; Tucker, Kimberly Pause; Colombet, Jonathan; Bettarel, Yvan; Desmond, Elie; Gribaldo, Simonetta; Forterre, Patrick; Breitbart, Mya; Prangishvili, David
2011-08-01
Remarkable morphological diversity of virus-like particles was observed by transmission electron microscopy in a hypersaline water sample from Lake Retba, Senegal. The majority of particles morphologically resembled hyperthermophilic archaeal DNA viruses isolated from extreme geothermal environments. Some hypersaline viral morphotypes have not been previously observed in nature, and less than 1% of observed particles had a head-and-tail morphology, which is typical for bacterial DNA viruses. Culture-independent analysis of the microbial diversity in the sample suggested the dominance of extremely halophilic archaea. Few of the 16S sequences corresponded to known archeal genera (Haloquadratum, Halorubrum and Natronomonas), whereas the majority represented novel archaeal clades. Three sequences corresponded to a new basal lineage of the haloarchaea. Bacteria belonged to four major phyla, consistent with the known diversity in saline environments. Metagenomic sequencing of DNA from the purified virus-like particles revealed very few similarities to the NCBI non-redundant database at either the nucleotide or amino acid level. Some of the identifiable virus sequences were most similar to previously described haloarchaeal viruses, but no sequence similarities were found to archaeal viruses from extreme geothermal environments. A large proportion of the sequences had similarity to previously sequenced viral metagenomes from solar salterns. © 2010 Society for Applied Microbiology and Blackwell Publishing Ltd.
String Mining in Bioinformatics
NASA Astrophysics Data System (ADS)
Abouelhoda, Mohamed; Ghanem, Moustafa
Sequence analysis is a major area in bioinformatics encompassing the methods and techniques for studying the biological sequences, DNA, RNA, and proteins, on the linear structure level. The focus of this area is generally on the identification of intra- and inter-molecular similarities. Identifying intra-molecular similarities boils down to detecting repeated segments within a given sequence, while identifying inter-molecular similarities amounts to spotting common segments among two or multiple sequences. From a data mining point of view, sequence analysis is nothing but string- or pattern mining specific to biological strings. For a long time, this point of view, however, has not been explicitly embraced neither in the data mining nor in the sequence analysis text books, which may be attributed to the co-evolution of the two apparently independent fields. In other words, although the word "data-mining" is almost missing in the sequence analysis literature, its basic concepts have been implicitly applied. Interestingly, recent research in biological sequence analysis introduced efficient solutions to many problems in data mining, such as querying and analyzing time series [49,53], extracting information from web pages [20], fighting spam mails [50], detecting plagiarism [22], and spotting duplications in software systems [14].
String Mining in Bioinformatics
NASA Astrophysics Data System (ADS)
Abouelhoda, Mohamed; Ghanem, Moustafa
Sequence analysis is a major area in bioinformatics encompassing the methods and techniques for studying the biological sequences, DNA, RNA, and proteins, on the linear structure level. The focus of this area is generally on the identification of intra- and inter-molecular similarities. Identifying intra-molecular similarities boils down to detecting repeated segments within a given sequence, while identifying inter-molecular similarities amounts to spotting common segments among two or multiple sequences. From a data mining point of view, sequence analysis is nothing but string- or pattern mining specific to biological strings. For a long time, this point of view, however, has not been explicitly embraced neither in the data mining nor in the sequence analysis text books, which may be attributed to the co-evolution of the two apparently independent fields. In other words, although the word “data-mining” is almost missing in the sequence analysis literature, its basic concepts have been implicitly applied. Interestingly, recent research in biological sequence analysis introduced efficient solutions to many problems in data mining, such as querying and analyzing time series [49,53], extracting information from web pages [20], fighting spam mails [50], detecting plagiarism [22], and spotting duplications in software systems [14].
Encoding and choice in the task span paradigm.
Reiman, Kaitlin M; Weaver, Starla M; Arrington, Catherine M
2015-03-01
Cognitive control during sequences of planned behaviors requires both plan-level processes such as generating, maintaining, and monitoring the plan, as well as task-level processes such as selecting, establishing and implementing specific task sets. The task span paradigm (Logan in J Exp Psychol Gen 133:218-236, 2004) combines two common cognitive control paradigms, task switching and working memory span, to investigate the integration of plan-level and task-level processes during control of sequential behavior. The current study expands past task span research to include measures of encoding processes and choice behavior with volitional sequence generation, using the standard task span as well as a novel voluntary task span paradigm. In two experiments, we consider how sequence complexity, defined separately for plan-level and task-level complexity, influences sequence encoding (Experiment 1), sequence choice (Experiment 2), sequence memory, and task performance of planned sequences of action. Results indicate that participants were sensitive to sequence complexity, but that different aspects of behavior are most strongly influenced by different types of complexity. Hierarchical complexity at the plan level best predicts voluntary sequence generation and memory; while switch frequency at the task level best predicts encoding of externally defined sequences and task performance. Furthermore, performance RTs were similar for externally and internally defined plans, whereas memory was improved for internally defined sequences. Finally, participants demonstrated a significant sequence choice bias in the voluntary task span. Consistent with past research on choice behavior, volitional selection of plans was markedly influenced by both the ease of memory and performance.
Novel Δ J =1 Sequence in 78Ge: Possible Evidence for Triaxiality
NASA Astrophysics Data System (ADS)
Forney, A. M.; Walters, W. B.; Chiara, C. J.; Janssens, R. V. F.; Ayangeakaa, A. D.; Sethi, J.; Harker, J.; Alcorta, M.; Carpenter, M. P.; Gürdal, G.; Hoffman, C. R.; Kay, B. P.; Kondev, F. G.; Lauritsen, T.; Lister, C. J.; McCutchan, E. A.; Rogers, A. M.; Seweryniak, D.; Stefanescu, I.; Zhu, S.
2018-05-01
A sequence of low-energy levels in Ge783246 has been identified with spins and parity of 2+, 3+, 4+, 5+, and 6+. Decays within this band proceed strictly through Δ J =1 transitions, unlike similar sequences in neighboring Ge and Se nuclei. Above the 2+ level, members of this sequence do not decay into the ground-state band. Moreover, the energy staggering of this sequence has the phase that would be expected for a γ -rigid structure. The energies and branching ratios of many of the levels are described well by shell-model calculations. However, the calculated reduced transition probabilities for the Δ J =2 in-band transitions imply that they should have been observed, in contradiction with the experiment. Within the calculations of Davydov, Filippov, and Rostovsky for rigid-triaxial rotors with γ =3 0 ° , there are sequences of higher-spin levels connected by strong Δ J =1 transitions which decay in the same manner as those observed experimentally, yet are calculated at too high an excitation energy.
Zemla, Adam T; Lang, Dorothy M; Kostova, Tanya; Andino, Raul; Ecale Zhou, Carol L
2011-06-02
Most of the currently used methods for protein function prediction rely on sequence-based comparisons between a query protein and those for which a functional annotation is provided. A serious limitation of sequence similarity-based approaches for identifying residue conservation among proteins is the low confidence in assigning residue-residue correspondences among proteins when the level of sequence identity between the compared proteins is poor. Multiple sequence alignment methods are more satisfactory--still, they cannot provide reliable results at low levels of sequence identity. Our goal in the current work was to develop an algorithm that could help overcome these difficulties by facilitating the identification of structurally (and possibly functionally) relevant residue-residue correspondences between compared protein structures. Here we present StralSV (structure-alignment sequence variability), a new algorithm for detecting closely related structure fragments and quantifying residue frequency from tight local structure alignments. We apply StralSV in a study of the RNA-dependent RNA polymerase of poliovirus, and we demonstrate that the algorithm can be used to determine regions of the protein that are relatively unique, or that share structural similarity with proteins that would be considered distantly related. By quantifying residue frequencies among many residue-residue pairs extracted from local structural alignments, one can infer potential structural or functional importance of specific residues that are determined to be highly conserved or that deviate from a consensus. We further demonstrate that considerable detailed structural and phylogenetic information can be derived from StralSV analyses. StralSV is a new structure-based algorithm for identifying and aligning structure fragments that have similarity to a reference protein. StralSV analysis can be used to quantify residue-residue correspondences and identify residues that may be of particular structural or functional importance, as well as unusual or unexpected residues at a given sequence position. StralSV is provided as a web service at http://proteinmodel.org/AS2TS/STRALSV/.
Lei, Yong-Liang; Wang, Xiao-Guang; Liu, Fu-Ming; Chen, Xiu-Ying; Ye, Bi-Feng; Mei, Jian-Hua; Lan, Jin-Quan; Tang, Qing
2009-08-01
Based on sequencing the full-length genomes of two Chinese Ferret-Badger, we analyzed the properties of rabies viruses genetic variation in molecular level to get information on prevalence and variation of rabies viruses in Zhejiang, and to enrich the genome database of rabies viruses street strains isolated from Chinese wildlife. Overlapped fragments were amplified by RT-PCR and full-length genomes were assembled to analyze the nucleotide and deduced protein similarities and phylogenetic analyses of the N genes from Chinese Ferret-Badger, sika deer, vole, dog. Vaccine strains were then determined. The two full-length genomes were completely sequenced to find out that they had the same genetic structure with 11 923 nts including 58 nts-Leader, 1353 nts-NP, 894 nts-PP, 609 nts-MP, 1575 nts-GP, 6386 nts-LP, and 2, 5, 5 nts- intergenic regions (IGRs), 423 nts-Pseudogene-like sequence (Psi), 70 nts-Trailer. The two full-length genomes were in accordance with the properties of Rhabdoviridae Lyssa virus by blast and multi-sequence alignment. The nucleotide and amino acid sequences among Chinese strains had the highest similarity, especially among animals of the same species. Of the two full-length genomes, the similarity in amino acid level was dramatically higher than that in nucleotide level, so that the nucleotide mutations happened in these two genomes were most probably as synonymous mutations. Compared to the referenced rabies viruses, the lengths of the five protein coding regions did not show any changes or recombination, but only with a few-point mutations. It was evident that the five proteins appeared to be stable. The variation sites and types of the two ferret badgers genomes were similar to the referenced vaccine or street strains. The two strains were genotype 1 according to the multi-sequence and phylogenetic analyses, which possessing the distinct geographyphic characteristics of China. All the evidence suggested a cue that these two ferret badgers rabies viruses were likely to be street virus that already circulating in wildlife.
Cloning and High-Level Expression of α-Galactosidase cDNA from Penicillium purpurogenum
Shibuya, Hajime; Nagasaki, Hiroaki; Kaneko, Satoshi; Yoshida, Shigeki; Park, Gwi Gun; Kusakabe, Isao; Kobayashi, Hideyuki
1998-01-01
The cDNA coding for Penicillium purpurogenum α-galactosidase (αGal) was cloned and sequenced. The deduced amino acid sequence of the α-Gal cDNA showed that the mature enzyme consisted of 419 amino acid residues with a molecular mass of 46,334 Da. The derived amino acid sequence of the enzyme showed similarity to eukaryotic αGals from plants, animals, yeasts, and filamentous fungi. The highest similarity observed (57% identity) was to Trichoderma reesei AGLI. The cDNA was expressed in Saccharomyces cerevisiae under the control of the yeast GAL10 promoter. Almost all of the enzyme produced was secreted into the culture medium, and the expression level reached was approximately 0.2 g/liter. The recombinant enzyme purified to homogeneity was highly glycosylated, showed slightly higher specific activity, and exhibited properties almost identical to those of the native enzyme from P. purpurogenum in terms of the N-terminal amino acid sequence, thermoactivity, pH profile, and mode of action on galacto-oligosaccharides. PMID:9797312
SW#db: GPU-Accelerated Exact Sequence Similarity Database Search.
Korpar, Matija; Šošić, Martin; Blažeka, Dino; Šikić, Mile
2015-01-01
In recent years we have witnessed a growth in sequencing yield, the number of samples sequenced, and as a result-the growth of publicly maintained sequence databases. The increase of data present all around has put high requirements on protein similarity search algorithms with two ever-opposite goals: how to keep the running times acceptable while maintaining a high-enough level of sensitivity. The most time consuming step of similarity search are the local alignments between query and database sequences. This step is usually performed using exact local alignment algorithms such as Smith-Waterman. Due to its quadratic time complexity, alignments of a query to the whole database are usually too slow. Therefore, the majority of the protein similarity search methods prior to doing the exact local alignment apply heuristics to reduce the number of possible candidate sequences in the database. However, there is still a need for the alignment of a query sequence to a reduced database. In this paper we present the SW#db tool and a library for fast exact similarity search. Although its running times, as a standalone tool, are comparable to the running times of BLAST, it is primarily intended to be used for exact local alignment phase in which the database of sequences has already been reduced. It uses both GPU and CPU parallelization and was 4-5 times faster than SSEARCH, 6-25 times faster than CUDASW++ and more than 20 times faster than SSW at the time of writing, using multiple queries on Swiss-prot and Uniref90 databases.
Browning, J.V.; Miller, K.G.; McLaughlin, P.P.; Kominz, M.A.; Sugarman, P.J.; Monteverde, D.; Feigenson, M.D.; Hernandez, J.C.
2006-01-01
We use backstripping to quantify the roles of variations in global sea level (eustasy), subsidence, and sediment supply on the development of the Miocene stratigraphic record of the mid-Atlantic continental margin of the United States (New Jersey, Delaware, and Maryland). Eustasy is a primary influence on sequence patterns, determining the global template of sequences (i.e., times when sequences can be preserved) and explaining similarities in Miocene sequence architecture on margins throughout the world. Sequences can be correlated throughout the mid-Atlantic region with Sr-isotopic chronology (??0.6 m.y. to ??1.2 m.y.). Eight Miocene sequences correlate regionally and can be correlated to global ??18O increases, indicating glacioeustatic control. This margin is dominated by passive subsidence with little evidence for active tectonic overprints, except possibly in Maryland during the early Miocene. However, early Miocene sequences in New Jersey and Delaware display a patchwork distribution that is attributable to minor (tens of meters) intervals of excess subsidence. Backstripping quantifies that excess subsidence began in Delaware at ca. 21 Ma and continued until 12 Ma, with maximum rates from ca. 21-16 Ma. We attribute this enhanced subsidence to local flexural response to the progradation of thick sequences offshore and adjacent to this area. Removing this excess subsidence in Delaware yields a record that is remarkably similar to New Jersey eustatic estimates. We conclude that sea-level rise and fall is a first-order control on accommodation providing similar timing on all margins to the sequence record. Tectonic changes due to movement of the crust can overprint the record, resulting in large gaps in the stratigraphic record. Smaller differences in sequences can be attributed to local flexural loading effects, particularly in regions experiencing large-scale progradation. ?? 2006 Geological Society of America.
Zhang, Bochao; Meng, Wenzhao; Prak, Eline T Luning; Hershberg, Uri
2015-12-01
Immune repertoires are collections of lymphocytes that express diverse antigen receptor gene rearrangements consisting of Variable (V), (Diversity (D) in the case of heavy chains) and Joining (J) gene segments. Clonally related cells typically share the same germline gene segments and have highly similar junctional sequences within their third complementarity determining regions. Identifying clonal relatedness of sequences is a key step in the analysis of immune repertoires. The V gene is the most important for clone identification because it has the longest sequence and the greatest number of sequence variants. However, accurate identification of a clone's germline V gene source is challenging because there is a high degree of similarity between different germline V genes. This difficulty is compounded in antibodies, which can undergo somatic hypermutation. Furthermore, high-throughput sequencing experiments often generate partial sequences and have significant error rates. To address these issues, we describe a novel method to estimate which germline V genes (or alleles) cannot be discriminated under different conditions (read lengths, sequencing errors or somatic hypermutation frequencies). Starting with any set of germline V genes, this method measures their similarity using different sequencing lengths and calculates their likelihood of unambiguous assignment under different levels of mutation. Hence, one can identify, under different experimental and biological conditions, the germline V genes (or alleles) that cannot be uniquely identified and bundle them together into groups of specific V genes with highly similar sequences. Copyright © 2015 Elsevier B.V. All rights reserved.
Rapid comparison of protein binding site surfaces with Property Encoded Shape Distributions (PESD)
Das, Sourav; Kokardekar, Arshad
2009-01-01
Patterns in shape and property distributions on the surface of binding sites are often conserved across functional proteins without significant conservation of the underlying amino-acid residues. To explore similarities of these sites from the viewpoint of a ligand, a sequence and fold-independent method was created to rapidly and accurately compare binding sites of proteins represented by property-mapped triangulated Gauss-Connolly surfaces. Within this paradigm, signatures for each binding site surface are produced by calculating their property-encoded shape distributions (PESD), a measure of the probability that a particular property will be at a specific distance to another on the molecular surface. Similarity between the signatures can then be treated as a measure of similarity between binding sites. As postulated, the PESD method rapidly detected high levels of similarity in binding site surface characteristics even in cases where there was very low similarity at the sequence level. In a screening experiment involving each member of the PDBBind 2005 dataset as a query against the rest of the set, PESD was able to retrieve a binding site with identical E.C. (Enzyme Commission) numbers as the top match in 79.5% of cases. The ability of the method in detecting similarity in binding sites with low sequence conservations were compared with state-of-the-art binding site comparison methods. PMID:19919089
Analysis of sequence repeats of proteins in the PDB.
Mary Rajathei, David; Selvaraj, Samuel
2013-12-01
Internal repeats in protein sequences play a significant role in the evolution of protein structure and function. Applications of different bioinformatics tools help in the identification and characterization of these repeats. In the present study, we analyzed sequence repeats in a non-redundant set of proteins available in the Protein Data Bank (PDB). We used RADAR for detecting internal repeats in a protein, PDBeFOLD for assessing structural similarity, PDBsum for finding functional involvement and Pfam for domain assignment of the repeats in a protein. Through the analysis of sequence repeats, we found that identity of the sequence repeats falls in the range of 20-40% and, the superimposed structures of the most of the sequence repeats maintain similar overall folding. Analysis sequence repeats at the functional level reveals that most of the sequence repeats are involved in the function of the protein through functionally involved residues in the repeat regions. We also found that sequence repeats in single and two domain proteins often contained conserved sequence motifs for the function of the domain. Copyright © 2013 Elsevier Ltd. All rights reserved.
Nucleic and Amino Acid Sequences Support Structure-Based Viral Classification.
Sinclair, Robert M; Ravantti, Janne J; Bamford, Dennis H
2017-04-15
Viral capsids ensure viral genome integrity by protecting the enclosed nucleic acids. Interactions between the genome and capsid and between individual capsid proteins (i.e., capsid architecture) are intimate and are expected to be characterized by strong evolutionary conservation. For this reason, a capsid structure-based viral classification has been proposed as a way to bring order to the viral universe. The seeming lack of sufficient sequence similarity to reproduce this classification has made it difficult to reject structural convergence as the basis for the classification. We reinvestigate whether the structure-based classification for viral coat proteins making icosahedral virus capsids is in fact supported by previously undetected sequence similarity. Since codon choices can influence nascent protein folding cotranslationally, we searched for both amino acid and nucleotide sequence similarity. To demonstrate the sensitivity of the approach, we identify a candidate gene for the pandoravirus capsid protein. We show that the structure-based classification is strongly supported by amino acid and also nucleotide sequence similarities, suggesting that the similarities are due to common descent. The correspondence between structure-based and sequence-based analyses of the same proteins shown here allow them to be used in future analyses of the relationship between linear sequence information and macromolecular function, as well as between linear sequence and protein folds. IMPORTANCE Viral capsids protect nucleic acid genomes, which in turn encode capsid proteins. This tight coupling of protein shell and nucleic acids, together with strong functional constraints on capsid protein folding and architecture, leads to the hypothesis that capsid protein-coding nucleotide sequences may retain signatures of ancient viral evolution. We have been able to show that this is indeed the case, using the major capsid proteins of viruses forming icosahedral capsids. Importantly, we detected similarity at the nucleotide level between capsid protein-coding regions from viruses infecting cells belonging to all three domains of life, reproducing a previously established structure-based classification of icosahedral viral capsids. Copyright © 2017 Sinclair et al.
Nucleic and Amino Acid Sequences Support Structure-Based Viral Classification
Sinclair, Robert M.; Ravantti, Janne J.
2017-01-01
ABSTRACT Viral capsids ensure viral genome integrity by protecting the enclosed nucleic acids. Interactions between the genome and capsid and between individual capsid proteins (i.e., capsid architecture) are intimate and are expected to be characterized by strong evolutionary conservation. For this reason, a capsid structure-based viral classification has been proposed as a way to bring order to the viral universe. The seeming lack of sufficient sequence similarity to reproduce this classification has made it difficult to reject structural convergence as the basis for the classification. We reinvestigate whether the structure-based classification for viral coat proteins making icosahedral virus capsids is in fact supported by previously undetected sequence similarity. Since codon choices can influence nascent protein folding cotranslationally, we searched for both amino acid and nucleotide sequence similarity. To demonstrate the sensitivity of the approach, we identify a candidate gene for the pandoravirus capsid protein. We show that the structure-based classification is strongly supported by amino acid and also nucleotide sequence similarities, suggesting that the similarities are due to common descent. The correspondence between structure-based and sequence-based analyses of the same proteins shown here allow them to be used in future analyses of the relationship between linear sequence information and macromolecular function, as well as between linear sequence and protein folds. IMPORTANCE Viral capsids protect nucleic acid genomes, which in turn encode capsid proteins. This tight coupling of protein shell and nucleic acids, together with strong functional constraints on capsid protein folding and architecture, leads to the hypothesis that capsid protein-coding nucleotide sequences may retain signatures of ancient viral evolution. We have been able to show that this is indeed the case, using the major capsid proteins of viruses forming icosahedral capsids. Importantly, we detected similarity at the nucleotide level between capsid protein-coding regions from viruses infecting cells belonging to all three domains of life, reproducing a previously established structure-based classification of icosahedral viral capsids. PMID:28122979
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wilkins, T.A.
1993-06-01
This study investigates the molecular events of vacuole ontogeny in rapidly elongated cotton plant cells. Within the DNA coding region, the cotton and carrot cDNA clones exhibit 82.2% nucleotide sequence homology; at the amino acid level cotton and carrot catalytic subunits exhibited 95.7% identity and 2.1% amino acid similarity. When aligned with the analogous sequences from yeast, the cotton protein shared only 60.5% amino acid identity and 12.7% similarity. 10 refs., 1 tab.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zemla, A; Lang, D; Kostova, T
2010-11-29
Most of the currently used methods for protein function prediction rely on sequence-based comparisons between a query protein and those for which a functional annotation is provided. A serious limitation of sequence similarity-based approaches for identifying residue conservation among proteins is the low confidence in assigning residue-residue correspondences among proteins when the level of sequence identity between the compared proteins is poor. Multiple sequence alignment methods are more satisfactory - still, they cannot provide reliable results at low levels of sequence identity. Our goal in the current work was to develop an algorithm that could overcome these difficulties and facilitatemore » the identification of structurally (and possibly functionally) relevant residue-residue correspondences between compared protein structures. Here we present StralSV, a new algorithm for detecting closely related structure fragments and quantifying residue frequency from tight local structure alignments. We apply StralSV in a study of the RNA-dependent RNA polymerase of poliovirus and demonstrate that the algorithm can be used to determine regions of the protein that are relatively unique or that shared structural similarity with structures that are distantly related. By quantifying residue frequencies among many residue-residue pairs extracted from local alignments, one can infer potential structural or functional importance of specific residues that are determined to be highly conserved or that deviate from a consensus. We further demonstrate that considerable detailed structural and phylogenetic information can be derived from StralSV analyses. StralSV is a new structure-based algorithm for identifying and aligning structure fragments that have similarity to a reference protein. StralSV analysis can be used to quantify residue-residue correspondences and identify residues that may be of particular structural or functional importance, as well as unusual or unexpected residues at a given sequence position.« less
The annotation-enriched non-redundant patent sequence databases.
Li, Weizhong; Kondratowicz, Bartosz; McWilliam, Hamish; Nauche, Stephane; Lopez, Rodrigo
2013-01-01
The EMBL-European Bioinformatics Institute (EMBL-EBI) offers public access to patent sequence data, providing a valuable service to the intellectual property and scientific communities. The non-redundant (NR) patent sequence databases comprise two-level nucleotide and protein sequence clusters (NRNL1, NRNL2, NRPL1 and NRPL2) based on sequence identity (level-1) and patent family (level-2). Annotation from the source entries in these databases is merged and enhanced with additional information from the patent literature and biological context. Corrections in patent publication numbers, kind-codes and patent equivalents significantly improve the data quality. Data are available through various user interfaces including web browser, downloads via FTP, SRS, Dbfetch and EBI-Search. Sequence similarity/homology searches against the databases are available using BLAST, FASTA and PSI-Search. In this article, we describe the data collection and annotation and also outline major changes and improvements introduced since 2009. Apart from data growth, these changes include additional annotation for singleton clusters, the identifier versioning for tracking entry change and the entry mappings between the two-level databases. Database URL: http://www.ebi.ac.uk/patentdata/nr/
The Annotation-enriched non-redundant patent sequence databases
Li, Weizhong; Kondratowicz, Bartosz; McWilliam, Hamish; Nauche, Stephane; Lopez, Rodrigo
2013-01-01
The EMBL-European Bioinformatics Institute (EMBL-EBI) offers public access to patent sequence data, providing a valuable service to the intellectual property and scientific communities. The non-redundant (NR) patent sequence databases comprise two-level nucleotide and protein sequence clusters (NRNL1, NRNL2, NRPL1 and NRPL2) based on sequence identity (level-1) and patent family (level-2). Annotation from the source entries in these databases is merged and enhanced with additional information from the patent literature and biological context. Corrections in patent publication numbers, kind-codes and patent equivalents significantly improve the data quality. Data are available through various user interfaces including web browser, downloads via FTP, SRS, Dbfetch and EBI-Search. Sequence similarity/homology searches against the databases are available using BLAST, FASTA and PSI-Search. In this article, we describe the data collection and annotation and also outline major changes and improvements introduced since 2009. Apart from data growth, these changes include additional annotation for singleton clusters, the identifier versioning for tracking entry change and the entry mappings between the two-level databases. Database URL: http://www.ebi.ac.uk/patentdata/nr/ PMID:23396323
Novel Δ J = 1 Sequence in Ge 78 : Possible Evidence for Triaxiality
Forney, A. M.; Walters, W. B.; Chiara, C. J.; ...
2018-05-22
Here, a sequence of low-energy levels in 78 32Ge 46 has been identified with spins and parity of 2 +, 3 +, 4 +, 5 +, and 6 +. Decays within this band proceed strictly through ΔJ=1 transitions, unlike similar sequences in neighboring Ge and Se nuclei. Above the 2+ level, members of this sequence do not decay into the ground-state band. Moreover, the energy staggering of this sequence has the phase that would be expected for a γ-rigid structure. The energies and branching ratios of many of the levels are described well by shell-model calculations. However, the calculated reducedmore » transition probabilities for the ΔJ=2 in-band transitions imply that they should have been observed, in contradiction with the experiment. Within the calculations of Davydov, Filippov, and Rostovsky for rigid-triaxial rotors with γ=30°, there are sequences of higher-spin levels connected by strong ΔJ=1 transitions which decay in the same manner as those observed experimentally, yet are calculated at too high an excitation energy.« less
A novel ΔJ = 1 sequence in 78Ge: possible evidence for triaxiality
DOE Office of Scientific and Technical Information (OSTI.GOV)
Forney, A. M.; Walters, W. B.; Chiara, C. J.
2018-02-20
A sequence of low-energy levels inmore » $$78\\atop{32}$$Ge 46 has been identi ed with spins and parity of 2 +, 3 +, 4 +, 5 +, and 6 +. Decays within this band proceed strictly through ΔJ = 1 transitions, unlike similar sequences in neighboring Ge and Se nuclei. Above the 2 + level, members of this sequence do not decay into the ground-state band. Moreover, the energy staggering of this sequence has the phase that would be expected for a γ-rigid structure. The energies and branching ratios of many of the levels are described well by shell-model calculations. However, the calculated reduced transition probabilities for the ΔJ = 2 in-band transitions imply that they should have been observed, in contradiction with the experiment. Lastly, within the calculations of Davydov, Filippov, and Rostovsky for rigid-triaxial rotors with γ = 30°, there are sequences of higher-spin levels connected by strong ΔJ = 1 transitions which decay in the same manner as those observed experimentally, yet calculated at too high an excitation energy.« less
Novel Δ J = 1 Sequence in Ge 78 : Possible Evidence for Triaxiality
DOE Office of Scientific and Technical Information (OSTI.GOV)
Forney, A. M.; Walters, W. B.; Chiara, C. J.
Here, a sequence of low-energy levels in 78 32Ge 46 has been identified with spins and parity of 2 +, 3 +, 4 +, 5 +, and 6 +. Decays within this band proceed strictly through ΔJ=1 transitions, unlike similar sequences in neighboring Ge and Se nuclei. Above the 2+ level, members of this sequence do not decay into the ground-state band. Moreover, the energy staggering of this sequence has the phase that would be expected for a γ-rigid structure. The energies and branching ratios of many of the levels are described well by shell-model calculations. However, the calculated reducedmore » transition probabilities for the ΔJ=2 in-band transitions imply that they should have been observed, in contradiction with the experiment. Within the calculations of Davydov, Filippov, and Rostovsky for rigid-triaxial rotors with γ=30°, there are sequences of higher-spin levels connected by strong ΔJ=1 transitions which decay in the same manner as those observed experimentally, yet are calculated at too high an excitation energy.« less
Gordon, Kacy L.; Arthur, Robert K.; Ruvinsky, Ilya
2015-01-01
Gene regulatory information guides development and shapes the course of evolution. To test conservation of gene regulation within the phylum Nematoda, we compared the functions of putative cis-regulatory sequences of four sets of orthologs (unc-47, unc-25, mec-3 and elt-2) from distantly-related nematode species. These species, Caenorhabditis elegans, its congeneric C. briggsae, and three parasitic species Meloidogyne hapla, Brugia malayi, and Trichinella spiralis, represent four of the five major clades in the phylum Nematoda. Despite the great phylogenetic distances sampled and the extensive sequence divergence of nematode genomes, all but one of the regulatory elements we tested are able to drive at least a subset of the expected gene expression patterns. We show that functionally conserved cis-regulatory elements have no more extended sequence similarity to their C. elegans orthologs than would be expected by chance, but they do harbor motifs that are important for proper expression of the C. elegans genes. These motifs are too short to be distinguished from the background level of sequence similarity, and while identical in sequence they are not conserved in orientation or position. Functional tests reveal that some of these motifs contribute to proper expression. Our results suggest that conserved regulatory circuitry can persist despite considerable turnover within cis elements. PMID:26020930
Identification of two allelic IgG1 C(H) coding regions (Cgamma1) of cat.
Kanai, T H; Ueda, S; Nakamura, T
2000-01-31
Two types of cDNA encoding IgG1 heavy chain (gamma1) were isolated from a single domestic short-hair cat. Sequence analysis indicated a higher level of similarity of these Cgamma1 sequences to human Cgamma1 sequence (76.9 and 77.0%) than to mouse sequence (70.0 and 69.7%) at the nucleotide level. Predicted primary structures of both the feline Cgamma1 genes, designated as Cgamma1a and Cgamma1b, were similar to that of human Cgamma1 gene, for instance, as to the size of constant domains, the presence of six conserved cysteine residues involved in formation of the domain structure, and the location of a conserved N-linked glycosylation site. Sequence comparison between the two alleles showed that 7 out of 10 nucleotide differences were within the C(H)3 domain coding region, all leading to nonsynonymous changes in amino acid residues. Partial sequence analysis of genomic clones showed three nucleotide substitutions between the two Cgamma1 alleles in the intron between the CH2 and C(H)3 domain coding regions. In 12 domestic short-hair cats used in this study, the frequency of Cgamma1a allele (62.5%) was higher than that of the Cgamma1b allele (37.5%).
The complete nucleotide sequence of RNA 3 of a peach isolate of Prunus necrotic ringspot virus.
Hammond, R W; Crosslin, J M
1995-04-01
The complete nucleotide sequence of RNA 3 of the PE-5 peach isolate of Prunus necrotic ringspot ilarvirus (PNRSV) was obtained from cloned cDNA. The RNA sequence is 1941 nucleotides and contains two open reading frames (ORFs). ORF 1 consisted of 284 amino acids with a calculated molecular weight of 31,729 Da and ORF 2 contained 224 amino acids with a calculated molecular weight of 25,018 Da. ORF 2 corresponds to the coat protein gene. Expression of ORF 2 engineered into a pTrcHis vector in Escherichia coli results in a fusion polypeptide of approximately 28 kDa which cross-reacts with PNRSV polyclonal antiserum. Analysis of the coat protein amino acid sequence reveals a putative "zinc-finger" domain at the amino-terminal portion of the protein. Two tetranucleotide AUGC motifs occur in the 3'-UTR of the RNA and may function in coat protein binding and genome activation. ORF 1 homologies to other ilarviruses and alfalfa mosaic virus are confined to limited regions of conserved amino acids. The translated amino acid sequence of the coat protein gene shows 92% similarity to one isolate of apple mosaic virus, a closely related member of the ilarvirus group of plant viruses, but only 66% similarity to the amino acid sequence of the coat protein gene of a second isolate. These relationships are also reflected at the nucleotide sequence level. These results in one instance confirm the close similarities observed at the biophysical and serological levels between these two viruses, but on the other hand call into question the nomenclature used to describe these viruses.
Comprehensive comparison of three commercial human whole-exome capture platforms.
Asan; Xu, Yu; Jiang, Hui; Tyler-Smith, Chris; Xue, Yali; Jiang, Tao; Wang, Jiawei; Wu, Mingzhi; Liu, Xiao; Tian, Geng; Wang, Jun; Wang, Jian; Yang, Huangming; Zhang, Xiuqing
2011-09-28
Exome sequencing, which allows the global analysis of protein coding sequences in the human genome, has become an effective and affordable approach to detecting causative genetic mutations in diseases. Currently, there are several commercial human exome capture platforms; however, the relative performances of these have not been characterized sufficiently to know which is best for a particular study. We comprehensively compared three platforms: NimbleGen's Sequence Capture Array and SeqCap EZ, and Agilent's SureSelect. We assessed their performance in a variety of ways, including number of genes covered and capture efficacy. Differences that may impact on the choice of platform were that Agilent SureSelect covered approximately 1,100 more genes, while NimbleGen provided better flanking sequence capture. Although all three platforms achieved similar capture specificity of targeted regions, the NimbleGen platforms showed better uniformity of coverage and greater genotype sensitivity at 30- to 100-fold sequencing depth. All three platforms showed similar power in exome SNP calling, including medically relevant SNPs. Compared with genotyping and whole-genome sequencing data, the three platforms achieved a similar accuracy of genotype assignment and SNP detection. Importantly, all three platforms showed similar levels of reproducibility, GC bias and reference allele bias. We demonstrate key differences between the three platforms, particularly advantages of solutions over array capture and the importance of a large gene target set.
Two new miniature inverted-repeat transposable elements in the genome of the clam Donax trunculus.
Šatović, Eva; Plohl, Miroslav
2017-10-01
Repetitive sequences are important components of eukaryotic genomes that drive their evolution. Among them are different types of mobile elements that share the ability to spread throughout the genome and form interspersed repeats. To broaden the generally scarce knowledge on bivalves at the genome level, in the clam Donax trunculus we described two new non-autonomous DNA transposons, miniature inverted-repeat transposable elements (MITEs), named DTC M1 and DTC M2. Like other MITEs, they are characterized by their small size, their A + T richness, and the presence of terminal inverted repeats (TIRs). DTC M1 and DTC M2 are 261 and 286 bp long, respectively, and in addition to TIRs, both of them contain a long imperfect palindrome sequence in their central parts. These elements are present in complete and truncated versions within the genome of the clam D. trunculus. The two new MITEs share only structural similarity, but lack any nucleotide sequence similarity to each other. In a search for related elements in databases, blast search revealed within the Crassostrea gigas genome a larger element sharing sequence similarity only to DTC M1 in its TIR sequences. The lack of sequence similarity with any previously published mobile elements indicates that DTC M1 and DTC M2 elements may be unique to D. trunculus.
Mourier, Tobias; Mollerup, Sarah; Vinner, Lasse; Hansen, Thomas Arn; Kjartansdóttir, Kristín Rós; Guldberg Frøslev, Tobias; Snogdal Boutrup, Torsten; Nielsen, Lars Peter; Willerslev, Eske; Hansen, Anders J.
2015-01-01
From Illumina sequencing of DNA from brain and liver tissue from the lion, Panthera leo, and tumor samples from the pike-perch, Sander lucioperca, we obtained two assembled sequence contigs with similarity to known retroviruses. Phylogenetic analyses suggest that the pike-perch retrovirus belongs to the epsilonretroviruses, and the lion retrovirus to the gammaretroviruses. To determine if these novel retroviral sequences originate from an endogenous retrovirus or from a recently integrated exogenous retrovirus, we assessed the genetic diversity of the parental sequences from which the short Illumina reads are derived. First, we showed by simulations that we can robustly infer the level of genetic diversity from short sequence reads. Second, we find that the measures of nucleotide diversity inferred from our retroviral sequences significantly exceed the level observed from Human Immunodeficiency Virus infections, prompting us to conclude that the novel retroviruses are both of endogenous origin. Through further simulations, we rule out the possibility that the observed elevated levels of nucleotide diversity are the result of co-infection with two closely related exogenous retroviruses. PMID:26493184
Juhasz, E.; Muller, P.; Toth-Makk, A.; Hamor, T.; Farkas-Bulla, J.; Suto-Szentai, M.; Phillips, R.L.; Ricketts, B.
1996-01-01
Detailed sedimentological and paleontological analyses were carried out on more than 13,000 m of core from ten boreholes in the Late Neogene sediments of the Pannonian Basin, Hungary. These data provide the basis for determining the character of high-order depositional cycles and their stacking patterns. In the Late Neogene sediments of the Pannonian Basin there are two third-order sequences: the Late Miocene and the Pliocene ones. The Miocene sequence shows a regressive, upward-coarsening trend. There are four distinguishable sedimentary units in this sequence: the basal transgressive, the lower aggradational, the progradational and the upper aggradational units. The Pliocene sequence is also of aggradational character. The progradation does not coincide in time in the wells within the basin. The character of the relative water-level curves is similar throughout the basin but shows only very faint similarity to the sea-level curve. Therefore, it is unlikely that eustasy played any significant role in the pattern of basin filling. Rather, the dominant controls were the rapidly changing basin subsidence and high sedimentation rates, together with possible climatic factors.
Rajendran, Senthilnathan; Jothi, Arunachalam
2018-05-16
The Three-dimensional structure of a protein depends on the interaction between their amino acid residues. These interactions are in turn influenced by various biophysical properties of the amino acids. There are several examples of proteins that share the same fold but are very dissimilar at the sequence level. For proteins to share a common fold some crucial interactions should be maintained despite insignificant sequence similarity. Since the interactions are because of the biophysical properties of the amino acids, we should be able to detect descriptive patterns for folds at such a property level. In this line, the main focus of our research is to analyze such proteins and to characterize them in terms of their biophysical properties. Protein structures with sequence similarity lesser than 40% were selected for ten different subfolds from three different mainfolds (according to CATH classification) and were used for this analysis. We used the normalized values of the 49 physio-chemical, energetic and conformational properties of amino acids. We characterize the folds based on the average biophysical property values. We also observed a fold specific correlational behavior of biophysical properties despite a very low sequence similarity in our data. We further trained three different binary classification models (Naive Bayes-NB, Support Vector Machines-SVM and Bayesian Generalized Linear Model-BGLM) which could discriminate mainfold based on the biophysical properties. We also show that among the three generated models, the BGLM classifier model was able to discriminate protein sequences coming under all beta category with 81.43% accuracy and all alpha, alpha-beta proteins with 83.37% accuracy. Copyright © 2018 Elsevier Ltd. All rights reserved.
AlignMe—a membrane protein sequence alignment web server
Stamm, Marcus; Staritzbichler, René; Khafizov, Kamil; Forrest, Lucy R.
2014-01-01
We present a web server for pair-wise alignment of membrane protein sequences, using the program AlignMe. The server makes available two operational modes of AlignMe: (i) sequence to sequence alignment, taking two sequences in fasta format as input, combining information about each sequence from multiple sources and producing a pair-wise alignment (PW mode); and (ii) alignment of two multiple sequence alignments to create family-averaged hydropathy profile alignments (HP mode). For the PW sequence alignment mode, four different optimized parameter sets are provided, each suited to pairs of sequences with a specific similarity level. These settings utilize different types of inputs: (position-specific) substitution matrices, secondary structure predictions and transmembrane propensities from transmembrane predictions or hydrophobicity scales. In the second (HP) mode, each input multiple sequence alignment is converted into a hydrophobicity profile averaged over the provided set of sequence homologs; the two profiles are then aligned. The HP mode enables qualitative comparison of transmembrane topologies (and therefore potentially of 3D folds) of two membrane proteins, which can be useful if the proteins have low sequence similarity. In summary, the AlignMe web server provides user-friendly access to a set of tools for analysis and comparison of membrane protein sequences. Access is available at http://www.bioinfo.mpg.de/AlignMe PMID:24753425
Calva, E; Torres, J; Vázquez, M; Angeles, V; de la Vega, H; Ruíz-Palacios, G M
1989-02-20
Campylobacter jejuni is one of the main etiologic agents of gastrointestinal illness in developing and developed areas throughout the world. Isolation of enterotoxin-producing C. jejuni has been associated with clinical symptoms of a watery-secretory type of diarrhea. Although physiological and immunological relatedness has been demonstrated between the C. jejuni enterotoxin (CJT), the Vibrio cholerae enterotoxin (CT), and the heat-labile cholera-like Escherichia coli enterotoxin (LT), nucleotide sequence similarity between C. jejuni DNA and either the toxA, toxB, eltA or eltB genes remained to be shown. We found that binding to ganglioside GM1 prevented recognition of CJT by monoclonal antibodies directed to either CT or LT. This indicates antigenic similarity between the three enterotoxins in the ganglioside GM1-binding site. Therefore we searched for corresponding similarities at the DNA level and found, by oligodeoxynucleotide hybridization, C. jejuni chromosomal nucleotide sequences similar to the coding region for a postulated ganglioside GM1-binding site on toxB and eltB.
Visualizing and Clustering Protein Similarity Networks: Sequences, Structures, and Functions.
Mai, Te-Lun; Hu, Geng-Ming; Chen, Chi-Ming
2016-07-01
Research in the recent decade has demonstrated the usefulness of protein network knowledge in furthering the study of molecular evolution of proteins, understanding the robustness of cells to perturbation, and annotating new protein functions. In this study, we aimed to provide a general clustering approach to visualize the sequence-structure-function relationship of protein networks, and investigate possible causes for inconsistency in the protein classifications based on sequences, structures, and functions. Such visualization of protein networks could facilitate our understanding of the overall relationship among proteins and help researchers comprehend various protein databases. As a demonstration, we clustered 1437 enzymes by their sequences and structures using the minimum span clustering (MSC) method. The general structure of this protein network was delineated at two clustering resolutions, and the second level MSC clustering was found to be highly similar to existing enzyme classifications. The clustering of these enzymes based on sequence, structure, and function information is consistent with each other. For proteases, the Jaccard's similarity coefficient is 0.86 between sequence and function classifications, 0.82 between sequence and structure classifications, and 0.78 between structure and function classifications. From our clustering results, we discussed possible examples of divergent evolution and convergent evolution of enzymes. Our clustering approach provides a panoramic view of the sequence-structure-function network of proteins, helps visualize the relation between related proteins intuitively, and is useful in predicting the structure and function of newly determined protein sequences.
Zurfluh, Katrin; Wang, Juan; Klumpp, Jochen; Nüesch-Inderbinen, Magdalena; Fanning, Séamus; Stephan, Roger
2014-01-01
Objectives: The purpose of this study was to characterize sets of extended-spectrum β-lactamases (ESBL)-producing Enterobacteriaceae collected longitudinally from different flocks of broiler breeders, meconium of 1-day-old broilers from theses breeder flocks, as well as from these broiler flocks before slaughter. Methods: Five sets of ESBL-producing Escherichia coli were studied by multi-locus sequence typing (MLST), phylogenetic grouping, PCR-based replicon typing and resistance profiling. The blaCTX-M-1-harboring plasmids of one set (pHV295.1, pHV114.1, and pHV292.1) were fully sequenced and subjected to comparative analysis. Results: Eleven different MLST sequence types (ST) were identified with ST1056 the predominant one, isolated in all five sets either on the broiler breeder or meconium level. Plasmid sequencing revealed that blaCTX-M-1 was carried by highly similar IncI1/ST3 plasmids that were 105 076 bp, 110 997 bp, and 117 269 bp in size, respectively. Conclusions: The fact that genetically similar IncI1/ST3 plasmids were found in ESBL-producing E. coli of different MLST types isolated at the different levels in the broiler production pyramid provides strong evidence for a vertical transmission of these plasmids from a common source (nucleus poultry flocks). PMID:25324838
Zurfluh, Katrin; Wang, Juan; Klumpp, Jochen; Nüesch-Inderbinen, Magdalena; Fanning, Séamus; Stephan, Roger
2014-01-01
The purpose of this study was to characterize sets of extended-spectrum β-lactamases (ESBL)-producing Enterobacteriaceae collected longitudinally from different flocks of broiler breeders, meconium of 1-day-old broilers from theses breeder flocks, as well as from these broiler flocks before slaughter. Five sets of ESBL-producing Escherichia coli were studied by multi-locus sequence typing (MLST), phylogenetic grouping, PCR-based replicon typing and resistance profiling. The bla CTX-M-1-harboring plasmids of one set (pHV295.1, pHV114.1, and pHV292.1) were fully sequenced and subjected to comparative analysis. Eleven different MLST sequence types (ST) were identified with ST1056 the predominant one, isolated in all five sets either on the broiler breeder or meconium level. Plasmid sequencing revealed that bla CTX-M-1 was carried by highly similar IncI1/ST3 plasmids that were 105 076 bp, 110 997 bp, and 117 269 bp in size, respectively. The fact that genetically similar IncI1/ST3 plasmids were found in ESBL-producing E. coli of different MLST types isolated at the different levels in the broiler production pyramid provides strong evidence for a vertical transmission of these plasmids from a common source (nucleus poultry flocks).
Mashiyama, Susan T.; Koupparis, Kyriacos; Caffrey, Conor R.; McKerrow, James H.; Babbitt, Patricia C.
2012-01-01
We performed a genome-level computational study of sequence and structure similarity, the latter using crystal structures and models, of the proteases of Homo sapiens and the human parasite Trypanosoma brucei. Using sequence and structure similarity networks to summarize the results, we constructed global views that show visually the relative abundance and variety of proteases in the degradome landscapes of these two species, and provide insights into evolutionary relationships between proteases. The results also indicate how broadly these sequence sets are covered by three-dimensional structures. These views facilitate cross-species comparisons and offer clues for drug design from knowledge about the sequences and structures of potential drug targets and their homologs. Two protease groups (“M32” and “C51”) that are very different in sequence from human proteases are examined in structural detail, illustrating the application of this global approach in mining new pathogen genomes for potential drug targets. Based on our analyses, a human ACE2 inhibitor was selected for experimental testing on one of these parasite proteases, TbM32, and was shown to inhibit it. These sequence and structure data, along with interactive versions of the protein similarity networks generated in this study, are available at http://babbittlab.ucsf.edu/resources.html. PMID:23236535
Concerted evolution at the population level: pupfish HindIII satellite DNA sequences.
Elder, J F; Turner, B J
1994-01-01
The canonical monomers (approximately 170 bp) of an abundant (1.9 x 10(6) copies per diploid genome) satellite DNA sequence family in the genome of Cyprinodon variegatus, a "pupfish" that ranges along the Atlantic coast from Cape Cod to central Mexico, are divergent in base sequence in 10 of 12 samples collected from natural populations. The divergence involves substitutions, deletions, and insertions, is marked in scope (mean pairwise sequence similarity = 61.6%; range = 35-95.9%), is largely confined to the 3' half of the monomer, and is not correlated with the distance among collecting sites. Repetitive cloning and direct genomic sequencing experiments failed to detect intrapopulation and intraindividual variation, suggesting high levels of sequence homogeneity within populations. The satellite sequence has therefore undergone "concerted evolution," at the level of the local population. Concerted evolution has previously almost always been discussed in terms of the divergence of species or higher taxa; its intraspecific occurrence apparently has not been reported previously. The generality of the observation is difficult to evaluate, for although satellite DNAs from a large number of organisms have been studied in detail, there appear to be little or no other data on their sequence variation in natural populations. The relationship (if any) between concerted, population level, satellite DNA divergence and the extent of gene flow/genetic isolation among conspecific natural populations remains to be established. Images PMID:8302879
A high level interface to SCOP and ASTRAL implemented in python.
Casbon, James A; Crooks, Gavin E; Saqi, Mansoor A S
2006-01-10
Benchmarking algorithms in structural bioinformatics often involves the construction of datasets of proteins with given sequence and structural properties. The SCOP database is a manually curated structural classification which groups together proteins on the basis of structural similarity. The ASTRAL compendium provides non redundant subsets of SCOP domains on the basis of sequence similarity such that no two domains in a given subset share more than a defined degree of sequence similarity. Taken together these two resources provide a 'ground truth' for assessing structural bioinformatics algorithms. We present a small and easy to use API written in python to enable construction of datasets from these resources. We have designed a set of python modules to provide an abstraction of the SCOP and ASTRAL databases. The modules are designed to work as part of the Biopython distribution. Python users can now manipulate and use the SCOP hierarchy from within python programs, and use ASTRAL to return sequences of domains in SCOP, as well as clustered representations of SCOP from ASTRAL. The modules make the analysis and generation of datasets for use in structural genomics easier and more principled.
Bayesian Correlation Analysis for Sequence Count Data
Lau, Nelson; Perkins, Theodore J.
2016-01-01
Evaluating the similarity of different measured variables is a fundamental task of statistics, and a key part of many bioinformatics algorithms. Here we propose a Bayesian scheme for estimating the correlation between different entities’ measurements based on high-throughput sequencing data. These entities could be different genes or miRNAs whose expression is measured by RNA-seq, different transcription factors or histone marks whose expression is measured by ChIP-seq, or even combinations of different types of entities. Our Bayesian formulation accounts for both measured signal levels and uncertainty in those levels, due to varying sequencing depth in different experiments and to varying absolute levels of individual entities, both of which affect the precision of the measurements. In comparison with a traditional Pearson correlation analysis, we show that our Bayesian correlation analysis retains high correlations when measurement confidence is high, but suppresses correlations when measurement confidence is low—especially for entities with low signal levels. In addition, we consider the influence of priors on the Bayesian correlation estimate. Perhaps surprisingly, we show that naive, uniform priors on entities’ signal levels can lead to highly biased correlation estimates, particularly when different experiments have widely varying sequencing depths. However, we propose two alternative priors that provably mitigate this problem. We also prove that, like traditional Pearson correlation, our Bayesian correlation calculation constitutes a kernel in the machine learning sense, and thus can be used as a similarity measure in any kernel-based machine learning algorithm. We demonstrate our approach on two RNA-seq datasets and one miRNA-seq dataset. PMID:27701449
Tan, Yen Hock; Huang, He; Kihara, Daisuke
2006-08-15
Aligning distantly related protein sequences is a long-standing problem in bioinformatics, and a key for successful protein structure prediction. Its importance is increasing recently in the context of structural genomics projects because more and more experimentally solved structures are available as templates for protein structure modeling. Toward this end, recent structure prediction methods employ profile-profile alignments, and various ways of aligning two profiles have been developed. More fundamentally, a better amino acid similarity matrix can improve a profile itself; thereby resulting in more accurate profile-profile alignments. Here we have developed novel amino acid similarity matrices from knowledge-based amino acid contact potentials. Contact potentials are used because the contact propensity to the other amino acids would be one of the most conserved features of each position of a protein structure. The derived amino acid similarity matrices are tested on benchmark alignments at three different levels, namely, the family, the superfamily, and the fold level. Compared to BLOSUM45 and the other existing matrices, the contact potential-based matrices perform comparably in the family level alignments, but clearly outperform in the fold level alignments. The contact potential-based matrices perform even better when suboptimal alignments are considered. Comparing the matrices themselves with each other revealed that the contact potential-based matrices are very different from BLOSUM45 and the other matrices, indicating that they are located in a different basin in the amino acid similarity matrix space.
Kosushkin, S A; Borodulina, O R; Solov'eva, E N; Grechko, V V
2008-01-01
We have isolated and characterised sequences of a SINE family specific for squamate reptiles from a genome of lacertid lizard that we called Squam1. Copies are 360-390 bp in length and share a significant similarity with tRNA gene sequence on its 5'-end. This family was also detected by us in DNA of representatives of varanids, iguanids (anolis), gekkonids, and snakes. No signs of it were found in DNA of mammals, birds, amphibians, and crocodiles. Detailed analysis of primary structure of the retroposons obtained by us from genomic libraries or GenBank sequences was carried out. Most taxa possess 2-3 subfamilies of the SINE in their genomes with specific diagnostic features in their primary structure. Individual variability of copies in different families is about 85% and is just slightly lower on the genera level. Comparison of consensus sequences on family level reveals a high degree of structural similarity with a number of specific apomorphic features which makes it a useful marker of phylogeny for this group of reptiles. Snakes do not show specific affinity to varanids when compared to other lizards, as it was suggested earlier.
Peterson, K A; Yoshigi, M; Hazel, M W; Delker, D A; Lin, E; Krishnamurthy, C; Consiglio, N; Robson, J; Yandell, M; Clayton, F
2018-06-04
Although current American guidelines distinguish proton pump inhibitor-responsive oesophageal eosinophilia (PPI-REE) from eosinophilic oesophagitis (EoE), these entities are broadly similar. While two microarray studies showed that they have similar transcriptomes, more extensive RNA sequencing studies have not been done previously. To determine whether RNA sequencing identifies genetic markers distinguishing PPI-REE from EoE. We retrospectively examined 13 PPI-REE and 14 EoE biopsies, matched for tissue eosinophil content, and 14 normal controls. Patients and controls were not PPI-treated at the time of biopsy. We did RNA sequencing on formalin-fixed, paraffin-embedded tissue, with differential expression confirmation by quantitative polymerase chain reaction (PCR). We validated the use of formalin-fixed, paraffin-embedded vs RNAlater-preserved tissue, and compared our formalin-fixed, paraffin-embedded EoE results to a prior EoE study. By RNA sequencing, no genes were differentially expressed between the EoE and PPI-REE groups at the false discovery rate (FDR) ≤0.01 level. Compared to normal controls, 1996 genes were differentially expressed in the PPI-REE group and 1306 genes in the EoE group. By less stringent criteria, only MAPK8IP2 was differentially expressed between PPI-REE and EoE (FDR = 0.029, 2.2-fold less in EoE than in PPI-REE), with similar results by PCR. KCNJ2, which was differentially expressed in a prior study, was similar in the EoE and PPI-REE groups by both RNA sequencing and real-time PCR. Eosinophilic oesophagitis and PPI-REE have comparable transcriptomes, confirming that they are part of the same disease continuum. © 2018 John Wiley & Sons Ltd.
Comparative Analyses of DNA Methylation and Sequence Evolution Using Nasonia Genomes
Park, Jungsun; Peng, Zuogang; Zeng, Jia; Elango, Navin; Park, Taesung; Wheeler, Dave; Werren, John H.; Yi, Soojin V.
2011-01-01
The functional and evolutionary significance of DNA methylation in insect genomes remains to be resolved. Nasonia is well situated for comparative analyses of DNA methylation and genome evolution, since the genomes of a moderately distant outgroup species as well as closely related sibling species are available. Using direct sequencing of bisulfite-converted DNA, we uncovered a substantial level of DNA methylation in 17 of 18 Nasonia vitripennis genes and a strong correlation between methylation level and CpG depletion. Notably, in the sex-determining locus transformer, the exon that is alternatively spliced between the sexes is heavily methylated in both males and females, whereas other exons are only sparsely methylated. Orthologous genes of the honeybee and Nasonia show highly similar relative levels of CpG depletion, despite ∼190 My divergence. Densely and sparsely methylated genes in these species also exhibit similar functional enrichments. We found that the degree of CpG depletion is negatively correlated with substitution rates between closely related Nasonia species for synonymous, nonsynonymous, and intron sites. This suggests that mutation rates increase with decreasing levels of germ line methylation. Thus, DNA methylation is prevalent in the Nasonia genome, may participate in regulatory processes such as sex determination and alternative splicing, and is correlated with several aspects of genome and sequence evolution. PMID:21693438
Hwang, Chiachi; Wu, Weimin; Gentry, Terry J; Carley, Jack; Corbin, Gail A; Carroll, Sue L; Watson, David B; Jardine, Phil M; Zhou, Jizhong; Criddle, Craig S; Fields, Matthew W
2009-01-01
Bacterial community succession was investigated in a field-scale subsurface reactor formed by a series of wells that received weekly ethanol additions to re-circulating groundwater. Ethanol additions stimulated denitrification, metal reduction, sulfate reduction and U(VI) reduction to sparingly soluble U(IV). Clone libraries of SSU rRNA gene sequences from groundwater samples enabled tracking of spatial and temporal changes over a 1.5-year period. Analyses showed that the communities changed in a manner consistent with geochemical variations that occurred along temporal and spatial scales. Canonical correspondence analysis revealed that the levels of nitrate, uranium, sulfide, sulfate and ethanol were strongly correlated with particular bacterial populations. As sulfate and U(VI) levels declined, sequences representative of sulfate reducers and metal reducers were detected at high levels. Ultimately, sequences associated with sulfate-reducing populations predominated, and sulfate levels declined as U(VI) remained at low levels. When engineering controls were compared with the population variation through canonical ordination, changes could be related to dissolved oxygen control and ethanol addition. The data also indicated that the indigenous populations responded differently to stimulation for bioreduction; however, the two biostimulated communities became more similar after different transitions in an idiosyncratic manner. The strong associations between particular environmental variables and certain populations provide insight into the establishment of practical and successful remediation strategies in radionuclide-contaminated environments with respect to engineering controls and microbial ecology.
A self-similar hierarchy of the Korean stock market
NASA Astrophysics Data System (ADS)
Lim, Gyuchang; Min, Seungsik; Yoo, Kun-Woo
2013-01-01
A scaling analysis is performed on market values of stocks listed on Korean stock exchanges such as the KOSPI and the KOSDAQ. Different from previous studies on price fluctuations, market capitalizations are dealt with in this work. First, we show that the sum of the two stock exchanges shows a clear rank-size distribution, i.e., the Zipf's law, just as each separate one does. Second, by abstracting Zipf's law as a γ-sequence, we define a self-similar hierarchy consisting of many levels, with the numbers of firms at each level forming a geometric sequence. We also use two exponential functions to describe the hierarchy and derive a scaling law from them. Lastly, we propose a self-similar hierarchical process and perform an empirical analysis on our data set. Based on our findings, we argue that all money invested in the stock market is distributed in a hierarchical way and that a slight difference exists between the two exchanges.
Porras-Alfaro, Andrea; Liu, Kuan-Liang; Kuske, Cheryl R; Xie, Gary
2014-02-01
We compared the classification accuracy of two sections of the fungal internal transcribed spacer (ITS) region, individually and combined, and the 5' section (about 600 bp) of the large-subunit rRNA (LSU), using a naive Bayesian classifier and BLASTN. A hand-curated ITS-LSU training set of 1,091 sequences and a larger training set of 8,967 ITS region sequences were used. Of the factors evaluated, database composition and quality had the largest effect on classification accuracy, followed by fragment size and use of a bootstrap cutoff to improve classification confidence. The naive Bayesian classifier and BLASTN gave similar results at higher taxonomic levels, but the classifier was faster and more accurate at the genus level when a bootstrap cutoff was used. All of the ITS and LSU sections performed well (>97.7% accuracy) at higher taxonomic ranks from kingdom to family, and differences between them were small at the genus level (within 0.66 to 1.23%). When full-length sequence sections were used, the LSU outperformed the ITS1 and ITS2 fragments at the genus level, but the ITS1 and ITS2 showed higher accuracy when smaller fragment sizes of the same length and a 50% bootstrap cutoff were used. In a comparison using the larger ITS training set, ITS1 and ITS2 had very similar accuracy classification for fragments between 100 and 200 bp. Collectively, the results show that any of the ITS or LSU sections we tested provided comparable classification accuracy to the genus level and underscore the need for larger and more diverse classification training sets.
Liu, Kuan-Liang; Kuske, Cheryl R.
2014-01-01
We compared the classification accuracy of two sections of the fungal internal transcribed spacer (ITS) region, individually and combined, and the 5′ section (about 600 bp) of the large-subunit rRNA (LSU), using a naive Bayesian classifier and BLASTN. A hand-curated ITS-LSU training set of 1,091 sequences and a larger training set of 8,967 ITS region sequences were used. Of the factors evaluated, database composition and quality had the largest effect on classification accuracy, followed by fragment size and use of a bootstrap cutoff to improve classification confidence. The naive Bayesian classifier and BLASTN gave similar results at higher taxonomic levels, but the classifier was faster and more accurate at the genus level when a bootstrap cutoff was used. All of the ITS and LSU sections performed well (>97.7% accuracy) at higher taxonomic ranks from kingdom to family, and differences between them were small at the genus level (within 0.66 to 1.23%). When full-length sequence sections were used, the LSU outperformed the ITS1 and ITS2 fragments at the genus level, but the ITS1 and ITS2 showed higher accuracy when smaller fragment sizes of the same length and a 50% bootstrap cutoff were used. In a comparison using the larger ITS training set, ITS1 and ITS2 had very similar accuracy classification for fragments between 100 and 200 bp. Collectively, the results show that any of the ITS or LSU sections we tested provided comparable classification accuracy to the genus level and underscore the need for larger and more diverse classification training sets. PMID:24242255
Campion, S R; Ameen, A S; Lai, L; King, J M; Munzenmaier, T N
2001-08-15
This report describes the application of a simple computational tool, AAPAIR.TAB, for the systematic analysis of the cysteine-rich EGF, Sushi, and Laminin motif/sequence families at the two-amino acid level. Automated dipeptide frequency/bias analysis detects preferences in the distribution of amino acids in established protein families, by determining which "ordered dipeptides" occur most frequently in comprehensive motif-specific sequence data sets. Graphic display of the dipeptide frequency/bias data revealed family-specific preferences for certain dipeptides, but more importantly detected a shared preference for employment of the ordered dipeptides Gly-Tyr (GY) and Gly-Phe (GF) in all three protein families. The dipeptide Asn-Gly (NG) also exhibited high-frequency and bias in the EGF and Sushi motif families, whereas Asn-Thr (NT) was distinguished in the Laminin family. Evaluation of the distribution of dipeptides identified by frequency/bias analysis subsequently revealed the highly restricted localization of the G(F/Y) and N(G/T) sequence elements at two separate sites of extreme conservation in the consensus sequence of all three sequence families. The similar employment of the high-frequency/bias dipeptides in three distinct protein sequence families was further correlated with the concurrence of these shared molecular determinants at similar positions within the distinctive scaffolds of three structurally divergent, but similarly employed, motif modules.
Steinberg, Lisa M; Regan, John M
2008-11-01
Methanogens play a critical role in the decomposition of organics under anaerobic conditions. The methanogenic consortia in saturated wetland soils are often subjected to large temperature fluctuations and acidic conditions, imposing a selective pressure for psychro- and acidotolerant community members; however, methanogenic communities in engineered digesters are frequently maintained within a narrow range of mesophilic and circumneutral conditions to retain system stability. To investigate the hypothesis that these two disparate environments have distinct methanogenic communities, the methanogens in an oligotrophic acidic fen and a mesophilic anaerobic digester treating municipal wastewater sludge were characterized by creating clone libraries for the 16S rRNA and methyl coenzyme M reductase alpha subunit (mcrA) genes. A quantitative framework was developed to assess the differences between these two communities by calculating the average sequence similarity for 16S rRNA genes and mcrA within a genus and family using sequences of isolated and characterized methanogens within the approved methanogen taxonomy. The average sequence similarities for 16S rRNA genes within a genus and family were 96.0 and 93.5%, respectively, and the average sequence similarities for mcrA within a genus and family were 88.9 and 79%, respectively. The clone libraries of the bog and digester environments showed no overlap at the species level and almost no overlap at the family level. Both libraries were dominated by clones related to uncultured methanogen groups within the Methanomicrobiales, although members of the Methanosarcinales and Methanobacteriales were also found in both libraries. Diversity indices for the 16S rRNA gene library of the bog and both mcrA libraries were similar, but these indices indicated much lower diversity in the 16S digester library than in the other three libraries.
Soares, René Arderius; Passaglia, Luciane Maria Pereira
2010-10-01
Bradyrhizobium elkanii is successfully used in the formulation of commercial inoculants and, together with B. japonicum, it fully supplies the plant nitrogen demands. Despite the similarity between B. japonicum and B. elkanii species, several works demonstrated genetic and physiological differences between them. In this work Representational Difference Analysis (RDA) was used for genomic comparison between B. elkanii SEMIA 587, a crop inoculant strain, and B. japonicum USDA 110, a reference strain. Two hundred sequences were obtained. From these, 46 sequences belonged exclusively to the genome of B. elkanii strain, and 154 showed similarity to sequences from B. japonicum genome. From the 46 sequences with no similarity to sequences from B. japonicum, 39 showed no similarity to sequences in public databases and seven showed similarity to sequences of genes coding for known proteins. These seven sequences were divided in three groups: similar to sequences from other Bradyrhizobium strains, similar to sequences from other nitrogen-fixing bacteria, and similar to sequences from non nitrogen-fixing bacteria. These new sequences could be used as DNA markers in order to investigate the rates of genetic material gain and loss in natural Bradyrhizobium strains.
Zhang, Wenqiang; Lin, Xiaojuan; Jiang, Ping; Tao, Zexin; Liu, Xiaolin; Ji, Feng; Wang, Tongzhan; Wang, Suting; Lv, Hui; Xu, Aiqiang; Wang, Haiyan
2016-08-01
Coxsackievirus B3 (CV-B3) has frequently been associated with aseptic meningitis outbreaks in China. To identify sequence motifs related to aseptic meningitis and to construct an infectious clone, the genome sequence of 08TC170, a representative strain isolated from cerebrospinal fluid (CSF) samples from an outbreak in Shandong in 2008, was determined, and the coding regions for P1-P3 and VP1 were aligned. The first 21 and last 20 residues were "TTAAAACAGCCTGTGGGTTGT" and "ATTCTCCGCATTCGGTGCGG", respectively. The whole genome consisted of 7401 nucleotides, sharing 80.8 % identity with the prototype strain Nancy and low sequence similarity with members of clusters A-C. In contrast, 08TC170 showed high sequence similarity to members of cluster D. An especially high level of sequence identity (≥97.7 %) was found within a branch constituted by 08TC170 and four Chinese strains that clustered together in all of the P1-P3 phylogenic trees. In addition, 08TC170 also possessed a close relationship to the Hong Kong strain 26362/08 in VP1. Similarity plot analysis showed that 08TC170 was most similar to the Chinese CV-B3 strain SSM in P1 and the partial P2 coding region but to the CV-B5 or E-6 strain in 2C and following regions. A T277A mutation was found in 08TC170 and other strains isolated in 2008-2010, but not in strains isolated before 2008, which had high sequence similarity and formed the cluster A277. The results suggested that 08TC170 was the product of both intertypic recombination and point mutation, whose effects on viral neurovirulence will be investigated in a further study. The high homology between 08TC170 and other strains revealed their co-circulation in mainland China and Hong Kong and indicates that further surveillance is needed.
Naz, Sadia; Ngo, Tony; Farooq, Umar
2017-01-01
Background The rapid increase in antibiotic resistance by various bacterial pathogens underlies the significance of developing new therapies and exploring different drug targets. A fraction of bacterial pathogens abbreviated as ESKAPE by the European Center for Disease Prevention and Control have been considered a major threat due to the rise in nosocomial infections. Here, we compared putative drug binding pockets of twelve essential and mostly conserved metabolic enzymes in numerous bacterial pathogens including those of the ESKAPE group and Mycobacterium tuberculosis. The comparative analysis will provide guidelines for the likelihood of transferability of the inhibitors from one species to another. Methods Nine bacterial species including six ESKAPE pathogens, Mycobacterium tuberculosis along with Mycobacterium smegmatis and Eschershia coli, two non-pathogenic bacteria, have been selected for drug binding pocket analysis of twelve essential enzymes. The amino acid sequences were obtained from Uniprot, aligned using ICM v3.8-4a and matched against the Pocketome encyclopedia. We used known co-crystal structures of selected target enzyme orthologs to evaluate the location of their active sites and binding pockets and to calculate a matrix of pairwise sequence identities across each target enzyme across the different species. This was used to generate sequence maps. Results High sequence identity of enzyme binding pockets, derived from experimentally determined co-crystallized structures, was observed among various species. Comparison at both full sequence level and for drug binding pockets of key metabolic enzymes showed that binding pockets are highly conserved (sequence similarity up to 100%) among various ESKAPE pathogens as well as Mycobacterium tuberculosis. Enzymes orthologs having conserved binding sites may have potential to interact with inhibitors in similar way and might be helpful for design of similar class of inhibitors for a particular species. The derived pocket alignments and distance-based maps provide guidelines for drug discovery and repurposing. In addition they also provide recommendations for the relevant model bacteria that may be used for initial drug testing. Discussion Comparing ligand binding sites through sequence identity calculation could be an effective approach to identify conserved orthologs as drug binding pockets have shown higher level of conservation among various species. By using this approach we could avoid the problems associated with full sequence comparison. We identified essential metabolic enzymes among ESKAPE pathogens that share high sequence identity in their putative drug binding pockets (up to 100%), of which known inhibitors can potentially antagonize these identical pockets in the various species in a similar manner. PMID:28948099
Naz, Sadia; Ngo, Tony; Farooq, Umar; Abagyan, Ruben
2017-01-01
The rapid increase in antibiotic resistance by various bacterial pathogens underlies the significance of developing new therapies and exploring different drug targets. A fraction of bacterial pathogens abbreviated as ESKAPE by the European Center for Disease Prevention and Control have been considered a major threat due to the rise in nosocomial infections. Here, we compared putative drug binding pockets of twelve essential and mostly conserved metabolic enzymes in numerous bacterial pathogens including those of the ESKAPE group and Mycobacterium tuberculosis . The comparative analysis will provide guidelines for the likelihood of transferability of the inhibitors from one species to another. Nine bacterial species including six ESKAPE pathogens, Mycobacterium tuberculosis along with Mycobacterium smegmatis and Eschershia coli , two non-pathogenic bacteria, have been selected for drug binding pocket analysis of twelve essential enzymes. The amino acid sequences were obtained from Uniprot, aligned using ICM v3.8-4a and matched against the Pocketome encyclopedia. We used known co-crystal structures of selected target enzyme orthologs to evaluate the location of their active sites and binding pockets and to calculate a matrix of pairwise sequence identities across each target enzyme across the different species. This was used to generate sequence maps. High sequence identity of enzyme binding pockets, derived from experimentally determined co-crystallized structures, was observed among various species. Comparison at both full sequence level and for drug binding pockets of key metabolic enzymes showed that binding pockets are highly conserved (sequence similarity up to 100%) among various ESKAPE pathogens as well as Mycobacterium tuberculosis . Enzymes orthologs having conserved binding sites may have potential to interact with inhibitors in similar way and might be helpful for design of similar class of inhibitors for a particular species. The derived pocket alignments and distance-based maps provide guidelines for drug discovery and repurposing. In addition they also provide recommendations for the relevant model bacteria that may be used for initial drug testing. Comparing ligand binding sites through sequence identity calculation could be an effective approach to identify conserved orthologs as drug binding pockets have shown higher level of conservation among various species. By using this approach we could avoid the problems associated with full sequence comparison. We identified essential metabolic enzymes among ESKAPE pathogens that share high sequence identity in their putative drug binding pockets (up to 100%), of which known inhibitors can potentially antagonize these identical pockets in the various species in a similar manner.
Zhang, Yinan; Samee, Md. Abul Hassan; Halfon, Marc S.; Sinha, Saurabh
2014-01-01
Many genes familiar from Drosophila development, such as the so-called gap, pair-rule, and segment polarity genes, play important roles in the development of other insects and in many cases appear to be deployed in a similar fashion, despite the fact that Drosophila-like “long germband” development is highly derived and confined to a subset of insect families. Whether or not these similarities extend to the regulatory level is unknown. Identification of regulatory regions beyond the well-studied Drosophila has been challenging as even within the Diptera (flies, including mosquitoes) regulatory sequences have diverged past the point of recognition by standard alignment methods. Here, we demonstrate that methods we previously developed for computational cis-regulatory module (CRM) discovery in Drosophila can be used effectively in highly diverged (250–350 Myr) insect species including Anopheles gambiae, Tribolium castaneum, Apis mellifera, and Nasonia vitripennis. In Drosophila, we have successfully used small sets of known CRMs as “training data” to guide the search for other CRMs with related function. We show here that although species-specific CRM training data do not exist, training sets from Drosophila can facilitate CRM discovery in diverged insects. We validate in vivo over a dozen new CRMs, roughly doubling the number of known CRMs in the four non-Drosophila species. Given the growing wealth of Drosophila CRM annotation, these results suggest that extensive regulatory sequence annotation will be possible in newly sequenced insects without recourse to costly and labor-intensive genome-scale experiments. We develop a new method, Regulus, which computes a probabilistic score of similarity based on binding site composition (despite the absence of nucleotide-level sequence alignment), and demonstrate similarity between functionally related CRMs from orthologous loci. Our work represents an important step toward being able to trace the evolutionary history of gene regulatory networks and defining the mechanisms underlying insect evolution. PMID:25173756
Kazemian, Majid; Suryamohan, Kushal; Chen, Jia-Yu; Zhang, Yinan; Samee, Md Abul Hassan; Halfon, Marc S; Sinha, Saurabh
2014-09-01
Many genes familiar from Drosophila development, such as the so-called gap, pair-rule, and segment polarity genes, play important roles in the development of other insects and in many cases appear to be deployed in a similar fashion, despite the fact that Drosophila-like "long germband" development is highly derived and confined to a subset of insect families. Whether or not these similarities extend to the regulatory level is unknown. Identification of regulatory regions beyond the well-studied Drosophila has been challenging as even within the Diptera (flies, including mosquitoes) regulatory sequences have diverged past the point of recognition by standard alignment methods. Here, we demonstrate that methods we previously developed for computational cis-regulatory module (CRM) discovery in Drosophila can be used effectively in highly diverged (250-350 Myr) insect species including Anopheles gambiae, Tribolium castaneum, Apis mellifera, and Nasonia vitripennis. In Drosophila, we have successfully used small sets of known CRMs as "training data" to guide the search for other CRMs with related function. We show here that although species-specific CRM training data do not exist, training sets from Drosophila can facilitate CRM discovery in diverged insects. We validate in vivo over a dozen new CRMs, roughly doubling the number of known CRMs in the four non-Drosophila species. Given the growing wealth of Drosophila CRM annotation, these results suggest that extensive regulatory sequence annotation will be possible in newly sequenced insects without recourse to costly and labor-intensive genome-scale experiments. We develop a new method, Regulus, which computes a probabilistic score of similarity based on binding site composition (despite the absence of nucleotide-level sequence alignment), and demonstrate similarity between functionally related CRMs from orthologous loci. Our work represents an important step toward being able to trace the evolutionary history of gene regulatory networks and defining the mechanisms underlying insect evolution. © The Author(s) 2014. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.
Snelling, Timothy J; Genç, Buğra; McKain, Nest; Watson, Mick; Waters, Sinéad M; Creevey, Christopher J; Wallace, R John
2014-01-01
Ruminal archaeomes of two mature sheep grazing in the Scottish uplands were analysed by different sequencing and analysis methods in order to compare the apparent archaeal communities. All methods revealed that the majority of methanogens belonged to the Methanobacteriales order containing the Methanobrevibacter, Methanosphaera and Methanobacteria genera. Sanger sequenced 1.3 kb 16S rRNA gene amplicons identified the main species of Methanobrevibacter present to be a SGMT Clade member Mbb. millerae (≥ 91% of OTUs); Methanosphaera comprised the remainder of the OTUs. The primers did not amplify ruminal Thermoplasmatales-related 16S rRNA genes. Illumina sequenced V6-V8 16S rRNA gene amplicons identified similar Methanobrevibacter spp. and Methanosphaera clades and also identified the Thermoplasmatales-related order as 13% of total archaea. Unusually, both methods concluded that Mbb. ruminantium and relatives from the same clade (RO) were almost absent. Sequences mapping to rumen 16S rRNA and mcrA gene references were extracted from Illumina metagenome data. Mapping of the metagenome data to 16S rRNA gene references produced taxonomic identification to Order level including 2-3% Thermoplasmatales, but was unable to discriminate to species level. Mapping of the metagenome data to mcrA gene references resolved 69% to unclassified Methanobacteriales. Only 30% of sequences were assigned to species level clades: of the sequences assigned to Methanobrevibacter, most mapped to SGMT (16%) and RO (10%) clades. The Sanger 16S amplicon and Illumina metagenome mcrA analyses showed similar species richness (Chao1 Index 19-35), while Illumina metagenome and amplicon 16S rRNA analysis gave lower richness estimates (10-18). The values of the Shannon Index were low in all methods, indicating low richness and uneven species distribution. Thus, although much information may be extracted from the other methods, Illumina amplicon sequencing of the V6-V8 16S rRNA gene would be the method of choice for studying rumen archaeal communities.
Ekanayake, Saliya; Ruan, Yang; Schütte, Ursel M. E.; Kaonongbua, Wittaya; Fox, Geoffrey; Ye, Yuzhen; Bever, James D.
2016-01-01
ABSTRACT Arbuscular mycorrhizal (AM) fungi form mutualisms with plant roots that increase plant growth and shape plant communities. Each AM fungal cell contains a large amount of genetic diversity, but it is unclear if this diversity varies across evolutionary lineages. We found that sequence variation in the nuclear large-subunit (LSU) rRNA gene from 29 isolates representing 21 AM fungal species generally assorted into genus- and species-level clades, with the exception of species of the genera Claroideoglomus and Entrophospora. However, there were significant differences in the levels of sequence variation across the phylogeny and between genera, indicating that it is an evolutionarily constrained trait in AM fungi. These consistent patterns of sequence variation across both phylogenetic and taxonomic groups pose challenges to interpreting operational taxonomic units (OTUs) as approximations of species-level groups of AM fungi. We demonstrate that the OTUs produced by five sequence clustering methods using 97% or equivalent sequence similarity thresholds failed to match the expected species of AM fungi, although OTUs from AbundantOTU, CD-HIT-OTU, and CROP corresponded better to species than did OTUs from mothur or UPARSE. This lack of OTU-to-species correspondence resulted both from sequences of one species being split into multiple OTUs and from sequences of multiple species being lumped into the same OTU. The OTU richness therefore will not reliably correspond to the AM fungal species richness in environmental samples. Conservatively, this error can overestimate species richness by 4-fold or underestimate richness by one-half, and the direction of this error will depend on the genera represented in the sample. IMPORTANCE Arbuscular mycorrhizal (AM) fungi form important mutualisms with the roots of most plant species. Individual AM fungi are genetically diverse, but it is unclear whether the level of this diversity differs among evolutionary lineages. We found that the amount of sequence variation in an rRNA gene that is commonly used to identify AM fungal species varied significantly between evolutionary groups that correspond to different genera, with the exception of two genera that are genetically indistinguishable from each other. When we clustered groups of similar sequences into operational taxonomic units (OTUs) using five different clustering methods, these patterns of sequence variation caused the number of OTUs to either over- or underestimate the actual number of AM fungal species, depending on the genus. Our results indicate that OTU-based inferences about AM fungal species composition from environmental sequences can be improved if they take these taxonomically structured patterns of sequence variation into account. PMID:27260357
Genomic and molecular analysis of phage CMP1 from Clavibacter michiganensis subspecies michiganensis
Wittmann, Johannes; Gartemann, Karl-Heinz; Eichenlaub, Rudolf
2011-01-01
Bacteriophage CMP1 is a member of the Siphoviridae family that infects specifically the plant-pathogen Clavibacter michiganensis subsp. michiganensis. The linear double- stranded DNA is terminally redundant and not circularly permuted. The complete nucleotide sequence of the bacteriophage CMP1 genome consists of 58,652 bp including the terminal redundant ends of 791 bp. The G+C content of the phage (57%) is significantly lower than that of its host (72.66%). 74 potential open reading frames were identified and annotated by different bioinformatic tools. Two large clusters which encode the early and the late functions could be identified which are divergently transcribed. There are only a few hypothetical gene products with conserved domains and significant similarity to sequences from the databases. Functional analyses confirmed the activity of four gene products, an endonuclease, an exonuclease, a single-stranded DNA binding protein and a thymidylate synthase. Partial genomic sequences of CN77, a phage of Clavibacter michiganensis subsp. nebraskensis, revealed a similar genome structure and significant similarities on the level of deduced amino acid sequences. An endolysin with peptidase activity has been identified for both phages, which may be good tools for disease control of tomato plants against Clavibacter infections. PMID:21687530
Wittmann, Johannes; Gartemann, Karl-Heinz; Eichenlaub, Rudolf; Dreiseikelmann, Brigitte
2011-01-01
Bacteriophage CMP1 is a member of the Siphoviridae family that infects specifically the plant-pathogen Clavibacter michiganensis subsp. michiganensis. The linear double- stranded DNA is terminally redundant and not circularly permuted. The complete nucleotide sequence of the bacteriophage CMP1 genome consists of 58,652 bp including the terminal redundant ends of 791 bp. The G+C content of the phage (57%) is significantly lower than that of its host (72.66%). 74 potential open reading frames were identified and annotated by different bioinformatic tools. Two large clusters which encode the early and the late functions could be identified which are divergently transcribed. There are only a few hypothetical gene products with conserved domains and significant similarity to sequences from the databases. Functional analyses confirmed the activity of four gene products, an endonuclease, an exonuclease, a single-stranded DNA binding protein and a thymidylate synthase. Partial genomic sequences of CN77, a phage of Clavibacter michiganensis subsp. nebraskensis, revealed a similar genome structure and significant similarities on the level of deduced amino acid sequences. An endolysin with peptidase activity has been identified for both phages, which may be good tools for disease control of tomato plants against Clavibacter infections.
van den Berg, M; Verbaarschot, P; Hontelez, S; Vet, L E M; Dicke, M; Smid, H M
2010-06-01
The cAMP/PKA signalling pathway and transcription factor cAMP response element-binding protein (CREB) play key roles in long-term memory (LTM) formation. We used two closely related parasitic wasp species, Cotesia glomerata and Cotesia rubecula, which were previously shown to be different in LTM formation, and sequenced at least nine different CREB transcripts in both wasp species. The splicing patterns, functional domains and amino acid sequences were similar to those found in the CREB genes of other organisms. The predicted amino acid sequences of the CREB isoforms were identical in both wasp species. Using real-time quantitative PCR we found that two low abundant CREB transcripts are differentially expressed in the two wasps, whereas the expression levels of high abundant transcripts are similar.
Mycofier: a new machine learning-based classifier for fungal ITS sequences.
Delgado-Serrano, Luisa; Restrepo, Silvia; Bustos, Jose Ricardo; Zambrano, Maria Mercedes; Anzola, Juan Manuel
2016-08-11
The taxonomic and phylogenetic classification based on sequence analysis of the ITS1 genomic region has become a crucial component of fungal ecology and diversity studies. Nowadays, there is no accurate alignment-free classification tool for fungal ITS1 sequences for large environmental surveys. This study describes the development of a machine learning-based classifier for the taxonomical assignment of fungal ITS1 sequences at the genus level. A fungal ITS1 sequence database was built using curated data. Training and test sets were generated from it. A Naïve Bayesian classifier was built using features from the primary sequence with an accuracy of 87 % in the classification at the genus level. The final model was based on a Naïve Bayes algorithm using ITS1 sequences from 510 fungal genera. This classifier, denoted as Mycofier, provides similar classification accuracy compared to BLASTN, but the database used for the classification contains curated data and the tool, independent of alignment, is more efficient and contributes to the field, given the lack of an accurate classification tool for large data from fungal ITS1 sequences. The software and source code for Mycofier are freely available at https://github.com/ldelgado-serrano/mycofier.git .
Jangid, Kamlesh; Kao, Ming-Hung; Lahamge, Aishwarya; Williams, Mark A; Rathbun, Stephen L; Whitman, William B
2016-01-01
K-shuff is a new algorithm for comparing the similarity of gene sequence libraries, providing measures of the structural and compositional diversity as well as the significance of the differences between these measures. Inspired by Ripley's K-function for spatial point pattern analysis, the Intra K-function or IKF measures the structural diversity, including both the richness and overall similarity of the sequences, within a library. The Cross K-function or CKF measures the compositional diversity between gene libraries, reflecting both the number of OTUs shared as well as the overall similarity in OTUs. A Monte Carlo testing procedure then enables statistical evaluation of both the structural and compositional diversity between gene libraries. For 16S rRNA gene libraries from complex bacterial communities such as those found in seawater, salt marsh sediments, and soils, K-shuff yields reproducible estimates of structural and compositional diversity with libraries greater than 50 sequences. Similarly, for pyrosequencing libraries generated from a glacial retreat chronosequence and Illumina® libraries generated from US homes, K-shuff required >300 and 100 sequences per sample, respectively. Power analyses demonstrated that K-shuff is sensitive to small differences in Sanger or Illumina® libraries. This extra sensitivity of K-shuff enabled examination of compositional differences at much deeper taxonomic levels, such as within abundant OTUs. This is especially useful when comparing communities that are compositionally very similar but functionally different. K-shuff will therefore prove beneficial for conventional microbiome analysis as well as specific hypothesis testing.
Borozan, Ivan; Watt, Stuart; Ferretti, Vincent
2015-05-01
Alignment-based sequence similarity searches, while accurate for some type of sequences, can produce incorrect results when used on more divergent but functionally related sequences that have undergone the sequence rearrangements observed in many bacterial and viral genomes. Here, we propose a classification model that exploits the complementary nature of alignment-based and alignment-free similarity measures with the aim to improve the accuracy with which DNA and protein sequences are characterized. Our model classifies sequences using a combined sequence similarity score calculated by adaptively weighting the contribution of different sequence similarity measures. Weights are determined independently for each sequence in the test set and reflect the discriminatory ability of individual similarity measures in the training set. Because the similarity between some sequences is determined more accurately with one type of measure rather than another, our classifier allows different sets of weights to be associated with different sequences. Using five different similarity measures, we show that our model significantly improves the classification accuracy over the current composition- and alignment-based models, when predicting the taxonomic lineage for both short viral sequence fragments and complete viral sequences. We also show that our model can be used effectively for the classification of reads from a real metagenome dataset as well as protein sequences. All the datasets and the code used in this study are freely available at https://collaborators.oicr.on.ca/vferretti/borozan_csss/csss.html. ivan.borozan@gmail.com Supplementary data are available at Bioinformatics online. © The Author 2015. Published by Oxford University Press.
Borozan, Ivan; Watt, Stuart; Ferretti, Vincent
2015-01-01
Motivation: Alignment-based sequence similarity searches, while accurate for some type of sequences, can produce incorrect results when used on more divergent but functionally related sequences that have undergone the sequence rearrangements observed in many bacterial and viral genomes. Here, we propose a classification model that exploits the complementary nature of alignment-based and alignment-free similarity measures with the aim to improve the accuracy with which DNA and protein sequences are characterized. Results: Our model classifies sequences using a combined sequence similarity score calculated by adaptively weighting the contribution of different sequence similarity measures. Weights are determined independently for each sequence in the test set and reflect the discriminatory ability of individual similarity measures in the training set. Because the similarity between some sequences is determined more accurately with one type of measure rather than another, our classifier allows different sets of weights to be associated with different sequences. Using five different similarity measures, we show that our model significantly improves the classification accuracy over the current composition- and alignment-based models, when predicting the taxonomic lineage for both short viral sequence fragments and complete viral sequences. We also show that our model can be used effectively for the classification of reads from a real metagenome dataset as well as protein sequences. Availability and implementation: All the datasets and the code used in this study are freely available at https://collaborators.oicr.on.ca/vferretti/borozan_csss/csss.html. Contact: ivan.borozan@gmail.com Supplementary information: Supplementary data are available at Bioinformatics online. PMID:25573913
Clifford, Jacob; Adami, Christoph
2015-09-02
Transcription factor binding to the surface of DNA regulatory regions is one of the primary causes of regulating gene expression levels. A probabilistic approach to model protein-DNA interactions at the sequence level is through position weight matrices (PWMs) that estimate the joint probability of a DNA binding site sequence by assuming positional independence within the DNA sequence. Here we construct conditional PWMs that depend on the motif signatures in the flanking DNA sequence, by conditioning known binding site loci on the presence or absence of additional binding sites in the flanking sequence of each site's locus. Pooling known sites with similar flanking sequence patterns allows for the estimation of the conditional distribution function over the binding site sequences. We apply our model to the Dorsal transcription factor binding sites active in patterning the Dorsal-Ventral axis of Drosophila development. We find that those binding sites that cooperate with nearby Twist sites on average contain about 0.5 bits of information about the presence of Twist transcription factor binding sites in the flanking sequence. We also find that Dorsal binding site detectors conditioned on flanking sequence information make better predictions about what is a Dorsal site relative to background DNA than detection without information about flanking sequence features.
NASA Technical Reports Server (NTRS)
Brandstatter, I.; Kieber, J. J.; Evans, M. L. (Principal Investigator)
1998-01-01
Cytokinins are central regulators of plant growth and development, but little is known about their mode of action. By using differential display, we identified a gene, IBC6 (for induced by cytokinin), from etiolated Arabidopsis seedlings, that is induced rapidly by cytokinin. The steady state level of IBC6 mRNA was elevated within 10 min by the exogenous application of cytokinin, and this induction did not require de novo protein synthesis. IBC6 was not induced by other plant hormones or by light. A second Arabidopsis gene with a sequence highly similar to IBC6 was identified. This IBC7 gene also was induced by cytokinin, although with somewhat slower kinetics and to a lesser extent. The pattern of expression of the two genes was similar, with higher expression in leaves, rachises, and flowers and lower transcript levels in roots and siliques. Sequence analysis revealed that IBC6 and IBC7 are similar to the receiver domain of bacterial two-component response regulators. This homology, coupled with previously published work on the CKI1 histidine kinase homolog, suggests that these proteins may play a role in early cytokinin signaling.
NASA Astrophysics Data System (ADS)
Leray, M.; Boehm, J. T.; Mills, S. C.; Meyer, C. P.
2012-06-01
Identifying species involved in consumer-resource interactions is one of the main limitations in the construction of food webs. DNA barcoding of prey items in predator guts provides a valuable tool for characterizing trophic interactions, but the method relies on the availability of reference sequences to which prey sequences can be matched. In this study, we demonstrate that the COI sequence library of the Moorea BIOCODE project, an ecosystem-level barcode initiative, enables the identification of a large proportion of semi-digested fish, crustacean and mollusks found in the guts of three Hawkfish and two Squirrelfish species. While most prey remains lacked diagnostic morphological characters, 94% of the prey found in 67 fishes had >98% sequence similarity with BIOCODE reference sequences. Using this species-level prey identification, we demonstrate how DNA barcoding can provide insights into resource partitioning, predator feeding behaviors and the consequences of predation on ecosystem function.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hwang, Chiachi; Wu, Weimin; Gentry, Terry J.
2009-05-22
Bacterial community succession was investigated in a field-scale subsurface reactor formed by a series of wells that received weekly ethanol additions to re-circulating groundwater. Ethanol additions stimulated denitrification, metal reduction, sulfate reduction, and U(VI) reduction to sparingly soluble U(IV). Clone libraries of SSU rRNA gene sequences from groundwater samples enabled tracking of spatial and temporal changes over a 1.5 y period. Analyses showed that the communities changed in a manner consistent with geochemical variations that occurred along temporal and spatial scales. Canonical correspondence analysis revealed that the levels of nitrate, uranium, sulfide, sulfate, and ethanol strongly correlated with particular bacterialmore » populations. As sulfate and U(VI) levels declined, sequences representative of sulfate-reducers and metal-reducers were detected at high levels. Ultimately, sequences associated with sulfate-reducing populations predominated, and sulfate levels declined as U(VI) remained at low levels. When engineering controls were compared to the population variation via canonical ordination, changes could be related to dissolved oxygen control and ethanol addition. The data also indicated that the indigenous populations responded differently to stimulation for bio-reduction; however, the two bio-stimulated communities became more similar after different transitions in an idiosyncratic manner. The strong associations between particular environmental variables and certain populations provide insight into the establishment of practical and successful remediation strategies in radionuclide-contaminated environments with respect to engineering controls and microbial ecology.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wu, Liyou; Yi, T. Y.; Van Nostrand, Joy
Phylogenetic analyses were done for the Shewanella strains isolated from Baltic Sea (38 strains), US DOE Hanford Uranium bioremediation site [Hanford Reach of the Columbia River (HRCR), 11 strains], Pacific Ocean and Hawaiian sediments (8 strains), and strains from other resources (16 strains) with three out group strains, Rhodopseudomonas palustris, Clostridium cellulolyticum, and Thermoanaerobacter ethanolicus X514, using DNA relatedness derived from WCGA-based DNA-DNA hybridizations, sequence similarities of 16S rRNA gene and gyrB gene, and sequence similarities of 6 loci of Shewanella genome selected from a shared gene list of the Shewanella strains with whole genome sequenced based on the averagemore » nucleotide identity of them (ANI). The phylogenetic trees based on 16S rRNA and gyrB gene sequences, and DNA relatedness derived from WCGA hybridizations of the tested Shewanella strains share exactly the same sub-clusters with very few exceptions, in which the strains were basically grouped by species. However, the phylogenetic analysis based on DNA relatedness derived from WCGA hybridizations dramatically increased the differentiation resolution at species and strains level within Shewanella genus. When the tree based on DNA relatedness derived from WCGA hybridizations was compared to the tree based on the combined sequences of the selected functional genes (6 loci), we found that the resolutions of both methods are similar, but the clustering of the tree based on DNA relatedness derived from WMGA hybridizations was clearer. These results indicate that WCGA-based DNA-DNA hybridization is an idea alternative of conventional DNA-DNA hybridization methods and it is superior to the phylogenetics methods based on sequence similarities of single genes. Detailed analysis is being performed for the re-classification of the strains examined.« less
Dialog detection in narrative video by shot and face analysis
NASA Astrophysics Data System (ADS)
Kroon, B.; Nesvadba, J.; Hanjalic, A.
2007-01-01
The proliferation of captured personal and broadcast content in personal consumer archives necessitates comfortable access to stored audiovisual content. Intuitive retrieval and navigation solutions require however a semantic level that cannot be reached by generic multimedia content analysis alone. A fusion with film grammar rules can help to boost the reliability significantly. The current paper describes the fusion of low-level content analysis cues including face parameters and inter-shot similarities to segment commercial content into film grammar rule-based entities and subsequently classify those sequences into so-called shot reverse shots, i.e. dialog sequences. Moreover shot reverse shot specific mid-level cues are analyzed augmenting the shot reverse shot information with dialog specific descriptions.
Transcriptomics of the Bed Bug (Cimex lectularius)
Rajarapu, Swapna P.; Jones, Susan C.; Mittapalli, Omprakash
2011-01-01
Background Bed bugs (Cimex lectularius) are blood-feeding insects poised to become one of the major pests in households throughout the United States. Resistance of C. lectularius to insecticides/pesticides is one factor thought to be involved in its sudden resurgence. Despite its high-impact status, scant knowledge exists at the genomic level for C. lectularius. Hence, we subjected the C. lectularius transcriptome to 454 pyrosequencing in order to identify potential genes involved in pesticide resistance. Methodology and Principal Findings Using 454 pyrosequencing, we obtained a total of 216,419 reads with 79,596,412 bp, which were assembled into 35,646 expressed sequence tags (3902 contigs and 31744 singletons). Nearly 85.9% of the C. lectularius sequences showed similarity to insect sequences, but 44.8% of the deduced proteins of C. lectularius did not show similarity with sequences in the GenBank non-redundant database. KEGG analysis revealed putative members of several detoxification pathways involved in pesticide resistance. Lamprin domains, Protein Kinase domains, Protein Tyrosine Kinase domains and cytochrome P450 domains were among the top Pfam domains predicted for the C. lectularius sequences. An initial assessment of putative defense genes, including a cytochrome P450 and a glutathione-S-transferase (GST), revealed high transcript levels for the cytochrome P450 (CYP9) in pesticide-exposed versus pesticide-susceptible C. lectularius populations. A significant number of single nucleotide polymorphisms (296) and microsatellite loci (370) were predicted in the C. lectularius sequences. Furthermore, 59 putative sequences of Wolbachia were retrieved from the database. Conclusions To our knowledge this is the first study to elucidate the genetic makeup of C. lectularius. This pyrosequencing effort provides clues to the identification of potential detoxification genes involved in pesticide resistance of C. lectularius and lays the foundation for future functional genomics studies. PMID:21283830
Context and meter enhance long-range planning in music performance
Mathias, Brian; Pfordresher, Peter Q.; Palmer, Caroline
2015-01-01
Neural responses demonstrate evidence of resonance, or oscillation, during the production of periodic auditory events. Music contains periodic auditory events that give rise to a sense of beat, which in turn generates a sense of meter on the basis of multiple periodicities. Metrical hierarchies may aid memory for music by facilitating similarity-based associations among sequence events at different periodic distances that unfold in longer contexts. A fundamental question is how metrical associations arising from a musical context influence memory during music performance. Longer contexts may facilitate metrical associations at higher hierarchical levels more than shorter contexts, a prediction of the range model, a formal model of planning processes in music performance (Palmer and Pfordresher, 2003; Pfordresher et al., 2007). Serial ordering errors, in which intended sequence events are produced in incorrect sequence positions, were measured as skilled pianists performed musical pieces that contained excerpts embedded in long or short musical contexts. Pitch errors arose from metrically similar positions and further sequential distances more often when the excerpt was embedded in long contexts compared to short contexts. Musicians’ keystroke intensities and error rates also revealed influences of metrical hierarchies, which differed for performances in long and short contexts. The range model accounted for contextual effects and provided better fits to empirical findings when metrical associations between sequence events were included. Longer sequence contexts may facilitate planning during sequence production by increasing conceptual similarity between hierarchically associated events. These findings are consistent with the notion that neural oscillations at multiple periodicities may strengthen metrical associations across sequence events during planning. PMID:25628550
Graph pyramids for protein function prediction
2015-01-01
Background Uncovering the hidden organizational characteristics and regularities among biological sequences is the key issue for detailed understanding of an underlying biological phenomenon. Thus pattern recognition from nucleic acid sequences is an important affair for protein function prediction. As proteins from the same family exhibit similar characteristics, homology based approaches predict protein functions via protein classification. But conventional classification approaches mostly rely on the global features by considering only strong protein similarity matches. This leads to significant loss of prediction accuracy. Methods Here we construct the Protein-Protein Similarity (PPS) network, which captures the subtle properties of protein families. The proposed method considers the local as well as the global features, by examining the interactions among 'weakly interacting proteins' in the PPS network and by using hierarchical graph analysis via the graph pyramid. Different underlying properties of the protein families are uncovered by operating the proposed graph based features at various pyramid levels. Results Experimental results on benchmark data sets show that the proposed hierarchical voting algorithm using graph pyramid helps to improve computational efficiency as well the protein classification accuracy. Quantitatively, among 14,086 test sequences, on an average the proposed method misclassified only 21.1 sequences whereas baseline BLAST score based global feature matching method misclassified 362.9 sequences. With each correctly classified test sequence, the fast incremental learning ability of the proposed method further enhances the training model. Thus it has achieved more than 96% protein classification accuracy using only 20% per class training data. PMID:26044522
Graph pyramids for protein function prediction.
Sandhan, Tushar; Yoo, Youngjun; Choi, Jin; Kim, Sun
2015-01-01
Uncovering the hidden organizational characteristics and regularities among biological sequences is the key issue for detailed understanding of an underlying biological phenomenon. Thus pattern recognition from nucleic acid sequences is an important affair for protein function prediction. As proteins from the same family exhibit similar characteristics, homology based approaches predict protein functions via protein classification. But conventional classification approaches mostly rely on the global features by considering only strong protein similarity matches. This leads to significant loss of prediction accuracy. Here we construct the Protein-Protein Similarity (PPS) network, which captures the subtle properties of protein families. The proposed method considers the local as well as the global features, by examining the interactions among 'weakly interacting proteins' in the PPS network and by using hierarchical graph analysis via the graph pyramid. Different underlying properties of the protein families are uncovered by operating the proposed graph based features at various pyramid levels. Experimental results on benchmark data sets show that the proposed hierarchical voting algorithm using graph pyramid helps to improve computational efficiency as well the protein classification accuracy. Quantitatively, among 14,086 test sequences, on an average the proposed method misclassified only 21.1 sequences whereas baseline BLAST score based global feature matching method misclassified 362.9 sequences. With each correctly classified test sequence, the fast incremental learning ability of the proposed method further enhances the training model. Thus it has achieved more than 96% protein classification accuracy using only 20% per class training data.
cDNA sequences and organization of IgM heavy chain genes in two holostean fish.
Wilson, M R; van Ravenstein, E; Miller, N W; Clem, L W; Middleton, D L; Warr, G W
1995-01-01
Immunoglobulin M heavy chain (mu) sequences of two holostean fish, the bowfin, Amia calva, and the longnose gar, Lepisosteus osseus, were amplified from spleen mRNA by RACE-PCR, cloned, and sequenced. Each mu chain showed the conserved four constant domain structure typical of a secreted mu chain. Southern blot analyses with specific heavy chain variable (VH) and constant (CH) region probes suggest that both fish possess an IgH locus that resembles that of the teleosts, amphibians, and mammals in its organization. The overall sequence similarity of gar and bowfin mu chains was 60% and 48% at the nucleotide and amino acid levels, respectively, while similarity to the mu chains of teleosts and elasmobranchs was lower. The bowfin mu chain possesses a distinctive proline-rich sequence at the C mu 1/C mu 2 boundary; a shorter proline-rich sequence is present at this position in the gar mu chain. Both gar and bowfin show, in their C mu 4 sequences, motifs that could serve as cryptic splice donor sites for the production of mRNA encoding the membrane-bound form of the mu chains, and the bowfin also shows a potential cryptic splice donor site in the C mu 3 exon.
Kaplan, Oktay I; Berber, Burak; Hekim, Nezih; Doluca, Osman
2016-11-02
Many studies show that short non-coding sequences are widely conserved among regulatory elements. More and more conserved sequences are being discovered since the development of next generation sequencing technology. A common approach to identify conserved sequences with regulatory roles relies on topological changes such as hairpin formation at the DNA or RNA level. G-quadruplexes, non-canonical nucleic acid topologies with little established biological roles, are increasingly considered for conserved regulatory element discovery. Since the tertiary structure of G-quadruplexes is strongly dependent on the loop sequence which is disregarded by the generally accepted algorithm, we hypothesized that G-quadruplexes with similar topology and, indirectly, similar interaction patterns, can be determined using phylogenetic clustering based on differences in the loop sequences. Phylogenetic analysis of 52 G-quadruplex forming sequences in the Escherichia coli genome revealed two conserved G-quadruplex motifs with a potential regulatory role. Further analysis revealed that both motifs tend to form hairpins and G quadruplexes, as supported by circular dichroism studies. The phylogenetic analysis as described in this work can greatly improve the discovery of functional G-quadruplex structures and may explain unknown regulatory patterns. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.
Nishizawa, M; Nishizawa, K
2000-10-01
The tendency for repetitiveness of nucleotides in DNA sequences has been reported for a variety of organisms. We show that the tendency for repetitive use of amino acids is widespread and is observed even for segments conserved between human and Drosophila melanogaster at the level of >50% amino acid identity. This indicates that repetitiveness influences not only the weakly constrained segments but also those sequence segments conserved among phyla. Not only glutamine (Q) but also many of the 20 amino acids show a comparable level of repetitiveness. Repetitiveness in bases at codon position 3 is stronger for human than for D.melanogaster, whereas local repetitiveness in intron sequences is similar between the two organisms. While genes for immune system-specific proteins, but not ancient human genes (i.e. human homologs of Escherichia coli genes), have repetitiveness at codon bases 1 and 2, repetitiveness at codon base 3 for these groups is similar, suggesting that the human genome has at least two mechanisms generating local repetitiveness. Neither amino acid nor nucleotide repetitiveness is observed beyond the exon boundary, denying the possibility that such repetitiveness could mainly stem from natural selection on mRNA or protein sequences. Analyses of mammalian sequence alignments show that while the 'between gene' GC content heterogeneity, which is linked to 'isochores', is a principal factor associated with the bias in substitution patterns in human, 'within gene' heterogeneity in nucleotide composition is also associated with such bias on a more local scale. The relationship amongst the various types of repetitiveness is discussed.
Nishizawa, Manami; Nishizawa, Kazuhisa
2000-01-01
The tendency for repetitiveness of nucleotides in DNA sequences has been reported for a variety of organisms. We show that the tendency for repetitive use of amino acids is widespread and is observed even for segments conserved between human and Drosophila melanogaster at the level of >50% amino acid identity. This indicates that repetitiveness influences not only the weakly constrained segments but also those sequence segments conserved among phyla. Not only glutamine (Q) but also many of the 20 amino acids show a comparable level of repetitiveness. Repetitiveness in bases at codon position 3 is stronger for human than for D.melanogaster, whereas local repetitiveness in intron sequences is similar between the two organisms. While genes for immune system-specific proteins, but not ancient human genes (i.e. human homologs of Escherichia coli genes), have repetitiveness at codon bases 1 and 2, repetitiveness at codon base 3 for these groups is similar, suggesting that the human genome has at least two mechanisms generating local repetitiveness. Neither amino acid nor nucleotide repetitiveness is observed beyond the exon boundary, denying the possibility that such repetitiveness could mainly stem from natural selection on mRNA or protein sequences. Analyses of mammalian sequence alignments show that while the ‘between gene’ GC content heterogeneity, which is linked to ‘isochores’, is a principal factor associated with the bias in substitution patterns in human, ‘within gene’ heterogeneity in nucleotide composition is also associated with such bias on a more local scale. The relationship amongst the various types of repetitiveness is discussed. PMID:11000273
How good are indirect tests at detecting recombination in human mtDNA?
White, Daniel James; Bryant, David; Gemmell, Neil John
2013-07-08
Empirical proof of human mitochondrial DNA (mtDNA) recombination in somatic tissues was obtained in 2004; however, a lack of irrefutable evidence exists for recombination in human mtDNA at the population level. Our inability to demonstrate convincingly a signal of recombination in population data sets of human mtDNA sequence may be due, in part, to the ineffectiveness of current indirect tests. Previously, we tested some well-established indirect tests of recombination (linkage disequilibrium vs. distance using D' and r(2), Homoplasy Test, Pairwise Homoplasy Index, Neighborhood Similarity Score, and Max χ(2)) on sequence data derived from the only empirically confirmed case of human mtDNA recombination thus far and demonstrated that some methods were unable to detect recombination. Here, we assess the performance of these six well-established tests and explore what characteristics specific to human mtDNA sequence may affect their efficacy by simulating sequence under various parameters with levels of recombination (ρ) that vary around an empirically derived estimate for human mtDNA (population parameter ρ = 5.492). No test performed infallibly under any of our scenarios, and error rates varied across tests, whereas detection rates increased substantially with ρ values > 5.492. Under a model of evolution that incorporates parameters specific to human mtDNA, including rate heterogeneity, population expansion, and ρ = 5.492, successful detection rates are limited to a range of 7-70% across tests with an acceptable level of false-positive results: the neighborhood similarity score incompatibility test performed best overall under these parameters. Population growth seems to have the greatest impact on recombination detection probabilities across all models tested, likely due to its impact on sequence diversity. The implications of our findings on our current understanding of mtDNA recombination in humans are discussed.
How Good Are Indirect Tests at Detecting Recombination in Human mtDNA?
White, Daniel James; Bryant, David; Gemmell, Neil John
2013-01-01
Empirical proof of human mitochondrial DNA (mtDNA) recombination in somatic tissues was obtained in 2004; however, a lack of irrefutable evidence exists for recombination in human mtDNA at the population level. Our inability to demonstrate convincingly a signal of recombination in population data sets of human mtDNA sequence may be due, in part, to the ineffectiveness of current indirect tests. Previously, we tested some well-established indirect tests of recombination (linkage disequilibrium vs. distance using D′ and r2, Homoplasy Test, Pairwise Homoplasy Index, Neighborhood Similarity Score, and Max χ2) on sequence data derived from the only empirically confirmed case of human mtDNA recombination thus far and demonstrated that some methods were unable to detect recombination. Here, we assess the performance of these six well-established tests and explore what characteristics specific to human mtDNA sequence may affect their efficacy by simulating sequence under various parameters with levels of recombination (ρ) that vary around an empirically derived estimate for human mtDNA (population parameter ρ = 5.492). No test performed infallibly under any of our scenarios, and error rates varied across tests, whereas detection rates increased substantially with ρ values > 5.492. Under a model of evolution that incorporates parameters specific to human mtDNA, including rate heterogeneity, population expansion, and ρ = 5.492, successful detection rates are limited to a range of 7−70% across tests with an acceptable level of false-positive results: the neighborhood similarity score incompatibility test performed best overall under these parameters. Population growth seems to have the greatest impact on recombination detection probabilities across all models tested, likely due to its impact on sequence diversity. The implications of our findings on our current understanding of mtDNA recombination in humans are discussed. PMID:23665874
Random whole metagenomic sequencing for forensic discrimination of soils.
Khodakova, Anastasia S; Smith, Renee J; Burgoyne, Leigh; Abarno, Damien; Linacre, Adrian
2014-01-01
Here we assess the ability of random whole metagenomic sequencing approaches to discriminate between similar soils from two geographically distinct urban sites for application in forensic science. Repeat samples from two parklands in residential areas separated by approximately 3 km were collected and the DNA was extracted. Shotgun, whole genome amplification (WGA) and single arbitrarily primed DNA amplification (AP-PCR) based sequencing techniques were then used to generate soil metagenomic profiles. Full and subsampled metagenomic datasets were then annotated against M5NR/M5RNA (taxonomic classification) and SEED Subsystems (metabolic classification) databases. Further comparative analyses were performed using a number of statistical tools including: hierarchical agglomerative clustering (CLUSTER); similarity profile analysis (SIMPROF); non-metric multidimensional scaling (NMDS); and canonical analysis of principal coordinates (CAP) at all major levels of taxonomic and metabolic classification. Our data showed that shotgun and WGA-based approaches generated highly similar metagenomic profiles for the soil samples such that the soil samples could not be distinguished accurately. An AP-PCR based approach was shown to be successful at obtaining reproducible site-specific metagenomic DNA profiles, which in turn were employed for successful discrimination of visually similar soil samples collected from two different locations.
Gonzalez, P; Barroso, G; Labarère, J
1998-10-05
The Basidiomycota Agrocybe aegerita (Aa) mitochondrial cox1 gene (6790 nucleotides), encoding a protein of 527aa (58377Da), is split by four large subgroup IB introns possessing site-specific endonucleases assumed to be involved in intron mobility. When compared to other fungal COX1 proteins, the Aa protein is closely related to the COX1 one of the Basidiomycota Schizophyllum commune (Sc). This clade reveals a relationship with the studied Ascomycota ones, with the exception of Schizosaccharomyces pombe (Sp) which ranges in an out-group position compared with both higher fungi divisions. When comparison is extended to other kingdoms, fungal COX1 sequences are found to be more related to algae and plant ones (more than 57.5% aa similarity) than to animal sequences (53.6% aa similarity), contrasting with the previously established close relationship between fungi and animals, based on comparisons of nuclear genes. The four Aa cox1 introns are homologous to Ascomycota or algae cox1 introns sharing the same location within the exonic sequences. The percentages of identity of the intronic nucleotide sequences suggest a possible acquisition by lateral transfers of ancestral copies or of their derived sequences. These identities extend over the whole intronic sequences, arguing in favor of a transfer of the complete intron rather than a transfer limited to the encoded ORF. The intron i4 shares 74% of identity, at the nucleotidic level, with the Podospora anserina (Pa) intron i14, and up to 90.5% of aa similarity between the encoded proteins, i.e. the highest values reported to date between introns of two phylogenetically distant species. This low divergence argues for a recent lateral transfer between the two species. On the contrary, the low sequence identities (below 36%) observed between Aa i1 and the homologous Sp i1 or Prototheca wickeramii (Pw) i1 suggest a long evolution time after the separation of these sequences. The introns i2 and i3 possessed intermediate percentages of identity with their homologous Ascomycota introns. This is the first report of the complete nucleotide sequence and molecular organization of a mitochondrial cox1 gene of any member of the Basidiomycota division.
Yom Din, S; Hurvitz, A; Goldberg, D; Jackson, K; Levavi-Sivan, B; Degani, G
2008-03-01
In this study, the GH and IGF-I of the Russian sturgeon (rs), Acipenser gueldenstaedtii, were cloned and sequenced, and their mRNA gene expression determined. In addition, to improve our understanding of the GH function, the expression of this hormone was assessed in young males and females. Moreover, IGF-I expression was quantified in young males and compared to that in older ones. The nucleotide sequence of the rsGH cDNA was 980 bp long and had an open reading frame of 642 bp, beginning with the first ATG codon at position 39 and ending with the stop codon at position 683. A putative polyadenylation signal, AATAAA, was recognized 42 bp upstream of the poly (A) tail. The position of the signal- peptide cleavage site was predicted to be at position 111, yielding a signal peptide of 24 amino-acids (aa) and a mature peptide of 190 aa. When the rsGH aa sequence was compared with other species, the highest degree of identity was found to be with mammalians (66-70% identity), followed by anguilliformes and amphibia (61%) and other fish (39-47%). The level of rsGH mRNA was discovered to be similar in pituitaries of females and males of 5 age groups (1, 2, 3, 4, and 5- yr-old). In females and males, the levels did not change dramatically during the first 5 yr of growth. The partial nucleotide sequence of the rsIGF-I was 445 bp long and had an open reading frame of 396 bp, beginning with the ATG codon at position 50. The position of the signal-peptide cleavage site was predicted to be at position 187, yielding a signal peptide of 44 aa. The highest level of IGF-I mRNA expression was recorded in the kidney of adult sturgeons. The IGF-I mRNA expression levels in the intestine, pituitary gland, and liver were not significantly different. Low levels of expression were found in the brain, heart, and muscle. In most tissues, there was no significant difference between mRNA levels of one and 5-yr-old fish. In conclusion, based on the GH-sequence analysis, A. gueldenstaedtii is genetically distant from other teleosts. The expression of the GH mRNA was similar in males and females, and its level remained constant during the first 5 yr of growth. While the IGF-I mRNA expression differed amongst various tissues, the level in each tissue was similar in 1 and 5-yr-old fish.
A generalized global alignment algorithm.
Huang, Xiaoqiu; Chao, Kun-Mao
2003-01-22
Homologous sequences are sometimes similar over some regions but different over other regions. Homologous sequences have a much lower global similarity if the different regions are much longer than the similar regions. We present a generalized global alignment algorithm for comparing sequences with intermittent similarities, an ordered list of similar regions separated by different regions. A generalized global alignment model is defined to handle sequences with intermittent similarities. A dynamic programming algorithm is designed to compute an optimal general alignment in time proportional to the product of sequence lengths and in space proportional to the sum of sequence lengths. The algorithm is implemented as a computer program named GAP3 (Global Alignment Program Version 3). The generalized global alignment model is validated by experimental results produced with GAP3 on both DNA and protein sequences. The GAP3 program extends the ability of standard global alignment programs to recognize homologous sequences of lower similarity. The GAP3 program is freely available for academic use at http://bioinformatics.iastate.edu/aat/align/align.html.
Pickard, Mark R.; Williams, Gwyn T.
2016-01-01
Growth arrest-specific 5 (GAS5) lncRNA promotes apoptosis, and its expression is down-regulated in breast cancer. GAS5 lncRNA is a decoy of glucocorticoid/related receptors; a stem-loop sequence constitutes the GAS5 hormone response element mimic (HREM), which is essential for the regulation of breast cancer cell apoptosis. This preclinical study aimed to determine if the GAS5 HREM sequence alone promotes the apoptosis of breast cancer cells. Nucleofection of hormone-sensitive and –insensitive breast cancer cell lines with a GAS5 HREM DNA oligonucleotide increased both basal and ultraviolet-C-induced apoptosis, and decreased culture viability and clonogenic growth, similar to GAS5 lncRNA. The HREM oligonucleotide demonstrated similar sequence specificity to the native HREM for its functional activity and had no effect on endogenous GAS5 lncRNA levels. Certain chemically modified HREM oligonucleotides, notably DNA and RNA phosphorothioates, retained pro-apoptotic. activity. Crucially the HREM oligonucleotide could overcome apoptosis resistance secondary to deficient endogenous GAS5 lncRNA levels. Thus, the GAS5 lncRNA HREM sequence alone is sufficient to induce apoptosis in breast cancer cells, including triple-negative breast cancer cells. These findings further suggest that emerging knowledge of structure/function relationships in the field of lncRNA biology can be exploited for the development of entirely novel, oligonucleotide mimic-based, cancer therapies. PMID:26862727
Kimura, Tomohiro; Nakano, Toshiki; Yamaguchi, Toshiyasu; Sato, Minoru; Ogawa, Tomohisa; Muramoto, Koji; Yokoyama, Takehiko; Kan-No, Nobuhiro; Nagahisa, Eizou; Janssen, Frank; Grieshaber, Manfred K
2004-01-01
The complete complementary DNA sequences of genes presumably coding for opine dehydrogenases from Arabella iricolor (sandworm), Haliotis discus hannai (abalone), and Patinopecten yessoensis (scallop) were determined, and partial cDNA sequences were derived for Meretrix lusoria (Japanese hard clam) and Spisula sachalinensis (Sakhalin surf clam). The primers ODH-9F and ODH-11R proved useful for amplifying the sequences for opine dehydrogenases from the 4 mollusk species investigated in this study. The sequence of the sandworm was obtained using primers constructed from the amino acid sequence of tauropine dehydrogenase, the main opine dehydrogenase in A. iricolor. The complete cDNA sequence of A. iricolor, H. discus hannai, and P. yessoensis encode 397, 400, and 405 amino acids, respectively. All sequences were aligned and compared with published databank sequences of Loligo opalescens, Loligo vulgaris (squid), Sepia officinalis (cuttlefish), and Pecten maximus (scallop). As expected, a high level of homology was observed for the cDNA from closely related species, such as for cephalopods or scallops, whereas cDNA from the other species showed lower-level homologies. A similar trend was observed when the deduced amino acid sequences were compared. Furthermore, alignment of these sequences revealed some structural motifs that are possibly related to the binding sites of the substrates. The phylogenetic trees derived from the nucleotide and amino acid sequences were consistent with the classification of species resulting from classical taxonomic analyses.
De Pittà, Cristiano; Bertolucci, Cristiano; Mazzotta, Gabriella M; Bernante, Filippo; Rizzo, Giorgia; De Nardi, Barbara; Pallavicini, Alberto; Lanfranchi, Gerolamo; Costa, Rodolfo
2008-01-01
Background Little is known about the genome sequences of Euphausiacea (krill) although these crustaceans are abundant components of the pelagic ecosystems in all oceans and used for aquaculture and pharmaceutical industry. This study reports the results of an expressed sequence tag (EST) sequencing project from different tissues of Euphausia superba (the Antarctic krill). Results We have constructed and sequenced five cDNA libraries from different Antarctic krill tissues: head, abdomen, thoracopods and photophores. We have identified 1.770 high-quality ESTs which were assembled into 216 overlapping clusters and 801 singletons resulting in a total of 1.017 non-redundant sequences. Quantitative RT-PCR analysis was performed to quantify and validate the expression levels of ten genes presenting different EST countings in krill tissues. In addition, bioinformatic screening of the non-redundant E. superba sequences identified 69 microsatellite containing ESTs. Clusters, consensuses and related similarity and gene ontology searches were organized in a dedicated E. superba database . Conclusion We defined the first tissue transcriptional signatures of E. superba based on functional categorization among the examined tissues. The analyses of annotated transcripts showed a higher similarity with genes from insects with respect to Malacostraca possibly as an effect of the limited number of Malacostraca sequences in the public databases. Our catalogue provides for the first time a genomic tool to investigate the biology of the Antarctic krill. PMID:18226200
Detection and characterization of hepatitis A virus circulating in Egypt.
Hamza, Hazem; Abd-Elshafy, Dina Nadeem; Fayed, Sayed A; Bahgat, Mahmoud Mohamed; El-Esnawy, Nagwa Abass; Abdel-Mobdy, Emam
2017-07-01
Hepatitis A virus (HAV) still poses a considerable problem worldwide. In the current study, hepatitis A virus was recovered from wastewater samples collected from three wastewater treatment plants over one year. Using RT-PCR, HAV was detected in 43 out of 68 samples (63.2%) representing both inlet and outlet. Eleven positive samples were subjected to sequencing targeting the VP1-2A junction region. Phylogenetic analysis revealed that all samples belonged to subgenotype IB with few substitutions at the amino acid level. The complete sequence of one isolate (HAV/Egy/BI-11/2015) showed that the similarity at the amino acid level was not reflected at the nucleotide level. However, the deduced amino acid sequence derived from the complete nucleotide sequence showed distinct substitutions in the 2B, 2C, and 3A regions. Recombination analysis revealed a recombination event between X75215 (subgenotype IA) and AF268396 (subgenotype IB) involving a portion of the 2B nonstructural protein coding region (nucleotides 3757-3868) assuming the herein characterized sequence an actual recombinant. Despite the role of recombination in picornaviruses evolution, its involvement in HAV evolution has rarely been reported, and this may be due to the limited available complete HAV sequences. To our knowledge, this represents the first characterized complete sequence of an Egyptian isolate and the described recombination event provides an important update on the circulating HAV strains in Egypt.
Sequence-similar, structure-dissimilar protein pairs in the PDB.
Kosloff, Mickey; Kolodny, Rachel
2008-05-01
It is often assumed that in the Protein Data Bank (PDB), two proteins with similar sequences will also have similar structures. Accordingly, it has proved useful to develop subsets of the PDB from which "redundant" structures have been removed, based on a sequence-based criterion for similarity. Similarly, when predicting protein structure using homology modeling, if a template structure for modeling a target sequence is selected by sequence alone, this implicitly assumes that all sequence-similar templates are equivalent. Here, we show that this assumption is often not correct and that standard approaches to create subsets of the PDB can lead to the loss of structurally and functionally important information. We have carried out sequence-based structural superpositions and geometry-based structural alignments of a large number of protein pairs to determine the extent to which sequence similarity ensures structural similarity. We find many examples where two proteins that are similar in sequence have structures that differ significantly from one another. The source of the structural differences usually has a functional basis. The number of such proteins pairs that are identified and the magnitude of the dissimilarity depend on the approach that is used to calculate the differences; in particular sequence-based structure superpositioning will identify a larger number of structurally dissimilar pairs than geometry-based structural alignments. When two sequences can be aligned in a statistically meaningful way, sequence-based structural superpositioning provides a meaningful measure of structural differences. This approach and geometry-based structure alignments reveal somewhat different information and one or the other might be preferable in a given application. Our results suggest that in some cases, notably homology modeling, the common use of nonredundant datasets, culled from the PDB based on sequence, may mask important structural and functional information. We have established a data base of sequence-similar, structurally dissimilar protein pairs that will help address this problem (http://luna.bioc.columbia.edu/rachel/seqsimstrdiff.htm).
[Molecular identification of medicinal plant genus Uncaria in Guizhou].
Gang, Tao; Liu, Tao; Zhu, Ying; Liu, Zuo-Yi
2008-06-01
To analyze rDNA ITS regions of the Medicinal Plant Genus Uncaria in Guizhou and construct their phylogenetic tree in order to supply molecular evidence of taxonomy and identification of these Medicinal Plants in genetic level. The ITS gene fragments of the 4 Medicinal Plants were PCR amplified and sequenced. The rDNA ITS regions were analyzed by means of the software of ClustalX, BioEdit and PAUP* 4.0 beta 10. The entire sequences of rDNA ITS1, ITS2, and 5.8S rDNA were obtained, The Maximum-parsimony tree of four ITS regions together with those of similar sequences from GenBank were found, as Mitrayna rubrostipulata (AJ492621 ) and Mitragyna rubrostipulata (AJ605988) were designated as outgroup. The 4 medicinal plants are the 4 species in the genus Uncaria, and are mostly similar to the Uncaria rhynhcophylla.
de Mio, Giuliano; Giacheti, Heraldo L
2007-03-01
Correlations between mapping units of costal sedimentary basin and interpretation of piezocone test results are presented and discussed based on examples from Caravelas strandplain, (State of Bahia), Paranaguá (State of Paraná) and Guarujá bays (State of São Paulo), Brazil. Recognizing that the sedimentary environment was mainly controlled by sea level fluctuations led to the interpretation of transgressive and regressive sedimentary sequences, which is in a good agreement with the sea level fluctuation curves currently accepted for these regions. The interpretation of piezocone test results shows that the sedimentary sequences of Caravelas and Guarujá sites are similar and they have a good correlation to the sea level fluctuation curve accepted for Salvador region, State of Bahia. On the other hand, the piezocone test results from Paranaguá site indicate a different sedimentary sequence from the previous ones, relating to the sea level fluctuation curve accepted for Paranaguá region. The results show the high applicability of piezocone testing for stratigraphical logging and suggest that it is possible to integrate it with other current techniques used for paleo-environmental studies in Brazil, in accordance with recent approaches used in international research on the subject.
Evidence for a lineage of virulent bacteriophages that target Campylobacter.
Timms, Andrew R; Cambray-Young, Joanna; Scott, Andrew E; Petty, Nicola K; Connerton, Phillippa L; Clarke, Louise; Seeger, Kathy; Quail, Mike; Cummings, Nicola; Maskell, Duncan J; Thomson, Nicholas R; Connerton, Ian F
2010-03-30
Our understanding of the dynamics of genome stability versus gene flux within bacteriophage lineages is limited. Recently, there has been a renewed interest in the use of bacteriophages as 'therapeutic' agents; a prerequisite for their use in such therapies is a thorough understanding of their genetic complement, genome stability and their ecology to avoid the dissemination or mobilisation of phage or bacterial virulence and toxin genes. Campylobacter, a food-borne pathogen, is one of the organisms for which the use of bacteriophage is being considered to reduce human exposure to this organism. Sequencing and genome analysis was performed for two Campylobacter bacteriophages. The genomes were extremely similar at the nucleotide level (> or = 96%) with most differences accounted for by novel insertion sequences, DNA methylases and an approximately 10 kb contiguous region of metabolic genes that were dissimilar at the sequence level but similar in gene function between the two phages. Both bacteriophages contained a large number of radical S-adenosylmethionine (SAM) genes, presumably involved in boosting host metabolism during infection, as well as evidence that many genes had been acquired from a wide range of bacterial species. Further bacteriophages, from the UK Campylobacter typing set, were screened for the presence of bacteriophage structural genes, DNA methylases, mobile genetic elements and regulatory genes identified from the genome sequences. The results indicate that many of these bacteriophages are related, with 10 out of 15 showing some relationship to the sequenced genomes. Two large virulent Campylobacter bacteriophages were found to show very high levels of sequence conservation despite separation in time and place of isolation. The bacteriophages show adaptations to their host and possess genes that may enhance Campylobacter metabolism, potentially advantaging both the bacteriophage and its host. Genetic conservation has been shown to extend to other Campylobacter bacteriophages, forming a highly conserved lineage of bacteriophages that predate upon campylobacters and indicating that highly adapted bacteriophage genomes can be stable over prolonged periods of time.
Deciphering the genomic targets of alkylating polyamide conjugates using high-throughput sequencing
Chandran, Anandhakumar; Syed, Junetha; Taylor, Rhys D.; Kashiwazaki, Gengo; Sato, Shinsuke; Hashiya, Kaori; Bando, Toshikazu; Sugiyama, Hiroshi
2016-01-01
Chemically engineered small molecules targeting specific genomic sequences play an important role in drug development research. Pyrrole-imidazole polyamides (PIPs) are a group of molecules that can bind to the DNA minor-groove and can be engineered to target specific sequences. Their biological effects rely primarily on their selective DNA binding. However, the binding mechanism of PIPs at the chromatinized genome level is poorly understood. Herein, we report a method using high-throughput sequencing to identify the DNA-alkylating sites of PIP-indole-seco-CBI conjugates. High-throughput sequencing analysis of conjugate 2 showed highly similar DNA-alkylating sites on synthetic oligos (histone-free DNA) and on human genomes (chromatinized DNA context). To our knowledge, this is the first report identifying alkylation sites across genomic DNA by alkylating PIP conjugates using high-throughput sequencing. PMID:27098039
Characterization of tannase protein sequences of bacteria and fungi: an in silico study.
Banerjee, Amrita; Jana, Arijit; Pati, Bikash R; Mondal, Keshab C; Das Mohapatra, Pradeep K
2012-04-01
The tannase protein sequences of 149 bacteria and 36 fungi were retrieved from NCBI database. Among them only 77 bacterial and 31 fungal tannase sequences were taken which have different amino acid compositions. These sequences were analysed for different physical and chemical properties, superfamily search, multiple sequence alignment, phylogenetic tree construction and motif finding to find out the functional motif and the evolutionary relationship among them. The superfamily search for these tannase exposed the occurrence of proline iminopeptidase-like, biotin biosynthesis protein BioH, O-acetyltransferase, carboxylesterase/thioesterase 1, carbon-carbon bond hydrolase, haloperoxidase, prolyl oligopeptidase, C-terminal domain and mycobacterial antigens families and alpha/beta hydrolase superfamily. Some bacterial and fungal sequence showed similarity with different families individually. The multiple sequence alignment of these tannase protein sequences showed conserved regions at different stretches with maximum homology from amino acid residues 389-469 and 482-523 which could be used for designing degenerate primers or probes specific for tannase producing bacterial and fungal species. Phylogenetic tree showed two different clusters; one has only bacteria and another have both fungi and bacteria showing some relationship between these different genera. Although in second cluster near about all fungal species were found together in a corner which indicates the sequence level similarity among fungal genera. The distributions of fourteen motifs analysis revealed Motif 1 with a signature amino acid sequence of 29 amino acids, i.e. GCSTGGREALKQAQRWPHDYDGIIANNPA, was uniformly observed in 83.3 % of studied tannase sequences representing its participation with the structure and enzymatic function.
Jangid, Kamlesh; Kao, Ming-Hung; Lahamge, Aishwarya; Williams, Mark A.; Rathbun, Stephen L.; Whitman, William B.
2016-01-01
K-shuff is a new algorithm for comparing the similarity of gene sequence libraries, providing measures of the structural and compositional diversity as well as the significance of the differences between these measures. Inspired by Ripley’s K-function for spatial point pattern analysis, the Intra K-function or IKF measures the structural diversity, including both the richness and overall similarity of the sequences, within a library. The Cross K-function or CKF measures the compositional diversity between gene libraries, reflecting both the number of OTUs shared as well as the overall similarity in OTUs. A Monte Carlo testing procedure then enables statistical evaluation of both the structural and compositional diversity between gene libraries. For 16S rRNA gene libraries from complex bacterial communities such as those found in seawater, salt marsh sediments, and soils, K-shuff yields reproducible estimates of structural and compositional diversity with libraries greater than 50 sequences. Similarly, for pyrosequencing libraries generated from a glacial retreat chronosequence and Illumina® libraries generated from US homes, K-shuff required >300 and 100 sequences per sample, respectively. Power analyses demonstrated that K-shuff is sensitive to small differences in Sanger or Illumina® libraries. This extra sensitivity of K-shuff enabled examination of compositional differences at much deeper taxonomic levels, such as within abundant OTUs. This is especially useful when comparing communities that are compositionally very similar but functionally different. K-shuff will therefore prove beneficial for conventional microbiome analysis as well as specific hypothesis testing. PMID:27911946
Valenzuela-González, Fabiola; Martínez-Porchas, Marcel; Villalpando-Canchola, Enrique; Vargas-Albores, Francisco
2016-03-01
Ultrafast-metagenomic sequence classification using exact alignments (Kraken) is a novel approach to classify 16S rDNA sequences. The classifier is based on mapping short sequences to the lowest ancestor and performing alignments to form subtrees with specific weights in each taxon node. This study aimed to evaluate the classification performance of Kraken with long 16S rDNA random environmental sequences produced by cloning and then Sanger sequenced. A total of 480 clones were isolated and expanded, and 264 of these clones formed contigs (1352 ± 153 bp). The same sequences were analyzed using the Ribosomal Database Project (RDP) classifier. Deeper classification performance was achieved by Kraken than by the RDP: 73% of the contigs were classified up to the species or variety levels, whereas 67% of these contigs were classified no further than the genus level by the RDP. The results also demonstrated that unassembled sequences analyzed by Kraken provide similar or inclusively deeper information. Moreover, sequences that did not form contigs, which are usually discarded by other programs, provided meaningful information when analyzed by Kraken. Finally, it appears that the assembly step for Sanger sequences can be eliminated when using Kraken. Kraken cumulates the information of both sequence senses, providing additional elements for the classification. In conclusion, the results demonstrate that Kraken is an excellent choice for use in the taxonomic assignment of sequences obtained by Sanger sequencing or based on third generation sequencing, of which the main goal is to generate larger sequences. Copyright © 2016 Elsevier B.V. All rights reserved.
Seo, Joo-Hyun; Park, Jihyang; Kim, Eun-Mi; Kim, Juhan; Joo, Keehyoung; Lee, Jooyoung; Kim, Byung-Gee
2014-02-01
Sequence subgrouping for a given sequence set can enable various informative tasks such as the functional discrimination of sequence subsets and the functional inference of unknown sequences. Because an identity threshold for sequence subgrouping may vary according to the given sequence set, it is highly desirable to construct a robust subgrouping algorithm which automatically identifies an optimal identity threshold and generates subgroups for a given sequence set. To meet this end, an automatic sequence subgrouping method, named 'Subgrouping Automata' was constructed. Firstly, tree analysis module analyzes the structure of tree and calculates the all possible subgroups in each node. Sequence similarity analysis module calculates average sequence similarity for all subgroups in each node. Representative sequence generation module finds a representative sequence using profile analysis and self-scoring for each subgroup. For all nodes, average sequence similarities are calculated and 'Subgrouping Automata' searches a node showing statistically maximum sequence similarity increase using Student's t-value. A node showing the maximum t-value, which gives the most significant differences in average sequence similarity between two adjacent nodes, is determined as an optimum subgrouping node in the phylogenetic tree. Further analysis showed that the optimum subgrouping node from SA prevents under-subgrouping and over-subgrouping. Copyright © 2013. Published by Elsevier Ltd.
Large-Scale Concatenation cDNA Sequencing
Yu, Wei; Andersson, Björn; Worley, Kim C.; Muzny, Donna M.; Ding, Yan; Liu, Wen; Ricafrente, Jennifer Y.; Wentland, Meredith A.; Lennon, Greg; Gibbs, Richard A.
1997-01-01
A total of 100 kb of DNA derived from 69 individual human brain cDNA clones of 0.7–2.0 kb were sequenced by concatenated cDNA sequencing (CCS), whereby multiple individual DNA fragments are sequenced simultaneously in a single shotgun library. The method yielded accurate sequences and a similar efficiency compared with other shotgun libraries constructed from single DNA fragments (>20 kb). Computer analyses were carried out on 65 cDNA clone sequences and their corresponding end sequences to examine both nucleic acid and amino acid sequence similarities in the databases. Thirty-seven clones revealed no DNA database matches, 12 clones generated exact matches (≥98% identity), and 16 clones generated nonexact matches (57%–97% identity) to either known human or other species genes. Of those 28 matched clones, 8 had corresponding end sequences that failed to identify similarities. In a protein similarity search, 27 clone sequences displayed significant matches, whereas only 20 of the end sequences had matches to known protein sequences. Our data indicate that full-length cDNA insert sequences provide significantly more nucleic acid and protein sequence similarity matches than expressed sequence tags (ESTs) for database searching. [All 65 cDNA clone sequences described in this paper have been submitted to the GenBank data library under accession nos. U79240–U79304.] PMID:9110174
An oleate 12-hydroxylase from Ricinus communis L. is a fatty acyl desaturase homolog
DOE Office of Scientific and Technical Information (OSTI.GOV)
Van De Loo, F.J.; Broun, P.; Turner, S.
1995-07-18
Recent spectroscopic evidence implicating a binuclear iron site at the reaction center of fatty acyl desaturases suggested to us that certain fatty acyl hydroxylases may share significant amino acid sequence similarity with desaturases. To test this theory, we prepared a cDNA library from developing endosperm of the castor-oil plant (Ricinus communis L.) and obtained partial nucleotide sequences for 468 anonymous clones that were not expressed at high levels in leaves, a tissue deficient in 12-hydroxyoleic acid. This resulted in the identification of several cDNA clones encoding a polypeptide of 387 amino acids with a predicted molecular weight of 44,407 andmore » with {approx}67% sequence homology to microsomal oleate desaturase from Arabidopsis. Expression of a full-length clone under control of the cauliflower mosaic virus 35S promoter in transgenic tobacco resulted in the accumulation of low levels of 12-hydroxyoleic acid in seeds, indicating that the clone encodes the castor oleate hydroxylase. These results suggest that fatty acyl desaturases and hydroxylases share similar reaction mechanisms and provide an example of enzyme evolution. 26 refs., 6 figs., 1 tab.« less
Bartho, Joseph D.; Bellini, Dom; Wuerges, Jochen; Demitri, Nicola; Toccafondi, Mirco; Schmitt, Armin O.; Zhao, Youfu; Walsh, Martin A.
2017-01-01
AmyR is a stress and virulence associated protein from the plant pathogenic Enterobacteriaceae species Erwinia amylovora, and is a functionally conserved ortholog of YbjN from Escherichia coli. The crystal structure of E. amylovora AmyR reveals a class I type III secretion chaperone-like fold, despite the lack of sequence similarity between these two classes of protein and lacking any evidence of a secretion-associated role. The results indicate that AmyR, and YbjN proteins in general, function through protein-protein interactions without any enzymatic action. The YbjN proteins of Enterobacteriaceae show remarkably low sequence similarity with other members of the YbjN protein family in Eubacteria, yet a high level of structural conservation is observed. Across the YbjN protein family sequence conservation is limited to residues stabilising the protein core and dimerization interface, while interacting regions are only conserved between closely related species. This study presents the first structure of a YbjN protein from Enterobacteriaceae, the most highly divergent and well-studied subgroup of YbjN proteins, and an in-depth sequence and structural analysis of this important but poorly understood protein family. PMID:28426806
Bartho, Joseph D; Bellini, Dom; Wuerges, Jochen; Demitri, Nicola; Toccafondi, Mirco; Schmitt, Armin O; Zhao, Youfu; Walsh, Martin A; Benini, Stefano
2017-01-01
AmyR is a stress and virulence associated protein from the plant pathogenic Enterobacteriaceae species Erwinia amylovora, and is a functionally conserved ortholog of YbjN from Escherichia coli. The crystal structure of E. amylovora AmyR reveals a class I type III secretion chaperone-like fold, despite the lack of sequence similarity between these two classes of protein and lacking any evidence of a secretion-associated role. The results indicate that AmyR, and YbjN proteins in general, function through protein-protein interactions without any enzymatic action. The YbjN proteins of Enterobacteriaceae show remarkably low sequence similarity with other members of the YbjN protein family in Eubacteria, yet a high level of structural conservation is observed. Across the YbjN protein family sequence conservation is limited to residues stabilising the protein core and dimerization interface, while interacting regions are only conserved between closely related species. This study presents the first structure of a YbjN protein from Enterobacteriaceae, the most highly divergent and well-studied subgroup of YbjN proteins, and an in-depth sequence and structural analysis of this important but poorly understood protein family.
Frahry, Matthew Blake; Sun, Cheng; Chong, Rebecca A; Mueller, Rachel Lockridge
2015-02-01
Across the tree of life, species vary dramatically in nuclear genome size. Mutations that add or remove sequences from genomes-insertions or deletions, or indels-are the ultimate source of this variation. Differences in the tempo and mode of insertion and deletion across taxa have been proposed to contribute to evolutionary diversity in genome size. Among vertebrates, most of the largest genomes are found within the salamanders, an amphibian clade with genome sizes ranging from ~14 to ~120 Gb. Salamander genomes have been shown to experience slower rates of DNA loss through small (i.e., <30 bp) deletions than do other vertebrate genomes. However, no studies have addressed DNA loss from salamander genomes resulting from larger deletions. Here, we focus on one type of large deletion-ectopic-recombination-mediated removal of LTR retrotransposon sequences. In ectopic recombination, double-strand breaks are repaired using a "wrong" (i.e., ectopic, or non-allelic) template sequence-typically another locus of similar sequence. When breaks occur within the LTR portions of LTR retrotransposons, ectopic-recombination-mediated repair can produce deletions that remove the internal transposon sequence and the equivalent of one of the two LTR sequences. These deletions leave a signature in the genome-a solo LTR sequence. We compared levels of solo LTRs in the genomes of four salamander species with levels present in five vertebrates with smaller genomes. Our results demonstrate that salamanders have low levels of solo LTRs, suggesting that ectopic-recombination-mediated deletion of LTR retrotransposons occurs more slowly than in other vertebrates with smaller genomes.
Length and sequence variability in mitochondrial control region of the milkfish, Chanos chanos.
Ravago, Rachel G; Monje, Virginia D; Juinio-Meñez, Marie Antonette
2002-01-01
Extensive length variability was observed in the mitochondrial control region of the milkfish, Chanos chanos. The nucleotide sequence of the control region and flanking regions was determined. Length variability and heteroplasmy was due to the presence of varying numbers of a 41-bp tandemly repeated sequence and a 48-bp insertion/deletion (indel). The structure and organization of the milkfish control region is similar to that of other teleost fish and vertebrates. However, extensive variation in the copy number of tandem repeats (4-20 copies) and the presence of a relatively large (48-bp) indel, are apparently uncommon in teleost fish control region sequences reported to date. High sequence variability of control region peripheral domains indicates the potential utility of selected regions as markers for population-level studies.
Mammoth and Elephant Phylogenetic Relationships: Mammut Americanum, the Missing Outgroup
Orlando, Ludovic; Hänni, Catherine; Douady, Christophe J.
2007-01-01
At the morphological level, the woolly mammoth has most often been considered as the sister-species of Asian elephants, but at the DNA level, different studies have found support for proximity with African elephants. Recent reports have increased the available sequence data and apparently solved the discrepancy, finding mammoths to be most closely related to Asian elephants. However, we demonstrate here that the three competing topologies have similar likelihood, bayesian and parsimony supports. The analysis further suggests the inadequacy of using Sirenia or Hyracoidea as outgroups. We therefore argue that orthologous sequences from the extinct American mastodon will be required to definitively solve this long-standing question. PMID:19430604
King, Brian R; Aburdene, Maurice; Thompson, Alex; Warres, Zach
2014-01-01
Digital signal processing (DSP) techniques for biological sequence analysis continue to grow in popularity due to the inherent digital nature of these sequences. DSP methods have demonstrated early success for detection of coding regions in a gene. Recently, these methods are being used to establish DNA gene similarity. We present the inter-coefficient difference (ICD) transformation, a novel extension of the discrete Fourier transformation, which can be applied to any DNA sequence. The ICD method is a mathematical, alignment-free DNA comparison method that generates a genetic signature for any DNA sequence that is used to generate relative measures of similarity among DNA sequences. We demonstrate our method on a set of insulin genes obtained from an evolutionarily wide range of species, and on a set of avian influenza viral sequences, which represents a set of highly similar sequences. We compare phylogenetic trees generated using our technique against trees generated using traditional alignment techniques for similarity and demonstrate that the ICD method produces a highly accurate tree without requiring an alignment prior to establishing sequence similarity.
Taylor, William R; Stoye, Jonathan P; Taylor, Ian A
2017-04-04
The Spumaretrovirinae (foamy viruses) and the Orthoretrovirinae (e.g. HIV) share many similarities both in genome structure and the sequences of the core viral encoded proteins, such as the aspartyl protease and reverse transcriptase. Similarity in the gag region of the genome is less obvious at the sequence level but has been illuminated by the recent solution of the foamy virus capsid (CA) structure. This revealed a clear structural similarity to the orthoretrovirus capsids but with marked differences that left uncertainty in the relationship between the two domains that comprise the structure. We have applied protein structure comparison methods in order to try and resolve this ambiguous relationship. These included both the DALI method and the SAP method, with rigorous statistical tests applied to the results of both methods. For this, we employed collections of artificial fold 'decoys' (generated from the pair of native structures being compared) to provide a customised background distribution for each comparison, thus allowing significance levels to be estimated. We have shown that the relationship of the two domains conforms to a simple linear correspondence rather than a domain transposition. These similarities suggest that the origin of both viral capsids was a common ancestor with a double domain structure. In addition, we show that there is also a significant structural similarity between the amino and carboxy domains in both the foamy and ortho viruses. These results indicate that, as well as the duplication of the double domain capsid, there may have been an even more ancient gene-duplication that preceded the double domain structure. In addition, our structure comparison methodology demonstrates a general approach to problems where the components have a high intrinsic level of similarity.
Extensive concerted evolution of rice paralogs and the road to regaining independence.
Wang, Xiyin; Tang, Haibao; Bowers, John E; Feltus, Frank A; Paterson, Andrew H
2007-11-01
Many genes duplicated by whole-genome duplications (WGDs) are more similar to one another than expected. We investigated whether concerted evolution through conversion and crossing over, well-known to affect tandem gene clusters, also affects dispersed paralogs. Genome sequences for two Oryza subspecies reveal appreciable gene conversion in the approximately 0.4 MY since their divergence, with a gradual progression toward independent evolution of older paralogs. Since divergence from subspecies indica, approximately 8% of japonica paralogs produced 5-7 MYA on chromosomes 11 and 12 have been affected by gene conversion and several reciprocal exchanges of chromosomal segments, while approximately 70-MY-old "paleologs" resulting from a genome duplication (GD) show much less conversion. Sequence similarity analysis in proximal gene clusters also suggests more conversion between younger paralogs. About 8% of paleologs may have been converted since rice-sorghum divergence approximately 41 MYA. Domain-encoding sequences are more frequently converted than nondomain sequences, suggesting a sort of circularity--that sequences conserved by selection may be further conserved by relatively frequent conversion. The higher level of concerted evolution in the 5-7 MY-old segmental duplication may reflect the behavior of many genomes within the first few million years after duplication or polyploidization.
Comparative sequence analyses of sixteen reptilian paramyxoviruses
Ahne, W.; Batts, W.N.; Kurath, G.; Winton, J.R.
1999-01-01
Viral genomic RNA of Fer-de-Lance virus (FDLV), a paramyxovirus highly pathogenic for reptiles, was reverse transcribed and cloned. Plasmids with significant sequence similarities to the hemagglutinin-neuraminidase (HN) and polymerase (L) genes of mammalian paramyxoviruses were identified by BLAST search. Partial sequences of the FDLV genes were used to design primers for amplification by nested polymerase chain reaction (PCR) and sequencing of 518-bp L gene and 352-bp HN gene fragments from a collection of 15 previously uncharacterized reptilian paramyxoviruses. Phylogenetic analyses of the partial L and HN sequences produced similar trees in which there were two distinct subgroups of isolates that were supported with maximum bootstrap values, and several intermediate isolates. Within each subgroup the nucleotide divergence values were less than 2.5%, while the divergence between the two subgroups was 20-22%. This indicated that the two subgroups represent distinct virus species containing multiple virus strains. The five intermediate isolates had nucleotide divergence values of 11-20% and may represent additional distinct species. In addition to establishing diversity among reptilian paramyxoviruses, the phylogenetic groupings showed some correlation with geographic location, and clearly demonstrated a low level of host species-specificity within these viruses. Copyright (C) 1999 Elsevier Science B.V.
Musical Sequence Learning and EEG Correlates of Audiomotor Processing
Schalles, Matt D.; Pineda, Jaime A.
2015-01-01
Our motor and auditory systems are functionally connected during musical performance, and functional imaging suggests that the association is strong enough that passive music listening can engage the motor system. As predictive coding constrains movement sequence selections, could the motor system contribute to sequential processing of musical passages? If this is the case, then we hypothesized that the motor system should respond preferentially to passages of music that contain similar sequential information, even if other aspects of music, such as the absolute pitch, have been altered. We trained piano naive subjects with a learn-to play-by-ear paradigm, to play a simple melodic sequence over five days. After training, we recorded EEG of subjects listening to the song they learned to play, a transposed version of that song, and a control song with different notes and sequence from the learned song. Beta band power over sensorimotor scalp showed increased suppression for the learned song, a moderate level of suppression for the transposed song, and no suppression for the control song. As beta power is associated with attention and motor processing, we interpret this as support of the motor system's activity during covert perception of music one can play and similar musical sequences. PMID:26527118
Allergen cross reactions: a problem greater than ever thought?
Pfiffner, P; Truffer, R; Matsson, P; Rasi, C; Mari, A; Stadler, B M
2010-12-01
Cross reactions are an often observed phenomenon in patients with allergy. Sensitization against some allergens may cause reactions against other seemingly unrelated allergens. Today, cross reactions are being investigated on a per-case basis, analyzing blood serum specific IgE (sIgE) levels and clinical features of patients suffering from cross reactions. In this study, we evaluated the level of sIgE compared to patients' total IgE assuming epitope specificity is a consequence of sequence similarity. Our objective was to evaluate our recently published model of molecular sequence similarities underlying cross reactivity using serum-derived data from IgE determinations of standard laboratory tests. We calculated the probabilities of protein cross reactivity based on conserved sequence motifs and compared these in silico predictions to a database consisting of 5362 sera with sIgE determinations. Cumulating sIgE values of a patient resulted in a median of 25-30% total IgE. Comparing motif cross reactivity predictions to sIgE levels showed that on average three times fewer motifs than extracts were recognized in a given serum (correlation coefficient: 0.967). Extracts belonging to the same motif group co-reacted in a high percentage of sera (up to 80% for some motifs). Cumulated sIgE levels are exaggerated because of a high level of observed cross reactions. Thus, not only bioinformatic prediction of allergenic motifs, but also serological routine testing of allergic patients implies that the immune system may recognize only a small number of allergenic structures. © 2010 John Wiley & Sons A/S.
Caldwell, Rachel; Lin, Yan-Xia; Zhang, Ren
2015-01-01
There is a continuing interest in the analysis of gene architecture and gene expression to determine the relationship that may exist. Advances in high-quality sequencing technologies and large-scale resource datasets have increased the understanding of relationships and cross-referencing of expression data to the large genome data. Although a negative correlation between expression level and gene (especially transcript) length has been generally accepted, there have been some conflicting results arising from the literature concerning the impacts of different regions of genes, and the underlying reason is not well understood. The research aims to apply quantile regression techniques for statistical analysis of coding and noncoding sequence length and gene expression data in the plant, Arabidopsis thaliana, and fruit fly, Drosophila melanogaster, to determine if a relationship exists and if there is any variation or similarities between these species. The quantile regression analysis found that the coding sequence length and gene expression correlations varied, and similarities emerged for the noncoding sequence length (5′ and 3′ UTRs) between animal and plant species. In conclusion, the information described in this study provides the basis for further exploration into gene regulation with regard to coding and noncoding sequence length. PMID:26114098
Liu, Maoyan; Liu, Xiangning; Li, Xun; Zhang, Deyong; Dai, Liangyin; Tang, Qianjun
2016-03-01
The genome sequence of pepper vein yellows virus (PeVYV) (PeVYV-HN, accession number KP326573), isolated from pepper plants (Capsicum annuum L.) grown at the Hunan Vegetables Institute (Changsha, Hunan, China), was determined by deep sequencing of small RNAs. The PeVYV-HN genome consists of 6244 nucleotides, contains six open reading frames (ORFs), and is similar to that of an isolate (AB594828) from Japan. Its genomic organization is similar to that of members of the genus Polerovirus. Sequence analysis revealed that PeVYV-HN shared 92% sequence identity with the Japanese PeVYV genome at both the nucleotide and amino acid levels. Evolutionary analysis based on the coat protein (CP), movement protein (MP), and RNA-dependent RNA polymerase (RdRP) showed that PeVYV could be divided into two major lineages corresponding to their geographical origins. The Asian isolates have a higher population expansion frequency than the African isolates. Negative selection and genetic drift (founder effect) were found to be the potential drivers of the molecular evolution of PeVYV. Moreover, recombination was not the distinct cause of PeVYV evolution. This is the first report of a complete genomic sequence of PeVYV in China.
Chappell, J; Chrispeels, M J
1986-05-01
The expression of phaseolin and phytohemagglutinin (PHA) in the developing cotyledons of a normal (Greensleeves) and a PHA-deficient (Pinto 111) cultivar of Phaseolus vulgaris was investigated. Phaseolin mRNA translational activity and abundance were present at similar levels in both cultivars. In contrast, PHA mRNA translational activity and abundance in Pinto 111 were less than 1% of the levels measured in Greensleeves. Using nuclear runoff assays, the transcription rate of phaseolin gene sequences was similar in both cultivars. The transcription rate of PHA gene sequences in Pinto 111 was only 20% of that measured in Greensleeves. Comparison of the transcription rates with the relative mRNA amounts measured in RNA blot hybridizations indicated that the normally expressed storage protein gene mRNAs were very stable with half-lives greater than several days. Because a low level of PHA gene transcription in Pinto 111 was measurable but no PHA mRNA accumulated, these results suggest that the PHA deficiency in Pinto 111 is due to a reduced transcription rate and possibly an instability of the mRNA.
Zhang, L J; Dong, W X; Guo, S M; Wang, Y X; Wang, A D; Lu, X J
2015-11-19
This study aims to explore the roles of somatic embryogenesis receptor-like kinase (SERK) in Malus hupehensis (Pingyi Tiancha). The full-length sequences of SERK1 in triploid Pingyi Tiancha (3n) and a tetraploid hybrid strain 33# (4n) were cloned, sequenced, and designated as MhSERK1 and MhdSERK1, respectively. Multiple alignments of amino acid sequences were conducted to identify similarity between MhSERK1 and MhdSERK1 and SERK sequences in other species, and a neighbor-joining phylogenetic tree was constructed to elucidate their phylogenetic relations. Expression levels of MhSERK1 and MhdSERK1 in different tissues and developmental stages were investigated using quantitative real-time PCR. The coding sequence lengths of MhSERK1 and MhdSERK1 were 1899 bp (encoding 632 amino acids) and 1881 bp (encoding 626 amino acids), respectively. Sequence analysis demonstrated that MhSERK1 and MhdSERK1 display high similarity to SERKs in other species, with a conserved intron/exon structure that is unique to members of the SERK family. Additionally, the phylogenetic tree showed that MhSERK1 and MhdSERK1 clustered with orange CitSERK (93%). Furthermore, MhSERK1 and MhdSERK1 were mainly expressed in the reproductive organs, in particular the ovary. Their expression levels were highest in young flowers and they differed among different tissues and organs. Our results suggest that MhSERK1 and MhdSERK1 are related to plant reproduction, and that MhSERK1 is related to apomixis in triploid Pingyi Tiancha.
A critical evaluation of random copolymer mimesis of homogeneous antimicrobial peptides.
Hu, Kan; Schmidt, Nathan W; Zhu, Rui; Jiang, Yunjiang; Lai, Ghee Hwee; Wei, Gang; Palermo, Edmund F; Kuroda, Kenichi; Wong, Gerard C L; Yang, Lihua
2013-01-01
Polymeric synthetic mimics of antimicrobial peptides (SMAMPs) have recently demonstrated similar antimicrobial activity as natural antimicrobial peptides (AMPs) from innate immunity. This is surprising, since polymeric SMAMPs are heterogeneous in terms of chemical structure (random sequence) and conformation (random coil), in contrast to defined amino acid sequence and intrinsic secondary structure. To understand this better, we compare AMPs with a 'minimal' mimic, a well characterized family of polydisperse cationic methacrylate-based random copolymer SMAMPs. Specifically, we focus on a comparison between the quantifiable membrane curvature generating capacity, charge density, and hydrophobicity of the polymeric SMAMPs and AMPs. Synchrotron small angle x-ray scattering (SAXS) results indicate that typical AMPs and these methacrylate SMAMPs generate similar amounts of membrane negative Gaussian curvature (NGC), which is topologically necessary for a variety of membrane-destabilizing processes. Moreover, the curvature generating ability of SMAMPs is more tolerant of changes in the lipid composition than that of natural AMPs with similar chemical groups, consistent with the lower specificity of SMAMPs. We find that, although the amount of NGC generated by these SMAMPs and AMPs are similar, the SMAMPs require significantly higher levels of hydrophobicity and cationic charge to achieve the same level of membrane deformation. We propose an explanation for these differences, which has implications for new synthetic strategies aimed at improved mimesis of AMPs.
CMSA: a heterogeneous CPU/GPU computing system for multiple similar RNA/DNA sequence alignment.
Chen, Xi; Wang, Chen; Tang, Shanjiang; Yu, Ce; Zou, Quan
2017-06-24
The multiple sequence alignment (MSA) is a classic and powerful technique for sequence analysis in bioinformatics. With the rapid growth of biological datasets, MSA parallelization becomes necessary to keep its running time in an acceptable level. Although there are a lot of work on MSA problems, their approaches are either insufficient or contain some implicit assumptions that limit the generality of usage. First, the information of users' sequences, including the sizes of datasets and the lengths of sequences, can be of arbitrary values and are generally unknown before submitted, which are unfortunately ignored by previous work. Second, the center star strategy is suited for aligning similar sequences. But its first stage, center sequence selection, is highly time-consuming and requires further optimization. Moreover, given the heterogeneous CPU/GPU platform, prior studies consider the MSA parallelization on GPU devices only, making the CPUs idle during the computation. Co-run computation, however, can maximize the utilization of the computing resources by enabling the workload computation on both CPU and GPU simultaneously. This paper presents CMSA, a robust and efficient MSA system for large-scale datasets on the heterogeneous CPU/GPU platform. It performs and optimizes multiple sequence alignment automatically for users' submitted sequences without any assumptions. CMSA adopts the co-run computation model so that both CPU and GPU devices are fully utilized. Moreover, CMSA proposes an improved center star strategy that reduces the time complexity of its center sequence selection process from O(mn 2 ) to O(mn). The experimental results show that CMSA achieves an up to 11× speedup and outperforms the state-of-the-art software. CMSA focuses on the multiple similar RNA/DNA sequence alignment and proposes a novel bitmap based algorithm to improve the center star strategy. We can conclude that harvesting the high performance of modern GPU is a promising approach to accelerate multiple sequence alignment. Besides, adopting the co-run computation model can maximize the entire system utilization significantly. The source code is available at https://github.com/wangvsa/CMSA .
Model-free aftershock forecasts constructed from similar sequences in the past
NASA Astrophysics Data System (ADS)
van der Elst, N.; Page, M. T.
2017-12-01
The basic premise behind aftershock forecasting is that sequences in the future will be similar to those in the past. Forecast models typically use empirically tuned parametric distributions to approximate past sequences, and project those distributions into the future to make a forecast. While parametric models do a good job of describing average outcomes, they are not explicitly designed to capture the full range of variability between sequences, and can suffer from over-tuning of the parameters. In particular, parametric forecasts may produce a high rate of "surprises" - sequences that land outside the forecast range. Here we present a non-parametric forecast method that cuts out the parametric "middleman" between training data and forecast. The method is based on finding past sequences that are similar to the target sequence, and evaluating their outcomes. We quantify similarity as the Poisson probability that the observed event count in a past sequence reflects the same underlying intensity as the observed event count in the target sequence. Event counts are defined in terms of differential magnitude relative to the mainshock. The forecast is then constructed from the distribution of past sequences outcomes, weighted by their similarity. We compare the similarity forecast with the Reasenberg and Jones (RJ95) method, for a set of 2807 global aftershock sequences of M≥6 mainshocks. We implement a sequence-specific RJ95 forecast using a global average prior and Bayesian updating, but do not propagate epistemic uncertainty. The RJ95 forecast is somewhat more precise than the similarity forecast: 90% of observed sequences fall within a factor of two of the median RJ95 forecast value, whereas the fraction is 85% for the similarity forecast. However, the surprise rate is much higher for the RJ95 forecast; 10% of observed sequences fall in the upper 2.5% of the (Poissonian) forecast range. The surprise rate is less than 3% for the similarity forecast. The similarity forecast may be useful to emergency managers and non-specialists when confidence or expertise in parametric forecasting may be lacking. The method makes over-tuning impossible, and minimizes the rate of surprises. At the least, this forecast constitutes a useful benchmark for more precisely tuned parametric forecasts.
Chakraborty, Mukta; Chen, Liang-Fu; Fridel, Emma E; Klein, Marguerita E; Senft, Rebecca A; Sarkar, Abhra; Jarvis, Erich D
2017-04-21
Zebra finches (Taeniopygia guttata) learn to produce songs in a manner reminiscent of spoken language development in humans. One candidate gene implicated in influencing learning is the N-methyl-D-aspartate (NMDA) subtype 2B glutamate receptor (NR2B). Consistent with this idea, NR2B levels are high in the song learning nucleus LMAN (lateral magnocellular nucleus of the anterior nidopallium) during juvenile vocal learning, and decreases to low levels in adults after learning is complete and the song becomes more stereotyped. To test for the role of NR2B in generating song plasticity, we manipulated NR2B expression in LMAN of adult male zebra finches by increasing its protein levels to those found in juvenile birds, using a lentivirus containing the full-length coding sequence of the human NR2B subunit. We found that increased NR2B expression in adult LMAN induced increases in song sequence diversity and slower song tempo more similar to juvenile songs, but also increased syllable repetitions similar to stuttering. We did not observe these effects in control birds with overexpression of NR2B outside of LMAN or with the green fluorescent protein (GFP) in LMAN. Our results suggest that low NR2B subunit expression in adult LMAN is important in conserving features of stereotyped adult courtship song.
ABM Drag_Pass Report Generator
NASA Technical Reports Server (NTRS)
Fisher, Forest; Gladden, Roy; Khanampornpan, Teerapat
2008-01-01
dragREPORT software was developed in parallel with abmREPORT, which is described in the preceding article. Both programs were built on the capabilities created during that process. This tool generates a drag_pass report that summarizes vital information from the MRO aerobreaking drag_pass build process to facilitate both sequence reviews and provide a high-level summarization of the sequence for mission management. The script extracts information from the ENV, SSF, FRF, SCMFmax, and OPTG files, presenting them in a single, easy-to-check report providing the majority of parameters needed for cross check and verification as part of the sequence review process. Prior to dragReport, all the needed information was spread across a number of different files, each in a different format. This software is a Perl script that extracts vital summarization information and build-process details from a number of source files into a single, concise report format used to aid the MPST sequence review process and to provide a high-level summarization of the sequence for mission management reference. This software could be adapted for future aerobraking missions to provide similar reports, review and summarization information.
[Hepatitis C virus: sequence homology of a European isolate and divergence from the prototype].
Seelig, R; Seelig, H P; Renz, M
1991-08-01
The polymerase chain reaction (PCR) detected specific hepatitis C viral (HCV) RNA sequences in liver biopsies from two patients with chronic hepatitis, in the tissue of a liver implantate, in plasma from four chronic non-A, non-B hepatitis (NANBH) patients and, for the first time, in an infectious anti-D-immunoglobulin preparation. A comparison of the viral sequences coding for a region for the nonstructural NS3 protein from the liver tissues revealed only a very small degree of sequence divergence on the cDNA as well as on the amino acid level (between 0 and 5%). The sequence similarities of the RNA isolated from plasma of the four chronic NANBH patients and the anti-D-immunoglobulin preparation were partly somewhat lower but altogether also high (between 90 and 100%). In contrast, all eight cDNA and amino acid sequences exhibited a significantly higher degree of divergence in comparison with the HCV prototype sequence (between 29 and 32%) than among themselves (between 0 and 10%). This unexpected high sequence similarity of the eight European isolates and their low homology to the Northamerican prototype sequence is indicative for the existence of different types of HCV. This will be important not only for epidemiological studies but also for the development of effective diagnostic procedures and vaccines. Concerning the pathogenesis of NANBH, a double infection or a helper mechanism has to be considered: in addition to the C virus, sequences of an other virus particle were found in the infectious IgG preparation as well as in the liver biopsies.
Ikram, Najmul; Qadir, Muhammad Abdul; Afzal, Muhammad Tanvir
2018-01-01
Sequence similarity is a commonly used measure to compare proteins. With the increasing use of ontologies, semantic (function) similarity is getting importance. The correlation between these measures has been applied in the evaluation of new semantic similarity methods, and in protein function prediction. In this research, we investigate the relationship between the two similarity methods. The results suggest absence of a strong correlation between sequence and semantic similarities. There is a large number of proteins with low sequence similarity and high semantic similarity. We observe that Pearson's correlation coefficient is not sufficient to explain the nature of this relationship. Interestingly, the term semantic similarity values above 0 and below 1 do not seem to play a role in improving the correlation. That is, the correlation coefficient depends only on the number of common GO terms in proteins under comparison, and the semantic similarity measurement method does not influence it. Semantic similarity and sequence similarity have a distinct behavior. These findings are of significant effect for future works on protein comparison, and will help understand the semantic similarity between proteins in a better way.
Mahillon, Jacques; Chandler, Michael
1998-01-01
Insertion sequences (ISs) constitute an important component of most bacterial genomes. Over 500 individual ISs have been described in the literature to date, and many more are being discovered in the ongoing prokaryotic and eukaryotic genome-sequencing projects. The last 10 years have also seen some striking advances in our understanding of the transposition process itself. Not least of these has been the development of various in vitro transposition systems for both prokaryotic and eukaryotic elements and, for several of these, a detailed understanding of the transposition process at the chemical level. This review presents a general overview of the organization and function of insertion sequences of eubacterial, archaebacterial, and eukaryotic origins with particular emphasis on bacterial elements and on different aspects of the transposition mechanism. It also attempts to provide a framework for classification of these elements by assigning them to various families or groups. A total of 443 members of the collection have been grouped in 17 families based on combinations of the following criteria: (i) similarities in genetic organization (arrangement of open reading frames); (ii) marked identities or similarities in the enzymes which mediate the transposition reactions, the recombinases/transposases (Tpases); (iii) similar features of their ends (terminal IRs); and (iv) fate of the nucleotide sequence of their target sites (generation of a direct target duplication of determined length). A brief description of the mechanism(s) involved in the mobility of individual ISs in each family and of the structure-function relationships of the individual Tpases is included where available. PMID:9729608
DNA Barcode Sequence Identification Incorporating Taxonomic Hierarchy and within Taxon Variability
Little, Damon P.
2011-01-01
For DNA barcoding to succeed as a scientific endeavor an accurate and expeditious query sequence identification method is needed. Although a global multiple–sequence alignment can be generated for some barcoding markers (e.g. COI, rbcL), not all barcoding markers are as structurally conserved (e.g. matK). Thus, algorithms that depend on global multiple–sequence alignments are not universally applicable. Some sequence identification methods that use local pairwise alignments (e.g. BLAST) are unable to accurately differentiate between highly similar sequences and are not designed to cope with hierarchic phylogenetic relationships or within taxon variability. Here, I present a novel alignment–free sequence identification algorithm–BRONX–that accounts for observed within taxon variability and hierarchic relationships among taxa. BRONX identifies short variable segments and corresponding invariant flanking regions in reference sequences. These flanking regions are used to score variable regions in the query sequence without the production of a global multiple–sequence alignment. By incorporating observed within taxon variability into the scoring procedure, misidentifications arising from shared alleles/haplotypes are minimized. An explicit treatment of more inclusive terminals allows for separate identifications to be made for each taxonomic level and/or for user–defined terminals. BRONX performs better than all other methods when there is imperfect overlap between query and reference sequences (e.g. mini–barcode queries against a full–length barcode database). BRONX consistently produced better identifications at the genus–level for all query types. PMID:21857897
Nelson, A.R.; Jennings, A.E.; Kashima, K.
1996-01-01
Much of the uncertainty in determining the number and magnitude of past great earthquakes in the Cascadia subduction zone of western North America stems from difficulties in using estuarine stratigraphy to infer the size and rate of late Holocene relative sea-level changes. A sequence of interbedded peaty and muddy intertidal sediment beneath a small, protected tidal marsh in a narrow inlet of Coos Bay, Oregon, records ten rapid to instantaneous rises in relative sea level. Each rise is marked by a contact that records an upward transition from peaty to muddy sediment. But only two contacts, dating from about 1700 and 2300 yr ago, show the site-wide extent and abrupt changes in lithology and foraminiferal and diatom assemblages that can be used to infer at least half a meter of sudden coseismic subsidence. Although the characteristics of a third, gradual contact do not differ from those of some contacts produced by nonseismic processes, regional correlation with other similar sequences and high-precision 14C dating suggest that the third contact records a great plate-boundary earthquake about 300 yr ago. A fourth contact formed too slowly to have been caused by coseismic subsidence. Because lithologic and microfossil data are not sufficient to distinguish a coseismic from a nonseismic origin for the other six peatmud contacts, we cannot determine earthquake recurrence intervals at this site. Similar uncertainties in great earthquake recurrence and magnitude prevail at similar sites elsewhere in the Cascadia subduction zone, except those with sequences showing changes in fossils indicative of > 1 m of sudden subsidence, sand sheets deposited by tsunamis, or liquefaction features.
Cousins, Matthew M.; Ou, San-San; Wawer, Maria J.; Munshaw, Supriya; Swan, David; Magaret, Craig A.; Mullis, Caroline E.; Serwadda, David; Porcella, Stephen F.; Gray, Ronald H.; Quinn, Thomas C.; Donnell, Deborah; Eshleman, Susan H.
2012-01-01
Next-generation sequencing (NGS) has recently been used for analysis of HIV diversity, but this method is labor-intensive, costly, and requires complex protocols for data analysis. We compared diversity measures obtained using NGS data to those obtained using a diversity assay based on high-resolution melting (HRM) of DNA duplexes. The HRM diversity assay provides a single numeric score that reflects the level of diversity in the region analyzed. HIV gag and env from individuals in Rakai, Uganda, were analyzed in a previous study using NGS (n = 220 samples from 110 individuals). Three sequence-based diversity measures were calculated from the NGS sequence data (percent diversity, percent complexity, and Shannon entropy). The amplicon pools used for NGS were analyzed with the HRM diversity assay. HRM scores were significantly associated with sequence-based measures of HIV diversity for both gag and env (P < 0.001 for all measures). The level of diversity measured by the HRM diversity assay and NGS increased over time in both regions analyzed (P < 0.001 for all measures except for percent complexity in gag), and similar amounts of diversification were observed with both methods (P < 0.001 for all measures except for percent complexity in gag). Diversity measures obtained using the HRM diversity assay were significantly associated with those from NGS, and similar increases in diversity over time were detected by both methods. The HRM diversity assay is faster and less expensive than NGS, facilitating rapid analysis of large studies of HIV diversity and evolution. PMID:22785188
Fowler, Elizabeth V; Peters, Jennifer M; Gatton, Michelle L; Chen, Nanhua; Cheng, Qin
2002-03-01
In Plasmodium falciparum a highly polymorphic multi-copy gene family, var, encodes the variant surface antigen P. falciparum erythrocyte membrane protein 1 (PfEMP1), which has an important role in cytoadherence and immune evasion. Using previously described universal PCR primers for the first Duffy binding-like domain (DBLalpha) of var we analysed the DBLalpha repertoires of Dd2 (originally from Thailand) and eight isolates from the Solomon Islands (n=4), Philippines (n=2), Papua New Guinea (n=1) and Africa (n=1). We found 15-32 unique DBLalpha sequence types among these isolates and estimated detectable DBLalpha repertoire sizes ranging from 33-38 to 52-57 copies per genome. Our data suggest that var gene repertoires generally consist of 40-50 copies per genome. Eighteen DBLalpha sequences appeared in more than one Asia-Pacific isolate with the number of sequences shared between any two isolates ranging from 0 to 6 (mean=2.0 +/-1.6). At the amino acid level DBLalpha sequence similarity within isolates ranged from 45.2 +/- 7.1 to 50.2 +/- 6.9%, and was not significantly different from the DBLalpha amino acid sequence similarity among isolates (P>0.1). Comparisons with published sequences also revealed little overlap among DBLalpha sequences from different regions. High DBLalpha sequence diversity and minimal overlap among these isolates suggest that the global var gene repertoire is immense, and may potentially be selected for by the host's protective immune response to the var gene products, PfEMP1.
Jossinet, Fabrice; Westhof, Eric
2005-08-01
Efficient RNA sequence manipulations (such as multiple alignments) need to be constrained by rules of RNA structure folding. The structural knowledge has increased dramatically in the last years with the accumulation of several large RNA structures similar to those of the bacterial ribosome subunits. However, no tool in the RNA community provides an easy way to link and integrate progress made at the sequence level using the available three-dimensional information. Sequence to Structure (S2S) proposes a framework in which an user can easily display, manipulate and interconnect heterogeneous RNA data, such as multiple sequence alignments, secondary and tertiary structures. S2S has been implemented using the Java language and has been developed and tested under UNIX systems, such as Linux and MacOSX. S2S is available at http://bioinformatics.org/S2S/.
Chen, Yuhuang; Duan, Ran; Li, Xu; Li, Kewei; Liang, Junrong; Liu, Chang; Qiu, Haiyan; Xiao, Yuchun; Jing, Huaiqi; Wang, Xin
2015-12-01
The outer membrane protein A (OmpA) is one of the intra-species conserved proteins with immunogenicity widely found in the family of Enterobacteriaceae. Here we first confirmed OmpA is conserved in the three pathogenic Yersinia: Yersinia pestis, Yersinia pseudotuberculosis and pathogenic Yersinia enterocolitica, with high homology at the nucleotide level and at the amino acid sequence level. The identity of ompA sequences for 262 Y. pestis strains, 134 Y. pseudotuberculosis strains and 219 pathogenic Y. enterocolitica strains are 100%, 98.8% and 97.7% similar. The main pattern of OmpA of pathogenic Yersinia are 86.2% and 88.8% identical at the nucleotide and amino acid sequence levels, respectively. Immunological analysis showed the immunogenicity of each OmpA and cross-immunogenicity of OmpA for pathogenic Yersinia where OmpA may be a vaccine candidate for Y. pestis and other pathogenic Yersinia. Copyright © 2015 Elsevier Ltd. All rights reserved.
Analysis of levels of support and resonance demonstrated by an elite singing teacher
NASA Astrophysics Data System (ADS)
Scherer, Ronald C.; Radhakrishnan, Nandhakumar; Poulimenos, Andreas
2003-04-01
This was a study of levels of singing expertise demonstrated by an elite operatic singer and teacher. This approach may prove advantageous because the teacher demonstrates what he thinks is important, not what the nonsinging scientist thinks should be important. Two pedagogical sequences were studied: (1) the location of support-glottis (poor), chest (better), abdomen (best); (2) locations of resonance-hard palate/straight tone (poor), mouth (better), sinus/head (best). Measures were obtained for a single frequency (196 Hz), the vowel /ae/, and for mezzo-forte loudness using the /pae pae pae/ technique. Sequence differences: The support sequence was characterized by formant frequency lowering suggestive of vocal tract lengthening. The resonance sequence was characterized by flow (AC, mean flow) and abduction increases. Sequence similarities: The best locations had the widest F2 bandwidths. The better and best locations had the largest dB difference between F2 and F3. Although acoustic power increased through the sequences, the acoustic efficiency was not a discriminating factor. Open and speed quotients were not differentiating. The flow resistance was highest and aerodynamic power the lowest for the first of each sequence. Combined data: The maximum flow declination rate correlated highly with the AC flow (r=-0.92) and SPL (r=0.901).
ACLAME: a CLAssification of Mobile genetic Elements, update 2010.
Leplae, Raphaël; Lima-Mendez, Gipsi; Toussaint, Ariane
2010-01-01
The ACLAME database is dedicated to the collection, analysis and classification of sequenced mobile genetic elements (MGEs, in particular phages and plasmids). In addition to providing information on the MGEs content, classifications are available at various levels of organization. At the gene/protein level, families group similar sequences that are expected to share the same function. Families of four or more proteins are manually assigned with a functional annotation using the GeneOntology and the locally developed ontology MeGO dedicated to MGEs. At the genome level, evolutionary cohesive modules group sets of protein families shared among MGEs. At the population level, networks display the reticulate evolutionary relationships among MGEs. To increase the coverage of the phage sequence space, ACLAME version 0.4 incorporates 760 high-quality predicted prophages selected from the Prophinder database. Most of the data can be downloaded from the freely accessible ACLAME web site (http://aclame.ulb.ac.be). The BLAST interface for querying the database has been extended and numerous tools for in-depth analysis of the results have been added.
Upper Cretaceous sequences and sea-level history, New Jersey Coastal Plain
Miller, K.G.; Sugarman, P.J.; Browning, J.V.; Kominz, M.A.; Olsson, R.K.; Feigenson, M.D.; Hernandez, J.C.
2004-01-01
We developed a Late Cretaceous sealevel estimate from Upper Cretaceous sequences at Bass River and Ancora, New Jersey (ODP [Ocean Drilling Program] Leg 174AX). We dated 11-14 sequences by integrating Sr isotope and biostratigraphy (age resolution ??0.5 m.y.) and then estimated paleoenvironmental changes within the sequences from lithofacies and biofacies analyses. Sequences generally shallow upsection from middle-neritic to inner-neritic paleodepths, as shown by the transition from thin basal glauconite shelf sands (transgressive systems tracts [TST]), to medial-prodelta silty clays (highstand systems tracts [HST]), and finally to upper-delta-front quartz sands (HST). Sea-level estimates obtained by backstripping (accounting for paleodepth variations, sediment loading, compaction, and basin subsidence) indicate that large (>25 m) and rapid (???1 m.y.) sea-level variations occurred during the Late Cretaceous greenhouse world. The fact that the timing of Upper Cretaceous sequence boundaries in New Jersey is similar to the sea-level lowering records of Exxon Production Research Company (EPR), northwest European sections, and Russian platform outcrops points to a global cause. Because backstripping, seismicity, seismic stratigraphic data, and sediment-distribution patterns all indicate minimal tectonic effects on the New Jersey Coastal Plain, we interpret that we have isolated a eustatic signature. The only known mechanism that can explain such global changes-glacio-eustasy-is consistent with foraminiferal ??18O data. Either continental ice sheets paced sea-level changes during the Late Cretaceous, or our understanding of causal mechanisms for global sea-level change is fundamentally flawed. Comparison of our eustatic history with published ice-sheet models and Milankovitch predictions suggests that small (5-10 ?? 106 km3), ephemeral, and areally restricted Antarctic ice sheets paced the Late Cretaceous global sea-level change. New Jersey and Russian eustatic estimates are typically one-half of the EPR amplitudes, though this difference varies through time, yielding markedly different eustatic curves. We conclude that New Jersey provides the best available estimate for Late Cretaceous sea-level variations. ?? 2004 Geological Society America.
A comparative analysis of serpin genes in the silkworm genome
Zou, Zhen; Picheng, Zhao; Weng, Hua; Mita, Kazuei; Jiang, Haobo
2009-01-01
Serine protease inhibitors (serpins) are a superfamily of proteins, most of which control protease-mediated processes by inhibiting their cognate enzymes. Sequencing of the silkworm genome provides an opportunity to investigate serpin structure, function, and evolution at the genome level. There are thirty-four serpin genes in Bombyx mori. Six are highly similar to their Manduca sexta orthologs that regulate innate immunity. Three alternative exons in serpin1 gene and four in serpin28 encode a variable region including the reactive site loop. Splicing of serpin2 pre-mRNA yields variations in serpin2A, 2A′ and 2B. Sequence similarity and intron positions reveal the evolutionary pathway of seven serpin genes in group C. RT-PCR indicates an increase in the mRNA levels of serpin1, 3, 5, 6, 9, 12, 13, 25, 27, 32 and 34 in fat body and hemocytes of larvae injected with bacteria. These results suggest that the silkworm serpins play regulatory roles in defense responses. PMID:19150649
Sequence information signal processor
Peterson, John C.; Chow, Edward T.; Waterman, Michael S.; Hunkapillar, Timothy J.
1999-01-01
An electronic circuit is used to compare two sequences, such as genetic sequences, to determine which alignment of the sequences produces the greatest similarity. The circuit includes a linear array of series-connected processors, each of which stores a single element from one of the sequences and compares that element with each successive element in the other sequence. For each comparison, the processor generates a scoring parameter that indicates which segment ending at those two elements produces the greatest degree of similarity between the sequences. The processor uses the scoring parameter to generate a similar scoring parameter for a comparison between the stored element and the next successive element from the other sequence. The processor also delivers the scoring parameter to the next processor in the array for use in generating a similar scoring parameter for another pair of elements. The electronic circuit determines which processor and alignment of the sequences produce the scoring parameter with the highest value.
Estimation of pairwise sequence similarity of mammalian enhancers with word neighbourhood counts.
Göke, Jonathan; Schulz, Marcel H; Lasserre, Julia; Vingron, Martin
2012-03-01
The identity of cells and tissues is to a large degree governed by transcriptional regulation. A major part is accomplished by the combinatorial binding of transcription factors at regulatory sequences, such as enhancers. Even though binding of transcription factors is sequence-specific, estimating the sequence similarity of two functionally similar enhancers is very difficult. However, a similarity measure for regulatory sequences is crucial to detect and understand functional similarities between two enhancers and will facilitate large-scale analyses like clustering, prediction and classification of genome-wide datasets. We present the standardized alignment-free sequence similarity measure N2, a flexible framework that is defined for word neighbourhoods. We explore the usefulness of adding reverse complement words as well as words including mismatches into the neighbourhood. On simulated enhancer sequences as well as functional enhancers in mouse development, N2 is shown to outperform previous alignment-free measures. N2 is flexible, faster than competing methods and less susceptible to single sequence noise and the occurrence of repetitive sequences. Experiments on the mouse enhancers reveal that enhancers active in different tissues can be separated by pairwise comparison using N2. N2 represents an improvement over previous alignment-free similarity measures without compromising speed, which makes it a good candidate for large-scale sequence comparison of regulatory sequences. The software is part of the open-source C++ library SeqAn (www.seqan.de) and a compiled version can be downloaded at http://www.seqan.de/projects/alf.html. Supplementary data are available at Bioinformatics online.
Taxonomic resolutions based on 18S rRNA genes: a case study of subclass copepoda.
Wu, Shu; Xiong, Jie; Yu, Yuhe
2015-01-01
Biodiversity studies are commonly conducted using 18S rRNA genes. In this study, we compared the inter-species divergence of variable regions (V1-9) within the copepod 18S rRNA gene, and tested their taxonomic resolutions at different taxonomic levels. Our results indicate that the 18S rRNA gene is a good molecular marker for the study of copepod biodiversity, and our conclusions are as follows: 1) 18S rRNA genes are highly conserved intra-species (intra-species similarities are close to 100%); and could aid in species-level analyses, but with some limitations; 2) nearly-whole-length sequences and some partial regions (around V2, V4, and V9) of the 18S rRNA gene can be used to discriminate between samples at both the family and order levels (with a success rate of about 80%); 3) compared with other regions, V9 has a higher resolution at the genus level (with an identification success rate of about 80%); and 4) V7 is most divergent in length, and would be a good candidate marker for the phylogenetic study of Acartia species. This study also evaluated the correlation between similarity thresholds and the accuracy of using nuclear 18S rRNA genes for the classification of organisms in the subclass Copepoda. We suggest that sample identification accuracy should be considered when a molecular sequence divergence threshold is used for taxonomic identification, and that the lowest similarity threshold should be determined based on a pre-designated level of acceptable accuracy.
Taxonomic Resolutions Based on 18S rRNA Genes: A Case Study of Subclass Copepoda
Wu, Shu; Xiong, Jie; Yu, Yuhe
2015-01-01
Biodiversity studies are commonly conducted using 18S rRNA genes. In this study, we compared the inter-species divergence of variable regions (V1–9) within the copepod 18S rRNA gene, and tested their taxonomic resolutions at different taxonomic levels. Our results indicate that the 18S rRNA gene is a good molecular marker for the study of copepod biodiversity, and our conclusions are as follows: 1) 18S rRNA genes are highly conserved intra-species (intra-species similarities are close to 100%); and could aid in species-level analyses, but with some limitations; 2) nearly-whole-length sequences and some partial regions (around V2, V4, and V9) of the 18S rRNA gene can be used to discriminate between samples at both the family and order levels (with a success rate of about 80%); 3) compared with other regions, V9 has a higher resolution at the genus level (with an identification success rate of about 80%); and 4) V7 is most divergent in length, and would be a good candidate marker for the phylogenetic study of Acartia species. This study also evaluated the correlation between similarity thresholds and the accuracy of using nuclear 18S rRNA genes for the classification of organisms in the subclass Copepoda. We suggest that sample identification accuracy should be considered when a molecular sequence divergence threshold is used for taxonomic identification, and that the lowest similarity threshold should be determined based on a pre-designated level of acceptable accuracy. PMID:26107258
Game-like tasks for comparative research: leveling the playing field
NASA Technical Reports Server (NTRS)
Washburn, D. A.; Gulledge, J. P.; Rumbaugh, D. M. (Principal Investigator)
1995-01-01
Game-like computer tasks offer many benefits for psychological research. In this paper, the usefulness of such tasks to bridge population differences (e.g., age, intelligence, species) is discussed and illustrated. A task called ALVIN was used to assess humans' and monkeys' working memory for sequences of colors with or without tones. Humans repeated longer lists than did the monkeys, and only humans benefited when the visual stimuli were accompanied by auditory cues. However, the monkeys did recall sequences at levels comparable to those reported elsewhere for children. Comparison of similarities and differences between the species is possible because the two groups were tested with exactly the same game-like paradigm.
Game-like tasks for comparative research: leveling the playing field.
Washburn, D A; Gulledge, J P
1995-01-01
Game-like computer tasks offer many benefits for psychological research. In this paper, the usefulness of such tasks to bridge population differences (e.g., age, intelligence, species) is discussed and illustrated. A task called ALVIN was used to assess humans' and monkeys' working memory for sequences of colors with or without tones. Humans repeated longer lists than did the monkeys, and only humans benefited when the visual stimuli were accompanied by auditory cues. However, the monkeys did recall sequences at levels comparable to those reported elsewhere for children. Comparison of similarities and differences between the species is possible because the two groups were tested with exactly the same game-like paradigm.
Molecular identification of catalases from Nicotiana plumbaginifolia (L.).
Willekens, H; Villarroel, R; Van Montagu, M; Inzé, D; Van Camp, W
1994-09-19
We have isolated three different catalase cDNAs from Nicotiana plumbaginifolia (cat1, cat2, and cat3) and a partial sequence of a fourth catalase gene (cat4) that shows no discernible expression based on Northern analysis. The catalase sequences were used to determine the similarity with other plant catalases and to study the transcriptional response to paraquat, 3-aminotriazole, and salicylic acid. 3-Aminotriazole induces mRNA levels of cat1, cat2 and cat3, indicating that a reduction in catalase activity positively affects catalase mRNA abundance. Salicylic acid that binds catalase in vitro, had no effect on catalase transcript levels at physiological concentrations. Paraquat resulted in the induction of cat1.
Girma, Gezahegn; Hyma, Katie E; Asiedu, Robert; Mitchell, Sharon E; Gedil, Melaku; Spillane, Charles
2014-08-01
Genotyping by sequencing (GBS) is used to understand the origin and domestication of guinea yams, including the contribution of wild relatives and polyploidy events to the cultivated guinea yams. Patterns of genetic diversity within and between two cultivated guinea yams (Dioscorea rotundata and D. cayenensis) and five wild relatives (D. praehensilis, D. mangenotiana, D. abyssinica, D. togoensis and D. burkilliana) were investigated using next-generation sequencing (genotyping by sequencing, GBS). Additionally, the two cultivated species were assessed for intra-specific morphological and ploidy variation. In guinea yams, ploidy level is correlated with species identity. Using flow cytometry a single ploidy level was inferred across D. cayenensis (3x, N = 21), D. praehensilis (2x, N = 7), and D. mangenotiana (3x, N = 5) accessions, whereas both diploid and triploid (or aneuploid) accessions were present in D. rotundata (N = 11 and N = 32, respectively). Multi-dimensional scaling and maximum parsimony analyses of 2,215 SNPs revealed that wild guinea yam populations form discrete genetic groupings according to species. D. togoensis and D. burkilliana were most distant from the two cultivated yam species, whereas D. abyssinica, D. mangenotiana, and D. praehensilis were closest to cultivated yams. In contrast, cultivated species were genetically less clearly defined at the intra-specific level. While D. cayenensis formed a single genetic group, D. rotundata comprised three separate groups consisting of; (1) a set of diploid individuals genetically similar to D. praehensilis, (2) a set of diploid individuals genetically similar to D. cayenensis, and (3) a set of triploid individuals. The current study demonstrates the utility of GBS for assessing yam genomic diversity. Combined with morphological and biological data, GBS provides a powerful tool for testing hypotheses regarding the evolution, domestication and breeding of guinea yams.
Is the phonological similarity effect in working memory due to proactive interference?
Baddeley, Alan D; Hitch, Graham J; Quinlan, Philip T
2018-04-12
Immediate serial recall of verbal material is highly sensitive to impairment attributable to phonological similarity. Although this has traditionally been interpreted as a within-sequence similarity effect, Engle (2007) proposed an interpretation based on interference from prior sequences, a phenomenon analogous to that found in the Peterson short-term memory (STM) task. We use the method of serial reconstruction to test this in an experiment contrasting the standard paradigm in which successive sequences are drawn from the same set of phonologically similar or dissimilar words and one in which the vowel sound on which similarity is based is switched from trial to trial, a manipulation analogous to that producing release from PI in the Peterson task. A substantial similarity effect occurs under both conditions although there is a small advantage from switching across similar sequences. There is, however, no evidence for the suggestion that the similarity effect will be absent from the very first sequence tested. Our results support the within-sequence similarity rather than a between-list PI interpretation. Reasons for the contrast with the classic Peterson short-term forgetting task are briefly discussed. (PsycINFO Database Record (c) 2018 APA, all rights reserved).
Differences in the emergent coding properties of cortical and striatal ensembles
Ma, L.; Hyman, J.M.; Lindsay, A.J.; Phillips, A.G.; Seamans, J.K.
2016-01-01
The function of a given brain region is often defined by the coding properties of its individual neurons, yet how this information is combined at the ensemble level is an equally important consideration. In the present study, multiple neurons from the anterior cingulate cortex (ACC) and the dorsal striatum (DS) were recorded simultaneously as rats performed different sequences of the same three actions. Sequence and lever decoding was remarkably similar on a per-neuron basis in the two regions. At the ensemble level, sequence-specific representations in the DS appeared synchronously but transiently along with the representation of lever location, while these two streams of information appeared independently and asynchronously in the ACC. As a result the ACC achieved superior ensemble decoding accuracy overall. Thus, the manner in which information was combined across neurons in an ensemble determined the functional separation of the ACC and DS on this task. PMID:24974796
Sadkowska-Todys, M
2000-01-01
The aims of these studies were: genetic characteristic of street rabies virus strains isolated from different animal species in Poland and determination of phylogenetic relationships to reference laboratory strains of the street rabies viruses belonging to genotype 1 and 5. The variability of rabies isolates and their phylogenetic relationship were studied by comparing the nucleotide sequence of the virus genome fragment. The Polish strains of genotype 1 belong to four phylogenetic groups (NE, CE, NEE, EE) corresponding to four variants: fox-racoon dog (F-RD); European fox 1 (F1); European fox 2 (F2) and European fox 3 (F3). On the Polish territories there are no rabies strains representing the variant dog-wolf and typical for arctic fox variant. The similarity of nucleotide and amino acid sequences of street rabies strains belonging to genotype 1 and laboratory strain CVS is very high. It is about 91% similarity at nucleotide level and 95% at amino acid level. Rabies strain CVS is similar to genotype 5 bat strains (EBL 1) only in about 69% and 74% at nucleotide and amino acid level, respectively. The genetic divergence of rabies strains circulating in Poland raised the need of permanent epidemiological and virological surveillance. The genotype and variant of isolated strains should be determined (using PCR and RLFP methods).
Shimizu, Renee E; Wu, Allan D; Knowlton, Barbara J
2016-12-01
Effective learning results not only in improved performance on a practiced task, but also in the ability to transfer the acquired knowledge to novel, similar tasks. Using a modified serial reaction time (RT) task, the authors examined the ability to transfer to novel sequences after practicing sequences in a repetitive order versus a nonrepeating interleaved order. Interleaved practice resulted in better performance on new sequences than repetitive practice. In a second study, participants practiced interleaved sequences in a functional MRI (fMRI) scanner and received a transfer test of novel sequences. Transfer ability was positively correlated with cerebellar blood oxygen level dependent activity during practice, indicating that greater cerebellar engagement during training resulted in better subsequent transfer performance. Interleaved practice may thus result in a more generalized representation that is robust to interference, and the degree of activation in the cerebellum may be a reflection of the instantiation and engagement of internal models. (PsycINFO Database Record (c) 2016 APA, all rights reserved).
Innovation and nested preferential growth in chess playing behavior
NASA Astrophysics Data System (ADS)
Perotti, J. I.; Jo, H.-H.; Schaigorodsky, A. L.; Billoni, O. V.
2013-11-01
Complexity develops via the incorporation of innovative properties. Chess is one of the most complex strategy games, where expert contenders exercise decision making by imitating old games or introducing innovations. In this work, we study innovation in chess by analyzing how different move sequences are played at the population level. It is found that the probability of exploring a new or innovative move decreases as a power law with the frequency of the preceding move sequence. Chess players also exploit already known move sequences according to their frequencies, following a preferential growth mechanism. Furthermore, innovation in chess exhibits Heaps' law suggesting similarities with the process of vocabulary growth. We propose a robust generative mechanism based on nested Yule-Simon preferential growth processes that reproduces the empirical observations. These results, supporting the self-similar nature of innovations in chess are important in the context of decision making in a competitive scenario, and extend the scope of relevant findings recently discovered regarding the emergence of Zipf's law in chess.
(GTG)5 microsatellite regions in citrinin-producing Penicillium.
Di Conza, José Alejandro; Nepote, Andrea Fabiana; González, Ana María; Lurá, María Cristina
2007-03-01
Morphological and cultural characteristics, as well as biochemical properties, are the main criteria used in fungal taxonomy and in the standard description of fungi species. Sometimes, however, this criterion is difficult to apply due to fungal phenotypic variations. This is particularly true in the genus Penicillium. The aims of this work were to determine (GTG)5 microsatellite sequence in potentially citrinin-producing Penicillium strains and to investigate if this sequence could be useful to characterize such fungi. Penicillium citrinum Thom and Penicillium chrysogenum Thom were isolated from different foods. The identification of the isolates at species level was carried out according to classical taxonomy. The production of citrinin was determined by thin layer chromatography. This study proved that microsatellite regions exist as short repeated sequences in all tested strains. The patterns were very similar for all P. citrinum isolates and it was possible to group them in function of the quantity of citrinin produced. Yet, not similar clusters were obtained when P. chrysogenum isolates were analyzed.
The mathematical relationship between Zipf’s law and the hierarchical scaling law
NASA Astrophysics Data System (ADS)
Chen, Yanguang
2012-06-01
The empirical studies of city-size distribution show that Zipf's law and the hierarchical scaling law are linked in many ways. The rank-size scaling and hierarchical scaling seem to be two different sides of the same coin, but their relationship has never been revealed by strict mathematical proof. In this paper, the Zipf's distribution of cities is abstracted as a q-sequence. Based on this sequence, a self-similar hierarchy consisting of many levels is defined and the numbers of cities in different levels form a geometric sequence. An exponential distribution of the average size of cities is derived from the hierarchy. Thus we have two exponential functions, from which follows a hierarchical scaling equation. The results can be statistically verified by simple mathematical experiments and observational data of cities. A theoretical foundation is then laid for the conversion from Zipf's law to the hierarchical scaling law, and the latter can show more information about city development than the former. Moreover, the self-similar hierarchy provides a new perspective for studying networks of cities as complex systems. A series of mathematical rules applied to cities such as the allometric growth law, the 2n principle and Pareto's law can be associated with one another by the hierarchical organization.
PuLSE: Quality control and quantification of peptide sequences explored by phage display libraries.
Shave, Steven; Mann, Stefan; Koszela, Joanna; Kerr, Alastair; Auer, Manfred
2018-01-01
The design of highly diverse phage display libraries is based on assumption that DNA bases are incorporated at similar rates within the randomized sequence. As library complexity increases and expected copy numbers of unique sequences decrease, the exploration of library space becomes sparser and the presence of truly random sequences becomes critical. We present the program PuLSE (Phage Library Sequence Evaluation) as a tool for assessing randomness and therefore diversity of phage display libraries. PuLSE runs on a collection of sequence reads in the fastq file format and generates tables profiling the library in terms of unique DNA sequence counts and positions, translated peptide sequences, and normalized 'expected' occurrences from base to residue codon frequencies. The output allows at-a-glance quantitative quality control of a phage library in terms of sequence coverage both at the DNA base and translated protein residue level, which has been missing from toolsets and literature. The open source program PuLSE is available in two formats, a C++ source code package for compilation and integration into existing bioinformatics pipelines and precompiled binaries for ease of use.
Gopal, J; Yebra, M J; Bhagwat, A S
1994-01-01
The methyltransferase (MTase) in the DsaV restriction--modification system methylates within 5'-CCNGG sequences. We have cloned the gene for this MTase and determined its sequence. The predicted sequence of the MTase protein contains sequence motifs conserved among all cytosine-5 MTases and is most similar to other MTases that methylate CCNGG sequences, namely M.ScrFI and M.SsoII. All three MTases methylate the internal cytosine within their recognition sequence. The 'variable' region within the three enzymes that methylate CCNGG can be aligned with the sequences of two enzymes that methylate CCWGG sequences. Remarkably, two segments within this region contain significant similarity with the region of M.HhaI that is known to contact DNA bases. These alignments suggest that many cytosine-5 MTases are likely to interact with DNA using a similar structural framework. Images PMID:7971279
Song, Yuhyun; Leman, Scotland; Monteil, Caroline L.; Heath, Lenwood S.; Vinatzer, Boris A.
2014-01-01
A broadly accepted and stable biological classification system is a prerequisite for biological sciences. It provides the means to describe and communicate about life without ambiguity. Current biological classification and nomenclature use the species as the basic unit and require lengthy and laborious species descriptions before newly discovered organisms can be assigned to a species and be named. The current system is thus inadequate to classify and name the immense genetic diversity within species that is now being revealed by genome sequencing on a daily basis. To address this lack of a general intra-species classification and naming system adequate for today’s speed of discovery of new diversity, we propose a classification and naming system that is exclusively based on genome similarity and that is suitable for automatic assignment of codes to any genome-sequenced organism without requiring any phenotypic or phylogenetic analysis. We provide examples demonstrating that genome similarity-based codes largely align with current taxonomic groups at many different levels in bacteria, animals, humans, plants, and viruses. Importantly, the proposed approach is only slightly affected by the order of code assignment and can thus provide codes that reflect similarity between organisms and that do not need to be revised upon discovery of new diversity. We envision genome similarity-based codes to complement current biological nomenclature and to provide a universal means to communicate unambiguously about any genome-sequenced organism in fields as diverse as biodiversity research, infectious disease control, human and microbial forensics, animal breed and plant cultivar certification, and human ancestry research. PMID:24586551
Substrate-Driven Mapping of the Degradome by Comparison of Sequence Logos
Fuchs, Julian E.; von Grafenstein, Susanne; Huber, Roland G.; Kramer, Christian; Liedl, Klaus R.
2013-01-01
Sequence logos are frequently used to illustrate substrate preferences and specificity of proteases. Here, we employed the compiled substrates of the MEROPS database to introduce a novel metric for comparison of protease substrate preferences. The constructed similarity matrix of 62 proteases can be used to intuitively visualize similarities in protease substrate readout via principal component analysis and construction of protease specificity trees. Since our new metric is solely based on substrate data, we can engraft the protease tree including proteolytic enzymes of different evolutionary origin. Thereby, our analyses confirm pronounced overlaps in substrate recognition not only between proteases closely related on sequence basis but also between proteolytic enzymes of different evolutionary origin and catalytic type. To illustrate the applicability of our approach we analyze the distribution of targets of small molecules from the ChEMBL database in our substrate-based protease specificity trees. We observe a striking clustering of annotated targets in tree branches even though these grouped targets do not necessarily share similarity on protein sequence level. This highlights the value and applicability of knowledge acquired from peptide substrates in drug design of small molecules, e.g., for the prediction of off-target effects or drug repurposing. Consequently, our similarity metric allows to map the degradome and its associated drug target network via comparison of known substrate peptides. The substrate-driven view of protein-protein interfaces is not limited to the field of proteases but can be applied to any target class where a sufficient amount of known substrate data is available. PMID:24244149
BLAST and FASTA similarity searching for multiple sequence alignment.
Pearson, William R
2014-01-01
BLAST, FASTA, and other similarity searching programs seek to identify homologous proteins and DNA sequences based on excess sequence similarity. If two sequences share much more similarity than expected by chance, the simplest explanation for the excess similarity is common ancestry-homology. The most effective similarity searches compare protein sequences, rather than DNA sequences, for sequences that encode proteins, and use expectation values, rather than percent identity, to infer homology. The BLAST and FASTA packages of sequence comparison programs provide programs for comparing protein and DNA sequences to protein databases (the most sensitive searches). Protein and translated-DNA comparisons to protein databases routinely allow evolutionary look back times from 1 to 2 billion years; DNA:DNA searches are 5-10-fold less sensitive. BLAST and FASTA can be run on popular web sites, but can also be downloaded and installed on local computers. With local installation, target databases can be customized for the sequence data being characterized. With today's very large protein databases, search sensitivity can also be improved by searching smaller comprehensive databases, for example, a complete protein set from an evolutionarily neighboring model organism. By default, BLAST and FASTA use scoring strategies target for distant evolutionary relationships; for comparisons involving short domains or queries, or searches that seek relatively close homologs (e.g. mouse-human), shallower scoring matrices will be more effective. Both BLAST and FASTA provide very accurate statistical estimates, which can be used to reliably identify protein sequences that diverged more than 2 billion years ago.
Extensive Concerted Evolution of Rice Paralogs and the Road to Regaining Independence
Wang, Xiyin; Tang, Haibao; Bowers, John E.; Feltus, Frank A.; Paterson, Andrew H.
2007-01-01
Many genes duplicated by whole-genome duplications (WGDs) are more similar to one another than expected. We investigated whether concerted evolution through conversion and crossing over, well-known to affect tandem gene clusters, also affects dispersed paralogs. Genome sequences for two Oryza subspecies reveal appreciable gene conversion in the ∼0.4 MY since their divergence, with a gradual progression toward independent evolution of older paralogs. Since divergence from subspecies indica, ∼8% of japonica paralogs produced 5–7 MYA on chromosomes 11 and 12 have been affected by gene conversion and several reciprocal exchanges of chromosomal segments, while ∼70-MY-old “paleologs” resulting from a genome duplication (GD) show much less conversion. Sequence similarity analysis in proximal gene clusters also suggests more conversion between younger paralogs. About 8% of paleologs may have been converted since rice–sorghum divergence ∼41 MYA. Domain-encoding sequences are more frequently converted than nondomain sequences, suggesting a sort of circularity—that sequences conserved by selection may be further conserved by relatively frequent conversion. The higher level of concerted evolution in the 5–7 MY-old segmental duplication may reflect the behavior of many genomes within the first few million years after duplication or polyploidization. PMID:18039882
Al-Bustan, Suzanne A; Al-Serri, Ahmad; Annice, Babitha G; Alnaqeeb, Majed A; Al-Kandari, Wafa Y; Dashti, Mohammed
2018-01-01
The role interethnic genetic differences play in plasma lipid level variation across populations is a global health concern. Several genes involved in lipid metabolism and transport are strong candidates for the genetic association with lipid level variation especially lipoprotein lipase (LPL). The objective of this study was to re-sequence the full LPL gene in Kuwaiti Arabs, analyse the sequence variation and identify variants that could attribute to variation in plasma lipid levels for further genetic association. Samples (n = 100) of an Arab ethnic group from Kuwait were analysed for sequence variation by Sanger sequencing across the 30 Kb LPL gene and its flanking sequences. A total of 293 variants including 252 single nucleotide polymorphisms (SNPs) and 39 insertions/deletions (InDels) were identified among which 47 variants (32 SNPs and 15 InDels) were novel to Kuwaiti Arabs. This study is the first to report sequence data and analysis of frequencies of variants at the LPL gene locus in an Arab ethnic group with a novel "rare" variant (LPL:g.18704C>A) significantly associated to HDL (B = -0.181; 95% CI (-0.357, -0.006); p = 0.043), TG (B = 0.134; 95% CI (0.004-0.263); p = 0.044) and VLDL (B = 0.131; 95% CI (-0.001-0.263); p = 0.043) levels. Sequence variation in Kuwaiti Arabs was compared to other populations and was found to be similar with regards to the number of SNPs, InDels and distribution of the number of variants across the LPL gene locus and minor allele frequency (MAF). Moreover, comparison of the identified variants and their MAF with other reports provided a list of 46 potential variants across the LPL gene to be considered for future genetic association studies. The findings warrant further investigation into the association of g.18704C>A with lipid levels in other ethnic groups and with clinical manifestations of dyslipidemia.
Al-Serri, Ahmad; Annice, Babitha G.; Alnaqeeb, Majed A.; Al-Kandari, Wafa Y.; Dashti, Mohammed
2018-01-01
The role interethnic genetic differences play in plasma lipid level variation across populations is a global health concern. Several genes involved in lipid metabolism and transport are strong candidates for the genetic association with lipid level variation especially lipoprotein lipase (LPL). The objective of this study was to re-sequence the full LPL gene in Kuwaiti Arabs, analyse the sequence variation and identify variants that could attribute to variation in plasma lipid levels for further genetic association. Samples (n = 100) of an Arab ethnic group from Kuwait were analysed for sequence variation by Sanger sequencing across the 30 Kb LPL gene and its flanking sequences. A total of 293 variants including 252 single nucleotide polymorphisms (SNPs) and 39 insertions/deletions (InDels) were identified among which 47 variants (32 SNPs and 15 InDels) were novel to Kuwaiti Arabs. This study is the first to report sequence data and analysis of frequencies of variants at the LPL gene locus in an Arab ethnic group with a novel “rare” variant (LPL:g.18704C>A) significantly associated to HDL (B = -0.181; 95% CI (-0.357, -0.006); p = 0.043), TG (B = 0.134; 95% CI (0.004–0.263); p = 0.044) and VLDL (B = 0.131; 95% CI (-0.001–0.263); p = 0.043) levels. Sequence variation in Kuwaiti Arabs was compared to other populations and was found to be similar with regards to the number of SNPs, InDels and distribution of the number of variants across the LPL gene locus and minor allele frequency (MAF). Moreover, comparison of the identified variants and their MAF with other reports provided a list of 46 potential variants across the LPL gene to be considered for future genetic association studies. The findings warrant further investigation into the association of g.18704C>A with lipid levels in other ethnic groups and with clinical manifestations of dyslipidemia. PMID:29438437
High-resolution Fourier transform spectroscopy of the Meinel system of OH
NASA Technical Reports Server (NTRS)
Abrams, Mark C.; Davis, Sumner P.; Rao, M. L. P.; Engleman, Rolf, Jr.; Brault, James W.
1994-01-01
The infrared spectrum of the hydroxyl radical OH, between 1850 and 9000/cm has been measured with a Fourier transform spectrometer. The source, a hydrogen-ozone diffusion flame, was designed to study the excitation of rotation-vibration levels of the OH Meinel bands under conditions similar to those in the upper atmosphere which produce the nighttime OH airglow emission. Twenty-three bands were observed: nine bands in the Delta upsilon = 1 sequence, nine bands in the Delta upsilon = 2 sequence, and five bands in the Delta upsilon = 3 sequence. A global nonlinear least-squares fit of 1696 lines yielded molecular parameters with a standard deviation of 0.003/cm. Term values are computed, and transition frequencies in the Delta upsilon = 3, 4, 5, 6 sequences in the near-infrared are predicted.
Dual-Layer Video Encryption using RSA Algorithm
NASA Astrophysics Data System (ADS)
Chadha, Aman; Mallik, Sushmit; Chadha, Ankit; Johar, Ravdeep; Mani Roja, M.
2015-04-01
This paper proposes a video encryption algorithm using RSA and Pseudo Noise (PN) sequence, aimed at applications requiring sensitive video information transfers. The system is primarily designed to work with files encoded using the Audio Video Interleaved (AVI) codec, although it can be easily ported for use with Moving Picture Experts Group (MPEG) encoded files. The audio and video components of the source separately undergo two layers of encryption to ensure a reasonable level of security. Encryption of the video component involves applying the RSA algorithm followed by the PN-based encryption. Similarly, the audio component is first encrypted using PN and further subjected to encryption using the Discrete Cosine Transform. Combining these techniques, an efficient system, invulnerable to security breaches and attacks with favorable values of parameters such as encryption/decryption speed, encryption/decryption ratio and visual degradation; has been put forth. For applications requiring encryption of sensitive data wherein stringent security requirements are of prime concern, the system is found to yield negligible similarities in visual perception between the original and the encrypted video sequence. For applications wherein visual similarity is not of major concern, we limit the encryption task to a single level of encryption which is accomplished by using RSA, thereby quickening the encryption process. Although some similarity between the original and encrypted video is observed in this case, it is not enough to comprehend the happenings in the video.
A critical evaluation of random copolymer mimesis of homogeneous antimicrobial peptides
Hu, Kan; Schmidt, Nathan W.; Zhu, Rui; Jiang, Yunjiang; Lai, Ghee Hwee; Wei, Gang; Palermo, Edmund F.; Kuroda, Kenichi; Wong, Gerard C. L.; Yang, Lihua
2013-01-01
Polymeric synthetic mimics of antimicrobial peptides (SMAMPs) have recently demonstrated similar antimicrobial activity as natural antimicrobial peptides (AMPs) from innate immunity. This is surprising, since polymeric SMAMPs are heterogeneous in terms of chemical structure (random sequence) and conformation (random coil), in contrast to defined amino acid sequence and intrinsic secondary structure. To understand this better, we compare AMPs with a ‘minimal’ mimic, a well characterized family of polydisperse cationic methacrylate-based random copolymer SMAMPs. Specifically, we focus on a comparison between the quantifiable membrane curvature generating capacity, charge density, and hydrophobicity of the polymeric SMAMPs and AMPs. Synchrotron small angle x-ray scattering (SAXS) results indicate that typical AMPs and these methacrylate SMAMPs generate similar amounts of membrane negative Gaussian curvature (NGC), which is topologically necessary for a variety of membrane-destabilizing processes. Moreover, the curvature generating ability of SMAMPs is more tolerant of changes in the lipid composition than that of natural AMPs with similar chemical groups, consistent with the lower specificity of SMAMPs. We find that, although the amount of NGC generated by these SMAMPs and AMPs are similar, the SMAMPs require significantly higher levels of hydrophobicity and cationic charge to achieve the same level of membrane deformation. We propose an explanation for these differences, which has implications for new synthetic strategies aimed at improved mimesis of AMPs. PMID:23750051
Nikolaidis, Nikolas; Nei, Masatoshi
2004-03-01
We have identified the Hsp70 gene superfamily of the nematode Caenorhabditis briggsae and investigated the evolution of these genes in comparison with Hsp70 genes from C. elegans, Drosophila, and yeast. The Hsp70 genes are classified into three monophyletic groups according to their subcellular localization, namely, cytoplasm (CYT), endoplasmic reticulum (ER), and mitochondria (MT). The Hsp110 genes can be classified into the polyphyletic CYT group and the monophyletic ER group. The different Hsp70 and Hsp110 groups appeared to evolve following the model of divergent evolution. This model can also explain the evolution of the ER and MT genes. On the other hand, the CYT genes are divided into heat-inducible and constitutively expressed genes. The constitutively expressed genes have evolved more or less following the birth-and-death process, and the rates of gene birth and gene death are different between the two nematode species. By contrast, some heat-inducible genes show an intraspecies phylogenetic clustering. This suggests that they are subject to sequence homogenization resulting from gene conversion-like events. In addition, the heat-inducible genes show high levels of sequence conservation in both intra-species and inter-species comparisons, and in most cases, amino acid sequence similarity is higher than nucleotide sequence similarity. This indicates that purifying selection also plays an important role in maintaining high sequence similarity among paralogous Hsp70 genes. Therefore, we suggest that the CYT heat-inducible genes have been subjected to a combination of purifying selection, birth-and-death process, and gene conversion-like events.
CLAST: CUDA implemented large-scale alignment search tool.
Yano, Masahiro; Mori, Hiroshi; Akiyama, Yutaka; Yamada, Takuji; Kurokawa, Ken
2014-12-11
Metagenomics is a powerful methodology to study microbial communities, but it is highly dependent on nucleotide sequence similarity searching against sequence databases. Metagenomic analyses with next-generation sequencing technologies produce enormous numbers of reads from microbial communities, and many reads are derived from microbes whose genomes have not yet been sequenced, limiting the usefulness of existing sequence similarity search tools. Therefore, there is a clear need for a sequence similarity search tool that can rapidly detect weak similarity in large datasets. We developed a tool, which we named CLAST (CUDA implemented large-scale alignment search tool), that enables analyses of millions of reads and thousands of reference genome sequences, and runs on NVIDIA Fermi architecture graphics processing units. CLAST has four main advantages over existing alignment tools. First, CLAST was capable of identifying sequence similarities ~80.8 times faster than BLAST and 9.6 times faster than BLAT. Second, CLAST executes global alignment as the default (local alignment is also an option), enabling CLAST to assign reads to taxonomic and functional groups based on evolutionarily distant nucleotide sequences with high accuracy. Third, CLAST does not need a preprocessed sequence database like Burrows-Wheeler Transform-based tools, and this enables CLAST to incorporate large, frequently updated sequence databases. Fourth, CLAST requires <2 GB of main memory, making it possible to run CLAST on a standard desktop computer or server node. CLAST achieved very high speed (similar to the Burrows-Wheeler Transform-based Bowtie 2 for long reads) and sensitivity (equal to BLAST, BLAT, and FR-HIT) without the need for extensive database preprocessing or a specialized computing platform. Our results demonstrate that CLAST has the potential to be one of the most powerful and realistic approaches to analyze the massive amount of sequence data from next-generation sequencing technologies.
2014-01-01
Sorption of phenanthrene onto the natural sediment with low organic carbon content (OC%), organic-free sediment, and kaolinite was investigated through isotherm experiments. Effects of cosolutes (pyrene, 4-n-nonyphenol (NP), and humic acid (HA)) on phenanthrene sorption were also studied by comparing apparent solid-water distribution coefficients (K d app) of phenanthrene. Two addition sequences, including “cosolute added prior to phenanthrene” and “cosolute and phenanthrene added simultaneously,” were adopted. The Freundlich model fits phenanthrene sorption on all 3 sorbents well. The sorption coefficients on these sorbents were similar, suggesting that mineral surface plays an important role in the sorption of hydrophobic organic contaminants on low OC% sediments. Cosolutes could affect phenanthrene sorption on the sorbents, which depended on their properties, concentrations, and addition sequences. Pyrene inhibited phenanthrene sorption. Sorbed NP inhibited phenanthrene sorption at low levels and promoted sorption at high levels. Similar to NP, effect of HA on phenanthrene sorption onto the natural sediment depended on its concentrations, whereas, for the organic-free sediment and kaolinite, preloading of HA at high levels led to an enhancement in phenanthrene K d app while no obvious effect was observed at low HA levels; dissolved HA could inhibit phenanthrene sorption on the two sorbents. PMID:25147865
DNA hypomethylation of individual sequences in aborted cloned bovine fetuses.
Chen, Tao; Jiang, Yan; Zhang, Yan-Ling; Liu, Jing-He; Hou, Yi; Schatten, Heide; Chen, Da-Yuan; Sun, Qing-Yuan
2005-09-01
Cloned bovines have a much higher abortion rate than those derived in vivo. Available evidence indicates that inappropriate epigenetic reprogramming of donor nuclei is the primary cause of cloning failure. To gain a better understanding of the DNA methylation changes associated with the high abortion rate of cloned bovines, we examined the DNA methylation status of a repeated sequence (satellite I) and the promoter regions of two single-copy genes (interleukin 3/cytokeratin) in aborted cloned fetuses, aborted fetuses derived from artificial insemination (AI), cloned adults and AI adults by bisulfite sequencing and restriction enzyme analysis. Two of four aborted cloned fetuses show very low methylation levels in the two single-copy gene promoter regions. One of the two fetuses also showed undermethylated status in the satellite I sequence. The other two aborted cloned fetuses have similar methylation levels to those of aborted AI fetuses. However, no difference in methylation was observed between cloned adults and AI adults. Our results demonstrate for the first time the undermethylated status of individual sequences in aborted cloned fetuses. These findings suggest that aberrant DNA methylation may contribute to the developmental failure of cloned bovine fetuses.
Discovering frequently recurring movement sequences in team-sport athlete spatiotemporal data.
Sweeting, Alice J; Aughey, Robert J; Cormack, Stuart J; Morgan, Stuart
2017-12-01
Athlete external load is typically analysed from predetermined movement thresholds. The combination of movement sequences and differences in these movements between playing positions is also currently unknown. This study developed a method to discover the frequently recurring movement sequences across playing position during matches. The external load of 12 international female netball athletes was collected by a local positioning system during four national-level matches. Velocity, acceleration and angular velocity were calculated from positional (X, Y) data, clustered via one-dimensional k-means and assigned a unique alphabetic label. Combinations of velocity, acceleration and angular velocity movement were compared using the Levenshtein distance and similarities computed by the longest common substring problem. The contribution of each movement sequence, according to playing position and relative to the wider data set, was then calculated via the Minkowski distance. A total of 10 frequently recurring combinations of movement were discovered, regardless of playing position. Only the wing attack, goal attack and goal defence playing positions are closely related. We developed a technique to discover the movement sequences, according to playing position, performed by elite netballers. This methodology can be extended to discover the frequently recurring movements within other team sports and across levels of competition.
An improved model for whole genome phylogenetic analysis by Fourier transform.
Yin, Changchuan; Yau, Stephen S-T
2015-10-07
DNA sequence similarity comparison is one of the major steps in computational phylogenetic studies. The sequence comparison of closely related DNA sequences and genomes is usually performed by multiple sequence alignments (MSA). While the MSA method is accurate for some types of sequences, it may produce incorrect results when DNA sequences undergone rearrangements as in many bacterial and viral genomes. It is also limited by its computational complexity for comparing large volumes of data. Previously, we proposed an alignment-free method that exploits the full information contents of DNA sequences by Discrete Fourier Transform (DFT), but still with some limitations. Here, we present a significantly improved method for the similarity comparison of DNA sequences by DFT. In this method, we map DNA sequences into 2-dimensional (2D) numerical sequences and then apply DFT to transform the 2D numerical sequences into frequency domain. In the 2D mapping, the nucleotide composition of a DNA sequence is a determinant factor and the 2D mapping reduces the nucleotide composition bias in distance measure, and thus improving the similarity measure of DNA sequences. To compare the DFT power spectra of DNA sequences with different lengths, we propose an improved even scaling algorithm to extend shorter DFT power spectra to the longest length of the underlying sequences. After the DFT power spectra are evenly scaled, the spectra are in the same dimensionality of the Fourier frequency space, then the Euclidean distances of full Fourier power spectra of the DNA sequences are used as the dissimilarity metrics. The improved DFT method, with increased computational performance by 2D numerical representation, can be applicable to any DNA sequences of different length ranges. We assess the accuracy of the improved DFT similarity measure in hierarchical clustering of different DNA sequences including simulated and real datasets. The method yields accurate and reliable phylogenetic trees and demonstrates that the improved DFT dissimilarity measure is an efficient and effective similarity measure of DNA sequences. Due to its high efficiency and accuracy, the proposed DFT similarity measure is successfully applied on phylogenetic analysis for individual genes and large whole bacterial genomes. Copyright © 2015 Elsevier Ltd. All rights reserved.
Arnold, Roland; Goldenberg, Florian; Mewes, Hans-Werner; Rattei, Thomas
2014-01-01
The Similarity Matrix of Proteins (SIMAP, http://mips.gsf.de/simap/) database has been designed to massively accelerate computationally expensive protein sequence analysis tasks in bioinformatics. It provides pre-calculated sequence similarities interconnecting the entire known protein sequence universe, complemented by pre-calculated protein features and domains, similarity clusters and functional annotations. SIMAP covers all major public protein databases as well as many consistently re-annotated metagenomes from different repositories. As of September 2013, SIMAP contains >163 million proteins corresponding to ∼70 million non-redundant sequences. SIMAP uses the sensitive FASTA search heuristics, the Smith–Waterman alignment algorithm, the InterPro database of protein domain models and the BLAST2GO functional annotation algorithm. SIMAP assists biologists by facilitating the interactive exploration of the protein sequence universe. Web-Service and DAS interfaces allow connecting SIMAP with any other bioinformatic tool and resource. All-against-all protein sequence similarity matrices of project-specific protein collections are generated on request. Recent improvements allow SIMAP to cover the rapidly growing sequenced protein sequence universe. New Web-Service interfaces enhance the connectivity of SIMAP. Novel tools for interactive extraction of protein similarity networks have been added. Open access to SIMAP is provided through the web portal; the portal also contains instructions and links for software access and flat file downloads. PMID:24165881
Helical Antifreeze Proteins Have Independently Evolved in Fishes on Four Occasions
Graham, Laurie A.; Hobbs, Rod S.; Fletcher, Garth L.; Davies, Peter L.
2013-01-01
Alanine-rich α-helical (type I) antifreeze proteins (AFPs) are produced by a variety of fish species from three different orders to protect against freezing in icy seawater. Interspersed amongst and within these orders are fishes making AFPs that are completely different in both sequence and structure. The origin of this variety of types I, II, III and antifreeze glycoproteins (AFGPs) has been attributed to adaptation following sea-level glaciations that occurred after the divergence of most of the extant families of fish. The presence of similar types of AFPs in distantly related fishes has been ascribed to lateral gene transfer in the case of the structurally complex globular type II lectin-like AFPs and to convergent evolution for the AFGPs, which consist of a well-conserved tripeptide repeat. In this paper, we examine the genesis of the type I AFPs, which are intermediate in complexity. These predominantly α-helical peptides share many features, such as putative capping structures, Ala-richness and amphipathic character. We have added to the type I repertoire by cloning additional sequences from sculpin and have found that the similarities between the type I AFPs of the four distinct groups of fishes are not borne out at the nucleotide level. Both the non-coding sequences and the codon usage patterns are strikingly different. We propose that these AFPs arose via convergence from different progenitor helices with a weak affinity for ice and that their similarity is dictated by the propensity of specific amino acids to form helices and to align water on one side of the helix into an ice-like pattern. PMID:24324684
Molecular Characterization of Epiphytic Bacterial Communities on Charophycean Green Algae
Fisher, Madeline M.; Wilcox, Lee W.; Graham, Linda E.
1998-01-01
Epiphytic bacterial communities within the sheath material of three filamentous green algae, Desmidium grevillii, Hyalotheca dissiliens, and Spondylosium pulchrum (class Charophyceae, order Zygnematales), collected from a Sphagnum bog were characterized by PCR amplification, cloning, and sequencing of 16S ribosomal DNA. A total of 20 partial sequences and nine different sequence types were obtained, and one sequence type was recovered from the bacterial communities on all three algae. By phylogenetic analysis, the cloned sequences were placed into several major lineages of the Bacteria domain: the Flexibacter/Cytophaga/Bacteroides phylum and the α, β, and γ subdivisions of the phylum Proteobacteria. Analysis at the subphylum level revealed that the majority of our sequences were not closely affiliated with those of known, cultured taxa, although the estimated evolutionary distances between our sequences and their nearest neighbors were always less than 0.1 (i.e., greater than 90% similar). This result suggests that the majority of sequences obtained in this study represent as yet phenotypically undescribed bacterial species and that the range of bacterial-algal interactions that occur in nature has not yet been fully described. PMID:9797295
Integrated sequencing of exome and mRNA of large-sized single cells.
Wang, Lily Yan; Guo, Jiajie; Cao, Wei; Zhang, Meng; He, Jiankui; Li, Zhoufang
2018-01-10
Current approaches of single cell DNA-RNA integrated sequencing are difficult to call SNPs, because a large amount of DNA and RNA is lost during DNA-RNA separation. Here, we performed simultaneous single-cell exome and transcriptome sequencing on individual mouse oocytes. Using microinjection, we kept the nuclei intact to avoid DNA loss, while retaining the cytoplasm inside the cell membrane, to maximize the amount of DNA and RNA captured from the single cell. We then conducted exome-sequencing on the isolated nuclei and mRNA-sequencing on the enucleated cytoplasm. For single oocytes, exome-seq can cover up to 92% of exome region with an average sequencing depth of 10+, while mRNA-sequencing reveals more than 10,000 expressed genes in enucleated cytoplasm, with similar performance for intact oocytes. This approach provides unprecedented opportunities to study DNA-RNA regulation, such as RNA editing at single nucleotide level in oocytes. In future, this method can also be applied to other large cells, including neurons, large dendritic cells and large tumour cells for integrated exome and transcriptome sequencing.
Seismic stratigraphy and late Quaternary shelf history, south-central Monterey Bay, California
Chin, J.L.; Clifton, H.E.; Mullins, H.T.
1988-01-01
The south-central Monterey Bay shelf is a high-energy, wave-dominated, tectonically active coastal region on the central California continental margin. A prominent feature of this shelf is a sediment lobe off the mouth of the Salinas River that has surface expression. High-resolution seismic-reflection profiles reveal that an angular unconformity (Quaternary?) underlies the entire shelf and separates undeformed strata above it from deformed strata below it. The Salinas River lobe is a convex bulge on the shelf covering an area of approximately 72 km2 in water depths from 10 to 90 m. It reaches a maximum thickness of 35 m about 2.5 km seaward of the river mouth and thins in all directions away from this point. Adjacent shelf areas are characterized by only a thin (2 to 5 m thick) and uniform veneer of sediment. Acoustic stratigraphy of the lobe is complex and is characterized by at least three unconformity-bounded depositional sequences. Acoustically, these sequences are relatively well bedded. Acoustic foresets occur within the intermediate sequence and dip seaward at 0.7?? to 2.0??. Comparison with sedimentary sequences in uplifted onshore Pleistocene marine-terrace deposits of the Monterey Bay area, which were presumably formed in a similar setting under similar processes, suggests that a general interpretation can be formulated for seismic stratigraphic patterns. Depositional sequences are interpreted to represent shallowing-upwards progradational sequences of marine to nonmarine coastal deposits formed during interglacial highstands and/or during early stages of falling sea level. Acoustic foresets within the intermediate sequence are evidence of seaward progradation. Acoustic unconformities that separate depositional sequences are interpreted as having formed largely by shoreface planation and may be the only record of the intervening transgressions. The internal stratigraphy of the Salinas River lobe thus suggests that at least several late Quaternary regressions and transgressions may be recorded under the present shelf. This record may represent the last major eustatic cycle of sea level, an interval not observed in uplifted onshore Pleistocene marine terraces. ?? 1988.
Garland, Ellen C; Noad, Michael J; Goldizen, Anne W; Lilley, Matthew S; Rekdahl, Melinda L; Garrigue, Claire; Constantine, Rochelle; Daeschler Hauser, Nan; Poole, M Michael; Robbins, Jooke
2013-01-01
Humpback whales have a continually evolving vocal sexual display, or "song," that appears to undergo both evolutionary and "revolutionary" change. All males within a population adhere to the current content and arrangement of the song. Populations within an ocean basin share similarities in their songs; this sharing is complex as multiple variations of the song (song types) may be present within a region at any one time. To quantitatively investigate the similarity of song types, songs were compared at both the individual singer and population level using the Levenshtein distance technique and cluster analysis. The highly stereotyped sequences of themes from the songs of 211 individuals from populations within the western and central South Pacific region from 1998 through 2008 were grouped together based on the percentage of song similarity, and compared to qualitatively assigned song types. The analysis produced clusters of highly similar songs that agreed with previous qualitative assignments. Each cluster contained songs from multiple populations and years, confirming the eastward spread of song types and their progressive evolution through the study region. Quantifying song similarity and exchange will assist in understanding broader song dynamics and contribute to the use of vocal displays as population identifiers.
Vakili Azghandi, Masoume; Nasiri, Mohammadreza; Shamsa, Ali; Jalali, Mohsen; Shariati, Mohammad Mahdi
2016-04-01
The SRY gene (SRY) provides instructions for making a transcription factor called the sex-determining region Y protein. The sex-determining region Y protein causes a fetus to develop as a male. In this study, SRY of 15 spices included of human, chimpanzee, dog, pig, rat, cattle, buffalo, goat, sheep, horse, zebra, frog, urial, dolphin and killer whale were used for determine of bioinformatic differences. Nucleotide sequences of SRY were retrieved from the NCBI databank. Bioinformatic analysis of SRY is done by CLC Main Workbench version 5.5 and ClustalW (http:/www.ebi.ac.uk/clustalw/) and MEGA6 softwares. The multiple sequence alignment results indicated that SRY protein sequences from Orcinus orca (killer whale) and Tursiopsaduncus (dolphin) have least genetic distance of 0.33 in these 15 species and are 99.67% identical at the amino acid level. Homosapiens and Pantroglodytes (chimpanzee) have the next lowest genetic distance of 1.35 and are 98.65% identical at the amino acid level. These findings indicate that the SRY proteins are conserved in the 15 species, and their evolutionary relationships are similar.
2012-01-01
Background A detailed knowledge about spatial and temporal gene expression is important for understanding both the function of genes and their evolution. For the vast majority of species, transcriptomes are still largely uncharacterized and even in those where substantial information is available it is often in the form of partially sequenced transcriptomes. With the development of next generation sequencing, a single experiment can now simultaneously identify the transcribed part of a species genome and estimate levels of gene expression. Results mRNA from actively growing needles of Norway spruce (Picea abies) was sequenced using next generation sequencing technology. In total, close to 70 million fragments with a length of 76 bp were sequenced resulting in 5 Gbp of raw data. A de novo assembly of these reads, together with publicly available expressed sequence tag (EST) data from Norway spruce, was used to create a reference transcriptome. Of the 38,419 PUTs (putative unique transcripts) longer than 150 bp in this reference assembly, 83.5% show similarity to ESTs from other spruce species and of the remaining PUTs, 3,704 show similarity to protein sequences from other plant species, leaving 4,167 PUTs with limited similarity to currently available plant proteins. By predicting coding frames and comparing not only the Norway spruce PUTs, but also PUTs from the close relatives Picea glauca and Picea sitchensis to both Pinus taeda and Taxus mairei, we obtained estimates of synonymous and non-synonymous divergence among conifer species. In addition, we detected close to 15,000 SNPs of high quality and estimated gene expression differences between samples collected under dark and light conditions. Conclusions Our study yielded a large number of single nucleotide polymorphisms as well as estimates of gene expression on transcriptome scale. In agreement with a recent study we find that the synonymous substitution rate per year (0.6 × 10−09 and 1.1 × 10−09) is an order of magnitude smaller than values reported for angiosperm herbs. However, if one takes generation time into account, most of this difference disappears. The estimates of the dN/dS ratio (non-synonymous over synonymous divergence) reported here are in general much lower than 1 and only a few genes showed a ratio larger than 1. PMID:23122049
Mapping the Space of Genomic Signatures
Kari, Lila; Hill, Kathleen A.; Sayem, Abu S.; Karamichalis, Rallis; Bryans, Nathaniel; Davis, Katelyn; Dattani, Nikesh S.
2015-01-01
We propose a computational method to measure and visualize interrelationships among any number of DNA sequences allowing, for example, the examination of hundreds or thousands of complete mitochondrial genomes. An "image distance" is computed for each pair of graphical representations of DNA sequences, and the distances are visualized as a Molecular Distance Map: Each point on the map represents a DNA sequence, and the spatial proximity between any two points reflects the degree of structural similarity between the corresponding sequences. The graphical representation of DNA sequences utilized, Chaos Game Representation (CGR), is genome- and species-specific and can thus act as a genomic signature. Consequently, Molecular Distance Maps could inform species identification, taxonomic classifications and, to a certain extent, evolutionary history. The image distance employed, Structural Dissimilarity Index (DSSIM), implicitly compares the occurrences of oligomers of length up to k (herein k = 9) in DNA sequences. We computed DSSIM distances for more than 5 million pairs of complete mitochondrial genomes, and used Multi-Dimensional Scaling (MDS) to obtain Molecular Distance Maps that visually display the sequence relatedness in various subsets, at different taxonomic levels. This general-purpose method does not require DNA sequence alignment and can thus be used to compare similar or vastly different DNA sequences, genomic or computer-generated, of the same or different lengths. We illustrate potential uses of this approach by applying it to several taxonomic subsets: phylum Vertebrata, (super)kingdom Protista, classes Amphibia-Insecta-Mammalia, class Amphibia, and order Primates. This analysis of an extensive dataset confirms that the oligomer composition of full mtDNA sequences can be a source of taxonomic information. This method also correctly finds the mtDNA sequences most closely related to that of the anatomically modern human (the Neanderthal, the Denisovan, and the chimp), and that the sequence most different from it in this dataset belongs to a cucumber. PMID:26000734
Peak, K. Kealy; Duncan, Kathleen E.; Luna, Vicki A.; King, Debra S.; McCarthy, Peter J.; Cannons, Andrew C.
2011-01-01
Bacillus strains with >99.7% 16S rRNA gene sequence similarity were characterized with DNA:DNA hybridization, cellular fatty acid (CFA) analysis, and testing of 100 phenotypic traits. When paired with the most closely related type strain, percent DNA:DNA similarities (% S) for six Bacillus strains were all far below the recommended 70% threshold value for species circumscription with Bacillus nealsonii. An apparent genomic group of four Bacillus strain pairings with 94%–70% S was contradicted by the failure of the strains to cluster in CFA- and phenotype-based dendrograms as well as by their differentiation with 9–13 species level discriminators such as nitrate reduction, temperature range, and acid production from carbohydrates. The novel Bacillus strains were monophyletic and very closely related based on 16S rRNA gene sequence. Coherent genomic groups were not however supported by similarly organized phenotypic clusters. Therefore, the strains were not effectively circumscribed within the taxonomic species definition. PMID:22046187
Zhao, Shanshan; Ye, Lan; Liu, Chongxi; Abagana, Adam Yacoub; Zheng, Weiwei; Sun, Pengyu; Li, Jiansong; Xiang, Wensheng; Wang, Xiangjing
2017-04-01
During an investigation exploring potential sources of novel species and natural products, a novel actinomycete with antifungal activity, designated strain NEAU-Gz11 T , was isolated from a soil sample, which was collected from Gama, Chad. The isolate was found to have morphological and chemotaxonomic characteristics typical of members of the genus Streptomyces. 16S rRNA gene sequence similarity studies showed that strain NEAU-Gz11 T belongs to the genus Streptomyces with high sequence similarity to Streptomyces hiroshimensis JCM 4098 T (98.0 %). Similarities to other type strains of the genus Streptomyces were lower than 98.0 %. However, the physiological and biochemical characteristics and low levels of DNA-DNA relatedness could differentiate the isolate genotypically and phenotypically from S. hiroshimensis JCM 4098 T . Therefore, the strain is concluded to represent a novel species of the genus Streptomyces, for which the name Streptomyces gamaensis sp. nov. is proposed. The type strain is NEAU-Gz11 T (=CGMCC 4.7304 T =DSM 101531 T ).
Application of agglomerative clustering for analyzing phylogenetically on bacterium of saliva
NASA Astrophysics Data System (ADS)
Bustamam, A.; Fitria, I.; Umam, K.
2017-07-01
Analyzing population of Streptococcus bacteria is important since these species can cause dental caries, periodontal, halitosis (bad breath) and more problems. This paper will discuss the phylogenetically relation between the bacterium Streptococcus in saliva using a phylogenetic tree of agglomerative clustering methods. Starting with the bacterium Streptococcus DNA sequence obtained from the GenBank, then performed characteristic extraction of DNA sequences. The characteristic extraction result is matrix form, then performed normalization using min-max normalization and calculate genetic distance using Manhattan distance. Agglomerative clustering technique consisting of single linkage, complete linkage and average linkage. In this agglomerative algorithm number of group is started with the number of individual species. The most similar species is grouped until the similarity decreases and then formed a single group. Results of grouping is a phylogenetic tree and branches that join an established level of distance, that the smaller the distance the more the similarity of the larger species implementation is using R, an open source program.
Zhou, Jianye; Jiang, Nan; Wang, Zhenzhen; Li, Longqing; Zhang, Jumei; Ma, Rui; Nie, Hongbing
2016-01-01
ABSTRACT This study aimed to identify the differences in the oral microbial communities in saliva from patients with and without caries by performing sequencing with the Illumina MiSeq platform, as well as to further assess their relationships with environmental factors (salivary pH and iron concentration). Forty-three volunteers were selected, including 21 subjects with and 22 without caries, from one village in Gansu, China. Based on 966,255 trimmed sequences and clustering at the 97% similarity level, 1,303 species-level operational taxonomic units were generated. The sequencing data for the two groups revealed that (i) particular distribution patterns (synergistic effects or competition) existed in the subjects with and without caries at both the genus and species levels and (ii) both the salivary pH and iron concentration had significant influences on the microbial community structure. IMPORTANCE The significant influences of the oral environment observed in this study increase the current understanding of the salivary microbiome in caries. These results will be useful for expanding research directions and for improving disease diagnosis, prognosis, and therapy. PMID:27940544
Zhou, Jianye; Jiang, Nan; Wang, Zhenzhen; Li, Longqing; Zhang, Jumei; Ma, Rui; Nie, Hongbing; Li, Zhiqiang
2017-02-15
This study aimed to identify the differences in the oral microbial communities in saliva from patients with and without caries by performing sequencing with the Illumina MiSeq platform, as well as to further assess their relationships with environmental factors (salivary pH and iron concentration). Forty-three volunteers were selected, including 21 subjects with and 22 without caries, from one village in Gansu, China. Based on 966,255 trimmed sequences and clustering at the 97% similarity level, 1,303 species-level operational taxonomic units were generated. The sequencing data for the two groups revealed that (i) particular distribution patterns (synergistic effects or competition) existed in the subjects with and without caries at both the genus and species levels and (ii) both the salivary pH and iron concentration had significant influences on the microbial community structure. The significant influences of the oral environment observed in this study increase the current understanding of the salivary microbiome in caries. These results will be useful for expanding research directions and for improving disease diagnosis, prognosis, and therapy. Copyright © 2017 Zhou et al.
Bourgis, Fabienne; Kilaru, Aruna; Cao, Xia; Ngando-Ebongue, Georges-Frank; Drira, Noureddine; Ohlrogge, John B; Arondel, Vincent
2011-07-26
Oil palm can accumulate up to 90% oil in its mesocarp, the highest level observed in the plant kingdom. In contrast, the closely related date palm accumulates almost exclusively sugars. To gain insight into the mechanisms that lead to such an extreme difference in carbon partitioning, the transcriptome and metabolite content of oil palm and date palm were compared during mesocarp development. Compared with date palm, the high oil content in oil palm was associated with much higher transcript levels for all fatty acid synthesis enzymes, specific plastid transporters, and key enzymes of plastidial carbon metabolism, including phosphofructokinase, pyruvate kinase, and pyruvate dehydrogenase. Transcripts representing an ortholog of the WRI1 transcription factor were 57-fold higher in oil palm relative to date palm and displayed a temporal pattern similar to its target genes. Unexpectedly, despite more than a 100-fold difference in flux to lipids, most enzymes of triacylglycerol assembly were expressed at similar levels in oil palm and date palm. Similarly, transcript levels for all but one cytosolic enzyme of glycolysis were comparable in both species. Together, these data point to synthesis of fatty acids and supply of pyruvate in the plastid, rather than acyl assembly into triacylglycerol, as a major control over the storage of oil in the mesocarp of oil palm. In addition to greatly increasing molecular resources devoted to oil palm and date palm, the combination of temporal and comparative studies illustrates how deep sequencing can provide insights into gene expression patterns of two species that lack genome sequence information.
Bourgis, Fabienne; Kilaru, Aruna; Cao, Xia; Ngando-Ebongue, Georges-Frank; Drira, Noureddine; Ohlrogge, John B.; Arondel, Vincent
2011-01-01
Oil palm can accumulate up to 90% oil in its mesocarp, the highest level observed in the plant kingdom. In contrast, the closely related date palm accumulates almost exclusively sugars. To gain insight into the mechanisms that lead to such an extreme difference in carbon partitioning, the transcriptome and metabolite content of oil palm and date palm were compared during mesocarp development. Compared with date palm, the high oil content in oil palm was associated with much higher transcript levels for all fatty acid synthesis enzymes, specific plastid transporters, and key enzymes of plastidial carbon metabolism, including phosphofructokinase, pyruvate kinase, and pyruvate dehydrogenase. Transcripts representing an ortholog of the WRI1 transcription factor were 57-fold higher in oil palm relative to date palm and displayed a temporal pattern similar to its target genes. Unexpectedly, despite more than a 100-fold difference in flux to lipids, most enzymes of triacylglycerol assembly were expressed at similar levels in oil palm and date palm. Similarly, transcript levels for all but one cytosolic enzyme of glycolysis were comparable in both species. Together, these data point to synthesis of fatty acids and supply of pyruvate in the plastid, rather than acyl assembly into triacylglycerol, as a major control over the storage of oil in the mesocarp of oil palm. In addition to greatly increasing molecular resources devoted to oil palm and date palm, the combination of temporal and comparative studies illustrates how deep sequencing can provide insights into gene expression patterns of two species that lack genome sequence information. PMID:21709233
Young, C-C; Busse, H-J; Langer, S; Chu, Jiunn-Nan; Schumann, P; Arun, A B; Shen, Fo-Ting; Rekha, P D; Kämpfer, P
2010-04-01
Three Gram-positive, rod-shaped bacteria (strains CC-SBCK-209( T), CC-12309(T) and CC-5209(T)) were isolated from the stalk of the edible mushroom Agaricus blazei grown in the laboratory. 16S rRNA gene sequence analysis indicated that all three isolates clearly belonged to the genus Microbacterium. Strains CC-SBCK-209( T) and CC-12309(T) were most related closely to the type strain of Microbacterium halotolerans (95.9 and 96.1 % 16S rRNA gene sequence similarity, respectively). These two novel strains shared 97.9 % 16S rRNA gene sequence similarity. Levels of similarity to the type strains of all other recognized Microbacterium species were lower than 95.5 %. The third strain (CC-5209( T)) showed the highest 16S rRNA gene sequence similarity to the type strain of Microbacterium resistens (97.6 %); levels of similarity to the type strains of all other recognized Microbacterium species were lower than 96 %. The quinone systems of strains CC-SBCK-209(T), CC-12309(T) and CC-5209(T) consisted of MK-11/MK-12, MK-11/MK-10 and MK-13 as major compounds, respectively. All three strains contained ornithine in their peptidoglycan. The major polar lipids were diphosphatidylglycerol, phosphatidylglycerol and an unknown glycolipid. The polyamine pattern consisted of spermidine and spermine as predominant components. Fatty acid profiles (anteiso-C(15 : 0), iso-C(16 : 0) and anteiso-C(17 : 0 ) as major components) supported the affiliation of all three strains to the genus Microbacterium. The results of physiological and biochemical tests and DNA-DNA hybridization experiments allowed the clear phenotypic and genotypic differentiation of strains CC-SBCK-209(T) and CC-12309( T) from M. halotolerans and other closely related Microbacterium species. Strain CC-5209(T) could be differentiated clearly from M. resistens both genotypically and phenotypically. Based on these data, the novel strains are considered to represent three novel species of the genus Microbacterium. The names proposed for these organisms are Microbacterium agarici sp. nov. [type strain CC-SBCK-209( T) (=DSM 21798(T)=CCM 7686(T))], Microbacterium humi sp. nov. [type strain CC-12309(T) (=DSM 21799(T)=CCM 7687(T))] and Microbacterium pseudoresistens sp. nov. [type strain CC-5209(T) (=DSM 22185(T)=CCM 7688(T))].
ERIC Educational Resources Information Center
Marcer, D.; And Others
1977-01-01
Compares the rates of forgetting of five-item sequences of acoustically similar and dissimilar consonants and words in the absence of proactive and retroactive interference in order to test whether within sequence similarity rather than stimulus length would have a greater influence on retention. (Author/RK)
A space-efficient algorithm for local similarities.
Huang, X Q; Hardison, R C; Miller, W
1990-10-01
Existing dynamic-programming algorithms for identifying similar regions of two sequences require time and space proportional to the product of the sequence lengths. Often this space requirement is more limiting than the time requirement. We describe a dynamic-programming local-similarity algorithm that needs only space proportional to the sum of the sequence lengths. The method can also find repeats within a single long sequence. To illustrate the algorithm's potential, we discuss comparison of a 73,360 nucleotide sequence containing the human beta-like globin gene cluster and a corresponding 44,594 nucleotide sequence for rabbit, a problem well beyond the capabilities of other dynamic-programming software.
Vujaklija, Ivan; Bielen, Ana; Paradžik, Tina; Biđin, Siniša; Goldstein, Pavle; Vujaklija, Dušica
2016-02-18
The massive accumulation of protein sequences arising from the rapid development of high-throughput sequencing, coupled with automatic annotation, results in high levels of incorrect annotations. In this study, we describe an approach to decrease annotation errors of protein families characterized by low overall sequence similarity. The GDSL lipolytic family comprises proteins with multifunctional properties and high potential for pharmaceutical and industrial applications. The number of proteins assigned to this family has increased rapidly over the last few years. In particular, the natural abundance of GDSL enzymes reported recently in plants indicates that they could be a good source of novel GDSL enzymes. We noticed that a significant proportion of annotated sequences lack specific GDSL motif(s) or catalytic residue(s). Here, we applied motif-based sequence analyses to identify enzymes possessing conserved GDSL motifs in selected proteomes across the plant kingdom. Motif-based HMM scanning (Viterbi decoding-VD and posterior decoding-PD) and the here described PD/VD protocol were successfully applied on 12 selected plant proteomes to identify sequences with GDSL motifs. A significant number of identified GDSL sequences were novel. Moreover, our scanning approach successfully detected protein sequences lacking at least one of the essential motifs (171/820) annotated by Pfam profile search (PfamA) as GDSL. Based on these analyses we provide a curated list of GDSL enzymes from the selected plants. CLANS clustering and phylogenetic analysis helped us to gain a better insight into the evolutionary relationship of all identified GDSL sequences. Three novel GDSL subfamilies as well as unreported variations in GDSL motifs were discovered in this study. In addition, analyses of selected proteomes showed a remarkable expansion of GDSL enzymes in the lycophyte, Selaginella moellendorffii. Finally, we provide a general motif-HMM scanner which is easily accessible through the graphical user interface ( http://compbio.math.hr/ ). Our results show that scanning with a carefully parameterized motif-HMM is an effective approach for annotation of protein families with low sequence similarity and conserved motifs. The results of this study expand current knowledge and provide new insights into the evolution of the large GDSL-lipase family in land plants.
SSAW: A new sequence similarity analysis method based on the stationary discrete wavelet transform.
Lin, Jie; Wei, Jing; Adjeroh, Donald; Jiang, Bing-Hua; Jiang, Yue
2018-05-02
Alignment-free sequence similarity analysis methods often lead to significant savings in computational time over alignment-based counterparts. A new alignment-free sequence similarity analysis method, called SSAW is proposed. SSAW stands for Sequence Similarity Analysis using the Stationary Discrete Wavelet Transform (SDWT). It extracts k-mers from a sequence, then maps each k-mer to a complex number field. Then, the series of complex numbers formed are transformed into feature vectors using the stationary discrete wavelet transform. After these steps, the original sequence is turned into a feature vector with numeric values, which can then be used for clustering and/or classification. Using two different types of applications, namely, clustering and classification, we compared SSAW against the the-state-of-the-art alignment free sequence analysis methods. SSAW demonstrates competitive or superior performance in terms of standard indicators, such as accuracy, F-score, precision, and recall. The running time was significantly better in most cases. These make SSAW a suitable method for sequence analysis, especially, given the rapidly increasing volumes of sequence data required by most modern applications.
Current challenges in genome annotation through structural biology and bioinformatics.
Furnham, Nicholas; de Beer, Tjaart A P; Thornton, Janet M
2012-10-01
With the huge volume in genomic sequences being generated from high-throughout sequencing projects the requirement for providing accurate and detailed annotations of gene products has never been greater. It is proving to be a huge challenge for computational biologists to use as much information as possible from experimental data to provide annotations for genome data of unknown function. A central component to this process is to use experimentally determined structures, which provide a means to detect homology that is not discernable from just the sequence and permit the consequences of genomic variation to be realized at the molecular level. In particular, structures also form the basis of many bioinformatics methods for improving the detailed functional annotations of enzymes in combination with similarities in sequence and chemistry. Copyright © 2012. Published by Elsevier Ltd.
[Structural organization of 5S ribosomal DNA of Rosa rugosa].
Tynkevych, Iu O; Volkov, R A
2014-01-01
In order to clarify molecular organization of the genomic region encoding 5S rRNA in diploid species Rosa rugosa several 5S rDNA repeated units were cloned and sequenced. Analysis of the obtained sequences revealed that only one length variant of 5S rDNA repeated units, which contains intact promoter elements in the intergenic spacer region (IGS) and appears to be transcriptionally active is present in the genome. Additionally, a limited number of 5S rDNA pseudogenes lacking a portion of coding sequence and the complete IGS was detected. A high level of sequence similarity (from 93.7 to 97.5%) between the IGS of major 5S rDNA variants of East Asian R. rugosa and North American R. nitida was found indicating comparatively recent divergence of these species.
Pyrosequencing the Canine Faecal Microbiota: Breadth and Depth of Biodiversity
Hand, Daniel; Wallis, Corrin; Colyer, Alison; Penn, Charles W.
2013-01-01
Mammalian intestinal microbiota remain poorly understood despite decades of interest and investigation by culture-based and other long-established methodologies. Using high-throughput sequencing technology we now report a detailed analysis of canine faecal microbiota. The study group of animals comprised eleven healthy adult miniature Schnauzer dogs of mixed sex and age, some closely related and all housed in kennel and pen accommodation on the same premises with similar feeding and exercise regimes. DNA was extracted from faecal specimens and subjected to PCR amplification of 16S rDNA, followed by sequencing of the 5′ region that included variable regions V1 and V2. Barcoded amplicons were sequenced by Roche-454 FLX high-throughput pyrosequencing. Sequences were assigned to taxa using the Ribosomal Database Project Bayesian classifier and revealed dominance of Fusobacterium and Bacteroidetes phyla. Differences between animals in the proportions of different taxa, among 10,000 reads per animal, were clear and not supportive of the concept of a “core microbiota”. Despite this variability in prominent genera, littermates were shown to have a more similar faecal microbial composition than unrelated dogs. Diversity of the microbiota was also assessed by assignment of sequence reads into operational taxonomic units (OTUs) at the level of 97% sequence identity. The OTU data were then subjected to rarefaction analysis and determination of Chao1 richness estimates. The data indicated that faecal microbiota comprised possibly as many as 500 to 1500 OTUs. PMID:23382835
Ehrmann, M A; Vogel, R E
2001-11-01
An insertion sequence has been identified in the genome of Lactobacillus sanfranciscensis DSM 20451T as segment of 1351 nucleotides containing 37-bp imperfect terminal inverted repeats. The sequence of this element encodes two out of phase, overlapping open reading frames, orfA and orfB, from which three putative proteins are produced. OrfAB is a transframe protein produced by -1 translational frame shifting between orf A and orf B that is presumed to be the transposase. The large orfAB of this element encodes a 342 amino acid protein that displays similarities with transposases encoded by bacterial insertion sequences belonging to the IS3 family. In L. sanfranciscensis type strain DSM 20451T multiple truncated IS elements were identified. Inverse PCR was used to analyze target sites of four of these elements, but except of their highly AT rich character not any sequence specificity was identified so far. Moreover, no flanking direct repeats were identified. Multiple copies of IS153 were detected by hybridization in other strains of L. sanfranciscensis. Resulting hybridization patterns were shown to differentiate between organisms at strain level rather than a probe targeted against the 16S rDNA. With a PCR based approach IS153 or highly similar sequences were detected in L. acidophilus, L. casei, L. malefermentans, L. plantarum, L. hilgardii, L. collinoides L. farciminis L. sakei and L. salivarius, L. reuteri as well as in Enterococcus faecium, Pediococcus acidilactici and P. pentosaceus.
Generation, annotation and analysis of ESTs from Trichoderma harzianum CECT 2413
Vizcaíno, Juan Antonio; González, Francisco Javier; Suárez, M Belén; Redondo, José; Heinrich, Julian; Delgado-Jarana, Jesús; Hermosa, Rosa; Gutiérrez, Santiago; Monte, Enrique; Llobell, Antonio; Rey, Manuel
2006-01-01
Background The filamentous fungus Trichoderma harzianum is used as biological control agent of several plant-pathogenic fungi. In order to study the genome of this fungus, a functional genomics project called "TrichoEST" was developed to give insights into genes involved in biological control activities using an approach based on the generation of expressed sequence tags (ESTs). Results Eight different cDNA libraries from T. harzianum strain CECT 2413 were constructed. Different growth conditions involving mainly different nutrient conditions and/or stresses were used. We here present the analysis of the 8,710 ESTs generated. A total of 3,478 unique sequences were identified of which 81.4% had sequence similarity with GenBank entries, using the BLASTX algorithm. Using the Gene Ontology hierarchy, we performed the annotation of 51.1% of the unique sequences and compared its distribution among the gene libraries. Additionally, the InterProScan algorithm was used in order to further characterize the sequences. The identification of the putatively secreted proteins was also carried out. Later, based on the EST abundance, we examined the highly expressed genes and a hydrophobin was identified as the gene expressed at the highest level. We compared our collection of ESTs with the previous collections obtained from Trichoderma species and we also compared our sequence set with different complete eukaryotic genomes from several animals, plants and fungi. Accordingly, the presence of similar sequences in different kingdoms was also studied. Conclusion This EST collection and its annotation provide a significant resource for basic and applied research on T. harzianum, a fungus with a high biotechnological interest. PMID:16872539
Molecular characterization of a wild poliovirus type 3 epidemic in The Netherlands (1992 and 1993).
Mulders, M N; van Loon, A M; van der Avoort, H G; Reimerink, J H; Ras, A; Bestebroer, T M; Drebot, M A; Kew, O M; Koopmans, M P
1995-01-01
An outbreak of poliomyelitis due to wild poliovirus type 3 (PV3) occurred in an unvaccinated community in The Netherlands between September 1992 and February 1993. The outbreak involved 71 patients. The aim of this study was to characterize the virus at the molecular level and to analyze the molecular evolution of the epidemic virus. Molecular analysis was carried out by sequencing the VP1/2A junction region (150 nucleotides) of 50 PV3 strains isolated in association with this outbreak and the entire VP1 gene of 14 strains. In addition, the sequence of the VP1/2A junction region of strains from geographical regions endemic for PV3 (Egypt, India, and Central Asia) was analyzed and compared with the nucleotide sequence of the epidemic strain from The Netherlands. The earliest isolate was obtained from river water sampled 3 weeks before diagnosis of the first poliomyelitis patient and was found by VP1/2A sequence analysis to be genetically identical to the strain isolated from the first patient. Sequence divergence among the strains from the epidemic in The Netherlands was less than 2%. The closest genetic similarity (97.3%) was found with an Indian isolate (New Delhi, December 1991), indicating the likely source of the virus. A more than 99% sequence similarity was found in the VP1/2A region. Finally, the sequence information was used to design primers for the specific and highly sensitive molecular detection of PV3 strains during the epidemic. PMID:8586711
Mouse Vk gene classification by nucleic acid sequence similarity.
Strohal, R; Helmberg, A; Kroemer, G; Kofler, R
1989-01-01
Analyses of immunoglobulin (Ig) variable (V) region gene usage in the immune response, estimates of V gene germline complexity, and other nucleic acid hybridization-based studies depend on the extent to which such genes are related (i.e., sequence similarity) and their organization in gene families. While mouse Igh heavy chain V region (VH) gene families are relatively well-established, a corresponding systematic classification of Igk light chain V region (Vk) genes has not been reported. The present analysis, in the course of which we reviewed the known extent of the Vk germline gene repertoire and Vk gene usage in a variety of responses to foreign and self antigens, provides a classification of mouse Vk genes in gene families composed of members with greater than 80% overall nucleic acid sequence similarity. This classification differed in several aspects from that of VH genes: only some Vk gene families were as clearly separated (by greater than 25% sequence dissimilarity) as typical VH gene families; most Vk gene families were closely related and, in several instances, members from different families were very similar (greater than 80%) over large sequence portions; frequently, classification by nucleic acid sequence similarity diverged from existing classifications based on amino-terminal protein sequence similarity. Our data have implications for Vk gene analyses by nucleic acid hybridization and describe potentially important differences in sequence organization between VH and Vk genes.
IgM Repertoire Biodiversity is Reduced in HIV-1 Infection and Systemic Lupus Erythematosus.
Yin, Li; Hou, Wei; Liu, Li; Cai, Yunpeng; Wallet, Mark Andrew; Gardner, Brent Paul; Chang, Kaifen; Lowe, Amanda Catherine; Rodriguez, Carina Adriana; Sriaroon, Panida; Farmerie, William George; Sleasman, John William; Goodenow, Maureen Michels
2013-01-01
HIV-1 infection or systemic lupus erythematosus (SLE) disrupt B cell homeostasis, reduce memory B cells, and impair function of IgG and IgM antibodies. To determine how disturbances in B cell populations producing polyclonal antibodies relate to the IgM repertoire, the IgM transcriptome in health and disease was explored at the complementarity determining region 3 (CDRH3) sequence level. 454-deep pyrosequencing in combination with a novel analysis pipeline was applied to define populations of IGHM CDRH3 sequences based on absence or presence of somatic hypermutations (SHM) in peripheral blood B cells. HIV or SLE subjects have reduced biodiversity within their IGHM transcriptome compared to healthy subjects, mainly due to a significant decrease in the number of unique combinations of alleles, although recombination machinery was intact. While major differences between sequences without or with SHM occurred among all groups, IGHD and IGHJ allele use, CDRH3 length distribution, or generation of SHM were similar among study cohorts. Antiretroviral therapy failed to normalize IGHM biodiversity in HIV-infected individuals. All subjects had a low frequency of allelic combinations within the IGHM repertoire similar to known broadly neutralizing HIV-1 antibodies. Polyclonal expansion would decrease overall IgM biodiversity independent of other mechanisms for development of the B cell repertoire. Applying deep sequencing as a strategy to follow development of the IgM repertoire in health and disease provides a novel molecular assessment of multiple points along the B cell differentiation pathway that is highly sensitive for detecting perturbations within the repertoire at the population level.
Nostoc thermotolerans sp. nov., a soil-dwelling species of Nostoc (Cyanobacteria).
Suradkar, Archana; Villanueva, Chelsea; Gaysina, Lira A; Casamatta, Dale A; Saraf, Aniket; Dighe, Gandhali; Mergu, Ratnaprabha; Singh, Prashant
2017-05-01
A filamentous, soil-dwelling cyanobacterial strain (9C-PST) was isolated from Mandsaur, Madhya Pradesh, India, and is described as a new species of the genus Nostoc. Extensive morphological and molecular characterization along with a thorough assessment of ecology was performed. The style of filament orientation, type and nature of the sheath (e.g. distribution and visibility across the trichome), and vegetative and heterocyte cell dimensions and shape were assessed for over one year using both the laboratory grown culture and the naturally occurring samples. Sequencing of the 16S rRNA gene showed 94 % similarity with Nostocpiscinale CENA21 while analyses of the secondary structures of the 16S-23S ITS region showed unique folding patterns that differentiated this strain from other species of Nostoc. The level of rbcl and rpoC1 gene sequence similarity was 91 and 94 % to Nostocsp. PCC 7524 and Nostocpiscinale CENA21, respectively, while the nifD gene sequence similarity was found to be 99 % with Nostocpiscinale CENA21. The phenotypic, ecological, genetic and phylogenetic observations indicate that the strain 9C-PST represents a novel species of the genus Nostoc with the name proposed being Nostoc thermotolerans sp. nov. according to the International Code of Nomenclature for Algae, Fungi, and Plants.
Juola, Frans A; Dearborn, Donald C
2012-01-07
The major histocompatibility complex (MHC) is a polymorphic gene family associated with immune defence, and it can play a role in mate choice. Under the genetic compatibility hypothesis, females choose mates that differ genetically from their own MHC genotypes, avoiding inbreeding and/or enhancing the immunocompetence of their offspring. We tested this hypothesis of disassortative mating based on MHC genotypes in a population of great frigatebirds (Fregata minor) by sequencing the second exon of MHC class II B. Extensive haploid cloning yielded two to four alleles per individual, suggesting the amplification of two genes. MHC similarity between mates was not significantly different between pairs that did (n = 4) or did not (n = 42) exhibit extra-pair paternity. Comparing all 46 mated pairs to a distribution based on randomized re-pairings, we observed the following (i): no evidence for mate choice based on maximal or intermediate levels of MHC allele sharing (ii), significantly disassortative mating based on similarity of MHC amino acid sequences, and (iii) no evidence for mate choice based on microsatellite alleles, as measured by either allele sharing or similarity in allele size. This suggests that females choose mates that differ genetically from themselves at MHC loci, but not as an inbreeding-avoidance mechanism.
Iterative refinement of structure-based sequence alignments by Seed Extension
Kim, Changhoon; Tai, Chin-Hsien; Lee, Byungkook
2009-01-01
Background Accurate sequence alignment is required in many bioinformatics applications but, when sequence similarity is low, it is difficult to obtain accurate alignments based on sequence similarity alone. The accuracy improves when the structures are available, but current structure-based sequence alignment procedures still mis-align substantial numbers of residues. In order to correct such errors, we previously explored the possibility of replacing the residue-based dynamic programming algorithm in structure alignment procedures with the Seed Extension algorithm, which does not use a gap penalty. Here, we describe a new procedure called RSE (Refinement with Seed Extension) that iteratively refines a structure-based sequence alignment. Results RSE uses SE (Seed Extension) in its core, which is an algorithm that we reported recently for obtaining a sequence alignment from two superimposed structures. The RSE procedure was evaluated by comparing the correctly aligned fractions of residues before and after the refinement of the structure-based sequence alignments produced by popular programs. CE, DaliLite, FAST, LOCK2, MATRAS, MATT, TM-align, SHEBA and VAST were included in this analysis and the NCBI's CDD root node set was used as the reference alignments. RSE improved the average accuracy of sequence alignments for all programs tested when no shift error was allowed. The amount of improvement varied depending on the program. The average improvements were small for DaliLite and MATRAS but about 5% for CE and VAST. More substantial improvements have been seen in many individual cases. The additional computation times required for the refinements were negligible compared to the times taken by the structure alignment programs. Conclusion RSE is a computationally inexpensive way of improving the accuracy of a structure-based sequence alignment. It can be used as a standalone procedure following a regular structure-based sequence alignment or to replace the traditional iterative refinement procedures based on residue-level dynamic programming algorithm in many structure alignment programs. PMID:19589133
Urade, Y; Oberdick, J; Molinar-Rode, R; Morgan, J I
1991-01-01
The cerebellum contains a hexadecapeptide, termed cerebellin, that is conserved in sequence from human to chicken. Three independent, overlapping cDNA clones have been isolated from a human cerebellum cDNA library that encode the cerebellin sequence. The longest clone codes for a protein of 193 amino acids that we term precerebellin. This protein has a significant similarity (31.3% identity, 52.2% similarity) to the globular (non-collagen-like) region of the B chain of human complement component C1q. The region of relatedness extends over approximately 145 amino acids located in the carboxyl terminus of both proteins. Unlike C1q B chain, no collagen-like motifs are present in the amino-terminal regions of precerebellin. The amino terminus of precerebellin contains three possible N-linked glycosylation sites. Although hydrophobic amino acids are clustered at the amino terminus, they do not conform to the classical signal-peptide motif, and no other obvious membrane-spanning domains are predicted from the cDNA sequence. The cDNA predicts that the cerebellin peptide is flanked by Val-Arg and Glu-Pro residues. Therefore, cerebellin is not liberated from precerebellin by the classical dibasic amino acid proteolytic-cleavage mechanism seen in many neuropeptide precursors. In Northern (RNA) blots, precerebellin transcripts, with four distinct sizes (1.8, 2.3, 2.7, and 3.0 kilobases), are abundant in cerebellum. These transcripts are present at either very low or undetectable levels in other brain areas and extraneural structures. A similar pattern of cerebellin precursor transcripts are seen in rat, mouse, and human cerebellum. Furthermore, a partial genomic fragment from mouse shows the same bands in Northern blots as the human cDNA clone. During rat development, precerebellin transcripts mirror the level of cerebellin peptide. Low levels of precerebellin mRNA are seen at birth. Levels increase modestly from postpartum day 1 to 8, then increase more dramatically between day 5 and 15, and eventually reach peak values between day 21 and 56. Because cerebellin-like immunoreactivity is associated with Purkinje cell postsynaptic structures, these data raise interesting possibilities concerning the function of the cerebellin precursor in synaptic physiology. Images PMID:1704129
Shotgun metagenomic data streams: surfing without fear
DOE Office of Scientific and Technical Information (OSTI.GOV)
Berendzen, Joel R
2010-12-06
Timely information about bio-threat prevalence, consequence, propagation, attribution, and mitigation is needed to support decision-making, both routinely and in a crisis. One DNA sequencer can stream 25 Gbp of information per day, but sampling strategies and analysis techniques are needed to turn raw sequencing power into actionable knowledge. Shotgun metagenomics can enable biosurveillance at the level of a single city, hospital, or airplane. Metagenomics characterizes viruses and bacteria from complex environments such as soil, air filters, or sewage. Unlike targeted-primer-based sequencing, shotgun methods are not blind to sequences that are truly novel, and they can measure absolute prevalence. Shotgun metagenomicmore » sampling can be non-invasive, efficient, and inexpensive while being informative. We have developed analysis techniques for shotgun metagenomic sequencing that rely upon phylogenetic signature patterns. They work by indexing local sequence patterns in a manner similar to web search engines. Our methods are laptop-fast and favorable scaling properties ensure they will be sustainable as sequencing methods grow. We show examples of application to soil metagenomic samples.« less
Brossard, Patrick; Weitkunat, Rolf; Poux, Valerie; Lama, Nicola; Haziza, Christelle; Picavet, Patrick; Baker, Gizelle; Lüdicke, Frank
2017-10-01
Two open-label randomized cross-over studies in Japanese smokers investigated the single-use nicotine pharmacokinetic profile of the Tobacco Heating System (THS) 2.2, cigarettes (CC) and nicotine replacement therapy (Gum). In each study, one on the regular and one on the menthol variants of the THS and CC, both using Gum as reference, 62 subjects were randomized to four sequences: Sequence 1: THS - CC (n = 22); Sequence 2: CC - THS (n = 22); Sequence 3: THS - Gum (n = 9); Sequence 4: Gum - THS (n = 9). Plasma nicotine concentrations were measured in 16 blood samples collected over 24 h after single use. Maximal nicotine concentration (C max ) and area under the curve from start of product use to time of last quantifiable concentration (AUC 0-last ) were similar between THS and CC in both studies, with ratios varying from 88 to 104% for C max and from 96 to 98% for AUC 0-last . Urge-to-smoke total scores were comparable between THS and CC. The THS nicotine pharmacokinetic profile was close to CC, with similar levels of urge-to-smoke. This suggests that THS can satisfy smokers and be a viable alternative to cigarettes for adult smokers who want to continue using tobacco. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.
Li, S.-F.; Xu, J.-W.; Yang, Q.-L.; Wang, C.H.; Chen, Q.; Chapman, D.C.; Lu, G.
2009-01-01
Based upon morphological characters, Silver carp Hypophthalmichthys molitrix and bighead carp Hypophthalmichthys nobilis (or Aristichthys nobilis) have been classified into either the same genus or two distinct genera. Consequently, the taxonomic relationship of the two species at the generic level remains equivocal. This issue is addressed by sequencing complete mitochondrial genomes of H. molitrix and H. nobilis, comparing their mitogenome organization, structure and sequence similarity, and conducting a comprehensive phylogenetic analysis of cyprinid species. As with other cyprinid fishes, the mitogenomes of the two species were structurally conserved, containing 37 genes including 13 protein-coding genes, two ribosomal RNA genes, 22 transfer RNA (tRNAs) genes and a putative control region (D-loop). Sequence similarity between the two mitogenomes varied in different genes or regions, being highest in the tRNA genes (98??8%), lowest in the control region (89??4%) and intermediate in the protein-coding genes (94??2%). Analyses of the sequence comparison and phylogeny using concatenated protein sequences support the view that the two species belong to the genus Hypophthalmichthys. Further studies using nuclear markers and involving more closely related species, and the systematic combination of traditional biology and molecular biology are needed in order to confirm this conclusion. ?? 2009 The Fisheries Society of the British Isles.
Integration of Temporal and Ordinal Information During Serial Interception Sequence Learning
Gobel, Eric W.; Sanchez, Daniel J.; Reber, Paul J.
2011-01-01
The expression of expert motor skills typically involves learning to perform a precisely timed sequence of movements (e.g., language production, music performance, athletic skills). Research examining incidental sequence learning has previously relied on a perceptually-cued task that gives participants exposure to repeating motor sequences but does not require timing of responses for accuracy. Using a novel perceptual-motor sequence learning task, learning a precisely timed cued sequence of motor actions is shown to occur without explicit instruction. Participants learned a repeating sequence through practice and showed sequence-specific knowledge via a performance decrement when switched to an unfamiliar sequence. In a second experiment, the integration of representation of action order and timing sequence knowledge was examined. When either action order or timing sequence information was selectively disrupted, performance was reduced to levels similar to completely novel sequences. Unlike prior sequence-learning research that has found timing information to be secondary to learning action sequences, when the task demands require accurate action and timing information, an integrated representation of these types of information is acquired. These results provide the first evidence for incidental learning of fully integrated action and timing sequence information in the absence of an independent representation of action order, and suggest that this integrative mechanism may play a material role in the acquisition of complex motor skills. PMID:21417511
Team-based learning to improve learning outcomes in a therapeutics course sequence.
Bleske, Barry E; Remington, Tami L; Wells, Trisha D; Dorsch, Michael P; Guthrie, Sally K; Stumpf, Janice L; Alaniz, Marissa C; Ellingrod, Vicki L; Tingen, Jeffrey M
2014-02-12
To compare the effectiveness of team-based learning (TBL) to that of traditional lectures on learning outcomes in a therapeutics course sequence. A revised TBL curriculum was implemented in a therapeutic course sequence. Multiple choice and essay questions identical to those used to test third-year students (P3) taught using a traditional lecture format were administered to the second-year pharmacy students (P2) taught using the new TBL format. One hundred thirty-one multiple-choice questions were evaluated; 79 tested recall of knowledge and 52 tested higher level, application of knowledge. For the recall questions, students taught through traditional lectures scored significantly higher compared to the TBL students (88%±12% vs. 82%±16%, p=0.01). For the questions assessing application of knowledge, no differences were seen between teaching pedagogies (81%±16% vs. 77%±20%, p=0.24). Scores on essay questions and the number of students who achieved 100% were also similar between groups. Transition to a TBL format from a traditional lecture-based pedagogy allowed P2 students to perform at a similar level as students with an additional year of pharmacy education on application of knowledge type questions. However, P3 students outperformed P2 students regarding recall type questions and overall. Further assessment of long-term learning outcomes is needed to determine if TBL produces more persistent learning and improved application in clinical settings.
Knoch, Tobias A; Wachsmuth, Malte; Kepper, Nick; Lesnussa, Michael; Abuseiris, Anis; Ali Imam, A M; Kolovos, Petros; Zuin, Jessica; Kockx, Christel E M; Brouwer, Rutger W W; van de Werken, Harmen J G; van IJcken, Wilfred F J; Wendt, Kerstin S; Grosveld, Frank G
2016-01-01
The dynamic three-dimensional chromatin architecture of genomes and its co-evolutionary connection to its function-the storage, expression, and replication of genetic information-is still one of the central issues in biology. Here, we describe the much debated 3D architecture of the human and mouse genomes from the nucleosomal to the megabase pair level by a novel approach combining selective high-throughput high-resolution chromosomal interaction capture ( T2C ), polymer simulations, and scaling analysis of the 3D architecture and the DNA sequence. The genome is compacted into a chromatin quasi-fibre with ~5 ± 1 nucleosomes/11 nm, folded into stable ~30-100 kbp loops forming stable loop aggregates/rosettes connected by similar sized linkers. Minor but significant variations in the architecture are seen between cell types and functional states. The architecture and the DNA sequence show very similar fine-structured multi-scaling behaviour confirming their co-evolution and the above. This architecture, its dynamics, and accessibility, balance stability and flexibility ensuring genome integrity and variation enabling gene expression/regulation by self-organization of (in)active units already in proximity. Our results agree with the heuristics of the field and allow "architectural sequencing" at a genome mechanics level to understand the inseparable systems genomic properties.
Natrinema gari sp. nov., a halophilic archaeon isolated from fish sauce in Thailand.
Tapingkae, Wanaporn; Tanasupawat, Somboon; Itoh, Takashi; Parkin, Kirk L; Benjakul, Soottawat; Visessanguan, Wonnop; Valyasevi, Ruud
2008-10-01
Two Gram-negative, rod-shaped, halophilic archaea, designated strains HIS40-3(T) and HDS3-1, were isolated from anchovy fish sauce (nam-pla) collected from two different locations in Thailand. The two strains were able to grow at 20-60 degrees C (optimum 37-40 degrees C), at 1.7-5.1 M NaCl (optimum 2.6-3.4 M NaCl) and at pH 5.5-8.5 (optimum pH 6.0-6.5). Hypotonic treatment with less than 1.7 M NaCl caused cell lysis. The major polar lipids of the isolates were C(20)C(20) and C(20)C(25) derivatives of phosphatidylglycerol, phosphatidylglycerol phosphate methyl ester, phosphatidylglycerol sulfate, two glycolipids and one unidentified lipid. The DNA G+C contents were 64.0-65.4 mol%. In addition to phenotypic and chemotaxonomic characteristics, phylogenetic analysis based on 16S rRNA gene sequence similarities showed that strains HIS40-3(T) and HDS3-1 were related most closely to species of the genus Natrinema. Levels of 16S rRNA gene sequence similarity between strains HIS40-3(T) and HDS3-1 and the type strains of recognized Natrinema species were 99.1-96.6 %. The two novel strains could be distinguished from recognized Natrinema species on the basis of low levels of DNA-DNA relatedness and differences in whole-cell protein patterns and phenotypic properties. Levels of 16S rRNA gene sequence similarity and DNA-DNA relatedness between the two strains were 99.7 and 77.7 %, respectively, suggesting that they should be classified as representing a single species. Based on these taxonomic data, strains HIS40-3(T) and HDS3-1 are considered to represent a novel species of the genus Natrinema, for which the name Natrinema gari sp. nov. is proposed. The type strain is HIS40-3(T) (=BCC 24370(T) =JCM 14663(T) =PCU 303(T)).
NASA Astrophysics Data System (ADS)
Huang, Tung-Yi; Hsu, Bing-Mu; Chao, Wei-Chun; Fan, Cheng-Wei
2018-03-01
n-Alkane and alkane-degrading bacteria have long been used as crucial biological indicators of paleoecology, petroleum pollution, and oil and gas prospecting. However, the relationship between n-alkane and alkane-degrading bacteria in natural forests is still poorly understood. In this study, long-chain n-alkane (C14-C35) concentrations in litterfall, litter layer, and topsoil as well as the diversity and abundance of n-alkane-degrading bacterial communities in litter layers were investigated in three habitats across a lowland subtropical rainforest in southern Taiwan: ravine, windward, and leeward habitats in Nanjenshan. Our results demonstrate that the litterfall yield and productivity of long-chain n-alkane were highest in the ravine habitats. However, long-chain n-alkane concentrations in all habitats were decreased drastically to a similar low level from the litterfall to the bulk soil, suggesting a higher rate of long-chain n-alkane degradation in the ravine habitat. Operational taxonomic unit (OTU) analysis using next-generation sequencing data revealed that the relative abundances of microbial communities in the windward and leeward habitats were similar and different from that in the ravine habitat. Data mining of community amplicon sequencing using the NCBI database revealed that alkB-gene-associated bacteria (95 % DNA sequence similarity to alkB-containing bacteria) were most abundant in the ravine habitat. Empirical testing of litter layer samples using semi-quantitative polymerase chain reaction for determining alkB gene levels confirmed that the ravine habitat had higher alkB gene levels than the windward and leeward habitats. Heat map analysis revealed parallels in pattern color between the plant and microbial species compositions of the habitats, suggesting a causal relationship between the plant n-alkane production and microbial community diversity. This finding indicates that the diversity and relative abundance of microbial communities in the litter layer are affected by n-alkane plant composition in the litterfall.
Denef, Vincent J.; Fujimoto, Masanori; Berry, Michelle A.; ...
2016-04-29
Relative abundance profiles of bacterial populations measured by sequencing DNA or RNA of marker genes can widely differ. These differences, made apparent when calculating ribosomal RNA:DNA ratios, have been interpreted as variable activities of bacterial populations. However, inconsistent correlations between ribosomal RNA:DNA ratios and metabolic activity or growth rates have led to a more conservative interpretation of this metric as the cellular protein synthesis potential (PSP). Little is known, particularly in freshwater systems, about how PSP varies for specific taxa across temporal and spatial environmental gradients and how conserved PSP is across bacterial phylogeny. Here, we generated 16S rRNA genemore » sequencing data using simultaneously extracted DNA and RNA from fractionated (free-living and particulate) water samples taken seasonally along a eutrophic freshwater estuary to oligotrophic pelagic transect in Lake Michigan. In contrast to previous reports, we observed frequent clustering of DNA and RNA data from the same sample. Analysis of the overlap in taxa detected at the RNA and DNA level indicated that microbial dormancy may be more common in the estuary, the particulate fraction, and during the stratified period. Across spatiotemporal gradients, PSP was often conserved at the phylum and class levels. PSPs for specific taxa were more similar across habitats in spring than in summer and fall. This was most notable for PSPs of the same taxa when located in the free-living or particulate fractions, but also when contrasting surface to deep, and estuary to Lake Michigan communities. Our results show that community composition assessed by RNA and DNA measurements are more similar than previously assumed in freshwater systems. Furthermore, the similarity between RNA and DNA measurements and taxa-specific PSPs that drive community-level similarities are conditional on spatiotemporal factors.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Denef, Vincent J.; Fujimoto, Masanori; Berry, Michelle A.
Relative abundance profiles of bacterial populations measured by sequencing DNA or RNA of marker genes can widely differ. These differences, made apparent when calculating ribosomal RNA:DNA ratios, have been interpreted as variable activities of bacterial populations. However, inconsistent correlations between ribosomal RNA:DNA ratios and metabolic activity or growth rates have led to a more conservative interpretation of this metric as the cellular protein synthesis potential (PSP). Little is known, particularly in freshwater systems, about how PSP varies for specific taxa across temporal and spatial environmental gradients and how conserved PSP is across bacterial phylogeny. Here, we generated 16S rRNA genemore » sequencing data using simultaneously extracted DNA and RNA from fractionated (free-living and particulate) water samples taken seasonally along a eutrophic freshwater estuary to oligotrophic pelagic transect in Lake Michigan. In contrast to previous reports, we observed frequent clustering of DNA and RNA data from the same sample. Analysis of the overlap in taxa detected at the RNA and DNA level indicated that microbial dormancy may be more common in the estuary, the particulate fraction, and during the stratified period. Across spatiotemporal gradients, PSP was often conserved at the phylum and class levels. PSPs for specific taxa were more similar across habitats in spring than in summer and fall. This was most notable for PSPs of the same taxa when located in the free-living or particulate fractions, but also when contrasting surface to deep, and estuary to Lake Michigan communities. Our results show that community composition assessed by RNA and DNA measurements are more similar than previously assumed in freshwater systems. Furthermore, the similarity between RNA and DNA measurements and taxa-specific PSPs that drive community-level similarities are conditional on spatiotemporal factors.« less
Amino Acid Properties Conserved in Molecular Evolution
Rudnicki, Witold R.; Mroczek, Teresa; Cudek, Paweł
2014-01-01
That amino acid properties are responsible for the way protein molecules evolve is natural and is also reasonably well supported both by the structure of the genetic code and, to a large extent, by the experimental measures of the amino acid similarity. Nevertheless, there remains a significant gap between observed similarity matrices and their reconstructions from amino acid properties. Therefore, we introduce a simple theoretical model of amino acid similarity matrices, which allows splitting the matrix into two parts – one that depends only on mutabilities of amino acids and another that depends on pairwise similarities between them. Then the new synthetic amino acid properties are derived from the pairwise similarities and used to reconstruct similarity matrices covering a wide range of information entropies. Our model allows us to explain up to 94% of the variability in the BLOSUM family of the amino acids similarity matrices in terms of amino acid properties. The new properties derived from amino acid similarity matrices correlate highly with properties known to be important for molecular evolution such as hydrophobicity, size, shape and charge of amino acids. This result closes the gap in our understanding of the influence of amino acids on evolution at the molecular level. The methods were applied to the single family of similarity matrices used often in general sequence homology searches, but it is general and can be used also for more specific matrices. The new synthetic properties can be used in analyzes of protein sequences in various biological applications. PMID:24967708
Mackey, Aaron J; Pearson, William R
2004-10-01
Relational databases are designed to integrate diverse types of information and manage large sets of search results, greatly simplifying genome-scale analyses. Relational databases are essential for management and analysis of large-scale sequence analyses, and can also be used to improve the statistical significance of similarity searches by focusing on subsets of sequence libraries most likely to contain homologs. This unit describes using relational databases to improve the efficiency of sequence similarity searching and to demonstrate various large-scale genomic analyses of homology-related data. This unit describes the installation and use of a simple protein sequence database, seqdb_demo, which is used as a basis for the other protocols. These include basic use of the database to generate a novel sequence library subset, how to extend and use seqdb_demo for the storage of sequence similarity search results and making use of various kinds of stored search results to address aspects of comparative genomic analysis.
rpoB-Based Identification of Nonpigmented and Late-Pigmenting Rapidly Growing Mycobacteria
Adékambi, Toïdi; Colson, Philippe; Drancourt, Michel
2003-01-01
Nonpigmented and late-pigmenting rapidly growing mycobacteria (RGM) are increasingly isolated in clinical microbiology laboratories. Their accurate identification remains problematic because classification is labor intensive work and because new taxa are not often incorporated into classification databases. Also, 16S rRNA gene sequence analysis underestimates RGM diversity and does not distinguish between all taxa. We determined the complete nucleotide sequence of the rpoB gene, which encodes the bacterial β subunit of the RNA polymerase, for 20 RGM type strains. After using in-house software which analyzes and graphically represents variability stretches of 60 bp along the nucleotide sequence, our analysis focused on a 723-bp variable region exhibiting 83.9 to 97% interspecies similarity and 0 to 1.7% intraspecific divergence. Primer pair Myco-F-Myco-R was designed as a tool for both PCR amplification and sequencing of this region for molecular identification of RGM. This tool was used for identification of 63 RGM clinical isolates previously identified at the species level on the basis of phenotypic characteristics and by 16S rRNA gene sequence analysis. Of 63 clinical isolates, 59 (94%) exhibited <2% partial rpoB gene sequence divergence from 1 of 20 species under study and were regarded as correctly identified at the species level. Mycobacterium abscessus and Mycobacterium mucogenicum isolates were clearly distinguished from Mycobacterium chelonae; Mycobacterium mageritense isolates were clearly distinguished from “Mycobacterium houstonense.” Four isolates were not identified at the species level because they exhibited >3% partial rpoB gene sequence divergence from the corresponding type strain; they belonged to three taxa related to M. mucogenicum, Mycobacterium smegmatis, and Mycobacterium porcinum. For M. abscessus and M. mucogenicum, this partial sequence yielded a high genetic heterogeneity within the clinical isolates. We conclude that molecular identification by analysis of the 723-bp rpoB sequence is a rapid and accurate tool for identification of RGM. PMID:14662964
Lu, Hui-Meng; Yin, Da-Chuan; Ye, Ya-Jing; Luo, Hui-Min; Geng, Li-Qiang; Li, Hai-Sheng; Guo, Wei-Hong; Shang, Peng
2009-01-01
As the most widely utilized technique to determine the 3-dimensional structure of protein molecules, X-ray crystallography can provide structure of the highest resolution among the developed techniques. The resolution obtained via X-ray crystallography is known to be influenced by many factors, such as the crystal quality, diffraction techniques, and X-ray sources, etc. In this paper, the authors found that the protein sequence could also be one of the factors. We extracted information of the resolution and the sequence of proteins from the Protein Data Bank (PDB), classified the proteins into different clusters according to the sequence similarity, and statistically analyzed the relationship between the sequence similarity and the best resolution obtained. The results showed that there was a pronounced correlation between the sequence similarity and the obtained resolution. These results indicate that protein structure itself is one variable that may affect resolution when X-ray crystallography is used.
Brewer, Michael S; Swafford, Lynn; Spruill, Chad L; Bond, Jason E
2013-01-01
Arthropods are the most diverse group of eukaryotic organisms, but their phylogenetic relationships are poorly understood. Herein, we describe three mitochondrial genomes representing orders of millipedes for which complete genomes had not been characterized. Newly sequenced genomes are combined with existing data to characterize the protein coding regions of myriapods and to attempt to reconstruct the evolutionary relationships within the Myriapoda and Arthropoda. The newly sequenced genomes are similar to previously characterized millipede sequences in terms of synteny and length. Unique translocations occurred within the newly sequenced taxa, including one half of the Appalachioria falcifera genome, which is inverted with respect to other millipede genomes. Across myriapods, amino acid conservation levels are highly dependent on the gene region. Additionally, individual loci varied in the level of amino acid conservation. Overall, most gene regions showed low levels of conservation at many sites. Attempts to reconstruct the evolutionary relationships suffered from questionable relationships and low support values. Analyses of phylogenetic informativeness show the lack of signal deep in the trees (i.e., genes evolve too quickly). As a result, the myriapod tree resembles previously published results but lacks convincing support, and, within the arthropod tree, well established groups were recovered as polyphyletic. The novel genome sequences described herein provide useful genomic information concerning millipede groups that had not been investigated. Taken together with existing sequences, the variety of compositions and evolution of myriapod mitochondrial genomes are shown to be more complex than previously thought. Unfortunately, the use of mitochondrial protein-coding regions in deep arthropod phylogenetics appears problematic, a result consistent with previously published studies. Lack of phylogenetic signal renders the resulting tree topologies as suspect. As such, these data are likely inappropriate for investigating such ancient relationships.
The effect of different control point sampling sequences on convergence of VMAT inverse planning
NASA Astrophysics Data System (ADS)
Pardo Montero, Juan; Fenwick, John D.
2011-04-01
A key component of some volumetric-modulated arc therapy (VMAT) optimization algorithms is the progressive addition of control points to the optimization. This idea was introduced in Otto's seminal VMAT paper, in which a coarse sampling of control points was used at the beginning of the optimization and new control points were progressively added one at a time. A different form of the methodology is also present in the RapidArc optimizer, which adds new control points in groups called 'multiresolution levels', each doubling the number of control points in the optimization. This progressive sampling accelerates convergence, improving the results obtained, and has similarities with the ordered subset algorithm used to accelerate iterative image reconstruction. In this work we have used a VMAT optimizer developed in-house to study the performance of optimization algorithms which use different control point sampling sequences, most of which fall into three different classes: doubling sequences, which add new control points in groups such that the number of control points in the optimization is (roughly) doubled; Otto-like progressive sampling which adds one control point at a time, and equi-length sequences which contain several multiresolution levels each with the same number of control points. Results are presented in this study for two clinical geometries, prostate and head-and-neck treatments. A dependence of the quality of the final solution on the number of starting control points has been observed, in agreement with previous works. We have found that some sequences, especially E20 and E30 (equi-length sequences with 20 and 30 multiresolution levels, respectively), generate better results than a 5 multiresolution level RapidArc-like sequence. The final value of the cost function is reduced up to 20%, such reductions leading to small improvements in dosimetric parameters characterizing the treatments—slightly more homogeneous target doses and better sparing of the organs at risk.
Precise auditory-vocal mirroring in neurons for learned vocal communication.
Prather, J F; Peters, S; Nowicki, S; Mooney, R
2008-01-17
Brain mechanisms for communication must establish a correspondence between sensory and motor codes used to represent the signal. One idea is that this correspondence is established at the level of single neurons that are active when the individual performs a particular gesture or observes a similar gesture performed by another individual. Although neurons that display a precise auditory-vocal correspondence could facilitate vocal communication, they have yet to be identified. Here we report that a certain class of neurons in the swamp sparrow forebrain displays a precise auditory-vocal correspondence. We show that these neurons respond in a temporally precise fashion to auditory presentation of certain note sequences in this songbird's repertoire and to similar note sequences in other birds' songs. These neurons display nearly identical patterns of activity when the bird sings the same sequence, and disrupting auditory feedback does not alter this singing-related activity, indicating it is motor in nature. Furthermore, these neurons innervate striatal structures important for song learning, raising the possibility that singing-related activity in these cells is compared to auditory feedback to guide vocal learning.
Contour Tracking with a Spatio-Temporal Intensity Moment.
Demi, Marcello
2016-06-01
Standard edge detection operators such as the Laplacian of Gaussian and the gradient of Gaussian can be used to track contours in image sequences. When using edge operators, a contour, which is determined on a frame of the sequence, is simply used as a starting contour to locate the nearest contour on the subsequent frame. However, the strategy used to look for the nearest edge points may not work when tracking contours of non isolated gray level discontinuities. In these cases, strategies derived from the optical flow equation, which look for similar gray level distributions, appear to be more appropriate since these can work with a lower frame rate than that needed for strategies based on pure edge detection operators. However, an optical flow strategy tends to propagate the localization errors through the sequence and an additional edge detection procedure is essential to compensate for such a drawback. In this paper a spatio-temporal intensity moment is proposed which integrates the two basic functions of edge detection and tracking.
Finding functional features in Saccharomyces genomes by phylogenetic footprinting.
Cliften, Paul; Sudarsanam, Priya; Desikan, Ashwin; Fulton, Lucinda; Fulton, Bob; Majors, John; Waterston, Robert; Cohen, Barak A; Johnston, Mark
2003-07-04
The sifting and winnowing of DNA sequence that occur during evolution cause nonfunctional sequences to diverge, leaving phylogenetic footprints of functional sequence elements in comparisons of genome sequences. We searched for such footprints among the genome sequences of six Saccharomyces species and identified potentially functional sequences. Comparison of these sequences allowed us to revise the catalog of yeast genes and identify sequence motifs that may be targets of transcriptional regulatory proteins. Some of these conserved sequence motifs reside upstream of genes with similar functional annotations or similar expression patterns or those bound by the same transcription factor and are thus good candidates for functional regulatory sequences.
Garrett, Connie; Hertler, Heidi; Hoenstine, Ronald; Highley, Brad
1993-01-01
The shallow dip of the Florida carbonate platform results in low wave energy on Florida ???Big Bend??? coasts. Therefore sedimentation is dominated by river-and tidal-hydrodynamics near the Aucilla River mouth. Where present, Holocene sediments are thin and unconformably overlie Oligocene-aged Suwannee Limestone. The oldest unlithified sediments include reworked carbonate rubble with clay and wood fragments (seven thousand years old or less, based on wood radio-carbon dating). Although this basal sequence is observed in most areas, the sediments that overlie it vary. Sediment sequences from the outer littoral to submarine environments include organic-rich sands, oyster biotherm remains, and cleaner sands with organic-filled burrows. Inner littoral (salt-marsh) sequences generally consist of sandy, fining-upwards sequences in which dry weights of fine-grained clastics and organic components increase up-sequence at similar rates. Offshore sediments preserve greatly attenuated fluvial and salt-marsh facies, if these facies are preserved at all. With sea-level rise, erosion can result from insufficient sediment supply and down-cutting by tidal currents (Dolotov, 1992; and Dalrymple et al., 1992). Dolotov (1992) attributes displacement of original coastal stratigraphy to insufficient sediments for beach profile maintenance, while Dalrymple et al. (1992) attribute erosional truncation (ravinement) or complete removal of portions of typical estuarine sequences to headward migration of tidal channels.
K2 and K2*: efficient alignment-free sequence similarity measurement based on Kendall statistics.
Lin, Jie; Adjeroh, Donald A; Jiang, Bing-Hua; Jiang, Yue
2018-05-15
Alignment-free sequence comparison methods can compute the pairwise similarity between a huge number of sequences much faster than sequence-alignment based methods. We propose a new non-parametric alignment-free sequence comparison method, called K2, based on the Kendall statistics. Comparing to the other state-of-the-art alignment-free comparison methods, K2 demonstrates competitive performance in generating the phylogenetic tree, in evaluating functionally related regulatory sequences, and in computing the edit distance (similarity/dissimilarity) between sequences. Furthermore, the K2 approach is much faster than the other methods. An improved method, K2*, is also proposed, which is able to determine the appropriate algorithmic parameter (length) automatically, without first considering different values. Comparative analysis with the state-of-the-art alignment-free sequence similarity methods demonstrates the superiority of the proposed approaches, especially with increasing sequence length, or increasing dataset sizes. The K2 and K2* approaches are implemented in the R language as a package and is freely available for open access (http://community.wvu.edu/daadjeroh/projects/K2/K2_1.0.tar.gz). yueljiang@163.com. Supplementary data are available at Bioinformatics online.
A new method to improve network topological similarity search: applied to fold recognition
Lhota, John; Hauptman, Ruth; Hart, Thomas; Ng, Clara; Xie, Lei
2015-01-01
Motivation: Similarity search is the foundation of bioinformatics. It plays a key role in establishing structural, functional and evolutionary relationships between biological sequences. Although the power of the similarity search has increased steadily in recent years, a high percentage of sequences remain uncharacterized in the protein universe. Thus, new similarity search strategies are needed to efficiently and reliably infer the structure and function of new sequences. The existing paradigm for studying protein sequence, structure, function and evolution has been established based on the assumption that the protein universe is discrete and hierarchical. Cumulative evidence suggests that the protein universe is continuous. As a result, conventional sequence homology search methods may be not able to detect novel structural, functional and evolutionary relationships between proteins from weak and noisy sequence signals. To overcome the limitations in existing similarity search methods, we propose a new algorithmic framework—Enrichment of Network Topological Similarity (ENTS)—to improve the performance of large scale similarity searches in bioinformatics. Results: We apply ENTS to a challenging unsolved problem: protein fold recognition. Our rigorous benchmark studies demonstrate that ENTS considerably outperforms state-of-the-art methods. As the concept of ENTS can be applied to any similarity metric, it may provide a general framework for similarity search on any set of biological entities, given their representation as a network. Availability and implementation: Source code freely available upon request Contact: lxie@iscb.org PMID:25717198
Conservation of streptococcal CRISPRs on human skin and saliva.
Robles-Sikisaka, Refugio; Naidu, Mayuri; Ly, Melissa; Salzman, Julia; Abeles, Shira R; Boehm, Tobias K; Pride, David T
2014-06-06
Clustered Regularly Interspaced Short Palindromic Repeats (CRISPRs) are utilized by bacteria to resist encounters with their viruses. Human body surfaces have numerous bacteria that harbor CRISPRs, and their content can provide clues as to the types and features of viruses they may have encountered. We investigated the conservation of CRISPR content from streptococci on skin and saliva of human subjects over 8-weeks to determine whether similarities existed in the CRISPR spacer profiles and whether CRISPR spacers were a stable component of each biogeographic site. Most of the CRISPR sequences identified were unique, but a small proportion of spacers from the skin and saliva of each subject matched spacers derived from previously sequenced loci of S. thermophilus and other streptococci. There were significant proportions of CRISPR spacers conserved over the entire 8-week study period for all subjects, and salivary CRISPR spacers sampled in the mornings showed significantly higher levels of conservation than any other time of day. We also found substantial similarities in the spacer repertoires of the skin and saliva of each subject. Many skin-derived spacers matched salivary viruses, supporting that bacteria of the skin may encounter viruses with similar sequences to those found in the mouth. Despite the similarities between skin and salivary spacer repertoires, the variation present was distinct based on each subject and body site. The conservation of CRISPR spacers in the saliva and the skin of human subjects over the time period studied suggests a relative conservation of the bacteria harboring them.
Conservation of streptococcal CRISPRs on human skin and saliva
2014-01-01
Background Clustered Regularly Interspaced Short Palindromic Repeats (CRISPRs) are utilized by bacteria to resist encounters with their viruses. Human body surfaces have numerous bacteria that harbor CRISPRs, and their content can provide clues as to the types and features of viruses they may have encountered. Results We investigated the conservation of CRISPR content from streptococci on skin and saliva of human subjects over 8-weeks to determine whether similarities existed in the CRISPR spacer profiles and whether CRISPR spacers were a stable component of each biogeographic site. Most of the CRISPR sequences identified were unique, but a small proportion of spacers from the skin and saliva of each subject matched spacers derived from previously sequenced loci of S. thermophilus and other streptococci. There were significant proportions of CRISPR spacers conserved over the entire 8-week study period for all subjects, and salivary CRISPR spacers sampled in the mornings showed significantly higher levels of conservation than any other time of day. We also found substantial similarities in the spacer repertoires of the skin and saliva of each subject. Many skin-derived spacers matched salivary viruses, supporting that bacteria of the skin may encounter viruses with similar sequences to those found in the mouth. Despite the similarities between skin and salivary spacer repertoires, the variation present was distinct based on each subject and body site. Conclusions The conservation of CRISPR spacers in the saliva and the skin of human subjects over the time period studied suggests a relative conservation of the bacteria harboring them. PMID:24903519
Cross cultural differences in unconscious knowledge.
Kiyokawa, Sachiko; Dienes, Zoltán; Tanaka, Daisuke; Yamada, Ayumi; Crowe, Louise
2012-07-01
Previous studies have indicated cross cultural differences in conscious processes, such that Asians have a global preference and Westerners a more analytical one. We investigated whether these biases also apply to unconscious knowledge. In Experiment 1, Japanese and UK participants memorized strings of large (global) letters made out of small (local) letters. The strings constituted one sequence of letters at a global level and a different sequence at a local level. Implicit learning occurred at the global and not the local level for the Japanese but equally at both levels for the English. In Experiment 2, the Japanese preference for global over local processing persisted even when structure existed only at the local but not global level. In Experiment 3, Japanese and UK participants were asked to attend to just one of the levels, global or local. Now the cultural groups performed similarly, indicating that the bias largely reflects preference rather than ability (although the data left room for residual ability differences). In Experiment 4, the greater global advantage of Japanese rather English was confirmed for strings made of Japanese kana rather than Roman letters. That is, the cultural difference is not due to familiarity of the sequence elements. In sum, we show for the first time that cultural biases strongly affect the type of unconscious knowledge people acquire. Copyright © 2012 Elsevier B.V. All rights reserved.
Aguilera-Mendoza, Longendri; Marrero-Ponce, Yovani; Tellez-Ibarra, Roberto; Llorente-Quesada, Monica T; Salgado, Jesús; Barigye, Stephen J; Liu, Jun
2015-08-01
The large variety of antimicrobial peptide (AMP) databases developed to date are characterized by a substantial overlap of data and similarity of sequences. Our goals are to analyze the levels of redundancy for all available AMP databases and use this information to build a new non-redundant sequence database. For this purpose, a new software tool is introduced. A comparative study of 25 AMP databases reveals the overlap and diversity among them and the internal diversity within each database. The overlap analysis shows that only one database (Peptaibol) contains exclusive data, not present in any other, whereas all sequences in the LAMP_Patent database are included in CAMP_Patent. However, the majority of databases have their own set of unique sequences, as well as some overlap with other databases. The complete set of non-duplicate sequences comprises 16 990 cases, which is almost half of the total number of reported peptides. On the other hand, the diversity analysis identifies the most and least diverse databases and proves that all databases exhibit some level of redundancy. Finally, we present a new parallel-free software, named Dover Analyzer, developed to compute the overlap and diversity between any number of databases and compile a set of non-redundant sequences. These results are useful for selecting or building a suitable representative set of AMPs, according to specific needs. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.
Follin, Elna; Karlsson, Maria; Lundegaard, Claus; Nielsen, Morten; Wallin, Stefan; Paulsson, Kajsa; Westerdahl, Helena
2013-04-01
The major histocompatibility complex (MHC) genes are the most polymorphic genes found in the vertebrate genome, and they encode proteins that play an essential role in the adaptive immune response. Many songbirds (passerines) have been shown to have a large number of transcribed MHC class I genes compared to most mammals. To elucidate the reason for this large number of genes, we compared 14 MHC class I alleles (α1-α3 domains), from great reed warbler, house sparrow and tree sparrow, via phylogenetic analysis, homology modelling and in silico peptide-binding predictions to investigate their functional and genetic relationships. We found more pronounced clustering of the MHC class I allomorphs (allele specific proteins) in regards to their function (peptide-binding specificities) compared to their genetic relationships (amino acid sequences), indicating that the high number of alleles is of functional significance. The MHC class I allomorphs from house sparrow and tree sparrow, species that diverged 10 million years ago (MYA), had overlapping peptide-binding specificities, and these similarities across species were also confirmed in phylogenetic analyses based on amino acid sequences. Notably, there were also overlapping peptide-binding specificities in the allomorphs from house sparrow and great reed warbler, although these species diverged 30 MYA. This overlap was not found in a tree based on amino acid sequences. Our interpretation is that convergent evolution on the level of the protein function, possibly driven by selection from shared pathogens, has resulted in allomorphs with similar peptide-binding repertoires, although trans-species evolution in combination with gene conversion cannot be ruled out.
Elkins, Christopher A.; Savage, Dwayne C.
1998-01-01
Cytosolic extracts of Lactobacillus johnsonii 100-100 (previously reported as Lactobacillus sp. strain 100-100) contain four heterotrimeric isozymes composed of two peptides, α and β, with conjugated bile salt hydrolase (BSH) activity. We now report cloning, from the genome of strain 100-100, a 2,977-bp DNA segment that expresses BSH activity in Escherichia coli. The sequencing of this segment showed that it contained one complete and two partial open reading frames (ORFs). The 3′ partial ORF (927 nucleotides) was predicted by BLAST and confirmed with 5′ and 3′ deletions to be a BSH gene. Thermal asymmetric interlaced PCR was used to extend and complete the 948-nucleotide sequence of the BSH gene 3′ of the cloned segment. The predicted amino acid sequence of the 5′ partial ORF (651 nucleotides) was about 80% similar to the C-terminal half of the largest, complete ORF (1,353 nucleotides), and these two putative proteins were similar to several amine, multidrug resistance, and sugar transport proteins of the major facilitator superfamily. E. coli DH5α cells transformed with a construct containing these ORFs, in concert with an extracellular factor produced by strain 100-100, demonstrated levels of uptake of [14C]taurocholic acid that were increased as much as threefold over control levels. [14C]Cholic acid was taken up in similar amounts by strain DH5α pSportI (control) and DH5α p2000 (transport clones). These findings support a hypothesis that the ORFs are conjugated bile salt transport genes which may be arranged in an operon with BSH genes. PMID:9721268
Cloning and sequencing of the allophycocyanin genes from Spirulina maxima (Cyanophyta)
NASA Astrophysics Data System (ADS)
Qin, Song; Hiroyuki, Kojima; Yoshikazu, Kawata; Shin-Ichi, Yano; Zeng, Cheng-Kui
1998-03-01
The genes coding for the α-and β-subunit of allophycocyanin ( apcA and apcB) from the cyanophyte Spirulina maxima were cloned and sequenced. The results revealed 44.4% of nucleotide sequence similarity and 30.4% of similarity of deduced amino acid sequence between them. The amino acid sequence identities between S. maxima and S. platensis are 99.4% for α subunit and 100% for β subunit.
Bruce, A. Gregory; Ryan, Jonathan T.; Thomas, Mathew J.; Peng, Xinxia; Grundhoff, Adam; Tsai, Che-Chung
2013-01-01
The complete sequence of retroperitoneal fibromatosis-associated herpesvirus Macaca nemestrina (RFHVMn), the pig-tailed macaque homolog of Kaposi's sarcoma-associated herpesvirus (KSHV), was determined by next-generation sequence analysis of a Kaposi's sarcoma (KS)-like macaque tumor. Colinearity of genes was observed with the KSHV genome, and the core herpesvirus genes had strong sequence homology to the corresponding KSHV genes. RFHVMn lacked homologs of open reading frame 11 (ORF11) and KSHV ORFs K5 and K6, which appear to have been generated by duplication of ORFs K3 and K4 after the divergence of KSHV and RFHV. RFHVMn contained positional homologs of all other unique KSHV genes, although some showed limited sequence similarity. RFHVMn contained a number of candidate microRNA genes. Although there was little sequence similarity with KSHV microRNAs, one candidate contained the same seed sequence as the positional homolog, kshv-miR-K12-10a, suggesting functional overlap. RNA transcript splicing was highly conserved between RFHVMn and KSHV, and strong sequence conservation was noted in specific promoters and putative origins of replication, predicting important functional similarities. Sequence comparisons indicated that RFHVMn and KSHV developed in long-term synchrony with the evolution of their hosts, and both viruses phylogenetically group within the RV1 lineage of Old World primate rhadinoviruses. RFHVMn is the closest homolog of KSHV to be completely sequenced and the first sequenced RV1 rhadinovirus homolog of KSHV from a nonhuman Old World primate. The strong genetic and sequence similarity between RFHVMn and KSHV, coupled with similarities in biology and pathology, demonstrate that RFHVMn infection in macaques offers an important and relevant model for the study of KSHV in humans. PMID:24109218
BrEPS 2.0: Optimization of sequence pattern prediction for enzyme annotation.
Dudek, Christian-Alexander; Dannheim, Henning; Schomburg, Dietmar
2017-01-01
The prediction of gene functions is crucial for a large number of different life science areas. Faster high throughput sequencing techniques generate more and larger datasets. The manual annotation by classical wet-lab experiments is not suitable for these large amounts of data. We showed earlier that the automatic sequence pattern-based BrEPS protocol, based on manually curated sequences, can be used for the prediction of enzymatic functions of genes. The growing sequence databases provide the opportunity for more reliable patterns, but are also a challenge for the implementation of automatic protocols. We reimplemented and optimized the BrEPS pattern generation to be applicable for larger datasets in an acceptable timescale. Primary improvement of the new BrEPS protocol is the enhanced data selection step. Manually curated annotations from Swiss-Prot are used as reliable source for function prediction of enzymes observed on protein level. The pool of sequences is extended by highly similar sequences from TrEMBL and SwissProt. This allows us to restrict the selection of Swiss-Prot entries, without losing the diversity of sequences needed to generate significant patterns. Additionally, a supporting pattern type was introduced by extending the patterns at semi-conserved positions with highly similar amino acids. Extended patterns have an increased complexity, increasing the chance to match more sequences, without losing the essential structural information of the pattern. To enhance the usability of the database, we introduced enzyme function prediction based on consensus EC numbers and IUBMB enzyme nomenclature. BrEPS is part of the Braunschweig Enzyme Database (BRENDA) and is available on a completely redesigned website and as download. The database can be downloaded and used with the BrEPScmd command line tool for large scale sequence analysis. The BrEPS website and downloads for the database creation tool, command line tool and database are freely accessible at http://breps.tu-bs.de.
BrEPS 2.0: Optimization of sequence pattern prediction for enzyme annotation
Schomburg, Dietmar
2017-01-01
The prediction of gene functions is crucial for a large number of different life science areas. Faster high throughput sequencing techniques generate more and larger datasets. The manual annotation by classical wet-lab experiments is not suitable for these large amounts of data. We showed earlier that the automatic sequence pattern-based BrEPS protocol, based on manually curated sequences, can be used for the prediction of enzymatic functions of genes. The growing sequence databases provide the opportunity for more reliable patterns, but are also a challenge for the implementation of automatic protocols. We reimplemented and optimized the BrEPS pattern generation to be applicable for larger datasets in an acceptable timescale. Primary improvement of the new BrEPS protocol is the enhanced data selection step. Manually curated annotations from Swiss-Prot are used as reliable source for function prediction of enzymes observed on protein level. The pool of sequences is extended by highly similar sequences from TrEMBL and SwissProt. This allows us to restrict the selection of Swiss-Prot entries, without losing the diversity of sequences needed to generate significant patterns. Additionally, a supporting pattern type was introduced by extending the patterns at semi-conserved positions with highly similar amino acids. Extended patterns have an increased complexity, increasing the chance to match more sequences, without losing the essential structural information of the pattern. To enhance the usability of the database, we introduced enzyme function prediction based on consensus EC numbers and IUBMB enzyme nomenclature. BrEPS is part of the Braunschweig Enzyme Database (BRENDA) and is available on a completely redesigned website and as download. The database can be downloaded and used with the BrEPScmd command line tool for large scale sequence analysis. The BrEPS website and downloads for the database creation tool, command line tool and database are freely accessible at http://breps.tu-bs.de. PMID:28750104
Garland, Ellen C; Rendell, Luke; Lilley, Matthew S; Poole, M Michael; Allen, Jenny; Noad, Michael J
2017-07-01
Identifying and quantifying variation in vocalizations is fundamental to advancing our understanding of processes such as speciation, sexual selection, and cultural evolution. The song of the humpback whale (Megaptera novaeangliae) presents an extreme example of complexity and cultural evolution. It is a long, hierarchically structured vocal display that undergoes constant evolutionary change. Obtaining robust metrics to quantify song variation at multiple scales (from a sound through to population variation across the seascape) is a substantial challenge. Here, the authors present a method to quantify song similarity at multiple levels within the hierarchy. To incorporate the complexity of these multiple levels, the calculation of similarity is weighted by measurements of sound units (lower levels within the display) to bridge the gap in information between upper and lower levels. Results demonstrate that the inclusion of weighting provides a more realistic and robust representation of song similarity at multiple levels within the display. This method permits robust quantification of cultural patterns and processes that will also contribute to the conservation management of endangered humpback whale populations, and is applicable to any hierarchically structured signal sequence.
Bertke, Andrea S; Patel, Amita; Imai, Yumi; Apakupakul, Kathleen; Margolis, Todd P; Krause, Philip R
2009-10-01
Herpes simplex virus 1 (HSV-1) and HSV-2 cause similar acute infections but differ in their abilities to reactivate from trigeminal and lumbosacral dorsal root ganglia. During latency, HSV-1 and HSV-2 also preferentially express their latency-associated transcripts (LATs) in different sensory neuronal subtypes that are positive for A5 and KH10 markers, respectively. Chimeric virus studies showed that LAT region sequences influence both of these viral species-specific phenotypes. To further map the LAT region sequences responsible for these phenotypes, we constructed the chimeric virus HSV2-LAT-E1, in which exon 1 (from the LAT TATA to the intron splice site) was replaced by the corresponding sequence from HSV-1 LAT. In intravaginally infected guinea pigs, HSV2-LAT-E1 reactivated inefficiently relative to the efficiency of its rescuant and wild-type HSV-2, but it yielded similar levels of viral DNA, LAT, and ICP0 during acute and latent infection. HSV2-LAT-E1 preferentially expressed the LAT in A5+ neurons (as does HSV-1), while the chimeric viruses HSV2-LAT-P1 (LAT promoter swap) and HSV2-LAT-S1 (LAT sequence swap downstream of the promoter) exhibited neuron subtype-specific latent LAT expression phenotypes more similar to that of HSV-2 than that of HSV-1. Rescuant viruses displayed the wild-type HSV-2 phenotypes of efficient reactivation in the guinea pig genital model and a tendency to express LAT in KH10+ neurons. The region that is critical for HSV species-specific differences in latency and reactivation thus lies between the LAT TATA and the intron splice site, and minor differences in the 5' ends of chimeric sequences in HSV2-LAT-E1 and HSV2-LAT-S1 point to sequences immediately downstream of the LAT TATA.
Bertke, Andrea S.; Patel, Amita; Imai, Yumi; Apakupakul, Kathleen; Margolis, Todd P.; Krause, Philip R.
2009-01-01
Herpes simplex virus 1 (HSV-1) and HSV-2 cause similar acute infections but differ in their abilities to reactivate from trigeminal and lumbosacral dorsal root ganglia. During latency, HSV-1 and HSV-2 also preferentially express their latency-associated transcripts (LATs) in different sensory neuronal subtypes that are positive for A5 and KH10 markers, respectively. Chimeric virus studies showed that LAT region sequences influence both of these viral species-specific phenotypes. To further map the LAT region sequences responsible for these phenotypes, we constructed the chimeric virus HSV2-LAT-E1, in which exon 1 (from the LAT TATA to the intron splice site) was replaced by the corresponding sequence from HSV-1 LAT. In intravaginally infected guinea pigs, HSV2-LAT-E1 reactivated inefficiently relative to the efficiency of its rescuant and wild-type HSV-2, but it yielded similar levels of viral DNA, LAT, and ICP0 during acute and latent infection. HSV2-LAT-E1 preferentially expressed the LAT in A5+ neurons (as does HSV-1), while the chimeric viruses HSV2-LAT-P1 (LAT promoter swap) and HSV2-LAT-S1 (LAT sequence swap downstream of the promoter) exhibited neuron subtype-specific latent LAT expression phenotypes more similar to that of HSV-2 than that of HSV-1. Rescuant viruses displayed the wild-type HSV-2 phenotypes of efficient reactivation in the guinea pig genital model and a tendency to express LAT in KH10+ neurons. The region that is critical for HSV species-specific differences in latency and reactivation thus lies between the LAT TATA and the intron splice site, and minor differences in the 5′ ends of chimeric sequences in HSV2-LAT-E1 and HSV2-LAT-S1 point to sequences immediately downstream of the LAT TATA. PMID:19641003
Using SQL Databases for Sequence Similarity Searching and Analysis.
Pearson, William R; Mackey, Aaron J
2017-09-13
Relational databases can integrate diverse types of information and manage large sets of similarity search results, greatly simplifying genome-scale analyses. By focusing on taxonomic subsets of sequences, relational databases can reduce the size and redundancy of sequence libraries and improve the statistical significance of homologs. In addition, by loading similarity search results into a relational database, it becomes possible to explore and summarize the relationships between all of the proteins in an organism and those in other biological kingdoms. This unit describes how to use relational databases to improve the efficiency of sequence similarity searching and demonstrates various large-scale genomic analyses of homology-related data. It also describes the installation and use of a simple protein sequence database, seqdb_demo, which is used as a basis for the other protocols. The unit also introduces search_demo, a database that stores sequence similarity search results. The search_demo database is then used to explore the evolutionary relationships between E. coli proteins and proteins in other organisms in a large-scale comparative genomic analysis. © 2017 by John Wiley & Sons, Inc. Copyright © 2017 John Wiley & Sons, Inc.
Panwar, Priyankar; Verma, A K; Dubey, Ashutosh
2018-05-01
Barnyard ( Echinochloa frumentacea ) and finger ( Eleusine coracana ) millet growing at northwestern Himalaya were explored for the α-amylase inhibitor (α-AI). The mature seeds of barnyard millet variety PRJ1 had maximum α-AI activity which increases in different developmental stage. α-AI was purified up to 22.25-fold from barnyard millet variety PRJ1. Semi-quantitative PCR of different developmental stages of barnyard millet seeds showed increased levels of the transcript from 7 to 28 days. Sequence analysis revealed that it contained 315 bp nucleotide which encodes 104 amino acid sequence with molecular weight 10.72 kDa. The predicted 3D structure of α-AI was 86.73% similar to a bifunctional inhibitor of ragi. In silico analysis of 71 α-AI protein sequences were carried out for biochemical features, homology search, multiple sequence alignment, phylogenetic tree construction, motif, and superfamily distribution of protein sequences. Analysis of multiple sequence alignment revealed the existence of conserved regions NPLP[S/G]CRWYVV[S/Q][Q/R]TCG[V/I] throughout sequences. Superfam analysis revealed that α-AI protein sequences were distributed among seven different superfamilies.
Chan, Rachel W; von Deuster, Constantin; Giese, Daniel; Stoeck, Christian T; Harmer, Jack; Aitken, Andrew P; Atkinson, David; Kozerke, Sebastian
2014-07-01
Diffusion tensor imaging (DTI) of moving organs is gaining increasing attention but robust performance requires sequence modifications and dedicated correction methods to account for system imperfections. In this study, eddy currents in the "unipolar" Stejskal-Tanner and the velocity-compensated "bipolar" spin-echo diffusion sequences were investigated and corrected for using a magnetic field monitoring approach in combination with higher-order image reconstruction. From the field-camera measurements, increased levels of second-order eddy currents were quantified in the unipolar sequence relative to the bipolar diffusion sequence while zeroth and linear orders were found to be similar between both sequences. Second-order image reconstruction based on field-monitoring data resulted in reduced spatial misalignment artifacts and residual displacements of less than 0.43 mm and 0.29 mm (in the unipolar and bipolar sequences, respectively) after second-order eddy-current correction. Results demonstrate the need for second-order correction in unipolar encoding schemes but also show that bipolar sequences benefit from second-order reconstruction to correct for incomplete intrinsic cancellation of eddy-currents. Copyright © 2014 The Authors. Published by Elsevier Inc. All rights reserved.
tRNADB-CE: tRNA gene database well-timed in the era of big sequence data.
Abe, Takashi; Inokuchi, Hachiro; Yamada, Yuko; Muto, Akira; Iwasaki, Yuki; Ikemura, Toshimichi
2014-01-01
The tRNA gene data base curated by experts "tRNADB-CE" (http://trna.ie.niigata-u.ac.jp) was constructed by analyzing 1,966 complete and 5,272 draft genomes of prokaryotes, 171 viruses', 121 chloroplasts', and 12 eukaryotes' genomes plus fragment sequences obtained by metagenome studies of environmental samples. 595,115 tRNA genes in total, and thus two times of genes compiled previously, have been registered, for which sequence, clover-leaf structure, and results of sequence-similarity and oligonucleotide-pattern searches can be browsed. To provide collective knowledge with help from experts in tRNA researches, we added a column for enregistering comments to each tRNA. By grouping bacterial tRNAs with an identical sequence, we have found high phylogenetic preservation of tRNA sequences, especially at the phylum level. Since many species-unknown tRNAs from metagenomic sequences have sequences identical to those found in species-known prokaryotes, the identical sequence group (ISG) can provide phylogenetic markers to investigate the microbial community in an environmental ecosystem. This strategy can be applied to a huge amount of short sequences obtained from next-generation sequencers, as showing that tRNADB-CE is a well-timed database in the era of big sequence data. It is also discussed that batch-learning self-organizing-map with oligonucleotide composition is useful for efficient knowledge discovery from big sequence data.
A matter of emphasis: Linguistic stress habits modulate serial recall.
Taylor, John C; Macken, Bill; Jones, Dylan M
2015-04-01
Models of short-term memory for sequential information rely on item-level, feature-based descriptions to account for errors in serial recall. Transposition errors within alternating similar/dissimilar letter sequences derive from interactions between overlapping features. However, in two experiments, we demonstrated that the characteristics of the sequence are what determine the fates of items, rather than the properties ascribed to the items themselves. Performance in alternating sequences is determined by the way that the sequences themselves induce particular prosodic rehearsal patterns, and not by the nature of the items per se. In a serial recall task, the shapes of the canonical "saw-tooth" serial position curves and transposition error probabilities at successive input-output distances were modulated by subvocal rehearsal strategies, despite all item-based parameters being held constant. We replicated this finding using nonalternating lists, thus demonstrating that transpositions are substantially influenced by prosodic features-such as stress-that emerge during subvocal rehearsal.
Gascoyne-Binzi, D M; Heritage, J; Hawkey, P M
1993-11-01
High-level tetracycline-resistant Neisseria gonorrhoeae (TRNG) has been associated with the presence of a plasmid approximately 25.2 MDa in size which carries a Tet M tetracycline resistance determinant. Two different plasmid types, American and Dutch, have previously been described, based on the restriction endonuclease digestion pattern. In this study, the tet(M) genes from the two plasmid types have been amplified by the polymerase chain reaction (PCR) and then sequenced. The gene sequences from the two plasmids shared 96.8% identity, and showed similarities with different segments of the tet(M) gene sequences from Tn1545, Tn916 and Ureaplasma urealyticum. The data suggest that it is highly likely that the Tet M determinant found in the American type plasmid has a different origin from that present in the Dutch plasmid.
Ma, Yuyuan; Lv, Maomin; Xu, Shu; Wu, Jianmin; Tian, Kegong; Zhang, Jingang
2010-07-01
Existence of porcine endogenous retrovirus (PERV) hinders pigs to be used in clinical xenotransplantation to alleviate the shortage of human transplants. Chinese miniature pigs are potential organ donors for xenotransplantation in China. However, so far, an adequate level of information on the molecular characteristics of PERV from Chinese miniature pigs has not been available. We described here the cloning and characterization of full-length proviral DNA of PERV from Chinese Wuzhishan miniature pigs inbred (WZSP). Full-length nucleotide sequences of PERV-WZSP and other PERVs were aligned and phylogenetic tree was constructed from deduced amino-acid sequences of env. The results demonstrated that the full-length proviral DNA of PERV-WZSP belongs to gammaretrovirus and shares high similarity with other PERVs. Sequence analysis also suggested that different patterns of LTR existed in the same porcine germ line and partial PERV-C sequence may recombine with PERV-A sequence in LTR. (c) 2008 Elsevier Ltd. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Curtis, L.J.
1986-02-01
The 5s/sup 2/ /sup 1/S/sub 0/-5s5p/sup 1,3/P/sub J/ energy intervals in the Cd isoelectronic sequence have been investigated through a semiempirical systematization of recent measurements and through the performance of ab initio multiconfiguration Dirac-Fock calculations. Screening-parameter reductions of the spin-orbit and exchange energies both for the observed data and for the theoretically computed values establish the existence of empirical linearities similar to those exploited earlier for the Be, Mg, and Zn sequences. This permits extrapolative isoelectronic predictions of the relative energies of the 5s5p levels, which can be connected to 5s/sup 2/ using intersinglet intervals obtained from empirically corrected abmore » initio calculations. These linearities have also been examined homologously for the Zn, Cd, and Hg sequences, and common relationships have been found that accurately describe all three of these sequences.« less
Fast discovery and visualization of conserved regions in DNA sequences using quasi-alignment
2013-01-01
Background Next Generation Sequencing techniques are producing enormous amounts of biological sequence data and analysis becomes a major computational problem. Currently, most analysis, especially the identification of conserved regions, relies heavily on Multiple Sequence Alignment and its various heuristics such as progressive alignment, whose run time grows with the square of the number and the length of the aligned sequences and requires significant computational resources. In this work, we present a method to efficiently discover regions of high similarity across multiple sequences without performing expensive sequence alignment. The method is based on approximating edit distance between segments of sequences using p-mer frequency counts. Then, efficient high-throughput data stream clustering is used to group highly similar segments into so called quasi-alignments. Quasi-alignments have numerous applications such as identifying species and their taxonomic class from sequences, comparing sequences for similarities, and, as in this paper, discovering conserved regions across related sequences. Results In this paper, we show that quasi-alignments can be used to discover highly similar segments across multiple sequences from related or different genomes efficiently and accurately. Experiments on a large number of unaligned 16S rRNA sequences obtained from the Greengenes database show that the method is able to identify conserved regions which agree with known hypervariable regions in 16S rRNA. Furthermore, the experiments show that the proposed method scales well for large data sets with a run time that grows only linearly with the number and length of sequences, whereas for existing multiple sequence alignment heuristics the run time grows super-linearly. Conclusion Quasi-alignment-based algorithms can detect highly similar regions and conserved areas across multiple sequences. Since the run time is linear and the sequences are converted into a compact clustering model, we are able to identify conserved regions fast or even interactively using a standard PC. Our method has many potential applications such as finding characteristic signature sequences for families of organisms and studying conserved and variable regions in, for example, 16S rRNA. PMID:24564200
Fast discovery and visualization of conserved regions in DNA sequences using quasi-alignment.
Nagar, Anurag; Hahsler, Michael
2013-01-01
Next Generation Sequencing techniques are producing enormous amounts of biological sequence data and analysis becomes a major computational problem. Currently, most analysis, especially the identification of conserved regions, relies heavily on Multiple Sequence Alignment and its various heuristics such as progressive alignment, whose run time grows with the square of the number and the length of the aligned sequences and requires significant computational resources. In this work, we present a method to efficiently discover regions of high similarity across multiple sequences without performing expensive sequence alignment. The method is based on approximating edit distance between segments of sequences using p-mer frequency counts. Then, efficient high-throughput data stream clustering is used to group highly similar segments into so called quasi-alignments. Quasi-alignments have numerous applications such as identifying species and their taxonomic class from sequences, comparing sequences for similarities, and, as in this paper, discovering conserved regions across related sequences. In this paper, we show that quasi-alignments can be used to discover highly similar segments across multiple sequences from related or different genomes efficiently and accurately. Experiments on a large number of unaligned 16S rRNA sequences obtained from the Greengenes database show that the method is able to identify conserved regions which agree with known hypervariable regions in 16S rRNA. Furthermore, the experiments show that the proposed method scales well for large data sets with a run time that grows only linearly with the number and length of sequences, whereas for existing multiple sequence alignment heuristics the run time grows super-linearly. Quasi-alignment-based algorithms can detect highly similar regions and conserved areas across multiple sequences. Since the run time is linear and the sequences are converted into a compact clustering model, we are able to identify conserved regions fast or even interactively using a standard PC. Our method has many potential applications such as finding characteristic signature sequences for families of organisms and studying conserved and variable regions in, for example, 16S rRNA.
Rattei, Thomas; Tischler, Patrick; Götz, Stefan; Jehl, Marc-André; Hoser, Jonathan; Arnold, Roland; Conesa, Ana; Mewes, Hans-Werner
2010-01-01
The prediction of protein function as well as the reconstruction of evolutionary genesis employing sequence comparison at large is still the most powerful tool in sequence analysis. Due to the exponential growth of the number of known protein sequences and the subsequent quadratic growth of the similarity matrix, the computation of the Similarity Matrix of Proteins (SIMAP) becomes a computational intensive task. The SIMAP database provides a comprehensive and up-to-date pre-calculation of the protein sequence similarity matrix, sequence-based features and sequence clusters. As of September 2009, SIMAP covers 48 million proteins and more than 23 million non-redundant sequences. Novel features of SIMAP include the expansion of the sequence space by including databases such as ENSEMBL as well as the integration of metagenomes based on their consistent processing and annotation. Furthermore, protein function predictions by Blast2GO are pre-calculated for all sequences in SIMAP and the data access and query functions have been improved. SIMAP assists biologists to query the up-to-date sequence space systematically and facilitates large-scale downstream projects in computational biology. Access to SIMAP is freely provided through the web portal for individuals (http://mips.gsf.de/simap/) and for programmatic access through DAS (http://webclu.bio.wzw.tum.de/das/) and Web-Service (http://mips.gsf.de/webservices/services/SimapService2.0?wsdl).
High levels of variation in Salix lignocellulose genes revealed using poplar genomic resources
2013-01-01
Background Little is known about the levels of variation in lignin or other wood related genes in Salix, a genus that is being increasingly used for biomass and biofuel production. The lignin biosynthesis pathway is well characterized in a number of species, including the model tree Populus. We aimed to transfer the genomic resources already available in Populus to its sister genus Salix to assess levels of variation within genes involved in wood formation. Results Amplification trials for 27 gene regions were undertaken in 40 Salix taxa. Twelve of these regions were sequenced. Alignment searches of the resulting sequences against reference databases, combined with phylogenetic analyses, showed the close similarity of these Salix sequences to Populus, confirming homology of the primer regions and indicating a high level of conservation within the wood formation genes. However, all sequences were found to vary considerably among Salix species, mainly as SNPs with a smaller number of insertions-deletions. Between 25 and 176 SNPs per kbp per gene region (in predicted exons) were discovered within Salix. Conclusions The variation found is sizeable but not unexpected as it is based on interspecific and not intraspecific comparison; it is comparable to interspecific variation in Populus. The characterisation of genetic variation is a key process in pre-breeding and for the conservation and exploitation of genetic resources in Salix. This study characterises the variation in several lignocellulose gene markers for such purposes. PMID:23924375
Jessen, Leon Eyrich; Hoof, Ilka; Lund, Ole; Nielsen, Morten
2013-07-01
Identifying which mutation(s) within a given genotype is responsible for an observable phenotype is important in many aspects of molecular biology. Here, we present SigniSite, an online application for subgroup-free residue-level genotype-phenotype correlation. In contrast to similar methods, SigniSite does not require any pre-definition of subgroups or binary classification. Input is a set of protein sequences where each sequence has an associated real number, quantifying a given phenotype. SigniSite will then identify which amino acid residues are significantly associated with the data set phenotype. As output, SigniSite displays a sequence logo, depicting the strength of the phenotype association of each residue and a heat-map identifying 'hot' or 'cold' regions. SigniSite was benchmarked against SPEER, a state-of-the-art method for the prediction of specificity determining positions (SDP) using a set of human immunodeficiency virus protease-inhibitor genotype-phenotype data and corresponding resistance mutation scores from the Stanford University HIV Drug Resistance Database, and a data set of protein families with experimentally annotated SDPs. For both data sets, SigniSite was found to outperform SPEER. SigniSite is available at: http://www.cbs.dtu.dk/services/SigniSite/.
Kurgan, Lukasz; Cios, Krzysztof; Chen, Ke
2008-05-01
Protein structure prediction methods provide accurate results when a homologous protein is predicted, while poorer predictions are obtained in the absence of homologous templates. However, some protein chains that share twilight-zone pairwise identity can form similar folds and thus determining structural similarity without the sequence similarity would be desirable for the structure prediction. The folding type of a protein or its domain is defined as the structural class. Current structural class prediction methods that predict the four structural classes defined in SCOP provide up to 63% accuracy for the datasets in which sequence identity of any pair of sequences belongs to the twilight-zone. We propose SCPRED method that improves prediction accuracy for sequences that share twilight-zone pairwise similarity with sequences used for the prediction. SCPRED uses a support vector machine classifier that takes several custom-designed features as its input to predict the structural classes. Based on extensive design that considers over 2300 index-, composition- and physicochemical properties-based features along with features based on the predicted secondary structure and content, the classifier's input includes 8 features based on information extracted from the secondary structure predicted with PSI-PRED and one feature computed from the sequence. Tests performed with datasets of 1673 protein chains, in which any pair of sequences shares twilight-zone similarity, show that SCPRED obtains 80.3% accuracy when predicting the four SCOP-defined structural classes, which is superior when compared with over a dozen recent competing methods that are based on support vector machine, logistic regression, and ensemble of classifiers predictors. The SCPRED can accurately find similar structures for sequences that share low identity with sequence used for the prediction. The high predictive accuracy achieved by SCPRED is attributed to the design of the features, which are capable of separating the structural classes in spite of their low dimensionality. We also demonstrate that the SCPRED's predictions can be successfully used as a post-processing filter to improve performance of modern fold classification methods.
Kurgan, Lukasz; Cios, Krzysztof; Chen, Ke
2008-01-01
Background Protein structure prediction methods provide accurate results when a homologous protein is predicted, while poorer predictions are obtained in the absence of homologous templates. However, some protein chains that share twilight-zone pairwise identity can form similar folds and thus determining structural similarity without the sequence similarity would be desirable for the structure prediction. The folding type of a protein or its domain is defined as the structural class. Current structural class prediction methods that predict the four structural classes defined in SCOP provide up to 63% accuracy for the datasets in which sequence identity of any pair of sequences belongs to the twilight-zone. We propose SCPRED method that improves prediction accuracy for sequences that share twilight-zone pairwise similarity with sequences used for the prediction. Results SCPRED uses a support vector machine classifier that takes several custom-designed features as its input to predict the structural classes. Based on extensive design that considers over 2300 index-, composition- and physicochemical properties-based features along with features based on the predicted secondary structure and content, the classifier's input includes 8 features based on information extracted from the secondary structure predicted with PSI-PRED and one feature computed from the sequence. Tests performed with datasets of 1673 protein chains, in which any pair of sequences shares twilight-zone similarity, show that SCPRED obtains 80.3% accuracy when predicting the four SCOP-defined structural classes, which is superior when compared with over a dozen recent competing methods that are based on support vector machine, logistic regression, and ensemble of classifiers predictors. Conclusion The SCPRED can accurately find similar structures for sequences that share low identity with sequence used for the prediction. The high predictive accuracy achieved by SCPRED is attributed to the design of the features, which are capable of separating the structural classes in spite of their low dimensionality. We also demonstrate that the SCPRED's predictions can be successfully used as a post-processing filter to improve performance of modern fold classification methods. PMID:18452616
Cell cycle, differentiation and tissue-independent expression of ribosomal protein L37.
Su, S; Bird, R C
1995-09-15
A unique human cDNA (hG1.16) that encodes a mRNA of 450 nucleotides was isolated from a subtractive library derived from HeLa cells. The relative expression level of hG1.16 during different cell-cycle phases was determined by Northern-blot analysis of cells synchronized by double-thymidine block and serum deprivation/refeeding. hG1.16 was constitutively expressed during all phases of the cell cycle, including the quiescent phase when even most constitutively expressed genes experience some suppression of expression. The expression level of hG1.16 did not change during terminal differentiation of myoblasts to myotubes, during which cells become permanently post-mitotic. Examination of other tissues revealed that the relative expression level of hG1.16 was constitutive in all embryonic mouse tissues examined, including brain, eye, heart, kidney, liver, lung and skeletal muscle. This was unusual in that expression was not down-modulated during differentiation and did not vary appreciably between tissue types. Analysis by inter-species Northern-blot analysis revealed that hG1.16 was highly conserved among all vertebrates studied (from fish to humans but not in insects). DNA sequence analysis of hG1.16 revealed a high level of similarity to rat ribosomal protein L37, identifying hG1.16 as a new member of this multigene family. The deduced amino acid sequence of hG1.16 was identical to rat ribosomal protein L37 that contained 97 amino acids, many of which are highly positively charged (15 arginine and 14 lysine residues with a predicted M(r) of 11,065). hG1.16 protein has a single C2-C2 zinc-finger-like motif which is also present in rat ribosomal protein L37. Using primers designed from the sequence of hG1.16, unique bovine and rat cDNAs were also isolated by 5'-rapid-amplification of cDNA ends. DNA sequences of bovine and rat G1.16, clones were 92.8% and 92.2% similar to human G1.16 while the deduced amino acid sequences derived from bovine and rat cDNAs each differed by a single amino acid from the sequence of hG1.16 and the published rat L37 sequence. Southern-blot analysis revealed that hG1.16 exists in multiple copies in human, rat and mouse genomes. These G1.16 clones encode unique human, rat and bovine members of the ribosomal protein L37 gene family, which are constitutively expressed even during transitions from quiescence to active cell proliferation or terminal differentiation, in all tissues and all vertebrates investigated.
Community detection in sequence similarity networks based on attribute clustering
Chowdhary, Janamejaya; Loeffler, Frank E.; Smith, Jeremy C.
2017-07-24
Networks are powerful tools for the presentation and analysis of interactions in multi-component systems. A commonly studied mesoscopic feature of networks is their community structure, which arises from grouping together similar nodes into one community and dissimilar nodes into separate communities. Here in this paper, the community structure of protein sequence similarity networks is determined with a new method: Attribute Clustering Dependent Communities (ACDC). Sequence similarity has hitherto typically been quantified by the alignment score or its expectation value. However, pair alignments with the same score or expectation value cannot thus be differentiated. To overcome this deficiency, the method constructs,more » for pair alignments, an extended alignment metric, the link attribute vector, which includes the score and other alignment characteristics. Rescaling components of the attribute vectors qualitatively identifies a systematic variation of sequence similarity within protein superfamilies. The problem of community detection is then mapped to clustering the link attribute vectors, selection of an optimal subset of links and community structure refinement based on the partition density of the network. ACDC-predicted communities are found to be in good agreement with gold standard sequence databases for which the "ground truth" community structures (or families) are known. ACDC is therefore a community detection method for sequence similarity networks based entirely on pair similarity information. A serial implementation of ACDC is available from https://cmb.ornl.gov/resources/developments« less
An approach to large scale identification of non-obvious structural similarities between proteins
Cherkasov, Artem; Jones, Steven JM
2004-01-01
Background A new sequence independent bioinformatics approach allowing genome-wide search for proteins with similar three dimensional structures has been developed. By utilizing the numerical output of the sequence threading it establishes putative non-obvious structural similarities between proteins. When applied to the testing set of proteins with known three dimensional structures the developed approach was able to recognize structurally similar proteins with high accuracy. Results The method has been developed to identify pathogenic proteins with low sequence identity and high structural similarity to host analogues. Such protein structure relationships would be hypothesized to arise through convergent evolution or through ancient horizontal gene transfer events, now undetectable using current sequence alignment techniques. The pathogen proteins, which could mimic or interfere with host activities, would represent candidate virulence factors. The developed approach utilizes the numerical outputs from the sequence-structure threading. It identifies the potential structural similarity between a pair of proteins by correlating the threading scores of the corresponding two primary sequences against the library of the standard folds. This approach allowed up to 64% sensitivity and 99.9% specificity in distinguishing protein pairs with high structural similarity. Conclusion Preliminary results obtained by comparison of the genomes of Homo sapiens and several strains of Chlamydia trachomatis have demonstrated the potential usefulness of the method in the identification of bacterial proteins with known or potential roles in virulence. PMID:15147578
Community detection in sequence similarity networks based on attribute clustering
DOE Office of Scientific and Technical Information (OSTI.GOV)
Chowdhary, Janamejaya; Loeffler, Frank E.; Smith, Jeremy C.
Networks are powerful tools for the presentation and analysis of interactions in multi-component systems. A commonly studied mesoscopic feature of networks is their community structure, which arises from grouping together similar nodes into one community and dissimilar nodes into separate communities. Here in this paper, the community structure of protein sequence similarity networks is determined with a new method: Attribute Clustering Dependent Communities (ACDC). Sequence similarity has hitherto typically been quantified by the alignment score or its expectation value. However, pair alignments with the same score or expectation value cannot thus be differentiated. To overcome this deficiency, the method constructs,more » for pair alignments, an extended alignment metric, the link attribute vector, which includes the score and other alignment characteristics. Rescaling components of the attribute vectors qualitatively identifies a systematic variation of sequence similarity within protein superfamilies. The problem of community detection is then mapped to clustering the link attribute vectors, selection of an optimal subset of links and community structure refinement based on the partition density of the network. ACDC-predicted communities are found to be in good agreement with gold standard sequence databases for which the "ground truth" community structures (or families) are known. ACDC is therefore a community detection method for sequence similarity networks based entirely on pair similarity information. A serial implementation of ACDC is available from https://cmb.ornl.gov/resources/developments« less
Yin, H; Medstrand, P; Kristofferson, A; Dietrich, U; Aman, P; Blomberg, J
1999-03-30
Previously, we found a retroviral sequence, HML-6.2BC1, to be expressed at high levels in a multifocal ductal breast cancer from a 41-year-old woman who also developed ovarian carcinoma. The sequence of a human genomic clone (HML-6.28) selected by high-stringency hybridization with HML-6.2BC1 is reported here. It was 99% identical to HML-6.2BC1 and gave the same restriction fragments as total DNA. HML-6.28 is a 4.7-kb provirus with a 5'LTR, truncated in RT. Data from two similar genomic clones and sequences found in GenBank are also reported. Overlaps between them gave a rather complete picture of the HML-6.2BC1-like human endogenous retroviral elements. Work with somatic cell hybrids and FISH localized HML-6.28 to chromosome 6, band p21, close to the MHC region. The causal role of HML-6.28 in breast cancer remains unclear. Nevertheless, the ca. 20 Myr old HML-6 sequences enabled the definition of common and unique features of type A, B, and D (ABD) retroviruses. In Gag, HML-6 has no intervening sequences between matrix and capsid proteins, unlike extant exogenous ABD viruses, possibly an ancestral feature. Alignment of the dUTPase showed it to be present in all ABD viruses, but gave a phylogenetic tree different from trees made from other ABD genes, indicating a distinct phylogeny of dUTPase. A conserved 24-mer sequence in the amino terminus of some ABD envelope genes suggested a conserved function. Copyright 1999 Academic Press.
Rojas-Cartagena, Carmencita; Ortíz-Pineda, Pablo; Ramírez-Gómez, Francisco; Suárez-Castillo, Edna C.; Matos-Cruz, Vanessa; Rodríguez, Carlos; Ortíz-Zuazaga, Humberto; García-Arrarás, José E.
2010-01-01
Repair and regeneration are key processes for tissue maintenance, and their disruption may lead to disease states. Little is known about the molecular mechanisms that underline the repair and regeneration of the digestive tract. The sea cucumber Holothuria glaberrima represents an excellent model to dissect and characterize the molecular events during intestinal regeneration. To study the gene expression profile, cDNA libraries were constructed from normal, 3-day, and 7-day regenerating intestines of H. glaberrima. Clones were randomly sequenced and queried against the nonredundant protein database at the National Center for Biotechnology Information. RT-PCR analyses were made of several genes to determine their expression profile during intestinal regeneration. A total of 5,173 sequences from three cDNA libraries were obtained. About 46.2, 35.6, and 26.2% of the sequences for the normal, 3-days, and 7-days cDNA libraries, respectively, shared significant similarity with known sequences in the protein database of GenBank but only present 10% of similarity among them. Analysis of the libraries in terms of functional processes, protein domains, and most common sequences suggests that a differential expression profile is taking place during the regeneration process. Further examination of the expressed sequence tag dataset revealed that 12 putative genes are differentially expressed at significant level (R > 6). Experimental validation by RT-PCR analysis reveals that at least three genes (unknown C-4677-1, melanotransferrin, and centaurin) present a differential expression during regeneration. These findings strongly suggest that the gene expression profile varies among regeneration stages and provide evidence for the existence of differential gene expression. PMID:17579180
Identification and analysis of multigene families by comparison of exon fingerprints.
Brown, N P; Whittaker, A J; Newell, W R; Rawlings, C J; Beck, S
1995-06-02
Gene families are often recognised by sequence homology using similarity searching to find relationships, however, genomic sequence data provides gene architectural information not used by conventional search methods. In particular, intron positions and phases are expected to be relatively conserved features, because mis-splicing and reading frame shifts should be selected against. A fast search technique capable of detecting possible weak sequence homologies apparent at the intron/exon level of gene organization is presented for comparing spliceosomal genes and gene fragments. FINEX compares strings of exons delimited by intron/exon boundary positions and intron phases (exon fingerprint) using a global dynamic programming algorithm with a combined intron phase identity and exon size dissimilarity score. Exon fingerprints are typically two orders of magnitude smaller than their nucleic acid sequence counterparts giving rise to fast search times: a ranked search against a library of 6755 fingerprints for a typical three exon fingerprint completes in under 30 seconds on an ordinary workstation, while a worst case largest fingerprint of 52 exons completes in just over one minute. The short "sequence" length of exon fingerprints in comparisons is compensated for by the large exon alphabet compounded of intron phase types and a wide range of exon sizes, the latter contributing the most information to alignments. FINEX performs better in some searches than conventional methods, finding matches with similar exon organization, but low sequence homology. A search using a human serum albumin finds all members of the multigene family in the FINEX database at the top of the search ranking, despite very low amino acid percentage identities between family members. The method should complement conventional sequence searching and alignment techniques, offering a means of identifying otherwise hard to detect homologies where genomic data are available.
Genome-wide signatures of convergent evolution in echolocating mammals
Parker, Joe; Tsagkogeorga, Georgia; Cotton, James A.; Liu, Yuan; Provero, Paolo; Stupka, Elia; Rossiter, Stephen J.
2013-01-01
Evolution is typically thought to proceed through divergence of genes, proteins, and ultimately phenotypes1-3. However, similar traits might also evolve convergently in unrelated taxa due to similar selection pressures4,5. Adaptive phenotypic convergence is widespread in nature, and recent results from a handful of genes have suggested that this phenomenon is powerful enough to also drive recurrent evolution at the sequence level6-9. Where homoplasious substitutions do occur these have long been considered the result of neutral processes. However, recent studies have demonstrated that adaptive convergent sequence evolution can be detected in vertebrates using statistical methods that model parallel evolution9,10 although the extent to which sequence convergence between genera occurs across genomes is unknown. Here we analyse genomic sequence data in mammals that have independently evolved echolocation and show for the first time that convergence is not a rare process restricted to a handful of loci but is instead widespread, continuously distributed and commonly driven by natural selection acting on a small number of sites per locus. Systematic analyses of convergent sequence evolution in 805,053 amino acids within 2,326 orthologous coding gene sequences compared across 22 mammals (including four new bat genomes) revealed signatures consistent with convergence in nearly 200 loci. Strong and significant support for convergence among bats and the dolphin was seen in numerous genes linked to hearing or deafness, consistent with an involvement in echolocation. Surprisingly we also found convergence in many genes linked to vision: the convergent signal of many sensory genes was robustly correlated with the strength of natural selection. This first attempt to detect genome-wide convergent sequence evolution across divergent taxa reveals the phenomenon to be much more pervasive than previously recognised. PMID:24005325
Isolation of laccase gene-specific sequences from white rot and brown rot fungi by PCR.
D'Souza, T M; Boominathan, K; Reddy, C A
1996-01-01
Degenerate primers corresponding to the consensus sequences of the copper-binding regions in the N-terminal domains of known basidiomycete laccases were used to isolate laccase gene-specific sequences from strains representing nine genera of wood rot fungi. All except three gave the expected PCR product of about 200 bp. Computer searches of the databases identified the sequence of each of the PCR products analyzed as a laccase gene sequence, suggesting the specificity of the primers. PCR products of the white rot fungi Ganoderma lucidum, Phlebia brevispora, and Trametes versicolor showed 65 to 74% nucleotide sequence similarity to each other; the similarity in deduced amino acid sequences was 83 to 91%. The PCR products of Lentinula edodes and Lentinus tigrinus, on the other hand, showed relatively low nucleotide and amino acid similarities (58 to 64 and 62 to 81%, respectively); however, these similarities were still much higher than when compared with the corresponding regions in the laccases of the ascomycete fungi Aspergillus nidulans and Neurospora crassa. A few of the white rot fungi, as well as Gloeophyllum trabeum, a brown rot fungus, gave a 144-bp PCR fragment which had a nucleotide sequence similarity of 60 to 71%. Demonstration of laccase activity in G. trabeum and several other brown rot fungi was of particular interest because these organisms were not previously shown to produce laccases. PMID:8837429
Benson, Dennis A; Karsch-Mizrachi, Ilene; Lipman, David J; Ostell, James; Sayers, Eric W
2010-01-01
GenBank is a comprehensive database that contains publicly available nucleotide sequences for more than 300,000 organisms named at the genus level or lower, obtained primarily through submissions from individual laboratories and batch submissions from large-scale sequencing projects, including whole genome shotgun (WGS) and environmental sampling projects. Most submissions are made using the web-based BankIt or standalone Sequin programs, and accession numbers are assigned by GenBank staff upon receipt. Daily data exchange with the European Molecular Biology Laboratory Nucleotide Sequence Database in Europe and the DNA Data Bank of Japan ensures worldwide coverage. GenBank is accessible through the NCBI Entrez retrieval system, which integrates data from the major DNA and protein sequence databases along with taxonomy, genome, mapping, protein structure and domain information, and the biomedical journal literature via PubMed. BLAST provides sequence similarity searches of GenBank and other sequence databases. Complete bi-monthly releases and daily updates of the GenBank database are available by FTP. To access GenBank and its related retrieval and analysis services, begin at the NCBI homepage: www.ncbi.nlm.nih.gov.
Benson, Dennis A; Karsch-Mizrachi, Ilene; Lipman, David J; Ostell, James; Sayers, Eric W
2009-01-01
GenBank is a comprehensive database that contains publicly available nucleotide sequences for more than 300,000 organisms named at the genus level or lower, obtained primarily through submissions from individual laboratories and batch submissions from large-scale sequencing projects. Most submissions are made using the web-based BankIt or standalone Sequin programs, and accession numbers are assigned by GenBank(R) staff upon receipt. Daily data exchange with the European Molecular Biology Laboratory Nucleotide Sequence Database in Europe and the DNA Data Bank of Japan ensures worldwide coverage. GenBank is accessible through the National Center for Biotechnology Information (NCBI) Entrez retrieval system, which integrates data from the major DNA and protein sequence databases along with taxonomy, genome, mapping, protein structure and domain information, and the biomedical journal literature via PubMed. BLAST provides sequence similarity searches of GenBank and other sequence databases. Complete bimonthly releases and daily updates of the GenBank database are available by FTP. To access GenBank and its related retrieval and analysis services, begin at the NCBI Homepage: www.ncbi.nlm.nih.gov.
Gold, Nicola D; Jackson, Richard M
2006-02-03
The rapid growth in protein structural data and the emergence of structural genomics projects have increased the need for automatic structure analysis and tools for function prediction. Small molecule recognition is critical to the function of many proteins; therefore, determination of ligand binding site similarity is important for understanding ligand interactions and may allow their functional classification. Here, we present a binding sites database (SitesBase) that given a known protein-ligand binding site allows rapid retrieval of other binding sites with similar structure independent of overall sequence or fold similarity. However, each match is also annotated with sequence similarity and fold information to aid interpretation of structure and functional similarity. Similarity in ligand binding sites can indicate common binding modes and recognition of similar molecules, allowing potential inference of function for an uncharacterised protein or providing additional evidence of common function where sequence or fold similarity is already known. Alternatively, the resource can provide valuable information for detailed studies of molecular recognition including structure-based ligand design and in understanding ligand cross-reactivity. Here, we show examples of atomic similarity between superfamily or more distant fold relatives as well as between seemingly unrelated proteins. Assignment of unclassified proteins to structural superfamiles is also undertaken and in most cases substantiates assignments made using sequence similarity. Correct assignment is also possible where sequence similarity fails to find significant matches, illustrating the potential use of binding site comparisons for newly determined proteins.
PRISE2: software for designing sequence-selective PCR primers and probes.
Huang, Yu-Ting; Yang, Jiue-in; Chrobak, Marek; Borneman, James
2014-09-25
PRISE2 is a new software tool for designing sequence-selective PCR primers and probes. To achieve high level of selectivity, PRISE2 allows the user to specify a collection of target sequences that the primers are supposed to amplify, as well as non-target sequences that should not be amplified. The program emphasizes primer selectivity on the 3' end, which is crucial for selective amplification of conserved sequences such as rRNA genes. In PRISE2, users can specify desired properties of primers, including length, GC content, and others. They can interactively manipulate the list of candidate primers, to choose primer pairs that are best suited for their needs. A similar process is used to add probes to selected primer pairs. More advanced features include, for example, the capability to define a custom mismatch penalty function. PRISE2 is equipped with a graphical, user-friendly interface, and it runs on Windows, Macintosh or Linux machines. PRISE2 has been tested on two very similar strains of the fungus Dactylella oviparasitica, and it was able to create highly selective primers and probes for each of them, demonstrating the ability to create useful sequence-selective assays. PRISE2 is a user-friendly, interactive software package that can be used to design high-quality selective primers for PCR experiments. In addition to choosing primers, users have an option to add a probe to any selected primer pair, enabling design of Taqman and other primer-probe based assays. PRISE2 can also be used to design probes for FISH and other hybridization-based assays.
Glareosin: a novel sexually dimorphic urinary lipocalin in the bank vole, Myodes glareolus.
Loxley, Grace M; Unsworth, Jennifer; Turton, Michael J; Jebb, Alexandra; Lilley, Kathryn S; Simpson, Deborah M; Rigden, Daniel J; Hurst, Jane L; Beynon, Robert J
2017-09-01
The urine of bank voles ( Myodes glareolus ) contains substantial quantities of a small protein that is expressed at much higher levels in males than females, and at higher levels in males in the breeding season. This protein was purified and completely sequenced at the protein level by mass spectrometry. Leucine/isoleucine ambiguity was completely resolved by metabolic labelling, monitoring the incorporation of dietary deuterated leucine into specific sites in the protein. The predicted mass of the sequenced protein was exactly consonant with the mass of the protein measured in bank vole urine samples, correcting for the formation of two disulfide bonds. The sequence of the protein revealed that it was a lipocalin related to aphrodisin and other odorant-binding proteins (OBPs), but differed from all OBPs previously described. The pattern of secretion in urine used for scent marking by male bank voles, and the similarity to other lipocalins used as chemical signals in rodents, suggest that this protein plays a role in male sexual and/or competitive communication. We propose the name glareosin for this novel protein to reflect the origin of the protein and to emphasize the distinction from known OBPs. © 2017 The Authors.
Taniguchi, Takako; Sekiya, Ayumi; Higa, Mariko; Saeki, Yuji; Umeki, Kazumi; Okayama, Akihiko; Hayashi, Tetsuya
2014-01-01
Helicobacter cinaedi infection is recognized as an increasingly important emerging disease in humans. Although H. cinaedi-like strains have been isolated from a variety of animals, it is difficult to identify particular isolates due to their unusual phenotypic profiles and the limited number of biochemical tests for detecting helicobacters. Moreover, analyses of the 16S rRNA gene sequences are also limited due to the high levels of similarity among closely related helicobacters. This study was conducted to evaluate intact-cell mass spectrometry (ICMS) profiling using matrix-assisted laser desorption ionization–time of flight mass spectrometry (MALDI-TOF MS) as a tool for the identification of H. cinaedi. A total of 68 strains of H. cinaedi isolated from humans, dogs, a cat, and hamsters were examined in addition to other Helicobacter species. The major ICMS profiles of H. cinaedi were identical and differed from those of Helicobacter bilis, which show >98% sequence similarity at the 16S rRNA sequence level. A phyloproteomic analysis of the H. cinaedi strains examined in this work revealed that human isolates formed a single cluster that was distinct from that of the animal isolates, with the exception of two strains from dogs. These phyloproteomic results agreed with those of the phylogenetic analysis based on the nucleotide sequences of the hsp60 gene. Because they formed a distinct cluster in both analyses, our data suggest that animal strains may not be a major source of infection in humans. In conclusion, the ICMS profiles obtained using a MALDI-TOF MS approach may be useful for the identification and subtyping of H. cinaedi. PMID:24153128
Ultrashort Echo Time and Zero Echo Time MRI at 7T
Larson, Peder E. Z.; Han, Misung; Krug, Roland; Jakary, Angela; Nelson, Sarah J.; Vigneron, Daniel B.; Henry, Roland G.; McKinnon, Graeme; Kelley, Douglas A. C.
2016-01-01
Object Zero echo time (ZTE) and ultrashort echo time (UTE) pulse sequences for MRI offer unique advantages of being able to detect signal from rapidly decaying short-T2 tissue components. In this paper, we applied 3D zero echo time (ZTE) and ultrashort echo time (UTE) pulse sequences at 7T to assess differences between these methods. Materials and Methods We matched the ZTE and UTE pulse sequences closely in terms of readout trajectories and image contrast. Our ZTE used the Water- and fat-suppressed solid-state proton projection imaging (WASPI) method to fill the center of k-space. Images from healthy volunteers obtained at 7T were compared qualitatively as well as with SNR and CNR measurements for various ultrashort, short, and long-T2 tissues. Results We measured nearly identical contrast-to-noise and signal-to-noise ratios (CNR/SNR) in similar scan times between the two approaches for ultrashort, short, and long-T2 components in the brain, knee and ankle. In our protocol, we observed gradient fidelity artifacts in UTE, and our chosen flip angle and readout also resulted as well as shading artifacts in ZTE due to inadvertent spatial selectivity. These can be corrected by advanced reconstruction methods or with different chosen protocol parameters. Conclusion The applied ZTE and UTE pulse sequences achieved similar contrast and SNR efficiency for volumetric imaging of ultrashort-T2 components. Several key differences are that ZTE is limited to volumetric imaging but has substantially reduced acoustic noise levels during the scan. Meanwhile, UTE has higher acoustic noise levels and greater sensitivity to gradient fidelity, but offers more flexibility in image contrast and volume selection. PMID:26702940
Zhu, Daochen; Tanabe, Shoko-Hosoi; Yang, Chong; Zhang, Weimin; Sun, Jianzhong
2013-01-01
Background Subseafloor sediments accumulate large amounts of organic and inorganic materials that contain a highly diverse microbial ecosystem. The aim of this study was to survey the bacterial community of subseafloor sediments from the South China Sea. Methodology/Principal Findings Pyrosequencing of over 265,000 amplicons of the V3 hypervariable region of the 16S ribosomal RNA gene was performed on 16 sediment samples collected from multiple locations in the northern region of the South China Sea from depths ranging from 35 to 4000 m. A total of 9,726 operational taxonomic units (OTUs; between 695 and 2819 unique OTUs per sample) at 97% sequence similarity level were generated. In total, 40 bacterial phyla including 22 formally described phyla and 18 candidate phyla, with Proteobacteria, Firmicutes, Planctomycetes, Actinobacteria and Chloroflexi being most diverse, were identified. The most abundant phylotype, accounting for 42.6% of all sequences, belonged to Gammaproteobacteria, which possessed absolute predominance in the samples analyzed. Among the 18 candidate phyla, 12 were found for the first time in the South China Sea. Conclusions This study provided a novel insight into the composition of bacterial communities of the South China Sea subseafloor. Furthermore, abundances and community similarity analysis showed that the compositions of the bacterial communities are very similar at phylum level at different depths from 35-4000 m. PMID:24205246
Zhu, Daochen; Tanabe, Shoko-Hosoi; Yang, Chong; Zhang, Weimin; Sun, Jianzhong
2013-01-01
Subseafloor sediments accumulate large amounts of organic and inorganic materials that contain a highly diverse microbial ecosystem. The aim of this study was to survey the bacterial community of subseafloor sediments from the South China Sea. Pyrosequencing of over 265,000 amplicons of the V3 hypervariable region of the 16S ribosomal RNA gene was performed on 16 sediment samples collected from multiple locations in the northern region of the South China Sea from depths ranging from 35 to 4000 m. A total of 9,726 operational taxonomic units (OTUs; between 695 and 2819 unique OTUs per sample) at 97% sequence similarity level were generated. In total, 40 bacterial phyla including 22 formally described phyla and 18 candidate phyla, with Proteobacteria, Firmicutes, Planctomycetes, Actinobacteria and Chloroflexi being most diverse, were identified. The most abundant phylotype, accounting for 42.6% of all sequences, belonged to Gammaproteobacteria, which possessed absolute predominance in the samples analyzed. Among the 18 candidate phyla, 12 were found for the first time in the South China Sea. This study provided a novel insight into the composition of bacterial communities of the South China Sea subseafloor. Furthermore, abundances and community similarity analysis showed that the compositions of the bacterial communities are very similar at phylum level at different depths from 35-4000 m.
Local alignment of two-base encoded DNA sequence
Homer, Nils; Merriman, Barry; Nelson, Stanley F
2009-01-01
Background DNA sequence comparison is based on optimal local alignment of two sequences using a similarity score. However, some new DNA sequencing technologies do not directly measure the base sequence, but rather an encoded form, such as the two-base encoding considered here. In order to compare such data to a reference sequence, the data must be decoded into sequence. The decoding is deterministic, but the possibility of measurement errors requires searching among all possible error modes and resulting alignments to achieve an optimal balance of fewer errors versus greater sequence similarity. Results We present an extension of the standard dynamic programming method for local alignment, which simultaneously decodes the data and performs the alignment, maximizing a similarity score based on a weighted combination of errors and edits, and allowing an affine gap penalty. We also present simulations that demonstrate the performance characteristics of our two base encoded alignment method and contrast those with standard DNA sequence alignment under the same conditions. Conclusion The new local alignment algorithm for two-base encoded data has substantial power to properly detect and correct measurement errors while identifying underlying sequence variants, and facilitating genome re-sequencing efforts based on this form of sequence data. PMID:19508732
McDougall, Carmel; Woodcroft, Ben J.
2016-01-01
In nature, numerous mechanisms have evolved by which organisms fabricate biological structures with an impressive array of physical characteristics. Some examples of metazoan biological materials include the highly elastic byssal threads by which bivalves attach themselves to rocks, biomineralized structures that form the skeletons of various animals, and spider silks that are renowned for their exceptional strength and elasticity. The remarkable properties of silks, which are perhaps the best studied biological materials, are the result of the highly repetitive, modular, and biased amino acid composition of the proteins that compose them. Interestingly, similar levels of modularity/repetitiveness and similar bias in amino acid compositions have been reported in proteins that are components of structural materials in other organisms, however the exact nature and extent of this similarity, and its functional and evolutionary relevance, is unknown. Here, we investigate this similarity and use sequence features common to silks and other known structural proteins to develop a bioinformatics-based method to identify similar proteins from large-scale transcriptome and whole-genome datasets. We show that a large number of proteins identified using this method have roles in biological material formation throughout the animal kingdom. Despite the similarity in sequence characteristics, most of the silk-like structural proteins (SLSPs) identified in this study appear to have evolved independently and are restricted to a particular animal lineage. Although the exact function of many of these SLSPs is unknown, the apparent independent evolution of proteins with similar sequence characteristics in divergent lineages suggests that these features are important for the assembly of biological materials. The identification of these characteristics enable the generation of testable hypotheses regarding the mechanisms by which these proteins assemble and direct the construction of biological materials with diverse morphologies. The SilkSlider predictor software developed here is available at https://github.com/wwood/SilkSlider. PMID:27415783
Exploring Dance Movement Data Using Sequence Alignment Methods
Chavoshi, Seyed Hossein; De Baets, Bernard; Neutens, Tijs; De Tré, Guy; Van de Weghe, Nico
2015-01-01
Despite the abundance of research on knowledge discovery from moving object databases, only a limited number of studies have examined the interaction between moving point objects in space over time. This paper describes a novel approach for measuring similarity in the interaction between moving objects. The proposed approach consists of three steps. First, we transform movement data into sequences of successive qualitative relations based on the Qualitative Trajectory Calculus (QTC). Second, sequence alignment methods are applied to measure the similarity between movement sequences. Finally, movement sequences are grouped based on similarity by means of an agglomerative hierarchical clustering method. The applicability of this approach is tested using movement data from samba and tango dancers. PMID:26181435
The limits of protein sequence comparison?
Pearson, William R; Sierk, Michael L
2010-01-01
Modern sequence alignment algorithms are used routinely to identify homologous proteins, proteins that share a common ancestor. Homologous proteins always share similar structures and often have similar functions. Over the past 20 years, sequence comparison has become both more sensitive, largely because of profile-based methods, and more reliable, because of more accurate statistical estimates. As sequence and structure databases become larger, and comparison methods become more powerful, reliable statistical estimates will become even more important for distinguishing similarities that are due to homology from those that are due to analogy (convergence). The newest sequence alignment methods are more sensitive than older methods, but more accurate statistical estimates are needed for their full power to be realized. PMID:15919194
Similar clinical and neuroimaging features in monozygotic twin pair with mutation in progranulin
McDade, E.; Burrus, T.M.; Boot, B.P.; Kantarci, K.; Fields, J.; Lowe, V.J.; Peller, P.; Knopman, D.; Baker, M.; Finch, N.; Rademakers, R.; Petersen, R.
2012-01-01
Objective: To report the phenotypic characterization of monozygotic twins with mutations encoding progranulin (PGRN). Methods: We studied a twin pair with an exon 4 gene deletion in the PGRN gene. Both twins had clinical and neuropsychological examinations as well as structural MRI and fluorodeoxyglucose PET (FDG-PET) scans. PGRN gene sequencing was performed followed by progranulin ELISA in plasma. Results: Both twins manifested symptoms within 3 years of each other, with early behavioral, language, dysexecutive, and memory problems. MRI and FDG-PET imaging demonstrated a strikingly similar topography of findings with clear left hemisphere predominance. Serum progranulin levels in both were well below those from a normal population sample. Conclusions: Compared with the heterogeneity seen in many families with PGRN mutations, these monozygotic twins demonstrated strong clinical, neuroimaging, and serum progranulin level similarities, demonstrating the importance of shared genetic profiles beyond environmental influences in the symptomatic expression of the disease. PMID:22491866
Movie denoising by average of warped lines.
Bertalmío, Marcelo; Caselles, Vicent; Pardo, Alvaro
2007-09-01
Here, we present an efficient method for movie denoising that does not require any motion estimation. The method is based on the well-known fact that averaging several realizations of a random variable reduces the variance. For each pixel to be denoised, we look for close similar samples along the level surface passing through it. With these similar samples, we estimate the denoised pixel. The method to find close similar samples is done via warping lines in spatiotemporal neighborhoods. For that end, we present an algorithm based on a method for epipolar line matching in stereo pairs which has per-line complexity O (N), where N is the number of columns in the image. In this way, when applied to the image sequence, our algorithm is computationally efficient, having a complexity of the order of the total number of pixels. Furthermore, we show that the presented method is unsupervised and is adapted to denoise image sequences with an additive white noise while respecting the visual details on the movie frames. We have also experimented with other types of noise with satisfactory results.
Genomic Sequence around Butterfly Wing Development Genes: Annotation and Comparative Analysis
Conceição, Inês C.; Long, Anthony D.; Gruber, Jonathan D.; Beldade, Patrícia
2011-01-01
Background Analysis of genomic sequence allows characterization of genome content and organization, and access beyond gene-coding regions for identification of functional elements. BAC libraries, where relatively large genomic regions are made readily available, are especially useful for species without a fully sequenced genome and can increase genomic coverage of phylogenetic and biological diversity. For example, no butterfly genome is yet available despite the unique genetic and biological properties of this group, such as diversified wing color patterns. The evolution and development of these patterns is being studied in a few target species, including Bicyclus anynana, where a whole-genome BAC library allows targeted access to large genomic regions. Methodology/Principal Findings We characterize ∼1.3 Mb of genomic sequence around 11 selected genes expressed in B. anynana developing wings. Extensive manual curation of in silico predictions, also making use of a large dataset of expressed genes for this species, identified repetitive elements and protein coding sequence, and highlighted an expansion of Alcohol dehydrogenase genes. Comparative analysis with orthologous regions of the lepidopteran reference genome allowed assessment of conservation of fine-scale synteny (with detection of new inversions and translocations) and of DNA sequence (with detection of high levels of conservation of non-coding regions around some, but not all, developmental genes). Conclusions The general properties and organization of the available B. anynana genomic sequence are similar to the lepidopteran reference, despite the more than 140 MY divergence. Our results lay the groundwork for further studies of new interesting findings in relation to both coding and non-coding sequence: 1) the Alcohol dehydrogenase expansion with higher similarity between the five tandemly-repeated B. anynana paralogs than with the corresponding B. mori orthologs, and 2) the high conservation of non-coding sequence around the genes wingless and Ecdysone receptor, both involved in multiple developmental processes including wing pattern formation. PMID:21909358
Evidence for the Concerted Evolution between Short Linear Protein Motifs and Their Flanking Regions
Chica, Claudia; Diella, Francesca; Gibson, Toby J.
2009-01-01
Background Linear motifs are short modules of protein sequences that play a crucial role in mediating and regulating many protein–protein interactions. The function of linear motifs strongly depends on the context, e.g. functional instances mainly occur inside flexible regions that are accessible for interaction. Sometimes linear motifs appear as isolated islands of conservation in multiple sequence alignments. However, they also occur in larger blocks of sequence conservation, suggesting an active role for the neighbouring amino acids. Results The evolution of regions flanking 116 functional linear motif instances was studied. The conservation of the amino acid sequence and order/disorder tendency of those regions was related to presence/absence of the instance. For the majority of the analysed instances, the pairs of sequences conserving the linear motif were also observed to maintain a similar local structural tendency and/or to have higher local sequence conservation when compared to pairs of sequences where one is missing the linear motif. Furthermore, those instances have a higher chance to co–evolve with the neighbouring residues in comparison to the distant ones. Those findings are supported by examples where the regulation of the linear motif–mediated interaction has been shown to depend on the modifications (e.g. phosphorylation) at neighbouring positions or is thought to benefit from the binding versatility of disordered regions. Conclusion The results suggest that flanking regions are relevant for linear motif–mediated interactions, both at the structural and sequence level. More interestingly, they indicate that the prediction of linear motif instances can be enriched with contextual information by performing a sequence analysis similar to the one presented here. This can facilitate the understanding of the role of these predicted instances in determining the protein function inside the broader context of the cellular network where they arise. PMID:19584925
Kinoti, Wycliff M; Constable, Fiona E; Nancarrow, Narelle; Plummer, Kim M; Rodoni, Brendan
2017-01-01
PCR amplicon next generation sequencing (NGS) analysis offers a broadly applicable and targeted approach to detect populations of both high- or low-frequency virus variants in one or more plant samples. In this study, amplicon NGS was used to explore the diversity of the tripartite genome virus, Prunus necrotic ringspot virus (PNRSV) from 53 PNRSV-infected trees using amplicons from conserved gene regions of each of PNRSV RNA1, RNA2 and RNA3. Sequencing of the amplicons from 53 PNRSV-infected trees revealed differing levels of polymorphism across the three different components of the PNRSV genome with a total number of 5040, 2083 and 5486 sequence variants observed for RNA1, RNA2 and RNA3 respectively. The RNA2 had the lowest diversity of sequences compared to RNA1 and RNA3, reflecting the lack of flexibility tolerated by the replicase gene that is encoded by this RNA component. Distinct PNRSV phylo-groups, consisting of closely related clusters of sequence variants, were observed in each of PNRSV RNA1, RNA2 and RNA3. Most plant samples had a single phylo-group for each RNA component. Haplotype network analysis showed that smaller clusters of PNRSV sequence variants were genetically connected to the largest sequence variant cluster within a phylo-group of each RNA component. Some plant samples had sequence variants occurring in multiple PNRSV phylo-groups in at least one of each RNA and these phylo-groups formed distinct clades that represent PNRSV genetic strains. Variants within the same phylo-group of each Prunus plant sample had ≥97% similarity and phylo-groups within a Prunus plant sample and between samples had less ≤97% similarity. Based on the analysis of diversity, a definition of a PNRSV genetic strain was proposed. The proposed definition was applied to determine the number of PNRSV genetic strains in each of the plant samples and the complexity in defining genetic strains in multipartite genome viruses was explored.
Analysis of expressed sequence tags of the cyclically parthenogenetic rotifer Brachionus plicatilis.
Suga, Koushirou; Welch, David Mark; Tanaka, Yukari; Sakakura, Yoshitaka; Hagiwara, Atsushi
2007-08-01
Rotifers are among the most common non-arthropod animals and are the most experimentally tractable members of the basal assemblage of metazoan phyla known as Gnathifera. The monogonont rotifer Brachionus plicatilis is a developing model system for ecotoxicology, aquatic ecology, cryptic speciation, and the evolution of sex, and is an important food source for finfish aquaculture. However, basic knowledge of the genome and transcriptome of any rotifer species has been lacking. We generated and partially sequenced a cDNA library from B. plicatilis and constructed a database of over 2300 expressed sequence tags corresponding to more than 450 transcripts. About 20% of the transcripts had no significant similarity to database sequences by BLAST; most of these contained open reading frames of significant length but few had recognized Pfam motifs. Sixteen transcripts accounted for 25% of the ESTs; four of these had no significant similarity to BLAST or Pfam databases. Putative up- and downstream untranslated regions are relatively short and AT rich. In contrast to bdelloid rotifers, there was no evidence of a conserved trans-spliced leader sequence among the transcripts and most genes were single-copy. Despite the small size of this EST project it revealed several important features of the rotifer transcriptome and of individual monogonont genes. Because there is little genomic data for Gnathifera, the transcripts we found with no known function may represent genes that are species-, class-, phylum- or even superphylum-specific; the fact that some are among the most highly expressed indicates their importance. The absence of trans-spliced leader exons in this monogonont species contrasts with their abundance in bdelloid rotifers and indicates that the presence of this phenomenon can vary at the subphylum level. Our EST database provides a relatively large quantity of transcript-level data for B. plicatilis, and more generally of rotifers and other gnathiferan phyla, and can be browsed and searched at gmod.mbl.edu.
Analysis of Expressed Sequence Tags of the Cyclically Parthenogenetic Rotifer Brachionus plicatilis
Suga, Koushirou; Mark Welch, David; Tanaka, Yukari; Sakakura, Yoshitaka; Hagiwara, Atsushi
2007-01-01
Background Rotifers are among the most common non-arthropod animals and are the most experimentally tractable members of the basal assemblage of metazoan phyla known as Gnathifera. The monogonont rotifer Brachionus plicatilis is a developing model system for ecotoxicology, aquatic ecology, cryptic speciation, and the evolution of sex, and is an important food source for finfish aquaculture. However, basic knowledge of the genome and transcriptome of any rotifer species has been lacking. Methodology/Principal Findings We generated and partially sequenced a cDNA library from B. plicatilis and constructed a database of over 2300 expressed sequence tags corresponding to more than 450 transcripts. About 20% of the transcripts had no significant similarity to database sequences by BLAST; most of these contained open reading frames of significant length but few had recognized Pfam motifs. Sixteen transcripts accounted for 25% of the ESTs; four of these had no significant similarity to BLAST or Pfam databases. Putative up- and downstream untranslated regions are relatively short and AT rich. In contrast to bdelloid rotifers, there was no evidence of a conserved trans-spliced leader sequence among the transcripts and most genes were single-copy. Conclusions/Significance Despite the small size of this EST project it revealed several important features of the rotifer transcriptome and of individual monogonont genes. Because there is little genomic data for Gnathifera, the transcripts we found with no known function may represent genes that are species-, class-, phylum- or even superphylum-specific; the fact that some are among the most highly expressed indicates their importance. The absence of trans-spliced leader exons in this monogonont species contrasts with their abundance in bdelloid rotifers and indicates that the presence of this phenomenon can vary at the subphylum level. Our EST database provides a relatively large quantity of transcript-level data for B. plicatilis, and more generally of rotifers and other gnathiferan phyla, and can be browsed and searched at gmod.mbl.edu. PMID:17668053
Suflita, Joseph M; Aktas, Deniz F; Oldham, Athenia L; Perez-Ibarra, Beatriz Monica; Duncan, Kathleen
2012-01-01
Investigating the susceptibility of various fuels to anaerobic biodegradation has become complicated with the recognition that the fuels themselves are not sterile. Bacterial DNA could be obtained when various fuels were filtered through a hydrophobic teflon (0.22 μm) membrane filter. Bacterial 16S rRNA genes from these preparations were PCR amplified, cloned, and the resulting libraries sequenced to identify the fuel-borne bacterial communities. The most common sequence, found in algal- and camelina-based biofuels as well as in ultra-low sulfur diesel (ULSD) and F76 diesel, was similar to that of a Tumebacillus. The next most common sequence was similar to Methylobacterium and was found in the biofuels and ULSD. Higher level phylogenetic groups included representatives of the Firmicutes (Bacillus, Lactobacillus and Streptococcus), several Actinobacteria, Deinococcus-Thermus, Chloroflexi, Cyanobacteria, Bacteroidetes, Alphaproteobacteria (Methylobacterium and Sphingomonadales), Betaproteobacteria (Oxalobacteraceae and Burkholderiales) and Deltaproteobacteria. All of the fuel-associated bacterial sequences, except those obtained from a few facultative microorganisms, were from aerobes and only remotely affiliated with sequences that resulted from anaerobic successional events evident when ULSD was incubated with a coastal seawater and sediment inoculum. Thus, both traditional and alternate fuel formulations harbor a characteristic microflora, but these microorganisms contributed little to the successional patterns that ultimately resulted in fuel decomposition, sulfide formation and metal biocorrosion. The findings illustrate the value of molecular approaches to track the fate of bacteria that might come in contact with fuels and potentially contribute to corrosion problems throughout the energy value chain.
Raibaud, A; Zalacain, M; Holt, T G; Tizard, R; Thompson, C J
1991-01-01
Nucleotide sequence analysis of a 5,000-bp region of the bialaphos antibiotic production (bap) gene cluster defined five open reading frames (ORFs) which predicted structural genes in the order bah, ORF1, ORF2, and ORF3 followed by the regulatory gene, brpA (H. Anzai, T. Murakami, S. Imai, A. Satoh, K. Nagaoka, and C.J. Thompson, J. Bacteriol. 169:3482-3488, 1987). The four structural genes were translationally coupled and apparently cotranscribed from an undefined promoter(s) under the positive control of the brpA gene product. S1 mapping experiments indicated that brpA was transcribed by two promoters (brpAp1 and brpAp2) which initiate transcription 150 and 157 bp upstream of brp A within an intergenic region and at least one promoter further upstream within the bap gene cluster (brpAp3). All three transcripts were present at low levels during exponential growth and increased just before the stationary phase. The levels of the brpAp3 band continued to increase at the onset of stationary phase, whereas brpAp1-and brpAp2-protected fragments showed no further change. BrpA contained a possible helix-turn-helix motif at its C terminus which was similar to the C-terminal regulatory motif found in the receiver component of a family of two-component transcriptional activator proteins. This motif was not associated with the N-terminal domain conserved in other members of the family. The structural gene cluster sequenced began with bah, encoding a bialaphos acetylhydrolase which removes the N-acetyl group from bialaphos as one of the final steps in the biosynthetic pathway. The observation that Bah was similar to a rat and to a bacterial (Acinetobacter calcoaceticus) lipase probably reflects the fact that the ester bonds of triglycerides and the amide bond linking acetate to phosphinothricin are similar and hydrolysis is catalyzed by structurally related enzymes. This was followed by two regions encoding ORF1 and ORF2 which were similar to each other (48% nucleotide identity, 31% amino acid identity), as well as to GrsT, a protein encoded by a gene located adjacent to gramicidin S synthetase in Bacillus brevis, and to vertebrate (mallard duck and rat) thioesterases. The amino acid sequence and hydrophobicity profile of ORF3 indicated that it was related to a family of membrane transport proteins. It was strikingly similar to the citrate uptake protein encoded by the transposon Tn3411. Images PMID:2066341
An early illness recognition framework using a temporal Smith Waterman algorithm and NLP.
Hajihashemi, Zahra; Popescu, Mihail
2013-01-01
In this paper we propose a framework for detecting health patterns based on non-wearable sensor sequence similarity and natural language processing (NLP). In TigerPlace, an aging in place facility from Columbia, MO, we deployed 47 sensor networks together with a nursing electronic health record (EHR) system to provide early illness recognition. The proposed framework utilizes sensor sequence similarity and NLP on EHR nursing comments to automatically notify the physician when health problems are detected. The reported methodology is inspired by genomic sequence annotation using similarity algorithms such as Smith Waterman (SW). Similarly, for each sensor sequence, we associate health concepts extracted from the nursing notes using Metamap, a NLP tool provided by Unified Medical Language System (UMLS). Since sensor sequences, unlike genomics ones, have an associated time dimension we propose a temporal variant of SW (TSW) to account for time. The main challenges presented by our framework are finding the most suitable time sequence similarity and aggregation of the retrieved UMLS concepts. On a pilot dataset from three Tiger Place residents, with a total of 1685 sensor days and 626 nursing records, we obtained an average precision of 0.64 and a recall of 0.37.
Clustering and visualizing similarity networks of membrane proteins.
Hu, Geng-Ming; Mai, Te-Lun; Chen, Chi-Ming
2015-08-01
We proposed a fast and unsupervised clustering method, minimum span clustering (MSC), for analyzing the sequence-structure-function relationship of biological networks, and demonstrated its validity in clustering the sequence/structure similarity networks (SSN) of 682 membrane protein (MP) chains. The MSC clustering of MPs based on their sequence information was found to be consistent with their tertiary structures and functions. For the largest seven clusters predicted by MSC, the consistency in chain function within the same cluster is found to be 100%. From analyzing the edge distribution of SSN for MPs, we found a characteristic threshold distance for the boundary between clusters, over which SSN of MPs could be properly clustered by an unsupervised sparsification of the network distance matrix. The clustering results of MPs from both MSC and the unsupervised sparsification methods are consistent with each other, and have high intracluster similarity and low intercluster similarity in sequence, structure, and function. Our study showed a strong sequence-structure-function relationship of MPs. We discussed evidence of convergent evolution of MPs and suggested applications in finding structural similarities and predicting biological functions of MP chains based on their sequence information. © 2015 Wiley Periodicals, Inc.
Analysis of Ribosome Inactivating Protein (RIP): A Bioinformatics Approach
NASA Astrophysics Data System (ADS)
Jothi, G. Edward Gnana; Majilla, G. Sahaya Jose; Subhashini, D.; Deivasigamani, B.
2012-10-01
In spite of the medical advances in recent years, the world is in need of different sources to encounter certain health issues.Ribosome Inactivating Proteins (RIPs) were found to be one among them. In order to get easy access about RIPs, there is a need to analyse RIPs towards constructing a database on RIPs. Also, multiple sequence alignment was done towards screening for homologues of significant RIPs from rare sources against RIPs from easily available sources in terms of similarity. Protein sequences were retrieved from SWISS-PROT and are further analysed using pair wise and multiple sequence alignment.Analysis shows that, 151 RIPs have been characterized to date. Amongst them, there are 87 type I, 37 type II, 1 type III and 25 unknown RIPs. The sequence length information of various RIPs about the availability of full or partial sequence was also found. The multiple sequence alignment of 37 type I RIP using the online server Multalin, indicates the presence of 20 conserved residues. Pairwise alignment and multiple sequence alignment of certain selected RIPs in two groups namely Group I and Group II were carried out and the consensus level was found to be 98%, 98% and 90% respectively.
Krisinger, J; Jeung, E B; Simmen, R C; Leung, P C
1995-01-01
The expression of Calbindin-D9k (CaBP-9k) in the pig uterus and placenta was measured by Northern blot analysis and reverse transcription polymerase chain reaction (PCR), respectively. Progesterone (P4) administration to ovariectomized pigs decreased CaBP-9k mRNA levels. Expression of endometrial CaBP-9k mRNA was high on pregnancy Days 10-12 and below the detection limit on Days 15 and 18. On Day 60, expression could be detected at low levels. In myometrium and placenta, CaBP-9k mRNA expression was not detectable by Northern analysis using total RNA. Reverse-transcribed RNA from both tissues demonstrated the presence of CaBP-9k transcripts by means of PCR. The partial CaBP-9k gene was amplified by PCR and cloned to determine the sequence of intron A. In contrast to the rat CaBP-9k gene, the pig gene does not contain a functional estrogen response element (ERE) within this region. A similar ERE-like sequence located at the identical location was examined by gel retardation analysis and failed to bind the estradiol receptor. A similar disruption of this ERE-like sequence has been described in the human CaBP-9k gene, which is not expressed at any level in placenta, myometrium, or endometrium. It is concluded that the pig CaBP-9k gene is regulated in these reproductive tissues in a manner distinct from that in rat and human tissues. The regulation is probably due to a regulatory region outside of intron A, which in the rat gene contains the key cis element for uterine expression of the CaBP-9k gene.
Ellis, Crystal N.; Schuster, Brian M.; Striplin, Megan J.; Jones, Stephen H.; Whistler, Cheryl A.
2012-01-01
Risk of gastric infection with Vibrio parahaemolyticus increases with favorable environmental conditions and population shifts that increase prevalence of infective strains. Genetic analysis of New Hampshire strains revealed a unique population with some isolates similar to outbreak-causing strains and high-level diversity that increased as waters warmed. PMID:22407686
Ellis, Crystal N; Schuster, Brian M; Striplin, Megan J; Jones, Stephen H; Whistler, Cheryl A; Cooper, Vaughn S
2012-05-01
Risk of gastric infection with Vibrio parahaemolyticus increases with favorable environmental conditions and population shifts that increase prevalence of infective strains. Genetic analysis of New Hampshire strains revealed a unique population with some isolates similar to outbreak-causing strains and high-level diversity that increased as waters warmed.
Detecting and treating breast cancer resistance to EGFR inhibitors
Moonlee, Sun-Young; Bissell, Mina J.; Furuta, Saori; Meier, Roland; Kenny, Paraic A.
2016-04-05
The application describes therapeutic compositions and methods for treating cancer. For example, therapeutic compositions and methods related to inhibition of FAM83A (family with sequence similarity 83) are provided. The application also describes methods for diagnosing cancer resistance to EGFR inhibitors. For example, a method of diagnosing cancer resistance to EGFR inhibitors by detecting increased FAM83A levels is described.
Hong, Yuan-Yuan; Ma, Yu-Chao; Zhou, Yu-Guang; Gao, Fei; Liu, Hong-Can; Chen, San-Feng
2009-11-01
A nitrogen-fixing bacterium, designated strain X19-5(T), was isolated from rhizosphere soil of Sonchus oleraceus. Phylogenetic analysis based on a fragment of the nifH gene and the full-length 16S rRNA gene sequence revealed that strain X19-5(T) was a member of the genus Paenibacillus. Strain X19-5(T) showed the highest 16S rRNA gene sequence similarity (98.8 %) with Paenibacillus graminis RSA19(T) and below 97 % similarity with other recognized members of the genus. The level of DNA-DNA relatedness between strain X19-5(T) and P. graminis RSA19(T) was 45.7 %. The DNA G+C content of strain X19-5(T) was 46.8 mol%. The major fatty acids were anteiso-C(15 : 0), C(16 : 0) and iso-C(16 : 0). On the basis of its phenotypic characteristics and the level of DNA-DNA hybridization, strain X19-5(T) is considered to represent a novel species of the genus Paenibacillus, for which the name Paenibacillus sonchi sp. nov. is proposed. The type strain is X19-5(T) (=CCBAU 83901(T)=LMG 24727(T)).
Verma, Pankaj; Pandey, Prashant Kumar; Gupta, Arvind Kumar; Seong, Chi Nam; Park, Seong Chan; Choe, Han Na; Baik, Keun Sik; Patole, Milind Shivaji; Shouche, Yogesh Shreepad
2012-10-01
We have carried out a polyphasic taxonomic characterization of Bacillus beijingensis DSM 19037(T) and Bacillus ginsengi DSM 19038(T), which are closely related phylogenetically to Bhargavaea cecembensis LMG 24411(T). All three strains are Gram-stain-positive, non-motile, moderately halotolerant and non-spore-forming. 16S rRNA gene sequence analyses showed that the strains constituted a coherent cluster, with sequence similarities between 99.7 and 98.7 %. The percentage similarity on the basis of amino acid sequences deduced from partial gyrB gene nucleotide sequences of these three type strains was 96.1-92.7 %. Phylogenetic trees based on the 16S rRNA gene and GyrB amino acid sequences, obtained by using three different algorithms, were consistent and showed that these three species constituted a deeply rooted cluster separated from the clades represented by the genera Bacillus, Planococcus, Planomicrobium, Sporosarcina, Lysinibacillus, Viridibacillus, Kurthia and Geobacillus, supporting their placement in the genus Bhargavaea. All three type strains have menaquinone MK-8 as the major respiratory quinone and showed similar fatty acid profiles. The main polar lipids present in the three type strains were diphosphatidylglycerol and phosphatidylglycerol, and the three strains showed peptidoglycan type A4α with L-lysine as the diagnostic diamino acid. The DNA G+C contents of Bacillus beijingensis DSM 19037(T), Bacillus ginsengi DSM 19038(T) and Bhargavaea cecembensis LMG 24411(T) were 53.1, 50.2 and 53.7 mol%, respectively. The level of DNA-DNA hybridization among the three strains was 57-39 %, indicating that they are members of different species of the genus Bhargavaea. The phenotypic data are consistent with the placement of these three species in a single genus and support their differentiation at the species level. On the basis of these data, we have emended the description of the genus Bhargavaea and propose the reclassification of Bacillus beijingensis and Bacillus ginsengi to the genus Bhargavaea, as Bhargavaea beijingensis comb. nov. (type strain ge10(T) = DSM 19037(T) = CGMCC 1.6762(T)) and Bhargavaea ginsengi comb. nov. (type strain ge14(T) = DSM 19038(T) = CGMCC 1.6763(T)).
Isolation of laccase gene-specific sequences from white rot and brown rot fungi by PCR
DOE Office of Scientific and Technical Information (OSTI.GOV)
D`Souza, T.M.; Boominathan, K.; Reddy, C.A.
1996-10-01
Degenerate primers corresponding to the consensus sequences of the copper-binding regions in the N-terminal domains of known basidiomycete laccases were used to isolate laccase gene-specific sequences from strains representing nine genera of wood rot fungi. All except three gave the expected PCR product of about 200 bp. Computer searches of the databases identified the sequences of each of the PCR product of about 200 bp. Computer searches of the databases identified the sequence of each of the PCR products analyzed as a laccase gene sequence, suggesting the specificity of the primers. PCR products of the white rot fungi Ganoderma lucidum,more » Phlebia brevispora, and Trametes versicolor showed 65 to 74% nucleotide sequence similarity to each other; the similarity in deduced amino acid sequences was 83 to 91%. The PCR products of Lentinula edodes and Lentinus tigrinus, on the other hand, showed relatively low nucleotide and amino acid similarities (58 to 64 and 62 to 81%, respectively); however, these similarities were still much higher than when compared with the corresponding regions in the laccases of the ascomycete fungi Aspergillus nidulans and Neurospora crassa. A few of the white rot fungi, as well as Gloeophyllum trabeum, a brown rot fungus, gave a 144-bp PCR fragment which had a nucleotide sequence similarity of 60 to 71%. Demonstration of laccase activity in G. trabeum and several other brown rot fungi was of particular interest because these organisms were not previously shown to produce laccases. 36 refs., 6 figs., 2 tabs.« less
Carter, Stuart D.; Birtles, Richard J.; Brown, Jennifer M.; Hart, C. Anthony; Evans, Nicholas J.
2016-01-01
ABSTRACT Treponema species are implicated in many diseases of humans and animals. Digital dermatitis (DD) treponemes are reported to cause severe lesions in cattle, sheep, pigs, goats, and wild elk, causing substantial global animal welfare issues and economic losses. The fastidiousness of these spirochetes has previously precluded studies investigating within-phylogroup genetic diversity. An archive of treponemes that we isolated enabled multilocus sequence typing to quantify the diversity and population structure of DD treponemes. Isolates (n = 121) were obtained from different animal hosts in nine countries on three continents. The analyses herein of currently isolated DD treponemes at seven housekeeping gene loci confirm the classification of the three previously designated phylogroups: the Treponema medium, Treponema phagedenis, and Treponema pedis phylogroups. Sequence analysis of seven DD treponeme housekeeping genes revealed a generally low level of diversity among the strains within each phylogroup, removing the need for the previously used “-like” suffix. Surprisingly, all isolates within each phylogroup clustered together, regardless of host or geographic origin, suggesting that the same sequence types (STs) can infect different animals. Some STs were derived from multiple animals from the same farm, highlighting probable within-farm transmissions. Several STs infected multiple hosts from similar geographic regions, identifying probable frequent between-host transmissions. Interestingly, T. pedis appears to be evolving more quickly than the T. medium or T. phagedenis DD treponeme phylogroup, by forming two unique ST complexes. The lack of phylogenetic discrimination between treponemes isolated from different hosts or geographic regions substantially contrasts with the data for other clinically relevant spirochetes. IMPORTANCE The recent expansion of the host range of digital dermatitis (DD) treponemes from cattle to sheep, goats, pigs, and wild elk, coupled with the high level of 16S rRNA gene sequence similarity across hosts and with human treponemes, suggests that the same bacterial species can cause disease in multiple different hosts. This multilocus sequence typing (MLST) study further demonstrates that these bacteria isolated from different hosts are indeed very similar, raising the potential for cross-species transmission. The study also shows that infection spread occurs frequently, both locally and globally, suggesting transmission by routes other than animal-animal transmission alone. These results indicate that on-farm biosecurity is important for controlling disease spread in domesticated species. Continued surveillance and vigilance are important for ascertaining the evolution and tracking any further host range expansion of these important pathogens. PMID:27208135
Clegg, Simon R; Carter, Stuart D; Birtles, Richard J; Brown, Jennifer M; Hart, C Anthony; Evans, Nicholas J
2016-08-01
Treponema species are implicated in many diseases of humans and animals. Digital dermatitis (DD) treponemes are reported to cause severe lesions in cattle, sheep, pigs, goats, and wild elk, causing substantial global animal welfare issues and economic losses. The fastidiousness of these spirochetes has previously precluded studies investigating within-phylogroup genetic diversity. An archive of treponemes that we isolated enabled multilocus sequence typing to quantify the diversity and population structure of DD treponemes. Isolates (n = 121) were obtained from different animal hosts in nine countries on three continents. The analyses herein of currently isolated DD treponemes at seven housekeeping gene loci confirm the classification of the three previously designated phylogroups: the Treponema medium, Treponema phagedenis, and Treponema pedis phylogroups. Sequence analysis of seven DD treponeme housekeeping genes revealed a generally low level of diversity among the strains within each phylogroup, removing the need for the previously used "-like" suffix. Surprisingly, all isolates within each phylogroup clustered together, regardless of host or geographic origin, suggesting that the same sequence types (STs) can infect different animals. Some STs were derived from multiple animals from the same farm, highlighting probable within-farm transmissions. Several STs infected multiple hosts from similar geographic regions, identifying probable frequent between-host transmissions. Interestingly, T. pedis appears to be evolving more quickly than the T. medium or T. phagedenis DD treponeme phylogroup, by forming two unique ST complexes. The lack of phylogenetic discrimination between treponemes isolated from different hosts or geographic regions substantially contrasts with the data for other clinically relevant spirochetes. The recent expansion of the host range of digital dermatitis (DD) treponemes from cattle to sheep, goats, pigs, and wild elk, coupled with the high level of 16S rRNA gene sequence similarity across hosts and with human treponemes, suggests that the same bacterial species can cause disease in multiple different hosts. This multilocus sequence typing (MLST) study further demonstrates that these bacteria isolated from different hosts are indeed very similar, raising the potential for cross-species transmission. The study also shows that infection spread occurs frequently, both locally and globally, suggesting transmission by routes other than animal-animal transmission alone. These results indicate that on-farm biosecurity is important for controlling disease spread in domesticated species. Continued surveillance and vigilance are important for ascertaining the evolution and tracking any further host range expansion of these important pathogens. Copyright © 2016 Clegg et al.
Hiett, Kelli L; Rothrock, Michael J; Seal, Bruce S
2013-09-01
The complete nucleotide sequence was determined for a cryptic plasmid, pTIW94, recovered from several Campylobacter jejuni isolates from wild birds in the southeastern United States. pTIW94 is a circular molecule of 3860 nucleotides, with a G+C content (31.0%) similar to that of many Campylobacter spp. genomes. A typical origin of replication, with iteron sequences, was identified upstream of DNA sequences that demonstrated similarity to replication initiation proteins. A total of five open reading frames (ORFs) were identified; two of the five ORFs demonstrated significant similarity to plasmid pCC2228-2 found within Campylobacter coli. These two ORFs were similar to essential replication proteins RepA (100%; 26/26 aa identity) and RepB (95%; 327/346 aa identity). A third identified ORF demonstrated significant similarity (99%; 421/424 aa identity) to the MOB protein from C. coli 67-8, originally recovered from swine. The other two identified ORFs were either similar to hypothetical proteins from other Campylobacter spp., or exhibited no significant similarity to any DNA or protein sequence in the GenBank database. Promoter regions (-35 and -10 signal sites), ribosomal binding sites upstream of ORFs, and stem-loop structures were also identified within the plasmid. These results demonstrate that pTIW94 represents a previously un-reported small cryptic plasmid with unique sequences as well as highly similar sequences to other small plasmids found within Campylobacter spp., and that this cryptic plasmid is present among Campylobacter spp. recovered from different genera of wild birds. Copyright © 2013. Published by Elsevier Inc.
Secondary structural analyses of ITS1 in Paramecium.
Hoshina, Ryo
2010-01-01
The nuclear ribosomal RNA gene operon is interrupted by internal transcribed spacer (ITS) 1 and ITS2. Although the secondary structure of ITS2 has been widely investigated, less is known about ITS1 and its structure. In this study, the secondary structure of ITS1 sequences for Paramecium and other ciliates was predicted. Each Paramecium ITS1 forms an open loop with three helices, A through C. Helix B was highly conserved among Paramecium, and similar helices were found in other ciliates. A phylogenetic analysis using the ITS1 sequences showed high-resolution, implying that ITS1 is a good tool for species-level analyses.
Trung, Le Quang; VAN Puyvelde, Karolien; Triest, Ludwig
2008-03-01
Consensus primers, based on exon sequences of the cyp73 gene family coding for cinnamate 4-hydroxylase (C4H) of the lignin biosynthesis pathway, were designed for the tetraploid willow species Salix alba and Salix fragilis. Diagnostic alleles at species level were observed among introns of three cyp73 genes and allowed unambiguous detection of the first generation and introgressed hybrids in populations. Progeny analysis of a female S. alba with a male introgressed hybrid confirmed the codominant inheritance of each intron. Sequences of the diagnostic alleles of both species were similar to those found in the hybrids. © 2007 The Authors.
Trading genes along the silk road: mtDNA sequences and the origin of central Asian populations.
Comas, D; Calafell, F; Mateu, E; Pérez-Lezaun, A; Bosch, E; Martínez-Arias, R; Clarimon, J; Facchini, F; Fiori, G; Luiselli, D; Pettener, D; Bertranpetit, J
1998-01-01
Central Asia is a vast region at the crossroads of different habitats, cultures, and trade routes. Little is known about the genetics and the history of the population of this region. We present the analysis of mtDNA control-region sequences in samples of the Kazakh, the Uighurs, the lowland Kirghiz, and the highland Kirghiz, which we have used to address both the population history of the region and the possible selective pressures that high altitude has on mtDNA genes. Central Asian mtDNA sequences present features intermediate between European and eastern Asian sequences, in several parameters-such as the frequencies of certain nucleotides, the levels of nucleotide diversity, mean pairwise differences, and genetic distances. Several hypotheses could explain the intermediate position of central Asia between Europe and eastern Asia, but the most plausible would involve extensive levels of admixture between Europeans and eastern Asians in central Asia, possibly enhanced during the Silk Road trade and clearly after the eastern and western Eurasian human groups had diverged. Lowland and highland Kirghiz mtDNA sequences are very similar, and the analysis of molecular variance has revealed that the fraction of mitochondrial genetic variance due to altitude is not significantly different from zero. Thus, it seems unlikely that altitude has exerted a major selective pressure on mitochondrial genes in central Asian populations. PMID:9837835
Tatonova, Yulia V; Chelomina, Galina N; Nguyen, Hung Manh
2017-11-01
Here we examined the intraspecific genetic variability of Clonorchis sinensis from Russia and Vietnam using nuclear DNA sequences (the 5.8S gene and two internal transcribed spacers of the ribosomal cluster). Despite the low level of variability in the ITS1 region, this marker has revealed some features of C. sinensis across multiple geographic regions. The genetic diversity levels for the Russian and Vietnamese populations were similar (0.1 and 0.09%, respectively) but were significantly lower than the C. sinensis from China (0.31%). About half of the sequences of the Chinese (53%) and Korean (47%) populations and about a tenth of the Vietnamese (12%) and Russian (8%) sequences included a 5bp insertion. No sequences with nucleotide substitutions both upstream and downstream of the 5bp insertion were found within the whole data set. The population of northern China had both sequence variants (with substitutions either upstream or downstream of the insertion), while only one of these variants was presented at the other localities. The Vietnamese population had a higher frequency of intragenomic polymorphism than the Russian population (69% vs. 46% and 23% vs. 3% at the 114bp and 339bp positions, respectively). These data are discussed in connection with parasite origin and adaptation, and also its invasive capacity and drug-resistance. Copyright © 2017 Elsevier B.V. All rights reserved.
Osipiuk, J; Joachimiak, A
1997-09-12
We propose that the dnaK operon of Thermus thermophilus HB8 is composed of three functionally linked genes: dnaK, grpE, and dnaJ. The dnaK and dnaJ gene products are most closely related to their cyanobacterial homologs. The DnaK protein sequence places T. thermophilus in the plastid Hsp70 subfamily. In contrast, the grpE translated sequence is most similar to GrpE from Clostridium acetobutylicum, a Gram-positive anaerobic bacterium. A single promoter region, with homology to the Escherichia coli consensus promoter sequences recognized by the sigma70 and sigma32 transcription factors, precedes the postulated operon. This promoter is heat-shock inducible. The dnaK mRNA level increased more than 30 times upon 10 min of heat shock (from 70 degrees C to 85 degrees C). A strong transcription terminating sequence was found between the dnaK and grpE genes. The individual genes were cloned into pET expression vectors and the thermophilic proteins were overproduced at high levels in E. coli and purified to homogeneity. The recombinant T. thermophilus DnaK protein was shown to have a weak ATP-hydrolytic activity, with an optimum at 90 degrees C. The ATPase was stimulated by the presence of GrpE and DnaJ. Another open reading frame, coding for ClpB heat-shock protein, was found downstream of the dnaK operon.
Lactobacillus heilongjiangensis sp. nov., isolated from Chinese pickle.
Gu, Chun Tao; Li, Chun Yan; Yang, Li Jie; Huo, Gui Cheng
2013-11-01
A Gram-stain-positive bacterial strain, S4-3(T), was isolated from traditional pickle in Heilongjiang Province, China. The bacterium was characterized by a polyphasic approach, including 16S rRNA gene sequence analysis, pheS gene sequence analysis, rpoA gene sequence analysis, dnaK gene sequence analysis, fatty acid methyl ester (FAME) analysis, determination of DNA G+C content, DNA-DNA hybridization and an analysis of phenotypic features. Strain S4-3(T) showed 97.9-98.7 % 16S rRNA gene sequence similarities, 84.4-94.1 % pheS gene sequence similarities and 94.4-96.9 % rpoA gene sequence similarities to the type strains of Lactobacillus nantensis, Lactobacillus mindensis, Lactobacillus crustorum, Lactobacillus futsaii, Lactobacillus farciminis and Lactobacillus kimchiensis. dnaK gene sequence similarities between S4-3(T) and Lactobacillus nantensis LMG 23510(T), Lactobacillus mindensis LMG 21932(T), Lactobacillus crustorum LMG 23699(T), Lactobacillus futsaii JCM 17355(T) and Lactobacillus farciminis LMG 9200(T) were 95.4, 91.5, 90.4, 91.7 and 93.1 %, respectively. Based upon the data obtained in the present study, a novel species, Lactobacillus heilongjiangensis sp. nov., is proposed and the type strain is S4-3(T) ( = LMG 26166(T) = NCIMB 14701(T)).
FRESCO: Referential compression of highly similar sequences.
Wandelt, Sebastian; Leser, Ulf
2013-01-01
In many applications, sets of similar texts or sequences are of high importance. Prominent examples are revision histories of documents or genomic sequences. Modern high-throughput sequencing technologies are able to generate DNA sequences at an ever-increasing rate. In parallel to the decreasing experimental time and cost necessary to produce DNA sequences, computational requirements for analysis and storage of the sequences are steeply increasing. Compression is a key technology to deal with this challenge. Recently, referential compression schemes, storing only the differences between a to-be-compressed input and a known reference sequence, gained a lot of interest in this field. In this paper, we propose a general open-source framework to compress large amounts of biological sequence data called Framework for REferential Sequence COmpression (FRESCO). Our basic compression algorithm is shown to be one to two orders of magnitudes faster than comparable related work, while achieving similar compression ratios. We also propose several techniques to further increase compression ratios, while still retaining the advantage in speed: 1) selecting a good reference sequence; and 2) rewriting a reference sequence to allow for better compression. In addition,we propose a new way of further boosting the compression ratios by applying referential compression to already referentially compressed files (second-order compression). This technique allows for compression ratios way beyond state of the art, for instance,4,000:1 and higher for human genomes. We evaluate our algorithms on a large data set from three different species (more than 1,000 genomes, more than 3 TB) and on a collection of versions of Wikipedia pages. Our results show that real-time compression of highly similar sequences at high compression ratios is possible on modern hardware.
Tissue-specific expression of the gene for a putative plasma membrane H(+)-ATPase in a seagrass.
Fukuhara, T; Pak, J Y; Ohwaki, Y; Tsujimura, H; Nitta, T
1996-01-01
A cDNA clone corresponding to the gene (ZHA1) for a putative plasma membrane H(+)-ATPase of a seagrass (Zostera marina L.) was isolated and sequenced. Comparison of the amino acid predicted sequence from the nucleotide sequence of ZHA1 with those encoded by known genes for plasma membrane H(+)-ATPases from other plants indicated that ZHA1 is most similar to the gene (PMA4) for a plasma membrane H(+)-ATPase in a tobacco (84.4%). Northern hybridization indicated that ZHA1 was strongly expressed in mature leaves, which are exposed to seawater and have the ability of tolerate salinity; ZHA1 was weakly expressed in immature leaves, which are protected from seawater by tightly enveloping sheaths and are sensitive to salinity. In mature leaves, in situ hybridization revealed that ZHA1 was expressed specifically in epidermal cells, the plasma membranes of which were highly invaginated and morphologically similar to those of typical transfer cells. Therefore, the differentiation of the transfer cell-like structures, accompanied by the high-level expression of ZHA1, in the epidermal cells of mature leaves in particular may be important for the excretion of salt by these cells. PMID:8587992
Species and hybrids in the genus Diaphanosoma Fischer, 1850 (Crustacea: Branchiopoda: Cladocera).
Liu, Ping; Xu, Lei; Xu, Shao-Lin; Martínez, Alejandro; Chen, Hua; Cheng, Dan; Dumont, Henri J; Han, Bo-Ping; Fontaneto, Diego
2018-01-01
Cladocerans are well-studied planktonic crustaceans, especially those of the genus Daphnia in which interesting evolutionary questions have been addressed on speciation processes. The aim of the present study is to demonstrate that other genera of cladocerans show similar levels of cryptic diversity, intraspecific gene flow, and thus become useful model systems for comparison. In order to do so, we chose the genus Diaphanosoma, widespread in tropical and temperate areas. We started with a survey of species diversity in the genus Diaphanosoma in Asia using a morphological approach, then obtained sequences from a mitochondrial and a nuclear marker from multiple individuals of different species, performed tests on DNA taxonomy and molecular phylogenies, and assessed the role of hybridization in explaining the cases of mitonuclear discordance. The results are that cryptic diversity occurs in Diaphanosoma, and mitonuclear discordance was found in about 6% of the sequenced animals. Past hybridization is supported as the most likely explanation for the discordance: no evidence was found of first generation hybrids with heterozygous sequences. Our analysis on patterns of genetic diversity in Diaphanosoma supports similarities and differences with what is known in Daphnia. Copyright © 2017 Elsevier Inc. All rights reserved.
Using string alignment in a query-by-humming system for real world applications
NASA Astrophysics Data System (ADS)
Sailer, Christian
2005-09-01
Though query by humming (i.e., retrieving music or information about music by singing a characteristic melody) has been a popular research topic during the past decade, few approaches have reached a level of usefulness beyond mere scientific interest. One of the main problems is the inherent contradiction between error tolerance and dicriminative power in conventional melody matching algorithms that rely on a melody contour approach to handle intonation or transcription errors. Adopting the string matching/alignment techniques from bioinformatics to melody sequences allows to directly assess the similarity between two melodies. This method takes an MPEG-7 compliant melody sequence (i.e., a list of note intervals and length ratios) as query and evaluates the steps necessary to transform it into the reference sequence. By introducing a musically founded cost-of-replace function and an adequate post processing, this method yields a measure for melodic similarity. Thus it is possible to construct a query by humming system that can properly discriminate between thousands of melodies and still be sufficiently error tolerant to be used by untrained singers. The robustness has been verified in extensive tests and real world applications.
Kadri, Zaina; Amar, Mohamed; Ouadghiri, Mouna; Cnockaert, Margo; Aerts, Maarten; El Farricha, Omar; Vandamme, Peter
2014-07-01
Two catalase- and oxidase-negative Streptococcus-like strains, LMG 27682(T) and LMG 27684(T), were isolated from raw camel milk in Morocco. Comparative 16S rRNA gene sequencing assigned these bacteria to the genus Streptococcus with Streptococcus rupicaprae 2777-2-07(T) as their closest phylogenetic neighbour (95.9% and 95.7% similarity, respectively). 16S rRNA gene sequence similarity between the two strains was 96.7%. Although strains LMG 27682(T) and LMG 27684(T) shared a DNA-DNA hybridization value that corresponded to the threshold level for species delineation (68%), the two strains could be distinguished by multiple biochemical tests, sequence analysis of the phenylalanyl-tRNA synthase (pheS), RNA polymerase (rpoA) and ATP synthase (atpA) genes and by their MALDI-TOF MS profiles. On the basis of these considerable phenotypic and genotypic differences, we propose to classify both strains as novel species of the genus Streptococcus, for which the names Streptococcus moroccensis sp. nov. (type strain, LMG 27682(T) = CCMM B831(T)) and Streptococcus rifensis sp. nov. (type strain, LMG 27684(T) = CCMM B833(T)) are proposed. © 2014 IUMS.
Youssef, Noha H.; Couger, M. B.; Elshahed, Mostafa S.
2010-01-01
Background The adaptation of pyrosequencing technologies for use in culture-independent diversity surveys allowed for deeper sampling of ecosystems of interest. One extremely well suited area of interest for pyrosequencing-based diversity surveys that has received surprisingly little attention so far, is examining fine scale (e.g. micrometer to millimeter) beta diversity in complex microbial ecosystems. Methodology/Principal Findings We examined the patterns of fine scale Beta diversity in four adjacent sediment samples (1mm apart) from the source of an anaerobic sulfide and sulfur rich spring (Zodletone spring) in southwestern Oklahoma, USA. Using pyrosequencing, a total of 292,130 16S rRNA gene sequences were obtained. The beta diversity patterns within the four datasets were examined using various qualitative and quantitative similarity indices. Low levels of Beta diversity (high similarity indices) were observed between the four samples at the phylum-level. However, at a putative species (OTU0.03) level, higher levels of beta diversity (lower similarity indices) were observed. Further examination of beta diversity patterns within dominant and rare members of the community indicated that at the putative species level, beta diversity is much higher within rare members of the community. Finally, sub-classification of rare members of Zodletone spring community based on patterns of novelty and uniqueness, and further examination of fine scale beta diversity of each of these subgroups indicated that members of the community that are unique, but non novel showed the highest beta diversity within these subgroups of the rare biosphere. Conclusions/Significance The results demonstrate the occurrence of high inter-sample diversity within seemingly identical samples from a complex habitat. We reason that such unexpected diversity should be taken into consideration when exploring gamma diversity of various ecosystems, as well as planning for sequencing-intensive metagenomic surveys of highly complex ecosystems. PMID:20865128
Assessing Analytical Similarity of Proposed Amgen Biosimilar ABP 501 to Adalimumab.
Liu, Jennifer; Eris, Tamer; Li, Cynthia; Cao, Shawn; Kuhns, Scott
2016-08-01
ABP 501 is being developed as a biosimilar to adalimumab. Comprehensive comparative analytical characterization studies have been conducted and completed. The objective of this study was to assess analytical similarity between ABP 501 and two adalimumab reference products (RPs), licensed by the United States Food and Drug Administration (adalimumab [US]) and authorized by the European Union (adalimumab [EU]), using state-of-the-art analytical methods. Comprehensive analytical characterization incorporating orthogonal analytical techniques was used to compare products. Physicochemical property comparisons comprised the primary structure related to amino acid sequence and post-translational modifications including glycans; higher-order structure; primary biological properties mediated by target and receptor binding; product-related substances and impurities; host-cell impurities; general properties of the finished drug product, including strength and formulation; subvisible and submicron particles and aggregates; and forced thermal degradation. ABP 501 had the same amino acid sequence and similar post-translational modification profiles compared with adalimumab RPs. Primary structure, higher-order structure, and biological activities were similar for the three products. Product-related size and charge variants and aggregate and particle levels were also similar. ABP 501 had very low residual host-cell protein and DNA. The finished ABP 501 drug product has the same strength with regard to protein concentration and fill volume as adalimumab RPs. ABP 501 and the RPs had a similar stability profile both in normal storage and thermal stress conditions. Based on the comprehensive analytical similarity assessment, ABP 501 was found to be similar to adalimumab with respect to physicochemical and biological properties.
Ultrasound biofeedback treatment for persisting childhood apraxia of speech.
Preston, Jonathan L; Brick, Nickole; Landi, Nicole
2013-11-01
The purpose of this study was to evaluate the efficacy of a treatment program that includes ultrasound biofeedback for children with persisting speech sound errors associated with childhood apraxia of speech (CAS). Six children ages 9-15 years participated in a multiple baseline experiment for 18 treatment sessions during which treatment focused on producing sequences involving lingual sounds. Children were cued to modify their tongue movements using visual feedback from real-time ultrasound images. Probe data were collected before, during, and after treatment to assess word-level accuracy for treated and untreated sound sequences. As participants reached preestablished performance criteria, new sequences were introduced into treatment. All participants met the performance criterion (80% accuracy for 2 consecutive sessions) on at least 2 treated sound sequences. Across the 6 participants, performance criterion was met for 23 of 31 treated sequences in an average of 5 sessions. Some participants showed no improvement in untreated sequences, whereas others showed generalization to untreated sequences that were phonetically similar to the treated sequences. Most gains were maintained 2 months after the end of treatment. The percentage of phonemes correct increased significantly from pretreatment to the 2-month follow-up. A treatment program including ultrasound biofeedback is a viable option for improving speech sound accuracy in children with persisting speech sound errors associated with CAS.
Rosendal, Thomas; Dewey, Cate; Friendship, Robert; Wootton, Sarah; Young, Beth; Poljak, Zvonimir
2014-10-01
A study of Ontario swine farms positive for Porcine reproductive and respiratory syndrome virus (PRRSV) tested the association between genetic similarity of the virus and similarity of clinical signs reported by the herd owner. Herds were included if a positive result of polymerase chain reaction for PRRSV at the Animal Health Laboratory at the University of Guelph, Guelph, Ontario, was found between September 2004 and August 2007. Nucleotide-sequence similarity and clinical similarity, as determined from a telephone survey, were calculated for all pairs of herds. The Mantel test indicated that clinical similarity and sequence similarity were weakly correlated for most clinical signs. The generalized additive model indicated that virus homology with 2 vaccine viruses affected the association between sequence similarity and clinical similarity. When the data for herds with vaccine-like virus were removed from the dataset there was a significant association between virus similarity and similarity of the reported presence of abortion, stillbirth, preweaning mortality, and sow/boar mortality. Ownership similarity was also found to be associated with virus similarity and with similarity of the reported presence of sows being off-feed, nursery respiratory disease, nursery mortality, finisher respiratory disease, and finisher mortality. These results indicate that clinical signs of PRRS are associated with PRRSV genotype and that herd ownership is associated with both of these.
Rosendal, Thomas; Dewey, Cate; Friendship, Robert; Wootton, Sarah; Young, Beth; Poljak, Zvonimir
2014-01-01
A study of Ontario swine farms positive for Porcine reproductive and respiratory syndrome virus (PRRSV) tested the association between genetic similarity of the virus and similarity of clinical signs reported by the herd owner. Herds were included if a positive result of polymerase chain reaction for PRRSV at the Animal Health Laboratory at the University of Guelph, Guelph, Ontario, was found between September 2004 and August 2007. Nucleotide-sequence similarity and clinical similarity, as determined from a telephone survey, were calculated for all pairs of herds. The Mantel test indicated that clinical similarity and sequence similarity were weakly correlated for most clinical signs. The generalized additive model indicated that virus homology with 2 vaccine viruses affected the association between sequence similarity and clinical similarity. When the data for herds with vaccine-like virus were removed from the dataset there was a significant association between virus similarity and similarity of the reported presence of abortion, stillbirth, preweaning mortality, and sow/boar mortality. Ownership similarity was also found to be associated with virus similarity and with similarity of the reported presence of sows being off-feed, nursery respiratory disease, nursery mortality, finisher respiratory disease, and finisher mortality. These results indicate that clinical signs of PRRS are associated with PRRSV genotype and that herd ownership is associated with both of these. PMID:25355993
High levels of diversity characterize mandrill (Mandrillus sphinx) Mhc-DRB sequences.
Abbott, Kristin M; Wickings, E Jean; Knapp, Leslie A
2006-08-01
The major histocompatibility complex (MHC) is highly polymorphic in most primate species studied thus far. The rhesus macaque (Macaca mulatta) has been studied extensively and the Mhc-DRB region demonstrates variability similar to humans. The extent of MHC diversity is relatively unknown for other Old World monkeys (OWM), especially among genera other than Macaca. A molecular survey of the Mhc-DRB region in mandrills (Mandrillus sphinx) revealed extensive variability, suggesting that other OWMs may also possess high levels of Mhc-DRB polymorphism. In the present study, 33 Mhc-DRB loci were identified from only 13 animals. Eleven were wild-born and presumed to be unrelated and two were captive-born twins. Two to seven different sequences were identified for each individual, suggesting that some mandrills may have as many as four Mhc-DRB loci on a single haplotype. From these sequences, representatives of at least six Mhc-DRB loci or lineages were identified. As observed in other primates, some new lineages may have arisen through the process of gene conversion. These findings indicate that mandrills have Mhc-DRB diversity not unlike rhesus macaques and humans.
NASA Astrophysics Data System (ADS)
Liu, Jiao; Li, Xianchao; Tang, Xuexi; Zhou, Bin
2016-03-01
Members of the DnaJ family are proteins that play a pivotal role in various cellular processes, such as protein folding, protein transport and cellular responses to stress. In the present study, we identified and characterized the full-length DnaJ cDNA sequence from expressed sequence tags of Pyropia yezoensis ( PyDnaJ) via rapid identification of cDNA ends. This cDNA encoded a protein of 429 amino acids, which shared high sequence similarity with other identified DnaJ proteins, such as a heat shock protein 40/DnaJ from Pyropia haitanensis. The relative mRNA expression level of PyDnaJ was investigated using real-time PCR to determine its specific expression during the algal life cycle and during desiccation. The relative mRNA expression level in sporophytes was higher than that in gametophytes and significantly increased during the whole desiccation process. These results indicate that PyDnaJ is an authentic member of the DnaJ family in plants and red algae and might play a pivotal role in mitigating damage to P. yezoensis during desiccation.
Detection of Plasmodium sp. in capybara.
dos Santos, Leonilda Correia; Curotto, Sandra Mara Rotter; de Moraes, Wanderlei; Cubas, Zalmir Silvino; Costa-Nascimento, Maria de Jesus; de Barros Filho, Ivan Roque; Biondo, Alexander Welker; Kirchgatter, Karin
2009-07-07
In the present study, we have microscopically and molecularly surveyed blood samples from 11 captive capybaras (Hydrochaeris hydrochaeris) from the Sanctuary Zoo for Plasmodium sp. infection. One animal presented positive on blood smear by light microscopy. Polymerase chain reaction was carried out accordingly using a nested genus-specific protocol, which uses oligonucleotides from conserved sequences flanking a variable sequence region in the small subunit ribosomal RNA (ssrRNA) of all Plasmodium organisms. This revealed three positive animals. Products from two samples were purified and sequenced. The results showed less than 1% divergence between the two capybara sequences. When compared with GenBank sequences, a 55% similarity was obtained to Toxoplasma gondii and a higher similarity (73-77.2%) was found to ssrRNAs from Plasmodium species that infect reptile, avian, rodents, and human beings. The most similar Plasmodium sequence was from Plasmodium mexicanum that infects lizards of North America, where around 78% identity was found. This work is the first report of Plasmodium in capybaras, and due to the low similarity with other Plasmodium species, we suggest it is a new species, which, in the future could be denominated "Plasmodium hydrochaeri".
Fröhlich, K U
1994-04-01
A new method for the presentation of alignments of long sequences is described. The degree of identity for the aligned sequences is averaged for sections of a fixed number of residues. The resulting values are converted to shades of gray, with white corresponding to lack of identity and black corresponding to perfect identity. A sequence alignment is represented as a bar filled with varying shades of gray. The display is compact and allows for a fast and intuitive recognition of the distribution of regions with a high similarity. It is well suited for the presentation of alignments of long sequences, e.g. of protein superfamilies, in plenary lectures. The method is implemented as a HyperCard stack for Apple Macintosh computers. Several options for the modification of the output are available (e.g. background reduction, size of the summation window, consideration of amino acid similarity, inclusion of graphic markers to indicate specific domains). The output is a PostScript file which can be printed, imported as EPS or processed further with Adobe Illustrator.
Vasdev, Kavita; Dhawan, Shikha; Kapoor, Rajeev Kumar; Kuhad, Ramesh Chander
2005-08-01
Cyathus bulleri, a bird's nest fungus, known to decolorize polymeric dye Poly R-478, was found to produce 8 U ml(-1) of laccase in malt extract broth. Laccase activity appeared as a single band on non-denaturing gel. Laccase was purified to homogeneity by anion exchange chromatography and gel filtration. The enzyme was a monomer with an apparent molecular mass of 60 kD, pI of 3.7 and was stable in the pH range of 2-6 with an optimum pH of 5.2. The optimal reaction temperature was 45 degrees C and the enzyme lost its activity above 70 degrees C. Enzyme could oxidize a broad range of various phenolic substrates. K(m) values for ABTS, 2,6-dimethoxyphenol, guaiacol, and ferulic acid were found to be 48.6, 56, 22, and 14 mM while K(cat) values were 204, 180, 95.6, and 5.2, respectively. It was completely inhibited by KCN, NaN(3), beta-mercaptoethanol, HgCl(2), and SDS, while EDTA had no effect on enzyme activity. The N-terminal amino acid sequence of C. bulleri laccase showed close homology to N-terminal sequences of laccase from other white-rot fungi. A 150 bp gene sequence encoding copper-binding domains I and II was most similar to the sequence encoding a laccase from Pycnoporus cinnabarinus with 74.8% level of similarity.
Hegeman, Carla E.; Grabau, Elizabeth A.
2001-01-01
Phytic acid (myo-inositol hexakisphosphate) is the major storage form of phosphorus in plant seeds. During germination, stored reserves are used as a source of nutrients by the plant seedling. Phytic acid is degraded by the activity of phytases to yield inositol and free phosphate. Due to the lack of phytases in the non-ruminant digestive tract, monogastric animals cannot utilize dietary phytic acid and it is excreted into manure. High phytic acid content in manure results in elevated phosphorus levels in soil and water and accompanying environmental concerns. The use of phytases to degrade seed phytic acid has potential for reducing the negative environmental impact of livestock production. A phytase was purified to electrophoretic homogeneity from cotyledons of germinated soybeans (Glycine max L. Merr.). Peptide sequence data generated from the purified enzyme facilitated the cloning of the phytase sequence (GmPhy) employing a polymerase chain reaction strategy. The introduction of GmPhy into soybean tissue culture resulted in increased phytase activity in transformed cells, which confirmed the identity of the phytase gene. It is surprising that the soybean phytase was unrelated to previously characterized microbial or maize (Zea mays) phytases, which were classified as histidine acid phosphatases. The soybean phytase sequence exhibited a high degree of similarity to purple acid phosphatases, a class of metallophosphoesterases. PMID:11500558
A dehydration-inducible gene in the truffle Tuber borchii identifies a novel group of dehydrins
Abba', Simona; Ghignone, Stefano; Bonfante, Paola
2006-01-01
Background The expressed sequence tag M6G10 was originally isolated from a screening for differentially expressed transcripts during the reproductive stage of the white truffle Tuber borchii. mRNA levels for M6G10 increased dramatically during fruiting body maturation compared to the vegetative mycelial stage. Results Bioinformatics tools, phylogenetic analysis and expression studies were used to support the hypothesis that this sequence, named TbDHN1, is the first dehydrin (DHN)-like coding gene isolated in fungi. Homologs of this gene, all defined as "coding for hypothetical proteins" in public databases, were exclusively found in ascomycetous fungi and in plants. Although complete (or almost complete) fungal genomes and EST collections of some Basidiomycota and Glomeromycota are already available, DHN-like proteins appear to be represented only in Ascomycota. A new and previously uncharacterized conserved signature pattern was identified and proposed to Uniprot database as the main distinguishing feature of this new group of DHNs. Expression studies provide experimental evidence of a transcript induction of TbDHN1 during cellular dehydration. Conclusion Expression pattern and sequence similarities to known plant DHNs indicate that TbDHN1 is the first characterized DHN-like protein in fungi. The high similarity of TbDHN1 with homolog coding sequences implies the existence of a novel fungal/plant group of LEA Class II proteins characterized by a previously undescribed signature pattern. PMID:16512918
Dombrovsky, Aviv; Glanz, Eyal; Lachman, Oded; Sela, Noa; Doron-Faigenboim, Adi; Antignus, Yehezkel
2013-01-01
We determined the complete sequence and organization of the genome of a putative member of the genus Polerovirus tentatively named Pepper yellow leaf curl virus (PYLCV). PYLCV has a wider host range than Tobacco vein-distorting virus (TVDV) and has a close serological relationship with Cucurbit aphid-borne yellows virus (CABYV) (both poleroviruses). The extracted viral RNA was subjected to SOLiD next-generation sequence analysis and used as a template for reverse transcription synthesis, which was followed by PCR amplification. The ssRNA genome of PYLCV includes 6,028 nucleotides encoding six open reading frames (ORFs), which is typical of the genus Polerovirus. Comparisons of the deduced amino acid sequences of the PYLCV ORFs 2-4 and ORF5, indicate that there are high levels of similarity between these sequences to ORFs 2-4 of TVDV (84-93%) and to ORF5 of CABYV (87%). Both PYLCV and Pepper vein yellowing virus (PeVYV) contain sequences that point to a common ancestral polerovirus. The recombination breakpoint which is located at CABYV ORF3, which encodes the viral coat protein (CP), may explain the CABYV-like sequences found in the genomes of the pepper infecting viruses PYLCV and PeVYV. Two additional regions unique to PYLCV (PY1 and PY2) were identified between nucleotides 4,962 and 5,061 (ORF 5) and between positions 5,866 and 6,028 in the 3' NCR. Sequence analysis of the pepper-infecting PeVYV revealed three unique regions (Pe1-Pe3) with no similarity to other members of the genus Polerovirus. Genomic analyses of PYLCV and PeVYV suggest that the speciation of these viruses occurred through putative recombination event(s) between poleroviruses co-infecting a common host(s), resulting in the emergence of PYLCV, a novel pathogen with a wider host range. PMID:23936244
Dombrovsky, Aviv; Glanz, Eyal; Lachman, Oded; Sela, Noa; Doron-Faigenboim, Adi; Antignus, Yehezkel
2013-01-01
We determined the complete sequence and organization of the genome of a putative member of the genus Polerovirus tentatively named Pepper yellow leaf curl virus (PYLCV). PYLCV has a wider host range than Tobacco vein-distorting virus (TVDV) and has a close serological relationship with Cucurbit aphid-borne yellows virus (CABYV) (both poleroviruses). The extracted viral RNA was subjected to SOLiD next-generation sequence analysis and used as a template for reverse transcription synthesis, which was followed by PCR amplification. The ssRNA genome of PYLCV includes 6,028 nucleotides encoding six open reading frames (ORFs), which is typical of the genus Polerovirus. Comparisons of the deduced amino acid sequences of the PYLCV ORFs 2-4 and ORF5, indicate that there are high levels of similarity between these sequences to ORFs 2-4 of TVDV (84-93%) and to ORF5 of CABYV (87%). Both PYLCV and Pepper vein yellowing virus (PeVYV) contain sequences that point to a common ancestral polerovirus. The recombination breakpoint which is located at CABYV ORF3, which encodes the viral coat protein (CP), may explain the CABYV-like sequences found in the genomes of the pepper infecting viruses PYLCV and PeVYV. Two additional regions unique to PYLCV (PY1 and PY2) were identified between nucleotides 4,962 and 5,061 (ORF 5) and between positions 5,866 and 6,028 in the 3' NCR. Sequence analysis of the pepper-infecting PeVYV revealed three unique regions (Pe1-Pe3) with no similarity to other members of the genus Polerovirus. Genomic analyses of PYLCV and PeVYV suggest that the speciation of these viruses occurred through putative recombination event(s) between poleroviruses co-infecting a common host(s), resulting in the emergence of PYLCV, a novel pathogen with a wider host range.
Ashburner, M; Misra, S; Roote, J; Lewis, S E; Blazej, R; Davis, T; Doyle, C; Galle, R; George, R; Harris, N; Hartzell, G; Harvey, D; Hong, L; Houston, K; Hoskins, R; Johnson, G; Martin, C; Moshrefi, A; Palazzolo, M; Reese, M G; Spradling, A; Tsang, G; Wan, K; Whitelaw, K; Celniker, S
1999-01-01
A contiguous sequence of nearly 3 Mb from the genome of Drosophila melanogaster has been sequenced from a series of overlapping P1 and BAC clones. This region covers 69 chromosome polytene bands on chromosome arm 2L, including the genetically well-characterized "Adh region." A computational analysis of the sequence predicts 218 protein-coding genes, 11 tRNAs, and 17 transposable element sequences. At least 38 of the protein-coding genes are arranged in clusters of from 2 to 6 closely related genes, suggesting extensive tandem duplication. The gene density is one protein-coding gene every 13 kb; the transposable element density is one element every 171 kb. Of 73 genes in this region identified by genetic analysis, 49 have been located on the sequence; P-element insertions have been mapped to 43 genes. Ninety-five (44%) of the known and predicted genes match a Drosophila EST, and 144 (66%) have clear similarities to proteins in other organisms. Genes known to have mutant phenotypes are more likely to be represented in cDNA libraries, and far more likely to have products similar to proteins of other organisms, than are genes with no known mutant phenotype. Over 650 chromosome aberration breakpoints map to this chromosome region, and their nonrandom distribution on the genetic map reflects variation in gene spacing on the DNA. This is the first large-scale analysis of the genome of D. melanogaster at the sequence level. In addition to the direct results obtained, this analysis has allowed us to develop and test methods that will be needed to interpret the complete sequence of the genome of this species.Before beginning a Hunt, it is wise to ask someone what you are looking for before you begin looking for it. Milne 1926 PMID:10471707
The Age-Related Properties of the HD 98800 System
NASA Technical Reports Server (NTRS)
Soderblom, David R.; Henry, Todd J.; Shetrone, Matthew D.; Jones, Burton F.; Saar, Steven H.
1996-01-01
We present optical spectroscopy of the field K star system HD 98800, which has been found to have significant infrared emission from circumstellar material. The lithium abundances of the stars in HD 98800 are well above those of Pleiades of similar color, but activity levels and rotation in these stars are at or below Pleiades level. Thus, it is not yet possible to say whether HD 98800 is or is not a pre-main-sequence system, and it is possible that its components are on or near the zero-age main sequence. However, the two visible objects that make up HD 98800 both have high levels of lithium and activity, strongly suggesting that they are physically related to one another. As shown by Torres and coworkers, having these stars physically tied implies that their relative orbit is highly eccentric and highly inclined to our line of sight, and it also means that we are viewing the HD 98800 system at an unusual time in its orbit.
Tao, Junjie; Feng, Chao; Ai, Bin; Kang, Ming
2016-01-01
Background and Aims Limestone karst areas possess high floral diversity and endemism. The genus Primulina, which contributes to the unique calcicole flora, has high species richness and exhibit specific soil-based habitat associations that are mainly distributed on calcareous karst soils. The adaptive molecular evolutionary mechanism of the genus to karst calcium-rich environments is still not well understood. The Ca2+-permeable channel TPC1 was used in this study to test whether its gene is involved in the local adaptation of Primulina to karst high-calcium soil environments. Methods Specific amplification and sequencing primers were designed and used to amplify the full-length coding sequences of TPC1 from cDNA of 76 Primulina species. The sequence alignment without recombination and the corresponding reconstructed phylogeny tree were used in molecular evolutionary analyses at the nucleic acid level and amino acid level, respectively. Finally, the identified sites under positive selection were labelled on the predicted secondary structure of TPC1. Key Results Seventy-six full-length coding sequences of Primulina TPC1 were obtained. The length of the sequences varied between 2220 and 2286 bp and the insertion/deletion was located at the 5′ end of the sequences. No signal of substitution saturation was detected in the sequences, while significant recombination breakpoints were detected. The molecular evolutionary analyses showed that TPC1 was dominated by purifying selection and the selective pressures were not significantly different among species lineages. However, significant signals of positive selection were detected at both TPC1 codon level and amino acid level, and five sites under positive selective pressure were identified by at least three different methods. Conclusions The Ca2+-permeable channel TPC1 may be involved in the local adaptation of Primulina to karst Ca2+-rich environments. Different species lineages suffered similar selective pressure associated with calcium in karst environments, and episodic diversifying selection at a few sites may play a major role in the molecular evolution of Primulina TPC1. PMID:27582362
Complementary DNA cloning and organ expression of cytochrome P450 1C2 in carp (Cyprinus carpio).
Kaminishi, Yoshio; El-Kady, Mohamed A H; Mitsuo, Ryoichi; Itakura, Takao
2007-01-01
Cytochrome P450 (CYP) genes, which make up a large gene superfamily, are known to play an important role in drug metabolism. The CYP1 family, one of the gene families of the CYP superfamily, has three subfamilies of genes whose sequences have been deposited in the GenBank/EMBL thus far: CYP1A, CYP1B, and CYP1C. Mammals as well as fish confront numerous foreign chemicals in the environment that may accumulate to toxic levels unless they are metabolized and eliminated by processes largely mediated by CYP enzymes. A new complementary DNA of the CYP1C subfamily encoding CYP1C2 was isolated from the carp liver after a single intraperitoneal injection of beta-napthoflavone (BNF). The full-length cDNA obtained contained a 5' noncoding region of 198 bp, an open reading frame of 1575 bp coding for 524 amino acids and a stop codon, and a 3' noncoding region of 531 bp. The predicted molecular weight of the protein was approximately 59.3 kDa. The amino acid sequence deduced from the carp CYP1C2 sequence showed a similarity of 76.6% with that deduced from our previously reported carp CYP1C1. It exhibited similarities of 77.3, 73.7, and 76.4% with those deduced from scup CYP1C2, scup CYP1C1, and Japanese eel CYP1C1 sequences, respectively. Carp CYP1C2 cDNA showed similarities with reported CYP1Bs of teleosts and mammals, namely, 47.6, 45.3, 45.7, 44.0, and 44.6% for carp, plaice, human, rat, and mouse CYP1B1s, respectively, while it exhibited a similarity of 49.0% with carp CYP1B2. The carp CYP1C2 sequence was aligned with the CYP1 sequences and has been deposited in the GenBank/EMBL data bank with the accession number AY437777. The phylogenetic tree constructed using fish and mammalian CYP1 sequences suggested a closer relationship of CYP1C with CYP1B than with CYP1A. The tree showed possibile existence of CYP1C subfamily genes in mammalian species. Northern blot analysis of the liver, intestines, kidneys, and gills revealed a distinct induced expression only in the kidneys, with no detectable constitutive expression in the other organs studied.
NASA Astrophysics Data System (ADS)
Li, D.
2016-12-01
The Lishui Depression (LD) is a polycyclic rift basin located in the southwestern of the East China Sea Shelf Basin. From bottom to top, the Palaeocene strata sequentially comprise the Yueguifeng (YGF), Lingfeng (LF) and Mingyuefeng Formations (MYF). The YGF clastic deposits were produced by a continental lacustrine. The LF and MYF were a set of coal-bearing strata formed by marine transgressive-regressive cycles. The Palaeocene depositional cycle is divided into two second-order sequences, namely SQII1 (YGF, 66.5-60Ma) and SQII2 (LF and MYF, 60-53Ma), which can be interpreted as the initial rifting sequence and the strong rifting sequence respectively that controlled by episodic tectonic subsidence, namely Yandang and Oujiang movements. The SQII1 includes only one third-order sequence, namely SQIII1, which is constituted by lake transgressive systems tract (LTST) and lake regressive systems tract (LRST). The SQII2 can be subdivided into four third-order sequences, namely SQIII2 (Lower LF, 60-57Ma), SQIII3 (Upper LF, 57-55Ma), SQIII4 (Lower MYF, 55-54.5Ma) and SQIII5 (Upper MYF, 54.5-53Ma). In the SQIII2 period, LD suffered massive transgression and the sustained high relative sea level led to the only development of transgressive systems tract (TST) and highstand systems tract (HST). In the SQIII3 period, the relative sea level declined and simultaneously two sets of incised valley were recognized on the seismic reflection with no lowstand fan developed. So the SQIII3 is considered to be composed of basin margin systems tract (BMST, similar to the shelf margin systems tract), TST and HST. Early SQIII4 (55Ma ), the relative sea level started global rapid declining and the LST of LD developed a completed system of prograding wedge, incised valley and basin floor fan. While the TST developed a retrograding marine sediments and the HST was characterized by a typical foreset parasequences. In SQIII5 period, the global sea level continuously rose and the sedimentary cycle of LD was only composed of TST and HST.
Mikalová, Lenka; Strouhal, Michal; Oppelt, Jan; Grange, Philippe Alain; Janier, Michel; Benhaddou, Nadjet; Dupin, Nicolas; Šmajs, David
2017-01-01
Background Treponema pallidum subsp. endemicum (TEN) is the causative agent of endemic syphilis (bejel). An unusual human TEN 11q/j isolate was obtained from a syphilis-like primary genital lesion from a patient that returned to France from Pakistan. Methodology/Principal findings The TEN 11q/j isolate was characterized using nested PCR followed by Sanger sequencing and/or direct Illumina sequencing. Altogether, 44 chromosomal regions were analyzed. Overall, the 11q/j isolate clustered with TEN strains Bosnia A and Iraq B as expected from previous TEN classification of the 11q/j isolate. However, the 11q/j sequence in a 505 bp-long region at the TP0488 locus was similar to Treponema pallidum subsp. pallidum (TPA) strains, but not to TEN Bosnia A and Iraq B sequences, suggesting a recombination event at this locus. Similarly, the 11q/j sequence in a 613 bp-long region at the TP0548 locus was similar to Treponema pallidum subsp. pertenue (TPE) strains, but not to TEN sequences. Conclusions/Significance A detailed analysis of two recombinant loci found in the 11q/j clinical isolate revealed that the recombination event occurred just once, in the TP0488, with the donor sequence originating from a TPA strain. Since TEN Bosnia A and Iraq B were found to contain TPA-like sequences at the TP0548 locus, the recombination at TP0548 took place in a treponeme that was an ancestor to both TEN Bosnia A and Iraq B. The sequence of 11q/j isolate in TP0548 represents an ancestral TEN sequence that is similar to yaws-causing treponemes. In addition to the importance of the 11q/j isolate for reconstruction of the TEN phylogeny, this case emphasizes the possible role of TEN strains in development of syphilis-like lesions. PMID:28263990
Cloning and baculovirus expression of a desiccation stress gene from the beetle, Tenebrio molitor.
Graham, L A; Bendena, W G; Walker, V K
1996-02-01
The cDNA sequence encoding a novel desiccation stress protein (dsp28) found in the hemolymph of the common yellow mealworm beetle, Tenebrio molitor, has been determined. The sequence encodes a 225 amino acid protein containing a 20 amino acid signal peptide. Dsp28 shows no significant similarity to any known nucleic acid or protein sequence. Levels of dsp28 mRNA were found to increase approx 5-fold following desiccation. Dsp28 cDNA has been cloned into a baculovirus expression vector and the expressed protein was compared to native dsp28. Both dsp28 expressed by recombinant baculovirus and native dsp28 are glycosylated and N-terminally processed. Although dsp28 is induced by cold in addition to desiccation stress, it does not contribute to the freezing point depression (thermal hysteresis) observed in Tenebrio hemolymph.
Structural Plasticity and Rapid Evolution in a Viral RNA Revealed by In Vivo Genetic Selection▿ †
Guo, Rong; Lin, Wai; Zhang, Jiuchun; Simon, Anne E.; Kushner, David B.
2009-01-01
Satellite RNAs usually lack substantial homology with their helper viruses. The 356-nucleotide satC of Turnip crinkle virus (TCV) is unusual in that its 3′-half shares high sequence similarity with the TCV 3′ end. Computer modeling, structure probing, and/or compensatory mutagenesis identified four hairpins and three pseudoknots in this TCV region that participate in replication and/or translation. Two hairpins and two pseudoknots have been confirmed as important for satC replication. One portion of the related 3′ end of satC that remains poorly characterized corresponds to juxtaposed TCV hairpins H4a and H4b and pseudoknot ψ3, which are required for the TCV-specific requirement of translation (V. A. Stupina et al., RNA 14:2379-2393, 2008). Replacement of satC H4a with randomized sequence and scoring for fitness in plants by in vivo genetic selection (SELEX) resulted in winning sequences that contain an H4a-like stem-loop, which can have additional upstream sequence composing a portion of the stem. SELEX of the combined H4a and H4b region in satC generated three distinct groups of winning sequences. One group models into two stem-loops similar to H4a and H4b of TCV. However, the selected sequences in the other two groups model into single hairpins. Evolution of these single-hairpin SELEX winners in plants resulted in satC that can accumulate to wild-type (wt) levels in protoplasts but remain less fit in planta when competed against wt satC. These data indicate that two highly distinct RNA conformations in the H4a and H4b region can mediate satC fitness in protoplasts. PMID:19004956
Chloroplast Genome Evolution in Early Diverged Leptosporangiate Ferns
Kim, Hyoung Tae; Chung, Myong Gi; Kim, Ki-Joong
2014-01-01
In this study, the chloroplast (cp) genome sequences from three early diverged leptosporangiate ferns were completed and analyzed in order to understand the evolution of the genome of the fern lineages. The complete cp genome sequence of Osmunda cinnamomea (Osmundales) was 142,812 base pairs (bp). The cp genome structure was similar to that of eusporangiate ferns. The gene/intron losses that frequently occurred in the cp genome of leptosporangiate ferns were not found in the cp genome of O. cinnamomea. In addition, putative RNA editing sites in the cp genome were rare in O. cinnamomea, even though the sites were frequently predicted to be present in leptosporangiate ferns. The complete cp genome sequence of Diplopterygium glaucum (Gleicheniales) was 151,007 bp and has a 9.7 kb inversion between the trnL-CAA and trnV-GCA genes when compared to O. cinnamomea. Several repeated sequences were detected around the inversion break points. The complete cp genome sequence of Lygodium japonicum (Schizaeales) was 157,142 bp and a deletion of the rpoC1 intron was detected. This intron loss was shared by all of the studied species of the genus Lygodium. The GC contents and the effective numbers of co-dons (ENCs) in ferns varied significantly when compared to seed plants. The ENC values of the early diverged leptosporangiate ferns showed intermediate levels between eusporangiate and core leptosporangiate ferns. However, our phylogenetic tree based on all of the cp gene sequences clearly indicated that the cp genome similarity between O. cinnamomea (Osmundales) and eusporangiate ferns are symplesiomorphies, rather than synapomorphies. Therefore, our data is in agreement with the view that Osmundales is a distinct early diverged lineage in the leptosporangiate ferns. PMID:24823358
Chloroplast genome evolution in early diverged leptosporangiate ferns.
Kim, Hyoung Tae; Chung, Myong Gi; Kim, Ki-Joong
2014-05-01
In this study, the chloroplast (cp) genome sequences from three early diverged leptosporangiate ferns were completed and analyzed in order to understand the evolution of the genome of the fern lineages. The complete cp genome sequence of Osmunda cinnamomea (Osmundales) was 142,812 base pairs (bp). The cp genome structure was similar to that of eusporangiate ferns. The gene/intron losses that frequently occurred in the cp genome of leptosporangiate ferns were not found in the cp genome of O. cinnamomea. In addition, putative RNA editing sites in the cp genome were rare in O. cinnamomea, even though the sites were frequently predicted to be present in leptosporangiate ferns. The complete cp genome sequence of Diplopterygium glaucum (Gleicheniales) was 151,007 bp and has a 9.7 kb inversion between the trnL-CAA and trnVGCA genes when compared to O. cinnamomea. Several repeated sequences were detected around the inversion break points. The complete cp genome sequence of Lygodium japonicum (Schizaeales) was 157,142 bp and a deletion of the rpoC1 intron was detected. This intron loss was shared by all of the studied species of the genus Lygodium. The GC contents and the effective numbers of codons (ENCs) in ferns varied significantly when compared to seed plants. The ENC values of the early diverged leptosporangiate ferns showed intermediate levels between eusporangiate and core leptosporangiate ferns. However, our phylogenetic tree based on all of the cp gene sequences clearly indicated that the cp genome similarity between O. cinnamomea (Osmundales) and eusporangiate ferns are symplesiomorphies, rather than synapomorphies. Therefore, our data is in agreement with the view that Osmundales is a distinct early diverged lineage in the leptosporangiate ferns.
NASA Astrophysics Data System (ADS)
Uthicke, S.; McGuire, K.
2007-03-01
Bacterial communities in eight 16S rDNA clone libraries from calcareous sediments were investigated to provide an assessment of the bacterial diversity on sediments of the Great Barrier Reef (GBR) and to investigate differences due to decreased water quality. Sample effort was spread across two locations on each of four coral reefs, with two reefs located nearshore and two reefs on the outer shelf to allow robust statistical comparison of nearshore reefs (subjected to enhanced runoff) and outer shelf reefs (pristine conditions). Out of 221 non-chimeric sequences, 189 (85.5%) were unique and only one sequence occurred in more than one library. Rarefaction analyses and coverage calculations indicated that only a small fraction of the diversity was sampled. Cluster analyses and comparison to published sequences indicated that sequences retrieved belonged to the α, γ and δ subdivision of the Proteobacteria (6.8, 29.4 and 13.6% of the total, respectively), Cytophaga-Flavobacteria-Bacteroidetes (CFB) group (20.4%), Cyanobacteria (5.4%), Planctomycetaceae (7.7%), Verrucomicrobiaceae (6.8%), Acidobacteriaceae (2.7%). Analysis of Similarity (ANOSIM, based on grouping all retrieved sequences into 9 phylogenetic groups) indicated that subtle differences do exist in the community composition between nearshore and outer shelf reefs. Similarity percentage analysis (SIMPER) indicated that Acidobacteriaceae and Cyanobacteriaceae were the main contributors to the dissimilarity. A significant difference between bacteria on nearshore and outer shelf reefs also existed on the molecular level ( FST = 0.008, p = 0.007 for all samples, 0.006, p = 0.022 when repeated sequences within libraries were removed). Thus, bacterial communities on carbonate sediments investigated were highly diverse and differences in community composition may provide important leads for the search for indicator species or communities for water quality differences.
The HMMER Web Server for Protein Sequence Similarity Search.
Prakash, Ananth; Jeffryes, Matt; Bateman, Alex; Finn, Robert D
2017-12-08
Protein sequence similarity search is one of the most commonly used bioinformatics methods for identifying evolutionarily related proteins. In general, sequences that are evolutionarily related share some degree of similarity, and sequence-search algorithms use this principle to identify homologs. The requirement for a fast and sensitive sequence search method led to the development of the HMMER software, which in the latest version (v3.1) uses a combination of sophisticated acceleration heuristics and mathematical and computational optimizations to enable the use of profile hidden Markov models (HMMs) for sequence analysis. The HMMER Web server provides a common platform by linking the HMMER algorithms to databases, thereby enabling the search for homologs, as well as providing sequence and functional annotation by linking external databases. This unit describes three basic protocols and two alternate protocols that explain how to use the HMMER Web server using various input formats and user defined parameters. © 2017 by John Wiley & Sons, Inc. Copyright © 2017 John Wiley & Sons, Inc.
Pseudoxanthomonas koreensis sp. nov. and Pseudoxanthomonas daejeonensis sp. nov.
Yang, Deok-Chun; Im, Wan-Taek; Kim, Myung Kyum; Lee, Sung-Taik
2005-03-01
Gram-negative, non-spore-forming, rod-shaped bacteria, T7-09(T) and TR6-08(T), were isolated from soil from a ginseng field in South Korea and characterized to determine their taxonomic position. 16S rRNA gene sequence analysis showed that the two isolates shared 99.5 % sequence similarity. Strains T7-09(T) and TR6-08(T) were shown to belong to the Proteobacteria and showed the highest levels of sequence similarity to Pseudoxanthomonas broegbernensis DSM 12573(T) (98.1 %), Pseudoxanthomonas mexicana AMX 26B(T) (97.4-97.5 %), Pseudoxanthomonas japonensis 12-3(T) (96.5-96.6 %), Pseudoxanthomonas taiwanensis ATCC BAA-404(T) (95.7 %) and Xanthomonas campestris ATCC 33913(T) (96.3-96.5 %). The sequence similarity values with respect to any species with validly published names in related genera were less than 96.5 %. The detection of a quinone system with Q-8 as the predominant compound and a fatty acid profile with C(15 : 0) iso as the predominant acid supported the assignment of the novel isolates to the order 'Xanthomonadales'. The two isolates could be distinguished from the established species of the genus Pseudoxanthomonas by the presence of quantitative unsaturated fatty acid C(17 : 1) iso omega9c and by their unique biochemical profiles. The results of DNA-DNA hybridization clearly demonstrated that T7-09(T) and TR6-08(T) represent separate species. On the basis of these data, it is proposed that T7-09(T) (=KCTC 12208(T)=IAM 15116(T)) and TR6-08(T) (=KCTC 12207(T)=IAM 15115(T)) be classified as the type strains of two novel Pseudoxanthomonas species, for which the names Pseudoxanthomonas koreensis sp. nov. and Pseudoxanthomonas daejeonensis sp. nov., respectively, are proposed.
Domain architecture conservation in orthologs
2011-01-01
Background As orthologous proteins are expected to retain function more often than other homologs, they are often used for functional annotation transfer between species. However, ortholog identification methods do not take into account changes in domain architecture, which are likely to modify a protein's function. By domain architecture we refer to the sequential arrangement of domains along a protein sequence. To assess the level of domain architecture conservation among orthologs, we carried out a large-scale study of such events between human and 40 other species spanning the entire evolutionary range. We designed a score to measure domain architecture similarity and used it to analyze differences in domain architecture conservation between orthologs and paralogs relative to the conservation of primary sequence. We also statistically characterized the extents of different types of domain swapping events across pairs of orthologs and paralogs. Results The analysis shows that orthologs exhibit greater domain architecture conservation than paralogous homologs, even when differences in average sequence divergence are compensated for, for homologs that have diverged beyond a certain threshold. We interpret this as an indication of a stronger selective pressure on orthologs than paralogs to retain the domain architecture required for the proteins to perform a specific function. In general, orthologs as well as the closest paralogous homologs have very similar domain architectures, even at large evolutionary separation. The most common domain architecture changes observed in both ortholog and paralog pairs involved insertion/deletion of new domains, while domain shuffling and segment duplication/deletion were very infrequent. Conclusions On the whole, our results support the hypothesis that function conservation between orthologs demands higher domain architecture conservation than other types of homologs, relative to primary sequence conservation. This supports the notion that orthologs are functionally more similar than other types of homologs at the same evolutionary distance. PMID:21819573
Tani, Akio; Sahin, Nurettin; Matsuyama, Yumiko; Enomoto, Takashi; Nishimura, Naoki; Yokota, Akira; Kimbara, Kazuhide
2012-01-01
Methylobacterium species are ubiquitous α-proteobacteria that reside in the phyllosphere and are fed by methanol that is emitted from plants. In this study, we applied whole-cell matrix-assisted laser desorption/ionization time-of-flight mass spectrometry analysis (WC-MS) to evaluate the diversity of Methylobacterium species collected from a variety of plants. The WC-MS spectrum was reproducible through two weeks of cultivation on different media. WC-MS spectrum peaks of M. extorquens strain AM1 cells were attributed to ribosomal proteins, but those were not were also found. We developed a simple method for rapid identification based on spectra similarity. Using all available type strains of Methylobacterium species, the method provided a certain threshold similarity value for species-level discrimination, although the genus contains some type strains that could not be easily discriminated solely by 16S rRNA gene sequence similarity. Next, we evaluated the WC-MS data of approximately 200 methylotrophs isolated from various plants with MALDI Biotyper software (Bruker Daltonics). Isolates representing each cluster were further identified by 16S rRNA gene sequencing. In most cases, the identification by WC-MS matched that by sequencing, and isolates with unique spectra represented possible novel species. The strains belonging to M. extorquens, M. adhaesivum, M. marchantiae, M. komagatae, M. brachiatum, M. radiotolerans, and novel lineages close to M. adhaesivum, many of which were isolated from bryophytes, were found to be the most frequent phyllospheric colonizers. The WC-MS technique provides emerging high-throughputness in the identification of known/novel species of bacteria, enabling the selection of novel species in a library and identification without 16S rRNA gene sequencing. PMID:22808262
HLA Diversity in the 1000 Genomes Dataset
Gourraud, Pierre-Antoine; Khankhanian, Pouya; Cereb, Nezih; Yang, Soo Young; Feolo, Michael; Maiers, Martin; D. Rioux, John; Hauser, Stephen; Oksenberg, Jorge
2014-01-01
The 1000 Genomes Project aims to provide a deep characterization of human genome sequence variation by sequencing at a level that should allow the genome-wide detection of most variants with frequencies as low as 1%. However, in the major histocompatibility complex (MHC), only the top 10 most frequent haplotypes are in the 1% frequency range whereas thousands of haplotypes are present at lower frequencies. Given the limitation of both the coverage and the read length of the sequences generated by the 1000 Genomes Project, the highly variable positions that define HLA alleles may be difficult to identify. We used classical Sanger sequencing techniques to type the HLA-A, HLA-B, HLA-C, HLA-DRB1 and HLA-DQB1 genes in the available 1000 Genomes samples and combined the results with the 103,310 variants in the MHC region genotyped by the 1000 Genomes Project. Using pairwise identity-by-descent distances between individuals and principal component analysis, we established the relationship between ancestry and genetic diversity in the MHC region. As expected, both the MHC variants and the HLA phenotype can identify the major ancestry lineage, informed mainly by the most frequent HLA haplotypes. To some extent, regions of the genome with similar genetic or similar recombination rate have similar properties. An MHC-centric analysis underlines departures between the ancestral background of the MHC and the genome-wide picture. Our analysis of linkage disequilibrium (LD) decay in these samples suggests that overestimation of pairwise LD occurs due to a limited sampling of the MHC diversity. This collection of HLA-specific MHC variants, available on the dbMHC portal, is a valuable resource for future analyses of the role of MHC in population and disease studies. PMID:24988075
HLA diversity in the 1000 genomes dataset.
Gourraud, Pierre-Antoine; Khankhanian, Pouya; Cereb, Nezih; Yang, Soo Young; Feolo, Michael; Maiers, Martin; Rioux, John D; Hauser, Stephen; Oksenberg, Jorge
2014-01-01
The 1000 Genomes Project aims to provide a deep characterization of human genome sequence variation by sequencing at a level that should allow the genome-wide detection of most variants with frequencies as low as 1%. However, in the major histocompatibility complex (MHC), only the top 10 most frequent haplotypes are in the 1% frequency range whereas thousands of haplotypes are present at lower frequencies. Given the limitation of both the coverage and the read length of the sequences generated by the 1000 Genomes Project, the highly variable positions that define HLA alleles may be difficult to identify. We used classical Sanger sequencing techniques to type the HLA-A, HLA-B, HLA-C, HLA-DRB1 and HLA-DQB1 genes in the available 1000 Genomes samples and combined the results with the 103,310 variants in the MHC region genotyped by the 1000 Genomes Project. Using pairwise identity-by-descent distances between individuals and principal component analysis, we established the relationship between ancestry and genetic diversity in the MHC region. As expected, both the MHC variants and the HLA phenotype can identify the major ancestry lineage, informed mainly by the most frequent HLA haplotypes. To some extent, regions of the genome with similar genetic or similar recombination rate have similar properties. An MHC-centric analysis underlines departures between the ancestral background of the MHC and the genome-wide picture. Our analysis of linkage disequilibrium (LD) decay in these samples suggests that overestimation of pairwise LD occurs due to a limited sampling of the MHC diversity. This collection of HLA-specific MHC variants, available on the dbMHC portal, is a valuable resource for future analyses of the role of MHC in population and disease studies.
Wong, Gerard; Leckie, Christopher; Gorringe, Kylie L; Haviv, Izhak; Campbell, Ian G; Kowalczyk, Adam
2010-04-15
High-density single nucleotide polymorphism (SNP) genotyping arrays are efficient and cost effective platforms for the detection of copy number variation (CNV). To ensure accuracy in probe synthesis and to minimize production costs, short oligonucleotide probe sequences are used. The use of short probe sequences limits the specificity of binding targets in the human genome. The specificity of these short probeset sequences has yet to be fully analysed against a normal reference human genome. Sequence similarity can artificially elevate or suppress copy number measurements, and hence reduce the reliability of affected probe readings. For the purpose of detecting narrow CNVs reliably down to the width of a single probeset, sequence similarity is an important issue that needs to be addressed. We surveyed the Affymetrix Human Mapping SNP arrays for probeset sequence similarity against the reference human genome. Utilizing sequence similarity results, we identified a collection of fine-scaled putative CNVs between gender from autosomal probesets whose sequence matches various loci on the sex chromosomes. To detect these variations, we utilized our statistical approach, Detecting REcurrent Copy number change using rank-order Statistics (DRECS), and showed that its performance was superior and more stable than the t-test in detecting CNVs. Through the application of DRECS on the HapMap population datasets with multi-matching probesets filtered, we identified biologically relevant SNPs in aberrant regions across populations with known association to physical traits, such as height, covered by the span of a single probe. This provided empirical confirmation of the existence of naturally occurring narrow CNVs as well as the sensitivity of the Affymetrix SNP array technology in detecting them. The MATLAB implementation of DRECS is available at http://ww2.cs.mu.oz.au/ approximately gwong/DRECS/index.html.
Pei, Haisheng; Chen, Zhou; Tan, Xiaoyan; Hu, Jing; Yang, Bin; Sun, Junshe
2017-01-01
Ganoderma lucidum is a typical polypore fungus used for traditional Chinese medical purposes. The taxonomic delimitation of Ganoderma lucidum is still debated. In this study, we sequenced seven internal transcribed spacer (ITS) sequences of Ganoderma lucidum strains and annotated the ITS1 and ITS2 regions. Phylogenetic analysis of ITS1 differentiated the strains into three geographic groups. Groups 1–3 were originated from Europe, tropical Asia, and eastern Asia, respectively. While ITS2 could only differentiate the strains into two groups in which Group 2 originated from tropical Asia gathered with Groups 1 and 3 originated from Europe and eastern Asia. By determining the secondary structures of the ITS1 sequences, these three groups exhibited similar structures with a conserved central core and differed helices. While compared to Group 2, Groups 1 and 3 of ITS2 sequences shared similar structures with the difference in helix 4. Large-scale evaluation of ITS1 and ITS2 both exhibited that the majority of subgroups in the same group shared the similar structures. Further Weblogo analysis of ITS1 sequences revealed two main variable regions located in helix 2 in which C/T or A/G substitutions frequently occurred and ITS1 exhibited more nucleotide variances compared to ITS2. ITS1 multi-alignment of seven spawn strains and culture tests indicated that a single-nucleotide polymorphism (SNP) site at position 180 correlated with strain antagonism. The HZ, TK and 203 fusion strains of Ganoderma lucidum had a T at position 180, whereas other strains exhibiting antagonism, including DB, RB, JQ, and YS, had a C. Taken together, compared to ITS2 region, ITS1 region could differentiated Ganoderma lucidum into three geographic originations based on phylogenetic analysis and secondary structure prediction. Besides, a SNP in ITS 1 could delineate Ganoderma lucidum strains at the intraspecific level. These findings will be implemented to improve species quality control in the Ganoderma industry. PMID:28056060
Zhang, Xiuqing; Xu, Zhangyang; Pei, Haisheng; Chen, Zhou; Tan, Xiaoyan; Hu, Jing; Yang, Bin; Sun, Junshe
2017-01-01
Ganoderma lucidum is a typical polypore fungus used for traditional Chinese medical purposes. The taxonomic delimitation of Ganoderma lucidum is still debated. In this study, we sequenced seven internal transcribed spacer (ITS) sequences of Ganoderma lucidum strains and annotated the ITS1 and ITS2 regions. Phylogenetic analysis of ITS1 differentiated the strains into three geographic groups. Groups 1-3 were originated from Europe, tropical Asia, and eastern Asia, respectively. While ITS2 could only differentiate the strains into two groups in which Group 2 originated from tropical Asia gathered with Groups 1 and 3 originated from Europe and eastern Asia. By determining the secondary structures of the ITS1 sequences, these three groups exhibited similar structures with a conserved central core and differed helices. While compared to Group 2, Groups 1 and 3 of ITS2 sequences shared similar structures with the difference in helix 4. Large-scale evaluation of ITS1 and ITS2 both exhibited that the majority of subgroups in the same group shared the similar structures. Further Weblogo analysis of ITS1 sequences revealed two main variable regions located in helix 2 in which C/T or A/G substitutions frequently occurred and ITS1 exhibited more nucleotide variances compared to ITS2. ITS1 multi-alignment of seven spawn strains and culture tests indicated that a single-nucleotide polymorphism (SNP) site at position 180 correlated with strain antagonism. The HZ, TK and 203 fusion strains of Ganoderma lucidum had a T at position 180, whereas other strains exhibiting antagonism, including DB, RB, JQ, and YS, had a C. Taken together, compared to ITS2 region, ITS1 region could differentiated Ganoderma lucidum into three geographic originations based on phylogenetic analysis and secondary structure prediction. Besides, a SNP in ITS 1 could delineate Ganoderma lucidum strains at the intraspecific level. These findings will be implemented to improve species quality control in the Ganoderma industry.
Analysis of xylem formation in pine by cDNA sequencing
NASA Technical Reports Server (NTRS)
Allona, I.; Quinn, M.; Shoop, E.; Swope, K.; St Cyr, S.; Carlis, J.; Riedl, J.; Retzel, E.; Campbell, M. M.; Sederoff, R.;
1998-01-01
Secondary xylem (wood) formation is likely to involve some genes expressed rarely or not at all in herbaceous plants. Moreover, environmental and developmental stimuli influence secondary xylem differentiation, producing morphological and chemical changes in wood. To increase our understanding of xylem formation, and to provide material for comparative analysis of gymnosperm and angiosperm sequences, ESTs were obtained from immature xylem of loblolly pine (Pinus taeda L.). A total of 1,097 single-pass sequences were obtained from 5' ends of cDNAs made from gravistimulated tissue from bent trees. Cluster analysis detected 107 groups of similar sequences, ranging in size from 2 to 20 sequences. A total of 361 sequences fell into these groups, whereas 736 sequences were unique. About 55% of the pine EST sequences show similarity to previously described sequences in public databases. About 10% of the recognized genes encode factors involved in cell wall formation. Sequences similar to cell wall proteins, most known lignin biosynthetic enzymes, and several enzymes of carbohydrate metabolism were found. A number of putative regulatory proteins also are represented. Expression patterns of several of these genes were studied in various tissues and organs of pine. Sequencing novel genes expressed during xylem formation will provide a powerful means of identifying mechanisms controlling this important differentiation pathway.
Molecular identification of Mango, Mangifera indica L.var. totupura
Jagarlamudi, Sankar; G, Rosaiah; Kurapati, Ravi Kumar; Pinnamaneni, Rajasekhar
2011-01-01
Mango (>Mangifera indica) belonging to Anacardiaceae family is a fruit that grows in tropical regions. It is considered as the King of fruits. The present work was taken up to identify a tool in identifying the mango species at the molecular level. The chloroplast trnL-F region was amplified from extracted total genomic DNA using the polymerase chain reaction (PCR) and sequenced. Sequence of the dominant DGGE band revealed that Mangifera indica in tested leaves was Mangifera indica (100% similarity to the ITS sequences of Mangifera indica). This sequence was deposited in NCBI with the accession no. GQ927757. Abbreviations AFLP - Amplified fragment length polymorphism , cpDNA - Chloroplast DNA, DDGE - Denaturing gradient gel electrophoresis, DNA - Deoxyribo nucleic acid, EDTA - Ethylenediamine tetraacetic acid, HCl - Hydrochloric acid, ISSR - Inter simple sequence repeats, ITS - Internal transcribed spacer, MATAB - Methyl Ammonium Bromide, Na2SO3 - Sodium sulphite, NaCl - Sodium chloride, NCBI - National Centre for Biotechnology Information, PCR - Polymerase chain reaction, PEG - Polyethylene glycol, RAPD - Randomly amplified polymorphic DNA, trnL-F - Transfer RNA genes start codon- termination codon. PMID:21423885
Benson, Dennis A; Karsch-Mizrachi, Ilene; Lipman, David J; Ostell, James; Sayers, Eric W
2011-01-01
GenBank® is a comprehensive database that contains publicly available nucleotide sequences for more than 380,000 organisms named at the genus level or lower, obtained primarily through submissions from individual laboratories and batch submissions from large-scale sequencing projects, including whole genome shotgun (WGS) and environmental sampling projects. Most submissions are made using the web-based BankIt or standalone Sequin programs, and accession numbers are assigned by GenBank staff upon receipt. Daily data exchange with the European Nucleotide Archive (ENA) and the DNA Data Bank of Japan (DDBJ) ensures worldwide coverage. GenBank is accessible through the NCBI Entrez retrieval system that integrates data from the major DNA and protein sequence databases along with taxonomy, genome, mapping, protein structure and domain information, and the biomedical journal literature via PubMed. BLAST provides sequence similarity searches of GenBank and other sequence databases. Complete bimonthly releases and daily updates of the GenBank database are available by FTP. To access GenBank and its related retrieval and analysis services, begin at the NCBI Homepage: www.ncbi.nlm.nih.gov.
Optically Mapping Multiple Bacterial Genomes Simultaneously in a Single Run
2011-11-21
sequence orientation. We have demonstrated mapping of Shigella dysenteriae and Escherichia coli simultaneously, despite their very close phylogenetic...relationship ( Shigella and Escherichia coli are generally considered to be within a single species, but are segregated at the genus level for historical...reasons [4]); two clones of Shigella would likely not map together successfully using the mixed DNA method. Similarly, based on reference maps being
Wang, Guo-Dong; Fan, Ruo-Xi; Zhai, Weiwei; Liu, Fei; Wang, Lu; Zhong, Li; Wu, Hong; Yang, He-Chuan; Wu, Shi-Fang; Zhu, Chun-Ling; Li, Yan; Gao, Yun; Ge, Ri-Li; Wu, Chung-I; Zhang, Ya-Ping
2014-01-01
The high-altitude hypoxic environment represents one of the most extreme challenges for mammals. Previous studies of humans on the Tibetan plateau and in the Andes Mountains have identified statistical signatures of selection in different sets of loci. Here, we first measured the hemoglobin levels in village dogs from Tibet and those from Chinese lowlands. We found that the hemoglobin levels are very similar between the two groups, suggesting that Tibetan dogs might share similar adaptive strategies as the Tibetan people. Through a whole-genome sequencing approach, we have identified EPAS1 and HBB as candidate genes for the hypoxic adaptation on the Tibetan plateau. The population genetic analysis shows a significant convergence between humans and dogs in Tibet. The similarities in the sets of loci that exhibit putative signatures of selection and the hemoglobin levels between humans and dogs of the same environment, but not between human populations in different regions, suggests an extraordinary landscape of convergent evolution between human beings and their best friend on the Tibetan plateau. PMID:25091388
Lepère, Cécile; Domaizon, Isabelle; Debroas, Didier
2008-01-01
The diversity of small eukaryotes (0.2 to 5 μm) in a mesotrophic lake (Lake Bourget) was investigated using 18S rRNA gene library construction and fluorescent in situ hybridization coupled with tyramide signal amplification (TSA-FISH). Samples collected from the epilimnion on two dates were used to extend a data set previously obtained using similar approaches for lakes with a range of trophic types. A high level of diversity was recorded for this system with intermediate trophic status, and the main sequences from Lake Bourget were affiliated with ciliates (maximum, 19% of the operational taxonomic units [OTUs]), cryptophytes (33%), stramenopiles (13.2%), and cercozoa (9%). Although the comparison of TSA-FISH results and clone libraries suggested that the level of Chlorophyceae may have been underestimated using PCR with 18S rRNA primers, heterotrophic organisms dominated the small-eukaryote assemblage. We found that a large fraction of the sequences belonged to potential parasites of freshwater phytoplankton, including sequences affiliated with fungi and Perkinsozoa. On average, these sequences represented 30% of the OTUs (40% of the clones) obtained for each of two dates for Lake Bourget. Our results provide information on lacustrine small-eukaryote diversity and structure, adding to the phylogenetic data available for lakes with various trophic types. PMID:18359836
Lepère, Cécile; Domaizon, Isabelle; Debroas, Didier
2008-05-01
The diversity of small eukaryotes (0.2 to 5 mum) in a mesotrophic lake (Lake Bourget) was investigated using 18S rRNA gene library construction and fluorescent in situ hybridization coupled with tyramide signal amplification (TSA-FISH). Samples collected from the epilimnion on two dates were used to extend a data set previously obtained using similar approaches for lakes with a range of trophic types. A high level of diversity was recorded for this system with intermediate trophic status, and the main sequences from Lake Bourget were affiliated with ciliates (maximum, 19% of the operational taxonomic units [OTUs]), cryptophytes (33%), stramenopiles (13.2%), and cercozoa (9%). Although the comparison of TSA-FISH results and clone libraries suggested that the level of Chlorophyceae may have been underestimated using PCR with 18S rRNA primers, heterotrophic organisms dominated the small-eukaryote assemblage. We found that a large fraction of the sequences belonged to potential parasites of freshwater phytoplankton, including sequences affiliated with fungi and Perkinsozoa. On average, these sequences represented 30% of the OTUs (40% of the clones) obtained for each of two dates for Lake Bourget. Our results provide information on lacustrine small-eukaryote diversity and structure, adding to the phylogenetic data available for lakes with various trophic types.
The Nucleotide Sequence and Spliced pol mRNA Levels of the Nonprimate Spumavirus Bovine Foamy Virus
Holzschu, Donald L.; Delaney, Mari A.; Renshaw, Randall W.; Casey, James W.
1998-01-01
We have determined the complete nucleotide sequence of a replication-competent clone of bovine foamy virus (BFV) and have quantitated the amount of splice pol mRNA processed early in infection. The 544-amino-acid Gag protein precursor has little sequence similarity with its primate foamy virus homologs, but the putative nucleocapsid (NC) protein, like the primate NCs, contains the three glycine-arginine-rich regions that are postulated to bind genomic RNA during virion assembly. The BFV gag and pol open reading frames overlap, with pro and pol in the same translational frame. As with the human foamy virus (HFV) and feline foamy virus, we have detected a spliced pol mRNA by PCR. Quantitatively, this mRNA approximates the level of full-length genomic RNA early in infection. The integrase (IN) domain of reverse transcriptase does not contain the canonical HH-CC zinc finger motif present in all characterized retroviral INs, but it does contain a nearby histidine residue that could conceivably participate as a member of the zinc finger. The env gene encodes a protein that is over 40% identical in sequence to the HFV Env. By comparison, the Gag precursor of BFV is predicted to be only 28% identical to the HFV protein. PMID:9499074
Mott, I; Ivarie, R
2002-06-01
Decades of selective breeding have yielded lines of poultry with substantial myofiber hyperplasia, vet little is known about what genes have been altered during the course of selection. Myostatin is a strong negative regulator of muscle mass in mice and cattle and could have been one of many genetic factors contributing to increased myofiber deposition in growth-selected lines of poultry. To test this hypothesis, the sequence and expression patterns of myostatin were analyzed in growth-selected lines of chickens and quail. The sequence of broiler myostatin cDNA, amplified via reverse transcription (RT)-PCR from embryonic muscle RNA, contained no missense mutations in the coding sequence when compared to that of White Leghorn layers, although two silent single nucleotide polymorphisms (SNP) were found. Northern analysis of myostatin transcripts from embryonic pectoralis and quadriceps showed no significant differences in expression levels between broiler and layer muscle RNA. However, levels of myostatin transcripts were greatly reduced in muscles of posthatch chicks compared to embryonic muscle. Myostatin protein was also present in broiler and layer embryonic muscle at similar levels. No significant polymorphisms or differences in RNA expression levels were found in embryonic muscles of divergently selected lines of Japanese quail. These results indicate that intense artificial selection in these growth-selected lines of poultry has neither silenced the expression of myostatin nor created null alleles via mutation in the lines analyzed.
De Gannes, Vidya; Eudoxie, Gaius; Hickey, William J
2013-01-01
Fungal community composition in composts of lignocellulosic wastes was assessed via 454-pyrosequencing of ITS1 libraries derived from the three major composting phases. Ascomycota represented most (93%) of the 27,987 fungal sequences. A total of 102 genera, 120 species, and 222 operational taxonomic units (OTUs; >97% similarity) were identified. Thirty genera predominated (ca. 94% of the sequences), and at the species level, sequences matching Chaetomium funicola and Fusarium oxysporum were the most abundant (26 and 12%, respectively). In all composts, fungal diversity in the mature phase exceeded that of the mesophilic phase, but there was no consistent pattern in diversity changes occurring in the thermophilic phase. Fifteen species of human pathogens were identified, eight of which have not been previously identified in composts. This study demonstrated that deep sequencing can elucidate fungal community diversity in composts, and that this information can have important implications for compost use and human health.
De Gannes, Vidya; Eudoxie, Gaius; Hickey, William J.
2013-01-01
Fungal community composition in composts of lignocellulosic wastes was assessed via 454-pyrosequencing of ITS1 libraries derived from the three major composting phases. Ascomycota represented most (93%) of the 27,987 fungal sequences. A total of 102 genera, 120 species, and 222 operational taxonomic units (OTUs; >97% similarity) were identified. Thirty genera predominated (ca. 94% of the sequences), and at the species level, sequences matching Chaetomium funicola and Fusarium oxysporum were the most abundant (26 and 12%, respectively). In all composts, fungal diversity in the mature phase exceeded that of the mesophilic phase, but there was no consistent pattern in diversity changes occurring in the thermophilic phase. Fifteen species of human pathogens were identified, eight of which have not been previously identified in composts. This study demonstrated that deep sequencing can elucidate fungal community diversity in composts, and that this information can have important implications for compost use and human health. PMID:23785368
Inhibition in motor imagery: a novel action mode switching paradigm.
Rieger, Martina; Dahm, Stephan F; Koch, Iring
2017-04-01
Motor imagery requires that actual movements are prevented (i.e., inhibited) from execution. To investigate at what level inhibition takes place in motor imagery, we developed a novel action mode switching paradigm. Participants imagined (indicating only start and end) and executed movements from start buttons to target buttons, and we analyzed trial sequence effects. Trial sequences depended on current action mode (imagination or execution), previous action mode (pure blocks/same mode, mixed blocks/same mode, or mixed blocks/other mode), and movement sequence (action repetition, hand repetition, or hand alternation). Results provided evidence for global inhibition (indicated by switch benefits in execution-imagination (E-I)-sequences in comparison to I-I-sequences), effector-specific inhibition (indicated by hand repetition costs after an imagination trial), and target inhibition (indicated by target repetition benefits in I-I-sequences). No evidence for subthreshold motor activation or action-specific inhibition (inhibition of the movement of an effector to a specific target) was obtained. Two (global inhibition and effector-specific inhibition) of the three observed mechanisms are active inhibition mechanisms. In conclusion, motor imagery is not simply a weaker form of execution, which often is implied in views focusing on similarities between imagination and execution.
Winnowing sequences from a database search.
Berman, P; Zhang, Z; Wolf, Y I; Koonin, E V; Miller, W
2000-01-01
In database searches for sequence similarity, matches to a distinct sequence region (e.g., protein domain) are frequently obscured by numerous matches to another region of the same sequence. In order to cope with this problem, algorithms are developed to discard redundant matches. One model for this problem begins with a list of intervals, each with an associated score; each interval gives the range of positions in the query sequence that align to a database sequence, and the score is that of the alignment. If interval I is contained in interval J, and I's score is less than J's, then I is said to be dominated by J. The problem is then to identify each interval that is dominated by at least K other intervals, where K is a given level of "tolerable redundancy." An algorithm is developed to solve the problem in O(N log N) time and O(N*) space, where N is the number of intervals and N* is a precisely defined value that never exceeds N and is frequently much smaller. This criterion for discarding database hits has been implemented in the Blast program, as illustrated herein with examples. Several variations and extensions of this approach are also described.
A fully automatic evolutionary classification of protein folds: Dali Domain Dictionary version 3
Dietmann, Sabine; Park, Jong; Notredame, Cedric; Heger, Andreas; Lappe, Michael; Holm, Liisa
2001-01-01
The Dali Domain Dictionary (http://www.ebi.ac.uk/dali/domain) is a numerical taxonomy of all known structures in the Protein Data Bank (PDB). The taxonomy is derived fully automatically from measurements of structural, functional and sequence similarities. Here, we report the extension of the classification to match the traditional four hierarchical levels corresponding to: (i) supersecondary structural motifs (attractors in fold space), (ii) the topology of globular domains (fold types), (iii) remote homologues (functional families) and (iv) homologues with sequence identity above 25% (sequence families). The computational definitions of attractors and functional families are new. In September 2000, the Dali classification contained 10 531 PDB entries comprising 17 101 chains, which were partitioned into five attractor regions, 1375 fold types, 2582 functional families and 3724 domain sequence families. Sequence families were further associated with 99 582 unique homologous sequences in the HSSP database, which increases the number of effectively known structures several-fold. The resulting database contains the description of protein domain architecture, the definition of structural neighbours around each known structure, the definition of structurally conserved cores and a comprehensive library of explicit multiple alignments of distantly related protein families. PMID:11125048
MIPS: analysis and annotation of genome information in 2007
Mewes, H. W.; Dietmann, S.; Frishman, D.; Gregory, R.; Mannhaupt, G.; Mayer, K. F. X.; Münsterkötter, M.; Ruepp, A.; Spannagl, M.; Stümpflen, V.; Rattei, T.
2008-01-01
The Munich Information Center for Protein Sequences (MIPS-GSF, Neuherberg, Germany) combines automatic processing of large amounts of sequences with manual annotation of selected model genomes. Due to the massive growth of the available data, the depth of annotation varies widely between independent databases. Also, the criteria for the transfer of information from known to orthologous sequences are diverse. To cope with the task of global in-depth genome annotation has become unfeasible. Therefore, our efforts are dedicated to three levels of annotation: (i) the curation of selected genomes, in particular from fungal and plant taxa (e.g. CYGD, MNCDB, MatDB), (ii) the comprehensive, consistent, automatic annotation employing exhaustive methods for the computation of sequence similarities and sequence-related attributes as well as the classification of individual sequences (SIMAP, PEDANT and FunCat) and (iii) the compilation of manually curated databases for protein interactions based on scrutinized information from the literature to serve as an accepted set of reliable annotated interaction data (MPACT, MPPI, CORUM). All databases and tools described as well as the detailed descriptions of our projects can be accessed through the MIPS web server (http://mips.gsf.de). PMID:18158298
MIPS: analysis and annotation of genome information in 2007.
Mewes, H W; Dietmann, S; Frishman, D; Gregory, R; Mannhaupt, G; Mayer, K F X; Münsterkötter, M; Ruepp, A; Spannagl, M; Stümpflen, V; Rattei, T
2008-01-01
The Munich Information Center for Protein Sequences (MIPS-GSF, Neuherberg, Germany) combines automatic processing of large amounts of sequences with manual annotation of selected model genomes. Due to the massive growth of the available data, the depth of annotation varies widely between independent databases. Also, the criteria for the transfer of information from known to orthologous sequences are diverse. To cope with the task of global in-depth genome annotation has become unfeasible. Therefore, our efforts are dedicated to three levels of annotation: (i) the curation of selected genomes, in particular from fungal and plant taxa (e.g. CYGD, MNCDB, MatDB), (ii) the comprehensive, consistent, automatic annotation employing exhaustive methods for the computation of sequence similarities and sequence-related attributes as well as the classification of individual sequences (SIMAP, PEDANT and FunCat) and (iii) the compilation of manually curated databases for protein interactions based on scrutinized information from the literature to serve as an accepted set of reliable annotated interaction data (MPACT, MPPI, CORUM). All databases and tools described as well as the detailed descriptions of our projects can be accessed through the MIPS web server (http://mips.gsf.de).
Crampton, Mollee; Sripathi, Venkateswara R; Hossain, Khwaja; Kalavacharla, Venu
2016-01-01
Common bean (Phaseolus vulgaris L.) is economically important for its high protein, fiber, and micronutrient contents, with a relatively small genome size of ∼587 Mb. Common bean is genetically diverse with two major gene pools, Meso-American and Andean. The phenotypic variability within common bean is partly attributed to the genetic diversity and epigenetic changes that are largely influenced by environmental factors. It is well established that an important epigenetic regulator of gene expression is DNA methylation. Here, we present results generated from two high-throughput sequencing technologies, methylated DNA immunoprecipitation-sequencing (MeDIP-seq) and whole genome bisulfite-sequencing (BS-Seq). Our analyses revealed that this Meso-American common bean displays similar methylation patterns as other previously published plant methylomes, with CG ∼50%, CHG ∼30%, and CHH ∼2.7% methylation, however, these differ from the common bean reference methylome of Andean origin. We identified higher CG methylation levels in both promoter and genic regions than CHG and CHH contexts. Moreover, we found relatively higher CG methylation levels in genes than in promoters. Conversely, the CHG and CHH methylation levels were highest in promoters than in genes. This is the first genome-wide DNA methylation profiling study in a Meso-American common bean cultivar ("Sierra") using NGS approaches. Our long-term goal is to generate genome-wide epigenomic maps in common bean focusing on chromatin accessibility, histone modifications, and DNA methylation.
Zeng, Fansuo; Sun, Fengkun; Li, Leilei; Liu, Kun; Zhan, Yaguang
2014-01-01
Evidence supporting nitric oxide (NO) as a mediator of plant biochemistry continues to grow, but its functions at the molecular level remains poorly understood and, in some cases, controversial. To study the role of NO at the transcriptional level in Betula platyphylla cells, we conducted a genome-scale transcriptome analysis of these cells. The transcriptome of untreated birch cells and those treated by sodium nitroprusside (SNP) were analyzed using the Solexa sequencing. Data were collected by sequencing cDNA libraries of birch cells, which had a long period to adapt to the suspension culture conditions before SNP-treated cells and untreated cells were sampled. Among the 34,100 UniGenes detected, BLASTX search revealed that 20,631 genes showed significant (E-values≤10−5) sequence similarity with proteins from the NR-database. Numerous expressed sequence tags (i.e., 1374) were identified as differentially expressed between the 12 h SNP-treated cells and control cells samples: 403 up-regulated and 971 down-regulated. From this, we specifically examined a core set of NO-related transcripts. The altered expression levels of several transcripts, as determined by transcriptome analysis, was confirmed by qRT-PCR. The results of transcriptome analysis, gene expression quantification, the content of triterpenoid and activities of defensive enzymes elucidated NO has a significant effect on many processes including triterpenoid production, carbohydrate metabolism and cell wall biosynthesis. PMID:25551661
Crampton, Mollee; Sripathi, Venkateswara R.; Hossain, Khwaja; Kalavacharla, Venu
2016-01-01
Common bean (Phaseolus vulgaris L.) is economically important for its high protein, fiber, and micronutrient contents, with a relatively small genome size of ∼587 Mb. Common bean is genetically diverse with two major gene pools, Meso-American and Andean. The phenotypic variability within common bean is partly attributed to the genetic diversity and epigenetic changes that are largely influenced by environmental factors. It is well established that an important epigenetic regulator of gene expression is DNA methylation. Here, we present results generated from two high-throughput sequencing technologies, methylated DNA immunoprecipitation-sequencing (MeDIP-seq) and whole genome bisulfite-sequencing (BS-Seq). Our analyses revealed that this Meso-American common bean displays similar methylation patterns as other previously published plant methylomes, with CG ∼50%, CHG ∼30%, and CHH ∼2.7% methylation, however, these differ from the common bean reference methylome of Andean origin. We identified higher CG methylation levels in both promoter and genic regions than CHG and CHH contexts. Moreover, we found relatively higher CG methylation levels in genes than in promoters. Conversely, the CHG and CHH methylation levels were highest in promoters than in genes. This is the first genome-wide DNA methylation profiling study in a Meso-American common bean cultivar (“Sierra”) using NGS approaches. Our long-term goal is to generate genome-wide epigenomic maps in common bean focusing on chromatin accessibility, histone modifications, and DNA methylation. PMID:27199997
Asamizu, Erika; Nakamura, Yasukazu; Sato, Shusei; Tabata, Satoshi
2004-02-01
To perform a comprehensive analysis of genes expressed in a model legume, Lotus japonicus, a total of 74472 3'-end expressed sequence tags (EST) were generated from cDNA libraries produced from six different organs. Clustering of sequences was performed with an identity criterion of 95% for 50 bases, and a total of 20457 non-redundant sequences, 8503 contigs and 11954 singletons were generated. EST sequence coverage was analyzed by using the annotated L. japonicus genomic sequence and 1093 of the 1889 predicted protein-encoding genes (57.9%) were hit by the EST sequence(s). Gene content was compared to several plant species. Among the 8503 contigs, 471 were identified as sequences conserved only in leguminous species and these included several disease resistance-related genes. This suggested that in legumes, these genes may have evolved specifically to resist pathogen attack. The rate of gene sequence divergence was assessed by comparing similarity level and functional category based on the Gene Ontology (GO) annotation of Arabidopsis genes. This revealed that genes encoding ribosomal proteins, as well as those related to translation, photosynthesis, and cellular structure were more abundantly represented in the highly conserved class, and that genes encoding transcription factors and receptor protein kinases were abundantly represented in the less conserved class. To make the sequence information and the cDNA clones available to the research community, a Web database with useful services was created at http://www.kazusa.or.jp/en/plant/lotus/EST/.
Previously unknown and highly divergent ssDNA viruses populate the oceans.
Labonté, Jessica M; Suttle, Curtis A
2013-11-01
Single-stranded DNA (ssDNA) viruses are economically important pathogens of plants and animals, and are widespread in oceans; yet, the diversity and evolutionary relationships among marine ssDNA viruses remain largely unknown. Here we present the results from a metagenomic study of composite samples from temperate (Saanich Inlet, 11 samples; Strait of Georgia, 85 samples) and subtropical (46 samples, Gulf of Mexico) seawater. Most sequences (84%) had no evident similarity to sequenced viruses. In total, 608 putative complete genomes of ssDNA viruses were assembled, almost doubling the number of ssDNA viral genomes in databases. These comprised 129 genetically distinct groups, each represented by at least one complete genome that had no recognizable similarity to each other or to other virus sequences. Given that the seven recognized families of ssDNA viruses have considerable sequence homology within them, this suggests that many of these genetic groups may represent new viral families. Moreover, nearly 70% of the sequences were similar to one of these genomes, indicating that most of the sequences could be assigned to a genetically distinct group. Most sequences fell within 11 well-defined gene groups, each sharing a common gene. Some of these encoded putative replication and coat proteins that had similarity to sequences from viruses infecting eukaryotes, suggesting that these were likely from viruses infecting eukaryotic phytoplankton and zooplankton.
Peura, Sari; Eiler, Alexander; Hiltunen, Minna; Nykänen, Hannu; Tiirola, Marja; Jones, Roger I.
2012-01-01
Nutrient limitation and resource competition in bacterial and phytoplankton communities may appear different when considering different levels of taxonomic resolution. Nutrient amendment experiments conducted in a boreal lake on three occasions during one open water season revealed complex responses in overall bacterioplankton and phytoplankton abundance and biovolume. In general, bacteria were dominant in spring, while phytoplankton was clearly the predominant group in autumn. Seasonal differences in the community composition of bacteria and phytoplankton were mainly related to changes in observed taxa, while the differences across nutrient treatments within an experiment were due to changes in relative contributions of certain higher- and lower-level phylogenetic groups. Of the main bacterioplankton phyla, only Actinobacteria had a treatment response that was visible even at the phylum level throughout the season. With increasing resolution (from 75 to 99% sequence similarity) major responses to nutrient amendments appeared using 454 pyrosequencing data of 16S rRNA amplicons. This further revealed that OTUs (defined by 97% sequence similarity) annotated to the same highly resolved freshwater groups appeared to occur during different seasons and were showing treatment-dependent differentiation, indicating that OTUs within these groups were not ecologically coherent. Similarly, phytoplankton species from the same genera responded differently to nutrient amendments even though biovolumes of the majority of taxa increased when both nitrogen and phosphorus were added simultaneously. The bacterioplankton and phytoplankton community compositions showed concurrent trajectories that could be seen in synchronous succession patterns over the season. Overall, our data revealed that the response of both communities to nutrient changes was highly dependent on season and that contradictory results may be obtained when using different taxonomic resolutions. PMID:22715392
Guinea Pig ID-Like Families of SINEs
Kass, David H.; Schaetz, Brian A.; Beitler, Lindsey; Bonney, Kevin M.; Jamison, Nicole; Wiesner, Cathy
2009-01-01
Previous studies have indicated a paucity of SINEs within the genomes of the guinea pig and nutria, representatives of the Hystricognathi suborder of rodents. More recent work has shown that the guinea pig genome contains a large number of B1 elements, expanding to various levels among different rodents. In this work we utilized A–B PCR and screened GenBank with sequences from isolated clones to identify potentially uncharacterized SINEs within the guinea pig genome, and identified numerous sequences with a high degree of similarity (>92%) specific to the guinea pig. The presence of A-tails and flanking direct repeats associated with these sequences supported the identification of a full-length SINE, with a consensus sequence notably distinct from other rodent SINEs. Although most similar to the ID SINE, it clearly was not derived from the known ID master gene (BC1), hence we refer to this element as guinea pig ID-like (GPIDL). Using the consensus to screen the guinea pig genomic database (Assembly CavPor2) with Ensembl BlastView, we estimated at least 100,000 copies, which contrasts markedly to just over 100 copies of ID elements. Additionally we provided evidence of recent integrations of GPIDL as two of seven analyzed conserved GPIDL-containing loci demonstrated presence/absence variants in Cavia porcellus and C. aperea. Using intra-IDL PCR and sequence analyses we also provide evidence that GPIDL is derived from a hystricognath-specific SINE family. These results demonstrate that this SINE family continues to contribute to the dynamics of genomes of hystricognath rodents. PMID:19232383
Guinea pig ID-like families of SINEs.
Kass, David H; Schaetz, Brian A; Beitler, Lindsey; Bonney, Kevin M; Jamison, Nicole; Wiesner, Cathy
2009-05-01
Previous studies have indicated a paucity of SINEs within the genomes of the guinea pig and nutria, representatives of the Hystricognathi suborder of rodents. More recent work has shown that the guinea pig genome contains a large number of B1 elements, expanding to various levels among different rodents. In this work we utilized A-B PCR and screened GenBank with sequences from isolated clones to identify potentially uncharacterized SINEs within the guinea pig genome, and identified numerous sequences with a high degree of similarity (>92%) specific to the guinea pig. The presence of A-tails and flanking direct repeats associated with these sequences supported the identification of a full-length SINE, with a consensus sequence notably distinct from other rodent SINEs. Although most similar to the ID SINE, it clearly was not derived from the known ID master gene (BC1), hence we refer to this element as guinea pig ID-like (GPIDL). Using the consensus to screen the guinea pig genomic database (Assembly CavPor2) with Ensembl BlastView, we estimated at least 100,000 copies, which contrasts markedly to just over 100 copies of ID elements. Additionally we provided evidence of recent integrations of GPIDL as two of seven analyzed conserved GPIDL-containing loci demonstrated presence/absence variants in Cavia porcellus and C. aperea. Using intra-IDL PCR and sequence analyses we also provide evidence that GPIDL is derived from a hystricognath-specific SINE family. These results demonstrate that this SINE family continues to contribute to the dynamics of genomes of hystricognath rodents.
2011-01-01
Background Jamestown Canyon virus (JCV), family Bunyaviridae, is a mosquito-borne pathogen endemic in the United States and Canada that can cause encephalitis in humans and is considered an emerging threat to public health. The virus is genetically similar to Inkoo virus circulating in Europe, suggesting that much of the northern hemisphere contains JCV or similar variants. Results We have completed the sequence of three isolates of JCV collected in geographically diverse locations over a 57 year time span. The nucleotide identity for the three strains is 90, 83, and 85% for the S, M, and L segments respectively whereas the percent identify for the predicted amino acid sequences of the N, NSS, M poly, GN, NSM, GC, and L proteins was 97, 91, 94, 98, 91, 94, and 97%, respectively. In Swiss Webster mice, each JCV isolate exhibits low neuroinvasiveness but high infectivity. Two of the three JCV isolates were highly neurovirulent after IC inoculation whereas one isolate, JCV/03/CT, exhibited low neurovirulence. In rhesus monkeys, JCV infection is accompanied by a low-titered viremia, lack of clinical disease, but a robust neutralizing antibody response. Conclusions The first complete sequence of JCV is reported for three separate isolates, and a relatively high level of amino acid sequence conservation was observed even for viruses isolated 57 years apart indicating that the virus is in relative evolutionary stasis. JCV is highly infectious for mice and monkeys, and these animals, especially mice, represent useful experimental hosts for further study. PMID:21435230
Bradshaw, Charles Richard; Surendranath, Vineeth; Henschel, Robert; Mueller, Matthias Stefan; Habermann, Bianca Hermine
2011-03-10
Conserved domains in proteins are one of the major sources of functional information for experimental design and genome-level annotation. Though search tools for conserved domain databases such as Hidden Markov Models (HMMs) are sensitive in detecting conserved domains in proteins when they share sufficient sequence similarity, they tend to miss more divergent family members, as they lack a reliable statistical framework for the detection of low sequence similarity. We have developed a greatly improved HMMerThread algorithm that can detect remotely conserved domains in highly divergent sequences. HMMerThread combines relaxed conserved domain searches with fold recognition to eliminate false positive, sequence-based identifications. With an accuracy of 90%, our software is able to automatically predict highly divergent members of conserved domain families with an associated 3-dimensional structure. We give additional confidence to our predictions by validation across species. We have run HMMerThread searches on eight proteomes including human and present a rich resource of remotely conserved domains, which adds significantly to the functional annotation of entire proteomes. We find ∼4500 cross-species validated, remotely conserved domain predictions in the human proteome alone. As an example, we find a DNA-binding domain in the C-terminal part of the A-kinase anchor protein 10 (AKAP10), a PKA adaptor that has been implicated in cardiac arrhythmias and premature cardiac death, which upon stress likely translocates from mitochondria to the nucleus/nucleolus. Based on our prediction, we propose that with this HLH-domain, AKAP10 is involved in the transcriptional control of stress response. Further remotely conserved domains we discuss are examples from areas such as sporulation, chromosome segregation and signalling during immune response. The HMMerThread algorithm is able to automatically detect the presence of remotely conserved domains in proteins based on weak sequence similarity. Our predictions open up new avenues for biological and medical studies. Genome-wide HMMerThread domains are available at http://vm1-hmmerthread.age.mpg.de.
Bradshaw, Charles Richard; Surendranath, Vineeth; Henschel, Robert; Mueller, Matthias Stefan; Habermann, Bianca Hermine
2011-01-01
Conserved domains in proteins are one of the major sources of functional information for experimental design and genome-level annotation. Though search tools for conserved domain databases such as Hidden Markov Models (HMMs) are sensitive in detecting conserved domains in proteins when they share sufficient sequence similarity, they tend to miss more divergent family members, as they lack a reliable statistical framework for the detection of low sequence similarity. We have developed a greatly improved HMMerThread algorithm that can detect remotely conserved domains in highly divergent sequences. HMMerThread combines relaxed conserved domain searches with fold recognition to eliminate false positive, sequence-based identifications. With an accuracy of 90%, our software is able to automatically predict highly divergent members of conserved domain families with an associated 3-dimensional structure. We give additional confidence to our predictions by validation across species. We have run HMMerThread searches on eight proteomes including human and present a rich resource of remotely conserved domains, which adds significantly to the functional annotation of entire proteomes. We find ∼4500 cross-species validated, remotely conserved domain predictions in the human proteome alone. As an example, we find a DNA-binding domain in the C-terminal part of the A-kinase anchor protein 10 (AKAP10), a PKA adaptor that has been implicated in cardiac arrhythmias and premature cardiac death, which upon stress likely translocates from mitochondria to the nucleus/nucleolus. Based on our prediction, we propose that with this HLH-domain, AKAP10 is involved in the transcriptional control of stress response. Further remotely conserved domains we discuss are examples from areas such as sporulation, chromosome segregation and signalling during immune response. The HMMerThread algorithm is able to automatically detect the presence of remotely conserved domains in proteins based on weak sequence similarity. Our predictions open up new avenues for biological and medical studies. Genome-wide HMMerThread domains are available at http://vm1-hmmerthread.age.mpg.de. PMID:21423752
Brendolise, Cyril; Yauk, Yar-Khing; Eberhard, Ellen D; Wang, Mindy; Chagne, David; Andre, Christelle; Greenwood, David R; Beuning, Lesley L
2011-07-01
The pentacyclic triterpenes, in particular ursolic acid and oleanolic acid and their derivatives, exist abundantly in the plant kingdom, where they are well known for their anti-inflammatory, antitumour and antimicrobial properties. α-Amyrin and β-amyrin are the precursors of ursolic and oleanolic acids, respectively, formed by concerted cyclization of squalene epoxide by a complex synthase reaction. We identified three full-length expressed sequence tag sequences in cDNA libraries constructed from apple (Malus × domestica 'Royal Gala') that were likely to encode triterpene synthases. Two of these expressed sequence tag sequences were essentially identical (> 99% amino acid similarity; MdOSC1 and MdOSC3). MdOSC1 and MdOSC2 were expressed by transient expression in Nicotiana benthamiana leaves and by expression in the yeast Pichia methanolica. The resulting products were analysed by GC and GC-MS. MdOSC1 was shown to be a mixed amyrin synthase (a 5 : 1 ratio of α-amyrin to β-amyrin). MdOSC1 is the only triterpene synthase so far identified in which the level of α-amyrin produced is > 80% of the total product and is, therefore, primarily an α-amyrin synthase. No product was evident for MdOSC2 when expressed either transiently or in yeast, suggesting that this putative triterpene synthase is either encoded by a pseudogene or does not express well in these systems. Transcript expression analysis in Royal Gala indicated that the genes are mostly expressed in apple peel, and that the MdOSC2 expression level was much lower than that of MdOSC1 and MdOSC3 in all the tissues tested. Amyrin content analysis was undertaken by LC-MS, and demonstrated that levels and ratios differ between tissues, but that the true consequence of synthase activity is reflected in the ursolic/oleanolic acid content and in further triterpenoids derived from them. Phylogenetic analysis placed the three triterpene synthase sequences with other triterpene synthases that encoded either α-amyrin and/or β-amyrin synthase. MdOSC1 and MdOSC3 clustered with the multifunctional triterpene synthases, whereas MdOSC2 was most similar to the β-amyrin synthases. © 2011 The New Zealand Institute for Plant and Food Research Limited. Journal compilation © 2011 FEBS.
Trapnell, Cole; Davidson, Stuart; Pachter, Lior; Chu, Hou Cheng; Tonkin, Leath A.; Biggin, Mark D.; Eisen, Michael B.
2010-01-01
Changes in gene expression play an important role in evolution, yet the molecular mechanisms underlying regulatory evolution are poorly understood. Here we compare genome-wide binding of the six transcription factors that initiate segmentation along the anterior-posterior axis in embryos of two closely related species: Drosophila melanogaster and Drosophila yakuba. Where we observe binding by a factor in one species, we almost always observe binding by that factor to the orthologous sequence in the other species. Levels of binding, however, vary considerably. The magnitude and direction of the interspecies differences in binding levels of all six factors are strongly correlated, suggesting a role for chromatin or other factor-independent forces in mediating the divergence of transcription factor binding. Nonetheless, factor-specific quantitative variation in binding is common, and we show that it is driven to a large extent by the gain and loss of cognate recognition sequences for the given factor. We find only a weak correlation between binding variation and regulatory function. These data provide the first genome-wide picture of how modest levels of sequence divergence between highly morphologically similar species affect a system of coordinately acting transcription factors during animal development, and highlight the dominant role of quantitative variation in transcription factor binding over short evolutionary distances. PMID:20351773
Ae Kim, Sun; Hong Park, Si; In Lee, Sang; Owens, Casey M.; Ricke, Steven C.
2017-01-01
The purpose of this study was to 1) identify microbial compositional changes on chicken carcasses during processing, 2) determine the antimicrobial efficacy of peracetic acid (PAA) and Amplon (blend of sulfuric acid and sodium sulfate) at a poultry processing pilot plant scale, and 3) compare microbial communities between chicken carcass rinsates and recovered bacteria from media. Birds were collected from each processing step and rinsates were applied to estimate aerobic plate count (APC) and Campylobacter as well as Salmonella prevalence. Microbiome sequencing was utilized to identify microbial population changes over processing and antimicrobial treatments. Only the PAA treatment exhibited significant reduction of APC at the post chilling step while both Amplon and PAA yielded detectable Campylobacter reductions at all steps. Based on microbiome sequencing, Firmicutes were the predominant bacterial group at the phyla level with over 50% frequency in all steps while the relative abundance of Proteobacteria decreased as processing progressed. Overall microbiota between rinsate and APC plate microbial populations revealed generally similar patterns at the phyla level but they were different at the genus level. Both antimicrobials appeared to be effective on reducing problematic bacteria and microbiome can be utilized to identify optimal indicator microorganisms for enhancing product quality. PMID:28230180
DNA fingerprints in physical anthropology.
Weiss, Mark L
1989-01-01
Hypervariabal minisatellite DNA is a recently described class of nuclear sequences with no known biological function. The minisatellites do form a subtype of restricition fragment length polymorphisms possessing several characteristics particularly intriguing to anthropologists interested in forensics, sociobiology, primate conservation, genetic variability, and molecular evolution. The sequence occupy at least five dozen loci scattered throughout the human genome. Unlike many polymorphisms, many of the loci have numerous alleles each present at similar frequencies. Such a genetic structure produces exceptionally high levels of heterozygosity and thus provides a tool for the individualization of tissue samples. Additionally, as the alleles are inherited in a Mendelian fashion, the minisatellites provide a superb tool for the identification of paternity (or maternity). Unlike standard blood groups, levels of variability are so high in populations studied to data that parentage can be established by inclusion rather than exclution. Homologous sequences are shown to exist in a variety of Old World primates. Visualization of genetic fingerprints in nonhumans may allow for determination of paternity where the pool of potential sires is available, while also providing information on levels of genetic variability. These capabilities will ultimately provide for better management of primate colonies. Used in concert with behavioral data, a number of sociobiological will also become more amenable to investigation. Copyright © 1989 Wiley-Liss, Inc., A Wiley Company.
Liang, Yunyun; Liu, Sanyang; Zhang, Shengli
2015-01-01
Prediction of protein structural classes for low-similarity sequences is useful for understanding fold patterns, regulation, functions, and interactions of proteins. It is well known that feature extraction is significant to prediction of protein structural class and it mainly uses protein primary sequence, predicted secondary structure sequence, and position-specific scoring matrix (PSSM). Currently, prediction solely based on the PSSM has played a key role in improving the prediction accuracy. In this paper, we propose a novel method called CSP-SegPseP-SegACP by fusing consensus sequence (CS), segmented PsePSSM, and segmented autocovariance transformation (ACT) based on PSSM. Three widely used low-similarity datasets (1189, 25PDB, and 640) are adopted in this paper. Then a 700-dimensional (700D) feature vector is constructed and the dimension is decreased to 224D by using principal component analysis (PCA). To verify the performance of our method, rigorous jackknife cross-validation tests are performed on 1189, 25PDB, and 640 datasets. Comparison of our results with the existing PSSM-based methods demonstrates that our method achieves the favorable and competitive performance. This will offer an important complementary to other PSSM-based methods for prediction of protein structural classes for low-similarity sequences.
A survey and evaluations of histogram-based statistics in alignment-free sequence comparison.
Luczak, Brian B; James, Benjamin T; Girgis, Hani Z
2017-12-06
Since the dawn of the bioinformatics field, sequence alignment scores have been the main method for comparing sequences. However, alignment algorithms are quadratic, requiring long execution time. As alternatives, scientists have developed tens of alignment-free statistics for measuring the similarity between two sequences. We surveyed tens of alignment-free k-mer statistics. Additionally, we evaluated 33 statistics and multiplicative combinations between the statistics and/or their squares. These statistics are calculated on two k-mer histograms representing two sequences. Our evaluations using global alignment scores revealed that the majority of the statistics are sensitive and capable of finding similar sequences to a query sequence. Therefore, any of these statistics can filter out dissimilar sequences quickly. Further, we observed that multiplicative combinations of the statistics are highly correlated with the identity score. Furthermore, combinations involving sequence length difference or Earth Mover's distance, which takes the length difference into account, are always among the highest correlated paired statistics with identity scores. Similarly, paired statistics including length difference or Earth Mover's distance are among the best performers in finding the K-closest sequences. Interestingly, similar performance can be obtained using histograms of shorter words, resulting in reducing the memory requirement and increasing the speed remarkably. Moreover, we found that simple single statistics are sufficient for processing next-generation sequencing reads and for applications relying on local alignment. Finally, we measured the time requirement of each statistic. The survey and the evaluations will help scientists with identifying efficient alternatives to the costly alignment algorithm, saving thousands of computational hours. The source code of the benchmarking tool is available as Supplementary Materials. © The Author 2017. Published by Oxford University Press.
Evaluation of the reproducibility of amplicon sequencing with Illumina MiSeq platform
Van Nostrand, Joy D.; Ning, Daliang; Sun, Bo; Xue, Kai; Liu, Feifei; Deng, Ye; Liang, Yuting; Zhou, Jizhong
2017-01-01
Illumina’s MiSeq has become the dominant platform for gene amplicon sequencing in microbial ecology studies; however, various technical concerns, such as reproducibility, still exist. To assess reproducibility, 16S rRNA gene amplicons from 18 soil samples of a reciprocal transplantation experiment were sequenced on an Illumina MiSeq. The V4 region of 16S rRNA gene from each sample was sequenced in triplicate with each replicate having a unique barcode. The average OTU overlap, without considering sequence abundance, at a rarefaction level of 10,323 sequences was 33.4±2.1% and 20.2±1.7% between two and among three technical replicates, respectively. When OTU sequence abundance was considered, the average sequence abundance weighted OTU overlap was 85.6±1.6% and 81.2±2.1% for two and three replicates, respectively. Removing singletons significantly increased the overlap for both (~1–3%, p<0.001). Increasing the sequencing depth to 160,000 reads by deep sequencing increased OTU overlap both when sequence abundance was considered (95%) and when not (44%). However, if singletons were not removed the overlap between two technical replicates (not considering sequence abundance) plateaus at 39% with 30,000 sequences. Diversity measures were not affected by the low overlap as α-diversities were similar among technical replicates while β-diversities (Bray-Curtis) were much smaller among technical replicates than among treatment replicates (e.g., 0.269 vs. 0.374). Higher diversity coverage, but lower OTU overlap, was observed when replicates were sequenced in separate runs. Detrended correspondence analysis indicated that while there was considerable variation among technical replicates, the reproducibility was sufficient for detecting treatment effects for the samples examined. These results suggest that although there is variation among technical replicates, amplicon sequencing on MiSeq is useful for analyzing microbial community structure if used appropriately and with caution. For example, including technical replicates, removing spurious sequences and unrepresentative OTUs, using a clustering method with a high stringency for OTU generation, estimating treatment effects at higher taxonomic levels, and adapting the unique molecular identifier (UMI) and other newly developed methods to lower PCR and sequencing error and to identify true low abundance rare species all can increase reproducibility. PMID:28453559
Evaluation of the reproducibility of amplicon sequencing with Illumina MiSeq platform
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wen, Chongqing; Wu, Liyou; Qin, Yujia
Illumina's MiSeq has become the dominant platform for gene amplicon sequencing in microbial ecology studies; however, various technical concerns, such as reproducibility, still exist. To assess reproducibility, 16S rRNA gene amplicons from 18 soil samples of a reciprocal transplantation experiment were sequenced on an Illumina MiSeq. The V4 region of 16S rRNA gene from each sample was sequenced in triplicate with each replicate having a unique barcode. The average OTU overlap, without considering sequence abundance, at a rarefaction level of 10,323 sequences was 33.4±2.1% and 20.2±1.7% between two and among three technical replicates, respectively. When OTU sequence abundance was considered,more » the average sequence abundance weighted OTU overlap was 85.6±1.6% and 81.2±2.1% for two and three replicates, respectively. Removing singletons significantly increased the overlap for both (~1-3%, p<0.001). Increasing the sequencing depth to 160,000 reads by deep sequencing increased OTU overlap both when sequence abundance was considered (95%) and when not (44%). However, if singletons were not removed the overlap between two technical replicates (not considering sequence abundance) plateaus at 39% with 30,000 sequences. Diversity measures were not affected by the low overlap as α-diversities were similar among technical replicates while β-diversities (Bray-Curtis) were much smaller among technical replicates than among treatment replicates (e.g., 0.269 vs. 0.374). Higher diversity coverage, but lower OTU overlap, was observed when replicates were sequenced in separate runs. Detrended correspondence analysis indicated that while there was considerable variation among technical replicates, the reproducibility was sufficient for detecting treatment effects for the samples examined. These results suggest that although there is variation among technical replicates, amplicon sequencing on MiSeq is useful for analyzing microbial community structure if used appropriately and with caution. For example, including technical replicates, removing spurious sequences and unrepresentative OTUs, using a clustering method with a high stringency for OTU generation, estimating treatment effects at higher taxonomic levels, and adapting the unique molecular identifier (UMI) and other newly developed methods to lower PCR and sequencing error and to identify true low abundance rare species all can increase reproducibility.« less
Evaluation of the reproducibility of amplicon sequencing with Illumina MiSeq platform
Wen, Chongqing; Wu, Liyou; Qin, Yujia; ...
2017-04-28
Illumina's MiSeq has become the dominant platform for gene amplicon sequencing in microbial ecology studies; however, various technical concerns, such as reproducibility, still exist. To assess reproducibility, 16S rRNA gene amplicons from 18 soil samples of a reciprocal transplantation experiment were sequenced on an Illumina MiSeq. The V4 region of 16S rRNA gene from each sample was sequenced in triplicate with each replicate having a unique barcode. The average OTU overlap, without considering sequence abundance, at a rarefaction level of 10,323 sequences was 33.4±2.1% and 20.2±1.7% between two and among three technical replicates, respectively. When OTU sequence abundance was considered,more » the average sequence abundance weighted OTU overlap was 85.6±1.6% and 81.2±2.1% for two and three replicates, respectively. Removing singletons significantly increased the overlap for both (~1-3%, p<0.001). Increasing the sequencing depth to 160,000 reads by deep sequencing increased OTU overlap both when sequence abundance was considered (95%) and when not (44%). However, if singletons were not removed the overlap between two technical replicates (not considering sequence abundance) plateaus at 39% with 30,000 sequences. Diversity measures were not affected by the low overlap as α-diversities were similar among technical replicates while β-diversities (Bray-Curtis) were much smaller among technical replicates than among treatment replicates (e.g., 0.269 vs. 0.374). Higher diversity coverage, but lower OTU overlap, was observed when replicates were sequenced in separate runs. Detrended correspondence analysis indicated that while there was considerable variation among technical replicates, the reproducibility was sufficient for detecting treatment effects for the samples examined. These results suggest that although there is variation among technical replicates, amplicon sequencing on MiSeq is useful for analyzing microbial community structure if used appropriately and with caution. For example, including technical replicates, removing spurious sequences and unrepresentative OTUs, using a clustering method with a high stringency for OTU generation, estimating treatment effects at higher taxonomic levels, and adapting the unique molecular identifier (UMI) and other newly developed methods to lower PCR and sequencing error and to identify true low abundance rare species all can increase reproducibility.« less
Evaluation of the reproducibility of amplicon sequencing with Illumina MiSeq platform.
Wen, Chongqing; Wu, Liyou; Qin, Yujia; Van Nostrand, Joy D; Ning, Daliang; Sun, Bo; Xue, Kai; Liu, Feifei; Deng, Ye; Liang, Yuting; Zhou, Jizhong
2017-01-01
Illumina's MiSeq has become the dominant platform for gene amplicon sequencing in microbial ecology studies; however, various technical concerns, such as reproducibility, still exist. To assess reproducibility, 16S rRNA gene amplicons from 18 soil samples of a reciprocal transplantation experiment were sequenced on an Illumina MiSeq. The V4 region of 16S rRNA gene from each sample was sequenced in triplicate with each replicate having a unique barcode. The average OTU overlap, without considering sequence abundance, at a rarefaction level of 10,323 sequences was 33.4±2.1% and 20.2±1.7% between two and among three technical replicates, respectively. When OTU sequence abundance was considered, the average sequence abundance weighted OTU overlap was 85.6±1.6% and 81.2±2.1% for two and three replicates, respectively. Removing singletons significantly increased the overlap for both (~1-3%, p<0.001). Increasing the sequencing depth to 160,000 reads by deep sequencing increased OTU overlap both when sequence abundance was considered (95%) and when not (44%). However, if singletons were not removed the overlap between two technical replicates (not considering sequence abundance) plateaus at 39% with 30,000 sequences. Diversity measures were not affected by the low overlap as α-diversities were similar among technical replicates while β-diversities (Bray-Curtis) were much smaller among technical replicates than among treatment replicates (e.g., 0.269 vs. 0.374). Higher diversity coverage, but lower OTU overlap, was observed when replicates were sequenced in separate runs. Detrended correspondence analysis indicated that while there was considerable variation among technical replicates, the reproducibility was sufficient for detecting treatment effects for the samples examined. These results suggest that although there is variation among technical replicates, amplicon sequencing on MiSeq is useful for analyzing microbial community structure if used appropriately and with caution. For example, including technical replicates, removing spurious sequences and unrepresentative OTUs, using a clustering method with a high stringency for OTU generation, estimating treatment effects at higher taxonomic levels, and adapting the unique molecular identifier (UMI) and other newly developed methods to lower PCR and sequencing error and to identify true low abundance rare species all can increase reproducibility.
Lares-Jiménez, Luis Fernando; Booton, Gregory C; Lares-Villa, Fernando; Velázquez-Contreras, Carlos Arturo; Fuerst, Paul A
2014-11-01
Since the first report of Balamuthia mandrillaris as a causative agent of granulomatous amoebic encephalitis in humans, the environmental niche of this amoeba was assumed to be restricted to soil and dust. A single isolation from water was recently made independently by us from Northern Mexico. Now we report the isolation of 8 new strains of B. mandrillaris from Mexico. This continues the pattern of an excess of isolates from North America, compared to other parts of the world. All of the new isolates are environmental isolates, 7 from water samples and one from soil. The identity of each isolate was confirmed by PCR and by examining the sequences of the mitochondrial 16S-like rRNA gene. Success in amplification was determined using comparisons of amplifications of DNA from the strain CDC: V039 and the water strain (ITSON-BM1) as positive controls. The DNA sequences of the new isolates were compared to older strains from clinical cases using phylogenetic analysis, showing very high sequence similarity. The similarity among the new isolates and with previous clinical and environmental isolates of B. mandrillaris was also examined using biochemical and immunological studies. High homogeneity of total protein products, and similarity in antigenic moiety among the eight new isolates and two controls was found. Taken together, the molecular and biochemical studies indicate very low levels of genetic variation within B. mandrillaris. Copyright © 2014 Elsevier Inc. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Sharrock, R.A.; Quail, P.H.
1989-01-01
Phytochrome is a plant regulatory photoreceptor that mediates red light effects on a wide variety of physiological and molecular responses. DNA blot analysis indicates that the Arabidopsis thaliana genome contains four to five phytochrome-related gene sequences. The authors have isolated and sequenced cDNA clones corresponding to three of these genes and have deduced the amino acid sequence of the full-length polypeptide encoded in each case. One of these proteins (phyA) shows 65-80% amino acid sequence identity with the major, etiolated-tissue phytochrome apoproteins described previously in other plant species. The other two polypeptides (phyB and phyC) are unique in that theymore » have low sequence identity with each other, with phyA, and with all previously described phytochromes. The phyA, phyB, and phyC proteins are of similar molecular mass, have related hydropathic profiles, and contain a conserved chromophore attachment region. However, the sequence comparison data indicate that the three phy genes diverged early in plant evolution, well before the divergence of the two major groups of angiosperms, the monocots and dicots. The steady-state level of the phyA transcript is high in dark-grown A. thaliana seedlings and is down-regulated by light. In contrast, the phyB and phyC transcripts are present at lower levels and are not strongly light-regulated. These findings indicate that the red/far red light-responsive phytochrome photoreceptor system in A. thaliana, and perhaps in all higher plants, consists of a family of chromoproteins that are heterogeneous in structure and regulation.« less
Boutte, Julien; Aliaga, Benoît; Lima, Oscar; Ferreira de Carvalho, Julie; Ainouche, Abdelkader; Macas, Jiri; Rousseau-Gueutin, Mathieu; Coriton, Olivier; Ainouche, Malika; Salmon, Armel
2015-01-01
Gene and whole-genome duplications are widespread in plant nuclear genomes, resulting in sequence heterogeneity. Identification of duplicated genes may be particularly challenging in highly redundant genomes, especially when there are no diploid parents as a reference. Here, we developed a pipeline to detect the different copies in the ribosomal RNA gene family in the hexaploid grass Spartina maritima from next-generation sequencing (Roche-454) reads. The heterogeneity of the different domains of the highly repeated 45S unit was explored by identifying single nucleotide polymorphisms (SNPs) and assembling reads based on shared polymorphisms. SNPs were validated using comparisons with Illumina sequence data sets and by cloning and Sanger (re)sequencing. Using this approach, 29 validated polymorphisms and 11 validated haplotypes were reported (out of 34 and 20, respectively, that were initially predicted by our program). The rDNA domains of S. maritima have similar lengths as those found in other Poaceae, apart from the 5′-ETS, which is approximately two-times longer in S. maritima. Sequence homogeneity was encountered in coding regions and both internal transcribed spacers (ITS), whereas high intragenomic variability was detected in the intergenic spacer (IGS) and the external transcribed spacer (ETS). Molecular cytogenetic analysis by fluorescent in situ hybridization (FISH) revealed the presence of one pair of 45S rDNA signals on the chromosomes of S. maritima instead of three expected pairs for a hexaploid genome, indicating loss of duplicated homeologous loci through the diploidization process. The procedure developed here may be used at any ploidy level and using different sequencing technologies. PMID:26530424
Pattern similarity study of functional sites in protein sequences: lysozymes and cystatins
Nakai, Shuryo; Li-Chan, Eunice CY; Dou, Jinglie
2005-01-01
Background Although it is generally agreed that topography is more conserved than sequences, proteins sharing the same fold can have different functions, while there are protein families with low sequence similarity. An alternative method for profile analysis of characteristic conserved positions of the motifs within the 3D structures may be needed for functional annotation of protein sequences. Using the approach of quantitative structure-activity relationships (QSAR), we have proposed a new algorithm for postulating functional mechanisms on the basis of pattern similarity and average of property values of side-chains in segments within sequences. This approach was used to search for functional sites of proteins belonging to the lysozyme and cystatin families. Results Hydrophobicity and β-turn propensity of reference segments with 3–7 residues were used for the homology similarity search (HSS) for active sites. Hydrogen bonding was used as the side-chain property for searching the binding sites of lysozymes. The profiles of similarity constants and average values of these parameters as functions of their positions in the sequences could identify both active and substrate binding sites of the lysozyme of Streptomyces coelicolor, which has been reported as a new fold enzyme (Cellosyl). The same approach was successfully applied to cystatins, especially for postulating the mechanisms of amyloidosis of human cystatin C as well as human lysozyme. Conclusion Pattern similarity and average index values of structure-related properties of side chains in short segments of three residues or longer were, for the first time, successfully applied for predicting functional sites in sequences. This new approach may be applicable to studying functional sites in un-annotated proteins, for which complete 3D structures are not yet available. PMID:15904486
Query-seeded iterative sequence similarity searching improves selectivity 5–20-fold
Li, Weizhong; Lopez, Rodrigo
2017-01-01
Abstract Iterative similarity search programs, like psiblast, jackhmmer, and psisearch, are much more sensitive than pairwise similarity search methods like blast and ssearch because they build a position specific scoring model (a PSSM or HMM) that captures the pattern of sequence conservation characteristic to a protein family. But models are subject to contamination; once an unrelated sequence has been added to the model, homologs of the unrelated sequence will also produce high scores, and the model can diverge from the original protein family. Examination of alignment errors during psiblast PSSM contamination suggested a simple strategy for dramatically reducing PSSM contamination. psiblast PSSMs are built from the query-based multiple sequence alignment (MSA) implied by the pairwise alignments between the query model (PSSM, HMM) and the subject sequences in the library. When the original query sequence residues are inserted into gapped positions in the aligned subject sequence, the resulting PSSM rarely produces alignment over-extensions or alignments to unrelated sequences. This simple step, which tends to anchor the PSSM to the original query sequence and slightly increase target percent identity, can reduce the frequency of false-positive alignments more than 20-fold compared with psiblast and jackhmmer, with little loss in search sensitivity. PMID:27923999
Azab, Marwa Mohamed; Fayyad, Dalia Mukhtar
2018-01-01
The use of high throughput next generation technologies has allowed more comprehensive analysis than traditional Sanger sequencing. The specific aim of this study was to investigate the microbial diversity of primary endodontic infections using Illumina MiSeq sequencing platform in Egyptian patients. Samples were collected from 19 patients in Suez Canal University Hospital (Endodontic Department) using sterile # 15K file and paper points. DNA was extracted using Mo Bio power soil DNA isolation extraction kit followed by PCR amplification and agarose gel electrophoresis. The microbiome was characterized on the basis of the V3 and V4 hypervariable region of the 16S rRNA gene by using paired-end sequencing on Illumina MiSeq device. MOTHUR software was used in sequence filtration and analysis of sequenced data. A total of 1858 operational taxonomic units at 97% similarity were assigned to 26 phyla, 245 families, and 705 genera. Four main phyla Firmicutes, Bacteroidetes, Proteobacteria, and Synergistetes were predominant in all samples. At genus level, Prevotella, Bacillus, Porphyromonas, Streptococcus, and Bacteroides were the most abundant. Illumina MiSeq platform sequencing can be used to investigate oral microbiome composition of endodontic infections. Elucidating the ecology of endodontic infections is a necessary step in developing effective intracanal antimicrobials. PMID:29849646
Hong, Soon Gyu; Cramer, Robert A; Lawrence, Christopher B; Pryor, Barry M
2005-02-01
A gene for the Alternaria major allergen, Alt a 1, was amplified from 52 species of Alternaria and related genera, and sequence information was used for phylogenetic study. Alt a 1 gene sequences evolved 3.8 times faster and contained 3.5 times more parsimony-informative sites than glyceraldehyde-3-phosphate dehydrogenase (gpd) sequences. Analyses of Alt a 1 gene and gpd exon sequences strongly supported grouping of Alternaria spp. and related taxa into several species-groups described in previous studies, especially the infectoria, alternata, porri, brassicicola, and radicina species-groups and the Embellisia group. The sonchi species-group was newly suggested in this study. Monophyly of the Nimbya group was moderately supported, and monophyly of the Ulocladium group was weakly supported. Relationships among species-groups and among closely related species of the same species-group were not fully resolved. However, higher resolution could be obtained using Alt a 1 sequences or a combined dataset than using gpd sequences alone. Despite high levels of variation in amino acid sequences, results of in silico prediction of protein secondary structure for Alt a 1 demonstrated a high degree of structural similarity for most of the species suggesting a conservation of function.
Chiba, Satoshi
1999-04-01
An endemic land snail genus Mandarina of the oceanic Bonin (Ogasawara) Islands shows exceptionally rapid evolution not only of morphological and ecological traits, but of DNA sequence. A phylogenetic relationship based on mitochondrial DNA (mtDNA) sequences suggests that morphological differences equivalent to the differences between families were produced between Mandarina and its ancestor during the Pleistocene. The inferred phylogeny shows that species with similar morphologies and life habitats appeared repeatedly and independently in different lineages and islands at different times. Sequential adaptive radiations occurred in different islands of the Bonin Islands and species occupying arboreal, semiarboreal, and terrestrial habitat arose independently in each island. Because of a close relationship between shell morphology and life habitat, independent evolution of the same life habitat in different islands created species possesing the same shell morphology in different islands and lineages. This rapid evolution produced some incongruences between phylogenetic relationship and species taxonomy. Levels of sequence divergence of mtDNA among the species of Mandarina is extremely high. The maximum level of sequence divergence at 16S and 12S ribosomal RNA sequence within Mandarina are 18.7% and 17.7%, respectively, and this suggests that evolution of mtDNA of Mandarina is extremely rapid, more than 20 times faster than the standard rate in other animals. The present examination reveals that evolution of morphological and ecological traits occurs at extremely high rates in the time of adaptive radiation, especially in fragmented environments. © 1999 The Society for the Study of Evolution.
Two rapidly evolving genes contribute to male fitness in Drosophila
Reinhardt, Josephine A; Jones, Corbin D
2013-01-01
Purifying selection often results in conservation of gene sequence and function. The most functionally conserved genes are also thought to be among the most biologically essential. These observations have led to the use of sequence conservation as a proxy for functional conservation. Here we describe two genes that are exceptions to this pattern. We show that lack of sequence conservation among orthologs of CG15460 and CG15323 – herein named jean-baptiste (jb) and karr respectively – does not necessarily predict lack of functional conservation. These two Drosophila melanogaster genes are among the most rapidly evolving protein-coding genes in this species, being nearly as diverged from their D. yakuba orthologs as random sequences are. jb and karr are both expressed at an elevated level in larval males and adult testes, but they are not accessory gland proteins and their loss does not affect male fertility. Instead, knockdown of these genes in D. melanogaster via RNA interference caused male-biased viability defects. These viability effects occur prior to the third instar for jb and during late pupation for karr. We show that putative orthologs to jb and karr are also expressed strongly in the testes of other Drosophila species and have similar gene structure across species despite low levels of sequence conservation. While standard molecular evolution tests could not reject neutrality, other data hint at a role for natural selection. Together these data provide a clear case where a lack of sequence conservation does not imply a lack of conservation of expression or function. PMID:24221639
Pittet, Vanessa; Phister, Trevor G.; Ziola, Barry
2013-01-01
Growth of specific lactic acid bacteria in beer leads to spoiled product and economic loss for the brewing industry. Microbial growth is typically inhibited by the combined stresses found in beer (e.g., ethanol, hops, low pH, minimal nutrients); however, certain bacteria have adapted to grow in this harsh environment. Considering little is known about the mechanisms used by bacteria to grow in and spoil beer, transcriptome sequencing was performed on a variant of the beer-spoilage organism Pediococcus claussenii ATCC BAA-344T (Pc344-358). Illumina sequencing was used to compare the transcript levels in Pc344-358 growing mid-exponentially in beer to those in nutrient-rich MRS broth. Various operons demonstrated high gene expression in beer, several of which are involved in nutrient acquisition and overcoming the inhibitory effects of hop compounds. As well, genes functioning in cell membrane modification and biosynthesis demonstrated significantly higher transcript levels in Pc344-358 growing in beer. Three plasmids had the majority of their genes showing increased transcript levels in beer, whereas the two cryptic plasmids showed slightly decreased gene expression. Follow-up analysis of plasmid copy number in both growth environments revealed similar trends, where more copies of the three non-cryptic plasmids were found in Pc344-358 growing in beer. Transcriptome sequencing also enabled the addition of several genes to the P . claussenii ATCC BAA-344T genome annotation, some of which are putatively transcribed as non-coding RNAs. The sequencing results not only provide the first transcriptome description of a beer-spoilage organism while growing in beer, but they also highlight several targets for future exploration, including genes that may have a role in the general stress response of lactic acid bacteria. PMID:24040005
Jiang, Yi-Fan; Chou, Chung-Hsi; Lin, En-Chung; Chiu, Chih-Hsien
2011-02-01
Hypoxia-inducible factor 1 (HIF-1) is a transcription factor that senses and adapts cells to hypoxic environmental conditions. HIF-1 is composed of an oxygen-regulated α subunit (HIF-1α) and a constitutively expressed β subunit (HIF-1β). Taiwan voles (Microtus kikuchii) are an endemic species in Taiwan, found only in mountainous areas greater than 2000m above sea level. In this study, the full-length HIF-1α cDNA was cloned and sequenced from liver tissues of Taiwan voles. We found that HIF-1α of Taiwan voles had high sequence similarity to HIF-1α of other species. Sequence alignment of HIF-1α functional domains indicated basic helix-loop-helix (bHLH), PER-ARNT-SIM (PAS) and C-terminal transactivation (TAD-C) domains were conserved among species, but sequence variations were found between the oxygen-dependent degradation domains (ODDD). To measure Taiwan vole HIF-1α responses to hypoxia, animals were challenged with cobalt chloride, and HIF-1α mRNA and protein expression in brain, lung, heart, liver, kidney, and muscle was assessed by quantitative RT-PCR and Western blot analysis. Upon induction of hypoxic stress with cobalt chloride, an increase in HIF-1α mRNA levels was detected in lung, heart, kidney, and muscle tissue. In contrast, protein expression levels showed greater variation between individual animals. These results suggest that the regulation of HIF-1α may be important to the Taiwan vole under cobalt chloride treatments. But more details regarding the evolutionary effect of environmental pressure on HIF-1α primary sequence, HIF-1α function and regulation in Taiwan voles remain to be identified. Copyright © 2010 Elsevier Inc. All rights reserved.
Pervaiz, Tariq; Sun, Xin; Zhang, Yanyi; Tao, Ran; Zhang, Junhuan; Fang, Jinggui
2015-01-16
The nuclear DNA is conventionally used to assess the diversity and relatedness among different species, but variations at the DNA genome level has also been used to study the relationship among different organisms. In most species, mitochondrial and chloroplast genomes are inherited maternally; therefore it is anticipated that organelle DNA remains completely associated. Many research studies were conducted simultaneously on organelle genome. The objectives of this study was to analyze the genetic relationship between chloroplast and mitochondrial DNA in three Chinese Prunus genotypes viz., Prunus persica, Prunus domestica, and Prunus avium. We investigated the genetic diversity of Prunus genotypes using simple sequence repeat (SSR) markers relevant to the chloroplast and mitochondria. Most of the genotypes were genetically similar as revealed by phylogenetic analysis. The Y2 Wu Xing (Cherry) and L2 Hong Xin Li (Plum) genotypes have a high similarity index (0.89), followed by Zi Ye Li (0.85), whereas; L1 Tai Yang Li (plum) has the lowest genetic similarity (0.35). In case of cpSSR, Hong Tao (Peach) and L1 Tai Yang Li (Plum) genotypes demonstrated similarity index of 0.85 and Huang Tao has the lowest similarity index of 0.50. The mtSSR nucleotide sequence analysis revealed that each genotype has similar amplicon length (509 bp) except M5Y1 i.e., 505 bp with CCB256 primer; while in case of NAD6 primer, all genotypes showed different sizes. The MEHO (Peach), MEY1 (Cherry), MEL2 (Plum) and MEL1 (Plum) have 586 bps; while MEY2 (Cherry), MEZI (Plum) and MEHU (Peach) have 585, 584 and 566 bp, respectively. The CCB256 primer showed highly conserved sequences and minute single polymorphic nucleotides with no deletion or mutation. The cpSSR (ARCP511) microsatellites showed the harmonious amplicon length. The CZI (Plum), CHO (Peach) and CL1 (Plum) showed 182 bp; whileCHU (Peach), CY2 (Cherry), CL2 (Plum) and CY1 (Cherry) showed 181 bp amplicon lengths. These results demonstrated high conservation in chloroplast and mitochondrial genome among Prunus species during the evolutionary process. These findings are valuable to study the organelle DNA diversity in different species and genotypes of Prunus to provide in depth insight in to the mitochondrial and chloroplast genomes.
Olamendi-Portugal, Timoteo; Restano-Cassulini, Rita; Riaño-Umbarila, Lidia; Becerril, Baltazar; Possani, Lourival D
2017-01-01
A previously undescribed toxic peptide named Cl13 was purified from the venom of the Mexican scorpion Centruroides limpidus. It contains 66 amino acid residues, including four disulfide bonds. The physiological effects assayed in 7 different subtypes of voltage gated Na + -channels, showed that it belongs to the β-scorpion toxin type. The most notorious effects were observed in subtypes Nav1.4, Nav1.5 and Nav1.6. Although having important sequence similarities with two other lethal toxins from this scorpion species (Cll1m and Cll2), the recently developed single chain antibody fragments (scFv) of human origin were not capable of protecting against Cl13. At the amino acid sequence level, in 3 stretches of peptide Cl13 (positions 7-9, 30-38 and 62-66) some differences with respect to other similar toxins are observed. Some of these differences coincide with contact points with the human antibody fragments. Copyright © 2016 Elsevier Inc. All rights reserved.
mrtailor: a tool for PDB-file preparation for the generation of external restraints.
Gruene, Tim
2013-09-01
Model building starting from, for example, a molecular-replacement solution with low sequence similarity introduces model bias, which can be difficult to detect, especially at low resolution. The program mrtailor removes low-similarity regions from a template PDB file according to sequence similarity between the target sequence and the template sequence and maps the target sequence onto the PDB file. The modified PDB file can be used to generate external restraints for low-resolution refinement with reduced model bias and can be used as a starting point for model building and refinement. The program can call ProSMART [Nicholls et al. (2012), Acta Cryst. D68, 404-417] directly in order to create external restraints suitable for REFMAC5 [Murshudov et al. (2011), Acta Cryst. D67, 355-367]. Both a command-line version and a GUI exist.
The nucleotide sequence of 5S rRNA from a cellular slime mold Dictyostelium discoideum.
Hori, H; Osawa, S; Iwabuchi, M
1980-01-01
The nucleotide sequence of ribosomal 5S rRNA from a cellular slime mold Dictyostelium discoideum is GUAUACGGCCAUACUAGGUUGGAAACACAUCAUCCCGUUCGAUCUGAUA AGUAAAUCGACCUCAGGCCUUCCAAGUACUCUGGUUGGAGACAACAGGGGAACAUAGGGUGCUGUAUACU. A model for the secondary structure of this 5S rRNA is proposed. The sequence is more similar to those of animals (62% similarity on the average) rather than those of yeasts (56%). Images PMID:7465421
Primary Human Immunodeficiency Virus Type 1 (HIV-1) Infection during HIV-1 Gag Vaccination▿
Balamurugan, Arumugam; Lewis, Martha J.; Kitchen, Christina M. R.; Robertson, Michael N.; Shiver, John W.; Daar, Eric S.; Pitt, Jacqueline; Ali, Ayub; Ng, Hwee L.; Currier, Judith S.; Yang, Otto O.
2008-01-01
Vaccination for human immunodeficiency virus type 1 (HIV-1) remains an elusive goal. Whether an unsuccessful vaccine might not only fail to provoke detectable immune responses but also could actually interfere with subsequent natural immunity upon HIV-1 infection is unknown. We performed detailed assessment of an HIV-1 gag DNA vaccine recipient (subject 00015) who was previously uninfected but sustained HIV-1 infection before completing a vaccination trial and another contemporaneously acutely infected individual (subject 00016) with the same strain of HIV-1. Subject 00015 received the vaccine at weeks 0, 4, and 8 and was found to have been acutely HIV-1 infected around the time of the third vaccination. Subject 00016 was a previously HIV-1-seronegative sexual contact who had symptoms of acute HIV-1 infection approximately 2 weeks earlier than subject 00015 and demonstrated subsequent seroconversion. Both individuals reached an unusually low level of chronic viremia (<1,000 copies/ml) without treatment. Subject 00015 had no detectable HIV-1-specific cytotoxic T-lymphocyte (CTL) responses until a borderline response was noted at the time of the third vaccination. The magnitude and breadth of Gag-specific CTL responses in subject 00015 were similar to those of subject 00016 during early chronic infection. Viral sequences from gag, pol, and nef confirmed the common source of HIV-1 between these individuals. The diversity and divergence of sequences in subjects 00015 and 00016 were similar, indicating similar immune pressure on these proteins (including Gag). As a whole, the data suggested that while the gag DNA vaccine did not prime detectable early CTL responses in subject 00015, vaccination did not appreciably impair his ability to contain viremia at levels similar to those in subject 00016. PMID:18199650
Thalassospira lucentensis gen. nov., sp. nov., a new marine member of the alpha-Proteobacteria.
López-López, Arantxa; Pujalte, María J; Benlloch, Susana; Mata-Roig, Manuel; Rosselló-Mora, Ramón; Garay, Esperanza; Rodríguez-Valera, Francisco
2002-07-01
A novel bacterium from the Mediterranean Sea was isolated under oligotrophic conditions at in situ temperature after prolonged continuous culture. The isolates were initially characterized by partial 16S rRNA gene sequencing. Similarity searches of one of the isolates, QMT2T, indicated high sequence identity to the well-characterized Rhodospirillum rubrum, [Aquaspirillum] itersonii and [Oceanospirillum] pusillum micro-organisms, which are representatives of the alpha-subclass of the Proteobacteria. The highest level of similarity of the complete 165 rRNA gene with respect to these microorganisms was 89%. Features such as the low similarities of 165 rRNA of QMT2T with its phylogenetically close neighbours, the distinct G+C content, and the differences in phenotypic features, including pigmentation, fatty acid composition, salt tolerance, the lack of bacteriochlorophyll a, and the capacity to use carbohydrates as carbon sources, are indicative of the novel nature of the isolate QMT2T among the alpha-Proteobacteria. This report describes the classification of strain QMT2T (= DSM 14000T = CECT 5390T) as a new genus and species, Thalassospira lucentensis gen. nov, sp. nov., in the family Rhodospirillaceae.
Chopra, V S; Metzler, M; Rasper, D M; Engqvist-Goldstein, A E; Singaraja, R; Gan, L; Fichter, K M; McCutcheon, K; Drubin, D; Nicholson, D W; Hayden, M R
2000-11-01
Huntingtin-interacting protein I (HIP1) is a membrane-associated protein that interacts with huntingtin, the protein altered in Huntington disease. HIP1 shows homology to Sla2p, a protein essential for the assembly and function of the cytoskeleton and endocytosis in Saccharomyces cerevisiae. We have determined that the HIP1 gene comprises 32 exons spanning approximately 215 kb of genomic DNA and gives rise to two alternate splice forms termed HIP1-1 and HIP1-2. Additionally, we have identified a novel protein termed HIP12 with significant sequence and biochemical similarities to HIP1 and high sequence similarity to Sla2p. HIP12 differs from HIP1 in its pattern of expression both at the mRNA and protein level. However, HIP1 and HIP12 are both found within the brain and show a similar subcellular distribution pattern. In contrast to HIP1, which is toxic in cell culture, HIP12 does not confer toxicity in the same assay systems. Interestingly, HIP12 does not interact with huntingtin but can interact with HIP1. suggesting a potential interaction in vivo that may influence the function of each respective protein.
Gainza, Oreste; Ramírez, Carolina; Ramos, Alfredo Salinas; Romero, Jaime
2018-04-01
The goal of the study was to characterize the intestinal tract bacterial microbiota composition of Penaeus vannamei in intensive commercial ponds in Ecuador, comparing two shrimp-farming phases: nursery and harvest. Bacterial microbiota was examined by sequencing amplicons V2-V3 of the 16S rRNA using Ion Torrent technology. Archaea sequences were detected in both phases. Sequence analyses revealed quantitative and qualitative differences between the nursery phase and the harvest phase in shrimp intestinal microbiota composition. The main differences were observed at the phylum level during the nursery phase, and the prevailing phyla were CKC4 (37.3%), Proteobacteria (29.8%), Actinobacteria (11.6%), and Firmicutes (10.1%). In the harvest phase, the prevailing phyla were Proteobacteria (28.4%), Chloroflexi (19.9%), and Actinobacteria (15.1%). At the genus level, microbiota from the nursery phase showed greater relative abundances of CKC4 uncultured bacterium (37%) and Escherichia-Shigella (18%). On the contrary, in the microbiota of harvested shrimp, the prevailing genera were uncultured Caldilinea (19%) and Alphaproteobacteria with no other assigned rate (10%). The analysis of similarity ANOSIM test (beta diversity) indicated significant differences between the shrimp microbiota for these two farming phases. Similarly, alfa-diversity analysis (Chao1) indicated that the microbiota at harvest was far more diverse than the microbiota during the nursery phase, which showed a homogeneous composition. These results suggest that shrimp microbiota diversify their composition during intensive farming. The present work offers the most detailed description of the microbiota of P. vannamei under commercial production conditions to date.
NASA Technical Reports Server (NTRS)
Biermann, B.; Johnson, E. M.; Feldman, L. J.
1990-01-01
Maize (Zea mays) roots respond to a variety of environmental stimuli which are perceived by a specialized group of cells, the root cap. We are studying the transduction of extracellular signals by roots, particularly the role of protein kinases. Protein phosphorylation by kinases is an important step in many eukaryotic signal transduction pathways. As a first phase of this research we have isolated a cDNA encoding a maize protein similar to fungal and animal protein kinases known to be involved in the transduction of extracellular signals. The deduced sequence of this cDNA encodes a polypeptide containing amino acids corresponding to 33 out of 34 invariant or nearly invariant sequence features characteristic of protein kinase catalytic domains. The maize cDNA gene product is more closely related to the branch of serine/threonine protein kinase catalytic domains composed of the cyclic-nucleotide- and calcium-phospholipid-dependent subfamilies than to other protein kinases. Sequence identity is 35% or more between the deduced maize polypeptide and all members of this branch. The high structural similarity strongly suggests that catalytic activity of the encoded maize protein kinase may be regulated by second messengers, like that of all members of this branch whose regulation has been characterized. Northern hybridization with the maize cDNA clone shows a single 2400 base transcript at roughly similar levels in maize coleoptiles, root meristems, and the zone of root elongation, but the transcript is less abundant in mature leaves. In situ hybridization confirms the presence of the transcript in all regions of primary maize root tissue.
Angly, Florent E; Willner, Dana; Prieto-Davó, Alejandra; Edwards, Robert A; Schmieder, Robert; Vega-Thurber, Rebecca; Antonopoulos, Dionysios A; Barott, Katie; Cottrell, Matthew T; Desnues, Christelle; Dinsdale, Elizabeth A; Furlan, Mike; Haynes, Matthew; Henn, Matthew R; Hu, Yongfei; Kirchman, David L; McDole, Tracey; McPherson, John D; Meyer, Folker; Miller, R Michael; Mundt, Egbert; Naviaux, Robert K; Rodriguez-Mueller, Beltran; Stevens, Rick; Wegley, Linda; Zhang, Lixin; Zhu, Baoli; Rohwer, Forest
2009-12-01
Metagenomic studies characterize both the composition and diversity of uncultured viral and microbial communities. BLAST-based comparisons have typically been used for such analyses; however, sampling biases, high percentages of unknown sequences, and the use of arbitrary thresholds to find significant similarities can decrease the accuracy and validity of estimates. Here, we present Genome relative Abundance and Average Size (GAAS), a complete software package that provides improved estimates of community composition and average genome length for metagenomes in both textual and graphical formats. GAAS implements a novel methodology to control for sampling bias via length normalization, to adjust for multiple BLAST similarities by similarity weighting, and to select significant similarities using relative alignment lengths. In benchmark tests, the GAAS method was robust to both high percentages of unknown sequences and to variations in metagenomic sequence read lengths. Re-analysis of the Sargasso Sea virome using GAAS indicated that standard methodologies for metagenomic analysis may dramatically underestimate the abundance and importance of organisms with small genomes in environmental systems. Using GAAS, we conducted a meta-analysis of microbial and viral average genome lengths in over 150 metagenomes from four biomes to determine whether genome lengths vary consistently between and within biomes, and between microbial and viral communities from the same environment. Significant differences between biomes and within aquatic sub-biomes (oceans, hypersaline systems, freshwater, and microbialites) suggested that average genome length is a fundamental property of environments driven by factors at the sub-biome level. The behavior of paired viral and microbial metagenomes from the same environment indicated that microbial and viral average genome sizes are independent of each other, but indicative of community responses to stressors and environmental conditions.
Poudel, Pramod; Tashiro, Yukihiro; Miyamoto, Hirokuni; Miyamoto, Hisashi; Okugawa, Yuki; Sakai, Kenji
2017-01-01
Elucidation of functions of bacteria in a mixed culture system (MCS) such as composting, activated sludge system is difficult, since the system is complicating with many unisolated bacteria. Here, we developed a systematic feedback isolation strategy for the isolation and rapid screening of multiple targeted strains from MCS. Six major strains (Corynebacterium sphenisci, Bacillus thermocloacae, Bacillus thermoamylovorans, Bacillus smithii, Bacillus humi, and Bacillus coagulans), which are detected by denaturing gradient gel electrophoresis (DGGE) analysis in our previous study on MCS for l-lactic acid production, were targeted for isolation. Based on information of suitable cultivation conditions (e.g., media, pH, temperature) from the literature, feedback isolation was performed to form 136 colonies. The following direct colony matrix assisted laser desorption ionization-time of flight mass spectrometry (MALDI-TOF MS) was optimised as the second screening to narrow down 20 candidate colonies from similar spectra patterns with six closest type strains. This step could distinguish bacteria at the species level with distance similarity scores ≥0.55 corresponding to 16S rRNA gene sequence similarity ≥98.2%, suggesting that this is an effective technique to minimize isolates close to targeted type strains. Analysis of 16S rRNA gene sequences indicated that two targeted strains and one strain related to the target had successfully been isolated, showing high similarities (99.5-100%) with the sequences from the DGGE bands, and that the other candidates were affiliated with three strains that were closely related to the target species. This study proposes a new method for systematic feedback isolation that may be useful for isolating targeted strains from MCS for further investigation. Copyright © 2016 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.
Species classifier choice is a key consideration when analysing low-complexity food microbiome data.
Walsh, Aaron M; Crispie, Fiona; O'Sullivan, Orla; Finnegan, Laura; Claesson, Marcus J; Cotter, Paul D
2018-03-20
The use of shotgun metagenomics to analyse low-complexity microbial communities in foods has the potential to be of considerable fundamental and applied value. However, there is currently no consensus with respect to choice of species classification tool, platform, or sequencing depth. Here, we benchmarked the performances of three high-throughput short-read sequencing platforms, the Illumina MiSeq, NextSeq 500, and Ion Proton, for shotgun metagenomics of food microbiota. Briefly, we sequenced six kefir DNA samples and a mock community DNA sample, the latter constructed by evenly mixing genomic DNA from 13 food-related bacterial species. A variety of bioinformatic tools were used to analyse the data generated, and the effects of sequencing depth on these analyses were tested by randomly subsampling reads. Compositional analysis results were consistent between the platforms at divergent sequencing depths. However, we observed pronounced differences in the predictions from species classification tools. Indeed, PERMANOVA indicated that there was no significant differences between the compositional results generated by the different sequencers (p = 0.693, R 2 = 0.011), but there was a significant difference between the results predicted by the species classifiers (p = 0.01, R 2 = 0.127). The relative abundances predicted by the classifiers, apart from MetaPhlAn2, were apparently biased by reference genome sizes. Additionally, we observed varying false-positive rates among the classifiers. MetaPhlAn2 had the lowest false-positive rate, whereas SLIMM had the greatest false-positive rate. Strain-level analysis results were also similar across platforms. Each platform correctly identified the strains present in the mock community, but accuracy was improved slightly with greater sequencing depth. Notably, PanPhlAn detected the dominant strains in each kefir sample above 500,000 reads per sample. Again, the outputs from functional profiling analysis using SUPER-FOCUS were generally accordant between the platforms at different sequencing depths. Finally, and expectedly, metagenome assembly completeness was significantly lower on the MiSeq than either on the NextSeq (p = 0.03) or the Proton (p = 0.011), and it improved with increased sequencing depth. Our results demonstrate a remarkable similarity in the results generated by the three sequencing platforms at different sequencing depths, and, in fact, the choice of bioinformatics methodology had a more evident impact on results than the choice of sequencer did.
Wu, L-P; Yang, T; Liu, H-W; Postman, J; Li, R
2018-05-01
A large contig with sequence similarities to several nucleorhabdoviruses was identified by high-throughput sequencing analysis from a black currant (Ribes nigrum L.) cultivar. The complete genome sequence of this new nucleorhabdovirus is 14,432 nucleotides long. Its genomic organization is very similar to those of unsegmented plant rhabdoviruses, containing six open reading frames in the order 3'-N-P-P3-M-G-L-5. The virus, which is provisionally named "black currant-associated rhabdovirus", is 41-52% identical in its genome nucleotide sequence to other nucleorhabdoviruses and may represent a new species in the genus Nucleorhabdovirus.
Quéméneur, Marianne; Heinrich-Salmeron, Audrey; Muller, Daniel; Lièvremont, Didier; Jauzein, Michel; Bertin, Philippe N; Garrido, Francis; Joulian, Catherine
2008-07-01
A new primer set was designed to specifically amplify ca. 1,100 bp of aoxB genes encoding the As(III) oxidase catalytic subunit from taxonomically diverse aerobic As(III)-oxidizing bacteria. Comparative analysis of AoxB protein sequences showed variable conservation levels and highlighted the conservation of essential amino acids and structural motifs. AoxB phylogeny of pure strains showed well-discriminated taxonomic groups and was similar to 16S rRNA phylogeny. Alphaproteobacteria-, Betaproteobacteria-, and Gammaproteobacteria-related sequences were retrieved from environmental surveys, demonstrating their prevalence in mesophilic As-contaminated soils. Our study underlines the usefulness of the aoxB gene as a functional marker of aerobic As(III) oxidizers.
Lactobacillus rodentium sp. nov., from the digestive tract of wild rodents.
Killer, J; Havlík, J; Vlková, E; Rada, V; Pechar, R; Benada, O; Kopečný, J; Kofroňová, O; Sechovcová, H
2014-05-01
Three strains of regular, long, Gram-stain-positive bacterial rods were isolated using TPY, M.R.S. and Rogosa agar under anaerobic conditions from the digestive tract of wild mice (Mus musculus). All 16S rRNA gene sequences of these isolates were most similar to sequences of Lactobacillus gasseri ATCC 33323T and Lactobacillus johnsonii ATCC 33200T (97.3% and 97.2% sequence similarities, respectively). The novel strains shared 99.2-99.6% 16S rRNA gene sequence similarities. Type strains of L. gasseri and L. johnsonii were also most related to the newly isolated strains according to rpoA (83.9-84.0% similarities), pheS (84.6-87.8%), atpA (86.2-87.7%), hsp60 (89.4-90.4%) and tuf (92.7-93.6%) gene sequence similarities. Phylogenetic studies based on 16S rRNA, hsp60, rpoA, atpA and pheS gene sequences, other genotypic and many phenotypic characteristics (results of API 50 CHL, Rapid ID 32A and API ZYM biochemical tests; cellular fatty acid profiles; cellular polar lipid profiles; end products of glucose fermentation) showed that these bacterial strains represent a novel species within the genus Lactobacillus. The name Lactobacillus rodentium sp. nov. is proposed to accommodate this group of new isolates. The type strain is MYMRS/TLU1T (=DSM 24759T=CCM 7945T).
Classification of Plant Associated Bacteria Using RIF, a Computationally Derived DNA Marker
Schneider, Kevin L.; Marrero, Glorimar; Alvarez, Anne M.; Presting, Gernot G.
2011-01-01
A DNA marker that distinguishes plant associated bacteria at the species level and below was derived by comparing six sequenced genomes of Xanthomonas, a genus that contains many important phytopathogens. This DNA marker comprises a portion of the dnaA replication initiation factor (RIF). Unlike the rRNA genes, dnaA is a single copy gene in the vast majority of sequenced bacterial genomes, and amplification of RIF requires genus-specific primers. In silico analysis revealed that RIF has equal or greater ability to differentiate closely related species of Xanthomonas than the widely used ribosomal intergenic spacer region (ITS). Furthermore, in a set of 263 Xanthomonas, Ralstonia and Clavibacter strains, the RIF marker was directly sequenced in both directions with a success rate approximately 16% higher than that for ITS. RIF frameworks for Xanthomonas, Ralstonia and Clavibacter were constructed using 682 reference strains representing different species, subspecies, pathovars, races, hosts and geographic regions, and contain a total of 109 different RIF sequences. RIF sequences showed subspecific groupings but did not place strains of X. campestris or X. axonopodis into currently named pathovars nor R. solanacearum strains into their respective races, confirming previous conclusions that pathovar and race designations do not necessarily reflect genetic relationships. The RIF marker also was sequenced for 24 reference strains from three genera in the Enterobacteriaceae: Pectobacterium, Pantoea and Dickeya. RIF sequences of 70 previously uncharacterized strains of Ralstonia, Clavibacter, Pectobacterium and Dickeya matched, or were similar to, those of known reference strains, illustrating the utility of the frameworks to classify bacteria below the species level and rapidly match unknown isolates to reference strains. The RIF sequence frameworks are available at the online RIF database, RIFdb, and can be queried for diagnostic purposes with RIF sequences obtained from unknown strains in both chromatogram and FASTA format. PMID:21533033
Adhesive Proteins of Stalked and Acorn Barnacles Display Homology with Low Sequence Similarities
Jonker, Jaimie-Leigh; Abram, Florence; Pires, Elisabete; Varela Coelho, Ana; Grunwald, Ingo; Power, Anne Marie
2014-01-01
Barnacle adhesion underwater is an important phenomenon to understand for the prevention of biofouling and potential biotechnological innovations, yet so far, identifying what makes barnacle glue proteins ‘sticky’ has proved elusive. Examination of a broad range of species within the barnacles may be instructive to identify conserved adhesive domains. We add to extensive information from the acorn barnacles (order Sessilia) by providing the first protein analysis of a stalked barnacle adhesive, Lepas anatifera (order Lepadiformes). It was possible to separate the L. anatifera adhesive into at least 10 protein bands using SDS-PAGE. Intense bands were present at approximately 30, 70, 90 and 110 kilodaltons (kDa). Mass spectrometry for protein identification was followed by de novo sequencing which detected 52 peptides of 7–16 amino acids in length. None of the peptides matched published or unpublished transcriptome sequences, but some amino acid sequence similarity was apparent between L. anatifera and closely-related Dosima fascicularis. Antibodies against two acorn barnacle proteins (ab-cp-52k and ab-cp-68k) showed cross-reactivity in the adhesive glands of L. anatifera. We also analysed the similarity of adhesive proteins across several barnacle taxa, including Pollicipes pollicipes (a stalked barnacle in the order Scalpelliformes). Sequence alignment of published expressed sequence tags clearly indicated that P. pollicipes possesses homologues for the 19 kDa and 100 kDa proteins in acorn barnacles. Homology aside, sequence similarity in amino acid and gene sequences tended to decline as taxonomic distance increased, with minimum similarities of 18–26%, depending on the gene. The results indicate that some adhesive proteins (e.g. 100 kDa) are more conserved within barnacles than others (20 kDa). PMID:25295513
Adhesive proteins of stalked and acorn barnacles display homology with low sequence similarities.
Jonker, Jaimie-Leigh; Abram, Florence; Pires, Elisabete; Varela Coelho, Ana; Grunwald, Ingo; Power, Anne Marie
2014-01-01
Barnacle adhesion underwater is an important phenomenon to understand for the prevention of biofouling and potential biotechnological innovations, yet so far, identifying what makes barnacle glue proteins 'sticky' has proved elusive. Examination of a broad range of species within the barnacles may be instructive to identify conserved adhesive domains. We add to extensive information from the acorn barnacles (order Sessilia) by providing the first protein analysis of a stalked barnacle adhesive, Lepas anatifera (order Lepadiformes). It was possible to separate the L. anatifera adhesive into at least 10 protein bands using SDS-PAGE. Intense bands were present at approximately 30, 70, 90 and 110 kilodaltons (kDa). Mass spectrometry for protein identification was followed by de novo sequencing which detected 52 peptides of 7-16 amino acids in length. None of the peptides matched published or unpublished transcriptome sequences, but some amino acid sequence similarity was apparent between L. anatifera and closely-related Dosima fascicularis. Antibodies against two acorn barnacle proteins (ab-cp-52k and ab-cp-68k) showed cross-reactivity in the adhesive glands of L. anatifera. We also analysed the similarity of adhesive proteins across several barnacle taxa, including Pollicipes pollicipes (a stalked barnacle in the order Scalpelliformes). Sequence alignment of published expressed sequence tags clearly indicated that P. pollicipes possesses homologues for the 19 kDa and 100 kDa proteins in acorn barnacles. Homology aside, sequence similarity in amino acid and gene sequences tended to decline as taxonomic distance increased, with minimum similarities of 18-26%, depending on the gene. The results indicate that some adhesive proteins (e.g. 100 kDa) are more conserved within barnacles than others (20 kDa).
Naora, H; Nishida, T; Shindo, Y; Adachi, M; Naora, H
1998-04-01
Apoptosis is induced by the transcriptional inhibitor actinomycin D (Act D) in various cell types, particularly many leukemic cell lines such as HL-60. A common feature of these cell lines is their high constitutive expression level of the nbl gene, which was originally isolated by virtue of its abundance in a Namalwa Burkitt lymphoma cDNA library. In contrast, cell lines which constitutively express nbl at low levels appear not to undergo typical apoptotic death in response to Act D. Apoptotic induction by Act D in cells which normally express nbl at high levels was found in this study to be closely associated with a decline in nbl mRNA levels, raising the possibility that apoptosis could be induced by lowering nbl expression levels in such cells. Transient expression of nbl antisense sequences in HL-60 cells decreased cell viability, and induced typical apoptotic morphology such as cell shrinkage, chromatin condensation and nuclear fragmentation. Incubation with nbl antisense oligomers also induced similar features in HL-60 cells and in another high nb-expressing cell line, Jurkat, but had little effect in HepG2 cells which constitutively express nbl at low levels. These findings suggest that lowering constitutively high levels of nbl expression can induce apoptosis.
Effective Identification of Similar Patients Through Sequential Matching over ICD Code Embedding.
Nguyen, Dang; Luo, Wei; Venkatesh, Svetha; Phung, Dinh
2018-04-11
Evidence-based medicine often involves the identification of patients with similar conditions, which are often captured in ICD (International Classification of Diseases (World Health Organization 2013)) code sequences. With no satisfying prior solutions for matching ICD-10 code sequences, this paper presents a method which effectively captures the clinical similarity among routine patients who have multiple comorbidities and complex care needs. Our method leverages the recent progress in representation learning of individual ICD-10 codes, and it explicitly uses the sequential order of codes for matching. Empirical evaluation on a state-wide cancer data collection shows that our proposed method achieves significantly higher matching performance compared with state-of-the-art methods ignoring the sequential order. Our method better identifies similar patients in a number of clinical outcomes including readmission and mortality outlook. Although this paper focuses on ICD-10 diagnosis code sequences, our method can be adapted to work with other codified sequence data.
Sadsad, Rosemarie; Martinez, Elena; Jelfs, Peter; Hill-Cawthorne, Grant A.; Gilbert, Gwendolyn L.; Marais, Ben J.; Sintchenko, Vitali
2016-01-01
Background Improved tuberculosis control and the need to contain the spread of drug-resistant strains provide a strong rationale for exploring tuberculosis transmission dynamics at the population level. Whole-genome sequencing provides optimal strain resolution, facilitating detailed mapping of potential transmission pathways. Methods We sequenced 22 isolates from a Mycobacterium tuberculosis cluster in New South Wales, Australia, identified during routine 24-locus mycobacterial interspersed repetitive unit typing. Following high-depth paired-end sequencing using the Illumina HiSeq 2000 platform, two independent pipelines were employed for analysis, both employing read mapping onto reference genomes as well as de novo assembly, to control biases in variant detection. In addition to single-nucleotide polymorphisms, the analyses also sought to identify insertions, deletions and structural variants. Results Isolates were highly similar, with a distance of 13 variants between the most distant members of the cluster. The most sensitive analysis classified the 22 isolates into 18 groups. Four of the isolates did not appear to share a recent common ancestor with the largest clade; another four isolates had an uncertain ancestral relationship with the largest clade. Conclusion Whole genome sequencing, with analysis of single-nucleotide polymorphisms, insertions, deletions, structural variants and subpopulations, enabled the highest possible level of discrimination between cluster members, clarifying likely transmission pathways and exposing the complexity of strain origin. The analysis provides a basis for targeted public health intervention and enhanced classification of future isolates linked to the cluster. PMID:26938641
Santagati, Vito Davide; Sestili, Francesco; Lafiandra, Domenico; D'Ovidio, Renato; Rogniaux, Helene; Masci, Stefania
2016-07-01
Wheat high molecular weight glutenin subunit variation is important because of its great influence on glutenin polymer structure, that is related to dough technological properties. Among the different subunits, the pair Bx20 and By20 is known to have a negative effect on quality, but the reasons are not clear: Bx20 has two cysteines, which theoretically make this subunit a chain extender of the glutenin polymer, just like the other Bx subunits, showing four cysteines, two of which should be involved in intra-molecular disulfide bonds. By20 has never been characterized so far at molecular level. Here we report the nucleotide sequences of Bx20 and By20 genes isolated from the durum wheat cultivar 'Lira 45' and the validation of the corresponding deduced amino acid sequences by using MALDI-TOF and LC-MS/MS. Four nucleotide differences were identified in the Bx20 gene with respect to the deduced sequence present in NCBI, causing two amino acid substitutions. For the By20 subunit, nucleotide and amino acid sequences revealed a great similarity to By15, both at gene and protein levels, showing five nucleotide changes generating two amino acid differences. No evidence of post-translational modifications has been found. Hypotheses are formulated in regard to relationships with technological quality. Copyright © 2016 John Wiley & Sons, Ltd. Copyright © 2016 John Wiley & Sons, Ltd.
Shin, Dong-Ho; Webb, Barbara M; Nakao, Miki; Smith, Sylvia L
2009-07-01
Complement factor I is a crucial regulator of mammalian complement activity. Very little is known of complement regulators in non-mammalian species. We isolated and sequenced four highly similar complement factor I cDNAs from the liver of the nurse shark (Ginglymostoma cirratum), designated as GcIf-1, GcIf-2, GcIf-3 and GcIf-4 (previously referred to as nsFI-a, -b, -c and -d) which encode 689, 673, 673 and 657 amino acid residues, respectively. They share 95% (
Use of four next-generation sequencing platforms to determine HIV-1 coreceptor tropism.
Archer, John; Weber, Jan; Henry, Kenneth; Winner, Dane; Gibson, Richard; Lee, Lawrence; Paxinos, Ellen; Arts, Eric J; Robertson, David L; Mimms, Larry; Quiñones-Mateu, Miguel E
2012-01-01
HIV-1 coreceptor tropism assays are required to rule out the presence of CXCR4-tropic (non-R5) viruses prior treatment with CCR5 antagonists. Phenotypic (e.g., Trofile™, Monogram Biosciences) and genotypic (e.g., population sequencing linked to bioinformatic algorithms) assays are the most widely used. Although several next-generation sequencing (NGS) platforms are available, to date all published deep sequencing HIV-1 tropism studies have used the 454™ Life Sciences/Roche platform. In this study, HIV-1 co-receptor usage was predicted for twelve patients scheduled to start a maraviroc-based antiretroviral regimen. The V3 region of the HIV-1 env gene was sequenced using four NGS platforms: 454™, PacBio® RS (Pacific Biosciences), Illumina®, and Ion Torrent™ (Life Technologies). Cross-platform variation was evaluated, including number of reads, read length and error rates. HIV-1 tropism was inferred using Geno2Pheno, Web PSSM, and the 11/24/25 rule and compared with Trofile™ and virologic response to antiretroviral therapy. Error rates related to insertions/deletions (indels) and nucleotide substitutions introduced by the four NGS platforms were low compared to the actual HIV-1 sequence variation. Each platform detected all major virus variants within the HIV-1 population with similar frequencies. Identification of non-R5 viruses was comparable among the four platforms, with minor differences attributable to the algorithms used to infer HIV-1 tropism. All NGS platforms showed similar concordance with virologic response to the maraviroc-based regimen (75% to 80% range depending on the algorithm used), compared to Trofile (80%) and population sequencing (70%). In conclusion, all four NGS platforms were able to detect minority non-R5 variants at comparable levels suggesting that any NGS-based method can be used to predict HIV-1 coreceptor usage.
Shin, Dong-Ho; Webb, Barbara M.; Nakao, Miki; Smith, Sylvia L.
2009-01-01
Complement factor I is a crucial regulator of mammalian complement activity. Very little is known of complement regulators in non-mammalian species. We isolated and sequenced four highly similar complement factor I cDNAs from the liver of the nurse shark (Ginglymostoma cirratum), designated as GcIf-1, GcIf-2, GcIf-3 and GcIf-4 (previously referred to as nsFI-a, -b, -c and –d) which encode 689, 673, 673 and 657 amino acid residues, respectively. They share 95% (≤) amino acid identities with each other, 35.4 ~ 39.6% and 62.8 ~ 65.9% with factor I of mammals and banded houndshark (Triakis scyllium), respectively. The modular structure of the GcIf is similar to that of mammals with one notable exception, the presence of a novel shark-specific sequence between the leader peptide (LP) and the factor I membrane attack complex (FIMAC) domain. The cDNA sequences differ only in the size and composition of the shark-specific region (SSR). Sequence analysis of each SSR has identified within the region two novel short sequences (SS1 and SS2) and three repeat sequences (RS1, 2 and 3). Genomic analysis has revealed the existence of three introns between the leader peptide and the FIMAC domain, tentatively designated intron 1, intron 2, and intron 3 which span 4067, 2293 and 2082 bp, respectively. Southern blot analysis suggests the presence of a single gene copy for each cDNA type. Phylogenetic analysis suggests that complement factor I of cartilaginous fish diverged prior to the emergence of mammals. All four GcIf cDNA species are expressed in four different tissues and the liver is the main tissue in which expression level of all four is high. This suggests that the expression of GcIf isotypes is tissue-dependent. PMID:19423168
Characterization of cDNAs and genomic DNAs for human threonyl- and cysteinyl-tRNA synthetases
DOE Office of Scientific and Technical Information (OSTI.GOV)
Cruzen, M.E.
1993-01-01
Techniques of molecular biology were used to clone, sequence and map two human aminoacyl-tRNA synthetase (aaRS) cDNAs: threonyl-tRNA synthetase (ThrRS) a class II enzyme and cysteinyl-tRNA synthetase (CysRS) a class I enzyme. The predicted protein sequence of human ThrRS is highly homologous to that of lower eukaryotic and prokaryotic ThRSs, particularly in the regions containing the three structural motifs common to all class II synthetases. Signature regions 1 and 2, which characterize the class IIa subgroup (SerRS, ThrRS and HisRS) are highly conserved from bacteria to human. Structural predictions for human ThrRS based on the known structure of the closelymore » related SerRS from E.coli implicate strongly conserved residues in the signature sequences to be important in substrate binding. The amino terminal 100 residues of the deduced amino acid sequence of ThrRS shares structural similarity to SerRS consistent with forming an antiparallel helix implicated in tRNA binding. The 5' untranslated sequence of the human ThrRS gene shares short stretches of common sequence with the gene for hamster HisRS including a binding site for the promoter specific transcription factor sp-1. The deduced amino acid sequence of human CysRS has a high degree of sequence identify to E. coli CysRS. Human CysRS possesses the classic characteristics of a class I synthetase and is most closely related to the MetRS subgroup. The amino terminal half of human CysRS can be modeled as a nucleotide binding fold and shares significant sequence and structural similarity to the other enzymes in this subgroup. The CysRS structural gene (CARS) was mapped to human chromosome 11p15.5 by fluorescent in situ hybridization. CARS is the first aaRS gene to be mapped to chromosome 11. The steady state of both CysRS and ThrRs mRNA were quantitated in several human tissues. Message levels for these enzymes appear to be subjected to differential regulation in different cell types.« less
Constable, Fiona E.; Nancarrow, Narelle; Plummer, Kim M.; Rodoni, Brendan
2017-01-01
PCR amplicon next generation sequencing (NGS) analysis offers a broadly applicable and targeted approach to detect populations of both high- or low-frequency virus variants in one or more plant samples. In this study, amplicon NGS was used to explore the diversity of the tripartite genome virus, Prunus necrotic ringspot virus (PNRSV) from 53 PNRSV-infected trees using amplicons from conserved gene regions of each of PNRSV RNA1, RNA2 and RNA3. Sequencing of the amplicons from 53 PNRSV-infected trees revealed differing levels of polymorphism across the three different components of the PNRSV genome with a total number of 5040, 2083 and 5486 sequence variants observed for RNA1, RNA2 and RNA3 respectively. The RNA2 had the lowest diversity of sequences compared to RNA1 and RNA3, reflecting the lack of flexibility tolerated by the replicase gene that is encoded by this RNA component. Distinct PNRSV phylo-groups, consisting of closely related clusters of sequence variants, were observed in each of PNRSV RNA1, RNA2 and RNA3. Most plant samples had a single phylo-group for each RNA component. Haplotype network analysis showed that smaller clusters of PNRSV sequence variants were genetically connected to the largest sequence variant cluster within a phylo-group of each RNA component. Some plant samples had sequence variants occurring in multiple PNRSV phylo-groups in at least one of each RNA and these phylo-groups formed distinct clades that represent PNRSV genetic strains. Variants within the same phylo-group of each Prunus plant sample had ≥97% similarity and phylo-groups within a Prunus plant sample and between samples had less ≤97% similarity. Based on the analysis of diversity, a definition of a PNRSV genetic strain was proposed. The proposed definition was applied to determine the number of PNRSV genetic strains in each of the plant samples and the complexity in defining genetic strains in multipartite genome viruses was explored. PMID:28632759
Overcoming Sequence Misalignments with Weighted Structural Superposition
Khazanov, Nickolay A.; Damm-Ganamet, Kelly L.; Quang, Daniel X.; Carlson, Heather A.
2012-01-01
An appropriate structural superposition identifies similarities and differences between homologous proteins that are not evident from sequence alignments alone. We have coupled our Gaussian-weighted RMSD (wRMSD) tool with a sequence aligner and seed extension (SE) algorithm to create a robust technique for overlaying structures and aligning sequences of homologous proteins (HwRMSD). HwRMSD overcomes errors in the initial sequence alignment that would normally propagate into a standard RMSD overlay. SE can generate a corrected sequence alignment from the improved structural superposition obtained by wRMSD. HwRMSD’s robust performance and its superiority over standard RMSD are demonstrated over a range of homologous proteins. Its better overlay results in corrected sequence alignments with good agreement to HOMSTRAD. Finally, HwRMSD is compared to established structural alignment methods: FATCAT, SSM, CE, and Dalilite. Most methods are comparable at placing residue pairs within 2 Å, but HwRMSD places many more residue pairs within 1 Å, providing a clear advantage. Such high accuracy is essential in drug design, where small distances can have a large impact on computational predictions. This level of accuracy is also needed to correct sequence alignments in an automated fashion, especially for omics-scale analysis. HwRMSD can align homologs with low sequence identity and large conformational differences, cases where both sequence-based and structural-based methods may fail. The HwRMSD pipeline overcomes the dependency of structural overlays on initial sequence pairing and removes the need to determine the best sequence-alignment method, substitution matrix, and gap parameters for each unique pair of homologs. PMID:22733542
Vandenbol, M; Jauniaux, J C; Grenson, M
1989-11-15
The complete nucleotide (nt) sequence of the PUT4 gene, whose product is required for high-affinity proline active transport in the yeast Saccharomyces cerevisiae, is presented. The sequence contains a single long open reading frame of 1881 nt, encoding a polypeptide with a calculated Mr of 68,795. The predicted protein is strongly hydrophobic and exhibits six potential glycosylation sites. Its hydropathy profile suggests the presence of twelve membrane-spanning regions flanked by hydrophilic N- and C-terminal domains. The N terminus does not resemble signal sequences found in secreted proteins. These features are characteristic of integral membrane proteins catalyzing translocation of ligands across cellular membranes. Protein sequence comparisons indicate strong resemblance to the arginine and histidine permeases of S. cerevisiae, but no marked sequence similarity to the proline permease of Escherichia coli or to other known prokaryotic or eukaryotic transport proteins. The strong similarity between the three yeast amino acid permeases suggests a common ancestor for the three proteins.
Quan, Phenix-Lan; Junglen, Sandra; Tashmukhamedova, Alla; Conlan, Sean; Hutchison, Stephen K.; Kurth, Andreas; Ellerbrok, Heinz; Egholm, Michael; Briese, Thomas; Leendertz, Fabian H.; Ian Lipkin, W
2009-01-01
Characterization of arboviruses at the interface of pristine habitats and anthropogenic landscapes is crucial to comprehensive emergent disease surveillance and forecasting efforts. In context of surveillance campaign in and around a West African rainforest, particles morphologically consistent with rhabdoviruses were identified in cell cultures infected with homogenates of trapped mosquitoes. RNA recovered from these cultures was used to derive the first complete genome sequence of a rhabdovirus isolated from Culex decens mosquitoes in Côte d’Ivoire, tentatively named Moussa virus (MOUV). MOUV shows the classical genome organization of rhabdoviruses, with five open reading frames (ORF) in a linear order. However, sequences show only limited conservation (12–33% identity at amino acid level), and ORF2 and ORF3 have no significant similarity to sequences deposited in GenBank. Phylogenetic analysis indicates a potential new species with distant relationship to Tupaia and Tibrogargan virus. PMID:19804801
Quan, Phenix-Lan; Junglen, Sandra; Tashmukhamedova, Alla; Conlan, Sean; Hutchison, Stephen K; Kurth, Andreas; Ellerbrok, Heinz; Egholm, Michael; Briese, Thomas; Leendertz, Fabian H; Lipkin, W Ian
2010-01-01
Characterization of arboviruses at the interface of pristine habitats and anthropogenic landscapes is crucial to comprehensive emergent disease surveillance and forecasting efforts. In context of a surveillance campaign in and around a West African rainforest, particles morphologically consistent with rhabdoviruses were identified in cell cultures infected with homogenates of trapped mosquitoes. RNA recovered from these cultures was used to derive the first complete genome sequence of a rhabdovirus isolated from Culex decens mosquitoes in Côte d'Ivoire, tentatively named Moussa virus (MOUV). MOUV shows the classical genome organization of rhabdoviruses, with five open reading frames (ORF) in a linear order. However, sequences show only limited conservation (12-33% identity at amino acid level), and ORF2 and ORF3 have no significant similarity to sequences deposited in GenBank. Phylogenetic analysis indicates a potential new species with distant relationship to Tupaia and Tibrogargan virus.
Rafaelsen, Silje Hjorth; Raeder, Helge; Fagerheim, Anne Kristine; Knappskog, Per; Carpenter, Thomas O; Johansson, Stefan; Bjerknes, Robert
2013-06-01
Fibroblast growth factor 23 (FGF23) plays a crucial role in renal phosphate regulation, exemplified by the causal role of PHEX and DMP1 mutations in X-linked hypophosphatemic rickets and autosomal recessive rickets type 1, respectively. Using whole exome sequencing we identified compound heterozygous mutations in family with sequence similarity 20, member C (FAM20C) in two siblings referred for hypophosphatemia and severe dental demineralization disease. FAM20C mutations were not found in other undiagnosed probands of a national Norwegian population of familial hypophosphatemia. Our results demonstrate that mutations in FAM20C provide a putative new mechanism in human subjects leading to dysregulated FGF23 levels, hypophosphatemia, hyperphosphaturia, dental anomalies, intracerebral calcifications and osteosclerosis of the long bones in the absence of rickets. Copyright © 2013 American Society for Bone and Mineral Research.
De novo design of a four-fold symmetric TIM-barrel protein with atomic-level accuracy
Parmeggiani, Fabio; Velasco, D. Alejandro Fernandez; Höcker, Birte; Baker, David
2015-01-01
Despite efforts for over 25 years, de novo protein design has not succeeded in achieving the TIM-barrel fold. Here we describe the computational design of 4-fold symmetrical (β/α)8-barrels guided by geometrical and chemical principles. Experimental characterization of 33 designs revealed the importance of sidechain-backbone hydrogen bonding for defining the strand register between repeat units. The X-ray crystal structure of a designed thermostable 184-residue protein is nearly identical with the designed TIM-barrel model. PSI-BLAST searches do not identify sequence similarities to known TIM-barrel proteins, and sensitive profile-profile searches indicate that the design sequence is distant from other naturally occurring TIM-barrel superfamilies, suggesting that Nature has only sampled a subset of the sequence space available to the TIM-barrel fold. The ability to de novo design TIM-barrels opens new possibilities for custom-made enzymes. PMID:26595462
Stayton, M M; Black, M; Bedbrook, J; Dunsmuir, P
1986-12-22
The 16 petunia Cab genes which have been characterized are all closely related at the nucleotide sequence level and they encode Cab precursor polypeptides which are similar in sequence and length. Here we describe a novel petunia Cab gene which encodes a unique Cab precursor protein. This protein is a member of the smallest class of Cab precursor proteins for which no gene has previously been assigned in petunia or any other species. The features of this Cab precursor protein are that it is shorter by 2-3 amino acids than the formerly characterized Cab precursors, its transit peptide sequence is unrelated, and the mature polypeptide is significantly diverged at the functionally important N terminus from other petunia Cab proteins. Gene structure also discriminates this gene which is the only intron containing Cab gene in petunia genomic DNA.
Bhardwaj, Tulika; Haque, Shafiul; Somvanshi, Pallavi
2018-05-12
Bacterial pathogens invade and disrupt the host defense system by means of protein sequences structurally similar at global and local level both. The sharing of homologous sequences between the host and the pathogenic bacteria mediates the infection and defines the concept of molecular mimicry. In this study, various computational approaches were employed to elucidate the pathogenicity of Clostridium botulinum ATCC 3502 at genome-wide level. Genome-wide study revealed that the pathogen mimics the host (Homo sapiens) and unraveled the complex pathogenic pathway of causing infection. The comparative 'omics' approaches helped in selective screening of 'molecular mimicry' candidates followed by the qualitative assessment of the virulence potential and functional enrichment. Overall, this study provides a deep insight into the emergence and surveillance of multidrug resistant C. botulinum ATCC 3502 caused infections. This is the very first report identifying C. botulinum ATCC 3502 proteome enriched similarities to the human host proteins and resulted in the identification of 20 potential mimicry candidates, which were further characterized qualitatively by sub-cellular organization prediction and functional annotation. This study will provide a variety of avenues for future studies related to infectious agents, host-pathogen interactions and the evolution of pathogenesis process. Copyright © 2018. Published by Elsevier Ltd.
Tran, Phuong N; Savka, Michael A; Gan, Han Ming
2017-01-01
The genus Pseudomonas has one of the largest diversity of species within the Bacteria kingdom. To date, its taxonomy is still being revised and updated. Due to the non-standardized procedure and ambiguous thresholds at species level, largely based on 16S rRNA gene or conventional biochemical assay, species identification of publicly available Pseudomonas genomes remains questionable. In this study, we performed a large-scale analysis of all Pseudomonas genomes with species designation (excluding the well-defined P. aeruginosa ) and re-evaluated their taxonomic assignment via in silico genome-genome hybridization and/or genetic comparison with valid type species. Three-hundred and seventy-three pseudomonad genomes were analyzed and subsequently clustered into 145 distinct genospecies. We detected 207 erroneous labels and corrected 43 to the proper species based on Average Nucleotide Identity Multilocus Sequence Typing (MLST) sequence similarity to the type strain. Surprisingly, more than half of the genomes initially designated as Pseudomonas syringae and Pseudomonas fluorescens should be classified either to a previously described species or to a new genospecies. Notably, high pairwise average nucleotide identity (>95%) indicating species-level similarity was observed between P. synxantha-P. libanensis, P. psychrotolerans - P. oryzihabitans , and P. kilonensis- P. brassicacearum , that were previously differentiated based on conventional biochemical tests and/or genome-genome hybridization techniques.
De Cid, Rafael; Ben Yaou, Rabah; Roudaut, Carinne; Charton, Karine; Baulande, Sylvain; Leturcq, France; Romero, Norma Beatriz; Malfatti, Edoardo; Beuvin, Maud; Vihola, Anna; Criqui, Audrey; Nelson, Isabelle; Nectoux, Juliette; Ben Aim, Laurène; Caloustian, Christophe; Olaso, Robert; Udd, Bjarne; Bonne, Gisèle; Eymard, Bruno
2015-01-01
Objective: To identify the genetic defects present in 3 families with muscular dystrophy, contractures, and calpain 3 deficiency. Methods: We performed targeted exome sequencing on one patient presenting a deficiency in calpain 3 on Western blot but for which mutations in the gene had been excluded. The identification of a homozygous truncating mutation in the M-line part of titin prompted us to sequence this region in 2 additional patients presenting similar clinical and biochemical characteristics. Results: The 3 patients shared similar features: coexistence of limb-girdle weakness and early-onset diffuse joint contractures without cardiomyopathy. The biopsies showed rimmed vacuoles, a dystrophic pattern, and secondary reduction in calpain 3. We identified a novel homozygous mutation in the exon Mex3 of the TTN gene in the first patient. At protein level, this mutation introduces a stop codon at the level of Mex3. Interestingly, we identified truncating mutations in both alleles in the same region of the TTN gene in patients from 2 additional families. Molecular protein analyses confirm loss of the C-ter part of titin. Conclusions: Our study broadens the phenotype of titinopathies with the report of a new clinical entity with prominent contractures and no cardiac abnormality and where the recessive mutations lead to truncation of the M-line titin and secondary calpain 3 deficiency. PMID:26581302
Dai, Qi; Yang, Yanchun; Wang, Tianming
2008-10-15
Many proposed statistical measures can efficiently compare biological sequences to further infer their structures, functions and evolutionary information. They are related in spirit because all the ideas for sequence comparison try to use the information on the k-word distributions, Markov model or both. Motivated by adding k-word distributions to Markov model directly, we investigated two novel statistical measures for sequence comparison, called wre.k.r and S2.k.r. The proposed measures were tested by similarity search, evaluation on functionally related regulatory sequences and phylogenetic analysis. This offers the systematic and quantitative experimental assessment of our measures. Moreover, we compared our achievements with these based on alignment or alignment-free. We grouped our experiments into two sets. The first one, performed via ROC (receiver operating curve) analysis, aims at assessing the intrinsic ability of our statistical measures to search for similar sequences from a database and discriminate functionally related regulatory sequences from unrelated sequences. The second one aims at assessing how well our statistical measure is used for phylogenetic analysis. The experimental assessment demonstrates that our similarity measures intending to incorporate k-word distributions into Markov model are more efficient.
Cloning and sequence analysis of chitin synthase gene fragments of Demodex mites.
Zhao, Ya-e; Wang, Zheng-hang; Xu, Yang; Xu, Ji-ru; Liu, Wen-yan; Wei, Meng; Wang, Chu-ying
2012-10-01
To our knowledge, few reports on Demodex studied at the molecular level are available at present. In this study our group, for the first time, cloned, sequenced and analyzed the chitin synthase (CHS) gene fragments of Demodex folliculorum, Demodex brevis, and Demodex canis (three isolates from each species) from Xi'an China, by designing specific primers based on the only partial sequence of the CHS gene of D. canis from Japan, retrieved from GenBank. Results show that amplification was successful only in three D. canis isolates and one D. brevis isolate out of the nine Demodex isolates. The obtained fragments were sequenced to be 339 bp for D. canis and 338 bp for D. brevis. The CHS gene sequence similarities between the three Xi'an D. canis isolates and one Japanese D. canis isolate ranged from 99.7% to 100.0%, and those between four D. canis isolates and one D. brevis isolate were 99.1%-99.4%. Phylogenetic trees based on maximum parsimony (MP) and maximum likelihood (ML) methods shared the same clusters, according with the traditional classification. Two open reading frames (ORFs) were identified in each CHS gene sequenced, and their corresponding amino acid sequences were located at the catalytic domain. The relatively conserved sequences could be deduced to be a CHS class A gene, which is associated with chitin synthesis in the integument of Demodex mites.
Jia, Ying; Cantu, Bruno A; Sánchez, Elda E; Pérez, John C
2008-06-15
To advance our knowledge on the snake venom composition and transcripts expressed in venom gland at the molecular level, we constructed a cDNA library from the venom gland of Agkistrodon piscivorus leucostoma for the generation of expressed sequence tags (ESTs) database. From the randomly sequenced 2112 independent clones, we have obtained ESTs for 1309 (62%) cDNAs, which showed significant deduced amino acid sequence similarity (scores >80) to previously characterized proteins in National Center for Biotechnology Information (NCBI) database. Ribosomal proteins make up 47 clones (2%) and the remaining 756 (36%) cDNAs represent either unknown identity or show BLASTX sequence identity scores of <80 with known GenBank accessions. The most highly expressed gene encoding phospholipase A(2) (PLA(2)) accounting for 35% of A. p. leucostoma venom gland cDNAs was identified and further confirmed by crude venom applied to sodium dodecyl sulfate/polyacrylamide gel electrophoresis (SDS-PAGE) electrophoresis and protein sequencing. A total of 180 representative genes were obtained from the sequence assemblies and deposited to EST database. Clones showing sequence identity to disintegrins, thrombin-like enzymes, hemorrhagic toxins, fibrinogen clotting inhibitors and plasminogen activators were also identified in our EST database. These data can be used to develop a research program that will help us identify genes encoding proteins that are of medical importance or proteins involved in the mechanisms of the toxin venom.
Cloning and sequence analysis of chitin synthase gene fragments of Demodex mites*
Zhao, Ya-e; Wang, Zheng-hang; Xu, Yang; Xu, Ji-ru; Liu, Wen-yan; Wei, Meng; Wang, Chu-ying
2012-01-01
To our knowledge, few reports on Demodex studied at the molecular level are available at present. In this study our group, for the first time, cloned, sequenced and analyzed the chitin synthase (CHS) gene fragments of Demodex folliculorum, Demodex brevis, and Demodex canis (three isolates from each species) from Xi’an China, by designing specific primers based on the only partial sequence of the CHS gene of D. canis from Japan, retrieved from GenBank. Results show that amplification was successful only in three D. canis isolates and one D. brevis isolate out of the nine Demodex isolates. The obtained fragments were sequenced to be 339 bp for D. canis and 338 bp for D. brevis. The CHS gene sequence similarities between the three Xi’an D. canis isolates and one Japanese D. canis isolate ranged from 99.7% to 100.0%, and those between four D. canis isolates and one D. brevis isolate were 99.1%–99.4%. Phylogenetic trees based on maximum parsimony (MP) and maximum likelihood (ML) methods shared the same clusters, according with the traditional classification. Two open reading frames (ORFs) were identified in each CHS gene sequenced, and their corresponding amino acid sequences were located at the catalytic domain. The relatively conserved sequences could be deduced to be a CHS class A gene, which is associated with chitin synthesis in the integument of Demodex mites. PMID:23024043
Polishing mechanism of light-initiated dental composite: Geometric optics approach.
Chiang, Yu-Chih; Lai, Eddie Hsiang-Hua; Kunzelmann, Karl-Heinz
2016-12-01
For light-initiated dental hybrid composites, reinforcing particles are much stiffer than the matrix, which makes the surface rugged after inadequate polish and favors bacterial adhesion and biofilm redevelopment. The aim of the study was to investigate the polishing mechanism via the geometric optics approach. We defined the polishing abilities of six instruments using the obtained gloss values through the geometric optics approach (micro-Tri-gloss with 20°, 60°, and 85° measurement angles). The surface texture was validated using a field emission scanning electron microscope (FE-SEM). Based on the gloss values, we sorted polishing tools into three abrasive levels, and proposed polishing sequences to test the hypothesis that similar abrasive levels would leave equivalent gloss levels on dental composites. The three proposed, tested polishing sequences included: S1, Sof-Lex XT coarse disc, Sof-Lex XT fine disc, and OccluBrush; S2, Sof-Lex XT coarse disc, Prisma Gloss polishing paste, and OccluBrush; and S3, Sof-Lex XT coarse disc, Enhance finishing cups, and OccluBrush. S1 demonstrated significantly higher surface gloss than the other procedures (p < 0.05). The surface textures (FE-SEM micrographs) correlated well with the obtained gloss values. Nominally similar abrasive abilities did not result in equivalent polish levels, indicating that the polishing tools must be evaluated and cannot be judged based on their compositions or abrasive sizes. The geometric optic approach is an efficient and nondestructive method to characterize the polished surface of dental composites. Copyright © 2015. Published by Elsevier B.V.
An experimental study of nettle feeding in captive gorillas.
Tennie, Claudio; Hedwig, Daniela; Call, Josep; Tomasello, Michael
2008-06-01
Mountain gorillas (Gorilla beringei beringei) in Karisoke, Rwanda, feed on the stinging nettle Laportea alatipes by means of elaborate processing skills. Byrne [e.g. Philosophical Transactions of the Royal Society of London, Series B, Biological Sciences 358:529-536, 2003] has claimed that individuals acquire these skills by means of the so-called program-level imitation, in which the overall sequence of problem-solving steps (not the precise actions) is reproduced. In this study we present western lowland gorillas (Gorilla gorilla gorilla) with highly similar nettles. Twelve gorillas in three different groups (including also one nettle-naïve gorilla) used the same program-level technique as wild mountain gorillas (with differences mainly on the action level). Chimpanzees, orangutans, and bonobos did not show these program-level patterns, nor did the gorillas when presented with a plant similar in structural design but lacking stinging defenses. We conclude that although certain aspects (i.e. single actions) of this complex skill may be owing to social learning, at the program level gorilla nettle feeding derives mostly from genetic predispositions and individual learning of plant affordances. Copyright 2008 Wiley-Liss, Inc.
Aquaporin 4 is a Ubiquitously Expressed Isoform in the Dogfish (Squalus acanthias) Shark.
Cutler, Christopher P; Maciver, Bryce; Cramb, Gordon; Zeidel, Mark
2011-01-01
The dogfish ortholog of aquaporin 4 (AQP4) was amplified from cDNA using degenerate PCR followed by cloning and sequencing. The complete coding region was then obtained using 5' and 3' RACE techniques. Alignment of the sequence with AQP4 amino acid sequences from other species showed that dogfish AQP4 has high levels (up to 65.3%) of homology with higher vertebrate sequences but lower levels of homology to Agnathan (38.2%) or teleost (57.5%) fish sequences. Northern blotting indicated that the dogfish mRNA was approximately 3.2 kb and was highly expressed in the rectal gland (a shark fluid secretory organ). Semi-quantitative PCR further indicates that AQP4 is ubiquitous, being expressed in all tissues measured but at low levels in certain tissues, where the level in liver > gill > intestine. Manipulation of the external environmental salinity of groups of dogfish showed that when fish were acclimated in stages to 120% seawater (SW) or 75% SW, there was no change in AQP4 mRNA expression in either rectal gland, kidney, or esophagus/cardiac stomach. Whereas quantitative PCR experiments using the RNA samples from the same experiment, showed a significant 63.1% lower abundance of gill AQP4 mRNA expression in 120% SW-acclimated dogfish. The function of dogfish AQP4 was also determined by measuring the effect of the AQP4 expression in Xenopus laevis oocytes. Dogfish AQP4 expressing-oocytes, exhibited significantly increased osmotic water permeability (P(f)) compared to controls, and this was invariant with pH. Permeability was not significantly reduced by treatment of oocytes with mercury chloride, as is also the case with AQP4 in other species. Similarly AQP4 expressing-oocytes did not exhibit enhanced urea or glycerol permeability, which is also consistent with the water-selective property of AQP4 in other species.
Aquaporin 4 is a Ubiquitously Expressed Isoform in the Dogfish (Squalus acanthias) Shark
Cutler, Christopher P; MacIver, Bryce; Cramb, Gordon; Zeidel, Mark
2012-01-01
The dogfish ortholog of aquaporin 4 (AQP4) was amplified from cDNA using degenerate PCR followed by cloning and sequencing. The complete coding region was then obtained using 5′ and 3′ RACE techniques. Alignment of the sequence with AQP4 amino acid sequences from other species showed that dogfish AQP4 has high levels (up to 65.3%) of homology with higher vertebrate sequences but lower levels of homology to Agnathan (38.2%) or teleost (57.5%) fish sequences. Northern blotting indicated that the dogfish mRNA was approximately 3.2 kb and was highly expressed in the rectal gland (a shark fluid secretory organ). Semi-quantitative PCR further indicates that AQP4 is ubiquitous, being expressed in all tissues measured but at low levels in certain tissues, where the level in liver > gill > intestine. Manipulation of the external environmental salinity of groups of dogfish showed that when fish were acclimated in stages to 120% seawater (SW) or 75% SW, there was no change in AQP4 mRNA expression in either rectal gland, kidney, or esophagus/cardiac stomach. Whereas quantitative PCR experiments using the RNA samples from the same experiment, showed a significant 63.1% lower abundance of gill AQP4 mRNA expression in 120% SW-acclimated dogfish. The function of dogfish AQP4 was also determined by measuring the effect of the AQP4 expression in Xenopus laevis oocytes. Dogfish AQP4 expressing-oocytes, exhibited significantly increased osmotic water permeability (Pf) compared to controls, and this was invariant with pH. Permeability was not significantly reduced by treatment of oocytes with mercury chloride, as is also the case with AQP4 in other species. Similarly AQP4 expressing-oocytes did not exhibit enhanced urea or glycerol permeability, which is also consistent with the water-selective property of AQP4 in other species. PMID:22291652
Wagaba, Henry; Beyene, Getu; Aleu, Jude; Odipio, John; Okao-Okuja, Geoffrey; Chauhan, Raj Deepika; Munga, Theresia; Obiero, Hannington; Halsey, Mark E.; Ilyas, Muhammad; Raymond, Peter; Bua, Anton; Taylor, Nigel J.; Miano, Douglas; Alicai, Titus
2017-01-01
Cassava brown streak disease (CBSD) presents a serious threat to cassava production in East and Central Africa. Currently, no cultivars with high levels of resistance to CBSD are available to farmers. Transgenic RNAi technology was employed to combat CBSD by fusing coat protein (CP) sequences from Ugandan cassava brown streak virus (UCBSV) and Cassava brown streak virus (CBSV) to create an inverted repeat construct (p5001) driven by the constitutive Cassava vein mosaic virus promoter. Twenty-five plant lines of cultivar TME 204 expressing varying levels of small interfering RNAs (siRNAs) were established in confined field trials (CFTs) in Uganda and Kenya. Within an initial CFT at Namulonge, Uganda, non-transgenic TME 204 plants developed foliar and storage root CBSD incidences at 96–100% by 12 months after planting. In contrast, 16 of the 25 p5001 transgenic lines showed no foliar symptoms and had less than 8% of their storage roots symptomatic for CBSD. A direct positive correlation was seen between levels of resistance to CBSD and expression of transgenic CP-derived siRNAs. A subsequent CFT was established at Namulonge using stem cuttings from the initial trial. All transgenic lines established remained asymptomatic for CBSD, while 98% of the non-transgenic TME 204 stake-derived plants developed storage roots symptomatic for CBSD. Similarly, very high levels of resistance to CBSD were demonstrated by TME 204 p5001 RNAi lines grown within a CFT over a full cropping cycle at Mtwapa, coastal Kenya. Sequence analysis of CBSD causal viruses present at the trial sites showed that the transgenic lines were exposed to both CBSV and UCBSV, and that the sequenced isolates shared >90% CP identity with transgenic CP sequences expressed by the p5001 inverted repeat expression cassette. These results demonstrate very high levels of field resistance to CBSD conferred by the p5001 RNAi construct at diverse agro-ecological locations, and across the vegetative cropping cycle. PMID:28127301
Leuthaeuser, Janelle B; Knutson, Stacy T; Kumar, Kiran; Babbitt, Patricia C; Fetrow, Jacquelyn S
2015-09-01
The development of accurate protein function annotation methods has emerged as a major unsolved biological problem. Protein similarity networks, one approach to function annotation via annotation transfer, group proteins into similarity-based clusters. An underlying assumption is that the edge metric used to identify such clusters correlates with functional information. In this contribution, this assumption is evaluated by observing topologies in similarity networks using three different edge metrics: sequence (BLAST), structure (TM-Align), and active site similarity (active site profiling, implemented in DASP). Network topologies for four well-studied protein superfamilies (enolase, peroxiredoxin (Prx), glutathione transferase (GST), and crotonase) were compared with curated functional hierarchies and structure. As expected, network topology differs, depending on edge metric; comparison of topologies provides valuable information on structure/function relationships. Subnetworks based on active site similarity correlate with known functional hierarchies at a single edge threshold more often than sequence- or structure-based networks. Sequence- and structure-based networks are useful for identifying sequence and domain similarities and differences; therefore, it is important to consider the clustering goal before deciding appropriate edge metric. Further, conserved active site residues identified in enolase and GST active site subnetworks correspond with published functionally important residues. Extension of this analysis yields predictions of functionally determinant residues for GST subgroups. These results support the hypothesis that active site similarity-based networks reveal clusters that share functional details and lay the foundation for capturing functionally relevant hierarchies using an approach that is both automatable and can deliver greater precision in function annotation than current similarity-based methods. © 2015 The Authors Protein Science published by Wiley Periodicals, Inc. on behalf of The Protein Society.
Leuthaeuser, Janelle B; Knutson, Stacy T; Kumar, Kiran; Babbitt, Patricia C; Fetrow, Jacquelyn S
2015-01-01
The development of accurate protein function annotation methods has emerged as a major unsolved biological problem. Protein similarity networks, one approach to function annotation via annotation transfer, group proteins into similarity-based clusters. An underlying assumption is that the edge metric used to identify such clusters correlates with functional information. In this contribution, this assumption is evaluated by observing topologies in similarity networks using three different edge metrics: sequence (BLAST), structure (TM-Align), and active site similarity (active site profiling, implemented in DASP). Network topologies for four well-studied protein superfamilies (enolase, peroxiredoxin (Prx), glutathione transferase (GST), and crotonase) were compared with curated functional hierarchies and structure. As expected, network topology differs, depending on edge metric; comparison of topologies provides valuable information on structure/function relationships. Subnetworks based on active site similarity correlate with known functional hierarchies at a single edge threshold more often than sequence- or structure-based networks. Sequence- and structure-based networks are useful for identifying sequence and domain similarities and differences; therefore, it is important to consider the clustering goal before deciding appropriate edge metric. Further, conserved active site residues identified in enolase and GST active site subnetworks correspond with published functionally important residues. Extension of this analysis yields predictions of functionally determinant residues for GST subgroups. These results support the hypothesis that active site similarity-based networks reveal clusters that share functional details and lay the foundation for capturing functionally relevant hierarchies using an approach that is both automatable and can deliver greater precision in function annotation than current similarity-based methods. PMID:26073648
Reduced Utilization of Selenium by Naked Mole Rats Due to a Specific Defect in GPx1 Expression*
Kasaikina, Marina V.; Lobanov, Alexei V.; Malinouski, Mikalai Y.; Lee, Byung Cheon; Seravalli, Javier; Fomenko, Dmitri E.; Turanov, Anton A.; Finney, Lydia; Vogt, Stefan; Park, Thomas J.; Miller, Richard A.; Hatfield, Dolph L.; Gladyshev, Vadim N.
2011-01-01
Naked mole rat (MR) Heterocephalus glaber is a rodent model of delayed aging because of its unusually long life span (>28 years). It is also not known to develop cancer. In the current work, tissue imaging by x-ray fluorescence microscopy and direct analyses of trace elements revealed low levels of selenium in the MR liver and kidney, whereas MR and mouse brains had similar selenium levels. This effect was not explained by uniform selenium deficiency because methionine sulfoxide reductase activities were similar in mice and MR. However, glutathione peroxidase activity was an order of magnitude lower in MR liver and kidney than in mouse tissues. In addition, metabolic labeling of MR cells with 75Se revealed a loss of the abundant glutathione peroxidase 1 (GPx1) band, whereas other selenoproteins were preserved. To characterize the MR selenoproteome, we sequenced its liver transcriptome. Gene reconstruction revealed standard selenoprotein sequences except for GPx1, which had an early stop codon, and SelP, which had low selenocysteine content. When expressed in HEK 293 cells, MR GPx1 was present in low levels, and its expression could be rescued neither by removing the early stop codon nor by replacing its SECIS element. In addition, GPx1 mRNA was present in lower levels in MR liver than in mouse liver. To determine if GPx1 deficiency could account for the reduced selenium content, we analyzed GPx1 knock-out mice and found reduced selenium levels in their livers and kidneys. Thus, MR is characterized by the reduced utilization of selenium due to a specific defect in GPx1 expression. PMID:21372135
Seal, B S; Neill, J D; Ridpath, J F
1994-07-01
Caliciviruses are nonenveloped with a polyadenylated genome of approximately 7.6 kb and a single capsid protein. The "RNA Fold" computer program was used to analyze 3'-terminal noncoding sequences of five feline calicivirus (FCV), rabbit hemorrhagic disease virus (RHDV), and two San Miguel sea lion virus (SMSV) isolates. The FCV 3'-terminal sequences are 40-46 nucleotides in length and 72-91% similar. The FCV sequences were predicted to contain two possible duplex structures and one stem-loop structure with free energies of -2.1 to -18.2 kcal/mole. The RHDV genomic 3'-terminal RNA sequences are 54 nucleotides in length and share 49% sequence similarity to homologous regions of the FCV genome. The RHDV sequence was predicted to form two duplex structures in the 3'-terminal noncoding region with a single stem-loop structure, resembling that of FCV. In contrast, the SMSV 1 and 4 genomic 3'-terminal noncoding sequences were 185 and 182 nucleotides in length, respectively. Ten possible duplex structures were predicted with an average structural free energy of -35 kcal/mole. Sequence similarity between the two SMSV isolates was 75%. Furthermore, extensive cloverleaflike structures are predicted in the 3' noncoding region of the SMSV genome, in contrast to the predicted single stem-loop structures of FCV or RHDV.
SeqAPASS (Sequence Alignment to Predict Across Species Susceptibility) software and documentation
SeqAPASS is a software application facilitates rapid and streamlined, yet transparent, comparisons of the similarity of toxicologically-significant molecular targets across species. The present application facilitates analysis of primary amino acid sequence similarity (including ...
Resolving the tips of the tree of life: How much mitochondrialdata doe we need?
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bonett, Ronald M.; Macey, J. Robert; Boore, Jeffrey L.
2005-04-29
Mitochondrial (mt) DNA sequences are used extensively to reconstruct evolutionary relationships among recently diverged animals,and have constituted the most widely used markers for species- and generic-level relationships for the last decade or more. However, most studies to date have employed relatively small portions of the mt-genome. In contrast, complete mt-genomes primarily have been used to investigate deep divergences, including several studies of the amount of mt sequence necessary to recover ancient relationships. We sequenced and analyzed 24 complete mt-genomes from a group of salamander species exhibiting divergences typical of those in many species-level studies. We present the first comprehensive investigationmore » of the amount of mt sequence data necessary to consistently recover the mt-genome tree at this level, using parsimony and Bayesian methods. Both methods of phylogenetic analysis revealed extremely similar results. A surprising number of well supported, yet conflicting, relationships were found in trees based on fragments less than {approx}2000 nucleotides (nt), typical of the vast majority of the thousands of mt-based studies published to date. Large amounts of data (11,500+ nt) were necessary to consistently recover the whole mt-genome tree. Some relationships consistently were recovered with fragments of all sizes, but many nodes required the majority of the mt-genome to stabilize, particularly those associated with short internal branches. Although moderate amounts of data (2000-3000 nt) were adequate to recover mt-based relationships for which most nodes were congruent with the whole mt-genome tree, many thousands of nucleotides were necessary to resolve rapid bursts of evolution. Recent advances in genomics are making collection of large amounts of sequence data highly feasible, and our results provide the basis for comparative studies of other closely related groups to optimize mt sequence sampling and phylogenetic resolution at the ''tips'' of the Tree of Life.« less
GWFASTA: server for FASTA search in eukaryotic and microbial genomes.
Issac, Biju; Raghava, G P S
2002-09-01
Similarity searches are a powerful method for solving important biological problems such as database scanning, evolutionary studies, gene prediction, and protein structure prediction. FASTA is a widely used sequence comparison tool for rapid database scanning. Here we describe the GWFASTA server that was developed to assist the FASTA user in similarity searches against partially and/or completely sequenced genomes. GWFASTA consists of more than 60 microbial genomes, eight eukaryote genomes, and proteomes of annotatedgenomes. Infact, it provides the maximum number of databases for similarity searching from a single platform. GWFASTA allows the submission of more than one sequence as a single query for a FASTA search. It also provides integrated post-processing of FASTA output, including compositional analysis of proteins, multiple sequences alignment, and phylogenetic analysis. Furthermore, it summarizes the search results organism-wise for prokaryotes and chromosome-wise for eukaryotes. Thus, the integration of different tools for sequence analyses makes GWFASTA a powerful toolfor biologists.
Breast MRI at 7 Tesla with a bilateral coil and robust fat suppression.
Brown, Ryan; Storey, Pippa; Geppert, Christian; McGorty, KellyAnne; Klautau Leite, Ana Paula; Babb, James; Sodickson, Daniel K; Wiggins, Graham C; Moy, Linda
2014-03-01
To develop a bilateral coil and fat suppressed T1-weighted sequence for 7 Tesla (T) breast MRI. A dual-solenoid coil and three-dimensional (3D) T1w gradient echo sequence with B1+ insensitive fat suppression (FS) were developed. T1w FS image quality was characterized through image uniformity and fat-water contrast measurements in 11 subjects. Signal-to-noise ratio (SNR) and flip angle maps were acquired to assess the coil performance. Bilateral contrast-enhanced and unilateral high resolution (0.6 mm isotropic, 6.5 min acquisition time) imaging highlighted the 7T SNR advantage. Reliable and effective FS and high image quality was observed in all subjects at 7T, indicating that the custom coil and pulse sequence were insensitive to high-field obstacles such as variable tissue loading. 7T and 3T image uniformity was similar (P=0.24), indicating adequate 7T B1+ uniformity. High 7T SNR and fat-water contrast enabled 0.6 mm isotropic imaging and visualization of a high level of fibroglandular tissue detail. 7T T1w FS bilateral breast imaging is feasible with a custom radiofrequency (RF) coil and pulse sequence. Similar image uniformity was achieved at 7T and 3T, despite different RF field behavior and variable coil-tissue interaction due to anatomic differences that might be expected to alter magnetic field patterns. Copyright © 2013 Wiley Periodicals, Inc.
Phylogenetics of Saccharomycetales, the ascomycete yeasts.
Suh, Sung-Oui; Blackwell, Meredith; Kurtzman, Cletus P; Lachance, Marc-André
2006-01-01
Ascomycete yeasts (phylum Ascomycota: subphylum Saccharomycotina: class Saccharomycetes: order Saccharomycetales) comprise a monophyletic lineage with a single order of about 1000 known species. These yeasts live as saprobes, often in association with plants, animals and their interfaces. A few species account for most human mycotic infections, and fewer than 10 species are plant pathogens. Yeasts are responsible for important industrial and biotechnological processes, including baking, brewing and synthesis of recombinant proteins. Species such as Saccharomyces cerevisiae are model organisms in research, some of which led to a Nobel Prize. Yeasts usually reproduce asexually by budding, and their sexual states are not enclosed in a fruiting body. The group also is well defined by synapomorphies visible at the ultrastructural level. Yeast identification and classification changed dramatically with the availability of DNA sequencing. Species identification now benefits from a constantly updated sequence database and no longer relies on ambiguous growth tests. A phylogeny based on single gene analyses has shown the order to be remarkably divergent despite morphological similarities among members. The limits of many previously described genera are not supported by sequence comparisons, and multigene phylogenetic studies are under way to provide a stable circumscription of genera, families and orders. One recent multigene study has resolved species of the Saccharomycetaceae into genera that differ markedly from those defined by analysis of morphology and growth responses, and similar changes are likely to occur in other branches of the yeast tree as additional sequences become available.
Tropical Archaea: Diversity associated with the surface microlayer of corals
Kellogg, C.A.
2004-01-01
Recent 16S rDNA studies have focused on detecting uncultivated bacteria associated with Caribbean reef corals in an effort to address the ecological roles of coral-associated microbes. Reports of Archaea associated with fishes and marine invertebrates raised the question of whether Archaea might also be part of the coral-associated microbial community. DNA analysis of mucus from 3 reef-building species of Caribbean corals, Montastraea annularis complex, Diploria strigosa and D. labyrinthiformis in the US Virgin Islands yielded 34 groups of archaeal 16S ribotypes (defined at the level of 97% similarity). The majority (75%) was most closely matched by BLAST searches to sequences derived from marine water column samples, whereas the remaining ribotypes were most similar to sequences isolated from anoxic environments (15%) and hydrothermal vents (9%). Unlike previous 16S studies of coral-associated Bacteria, the results do not suggest specific associations between particular archaeal sequences and individual coral species. Marine Archaea (Groups I, II and III) in addition to Thermoplasma-like, methanogen, and marine benthic crenarchaeote phylotypes, were detected in the mucus of tropical corals. The finding of sequences from coral-associated Archaea that are closely related to strict and facultative anaerobes, as well as to uncultivated Archaea from other types of anoxic environments, suggests that anaerobic micro-niches may exist in coral mucus layers. Archaea, with their unique biogeochemical capabilities, broaden the scope of possible interactions between corals and their associated microbial communities.
Breast MRI at 7 Tesla with a Bilateral Coil and Robust Fat Suppression
Brown, Ryan; Storey, Pippa; Geppert, Christian; McGorty, KellyAnne; Leite, Ana Paula Klautau; Babb, James; Sodickson, Daniel K.; Wiggins, Graham C.; Moy, Linda
2013-01-01
Purpose To develop a bilateral coil and optimized fat suppressed T1-weighted sequence for 7T breast MRI. Materials and Methods A dual-solenoid coil and 3D T1w gradient echo sequence with B1+ insensitive fat suppression (FS) were developed for 7T. T1w FS image quality was characterized through image uniformity and fat/water contrast measurements in 11 subjects. Signal-to-noise ratio (SNR) and flip angle maps were acquired to assess the coil performance. Bilateral contrast-enhanced and unilateral high resolution (0.6 mm isotropic, 6.5 min acquisition time) imaging highlighted the 7 T SNR advantage. Results Reliable and effective FS and high image quality was observed in all subjects at 7T, indicating that the custom coil and pulse sequence were insensitive to high-field obstacles such as variable tissue loading. 7T and 3T T1w FS image uniformity was similar (P=0.24), indicating adequate 7T B1+ uniformity. High 7T SNR and fat/water contrast enabled 0.6 mm isotropic imaging and visualization of a high level of fibroglandular tissue detail. Conclusion 7T T1w FS bilateral breast imaging is feasible with a custom RF coil and pulse sequence. Similar image uniformity was achieved at 7T and 3T, despite different RF field behavior and variable coil-tissue interaction due to anatomic differences that might be expected to alter magnetic field patterns. PMID:24123517
Probabilistic topic modeling for the analysis and classification of genomic sequences
2015-01-01
Background Studies on genomic sequences for classification and taxonomic identification have a leading role in the biomedical field and in the analysis of biodiversity. These studies are focusing on the so-called barcode genes, representing a well defined region of the whole genome. Recently, alignment-free techniques are gaining more importance because they are able to overcome the drawbacks of sequence alignment techniques. In this paper a new alignment-free method for DNA sequences clustering and classification is proposed. The method is based on k-mers representation and text mining techniques. Methods The presented method is based on Probabilistic Topic Modeling, a statistical technique originally proposed for text documents. Probabilistic topic models are able to find in a document corpus the topics (recurrent themes) characterizing classes of documents. This technique, applied on DNA sequences representing the documents, exploits the frequency of fixed-length k-mers and builds a generative model for a training group of sequences. This generative model, obtained through the Latent Dirichlet Allocation (LDA) algorithm, is then used to classify a large set of genomic sequences. Results and conclusions We performed classification of over 7000 16S DNA barcode sequences taken from Ribosomal Database Project (RDP) repository, training probabilistic topic models. The proposed method is compared to the RDP tool and Support Vector Machine (SVM) classification algorithm in a extensive set of trials using both complete sequences and short sequence snippets (from 400 bp to 25 bp). Our method reaches very similar results to RDP classifier and SVM for complete sequences. The most interesting results are obtained when short sequence snippets are considered. In these conditions the proposed method outperforms RDP and SVM with ultra short sequences and it exhibits a smooth decrease of performance, at every taxonomic level, when the sequence length is decreased. PMID:25916734
Multiple alignment-free sequence comparison
Ren, Jie; Song, Kai; Sun, Fengzhu; Deng, Minghua; Reinert, Gesine
2013-01-01
Motivation: Recently, a range of new statistics have become available for the alignment-free comparison of two sequences based on k-tuple word content. Here, we extend these statistics to the simultaneous comparison of more than two sequences. Our suite of statistics contains, first, and , extensions of statistics for pairwise comparison of the joint k-tuple content of all the sequences, and second, , and , averages of sums of pairwise comparison statistics. The two tasks we consider are, first, to identify sequences that are similar to a set of target sequences, and, second, to measure the similarity within a set of sequences. Results: Our investigation uses both simulated data as well as cis-regulatory module data where the task is to identify cis-regulatory modules with similar transcription factor binding sites. We find that although for real data, all of our statistics show a similar performance, on simulated data the Shepp-type statistics are in some instances outperformed by star-type statistics. The multiple alignment-free statistics are more sensitive to contamination in the data than the pairwise average statistics. Availability: Our implementation of the five statistics is available as R package named ‘multiAlignFree’ at be http://www-rcf.usc.edu/∼fsun/Programs/multiAlignFree/multiAlignFreemain.html. Contact: reinert@stats.ox.ac.uk Supplementary information: Supplementary data are available at Bioinformatics online. PMID:23990418
Yoon, Jung-Hoon; Oh, Tae-Kwang; Park, Yong-Ha
2004-11-01
A Gram-variable, endospore-forming moderately halophilic rod, strain SF-121, was isolated from a marine solar saltern of the Yellow Sea in Korea. The result of 16S rRNA gene sequence analysis showed that strain SF-121 has highest sequence similarity (99.7 %) with the type strain of Bacillus halodenitrificans. Phylogenetic analyses based on 16S rRNA gene sequences revealed that B. halodenitrificans DSM 10037(T) and strain SF-121 are more closely related to the genus Virgibacillus than to the genus Bacillus. Strain SF-121 and B. halodenitrificans DSM 10037(T) exhibited 16S rRNA gene similarity levels of 95.3-97.5 % with the type strains of Virgibacillus species and 94.0 % with the type strain of Bacillus subtilis. DNA-DNA relatedness and phenotypic data indicated that B. halodenitrificans DSM 10037(T) and strain SF-121 are members of the same species. B. halodenitrificans DSM 10037(T) and strain SF-121 exhibited DNA-DNA relatedness values of 9-11 % with the type strains of Virgibacillus carmonensis and Virgibacillus marismortui. On the basis of the phenotypic, chemotaxonomic, phylogenetic and genetic data, B. halodenitrificans should be reclassified in the genus Virgibacillus as Virgibacillus halodenitrificans comb. nov.
Hongmei, Jing; Aitchison, Jonathan C; Lacap, Donnabella C; Peerapornpisal, Yuwadee; Sompong, Udomluk; Pointing, Stephen B
2005-08-01
Most community molecular studies of thermophilic cyanobacterial mats to date have focused on Synechococcus occurring at temperatures of approximately 50-65 degrees C. These reveal that molecular diversity exceeds that indicated by morphology, and that phylogeographic lineages exist. The moderately thermophilic and generally filamentous cyanobacterial mat communities occurring at lower temperatures have not previously been investigated at the community molecular level. Here we report community diversity in mats of 42-53 degrees C recovered from previously unstudied geothermal locations. Separation of 16S rRNA gene-defined genotypes from community DNA was achieved by DGGE. Genotypic diversity was greater than morphotype diversity in all mats sampled, although genotypes generally corresponded to observed morphotypes. Thirty-six sequences were recovered from DGGE bands. Phylogenetic analyses revealed these to form novel thermophilic lineages distinct from their mesophilic counterparts, within Calothrix, Cyanothece, Fischerella, Phormidium, Pleurocapsa, Oscillatoria and Synechococcus. Where filamentous cyanobacterial sequences belonging to the same genus were recovered from the same site, these were generally closely affiliated. Location-specific sequences were observed for some genotypes recovered from geochemically similar yet spatially separated sites, thus providing evidence for phylogeographic lineages that evolve in isolation. Other genotypes were more closely affiliated to geographically remote counterparts from similar habitats suggesting that adaptation to certain niches is also important.
Pindi, Pavan Kumar; Raghuveer Yadav, P.; Shiva Shanker, A.
2013-01-01
International drinking water quality monitoring programs have been established in order to prevent or to reduce the risk of contracting water-related infections. A survey was performed on groundwater-derived drinking water from 13 different hospitals in the Mahabubnagar District. A total of 55 bacterial strains were isolated which belonged to both gram-positive and gram-negative bacteria. All the taxa were identified based on the 16S rRNA gene sequence analysis based on which they are phylogenetically close to 27 different taxa. Many of the strains are closely related to their phylogenetic neighbors and exhibit from 98.4 to 100% sequence similarity at the 16S rRNA gene sequence level. The most common group was similar to Acinetobacter junii (21.8%) and Acinetobacter calcoaceticus (10.9%) which were shared by 7 and 5 water samples, respectively. Out of 55 isolates, only 3 isolates belonged to coliform group which are Citrobacter freundii and Pantoea anthophila. More than half (52.7%, 29 strains) of the phylogenetic neighbors which belonged to 12 groups were reported to be pathogenic and isolated from clinical specimens. Out of 27 representative taxa are affiliated have eight representative genera in drinking water except for those affiliated with the genera Exiguobacterium, Delftia, Kocuria, and Lysinibacillus. PMID:23862144
Tian, Wenzhi; Chua, Kevin; Strober, Warren; Chu, Charles C.
2002-01-01
BACKGROUND: Identification of differentially expressed genes between normal and diseased states is an area of intense current medical research that can lead to the discovery of new therapeutic targets. However, isolation of differentially expressed genes by subtraction often suffers from unreported contamination of the resulting subtraction library with clones containing DNA sequences not from the original RNA samples. MATERIALS AND METHODS: Subtraction using cDNA representational difference analysis (RDA) was performed on human B cells from normal or common variable immunodeficiency patients. The material remaining after the subtraction was cloned and individual clones were sequenced. The sequence of one clone with similarity to integrases (ILG1, integrase-like gene-1) was used to obtain the full length cDNA sequence and as a probe for the presence of this sequence in RNA or genomic DNA samples. RESULTS: After five rounds of cDNA RDA, 23.3% of the clones from the resulting subtraction library contained Escherichia coli DNA. In addition, three clones contained the sequence of a new integrase, ILG1. The full length cDNA sequence of ILG1 exhibits prokaryotic, but not eukaryotic, features. At the DNA level, ILG1 is not similar to any known gene. At the protein level, ILG1 has 58% similarity to integrases from the cryptic P4 bacteriophage family (S clade). The catalytic domain of ILG1 contains the conserved features found in site-specific recombinases. The critical residues that form the catalytic active site pocket are conserved, including the highly conserved R-H-R-Y hallmark of these recombinases. Interestingly, ILG1 was not present in the original B cell populations. By probing genomic DNA, ILG1 could only be detected in the E. coli TOP10F' strain used in our laboratory for molecular cloning, but not in any of its precursor strains, including TOP10. Furthermore, bacteria cultured from the mouth of the laboratory worker who performed cDNA RDA were also positive for ILG1. CONCLUSIONS: In the course of our studies using cDNA RDA, we have isolated and identified ILG1, a likely active site-specific recombinase and new member of the bacteriophage P4 family of integrases. This family of integrases is implicated in the horizontal DNA transfer of pathogenic genes between bacterial species, such as those found in pathogenic strains of E. coli, Shigella, Yersinia, and Vibrio cholera. Using ILG1 as a marker of our laboratory E. coli strain TOP10F', our evidence suggests that contaminating bacterial DNA in our subtraction experiment is due to this laboratory bacterial strain, which colonized exposed surfaces of the laboratory worker. Thus, identification of differentially expressed genes between normal and diseased states could be dramatically improved by using extra precaution to prevent bacterial contamination of samples. PMID:12393938
Gerdes, Kenn; Wagner, E Gerhart H
2007-04-01
Recent genomic analyses revealed a surprisingly large number of toxin-antitoxin loci in free-living prokaryotes. The antitoxins are proteins or antisense RNAs that counteract the toxins. Two antisense RNA-regulated toxin-antitoxin gene families, hok/sok and ldr, are unrelated sequence-wise but have strikingly similar properties at the level of gene and RNA organization. Recently, two SOS-induced toxins were found to be regulated by RNA antitoxins. One such toxin, SymE, exhibits similarity with MazE antitoxin and, surprisingly, inhibits translation. Thus, it is possible that an ancestral antitoxin gene evolved into the present toxin gene (symE) whose translation is repressed by an RNA antitoxin (SymR).
Johnston, J.W.; Thompson, T.A.; Wilcox, D.A.; Baedke, S.J.
2007-01-01
A common break was recognized in four Lake Superior strandplain sequences using geomorphic and sedimentologic characteristics. Strandplains were divided into lakeward and landward sets of beach ridges using aerial photographs and topographic surveys to identify similar surficial features and core data to identify similar subsurface features. Cross-strandplain, elevation-trend changes from a lowering towards the lake in the landward set of beach ridges to a rise or reduction of slope towards the lake in the lakeward set of beach ridges indicates that the break is associated with an outlet change for Lake Superior. Correlation of this break between study sites and age model results for the strandplain sequences suggest that the outlet change occurred sometime after about 2,400 calendar years ago (after the Algoma phase). Age model results from one site (Grand Traverse Bay) suggest an alternate age closer to about 1,200 calendar years ago but age models need to be investigated further. The landward part of the strandplain was deposited when water levels were common in all three upper Great Lakes basins (Superior, Huron, and Michigan) and drained through the Port Huron/Sarnia outlet. The lakeward part was deposited after the Sault outlet started to help regulate water levels in the Lake Superior basin. The landward beach ridges are commonly better defined and continuous across the embayments, more numerous, larger in relief, wider, have greater vegetation density, and intervening swales contain more standing water and peat than the lakeward set. Changes in drainage patterns, foreshore sediment thickness and grain size help in identifying the break between sets in the strandplain sequences. Investigation of these breaks may help identify possible gaps in the record or missing ridges in strandplain sequences that may not be apparent when viewing age distributions and may justify the need for multiple age and glacial isostatic adjustment models. ?? 2006 Springer Science+Business Media B.V.
Nelson, Alan R.; Shennan, Ian; Long, Antony J.
1996-01-01
Tidal-wetland stratigraphy reveals that great plate boundary earthquakes have caused hundreds of kilometers of coast to subside at the Cascadia subduction zone. However, determining earthquake recurrence intervals and mapping the coastal extent of past great earthquake ruptures in this region are complicated by the effects of many sedimentologic, hydrographic, and oceanographic processes that occur on the coasts of tectonically passive as well as active continental margins. Tidal-wetland stratigraphy at many Cascadia estuaries differs little from that at similar sites on passive-margin coasts where stratigraphic sequences form through nonseismic processes unrelated to coseismic land level changes. Methods developed through study of similar stratigraphic sequences in Europe provide a framework for investigating the Cascadia estuarine record. Five kinds of criteria must be evaluated when inferring regional coastal subsidence due to great plate boundary earthquakes: the suddenness and amount of submergence, the lateral extent of submerged tidal-wetland soils, the coincidence of submergence with tsunami deposits, and the degree of synchroneity of submergence events at widely spaced sites. Evaluation of such criteria at the Cascadia subduction zone indicates regional coastal subsidence during at least two great earthquakes. Evidence for a coseismic origin remains equivocal, however, for the many peat-mud contacts in Cascadia stratigraphic sequences that lack (1) contrasts in lithology or fossils indicative of more than half a meter of submergence, (2) well-studied tsunami deposits, or (3) precise ages needed for regional correlation. Paleoecologic studies of fossil assemblages are particularly important in estimating the size of sudden sea level changes recorded by abrupt peat-mud contacts and in helping to distinguish erosional and gradually formed contacts from coseismic contacts. Reconstruction of a history of great earthquakes for the Cascadia subduction zone will require rigorous application of the above criteria and many detailed investigations.
Karaboga, D; Aslan, S
2016-04-27
The great majority of biological sequences share significant similarity with other sequences as a result of evolutionary processes, and identifying these sequence similarities is one of the most challenging problems in bioinformatics. In this paper, we present a discrete artificial bee colony (ABC) algorithm, which is inspired by the intelligent foraging behavior of real honey bees, for the detection of highly conserved residue patterns or motifs within sequences. Experimental studies on three different data sets showed that the proposed discrete model, by adhering to the fundamental scheme of the ABC algorithm, produced competitive or better results than other metaheuristic motif discovery techniques.
Chen, Wei-Hua; Wang, Xue-Xia; Lin, Wei; He, Xiao-Wei; Wu, Zhen-Qiang; Lin, Ying; Hu, Song-Nian; Wang, Xiao-Ning
2006-01-01
Background The cynomolgus monkey (Macaca fascicularis) is one of the most widely used surrogate animal models for an increasing number of human diseases and vaccines, especially immune-system-related ones. Towards a better understanding of the gene expression background upon its immunogenetics, we constructed a cDNA library from Epstein-Barr virus (EBV)-transformed B lymphocytes of a cynomolgus monkey and sequenced 10,000 randomly picked clones. Results After processing, 8,312 high-quality expressed sequence tags (ESTs) were generated and assembled into 3,728 unigenes. Annotations of these uniquely expressed transcripts demonstrated that out of the 2,524 open reading frame (ORF) positive unigenes (mitochondrial and ribosomal sequences were not included), 98.8% shared significant similarities (E-value less than 1e-10) with the NCBI nucleotide (nt) database, while only 67.7% (E-value less than 1e-5) did so with the NCBI non-redundant protein (nr) database. Further analysis revealed that 90.0% of the unigenes that shared no similarities to the nr database could be assigned to human chromosomes, in which 75 did not match significantly to any cynomolgus monkey and human ESTs. The mapping regions to known human genes on the human genome were described in detail. The protein family and domain analysis revealed that the first, second and fourth of the most abundantly expressed protein families were all assigned to immunoglobulin and major histocompatibility complex (MHC)-related proteins. The expression profiles of these genes were compared with that of homologous genes in human blood, lymph nodes and a RAMOS cell line, which demonstrated expression changes after transformation with EBV. The degree of sequence similarity of the MHC class I and II genes to the human reference sequences was evaluated. The results indicated that class I molecules showed weak amino acid identities (<90%), while class II showed slightly higher ones. Conclusion These results indicated that the genes expressed in the cynomolgus monkey could be used to identify novel protein-coding genes and revise those incomplete or incorrect annotations in the human genome by comparative methods, since the old world monkeys and humans share high similarities at the molecular level, especially within coding regions. The identification of multiple genes involved in the immune response, their sequence variations to the human homologues, and their responses to EBV infection could provide useful information to improve our understanding of the cynomolgus monkey immune system. PMID:16618371
On the relationship between residue structural environment and sequence conservation in proteins.
Liu, Jen-Wei; Lin, Jau-Ji; Cheng, Chih-Wen; Lin, Yu-Feng; Hwang, Jenn-Kang; Huang, Tsun-Tsao
2017-09-01
Residues that are crucial to protein function or structure are usually evolutionarily conserved. To identify the important residues in protein, sequence conservation is estimated, and current methods rely upon the unbiased collection of homologous sequences. Surprisingly, our previous studies have shown that the sequence conservation is closely correlated with the weighted contact number (WCN), a measure of packing density for residue's structural environment, calculated only based on the C α positions of a protein structure. Moreover, studies have shown that sequence conservation is correlated with environment-related structural properties calculated based on different protein substructures, such as a protein's all atoms, backbone atoms, side-chain atoms, or side-chain centroid. To know whether the C α atomic positions are adequate to show the relationship between residue environment and sequence conservation or not, here we compared C α atoms with other substructures in their contributions to the sequence conservation. Our results show that C α positions are substantially equivalent to the other substructures in calculations of various measures of residue environment. As a result, the overlapping contributions between C α atoms and the other substructures are high, yielding similar structure-conservation relationship. Take the WCN as an example, the average overlapping contribution to sequence conservation is 87% between C α and all-atom substructures. These results indicate that only C α atoms of a protein structure could reflect sequence conservation at the residue level. © 2017 Wiley Periodicals, Inc.
Sequence requirement of the ade6-4095 meiotic recombination hotspot in Schizosaccharomyces pombe.
Foulis, Steven J; Fowler, Kyle R; Steiner, Walter W
2018-02-01
Homologous recombination occurs at a greatly elevated frequency in meiosis compared to mitosis and is initiated by programmed double-strand DNA breaks (DSBs). DSBs do not occur at uniform frequency throughout the genome in most organisms, but occur preferentially at a limited number of sites referred to as hotspots. The location of hotspots have been determined at nucleotide-level resolution in both the budding and fission yeasts, and while several patterns have emerged regarding preferred locations for DSB hotspots, it remains unclear why particular sites experience DSBs at much higher frequency than other sites with seemingly similar properties. Short sequence motifs, which are often sites for binding of transcription factors, are known to be responsible for a number of hotspots. In this study we identified the minimum sequence required for activity of one of such motif identified in a screen of random sequences capable of producing recombination hotspots. The experimentally determined sequence, GGTCTRGACC, closely matches the previously inferred sequence. Full hotspot activity requires an effective sequence length of 9.5 bp, whereas moderate activity requires an effective sequence length of approximately 8.2 bp and shows significant association with DSB hotspots. In combination with our previous work, this result is consistent with a large number of different sequence motifs capable of producing recombination hotspots, and supports a model in which hotspots can be rapidly regenerated by mutation as they are lost through recombination.
Aas-Hanssen, Kristin; Thompson, Keith M; Bogen, Bjarne; Munthe, Ludvig A
2015-01-01
Systemic lupus erythematosus (SLE) is marked by a T helper (Th) cell-dependent B cell hyperresponsiveness, with frequent germinal center reactions, and gammaglobulinemia. A feature of SLE is the finding of IgG autoantibodies specific for dsDNA. The specificity of the Th cells that drive the expansion of anti-dsDNA B cells is unresolved. However, anti-microbial, anti-histone, and anti-idiotype Th cell responses have been hypothesized to play a role. It has been entirely unclear if these seemingly disparate Th cell responses and hypotheses could be related or unified. Here, we describe that H chain CDR3 idiotypes from IgG(+) B cells of lupus mice have sequence similarities with both microbial and self peptides. Matched sequences were more frequent within the mutated CDR3 repertoire and when sequences were derived from lupus mice with expanded anti-dsDNA B cells. Analyses of histone sequences showed that particular histone peptides were similar to VDJ junctions. Moreover, lupus mice had Th cell responses toward histone peptides similar to anti-dsDNA CDR3 sequences. The results suggest that Th cells in lupus may have multiple cross-reactive specificities linked to the IgVH CDR3 Id-peptide sequences as well as similar DNA-associated protein motifs.
Holm, Liisa; Laakso, Laura M
2016-07-08
The Dali server (http://ekhidna2.biocenter.helsinki.fi/dali) is a network service for comparing protein structures in 3D. In favourable cases, comparing 3D structures may reveal biologically interesting similarities that are not detectable by comparing sequences. The Dali server has been running in various places for over 20 years and is used routinely by crystallographers on newly solved structures. The latest update of the server provides enhanced analytics for the study of sequence and structure conservation. The server performs three types of structure comparisons: (i) Protein Data Bank (PDB) search compares one query structure against those in the PDB and returns a list of similar structures; (ii) pairwise comparison compares one query structure against a list of structures specified by the user; and (iii) all against all structure comparison returns a structural similarity matrix, a dendrogram and a multidimensional scaling projection of a set of structures specified by the user. Structural superimpositions are visualized using the Java-free WebGL viewer PV. The structural alignment view is enhanced by sequence similarity searches against Uniprot. The combined structure-sequence alignment information is compressed to a stack of aligned sequence logos. In the stack, each structure is structurally aligned to the query protein and represented by a sequence logo. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.
Overvoorde, P J; Chao, W S; Grimes, H D
1997-06-20
Photoaffinity labeling of a soybean cotyledon membrane fraction identified a sucrose-binding protein (SBP). Subsequent studies have shown that the SBP is a unique plasma membrane protein that mediates the linear uptake of sucrose in the presence of up to 30 mM external sucrose when ectopically expressed in yeast. Analysis of the SBP-deduced amino acid sequence indicates it lacks sequence similarity with other known transport proteins. Data presented here, however, indicate that the SBP shares significant sequence and structural homology with the vicilin-like seed storage proteins that organize into homotrimers. These similarities include a repeated sequence that forms the basis of the reiterated domain structure characteristic of the vicilin-like protein family. In addition, analytical ultracentrifugation and nonreducing SDS-polyacrylamide gel electrophoresis demonstrate that the SBP appears to be organized into oligomeric complexes with a Mr indicative of the existence of SBP homotrimers and homodimers. The structural similarity shared by the SBP and vicilin-like proteins provides a novel framework to explore the mechanistic basis of SBP-mediated sucrose uptake. Expression of the maize Glb protein (a vicilin-like protein closely related to the SBP) in yeast demonstrates that a closely related vicilin-like protein is unable to mediate sucrose uptake. Thus, despite sequence and structural similarities shared by the SBP and the vicilin-like protein family, the SBP is functionally divergent from other members of this group.
Osmundson, Todd W.; Robert, Vincent A.; Schoch, Conrad L.; Baker, Lydia J.; Smith, Amy; Robich, Giovanni; Mizzan, Luca; Garbelotto, Matteo M.
2013-01-01
Despite recent advances spearheaded by molecular approaches and novel technologies, species description and DNA sequence information are significantly lagging for fungi compared to many other groups of organisms. Large scale sequencing of vouchered herbarium material can aid in closing this gap. Here, we describe an effort to obtain broad ITS sequence coverage of the approximately 6000 macrofungal-species-rich herbarium of the Museum of Natural History in Venice, Italy. Our goals were to investigate issues related to large sequencing projects, develop heuristic methods for assessing the overall performance of such a project, and evaluate the prospects of such efforts to reduce the current gap in fungal biodiversity knowledge. The effort generated 1107 sequences submitted to GenBank, including 416 previously unrepresented taxa and 398 sequences exhibiting a best BLAST match to an unidentified environmental sequence. Specimen age and taxon affected sequencing success, and subsequent work on failed specimens showed that an ITS1 mini-barcode greatly increased sequencing success without greatly reducing the discriminating power of the barcode. Similarity comparisons and nonmetric multidimensional scaling ordinations based on pairwise distance matrices proved to be useful heuristic tools for validating the overall accuracy of specimen identifications, flagging potential misidentifications, and identifying taxa in need of additional species-level revision. Comparison of within- and among-species nucleotide variation showed a strong increase in species discriminating power at 1–2% dissimilarity, and identified potential barcoding issues (same sequence for different species and vice-versa). All sequences are linked to a vouchered specimen, and results from this study have already prompted revisions of species-sequence assignments in several taxa. PMID:23638077
Osmundson, Todd W; Robert, Vincent A; Schoch, Conrad L; Baker, Lydia J; Smith, Amy; Robich, Giovanni; Mizzan, Luca; Garbelotto, Matteo M
2013-01-01
Despite recent advances spearheaded by molecular approaches and novel technologies, species description and DNA sequence information are significantly lagging for fungi compared to many other groups of organisms. Large scale sequencing of vouchered herbarium material can aid in closing this gap. Here, we describe an effort to obtain broad ITS sequence coverage of the approximately 6000 macrofungal-species-rich herbarium of the Museum of Natural History in Venice, Italy. Our goals were to investigate issues related to large sequencing projects, develop heuristic methods for assessing the overall performance of such a project, and evaluate the prospects of such efforts to reduce the current gap in fungal biodiversity knowledge. The effort generated 1107 sequences submitted to GenBank, including 416 previously unrepresented taxa and 398 sequences exhibiting a best BLAST match to an unidentified environmental sequence. Specimen age and taxon affected sequencing success, and subsequent work on failed specimens showed that an ITS1 mini-barcode greatly increased sequencing success without greatly reducing the discriminating power of the barcode. Similarity comparisons and nonmetric multidimensional scaling ordinations based on pairwise distance matrices proved to be useful heuristic tools for validating the overall accuracy of specimen identifications, flagging potential misidentifications, and identifying taxa in need of additional species-level revision. Comparison of within- and among-species nucleotide variation showed a strong increase in species discriminating power at 1-2% dissimilarity, and identified potential barcoding issues (same sequence for different species and vice-versa). All sequences are linked to a vouchered specimen, and results from this study have already prompted revisions of species-sequence assignments in several taxa.
1996-05-01
see figure appendix; B. abortus sequence in similarity arrangement with secD of E.coli, H. influenzae, M. leprae and S. coelicalor). Highly related...low similarity (E. coil and M. leprae approx 13.5% similarity). The Brucella and E. coil sequences were 25% similar (see figures appendix). In E...1987. Micobacterial growth inhibition by interferon-g activated bone marrow macrophages and differential susceptibility among strains of Mycobacterium
Safary, Azam; Moniri, Rezvan; Hamzeh-Mivehroud, Maryam; Dastmalchi, Siavoush
2016-01-01
Purpose: Robust pharmaceutical and industrial enzymes from extremophile microorganisms are main source of enzymes with tremendous stability under harsh conditions which make them potential tools for commercial and biotechnological applications. Methods: The genome of a Gram-positive halo-thermotolerant Bacillus sp. SL1, new isolate from Saline Lake, was investigated for the presence of genes coding for potentially pharmaceutical enzymes. We determined gene sequences for the enzymes laccase (CotA), l-asparaginase (ansA3, ansA1), glutamate-specific endopeptidase (blaSE), l-arabinose isomerase (araA2), endo-1,4-β mannosidase (gmuG), glutaminase (glsA), pectate lyase (pelA), cellulase (bglC1), aldehyde dehydrogenase (ycbD) and allantoinases (pucH) in the genome of Bacillus sp. SL1. Results: Based on the DNA sequence alignment results, six of the studied enzymes of Bacillus sp. SL-1 showed 100% similarity at the nucleotide level to the same genes of B. licheniformis 14580 demonstrating extensive organizational relationship between these two strains. Despite high similarities between the B. licheniformis and Bacillus sp. SL-1 genomes, there are minor differences in the sequences of some enzyme. Approximately 30% of the enzyme sequences revealed more than 99% identity with some variations in nucleotides leading to amino acid substitution in protein sequences. Conclusion: Molecular characterization of this new isolate provides useful information regarding evolutionary relationship between B. subtilis and B. licheniformis species. Since, the most industrial processes are often performed in harsh conditions, enzymes from such halo-thermotolerant bacteria may provide economically and industrially appealing biocatalysts to be used under specific physicochemical situations in medical, pharmaceutical, chemical and other industries. PMID:28101462
Safary, Azam; Moniri, Rezvan; Hamzeh-Mivehroud, Maryam; Dastmalchi, Siavoush
2016-12-01
Purpose: Robust pharmaceutical and industrial enzymes from extremophile microorganisms are main source of enzymes with tremendous stability under harsh conditions which make them potential tools for commercial and biotechnological applications. Methods: The genome of a Gram-positive halo-thermotolerant Bacillus sp. SL1, new isolate from Saline Lake, was investigated for the presence of genes coding for potentially pharmaceutical enzymes. We determined gene sequences for the enzymes laccase (CotA), l-asparaginase (ansA3, ansA1), glutamate-specific endopeptidase (blaSE), l-arabinose isomerase (araA2), endo-1,4-β mannosidase (gmuG), glutaminase (glsA), pectate lyase (pelA), cellulase (bglC1), aldehyde dehydrogenase (ycbD) and allantoinases (pucH) in the genome of Bacillus sp. SL1. Results: Based on the DNA sequence alignment results, six of the studied enzymes of Bacillus sp. SL-1 showed 100% similarity at the nucleotide level to the same genes of B. licheniformis 14580 demonstrating extensive organizational relationship between these two strains. Despite high similarities between the B. licheniformis and Bacillus sp. SL-1 genomes, there are minor differences in the sequences of some enzyme. Approximately 30% of the enzyme sequences revealed more than 99% identity with some variations in nucleotides leading to amino acid substitution in protein sequences. Conclusion: Molecular characterization of this new isolate provides useful information regarding evolutionary relationship between B. subtilis and B. licheniformis species. Since, the most industrial processes are often performed in harsh conditions, enzymes from such halo-thermotolerant bacteria may provide economically and industrially appealing biocatalysts to be used under specific physicochemical situations in medical, pharmaceutical, chemical and other industries.
Regional centromeres in the yeast Candida lusitaniae lack pericentromeric heterochromatin
Kapoor, Shivali; Zhu, Lisha; Froyd, Cara; Liu, Tao; Rusche, Laura N.
2015-01-01
Point centromeres are specified by a short consensus sequence that seeds kinetochore formation, whereas regional centromeres lack a conserved sequence and instead are epigenetically inherited. Regional centromeres are generally flanked by heterochromatin that ensures high levels of cohesin and promotes faithful chromosome segregation. However, it is not known whether regional centromeres require pericentromeric heterochromatin. In the yeast Candida lusitaniae, we identified a distinct type of regional centromere that lacks pericentromeric heterochromatin. Centromere locations were determined by ChIP-sequencing of two key centromere proteins, Cse4 and Mif2, and are consistent with bioinformatic predictions. The centromeric DNA sequence was unique for each chromosome and spanned 4–4.5 kbp, consistent with regional epigenetically inherited centromeres. However, unlike other regional centromeres, there was no evidence of pericentromeric heterochromatin in C. lusitaniae. In particular, flanking genes were expressed at a similar level to the rest of the genome, and a URA3 reporter inserted adjacent to a centromere was not repressed. In addition, regions flanking the centromeric core were not associated with hypoacetylated histones or a sirtuin deacetylase that generates heterochromatin in other yeast. Interestingly, the centromeric chromatin had a distinct pattern of histone modifications, being enriched for methylated H3K79 and H3R2 but lacking methylation of H3K4, which is found at other regional centromeres. Thus, not all regional centromeres require flanking heterochromatin. PMID:26371315
SeqAPASS: Sequence alignment to predict across-species ...
Efforts to shift the toxicity testing paradigm from whole organism studies to those focused on the initiation of toxicity and relevant pathways have led to increased utilization of in vitro and in silico methods. Hence the emergence of high through-put screening (HTS) programs, such as U.S. EPA ToxCast, and application of the adverse outcome pathway (AOP) framework for identifying and defining biological key events triggered upon perturbation of molecular initiating events and leading to adverse outcomes occuring at a level of organization relevant for risk assessment [1]. With these recent initiatives to harness the power of “the pathway” in describing and evaluating toxicity comes the need to extrapolate data beyond the model species. Sequence alignment to predict across-species susceptibilty (SeqAPASS) is a web-based tool that allows the user to begin to understand how broadly HTS data or AOP constructs may plausibly be extrapolated across species, while describing the relative intrinsic susceptibiltiy of different taxa to chemicals with known modes of action (e.g., pharmaceuticals and pesticides). The tool rapidly and strategically assesses available molecular target information to describe protein sequence similarity at the primary amino acid sequence, conserved domain, and individual amino acid residue levels. This in silico approach to species extrapolation was designed to automate and streamline the relatively complex and time-consuming process of co
Buitrago, Rosio; Depickère, Stéphanie; Bosseno, Marie-France; Patzi, Edda Siñani; Waleckx, Etienne; Salas, Renata; Aliaga, Claudia; Brenière, Simone Frédérique
2012-01-01
The identification of blood meals in vectors contributes greatly to the understanding of interactions between vectors, microorganisms and hosts. The aim of the current work was to complement the validation of cytochrome b (Cytb) heteroduplex assay (HDA) previously described, and to add the sequencing of the Cytb gene of some samples for the identification of blood meals in triatomines. Experimental feedings of reared triatomines helped to clarify the sensitivity of the HDA. Moreover, the sequencing coupled with the HDA, allowed the assessment of the technique's taxonomic level of discrimination. The primers used to produce DNA fragments of Cytb genes for HDA had a very high sensitivity for vertebrate DNAs, rather similar for mammals, birds and reptiles. However, the formation of heteroduplex depended on blood meal's quality rather than its quantity; a correlation was observed between blood meals' color and the positivity of HDA. HDA electrophoresis profiles were reproducible, and allowed the discrimination of blood origins at the species level. However, in some cases, intraspecific variability of Cytb gene generated different HDA profiles. The HDA based on comparison of electrophoresis profiles is a very useful tool for screening large samples to determine blood origins; the subsequent sequencing of PCR products of Cytb corresponding to different HDA profiles allowed the identification of species whatever the biotope in which the vectors were captured. Copyright © 2011. Published by Elsevier B.V.
Correlating low-similarity peptide sequences and allergenic epitopes.
Kanduc, D
2008-01-01
Although a high number of allergenic peptide epitopes has been experimentally identified and defined, the molecular basis and the precise mechanisms underlying peptide allergenicity are unknown. This issue was analyzed exploring the relationship between peptide allergenicity and sequence similarity to the human proteome. The structured analysis of the data reported in literature put into evidence that the most part of IgE-binding epitopes are (or harbor) pentapeptide unit(s) with no/low similarity to the human proteome, this way suggesting that no or low sequence similarity to the host proteome might represent a minimum common denominator identifying allergenic peptides. The present literature analysis might be of relevance in devising and designing short amino acid modules to be used for blocking pathogenic IgE.
Biosequence Similarity Search on the Mercury System
Krishnamurthy, Praveen; Buhler, Jeremy; Chamberlain, Roger; Franklin, Mark; Gyang, Kwame; Jacob, Arpith; Lancaster, Joseph
2007-01-01
Biosequence similarity search is an important application in modern molecular biology. Search algorithms aim to identify sets of sequences whose extensional similarity suggests a common evolutionary origin or function. The most widely used similarity search tool for biosequences is BLAST, a program designed to compare query sequences to a database. Here, we present the design of BLASTN, the version of BLAST that searches DNA sequences, on the Mercury system, an architecture that supports high-volume, high-throughput data movement off a data store and into reconfigurable hardware. An important component of application deployment on the Mercury system is the functional decomposition of the application onto both the reconfigurable hardware and the traditional processor. Both the Mercury BLASTN application design and its performance analysis are described. PMID:18846267
Pereiro, Patricia; Balseiro, Pablo; Romero, Alejandro; Dios, Sonia; Forn-Cuni, Gabriel; Fuste, Berta; Planas, Josep V.; Beltran, Sergi; Novoa, Beatriz; Figueras, Antonio
2012-01-01
Background Turbot (Scophthalmus maximus L.) is an important aquacultural resource both in Europe and Asia. However, there is little information on gene sequences available in public databases. Currently, one of the main problems affecting the culture of this flatfish is mortality due to several pathogens, especially viral diseases which are not treatable. In order to identify new genes involved in immune defense, we conducted 454-pyrosequencing of the turbot transcriptome after different immune stimulations. Methodology/Principal Findings Turbot were injected with viral stimuli to increase the expression level of immune-related genes. High-throughput deep sequencing using 454-pyrosequencing technology yielded 915,256 high-quality reads. These sequences were assembled into 55,404 contigs that were subjected to annotation steps. Intriguingly, 55.16% of the deduced protein was not significantly similar to any sequences in the databases used for the annotation and only 0.85% of the BLASTx top-hits matched S. maximus protein sequences. This relatively low level of annotation is possibly due to the limited information for this specie and other flatfish in the database. These results suggest the identification of a large number of new genes in turbot and in fish in general. A more detailed analysis showed the presence of putative members of several innate and specific immune pathways. Conclusions/Significance To our knowledge, this study is the first transcriptome analysis using 454-pyrosequencing for turbot. Previously, there were only 12,471 EST and less of 1,500 nucleotide sequences for S. maximus in NCBI database. Our results provide a rich source of data (55,404 contigs and 181,845 singletons) for discovering and identifying new genes, which will serve as a basis for microarray construction, gene expression characterization and for identification of genetic markers to be used in several applications. Immune stimulation in turbot was very effective, obtaining an enormous variety of sequences belonging to genes involved in the defense mechanisms. PMID:22629298
NemaPath: online exploration of KEGG-based metabolic pathways for nematodes
Wylie, Todd; Martin, John; Abubucker, Sahar; Yin, Yong; Messina, David; Wang, Zhengyuan; McCarter, James P; Mitreva, Makedonka
2008-01-01
Background Nematode.net is a web-accessible resource for investigating gene sequences from parasitic and free-living nematode genomes. Beyond the well-characterized model nematode C. elegans, over 500,000 expressed sequence tags (ESTs) and nearly 600,000 genome survey sequences (GSSs) have been generated from 36 nematode species as part of the Parasitic Nematode Genomics Program undertaken by the Genome Center at Washington University School of Medicine. However, these sequencing data are not present in most publicly available protein databases, which only include sequences in Swiss-Prot. Swiss-Prot, in turn, relies on GenBank/Embl/DDJP for predicted proteins from complete genomes or full-length proteins. Description Here we present the NemaPath pathway server, a web-based pathway-level visualization tool for navigating putative metabolic pathways for over 30 nematode species, including 27 parasites. The NemaPath approach consists of two parts: 1) a backend tool to align and evaluate nematode genomic sequences (curated EST contigs) against the annotated Kyoto Encyclopedia of Genes and Genomes (KEGG) protein database; 2) a web viewing application that displays annotated KEGG pathway maps based on desired confidence levels of primary sequence similarity as defined by a user. NemaPath also provides cross-referenced access to nematode genome information provided by other tools available on Nematode.net, including: detailed NemaGene EST cluster information; putative translations; GBrowse EST cluster views; links from nematode data to external databases for corresponding synonymous C. elegans counterparts, subject matches in KEGG's gene database, and also KEGG Ontology (KO) identification. Conclusion The NemaPath server hosts metabolic pathway mappings for 30 nematode species and is available on the World Wide Web at . The nematode source sequences used for the metabolic pathway mappings are available via FTP , as provided by the Genome Center at Washington University School of Medicine. PMID:18983679