Oligo/Polynucleotide-Based Gene Modification: Strategies and Therapeutic Potential

PubMed Central

Sargent, R. Geoffrey; Kim, Soya

2011-01-01

Oligonucleotide- and polynucleotide-based gene modification strategies were developed as an alternative to transgene-based and classical gene targeting-based gene therapy approaches for treatment of genetic disorders. Unlike the transgene-based strategies, oligo/polynucleotide gene targeting approaches maintain gene integrity and the relationship between the protein coding and gene-specific regulatory sequences. Oligo/polynucleotide-based gene modification also has several advantages over classical vector-based homologous recombination approaches. These include essentially complete homology to the target sequence and the potential to rapidly engineer patient-specific oligo/polynucleotide gene modification reagents. Several oligo/polynucleotide-based approaches have been shown to successfully mediate sequence-specific modification of genomic DNA in mammalian cells. The strategies involve the use of polynucleotide small DNA fragments, triplex-forming oligonucleotides, and single-stranded oligodeoxynucleotides to mediate homologous exchange. The primary focus of this review will be on the mechanistic aspects of the small fragment homologous replacement, triplex-forming oligonucleotide-mediated, and single-stranded oligodeoxynucleotide-mediated gene modification strategies as it relates to their therapeutic potential. PMID:21417933

Preparation of genosensor for detection of specific DNA sequence of the hepatitis B virus

NASA Astrophysics Data System (ADS)

Honorato Castro, Ana C.; França, Erick G.; de Paula, Lucas F.; Soares, Marcia M. C. N.; Goulart, Luiz R.; Madurro, João M.; Brito-Madurro, Ana G.

2014-09-01

An electrochemical genosensor was constructed for detection of specific DNA sequence of the hepatitis B virus, based on graphite electrodes modified with poly(4-aminophenol) and incorporating a specific oligonucleotide probe. The modified electrode containing the probe was evaluated by differential pulse voltammetry, before and after incubation with the complementary oligonucleotide target. Detection was performed by monitoring oxidizable DNA bases (direct detection) or using ethidium bromide as indicator of the hybridization process (indirect detection). The device showed a detection limit for the oligonucleotide target of 2.61 nmol L-1. Indirect detection using ethidium bromide was promising in discriminating mismatches, which is a very desirable attribute for detection of disease-related point mutations. In addition, it was possible to observe differences between hybridized and non-hybridized surfaces by atomic force microscopy.

Selective Amplification of SPR Biosensor Signal for Recognition of rpoB Gene Fragments by Use of Gold Nanoparticles Modified by Thiolated DNA

NASA Astrophysics Data System (ADS)

Matsishin, M.; Rachkov, A.; Lopatynskyi, A.; Chegel, V.; Soldatkin, A.; El'skaya, A.

2017-04-01

An experimental approach for improving the sensitivity of the surface plasmon resonance (SPR) DNA hybridization sensor using gold nanoparticles (GNPs), modified by specific oligonucleotides, was elaborated. An influence of the ionic strength on the aggregation stability of unmodified GNPs and GNPs modified by the thiolated oligonucleotides was investigated by monitoring a value of light extinction at 520 nm that can be considered as a measure of a quantity of the non-aggregated GNPs. While the unmodified GNPs started to aggregate in 0.2 × saline-sodium citrate (SSC), GNPs modified by the negatively charged oligonucleotides were more stable at increasing ionic strength up to 0.5 × SSC. A bioselective element of the SPR DNA hybridization sensor was formed by immobilization on the gold sensor surface of the thiolated oligonucleotides P2, the sequence of which is a fragment of the rpoB gene of Mycobacterium tuberculosis. The injections into the measuring flow cell of the SPR spectrometer of various concentrations of GNPs modified by the complementary oligonucleotides T2-18m caused the pronounced concentration-dependent sequence-specific sensor responses. The magnitude of the sensor responses was much higher than in the case of the free standing complementary oligonucleotides. According to the obtained experimental data, the usage of GNPs modified by specific oligonucleotides can amplify the sensor response of the SPR DNA hybridization sensor in 1200 times.

Visualization of genome signatures of eukaryote genomes by batch-learning self-organizing map with a special emphasis on Drosophila genomes.

PubMed

Abe, Takashi; Hamano, Yuta; Ikemura, Toshimichi

2014-01-01

A strategy of evolutionary studies that can compare vast numbers of genome sequences is becoming increasingly important with the remarkable progress of high-throughput DNA sequencing methods. We previously established a sequence alignment-free clustering method "BLSOM" for di-, tri-, and tetranucleotide compositions in genome sequences, which can characterize sequence characteristics (genome signatures) of a wide range of species. In the present study, we generated BLSOMs for tetra- and pentanucleotide compositions in approximately one million sequence fragments derived from 101 eukaryotes, for which almost complete genome sequences were available. BLSOM recognized phylotype-specific characteristics (e.g., key combinations of oligonucleotide frequencies) in the genome sequences, permitting phylotype-specific clustering of the sequences without any information regarding the species. In our detailed examination of 12 Drosophila species, the correlation between their phylogenetic classification and the classification on the BLSOMs was observed to visualize oligonucleotides diagnostic for species-specific clustering.

PNA-COMBO-FISH: From combinatorial probe design in silico to vitality compatible, specific labelling of gene targets in cell nuclei

DOE Office of Scientific and Technical Information (OSTI.GOV)

Müller, Patrick; Rößler, Jens; Schwarz-Finsterle, Jutta

Recently, advantages concerning targeting specificity of PCR constructed oligonucleotide FISH probes in contrast to established FISH probes, e.g. BAC clones, have been demonstrated. These techniques, however, are still using labelling protocols with DNA denaturing steps applying harsh heat treatment with or without further denaturing chemical agents. COMBO-FISH (COMBinatorial Oligonucleotide FISH) allows the design of specific oligonucleotide probe combinations in silico. Thus, being independent from primer libraries or PCR laboratory conditions, the probe sequences extracted by computer sequence data base search can also be synthesized as single stranded PNA-probes (Peptide Nucleic Acid probes). Gene targets can be specifically labelled with atmore » least about 20 PNA-probes obtaining visibly background free specimens. By using appropriately designed triplex forming oligonucleotides, the denaturing procedures can completely be omitted. These results reveal a significant step towards oligonucleotide-FISH maintaining the 3D-nanostructure and even the viability of the cell target. The method is demonstrated with the detection of Her2/neu and GRB7 genes, which are indicators in breast cancer diagnosis and therapy. - Highlights: • Denaturation free protocols preserve 3D architecture of chromosomes and nuclei. • Labelling sets are determined in silico for duplex and triplex binding. • Probes are produced chemically with freely chosen backbones and base variants. • Peptide nucleic acid backbones reduce hindering charge interactions. • Intercalating side chains stabilize binding of short oligonucleotides.« less

Method for performing site-specific affinity fractionation for use in DNA sequencing

DOEpatents

Mirzabekov, Andrei Darievich; Lysov, Yuri Petrovich; Dubley, Svetlana A.

1999-01-01

A method for fractionating and sequencing DNA via affinity interaction is provided comprising contacting cleaved DNA to a first array of oligonucleotide molecules to facilitate hybridization between said cleaved DNA and the molecules; extracting the hybridized DNA from the molecules; contacting said extracted hybridized DNA with a second array of oligonucleotide molecules, wherein the oligonucleotide molecules in the second array have specified base sequences that are complementary to said extracted hybridized DNA; and attaching labeled DNA to the second array of oligonucleotide molecules, wherein the labeled re-hybridized DNA have sequences that are complementary to the oligomers. The invention further provides a method for performing multi-step conversions of the chemical structure of compounds comprising supplying an array of polyacrylamide vessels separated by hydrophobic surfaces; immobilizing a plurality of reactants, such as enzymes, in the vessels so that each vessel contains one reactant; contacting the compounds to each of the vessels in a predetermined sequence and for a sufficient time to convert the compounds to a desired state; and isolating the converted compounds from said array.

Miniaturized reaction vessel system, method for performing site-specific biochemical reactions and affinity fractionation for use in DNA sequencing

DOEpatents

Mirzabekov, Andrei Darievich; Lysov, Yuri Petrovich; Dubley, Svetlana A.

2000-01-01

A method for fractionating and sequencing DNA via affinity interaction is provided comprising contacting cleaved DNA to a first array of oligonucleotide molecules to facilitate hybridization between said cleaved DNA and the molecules; extracting the hybridized DNA from the molecules; contacting said extracted hybridized DNA with a second array of oligonucleotide molecules, wherein the oligonucleotide molecules in the second array have specified base sequences that are complementary to said extracted hybridized DNA; and attaching labeled DNA to the second array of oligonucleotide molecules, wherein the labeled re-hybridized DNA have sequences that are complementary to the oligomers. The invention further provides a method for performing multi-step conversions of the chemical structure of compounds comprising supplying an array of polyacrylamide vessels separated by hydrophobic surfaces; immobilizing a plurality of reactants, such as enzymes, in the vessels so that each vessel contains one reactant; contacting the compounds to each of the vessels in a predetermined sequence and for a sufficient time to convert the compounds to a desired state; and isolating the converted compounds from said array.

Method for performing site-specific affinity fractionation for use in DNA sequencing

DOEpatents

Mirzabekov, A.D.; Lysov, Y.P.; Dubley, S.A.

1999-05-18

A method for fractionating and sequencing DNA via affinity interaction is provided comprising contacting cleaved DNA to a first array of oligonucleotide molecules to facilitate hybridization between the cleaved DNA and the molecules; extracting the hybridized DNA from the molecules; contacting the extracted hybridized DNA with a second array of oligonucleotide molecules, wherein the oligonucleotide molecules in the second array have specified base sequences that are complementary to the extracted hybridized DNA; and attaching labeled DNA to the second array of oligonucleotide molecules, wherein the labeled re-hybridized DNA have sequences that are complementary to the oligomers. The invention further provides a method for performing multi-step conversions of the chemical structure of compounds comprising supplying an array of polyacrylamide vessels separated by hydrophobic surfaces; immobilizing a plurality of reactants, such as enzymes, in the vessels so that each vessel contains one reactant; contacting the compounds to each of the vessels in a predetermined sequence and for a sufficient time to convert the compounds to a desired state; and isolating the converted compounds from the array. 14 figs.

Contribution of the first K-homology domain of poly(C)-binding protein 1 to its affinity and specificity for C-rich oligonucleotides

PubMed Central

Yoga, Yano M. K.; Traore, Daouda A. K.; Sidiqi, Mahjooba; Szeto, Chris; Pendini, Nicole R.; Barker, Andrew; Leedman, Peter J.; Wilce, Jacqueline A.; Wilce, Matthew C. J.

2012-01-01

Poly-C-binding proteins are triple KH (hnRNP K homology) domain proteins with specificity for single stranded C-rich RNA and DNA. They play diverse roles in the regulation of protein expression at both transcriptional and translational levels. Here, we analyse the contributions of individual αCP1 KH domains to binding C-rich oligonucleotides using biophysical and structural methods. Using surface plasmon resonance (SPR), we demonstrate that KH1 makes the most stable interactions with both RNA and DNA, KH3 binds with intermediate affinity and KH2 only interacts detectibly with DNA. The crystal structure of KH1 bound to a 5′-CCCTCCCT-3′ DNA sequence shows a 2:1 protein:DNA stoichiometry and demonstrates a molecular arrangement of KH domains bound to immediately adjacent oligonucleotide target sites. SPR experiments, with a series of poly-C-sequences reveals that cytosine is preferred at all four positions in the oligonucleotide binding cleft and that a C-tetrad binds KH1 with 10 times higher affinity than a C-triplet. The basis for this high affinity interaction is finally detailed with the structure determination of a KH1.W.C54S mutant bound to 5′-ACCCCA-3′ DNA sequence. Together, these data establish the lead role of KH1 in oligonucleotide binding by αCP1 and reveal the molecular basis of its specificity for a C-rich tetrad. PMID:22344691

Contribution of the first K-homology domain of poly(C)-binding protein 1 to its affinity and specificity for C-rich oligonucleotides.

PubMed

Yoga, Yano M K; Traore, Daouda A K; Sidiqi, Mahjooba; Szeto, Chris; Pendini, Nicole R; Barker, Andrew; Leedman, Peter J; Wilce, Jacqueline A; Wilce, Matthew C J

2012-06-01

Poly-C-binding proteins are triple KH (hnRNP K homology) domain proteins with specificity for single stranded C-rich RNA and DNA. They play diverse roles in the regulation of protein expression at both transcriptional and translational levels. Here, we analyse the contributions of individual αCP1 KH domains to binding C-rich oligonucleotides using biophysical and structural methods. Using surface plasmon resonance (SPR), we demonstrate that KH1 makes the most stable interactions with both RNA and DNA, KH3 binds with intermediate affinity and KH2 only interacts detectibly with DNA. The crystal structure of KH1 bound to a 5'-CCCTCCCT-3' DNA sequence shows a 2:1 protein:DNA stoichiometry and demonstrates a molecular arrangement of KH domains bound to immediately adjacent oligonucleotide target sites. SPR experiments, with a series of poly-C-sequences reveals that cytosine is preferred at all four positions in the oligonucleotide binding cleft and that a C-tetrad binds KH1 with 10 times higher affinity than a C-triplet. The basis for this high affinity interaction is finally detailed with the structure determination of a KH1.W.C54S mutant bound to 5'-ACCCCA-3' DNA sequence. Together, these data establish the lead role of KH1 in oligonucleotide binding by αCP1 and reveal the molecular basis of its specificity for a C-rich tetrad.

Selection of optimal oligonucleotide probes for microarrays usingmultiple criteria, global alignment and parameter estimation.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Li, Xingyuan; He, Zhili; Zhou, Jizhong

2005-10-30

The oligonucleotide specificity for microarray hybridizationcan be predicted by its sequence identity to non-targets, continuousstretch to non-targets, and/or binding free energy to non-targets. Mostcurrently available programs only use one or two of these criteria, whichmay choose 'false' specific oligonucleotides or miss 'true' optimalprobes in a considerable proportion. We have developed a software tool,called CommOligo using new algorithms and all three criteria forselection of optimal oligonucleotide probes. A series of filters,including sequence identity, free energy, continuous stretch, GC content,self-annealing, distance to the 3'-untranslated region (3'-UTR) andmelting temperature (Tm), are used to check each possibleoligonucleotide. A sequence identity is calculated based onmore » gapped globalalignments. A traversal algorithm is used to generate alignments for freeenergy calculation. The optimal Tm interval is determined based on probecandidates that have passed all other filters. Final probes are pickedusing a combination of user-configurable piece-wise linear functions andan iterative process. The thresholds for identity, stretch and freeenergy filters are automatically determined from experimental data by anaccessory software tool, CommOligo_PE (CommOligo Parameter Estimator).The program was used to design probes for both whole-genome and highlyhomologous sequence data. CommOligo and CommOligo_PE are freely availableto academic users upon request.« less

Routine HLA-B genotyping with PCR-sequence-specific oligonucleotides detects a B*52 variant (B*5206).

PubMed

Hoelsch, K; Lenggeler, I; Pfannes, W; Knabe, H; Klein, H-G; Woelpl, A

2005-05-01

A new human leukocyte antigen (HLA)-B allele was found during routine typing of samples for a German unrelated bone marrow donor registry, the "Aktion Knochenmarkspende Bayern". After first interpretation of data of two independent low-resolution sequence-specific oligonucleotide typing tests, a B*51 variant was suggested. Further analysis via sequence-based typing identified the sequence as new B*52 allele. This new allele officially assigned as B*5206 differs from HLA-B*520102 by one nucleotide exchange in exon 2. The mutation is located at nucleotide position 274, at which a cytosine is substituted by a thymine leading to an amino acid change at protein position 67 from serine (TCC) to phenylalanine (TTC).

Fluorescent probes for nucleic Acid visualization in fixed and live cells.

PubMed

Boutorine, Alexandre S; Novopashina, Darya S; Krasheninina, Olga A; Nozeret, Karine; Venyaminova, Alya G

2013-12-11

This review analyses the literature concerning non-fluorescent and fluorescent probes for nucleic acid imaging in fixed and living cells from the point of view of their suitability for imaging intracellular native RNA and DNA. Attention is mainly paid to fluorescent probes for fluorescence microscopy imaging. Requirements for the target-binding part and the fluorophore making up the probe are formulated. In the case of native double-stranded DNA, structure-specific and sequence-specific probes are discussed. Among the latest, three classes of dsDNA-targeting molecules are described: (i) sequence-specific peptides and proteins; (ii) triplex-forming oligonucleotides and (iii) polyamide oligo(N-methylpyrrole/N-methylimidazole) minor groove binders. Polyamides seem to be the most promising targeting agents for fluorescent probe design, however, some technical problems remain to be solved, such as the relatively low sequence specificity and the high background fluorescence inside the cells. Several examples of fluorescent probe applications for DNA imaging in fixed and living cells are cited. In the case of intracellular RNA, only modified oligonucleotides can provide such sequence-specific imaging. Several approaches for designing fluorescent probes are considered: linear fluorescent probes based on modified oligonucleotide analogs, molecular beacons, binary fluorescent probes and template-directed reactions with fluorescence probe formation, FRET donor-acceptor pairs, pyrene excimers, aptamers and others. The suitability of all these methods for living cell applications is discussed.

Oligonucleotide Sensor Based on Selective Capture of Upconversion Nanoparticles Triggered by Target-Induced DNA Interstrand Ligand Reaction

PubMed Central

2017-01-01

We present a sensor that exploits the phenomenon of upconversion luminescence to detect the presence of specific sequences of small oligonucleotides such as miRNAs among others. The sensor is based on NaYF4:Yb,Er@SiO2 nanoparticles functionalized with ssDNA that contain azide groups on the 3′ ends. In the presence of a target sequence, interstrand ligation is possible via the click-reaction between one azide of the upconversion probe and a DBCO-ssDNA-biotin probe present in the solution. As a result of this specific and selective process, biotin is covalently attached to the surface of the upconversion nanoparticles. The presence of biotin on the surface of the nanoparticles allows their selective capture on a streptavidin-coated support, giving a luminescent signal proportional to the amount of target strands present in the test samples. With the aim of studying the analytical properties of the sensor, total RNA samples were extracted from healthy mosquitoes and were spiked-in with a specific target sequence at different concentrations. The result of these experiments revealed that the sensor was able to detect 10–17 moles per well (100 fM) of the target sequence in mixtures containing 100 ng of total RNA per well. A similar limit of detection was found for spiked human serum samples, demonstrating the suitability of the sensor for detecting specific sequences of small oligonucleotides under real conditions. In contrast, in the presence of noncomplementary sequences or sequences having mismatches, the luminescent signal was negligible or conspicuously reduced. PMID:28332400

New redox-active layer create via epoxy-amine reaction - The base of genosensor for the detection of specific DNA and RNA sequences of avian influenza virus H5N1.

PubMed

Malecka, Kamila; Stachyra, Anna; Góra-Sochacka, Anna; Sirko, Agnieszka; Zagórski-Ostoja, Włodzimierz; Dehaen, Wim; Radecka, Hanna; Radecki, Jerzy

2015-03-15

This paper concerns the development of a redox-active monolayer and its application for the construction of an electrochemical genosensor designed for the detection of specific DNA and RNA oligonucleotide sequences related to the avian influenza virus (AIV) type H5N1. This new redox layer was created on a gold electrode surface step by step. Cyclic Voltammetry, Osteryoung Square-Wave Voltammetry and Differential Pulse Voltammetry were used for its characterization. This new redox-active layer was applied for the construction of the DNA biosensor. The NH2-NC3 probe (20-mer) was covalently attached to the gold electrode surface via a "click" reaction between the amine and an epoxide group. The hybridization process was monitored using the Osteryoung Square-Wave Voltammetry. The 20-mer DNA and ca. 280-mer RNA oligonucleotides were used as the targets. The constructed genosensor was capable to determine complementary oligonucleotide sequences with a detection limit in the pM range. It is able to distinguish the different position of the part RNA complementary to the DNA probe. The genosensor was very selective. The 20-mer DNA as well as the 280-mer RNA oligonucleotides without a complementary sequence generated a weak signal. Copyright © 2014 Elsevier B.V. All rights reserved.

Microchip method for the enrichment of specific DNA sequences

DOEpatents

Mirzabekov, A.D.; Lysov, Y.P.; Shick, V.V.; Dubiley, S.A.

1998-12-22

A method for enriching specific genetic material sequences is provided, whereby oligonucleotide molecules complementary to the desired genetic material is first used to isolate the genetic material from a first source of genomic material. Then the genetic material is used as a label to isolate similar genetic sequences from other sources. 4 figs.

Microchip method for the enrichment of specific DNA sequences

DOEpatents

Mirzabekov, Andrei Darievich; Lysov, Yuri Petrovich; Shick, Valentine Vladimirovich; Dubiley, Svetlana Alekseevna

1998-01-01

A method for enriching specific genetic material sequences is provided, whereby oligonucleotide molecules complementary to the desired genetic material is first used to isolate the genetic material from a first source of genomic material. Then the genetic material is used as a label to isolate similar genetic sequences from other sources.

Advanced surface-enhanced Raman gene probe systems and methods thereof

DOEpatents

Vo-Dinh, Tuan

2001-01-01

The subject invention is a series of methods and systems for using the Surface-Enhanced Raman (SER)-labeled Gene Probe for hybridization, detection and identification of SER-labeled hybridized target oligonucleotide material comprising the steps of immobilizing SER-labeled hybridized target oligonucleotide material on a support means, wherein the SER-labeled hybridized target oligonucleotide material comprise a SER label attached either to a target oligonucleotide of unknown sequence or to a gene probe of known sequence complementary to the target oligonucleotide sequence, the SER label is unique for the target oligonucleotide strands of a particular sequence wherein the SER-labeled oligonucleotide is hybridized to its complementary oligonucleotide strand, then the support means having the SER-labeled hybridized target oligonucleotide material adsorbed thereon is SERS activated with a SERS activating means, then the support means is analyzed.

Detection and prevention of mycoplasma hominis infection

DOEpatents

DelVecchio, Vito G.; Gallia, Gary L.; McCleskey, Ferne K.

1997-01-21

The present invention is directed to a rapid and sensitive method for detecting Mycoplasma hominis using M. hominis-specific probes, oligonucleotides or antibodies. In particular a target sequence can be amplified by in vitro nucleic acid amplification techniques, detected by nucleic acid hybridization using the subject probes and oligonucleotides or detected by immunoassay using M. hominis-specific antibodies. M. hominis-specific nucleic acids which do not recognize or hybridize to genomic nucleic acid of other Mycoplasma species are also provided.

Two cis elements collaborate to spatially repress transcription from a sea urchin promoter

NASA Technical Reports Server (NTRS)

Frudakis, T. N.; Wilt, F.

1995-01-01

The expression pattern of many territory-specific genes in metazoan embryos is maintained by an active process of negative spatial regulation. However, the mechanism of this strategy of gene regulation is not well understood in any system. Here we show that reporter constructs containing regulatory sequence for the SM30-alpha gene of Stronglyocentrotus purpuratus are expressed in a pattern congruent with that of the endogenous SM30 gene(s), largely as a result of active transcriptional repression in cell lineages in which the gene is not normally expressed. Chloramphenicol acetyl transferase assays of deletion constructs from the 2600-bp upstream region showed that repressive elements were present in the region from -1628 to -300. In situ hybridization analysis showed that the spatial fidelity of expression was severely compromised when the region from -1628 to -300 was deleted. Two highly repetitive sequence motifs, (G/A/C)CCCCT and (T/C)(T/A/C)CTTTT(T/A/C), are present in the -1628 to -300 region. Representatives of these elements were analyzed by gel mobility shift experiments and were found to interact specifically with protein in crude nuclear extracts. When oligonucleotides containing either sequence element were co-injected with a correctly regulated reporter as potential competitors, the reporter was expressed in inappropriate cells. When composite oligonucleotides, containing both sequence elements, were fused to a misregulated reporter, the expression of the reporter in inappropriate cells was suppressed. Comparison of composite oligonucleotides with oligonucleotides containing single constituent elements show that both sequence elements are required for effective spatial regulation. Thus, both individual elements are required, but only a composite element containing both elements is sufficient to function as a tissue-specific repressive element.

Alteration of hairpin ribozyme specificity utilizing PCR.

PubMed

DeGrandis, P; Hampel, A; Galasinski, S; Borneman, J; Siwkowski, A; Altschuler, M

1994-12-01

We have developed a method by which a researcher can quickly alter the specificity of a trans hairpin ribozyme. Utilizing this PCR method, two oligonucleotides, and any target vector, new ribozyme template sequences can be generated without the synthesis of longer oligonucleotides. We have produced templates with altered specificity for both standard and modified (larger) ribozymes. After transcription, these ribozymes show specific cleavage activity with the new substrate beta-glucuronidase (GUS), and no activity against the original substrate (HIV-1, 5' leader sequence). Utilizing this technique, it is also possible to produce an inactive ribozyme that can be used as an antisense control. Applications of this procedure would provide a rapid and economical system for the assessment of trans ribozyme activity.

Oligonucleotide gap-fill ligation for mutation detection and sequencing in situ

PubMed Central

Mignardi, Marco; Mezger, Anja; Qian, Xiaoyan; La Fleur, Linnea; Botling, Johan; Larsson, Chatarina; Nilsson, Mats

2015-01-01

In clinical diagnostics a great need exists for targeted in situ multiplex nucleic acid analysis as the mutational status can offer guidance for effective treatment. One well-established method uses padlock probes for mutation detection and multiplex expression analysis directly in cells and tissues. Here, we use oligonucleotide gap-fill ligation to further increase specificity and to capture molecular substrates for in situ sequencing. Short oligonucleotides are joined at both ends of a padlock gap probe by two ligation events and are then locally amplified by target-primed rolling circle amplification (RCA) preserving spatial information. We demonstrate the specific detection of the A3243G mutation of mitochondrial DNA and we successfully characterize a single nucleotide variant in the ACTB mRNA in cells by in situ sequencing of RCA products generated by padlock gap-fill ligation. To demonstrate the clinical applicability of our assay, we show specific detection of a point mutation in the EGFR gene in fresh frozen and formalin-fixed, paraffin-embedded (FFPE) lung cancer samples and confirm the detected mutation by in situ sequencing. This approach presents several advantages over conventional padlock probes allowing simpler assay design for multiplexed mutation detection to screen for the presence of mutations in clinically relevant mutational hotspots directly in situ. PMID:26240388

Effect on embryos of injection of phosphorothioate-modified oligonucleotides into pregnant mice.

PubMed

Gaudette, M F; Hampikian, G; Metelev, V; Agrawal, S; Crain, W R

1993-01-01

Phosphorothioate-modified oligonucleotides were injected into pregnant female mice to assess the effect on developing embryos. Injections were carried out during two different time periods, one when embryos were in preimplantation stages of development (about 3.5 days of development) and the other after implantation, when both a fetus and placenta are present (from days 9.5 to 11.5 of development). Three different phosphorothioate-modified oligonucleotides were injected. One, which had a sequence not present in the mouse genome, was used to ask whether nonspecific toxic or teratogenic effects on embryos result from treatment of the mother. A second was complementary to the mRNA of the testis-determining factor gene Sry and was used to ask whether a specific developmental pathway (i.e., sex determination) could be disrupted in embryos in vivo. The third was the complement of the anti-Sry sequence. None of these oligonucleotides reduced the frequency of successful pregnancy after mating or the average litter size from that observed in controls animals. Furthermore, examination of 291 pups or fetuses from all oligonucleotide-injected pregnant females revealed no developmental defects regardless of which sequence was used. It is concluded that injection of phosphorothioate-modified oligonucleotides into pregnant females according to the protocols described here is not toxic or teratogenic to embryos in a nonspecific way. Also, anti-Sry oligonucleotides did not influence sex determination in embryos, although there are several possible explanations for this.

Development of an oligonucleotide probe for Aureobasidium pullulans based on the small-subunit rRNA gene.

PubMed Central

Li, S; Cullen, D; Hjort, M; Spear, R; Andrews, J H

1996-01-01

Aureobasidium pullulans, a cosmopolitan yeast-like fungus, colonizes leaf surfaces and has potential as a biocontrol agent of pathogens. To assess the feasibility of rRNA as a target for A. pullulans-specific oligonucleotide probes, we compared the nucleotide sequences of the small-subunit rRNA (18S) genes of 12 geographically diverse A. pullulans strains. Extreme sequence conservation was observed. The consensus A. pullulans sequence was compared with other fungal sequences to identify potential probes. A 21-mer probe which hybridized to the 12 A. pullulans strains but not to 98 other fungi, including 82 isolates from the phylloplane, was identified. A 17-mer highly specific for Cladosporium herbarum was also identified. These probes have potential in monitoring and quantifying fungi in leaf surface and other microbial communities. PMID:8633850

Universal Oligonucleotide Microarray for Sub-Typing of Influenza A Virus

PubMed Central

Ryabinin, Vladimir A.; Kostina, Elena V.; Maksakova, Galiya A.; Neverov, Alexander A.; Chumakov, Konstantin M.; Sinyakov, Alexander N.

2011-01-01

A universal microchip was developed for genotyping Influenza A viruses. It contains two sets of oligonucleotide probes allowing viruses to be classified by the subtypes of hemagglutinin (H1–H13, H15, H16) and neuraminidase (N1–N9). Additional sets of probes are used to detect H1N1 swine influenza viruses. Selection of probes was done in two steps. Initially, amino acid sequences specific to each subtype were identified, and then the most specific and representative oligonucleotide probes were selected. Overall, between 19 and 24 probes were used to identify each subtype of hemagglutinin (HA) and neuraminidase (NA). Genotyping included preparation of fluorescently labeled PCR amplicons of influenza virus cDNA and their hybridization to microarrays of specific oligonucleotide probes. Out of 40 samples tested, 36 unambiguously identified HA and NA subtypes of Influenza A virus. PMID:21559081

In vitro selection using a dual RNA library that allows primerless selection

PubMed Central

Jarosch, Florian; Buchner, Klaus; Klussmann, Sven

2006-01-01

High affinity target-binding aptamers are identified from random oligonucleotide libraries by an in vitro selection process called Systematic Evolution of Ligands by EXponential enrichment (SELEX). Since the SELEX process includes a PCR amplification step the randomized region of the oligonucleotide libraries need to be flanked by two fixed primer binding sequences. These primer binding sites are often difficult to truncate because they may be necessary to maintain the structure of the aptamer or may even be part of the target binding motif. We designed a novel type of RNA library that carries fixed sequences which constrain the oligonucleotides into a partly double-stranded structure, thereby minimizing the risk that the primer binding sequences become part of the target-binding motif. Moreover, the specific design of the library including the use of tandem RNA Polymerase promoters allows the selection of oligonucleotides without any primer binding sequences. The library was used to select aptamers to the mirror-image peptide of ghrelin. Ghrelin is a potent stimulator of growth-hormone release and food intake. After selection, the identified aptamer sequences were directly synthesized in their mirror-image configuration. The final 44 nt-Spiegelmer, named NOX-B11-3, blocks ghrelin action in a cell culture assay displaying an IC50 of 4.5 nM at 37°C. PMID:16855281

Introduction on Using the FastPCR Software and the Related Java Web Tools for PCR and Oligonucleotide Assembly and Analysis.

PubMed

Kalendar, Ruslan; Tselykh, Timofey V; Khassenov, Bekbolat; Ramanculov, Erlan M

2017-01-01

This chapter introduces the FastPCR software as an integrated tool environment for PCR primer and probe design, which predicts properties of oligonucleotides based on experimental studies of the PCR efficiency. The software provides comprehensive facilities for designing primers for most PCR applications and their combinations. These include the standard PCR as well as the multiplex, long-distance, inverse, real-time, group-specific, unique, overlap extension PCR for multi-fragments assembling cloning and loop-mediated isothermal amplification (LAMP). It also contains a built-in program to design oligonucleotide sets both for long sequence assembly by ligase chain reaction and for design of amplicons that tile across a region(s) of interest. The software calculates the melting temperature for the standard and degenerate oligonucleotides including locked nucleic acid (LNA) and other modifications. It also provides analyses for a set of primers with the prediction of oligonucleotide properties, dimer and G/C-quadruplex detection, linguistic complexity as well as a primer dilution and resuspension calculator. The program consists of various bioinformatical tools for analysis of sequences with the GC or AT skew, CG% and GA% content, and the purine-pyrimidine skew. It also analyzes the linguistic sequence complexity and performs generation of random DNA sequence as well as restriction endonucleases analysis. The program allows to find or create restriction enzyme recognition sites for coding sequences and supports the clustering of sequences. It performs efficient and complete detection of various repeat types with visual display. The FastPCR software allows the sequence file batch processing that is essential for automation. The program is available for download at http://primerdigital.com/fastpcr.html , and its online version is located at http://primerdigital.com/tools/pcr.html .

A Targeted Oligonucleotide Enhancer of SMN2 Exon 7 Splicing Forms Competing Quadruplex and Protein Complexes in Functional Conditions

PubMed Central

Smith, Lindsay D.; Dickinson, Rachel L.; Lucas, Christian M.; Cousins, Alex; Malygin, Alexey A.; Weldon, Carika; Perrett, Andrew J.; Bottrill, Andrew R.; Searle, Mark S.; Burley, Glenn A.; Eperon, Ian C.

2014-01-01

Summary The use of oligonucleotides to activate the splicing of selected exons is limited by a poor understanding of the mechanisms affected. A targeted bifunctional oligonucleotide enhancer of splicing (TOES) anneals to SMN2 exon 7 and carries an exonic splicing enhancer (ESE) sequence. We show that it stimulates splicing specifically of intron 6 in the presence of repressing sequences in intron 7. Complementarity to the 5′ end of exon 7 increases U2AF65 binding, but the ESE sequence is required for efficient recruitment of U2 snRNP. The ESE forms at least three coexisting discrete states: a quadruplex, a complex containing only hnRNP F/H, and a complex enriched in the activator SRSF1. Neither hnRNP H nor quadruplex formation contributes to ESE activity. The results suggest that splicing limited by weak signals can be rescued by rapid exchange of TOES oligonucleotides in various complexes and raise the possibility that SR proteins associate transiently with ESEs. PMID:25263560

Enrichment of individual KIR2DL4 sequences from genomic DNA using long-template PCR and allele-specific hybridization to magnetic bead-bound oligonucleotide probes.

PubMed

Roberts, C H; Turino, C; Madrigal, J A; Marsh, S G E

2007-06-01

DNA enrichment by allele-specific hybridization (DEASH) was used as a means to isolate individual alleles of the killer cell immunoglobulin-like receptor (KIR2DL4) gene from heterozygous genomic DNA. Using long-template polymerase chain reaction (LT-PCR), the complete KIR2DL4 gene was amplified from a cell line that had previously been characterized for its KIR gene content by PCR using sequence-specific primers (PCR-SSP). The whole gene amplicons were sequenced and we identified two heterozygous positions in accordance with the predictions of the PCR-SSP. The amplicons were then hybridized to allele-specific, biotinylated oligonucleotide probes and through binding to streptavidin-coated beads, the targeted alleles were enriched. A second PCR amplified only the exonic regions of the enriched allele, and these were then sequenced in full. We show DEASH to be capable of enriching single alleles from a heterozygous PCR product, and through sequencing the enriched DNA, we are able to produce complete coding sequences of the KIR2DL4 alleles in accordance with the typing predicted by PCR-SSP.

RNA therapeutics: Beyond RNA interference and antisense oligonucleotides

PubMed Central

Kole, Ryszard; Krainer, Adrian R.; Altman, Sidney

2016-01-01

Here we discuss three RNA therapeutic technologies exploiting various oligonucleotides that bind RNA by base-pairing in a sequence-specific manner yet have different mechanisms of action and effects. RNA interference and antisense oligonucleotides downregulate gene expression by enzyme-dependent degradation of targeted mRNA. Steric blocking oligonucleotides block access of cellular machinery to pre-mRNA and mRNA without degrading the RNA. Through this mechanism, blocking oligonucleotides can redirect alternative splicing, repair defective RNA, restore protein production or also downregulate gene expression. Moreover, they can be extensively chemically modified, resulting in more drug-like properties. The ability of RNA blocking oligonucleotides to restore gene function makes them suited for treatment of genetic disorders. Positive results from clinical trials for the treatment of Duchenne muscular dystrophy show that this technology is close to realizing its clinical potential. PMID:22262036

Therapeutic Oligonucleotides Targeting Liver Disease: TTR Amyloidosis.

PubMed

Niemietz, Christoph; Chandhok, Gursimran; Schmidt, Hartmut

2015-09-30

The liver has become an increasingly interesting target for oligonucleotide therapy. Mutations of the gene encoding transthyretin (TTR), expressed in vast amounts by the liver, result in a complex degenerative disease, termed familial amyloid polyneuropathy (FAP). Misfolded variants of TTR are linked to the establishment of extracellular protein deposition in various tissues, including the heart and the peripheral nervous system. Recent progress in the chemistry and formulation of antisense (ASO) and small interfering RNA (siRNA) designed for a knockdown of TTR mRNA in the liver has allowed to address the issue of gene-specific molecular therapy in a clinical setting of FAP. The two therapeutic oligonucleotides bind to RNA in a sequence specific manner but exploit different mechanisms. Here we describe major developments that have led to the advent of therapeutic oligonucleotides for treatment of TTR-related disease.

[Oligonucleotide derivatives in the nucleic acid hybridization analysis. I. Covalent immobilization of oligonucleotide probes onto the nylon].

PubMed

Dmitrienko, E V; Pyshnaia, I A; Pyshnyĭ, D V

2010-01-01

The features of UV-induced immobilization of oligonucleotides on a nylon membranes and the effectiveness of enzymatic labeling of immobilized probes at heterophase detection of nucleic acids are studied. Short terminal oligothymidilate (up to 10 nt) sequences are suggested to attach to the probe via a flexible ethylene glycol based linker. The presence of such fragment enhances the intensity of immobilization and reduces UV-dependent degradation of the targeted (sequence-specific) part of the probe by reducing the dose needed for the immobilization of DNA. The optimum dose of UV-irradiation is determined to be ~0.4 J/cm(2) at the wavelength 254 nm. This dose provides high level of hybridization signal for immobilized probes with various nucleotide composition of the sequence specific moiety. The amide groups of the polyamide are shown to play the key role in the photoinduced immobilization of nucleic acids, whereas the primary amino groups in the structure of PA is not the center responsible for the covalent binding of DNA by UV-irradiation, as previously believed. Various additives in the soaking solution during the membrane of UV-dependent immobilization of probes are shown to influence its effectiveness. The use of alternative to UV-irradiation system of radical generation are shown to provide the immobilization of oligonucleotides onto the nylon membrane.

Oligonucleotides as antivirals: dream or realistic perspective?

PubMed

Van Aerschot, Arthur

2006-09-01

Many reports have been published on antiviral activity of synthetic oligonucleotides, targeted to act either by a true antisense effect or via non-sequence specific interactions. This short review will try to evaluate the current status of the field by focusing on the effects as reported for inhibition of either HSV-1, HCMV or HIV-1. Following an introduction with a historical background and a brief discussion on the different types of constructs and mechanisms of action, the therapeutic potential of antisense oligonucleotides as antivirals, as well as possible pitfalls upon their evaluation will be discussed.

Triple helix-forming oligonucleotide corresponding to the polypyrimidine sequence in the rat alpha 1(I) collagen promoter specifically inhibits factor binding and transcription.

PubMed

Kovacs, A; Kandala, J C; Weber, K T; Guntaka, R V

1996-01-19

Type I and III fibrillar collagens are the major structural proteins of the extracellular matrix found in various organs including the myocardium. Abnormal and progressive accumulation of fibrillar type I collagen in the interstitial spaces compromises organ function and therefore, the study of transcriptional regulation of this gene and specific targeting of its expression is of major interest. Transient transfection of adult cardiac fibroblasts indicate that the polypurine-polypyrimidine sequence of alpha 1(I) collagen promoter between nucleotides - 200 and -140 represents an overall positive regulatory element. DNase I footprinting and electrophoretic mobility shift assays suggest that multiple factors bind to different elements of this promoter region. We further demonstrate that the unique polypyrimidine sequence between -172 and -138 of the promoter represents a suitable target for a single-stranded polypurine oligonucleotide (TFO) to form a triple helix DNA structure. Modified electrophoretic mobility shift assays show that this TFO specifically inhibits the protein-DNA interaction within the target region. In vitro transcription assays and transient transfection experiments demonstrate that the transcriptional activity of the promoter is inhibited by this oligonucleotide. We propose that TFOs represent a therapeutic potential to specifically influence the expression of alpha 1(I) collagen gene in various disease states where abnormal type I collagen accumulation is known to occur.

In vitro transcription in the presence of DNA oligonucleotides can generate strong anomalous initiation sites.

PubMed

Chow, C W; Clark, M P; Rinaldo, J E; Chalkley, R

1996-03-01

In the present study, we have explored an unexpected observation in transcription initiation that is mediated by single-stranded oligonucleotides. Initially, our goal was to understand the function of different upstream regulatory elements/initiation sites in the rat xanthine dehydrogenase/oxidase (XDH/XO) promoter. We performed in vitro transcription with HeLa nuclear extracts in the presence of different double-stranded oligonucleotides against upstream elements as competitors. A new and unusual transcription initiation site was detected by primer extension. This new initiation site maps to the downstream region of the corresponding competitor. Subsequent analyses have indicated that the induction of a new transcription initiation site is anomalous which is due to the presence of a small amount of single-stranded oligonucleotide in the competitor. We found that this anomalous initiation site is insensitive to the orientation of the promoter and requires only a small amount of single-stranded oligonucleotide (< 2-fold molar excess relative to template). We surmise that a complementary interaction between the single-stranded oligonucleotide and transiently denatured promoter template may be responsible for this sequence-specific transcription initiation artifact. To study the regulation of transcription initiation by in vitro transcription approaches, we propose that one should probe the effect of removing transacting factors by adding an excess of a cognate oligonucleotide which does not bear exact sequence identity to the template.

miRNA-based therapies: Strategies and delivery platforms for oligonucleotide and non-oligonucleotide agents

PubMed Central

Baumann, V; Winkler, J

2015-01-01

The discovery of microRNAs as important regulatory agents for gene expression has expanded the therapeutic opportunities for oligonucleotides. In contrast to siRNA, miRNA-targeted therapy is able to influence not only a single gene, but entire cellular pathways or processes. It is possible to supplement down regulated or non-functional miRNAs by synthetic oligonucleotides, as well as alleviating effects caused by overexpression of malignant miRNAs through artificial antagonists, either oligonucleotides or small molecules. Chemical oligonucleotide modifications together with an efficient delivery system seem to be mandatory for successful therapeutic application. While miRNA-based therapy benefits from the decades of research spent on other therapeutic oligonucleotides, there are some specific challenges associated with miRNA therapy, mainly caused by the short target sequence. The current status and recent progress of miRNA-targeted therapeutics is described and future challenges and potential applications in treatment of cancer and viral infections are discussed. PMID:25495987

A Novel Bioinformatics Strategy to Analyze Microbial Big Sequence Data for Efficient Knowledge Discovery: Batch-Learning Self-Organizing Map (BLSOM).

PubMed

Iwasaki, Yuki; Abe, Takashi; Wada, Kennosuke; Wada, Yoshiko; Ikemura, Toshimichi

2013-11-20

With the remarkable increase of genomic sequence data of microorganisms, novel tools are needed for comprehensive analyses of the big sequence data available. The self-organizing map (SOM) is an effective tool for clustering and visualizing high-dimensional data, such as oligonucleotide composition on one map. By modifying the conventional SOM, we developed batch-learning SOM (BLSOM), which allowed classification of sequence fragments (e.g., 1 kb) according to phylotypes, solely depending on oligonucleotide composition. Metagenomics studies of uncultivable microorganisms in clinical and environmental samples should allow extensive surveys of genes important in life sciences. BLSOM is most suitable for phylogenetic assignment of metagenomic sequences, because fragmental sequences can be clustered according to phylotypes, solely depending on oligonucleotide composition. We first constructed oligonucleotide BLSOMs for all available sequences from genomes of known species, and by mapping metagenomic sequences on these large-scale BLSOMs, we can predict phylotypes of individual metagenomic sequences, revealing a microbial community structure of uncultured microorganisms, including viruses. BLSOM has shown that influenza viruses isolated from humans and birds clearly differ in oligonucleotide composition. Based on this host-dependent oligonucleotide composition, we have proposed strategies for predicting directional changes of virus sequences and for surveilling potentially hazardous strains when introduced into humans from non-human sources.

Retention of nucleic acids in ion-pair reversed-phase high-performance liquid chromatography depends not only on base composition but also on base sequence.

PubMed

Qiao, Jun-Qin; Liang, Chao; Wei, Lan-Chun; Cao, Zhao-Ming; Lian, Hong-Zhen

2016-12-01

The study on nucleic acid retention in ion-pair reversed-phase high-performance liquid chromatography mainly focuses on size-dependence, however, other factors influencing retention behaviors have not been comprehensively clarified up to date. In this present work, the retention behaviors of oligonucleotides and double-stranded DNAs were investigated on silica-based C 18 stationary phase by ion-pair reversed-phase high-performance liquid chromatography. It is found that the retention of oligonucleotides was influenced by base composition and base sequence as well as size, and oligonucleotides prone to self-dimerization have weaker retention than those not prone to self-dimerization but with the same base composition. However, homo-oligonucleotides are suitable for the size-dependent separation as a special case of oligonucleotides. For double-stranded DNAs, the retention is also influenced by base composition and base sequence, as well as size. This may be attributed to the interaction of exposed bases in major or minor grooves with the hydrophobic alky chains of stationary phase. In addition, no specific influence of guanine and cytosine content was confirmed on retention of double-stranded DNAs. Notably, the space effect resulted from the stereostructure of nucleic acids also influences the retention behavior in ion-pair reversed-phase high-performance liquid chromatography. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Regulation of the activity of the promoter of RNA-induced silencing, C3PO.

PubMed

Sahu, Shriya; Williams, Leo; Perez, Alberto; Philip, Finly; Caso, Giuseppe; Zurawsky, Walter; Scarlata, Suzanne

2017-09-01

RNA-induced silencing is a process which allows cells to regulate the synthesis of specific proteins. RNA silencing is promoted by the protein C3PO (component 3 of RISC). We have previously found that phospholipase Cβ, which increases intracellular calcium levels in response to specific G protein signals, inhibits C3PO activity towards certain genes. Understanding the parameters that control C3PO activity and which genes are impacted by G protein activation would help predict which genes are more vulnerable to downregulation. Here, using a library of 10 18 oligonucleotides, we show that C3PO binds oligonucleotides with structural specificity but little sequence specificity. Alternately, C3PO hydrolyzes oligonucleotides with a rate that is sensitive to substrate stability. Importantly, we find that oligonucleotides with higher Tm values are inhibited by bound PLCβ. This finding is supported by microarray analysis in cells over-expressing PLCβ1. Taken together, this study allows predictions of the genes whose post-transcriptional regulation is responsive to the G protein/phospholipase Cβ/calcium signaling pathway. © 2017 The Protein Society.

Chemical synthesis and characterization of branched oligodeoxyribonucleotides (bDNA) for use as signal amplifiers in nucleic acid quantification assays.

PubMed

Horn, T; Chang, C A; Urdea, M S

1997-12-01

The divergent synthesis of bDNA structures is described. This new type of branched DNA contains one unique oligonucleotide, the primary sequence, covalently attached through a comb-like branching network to many identical copies of a different oligonucleotide, the secondary sequence. The bDNA comb molecules were assembled on a solid support using parameters optimized for bDNA synthesis. The chemistry was used to synthesize bDNA comb molecules containing 15 secondary sequences. The bDNA comb molecules were elaborated by enzymatic ligation into branched amplification multimers, large bDNA molecules (a total of 1068 nt) containing an average of 36 repeated DNA oligomer sequences, each capable of hybridizing specifically to an alkaline phosphatase-labeled oligonucleotide. The bDNA comb molecules were characterized by electrophoretic methods and by controlled cleavage at periodate-cleavable moieties incorporated during synthesis. The branched amplification multimers have been used as signal amplifiers in nucleic acid quantification assays for detection of viral infection. It is possible to detect as few as 50 molecules with bDNA technology.

Chemical synthesis and characterization of branched oligodeoxyribonucleotides (bDNA) for use as signal amplifiers in nucleic acid quantification assays.

PubMed Central

Horn, T; Chang, C A; Urdea, M S

1997-01-01

The divergent synthesis of bDNA structures is described. This new type of branched DNA contains one unique oligonucleotide, the primary sequence, covalently attached through a comb-like branching network to many identical copies of a different oligonucleotide, the secondary sequence. The bDNA comb molecules were assembled on a solid support using parameters optimized for bDNA synthesis. The chemistry was used to synthesize bDNA comb molecules containing 15 secondary sequences. The bDNA comb molecules were elaborated by enzymatic ligation into branched amplification multimers, large bDNA molecules (a total of 1068 nt) containing an average of 36 repeated DNA oligomer sequences, each capable of hybridizing specifically to an alkaline phosphatase-labeled oligonucleotide. The bDNA comb molecules were characterized by electrophoretic methods and by controlled cleavage at periodate-cleavable moieties incorporated during synthesis. The branched amplification multimers have been used as signal amplifiers in nucleic acid quantification assays for detection of viral infection. It is possible to detect as few as 50 molecules with bDNA technology. PMID:9365266

Chemical synthesis of oligonucleotides containing a free sulphydryl group and subsequent attachment of thiol specific probes.

PubMed Central

Connolly, B A; Rider, P

1985-01-01

Oligonucleotides containing a free sulphydryl group at their 5'-termini have been synthesised and further derivatised with thiol specific probes. The nucleotide sequence required is prepared using standard solid phase phosphoramidite techniques and an extra round of synthesis is then performed using the S-triphenylmethyl O-methoxymorpholinophosphite derivatives of 2-mercaptoethanol, 3-mercaptopropan (1) ol or 6-mercaptohexan (1) ol. After cleavage from the resin and removal of the phosphate and base protecting groups, this yields an oligonucleotide containing an S-triphenylmethyl group attached to the 5'-phosphate group via a two, three or six carbon chain. The triphenylmethyl group can be readily removed with silver nitrate to give the free thiol. With the three and six carbon chain oligonucleotides, this thiol can be used, at pH 8, for the attachment of thiol specific probes as illustrated by the reaction with fluorescent conjugates of iodoacetates and maleiimides. However, oligonucleotides containing a thiol attached to the 5'-phosphate group via a two carbon chain are unstable at pH 8 decomposing to the free 5'-phosphate and so are unsuitable for further derivatisation. PMID:4011448

Biological and molecular characterization of cellular differentiation in Tetrahymena vorax: a potential biocontrol protozoan.

PubMed

Green, M M; LeBoeuf, R D; Churchill, P F

2000-01-01

Tetrahymena vorax (T. vorax) is an indigenous fresh water protozoan with the natural biological potential to maintain a specific aquatic microbial flora by ingesting and eliminating specific microorganism. To investigate the molecular mechanisms controlling Tetrahymena vorax (T. vorax) cellular differentiation from a small-mouth vegetative cell to a voracious large-mouth carnivore capable of ingesting prey ciliates and bacteria from aquatic environments, we use DNA subtraction and gene discovery techniques to identify and isolate T. vorax differentiation-specific genes. The physiological necessity for one newly discovered gene, SUBII-TG, was determined in vivo using an antisense oligonucleotide directed against the 5' SUBII-TG DNA sequence. The barriers to delivering antisense oligonucleotides to the cytoplasm of T. vorax were circumvented by employing a new but simple procedure of processing the oligonucleotide with the differentiation stimulus, stomatin. In these studies, the antisense oligonucleotide down-regulated SUBII-TG mRNA expression, and blocked differentiation and ingestion of prey ciliates. The ability to down-regulate SUBII-TG expression with the antisense oligonucleotide suggests that the molecular mechanisms controlling the natural biological activities of T. vorax can be manipulated to further study its cellular differentiation and potential as a biocontrol microorganism.

Depletion of Unwanted Nucleic Acid Templates by Selective Cleavage: LNAzymes, Catalytically Active Oligonucleotides Containing Locked Nucleic Acids, Open a New Window for Detecting Rare Microbial Community Members

PubMed Central

Dolinšek, Jan; Dorninger, Christiane; Lagkouvardos, Ilias; Wagner, Michael

2013-01-01

Many studies of molecular microbial ecology rely on the characterization of microbial communities by PCR amplification, cloning, sequencing, and phylogenetic analysis of genes encoding rRNAs or functional marker enzymes. However, if the established clone libraries are dominated by one or a few sequence types, the cloned diversity is difficult to analyze by random clone sequencing. Here we present a novel approach to deplete unwanted sequence types from complex nucleic acid mixtures prior to cloning and downstream analyses. It employs catalytically active oligonucleotides containing locked nucleic acids (LNAzymes) for the specific cleavage of selected RNA targets. When combined with in vitro transcription and reverse transcriptase PCR, this LNAzyme-based technique can be used with DNA or RNA extracts from microbial communities. The simultaneous application of more than one specific LNAzyme allows the concurrent depletion of different sequence types from the same nucleic acid preparation. This new method was evaluated with defined mixtures of cloned 16S rRNA genes and then used to identify accompanying bacteria in an enrichment culture dominated by the nitrite oxidizer “Candidatus Nitrospira defluvii.” In silico analysis revealed that the majority of publicly deposited rRNA-targeted oligonucleotide probes may be used as specific LNAzymes with no or only minor sequence modifications. This efficient and cost-effective approach will greatly facilitate tasks such as the identification of microbial symbionts in nucleic acid preparations dominated by plastid or mitochondrial rRNA genes from eukaryotic hosts, the detection of contaminants in microbial cultures, and the analysis of rare organisms in microbial communities of highly uneven composition. PMID:23263968

Oligonucleotide recombination enabled site-specific mutagenesis in bacteria

USDA-ARS?s Scientific Manuscript database

Recombineering refers to a strategy for engineering DNA sequences using a specialized mode of homologous recombination. This technology can be used for rapidly constructing precise changes in bacterial genome sequences in vivo. Oligo recombination is one type of recombineering that uses ssDNA olig...

Genome-wide inference of transcription factor-DNA binding specificity in cell regeneration using a combination strategy.

PubMed

Wang, Xiaofeng; Zhang, Aiqun; Ren, Weizheng; Chen, Caiyu; Dong, Jiahong

2012-11-01

The cell growth, development, and regeneration of tissue and organ are associated with a large number of gene regulation events, which are mediated in part by transcription factors (TFs) binding to cis-regulatory elements involved in the genome. Predicting the binding affinity and inferring the binding specificity of TF-DNA interactions at the genomic level would be fundamentally helpful for our understanding of the molecular mechanism and biological implication underlying sequence-specific TF-DNA recognition. In this study, we report the development of a combination method to characterize the interaction behavior of a 11-mer oligonucleotide segment and its mutations with the Gcn4p protein, a homodimeric, basic leucine zipper TF, and to predict the binding affinity and specificity of potential Gcn4p binders in the genome-wide scale. In this procedure, a position-mutated energy matrix is created based on molecular modeling analysis of native and mutated Gcn4p-DNA complex structures to describe the position-independent interaction energy profile of Gcn4p with different nucleotide types at each position of the oligonucleotide, and the energy terms extracted from the matrix and their interactives are then correlated with experimentally measured affinities of 19268 distinct oligonucleotides using statistical modeling methodology. Subsequently, the best one of built regression models is successfully applied to screen those of potential high-affinity Gcn4p binders from the complete genome. The findings arising from this study are briefly listed below: (i) The 11 positions of oligonucleotides are highly interactive and non-additive in contribution to Gcn4p-DNA binding affinity; (ii) Indirect conformational effects upon nucleotide mutations as well as associated subtle changes in interfacial atomic contacts, but not the direct nonbonded interactions, are primarily responsible for the sequence-specific recognition; (iii) The intrinsic synergistic effects among the sequence positions of oligonucleotides determine Gcn4p-DNA binding affinity and specificity; (iv) Linear regression models in conjunction with variable selection seem to perform fairly well in capturing the internal dependences hidden in the Gcn4p-DNA system, albeit ignoring nonlinear factors may lead the models to systematically underestimate and overestimate high- and low-affinity samples, respectively. © 2012 John Wiley & Sons A/S.

TIA-1 RRM23 binding and recognition of target oligonucleotides

PubMed Central

Waris, Saboora; García-Mauriño, Sofía M.; Sivakumaran, Andrew; Beckham, Simone A.; Loughlin, Fionna E.; Gorospe, Myriam; Díaz-Moreno, Irene; Wilce, Matthew C.J.

2017-01-01

Abstract TIA-1 (T-cell restricted intracellular antigen-1) is an RNA-binding protein involved in splicing and translational repression. It mainly interacts with RNA via its second and third RNA recognition motifs (RRMs), with specificity for U-rich sequences directed by RRM2. It has recently been shown that RRM3 also contributes to binding, with preferential binding for C-rich sequences. Here we designed UC-rich and CU-rich 10-nt sequences for engagement of both RRM2 and RRM3 and demonstrated that the TIA-1 RRM23 construct preferentially binds the UC-rich RNA ligand (5΄-UUUUUACUCC-3΄). Interestingly, this binding depends on the presence of Lys274 that is C-terminal to RRM3 and binding to equivalent DNA sequences occurs with similar affinity. Small-angle X-ray scattering was used to demonstrate that, upon complex formation with target RNA or DNA, TIA-1 RRM23 adopts a compact structure, showing that both RRMs engage with the target 10-nt sequences to form the complex. We also report the crystal structure of TIA-1 RRM2 in complex with DNA to 2.3 Å resolution providing the first atomic resolution structure of any TIA protein RRM in complex with oligonucleotide. Together our data support a specific mode of TIA-1 RRM23 interaction with target oligonucleotides consistent with the role of TIA-1 in binding RNA to regulate gene expression. PMID:28184449

TIA-1 RRM23 binding and recognition of target oligonucleotides.

PubMed

Waris, Saboora; García-Mauriño, Sofía M; Sivakumaran, Andrew; Beckham, Simone A; Loughlin, Fionna E; Gorospe, Myriam; Díaz-Moreno, Irene; Wilce, Matthew C J; Wilce, Jacqueline A

2017-05-05

TIA-1 (T-cell restricted intracellular antigen-1) is an RNA-binding protein involved in splicing and translational repression. It mainly interacts with RNA via its second and third RNA recognition motifs (RRMs), with specificity for U-rich sequences directed by RRM2. It has recently been shown that RRM3 also contributes to binding, with preferential binding for C-rich sequences. Here we designed UC-rich and CU-rich 10-nt sequences for engagement of both RRM2 and RRM3 and demonstrated that the TIA-1 RRM23 construct preferentially binds the UC-rich RNA ligand (5΄-UUUUUACUCC-3΄). Interestingly, this binding depends on the presence of Lys274 that is C-terminal to RRM3 and binding to equivalent DNA sequences occurs with similar affinity. Small-angle X-ray scattering was used to demonstrate that, upon complex formation with target RNA or DNA, TIA-1 RRM23 adopts a compact structure, showing that both RRMs engage with the target 10-nt sequences to form the complex. We also report the crystal structure of TIA-1 RRM2 in complex with DNA to 2.3 Å resolution providing the first atomic resolution structure of any TIA protein RRM in complex with oligonucleotide. Together our data support a specific mode of TIA-1 RRM23 interaction with target oligonucleotides consistent with the role of TIA-1 in binding RNA to regulate gene expression. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

Arrays of nucleic acid probes on biological chips

DOEpatents

Chee, Mark; Cronin, Maureen T.; Fodor, Stephen P. A.; Huang, Xiaohua X.; Hubbell, Earl A.; Lipshutz, Robert J.; Lobban, Peter E.; Morris, MacDonald S.; Sheldon, Edward L.

1998-11-17

DNA chips containing arrays of oligonucleotide probes can be used to determine whether a target nucleic acid has a nucleotide sequence identical to or different from a specific reference sequence. The array of probes comprises probes exactly complementary to the reference sequence, as well as probes that differ by one or more bases from the exactly complementary probes.

Generation of Aptamers from A Primer-Free Randomized ssDNA Library Using Magnetic-Assisted Rapid Aptamer Selection

NASA Astrophysics Data System (ADS)

Tsao, Shih-Ming; Lai, Ji-Ching; Horng, Horng-Er; Liu, Tu-Chen; Hong, Chin-Yih

2017-04-01

Aptamers are oligonucleotides that can bind to specific target molecules. Most aptamers are generated using random libraries in the standard systematic evolution of ligands by exponential enrichment (SELEX). Each random library contains oligonucleotides with a randomized central region and two fixed primer regions at both ends. The fixed primer regions are necessary for amplifying target-bound sequences by PCR. However, these extra-sequences may cause non-specific bindings, which potentially interfere with good binding for random sequences. The Magnetic-Assisted Rapid Aptamer Selection (MARAS) is a newly developed protocol for generating single-strand DNA aptamers. No repeat selection cycle is required in the protocol. This study proposes and demonstrates a method to isolate aptamers for C-reactive proteins (CRP) from a randomized ssDNA library containing no fixed sequences at 5‧ and 3‧ termini using the MARAS platform. Furthermore, the isolated primer-free aptamer was sequenced and binding affinity for CRP was analyzed. The specificity of the obtained aptamer was validated using blind serum samples. The result was consistent with monoclonal antibody-based nephelometry analysis, which indicated that a primer-free aptamer has high specificity toward targets. MARAS is a feasible platform for efficiently generating primer-free aptamers for clinical diagnoses.

[Oligonucleotide microarray for subtyping avian influenza virus].

PubMed

Xueqing, Han; Xiangmei, Lin; Yihong, Hou; Shaoqiang, Wu; Jian, Liu; Lin, Mei; Guangle, Jia; Zexiao, Yang

2008-09-01

Avian influenza viruses are important human and animal respiratory pathogens and rapid diagnosis of novel emerging avian influenza viruses is vital for effective global influenza surveillance. We developed an oligonucleotide microarray-based method for subtyping all avian influenza virus (16 HA and 9 NA subtypes). In total 25 pairs of primers specific for different subtypes and 1 pair of universal primers were carefully designed based on the genomic sequences of influenza A viruses retrieved from GenBank database. Several multiplex RT-PCR methods were then developed, and the target cDNAs of 25 subtype viruses were amplified by RT-PCR or overlapping PCR for evaluating the microarray. Further 52 oligonucleotide probes specific for all 25 subtype viruses were designed according to published gene sequences of avian influenza viruses in amplified target cDNAs domains, and a microarray for subtyping influenza A virus was developed. Then its specificity and sensitivity were validated by using different subtype strains and 2653 samples from 49 different areas. The results showed that all the subtypes of influenza virus could be identified simultaneously on this microarray with high sensitivity, which could reach to 2.47 pfu/mL virus or 2.5 ng target DNA. Furthermore, there was no cross reaction with other avian respiratory virus. An oligonucleotide microarray-based strategy for detection of avian influenza viruses has been developed. Such a diagnostic microarray will be useful in discovering and identifying all subtypes of avian influenza virus.

Derivatized versions of ligase enzymes for constructing DNA sequences

DOEpatents

Mariella, Jr., Raymond P.; Christian, Allen T [Tracy, CA; Tucker, James D [Novi, MN; Dzenitis, John M [Livermore, CA; Papavasiliou, Alexandros P [Oakland, CA

2006-08-15

A method of making very long, double-stranded synthetic poly-nucleotides. A multiplicity of short oligonucleotides is provided. The short oligonucleotides are sequentially hybridized to each other. Enzymatic ligation of the oligonucleotides provides a contiguous piece of PCR-ready DNA of predetermined sequence.

Definition of Cis-Acting Elements Regulating Expression of the Drosophila Melanogaster Ninae Opsin Gene by Oligonucleotide-Directed Mutagenesis

PubMed Central

Mismer, D.; Rubin, G. M.

1989-01-01

We have analyzed the cis-acting regulatory sequences of the Rh1 (ninaE) gene in Drosophila melanogaster by P-element-mediated germline transformation of indicator genes transcribed from mutant ninaE promoter sequences. We have previously shown that a 200-bp region extending from -120 to +67 relative to the transcription start site is sufficient to obtain eye-specific expression from the ninaE promoter. In the present study, 22 different 4-13-bp sequences in the -120/+67 promoter region were altered by oligonucleotide-directed mutagenesis. Several of these sequences were found to be required for proper promoter function; two of these are conserved in the promoter of the homologous gene isolated from the related species Drosophila virilis. Alteration of a conserved 9-bp sequence results in aberrant, low level expression in the body. Alteration of a separate 11-bp sequence, found in the promoter regions of several photoreceptor-specific genes of Drosophila, results in an approximately 15-fold reduction in promoter efficiency but without apparent alteration of tissue-specificity. A protein factor capable of interacting with this 11-bp sequence has been detected by DNaseI footprinting in embryonic nuclear extracts. Finally, we have further characterized two separable enhancer sequences previously shown to be required for normal levels of expression from this promoter. PMID:2521839

Decoy Oligonucleotide Rescues IGF1R Expression from MicroRNA-223 Suppression

PubMed Central

Wang, Rong; He, Bao Mei; Qi, Bing; Xu, Chang Jun; Wu, Xing Zhong

2013-01-01

A mature miRNA generally suppresses hundreds of mRNA targets. To evaluate the selective effect of synthetic oligonucleotide decoys on hsa-miR-223 activity, reporters containing 3’ untranslated regions (UTR) of IGF1R, FOXO1, POLR3G, FOXO3, CDC27, FBXW7 and PAXIP1 mRNAs were constructed for the luciferase assay. The oligonucleotide decoys were designed and synthesized according to mature miR-223 sequence and its target mRNA sequence. Quantitative RT-PCR & western analysis were used to measure miR-223-targeted mRNA expression, Interestingly, apart from the antisense oligonucleotide, decoy nucleotides which were complementary to the 5’, central or 3’ region of mature miR-223 suppressed miR-223 targeting the 3’UTR of IGF1R, FOXO1, FOXO3, CDC27, POLR3G, and FBXW7 mRNAs and rescued the expression of these genes to varying degrees from miR-223 suppression at both mRNA and protein levels. All decoys had no effect on PAXIP1 which was not targeted by miR-223. The decoy 1 that was based on the sequence of IGF1R 3’UTR rescued the expression of IGF1R more significantly than other decoy nucleotides except the antisense decoy 4. Decoy 1 also rescued the expression of FOXO3 and POLR3G of which their 3’UTRs have similar binding sites for miR-223 with IGF1R 3’UTR. However decoy 1 failed to recover Sp1, CDC27 and FBXW7 expression. These data support that the sequence-specific decoy oligonucleotides might represent exogenous competing RNA which selectively inhibits microRNA targeting. PMID:24324762

Decoy oligonucleotide rescues IGF1R expression from MicroRNA-223 suppression.

PubMed

Wu, Li Hui; Cai, Qian Qian; Dong, Yi Wei; Wang, Rong; He, Bao Mei; Qi, Bing; Xu, Chang Jun; Wu, Xing Zhong

2013-01-01

A mature miRNA generally suppresses hundreds of mRNA targets. To evaluate the selective effect of synthetic oligonucleotide decoys on hsa-miR-223 activity, reporters containing 3' untranslated regions (UTR) of IGF1R, FOXO1, POLR3G, FOXO3, CDC27, FBXW7 and PAXIP1 mRNAs were constructed for the luciferase assay. The oligonucleotide decoys were designed and synthesized according to mature miR-223 sequence and its target mRNA sequence. Quantitative RT-PCR & western analysis were used to measure miR-223-targeted mRNA expression, Interestingly, apart from the antisense oligonucleotide, decoy nucleotides which were complementary to the 5', central or 3' region of mature miR-223 suppressed miR-223 targeting the 3'UTR of IGF1R, FOXO1, FOXO3, CDC27, POLR3G, and FBXW7 mRNAs and rescued the expression of these genes to varying degrees from miR-223 suppression at both mRNA and protein levels. All decoys had no effect on PAXIP1 which was not targeted by miR-223. The decoy 1 that was based on the sequence of IGF1R 3'UTR rescued the expression of IGF1R more significantly than other decoy nucleotides except the antisense decoy 4. Decoy 1 also rescued the expression of FOXO3 and POLR3G of which their 3'UTRs have similar binding sites for miR-223 with IGF1R 3'UTR. However decoy 1 failed to recover Sp1, CDC27 and FBXW7 expression. These data support that the sequence-specific decoy oligonucleotides might represent exogenous competing RNA which selectively inhibits microRNA targeting.

Identifying of meat species using polymerase chain reaction (PCR)

NASA Astrophysics Data System (ADS)

Foong, Chow Ming; Sani, Norrakiah Abdullah

2013-11-01

Meat has been widely consumed as an important protein source in daily life of human. Furthermore, with busy and intense urban lifestyle, processed food is now one of the main protein sources of one's diet. Consumers rely on the food labeling to decide if the meat product purchased is safe and reliable. Therefore, it is important to ensure the food labeling is done in a correct manner to avoid consumer fraud. More consumers are now concern about the food quality and safety as compared to before. This study described the meat species identification and detection method using Polymerase Chain Reaction (PCR) in 8 types of meats (cattle, buffalo, goat, sheep, chicken, duck, pork and horse). The objective of this study is to decide on the specificity of oligonucleotide sequences obtained from previous study. There were 5 proposed oligonucleotide primer in this study. The main important finding in this work is the specificity of oligonucleotide primers to raw meats. It if found that the oligonucleotide primers proposed were not specific to the local raw meat species. Therefore, further study is needed to obtain a species-specific oligonucletide primers for PCR, in order to be applied in food product testing.

Identifying of meat species using polymerase chain reaction (PCR)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Foong, Chow Ming; Sani, Norrakiah Abdullah

Meat has been widely consumed as an important protein source in daily life of human. Furthermore, with busy and intense urban lifestyle, processed food is now one of the main protein sources of one’s diet. Consumers rely on the food labeling to decide if the meat product purchased is safe and reliable. Therefore, it is important to ensure the food labeling is done in a correct manner to avoid consumer fraud. More consumers are now concern about the food quality and safety as compared to before. This study described the meat species identification and detection method using Polymerase Chain Reactionmore » (PCR) in 8 types of meats (cattle, buffalo, goat, sheep, chicken, duck, pork and horse). The objective of this study is to decide on the specificity of oligonucleotide sequences obtained from previous study. There were 5 proposed oligonucleotide primer in this study. The main important finding in this work is the specificity of oligonucleotide primers to raw meats. It if found that the oligonucleotide primers proposed were not specific to the local raw meat species. Therefore, further study is needed to obtain a species-specific oligonucletide primers for PCR, in order to be applied in food product testing.« less

A facile one-step fluorescence method for the quantitation of low-content single base deamination impurity in synthetic oligonucleotides.

PubMed

Su, Xiaoye; Liang, Ruiting; Stolee, Jessica A

2018-06-05

Oligonucleotides are being researched and developed as potential drug candidates for the treatment of a broad spectrum of diseases. The characterization of antisense oligonucleotide (ASO) impurities caused by base mutations (e.g. deamination) which are closely related to the target ASO is a significant analytical challenge. Herein, we describe a novel one-step method, utilizing a strategy that combines fluorescence-ON detection with competitive hybridization, to achieve single base mutation quantitation in extensively modified synthetic ASOs. Given that this method is highly specific and sensitive (LoQ = 4 nM), we envision that it will find utility for screening other impurities as well as sequencing modified oligonucleotides. Copyright © 2018 Elsevier B.V. All rights reserved.

Label-Free Electrochemical Detection of the Specific Oligonucleotide Sequence of Dengue Virus Type 1 on Pencil Graphite Electrodes

PubMed Central

Souza, Elaine; Nascimento, Gustavo; Santana, Nataly; Ferreira, Danielly; Lima, Manoel; Natividade, Edna; Martins, Danyelly; Lima-Filho, José

2011-01-01

A biosensor that relies on the adsorption immobilization of the 18-mer single-stranded nucleic acid related to dengue virus gene 1 on activated pencil graphite was developed. Hybridization between the probe and its complementary oligonucleotides (the target) was investigated by monitoring guanine oxidation by differential pulse voltammetry (DPV). The pencil graphite electrode was made of ordinary pencil lead (type 4B). The polished surface of the working electrode was activated by applying a potential of 1.8 V for 5 min. Afterward, the dengue oligonucleotides probe was immobilized on the activated electrode by applying 0.5 V to the electrode in 0.5 M acetate buffer (pH 5.0) for 5 min. The hybridization process was carried out by incubating at the annealing temperature of the oligonucleotides. A time of five minutes and concentration of 1 μM were found to be the optimal conditions for probe immobilization. The electrochemical detection of annealing between the DNA probe (TS-1P) immobilized on the modified electrode, and the target (TS-1T) was achieved. The target could be quantified in a range from 1 to 40 nM with good linearity and a detection limit of 0.92 nM. The specificity of the electrochemical biosensor was tested using non-complementary sequences of dengue virus 2 and 3. PMID:22163916

Detection with synthetic oligonucleotide probes of nucleotide sequence variations in the genes encoding enterotoxins of Escherichia coli.

PubMed Central

Nishibuchi, M; Murakami, A; Arita, M; Jikuya, H; Takano, J; Honda, T; Miwatani, T

1989-01-01

We examined variations in the genes encoding heat-stable enterotoxin (ST) and heat-labile enterotoxin (LT) in 88 strains of Escherichia coli isolated from individuals with traveler's diarrhea to find suitable sequences for use as oligonucleotide probes. Four oligonucleotide probes of the gene encoding ST of human origin (STIb or STh), one oligonucleotide probe of the gene encoding ST of porcine origin (STIa or STp), and three oligonucleotide probes of the gene encoding LT of human origin (LTIh) were used in DNA colony hybridization tests. In 15 of 22 strains possessing the STh gene and 28 of 42 strains producing LT, the sequences of all regions tested were identical to the published sequences. One region in the STh gene examined with a 18-mer probe was relatively well conserved and was shown to be closely associated with the enterotoxicity of the E. coli strains in suckling mice. This oligonucleotide, however, hybridized with strains of Vibrio cholerae O1, V. parahaemolyticus, and Yersinia enterocolitica that gave negative results in the suckling mouse assay. PMID:2685027

New concepts of fluorescent probes for specific detection of DNA sequences: bis-modified oligonucleotides in excimer and exciplex detection.

PubMed

Gbaj, A; Bichenkova, Ev; Walsh, L; Savage, He; Sardarian, Ar; Etchells, Ll; Gulati, A; Hawisa, S; Douglas, Kt

2009-12-01

The detection of single base mismatches in DNA is important for diagnostics, treatment of genetic diseases, and identification of single nucleotide polymorphisms. Highly sensitive, specific assays are needed to investigate genetic samples from patients. The use of a simple fluorescent nucleoside analogue in detection of DNA sequence and point mutations by hybridisation in solution is described in this study. The 5'-bispyrene and 3'-naphthalene oligonucleotide probes form an exciplex on hybridisation to target in water and the 5'-bispyrene oligonucleotide alone is an adequate probe to determine concentration of target present. It was also indicated that this system has a potential to identify mismatches and insertions. The aim of this work was to investigate experimental structures and conditions that permit strong exciplex emission for nucleic acid detectors, and show how such exciplexes can register the presence of mismatches as required in SNP analysis. This study revealed that the hybridisation of 5'-bispyrenyl fluorophore to a DNA target results in formation of a fluorescent probe with high signal intensity change and specificity for detecting a complementary target in a homogeneous system. Detection of SNP mutations using this split-probe system is a highly specific, simple, and accessible method to meet the rigorous requirements of pharmacogenomic studies. Thus, it is possible for the system to act as SNP detectors and it shows promise for future applications in genetic testing.

Lyophilisation and concentration of chitosan/siRNA polyplexes: Influence of buffer composition, oligonucleotide sequence, and hyaluronic acid coating.

PubMed

Veilleux, Daniel; Gopalakrishna Panicker, Rajesh Krishnan; Chevrier, Anik; Biniecki, Kristof; Lavertu, Marc; Buschmann, Michael D

2018-02-15

Chitosan (CS)/siRNA polyplexes have great therapeutic potential for treating multiple diseases by gene silencing. However, clinical application of this technology requires the development of concentrated, hemocompatible, pH neutral formulations for safe and efficient administration. In this study we evaluate physicochemical properties of chitosan polyplexes in various buffers at increasing ionic strengths, to identify conditions for freeze-drying and rehydration at higher doses of uncoated or hyaluronic acid (HA)-coated polyplexes while maintaining physiological compatibility. Optimized formulations are used to evaluate the impact of the siRNA/oligonucleotide sequence on polyplex physicochemical properties, and to measure their in vitro silencing efficiency, cytotoxicity, and hemocompatibility. Specific oligonucleotide sequences influence polyplex physical properties at low N:P ratios, as well as their stability during freeze-drying. Nanoparticles display greater stability for oligodeoxynucleotides ODN vs siRNA; AT-rich vs GC-rich; and overhangs vs blunt ends. Using this knowledge, various CS/siRNA polyplexes are prepared with and without HA coating, freeze-dried and rehydrated at increased concentrations using reduced rehydration volumes. These polyplexes are non-cytotoxic and preserve silencing activity even after rehydration to 20-fold their initial concentration, while HA-coated polyplexes at pH∼7 also displayed increased hemocompatibility. These concentrated formulations represent a critical step towards clinical development of chitosan-based oligonucleotide intravenous delivery systems. Copyright © 2017 Elsevier Inc. All rights reserved.

Direct profiling of environmental microbial populations by thermal dissociation analysis of native rRNAs hybridized to oligonucleotide microarrays

NASA Technical Reports Server (NTRS)

El Fantroussi, Said; Urakawa, Hidetoshi; Bernhard, Anne E.; Kelly, John J.; Noble, Peter A.; Smidt, H.; Yershov, G. M.; Stahl, David A.

2003-01-01

Oligonucleotide microarrays were used to profile directly extracted rRNA from environmental microbial populations without PCR amplification. In our initial inspection of two distinct estuarine study sites, the hybridization patterns were reproducible and varied between estuarine sediments of differing salinities. The determination of a thermal dissociation curve (i.e., melting profile) for each probe-target duplex provided information on hybridization specificity, which is essential for confirming adequate discrimination between target and nontarget sequences.

Sensible use of antisense: how to use oligonucleotides as research tools.

PubMed

Myers, K J; Dean, N M

2000-01-01

In the past decade, there has been a vast increase in the amount of gene sequence information that has the potential to revolutionize the way diseases are both categorized and treated. Old diagnoses, largely anatomical or descriptive in nature, are likely to be superceded by the molecular characterization of the disease. The recognition that certain genes drive key disease processes will also enable the rational design of gene-specific therapeutics. Antisense oligonucleotides represent a technology that should play multiple roles in this process.

Application of Locked Nucleic Acid (LNA) Primer and PCR Clamping by LNA Oligonucleotide to Enhance the Amplification of Internal Transcribed Spacer (ITS) Regions in Investigating the Community Structures of Plant-Associated Fungi.

PubMed

Ikenaga, Makoto; Tabuchi, Masakazu; Kawauchi, Tomohiro; Sakai, Masao

2016-09-29

The simultaneous extraction of host plant DNA severely limits investigations of the community structures of plant-associated fungi due to the similar homologies of sequences in primer-annealing positions between fungi and host plants. Although fungal-specific primers have been designed, plant DNA continues to be excessively amplified by PCR, resulting in the underestimation of community structures. In order to overcome this limitation, locked nucleic acid (LNA) primers and PCR clamping by LNA oligonucleotides have been applied to enhance the amplification of fungal internal transcribed spacer (ITS) regions. LNA primers were designed by converting DNA into LNA, which is specific to fungi, at the forward primer side. LNA oligonucleotides, the sequences of which are complementary to the host plants, were designed by overlapping a few bases with the annealing position of the reverse primer. Plant-specific DNA was then converted into LNA at the shifted position from the 3' end of the primer-binding position. PCR using the LNA technique enhanced the amplification of fungal ITS regions, whereas those of the host plants were more likely to be amplified without the LNA technique. A denaturing gradient gel electrophoresis (DGGE) analysis displayed patterns that reached an acceptable level for investigating the community structures of plant-associated fungi using the LNA technique. The sequences of the bands detected using the LNA technique were mostly affiliated with known isolates. However, some sequences showed low similarities, indicating the potential to identify novel fungi. Thus, the application of the LNA technique is considered effective for widening the scope of community analyses of plant-associated fungi.

Application of Locked Nucleic Acid (LNA) Primer and PCR Clamping by LNA Oligonucleotide to Enhance the Amplification of Internal Transcribed Spacer (ITS) Regions in Investigating the Community Structures of Plant–Associated Fungi

PubMed Central

Ikenaga, Makoto; Tabuchi, Masakazu; Kawauchi, Tomohiro; Sakai, Masao

2016-01-01

The simultaneous extraction of host plant DNA severely limits investigations of the community structures of plant–associated fungi due to the similar homologies of sequences in primer–annealing positions between fungi and host plants. Although fungal-specific primers have been designed, plant DNA continues to be excessively amplified by PCR, resulting in the underestimation of community structures. In order to overcome this limitation, locked nucleic acid (LNA) primers and PCR clamping by LNA oligonucleotides have been applied to enhance the amplification of fungal internal transcribed spacer (ITS) regions. LNA primers were designed by converting DNA into LNA, which is specific to fungi, at the forward primer side. LNA oligonucleotides, the sequences of which are complementary to the host plants, were designed by overlapping a few bases with the annealing position of the reverse primer. Plant-specific DNA was then converted into LNA at the shifted position from the 3′ end of the primer–binding position. PCR using the LNA technique enhanced the amplification of fungal ITS regions, whereas those of the host plants were more likely to be amplified without the LNA technique. A denaturing gradient gel electrophoresis (DGGE) analysis displayed patterns that reached an acceptable level for investigating the community structures of plant–associated fungi using the LNA technique. The sequences of the bands detected using the LNA technique were mostly affiliated with known isolates. However, some sequences showed low similarities, indicating the potential to identify novel fungi. Thus, the application of the LNA technique is considered effective for widening the scope of community analyses of plant–associated fungi. PMID:27600711

Cellular Internalization of Therapeutic Oligonucleotides by Peptide Amphiphile Nanofibers and Nanospheres.

PubMed

Mumcuoglu, Didem; Sardan Ekiz, Melis; Gunay, Gokhan; Tekinay, Turgay; Tekinay, Ayse B; Guler, Mustafa O

2016-05-11

Oligonucleotides are promising drug candidates due to the exceptionally high specificity they exhibit toward their target DNA and RNA sequences. However, their poor pharmacokinetic and pharmacodynamic properties, in conjunction with problems associated with their internalization by cells, necessitates their delivery through specialized carrier systems for efficient therapy. Here, we investigate the effects of carrier morphology on the cellular internalization mechanisms of oligonucleotides by using self-assembled fibrous or spherical peptide nanostructures. Size and geometry were both found to be important parameters for the oligonucleotide internalization process; direct penetration was determined to be the major mechanism for the internalization of nanosphere carriers, whereas nanofibers were internalized by clathrin- and dynamin-dependent endocytosis pathways. We further showed that glucose conjugation to carrier nanosystems improved cellular internalization in cancer cells due to the enhanced glucose metabolism associated with oncogenesis, and the internalization of the glucose-conjugated peptide/oligonucleotide complexes was found to be dependent on glucose transporters present on the surface of the cell membrane.

Java web tools for PCR, in silico PCR, and oligonucleotide assembly and analysis.

PubMed

Kalendar, Ruslan; Lee, David; Schulman, Alan H

2011-08-01

The polymerase chain reaction is fundamental to molecular biology and is the most important practical molecular technique for the research laboratory. We have developed and tested efficient tools for PCR primer and probe design, which also predict oligonucleotide properties based on experimental studies of PCR efficiency. The tools provide comprehensive facilities for designing primers for most PCR applications and their combinations, including standard, multiplex, long-distance, inverse, real-time, unique, group-specific, bisulphite modification assays, Overlap-Extension PCR Multi-Fragment Assembly, as well as a programme to design oligonucleotide sets for long sequence assembly by ligase chain reaction. The in silico PCR primer or probe search includes comprehensive analyses of individual primers and primer pairs. It calculates the melting temperature for standard and degenerate oligonucleotides including LNA and other modifications, provides analyses for a set of primers with prediction of oligonucleotide properties, dimer and G-quadruplex detection, linguistic complexity, and provides a dilution and resuspension calculator. Copyright © 2011 Elsevier Inc. All rights reserved.

Assessing the Interplay between the Physicochemical Parameters of Ion-Pairing Reagents and the Analyte Sequence on the Electrospray Desorption Process for Oligonucleotides

NASA Astrophysics Data System (ADS)

Basiri, Babak; Murph, Mandi M.; Bartlett, Michael G.

2017-08-01

Alkylamines are widely used as ion-pairing agents during LC-MS of oligonucleotides. In addition to a better chromatographic separation, they also assist with the desorption of oligonucleotide ions into the gas phase, cause charge state reduction, and decrease cation adduction. However, the choice of such ion-pairing agents has considerable influence on the MS signal intensity of oligonucleotides as they can also cause significant ion suppression. Interestingly, optimal ion-pairing agents should be selected on a case by case basis as their choice is strongly influenced by the sequence of the oligonucleotide under investigation. Despite imposing major practical difficulties to analytical method development, such a highly variable system that responds very strongly to the nuances of the electrospray composition provides an excellent opportunity for a fundamental study of the electrospray ionization process. Our investigations using this system quantitatively revealed the major factors that influenced the ESI ionization efficiency of oligonucleotides. Parameters such as boiling point, proton affinity, partition coefficient, water solubility, and Henry's law constants for the ion-pairing reagents and the hydrophobic thymine content of the oligonucleotides were found to be the most significant contributors. Identification of these parameters also allowed for the development of a statistical predictive algorithm that can assist with the choice of an optimum IP agent for each particular oligonucleotide sequence. We believe that research in the field of oligonucleotide bioanalysis will significantly benefit from this algorithm (included in Supplementary Material) as it advocates for the use of lesser-known but more suitable ion-pair alternatives to TEA for many oligonucleotide sequences.

A high-throughput and quantitative method to assess the mutagenic potential of translesion DNA synthesis

PubMed Central

Taggart, David J.; Camerlengo, Terry L.; Harrison, Jason K.; Sherrer, Shanen M.; Kshetry, Ajay K.; Taylor, John-Stephen; Huang, Kun; Suo, Zucai

2013-01-01

Cellular genomes are constantly damaged by endogenous and exogenous agents that covalently and structurally modify DNA to produce DNA lesions. Although most lesions are mended by various DNA repair pathways in vivo, a significant number of damage sites persist during genomic replication. Our understanding of the mutagenic outcomes derived from these unrepaired DNA lesions has been hindered by the low throughput of existing sequencing methods. Therefore, we have developed a cost-effective high-throughput short oligonucleotide sequencing assay that uses next-generation DNA sequencing technology for the assessment of the mutagenic profiles of translesion DNA synthesis catalyzed by any error-prone DNA polymerase. The vast amount of sequencing data produced were aligned and quantified by using our novel software. As an example, the high-throughput short oligonucleotide sequencing assay was used to analyze the types and frequencies of mutations upstream, downstream and at a site-specifically placed cis–syn thymidine–thymidine dimer generated individually by three lesion-bypass human Y-family DNA polymerases. PMID:23470999

High-throughput assays for DNA gyrase and other topoisomerases

PubMed Central

Maxwell, Anthony; Burton, Nicolas P.; O'Hagan, Natasha

2006-01-01

We have developed high-throughput microtitre plate-based assays for DNA gyrase and other DNA topoisomerases. These assays exploit the fact that negatively supercoiled plasmids form intermolecular triplexes more efficiently than when they are relaxed. Two assays are presented, one using capture of a plasmid containing a single triplex-forming sequence by an oligonucleotide tethered to the surface of a microtitre plate and subsequent detection by staining with a DNA-specific fluorescent dye. The other uses capture of a plasmid containing two triplex-forming sequences by an oligonucleotide tethered to the surface of a microtitre plate and subsequent detection by a second oligonucleotide that is radiolabelled. The assays are shown to be appropriate for assaying DNA supercoiling by Escherichia coli DNA gyrase and DNA relaxation by eukaryotic topoisomerases I and II, and E.coli topoisomerase IV. The assays are readily adaptable to other enzymes that change DNA supercoiling (e.g. restriction enzymes) and are suitable for use in a high-throughput format. PMID:16936317

High-throughput assays for DNA gyrase and other topoisomerases.

PubMed

Maxwell, Anthony; Burton, Nicolas P; O'Hagan, Natasha

2006-01-01

We have developed high-throughput microtitre plate-based assays for DNA gyrase and other DNA topoisomerases. These assays exploit the fact that negatively supercoiled plasmids form intermolecular triplexes more efficiently than when they are relaxed. Two assays are presented, one using capture of a plasmid containing a single triplex-forming sequence by an oligonucleotide tethered to the surface of a microtitre plate and subsequent detection by staining with a DNA-specific fluorescent dye. The other uses capture of a plasmid containing two triplex-forming sequences by an oligonucleotide tethered to the surface of a microtitre plate and subsequent detection by a second oligonucleotide that is radiolabelled. The assays are shown to be appropriate for assaying DNA supercoiling by Escherichia coli DNA gyrase and DNA relaxation by eukaryotic topoisomerases I and II, and E.coli topoisomerase IV. The assays are readily adaptable to other enzymes that change DNA supercoiling (e.g. restriction enzymes) and are suitable for use in a high-throughput format.

A simple physical mechanism enables homeostasis in primitive cells

NASA Astrophysics Data System (ADS)

Engelhart, Aaron E.; Adamala, Katarzyna P.; Szostak, Jack W.

2016-05-01

The emergence of homeostatic mechanisms that enable maintenance of an intracellular steady state during growth was critical to the advent of cellular life. Here, we show that concentration-dependent reversible binding of short oligonucleotides, of both specific and random sequence, can modulate ribozyme activity. In both cases, catalysis is inhibited at high concentrations, and dilution activates the ribozyme via inhibitor dissociation, thus maintaining near-constant ribozyme specific activity throughout protocell growth. To mimic the result of RNA synthesis within non-growing protocells, we co-encapsulated high concentrations of ribozyme and oligonucleotides within fatty acid vesicles, and ribozyme activity was inhibited. Following vesicle growth, the resulting internal dilution produced ribozyme activation. This simple physical system enables a primitive homeostatic behaviour: the maintenance of constant ribozyme activity per unit volume during protocell volume changes. We suggest that such systems, wherein short oligonucleotides reversibly inhibit functional RNAs, could have preceded sophisticated modern RNA regulatory mechanisms, such as those involving miRNAs.

Toward a new paradigm of DNA writing using a massively parallel sequencing platform and degenerate oligonucleotide

PubMed Central

Hwang, Byungjin; Bang, Duhee

2016-01-01

All synthetic DNA materials require prior programming of the building blocks of the oligonucleotide sequences. The development of a programmable microarray platform provides cost-effective and time-efficient solutions in the field of data storage using DNA. However, the scalability of the synthesis is not on par with the accelerating sequencing capacity. Here, we report on a new paradigm of generating genetic material (writing) using a degenerate oligonucleotide and optomechanical retrieval method that leverages sequencing (reading) throughput to generate the desired number of oligonucleotides. As a proof of concept, we demonstrate the feasibility of our concept in digital information storage in DNA. In simulation, the ability to store data is expected to exponentially increase with increase in degenerate space. The present study highlights the major framework change in conventional DNA writing paradigm as a sequencer itself can become a potential source of making genetic materials. PMID:27876825

Toward a new paradigm of DNA writing using a massively parallel sequencing platform and degenerate oligonucleotide.

PubMed

Hwang, Byungjin; Bang, Duhee

2016-11-23

All synthetic DNA materials require prior programming of the building blocks of the oligonucleotide sequences. The development of a programmable microarray platform provides cost-effective and time-efficient solutions in the field of data storage using DNA. However, the scalability of the synthesis is not on par with the accelerating sequencing capacity. Here, we report on a new paradigm of generating genetic material (writing) using a degenerate oligonucleotide and optomechanical retrieval method that leverages sequencing (reading) throughput to generate the desired number of oligonucleotides. As a proof of concept, we demonstrate the feasibility of our concept in digital information storage in DNA. In simulation, the ability to store data is expected to exponentially increase with increase in degenerate space. The present study highlights the major framework change in conventional DNA writing paradigm as a sequencer itself can become a potential source of making genetic materials.

Clustered regularly interspaced short palindromic repeats (CRISPRs) analysis of members of the Mycobacterium tuberculosis complex.

PubMed

Botelho, Ana; Canto, Ana; Leão, Célia; Cunha, Mónica V

2015-01-01

Typical CRISPR (clustered, regularly interspaced, short palindromic repeat) regions are constituted by short direct repeats (DRs), interspersed with similarly sized non-repetitive spacers, derived from transmissible genetic elements, acquired when the cell is challenged with foreign DNA. The analysis of the structure, in number and nature, of CRISPR spacers is a valuable tool for molecular typing since these loci are polymorphic among strains, originating characteristic signatures. The existence of CRISPR structures in the genome of the members of Mycobacterium tuberculosis complex (MTBC) enabled the development of a genotyping method, based on the analysis of the presence or absence of 43 oligonucleotide spacers separated by conserved DRs. This method, called spoligotyping, consists on PCR amplification of the DR chromosomal region and recognition after hybridization of the spacers that are present. The workflow beneath this methodology implies that the PCR products are brought onto a membrane containing synthetic oligonucleotides that have complementary sequences to the spacer sequences. Lack of hybridization of the PCR products to a specific oligonucleotide sequence indicates absence of the correspondent spacer sequence in the examined strain. Spoligotyping gained great notoriety as a robust identification and typing tool for members of MTBC, enabling multiple epidemiological studies on human and animal tuberculosis.

Improved bioactivity of G-rich triplex-forming oligonucleotides containing modified guanine bases

PubMed Central

Rogers, Faye A; Lloyd, Janice A; Tiwari, Meetu Kaushik

2014-01-01

Triplex structures generated by sequence-specific triplex-forming oligonucleotides (TFOs) have proven to be promising tools for gene targeting strategies. In addition, triplex technology has been highly utilized to study the molecular mechanisms of DNA repair, recombination and mutagenesis. However, triplex formation utilizing guanine-rich oligonucleotides as third strands can be inhibited by potassium-induced self-association resulting in G-quadruplex formation. We report here that guanine-rich TFOs partially substituted with 8-aza-7-deaza-guanine (PPG) have improved target site binding in potassium compared with TFOs containing the natural guanine base. We designed PPG-substituted TFOs to bind to a polypurine sequence in the supFG1 reporter gene. The binding efficiency of PPG-substituted TFOs to the target sequence was analyzed using electrophoresis mobility gel shift assays. We have determined that in the presence of potassium, the non-substituted TFO, AG30 did not bind to its target sequence, however binding was observed with the PPG-substituted AG30 under conditions with up to 140 mM KCl. The PPG-TFOs were able to maintain their ability to induce genomic modifications as measured by an assay for gene-targeted mutagenesis. In addition, these compounds were capable of triplex-induced DNA double strand breaks, which resulted in activation of apoptosis. PMID:25483840

Use of rDNA polymorphism for identification of Heterophyidae infecting freshwater fishes.

PubMed

Dzikowski, R; Levy, M G; Poore, M F; Flowers, J R; Paperna, I

2004-04-21

Infections by trematodes are among the most common fish-borne zoonoses. Metacercariae of the Family Heterophyidae in marine and freshwater fishes are nonfastidious in their choice of definitive hosts, and therefore, cause infections in human and domestic animals. In the present study, species-specific polymerase chain reaction (PCR) assays were developed for identifying and differentiating the various species examined. Sequencing and aligning the 18S (SSU) rDNA revealed interspecific variation for which species-specific DNA oligonucleotides were designed and used for the identification of 6 heterophyid species recovered from piscivorous birds. The oligonucleotides were further used to evaluate the various stages (cercariae recovered from snails, metacercariae recovered from fish and adult trematodes) of the digeneans. By applying this method we elucidated for the first time the life cycle of Pygidiopsis genata. The phylogenetic interrelationship among the newly sequenced species of Heterophyidae is outlined.

Identification of sequence motifs in oligonucleotides whose presence is correlated with antisense activity

PubMed Central

Matveeva, O. V.; Tsodikov, A. D.; Giddings, M.; Freier, S. M.; Wyatt, J. R.; Spiridonov, A. N.; Shabalina, S. A.; Gesteland, R. F.; Atkins, J. F.

2000-01-01

Design of antisense oligonucleotides targeting any mRNA can be much more efficient when several activity-enhancing motifs are included and activity-decreasing motifs are avoided. This conclusion was made after statistical analysis of data collected from >1000 experiments with phosphorothioate-modified oligonucleotides. Highly significant positive correlation between the presence of motifs CCAC, TCCC, ACTC, GCCA and CTCT in the oligonucleotide and its antisense efficiency was demonstrated. In addition, negative correlation was revealed for the motifs GGGG, ACTG, AAA and TAA. It was found that the likelihood of activity of an oligonucleotide against a desired mRNA target is sequence motif content dependent. PMID:10908347

Development and characterization of a microheater array device for real-time DNA mutation detection

NASA Astrophysics Data System (ADS)

Williams, Layne; Okandan, Murat; Chagovetz, Alex; Blair, Steve

2008-04-01

DNA analysis, specifically single nucleotide polymorphism (SNP) detection, is becoming increasingly important in rapid diagnostics and disease detection. Temperature is often controlled to help speed reaction rates and perform melting of hybridized oligonucleotides. The difference in melting temperatures, Tm, between wild-type and SNP sequences, respectively, to a given probe oligonucleotide, is indicative of the specificity of the reaction. We have characterized Tm's in solution and on a solid substrate of three sequences from known mutations associated with Cystic Fibrosis. Taking advantage of Tm differences, a microheater array device was designed to enable individual temperature control of up to 18 specific hybridization events. The device was fabricated at Sandia National Laboratories using surface micromachining techniques. The microheaters have been characterized using an IR camera at Sandia and show individual temperature control with minimal thermal cross talk. Development of the device as a real-time DNA detection platform, including surface chemistry and associated microfluidics, is described.

Development and characterization of a microheater array device for real-time DNA mutation detection

NASA Astrophysics Data System (ADS)

Williams, Layne; Okandan, Murat; Chagovetz, Alex; Blair, Steve

2008-02-01

DNA analysis, specifically single nucleotide polymorphism (SNP) detection, is becoming increasingly important in rapid diagnostics and disease detection. Temperature is often controlled to help speed reaction rates and perform melting of hybridized oligonucleotides. The difference in melting temperatures, Tm, between wild-type and SNP sequences, respectively, to a given probe oligonucleotide, is indicative of the specificity of the reaction. We have characterized Tm's in solution and on a solid substrate of three sequences from known mutations associated with Cystic Fibrosis. Taking advantage of Tm differences, a microheater array device was designed to enable individual temperature control of up to 18 specific hybridization events. The device was fabricated at Sandia National Laboratories using surface micromachining techniques. The microheaters have been characterized using an IR camera at Sandia and show individual temperature control with minimal thermal cross talk. Development of the device as a real-time DNA detection platform, including surface chemistry and associated microfluidics, is described.

A statistical learning approach to the modeling of chromatographic retention of oligonucleotides incorporating sequence and secondary structure data

PubMed Central

Sturm, Marc; Quinten, Sascha; Huber, Christian G.; Kohlbacher, Oliver

2007-01-01

We propose a new model for predicting the retention time of oligonucleotides. The model is based on ν support vector regression using features derived from base sequence and predicted secondary structure of oligonucleotides. Because of the secondary structure information, the model is applicable even at relatively low temperatures where the secondary structure is not suppressed by thermal denaturing. This makes the prediction of oligonucleotide retention time for arbitrary temperatures possible, provided that the target temperature lies within the temperature range of the training data. We describe different possibilities of feature calculation from base sequence and secondary structure, present the results and compare our model to existing models. PMID:17567619

Experimental analysis of oligonucleotide microarray design criteria to detect deletions by comparative genomic hybridization.

PubMed

Flibotte, Stephane; Moerman, Donald G

2008-10-21

Microarray comparative genomic hybridization (CGH) is currently one of the most powerful techniques to measure DNA copy number in large genomes. In humans, microarray CGH is widely used to assess copy number variants in healthy individuals and copy number aberrations associated with various diseases, syndromes and disease susceptibility. In model organisms such as Caenorhabditis elegans (C. elegans) the technique has been applied to detect mutations, primarily deletions, in strains of interest. Although various constraints on oligonucleotide properties have been suggested to minimize non-specific hybridization and improve the data quality, there have been few experimental validations for CGH experiments. For genomic regions where strict design filters would limit the coverage it would also be useful to quantify the expected loss in data quality associated with relaxed design criteria. We have quantified the effects of filtering various oligonucleotide properties by measuring the resolving power for detecting deletions in the human and C. elegans genomes using NimbleGen microarrays. Approximately twice as many oligonucleotides are typically required to be affected by a deletion in human DNA samples in order to achieve the same statistical confidence as one would observe for a deletion in C. elegans. Surprisingly, the ability to detect deletions strongly depends on the oligonucleotide 15-mer count, which is defined as the sum of the genomic frequency of all the constituent 15-mers within the oligonucleotide. A similarity level above 80% to non-target sequences over the length of the probe produces significant cross-hybridization. We recommend the use of a fairly large melting temperature window of up to 10 degrees C, the elimination of repeat sequences, the elimination of homopolymers longer than 5 nucleotides, and a threshold of -1 kcal/mol on the oligonucleotide self-folding energy. We observed very little difference in data quality when varying the oligonucleotide length between 50 and 70, and even when using an isothermal design strategy. We have determined experimentally the effects of varying several key oligonucleotide microarray design criteria for detection of deletions in C. elegans and humans with NimbleGen's CGH technology. Our oligonucleotide design recommendations should be applicable for CGH analysis in most species.

Specific 16S ribosomal RNA targeted oligonucleotide probe against Clavibacter michiganensis subsp. sepedonicus.

PubMed

Mirza, M S; Rademaker, J L; Janse, J D; Akkermans, A D

1993-11-01

In this article we report on the polymerase chain reaction amplification of a partial 16S rRNA gene from the plant pathogenic bacterium Clavibacter michiganensis subsp. sepedonicus. A partial sequence (about 400 base pairs) of the gene was determined that covered two variable regions important for oligonucleotide probe development. A specific 24mer oligonucleotide probe targeted against the V6 region of 16S rRNA was designed. Specificity of the probe was determined using dot blot hybridization. Under stringent conditions (60 degrees C), the probe hybridized with all 16 Cl. michiganensis subsp. sepedonicus strains tested. Hybridization did not occur with 32 plant pathogenic and saprophytic bacteria used as controls under the same conditions. Under less stringent conditions (55 degrees C) the related Clavibacter michiganensis subsp. insidiosus, Clavibacter michiganensis subsp. nebraskensis, and Clavibacter michiganensis subsp. tesselarius also showed hybridization. At even lower stringency (40 degrees C), all Cl. michiganensis subspecies tested including Clavibacter michiganensis subsp. michiganensis showed hybridization signal, suggesting that under these conditions the probe may be used as a species-specific probe for Cl. michiganensis.

New Concepts of Fluorescent Probes for Specific Detection of DNA Sequences: Bis-Modified Oligonucleotides in Excimer and Exciplex Detection

PubMed Central

Gbaj, A; Bichenkova, EV; Walsh, L; Savage, HE; Sardarian, AR; Etchells, LL; Gulati, A; Hawisa, S; Douglas, KT

2009-01-01

The detection of single base mismatches in DNA is important for diagnostics, treatment of genetic diseases, and identification of single nucleotide polymorphisms. Highly sensitive, specific assays are needed to investigate genetic samples from patients. The use of a simple fluorescent nucleoside analogue in detection of DNA sequence and point mutations by hybridisation in solution is described in this study. The 5′-bispyrene and 3′-naphthalene oligonucleotide probes form an exciplex on hybridisation to target in water and the 5′-bispyrene oligonucleotide alone is an adequate probe to determine concentration of target present. It was also indicated that this system has a potential to identify mismatches and insertions. The aim of this work was to investigate experimental structures and conditions that permit strong exciplex emission for nucleic acid detectors, and show how such exciplexes can register the presence of mismatches as required in SNP analysis. This study revealed that the hybridisation of 5′-bispyrenyl fluorophore to a DNA target results in formation of a fluorescent probe with high signal intensity change and specificity for detecting a complementary target in a homogeneous system. Detection of SNP mutations using this split-probe system is a highly specific, simple, and accessible method to meet the rigorous requirements of pharmacogenomic studies. Thus, it is possible for the system to act as SNP detectors and it shows promise for future applications in genetic testing. PMID:21483539

Use of extremely short Förster resonance energy transfer probes in real-time polymerase chain reaction

PubMed Central

Kutyavin, Igor V.

2013-01-01

Described in the article is a new approach for the sequence-specific detection of nucleic acids in real-time polymerase chain reaction (PCR) using fluorescently labeled oligonucleotide probes. The method is based on the production of PCR amplicons, which fold into dumbbell-like secondary structures carrying a specially designed ‘probe-luring’ sequence at their 5′ ends. Hybridization of this sequence to a complementary ‘anchoring’ tail introduced at the 3′ end of a fluorescent probe enables the probe to bind to its target during PCR, and the subsequent probe cleavage results in the florescence signal. As it has been shown in the study, this amplicon-endorsed and guided formation of the probe-target duplex allows the use of extremely short oligonucleotide probes, up to tetranucleotides in length. In particular, the short length of the fluorescent probes makes possible the development of a ‘universal’ probe inventory that is relatively small in size but represents all possible sequence variations. The unparalleled cost-effectiveness of the inventory approach is discussed. Despite the short length of the probes, this new method, named Angler real-time PCR, remains highly sequence specific, and the results of the study indicate that it can be effectively used for quantitative PCR and the detection of polymorphic variations. PMID:24013564

Secondary binding sites for heavily modified triplex forming oligonucleotides

PubMed Central

Cardew, Antonia S.; Brown, Tom; Fox, Keith R.

2012-01-01

In order to enhance DNA triple helix stability synthetic oligonucleotides have been developed that bear amino groups on the sugar or base. One of the most effective of these is bis-amino-U (B), which possesses 5-propargylamino and 2′-aminoethoxy modifications. Inclusion of this modified nucleotide not only greatly enhances triplex stability, but also increases the affinity for related sequences. We have used a restriction enzyme protection, selection and amplification assay (REPSA) to isolate sequences that are bound by the heavily modified 9-mer triplex-forming oligonucleotide B6CBT. The isolated sequences contain An tracts (n = 6), suggesting that the 5′-end of this TFO was responsible for successful triplex formation. DNase I footprinting with these sequences confirmed triple helix formation at these secondary targets and demonstrated no interaction with similar oligonucleotides containing T or 5-propargylamino-dU. PMID:22180535

Modification of antisense phosphodiester oligodeoxynucleotides by a 5' cholesteryl moiety increases cellular association and improves efficacy.

PubMed

Krieg, A M; Tonkinson, J; Matson, S; Zhao, Q; Saxon, M; Zhang, L M; Bhanja, U; Yakubov, L; Stein, C A

1993-02-01

Phosphodiester oligodeoxynucleotides bearing a 5' cholesteryl (chol) modification bind to low density lipoprotein (LDL), apparently by partitioning the chol-modified oligonucleotides into the lipid layer. Both HL60 cells and primary mouse spleen T and B cells incubated with fluorescently labeled chol-modified oligonucleotide showed substantially increased cellular association by flow cytometry and increased internalization by confocal microscopy compared to an identical molecule not bearing the chol group. Cellular internalization of chol-modified oligonucleotide occurred at least partially through the LDL receptor; it was increased in mouse spleen cells by cell culture in lipoprotein-deficient medium and/or lovastatin, and it was decreased by culture in high serum medium. To determine whether chol-modified oligonucleotides are more potent antisense agents, we titered antisense unmodified phosphodiester and chol-modified oligonucleotides targeted against a mouse immunosuppressive protein. Murine spleen cells cultured with 20 microM phosphodiester antisense oligonucleotides had a 2-fold increase in RNA synthesis, indicating the expected lymphocyte activation. Antisense chol-modified oligonucleotides showed an 8-fold increase in relative potency: they caused a 2-fold increase in RNA synthesis at just 2.5 microM. The increased efficacy was blocked by heparin and was further increased by cell culture in 1% (vs. 10%) fetal bovine serum, suggesting that the effect may, at least in part, be mediated via the LDL receptor. Antisense chol-modified oligonucleotides are sequence specific and have increased potency as compared to unmodified oligonucleotides.

Sub-attomole oligonucleotide and p53 cDNA determinations via a high-resolution surface plasmon resonance combined with oligonucleotide-capped gold nanoparticle signal amplification.

PubMed

Yao, Xin; Li, Xin; Toledo, Freddy; Zurita-Lopez, Cecilia; Gutova, Margarita; Momand, Jamil; Zhou, Feimeng

2006-07-15

Oligonucleotide (ODN)-capped gold nanoparticles (Au-NPs) were used in a sandwich assay of ODN or polynucleotide by a flow injection surface plasmon resonance (SPR). A carboxylated dextran film was immobilized onto the SPR sensor surface to eliminate nonspecific adsorption of ODN-capped Au-NPs. The tandem use of signal amplification via the adlayer of the ODN-capped Au-NPs and the differential signal detection by the bicell detector on the SPR resulted in a remarkable DNA detection level. A 39-mer target at a quantity as low as 2.1 x 10(-20)mol, corresponding to 1.38 fM in a 15 microl solution, can be measured. To our knowledge, both the concentration and quantity detection levels are the lowest among all the gene analyses conducted with SPR to this point. The method is shown to be reproducible (relative standard deviation values <16%) and to possess high sequence specificity. It is also demonstrated to be viable for sequence-specific p53 cDNA analysis. The successful elimination of nonspecific adsorption of, and the signal amplification by, ODN-capped Au-NPs renders the SPR attractive for cases where the DNA concentration is extremely low and the sample availability is severely limited.

Evolution of thermophilic DNA polymerases for the recognition and amplification of C2ʹ-modified DNA

NASA Astrophysics Data System (ADS)

Chen, Tingjian; Hongdilokkul, Narupat; Liu, Zhixia; Adhikary, Ramkrishna; Tsuen, Shujian S.; Romesberg, Floyd E.

2016-06-01

The PCR amplification of oligonucleotides enables the evolution of sequences called aptamers that bind specific targets with antibody-like affinity. However, in many applications the use of these aptamers is limited by nuclease-mediated degradation. In contrast, oligonucleotides that are modified at their sugar C2ʹ positions with methoxy or fluorine substituents are stable to nucleases, but they cannot be synthesized by natural polymerases. Here we report the development of a polymerase-evolution system and its use to evolve thermostable polymerases that efficiently interconvert C2ʹ-OMe-modified oligonucleotides and their DNA counterparts via ‘transcription’ and ‘reverse transcription’ or, more importantly, that PCR-amplify partially C2ʹ-OMe- or C2ʹ-F-modified oligonucleotides. A mechanistic analysis demonstrates that the ability to amplify the modified oligonucleotides evolved by optimizing interdomain interactions that stabilize the catalytically competent closed conformation of the polymerase. The evolved polymerases should find practical applications and the developed evolution system should be a powerful tool for tailoring polymerases to have other types of novel function.

Requirement of the cyclic adenosine monophosphate response element-binding protein for hepatitis B virus replication.

PubMed

Kim, Bo Kyung; Lim, Seoung Ok; Park, Yun Gyu

2008-08-01

The cyclic adenosine monophosphate-response element (CRE)-transcription factor complex participates in the regulation of viral gene expression and pathologic processes caused by various viruses. The hepatitis B virus (HBV) enhancer I directs liver-specific transcription of viral genes and contains a CRE sequence (HBV-CRE); however, whether the HBV-CRE and CRE-binding protein (CREB) are required for the HBV life cycle remains to be determined. This study was designed to investigate the role of CREB in HBV replication and gene expression. Sequence-comparison analysis of 984 HBVs reported worldwide showed that the HBV-CRE sequence is highly conserved, indicating the possibility that it plays an important role in the HBV life cycle. The binding of CREB to the HBV-CRE site was markedly inhibited by oligonucleotides containing HBV-CRE and consensus CRE sequences in vitro and in vivo. The HBV promoter activity was demonstrated to be dependent upon the transactivation activity of CREB. Treatment with CRE decoy oligonucleotides reduced HBV promoter activity, and this was reversed by CREB overexpression. The levels of viral transcripts, DNA, and antigens were remarkably decreased in response to the overexpression of CREB mutants or treatment with the CRE decoy oligonucleotides, whereas enhancing CREB activity increased the levels of viral transcripts. In addition, introduction of a three-base mutation into the HBV-CRE led to a marked reduction in HBV messenger RNA synthesis. Taken together, our results demonstrate that both replication and gene expression of HBV require a functional CREB and HBV-CRE. We have also demonstrated that CRE decoy oligonucleotides and the overexpression of CREB mutants can effectively block the HBV life cycle, suggesting that interventions against CREB activity could provide a new avenue to treat HBV infection.

In vitro evaluation of phosphorothioate oligonucleotides targeted to the E2 mRNA of papillomavirus: potential treatment for genital warts.

PubMed Central

Cowsert, L M; Fox, M C; Zon, G; Mirabelli, C K

1993-01-01

Papillomaviruses induce benign proliferative lesions, such as genital warts, in humans. The E2 gene product is thought to play a major role in the regulation of viral transcription and DNA replication and may represent a rational target for an antisense oligonucleotide drug action. Phosphorothioate oligonucleotides complementary to E2 mRNAs were synthesized and tested in a series of in vitro bovine papillomavirus (BPV) and human papillomavirus (HPV) models for the ability to inhibit E2 transactivation and virus-induced focus formation. The most active BPV-specific compounds were complementary to the mRNA cap region (ISIS 1751), the translation initiation region for the full-length E2 transactivator (ISIS 1753), and the translation initiation region for the E2 transrepressor mRNA (ISIS 1755). ISIS 1751 and ISIS 1753 were found to reduce E2-dependent transactivation and viral focus formation in a sequence-specific and concentration-dependent manner. ISIS 1755 increased E2 transactivation in a dose-dependent manner but had no effect on focus formation. Oligonucleotides with a chain length of 20 residues had optimal activity in the E2 transactivation assay. On the basis of the above observations, ISIS 2105, a 20-residue phosphorothioate oligonucleotide targeted to the translation initiation of both HPV type 6 (HPV-6) and HPV-11 E2 mRNA, was designed and shown to inhibit E2-dependent transactivation by HPV-11 E2 expressed from a surrogate promoter. These observations support the rationale of E2 as a target for antiviral therapy against papillomavirus infections and specifically identify ISIS 2105 as a candidate antisense oligonucleotide for the treatment of genital warts induced by HPV-6 and HPV-11. Images PMID:8383937

Oligonucleotide probes to the 16S ribosomal RNA: implications of sequence homology and secondary structure with particular reference to the oral species Prevotella intermedia and Prevotella nigrescens.

PubMed

Shah, H N; Gharbia, S E; Scully, C; Finegold, S M

1995-03-01

Eight oligonucleotides based upon regions of the small subunit 16S ribosomal RNA gene sequences were analysed against a background of their position within the molecule and their two-dimensional structure to rationalise their use in recognising Prevotella intermedia and Prevotella nigrescens. The 41 clinical isolates from both oral and respiratory sites and two reference strains were subjected to DNA-DNA hybridisation and multilocus enzyme electrophoresis to confirm their identity. Alignment of oligonucleotide probes designated I Bi-2 to I Bi-6 (for P. intermedia) and 2Bi-2 (for P. nigrescens) with the 16S rRNA suggested that these probes lacked specificity or were constructed from hypervariable regions. A 52-mer oligonucleotide (designated Bi) reliably detected both species. Because of the high degree of concordance between the 16S rRNAs of both species, it was necessary to vary the stringency of hybridisation conditions for detection of both species. Thus probe I Bi-I recognised P. intermedia while I Bi-I detected both P. intermedia and P. nigrescens at low stringency. However, under conditions of high stringency only P. nigrescens was recognised by probe 2Bi-I. These probes were highly specific and did not hybridise with DNA from the closely related P. corporis, nor other periodontal pathogens such as Fusobacterium nucleatum, Actinobacillus actinomycetemcomitans, Treponema denticola and several pigmented species such as Prevotella melaninogenica, P. denticola, P. loescheii, Porphyromonas asaccharolytica, Py. endodontalis, Py. gingivalis, Py. levii, and Py. macacae.

Time-series oligonucleotide count to assign antiviral siRNAs with long utility fit in the big data era.

PubMed

Wada, K; Wada, Y; Iwasaki, Y; Ikemura, T

2017-10-01

Oligonucleotides are key elements of nucleic acid therapeutics such as small interfering RNAs (siRNAs). Influenza and Ebolaviruses are zoonotic RNA viruses mutating very rapidly, and their sequence changes must be characterized intensively to design therapeutic oligonucleotides with long utility. Focusing on a total of 182 experimentally validated siRNAs for influenza A, B and Ebolaviruses compiled by the siRNA database, we conducted time-series analyses of occurrences of siRNA targets in these viral genomes. Reflecting their high mutation rates, occurrences of target oligonucleotides evidently fluctuate in viral populations and often disappear. Time-series analysis of the one-base changed sequences derived from each original target identified the oligonucleotide that shows a compensatory increase and will potentially become the 'awaiting-type oligonucleotide'; the combined use of this oligonucleotide with the original can provide therapeutics with long utility. This strategy is also useful for assigning diagnostic reverse transcription-PCR primers with long utility.

Protein/oligonucleotide conjugates as a cell specific PNA carrier.

PubMed

Obara, K; Ishihara, T; Akaike, T; Maruyama, A

2001-01-01

We have focused on proteineus ligand conjugate with oligonucleotides (ODNs) as a cell-specific delivery vector for peptide nucleic acids (PNAs). Asialofetuin (AF), a hepatocyte-specific proteineus ligand, was conjugated with ODNs that served as binding sites for PNAs. Succinimidyl-transe-4(N-maleimidylmethyl)-cyclohexane-1-carboxylate (SMCC) modified AF was coupled with 5'-thiolated oligodeoxynucleotide (HS-ODN). The resulting conjugate held PNAs with sequence-specific manner. The PNA/DNA conjugate complex has resistance against nucleases in serum. The efficient release of PNA from the complex was observed when the complex was made in contact with a target nucleotide. PNA uptake to hepatocytes was greatly enhanced when hepatocytes was incubated with PNA/conjugate complex. Free AF thoroughly inhibited PNA uptake with the conjugate, evidencing asialoglycoprotein receptor (ASGP-R) mediated endocytosis to be a major-route for the cellular uptake.

Methods of DNA sequencing by hybridization based on optimizing concentration of matrix-bound oligonucleotide and device for carrying out same

DOEpatents

Khrapko, Konstantin R [Moscow, RU; Khorlin, Alexandr A [Moscow, RU; Ivanov, Igor B [Moskovskaya, RU; Ershov, Gennady M [Moscow, RU; Lysov, Jury P [Moscow, RU; Florentiev, Vladimir L [Moscow, RU; Mirzabekov, Andrei D [Moscow, RU

1996-09-03

A method for sequencing DNA by hybridization that includes the following steps: forming an array of oligonucleotides at such concentrations that either ensure the same dissociation temperature for all fully complementary duplexes or allows hybridization and washing of such duplexes to be conducted at the same temperature; hybridizing said oligonucleotide array with labeled test DNA; washing in duplex dissociation conditions; identifying single-base substitutions in the test DNA by analyzing the distribution of the dissociation temperatures and reconstructing the DNA nucleotide sequence based on the above analysis. A device for carrying out the method comprises a solid substrate and a matrix rigidly bound to the substrate. The matrix contains the oligonucleotide array and consists of a multiplicity of gel portions. Each gel portion contains one oligonucleotide of desired length. The gel portions are separated from one another by interstices and have a thickness not exceeding 30 .mu.m.

probeBase—an online resource for rRNA-targeted oligonucleotide probes and primers: new features 2016

PubMed Central

Greuter, Daniel; Loy, Alexander; Horn, Matthias; Rattei, Thomas

2016-01-01

probeBase http://www.probebase.net is a manually maintained and curated database of rRNA-targeted oligonucleotide probes and primers. Contextual information and multiple options for evaluating in silico hybridization performance against the most recent rRNA sequence databases are provided for each oligonucleotide entry, which makes probeBase an important and frequently used resource for microbiology research and diagnostics. Here we present a major update of probeBase, which was last featured in the NAR Database Issue 2007. This update describes a complete remodeling of the database architecture and environment to accommodate computationally efficient access. Improved search functions, sequence match tools and data output now extend the opportunities for finding suitable hierarchical probe sets that target an organism or taxon at different taxonomic levels. To facilitate the identification of complementary probe sets for organisms represented by short rRNA sequence reads generated by amplicon sequencing or metagenomic analysis with next generation sequencing technologies such as Illumina and IonTorrent, we introduce a novel tool that recovers surrogate near full-length rRNA sequences for short query sequences and finds matching oligonucleotides in probeBase. PMID:26586809

A method for high-throughput production of sequence-verified DNA libraries and strain collections.

PubMed

Smith, Justin D; Schlecht, Ulrich; Xu, Weihong; Suresh, Sundari; Horecka, Joe; Proctor, Michael J; Aiyar, Raeka S; Bennett, Richard A O; Chu, Angela; Li, Yong Fuga; Roy, Kevin; Davis, Ronald W; Steinmetz, Lars M; Hyman, Richard W; Levy, Sasha F; St Onge, Robert P

2017-02-13

The low costs of array-synthesized oligonucleotide libraries are empowering rapid advances in quantitative and synthetic biology. However, high synthesis error rates, uneven representation, and lack of access to individual oligonucleotides limit the true potential of these libraries. We have developed a cost-effective method called Recombinase Directed Indexing (REDI), which involves integration of a complex library into yeast, site-specific recombination to index library DNA, and next-generation sequencing to identify desired clones. We used REDI to generate a library of ~3,300 DNA probes that exhibited > 96% purity and remarkable uniformity (> 95% of probes within twofold of the median abundance). Additionally, we created a collection of ~9,000 individually accessible CRISPR interference yeast strains for > 99% of genes required for either fermentative or respiratory growth, demonstrating the utility of REDI for rapid and cost-effective creation of strain collections from oligonucleotide pools. Our approach is adaptable to any complex DNA library, and fundamentally changes how these libraries can be parsed, maintained, propagated, and characterized. © 2017 The Authors. Published under the terms of the CC BY 4.0 license.

Specific interaction of mutant p53 with regions of matrix attachment region DNA elements (MARs) with a high potential for base-unpairing

PubMed Central

Will, Katrin; Warnecke, Gabriele; Wiesmüller, Lisa; Deppert, Wolfgang

1998-01-01

Mutant, but not wild-type p53 binds with high affinity to a variety of MAR-DNA elements (MARs), suggesting that MAR-binding of mutant p53 relates to the dominant-oncogenic activities proposed for mutant p53. MARs recognized by mutant p53 share AT richness and contain variations of an AATATATTT “DNA-unwinding motif,” which enhances the structural dynamics of chromatin and promotes regional DNA base-unpairing. Mutant p53 specifically interacted with MAR-derived oligonucleotides carrying such unwinding motifs, catalyzing DNA strand separation when this motif was located within a structurally labile sequence environment. Addition of GC-clamps to the respective MAR-oligonucleotides or introducing mutations into the unwinding motif strongly reduced DNA strand separation, but supported the formation of tight complexes between mutant p53 and such oligonucleotides. We conclude that the specific interaction of mutant p53 with regions of MAR-DNA with a high potential for base-unpairing provides the basis for the high-affinity binding of mutant p53 to MAR-DNA. PMID:9811860

In situ identification of nocardioform actinomycetes in activated sludge using fluorescent rRNA-targeted oligonucleotide probes.

PubMed

Schuppler, M; Wagner, M; Schön, G; Göbel, U B

1998-01-01

Hitherto, few environmental samples have been investigated by a 'full cycle rRNA analysis'. Here the results of in situ hybridization experiments with specific rRNA-targeted oligonucleotide probes developed on the basis of new sequences derived from a previously described comparative 16S rRNA analysis of nocardioform actinomycetes in activated sludge are reported. Application of the specific probes enabled identification and discrimination of the distinct populations of nocardioform actinomycetes in activated sludge. One of the specific probes (DLP) detected rod-shaped bacteria which were found in 13 of the 16 investigated sludge samples from various wastewater treatment plants, suggesting their importance in the wastewater treatment process. Another probe (GLP2) hybridized with typically branched filaments of nocardioforms mainly found in samples from enhanced biological phosphorus removal plants, suggesting that these bacteria are involved in sludge foaming. The combination of in situ hybridization with fluorescently labelled rRNA-targeted oligonucleotide probes and confocal laser scanning microscopy improved the detection of nocardioform actinomycetes, which often showed only weak signals inside the activated-sludge flocs.

Identification of clinically relevant viridans streptococci by an oligonucleotide array.

PubMed

Chen, Chao Chien; Teng, Lee Jene; Kaiung, Seng; Chang, Tsung Chain

2005-04-01

Viridans streptococci (VS) are common etiologic agents of subacute infective endocarditis and are capable of causing a variety of pyogenic infections. Many species of VS are difficult to differentiate by phenotypic traits. An oligonucleotide array based on 16S-23S rRNA gene intergenic spacer (ITS) sequences was developed to identify 11 clinically relevant VS. These 11 species were Streptococcus anginosus, S. constellatus, S. gordonii, S. intermedius, S. mitis, S. mutans, S. oralis, S. parasanguinis, S. salivarius, S. sanguinis, and S. uberis. The method consisted of PCR amplification of the ITS regions by using a pair of universal primers, followed by hybridization of the digoxigenin-labeled PCR products to a panel of species-specific oligonucleotides immobilized on a nylon membrane. After 120 strains of the 11 species of VG and 91 strains of other bacteria were tested, the sensitivity and specificity of the oligonucleotide array were found to be 100% (120 of 120 strains) and 95.6% (87 of 91 strains), respectively. S. pneumoniae cross-hybridized to the probes used for the identification of S. mitis, and simple biochemical tests such as optochin susceptibility or bile solubility should be used to differentiate S. pneumoniae from S. mitis. In conclusion, identification of species of VS by use of the present oligonucleotide array is accurate and could be used as an alternative reliable method for species identification of strains of VS.

DNA microdevice for electrochemical detection of Escherichia coli 0157:H7 molecular markers.

PubMed

Berganza, J; Olabarria, G; García, R; Verdoy, D; Rebollo, A; Arana, S

2007-04-15

An electrochemical DNA sensor based on the hybridization recognition of a single-stranded DNA (ssDNA) probe immobilized onto a gold electrode to its complementary ssDNA is presented. The DNA probe is bound on gold surface electrode by using self-assembled monolayer (SAM) technology. An optimized mixed SAM with a blocking molecule preventing the nonspecific adsorption on the electrode surface has been prepared. In this paper, a DNA biosensor is designed by means of the immobilization of a single stranded DNA probe on an electrochemical transducer surface to recognize specifically Escherichia coli (E. coli) 0157:H7 complementary target DNA sequence via cyclic voltammetry experiments. The 21 mer DNA probe including a C6 alkanethiol group at the 5' phosphate end has been synthesized to form the SAM onto the gold surface through the gold sulfur bond. The goal of this paper has been to design, characterise and optimise an electrochemical DNA sensor. In order to investigate the oligonucleotide probe immobilization and the hybridization detection, experiments with different concentration of DNA and mismatch sequences have been performed. This microdevice has demonstrated the suitability of oligonucleotide Self-assembled monolayers (SAMs) on gold as immobilization method. The DNA probes deposited on gold surface have been functional and able to detect changes in bases sequence in a 21-mer oligonucleotide.

Targeted Capture and High-Throughput Sequencing Using Molecular Inversion Probes (MIPs).

PubMed

Cantsilieris, Stuart; Stessman, Holly A; Shendure, Jay; Eichler, Evan E

2017-01-01

Molecular inversion probes (MIPs) in combination with massively parallel DNA sequencing represent a versatile, yet economical tool for targeted sequencing of genomic DNA. Several thousand genomic targets can be selectively captured using long oligonucleotides containing unique targeting arms and universal linkers. The ability to append sequencing adaptors and sample-specific barcodes allows large-scale pooling and subsequent high-throughput sequencing at relatively low cost per sample. Here, we describe a "wet bench" protocol detailing the capture and subsequent sequencing of >2000 genomic targets from 192 samples, representative of a single lane on the Illumina HiSeq 2000 platform.

Programmable RNA recognition and cleavage by CRISPR/Cas9.

PubMed

O'Connell, Mitchell R; Oakes, Benjamin L; Sternberg, Samuel H; East-Seletsky, Alexandra; Kaplan, Matias; Doudna, Jennifer A

2014-12-11

The CRISPR-associated protein Cas9 is an RNA-guided DNA endonuclease that uses RNA-DNA complementarity to identify target sites for sequence-specific double-stranded DNA (dsDNA) cleavage. In its native context, Cas9 acts on DNA substrates exclusively because both binding and catalysis require recognition of a short DNA sequence, known as the protospacer adjacent motif (PAM), next to and on the strand opposite the twenty-nucleotide target site in dsDNA. Cas9 has proven to be a versatile tool for genome engineering and gene regulation in a large range of prokaryotic and eukaryotic cell types, and in whole organisms, but it has been thought to be incapable of targeting RNA. Here we show that Cas9 binds with high affinity to single-stranded RNA (ssRNA) targets matching the Cas9-associated guide RNA sequence when the PAM is presented in trans as a separate DNA oligonucleotide. Furthermore, PAM-presenting oligonucleotides (PAMmers) stimulate site-specific endonucleolytic cleavage of ssRNA targets, similar to PAM-mediated stimulation of Cas9-catalysed DNA cleavage. Using specially designed PAMmers, Cas9 can be specifically directed to bind or cut RNA targets while avoiding corresponding DNA sequences, and we demonstrate that this strategy enables the isolation of a specific endogenous messenger RNA from cells. These results reveal a fundamental connection between PAM binding and substrate selection by Cas9, and highlight the utility of Cas9 for programmable transcript recognition without the need for tags.

Programmable RNA recognition and cleavage by CRISPR/Cas9

PubMed Central

O’Connell, Mitchell R.; Oakes, Benjamin L.; Sternberg, Samuel H.; East-Seletsky, Alexandra; Kaplan, Matias; Doudna, Jennifer A.

2014-01-01

The CRISPR-associated protein Cas9 is an RNA-guided DNA endonuclease that uses RNA:DNA complementarity to identify target sites for sequence-specific doublestranded DNA (dsDNA) cleavage1-5. In its native context, Cas9 acts on DNA substrates exclusively because both binding and catalysis require recognition of a short DNA sequence, the protospacer adjacent motif (PAM), next to and on the strand opposite the 20-nucleotide target site in dsDNA4-7. Cas9 has proven to be a versatile tool for genome engineering and gene regulation in many cell types and organisms8, but it has been thought to be incapable of targeting RNA5. Here we show that Cas9 binds with high affinity to single-stranded RNA (ssRNA) targets matching the Cas9-associated guide RNA sequence when the PAM is presented in trans as a separate DNA oligonucleotide. Furthermore, PAM-presenting oligonucleotides (PAMmers) stimulate site-specific endonucleolytic cleavage of ssRNA targets, similar to PAM-mediated stimulation of Cas9-catalyzed DNA cleavage7. Using specially designed PAMmers, Cas9 can be specifically directed to bind or cut RNA targets while avoiding corresponding DNA sequences, and we demonstrate that this strategy enables the isolation of a specific endogenous mRNA from cells. These results reveal a fundamental connection between PAM binding and substrate selection by Cas9, and highlight the utility of Cas9 for programmable and tagless transcript recognition. PMID:25274302

OCaPPI-Db: an oligonucleotide probe database for pathogen identification through hybridization capture.

PubMed

Gasc, Cyrielle; Constantin, Antony; Jaziri, Faouzi; Peyret, Pierre

2017-01-01

The detection and identification of bacterial pathogens involved in acts of bio- and agroterrorism are essential to avoid pathogen dispersal in the environment and propagation within the population. Conventional molecular methods, such as PCR amplification, DNA microarrays or shotgun sequencing, are subject to various limitations when assessing environmental samples, which can lead to inaccurate findings. We developed a hybridization capture strategy that uses a set of oligonucleotide probes to target and enrich biomarkers of interest in environmental samples. Here, we present Oligonucleotide Capture Probes for Pathogen Identification Database (OCaPPI-Db), an online capture probe database containing a set of 1,685 oligonucleotide probes allowing for the detection and identification of 30 biothreat agents up to the species level. This probe set can be used in its entirety as a comprehensive diagnostic tool or can be restricted to a set of probes targeting a specific pathogen or virulence factor according to the user's needs. : http://ocappidb.uca.works. © The Author(s) 2017. Published by Oxford University Press.

Detection and discrimination of orthopoxviruses using microarrays of immobilized oligonucleotides.

PubMed

Laassri, Majid; Chizhikov, Vladimir; Mikheev, Maxim; Shchelkunov, Sergei; Chumakov, Konstantin

2003-09-01

Variola virus (VARV), causing smallpox, is a potential biological weapon. Methods to detect VARV rapidly and to differentiate it from other viruses causing similar clinical syndromes are needed urgently. We have developed a new microarray-based method that detects simultaneously and discriminates four orthopoxvirus (OPV) species pathogenic for humans (variola, monkeypox, cowpox, and vaccinia viruses) and distinguishes them from chickenpox virus (varicella-zoster virus or VZV). The OPV gene C23L/B29R, encoding the CC-chemokine binding protein, was sequenced for 41 strains of seven species of orthopox viruses obtained from different geographical regions. Those C23L/B29R sequences and the ORF 62 sequences from 13 strains of VZV (selected from GenBank) were used to design oligonucleotide probes that were immobilized on an aldehyde-coated glass surface (a total of 57 probes). The microchip contained several unique 13-21 bases long oligonucleotide probes specific to each virus species to ensure redundancy and robustness of the assay. A region approximately 1100 bases long was amplified from samples of viral DNA and fluorescently labeled with Cy5-modified dNTPs, and single-stranded DNA was prepared by strand separation. Hybridization was carried out under plastic coverslips, resulting in a fluorescent pattern that was quantified using a confocal laser scanner. 49 known and blinded samples of OPV DNA, representing different OPV species, and two VZV strains were tested. The oligonucleotide microarray hybridization technique identified reliably and correctly all samples. This new procedure takes only 3 h, and it can be used for parallel testing of multiple samples.

Gallium-68-labelled NOTA-oligonucleotides: an optimized method for their preparation.

PubMed

Gijs, Marlies; Dammicco, Sylvestre; Warnier, Corentin; Aerts, An; Impens, Nathalie R E N; D'Huyvetter, Matthias; Léonard, Marc; Baatout, Sarah; Luxen, André

2016-02-01

One of the most essential aspects to the success of radiopharmaceuticals is an easy and reliable radiolabelling protocol to obtain pure and stable products. In this study, we optimized the bioconjugation and gallium-68 ((68) Ga) radiolabelling conditions for a single-stranded 40-mer DNA oligonucleotide, in order to obtain highly pure and stable radiolabelled oligonucleotides. Quantitative bioconjugation was obtained for a disulfide-functionalized oligonucleotide conjugated to the macrocylic bifunctional chelator MMA-NOTA (maleimido-mono-amide (1,4,7-triazanonane-1,4,7-triyl)triacetic acid). Next, this NOTA-oligonucleotide bioconjugate was radiolabelled at room temperature with purified and pre-concentrated (68) Ga with quantitative levels of radioactive incorporation and high radiochemical and chemical purity. In addition, high chelate stability was observed in physiological-like conditions (37 °C, PBS and serum), in the presence of a transchelator (EDTA) and transferrin. A specific activity of 51.1 MBq/nmol was reached using a 1470-fold molar excess bioconjugate over (68) Ga. This study presents a fast, straightforward and reliable protocol for the preparation of (68) Ga-radiolabelled DNA oligonucleotides under mild reaction conditions and without the use of organic solvents. The methodology herein developed will be applied to the preparation of oligonucleotidic sequences (aptamers) targeting the human epidermal growth factor receptor 2 (HER2) for cancer imaging. Copyright © 2015 John Wiley & Sons, Ltd.

Direct fluorescence in situ hybridization on human metaphase chromosomes using quantum dot-platinum labeled DNA probes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hwang, Gyoyeon; Biological Chemistry, Korea University of Science and Technology, 217, Gajeong-ro, Yuseong-gu, Deajeon; Lee, Hansol

The telomere shortening in chromosomes implies the senescence, apoptosis, or oncogenic transformation of cells. Since detecting telomeres in aging and diseases like cancer, is important, the direct detection of telomeres has been a very useful biomarker. We propose a telomere detection method using a newly synthesized quantum dot (QD) based probe with oligonucleotide conjugation and direct fluorescence in situ hybridization (FISH). QD-oligonucleotides were prepared with metal coordination bonding based on platinum-guanine binding reported in our previous work. The QD-oligonucleotide conjugation method has an advantage where any sequence containing guanine at the end can be easily bound to the starting QD-Ptmore » conjugate. A synthesized telomeric oligonucleotide was bound to the QD-Pt conjugate successfully and this probe hybridized specifically on the telomere of fabricated MV-4-11 and MOLT-4 chromosomes. Additionally, the QD-telomeric oligonucleotide probe successfully detected the telomeres on the CGH metaphase slide. Due to the excellent photostability and high quantum yield of QDs, the QD-oligonucleotide probe has high fluorescence intensity when compared to the organic dye-oligonucleotide probe. Our QD-oligonucleotide probe, conjugation method of this QD probe, and hybridization protocol with the chromosomes can be a useful tool for chromosome painting and FISH. - Highlights: • We prepared a probe linked between QD and telomeric oligonucleotide with platinum-guanine bonding. • Telomeres were detected by our new telomere probes successfully in three different human metaphase chromosomes. • QDPt-DNA probe has high fluorescence intensity in comparison with organic dye-DNA probe.« less

Insertional Mutagenesis by CRISPR/Cas9 Ribonucleoprotein Gene Editing in Cells Targeted for Point Mutation Repair Directed by Short Single-Stranded DNA Oligonucleotides.

PubMed

Rivera-Torres, Natalia; Banas, Kelly; Bialk, Pawel; Bloh, Kevin M; Kmiec, Eric B

2017-01-01

CRISPR/Cas9 and single-stranded DNA oligonucleotides (ssODNs) have been used to direct the repair of a single base mutation in human genes. Here, we examine a method designed to increase the precision of RNA guided genome editing in human cells by utilizing a CRISPR/Cas9 ribonucleoprotein (RNP) complex to initiate DNA cleavage. The RNP is assembled in vitro and induces a double stranded break at a specific site surrounding the mutant base designated for correction by the ssODN. We use an integrated mutant eGFP gene, bearing a single base change rendering the expressed protein nonfunctional, as a single copy target in HCT 116 cells. We observe significant gene correction activity of the mutant base, promoted by the RNP and single-stranded DNA oligonucleotide with validation through genotypic and phenotypic readout. We demonstrate that all individual components must be present to obtain successful gene editing. Importantly, we examine the genotype of individually sorted corrected and uncorrected clonally expanded cell populations for the mutagenic footprint left by the action of these gene editing tools. While the DNA sequence of the corrected population is exact with no adjacent sequence modification, the uncorrected population exhibits heterogeneous mutagenicity with a wide variety of deletions and insertions surrounding the target site. We designate this type of DNA aberration as on-site mutagenicity. Analyses of two clonal populations bearing specific DNA insertions surrounding the target site, indicate that point mutation repair has occurred at the level of the gene. The phenotype, however, is not rescued because a section of the single-stranded oligonucleotide has been inserted altering the reading frame and generating truncated proteins. These data illustrate the importance of analysing mutagenicity in uncorrected cells. Our results also form the basis of a simple model for point mutation repair directed by a short single-stranded DNA oligonucleotides and CRISPR/Cas9 ribonucleoprotein complex.

Insertional Mutagenesis by CRISPR/Cas9 Ribonucleoprotein Gene Editing in Cells Targeted for Point Mutation Repair Directed by Short Single-Stranded DNA Oligonucleotides

PubMed Central

Rivera-Torres, Natalia; Bialk, Pawel; Bloh, Kevin M.; Kmiec, Eric B.

2017-01-01

CRISPR/Cas9 and single-stranded DNA oligonucleotides (ssODNs) have been used to direct the repair of a single base mutation in human genes. Here, we examine a method designed to increase the precision of RNA guided genome editing in human cells by utilizing a CRISPR/Cas9 ribonucleoprotein (RNP) complex to initiate DNA cleavage. The RNP is assembled in vitro and induces a double stranded break at a specific site surrounding the mutant base designated for correction by the ssODN. We use an integrated mutant eGFP gene, bearing a single base change rendering the expressed protein nonfunctional, as a single copy target in HCT 116 cells. We observe significant gene correction activity of the mutant base, promoted by the RNP and single-stranded DNA oligonucleotide with validation through genotypic and phenotypic readout. We demonstrate that all individual components must be present to obtain successful gene editing. Importantly, we examine the genotype of individually sorted corrected and uncorrected clonally expanded cell populations for the mutagenic footprint left by the action of these gene editing tools. While the DNA sequence of the corrected population is exact with no adjacent sequence modification, the uncorrected population exhibits heterogeneous mutagenicity with a wide variety of deletions and insertions surrounding the target site. We designate this type of DNA aberration as on-site mutagenicity. Analyses of two clonal populations bearing specific DNA insertions surrounding the target site, indicate that point mutation repair has occurred at the level of the gene. The phenotype, however, is not rescued because a section of the single-stranded oligonucleotide has been inserted altering the reading frame and generating truncated proteins. These data illustrate the importance of analysing mutagenicity in uncorrected cells. Our results also form the basis of a simple model for point mutation repair directed by a short single-stranded DNA oligonucleotides and CRISPR/Cas9 ribonucleoprotein complex. PMID:28052104

Parallel gene analysis with allele-specific padlock probes and tag microarrays

PubMed Central

Banér, Johan; Isaksson, Anders; Waldenström, Erik; Jarvius, Jonas; Landegren, Ulf; Nilsson, Mats

2003-01-01

Parallel, highly specific analysis methods are required to take advantage of the extensive information about DNA sequence variation and of expressed sequences. We present a scalable laboratory technique suitable to analyze numerous target sequences in multiplexed assays. Sets of padlock probes were applied to analyze single nucleotide variation directly in total genomic DNA or cDNA for parallel genotyping or gene expression analysis. All reacted probes were then co-amplified and identified by hybridization to a standard tag oligonucleotide array. The technique was illustrated by analyzing normal and pathogenic variation within the Wilson disease-related ATP7B gene, both at the level of DNA and RNA, using allele-specific padlock probes. PMID:12930977

Unknown sequence amplification: Application to in vitro genome walking in Chlamydia trachomatis L2

DOE Office of Scientific and Technical Information (OSTI.GOV)

Copley, C.G.; Boot, C.; Bundell, K.

1991-01-01

A recently described technique, Chemical Genetics' unknown sequence amplification method, which requires only one specific oligonucleotide, has broadened the applicability of the polymerase chain reaction to DNA of unknown sequence. The authors have adapted this technique to the study of the genome of Chlamydia trachomatis, an obligate intracellular bacterium, and describe modifications that significantly improve the utility of this approach. These techniques allow for rapid genomic analysis entirely in vitro, using DNA of limited quantity of purity.

Genetic characterization of an alloalbumin, albumin Kashmir, using gene amplification and allele-specific oligonucleotides.

PubMed Central

Savva, D; Tárnoky, A L; Vickers, M F

1990-01-01

The molecular basis for albumin Kashmir was studied using the polymerase chain reaction to amplify a DNA fragment containing codon 501 in exon 12 of the human albumin gene. Southern blots of the amplified DNA were hybridized to oligonucleotide probes specific either for the normal allele of albumin or for albumin Kashmir. The results provide strong evidence that codon 501 in albumin Kashmir is AAG (lysine) instead of GAG (glutamic acid), thus confirming the protein sequences reported. This approach was used to characterize a bisalbuminaemic individual as a carrier for albumin Kashmir. Similar strategies may be devised to study the molecular basis and to identify carriers of other alloalbumins. Images Fig. 1. Fig. 2. PMID:2317208

GeneChip{sup {trademark}} screening assay for cystic fibrosis mutations

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cronn, M.T.; Miyada, C.G.; Fucini, R.V.

1994-09-01

GeneChip{sup {trademark}} assays are based on high density, carefully designed arrays of short oligonucleotide probes (13-16 bases) built directly on derivatized silica substrates. DNA target sequence analysis is achieved by hybridizing fluorescently labeled amplification products to these arrays. Fluorescent hybridization signals located within the probe array are translated into target sequence information using the known probe sequence at each array feature. The mutation screening assay for cystic fibrosis includes sets of oligonucleotide probes designed to detect numerous different mutations that have been described in 14 exons and one intron of the CFTR gene. Each mutation site is addressed by amore » sub-array of at least 40 probe sequences, half designed to detect the wild type gene sequence and half designed to detect the reported mutant sequence. Hybridization with homozygous mutant, homozygous wild type or heterozygous targets results in distinctive hybridization patterns within a sub-array, permitting specific discrimination of each mutation. The GeneChip probe arrays are very small (approximately 1 cm{sup 2}). There miniature size coupled with their high information content make GeneChip probe arrays a useful and practical means for providing CF mutation analysis in a clinical setting.« less

Winnowing DNA for rare sequences: highly specific sequence and methylation based enrichment.

PubMed

Thompson, Jason D; Shibahara, Gosuke; Rajan, Sweta; Pel, Joel; Marziali, Andre

2012-01-01

Rare mutations in cell populations are known to be hallmarks of many diseases and cancers. Similarly, differential DNA methylation patterns arise in rare cell populations with diagnostic potential such as fetal cells circulating in maternal blood. Unfortunately, the frequency of alleles with diagnostic potential, relative to wild-type background sequence, is often well below the frequency of errors in currently available methods for sequence analysis, including very high throughput DNA sequencing. We demonstrate a DNA preparation and purification method that through non-linear electrophoretic separation in media containing oligonucleotide probes, achieves 10,000 fold enrichment of target DNA with single nucleotide specificity, and 100 fold enrichment of unmodified methylated DNA differing from the background by the methylation of a single cytosine residue.

Method of identifying hairpin DNA probes by partial fold analysis

DOEpatents

Miller, Benjamin L [Penfield, NY; Strohsahl, Christopher M [Saugerties, NY

2009-10-06

Method of identifying molecular beacons in which a secondary structure prediction algorithm is employed to identify oligonucleotide sequences within a target gene having the requisite hairpin structure. Isolated oligonucleotides, molecular beacons prepared from those oligonucleotides, and their use are also disclosed.

Method of identifying hairpin DNA probes by partial fold analysis

DOEpatents

Miller, Benjamin L.; Strohsahl, Christopher M.

2008-10-28

Methods of identifying molecular beacons in which a secondary structure prediction algorithm is employed to identify oligonucleotide sequences within a target gene having the requisite hairpin structure. Isolated oligonucleotides, molecular beacons prepared from those oligonucleotides, and their use are also disclosed.

Precise and selective sensing of DNA-DNA hybridization by graphene/Si-nanowires diode-type biosensors.

PubMed

Kim, Jungkil; Park, Shin-Young; Kim, Sung; Lee, Dae Hun; Kim, Ju Hwan; Kim, Jong Min; Kang, Hee; Han, Joong-Soo; Park, Jun Woo; Lee, Hosun; Choi, Suk-Ho

2016-08-18

Single-Si-nanowire (NW)-based DNA sensors have been recently developed, but their sensitivity is very limited because of high noise signals, originating from small source-drain current of the single Si NW. Here, we demonstrate that chemical-vapor-deposition-grown large-scale graphene/surface-modified vertical-Si-NW-arrays junctions can be utilized as diode-type biosensors for highly-sensitive and -selective detection of specific oligonucleotides. For this, a twenty-seven-base-long synthetic oligonucleotide, which is a fragment of human DENND2D promoter sequence, is first decorated as a probe on the surface of vertical Si-NW arrays, and then the complementary oligonucleotide is hybridized to the probe. This hybridization gives rise to a doping effect on the surface of Si NWs, resulting in the increase of the current in the biosensor. The current of the biosensor increases from 19 to 120% as the concentration of the target DNA varies from 0.1 to 500 nM. In contrast, such biosensing does not come into play by the use of the oligonucleotide with incompatible or mismatched sequences. Similar results are observed from photoluminescence microscopic images and spectra. The biosensors show very-uniform current changes with standard deviations ranging ~1 to ~10% by ten-times endurance tests. These results are very promising for their applications in accurate, selective, and stable biosensing.

A dynamic bead-based microarray for parallel DNA detection

NASA Astrophysics Data System (ADS)

Sochol, R. D.; Casavant, B. P.; Dueck, M. E.; Lee, L. P.; Lin, L.

2011-05-01

A microfluidic system has been designed and constructed by means of micromachining processes to integrate both microfluidic mixing of mobile microbeads and hydrodynamic microbead arraying capabilities on a single chip to simultaneously detect multiple bio-molecules. The prototype system has four parallel reaction chambers, which include microchannels of 18 × 50 µm2 cross-sectional area and a microfluidic mixing section of 22 cm length. Parallel detection of multiple DNA oligonucleotide sequences was achieved via molecular beacon probes immobilized on polystyrene microbeads of 16 µm diameter. Experimental results show quantitative detection of three distinct DNA oligonucleotide sequences from the Hepatitis C viral (HCV) genome with single base-pair mismatch specificity. Our dynamic bead-based microarray offers an effective microfluidic platform to increase parallelization of reactions and improve microbead handling for various biological applications, including bio-molecule detection, medical diagnostics and drug screening.

Strategies to Improve Efficiency and Specificity of Degenerate Primers in PCR.

PubMed

Campos, Maria Jorge; Quesada, Alberto

2017-01-01

PCR with degenerate primers can be used to identify the coding sequence of an unknown protein or to detect a genetic variant within a gene family. These primers, which are complex mixtures of slightly different oligonucleotide sequences, can be optimized to increase the efficiency and/or specificity of PCR in the amplification of a sequence of interest by the introduction of mismatches with the target sequence and balancing their position toward the primers 5'- or 3'-ends. In this work, we explain in detail examples of rational design of primers in two different applications, including the use of specific determinants at the 3'-end, to: (1) improve PCR efficiency with coding sequences for members of a protein family by fully degeneration at a core box of conserved genetic information, with the reduction of degeneration at the 5'-end, and (2) optimize specificity of allelic discrimination of closely related orthologous by 5'-end degenerate primers.

Structured oligonucleotides for target indexing to allow single-vessel PCR amplification and solid support microarray hybridization.

PubMed

Girard, Laurie D; Boissinot, Karel; Peytavi, Régis; Boissinot, Maurice; Bergeron, Michel G

2015-02-07

The combination of molecular diagnostic technologies is increasingly used to overcome limitations on sensitivity, specificity or multiplexing capabilities, and provide efficient lab-on-chip devices. Two such techniques, PCR amplification and microarray hybridization are used serially to take advantage of the high sensitivity and specificity of the former combined with high multiplexing capacities of the latter. These methods are usually performed in different buffers and reaction chambers. However, these elaborate methods have high complexity and cost related to reagent requirements, liquid storage and the number of reaction chambers to integrate into automated devices. Furthermore, microarray hybridizations have a sequence dependent efficiency not always predictable. In this work, we have developed the concept of a structured oligonucleotide probe which is activated by cleavage from polymerase exonuclease activity. This technology is called SCISSOHR for Structured Cleavage Induced Single-Stranded Oligonucleotide Hybridization Reaction. The SCISSOHR probes enable indexing the target sequence to a tag sequence. The SCISSOHR technology also allows the combination of nucleic acid amplification and microarray hybridization in a single vessel in presence of the PCR buffer only. The SCISSOHR technology uses an amplification probe that is irreversibly modified in presence of the target, releasing a single-stranded DNA tag for microarray hybridization. Each tag is composed of a 3-nucleotide sequence-dependent segment and a unique "target sequence-independent" 14-nucleotide segment allowing for optimal hybridization with minimal cross-hybridization. We evaluated the performance of five (5) PCR buffers to support microarray hybridization, compared to a conventional hybridization buffer. Finally, as a proof of concept, we developed a multiplexed assay for the amplification, detection, and identification of three (3) DNA targets. This new technology will facilitate the design of lab-on-chip microfluidic devices, while also reducing consumable costs. At term, it will allow the cost-effective automation of highly multiplexed assays for detection and identification of genetic targets.

Toward a solid-phase nucleic acid hybridization assay within microfluidic channels using immobilized quantum dots as donors in fluorescence resonance energy transfer.

PubMed

Chen, Lu; Algar, W Russ; Tavares, Anthony J; Krull, Ulrich J

2011-01-01

The optical properties and surface area of quantum dots (QDs) have made them an attractive platform for the development of nucleic acid biosensors based on fluorescence resonance energy transfer (FRET). Solid-phase assays based on FRET using mixtures of immobilized QD-oligonucleotide conjugates (QD biosensors) have been developed. The typical challenges associated with solid-phase detection strategies include non-specific adsorption, slow kinetics of hybridization, and sample manipulation. The new work herein has considered the immobilization of QD biosensors onto the surfaces of microfluidic channels in order to address these challenges. Microfluidic flow can be used to dynamically control stringency by adjustment of the potential in an electrokinetic-based microfluidics environment. The shearing force, Joule heating, and the competition between electroosmotic and electrophoretic mobilities allow the optimization of hybridization conditions, convective delivery of target to the channel surface to speed hybridization, amelioration of adsorption, and regeneration of the sensing surface. Microfluidic flow can also be used to deliver (for immobilization) and remove QD biosensors. QDs that were conjugated with two different oligonucleotide sequences were used to demonstrate feasibility. One oligonucleotide sequence on the QD was available as a linker for immobilization via hybridization with complementary oligonucleotides located on a glass surface within a microfluidic channel. A second oligonucleotide sequence on the QD served as a probe to transduce hybridization with target nucleic acid in a sample solution. A Cy3 label on the target was excited by FRET using green-emitting CdSe/ZnS QD donors and provided an analytical signal to explore this detection strategy. The immobilized QDs could be removed under denaturing conditions by disrupting the duplex that was used as the surface linker and thus allowed a new layer of QD biosensors to be re-coated within the channel for re-use of the microfluidic chip.

Repeat sequence chromosome specific nucleic acid probes and methods of preparing and using

DOEpatents

Weier, H.U.G.; Gray, J.W.

1995-06-27

A primer directed DNA amplification method to isolate efficiently chromosome-specific repeated DNA wherein degenerate oligonucleotide primers are used is disclosed. The probes produced are a heterogeneous mixture that can be used with blocking DNA as a chromosome-specific staining reagent, and/or the elements of the mixture can be screened for high specificity, size and/or high degree of repetition among other parameters. The degenerate primers are sets of primers that vary in sequence but are substantially complementary to highly repeated nucleic acid sequences, preferably clustered within the template DNA, for example, pericentromeric alpha satellite repeat sequences. The template DNA is preferably chromosome-specific. Exemplary primers and probes are disclosed. The probes of this invention can be used to determine the number of chromosomes of a specific type in metaphase spreads, in germ line and/or somatic cell interphase nuclei, micronuclei and/or in tissue sections. Also provided is a method to select arbitrarily repeat sequence probes that can be screened for chromosome-specificity. 18 figs.

Repeat sequence chromosome specific nucleic acid probes and methods of preparing and using

DOEpatents

Weier, Heinz-Ulrich G.; Gray, Joe W.

1995-01-01

A primer directed DNA amplification method to isolate efficiently chromosome-specific repeated DNA wherein degenerate oligonucleotide primers are used is disclosed. The probes produced are a heterogeneous mixture that can be used with blocking DNA as a chromosome-specific staining reagent, and/or the elements of the mixture can be screened for high specificity, size and/or high degree of repetition among other parameters. The degenerate primers are sets of primers that vary in sequence but are substantially complementary to highly repeated nucleic acid sequences, preferably clustered within the template DNA, for example, pericentromeric alpha satellite repeat sequences. The template DNA is preferably chromosome-specific. Exemplary primers ard probes are disclosed. The probes of this invention can be used to determine the number of chromosomes of a specific type in metaphase spreads, in germ line and/or somatic cell interphase nuclei, micronuclei and/or in tissue sections. Also provided is a method to select arbitrarily repeat sequence probes that can be screened for chromosome-specificity.

Sequence-specific sepsis-related DNA capture and fluorescent labeling in monoliths prepared by single-step photopolymerization in microfluidic devices.

PubMed

Knob, Radim; Hanson, Robert L; Tateoka, Olivia B; Wood, Ryan L; Guerrero-Arguero, Israel; Robison, Richard A; Pitt, William G; Woolley, Adam T

2018-05-21

Fast determination of antibiotic resistance is crucial in selecting appropriate treatment for sepsis patients, but current methods based on culture are time consuming. We are developing a microfluidic platform with a monolithic column modified with oligonucleotides designed for sequence-specific capture of target DNA related to the Klebsiella pneumoniae carbapenemase (KPC) gene. We developed a novel single-step monolith fabrication method with an acrydite-modified capture oligonucleotide in the polymerization mixture, enabling fast monolith preparation in a microfluidic channel using UV photopolymerization. These prepared columns had a threefold higher capacity compared to monoliths prepared in a multistep process involving Schiff-base DNA attachment. Conditions for denaturing, capture and fluorescence labeling using hybridization probes were optimized with synthetic 90-mer oligonucleotides. These procedures were applied for extraction of a PCR amplicon from the KPC antibiotic resistance gene in bacterial lysate obtained from a blood sample spiked with E. coli. The results showed similar eluted peak areas for KPC amplicon extracted from either hybridization buffer or bacterial lysate. Selective extraction of the KPC DNA was verified by real time PCR on eluted fractions. These results show great promise for application in an integrated microfluidic diagnostic system that combines upstream blood sample preparation and downstream single-molecule counting detection. Copyright © 2018 Elsevier B.V. All rights reserved.

Sequence-based design of bioactive small molecules that target precursor microRNAs

PubMed Central

Velagapudi, Sai Pradeep; Gallo, Steven M.; Disney, Matthew D.

2014-01-01

Oligonucleotides are designed to target RNA using base pairing rules, however, they are hampered by poor cellular delivery and non-specific stimulation of the immune system. Small molecules are preferred as lead drugs or probes, but cannot be designed from sequence. Herein, we describe an approach termed Inforna that designs lead small molecules for RNA from solely sequence. Inforna was applied to all human microRNA precursors and identified bioactive small molecules that inhibit biogenesis by binding to nuclease processing sites (41% hit rate). Amongst 29 lead interactions, the most avid interaction is between a benzimidazole (1) and precursor microRNA-96. Compound 1 selectively inhibits biogenesis of microRNA-96, upregulating a protein target (FOXO1) and inducing apoptosis in cancer cells. Apoptosis is ablated when FOXO1 mRNA expression is knocked down by an siRNA, validating compound selectivity. Importantly, microRNA profiling shows that 1 only significantly effects microRNA-96 biogenesis and is more selective than an oligonucleotide. PMID:24509821

Synthesis and hybridization of a series of biotinylated oligonucleotides.

PubMed Central

Cook, A F; Vuocolo, E; Brakel, C L

1988-01-01

A series of oligonucleotides containing biotin-11-dUMP at various positions were synthesized and compared in quantitative, colorimetric hybridization-detection studies. A deoxyuridine phosphoramidite containing a protected allylamino sidearm was synthesized and used in standard, automated synthesis cycles to prepare oligonucleotides with allylamino residues at various positions within a standard 17-base sequence. Biotin substituents were subsequently attached to the allylamino sidearms by reaction with N-biotinyl-6-aminocaproic acid N-hydroxysuccinimide ester. These oligomers were hybridized to target DNA immobilized on microtiter wells (ELISA plates), and were detected with a streptavidin-biotinylated horseradish peroxidase complex using hydrogen peroxide as substrate and o-phenylenediamine as chromogen. We found that the sensitivity of detection of target DNA by biotin-labeled oligonucleotide probes was strongly dependent upon the position of the biotin label. Oligonucleotides containing biotin labels near or off the ends of the hybridizing sequence were more effective probes than oligonucleotides containing internal biotin labels. An additive effect of increasing numbers of biotin-dUMP residues was found for some labeling configurations. PMID:3375076

Time-series oligonucleotide count to assign antiviral siRNAs with long utility fit in the big data era

PubMed Central

Wada, K; Wada, Y; Iwasaki, Y; Ikemura, T

2017-01-01

Oligonucleotides are key elements of nucleic acid therapeutics such as small interfering RNAs (siRNAs). Influenza and Ebolaviruses are zoonotic RNA viruses mutating very rapidly, and their sequence changes must be characterized intensively to design therapeutic oligonucleotides with long utility. Focusing on a total of 182 experimentally validated siRNAs for influenza A, B and Ebolaviruses compiled by the siRNA database, we conducted time-series analyses of occurrences of siRNA targets in these viral genomes. Reflecting their high mutation rates, occurrences of target oligonucleotides evidently fluctuate in viral populations and often disappear. Time-series analysis of the one-base changed sequences derived from each original target identified the oligonucleotide that shows a compensatory increase and will potentially become the ‘awaiting-type oligonucleotide’ the combined use of this oligonucleotide with the original can provide therapeutics with long utility. This strategy is also useful for assigning diagnostic reverse transcription-PCR primers with long utility. PMID:28905886

Characterization of Satellite DNA Sequences from the Commercially Important Marine Rotifers Brachionus rotundiformis and Brachionus plicatilis.

PubMed

Boehm; Gibson; Lubzens

2000-01-01

This study was initiated to search for species-specific and strain-specific satellite DNA sequences for which oligonucleotide primers could be designed to differentiate between various commercially important strains of the marine monogonont rotifers Brachionus rotundiformis and Brachionus plicatilis. Two unrelated, highly reiterated satellite sequences were cloned and characterized. The eight sequenced monomers from B. rotundiformis and six from B. plicatilis had low intrarepeat variability and were similar in their overall lengths, A + T compositions, and high degrees of repeated motif substructure. However, hybridizations to 19 representative strains, sequence characterizations, and GenBank searches indicated that these two satellites are morphotype-specific and population-specific, respectively, and share little homology to each other or to other characterized sequences in the database. Primer pairs designed for the B. rotundiformis satellite confirmed hybridization specificities on polymerase chain reaction and could serve as a useful molecular diagnostic tool to identify strains belonging to the SS morphotype, which are gaining widespread usage as first feeds for marine fish in commercial production.

Oligo Design: a computer program for development of probes for oligonucleotide microarrays.

PubMed

Herold, Keith E; Rasooly, Avraham

2003-12-01

Oligonucleotide microarrays have demonstrated potential for the analysis of gene expression, genotyping, and mutational analysis. Our work focuses primarily on the detection and identification of bacteria based on known short sequences of DNA. Oligo Design, the software described here, automates several design aspects that enable the improved selection of oligonucleotides for use with microarrays for these applications. Two major features of the program are: (i) a tiling algorithm for the design of short overlapping temperature-matched oligonucleotides of variable length, which are useful for the analysis of single nucleotide polymorphisms and (ii) a set of tools for the analysis of multiple alignments of gene families and related short DNA sequences, which allow for the identification of conserved DNA sequences for PCR primer selection and variable DNA sequences for the selection of unique probes for identification. Note that the program does not address the full genome perspective but, instead, is focused on the genetic analysis of short segments of DNA. The program is Internet-enabled and includes a built-in browser and the automated ability to download sequences from GenBank by specifying the GI number. The program also includes several utilities, including audio recital of a DNA sequence (useful for verifying sequences against a written document), a random sequence generator that provides insight into the relationship between melting temperature and GC content, and a PCR calculator.

The Status of Exon Skipping as a Therapeutic Approach to Duchenne Muscular Dystrophy

PubMed Central

Lu, Qi-Long; Yokota, Toshifumi; Takeda, Shin'ichi; Garcia, Luis; Muntoni, Francesco; Partridge, Terence

2011-01-01

Duchenne muscular dystrophy (DMD) is associated with mutations in the dystrophin gene that disrupt the open reading frame whereas the milder Becker's form is associated with mutations which leave an in-frame mRNA transcript that can be translated into a protein that includes the N- and C- terminal functional domains. It has been shown that by excluding specific exons at, or adjacent to, frame-shifting mutations, open reading frame can be restored to an out-of-frame mRNA, leading to the production of a partially functional Becker-like dystrophin protein. Such targeted exclusion can be achieved by administration of oligonucleotides that are complementary to sequences that are crucial to normal splicing of the exon into the transcript. This principle has been validated in mouse and canine models of DMD with a number of variants of oligonucleotide analogue chemistries and by transduction with adeno-associated virus (AAV)-small nuclear RNA (snRNA) reagents encoding the antisense sequence. Two different oligonucleotide agents are now being investigated in human trials for splicing out of exon 51 with some early indications of success at the biochemical level. PMID:20978473

High-density fiber optic biosensor arrays

NASA Astrophysics Data System (ADS)

Epstein, Jason R.; Walt, David R.

2002-02-01

Novel approaches are required to coordinate the immense amounts of information derived from diverse genomes. This concept has influenced the expanded role of high-throughput DNA detection and analysis in the biological sciences. A high-density fiber optic DNA biosensor was developed consisting of oligonucleotide-functionalized, 3.1 mm diameter microspheres deposited into the etched wells on the distal face of a 500 micrometers imaging fiber bundle. Imaging fiber bundles containing thousands of optical fibers, each associated with a unique oligonucleotide probe sequence, were the foundation for an optically connected, individually addressable DNA detection platform. Different oligonucleotide-functionalized microspheres were combined in a stock solution, and randomly dispersed into the etched wells. Microsphere positions were registered from optical dyes incorporated onto the microspheres. The distribution process provided an inherent redundancy that increases the signal-to-noise ratio as the square root of the number of sensors examined. The representative amount of each probe-type in the array was dependent on their initial stock solution concentration, and as other sequences of interest arise, new microsphere elements can be added to arrays without altering the existing detection capabilities. The oligonucleotide probe sequences hybridize to fluorescently-labeled, complementary DNA target solutions. Fiber optic DNA microarray research has included DNA-protein interaction profiles, microbial strain differentiation, non-labeled target interrogation with molecular beacons, and single cell-based assays. This biosensor array is proficient in DNA detection linked to specific disease states, single nucleotide polymorphism (SNP's) discrimination, and gene expression analysis. This array platform permits multiple detection formats, provides smaller feature sizes, and enables sensor design flexibility. High-density fiber optic microarray biosensors provide a fast, reversible format with the detection limit of a few hundred molecules.

Sequence selective capture, release and analysis of DNA using a magnetic microbead-assisted toehold-mediated DNA strand displacement reaction.

PubMed

Khodakov, Dmitriy A; Khodakova, Anastasia S; Linacre, Adrian; Ellis, Amanda V

2014-07-21

This paper reports on the modification of magnetic beads with oligonucleotide capture probes with a specially designed pendant toehold (overhang) aimed specifically to capture double-stranded PCR products. After capture, the PCR products were selectively released from the magnetic beads by means of a toehold-mediated strand displacement reaction using short artificial oligonucleotide triggers and analysed using capillary electrophoresis. The approach was successfully shown on two genes widely used in human DNA genotyping, namely human c-fms (macrophage colony-stimulating factor) proto-oncogene for the CSF-1 receptor (CSF1PO) and amelogenin.

Fluorescence energy transfer as a probe for nucleic acid structures and sequences.

PubMed Central

Mergny, J L; Boutorine, A S; Garestier, T; Belloc, F; Rougée, M; Bulychev, N V; Koshkin, A A; Bourson, J; Lebedev, A V; Valeur, B

1994-01-01

The primary or secondary structure of single-stranded nucleic acids has been investigated with fluorescent oligonucleotides, i.e., oligonucleotides covalently linked to a fluorescent dye. Five different chromophores were used: 2-methoxy-6-chloro-9-amino-acridine, coumarin 500, fluorescein, rhodamine and ethidium. The chemical synthesis of derivatized oligonucleotides is described. Hybridization of two fluorescent oligonucleotides to adjacent nucleic acid sequences led to fluorescence excitation energy transfer between the donor and the acceptor dyes. This phenomenon was used to probe primary and secondary structures of DNA fragments and the orientation of oligodeoxynucleotides synthesized with the alpha-anomers of nucleoside units. Fluorescence energy transfer can be used to reveal the formation of hairpin structures and the translocation of genes between two chromosomes. PMID:8152922

Automated detection and quantitation of bacterial RNA by using electrical microarrays.

PubMed

Elsholz, B; Wörl, R; Blohm, L; Albers, J; Feucht, H; Grunwald, T; Jürgen, B; Schweder, T; Hintsche, Rainer

2006-07-15

Low-density electrical 16S rRNA specific oligonucleotide microarrays and an automated analysis system have been developed for the identification and quantitation of pathogens. The pathogens are Escherichia coli, Pseudomonas aeruginosa, Enterococcus faecalis, Staphylococcus aureus, and Staphylococcus epidermidis, which are typically involved in urinary tract infections. Interdigitated gold array electrodes (IDA-electrodes), which have structures in the nanometer range, have been used for very sensitive analysis. Thiol-modified oligonucleotides are immobilized on the gold IDA as capture probes. They mediate the specific recognition of the target 16S rRNA by hybridization. Additionally three unlabeled oligonucleotides are hybridized in close proximity to the capturing site. They are supporting molecules, because they improve the RNA hybridization at the capturing site. A biotin labeled detector oligonucleotide is also allowed to hybridize to the captured RNA sequence. The biotin labels enable the binding of avidin alkaline phophatase conjugates. The phosphatase liberates the electrochemical mediator p-aminophenol from its electrically inactive phosphate derivative. The electrical signals were generated by amperometric redox cycling and detected by a unique multipotentiostat. The read out signals of the microarray are position specific current and change over time in proportion to the analyte concentration. If two additional biotins are introduced into the affinity binding complex via the supporting oligonucleotides, the sensitivity of the assays increase more than 60%. The limit of detection of Escherichia coli total RNA has been determined to be 0.5 ng/microL. The control of fluidics for variable assay formats as well as the multichannel electrical read out and data handling have all been fully automated. The fast and easy procedure does not require any amplification of the targeted nucleic acids by PCR.

nuID: a universal naming scheme of oligonucleotides for Illumina, Affymetrix, and other microarrays

PubMed Central

Du, Pan; Kibbe, Warren A; Lin, Simon M

2007-01-01

Background Oligonucleotide probes that are sequence identical may have different identifiers between manufacturers and even between different versions of the same company's microarray; and sometimes the same identifier is reused and represents a completely different oligonucleotide, resulting in ambiguity and potentially mis-identification of the genes hybridizing to that probe. Results We have devised a unique, non-degenerate encoding scheme that can be used as a universal representation to identify an oligonucleotide across manufacturers. We have named the encoded representation 'nuID', for nucleotide universal identifier. Inspired by the fact that the raw sequence of the oligonucleotide is the true definition of identity for a probe, the encoding algorithm uniquely and non-degenerately transforms the sequence itself into a compact identifier (a lossless compression). In addition, we added a redundancy check (checksum) to validate the integrity of the identifier. These two steps, encoding plus checksum, result in an nuID, which is a unique, non-degenerate, permanent, robust and efficient representation of the probe sequence. For commercial applications that require the sequence identity to be confidential, we have an encryption schema for nuID. We demonstrate the utility of nuIDs for the annotation of Illumina microarrays, and we believe it has universal applicability as a source-independent naming convention for oligomers. Reviewers This article was reviewed by Itai Yanai, Rong Chen (nominated by Mark Gerstein), and Gregory Schuler (nominated by David Lipman). PMID:17540033

Winnowing DNA for Rare Sequences: Highly Specific Sequence and Methylation Based Enrichment

PubMed Central

Thompson, Jason D.; Shibahara, Gosuke; Rajan, Sweta; Pel, Joel; Marziali, Andre

2012-01-01

Rare mutations in cell populations are known to be hallmarks of many diseases and cancers. Similarly, differential DNA methylation patterns arise in rare cell populations with diagnostic potential such as fetal cells circulating in maternal blood. Unfortunately, the frequency of alleles with diagnostic potential, relative to wild-type background sequence, is often well below the frequency of errors in currently available methods for sequence analysis, including very high throughput DNA sequencing. We demonstrate a DNA preparation and purification method that through non-linear electrophoretic separation in media containing oligonucleotide probes, achieves 10,000 fold enrichment of target DNA with single nucleotide specificity, and 100 fold enrichment of unmodified methylated DNA differing from the background by the methylation of a single cytosine residue. PMID:22355378

Interaction of the E. coli DNA G:T-mismatch endonuclease (vsr protein) with oligonucleotides containing its target sequence.

PubMed

Turner, D P; Connolly, B A

2000-12-15

The Escherichia coli vsr endonuclease recognises G:T base-pair mismatches in double-stranded DNA and initiates a repair pathway by hydrolysing the phosphate group 5' to the incorrectly paired T. The enzyme shows a preference for G:T mismatches within a particular sequence context, derived from the recognition site of the E. coli dcm DNA-methyltransferase (CC[A/T]GG). Thus, the preferred substrate for the vsr protein is (CT[A/T]GG), where the underlined T is opposed by a dG base. This paper provides quantitative data for the interaction of the vsr protein with a number of oligonucleotides containing G:T mismatches. Evaluation of specificity constant (k(st)/K(D); k(st)=rate constant for single turnover, K(D)=equilibrium dissociation constant) confirms vsr's preference for a G:T mismatch within a hemi-methylated dcm sequence, i.e. the best substrate is a duplex (both strands written in the 5'-3' orientation) composed of CT[A/T]GG and C(5Me)C[T/A]GG. Conversion of the mispaired T (underlined) to dU or the d(5Me)C to dC gave poorer substrates. No interaction was observed with oligonucleotides that lacked a G:T mismatch or did not possess a dcm sequence. An analysis of the fraction of active protein, by "reverse-titration" (i.e. adding increasing amounts of DNA to a fixed amount of protein followed by gel-mobility shift analysis) showed that less than 1% of the vsr endonuclease was able to bind to the substrate. This was confirmed using "competitive titrations" (where competitor oligonucleotides are used to displace a (32)P-labelled nucleic acid from the vsr protein) and burst kinetic analysis. This result is discussed in the light of previous in vitro and in vivo data which indicate that the MutL protein may be needed for full vsr activity. Copyright 2000 Academic Press.

Oligonucleotide Microarray for 16S rRNA Gene-Based Detection of All Recognized Lineages of Sulfate-Reducing Prokaryotes in the Environment

PubMed Central

Loy, Alexander; Lehner, Angelika; Lee, Natuschka; Adamczyk, Justyna; Meier, Harald; Ernst, Jens; Schleifer, Karl-Heinz; Wagner, Michael

2002-01-01

For cultivation-independent detection of sulfate-reducing prokaryotes (SRPs) an oligonucleotide microarray consisting of 132 16S rRNA gene-targeted oligonucleotide probes (18-mers) having hierarchical and parallel (identical) specificity for the detection of all known lineages of sulfate-reducing prokaryotes (SRP-PhyloChip) was designed and subsequently evaluated with 41 suitable pure cultures of SRPs. The applicability of SRP-PhyloChip for diversity screening of SRPs in environmental and clinical samples was tested by using samples from periodontal tooth pockets and from the chemocline of a hypersaline cyanobacterial mat from Solar Lake (Sinai, Egypt). Consistent with previous studies, SRP-PhyloChip indicated the occurrence of Desulfomicrobium spp. in the tooth pockets and the presence of Desulfonema- and Desulfomonile-like SRPs (together with other SRPs) in the chemocline of the mat. The SRP-PhyloChip results were confirmed by several DNA microarray-independent techniques, including specific PCR amplification, cloning, and sequencing of SRP 16S rRNA genes and the genes encoding the dissimilatory (bi)sulfite reductase (dsrAB). PMID:12324358

Metatranscriptomics of Soil Eukaryotic Communities.

PubMed

Yadav, Rajiv K; Bragalini, Claudia; Fraissinet-Tachet, Laurence; Marmeisse, Roland; Luis, Patricia

2016-01-01

Functions expressed by eukaryotic organisms in soil can be specifically studied by analyzing the pool of eukaryotic-specific polyadenylated mRNA directly extracted from environmental samples. In this chapter, we describe two alternative protocols for the extraction of high-quality RNA from soil samples. Total soil RNA or mRNA can be converted to cDNA for direct high-throughput sequencing. Polyadenylated mRNA-derived full-length cDNAs can also be cloned in expression plasmid vectors to constitute soil cDNA libraries, which can be subsequently screened for functional gene categories. Alternatively, the diversity of specific gene families can also be explored following cDNA sequence capture using exploratory oligonucleotide probes.

Partial 16S rRNA primary structure of five Actinomyces species: phylogenetic implications and development of an Actinomyces israelii-specific oligonucleotide probe.

PubMed

Stackebrandt, E; Charfreitag, O

1990-01-01

The intra- and intergeneric relationships of the genus Actinomyces were determined by comparing long 16S rRNA sequences, generated by reverse transcriptase. All species formed a phylogenetically coherent cluster in which Actinomyces bovis, A. viscosus, A. naeslundii, A. odontolyticus and A. israelii constituted genetically well defined species. A. israelii DSM 43322 (serotype 2) was not closely related to three other strains of this species (serotype 1) and, as judged from phylogenetic distances, could be accommodated within A. naeslundii, or represent a new species. In contrast to previous findings, members of the genus Actinomyces appear to be related to Bifidobacterium bifidum. Sequence information was used to develop an oligonucleotide probe for the A. israelii serotype 1 strains, which did not react with the serotype 2 strain or with rRNA from strains of eight Actinomyces species.

Artificial mismatch hybridization

DOEpatents

Guo, Zhen; Smith, Lloyd M.

1998-01-01

An improved nucleic acid hybridization process is provided which employs a modified oligonucleotide and improves the ability to discriminate a control nucleic acid target from a variant nucleic acid target containing a sequence variation. The modified probe contains at least one artificial mismatch relative to the control nucleic acid target in addition to any mismatch(es) arising from the sequence variation. The invention has direct and advantageous application to numerous existing hybridization methods, including, applications that employ, for example, the Polymerase Chain Reaction, allele-specific nucleic acid sequencing methods, and diagnostic hybridization methods.

[Inheritable phenotypic normalization of rodent cells transformed by simian adenovirus SA7 E1 oncogenes by singled-stranded oligonucleotides complementary to a long region of integrated oncogenes].

PubMed

Grineva, N I; Borovkova, T V; Sats, N V; Kurabekova, R M; Rozhitskaia, O S; Solov'ev, G Ia; Pantin, V I

1995-08-01

G11 mouse cells and SH2 rat cells transformed with simian adenovirus SA7 DNA showed inheritable oncogen-specific phenotypic normalization when treated with sense and antisense oligonucleotides complementary to long RNA sequences, plus or minus strands of the integrated adenovirus oncogenes E1A and E1B. Transitory treatment of the cells with the oligonucleotides in the absence of serum was shown to cause the appearance of normalized cell lines with fibroblastlike morphology, slower cell proliferation, and lack of ability to form colonies in soft agar. Proliferative activity and adhesion of the normalized cells that established cell lines were found to depend on the concentration of growth factors in the cultural medium. In some of the cell lines, an inhibition of transcription of the E1 oncogenes was observed. The normalization also produced cells that divided 2 - 5 times and died and cells that reverted to a transformed phenotype in 2 - 10 days. The latter appeared predominantly upon the action of the antisense oligonucleotides.

Particle-Based Microarrays of Oligonucleotides and Oligopeptides.

PubMed

Nesterov-Mueller, Alexander; Maerkle, Frieder; Hahn, Lothar; Foertsch, Tobias; Schillo, Sebastian; Bykovskaya, Valentina; Sedlmayr, Martyna; Weber, Laura K; Ridder, Barbara; Soehindrijo, Miriam; Muenster, Bastian; Striffler, Jakob; Bischoff, F Ralf; Breitling, Frank; Loeffler, Felix F

2014-10-28

In this review, we describe different methods of microarray fabrication based on the use of micro-particles/-beads and point out future tendencies in the development of particle-based arrays. First, we consider oligonucleotide bead arrays, where each bead is a carrier of one specific sequence of oligonucleotides. This bead-based array approach, appearing in the late 1990s, enabled high-throughput oligonucleotide analysis and had a large impact on genome research. Furthermore, we consider particle-based peptide array fabrication using combinatorial chemistry. In this approach, particles can directly participate in both the synthesis and the transfer of synthesized combinatorial molecules to a substrate. Subsequently, we describe in more detail the synthesis of peptide arrays with amino acid polymer particles, which imbed the amino acids inside their polymer matrix. By heating these particles, the polymer matrix is transformed into a highly viscous gel, and thereby, imbedded monomers are allowed to participate in the coupling reaction. Finally, we focus on combinatorial laser fusing of particles for the synthesis of high-density peptide arrays. This method combines the advantages of particles and combinatorial lithographic approaches.

Particle-Based Microarrays of Oligonucleotides and Oligopeptides

PubMed Central

Nesterov-Mueller, Alexander; Maerkle, Frieder; Hahn, Lothar; Foertsch, Tobias; Schillo, Sebastian; Bykovskaya, Valentina; Sedlmayr, Martyna; Weber, Laura K.; Ridder, Barbara; Soehindrijo, Miriam; Muenster, Bastian; Striffler, Jakob; Bischoff, F. Ralf; Breitling, Frank; Loeffler, Felix F.

2014-01-01

In this review, we describe different methods of microarray fabrication based on the use of micro-particles/-beads and point out future tendencies in the development of particle-based arrays. First, we consider oligonucleotide bead arrays, where each bead is a carrier of one specific sequence of oligonucleotides. This bead-based array approach, appearing in the late 1990s, enabled high-throughput oligonucleotide analysis and had a large impact on genome research. Furthermore, we consider particle-based peptide array fabrication using combinatorial chemistry. In this approach, particles can directly participate in both the synthesis and the transfer of synthesized combinatorial molecules to a substrate. Subsequently, we describe in more detail the synthesis of peptide arrays with amino acid polymer particles, which imbed the amino acids inside their polymer matrix. By heating these particles, the polymer matrix is transformed into a highly viscous gel, and thereby, imbedded monomers are allowed to participate in the coupling reaction. Finally, we focus on combinatorial laser fusing of particles for the synthesis of high-density peptide arrays. This method combines the advantages of particles and combinatorial lithographic approaches. PMID:27600347

Recognition of T·G mismatched base pairs in DNA by stacked imidazole-containing polyamides: surface plasmon resonance and circular dichroism studies

PubMed Central

Lacy, Eilyn R.; Cox, Kari K.; Wilson, W. David; Lee, Moses

2002-01-01

An imidazole-containing polyamide trimer, f-ImImIm, where f is a formamido group, was recently found using NMR methods to recognize T·G mismatched base pairs. In order to characterize in detail the T·G recognition affinity and specificity of imidazole-containing polyamides, f-ImIm, f-ImImIm and f-PyImIm were synthesized. The kinetics and thermodynamics for the polyamides binding to Watson–Crick and mismatched (containing one or two T·G, A·G or G·G mismatched base pairs) hairpin oligonucleotides were determined by surface plasmon resonance and circular dichroism (CD) methods. f-ImImIm binds significantly more strongly to the T·G mismatch-containing oligonucleotides than to the sequences with other mismatched or with Watson–Crick base pairs. Compared with the Watson–Crick CCGG sequence, f-ImImIm associates more slowly with DNAs containing T·G mismatches in place of one or two C·G base pairs and, more importantly, the dissociation rate from the T·G oligonucleotides is very slow (small kd). These results clearly demonstrate the binding selectivity and enhanced affinity of side-by-side imidazole/imidazole pairings for T·G mismatches and show that the affinity and specificity increase arise from much lower kd values with the T·G mismatched duplexes. CD titration studies of f-ImImIm complexes with T·G mismatched sequences produce strong induced bands at ∼330 nm with clear isodichroic points, in support of a single minor groove complex. CD DNA bands suggest that the complexes remain in the B conformation. PMID:11937638

Oligoribonucleotide map and protein of CMII: detection of conserved and nonconserved genetic elements in avian acute leukemia viruses CMII, MC29, and MH2.

PubMed Central

Bister, K; Löliger, H C; Duesberg, P H

1979-01-01

RNA and protein of the defective avian acute leukemia virus CMII, which causes myelocytomas in chickens, and of CMII-associated helper virus (CMIIAV) were investigated. The RNA of CMII measured 6 kilobases (kb) and that of CMIIAV measured 8.5 kb. By comparing more than 20 mapped oligonucleotides of CMII RNA with mapped and nonmapped oligonucleotides of acute leukemia viruses MC29 and MH2 and with mapped oligonucleotides of CMIIAV and other nondefective avian tumor viruses, three segments were distinguished in the oligonucleotide map of CMII RNA: (i) a 5' group-specific segment of 1.5 kb which was conserved among CMII, MC29, and MH2 and also homologous with gag-related oligonucleotides of CMIIAV and other helper viruses (hence, group specific); (ii) an internal segment of 2 kb which was conserved specifically among CMII, MC29, and MH2 and whose presence in CMII lends new support to the view that this class of genetic elements is essential for oncogenicity, because it was absent from an otherwise isogenic, nontransforming helper, CMIIAV; and (iii) a 3' group-specific segment of 2.5 kb which shared 13 of 14 oligonucleotides with CMIIAV and included env oligonucleotides of other nondefective viruses of the avian tumor virus group (hence, group specific). This segment and analogous map segments of MC29 and MH2 were not conserved at the level of shared oligonucleotides. CMII-transformed cells contained a nonstructural, gag gene-related protein of 90,000 daltons, distinguished by its size from 110,000-daltom MC29 and 100,000-dalton MH2 counterparts. The gag relatedness and similarity to the 110,000-dalton MC29 counterpart indicated that the 90,000-dalton CMII protein is translated from the 5' and internal segments of CMII RNA. The existence of conserved 5' and internal RNA segments and conserved nonstructural protein products in CMII, MC29, and MH2 indicates that these viruses belong to a related group, termed here the MC29 group. Viruses of the MC29 group differ from one another mainly in their 3' RNA segments and in minor variations of their conserved RNA segments as well as by strain-specific size markers of their gag-related proteins. Because (i) the conserved 5' gag-related and internal RNA segments and their gag-related, nonvirion protein products correlate with the conserved oncogenic spectra of the MC29 group of viruses and because (ii) the internal RNA sequences and nonvirion proteins are not found in nondefective viruses, we propose that the conserved RNA and protein elements are necessary for oncogenicity and probably are the onc gene products of the MC29 group of viruses. Images PMID:232172

shRNA target prediction informed by comprehensive enquiry (SPICE): a supporting system for high-throughput screening of shRNA library.

PubMed

Kamatuka, Kenta; Hattori, Masahiro; Sugiyama, Tomoyasu

2016-12-01

RNA interference (RNAi) screening is extensively used in the field of reverse genetics. RNAi libraries constructed using random oligonucleotides have made this technology affordable. However, the new methodology requires exploration of the RNAi target gene information after screening because the RNAi library includes non-natural sequences that are not found in genes. Here, we developed a web-based tool to support RNAi screening. The system performs short hairpin RNA (shRNA) target prediction that is informed by comprehensive enquiry (SPICE). SPICE automates several tasks that are laborious but indispensable to evaluate the shRNAs obtained by RNAi screening. SPICE has four main functions: (i) sequence identification of shRNA in the input sequence (the sequence might be obtained by sequencing clones in the RNAi library), (ii) searching the target genes in the database, (iii) demonstrating biological information obtained from the database, and (iv) preparation of search result files that can be utilized in a local personal computer (PC). Using this system, we demonstrated that genes targeted by random oligonucleotide-derived shRNAs were not different from those targeted by organism-specific shRNA. The system facilitates RNAi screening, which requires sequence analysis after screening. The SPICE web application is available at http://www.spice.sugysun.org/.

DNA - peptide polyelectrolyte complexes: Phase control by hybridization

NASA Astrophysics Data System (ADS)

Vieregg, Jeffrey; Lueckheide, Michael; Marciel, Amanda; Leon, Lorraine; Tirrell, Matthew

DNA is one of the most highly-charged molecules known, and interacts strongly with charged molecules in the cell. Condensation of long double-stranded DNA is one of the classic problems of biophysics, but the polyelectrolyte behavior of short and/or single-stranded nucleic acids has attracted far less study despite its importance for both biological and engineered systems. We report here studies of DNA oligonucleotides complexed with cationic peptides and polyamines. As seen previously for longer sequences, double-stranded oligonucleotides form solid precipitates, but single-stranded oligonucleotides instead undergo liquid-liquid phase separation to form coacervate droplets. Complexed oligonucleotides remain competent for hybridization, and display sequence-dependent environmental response. We observe similar behavior for RNA oligonucleotides, and methylphosphonate substitution of the DNA backbone indicates that nucleic acid charge density controls whether liquid or solid complexes are formed. Liquid-liquid phase separations of this type have been implicated in formation of membraneless organelles in vivo, and have been suggested as protocells in early life scenarios; oligonucleotides offer an excellent method to probe the physics controlling these phenomena.

Rapid and accurate synthesis of TALE genes from synthetic oligonucleotides.

PubMed

Wang, Fenghua; Zhang, Hefei; Gao, Jingxia; Chen, Fengjiao; Chen, Sijie; Zhang, Cuizhen; Peng, Gang

2016-01-01

Custom synthesis of transcription activator-like effector (TALE) genes has relied upon plasmid libraries of pre-fabricated TALE-repeat monomers or oligomers. Here we describe a novel synthesis method that directly incorporates annealed synthetic oligonucleotides into the TALE-repeat units. Our approach utilizes iterative sets of oligonucleotides and a translational frame check strategy to ensure the high efficiency and accuracy of TALE-gene synthesis. TALE arrays of more than 20 repeats can be constructed, and the majority of the synthesized constructs have perfect sequences. In addition, this novel oligonucleotide-based method can readily accommodate design changes to the TALE repeats. We demonstrated an increased gene targeting efficiency against a genomic site containing a potentially methylated cytosine by incorporating non-conventional repeat variable di-residue (RVD) sequences.

Structured oligonucleotides for target indexing to allow single-vessel PCR amplification and solid support microarray hybridization

PubMed Central

Girard, Laurie D.; Boissinot, Karel; Peytavi, Régis; Boissinot, Maurice; Bergeron, Michel G.

2014-01-01

The combination of molecular diagnostic technologies is increasingly used to overcome limitations on sensitivity, specificity or multiplexing capabilities, and provide efficient lab-on-chip devices. Two such techniques, PCR amplification and microarray hybridization are used serially to take advantage of the high sensitivity and specificity of the former combined with high multiplexing capacities of the latter. These methods are usually performed in different buffers and reaction chambers. However, these elaborate methods have a high complexity cost related to reagent requirements, liquid storage and the number of reaction chambers to integrate into automated devices. Furthermore, microarray hybridizations have a sequence dependent efficiency not always predictable. In this work, we have developed the concept of a structured oligonucleotide probe which is activated by cleavage from polymerase exonuclease activity. This technology is called SCISSOHR for Structured Cleavage Induced Single-Stranded Oligonucleotide Hybridization Reaction. The SCISSOHR probes enable indexing the target sequence to a tag sequence. The SCISSOHR technology also allows the combination of nucleic acid amplification and microarray hybridization in a single vessel in presence of the PCR buffer only. The SCISSOHR technology uses an amplification probe that is irreversibly modified in presence of the target, releasing a single-stranded DNA tag for microarray hybridization. Each tag is composed of a 3-nucleotidesequence-dependent segment and a unique “target sequence-independent” 14-nucleotide segment allowing for optimal hybridization with minimal cross-hybridization. We evaluated the performance of five (5) PCR buffers to support microarray hybridization, compared to a conventional hybridization buffer. Finally, as a proof of concept, we developed a multiplexed assay for the amplification, detection, and identification of three (3) DNA targets. This new technology will facilitate the design of lab-on-chip microfluidic devices, while also reducing consumable costs. At term, it will allow the cost-effective automation of highly multiplexed assays for detection and identification of genetic targets. PMID:25489607

Charge-induced geometrical reorganization of DNA oligonucleotides studied by tandem mass spectrometry and ion mobility.

PubMed

Ickert, Stefanie; Hofmann, Johanna; Riedel, Jens; Beck, Sebastian; Pagel, Kevin; Linscheid, Michael W

2018-04-01

Mass spectrometry is applied as a tool for the elucidation of molecular structures. This premises that gas-phase structures reflect the original geometry of the analytes, while it requires a thorough understanding and investigation of the forces controlling and affecting the gas-phase structures. However, only little is known about conformational changes of oligonucleotides in the gas phase. In this study, a series of multiply charged DNA oligonucleotides (n = 15-40) has been subjected to a comprehensive tandem mass spectrometric study to unravel transitions between different ionic gas-phase structures. The nucleobase sequence and the chain length were varied to gain insights into their influence on the geometrical oligonucleotide organization. Altogether, 23 oligonucleotides were analyzed using collision-induced fragmentation. All sequences showed comparable correlation regarding the characteristic collision energy. This value that is also a measure for stability, strongly correlates with the net charge density of the precursor ions. With decreasing charge of the oligonucleotides, an increase in the fragmentation energy was observed. At a distinct charge density, a deviation from linearity was observed for all studied species, indicating a structural reorganization. To corroborate the proposed geometrical change, collisional cross-sections of the oligonucleotides at different charge states were determined using ion mobility-mass spectrometry. The results clearly indicate that an increase in charge density and thus Coulomb repulsion results in the transition from a folded, compact form to elongated structures of the precursor ions. Our data show this structural transition to depend mainly on the charge density, whereas sequence and size do not have an influence.

Adeno-associated virus inverted terminal repeats stimulate gene editing.

PubMed

Hirsch, M L

2015-02-01

Advancements in genome editing have relied on technologies to specifically damage DNA which, in turn, stimulates DNA repair including homologous recombination (HR). As off-target concerns complicate the therapeutic translation of site-specific DNA endonucleases, an alternative strategy to stimulate gene editing based on fragile DNA was investigated. To do this, an episomal gene-editing reporter was generated by a disruptive insertion of the adeno-associated virus (AAV) inverted terminal repeat (ITR) into the egfp gene. Compared with a non-structured DNA control sequence, the ITR induced DNA damage as evidenced by increased gamma-H2AX and Mre11 foci formation. As local DNA damage stimulates HR, ITR-mediated gene editing was investigated using DNA oligonucleotides as repair substrates. The AAV ITR stimulated gene editing >1000-fold in a replication-independent manner and was not biased by the polarity of the repair oligonucleotide. Analysis of additional human DNA sequences demonstrated stimulation of gene editing to varying degrees. In particular, inverted yet not direct, Alu repeats induced gene editing, suggesting a role for DNA structure in the repair event. Collectively, the results demonstrate that inverted DNA repeats stimulate gene editing via double-strand break repair in an episomal context and allude to efficient gene editing of the human chromosome using fragile DNA sequences.

Spherical Nucleic Acids as Intracellular Agents for Nucleic Acid Based Therapeutics

NASA Astrophysics Data System (ADS)

Hao, Liangliang

Recent functional discoveries on the noncoding sequences of human genome and transcriptome could lead to revolutionary treatment modalities because the noncoding RNAs (ncRNAs) can be applied as therapeutic agents to manipulate disease-causing genes. To date few nucleic acid-based therapeutics have been translated into the clinic due to challenges in the delivery of the oligonucleotide agents in an effective, cell specific, and non-toxic fashion. Unmodified oligonucleotide agents are destroyed rapidly in biological fluids by enzymatic degradation and have difficulty crossing the plasma membrane without the aid of transfection reagents, which often cause inflammatory, cytotoxic, or immunogenic side effects. Spherical nucleic acids (SNAs), nanoparticles consisting of densely organized and highly oriented oligonucleotides, pose one possible solution to circumventing these problems in both the antisense and RNA interference (RNAi) pathways. The unique three dimensional architecture of SNAs protects the bioactive oligonucleotides from unspecific degradation during delivery and supports their targeting of class A scavenger receptors and endocytosis via a lipid-raft-dependent, caveolae-mediated pathway. Owing to their unique structure, SNAs are able to cross cell membranes and regulate target genes expression as a single entity, without triggering the cellular innate immune response. Herein, my thesis has focused on understanding the interactions between SNAs and cellular components and developing SNA-based nanostructures to improve therapeutic capabilities. Specifically, I developed a novel SNA-based, nanoscale agent for delivery of therapeutic oligonucleotides to manipulate microRNAs (miRNAs), the endogenous post-transcriptional gene regulators. I investigated the role of SNAs involving miRNAs in anti-cancer or anti-inflammation responses in cells and in in vivo murine disease models via systemic injection. Furthermore, I explored using different strategies to construct novel SNA-based nanomaterials with desired properties and applying targeting moieties to the SNA platform to achieve cell type specific gene regulation effects. Due to the flexibility of the SNA approach, the SNA platform can potentially be applied to many genetic disorders through tailored target specificities.

Enzymatic production of 'monoclonal stoichiometric' single-stranded DNA oligonucleotides.

PubMed

Ducani, Cosimo; Kaul, Corinna; Moche, Martin; Shih, William M; Högberg, Björn

2013-07-01

Single-stranded oligonucleotides are important as research tools, as diagnostic probes, in gene therapy and in DNA nanotechnology. Oligonucleotides are typically produced via solid-phase synthesis, using polymer chemistries that are limited relative to what biological systems produce. The number of errors in synthetic DNA increases with oligonucleotide length, and the resulting diversity of sequences can be a problem. Here we present the 'monoclonal stoichiometric' (MOSIC) method for enzyme-mediated production of DNA oligonucleotides. We amplified oligonucleotides from clonal templates derived from single bacterial colonies and then digested cutter hairpins in the products, which released pools of oligonucleotides with precisely controlled relative stoichiometric ratios. We prepared 14-378-nucleotide MOSIC oligonucleotides either by in vitro rolling-circle amplification or by amplification of phagemid DNA in Escherichia coli. Analyses of the formation of a DNA crystal and folding of DNA nanostructures confirmed the scalability, purity and stoichiometry of the produced oligonucleotides.

Enzymatic Production of Monoclonal Stoichiometric Single-Stranded DNA Oligonucleotides

PubMed Central

Ducani, Cosimo; Kaul, Corinna; Moche, Martin; Shih, William M.; Högberg, Björn

2013-01-01

Single-stranded oligonucleotides are important as research tools as probes for diagnostics and gene therapy. Today, production of oligonucleotides is done via solid-phase synthesis. However, the capabilities of current polymer chemistry are limited in comparison to what can be produced in biological systems. The errors in synthetic DNA increases with oligonucleotide length, and sequence diversity can often be a problem. Here, we present the Monoclonal Stoichiometric (MOSIC) method for enzymatic DNA oligonucleotide production. Using this method, we amplify oligonucleotides from clonal templates followed by digestion of a cutter-hairpin, resulting in pools of monoclonal oligonucleotides with precisely controlled relative stoichiometric ratios. We present data where MOSIC oligonucleotides, 14–378 nt long, were prepared either by in vitro rolling-circle amplification, or by amplification in Escherichia coli in the form of phagemid DNA. The formation of a DNA crystal and folding of DNA nanostructures confirmed the scalability, purity and stoichiometry of the produced oligonucleotides. PMID:23727986

Triplex technology in studies of DNA damage, DNA repair, and mutagenesis.

PubMed

Mukherjee, Anirban; Vasquez, Karen M

2011-08-01

Triplex-forming oligonucleotides (TFOs) can bind to the major groove of homopurine-homopyrimidine stretches of double-stranded DNA in a sequence-specific manner through Hoogsteen hydrogen bonding to form DNA triplexes. TFOs by themselves or conjugated to reactive molecules can be used to direct sequence-specific DNA damage, which in turn results in the induction of several DNA metabolic activities. Triplex technology is highly utilized as a tool to study gene regulation, molecular mechanisms of DNA repair, recombination, and mutagenesis. In addition, TFO targeting of specific genes has been exploited in the development of therapeutic strategies to modulate DNA structure and function. In this review, we discuss advances made in studies of DNA damage, DNA repair, recombination, and mutagenesis by using triplex technology to target specific DNA sequences. Copyright © 2011 Elsevier Masson SAS. All rights reserved.

Design and verification of a pangenome microarray oligonucleotide probe set for Dehalococcoides spp.

PubMed

Hug, Laura A; Salehi, Maryam; Nuin, Paulo; Tillier, Elisabeth R; Edwards, Elizabeth A

2011-08-01

Dehalococcoides spp. are an industrially relevant group of Chloroflexi bacteria capable of reductively dechlorinating contaminants in groundwater environments. Existing Dehalococcoides genomes revealed a high level of sequence identity within this group, including 98 to 100% 16S rRNA sequence identity between strains with diverse substrate specificities. Common molecular techniques for identification of microbial populations are often not applicable for distinguishing Dehalococcoides strains. Here we describe an oligonucleotide microarray probe set designed based on clustered Dehalococcoides genes from five different sources (strain DET195, CBDB1, BAV1, and VS genomes and the KB-1 metagenome). This "pangenome" probe set provides coverage of core Dehalococcoides genes as well as strain-specific genes while optimizing the potential for hybridization to closely related, previously unknown Dehalococcoides strains. The pangenome probe set was compared to probe sets designed independently for each of the five Dehalococcoides strains. The pangenome probe set demonstrated better predictability and higher detection of Dehalococcoides genes than strain-specific probe sets on nontarget strains with <99% average nucleotide identity. An in silico analysis of the expected probe hybridization against the recently released Dehalococcoides strain GT genome and additional KB-1 metagenome sequence data indicated that the pangenome probe set performs more robustly than the combined strain-specific probe sets in the detection of genes not included in the original design. The pangenome probe set represents a highly specific, universal tool for the detection and characterization of Dehalococcoides from contaminated sites. It has the potential to become a common platform for Dehalococcoides-focused research, allowing meaningful comparisons between microarray experiments regardless of the strain examined.

Bi-specific splice-switching PMO oligonucleotides conjugated via a single peptide active in a mouse model of Duchenne muscular dystrophy

PubMed Central

Shabanpoor, Fazel; McClorey, Graham; Saleh, Amer F.; Järver, Peter; Wood, Matthew J.A.; Gait, Michael J.

2015-01-01

The potential for therapeutic application of splice-switching oligonucleotides (SSOs) to modulate pre-mRNA splicing is increasingly evident in a number of diseases. However, the primary drawback of this approach is poor cell and in vivo oligonucleotide uptake efficacy. Biological activities can be significantly enhanced through the use of synthetically conjugated cationic cell penetrating peptides (CPPs). Studies to date have focused on the delivery of a single SSO conjugated to a CPP, but here we describe the conjugation of two phosphorodiamidate morpholino oligonucleotide (PMO) SSOs to a single CPP for simultaneous delivery and pre-mRNA targeting of two separate genes, exon 23 of the Dmd gene and exon 5 of the Acvr2b gene, in a mouse model of Duchenne muscular dystrophy. Conjugations of PMOs to a single CPP were carried out through an amide bond in one case and through a triazole linkage (‘click chemistry’) in the other. The most active bi-specific CPP–PMOs demonstrated comparable exon skipping levels for both pre-mRNA targets when compared to individual CPP–PMO conjugates both in cell culture and in vivo in the mdx mouse model. Thus, two SSOs with different target sequences conjugated to a single CPP are biologically effective and potentially suitable for future therapeutic exploitation. PMID:25468897

Primer design for a prokaryotic differential display RT-PCR.

PubMed Central

Fislage, R; Berceanu, M; Humboldt, Y; Wendt, M; Oberender, H

1997-01-01

We have developed a primer set for a prokaryotic differential display of mRNA in the Enterobacteriaceae group. Each combination of ten 10mer and ten 11mer primers generates up to 85 bands from total Escherichia coli RNA, thus covering expressed sequences of a complete bacterial genome. Due to the lack of polyadenylation in prokaryotic RNA the type T11VN anchored oligonucleotides for the reverse transcriptase reaction had to be replaced with respect to the original method described by Liang and Pardee [ Science , 257, 967-971 (1992)]. Therefore, the sequences of both the 10mer and the new 11mer oligonucleotides were determined by a statistical evaluation of species-specific coding regions extracted from the EMBL database. The 11mer primers used for reverse transcription were selected for localization in the 3'-region of the bacterial RNA. The 10mer primers preferentially bind to the 5'-end of the RNA. None of the primers show homology to rRNA or other abundant small RNA species. Randomly sampled cDNA bands were checked for their bacterial origin either by re-amplification, cloning and sequencing or by re-amplification and direct sequencing with 10mer and 11mer primers after asymmetric PCR. PMID:9108168

Primer design for a prokaryotic differential display RT-PCR.

PubMed

Fislage, R; Berceanu, M; Humboldt, Y; Wendt, M; Oberender, H

1997-05-01

We have developed a primer set for a prokaryotic differential display of mRNA in the Enterobacteriaceae group. Each combination of ten 10mer and ten 11mer primers generates up to 85 bands from total Escherichia coli RNA, thus covering expressed sequences of a complete bacterial genome. Due to the lack of polyadenylation in prokaryotic RNA the type T11VN anchored oligonucleotides for the reverse transcriptase reaction had to be replaced with respect to the original method described by Liang and Pardee [ Science , 257, 967-971 (1992)]. Therefore, the sequences of both the 10mer and the new 11mer oligonucleotides were determined by a statistical evaluation of species-specific coding regions extracted from the EMBL database. The 11mer primers used for reverse transcription were selected for localization in the 3'-region of the bacterial RNA. The 10mer primers preferentially bind to the 5'-end of the RNA. None of the primers show homology to rRNA or other abundant small RNA species. Randomly sampled cDNA bands were checked for their bacterial origin either by re-amplification, cloning and sequencing or by re-amplification and direct sequencing with 10mer and 11mer primers after asymmetric PCR.

Antisense phosphorothioate oligonucleotides: selective killing of the intracellular parasite Leishmania amazonensis.

PubMed

Ramazeilles, C; Mishra, R K; Moreau, S; Pascolo, E; Toulmé, J J

1994-08-16

We targeted the mini-exon sequence, present at the 5' end of every mRNA of the protozoan parasite Leishmania amazonensis, by phosphorothioate oligonucleotides. A complementary 16-mer (16PS) was able to kill amastigotes--the intracellular stage of the parasite--in murine macrophages in culture. After 24 hr of incubation with 10 microM 16PS, about 30% infected macrophages were cured. The oligomer 16PS acted through antisense hybridization in a sequence-dependent way; no effect on parasites was observed with noncomplementary phosphorothioate oligonucleotides. The antisense oligonucleotide 16PS was a selective killer of the protozoans without any detrimental effect to the host macrophage. Using 16PS linked to a palmitate chain, which enabled it to complex with low density lipoproteins, improved the leishmanicidal efficiency on intracellular amastigotes, probably due to increased endocytosis. Phosphorothioate oligonucleotides complementary to the intron part of the mini-exon pre-RNA were also effective, suggesting that antisense oligomers could prevent trans-splicing in these parasites.

Differential activity staining: its use in characterization of guanylyl-specific ribonuclease in the genus Ustilago.

PubMed Central

Blank, A; Dekker, C A

1975-01-01

Guanylyl-specific ribonuclease can be identified by a novel technique employing electrophoresis in polyacrylamide slabs followed by differential activity staining. The technique requires as little as 7 ng of enzyme which may be grossly admixed with contaminants, including other ribonucleases. Upon electrophoresis and activity staining, a variety of ribonucleases can be visualized as light or clear bands in a colored background formed by toluidine blue complexed with oligonucleotide substrate. Guanylyl-specific ribonuclease, which is detectable when using an oligonucleotide substrate of random base sequence, does not yield a band when using oligonucleotides bearing guanylyl residues at the 3'-termini only and containing, therefore, no susceptible internucleotide bonds; in contrast, a ribonuclease with a different base specificity or no base specificity yields a band with either substrate. This differential activity staining method for establishing guanylyl specificity permits estimation of the extent of nonspecific cleavage of internucleotide linkages by a putatively guanylyl-specific enzyme and is at least as sensitive as conventional procedures for determination of base specificity. With this new technique guanyloribonuclease has been identified in the unfractionated culture medium of 10 organisms belonging to the phytopathogenic fungal genus Ustilago. It is suggested that guanylyl-specific ribonuclease is widely distributed among Ustilago species; its electrophoretic properties may be revealing of phylogenetic relationships among these plant parasites and among their hosts. The general technique of differential activity staining, developed for determination of the base specificity of ribonucleases, may be widely applicable to analysis of enzymes catalyzing depolymerization reactions. Images PMID:813217

Triplex-mediated analysis of cytosine methylation at CpA sites in DNA.

PubMed

Johannsen, Marie W; Gerrard, Simon R; Melvin, Tracy; Brown, Tom

2014-01-18

Modified triplex-forming oligonucleotides distinguish 5-methyl cytosine from unmethylated cytosine in DNA duplexes by differences in triplex melting temperatures. The discrimination is sequence-specific; dramatic differences in stabilisation are seen for CpA methylation, whereas CpG methylation is not detected. This direct detection of DNA methylation constitutes a new approach for epigenetic analysis.

Specific Increase of Protein Levels by Enhancing Translation Using Antisense Oligonucleotides Targeting Upstream Open Frames.

PubMed

Liang, Xue-Hai; Shen, Wen; Crooke, Stanley T

2017-01-01

A number of diseases are caused by low levels of key proteins; therefore, increasing the amount of specific proteins in human bodies is of therapeutic interest. Protein expression is downregulated by some structural or sequence elements present in the 5' UTR of mRNAs, such as upstream open reading frames (uORF). Translation initiation from uORF(s) reduces translation from the downstream primary ORF encoding the main protein product in the same mRNA, leading to a less efficient protein expression. Therefore, it is possible to use antisense oligonucleotides (ASOs) to specifically inhibit translation of the uORF by base-pairing with the uAUG region of the mRNA, redirecting translation machinery to initiate from the primary AUG site. Here we review the recent findings that translation of specific mRNAs can be enhanced using ASOs targeting uORF regions. Appropriately designed and optimized ASOs are highly specific, and they act in a sequence- and position-dependent manner, with very minor off-target effects. Protein levels can be increased using this approach in different types of human and mouse cells, and, importantly, also in mice. Since uORFs are present in around half of human mRNAs, the uORF-targeting ASOs may thus have valuable potential as research tools and as therapeutics to increase the levels of proteins for a variety of genes.

Resolving prokaryotic taxonomy without rRNA: longer oligonucleotide word lengths improve genome and metagenome taxonomic classification.

PubMed

Alsop, Eric B; Raymond, Jason

2013-01-01

Oligonucleotide signatures, especially tetranucleotide signatures, have been used as method for homology binning by exploiting an organism's inherent biases towards the use of specific oligonucleotide words. Tetranucleotide signatures have been especially useful in environmental metagenomics samples as many of these samples contain organisms from poorly classified phyla which cannot be easily identified using traditional homology methods, including NCBI BLAST. This study examines oligonucleotide signatures across 1,424 completed genomes from across the tree of life, substantially expanding upon previous work. A comprehensive analysis of mononucleotide through nonanucleotide word lengths suggests that longer word lengths substantially improve the classification of DNA fragments across a range of sizes of relevance to high throughput sequencing. We find that, at present, heptanucleotide signatures represent an optimal balance between prediction accuracy and computational time for resolving taxonomy using both genomic and metagenomic fragments. We directly compare the ability of tetranucleotide and heptanucleotide world lengths (tetranucleotide signatures are the current standard for oligonucleotide word usage analyses) for taxonomic binning of metagenome reads. We present evidence that heptanucleotide word lengths consistently provide more taxonomic resolving power, particularly in distinguishing between closely related organisms that are often present in metagenomic samples. This implies that longer oligonucleotide word lengths should replace tetranucleotide signatures for most analyses. Finally, we show that the application of longer word lengths to metagenomic datasets leads to more accurate taxonomic binning of DNA scaffolds and have the potential to substantially improve taxonomic assignment and assembly of metagenomic data.

Detection and genotyping of Entamoeba histolytica, Entamoeba dispar, Giardia lamblia, and Cryptosporidium parvum by oligonucleotide microarray.

PubMed

Wang, Zheng; Vora, Gary J; Stenger, David A

2004-07-01

Entamoeba histolytica, Giardia lamblia, and Cryptosporidium parvum are the most frequently identified protozoan parasites causing waterborne disease outbreaks. The morbidity and mortality associated with these intestinal parasitic infections warrant the development of rapid and accurate detection and genotyping methods to aid public health efforts aimed at preventing and controlling outbreaks. In this study, we describe the development of an oligonucleotide microarray capable of detecting and discriminating between E. histolytica, Entamoeba dispar, G. lamblia assemblages A and B, and C. parvum types 1 and 2 in a single assay. Unique hybridization patterns for each selected protozoan were generated by amplifying six to eight diagnostic sequences/organism by multiplex PCR; fluorescent labeling of the amplicons via primer extension; and subsequent hybridization to a set of genus-, species-, and subtype-specific covalently immobilized oligonucleotide probes. The profile-based specificity of this methodology not only permitted for the unequivocal identification of the six targeted species and subtypes, but also demonstrated its potential in identifying related species such as Cryptosporidium meleagridis and Cryptosporidium muris. In addition, sensitivity assays demonstrated lower detection limits of five trophozoites of G. lamblia. Taken together, the specificity and sensitivity of the microarray-based approach suggest that this methodology may provide a promising tool to detect and genotype protozoa from clinical and environmental samples.

A multilevel ant colony optimization algorithm for classical and isothermic DNA sequencing by hybridization with multiplicity information available.

PubMed

Kwarciak, Kamil; Radom, Marcin; Formanowicz, Piotr

2016-04-01

The classical sequencing by hybridization takes into account a binary information about sequence composition. A given element from an oligonucleotide library is or is not a part of the target sequence. However, the DNA chip technology has been developed and it enables to receive a partial information about multiplicity of each oligonucleotide the analyzed sequence consist of. Currently, it is not possible to assess the exact data of such type but even partial information should be very useful. Two realistic multiplicity information models are taken into consideration in this paper. The first one, called "one and many" assumes that it is possible to obtain information if a given oligonucleotide occurs in a reconstructed sequence once or more than once. According to the second model, called "one, two and many", one is able to receive from biochemical experiment information if a given oligonucleotide is present in an analyzed sequence once, twice or at least three times. An ant colony optimization algorithm has been implemented to verify the above models and to compare with existing algorithms for sequencing by hybridization which utilize the additional information. The proposed algorithm solves the problem with any kind of hybridization errors. Computational experiment results confirm that using even the partial information about multiplicity leads to increased quality of reconstructed sequences. Moreover, they also show that the more precise model enables to obtain better solutions and the ant colony optimization algorithm outperforms the existing ones. Test data sets and the proposed ant colony optimization algorithm are available on: http://bioserver.cs.put.poznan.pl/download/ACO4mSBH.zip. Copyright © 2016 Elsevier Ltd. All rights reserved.

The Role of the Y-Chromosome in the Establishment of Murine Hybrid Dysgenesis and in the Analysis of the Nucleotide Sequence Organization, Genetic Transmission and Evolution of Repeated Sequences.

NASA Astrophysics Data System (ADS)

Nallaseth, Ferez Soli

The Y-chromosome presents a unique cytogenetic framework for the evolution of nucleotide sequences. Alignment of nine Y-chromosomal fragments in their increasing Y-specific/non Y-specific (male/female) sequence divergence ratios was directly and inversely related to their interspersion on these two respective genomic fractions. Sequence analysis confirmed a direct relationship between divergence ratios and the Alu, LINE-1, Satellite and their derivative oligonucleotide contents. Thus their relocation on the Y-chromosome is followed by sequence divergence rather than the well documented concerted evolution of these non-coding progenitor repeated sequences. Five of the nine Y-chromosomal fragments are non-pseudoautosomal and transcribed into heterogeneous PolyA^+ RNA and thus can be retrotransposed. Evolutionary and computer analysis identified homologous oligonucleotide tracts in several human loci suggesting common and random mechanistic origins. Dysgenic genomes represent the accelerated evolution driving sequence divergence (McClintock, 1984). Sex reversal and sterility characterizing dysgenesis occurs in C57BL/6JY ^{rm Pos} but not in 129/SvY^{rm Pos} derivative strains. High frequency, random, multi-locus deletion products of the feral Y^{ rm Pos}-chromosome are generated in the germlines of F1(C57BL/6J X 129/SvY^{ rm Pos})(male) and C57BL/6JY ^{rm Pos}(male) but not in 129/SvY^{rm Pos}(male). Equal, 10^{-1}, 10^ {-2}, and 0 copies (relative to males) of Y^{rm Pos}-specific deletion products respectively characterize C57BL/6JY ^{rm Pos} (HC), (LC), (T) and (F) females. The testes determining loci of inactive Y^{rm Pos}-chromosomes in C57BL/6JY^{rm Pos} HC females are the preferentially deleted/rearranged Y ^{rm Pos}-sequences. Disruption of regulation of plasma testosterone and hepatic MUP-A mRNA levels, TRD of a 4.7 Kbp EcoR1 fragment suggest disruption of autosomal/X-chromosomal sequences. These data and the highly repeated progenitor (Alu, GATA, LINE-1) sequence content of deletion products confirmed the previously unidentified loss of genetic control of mammalian chromosome biology and hybrid dysgenesis.

Use of continuous/contiguous stacking hybridization as a diagnostic tool

DOEpatents

Mirzabekov, Andrei Darievich; Kirillov, Eugene Vladislavovich; Parinov, Sergei Valeryevich; Barski, Victor Evgenievich; Dubiley, Svetlana Alekseevna

2002-01-01

A method for detecting disease-associated alleles in patient genetic material is provided whereby a first group of oligonucleotide molecules, synthesized to compliment base sequences of the disease associated alleles is immobilized on a predetermined position on a substrate, and then contacted with patient genetic material to form duplexes. The duplexes are then contacted with a second group of oligonucleotide molecules which are synthesized to extend the predetermined length of the oligonucleotide molecules of the first group, and where each of the oligonucleotide molecules of the second group are tagged and either incorporate universal bases or a mixture of guanine, cytosine, thymine, and adenine, or complementary nucleotide strands that are tagged with a different fluorochrome which radiates light at a predetermined wavelength. The treated substrate is then washed and the light patterns radiating therefrom are compared with predetermined light patterns of various diseases that were prepared on identical substrates. A method is also provided for determining the length of a repeat sequence in DNA or RNA, and also for determining the base sequence of unknown DNA or RNA.

Use of continuous/contiguous stacking hybridization as a diagnostic tool

DOEpatents

Mirzabekov, Andrei Darievich; Kirillov, Eugene Vladislavovich; Parinov, Sergei Valeryevich; Barski, Victor Evgenievich; Dubiley, Svetlana Alekseevna

2000-01-01

A method for detecting disease-associated alleles in patient genetic material is provided whereby a first group of oligonucleotide molecules, synthesized to compliment base sequences of the disease associated alleles is immobilized on a predetermined position on a substrate, and then contacted with patient genetic material to form duplexes. The duplexes are then contacted with a second group of oligonucleotide molecules which are synthesized to extend the predetermined length of the oligonucleotide molecules of the first group, and where each of the oligonucleotide molecules of the second group are tagged and either incorporate universal bases or a mixture of guanine, cytosine, thymine, and adenine, or complementary nucleotide strands that are tagged with a different fluorochrome which radiates light at a predetermined wavelength. The treated substrate is then washed and the light patterns radiating therefrom are compared with predetermined light patterns of various diseases that were prepared on identical substrates. A method is also provided for determining the length of a repeat sequence in DNA or RNA, and also for determining the base sequence of unknown DNA or RNA.

Antisense Oligonucleotides Modulating Activation of a Nonsense-Mediated RNA Decay Switch Exon in the ATM Gene.

PubMed

Kralovicova, Jana; Moreno, Pedro M D; Cross, Nicholas C P; Pêgo, Ana Paula; Vorechovsky, Igor

2016-12-01

ATM (ataxia-telangiectasia, mutated) is an important cancer susceptibility gene that encodes a key apical kinase in the DNA damage response pathway. ATM mutations in the germ line result in ataxia-telangiectasia (A-T), a rare genetic syndrome associated with hypersensitivity to double-strand DNA breaks and predisposition to lymphoid malignancies. ATM expression is limited by a tightly regulated nonsense-mediated RNA decay (NMD) switch exon (termed NSE) located in intron 28. In this study, we identify antisense oligonucleotides that modulate NSE inclusion in mature transcripts by systematically targeting the entire 3.1-kb-long intron. Their identification was assisted by a segmental deletion analysis of transposed elements, revealing NSE repression upon removal of a distant antisense Alu and NSE activation upon elimination of a long terminal repeat transposon MER51A. Efficient NSE repression was achieved by delivering optimized splice-switching oligonucleotides to embryonic and lymphoblastoid cells using chitosan-based nanoparticles. Together, these results provide a basis for possible sequence-specific radiosensitization of cancer cells, highlight the power of intronic antisense oligonucleotides to modify gene expression, and demonstrate transposon-mediated regulation of NSEs.

Position-dependent effects of locked nucleic acid (LNA) on DNA sequencing and PCR primers

PubMed Central

Levin, Joshua D.; Fiala, Dean; Samala, Meinrado F.; Kahn, Jason D.; Peterson, Raymond J.

2006-01-01

Genomes are becoming heavily annotated with important features. Analysis of these features often employs oligonucleotides that hybridize at defined locations. When the defined location lies in a poor sequence context, traditional design strategies may fail. Locked Nucleic Acid (LNA) can enhance oligonucleotide affinity and specificity. Though LNA has been used in many applications, formal design rules are still being defined. To further this effort we have investigated the effect of LNA on the performance of sequencing and PCR primers in AT-rich regions, where short primers yield poor sequencing reads or PCR yields. LNA was used in three positional patterns: near the 5′ end (LNA-5′), near the 3′ end (LNA-3′) and distributed throughout (LNA-Even). Quantitative measures of sequencing read length (Phred Q30 count) and real-time PCR signal (cycle threshold, CT) were characterized using two-way ANOVA. LNA-5′ increased the average Phred Q30 score by 60% and it was never observed to decrease performance. LNA-5′ generated cycle thresholds in quantitative PCR that were comparable to high-yielding conventional primers. In contrast, LNA-3′ and LNA-Even did not improve read lengths or CT. ANOVA demonstrated the statistical significance of these results and identified significant interaction between the positional design rule and primer sequence. PMID:17071964

Photouncaged Sequence-specific Interstrand DNA Cross-Linking with Photolabile 4-oxo-enal-modified Oligonucleotides

PubMed Central

Sun, Jingjing; Tang, Xinjing

2015-01-01

DNA cross-linking technology is an attractive tool for the detection, regulation, and manipulation of genes. In this study, a series of photolabile 4-oxo-enal-modified oligonucleotides functionalized with photosensitive ο-nitrobenzyl derivatives were rationally designed as a new kind of photocaged cross-linking agents. A comprehensive evaluation of cross-linking reactions for different nucleobases in complementary strands under different conditions suggested that the modified DNA oligonucleotides tended to form interstrand cross-linking to nucleobases with the potential of thymidine > guanosine » cytidine ~ adenosine. Different from previous literature reports that cytidine and adenosine were preferential cross-linked nucleobases with 4-oxo-enal moieties, our study represents the first example of DNA cross-linking for T and G selectivity using 4-oxo-enal moiety. The cross-linked adducts were identified and their cross-linking mechanism was also illustrated. This greatly expands the applications of 4-oxo-enal derivatives in the studies of DNA damage and RNA structure PMID:26020694

Photouncaged Sequence-specific Interstrand DNA Cross-Linking with Photolabile 4-oxo-enal-modified Oligonucleotides.

PubMed

Sun, Jingjing; Tang, Xinjing

2015-05-28

DNA cross-linking technology is an attractive tool for the detection, regulation, and manipulation of genes. In this study, a series of photolabile 4-oxo-enal-modified oligonucleotides functionalized with photosensitive ο-nitrobenzyl derivatives were rationally designed as a new kind of photocaged cross-linking agents. A comprehensive evaluation of cross-linking reactions for different nucleobases in complementary strands under different conditions suggested that the modified DNA oligonucleotides tended to form interstrand cross-linking to nucleobases with the potential of thymidine > guanosine » cytidine ~ adenosine. Different from previous literature reports that cytidine and adenosine were preferential cross-linked nucleobases with 4-oxo-enal moieties, our study represents the first example of DNA cross-linking for T and G selectivity using 4-oxo-enal moiety. The cross-linked adducts were identified and their cross-linking mechanism was also illustrated. This greatly expands the applications of 4-oxo-enal derivatives in the studies of DNA damage and RNA structure.

Oligonucleotides Containing Aminated 2'-Amino-LNA Nucleotides: Synthesis and Strong Binding to Complementary DNA and RNA.

PubMed

Lou, Chenguang; Samuelsen, Simone V; Christensen, Niels Johan; Vester, Birte; Wengel, Jesper

2017-04-19

Mono- and diaminated 2'-amino-LNA monomers were synthesized and introduced into oligonucleotides. Each modification imparts significant stabilization of nucleic acid duplexes and triplexes, excellent sequence selectivity, and significant nuclease resistance. Molecular modeling suggested that structural stabilization occurs via intrastrand electrostatic attraction between the protonated amino groups of the aminated 2'-amino-LNA monomers and the host oligonucleotide backbone.

Synthetic oligonucleotide antigens modified with locked nucleic acids detect disease specific antibodies

NASA Astrophysics Data System (ADS)

Samuelsen, Simone V.; Solov'Yov, Ilia A.; Balboni, Imelda M.; Mellins, Elizabeth; Nielsen, Christoffer Tandrup; Heegaard, Niels H. H.; Astakhova, Kira

2016-10-01

New techniques to detect and quantify antibodies to nucleic acids would provide a significant advance over current methods, which often lack specificity. We investigate the potential of novel antigens containing locked nucleic acids (LNAs) as targets for antibodies. Particularly, employing molecular dynamics we predict optimal nucleotide composition for targeting DNA-binding antibodies. As a proof of concept, we address a problem of detecting anti-DNA antibodies that are characteristic of systemic lupus erythematosus, a chronic autoimmune disease with multiple manifestations. We test the best oligonucleotide binders in surface plasmon resonance studies to analyze binding and kinetic aspects of interactions between antigens and target DNA. These DNA and LNA/DNA sequences showed improved binding in enzyme-linked immunosorbent assay using human samples of pediatric lupus patients. Our results suggest that the novel method is a promising tool to create antigens for research and point-of-care monitoring of anti-DNA antibodies.

Development of dansyl-modified oligonucleotide probes responding to structural changes in a duplex.

PubMed

Suzuki, Yoshio; Kowata, Keiko; Komatsu, Yasuo

2013-11-15

We have synthesized a nonnucleoside amidite block of dansyl fluorophore to prepare dansyl-modified oligonucleotides (ONTs). The fluorescence intensities of dansyl-ONT specifically increased by the presence of adjacent guanosine residues but, significantly reduced in a dansyl-flipping duplex. These changes were caused by solvatochromism effect due to the number of guanine which is hydrophobic functional group and the external environment of dansyl group. The fluorescence intensities could be plotted as a function of the ONTs concentrations and the increase in the fluorescence was observed to equimolar concentrations of target DNA. This duplex exhibited higher melting temperature relative to the corresponding duplexes containing other base pairs. Similar changes in fluorescence could be detected upon hybridization with complementary RNAs. Thus, the dansyl-modified ONTs provide sequence specific fluorescent probe of DNA and RNA. Copyright © 2013 Elsevier Ltd. All rights reserved.

Argonaute pull-down and RISC analysis using 2'-O-methylated oligonucleotides affinity matrices.

PubMed

Jannot, Guillaume; Vasquez-Rifo, Alejandro; Simard, Martin J

2011-01-01

During the last decade, several novel small non-coding RNA pathways have been unveiled, which reach out to many biological processes. Common to all these pathways is the binding of a small RNA molecule to a protein member of the Argonaute family, which forms a minimal core complex called the RNA-induced silencing complex or RISC. The RISC targets mRNAs in a sequence-specific manner, either to induce mRNA cleavage through the intrinsic activity of the Argonaute protein or to abrogate protein synthesis by a mechanism that is still under investigation. We describe here, in details, a method for the affinity chromatography of the let-7 RISC starting from extracts of the nematode Caenorhabditis elegans. Our method exploits the sequence specificity of the RISC and makes use of biotinylated and 2'-O-methylated oligonucleotides to trap and pull-down small RNAs and their associated proteins. Importantly, this technique may easily be adapted to target other small RNAs expressed in different cell types or model organisms. This method provides a useful strategy to identify the proteins associated with the RISC, and hence gain insight in the functions of small RNAs.

DNA-Encoded Solid-Phase Synthesis: Encoding Language Design and Complex Oligomer Library Synthesis.

PubMed

MacConnell, Andrew B; McEnaney, Patrick J; Cavett, Valerie J; Paegel, Brian M

2015-09-14

The promise of exploiting combinatorial synthesis for small molecule discovery remains unfulfilled due primarily to the "structure elucidation problem": the back-end mass spectrometric analysis that significantly restricts one-bead-one-compound (OBOC) library complexity. The very molecular features that confer binding potency and specificity, such as stereochemistry, regiochemistry, and scaffold rigidity, are conspicuously absent from most libraries because isomerism introduces mass redundancy and diverse scaffolds yield uninterpretable MS fragmentation. Here we present DNA-encoded solid-phase synthesis (DESPS), comprising parallel compound synthesis in organic solvent and aqueous enzymatic ligation of unprotected encoding dsDNA oligonucleotides. Computational encoding language design yielded 148 thermodynamically optimized sequences with Hamming string distance ≥ 3 and total read length <100 bases for facile sequencing. Ligation is efficient (70% yield), specific, and directional over 6 encoding positions. A series of isomers served as a testbed for DESPS's utility in split-and-pool diversification. Single-bead quantitative PCR detected 9 × 10(4) molecules/bead and sequencing allowed for elucidation of each compound's synthetic history. We applied DESPS to the combinatorial synthesis of a 75,645-member OBOC library containing scaffold, stereochemical and regiochemical diversity using mixed-scale resin (160-μm quality control beads and 10-μm screening beads). Tandem DNA sequencing/MALDI-TOF MS analysis of 19 quality control beads showed excellent agreement (<1 ppt) between DNA sequence-predicted mass and the observed mass. DESPS synergistically unites the advantages of solid-phase synthesis and DNA encoding, enabling single-bead structural elucidation of complex compounds and synthesis using reactions normally considered incompatible with unprotected DNA. The widespread availability of inexpensive oligonucleotide synthesis, enzymes, DNA sequencing, and PCR make implementation of DESPS straightforward, and may prompt the chemistry community to revisit the synthesis of more complex and diverse libraries.

Identification of the bacterial endosymbionts of the marine ciliate Euplotes magnicirratus (Ciliophora, Hypotrichia) and proposal of 'Candidatus Devosia euplotis'.

PubMed

Vannini, Claudia; Rosati, Giovanna; Verni, Franco; Petroni, Giulio

2004-07-01

This paper reports the identification of bacterial endosymbionts that inhabit the cytoplasm of the marine ciliated protozoon Euplotes magnicirratus. Ultrastructural and full-cycle rRNA approaches were used to reveal the identity of these bacteria. Based on analysis of 16S rRNA gene sequences, evolutionary trees were constructed; these placed the endosymbiont in the genus Devosia in the alpha-Proteobacteria. The validity of this finding was also shown by fluorescence in situ hybridization with a Devosia-specific oligonucleotide probe. Differences at the 16S rRNA gene level (which allowed the construction of a species-specific oligonucleotide probe) and the peculiar habitat indicate that the endosymbiont represents a novel species. As its cultivation has not been successful to date, the provisional name 'Candidatus Devosia euplotis' is proposed. The species- and group-specific probes designed in this study could represent convenient tools for the detection of 'Candidatus Devosia euplotis' and Devosia-like bacteria in the environment.

Aptamer-Targeted Gold Nanoparticles As Molecular-Specific Contrast Agents for Reflectance Imaging

PubMed Central

2008-01-01

Targeted metallic nanoparticles have shown potential as a platform for development of molecular-specific contrast agents. Aptamers have recently been demonstrated as ideal candidates for molecular targeting applications. In this study, we investigated the development of aptamer-based gold nanoparticles as contrast agents, using aptamers as targeting agents and gold nanoparticles as imaging agents. We devised a novel conjugation approach using an extended aptamer design where the extension is complementary to an oligonucleotide sequence attached to the surface of the gold nanoparticles. The chemical and optical properties of the aptamer−gold conjugates were characterized using size measurements and oligonucleotide quantitation assays. We demonstrate this conjugation approach to create a contrast agent designed for detection of prostate-specific membrane antigen (PSMA), obtaining reflectance images of PSMA(+) and PSMA(−) cell lines treated with the anti-PSMA aptamer−gold conjugates. This design strategy can easily be modified to incorporate multifunctional agents as part of a multimodal platform for reflectance imaging applications. PMID:18512972

Specific and reversible DNA-directed self-assembly of oil-in-water emulsion droplets

PubMed Central

Hadorn, Maik; Boenzli, Eva; Sørensen, Kristian T.; Fellermann, Harold; Eggenberger Hotz, Peter; Hanczyc, Martin M.

2012-01-01

Higher-order structures that originate from the specific and reversible DNA-directed self-assembly of microscopic building blocks hold great promise for future technologies. Here, we functionalized biotinylated soft colloid oil-in-water emulsion droplets with biotinylated single-stranded DNA oligonucleotides using streptavidin as an intermediary linker. We show the components of this modular linking system to be stable and to induce sequence-specific aggregation of binary mixtures of emulsion droplets. Three length scales were thereby involved: nanoscale DNA base pairing linking microscopic building blocks resulted in macroscopic aggregates visible to the naked eye. The aggregation process was reversible by changing the temperature and electrolyte concentration and by the addition of competing oligonucleotides. The system was reset and reused by subsequent refunctionalization of the emulsion droplets. DNA-directed self-assembly of oil-in-water emulsion droplets, therefore, offers a solid basis for programmable and recyclable soft materials that undergo structural rearrangements on demand and that range in application from information technology to medicine. PMID:23175791

Homogeneous versus heterogeneous probes for microbial ecological microarrays.

PubMed

Bae, Jin-Woo; Park, Yong-Ha

2006-07-01

Microbial ecological microarrays have been developed for investigating the composition and functions of microorganism communities in environmental niches. These arrays include microbial identification microarrays, which use oligonucleotides, gene fragments or microbial genomes as probes. In this article, the advantages and disadvantages of each type of probe are reviewed. Oligonucleotide probes are currently useful for probing uncultivated bacteria that are not amenable to gene fragment probing, whereas the functional gene fragments amplified randomly from microbial genomes require phylogenetic and hierarchical categorization before use as microbial identification probes, despite their high resolution for both specificity and sensitivity. Until more bacteria are sequenced and gene fragment probes are thoroughly validated, heterogeneous bacterial genome probes will provide a simple, sensitive and quantitative tool for exploring the ecosystem structure.

Method of manufacturing a matrix for the detection of mismatches

DOEpatents

Ershov, Gennady Moiseevich; Mirzabekov, Andrei Darievich

1998-01-01

This method for preparing micromatrices consists in applying a specially-patterned intermediate layer of laser-absorbing substance on a solid support. The configuration of the sublayer fully corresponds to the topology of the manufactured matrix. The intermediate layer is further covered by a continuous layer of gel , the gel and the material of the support being transparent towards laser radiation. The gel layer is irradiated by a laser beam for a time needed to evaporate simultaneously the gel in the places immediately above the laser-absorbing sublayer and the sublayer itself. Oligonucleotides from a chosen set are then attached to the formed gel `cells`, one oligonucleotide to each cell. This method is intended for use in biotechnology, specifically for deciphering the nucleotide sequence of DNA.

eSensor®: A Microarray Technology Based on Electrochemical Detection of Nucleic Acids and Its Application to Cystic Fibrosis Carrier Screening

NASA Astrophysics Data System (ADS)

Reed, Michael R.; Coty, William A.

We have developed a test for identification of carriers for cystic fibrosis using the eSensor® DNA detection technology. Oligonucleotide probes are deposited within self-assembled monolayers on gold electrodes arrayed upon printed circuit boards. These probes allow sequence-specific capture of amplicons containing a panel of mutation sites associated with cystic fibrosis. DNA targets are detected and mutations genotyped using a “sandwich” assay methodology employing electrochemical detection of ferrocene-labeled oligonucleotides for discrimination of carrier and non-carrier alleles. Performance of the cystic fibrosis application demonstrates sufficient accuracy and reliability for clinical diagnostic use, and the procedure can be performed by trained medical technologists available in the hospital laboratory.

Scalable amplification of strand subsets from chip-synthesized oligonucleotide libraries

PubMed Central

Schmidt, Thorsten L.; Beliveau, Brian J.; Uca, Yavuz O.; Theilmann, Mark; Da Cruz, Felipe; Wu, Chao-Ting; Shih, William M.

2015-01-01

Synthetic oligonucleotides are the main cost factor for studies in DNA nanotechnology, genetics and synthetic biology, which all require thousands of these at high quality. Inexpensive chip-synthesized oligonucleotide libraries can contain hundreds of thousands of distinct sequences, however only at sub-femtomole quantities per strand. Here we present a selective oligonucleotide amplification method, based on three rounds of rolling-circle amplification, that produces nanomole amounts of single-stranded oligonucleotides per millilitre reaction. In a multistep one-pot procedure, subsets of hundreds or thousands of single-stranded DNAs with different lengths can selectively be amplified and purified together. These oligonucleotides are used to fold several DNA nanostructures and as primary fluorescence in situ hybridization probes. The amplification cost is lower than other reported methods (typically around US$ 20 per nanomole total oligonucleotides produced) and is dominated by the use of commercial enzymes. PMID:26567534

Efficient self-assembly of DNA-functionalized fluorophores and gold nanoparticles with DNA functionalized silicon surfaces: the effect of oligomer spacers

PubMed Central

Milton, James A.; Patole, Samson; Yin, Huabing; Xiao, Qiang; Brown, Tom; Melvin, Tracy

2013-01-01

Although strategies for the immobilization of DNA oligonucleotides onto surfaces for bioanalytical and top-down bio-inspired nanobiofabrication approaches are well developed, the effect of introducing spacer molecules between the surface and the DNA oligonucleotide for the hybridization of nanoparticle–DNA conjugates has not been previously assessed in a quantitative manner. The hybridization efficiency of DNA oligonucleotides end-labelled with gold nanoparticles (1.4 or 10 nm diameter) with DNA sequences conjugated to silicon surfaces via hexaethylene glycol phosphate diester oligomer spacers (0, 1, 2, 6 oligomers) was found to be independent of spacer length. To quantify both the density of DNA strands attached to the surfaces and hybridization with the surface-attached DNA, new methodologies have been developed. Firstly, a simple approach based on fluorescence has been developed for determination of the immobilization density of DNA oligonucleotides. Secondly, an approach using mass spectrometry has been created to establish (i) the mean number of DNA oligonucleotides attached to the gold nanoparticles and (ii) the hybridization density of nanoparticle–oligonucleotide conjugates with the silicon surface–attached complementary sequence. These methods and results will be useful for application with nanosensors, the self-assembly of nanoelectronic devices and the attachment of nanoparticles to biomolecules for single-molecule biophysical studies. PMID:23361467

Random oligonucleotide mutagenesis: application to a large protein coding sequence of a major histocompatibility complex class I gene, H-2DP.

PubMed Central

Murray, R; Pederson, K; Prosser, H; Muller, D; Hutchison, C A; Frelinger, J A

1988-01-01

We have used random oligonucleotide mutagenesis (or saturation mutagenesis) to create a library of point mutations in the alpha 1 protein domain of a Major Histocompatibility Complex (MHC) molecule. This protein domain is critical for T cell and B cell recognition. We altered the MHC class I H-2DP gene sequence such that synthetic mutant alpha 1 exons (270 bp of coding sequence), which contain mutations identified by sequence analysis, can replace the wild type alpha 1 exon. The synthetic exons were constructed from twelve overlapping oligonucleotides which contained an average of 1.3 random point mutations per intact exon. DNA sequence analysis of mutant alpha 1 exons has shown a point mutant distribution that fits a Poisson distribution, and thus emphasizes the utility of this mutagenesis technique to "scan" a large protein sequence for important mutations. We report our use of saturation mutagenesis to scan an entire exon of the H-2DP gene, a cassette strategy to replace the wild type alpha 1 exon with individual mutant alpha 1 exons, and analysis of mutant molecules expressed on the surface of transfected mouse L cells. Images PMID:2903482

Dynamic peptide libraries for the discovery of supramolecular nanomaterials

NASA Astrophysics Data System (ADS)

Pappas, Charalampos G.; Shafi, Ramim; Sasselli, Ivan R.; Siccardi, Henry; Wang, Tong; Narang, Vishal; Abzalimov, Rinat; Wijerathne, Nadeesha; Ulijn, Rein V.

2016-11-01

Sequence-specific polymers, such as oligonucleotides and peptides, can be used as building blocks for functional supramolecular nanomaterials. The design and selection of suitable self-assembling sequences is, however, challenging because of the vast combinatorial space available. Here we report a methodology that allows the peptide sequence space to be searched for self-assembling structures. In this approach, unprotected homo- and heterodipeptides (including aromatic, aliphatic, polar and charged amino acids) are subjected to continuous enzymatic condensation, hydrolysis and sequence exchange to create a dynamic combinatorial peptide library. The free-energy change associated with the assembly process itself gives rise to selective amplification of self-assembling candidates. By changing the environmental conditions during the selection process, different sequences and consequent nanoscale morphologies are selected.

Dynamic peptide libraries for the discovery of supramolecular nanomaterials.

PubMed

Pappas, Charalampos G; Shafi, Ramim; Sasselli, Ivan R; Siccardi, Henry; Wang, Tong; Narang, Vishal; Abzalimov, Rinat; Wijerathne, Nadeesha; Ulijn, Rein V

2016-11-01

Sequence-specific polymers, such as oligonucleotides and peptides, can be used as building blocks for functional supramolecular nanomaterials. The design and selection of suitable self-assembling sequences is, however, challenging because of the vast combinatorial space available. Here we report a methodology that allows the peptide sequence space to be searched for self-assembling structures. In this approach, unprotected homo- and heterodipeptides (including aromatic, aliphatic, polar and charged amino acids) are subjected to continuous enzymatic condensation, hydrolysis and sequence exchange to create a dynamic combinatorial peptide library. The free-energy change associated with the assembly process itself gives rise to selective amplification of self-assembling candidates. By changing the environmental conditions during the selection process, different sequences and consequent nanoscale morphologies are selected.

DETECTING LOW-LEVEL SYNTHESIS IMPURITIES IN MODIFIED PHOSPHOROTHIOATE OLIGONUCLEOTIDES USING LIQUID CHROMATOGRAPHY – HIGH RESOLUTION MASS SPECTROMETRY

PubMed Central

Nikcevic, Irena; Wyrzykiewicz, Tadeusz K.; Limbach, Patrick A.

2010-01-01

Summary An LC-MS method based on the use of high resolution Fourier transform ion cyclotron resonance mass spectrometry (FTIRCMS) for profiling oligonucleotides synthesis impurities is described. Oligonucleotide phosphorothioatediesters (phosphorothioate oligonucleotides), in which one of the non-bridging oxygen atoms at each phosphorus center is replaced by a sulfur atom, are now one of the most popular oligonucleotide modifications due to their ease of chemical synthesis and advantageous pharmacokinetic properties. Despite significant progress in the solid-phase oligomerization chemistry used in the manufacturing of these oligonucleotides, multiple classes of low-level impurities always accompany synthetic oligonucleotides. Liquid chromatography-mass spectrometry has emerged as a powerful technique for the identification of these synthesis impurities. However, impurity profiling, where the entire complement of low-level synthetic impurities is identified in a single analysis, is more challenging. Here we present an LC-MS method based the use of high resolution-mass spectrometry, specifically Fourier transform ion cyclotron resonance mass spectrometry (FTIRCMS or FTMS). The optimal LC-FTMS conditions, including the stationary phase and mobile phases for the separation and identification of phosphorothioate oligonucleotides, were found. The characteristics of FTMS enable charge state determination from single m/z values of low-level impurities. Charge state information then enables more accurate modeling of the detected isotopic distribution for identification of the chemical composition of the detected impurity. Using this approach, a number of phosphorothioate impurities can be detected by LC-FTMS including failure sequences carrying 3′-terminal phosphate monoester and 3′-terminal phosphorothioate monoester, incomplete backbone sulfurization and desulfurization products, high molecular weight impurities, and chloral, isobutyryl, and N3 (2-cyanoethyl) adducts of the full length product. When compared with low resolution LC-MS, ~60% more impurities can be identified when charge state and isotopic distribution information is available and used for impurity profiling. PMID:21811394

Scar-less multi-part DNA assembly design automation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hillson, Nathan J.

The present invention provides a method of a method of designing an implementation of a DNA assembly. In an exemplary embodiment, the method includes (1) receiving a list of DNA sequence fragments to be assembled together and an order in which to assemble the DNA sequence fragments, (2) designing DNA oligonucleotides (oligos) for each of the DNA sequence fragments, and (3) creating a plan for adding flanking homology sequences to each of the DNA oligos. In an exemplary embodiment, the method includes (1) receiving a list of DNA sequence fragments to be assembled together and an order in which tomore » assemble the DNA sequence fragments, (2) designing DNA oligonucleotides (oligos) for each of the DNA sequence fragments, and (3) creating a plan for adding optimized overhang sequences to each of the DNA oligos.« less

Computer program for the IBM personal computer which searches for approximate matches to short oligonucleotide sequences in long target DNA sequences.

PubMed Central

Myers, E W; Mount, D W

1986-01-01

We describe a program which may be used to find approximate matches to a short predefined DNA sequence in a larger target DNA sequence. The program predicts the usefulness of specific DNA probes and sequencing primers and finds nearly identical sequences that might represent the same regulatory signal. The program is written in the C programming language and will run on virtually any computer system with a C compiler, such as the IBM/PC and other computers running under the MS/DOS and UNIX operating systems. The program has been integrated into an existing software package for the IBM personal computer (see article by Mount and Conrad, this volume). Some examples of its use are given. PMID:3753785

Biology of Symbioses between Marine Invertebrates and Intracellular Bacteria

DTIC Science & Technology

1990-01-30

bisphosphate carboxylase We designed from published sequence information oligonucleotide primers which are complementary to conserved regions on RubisCO ...large and small subunit genes. These primers were used successfully to amplify using polymerase chain reaction (PCR) specific regions of RubisCO ...for the large subunit of ribulose bisphosphate carboxylase/oxygenase ( RubisCO ) to symbiont DNA shows that the symbionts from both deep-sea and shallow

Friend and Moloney murine leukemia viruses specifically recombine with different endogenous retroviral sequences to generate mink cell focus-forming viruses.

PubMed

Evans, L H; Cloyd, M W

1985-01-01

A group of mink cell focus-forming (MCF) viruses was derived by inoculation of NFS/N mice with Moloney murine leukemia virus (Mo-MuLV 1387) and was compared to a similarly derived group of MCF viruses from mice inoculated with Friend MuLV (Fr-MuLV 57). Antigenic analyses using monoclonal antibodies specific for MCF virus and xenotropic MuLV envelope proteins and genomic structural analyses by RNase T1-resistant oligonucleotide finger-printing indicated that the Moloney and Friend MCF viruses arose by recombination of the respective ecotropic MuLVs with different endogenous retrovirus sequences of NFS mice.

repDNA: a Python package to generate various modes of feature vectors for DNA sequences by incorporating user-defined physicochemical properties and sequence-order effects.

PubMed

Liu, Bin; Liu, Fule; Fang, Longyun; Wang, Xiaolong; Chou, Kuo-Chen

2015-04-15

In order to develop powerful computational predictors for identifying the biological features or attributes of DNAs, one of the most challenging problems is to find a suitable approach to effectively represent the DNA sequences. To facilitate the studies of DNAs and nucleotides, we developed a Python package called representations of DNAs (repDNA) for generating the widely used features reflecting the physicochemical properties and sequence-order effects of DNAs and nucleotides. There are three feature groups composed of 15 features. The first group calculates three nucleic acid composition features describing the local sequence information by means of kmers; the second group calculates six autocorrelation features describing the level of correlation between two oligonucleotides along a DNA sequence in terms of their specific physicochemical properties; the third group calculates six pseudo nucleotide composition features, which can be used to represent a DNA sequence with a discrete model or vector yet still keep considerable sequence-order information via the physicochemical properties of its constituent oligonucleotides. In addition, these features can be easily calculated based on both the built-in and user-defined properties via using repDNA. The repDNA Python package is freely accessible to the public at http://bioinformatics.hitsz.edu.cn/repDNA/. bliu@insun.hit.edu.cn or kcchou@gordonlifescience.org Supplementary data are available at Bioinformatics online. © The Author 2014. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

Polymerase chain reaction (PCR) amplification of a nucleoprotein gene sequence of infectious hematopoietic necrosis virus

USGS Publications Warehouse

Arakawa, C.K.; Deering, R.E.; Higman, K.H.; Oshima, K.H.; O'Hara, P.J.; Winton, J.R.

1990-01-01

The polymerase chain reaction [PCR) was used to amplify a portion of the nucleoprotein [NI gene of infectious hematopoietic necrosis virus (IHNV). Using a published sequence for the Round Butte isolate of IHNV, a pair of PCR pnmers was synthesized that spanned a 252 nucleotide region of the N gene from residue 319 to residue 570 of the open reading frame. This region included a 30 nucleotide target sequence for a synthetic oligonucleotide probe developed for detection of IHNV N gene messenger RNA. After 25 cycles of amplification of either messenger or genomic RNA, the PCR product (DNA) of the expected size was easily visible on agarose gels stained with ethidium bromide. The specificity of the amplified DNA was confirmed by Southern and dot-blot analysis using the biotinylated oligonucleotide probe. The PCR was able to amplify the N gene sequence of purified genomic RNA from isolates of IHNV representing 5 different electropherotypes. Using the IHNV primer set, no PCR product was obtained from viral hemorrhagic septicemia virus RNA, but 2 higher molecular weight products were synthesized from hirame rhabdovirus RNA that did not hybridize with the biotinylated probe. The PCR could be efficiently performed with all IHNV genomic RNA template concentrations tested (1 ng to 1 pg). The lowest level of sensitivity was not determined. The PCR was used to amplify RNA extracted from infected cell cultures and selected tissues of Infected rainbow trout. The combination of PCR and nucleic acid probe promises to provide a detection method for IHNV that is rapid, h~ghly specific, and sensitive.

Comparison of small molecules and oligonucleotides that target a toxic, non-coding RNA.

PubMed

Costales, Matthew G; Rzuczek, Suzanne G; Disney, Matthew D

2016-06-01

Potential RNA targets for chemical probes and therapeutic modalities are pervasive in the transcriptome. Oligonucleotide-based therapeutics are commonly used to target RNA sequence. Small molecules are emerging as a modality to target RNA structures selectively, but their development is still in its infancy. In this work, we compare the activity of oligonucleotides and several classes of small molecules that target the non-coding r(CCUG) repeat expansion (r(CCUG)(exp)) that causes myotonic dystrophy type 2 (DM2), an incurable disease that is the second-most common cause of adult onset muscular dystrophy. Small molecule types investigated include monomers, dimers, and multivalent compounds synthesized on-site by using RNA-templated click chemistry. Oligonucleotides investigated include phosphorothioates that cleave their target and vivo-morpholinos that modulate target RNA activity via binding. We show that compounds assembled on-site that recognize structure have the highest potencies amongst small molecules and are similar in potency to a vivo-morpholino modified oligonucleotide that targets sequence. These studies are likely to impact the design of therapeutic modalities targeting other repeats expansions that cause fragile X syndrome and amyotrophic lateral sclerosis, for example. Copyright © 2016. Published by Elsevier Ltd.

Phosphorothioate oligonucleotides inhibit the intrinsic tenase complex.

PubMed

Sheehan, J P; Lan, H C

1998-09-01

Systemic administration of ISIS 2302, a 20-mer antisense phosphorothioate oligonucleotide targeting human intercellular adhesion molecule-1 mRNA, causes prolongation of plasma clotting times in both monkey and human studies. The anticoagulant effects of ISIS 2302 were investigated with both in vitro coagulation assays in human plasma and purified enzyme systems. At high oligonucleotide plasma concentrations (>100 microgram/mL), prolongation of the prothrombin and thrombin times was observed. In a thrombin time assay using purified components, high concentrations of ISIS 2302 inhibited thrombin clotting activity both by stimulating inhibition by heparin cofactor II and directly competing with fibrinogen for binding to anion binding exosite I. In contrast, low concentrations of ISIS 2302 (<100 microgram/mL) showed a selective, linear prolongation of the activated partial thromboplastin time (PTT). The rate limiting effect of 50 microgram/mL ISIS 2302, which prolonged the PTT to 1.5 times control, was identified by sequential modification of the clotting assay. Delaying addition of oligonucleotide until after contact activation failed to correct prolongation of the PTT. The calcium-dependent steps of the intrinsic pathway were individually assessed by adding sufficient activated coagulation factor to correct the PTT in plasma deficient in that specific factor. Addition of factor XIa, IXa, VIIIa, or Va failed to correct the PTT in the presence of ISIS 2302. In contrast, 0.2 nmol/L factor Xa corrected prolongation of the PTT in factor X-deficient plasma with or without oligonucleotide present. ISIS 2302 (50 microgram/mL) did not prolong a modified Russel viper venom time, suggesting no significant inhibition of prothrombinase. Thus, 50 microgram/mL ISIS 2302 prolonged the PTT by selectively inhibiting intrinsic tenase activity. ISIS 2302 showed partial inhibition of intrinsic tenase activity (to approximately 35% of control) at clinically relevant oligonucleotide concentrations in a chromogenic assay. This activity was oligonucleotide sequence-independent but required the phosphorothioate backbone, suggesting that inhibition of intrinsic tenase is a general property of this class of oligonucleotides. These results are relevant to both the therapeutic use of phosphorothioate oligonucleotides and the potential design of inhibitors of the intrinsic tenase complex, a novel target for anticoagulation. Copyright 1998 by The American Society of Hematology.

Oligonucleotide fingerprinting of rRNA genes for analysis of fungal community composition.

PubMed

Valinsky, Lea; Della Vedova, Gianluca; Jiang, Tao; Borneman, James

2002-12-01

Thorough assessments of fungal diversity are currently hindered by technological limitations. Here we describe a new method for identifying fungi, oligonucleotide fingerprinting of rRNA genes (OFRG). ORFG sorts arrayed rRNA gene (ribosomal DNA [rDNA]) clones into taxonomic clusters through a series of hybridization experiments, each using a single oligonucleotide probe. A simulated annealing algorithm was used to design an OFRG probe set for fungal rDNA. Analysis of 1,536 fungal rDNA clones derived from soil generated 455 clusters. A pairwise sequence analysis showed that clones with average sequence identities of 99.2% were grouped into the same cluster. To examine the accuracy of the taxonomic identities produced by this OFRG experiment, we determined the nucleotide sequences for 117 clones distributed throughout the tree. For all but two of these clones, the taxonomic identities generated by this OFRG experiment were consistent with those generated by a nucleotide sequence analysis. Eighty-eight percent of the clones were affiliated with Ascomycota, while 12% belonged to BASIDIOMYCOTA: A large fraction of the clones were affiliated with the genera Fusarium (404 clones) and Raciborskiomyces (176 clones). Smaller assemblages of clones had high sequence identities to the Alternaria, Ascobolus, Chaetomium, Cryptococcus, and Rhizoctonia clades.

Aptamer-based electrochemical sensors with aptamer-complementary DNA oligonucleotides as probe.

PubMed

Lu, Ying; Li, Xianchan; Zhang, Limin; Yu, Ping; Su, Lei; Mao, Lanqun

2008-03-15

This study describes a facile and general strategy for the development of aptamer-based electrochemical sensors with a high specificity toward the targets and a ready regeneration feature. Very different from the existing strategies for the development of electrochemical aptasensors with the aptamers as the probes, the strategy proposed here is essentially based on the utilization of the aptamer-complementary DNA (cDNA) oligonucleotides as the probes for electrochemical sensing. In this context, the sequences at both ends of the cDNA are tailor-made to be complementary and both the redox moiety (i.e., ferrocene in this study) and thiol group are labeled onto the cDNA. The labeled cDNA are hybridized with their respective aptamers (i.e., ATP- and thrombin-binding aptamers in this study) to form double-stranded DNA (ds-DNA) and the electrochemical aptasensors are prepared by self-assembling the labeled ds-DNA onto Au electrodes. Upon target binding, the aptamers confined onto electrode surface dissociate from their respective cDNA oligonucleotides into the solution and the single-stranded cDNA could thus tend to form a hairpin structure through the hybridization of the complementary sequences at both its ends. Such a conformational change of the cDNA resulting from the target binding-induced dissociation of the aptamers essentially leads to the change in the voltammetric signal of the redox moiety labeled onto the cDNA and thus constitutes the mechanism for the electrochemical aptasensors for specific target sensing. The aptasensors demonstrated here with the cDNA as the probe are readily regenerated and show good responses toward the targets. This study may offer a new and relatively general approach to electrochemical aptasensors with good analytical properties and potential applications.

Identification of some ectomycorrhizal basidiomycetes by PCR amplification of their gpd (glyceraldehyde-3-phosphate dehydrogenase) genes.

PubMed Central

Kreuzinger, N; Podeu, R; Gruber, F; Göbl, F; Kubicek, C P

1996-01-01

Degenerated oligonucleotide primers designed to flank an approximately 1.2-kb fragment of the gene encoding glyceraldehyde-3-phosphate dehydrogenase (gpd) from ascomycetes and basidiomycetes were used to amplify the corresponding gpd fragments from several species of the ectomycorrhizal fungal taxa Boletus, Amanita, and Lactarius. Those from B. edulis, A. muscaria, and L. deterrimus were cloned and sequenced. The respective nucleotide sequences of these gene fragments showed a moderate degree of similarity (72 to 76%) in the protein-encoding regions and only a low degree of similarity in the introns (56 to 66%). Introns, where present, occurred at conserved positions, but the respective positions and numbers of introns in a given taxon varied. The amplified fragment from a given taxon could be distinguished from that of others by both restriction nuclease cleavage analysis and Southern hybridization. A procedure for labeling DNA probes with fluorescein-12-dUTP by PCR was developed. These probes were used in a nonradioactive hybridization assay, with which the gene could be detected in 2 ng of chromosomal DNA of L. deterrimus on slot blots. Taxon-specific amplification was achieved by the design of specific oligonucleotide primers. The application of the gpd gene for the identification of mycorrhizal fungi under field conditions was demonstrated, with Picea abies (spruce) mycorrhizal roots harvested from a northern alpine forest area as well as from a plant-breeding nursery. The interference by inhibitory substances, which sometimes occurred in the DNA extracted from the root-fungus mixture, could be overcome by using very diluted concentrations of template DNA for a first round of PCR amplification followed by a second round with nested oligonucleotide primers. We conclude that gpd can be used to detect ectomycorrhizal fungi during symbiotic interaction. PMID:8795234

Isolation and characterization of target sequences of the chicken CdxA homeobox gene.

PubMed Central

Margalit, Y; Yarus, S; Shapira, E; Gruenbaum, Y; Fainsod, A

1993-01-01

The DNA binding specificity of the chicken homeodomain protein CDXA was studied. Using a CDXA-glutathione-S-transferase fusion protein, DNA fragments containing the binding site for this protein were isolated. The sources of DNA were oligonucleotides with random sequence and chicken genomic DNA. The DNA fragments isolated were sequenced and tested in DNA binding assays. Sequencing revealed that most DNA fragments are AT rich which is a common feature of homeodomain binding sites. By electrophoretic mobility shift assays it was shown that the different target sequences isolated bind to the CDXA protein with different affinities. The specific sequences bound by the CDXA protein in the genomic fragments isolated, were determined by DNase I footprinting. From the footprinted sequences, the CDXA consensus binding site was determined. The CDXA protein binds the consensus sequence A, A/T, T, A/T, A, T, A/G. The CAUDAL binding site in the ftz promoter is also included in this consensus sequence. When tested, some of the genomic target sequences were capable of enhancing the transcriptional activity of reporter plasmids when introduced into CDXA expressing cells. This study determined the DNA sequence specificity of the CDXA protein and it also shows that this protein can further activate transcription in cells in culture. Images PMID:7909943

Methylation-sensitive enrichment of minor DNA alleles using a double-strand DNA-specific nuclease.

PubMed

Liu, Yibin; Song, Chen; Ladas, Ioannis; Fitarelli-Kiehl, Mariana; Makrigiorgos, G Mike

2017-04-07

Aberrant methylation changes, often present in a minor allelic fraction in clinical samples such as plasma-circulating DNA (cfDNA), are potentially powerful prognostic and predictive biomarkers in human disease including cancer. We report on a novel, highly-multiplexed approach to facilitate analysis of clinically useful methylation changes in minor DNA populations. Methylation Specific Nuclease-assisted Minor-allele Enrichment (MS-NaME) employs a double-strand-specific DNA nuclease (DSN) to remove excess DNA with normal methylation patterns. The technique utilizes oligonucleotide-probes that direct DSN activity to multiple targets in bisulfite-treated DNA, simultaneously. Oligonucleotide probes targeting unmethylated sequences generate local double stranded regions resulting to digestion of unmethylated targets, and leaving methylated targets intact; and vice versa. Subsequent amplification of the targeted regions results in enrichment of the targeted methylated or unmethylated minority-epigenetic-alleles. We validate MS-NaME by demonstrating enrichment of RARb2, ATM, MGMT and GSTP1 promoters in multiplexed MS-NaME reactions (177-plex) using dilutions of methylated/unmethylated DNA and in DNA from clinical lung cancer samples and matched normal tissue. MS-NaME is a highly scalable single-step approach performed at the genomic DNA level in solution that combines with most downstream detection technologies including Sanger sequencing, methylation-sensitive-high-resolution melting (MS-HRM) and methylation-specific-Taqman-based-digital-PCR (digital Methylight) to boost detection of low-level aberrant methylation-changes. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

The prediction of human exons by oligonucleotide composition and discriminant analysis of spliceable open reading frames

DOE Office of Scientific and Technical Information (OSTI.GOV)

Solovyev, V.V.; Salamov, A.A.; Lawrence, C.B.

1994-12-31

Discriminant analysis is applied to the problem of recognition 5`-, internal and 3`-exons in human DNA sequences. Specific recognition functions were developed for revealing exons of particular types. The method based on a splice site prediction algorithm that uses the linear Fisher discriminant to combine the information about significant triplet frequencies of various functional parts of splice site regions and preferences of oligonucleotide in protein coding and nation regions. The accuracy of our splice site recognition function is about 97%. A discriminant function for 5`-exon prediction includes hexanucleotide composition of upstream region, triplet composition around the ATG codon, ORF codingmore » potential, donor splice site potential and composition of downstream introit region. For internal exon prediction, we combine in a discriminant function the characteristics describing the 5`- intron region, donor splice site, coding region, acceptor splice site and Y-intron region for each open reading frame flanked by GT and AG base pairs. The accuracy of precise internal exon recognition on a test set of 451 exon and 246693 pseudoexon sequences is 77% with a specificity of 79% and a level of pseudoexon ORF prediction of 99.96%. The recognition quality computed at the level of individual nucleotides is 89%, for exon sequences and 98% for intron sequences. A discriminant function for 3`-exon prediction includes octanucleolide composition of upstream nation region, triplet composition around the stop codon, ORF coding potential, acceptor splice site potential and hexanucleotide composition of downstream region. We unite these three discriminant functions in exon predicting program FEX (find exons). FEX exactly predicts 70% of 1016 exons from the test of 181 complete genes with specificity 73%, and 89% exons are exactly or partially predicted. On the average, 85% of nucleotides were predicted accurately with specificity 91%.« less

The chemical evolution of oligonucleotide therapies of clinical utility

PubMed Central

Khvorova, Anastasia; Watts, Jonathan K.

2017-01-01

After nearly 40 years of development, oligonucleotide therapeutics are nearing meaningful clinical productivity. One of the key advantages of oligonucleotide drugs is that their delivery and potency properties are derived primarily from the chemical structure of the oligonucleotide, while their target is defined by the base sequence. Thus, as oligonucleotides with a particular chemical design demonstrate appropriate distribution and safety profiles for clinical gene silencing in a particular tissue, this will open the door to the rapid development of additional drugs targeting other disease-associated genes in the same tissue. To achieve clinical productivity, the chemical architecture of the oligonucleotide needs to be optimized as a whole, using a combination of sugar, backbone, nucleobase and 3′/5′-terminal modifications. A portfolio of chemistries can be used to confer drug like properties onto the oligonucleotide as a whole, with minor chemical changes often translating into major improvements in clinical efficacy. Outstanding challenges in oligonucleotide chemical development include optimization of chemical architectures to ensure long-term safety and to enable robust clinical activity beyond the liver. PMID:28244990

Molecular cloning and nucleotide sequence of the alpha and beta subunits of allophycocyanin from the cyanelle genome of Cyanophora paradoxa.

PubMed Central

Bryant, D A; de Lorimier, R; Lambert, D H; Dubbs, J M; Stirewalt, V L; Stevens, S E; Porter, R D; Tam, J; Jay, E

1985-01-01

The genes for the alpha- and beta-subunit apoproteins of allophycocyanin (AP) were isolated from the cyanelle genome of Cyanophora paradoxa and subjected to nucleotide sequence analysis. The AP beta-subunit apoprotein gene was localized to a 7.8-kilobase-pair Pst I restriction fragment from cyanelle DNA by hybridization with a tetradecameric oligonucleotide probe. Sequence analysis using that oligonucleotide and its complement as primers for the dideoxy chain-termination sequencing method confirmed the presence of both AP alpha- and beta-subunit genes on this restriction fragment. Additional oligonucleotide primers were synthesized as sequencing progressed and were used to determine rapidly the nucleotide sequence of a 1336-base-pair region of this cloned fragment. This strategy allowed the sequencing to be completed without a detailed restriction map and without extensive and time-consuming subcloning. The sequenced region contains two open reading frames whose deduced amino acid sequences are 81-85% homologous to cyanobacterial and red algal AP subunits whose amino acid sequences have been determined. The two open reading frames are in the same orientation and are separated by 39 base pairs. AP alpha is 5' to AP beta and both coding sequences are preceded by a polypurine, Shine-Dalgarno-type sequence. Sequences upstream from AP alpha closely resemble the Escherichia coli consensus promoter sequences and also show considerable homology to promoter sequences for several chloroplast-encoded psbA genes. A 56-base-pair palindromic sequence downstream from the AP beta gene could play a role in the termination of transcription or translation. The allophycocyanin apoprotein subunit genes are located on the large single-copy region of the cyanelle genome. PMID:2987916

Capillary electrophoresis, a method for the determination of nucleic acid ligands covalently attached to quantum dots representing a donor of Förster resonance energy transfer.

PubMed

Datinská, Vladimíra; Klepárník, Karel; Belšánová, Barbora; Minárik, Marek; Foret, František

2018-05-09

The synthesis and determination of the structure of a Förster resonance energy transfer probe intended for the detection of specific nucleic acid sequences are described here. The probe is based on the hybridization of oligonucleotide modified quantum dots with a fluorescently labeled nucleic acid sample resulting in changes of the fluorescence emission due to the energy transfer effect. The stoichiometry distribution of oligonucleotides conjugated to quantum dots was determined by capillary electrophoresis separation. The results indicate that one to four molecules of oligonucleotide are conjugated to the surface of a single nanoparticle. This conclusion is confirmed by the course of the dependence of Förster resonance energy transfer efficiency on the concentration of fluorescently labeled complementary single-stranded nucleic acid, showing saturation. While the energy transfer efficiency of the probe hybridized with complementary nucleic acid strands was 30%, negligible efficiency was observed with a non-complementary strands. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

Silver-dendrimer nanocomposites as oligonucleotide labels for electrochemical stripping detection of DNA hybridization.

PubMed

Jin, Xin; Zhou, Ling; Zhu, Bo; Jiang, Xue; Zhu, Ningning

2018-06-01

Silver-dendrimer nanocomposites were synthesized and used as oligonucleotide labels for electrochemical stripping detection of DNA hybridization. The synthesized silver-dendrimer nanocomposites were characterized by UV-vis spectrophotometry, X-ray photoelectron spectroscopy (XPS) and transmission electron microscopy (TEM). Ratios of silver/dendrimer were optimized in order to obtain stable nanocomposites with maximal silver loading in the interior of a polymeric shell. The silver-dendrimer nanocomposites were attached to sequence-known DNA probes specific to colitoxin, and used to detect probe hybridization by dissolution of the silver nanoparticles in the interior of dendrimer in a diluted nitric acid, followed by measurement of Ag + ions by anodic stripping voltammetry (ASV). Use of differential pulse voltammetry for the stripping step, along with optimization of the ASV conditions, enabled a detection limit of 0.78 pM. The present strategy, in combination with dendrimer-encapsulated copper labeled oligonucleotides probe reported previously, could potentially be used to detect single or multiple DNA targets in one sample. Copyright © 2018 Elsevier B.V. All rights reserved.

Storage and utilization of HLA genomic data--new approaches to HLA typing.

PubMed

Helmberg, W

2000-01-01

Currently available DNA-based HLA typing assays can provide detailed information about sequence motifs of a tested sample. It is still a common practice, however, for information acquired by high-resolution sequence specific oligonucleotide probe (SSOP) typing or sequence specific priming (SSP) to be presented in a low-resolution serological format. Unfortunately, this representation can lead to significant loss of useful data in many cases. An alternative to assigning allele equivalents to suchDNA typing results is simply to store the observed typing pattern and utilize the information with the help of Virtual DNA Analysis (VDA). Interpretation of the stored typing patterns can then be updated based on newly defined alleles, assuming the sequence motifs detected by the typing reagents are known. Rather than updating reagent specificities in individual laboratories, such updates should be performed in a central, publicly available sequence database. By referring to this database, HLA genomic data can then be stored and transferred between laboratories without loss of information. The 13th International Histocompatibility Workshop offers an ideal opportunity to begin building this common database for the entire human MHC.

Selecting Fully-Modified XNA Aptamers Using Synthetic Genetics.

PubMed

Taylor, Alexander I; Holliger, Philipp

2018-06-01

This unit describes the application of "synthetic genetics," i.e., the replication of xeno nucleic acids (XNAs), artificial analogs of DNA and RNA bearing alternative backbone or sugar congeners, to the directed evolution of synthetic oligonucleotide ligands (XNA aptamers) specific for target proteins or nucleic acid motifs, using a cross-chemistry selective exponential enrichment (X-SELEX) approach. Protocols are described for synthesis of diverse-sequence XNA repertoires (typically 10 14 molecules) using DNA templates, isolation and panning for functional XNA sequences using targets immobilized on solid phase or gel shift induced by target binding in solution, and XNA reverse transcription to allow cDNA amplification or sequencing. The method may be generally applied to select fully-modified XNA aptamers specific for a wide range of target molecules. © 2018 by John Wiley & Sons, Inc. Copyright © 2018 John Wiley & Sons, Inc.

A sense oligonucleotide to inducible nitric oxide synthase mRNA increases the survival rate of rats in septic shock.

PubMed

Okuyama, Tetsuya; Nakatake, Richi; Kaibori, Masaki; Okumura, Tadayoshi; Kon, Masanori; Nishizawa, Mikio

2018-01-30

Natural antisense transcripts (asRNAs) that do not encode proteins are transcribed from rat, mouse, and human genes, encoding inducible nitric oxide synthase (iNOS), which catalyzes the production of the inflammatory mediator nitric oxide (NO). In septic shock, NO is excessively produced in hepatocytes and macrophages. The iNOS asRNA interacts with and stabilizes iNOS mRNA. We found that single-stranded 'sense' oligonucleotides corresponding to the iNOS mRNA sequence reduced iNOS mRNA levels by interfering with the mRNA-asRNA interactions in rat hepatocytes. The iNOS sense oligonucleotides that were substituted with phosphorothioate bonds and locked nucleic acids efficiently decreased the levels of iNOS mRNA and iNOS protein. In this study, the gene expression patterns in the livers of two endotoxemia model rats with acute liver failure were compared. Next, we optimized the sequence and modification of the iNOS sense oligonucleotides in interleukin 1β-treated rat hepatocytes. When a sense oligonucleotide was simultaneously administered with d-galactosamine and bacterial lipopolysaccharide (LPS) to rats, their survival rate significantly increased compared to the rats administered d-galactosamine and LPS alone. In the livers of the sense oligonucleotide-administered rats, apoptosis in the hepatocytes markedly decreased. These results suggest that natural antisense transcript-targeted regulation technology using iNOS sense oligonucleotides may be used to treat human inflammatory diseases, such as sepsis and septic shock. Copyright © 2017 Elsevier Inc. All rights reserved.

Multiplex analysis of DNA

DOEpatents

Church, George M.; Kieffer-Higgins, Stephen

1992-01-01

This invention features vectors and a method for sequencing DNA. The method includes the steps of: a) ligating the DNA into a vector comprising a tag sequence, the tag sequence includes at least 15 bases, wherein the tag sequence will not hybridize to the DNA under stringent hybridization conditions and is unique in the vector, to form a hybrid vector, b) treating the hybrid vector in a plurality of vessels to produce fragments comprising the tag sequence, wherein the fragments differ in length and terminate at a fixed known base or bases, wherein the fixed known base or bases differs in each vessel, c) separating the fragments from each vessel according to their size, d) hybridizing the fragments with an oligonucleotide able to hybridize specifically with the tag sequence, and e) detecting the pattern of hybridization of the tag sequence, wherein the pattern reflects the nucleotide sequence of the DNA.

HLA-A, -B, -DRB1 allele and haplotype frequencies of 920 cord blood units from Central Chile.

PubMed

Schäfer, Christian; Sauter, Jürgen; Riethmüller, Tobias; Kashi, Zahra Mehdizadeh; Schmidt, Alexander H; Barriga, Francisco J

2016-08-01

We present human leukocyte antigen (HLA) haplotype and allele/antigenic group frequencies derived from a data set of 920 umbilical cord blood units collected in Central Chile. HLA-A and -B genotypes were typed using sequence specific oligonucleotide probe methods while HLA-DRB1 genotypes were obtained from sequencing-based typing. The most frequent haplotype is A*29~B*44~DRB1*07:01 with an estimated frequency of 2.1%. Copyright © 2016 American Society for Histocompatibility and Immunogenetics. Published by Elsevier Inc. All rights reserved.

Metastasizing patent claims on BRCA1.

PubMed

Kepler, Thomas B; Crossman, Colin; Cook-Deegan, Robert

2010-05-01

Many patents make claims on DNA sequences; some include claims on oligonucleotides related to the primary patented gene. We used bioinformatics to quantify the reach of one such claim from patent 4,747,282 on BRCA1. We find that human chromosome 1 (which does not contain BRCA1) contains over 300,000 oligonucleotides covered by this claim, and that 80% of cDNA and mRNA sequences contributed to GenBank before the patent application was filed also contain at least one claimed oligonucleotide. Any "isolated" DNA molecules that include such 15 bp nucleotide sequences would fall under the claim as granted by the US Patent and Trademark Office. Anyone making, using, selling, or importing such a molecule for any purpose within the United States would thus be infringing the claim. This claim and others like it turn out, on examination, to be surprisingly broad, and if enforced would have substantial implications for medical practice and scientific research. Copyright 2010 Elsevier Inc. All rights reserved.

Optical properties and electronic transitions of DNA oligonucleotides as a function of composition and stacking sequence.

PubMed

Schimelman, Jacob B; Dryden, Daniel M; Poudel, Lokendra; Krawiec, Katherine E; Ma, Yingfang; Podgornik, Rudolf; Parsegian, V Adrian; Denoyer, Linda K; Ching, Wai-Yim; Steinmetz, Nicole F; French, Roger H

2015-02-14

The role of base pair composition and stacking sequence in the optical properties and electronic transitions of DNA is of fundamental interest. We present and compare the optical properties of DNA oligonucleotides (AT)10, (AT)5(GC)5, and (AT-GC)5 using both ab initio methods and UV-vis molar absorbance measurements. Our data indicate a strong dependence of both the position and intensity of UV absorbance features on oligonucleotide composition and stacking sequence. The partial densities of states for each oligonucleotide indicate that the valence band edge arises from a feature associated with the PO4(3-) complex anion, and the conduction band edge arises from anti-bonding states in DNA base pairs. The results show a strong correspondence between the ab initio and experimentally determined optical properties. These results highlight the benefit of full spectral analysis of DNA, as opposed to reductive methods that consider only the 260 nm absorbance (A260) or simple purity ratios, such as A260/A230 or A260/A280, and suggest that the slope of the absorption edge onset may provide a useful metric for the degree of base pair stacking in DNA. These insights may prove useful for applications in biology, bioelectronics, and mesoscale self-assembly.

Measuring DNA hybridization using fluorescent DNA-stabilized silver clusters to investigate mismatch effects on therapeutic oligonucleotides.

PubMed

de Bruin, Donny; Bossert, Nelli; Aartsma-Rus, Annemieke; Bouwmeester, Dirk

2018-04-06

Short nucleic acid oligomers have found a wide range of applications in experimental physics, biology and medicine, and show potential for the treatment of acquired and genetic diseases. These applications rely heavily on the predictability of hybridization through Watson-Crick base pairing to allow positioning on a nanometer scale, as well as binding to the target transcripts, but also off-target binding to transcripts with partial homology. These effects are of particular importance in the development of therapeutic oligonucleotides, where off-target effects caused by the binding of mismatched sequences need to be avoided. We employ a novel method of probing DNA hybridization using optically active DNA-stabilized silver clusters (Ag-DNA) to measure binding efficiencies through a change in fluorescence intensity. In this way we can determine their location-specific sensitivity to individual mismatches in the sequence. The results reveal a strong dependence of the hybridization on the location of the mismatch, whereby mismatches close to the edges and center show a relatively minor impact. In parallel, we propose a simple model for calculating the annealing ratios of mismatched DNA sequences, which supports our experimental results. The primary result shown in this work is a demonstration of a novel technique to measure DNA hybridization using fluorescent Ag-DNA. With this technique, we investigated the effect of mismatches on the hybridization efficiency, and found a significant dependence on the location of individual mismatches. These effects are strongly influenced by the length of the used oligonucleotides. The novel probe method based on fluorescent Ag-DNA functions as a reliable tool in measuring this behavior. As a secondary result, we formulated a simple model that is consistent with the experimental data.

Selective amplification of an mRNA and related pseudogene for a human ADP-ribosylation factor, a guanine nucleotide-dependent protein activator of cholera toxin

DOE Office of Scientific and Technical Information (OSTI.GOV)

Monaco, L.; Murtagh, J.J.; Newman, K.B.

1990-03-01

ADP-ribosylation factors (ARFs) are {approx}20-kDa proteins that act as GTP-dependent allosteric activators of cholera toxin. With deoxyinosine-containing degenerate oligonucleotide primers corresponding to conserved GTP-binding domains in ARFs, the polymerase chain reaction (PCR) was used to amplify simultaneously from human DNA portions of three ARF genes that include codons for 102 amino acids, with intervening sequences. Amplification products that differed in size because of differences in intron sizes were separated by agarose gel electrophoresis. One amplified DNA contained no introns and had a sequence different from those of known AFRs. Based on this sequence, selective oligonucleotide probes were prepared and usedmore » to isolate clone {Psi}ARF 4, a putative ARF pseudogene, from a human genomic library in {lambda} phage EMBL3. Reverse transcription-PCR was then used to clone from human poly(A){sup +} RNA the cDNA corresponding to the expressed homolog of {Psi}ARF 4, referred to as human ARF 4. It appears that {Psi}ARF 4 arose during human evolution by integration of processed ARF 4 mRNA into the genome. Human ARF 4 differs from previously identified mammalian ARFs 1, 2, and 3. Hybridization of ARF 4-specific oligonucleotide probes with human, bovine, and rat RNA revealed a single 1.8-kilobase mRNA, which was clearly distinguished from the 1.9-kilobase mRNA for ARF 1 in these tissues. The PCR provides a powerful tool for investigating diversity in this and other multigene families, especially with primers targeted at domains believed to have functional significance.« less

Identification of the genomic locus for the human Rieske Fe-S Protein gene on Chromosome 19q12

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pennacchio, L.A.

1994-05-06

We have identified the chromosomal location of the human Rieske Iron-Sulfur Protein (UQCRFS1) gene. Mapping by hybridization to a panel of monochromosomal hybrid cell lines indicated that the gene was either on chromosome 19 or 22. By screening a human chromosome 19 specific genomic cosmid library with an oligonucleotide probe made from the published Rieske cDNA sequence, we identified a corresponding cosmid. Portions of this cosmid were sequenced directly. The exon, exon:intron junction, and flanking sequences verified that this cosmid contains the genomic locus. Fluorescent in situ hybridization (FISH) was performed to localize this cosmid to chromosome band 19q12.

Transposon facilitated DNA sequencing

DOE Office of Scientific and Technical Information (OSTI.GOV)

Berg, D.E.; Berg, C.M.; Huang, H.V.

1990-01-01

The purpose of this research is to investigate and develop methods that exploit the power of bacterial transposable elements for large scale DNA sequencing: Our premise is that the use of transposons to put primer binding sites randomly in target DNAs should provide access to all portions of large DNA fragments, without the inefficiencies of methods involving random subcloning and attendant repetitive sequencing, or of sequential synthesis of many oligonucleotide primers that are used to match systematically along a DNA molecule. Two unrelated bacterial transposons, Tn5 and {gamma}{delta}, are being used because they have both proven useful for molecular analyses,more » and because they differ sufficiently in mechanism and specificity of transposition to merit parallel development.« less

VRP09 Reduction of Corneal Scarring Following Blast and Burn Injuries to Cornea Using siRNAs Targeting TGFb and CTGF

DTIC Science & Technology

2013-03-01

oligonucleotide-based drug approaches (better than ribozymes, antisense oligonucleotides ( ASO ), or microRNAs). (4) To accomplish these objectives, we...negative control scrambled ASO (designated NC). The combination of siRNAs T1 and R1 produced a knockdown of ~80% of TGFb1 protein in the conditioned...sequences (antisense oligonucleotides, ASOs ) into rabbit corneal cells and found that technique was very effective in delivering ASOs into the stroma and

Development of novel decoy oligonucleotides: advantages of circular dumb-bell decoy.

PubMed

Tomita, Naruya; Tomita, Tetsuya; Yuyama, Kazuhiko; Tougan, Takahiro; Tajima, Tsuyoshi; Ogihara, Toshio; Morishita, Ryuichi

2003-04-01

The inhibition of specific transcription regulatory proteins is a novel approach to regulate gene expression. The transcriptional activities of DNA binding proteins can be inhibited by the use of double-stranded oligonucleotides (ODNs) that compete for binding to their specific target sequences in promoters and enhancers. Transfection of this cis-element double-stranded ODN, referred to as decoy ODN, has been reported to be a powerful tool that provides a new class of anti-gene strategies to gene therapy and permits examination of specific gene regulation. We have demonstrated the usefulness of this decoy ODN strategy in animal models of restenosis, myocardial infarction, glomerulonephritis and rheumatoid arthritis. However, one of the major limitations of decoy ODN technology is the rapid degradation of phosphodiester ODNs by intracellular nucleases. To date, several different types of double-stranded decoy ODNs have been developed to overcome this issue. Circular dumb-bell (CD) double-stranded decoy ODNs that were developed to resolve this issue have attracted a high level of interest. In this review, the applications of decoy ODN strategy and the advantages of modified CD double-stranded decoy ODNs will be discussed.

Colorimetric Detection of Specific DNA Segments Amplified by Polymerase Chain Reactions

NASA Astrophysics Data System (ADS)

Kemp, David J.; Smith, Donald B.; Foote, Simon J.; Samaras, N.; Peterson, M. Gregory

1989-04-01

The polymerase chain reaction (PCR) procedure has many potential applications in mass screening. We describe here a general assay for colorimetric detection of amplified DNA. The target DNA is first amplified by PCR, and then a second set of oligonucleotides, nested between the first two, is incorporated by three or more PCR cycles. These oligonucleotides bear ligands: for example, one can be biotinylated and the other can contain a site for a double-stranded DNA-binding protein. After linkage to an immobilized affinity reagent (such as a cloned DNA-binding protein, which we describe here) and labeling with a second affinity reagent (for example, avidin) linked to horseradish peroxidase, reaction with a chromogenic substrate allows detection of the amplified DNA. This amplified DNA assay (ADA) is rapid, is readily applicable to mass screening, and uses routine equipment. We show here that it can be used to detect human immunodeficiency virus sequences specifically against a background of human DNA.

Manipulation of oligonucleotides immobilized on solid supports - DNA computations on surfaces

NASA Astrophysics Data System (ADS)

Liu, Qinghua

The manipulation of DNA oligonucleotides immobilized on various solid supports has been studied intensively, especially in the area of surface hybridization. Recently, surface-based biotechnology has been applied to the area of molecular computing. These surface-based methods have advantages with regard to ease of handling, facile purification, and less interference when compared to solution methodologies. This dissertation describes the investigation of molecular approaches to DNA computing. The feasibility of encoding a bit (0 or 1) of information for DNA-based computations at the single nucleotide level was studied, particularly with regard to the efficiency and specificity of hybridization discrimination. Both gold and glass surfaces, with addressed arrays of 32 oligonucleotides, were employed with similar hybridization results. Although single-base discrimination may be achieved in the system, it is at the cost of a severe decrease in the efficiency of hybridization to perfectly matched sequences. This compromises the utility of single nucleotide encoding for DNA computing applications in the absence of some additional mechanism for increasing specificity. Several methods are suggested including a multiple-base encoding strategy. The multiple-base encoding strategy was employed to develop a prototype DNA computer. The approach was demonstrated by solving a small example of the Satisfiability (SAT) problem, an NP-complete problem in Boolean logic. 16 distinct DNA oligonucleotides, encoding all candidate solutions to the 4-variable-4-clause-3-SAT problem, were immobilized on a gold surface in the non-addressed format. Four cycles of MARK (hybridization), DESTROY (enzymatic destruction) and UNMARK (denaturation) were performed, which identified and eliminated members of the set which were not solutions to the problem. Determination of the answer was accomplished in the READOUT (sequence identification) operation by PCR amplification of the remaining molecules and hybridization to an addressed array. Four answers were determined and the S/N ratio between correct and incorrect solutions ranged from 10 to 777, making discrimination between correct and incorrect solutions to the problem straightforward. Additionally, studies of enzymatic manipulations of DNA molecules on surfaces suggested the use of E. coli Exonuclease I (Exo I) and perhaps EarI in the DESTROY operation.

Template-Directed Ligation of Peptides to Oligonucleotides

NASA Technical Reports Server (NTRS)

Bruick, Richard K.; Dawson, Philip E.; Kent, Stephen BH; Usman, Nassim; Joyce, Gerald F.

1996-01-01

Synthetic oligonucleotides and peptides have enjoyed a wide range of applications in both biology and chemistry. As a consequence, oligonucleotide-peptide conjugates have received considerable attention, most notably in the development of antisense constructs with improved pharmacological properties. In addition, oligonucleotide-peptide conjugates have been used as molecular tags, in the assembly of supramolecular arrays and in the construction of encoded combinatorial libraries. To make these chimeric molecules more accessible for a broad range of investigations, we sought to develop a facile method for joining fully deprotected oligonucleotides and peptides through a stable amide bond linkage. Furthermore, we wished to make this ligation reaction addressable, enabling one to direct the ligation of specific oligonucleotide and peptide components.To confer specificity and accelerate the rate of the reaction, the ligation process was designed to be dependent on the presence of a complementary oligonucleotide template.

Secondary structure prediction and structure-specific sequence analysis of single-stranded DNA.

PubMed

Dong, F; Allawi, H T; Anderson, T; Neri, B P; Lyamichev, V I

2001-08-01

DNA sequence analysis by oligonucleotide binding is often affected by interference with the secondary structure of the target DNA. Here we describe an approach that improves DNA secondary structure prediction by combining enzymatic probing of DNA by structure-specific 5'-nucleases with an energy minimization algorithm that utilizes the 5'-nuclease cleavage sites as constraints. The method can identify structural differences between two DNA molecules caused by minor sequence variations such as a single nucleotide mutation. It also demonstrates the existence of long-range interactions between DNA regions separated by >300 nt and the formation of multiple alternative structures by a 244 nt DNA molecule. The differences in the secondary structure of DNA molecules revealed by 5'-nuclease probing were used to design structure-specific probes for mutation discrimination that target the regions of structural, rather than sequence, differences. We also demonstrate the performance of structure-specific 'bridge' probes complementary to non-contiguous regions of the target molecule. The structure-specific probes do not require the high stringency binding conditions necessary for methods based on mismatch formation and permit mutation detection at temperatures from 4 to 37 degrees C. Structure-specific sequence analysis is applied for mutation detection in the Mycobacterium tuberculosis katG gene and for genotyping of the hepatitis C virus.

Conducting electrospun fibres with polyanionic grafts as highly selective, label-free, electrochemical biosensor with a low detection limit for non-Hodgkin lymphoma gene.

PubMed

Kerr-Phillips, Thomas E; Aydemir, Nihan; Chan, Eddie Wai Chi; Barker, David; Malmström, Jenny; Plesse, Cedric; Travas-Sejdic, Jadranka

2018-02-15

A highly selective, label-free sensor for the non-Hodgkin lymphoma gene, with an aM detection limit, utilizing electrochemical impedance spectroscopy (EIS) is presented. The sensor consists of a conducting electrospun fibre mat, surface-grafted with poly(acrylic acid) (PAA) brushes and a conducting polymer sensing element with covalently attached oligonucleotide probes. The sensor was fabricated from electrospun NBR rubber, embedded with poly(3,4-ethylenedioxythiophene) (PEDOT), followed by grafting poly(acrylic acid) brushes and then electrochemically polymerizing a conducting polymer monomer with ssDNA probe sequence pre-attached. The resulting non-Hodgkin lymphoma gene sensor showed a detection limit of 1aM (1 × 10 -18 mol/L), more than 400 folds lower compared to a thin-film analogue. The sensor presented extraordinary selectivity, with only 1%, 2.7% and 4.6% of the signal recorded for the fully non-complimentary, T-A and G-C base mismatch oligonucleotide sequences, respectively. We suggest that such greatly enhanced selectivity is due to the presence of negatively charged carboxylic acid moieties from PAA grafts that electrostatically repel the non-complementary and mismatch DNA sequences, overcoming the non-specific binding. Copyright © 2017 Elsevier B.V. All rights reserved.

Silver ions-mediated conformational switch: facile design of structure-controllable nucleic acid probes.

PubMed

Wang, Yongxiang; Li, Jishan; Wang, Hao; Jin, Jianyu; Liu, Jinhua; Wang, Kemin; Tan, Weihong; Yang, Ronghua

2010-08-01

Conformationally constraint nucleic acid probes were usually designed by forming an intramolecular duplex based on Watson-Crick hydrogen bonds. The disadvantages of these approaches are the inflexibility and instability in complex environment of the Watson-Crick-based duplex. We report that this hydrogen bonding pattern can be replaced by metal-ligation between specific metal ions and the natural bases. To demonstrate the feasibility of this principle, two linear oligonucleotides and silver ions were examined as models for DNA hybridization assay and adenosine triphosphate detection. The both nucleic acids contain target binding sequences in the middle and cytosine (C)-rich sequences at the lateral portions. The strong interaction between Ag(+) ions and cytosines forms stable C-Ag(+)-C structures, which promises the oligonucleotides to form conformationally constraint formations. In the presence of its target, interaction between the loop sequences and the target unfolds the C-Ag(+)-C structures, and the corresponding probes unfolding can be detected by a change in their fluorescence emission. We discuss the thermodynamic and kinetic opportunities that are provided by using Ag(+) ion complexes instead of traditional Watson-Crick-based duplex. In particular, the intrinsic feature of the metal-ligation motif facilitates the design of functional nucleic acids probes by independently varying the concentration of Ag(+) ions in the medium.

A Single Molecular Beacon Probe Is Sufficient for the Analysis of Multiple Nucleic Acid Sequences

PubMed Central

Gerasimova, Yulia V.; Hayson, Aaron; Ballantyne, Jack; Kolpashchikov, Dmitry M.

2010-01-01

Molecular beacon (MB) probes are dual-labeled hairpin-shaped oligodeoxyribonucleotides that are extensively used for real-time detection of specific RNA/DNA analytes. In the MB probe, the loop fragment is complementary to the analyte: therefore, a unique probe is required for the analysis of each new analyte sequence. The conjugation of an oligonucleotide with two dyes and subsequent purification procedures add to the cost of MB probes, thus reducing their application in multiplex formats. Here we demonstrate how one MB probe can be used for the analysis of an arbitrary nucleic acid. The approach takes advantage of two oligonucleotide adaptor strands, each of which contains a fragment complementary to the analyte and a fragment complementary to an MB probe. The presence of the analyte leads to association of MB probe and the two DNA strands in quadripartite complex. The MB probe fluorescently reports the formation of this complex. In this design, the MB does not bind the analyte directly; therefore, the MB sequence is independent of the analyte. In this study one universal MB probe was used to genotype three human polymorphic sites. This approach promises to reduce the cost of multiplex real-time assays and improve the accuracy of single-nucleotide polymorphism genotyping. PMID:20665615

Pre-clinical Safety and Off-Target Studies to Support Translation of AAV-Mediated RNAi Therapy for FSHD.

PubMed

Wallace, Lindsay M; Saad, Nizar Y; Pyne, Nettie K; Fowler, Allison M; Eidahl, Jocelyn O; Domire, Jacqueline S; Griffin, Danielle A; Herman, Adam C; Sahenk, Zarife; Rodino-Klapac, Louise R; Harper, Scott Q

2018-03-16

RNAi emerged as a prospective molecular therapy nearly 15 years ago. Since then, two major RNAi platforms have been under development: oligonucleotides and gene therapy. Oligonucleotide-based approaches have seen more advancement, with some promising therapies that may soon reach market. In contrast, vector-based approaches for RNAi therapy have remained largely in the pre-clinical realm, with limited clinical safety and efficacy data to date. We are developing a gene therapy approach to treat the autosomal-dominant disorder facioscapulohumeral muscular dystrophy. Our strategy involves silencing the myotoxic gene DUX4 using adeno-associated viral vectors to deliver targeted microRNA expression cassettes (miDUX4s). We previously demonstrated proof of concept for this approach in mice, and we are now taking additional steps here to assess safety issues related to miDUX4 overexpression and sequence-specific off-target silencing. In this study, we describe improvements in vector design and expansion of our miDUX4 sequence repertoire and report differential toxicity elicited by two miDUX4 sequences, of which one was toxic and the other was not. This study provides important data to help advance our goal of translating RNAi gene therapy for facioscapulohumeral muscular dystrophy.

Versatile Method for the Site-Specific Modification of DNA with Boron Clusters: Anti-Epidermal Growth Factor Receptor (EGFR) Antisense Oligonucleotide Case.

PubMed

Ebenryter-Olbińska, Katarzyna; Kaniowski, Damian; Sobczak, Milena; Wojtczak, Błażej A; Janczak, Sławomir; Wielgus, Ewelina; Nawrot, Barbara; Leśnikowski, Zbigniew J

2017-11-21

A general and convenient approach for the incorporation of different types of boron clusters into specific locations of the DNA-oligonucleotide chain based on the automated phosphoramidite method of oligonucleotide synthesis and post-synthetic "click chemistry" modification has been developed. Pronounced effects of boron-cluster modification on the physico- and biochemical properties of the antisense oligonucleotides were observed. The silencing activity of antisense oligonucleotides bearing a single boron cluster modification in the middle of the oligonucleotide chain was substantially higher than that of unmodified oligonucleotides. This finding may be of importance for the design of therapeutic nucleic acids with improved properties. The proposed synthetic methodology broadens the availability of nucleic acid-boron cluster conjugates and opens up new avenues for their potential practical use. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Biocompatible artificial DNA linker that is read through by DNA polymerases and is functional in Escherichia coli

PubMed Central

El-Sagheer, Afaf H.; Sanzone, A. Pia; Gao, Rachel; Tavassoli, Ali; Brown, Tom

2011-01-01

A triazole mimic of a DNA phosphodiester linkage has been produced by templated chemical ligation of oligonucleotides functionalized with 5′-azide and 3′-alkyne. The individual azide and alkyne oligonucleotides were synthesized by standard phosphoramidite methods and assembled using a straightforward ligation procedure. This highly efficient chemical equivalent of enzymatic DNA ligation has been used to assemble a 300-mer from three 100-mer oligonucleotides, demonstrating the total chemical synthesis of very long oligonucleotides. The base sequences of the DNA strands containing this artificial linkage were copied during PCR with high fidelity and a gene containing the triazole linker was functional in Escherichia coli. PMID:21709264

Chemistry, mechanism and clinical status of antisense oligonucleotides and duplex RNAs

PubMed Central

Shen, Xiulong; Corey, David R

2018-01-01

Abstract RNA plays a central role in the expression of all genes. Because any sequence within RNA can be recognized by complementary base pairing, synthetic oligonucleotides and oligonucleotide mimics offer a general strategy for controlling processes that affect disease. The two primary antisense approaches for regulating expression through recognition of cellular RNAs are single-stranded antisense oligonucleotides and duplex RNAs. This review will discuss the chemical modifications and molecular mechanisms that make synthetic nucleic acid drugs possible. Lessons learned from recent clinical trials will be summarized. Ongoing clinical trials are likely to decisively test the adequacy of our current generation of antisense nucleic acid technologies and highlight areas where more basic research is needed. PMID:29240946

Specific Inhibition of the transcription factor Ci by a Cobalt(III)-Schiff base-DNA conjugate

PubMed Central

Hurtado, Ryan R.; Harney, Allison S.; Heffern, Marie C.; Holbrook, Robert J.; Holmgren, Robert A.; Meade, Thomas J.

2012-01-01

We describe the use of Co(III) Schiff base-DNA conjugates, a versatile class of research tools that target C2H2 transcription factors, to inhibit the Hedgehog (Hh) pathway. In developing mammalian embryos, Hh signaling is critical for the formation and development of many tissues and organs. Inappropriate activation of the Hedgehog (Hh) pathway has been implicated in a variety of cancers including medulloblastomas and basal cell carcinomas. It is well known that Hh regulates the activity of the Gli family of C2H2 zinc finger transcription factors in mammals. In Drosophila the function of the Gli proteins is performed by a single transcription factor with an identical DNA binding consensus sequence, Cubitus Interruptus (Ci). We have demonstrated previously that conjugation of a specific 17 base-pair oligonucleotide to a Co(III) Schiff base complex results in a targeted inhibitor of the Snail family C2H2 zinc finger transcription factors. Modification of the oligonucleotide sequence in the Co(III) Schiff base-DNA conjugate to that of Ci’s consensus sequence (Co(III)-Ci) generates an equally selective inhibitor of Ci. Co(III)-Ci irreversibly binds the Ci zinc finger domain and prevents it from binding DNA in vitro. In a Ci responsive tissue culture reporter gene assay, Co(III)-Ci reduces the transcriptional activity of Ci in a concentration dependent manner. In addition, injection of wild-type Drosophila embryos with Co(III)-Ci phenocopies a Ci loss of function phenotype, demonstrating effectiveness in vivo. This study provides evidence that Co(III) Schiff base-DNA conjugates are a versatile class of specific and potent tools for studying zinc finger domain proteins and have potential applications as customizable anti-cancer therapeutics. PMID:22214326

Cellular Interactions and Immune Response of Spherical Nucleic Acid (SNA) Nanoconjugates

NASA Astrophysics Data System (ADS)

Massich, Matthew David

Spherical nucleic acid (SNA) nanoconjugates consist of a densely packed monolayer shell of highly-oriented oligonucleotides covalently bound to a gold nanoparticle core. The nanoconjugates exhibit several important qualities, which make them useful for various biological applications, such as antisense gene regulation strategies and the intracellular detection of biomolecules. The focus of this thesis was to characterize the nanoconjugates interaction with cultured cells and specifically the immune response to their intracellular presence. The immune response of macrophage cells to internalized nanoconjugates was studied, and due to the dense functionalization of oligonucleotides on the surface of the nanoparticle and the resulting high localized salt concentration the innate immune response to the nanoconjugates is ˜25-fold less when compared to a lipoplex carrying the same sequence. Additionally, genome-wide expression profiling was used to study the biological response of cultured cells to the nanoconjugates. The biological response of HeLa cells to gold nanoparticles stabilized by weakly bound ligands was significant, yet when these same nanoparticles were stably functionalized with covalently attached oligonucleotides the cells showed no measurable response. In human keratinocytes, the oligonucleotide sequences caused 427 genes to be differentially expressed when complexed with Dharmafect, but when the oligonucleotides were conjugated to nanoparticles only 7 genes were differentially expressed. Beyond characterizing the cellular interactions and immune response of the nanoconjugates, the optimal length of siRNA (from 19--34 base pairs) that induces the most gene knockdown while maintaining limited immune activation was determined to be 24 base pairs. Further, the SNAs were shown to be useful as a potential antiviral gene therapy by demonstrating approximately 50% knockdown of the Ebola VP35 gene. Lastly, a scanning probe-enabled method was used to rapidly create nanoscale fibronectin patterns over large areas with a range of feature sizes, thereby opening the field of nanocombinatorics. This allowed the investigation of the relationship between fibronectin feature size and stem cell fate. MSCs cultured on nanoscale fibronectin features directed differentiation toward osteogenesis to a greater extent than cells grown on both microscale features and cells grown on non-patterned fibronectin substrates with osteogenic inducing media, demonstrating a new method for controlling stem cell fate.

The chemical evolution of oligonucleotide therapies of clinical utility.

PubMed

Khvorova, Anastasia; Watts, Jonathan K

2017-03-01

After nearly 40 years of development, oligonucleotide therapeutics are nearing meaningful clinical productivity. One of the key advantages of oligonucleotide drugs is that their delivery and potency are derived primarily from the chemical structure of the oligonucleotide whereas their target is defined by the base sequence. Thus, as oligonucleotides with a particular chemical design show appropriate distribution and safety profiles for clinical gene silencing in a particular tissue, this will open the door to the rapid development of additional drugs targeting other disease-associated genes in the same tissue. To achieve clinical productivity, the chemical architecture of the oligonucleotide needs to be optimized with a combination of sugar, backbone, nucleobase, and 3'- and 5'-terminal modifications. A portfolio of chemistries can be used to confer drug-like properties onto the oligonucleotide as a whole, with minor chemical changes often translating into major improvements in clinical efficacy. One outstanding challenge in oligonucleotide chemical development is the optimization of chemical architectures to ensure long-term safety. There are multiple designs that enable effective targeting of the liver, but a second challenge is to develop architectures that enable robust clinical efficacy in additional tissues.

The nucleotide sequence of Beneckea harveyi 5S rRNA. [bioluminescent marine bacterium

NASA Technical Reports Server (NTRS)

Luehrsen, K. R.; Fox, G. E.

1981-01-01

The primary sequence of the 5S ribosomal RNA isolated from the free-living bioluminescent marine bacterium Beneckea harveyi is reported and discussed in regard to indications of phylogenetic relationships with the bacteria Escherichia coli and Photobacterium phosphoreum. Sequences were determined for oligonucleotide products generated by digestion with ribonuclease T1, pancreatic ribonuclease and ribonuclease T2. The presence of heterogeneity is indicated for two sites. The B. harveyi sequence can be arranged into the same four helix secondary structures as E. coli and other prokaryotic 5S rRNAs. Examination of the 5S-RNS sequences of the three bacteria indicates that B. harveyi and P. phosphoreum are specifically related and share a common ancestor which diverged from an ancestor of E. coli at a somewhat earlier time, consistent with previous studies.

A bimetallic nanocomposite modified genosensor for recognition and determination of thalassemia gene.

PubMed

Hamidi-Asl, Ezat; Raoof, Jahan Bakhsh; Naghizadeh, Nahid; Akhavan-Niaki, Haleh; Ojani, Reza; Banihashemi, Ali

2016-10-01

The main roles of DNA in the cells are to maintain and properly express genetic information. It is important to have analytical methods capable of fast and sensitive detection of DNA damage. DNA hybridization sensors are well suited for diagnostics and other purposes, including determination of bacteria and viruses. Beta thalassemias (βth) are due to mutations in the β-globin gene. In this study, an electrochemical biosensor which detects the sequences related to the β-globin gene issued from real samples amplified by polymerase chain reaction (PCR) is described for the first time. The biosensor relies on the immobilization of 20-mer single stranded oligonucleotide (probe) related to βth sequence on the carbon paste electrode (CPE) modified by 15% silver (Ag) and platinum (Pt) nanoparticles to prepare the bimetallic nanocomposite electrode and hybridization of this oligonucleotide with its complementary sequence (target). The extent of hybridization between the probe and target sequences was shown by using linear sweep voltammetry (LSV) with methylene blue (MB) as hybridization indicator. The selectivity of sensor was investigated using PCR samples containing non-complementary oligonucleotides. The detection limit of biosensor was calculated about 470.0pg/μL. Copyright © 2016 Elsevier B.V. All rights reserved.

2'-modified nucleosides for site-specific labeling of oligonucleotides

NASA Technical Reports Server (NTRS)

Krider, Elizabeth S.; Miller, Jeremiah E.; Meade, Thomas J.

2002-01-01

We report the synthesis of 2'-modified nucleosides designed specifically for incorporating labels into oligonucleotides. Conversion of these nucleosides to phosphoramidite and solid support-bound derivatives proceeds in good yield. Large-scale synthesis of 11-mer oligonucleotides possessing the 2'-modified nucleosides is achieved using these derivatives. Thermal denaturation studies indicate that the presence of 2'-modified nucleosides in 11-mer duplexes has minimal destabilizing effects on the duplex structure when the nucleosides are placed at the duplex termini. The powerful combination of phosphoramidite and support-bound derivatives of 2'-modified nucleosides affords the large-scale preparation of an entirely new class of oligonucleotides. The ability to synthesize oligonucleotides containing label attachment sites at 3', intervening, and 5' locations of a duplex is a significant advance in the development of oligonucleotide conjugates.

Pressure-Mediated Oligonucleotide Transfection of Rat and Human Cardiovascular Tissues

NASA Astrophysics Data System (ADS)

Mann, Michael J.; Gibbons, Gary H.; Hutchinson, Howard; Poston, Robert S.; Hoyt, E. Grant; Robbins, Robert C.; Dzau, Victor J.

1999-05-01

The application of gene therapy to human disease is currently restricted by the relatively low efficiency and potential hazards of methods of oligonucleotide or gene delivery. Antisense or transcription factor decoy oligonucleotides have been shown to be effective at altering gene expression in cell culture expreriments, but their in vivo application is limited by the efficiency of cellular delivery, the intracellular stability of the compounds, and their duration of activity. We report herein the development of a highly efficient method for naked oligodeoxynucleotide (ODN) transfection into cardiovascular tissues by using controlled, nondistending pressure without the use of viral vectors, lipid formulations, or exposure to other adjunctive, potentially hazardous substances. In this study, we have documented the ability of ex vivo, pressure-mediated transfection to achieve nuclear localization of fluorescent (FITC)-labeled ODN in approximately 90% and 50% of cells in intact human saphenous vein and rat myocardium, respectively. We have further documented that pressure-mediated delivery of antisense ODN can functionally inhibited target gene expression in both of these tissues in a sequence-specific manner at the mRNA and protein levels. This oligonucleotide transfection system may represent a safe means of achieving the intraoperative genetic engineering of failure-resistant human bypass grafts and may provide an avenue for the genetic manipulation of cardiac allograft rejection, allograft vasculopathy, or other transplant diseases.

Sequence-specific "gene signatures" can be obtained by PCR with single specific primers at low stringency.

PubMed Central

Pena, S D; Barreto, G; Vago, A R; De Marco, L; Reinach, F C; Dias Neto, E; Simpson, A J

1994-01-01

Low-stringency single specific primer PCR (LSSP-PCR) is an extremely simple PCR-based technique that detects single or multiple mutations in gene-sized DNA fragments. A purified DNA fragment is subjected to PCR using high concentrations of a single specific oligonucleotide primer, large amounts of Taq polymerase, and a very low annealing temperature. Under these conditions the primer hybridizes specifically to its complementary region and nonspecifically to multiple sites within the fragment, in a sequence-dependent manner, producing a heterogeneous set of reaction products resolvable by electrophoresis. The complex banding pattern obtained is significantly altered by even a single-base change and thus constitutes a unique "gene signature." Therefore LSSP-PCR will have almost unlimited application in all fields of genetics and molecular medicine where rapid and sensitive detection of mutations and sequence variations is important. The usefulness of LSSP-PCR is illustrated by applications in the study of mutants of smooth muscle myosin light chain, analysis of a family with X-linked nephrogenic diabetes insipidus, and identity testing using human mitochondrial DNA. Images PMID:8127912

Synthetic oligonucleotide separations by mixed-mode reversed-phase/weak anion-exchange liquid chromatography.

PubMed

Zimmermann, Aleksandra; Greco, Roberto; Walker, Isabel; Horak, Jeannie; Cavazzini, Alberto; Lämmerhofer, Michael

2014-08-08

Synthetic oligonucleotides gain increasing importance in new therapeutic concepts and as probes in biological sciences. If pharmaceutical-grade purities are required, chromatographic purification using ion-pair reversed-phase chromatography is commonly carried out. However, separation selectivity for structurally closely related impurities is often insufficient, especially at high sample loads. In this study, a "mixed-mode" reversed-phase/weak anion exchanger stationary phase has been investigated as an alternative tool for chromatographic separation of synthetic oligonucleotides with minor sequence variations. The employed mixed-mode phase shows great flexibility in method development. It has been run in various gradient elution modes, viz. one, two or three parameter (mixed) gradients (altering buffer pH, buffer concentration, and organic modifier) to find optimal elution conditions and gain further insight into retention mechanisms. Compared to ion-pair reversed-phase and mere anion-exchange separation, enhanced selectivities were observed with the mixed-mode phase for 20-23 nucleotide (nt) long oligonucleotides with similar sequences. Oligonucleotides differing by 1, 2 or 3 nucleotides in length could be readily resolved and separation factors for single nucleotide replacements declined in the order Cytosine (C)/Guanine (G)>Adenine (A)/Guanine∼Guanine/Thymine (T)>Adenine/Cytosine∼Cytosine/Thymine>Adenine/Thymine. Selectivities were larger when the modification was at the 3' terminal-end, declined when it was in the middle of the sequence and was smallest when it was located at the 5' terminus. Due to the lower surface area of the 200Å pore size mixed-mode stationary phase compared to the corresponding 100Å material, lower retention times with equal selectivities under milder elution conditions were achievable. Considering high sample loading capacities of the mixed-mode anion-exchanger phase, it should have great potential for chromatographic oligonucleotide separation and purification. Copyright © 2014 Elsevier B.V. All rights reserved.

Triple helix purification and sequencing

DOEpatents

Wang, Renfeng; Smith, Lloyd M.; Tong, Xinchun E.

1995-01-01

Disclosed herein are methods, kits, and equipment for purifying single stranded circular DNA and then using the DNA for DNA sequencing purposes. Templates are provided with an insert having a hybridization region. An elongated oligonucleotide has two regions that are complementary to the insert and the oligo is bound to a magnetic anchor. The oligo hybridizes to the insert on two sides to form a stable triple helix complex. The anchor can then be used to drag the template out of solution using a magnet. The system can purify sequencing templates, and if desired the triple helix complex can be opened up to a double helix so that the oligonucleotide will act as a primer for further DNA synthesis.

Triple helix purification and sequencing

DOEpatents

Wang, R.; Smith, L.M.; Tong, X.E.

1995-03-28

Disclosed herein are methods, kits, and equipment for purifying single stranded circular DNA and then using the DNA for DNA sequencing purposes. Templates are provided with an insert having a hybridization region. An elongated oligonucleotide has two regions that are complementary to the insert and the oligo is bound to a magnetic anchor. The oligo hybridizes to the insert on two sides to form a stable triple helix complex. The anchor can then be used to drag the template out of solution using a magnet. The system can purify sequencing templates, and if desired the triple helix complex can be opened up to a double helix so that the oligonucleotide will act as a primer for further DNA synthesis. 4 figures.

Simultaneous detection of genetically modified organisms by multiplex ligation-dependent genome amplification and capillary gel electrophoresis with laser-induced fluorescence.

PubMed

García-Cañas, Virginia; Mondello, Monica; Cifuentes, Alejandro

2010-07-01

In this work, an innovative method useful to simultaneously analyze multiple genetically modified organisms is described. The developed method consists in the combination of multiplex ligation-dependent genome dependent amplification (MLGA) with CGE and LIF detection using bare-fused silica capillaries. The MLGA process is based on oligonucleotide constructs, formed by a universal sequence (vector) and long specific oligonucleotides (selectors) that facilitate the circularization of specific DNA target regions. Subsequently, the circularized target sequences are simultaneously amplified with the same couple of primers and analyzed by CGE-LIF using a bare-fused silica capillary and a run electrolyte containing 2-hydroxyethyl cellulose acting as both sieving matrix and dynamic capillary coating. CGE-LIF is shown to be very useful and informative for optimizing MLGA parameters such as annealing temperature, number of ligation cycles, and selector probes concentration. We demonstrate the specificity of the method in detecting the presence of transgenic DNA in certified reference and raw commercial samples. The method developed is sensitive and allows the simultaneous detection in a single run of percentages of transgenic maize as low as 1% of GA21, 1% of MON863, and 1% of MON810 in maize samples with signal-to-noise ratios for the corresponding DNA peaks of 15, 12, and 26, respectively. These results demonstrate, to our knowledge for the first time, the great possibilities of MLGA techniques for genetically modified organisms analysis.

Sequence-selective binding of C8-conjugated pyrrolobenzodiazepines (PBDs) to DNA.

PubMed

Basher, Mohammad A; Rahman, Khondaker Miraz; Jackson, Paul J M; Thurston, David E; Fox, Keith R

2017-11-01

DNA footprinting and melting experiments have been used to examine the sequence-specific binding of C8-conjugates of pyrrolobenzodiazepines (PBDs) and benzofused rings including benzothiophene and benzofuran, which are attached using pyrrole- or imidazole-containing linkers. The conjugates modulate the covalent attachment points of the PBDs, so that they bind best to guanines flanked by A/T-rich sequences on either the 5'- or 3'-side. The linker affects the binding, and pyrrole produces larger changes than imidazole. Melting studies with 14-mer oligonucleotide duplexes confirm covalent attachment of the conjugates, which show a different selectivity to anthramycin and reveal that more than one ligand molecule can bind to each duplex. Copyright © 2017 Elsevier B.V. All rights reserved.

Surface-enhanced Raman scattering detection of DNA derived from the West Nile virus genome using magnetic capture of Raman-active gold nanoparticles

USDA-ARS?s Scientific Manuscript database

A model paramagnetic nanoparticle (MNP) assay is demonstrated for surface-enhanced Raman scattering (SERS) detection of DNA oligonucleotides derived from the West Nile virus (WNV) genome. Detection is based on the capture of WNV target sequences by hybridization with complementary oligonucleotide pr...

A novel universal DNA labeling and amplification system for rapid microarray-based detection of 117 antibiotic resistance genes in Gram-positive bacteria.

PubMed

Strauss, Christian; Endimiani, Andrea; Perreten, Vincent

2015-01-01

A rapid and simple DNA labeling system has been developed for disposable microarrays and has been validated for the detection of 117 antibiotic resistance genes abundant in Gram-positive bacteria. The DNA was fragmented and amplified using phi-29 polymerase and random primers with linkers. Labeling and further amplification were then performed by classic PCR amplification using biotinylated primers specific for the linkers. The microarray developed by Perreten et al. (Perreten, V., Vorlet-Fawer, L., Slickers, P., Ehricht, R., Kuhnert, P., Frey, J., 2005. Microarray-based detection of 90 antibiotic resistance genes of gram-positive bacteria. J.Clin.Microbiol. 43, 2291-2302.) was improved by additional oligonucleotides. A total of 244 oligonucleotides (26 to 37 nucleotide length and with similar melting temperatures) were spotted on the microarray, including genes conferring resistance to clinically important antibiotic classes like β-lactams, macrolides, aminoglycosides, glycopeptides and tetracyclines. Each antibiotic resistance gene is represented by at least 2 oligonucleotides designed from consensus sequences of gene families. The specificity of the oligonucleotides and the quality of the amplification and labeling were verified by analysis of a collection of 65 strains belonging to 24 species. Association between genotype and phenotype was verified for 6 antibiotics using 77 Staphylococcus strains belonging to different species and revealed 95% test specificity and a 93% predictive value of a positive test. The DNA labeling and amplification is independent of the species and of the target genes and could be used for different types of microarrays. This system has also the advantage to detect several genes within one bacterium at once, like in Staphylococcus aureus strain BM3318, in which up to 15 genes were detected. This new microarray-based detection system offers a large potential for applications in clinical diagnostic, basic research, food safety and surveillance programs for antimicrobial resistance. Copyright © 2014 Elsevier B.V. All rights reserved.

DNA assembly with error correction on a droplet digital microfluidics platform.

PubMed

Khilko, Yuliya; Weyman, Philip D; Glass, John I; Adams, Mark D; McNeil, Melanie A; Griffin, Peter B

2018-06-01

Custom synthesized DNA is in high demand for synthetic biology applications. However, current technologies to produce these sequences using assembly from DNA oligonucleotides are costly and labor-intensive. The automation and reduced sample volumes afforded by microfluidic technologies could significantly decrease materials and labor costs associated with DNA synthesis. The purpose of this study was to develop a gene assembly protocol utilizing a digital microfluidic device. Toward this goal, we adapted bench-scale oligonucleotide assembly methods followed by enzymatic error correction to the Mondrian™ digital microfluidic platform. We optimized Gibson assembly, polymerase chain reaction (PCR), and enzymatic error correction reactions in a single protocol to assemble 12 oligonucleotides into a 339-bp double- stranded DNA sequence encoding part of the human influenza virus hemagglutinin (HA) gene. The reactions were scaled down to 0.6-1.2 μL. Initial microfluidic assembly methods were successful and had an error frequency of approximately 4 errors/kb with errors originating from the original oligonucleotide synthesis. Relative to conventional benchtop procedures, PCR optimization required additional amounts of MgCl 2 , Phusion polymerase, and PEG 8000 to achieve amplification of the assembly and error correction products. After one round of error correction, error frequency was reduced to an average of 1.8 errors kb - 1 . We demonstrated that DNA assembly from oligonucleotides and error correction could be completely automated on a digital microfluidic (DMF) platform. The results demonstrate that enzymatic reactions in droplets show a strong dependence on surface interactions, and successful on-chip implementation required supplementation with surfactants, molecular crowding agents, and an excess of enzyme. Enzymatic error correction of assembled fragments improved sequence fidelity by 2-fold, which was a significant improvement but somewhat lower than expected compared to bench-top assays, suggesting an additional capacity for optimization.

[A new human leukocyte antigen class I allele, HLA- B*52:11].

PubMed

Li, Xiao-feng; Zhang, Xu; Zhang, Kun-lian; Chen, Yang; Liu, Xian-zhi; Li, Jian-ping

2011-12-01

To identify and confirm a novel HLA allele. A new human leukocyte antigen class I allele was found during routine HLA genotyping by polymerase chain reaction-sequence specific oligonucleotide probes (PCR-SSOP) and sequencing-based typing (SBT). The novel HLA-B*52 allele was identical to B*52:01:01 with an exception of one base substitution at position 583 of exon 3 where a C was changed to T resulting in codon 195 changed from CAC(H) to TAC(Y). A new HLA class I allele, B*52:11, is identified, and is named officially by the WHO Nomenclature Committee.

Horse cDNA clones encoding two MHC class I genes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Barbis, D.P.; Maher, J.K.; Stanek, J.

1994-12-31

Two full-length clones encoding MHC class I genes were isolated by screening a horse cDNA library, using a probe encoding in human HLA-A2.2Y allele. The library was made in the pcDNA1 vector (Invitrogen, San Diego, CA), using mRNA from peripheral blood lymphocytes obtained from a Thoroughbred stallion (No. 0834) homozygous for a common horse MHC haplotype (ELA-A2, -B2, -D2; Antczak et al. 1984; Donaldson et al. 1988). The clones were sequenced, using SP6 and T7 universal primers and horse-specific oligonucleotides designed to extend previously determined sequences.

Histoimmunogenetics Markup Language 1.0: Reporting next generation sequencing-based HLA and KIR genotyping.

PubMed

Milius, Robert P; Heuer, Michael; Valiga, Daniel; Doroschak, Kathryn J; Kennedy, Caleb J; Bolon, Yung-Tsi; Schneider, Joel; Pollack, Jane; Kim, Hwa Ran; Cereb, Nezih; Hollenbach, Jill A; Mack, Steven J; Maiers, Martin

2015-12-01

We present an electronic format for exchanging data for HLA and KIR genotyping with extensions for next-generation sequencing (NGS). This format addresses NGS data exchange by refining the Histoimmunogenetics Markup Language (HML) to conform to the proposed Minimum Information for Reporting Immunogenomic NGS Genotyping (MIRING) reporting guidelines (miring.immunogenomics.org). Our refinements of HML include two major additions. First, NGS is supported by new XML structures to capture additional NGS data and metadata required to produce a genotyping result, including analysis-dependent (dynamic) and method-dependent (static) components. A full genotype, consensus sequence, and the surrounding metadata are included directly, while the raw sequence reads and platform documentation are externally referenced. Second, genotype ambiguity is fully represented by integrating Genotype List Strings, which use a hierarchical set of delimiters to represent allele and genotype ambiguity in a complete and accurate fashion. HML also continues to enable the transmission of legacy methods (e.g. site-specific oligonucleotide, sequence-specific priming, and Sequence Based Typing (SBT)), adding features such as allowing multiple group-specific sequencing primers, and fully leveraging techniques that combine multiple methods to obtain a single result, such as SBT integrated with NGS. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.

[Oligonucleotide derivatives in the nucleic acid hybridization analysis. III. Synthesis and investigation of properties of oligonucleotides, bearing bifunctional non-nucleotide insert].

PubMed

Kupriushkin, M S; Pyshnyĭ, D V

2012-01-01

Non-nucleotide phosporamidites were synthetized, having branched backbone with different position of functional groups. Obtained phosphoramidite monomers contain intercalator moiety--6-chloro-2-methoxyacridine, and additional hydroxyl residue protected with dimethoxytrityl group or with tert-butyldimethylsilyl group for post-synthetic modification. Synthesized oligothymidilates contain one or more modified units in different positions of sequence. Melting temperature and thermodynamic parameters of formation of complementary duplexes formed by modified oligonucleotides was defined (change in enthalpy and entropy). The introduction of intercalating residue causes a significant stabilization of DNA duplexes. It is shown that the efficiency of the fluorescence of acridine residue in the oligonucleotide conjugate significantly changes upon hybridization with DNA.

RNA-Catalyzed RNA Ligation on an External RNA Template

NASA Technical Reports Server (NTRS)

McGinness, Kathleen E.; Joyce, Gerald F.

2002-01-01

Variants of the hc ligase ribozyme, which catalyzes ligation of the 3' end of an RNA substrate to the 5' end of the ribozyme, were utilized to evolve a ribozyme that catalyzes ligation reactions on an external RNA template. The evolved ribozyme catalyzes the joining of an oligonucleotide 3'-hydroxyl to the 5'-triphosphate of an RNA hairpin molecule. The ribozyme can also utilize various substrate sequences, demonstrating a largely sequence-independent mechanism for substrate recognition. The ribozyme also carries out the ligation of two oligonucleotides that are bound at adjacent positions on a complementary template. Finally, it catalyzes addition of mononucleoside '5-triphosphates onto the '3 end of an oligonucleotide primer in a template-dependent manner. The development of ribozymes that catalyze polymerase-type reactions contributes to the notion that an RNA world could have existed during the early history of life on Earth.

Digital transcriptome profiling using selective hexamer priming for cDNA synthesis.

PubMed

Armour, Christopher D; Castle, John C; Chen, Ronghua; Babak, Tomas; Loerch, Patrick; Jackson, Stuart; Shah, Jyoti K; Dey, John; Rohl, Carol A; Johnson, Jason M; Raymond, Christopher K

2009-09-01

We developed a procedure for the preparation of whole transcriptome cDNA libraries depleted of ribosomal RNA from only 1 microg of total RNA. The method relies on a collection of short, computationally selected oligonucleotides, called 'not-so-random' (NSR) primers, to obtain full-length, strand-specific representation of nonribosomal RNA transcripts. In this study we validated the technique by profiling human whole brain and universal human reference RNA using ultra-high-throughput sequencing.

Anaerobic degradation of cyclohexane by sulfate-reducing bacteria from hydrocarbon-contaminated marine sediments.

PubMed

Jaekel, Ulrike; Zedelius, Johannes; Wilkes, Heinz; Musat, Florin

2015-01-01

The fate of cyclohexane, often used as a model compound for the biodegradation of cyclic alkanes due to its abundance in crude oils, in anoxic marine sediments has been poorly investigated. In the present study, we obtained an enrichment culture of cyclohexane-degrading sulfate-reducing bacteria from hydrocarbon-contaminated intertidal marine sediments. Microscopic analyses showed an apparent dominance by oval cells of 1.5 × 0.8 μm. Analysis of a 16S rRNA gene library, followed by whole-cell hybridization with group- and sequence-specific oligonucleotide probes showed that these cells belonged to a single phylotype, and were accounting for more than 80% of the total cell number. The dominant phylotype, affiliated with the Desulfosarcina-Desulfococcus cluster of the Deltaproteobacteria, is proposed to be responsible for the degradation of cyclohexane. Quantitative growth experiments showed that cyclohexane degradation was coupled with the stoichiometric reduction of sulfate to sulfide. Substrate response tests corroborated with hybridization with a sequence-specific oligonucleotide probe suggested that the dominant phylotype apparently was able to degrade other cyclic and n-alkanes, including the gaseous alkane n-butane. Based on GC-MS analyses of culture extracts cyclohexylsuccinate was identified as a metabolite, indicating an activation of cyclohexane by addition to fumarate. Other metabolites detected were 3-cyclohexylpropionate and cyclohexanecarboxylate providing evidence that the overall degradation pathway of cyclohexane under anoxic conditions is analogous to that of n-alkanes.

Differentiation of the seven major lyssavirus species by oligonucleotide microarray.

PubMed

Xi, Jin; Guo, Huancheng; Feng, Ye; Xu, Yunbin; Shao, Mingfu; Su, Nan; Wan, Jiayu; Li, Jiping; Tu, Changchun

2012-03-01

An oligonucleotide microarray, LyssaChip, has been developed and verified as a highly specific diagnostic tool for differentiation of the 7 major lyssavirus species. As with conventional typing microarray methods, the LyssaChip relies on sequence differences in the 371-nucleotide region coding for the nucleoprotein. This region was amplified using nested reverse transcription-PCR primers that bind to the 7 major lyssaviruses. The LyssaChip includes 57 pairs of species typing and corresponding control oligonucleotide probes (oligoprobes) immobilized on glass slides, and it can analyze 12 samples on a single slide within 8 h. Analysis of 111 clinical brain specimens (65 from animals with suspected rabies submitted to the laboratory and 46 of butchered dog brain tissues collected from restaurants) showed that the chip method was 100% sensitive and highly consistent with the "gold standard," a fluorescent antibody test (FAT). The chip method could detect rabies virus in highly decayed brain tissues, whereas the FAT did not, and therefore the chip test may be more applicable to highly decayed brain tissues than the FAT. LyssaChip may provide a convenient and inexpensive alternative for diagnosis and differentiation of rabies and rabies-related diseases.

Effects of non-CpG site methylation on DNA thermal stability: a fluorescence study

PubMed Central

Nardo, Luca; Lamperti, Marco; Salerno, Domenico; Cassina, Valeria; Missana, Natalia; Bondani, Maria; Tempestini, Alessia; Mantegazza, Francesco

2015-01-01

Cytosine methylation is a widespread epigenetic regulation mechanism. In healthy mature cells, methylation occurs at CpG dinucleotides within promoters, where it primarily silences gene expression by modifying the binding affinity of transcription factors to the promoters. Conversely, a recent study showed that in stem cells and cancer cell precursors, methylation also occurs at non-CpG pairs and involves introns and even gene bodies. The epigenetic role of such methylations and the molecular mechanisms by which they induce gene regulation remain elusive. The topology of both physiological and aberrant non-CpG methylation patterns still has to be detailed and could be revealed by using the differential stability of the duplexes formed between site-specific oligonucleotide probes and the corresponding methylated regions of genomic DNA. Here, we present a systematic study of the thermal stability of a DNA oligonucleotide sequence as a function of the number and position of non-CpG methylation sites. The melting temperatures were determined by monitoring the fluorescence of donor-acceptor dual-labelled oligonucleotides at various temperatures. An empirical model that estimates the methylation-induced variations in the standard values of hybridization entropy and enthalpy was developed. PMID:26354864

Quantification of Functionalised Gold Nanoparticle-Targeted Knockdown of Gene Expression in HeLa Cells

PubMed Central

Jiwaji, Meesbah; Sandison, Mairi E.; Reboud, Julien; Stevenson, Ross; Daly, Rónán; Barkess, Gráinne; Faulds, Karen; Kolch, Walter; Graham, Duncan; Girolami, Mark A.; Cooper, Jonathan M.; Pitt, Andrew R.

2014-01-01

Introduction Gene therapy continues to grow as an important area of research, primarily because of its potential in the treatment of disease. One significant area where there is a need for better understanding is in improving the efficiency of oligonucleotide delivery to the cell and indeed, following delivery, the characterization of the effects on the cell. Methods In this report, we compare different transfection reagents as delivery vehicles for gold nanoparticles functionalized with DNA oligonucleotides, and quantify their relative transfection efficiencies. The inhibitory properties of small interfering RNA (siRNA), single-stranded RNA (ssRNA) and single-stranded DNA (ssDNA) sequences targeted to human metallothionein hMT-IIa are also quantified in HeLa cells. Techniques used in this study include fluorescence and confocal microscopy, qPCR and Western analysis. Findings We show that the use of transfection reagents does significantly increase nanoparticle transfection efficiencies. Furthermore, siRNA, ssRNA and ssDNA sequences all have comparable inhibitory properties to ssDNA sequences immobilized onto gold nanoparticles. We also show that functionalized gold nanoparticles can co-localize with autophagosomes and illustrate other factors that can affect data collection and interpretation when performing studies with functionalized nanoparticles. Conclusions The desired outcome for biological knockdown studies is the efficient reduction of a specific target; which we demonstrate by using ssDNA inhibitory sequences targeted to human metallothionein IIa gene transcripts that result in the knockdown of both the mRNA transcript and the target protein. PMID:24926959

Telomerase Responsive Delivery of Doxorubicin from Mesoporous Silica Nanoparticles in Multiple Malignancies: Therapeutic Efficacies against Experimental Aggressive Murine Lymphoma.

PubMed

Srivastava, Prateek; Hira, Sumit Kumar; Sharma, Amod; Kashif, Mohammad; Srivastava, Prashant; Srivastava, Divesh N Narayan; Singh, Ram Adhar; Manna, Partha Pratim

2018-05-25

Mammalian telomerase maintain the length and integrity of telomeres by adding the telomeric repeats to chromosome end. This work describes the telomerase responsive delivery of doxorubicin against telomerase positive human and murine cancer cells. Wrapping of doxorubicin loaded mesoporous silica nanoparticles with specific oligonucleotide sequence, containing telomeric repeat complementary sequence and a telomerase substrate primer sequence resulted slow and sustained release of doxorubicin, contiguous to the tumor cells. The DNA wrapped nano probe significantly inhibit the proliferation and enhanced the cytotoxicity in telomerase positive human and mouse tumor cells, and its function is impeded following exposure to specific telomerase inhibitor, AZT. Entrapping of doxorubicin by telomerase specific oligo, manifests enhanced apoptosis and significantly higher uptake of the drug in the tumor cells. Treatment of telomerase positive Dalton's lymphoma bearing mice with a novel and newly designed oligo wrapped nano probe, specific for mouse telomerase, significantly enhanced the survival and improved the histopathological parameters. In addition, the treatment also induced significant reduction in the number of tumor foci and restored the normal architecture of the vascularised organs, besides preventing metastasis.

Label-free detection of DNA hybridization using carbon nanotube network field-effect transistors

NASA Astrophysics Data System (ADS)

Star, Alexander; Tu, Eugene; Niemann, Joseph; Gabriel, Jean-Christophe P.; Joiner, C. Steve; Valcke, Christian

2006-01-01

We report carbon nanotube network field-effect transistors (NTNFETs) that function as selective detectors of DNA immobilization and hybridization. NTNFETs with immobilized synthetic oligonucleotides have been shown to specifically recognize target DNA sequences, including H63D single-nucleotide polymorphism (SNP) discrimination in the HFE gene, responsible for hereditary hemochromatosis. The electronic responses of NTNFETs upon single-stranded DNA immobilization and subsequent DNA hybridization events were confirmed by using fluorescence-labeled oligonucleotides and then were further explored for label-free DNA detection at picomolar to micromolar concentrations. We have also observed a strong effect of DNA counterions on the electronic response, thus suggesting a charge-based mechanism of DNA detection using NTNFET devices. Implementation of label-free electronic detection assays using NTNFETs constitutes an important step toward low-cost, low-complexity, highly sensitive and accurate molecular diagnostics. hemochromatosis | SNP | biosensor

Merlin: Computer-Aided Oligonucleotide Design for Large Scale Genome Engineering with MAGE.

PubMed

Quintin, Michael; Ma, Natalie J; Ahmed, Samir; Bhatia, Swapnil; Lewis, Aaron; Isaacs, Farren J; Densmore, Douglas

2016-06-17

Genome engineering technologies now enable precise manipulation of organism genotype, but can be limited in scalability by their design requirements. Here we describe Merlin ( http://merlincad.org ), an open-source web-based tool to assist biologists in designing experiments using multiplex automated genome engineering (MAGE). Merlin provides methods to generate pools of single-stranded DNA oligonucleotides (oligos) for MAGE experiments by performing free energy calculation and BLAST scoring on a sliding window spanning the targeted site. These oligos are designed not only to improve recombination efficiency, but also to minimize off-target interactions. The application further assists experiment planning by reporting predicted allelic replacement rates after multiple MAGE cycles, and enables rapid result validation by generating primer sequences for multiplexed allele-specific colony PCR. Here we describe the Merlin oligo and primer design procedures and validate their functionality compared to OptMAGE by eliminating seven AvrII restriction sites from the Escherichia coli genome.

[Research progress of probe design software of oligonucleotide microarrays].

PubMed

Chen, Xi; Wu, Zaoquan; Liu, Zhengchun

2014-02-01

DNA microarray has become an essential medical genetic diagnostic tool for its high-throughput, miniaturization and automation. The design and selection of oligonucleotide probes are critical for preparing gene chips with high quality. Several sets of probe design software have been developed and are available to perform this work now. Every set of the software aims to different target sequences and shows different advantages and limitations. In this article, the research and development of these sets of software are reviewed in line with three main criteria, including specificity, sensitivity and melting temperature (Tm). In addition, based on the experimental results from literatures, these sets of software are classified according to their applications. This review will be helpful for users to choose an appropriate probe-design software. It will also reduce the costs of microarrays, improve the application efficiency of microarrays, and promote both the research and development (R&D) and commercialization of high-performance probe design software.

DNA cross-linking by dehydromonocrotaline lacks apparent base sequence preference.

PubMed

Rieben, W Kurt; Coulombe, Roger A

2004-12-01

Pyrrolizidine alkaloids (PAs) are ubiquitous plant toxins, many of which, upon oxidation by hepatic mixed-function oxidases, become reactive bifunctional pyrrolic electrophiles that form DNA-DNA and DNA-protein cross-links. The anti-mitotic, toxic, and carcinogenic action of PAs is thought to be caused, at least in part, by these cross-links. We wished to determine whether the activated PA pyrrole dehydromonocrotaline (DHMO) exhibits base sequence preferences when cross-linked to a set of model duplex poly A-T 14-mer oligonucleotides with varying internal and/or end 5'-d(CG), 5'-d(GC), 5'-d(TA), 5'-d(CGCG), or 5'-d(GCGC) sequences. DHMO-DNA cross-links were assessed by electrophoretic mobility shift assay (EMSA) of 32P endlabeled oligonucleotides and by HPLC analysis of cross-linked DNAs enzymatically digested to their constituent deoxynucleosides. The degree of DNA cross-links depended upon the concentration of the pyrrole, but not on the base sequence of the oligonucleotide target. Likewise, HPLC chromatograms of cross-linked and digested DNAs showed no discernible sequence preference for any nucleotide. Added glutathione, tyrosine, cysteine, and aspartic acid, but not phenylalanine, threonine, serine, lysine, or methionine competed with DNA as alternate nucleophiles for cross-linking by DHMO. From these data it appears that DHMO exhibits no strong base preference when forming cross-links with DNA, and that some cellular nucleophiles can inhibit DNA cross-link formation.

An improved divergent synthesis of comb-type branched oligodeoxyribonucleotides (bDNA) containing multiple secondary sequences.

PubMed

Horn, T; Chang, C A; Urdea, M S

1997-12-01

The divergent synthesis of branched DNA (bDNA) comb structures is described. This new type of bDNA contains one unique oligonucleotide, the primary sequence, covalently attached through a comb-like branch network to many identical copies of a different oligonucleotide, the secondary sequence. The bDNA comb structures were assembled on a solid support and several synthesis parameters were investigated and optimized. The bDNA comb molecules were characterized by polyacrylamide gel electrophoretic methods and by controlled cleavage at periodate-cleavable moieties incorporated during synthesis. The developed chemistry allows synthesis of bDNA comb molecules containing multiple secondary sequences. In the accompanying article we describe the synthesis and characterization of large bDNA combs containing all four deoxynucleotides for use as signal amplifiers in nucleic acid quantification assays.

An improved divergent synthesis of comb-type branched oligodeoxyribonucleotides (bDNA) containing multiple secondary sequences.

PubMed Central

Horn, T; Chang, C A; Urdea, M S

1997-01-01

The divergent synthesis of branched DNA (bDNA) comb structures is described. This new type of bDNA contains one unique oligonucleotide, the primary sequence, covalently attached through a comb-like branch network to many identical copies of a different oligonucleotide, the secondary sequence. The bDNA comb structures were assembled on a solid support and several synthesis parameters were investigated and optimized. The bDNA comb molecules were characterized by polyacrylamide gel electrophoretic methods and by controlled cleavage at periodate-cleavable moieties incorporated during synthesis. The developed chemistry allows synthesis of bDNA comb molecules containing multiple secondary sequences. In the accompanying article we describe the synthesis and characterization of large bDNA combs containing all four deoxynucleotides for use as signal amplifiers in nucleic acid quantification assays. PMID:9365265

Selective Inhibition of the Human tie-1 Promoter with Triplex-Forming Oligonucleotides Targeted to Ets Binding Sites

PubMed Central

Hewett, Peter W; Daft, Emma L; Laughton, Charles A; Ahmad, Shakil; Ahmed, Asif; Murray, J Clifford

2006-01-01

The Tie receptors (Tie-1 and Tie-2/Tek) are essential for angiogenesis and vascular remodeling/integrity. Tie receptors are up-regulated in tumor-associated endothelium, and their inhibition disrupts angiogenesis and can prevent tumor growth as a consequence. To investigate the potential of anti-gene approaches to inhibit tie gene expression for anti-angiogenic therapy, we have examined triple-helical (triplex) DNA formation at 2 tandem Ets transcription factor binding motifs (designated E-1 and E-2) in the human tie-1 promoter. Various tie-1 promoter deletion/mutation luciferase reporter constructs were generated and transfected into endothelial cells to examine the relative activities of E-1 and E-2. The binding of antiparallel and parallel (control) purine motif oligonucleotides (21–22 bp) targeted to E-1 and E-2 was assessed by plasmid DNA fragment binding and electrophoretic mobility shift assays. Triplex-forming oligonucleotides were incubated with tie-1 reporter constructs and transfected into endothelial cells to determine their activity. The Ets binding motifs in the E-1 sequence were essential for human tie-1 promoter activity in endothelial cells, whereas the deletion of E-2 had no effect. Antiparallel purine motif oligonucleotides targeted at E-1 or E-2 selectively formed strong triplex DNA (Kd ~10−7 M) at 37 °C. Transfection of tie-1 reporter constructs with triplex DNA at E-1, but not E-2, specifically inhibited tie-1 promoter activity by up to 75% compared with control oligonucleotides in endothelial cells. As similar multiple Ets binding sites are important for the regulation of several endothelial-restricted genes, this approach may have broad therapeutic potential for cancer and other pathologies involving endothelial proliferation/dysfunction. PMID:16838069

Selective inhibition of the human tie-1 promoter with triplex-forming oligonucleotides targeted to Ets binding sites.

PubMed

Hewett, Peter W; Daft, Emma L; Laughton, Charles A; Ahmad, Shakil; Ahmed, Asif; Murray, J Clifford

2006-01-01

The Tie receptors (Tie-1 and Tie-2/Tek) are essential for angiogenesis and vascular remodeling/integrity. Tie receptors are up-regulated in tumor-associated endothelium, and their inhibition disrupts angiogenesis and can prevent tumor growth as a consequence. To investigate the potential of anti-gene approaches to inhibit tie gene expression for anti-angiogenic therapy, we have examined triple-helical (triplex) DNA formation at 2 tandem Ets transcription factor binding motifs (designated E-1 and E-2) in the human tie-1 promoter. Various tie-1 promoter deletion/mutation luciferase reporter constructs were generated and transfected into endothelial cells to examine the relative activities of E-1 and E-2. The binding of antiparallel and parallel (control) purine motif oligonucleotides (21-22 bp) targeted to E-1 and E-2 was assessed by plasmid DNA fragment binding and electrophoretic mobility shift assays. Triplex-forming oligonucleotides were incubated with tie-1 reporter constructs and transfected into endothelial cells to determine their activity. The Ets binding motifs in the E-1 sequence were essential for human tie-1 promoter activity in endothelial cells, whereas the deletion of E-2 had no effect. Antiparallel purine motif oligonucleotides targeted at E-1 or E-2 selectively formed strong triplex DNA (K(d) approximately 10(-7) M) at 37 degrees C. Transfection of tie-1 reporter constructs with triplex DNA at E-1, but not E-2, specifically inhibited tie-1 promoter activity by up to 75% compared with control oligonucleotides in endothelial cells. As similar multiple Ets binding sites are important for the regulation of several endothelial-restricted genes, this approach may have broad therapeutic potential for cancer and other pathologies involving endothelial proliferation/dysfunction.

[Study toward practical use of oligonucleotide therapeutics].

PubMed

Inoue, Takao; Yoshida, Tokuyuki

2014-01-01

Over the past decade, oligonucleotide-based therapeutics such as antisense oligonucleotides and small interfering RNAs (siRNAs) have been developed extensively. For example, mipomersen (Kynamro; ISIS Pharmaceuticals), which is a second-generation antisense oligonucleotide administered by subcutaneous injection, has recently been approved by the FDA for the treatment of homozygous familial hypercholesterolemia. On the other hands, methods for the evaluation of quality, efficacy and safety of oligonucleotide therapeutics have not been fully discussed. Furthermore, the regulatory guidance specific for oligonucleotide therapeutics has not been established yet. Under these circumstances, we started to collaborate with Osaka University and PMDA to discuss regulatory science focused on oligonucleotide therapeutics. Through the collaboration, we would like to propose the possible design of quality evaluation and preclinical safety-evaluation of oligonucleotide therapeutics.

Detection of human papillomavirus (HPV) DNA in human prostatic tissues by polymerase chain reaction (PCR).

PubMed

Sarkar, F H; Sakr, W A; Li, Y W; Sreepathi, P; Crissman, J D

1993-01-01

Human papillomavirus (HPV) infections are strongly linked to the pathogenesis of uterine cervical neoplasms, and have been implicated in other cancers of the female genital tract. In contrast, the association of HPV with the cancers of the male urogenital tract is less evident, except in anal and penile cancers. However, recent studies reporting the prevalence of HPV infections in human prostate cancers (60-100% HPV 16 positive vs. no infection of HPV) have raised controversies regarding the prevalence of HPV in benign and neoplastic human prostate. We investigated the prevalence of HPV infections in prostatic intraepithelial neoplasia (PIN) and prostatic adenocarcinomas in 23 surgically resected prostates. Polymerase chain reaction (PCR) was used to amplify HPV 6b/11, 16, and 18 specific DNA sequences, using type specific HPV primers selected from the transforming gene E6-E7. The areas of PIN and cancer in 6 microns H&E stained tissue sections were identified, and respective areas of PIN and cancer were isolated from the adjacent serial sections and used for DNA amplification and HPV detection (Fig. 1). Our results demonstrated the presence of HPV 16 in three carcinomas (13%), using type specific primers in PCR amplified samples. We were not able to demonstrate the presence of other HPV types (HPV 6b/11 or HPV 18) in any of the samples using specific primers. Two of these prostates showed relatively strong positive signals by dot blot analysis, when hybridized with a 32P-labeled HPV 16 type specific oligonucleotide probe. One more sample showed weak positivity, when hybridized with a 32P-labeled HPV 16 type specific oligonucleotide probe. Subsequently, we have confirmed these results by Southern hybridization of the samples transferred to nylon membrane after agarose gel electrophoresis and detected by HPV 16 type specific oligonucleotide probe, using chemiluminescent assay. We, therefore, conclude that HPV infections of the prostate in general are not as common as has been previously claimed by other investigators.

DMTB: the magnetotactic bacteria database

NASA Astrophysics Data System (ADS)

Pan, Y.; Lin, W.

2012-12-01

Magnetotactic bacteria (MTB) are of interest in biogeomagnetism, rock magnetism, microbiology, biomineralization, and advanced magnetic materials because of their ability to synthesize highly ordered intracellular nano-sized magnetic minerals, magnetite or greigite. Great strides for MTB studies have been made in the past few decades. More than 600 articles concerning MTB have been published. These rapidly growing data are stimulating cross disciplinary studies in such field as biogeomagnetism. We have compiled the first online database for MTB, i.e., Database of Magnestotactic Bacteria (DMTB, http://database.biomnsl.com). It contains useful information of 16S rRNA gene sequences, oligonucleotides, and magnetic properties of MTB, and corresponding ecological metadata of sampling sites. The 16S rRNA gene sequences are collected from the GenBank database, while all other data are collected from the scientific literature. Rock magnetic properties for both uncultivated and cultivated MTB species are also included. In the DMTB database, data are accessible through four main interfaces: Site Sort, Phylo Sort, Oligonucleotides, and Magnetic Properties. References in each entry serve as links to specific pages within public databases. The online comprehensive DMTB will provide a very useful data resource for researchers from various disciplines, e.g., microbiology, rock magnetism and paleomagnetism, biogeomagnetism, magnetic material sciences and others.

Oligonucleotide-stabilized fluorescent silver nanoclusters for the specific and sensitive detection of biotin.

PubMed

Xiong, Xiaoli; Tang, Yan; Zhao, Jingjin; Zhao, Shulin

2016-02-21

A novel biotin fluorescent probe based on oligonucleotide-stabilized silver nanoclusters (DNA-AgNCs) was synthesized by employing a biotinylated cytosine-rich sequence as a synthesized template. The fluorescence properties of the DNA-AgNCs are related to the modified position of the DNA. When biotin is linked to the middle thymine base of the DNA sequence, the DNA-AgNCs emit the strongest fluorescence. Moreover, the stability of the DNA-AgNCs was affected by avidin through biotin-avidin binding, quenching the fluorescence of the DNA-AgNCs. In contrast, if free biotin is further introduced into this system, the quenching is apparently weakened by competition, leading to the restoration of fluorescence. This phenomenon can be utilized for the detection of biotin. Under the optimal conditions, the fluorescence recovery is linearly proportional to the concentration of biotin in the range of 10 nM-1.0 μM with a detection limit of 6.0 nM. This DNA-AgNCs probe with excellent fluorescent properties is sensitive and selective for the detection of biotin and has been applied for the determination of biotin in wheat flour.

Nucleic acid amplification using modular branched primers

DOEpatents

Ulanovsky, Levy; Raja, Mugasimangalam C.

2001-01-01

Methods and compositions expand the options for making primers for use in amplifying nucleic acid segments. The invention eliminates the step of custom synthesis of primers for Polymerase Chain Reactions (PCR). Instead of being custom-synthesized, a primer is replaced by a combination of several oligonucleotide modules selected from a pre-synthesized library. A modular combination of just a few oligonucleotides essentially mimics the performance of a conventional, custom-made primer by matching the sequence of the priming site in the template. Each oligonucleotide module has a segment that matches one of the stretches within the priming site.

Development of the Large-Scale Oligonucleotide Chip for the Diagnosis of Plant Viruses and its Practical Use

PubMed Central

Nam, Moon; Kim, Jeong-Seon; Lim, Seungmo; Park, Chung Youl; Kim, Jeong-Gyu; Choi, Hong-Soo; Lim, Hyoun-Sub; Moon, Jae Sun; Lee, Su-Heon

2014-01-01

A large-scale oligonucleotide (LSON) chip was developed for the detection of the plant viruses with known genetic information. The LSON chip contains two sets of 3,978 probes for 538 species of targets including plant viruses, satellite RNAs and viroids. A hundred forty thousand probes, consisting of isolate-, species- and genus-specific probes respectively, are designed from 20,000 of independent nucleotide sequence of plant viruses. Based on the economic importance, the amount of genome information, and the number of strains and/or isolates, one to fifty-one probes for each target virus are selected and spotted on the chip. The standard and field samples for the analysis of the LSON chip have been prepared and tested by RT-PCR. The probe’s specific and/or nonspecific reaction patterns by LSON chip allow us to diagnose the unidentified viruses. Thus, the LSON chip in this study could be highly useful for the detection of unexpected plant viruses, the monitoring of emerging viruses and the fluctuation of the population of major viruses in each plant. PMID:25288985

On-chip multiplexed solid-phase nucleic acid hybridization assay using spatial profiles of immobilized quantum dots and fluorescence resonance energy transfer.

PubMed

Noor, M Omair; Tavares, Anthony J; Krull, Ulrich J

2013-07-25

A microfluidic based solid-phase assay for the multiplexed detection of nucleic acid hybridization using quantum dot (QD) mediated fluorescence resonance energy transfer (FRET) is described herein. The glass surface of hybrid glass-polydimethylsiloxane (PDMS) microfluidic channels was chemically modified to assemble the biorecognition interface. Multiplexing was demonstrated using a detection system that was comprised of two colors of immobilized semi-conductor QDs and two different oligonucleotide probe sequences. Green-emitting and red-emitting QDs were paired with Cy3 and Alexa Fluor 647 (A647) labeled oligonucleotides, respectively. The QDs served as energy donors for the transduction of dye labeled oligonucleotide targets. The in-channel assembly of the biorecognition interface and the subsequent introduction of oligonucleotide targets was accomplished within minutes using a combination of electroosmotic flow and electrophoretic force. The concurrent quantification of femtomole quantities of two target sequences was possible by measuring the spatial coverage of FRET sensitized emission along the length of the channel. In previous reports, multiplexed QD-FRET hybridization assays that employed a ratiometric method for quantification had challenges associated with lower analytical sensitivity arising from both donor and acceptor dilution that resulted in reduced energy transfer pathways as compared to single-color hybridization assays. Herein, a spatial method for quantification that is based on in-channel QD-FRET profiles provided higher analytical sensitivity in the multiplexed assay format as compared to single-color hybridization assays. The selectivity of the multiplexed hybridization assays was demonstrated by discrimination between a fully-complementary sequence and a 3 base pair sequence at a contrast ratio of 8 to 1. Copyright © 2013 Elsevier B.V. All rights reserved.

Resistance gene candidates identified by PCR with degenerate oligonucleotide primers map to clusters of resistance genes in lettuce.

PubMed

Shen, K A; Meyers, B C; Islam-Faridi, M N; Chin, D B; Stelly, D M; Michelmore, R W

1998-08-01

The recent cloning of genes for resistance against diverse pathogens from a variety of plants has revealed that many share conserved sequence motifs. This provides the possibility of isolating numerous additional resistance genes by polymerase chain reaction (PCR) with degenerate oligonucleotide primers. We amplified resistance gene candidates (RGCs) from lettuce with multiple combinations of primers with low degeneracy designed from motifs in the nucleotide binding sites (NBSs) of RPS2 of Arabidopsis thaliana and N of tobacco. Genomic DNA, cDNA, and bacterial artificial chromosome (BAC) clones were successfully used as templates. Four families of sequences were identified that had the same similarity to each other as to resistance genes from other species. The relationship of the amplified products to resistance genes was evaluated by several sequence and genetic criteria. The amplified products contained open reading frames with additional sequences characteristic of NBSs. Hybridization of RGCs to genomic DNA and to BAC clones revealed large numbers of related sequences. Genetic analysis demonstrated the existence of clustered multigene families for each of the four RGC sequences. This parallels classical genetic data on clustering of disease resistance genes. Two of the four families mapped to known clusters of resistance genes; these two families were therefore studied in greater detail. Additional evidence that these RGCs could be resistance genes was gained by the identification of leucine-rich repeat (LRR) regions in sequences adjoining the NBS similar to those in RPM1 and RPS2 of A. thaliana. Fluorescent in situ hybridization confirmed the clustered genomic distribution of these sequences. The use of PCR with degenerate oligonucleotide primers is therefore an efficient method to identify numerous RGCs in plants.

Using RNA as a tool to modify lipid nanoparticles

NASA Astrophysics Data System (ADS)

Wilner, Samantha E.

Lipid nanoparticles (LNPs) provide an attractive option for therapeutic applications because they can self-assemble and carry a diverse set of cargoes ranging from hydrophobic drugs to small interfering RNA (siRNA). Liposomes and micelles represent two classes of LNPs that have been developed for medicinal purposes; however, active targeting of LNPs to specific tissues and LNP stability in vivo remain significant challenges. We have exploited the structural characteristics and targeting ability of nucleic acids to address these obstacles. Specifically, we have introduced short nucleic acid targeting species, called aptamers, to the surface of stable nucleic acid lipid particles (SNALPs), a subset of liposomes used in siRNA delivery. In this manner, we have actively targeted SNALPs to cancer cells that overexpress the transferrin receptor (TfR). HeLa cells expressing enhanced green fluorescent protein (EGFP) were treated with SNALPs bearing an antiTfR aptamer (C2) that was identified in our lab. C2-conjugated SNALPs showed increased levels of uptake by cells by flow cytometry. More importantly, the enhanced uptake by C2-conjugated SNALPs translated to an increased level of gene knockdown when SNALPs were loaded with anti-EGFP siRNA or anti-Lamin NC siRNA. Expression of EGFP and Lamin NC decreased, respectively. These preliminary studies illustrate that aptamer-conjugated SNALPs can be designed to knock down both endogenous and exogenous genes in cancer cells with high specificity. We have also used nucleic acids to stabilize lipid micelles by introducing short quadruplex forming oligonucleotide sequences at the lipid headgroup. Micelle formation was confirmed via dynamic light scattering, transmission electron microscopy, and small angle X-ray scattering. Micelle stability was assessed using NMR and by a FRET-based assay in the presence of serum proteins. Quadruplex-stabilized micelles demonstrated enhanced stability suggesting that alterations to oligonucleotide headgroup interactions could be used to tune micelle stability. Therefore, we engineered stabilized micelles with an oligonucleotide extension and have shown that the addition of an antisense oligonucleotide leads to micelle destabilization and cargo release. The ability to control particle stability with antisense oligonucleotides represents a new paradigm in the design of programmed nanoscale devices, which we envision will find utility in the development of novel diagnostics and therapeutics.

In Silico Screening Based on Predictive Algorithms as a Design Tool for Exon Skipping Oligonucleotides in Duchenne Muscular Dystrophy

PubMed Central

Echigoya, Yusuke; Mouly, Vincent; Garcia, Luis; Yokota, Toshifumi; Duddy, William

2015-01-01

The use of antisense ‘splice-switching’ oligonucleotides to induce exon skipping represents a potential therapeutic approach to various human genetic diseases. It has achieved greatest maturity in exon skipping of the dystrophin transcript in Duchenne muscular dystrophy (DMD), for which several clinical trials are completed or ongoing, and a large body of data exists describing tested oligonucleotides and their efficacy. The rational design of an exon skipping oligonucleotide involves the choice of an antisense sequence, usually between 15 and 32 nucleotides, targeting the exon that is to be skipped. Although parameters describing the target site can be computationally estimated and several have been identified to correlate with efficacy, methods to predict efficacy are limited. Here, an in silico pre-screening approach is proposed, based on predictive statistical modelling. Previous DMD data were compiled together and, for each oligonucleotide, some 60 descriptors were considered. Statistical modelling approaches were applied to derive algorithms that predict exon skipping for a given target site. We confirmed (1) the binding energetics of the oligonucleotide to the RNA, and (2) the distance in bases of the target site from the splice acceptor site, as the two most predictive parameters, and we included these and several other parameters (while discounting many) into an in silico screening process, based on their capacity to predict high or low efficacy in either phosphorodiamidate morpholino oligomers (89% correctly predicted) and/or 2’O Methyl RNA oligonucleotides (76% correctly predicted). Predictions correlated strongly with in vitro testing for sixteen de novo PMO sequences targeting various positions on DMD exons 44 (R2 0.89) and 53 (R2 0.89), one of which represents a potential novel candidate for clinical trials. We provide these algorithms together with a computational tool that facilitates screening to predict exon skipping efficacy at each position of a target exon. PMID:25816009

Importance of length and sequence order on magnesium binding to surface-bound oligonucleotides studied by second harmonic generation and atomic force microscopy.

PubMed

Holland, Joseph G; Geiger, Franz M

2012-06-07

The binding of magnesium ions to surface-bound single-stranded oligonucleotides was studied under aqueous conditions using second harmonic generation (SHG) and atomic force microscopy (AFM). The effect of strand length on the number of Mg(II) ions bound and their free binding energy was examined for 5-, 10-, 15-, and 20-mers of adenine and guanine at pH 7, 298 K, and 10 mM NaCl. The binding free energies for adenine and guanine sequences were calculated to be -32.1(4) and -35.6(2) kJ/mol, respectively, and invariant with strand length. Furthermore, the ion density for adenine oligonucleotides did not change as strand length increased, with an average value of 2(1) ions/strand. In sharp contrast, guanine oligonucleotides displayed a linear relationship between strand length and ion density, suggesting that cooperativity is important. This data gives predictive capabilities for mixed strands of various lengths, which we exploit for 20-mers of adenines and guanines. In addition, the role sequence order plays in strands of hetero-oligonucleotides was examined for 5'-A(10)G(10)-3', 5'-(AG)(10)-3', and 5'-G(10)A(10)-3' (here the -3' end is chemically modified to bind to the surface). Although the free energy of binding is the same for these three strands (averaged to be -33.3(4) kJ/mol), the total ion density increases when several guanine residues are close to the 3' end (and thus close to the solid support substrate). To further understand these results, we analyzed the height profiles of the functionalized surfaces with tapping-mode atomic force microscopy (AFM). When comparing the average surface height profiles of the oligonucleotide surfaces pre- and post- Mg(II) binding, a positive correlation was found between ion density and the subsequent height decrease following Mg(II) binding, which we attribute to reductions in Coulomb repulsion and strand collapse once a critical number of Mg(II) ions are bound to the strand.

Safety of antisense oligonucleotide and siRNA-based therapeutics.

PubMed

Chi, Xuan; Gatti, Philip; Papoian, Thomas

2017-05-01

Oligonucleotide-based therapy is an active area of drug development designed to treat a variety of gene-specific diseases. Two of the more promising platforms are the antisense oligonucleotides (ASOs) and short interfering RNAs (siRNAs), both of which are often directed against similar targets. In light of recent reports on clinical trials of severe thrombocytopenia with two different ASO drugs and increased peripheral neuropathy with an siRNA drug, we compared and contrasted the specific safety characteristics of these two classes of oligonucleotide therapeutic. The objectives were to assess factors that could contribute to the specific toxicities observed with these two classes of promising drugs, and get a better understanding of the potential mechanism(s) responsible for these rare, but serious, adverse events. Published by Elsevier Ltd.

Detection of single base mismatches of thymine and cytosine residues by potassium permanganate and hydroxylamine in the presence of tetralkylammonium salts.

PubMed Central

Gogos, J A; Karayiorgou, M; Aburatani, H; Kafatos, F C

1990-01-01

In the presence of tetramethylammonium chloride, potassium permanganate specifically modifies mismatched thymines. Similarly, the modification of mismatched cytosines by hydroxylamine was enhanced by tetraethylammonium chloride. Modification followed by piperidine cleavage permits specific identification of the T and C mismatches and by extension, when the opposite DNA strand is analyzed, of A and G mismatches as well. These reactions can be performed conveniently with DNA immobilized on Hybond M-G paper. We describe conditions that exploit these reactions to detect mismatches, e.g. point mutations or genetic polymorphisms, using either synthetic oligonucleotide probes or PCR amplification of specific genomic DNA sequences. Images PMID:2263445

Fusion primer and nested integrated PCR (FPNI-PCR): a new high-efficiency strategy for rapid chromosome walking or flanking sequence cloning

PubMed Central

2011-01-01

Background The advent of genomics-based technologies has revolutionized many fields of biological enquiry. However, chromosome walking or flanking sequence cloning is still a necessary and important procedure to determining gene structure. Such methods are used to identify T-DNA insertion sites and so are especially relevant for organisms where large T-DNA insertion libraries have been created, such as rice and Arabidopsis. The currently available methods for flanking sequence cloning, including the popular TAIL-PCR technique, are relatively laborious and slow. Results Here, we report a simple and effective fusion primer and nested integrated PCR method (FPNI-PCR) for the identification and cloning of unknown genomic regions flanked known sequences. In brief, a set of universal primers was designed that consisted of various 15-16 base arbitrary degenerate oligonucleotides. These arbitrary degenerate primers were fused to the 3' end of an adaptor oligonucleotide which provided a known sequence without degenerate nucleotides, thereby forming the fusion primers (FPs). These fusion primers are employed in the first step of an integrated nested PCR strategy which defines the overall FPNI-PCR protocol. In order to demonstrate the efficacy of this novel strategy, we have successfully used it to isolate multiple genomic sequences namely, 21 orthologs of genes in various species of Rosaceace, 4 MYB genes of Rosa rugosa, 3 promoters of transcription factors of Petunia hybrida, and 4 flanking sequences of T-DNA insertion sites in transgenic tobacco lines and 6 specific genes from sequenced genome of rice and Arabidopsis. Conclusions The successful amplification of target products through FPNI-PCR verified that this novel strategy is an effective, low cost and simple procedure. Furthermore, FPNI-PCR represents a more sensitive, rapid and accurate technique than the established TAIL-PCR and hiTAIL-PCR procedures. PMID:22093809

Synthesis of high-quality libraries of long (150mer) oligonucleotides by a novel depurination controlled process

PubMed Central

LeProust, Emily M.; Peck, Bill J.; Spirin, Konstantin; McCuen, Heather Brummel; Moore, Bridget; Namsaraev, Eugeni; Caruthers, Marvin H.

2010-01-01

We have achieved the ability to synthesize thousands of unique, long oligonucleotides (150mers) in fmol amounts using parallel synthesis of DNA on microarrays. The sequence accuracy of the oligonucleotides in such large-scale syntheses has been limited by the yields and side reactions of the DNA synthesis process used. While there has been significant demand for libraries of long oligos (150mer and more), the yields in conventional DNA synthesis and the associated side reactions have previously limited the availability of oligonucleotide pools to lengths <100 nt. Using novel array based depurination assays, we show that the depurination side reaction is the limiting factor for the synthesis of libraries of long oligonucleotides on Agilent Technologies’ SurePrint® DNA microarray platform. We also demonstrate how depurination can be controlled and reduced by a novel detritylation process to enable the synthesis of high quality, long (150mer) oligonucleotide libraries and we report the characterization of synthesis efficiency for such libraries. Oligonucleotide libraries prepared with this method have changed the economics and availability of several existing applications (e.g. targeted resequencing, preparation of shRNA libraries, site-directed mutagenesis), and have the potential to enable even more novel applications (e.g. high-complexity synthetic biology). PMID:20308161

Detection of cystic fibrosis transmembrane conductance regulator ΔF508 gene mutation using a paper-based nucleic acid hybridization assay and a smartphone camera.

PubMed

Malhotra, Karan; Noor, M Omair; Krull, Ulrich J

2018-05-29

Diagnostic technology that makes use of paper platforms in conjunction with the ubiquitous availability of digital cameras in cellular telephones and personal assistive devices offers opportunities for development of bioassays that are cost effective and widely distributed. Assays that operate effectively in aqueous solution require further development for implementation in paper substrates, overcoming issues associated with surface interactions on a matrix that offers a large surface-to-volume ratio and constraints on convective mixing. This report presents and compares two related methods for determination of oligonucleotides that serve as indicators of cystic fibrosis, differentiating between the normal wild-type sequence, and a mutant-type sequence that has a 3-base replacement. The transduction strategy operates by selective hybridization of oligonucleotide probes that are conjugated to fluorescent quantum dots, where hybridization of target sequences causes a molecular fluorophore to approach the quantum dot and become emissive through fluorescence resonance energy transfer. Detection can rely on hybridization of a target that is labelled with Cy3 fluorophore, or in the presence of an unlabelled target when a sandwich assay format is implemented with a labelled reporter oligonucleotide. Selectivity to determine the presence of mismatched sequences involves appropriate selection of nucleotide sequences to set melt temperatures, in conjunction with control of stringency conditions using formamide as a chaotrope. It was determined that both direct and sandwich assays on paper substrates are able to distinguish between wild-type and mutant-type samples.

Tritium labeling of antisense oligonucleotides by exchange with tritiated water.

PubMed Central

Graham, M J; Freier, S M; Crooke, R M; Ecker, D J; Maslova, R N; Lesnik, E A

1993-01-01

We describe a simple, efficient, procedure for labeling oligonucleotides to high specific activity (< 1 x 10(8) cpm/mumol) by hydrogen exchange with tritiated water at the C8 positions of purines in the presence of beta-mercaptoethanol, an effective radical scavenger. Approximately 90% of the starting material is recovered as intact, labeled oligonucleotide. The radiolabeled compounds are stable in biological systems; greater than 90% of the specific activity is retained after 72 hr incubation at 37 degrees C in serum-containing media. Data obtained from in vitro cellular uptake experiments using oligonucleotides labeled by this method are similar to those obtained using 35S or 14C-labeled compounds. Because this protocol is solely dependent upon the existence of purine residues, it should be useful for radiolabeling modified as well as unmodified phosphodiester oligonucleotides. Images PMID:8367289

Sequence-specific binding of counterions to B-DNA

PubMed Central

Denisov, Vladimir P.; Halle, Bertil

2000-01-01

Recent studies by x-ray crystallography, NMR, and molecular simulations have suggested that monovalent counterions can penetrate deeply into the minor groove of B form DNA. Such groove-bound ions potentially could play an important role in AT-tract bending and groove narrowing, thereby modulating DNA function in vivo. To address this issue, we report here 23Na magnetic relaxation dispersion measurements on oligonucleotides, including difference experiments with the groove-binding drug netropsin. The exquisite sensitivity of this method to ions in long-lived and intimate association with DNA allows us to detect sequence-specific sodium ion binding in the minor groove AT tract of three B-DNA dodecamers. The sodium ion occupancy is only a few percent, however, and therefore is not likely to contribute importantly to the ensemble of B-DNA structures. We also report results of ion competition experiments, indicating that potassium, rubidium, and cesium ions bind to the minor groove with similarly weak affinity as sodium ions, whereas ammonium ion binding is somewhat stronger. The present findings are discussed in the light of previous NMR and diffraction studies of sequence-specific counterion binding to DNA. PMID:10639130

Generation of non-genomic oligonucleotide tag sequences for RNA template-specific PCR

PubMed Central

Pinto, Fernando Lopes; Svensson, Håkan; Lindblad, Peter

2006-01-01

Background In order to overcome genomic DNA contamination in transcriptional studies, reverse template-specific polymerase chain reaction, a modification of reverse transcriptase polymerase chain reaction, is used. The possibility of using tags whose sequences are not found in the genome further improves reverse specific polymerase chain reaction experiments. Given the absence of software available to produce genome suitable tags, a simple tool to fulfill such need was developed. Results The program was developed in Perl, with separate use of the basic local alignment search tool, making the tool platform independent (known to run on Windows XP and Linux). In order to test the performance of the generated tags, several molecular experiments were performed. The results show that Tagenerator is capable of generating tags with good priming properties, which will deliberately not result in PCR amplification of genomic DNA. Conclusion The program Tagenerator is capable of generating tag sequences that combine genome absence with good priming properties for RT-PCR based experiments, circumventing the effects of genomic DNA contamination in an RNA sample. PMID:16820068

Development of a screening method for genetically modified soybean by plasmid-based quantitative competitive polymerase chain reaction.

PubMed

Shimizu, Eri; Kato, Hisashi; Nakagawa, Yuki; Kodama, Takashi; Futo, Satoshi; Minegishi, Yasutaka; Watanabe, Takahiro; Akiyama, Hiroshi; Teshima, Reiko; Furui, Satoshi; Hino, Akihiro; Kitta, Kazumi

2008-07-23

A novel type of quantitative competitive polymerase chain reaction (QC-PCR) system for the detection and quantification of the Roundup Ready soybean (RRS) was developed. This system was designed based on the advantage of a fully validated real-time PCR method used for the quantification of RRS in Japan. A plasmid was constructed as a competitor plasmid for the detection and quantification of genetically modified soy, RRS. The plasmid contained the construct-specific sequence of RRS and the taxon-specific sequence of lectin1 (Le1), and both had 21 bp oligonucleotide insertion in the sequences. The plasmid DNA was used as a reference molecule instead of ground seeds, which enabled us to precisely and stably adjust the copy number of targets. The present study demonstrated that the novel plasmid-based QC-PCR method could be a simple and feasible alternative to the real-time PCR method used for the quantification of genetically modified organism contents.

Genomic maps of lincRNA occupancy reveal principles of RNA-chromatin interactions

PubMed Central

Chu, Ci; Qu, Kun; Zhong, Franklin; Artandi, Steven E.; Chang, Howard Y.

2011-01-01

SUMMARY Long intergenic noncoding RNAs (lincRNAs) are key regulators of chromatin state, yet the nature and sites of RNA-chromatin interaction are mostly unknown. Here we introduce Chromatin Isolation by RNA Purification (ChIRP), where tiling oligonucleotides retrieve specific lincRNAs with bound protein and DNA sequences, which are enumerated by deep sequencing. ChIRP-seq of three lincRNAs reveal that RNA occupancy sites in the genome are focal, sequence-specific, and numerous. Drosophila roX2 RNA occupies male X-linked gene bodies with increasing tendency toward the 3’ end, peaking at CES sites. Human telomerase RNA TERC occupies telomeres and Wnt pathway genes. HOTAIR lincRNA preferentially occupies a GA-rich DNA motif to nucleate broad domains of Polycomb occupancy and histone H3 lysine 27 trimethylation. HOTAIR occupancy occurs independently of EZH2, suggesting the order of RNA guidance of Polycomb occupancy. ChIRP-seq is generally applicable to illuminate the intersection of RNA and chromatin with newfound precision genome-wide. PMID:21963238

DNA typing by microbead arrays and PCR-SSP: apparent false-negative or -positive hybridization or amplification signals disclose new HLA-B and -DRB1 alleles.

PubMed

Rahal, M; Kervaire, B; Villard, J; Tiercy, J-M

2008-03-01

Human leukocyte antigen (HLA) typing by polymerase chain reaction-sequence-specific oligonucleotide (PCR-SSO) hybridization on solid phase (microbead assay) or polymerase chain reaction-sequence-specific primers (PCR-SSP) requires interpretation softwares to detect all possible allele combinations. These programs propose allele calls by taking into account false-positive or false-negative signal(s). The laboratory has the option to validate typing results in the presence of strongly cross-reacting or apparent false-negative signals. Alternatively, these seemingly aberrant signals may disclose novel variants. We report here four new HLA-B (B*5620 and B*5716) and HLA-DRB1 alleles (DRB1*110107 and DRB1*1474) that were detected by apparent false-negative or -positive hybridization or amplification patterns, and ultimately resolved by sequencing. To avoid allele misassignments, a comprehensive evaluation of acquired data as documented in a quality assurance system is therefore required to confirm unambiguous typing interpretation.

Consensus-Degenerate Hybrid Oligonucleotide Primers for Amplification of Priming Glycosyltransferase Genes of the Exopolysaccharide Locus in Strains of the Lactobacillus casei Group

PubMed Central

Provencher, Cathy; LaPointe, Gisèle; Sirois, Stéphane; Van Calsteren, Marie-Rose; Roy, Denis

2003-01-01

A primer design strategy named CODEHOP (consensus-degenerate hybrid oligonucleotide primer) for amplification of distantly related sequences was used to detect the priming glycosyltransferase (GT) gene in strains of the Lactobacillus casei group. Each hybrid primer consisted of a short 3′ degenerate core based on four highly conserved amino acids and a longer 5′ consensus clamp region based on six sequences of the priming GT gene products from exopolysaccharide (EPS)-producing bacteria. The hybrid primers were used to detect the priming GT gene of 44 commercial isolates and reference strains of Lactobacillus rhamnosus, L. casei, Lactobacillus zeae, and Streptococcus thermophilus. The priming GT gene was detected in the genome of both non-EPS-producing (EPS−) and EPS-producing (EPS+) strains of L. rhamnosus. The sequences of the cloned PCR products were similar to those of the priming GT gene of various gram-negative and gram-positive EPS+ bacteria. Specific primers designed from the L. rhamnosus RW-9595M GT gene were used to sequence the end of the priming GT gene in selected EPS+ strains of L. rhamnosus. Phylogenetic analysis revealed that Lactobacillus spp. form a distinctive group apart from other lactic acid bacteria for which GT genes have been characterized to date. Moreover, the sequences show a divergence existing among strains of L. rhamnosus with respect to the terminal region of the priming GT gene. Thus, the PCR approach with consensus-degenerate hybrid primers designed with CODEHOP is a practical approach for the detection of similar genes containing conserved motifs in different bacterial genomes. PMID:12788729

[A new variant of the simian T-lymphotropic retrovirus type I (STLV-IF) in the Sukhumi colony of hamadryas baboons].

PubMed

Chikobaeva, M G; Schatzl, H; Rose, D; Bush, U; Iakovleva, L A; Deinhardt, F; Helm, K; Lapin, B A

1993-01-01

Polymerase chain reaction (PCR) was developed for the detection of simian T-lymphotropic virus type 1 (STLV-1) infection of P. hamadryas and direct sequencing using oligo-nucleotide primer pairs specific for the tax and env regions of the related human T-lymphotropic virus type 1 (HTLV-1). Excellent specificity was shown in the detection of STLV-1 provirus in infected baboons by PCR using HTLV-1-derived primers. The nucleotide sequences of env 467bp and tax 159bp of the proviral genome (env position 5700-6137, tax position 7373-7498 HTLV-1, according to Seiki et al., 1983) derived from STLV-1-infected P. hamadryas were analysed using PCR and direct sequencing techniques. Two STLV-1 isolates from different sources (Sukhumi main-SuTLV-1 and forest stocks-STLV-1F) were compared. Two variants of STLV-1 among P. hamadryas with different level of homology to HTLV-1 were wound (83.8% and 95.2%, respectively). A possible role of nucleotide changes in env and tax sequenced fragments and oncogenicity of STLV-1 variants is discussed.

Different strategies for the detection of bioagents using electrochemical and photoelectrochemical genosensors

NASA Astrophysics Data System (ADS)

Voccia, Diego; Bettazi, Francesca; Palchetti, Ilaria

2015-10-01

In recent years various kinds of biosensors for the detection of pathogens have been developed. A genosensor consists in the immobilization, onto the surface of a chosen transducer, of an oligonucleotide with a specific base sequence called capture probe. The complementary sequence (the analytical target, i.e. a specific sequence of the DNA/RNA of the pathogen) present in the sample is recognized and captured by the probe through the hybridization reaction. The evaluation of the extent of the hybridization allows one to confirm whether the sample contains the complementary sequence of the probe or not. Electrochemical transducers have received considerable attention in connection with the detection of DNA hybridization. Moreover, recently, with the emergence of novel photoelectrochemically active species and new detection schemes, photoelectrochemistry has resulted in substantial progress in its analytical performance for biosensing applications. In this paper, some examples of electrochemical genosensors for multiplexed pathogen detection are shown. Moreover, the preliminary experiments towards the development of a photoelectrochemical genosensor using a TiO2 - nanocrystal-modified ITO electrode are discussed.

Validation and application of quantitative PCR assays using host-specific Bacteroidales genetic markers for swine fecal pollution tracking.

PubMed

Fan, Lihua; Shuai, Jiangbing; Zeng, Ruoxue; Mo, Hongfei; Wang, Suhua; Zhang, Xiaofeng; He, Yongqiang

2017-12-01

Genome fragment enrichment (GFE) method was applied to identify host-specific bacterial genetic markers that differ among different fecal metagenomes. To enrich for swine-specific DNA fragments, swine fecal DNA composite (n = 34) was challenged against a DNA composite consisting of cow, human, goat, sheep, chicken, duck and goose fecal DNA extracts (n = 83). Bioinformatic analyses of 384 non-redundant swine enriched metagenomic sequences indicated a preponderance of Bacteroidales-like regions predicted to encode metabolism-associated, cellular processes and information storage and processing. After challenged against fecal DNA extracted from different animal sources, four sequences from the clone libraries targeting two Bacteroidales- (genes 1-38 and 3-53), a Clostridia- (gene 2-109) as well as a Bacilli-like sequence (gene 2-95), respectively, showed high specificity to swine feces based on PCR analysis. Host-specificity and host-sensitivity analysis confirmed that oligonucleotide primers and probes capable of annealing to select Bacteroidales-like sequences (1-38 and 3-53) exhibited high specificity (>90%) in quantitative PCR assays with 71 fecal DNAs from non-target animal sources. The two assays also demonstrated broad distributions of corresponding genetic markers (>94% positive) among 72 swine feces. After evaluation with environmental water samples from different areas, swine-targeted assays based on two Bacteroidales-like GFE sequences appear to be suitable quantitative tracing tools for swine fecal pollution. Copyright © 2017 Elsevier Ltd. All rights reserved.

The field effect transistor DNA biosensor based on ITO nanowires in label-free hepatitis B virus detecting compatible with CMOS technology.

PubMed

Shariati, Mohsen

2018-05-15

In this paper the field-effect transistor DNA biosensor for detecting hepatitis B virus (HBV) based on indium tin oxide nanowires (ITO NWs) in label free approach has been fabricated. Because of ITO nanowires intensive conductance and functional modified surface, the probe immobilization and target hybridization were increased strongly. The high resolution transmission electron microscopy (HRTEM) measurement showed that ITO nanowires were crystalline and less than 50nm in diameter. The single-stranded hepatitis B virus DNA (SS-DNA) was immobilized as probe on the Au-modified nanowires. The DNA targets were measured in a linear concentration range from 1fM to 10µM. The detection limit of the DNA biosensor was about 1fM. The time of the hybridization process for defined single strand was 90min. The switching ratio of the biosensor between "on" and "off" state was ~ 1.1 × 10 5 . For sensing the specificity of the biosensor, non-complementary, mismatch and complementary DNA oligonucleotide sequences were clearly discriminated. The HBV biosensor confirmed the highly satisfied specificity for differentiating complementary sequences from non-complementary and the mismatch oligonucleotides. The response time of the DNA sensor was 37s with a high reproducibility. The stability and repeatability of the DNA biosensor showed that the peak current of the biosensor retained 98% and 96% of its initial response for measurements after three and five weeks, respectively. Copyright © 2018 Elsevier B.V. All rights reserved.

DNA microarrays for identifying fishes.

PubMed

Kochzius, M; Nölte, M; Weber, H; Silkenbeumer, N; Hjörleifsdottir, S; Hreggvidsson, G O; Marteinsson, V; Kappel, K; Planes, S; Tinti, F; Magoulas, A; Garcia Vazquez, E; Turan, C; Hervet, C; Campo Falgueras, D; Antoniou, A; Landi, M; Blohm, D

2008-01-01

In many cases marine organisms and especially their diverse developmental stages are difficult to identify by morphological characters. DNA-based identification methods offer an analytically powerful addition or even an alternative. In this study, a DNA microarray has been developed to be able to investigate its potential as a tool for the identification of fish species from European seas based on mitochondrial 16S rDNA sequences. Eleven commercially important fish species were selected for a first prototype. Oligonucleotide probes were designed based on the 16S rDNA sequences obtained from 230 individuals of 27 fish species. In addition, more than 1200 sequences of 380 species served as sequence background against which the specificity of the probes was tested in silico. Single target hybridisations with Cy5-labelled, PCR-amplified 16S rDNA fragments from each of the 11 species on microarrays containing the complete set of probes confirmed their suitability. True-positive, fluorescence signals obtained were at least one order of magnitude stronger than false-positive cross-hybridisations. Single nontarget hybridisations resulted in cross-hybridisation signals at approximately 27% of the cases tested, but all of them were at least one order of magnitude lower than true-positive signals. This study demonstrates that the 16S rDNA gene is suitable for designing oligonucleotide probes, which can be used to differentiate 11 fish species. These data are a solid basis for the second step to create a "Fish Chip" for approximately 50 fish species relevant in marine environmental and fisheries research, as well as control of fisheries products.

Innovative approaches to the use of polyamines for DNA nanoparticle preparation for gene therapy.

PubMed

Vijayanathan, Veena; Agostinelli, Enzo; Thomas, Thresia; Thomas, T J

2014-03-01

Advances in genomic technologies, such as next generation sequencing and disease specific gene targeting through anti-sense, anti-gene, siRNA and microRNA approaches require the transport of nucleic acid drugs through the cell membrane. Membrane transport of DNA/RNA drugs is an inefficient process, and the mechanism(s) by which this process occurs is not clear. A pre-requisite for effective transport of DNA and RNA in cells is their condensation to nanoparticles of ~100 nm size. Although viral vectors are effective in gene therapy, the immune response elicited by viral proteins poses a major challenge. Multivalent cations, such as natural polyamines are excellent promoters of DNA/RNA condensation to nanoparticles. During the past 20 years, our laboratory has synthesized and tested several analogs of the natural polyamine, spermine, for their efficacy to provoke DNA condensation to nanoparticles. We determined the thermodynamics of polyamine-mediated DNA condensation, measured the structural specificity effects of polyamine analogs in facilitating the cellular uptake of oligonucleotides, and evaluated the gene silencing activity of DNA nanoparticles in breast cancer cells. Polyamine-complexed oligonucleotides showed a synergistic effect on target gene inhibition at the mRNA level compared to the use of polyamines and oligonucleotides as single agents. Ionic and structural specificity effects were evident in DNA condensation and cellular transportation effects of polyamines. In condensed DNA structures, correlation exists between the attractive and repulsive forces with structurally different polyamines and cobalt hexamine, indicating the existence of a common force in stabilizing the condensed structures. Future studies aimed at defining the mechanism(s) of DNA compaction and structural features of DNA nanoparticles might aid in the development of novel gene delivery vehicles.

Sequential strand displacement beacon for detection of DNA coverage on functionalized gold nanoparticles.

PubMed

Paliwoda, Rebecca E; Li, Feng; Reid, Michael S; Lin, Yanwen; Le, X Chris

2014-06-17

Functionalizing nanomaterials for diverse analytical, biomedical, and therapeutic applications requires determination of surface coverage (or density) of DNA on nanomaterials. We describe a sequential strand displacement beacon assay that is able to quantify specific DNA sequences conjugated or coconjugated onto gold nanoparticles (AuNPs). Unlike the conventional fluorescence assay that requires the target DNA to be fluorescently labeled, the sequential strand displacement beacon method is able to quantify multiple unlabeled DNA oligonucleotides using a single (universal) strand displacement beacon. This unique feature is achieved by introducing two short unlabeled DNA probes for each specific DNA sequence and by performing sequential DNA strand displacement reactions. Varying the relative amounts of the specific DNA sequences and spacing DNA sequences during their coconjugation onto AuNPs results in different densities of the specific DNA on AuNP, ranging from 90 to 230 DNA molecules per AuNP. Results obtained from our sequential strand displacement beacon assay are consistent with those obtained from the conventional fluorescence assays. However, labeling of DNA with some fluorescent dyes, e.g., tetramethylrhodamine, alters DNA density on AuNP. The strand displacement strategy overcomes this problem by obviating direct labeling of the target DNA. This method has broad potential to facilitate more efficient design and characterization of novel multifunctional materials for diverse applications.

Edesign: Primer and Enhanced Internal Probe Design Tool for Quantitative PCR Experiments and Genotyping Assays.

PubMed

Kimura, Yasumasa; Soma, Takahiro; Kasahara, Naoko; Delobel, Diane; Hanami, Takeshi; Tanaka, Yuki; de Hoon, Michiel J L; Hayashizaki, Yoshihide; Usui, Kengo; Harbers, Matthias

2016-01-01

Analytical PCR experiments preferably use internal probes for monitoring the amplification reaction and specific detection of the amplicon. Such internal probes have to be designed in close context with the amplification primers, and may require additional considerations for the detection of genetic variations. Here we describe Edesign, a new online and stand-alone tool for designing sets of PCR primers together with an internal probe for conducting quantitative real-time PCR (qPCR) and genotypic experiments. Edesign can be used for selecting standard DNA oligonucleotides like for instance TaqMan probes, but has been further extended with new functions and enhanced design features for Eprobes. Eprobes, with their single thiazole orange-labelled nucleotide, allow for highly sensitive genotypic assays because of their higher DNA binding affinity as compared to standard DNA oligonucleotides. Using new thermodynamic parameters, Edesign considers unique features of Eprobes during primer and probe design for establishing qPCR experiments and genotyping by melting curve analysis. Additional functions in Edesign allow probe design for effective discrimination between wild-type sequences and genetic variations either using standard DNA oligonucleotides or Eprobes. Edesign can be freely accessed online at http://www.dnaform.com/edesign2/, and the source code is available for download.

Edesign: Primer and Enhanced Internal Probe Design Tool for Quantitative PCR Experiments and Genotyping Assays

PubMed Central

Kasahara, Naoko; Delobel, Diane; Hanami, Takeshi; Tanaka, Yuki; de Hoon, Michiel J. L.; Hayashizaki, Yoshihide; Usui, Kengo; Harbers, Matthias

2016-01-01

Analytical PCR experiments preferably use internal probes for monitoring the amplification reaction and specific detection of the amplicon. Such internal probes have to be designed in close context with the amplification primers, and may require additional considerations for the detection of genetic variations. Here we describe Edesign, a new online and stand-alone tool for designing sets of PCR primers together with an internal probe for conducting quantitative real-time PCR (qPCR) and genotypic experiments. Edesign can be used for selecting standard DNA oligonucleotides like for instance TaqMan probes, but has been further extended with new functions and enhanced design features for Eprobes. Eprobes, with their single thiazole orange-labelled nucleotide, allow for highly sensitive genotypic assays because of their higher DNA binding affinity as compared to standard DNA oligonucleotides. Using new thermodynamic parameters, Edesign considers unique features of Eprobes during primer and probe design for establishing qPCR experiments and genotyping by melting curve analysis. Additional functions in Edesign allow probe design for effective discrimination between wild-type sequences and genetic variations either using standard DNA oligonucleotides or Eprobes. Edesign can be freely accessed online at http://www.dnaform.com/edesign2/, and the source code is available for download. PMID:26863543

Liver-Targeted Anti-HBV Single-Stranded Oligonucleotides with Locked Nucleic Acid Potently Reduce HBV Gene Expression In Vivo.

PubMed

Javanbakht, Hassan; Mueller, Henrik; Walther, Johanna; Zhou, Xue; Lopez, Anaïs; Pattupara, Thushara; Blaising, Julie; Pedersen, Lykke; Albæk, Nanna; Jackerott, Malene; Shi, Tianlai; Ploix, Corinne; Driessen, Wouter; Persson, Robert; Ravn, Jacob; Young, John A T; Ottosen, Søren

2018-06-01

Chronic hepatitis B infection (CHB) is an area of high unmet medical need. Current standard-of-care therapies only rarely lead to a functional cure, defined as durable hepatitis B surface antigen (HBsAg) loss following treatment. The goal for next generation CHB therapies is to achieve a higher rate of functional cure with finite treatment duration. To address this urgent need, we are developing liver-targeted single-stranded oligonucleotide (SSO) therapeutics for CHB based on the locked nucleic acid (LNA) platform. These LNA-SSOs target hepatitis B virus (HBV) transcripts for RNase-H-mediated degradation. Here, we describe a HBV-specific LNA-SSO that effectively reduces intracellular viral mRNAs and viral antigens (HBsAg and HBeAg) over an extended time period in cultured human hepatoma cell lines that were infected with HBV with mean 50% effective concentration (EC 50 ) values ranging from 1.19 to 1.66 μM. To achieve liver-specific targeting and minimize kidney exposure, this LNA-SSO was conjugated to a cluster of three N-acetylgalactosamine (GalNAc) moieties that direct specific binding to the asialoglycoprotein receptor (ASGPR) expressed specifically on the surface of hepatocytes. The GalNAc-conjugated LNA-SSO showed a strikingly higher level of potency when tested in the AAV-HBV mouse model as compared with its non-conjugated counterpart. Remarkably, higher doses of GalNAc-conjugated LNA-SSO resulted in a rapid and long-lasting reduction of HBsAg to below the detection limit for quantification, i.e., by 3 log10 (p < 0.0003). This antiviral effect depended on a close match between the sequences of the LNA-SSO and its HBV target, indicating that the antiviral effect is not due to non-specific oligonucleotide-driven immune activation. These data support the development of LNA-SSO therapeutics for the treatment of CHB infection. Copyright © 2018 The Authors. Published by Elsevier Inc. All rights reserved.

Identifying members of the domain Archaea with rRNA-targeted oligonucleotide probes.

PubMed

Burggraf, S; Mayer, T; Amann, R; Schadhauser, S; Woese, C R; Stetter, K O

1994-09-01

Two 16S rRNA-targeted oligonucleotide probes were designed for the archaeal kingdoms Euryachaeota and Crenarchaeota. Probe specificities were evaluated by nonradioactive dot blot hybridization against selected reference organisms. The successful application of fluorescent-probe derivatives for whole-cell hybridization required organism-specific optimizations of fixation and hybridization conditions to assure probe penetration and morphological integrity of the cells. The probes allowed preliminary grouping of three new hyperthermophilic isolates. Together with other group-specific rRNA-targeted oligonucleotide probes, these probes will facilitate rapid in situ monitoring of the populations present in hydrothermal systems and support cultivation attempts.

Development of species-specific rDNA probes for Giardia by multiple fluorescent in situ hybridization combined with immunocytochemical identification of cyst wall antigens.

PubMed

Erlandsen, Stanley L; Jarroll, Edward; Wallis, Peter; van Keulen, Harry

2005-08-01

In this study, we describe the development of fluorescent oligonucleotide probes to variable regions in the small subunit of 16S rRNA in three distinct Giardia species. Sense and antisense probes (17-22 mer) to variable regions 1, 3, and 8 were labeled with digoxygenin or selected fluorochomes (FluorX, Cy3, or Cy5). Optimal results were obtained with fluorochome-labeled oligonucleotides for detection of rRNA in Giardia cysts. Specificity of fluorescent in situ hybridization (FISH) was shown using RNase digestion and high stringency to diminish the hybridization signal, and oligonucleotide probes for rRNA in Giardia lamblia, Giardia muris, and Giardia ardeae were shown to specifically stain rRNA only within cysts or trophozoites of those species. The fluorescent oligonucleotide specific for rRNA in human isolates of Giardia was positive for ten different strains. A method for simultaneous FISH detection of cysts using fluorescent antibody (genotype marker) and two oligonucleotide probes (species marker) permitted visualization of G. lamblia and G. muris cysts in the same preparation. Testing of an environmental water sample revealed the presence of FISH-positive G. lamblia cysts with a specific rDNA probe for rRNA, while negative cysts were presumed to be of animal or bird origin.

Genotypic variations in field isolates of Theileria species infecting giraffes (Giraffa camelopardalis tippelskirchi and Giraffa camelopardalis reticulata) in Kenya.

PubMed

Githaka, Naftaly; Konnai, Satoru; Skilton, Robert; Kariuki, Edward; Kanduma, Esther; Murata, Shiro; Ohashi, Kazuhiko

2013-10-01

Recently, mortalities among giraffes, attributed to infection with unique species of piroplasms were reported in South Africa. Although haemoparasites are known to occur in giraffes of Kenya, the prevalence, genetic diversity and pathogenicity of these parasites have not been investigated. In this study, blood samples from 13 giraffes in Kenya were investigated microscopically and genomic DNA extracted. PCR amplicons of the hyper-variable region 4 (V4) of Theileria spp. small subunit ribosomal RNA (18S rRNA) gene were hybridized to a panel of genus- and species-specific oligonucleotide probes by reverse line blot (RLB). Two newly designed oligonucleotide probes specific for previously identified Theileria spp. of giraffes found single infections in eight of the specimens and mixed infections in the remaining five samples. Partial 18S rRNA genes were successfully amplified from 9 samples and the PCR amplicons were cloned. A total of 28 plasmid clones representing the Kenyan isolates were analyzed in the present study and compared with those of closely-related organisms retrieved from GenBank. In agreement with RLB results, the nucleotide sequence alignment indicated the presence of mixed infections in the giraffes. In addition, sequence alignment with the obtained 18S rRNA gene sequences revealed extensive microheterogeneities within and between isolates, characterized by indels in the V4 regions and point mutations outside this region. Phylogeny with 18S rRNA gene sequences from the detected parasites and those of related organisms places Theileria of giraffes into two major groups, within which are numerous clades that include the isolates reported in South Africa. Collectively, these data suggest the existence of at least two distinct Theileria species among giraffes, and extensive genetic diversity within the two parasite groups. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

Degradation product characterization of therapeutic oligonucleotides using liquid chromatography mass spectrometry.

PubMed

Elzahar, N M; Magdy, N; El-Kosasy, Amira M; Bartlett, Michael G

2018-05-01

Synthetic antisense phosphorothioate oligonucleotides (PS) have undergone rapid development as novel therapeutic agents. The increasing significance of this class of drugs requires significant investment in the development of quality control methods. The determination of the many degradation pathways of such complex molecules presents a significant challenge. However, an understanding of the potential impurities that may arise is necessary to continue to advance these powerful new therapeutics. In this study, four different antisense oligonucleotides representing several generations of oligonucleotide therapeutic agents were evaluated under various stress conditions (pH, thermal, and oxidative stress) using ion-pairing reversed-phase liquid chromatography tandem mass spectrometry (IP-RPLC-MS/MS) to provide in-depth characterization and identification of the degradation products. The oligonucleotide samples were stressed under different pH values at 45 and 90 °C. The main degradation products were observed to be losses of nucleotide moieties from the 3'- and 5'-terminus, depurination, formation of terminal phosphorothioates, and production of ribose, ribophosphorothioates (Rp), and phosphoribophosphorothioates (pRp). Moreover, the effects of different concentrations of hydrogen peroxide were studied resulting in primarily extensive desulfurization and subsequent oxidation of the phosphorothioate linkage to produce the corresponding phosphodiester. The reaction kinetics for the degradation of the oligonucleotides under the different stress conditions were studied and were found to follow pseudo-first-order kinetics. Differences in rates exist even for oligonucleotides of similar length but consisting of different sequences. Graphical abstract Identification of degradation products across several generations of oligonucleotide therapeutics using LC-MS.

2′-O-[2-[(N,N-dimethylamino)oxy]ethyl]-modified oligonucleotides inhibit expression of mRNA in vitro and in vivo

PubMed Central

Prakash, Thazha P.; Johnston, Joseph F.; Graham, Mark J.; Condon, Thomas P.; Manoharan, Muthiah

2004-01-01

Synthesis and antisense activity of oligonucleotides modified with 2′-O-[2-[(N,N-dimethylamino)oxy] ethyl] (2′-O-DMAOE) are described. The 2′-O-DMAOE-modified oligonucleotides showed superior metabolic stability in mice. The phosphorothioate oligonucleotide ‘gapmers’, with 2′-O-DMAOE- modified nucleoside residues at the ends and 2′-deoxy nucleosides residues in the central region, showed dose-dependent inhibition of mRNA expression in cell culture for two targets. ‘Gapmer’ oligonucleotides have one or two 2′-O-modified regions and a 2′-deoxyoligonucleotide phosphorothioate region that allows RNase H digestion of target mRNA. To determine the in vivo potency and efficacy, BalbC mice were treated with 2′-O-DMAOE gapmers and a dose-dependent reduction in the targeted C-raf mRNA expression was observed. Oligonucleotides with 2′-O-DMAOE modifications throughout the sequences reduced the intercellular adhesion molecule-1 (ICAM-1) protein expression very efficiently in HUVEC cells with an IC50 of 1.8 nM. The inhibition of ICAM-1 protein expression by these uniformly modified 2′-O-DMAOE oligonucleotides may be due to selective interference with the formation of the translational initiation complex. These results demonstrate that 2′-O-DMAOE- modified oligonucleotides are useful for antisense-based therapeutics when either RNase H-dependent or RNase H-independent target reduction mechanisms are employed. PMID:14762210

Promoter mapping of the mouse Tcp-10bt gene in transgenic mice identifies essential male germ cell regulatory sequences.

PubMed

Ewulonu, U K; Snyder, L; Silver, L M; Schimenti, J C

1996-03-01

Transgenic mice were generated to localize essential promoter elements in the mouse testis-expressed Tcp-10 genes. These genes are expressed exclusively in male germ cells, and exhibit a diffuse range of transcriptional start sites, possibly due to the absence of a TATA box. A series of transgene constructs containing different amounts of 5' flanking DNA revealed that all sequences necessary for appropriate temporal and tissue-specific transcription of Tcp-10 reside between positions -1 to -973. All transgenic animals containing these sequences expressed a chimeric transgene at high levels, in a pattern that paralleled the endogenous genes. These experiments further defined a 227 bp fragment from -746 to -973 that was absolutely essential for expression. In a gel-shift assay, this 227-bp fragment bound nuclear protein from testis, but not other tissues, to yield two retarded bands. Sequence analysis of this fragment revealed a half-site for the AP-2 transcription factor recognition sequence. Gel shift assays using native or mutant oligonucleotides demonstrated that the putative AP-2 recognition sequence was essential for generating the retarded bands. Since the binding activity is testis-specific, but AP-2 expression is not exclusive to male germ cells, it is possible that transcription of Tcp-10 requires interaction between AP-2 and a germ cell-specific transcription factor.

Triazole-linked DNA as a primer surrogate in the synthesis of first-strand cDNA.

PubMed

Fujino, Tomoko; Yasumoto, Ken-ichi; Yamazaki, Naomi; Hasome, Ai; Sogawa, Kazuhiro; Isobe, Hiroyuki

2011-11-04

A phosphate-eliminated nonnatural oligonucleotide serves as a primer surrogate in reverse transcription reaction of mRNA. Despite of the nonnatural triazole linkages in the surrogate, the reverse transcriptase effectively elongated cDNA sequences on the 3'-downstream of the primer by transcription of the complementary sequence of mRNA. A structure-activity comparison with the reference natural oligonucleotides shows the superior priming activity of the surrogate containing triazole-linkages. The nonnatural linkages also protect the transcribed cDNA from digestion reactions with 5'-exonuclease and enable us to remove noise transcripts of unknown origins. Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Prediction of the optimum hybridization conditions of dot-blot-SNP analysis using estimated melting temperature of oligonucleotide probes.

PubMed

Shiokai, Sachiko; Kitashiba, Hiroyasu; Nishio, Takeshi

2010-08-01

Although the dot-blot-SNP technique is a simple cost-saving technique suitable for genotyping of many plant individuals, optimization of hybridization and washing conditions for each SNP marker requires much time and labor. For prediction of the optimum hybridization conditions for each probe, we compared T (m) values estimated from nucleotide sequences using the DINAMelt web server, measured T (m) values, and hybridization conditions yielding allele-specific signals. The estimated T (m) values were comparable to the measured T (m) values with small differences of less than 3 degrees C for most of the probes. There were differences of approximately 14 degrees C between the specific signal detection conditions and estimated T (m) values. Change of one level of SSC concentrations of 0.1, 0.2, 0.5, and 1.0x SSC corresponded to a difference of approximately 5 degrees C in optimum signal detection temperature. Increasing the sensitivity of signal detection by shortening the exposure time to X-ray film changed the optimum hybridization condition for specific signal detection. Addition of competitive oligonucleotides to the hybridization mixture increased the suitable hybridization conditions by 1.8. Based on these results, optimum hybridization conditions for newly produced dot-blot-SNP markers will become predictable.

Efficiency, error and yield in light-directed maskless synthesis of DNA microarrays

PubMed Central

2011-01-01

Background Light-directed in situ synthesis of DNA microarrays using computer-controlled projection from a digital micromirror device--maskless array synthesis (MAS)--has proved to be successful at both commercial and laboratory scales. The chemical synthetic cycle in MAS is quite similar to that of conventional solid-phase synthesis of oligonucleotides, but the complexity of microarrays and unique synthesis kinetics on the glass substrate require a careful tuning of parameters and unique modifications to the synthesis cycle to obtain optimal deprotection and phosphoramidite coupling. In addition, unintended deprotection due to scattering and diffraction introduce insertion errors that contribute significantly to the overall error rate. Results Stepwise phosphoramidite coupling yields have been greatly improved and are now comparable to those obtained in solid phase synthesis of oligonucleotides. Extended chemical exposure in the synthesis of complex, long oligonucleotide arrays result in lower--but still high--final average yields which approach 99%. The new synthesis chemistry includes elimination of the standard oxidation until the final step, and improved coupling and light deprotection. Coupling Insertions due to stray light are the limiting factor in sequence quality for oligonucleotide synthesis for gene assembly. Diffraction and local flare are by far the largest contributors to loss of optical contrast. Conclusions Maskless array synthesis is an efficient and versatile method for synthesizing high density arrays of long oligonucleotides for hybridization- and other molecular binding-based experiments. For applications requiring high sequence purity, such as gene assembly, diffraction and flare remain significant obstacles, but can be significantly reduced with straightforward experimental strategies. PMID:22152062

Use of continuous/contiguous stacking hybridization as a diagnostic tool

DOEpatents

Mirzabekov, Andrei Darievich; Yershov, Gennadiy Moseyevich; Kirillov, Eugene Vladislavovich; Parinov, Sergei Valeryevich; Barski, Victor Evgenievich; Lysov, Yuri Petrovich

1999-01-01

A method for detecting disease-associated alleles in patient genetic material is provided whereby a first group of oligonucleotide molecules, synthesized to compliment base sequences of the disease associated alleles is immobilized on a predetermined position on a substrate, and then contacted with patient genetic material to form duplexes. The duplexes are then contacted with a second group of oligonucleotide molecules which are synthesized to extend the predetermined length of the oligonucleotide molecules of the first group, and where each of the oligonucleotide molecules of the second group are tagged and either incorporate universal bases or a mixture of guanine, cytosine, thymine, and adenine, or complementary nucleotide strands that are tagged with a different fluorochrome which radiates light at a predetermined wavelength. The treated substrate is then washed and the light patterns radiating therefrom are compared with predetermined light patterns of various diseases that were prepared on identical substrates.

Use of continuous/contiguous stacking hybridization as a diagnostic tool

DOEpatents

Mirzabekov, A.D.; Yershov, G.M.; Kirillov, E.V.; Parinov, S.V.; Barski, V.E.; Lysov, Y.P.

1999-06-01

A method for detecting disease-associated alleles in patient genetic material is provided whereby a first group of oligonucleotide molecules, synthesized to compliment base sequences of the disease associated alleles is immobilized on a predetermined position on a substrate, and then contacted with patient genetic material to form duplexes. The duplexes are then contacted with a second group of oligonucleotide molecules which are synthesized to extend the predetermined length of the oligonucleotide molecules of the first group, and where each of the oligonucleotide molecules of the second group are tagged and either incorporate universal bases or a mixture of guanine, cytosine, thymine, and adenine, or complementary nucleotide strands that are tagged with a different fluorochrome which radiates light at a predetermined wavelength. The treated substrate is then washed and the light patterns radiating therefrom are compared with predetermined light patterns of various diseases that were prepared on identical substrates. 5 figs.

Silver Nanoparticle Oligonucleotide Conjugates Based on DNA with Triple Cyclic Disulfide Moieties

PubMed Central

Lee, Jae-Seung; Lytton-Jean, Abigail K. R.; Hurst, Sarah J.; Mirkin, Chad A.

2011-01-01

We report a new strategy for preparing silver nanoparticle oligonucleotide conjugates that are based upon DNA with cyclic disulfide-anchoring groups. These particles are extremely stable and can withstand NaCl concentrations up to 1.0 M. When silver nanoparticles functionalized with complementary sequences are combined, they assemble to form DNA-linked nanoparticle networks. This assembly process is reversible with heating and is associated with a red-shifting of the particle surface plasmon resonance and a concomitant color change from yellow to pale red. Analogous to the oligonucleotide-functionalized gold nanoparticles, these particles also exhibit highly cooperative binding properties with extremely sharp melting transitions. This work is an important step towards being able to use silver nanoparticle oligonucleotide conjugates for a variety of purposes, including molecular diagnostic labels, synthons in programmable materials synthesis approaches, and functional components for nanoelectronic and plasmonic devices. PMID:17571909

Crosslinking transcription factors to their recognition sequences with PtII complexes

NASA Technical Reports Server (NTRS)

Chu, B. C.; Orgel, L. E.

1992-01-01

We have prepared phosphorothioate-containing cyclic oligodeoxynucleotides that fold into 'dumbbells' containing CRE and TRE sequences, the binding sequences for the CREB and JUN proteins, respectively. Six phosphorothioate residues were introduced into each of the recognition sequences. K2PtCl4 crosslinks CRE to CREB and TRE to JUN. The extent of crosslinking is about eight times greater than that observed with standard oligodeoxynucleotides and amounts to 30-50% of the efficiency of non-covalent association as estimated by gel-shift assays. Crosslinking is reversed by incubation with NaCN. The crosslinking reaction is specific--a dumbbell oligonucleotide with six phosphorothioate groups introduced into the Sp1 recognition sequence could not be crosslinked efficiently to CREB or JUN proteins with K2PtCl4. The binding of TRE to CREB is not strong enough for effective detection by gel-shift assays, but the TRE-CREB complex is crosslinked efficiently by K2PtCl4 and can then readily be detected.

Synthesis of Bipartite Tetracysteine PNA Probes for DNA In Situ Fluorescent Labeling.

PubMed

Fang, Ge-Min; Seitz, Oliver

2017-12-24

"Label-free" fluorescent probes that avoid additional steps or building blocks for conjugation of fluorescent dyes with oligonucleotides can significantly reduce the time and cost of parallel bioanalysis of a large number of nucleic acid samples. A method for the synthesis of "label-free" bicysteine-modified PNA probes using solid-phase synthesis and procedures for sequence-specific DNA in situ fluorescent labeling is described here. The concept is based on the adjacent alignment of two bicysteine-modified peptide nucleic acids on a DNA target to form a structurally optimized bipartite tetracysteine motif, which induces a sequence-specific fluorogenic reaction with commercially available biarsenic dyes, even in complex media such as cell lysate. This unit will help researchers to quickly synthesize bipartite tetracysteine PNA probes and carry out low-cost DNA in situ fluorescent labeling experiments. © 2017 by John Wiley & Sons, Inc. Copyright © 2017 John Wiley & Sons, Inc.

Crystallization and preliminary X-ray diffraction analysis of a self-complementary DNA heptacosamer with a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3;-terminus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yeo, Hyun Koo; Lee, Jae Young

2012-04-18

The self-complementary DNA heptacosamer (a 27-mer oligonucleotide) with sequence d(CGAGCACTGCGCAGTGCTCGTTGTTAT) forms a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus. Crystals of the oligonucleotide were obtained by sitting-drop vapor diffusion and diffracted to 2.8 {angstrom} resolution. The oligonucleotide was crystallized at 277 K using polyethylene glycol as a precipitant in the presence of magnesium chloride. The crystals belonged to the triclinic space group, with unit-cell parameters a = 48.74, b = 64.23, c = 79.34 {angstrom}, {alpha} = 91.37, {beta} = 93.21, {gamma} = 92.35{sup o}.

Crystallization and preliminary X-ray diffraction analysis of a self-complementary DNA heptacosamer with a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus.

PubMed

Yeo, Hyun Koo; Lee, Jae Young

2010-05-01

The self-complementary DNA heptacosamer (a 27-mer oligonucleotide) with sequence d(CGAGCACTGCGCAGTGCTCGTTGTTAT) forms a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus. Crystals of the oligonucleotide were obtained by sitting-drop vapour diffusion and diffracted to 2.8 A resolution. The oligonucleotide was crystallized at 277 K using polyethylene glycol as a precipitant in the presence of magnesium chloride. The crystals belonged to the triclinic space group, with unit-cell parameters a = 48.74, b = 64.23, c = 79.34 A, alpha = 91.37, beta = 93.21, gamma = 92.35 degrees .

Systematic validation and atomic force microscopy of non-covalent short oligonucleotide barcode microarrays.

PubMed

Cook, Michael A; Chan, Chi-Kin; Jorgensen, Paul; Ketela, Troy; So, Daniel; Tyers, Mike; Ho, Chi-Yip

2008-02-06

Molecular barcode arrays provide a powerful means to analyze cellular phenotypes in parallel through detection of short (20-60 base) unique sequence tags, or "barcodes", associated with each strain or clone in a collection. However, costs of current methods for microarray construction, whether by in situ oligonucleotide synthesis or ex situ coupling of modified oligonucleotides to the slide surface are often prohibitive to large-scale analyses. Here we demonstrate that unmodified 20mer oligonucleotide probes printed on conventional surfaces show comparable hybridization signals to covalently linked 5'-amino-modified probes. As a test case, we undertook systematic cell size analysis of the budding yeast Saccharomyces cerevisiae genome-wide deletion collection by size separation of the deletion pool followed by determination of strain abundance in size fractions by barcode arrays. We demonstrate that the properties of a 13K unique feature spotted 20 mer oligonucleotide barcode microarray compare favorably with an analogous covalently-linked oligonucleotide array. Further, cell size profiles obtained with the size selection/barcode array approach recapitulate previous cell size measurements of individual deletion strains. Finally, through atomic force microscopy (AFM), we characterize the mechanism of hybridization to unmodified barcode probes on the slide surface. These studies push the lower limit of probe size in genome-scale unmodified oligonucleotide microarray construction and demonstrate a versatile, cost-effective and reliable method for molecular barcode analysis.

Development of a Flow Cytometry-Based Method for Rapid Detection of Escherichia coli and Shigella Spp. Using an Oligonucleotide Probe

PubMed Central

Xue, Yong; Wilkes, Jon G.; Moskal, Ted J.; Williams, Anna J.; Cooper, Willie M.; Nayak, Rajesh; Rafii, Fatemeh; Buzatu, Dan A.

2016-01-01

Standard methods to detect Escherichia coli contamination in food use the polymerase chain reaction (PCR) and agar culture plates. These methods require multiple incubation steps and take a long time to results. An improved rapid flow-cytometry based detection method was developed, using a fluorescence-labeled oligonucleotide probe specifically binding a16S rRNA sequence. The method positively detected 51 E. coli isolates as well as 4 Shigella species. All 27 non-E. coli strains tested gave negative results. Comparison of the new genetic assay with a total plate count (TPC) assay and agar plate counting indicated similar sensitivity, agreement between cytometry cell and colony counts. This method can detect a small number of E.coli cells in the presence of large numbers of other bacteria. This method can be used for rapid, economical, and stable detection of E. coli and Shigella contamination in the food industry and other contexts. PMID:26913737

Development of a Flow Cytometry-Based Method for Rapid Detection of Escherichia coli and Shigella Spp. Using an Oligonucleotide Probe.

PubMed

Xue, Yong; Wilkes, Jon G; Moskal, Ted J; Williams, Anna J; Cooper, Willie M; Nayak, Rajesh; Rafii, Fatemeh; Buzatu, Dan A

2016-01-01

Standard methods to detect Escherichia coli contamination in food use the polymerase chain reaction (PCR) and agar culture plates. These methods require multiple incubation steps and take a long time to results. An improved rapid flow-cytometry based detection method was developed, using a fluorescence-labeled oligonucleotide probe specifically binding a16S rRNA sequence. The method positively detected 51 E. coli isolates as well as 4 Shigella species. All 27 non-E. coli strains tested gave negative results. Comparison of the new genetic assay with a total plate count (TPC) assay and agar plate counting indicated similar sensitivity, agreement between cytometry cell and colony counts. This method can detect a small number of E.coli cells in the presence of large numbers of other bacteria. This method can be used for rapid, economical, and stable detection of E. coli and Shigella contamination in the food industry and other contexts.

Importance of the DNA “bond” in programmable nanoparticle crystallization

PubMed Central

Macfarlane, Robert J.; Thaner, Ryan V.; Brown, Keith A.; Zhang, Jian; Lee, Byeongdu; Nguyen, SonBinh T.; Mirkin, Chad A.

2014-01-01

If a solution of DNA-coated nanoparticles is allowed to crystallize, the thermodynamic structure can be predicted by a set of structural design rules analogous to Pauling’s rules for ionic crystallization. The details of the crystallization process, however, have proved more difficult to characterize as they depend on a complex interplay of many factors. Here, we report that this crystallization process is dictated by the individual DNA bonds and that the effect of changing structural or environmental conditions can be understood by considering the effect of these parameters on free oligonucleotides. Specifically, we observed the reorganization of nanoparticle superlattices using time-resolved synchrotron small-angle X-ray scattering in systems with different DNA sequences, salt concentrations, and densities of DNA linkers on the surface of the nanoparticles. The agreement between bulk crystallization and the behavior of free oligonucleotides may bear important consequences for constructing novel classes of crystals and incorporating new interparticle bonds in a rational manner. PMID:25298535

Linear model for fast background subtraction in oligonucleotide microarrays.

PubMed

Kroll, K Myriam; Barkema, Gerard T; Carlon, Enrico

2009-11-16

One important preprocessing step in the analysis of microarray data is background subtraction. In high-density oligonucleotide arrays this is recognized as a crucial step for the global performance of the data analysis from raw intensities to expression values. We propose here an algorithm for background estimation based on a model in which the cost function is quadratic in a set of fitting parameters such that minimization can be performed through linear algebra. The model incorporates two effects: 1) Correlated intensities between neighboring features in the chip and 2) sequence-dependent affinities for non-specific hybridization fitted by an extended nearest-neighbor model. The algorithm has been tested on 360 GeneChips from publicly available data of recent expression experiments. The algorithm is fast and accurate. Strong correlations between the fitted values for different experiments as well as between the free-energy parameters and their counterparts in aqueous solution indicate that the model captures a significant part of the underlying physical chemistry.

fbpABC gene cluster in Neisseria meningitidis is transcribed as an operon.

PubMed

Khun, H H; Deved, V; Wong, H; Lee, B C

2000-12-01

The neisserial fbpABC locus has been proposed to constitute a single transcriptional unit. To confirm this operonic arrangement, transcription assays using reverse transcriptase PCR amplification were conducted with Neisseria meningitidis. The presence of fbpAB and fbpBC transcripts obtained by priming cDNA synthesis with an fbpC-sequence-specific oligonucleotide indicates that fbpABC is organized as a single expression unit. The ratio of fbpA to fbpABC mRNA was approximately between 10- to 20-fold, as determined by real-time quantitative PCR.

fbpABC Gene Cluster in Neisseria meningitidis Is Transcribed as an Operon

PubMed Central

Khun, Heng H.; Deved, Vinay; Wong, Howard; Lee, B. Craig

2000-01-01

The neisserial fbpABC locus has been proposed to constitute a single transcriptional unit. To confirm this operonic arrangement, transcription assays using reverse transcriptase PCR amplification were conducted with Neisseria meningitidis. The presence of fbpAB and fbpBC transcripts obtained by priming cDNA synthesis with an fbpC-sequence-specific oligonucleotide indicates that fbpABC is organized as a single expression unit. The ratio of fbpA to fbpABC mRNA was approximately between 10- to 20-fold, as determined by real-time quantitative PCR. PMID:11083849

Designing multilayered nanoplatforms for SERS-based detection of genetically modified organisms

NASA Astrophysics Data System (ADS)

Uluok, Saadet; Guven, Burcu; Eksi, Haslet; Ustundag, Zafer; Tamer, Ugur; Boyaci, Ismail Hakki

2015-01-01

In this study, the multilayered surface-enhanced Raman spectroscopy (SERS) platforms were developed for the analysis of genetically modified organisms (GMOs). For this purpose, two molecules [11-mercaptoundecanoic acid (11-MUA) and 2-mercaptoethylamine (2-MEA)] were attached with Aurod and Auspherical nanoparticles to form multilayered constructions on the gold (Au)slide surface. The best multilayered platform structure was chosen depending on SERS enhancement, and this surface was characterised with atomic force microscopy (AFM) and attenuated total reflectance Fourier transform infrared spectroscopy. After the optimum multilayered SERS platform and nanoparticle interaction was identified, the oligonucleotides on the Aurod nanoparticles and Auslide were combined to determine target concentrations from the 5,5'-dithiobis (2-nitrobenzoic acid) (DTNB) signals using SERS. The correlation between the SERS intensities for DTNB and target concentrations was found to be linear within a range of 10 pM to 1 µM, and with a detection limit of 34 fM. The selectivity and specificity of the developed sandwich assay were tested using negative and positive controls, and nonsense and real sample studies. The obtained results showed that the multilayered SERS sandwich method allows for sensitive, selective, and specific detection of oligonucleotide sequences.

Regulation of Gene Editing Activity Directed by Single-Stranded Oligonucleotides and CRISPR/Cas9 Systems

PubMed Central

Bialk, Pawel; Rivera-Torres, Natalia; Strouse, Bryan; Kmiec, Eric B.

2015-01-01

Single-stranded DNA oligonucleotides (ssODNs) can direct the repair of a single base mutation in human genes. While the regulation of this gene editing reaction has been partially elucidated, the low frequency with which repair occurs has hampered development toward clinical application. In this work a CRISPR/Cas9 complex is employed to induce double strand DNA breakage at specific sites surrounding the nucleotide designated for exchange. The result is a significant elevation in ssODN-directed gene repair, validated by a phenotypic readout. By analysing reaction parameters, we have uncovered restrictions on gene editing activity involving CRISPR/Cas9 complexes. First, ssODNs that hybridize to the non-transcribed strand direct a higher level of gene repair than those that hybridize to the transcribed strand. Second, cleavage must be proximal to the targeted mutant base to enable higher levels of gene editing. Third, DNA cleavage enables a higher level of gene editing activity as compared to single-stranded DNA nicks, created by modified Cas9 (Nickases). Fourth, we calculated the hybridization potential and free energy levels of ssODNs that are complementary to the guide RNA sequences of CRISPRs used in this study. We find a correlation between free energy potential and the capacity of single-stranded oligonucleotides to inhibit specific DNA cleavage activity, thereby indirectly reducing gene editing activity. Our data provide novel information that might be taken into consideration in the design and usage of CRISPR/Cas9 systems with ssODNs for gene editing. PMID:26053390

Regulation of Gene Editing Activity Directed by Single-Stranded Oligonucleotides and CRISPR/Cas9 Systems.

PubMed

Bialk, Pawel; Rivera-Torres, Natalia; Strouse, Bryan; Kmiec, Eric B

2015-01-01

Single-stranded DNA oligonucleotides (ssODNs) can direct the repair of a single base mutation in human genes. While the regulation of this gene editing reaction has been partially elucidated, the low frequency with which repair occurs has hampered development toward clinical application. In this work a CRISPR/Cas9 complex is employed to induce double strand DNA breakage at specific sites surrounding the nucleotide designated for exchange. The result is a significant elevation in ssODN-directed gene repair, validated by a phenotypic readout. By analysing reaction parameters, we have uncovered restrictions on gene editing activity involving CRISPR/Cas9 complexes. First, ssODNs that hybridize to the non-transcribed strand direct a higher level of gene repair than those that hybridize to the transcribed strand. Second, cleavage must be proximal to the targeted mutant base to enable higher levels of gene editing. Third, DNA cleavage enables a higher level of gene editing activity as compared to single-stranded DNA nicks, created by modified Cas9 (Nickases). Fourth, we calculated the hybridization potential and free energy levels of ssODNs that are complementary to the guide RNA sequences of CRISPRs used in this study. We find a correlation between free energy potential and the capacity of single-stranded oligonucleotides to inhibit specific DNA cleavage activity, thereby indirectly reducing gene editing activity. Our data provide novel information that might be taken into consideration in the design and usage of CRISPR/Cas9 systems with ssODNs for gene editing.

RNA-oligonucleotide quantification technique (ROQT) for the enumeration of uncultivated bacterial species in subgingival biofilms

PubMed Central

Teles, F.R.F.; Teles, R.P.; Siegelin, Y.; Paster, B.; Haffajee, A.D.; Socransky, S.S.

2010-01-01

SUMMARY Approximately 35% of the species present in subgingival biofilms are as yet uncultivated, so their role in periodontal pathogenesis is unknown. The aim of the present study was to develop a high throughput method to quantify a wide range of cultivated and uncultivated taxa in subgingival biofilm samples associated with periodontal disease or health. Oligonucleotides targeting the 16S ribosomal DNA gene were designed, synthesized and labeled with digoxigenin. These probes were hybridized with the total nucleic acids of pure cultures or subgingival biofilm samples. Target species included cultivated taxa associated with periodontal health and disease, as well as uncultivated species, such as TM7 sp OT 346, Mitsuokella sp. OT 131 and Desulfobulbus sp. OT 041. Sensitivity and specificity of the probes were determined. A Universal probe was used to assess total bacterial load. Sequences complementary to the probes were used as standards for quantification. Chemiluminescent signals were visualized after film exposure or using a CCD camera. In a pilot clinical study, 266 subgingival plaque samples from eight periodontally healthy people and 11 patients with periodontitis were examined. Probes were specific and sensitivity reached 104 cells. Fusobacterium nucleatum ss polymorphum and Actinomyces gerencseriae were the most abundant cultivated taxa in clinical samples. Among uncultivated/unrecognized species, Mitsuokella sp. OT 131 and Prevotella sp. OT 306 were the most numerous. Porphyromonas gingivalis and Desulfobulbus sp. OT 041 were only detected in patients with periodontitis. Direct hybridization of total nucleic acids using oligonucleotide probes permitted the quantification of multiple cultivated and uncultivated taxa in mixed species biofilm samples. PMID:21375703

Oligonucleotide-Gold Nanoparticle Networks for Detection of Cryptosporidium parvum Heat Shock Protein 70 mRNA ▿

PubMed Central

Javier, David J.; Castellanos-Gonzalez, Alejandro; Weigum, Shannon E.; White, A. Clinton; Richards-Kortum, Rebecca

2009-01-01

We report on a novel strategy for the detection of mRNA targets derived from Cryptosporidium parvum oocysts by the use of oligonucleotide-gold nanoparticles. Gold nanoparticles are functionalized with oligonucleotides which are complementary to unique sequences present on the heat shock protein 70 (HSP70) DNA/RNA target. The results indicate that the presence of HPS70 targets of increasing complexity causes the formation of oligonucleotide-gold nanoparticle networks which can be visually monitored via a simple colorimetric readout measured by a total internal reflection imaging setup. Furthermore, the induced expression of HSP70 mRNA in Cryptosporidium parvum oocysts via a simple heat shock process provides nonenzymatic amplification such that the HSP70 mRNA derived from as few as 5 × 103 purified C. parvum oocysts was successfully detected. Taken together, these results support the use of oligonucleotide-gold nanoparticles for the molecular diagnosis of cryptosporidiosis, offering new opportunities for the further development of point-of-care diagnostic assays with low-cost, robust reagents and simple colorimetric detection. PMID:19828740

tRNADB-CE: tRNA gene database well-timed in the era of big sequence data.

PubMed

Abe, Takashi; Inokuchi, Hachiro; Yamada, Yuko; Muto, Akira; Iwasaki, Yuki; Ikemura, Toshimichi

2014-01-01

The tRNA gene data base curated by experts "tRNADB-CE" (http://trna.ie.niigata-u.ac.jp) was constructed by analyzing 1,966 complete and 5,272 draft genomes of prokaryotes, 171 viruses', 121 chloroplasts', and 12 eukaryotes' genomes plus fragment sequences obtained by metagenome studies of environmental samples. 595,115 tRNA genes in total, and thus two times of genes compiled previously, have been registered, for which sequence, clover-leaf structure, and results of sequence-similarity and oligonucleotide-pattern searches can be browsed. To provide collective knowledge with help from experts in tRNA researches, we added a column for enregistering comments to each tRNA. By grouping bacterial tRNAs with an identical sequence, we have found high phylogenetic preservation of tRNA sequences, especially at the phylum level. Since many species-unknown tRNAs from metagenomic sequences have sequences identical to those found in species-known prokaryotes, the identical sequence group (ISG) can provide phylogenetic markers to investigate the microbial community in an environmental ecosystem. This strategy can be applied to a huge amount of short sequences obtained from next-generation sequencers, as showing that tRNADB-CE is a well-timed database in the era of big sequence data. It is also discussed that batch-learning self-organizing-map with oligonucleotide composition is useful for efficient knowledge discovery from big sequence data.

Liver as a target for oligonucleotide therapeutics.

PubMed

Sehgal, Alfica; Vaishnaw, Akshay; Fitzgerald, Kevin

2013-12-01

Oligonucleotide-based therapeutics are an emerging class of drugs that hold the promise for silencing "un-druggable" targets,thus creating unique opportunities for innovative medicines. As opposed to gene therapy, oligonucleotides are considered to be more akin to small molecule therapeutics because they are small,completely synthetic in origin, do not integrate into the host genome,and have a defined duration of therapeutic activity after which effects recover to baseline. They offer a high degree of specificity at the genetic level, thereby reducing off-target effects.At the same time, they provide a strategy for targeting any gene in the genome, including transcripts that produce mutated proteins.Oligonucleotide-based therapeutics include short interfering RNA (siRNA), that degrade target mRNA through RISC mediated RNAi; anti-miRs, that target miRNAs; miRNA mimics, that regulate target mRNA; antisense oligonucleotides, that may be working through RNAseH mediated mRNA decay; mRNA upregulation,by targeting long non-coding RNAs; and oligonucleotides induced alternative splicing [1]. All these approaches require some minimal degree of homology at the nucleic acid sequence level for them to be functional. The different mechanisms of action and their relevant activity are outlined in Fig. 1. Besides homology,RNA secondary structure has also been exploited in the case of ribozymes and aptamers, which act by binding to nucleic acids or proteins, respectively. While there have been many reports of gene knockdown and gene modulation in cell lines and mice with all these methods, very few have advanced to clinical stages.The main obstacle to date has been the safe and effective intracellular delivery of these compounds in higher species, including humans. Indeed, their action requires direct interaction with DNA/RNA within the target cell so even when one solves the issues of tissue and cellular access, intracellular/intranuclear location represents yet another barrier to overcome. To date,hepatic delivery of oligonucleotides has been the area with greatest progress, and thus we have focused on liver-targeted therapeutics that have shown promise at the preclinical and/or clinical level.The liver is the largest internal organ in the body, playing a central role in metabolism, detoxification, synthesis, and secretion of major plasma proteins (carrier proteins, coagulation factors,complement components, hormones, and apolipoproteins),and iron homeostasis. It is therefore not surprising that a large number of disease targets reside in the liver where they are susceptible to modulation by oligonucleotide therapies.

The high stability of the triple helices formed between short purine oligonucleotides and SIV/HIV-2 vpx genes is determined by the targeted DNA structure.

PubMed Central

Svinarchuk, F; Monnot, M; Merle, A; Malvy, C; Fermandjian, S

1995-01-01

In our previous works we have shown that the oligonucleotides 5'-GGGGAGGGGGAGG-3' and 5'-GGAGGGGGAGGGG-3' give very stable and specific triplexes with their target double stranded DNAs [Svinarchuk, F., Bertrand, J.-R. and Malvy, C. (1994) Nucleic Acids Res., 22, 3742-3747; Svinarchuk, F., Paoletti, J. and Malvy, C. (1995) J. Biol. Chem., 270, 14 068-14,071]. The target for the invariable part of these oligonucleotides, 5'-GGAGGGGGAGG-3', is found in a highly conserved 20 bp long purine/pyrimidine tract of the vpx gene of the SIV and HIV-2 viruses and could be a target for oligonucleotide directed antivirus therapy. Here were report on the ability of four purine oligonucleotides with different lengths (11-, 14-, 17- and 20-mer) to form triplexes with the purine/pyrimidine stretch of the vpx gene. Triplex formation was tested by joint dimethyl sulfate (DMS) footprint, gel-retardation assay, circular dichroism (CD) and UV-melting studies. Dimethyl sulfate footprint studies revealed the antiparallel orientation of the third strand to the purine strand of the Watson-Crick duplex. However, the protection of the guanines at the ends of the target sequence decreased as the length of the third strand oligonucleotide increased. Melting temperature studies provided profiles with only one transition for all of the triplexes. The melting temperatures of the triplexes were found to be the same as for the targeted duplex in the case of the 11- and 14-mer third strands while for the 17- and 20-mer third strands the melting temperature of the triplexes were correspondingly 4 and 8 degrees C higher than for the duplex. Heating and cooling melting curves were reversible for all of the tested triplexes except one with the 20-mer third strand oligonucleotide. Circular dichroism spectra showed the ability of the target DNA to adopt an A-like DNA conformation. Upon triplex formation the A-DNA form becomes even more pronounced. This effect depends on the length of the third strand oligonucleotide: the CD spectrum shows a 'classical' A-DNA shape with the 20-mer. This is not observed with the purine/pyrimidine stretch of the HIV-1 DNA which keeps a B-like spectrum even after triplex formation. We suggest, that an A-like duplex DNA is required for the formation of a stable DNA purine(purine-pyrimidine) triplex. Images PMID:7479024

Cadmium sulfide nanocluster-based electrochemical stripping detection of DNA hybridization.

PubMed

Zhu, Ningning; Zhang, Aiping; He, Pingang; Fang, Yuzhi

2003-03-01

A novel, sensitive electrochemical DNA hybridization detection assay, using cadmium sulfide (CdS) nanoclusters as the oligonucleotide labeling tag, is described. The assay relies on the hybridization of the target DNA with the CdS nanocluster oligonucleotide DNA probe, followed by the dissolution of the CdS nanoclusters anchored on the hybrids and the indirect determination of the dissolved cadmium ions by sensitive anodic stripping voltammetry (ASV) at a mercury-coated glassy carbon electrode (GCE). The results showed that only a complementary sequence could form a double-stranded dsDNA-CdS with the DNA probe and give an obvious electrochemical response. A three-base mismatch sequence and non-complementary sequence had negligible response. The combination of the large number of cadmium ions released from each dsDNA hybrid with the remarkable sensitivity of the electrochemical stripping analysis for cadmium at mercury-film GCE allows detection at levels as low as 0.2 pmol L(-1) of the complementary sequence of DNA.

In silico segmentations of lentivirus envelope sequences

PubMed Central

Boissin-Quillon, Aurélia; Piau, Didier; Leroux, Caroline

2007-01-01

Background The gene encoding the envelope of lentiviruses exhibits a considerable plasticity, particularly the region which encodes the surface (SU) glycoprotein. Interestingly, mutations do not appear uniformly along the sequence of SU, but they are clustered in restricted areas, called variable (V) regions, which are interspersed with relatively more stable regions, called constant (C) regions. We look for specific signatures of C/V regions, using hidden Markov models constructed with SU sequences of the equine, human, small ruminant and simian lentiviruses. Results Our models yield clear and accurate delimitations of the C/V regions, when the test set and the training set were made up of sequences of the same lentivirus, but also when they were made up of sequences of different lentiviruses. Interestingly, the models predicted the different regions of lentiviruses such as the bovine and feline lentiviruses, not used in the training set. Models based on composite training sets produce accurate segmentations of sequences of all these lentiviruses. Conclusion Our results suggest that each C/V region has a specific statistical oligonucleotide composition, and that the C (respectively V) regions of one of these lentiviruses are statistically more similar to the C (respectively V) regions of the other lentiviruses, than to the V (respectively C) regions of the same lentivirus. PMID:17376229

Polymerase ribozyme efficiency increased by G/T-rich DNA oligonucleotides

PubMed Central

Yao, Chengguo; Müller, Ulrich F.

2011-01-01

The RNA world hypothesis states that the early evolution of life went through a stage where RNA served as genome and as catalyst. The replication of RNA world organisms would have been facilitated by ribozymes that catalyze RNA polymerization. To recapitulate an RNA world in the laboratory, a series of RNA polymerase ribozymes was developed previously. However, these ribozymes have a polymerization efficiency that is too low for self-replication, and the most efficient ribozymes prefer one specific template sequence. The limiting factor for polymerization efficiency is the weak sequence-independent binding to its primer/template substrate. Most of the known polymerase ribozymes bind an RNA heptanucleotide to form the P2 duplex on the ribozyme. By modifying this heptanucleotide, we were able to significantly increase polymerization efficiency. Truncations at the 3′-terminus of this heptanucleotide increased full-length primer extension by 10-fold, on a specific template sequence. In contrast, polymerization on several different template sequences was improved dramatically by replacing the RNA heptanucleotide with DNA oligomers containing randomized sequences of 15 nt. The presence of G and T in the random sequences was sufficient for this effect, with an optimal composition of 60% G and 40% T. Our results indicate that these DNA sequences function by establishing many weak and nonspecific base-pairing interactions to the single-stranded portion of the template. Such low-specificity interactions could have had important functions in an RNA world. PMID:21622900

Substrate sequence selectivity of APOBEC3A implicates intra-DNA interactions.

PubMed

Silvas, Tania V; Hou, Shurong; Myint, Wazo; Nalivaika, Ellen; Somasundaran, Mohan; Kelch, Brian A; Matsuo, Hiroshi; Kurt Yilmaz, Nese; Schiffer, Celia A

2018-05-14

The APOBEC3 (A3) family of human cytidine deaminases is renowned for providing a first line of defense against many exogenous and endogenous retroviruses. However, the ability of these proteins to deaminate deoxycytidines in ssDNA makes A3s a double-edged sword. When overexpressed, A3s can mutate endogenous genomic DNA resulting in a variety of cancers. Although the sequence context for mutating DNA varies among A3s, the mechanism for substrate sequence specificity is not well understood. To characterize substrate specificity of A3A, a systematic approach was used to quantify the affinity for substrate as a function of sequence context, length, secondary structure, and solution pH. We identified the A3A ssDNA binding motif as (T/C)TC(A/G), which correlated with enzymatic activity. We also validated that A3A binds RNA in a sequence specific manner. A3A bound tighter to substrate binding motif within a hairpin loop compared to linear oligonucleotide, suggesting A3A affinity is modulated by substrate structure. Based on these findings and previously published A3A-ssDNA co-crystal structures, we propose a new model with intra-DNA interactions for the molecular mechanism underlying A3A sequence preference. Overall, the sequence and structural preferences identified for A3A leads to a new paradigm for identifying A3A's involvement in mutation of endogenous or exogenous DNA.

Nonenzymatic template-directed synthesis on hairpin oligonucleotides. 3. Incorporation of adenosine and uridine residues

NASA Technical Reports Server (NTRS)

Wu, T.; Orgel, L. E.

1992-01-01

We have used [32P]-labeled hairpin oligonucleotides to study template-directed synthesis on templates containing one or more A or T residues within a run of C residues. When nucleoside-5'-phosphoro(2-methyl)imidazolides are used as substrates, isolated A and T residues function efficiently in facilitating the incorporation of U and A, respectively. The reactions are regiospecific, producing mainly 3'-5'-phosphodiester bonds. Pairs of consecutive non-C residues are copied much less efficiently. Limited synthesis of CA and AC sequences on templates containing TG and GT sequences was observed along with some synthesis of the AA sequences on templates containing TT sequences. The other dimer sequences investigated, AA, AG, GA, TA, and AT, could not be copied. If A is absent from the reaction mixture, misincorporation of G residues is a significant reaction on templates containing an isolated T residue or two consecutive T residues. However, if both A and G are present, A is incorporated to a much greater extent than G. We believe that wobble-pairing between T and G is responsible for misincorporation when only G is present.

CODEHOP (COnsensus-DEgenerate Hybrid Oligonucleotide Primer) PCR primer design

PubMed Central

Rose, Timothy M.; Henikoff, Jorja G.; Henikoff, Steven

2003-01-01

We have developed a new primer design strategy for PCR amplification of distantly related gene sequences based on consensus-degenerate hybrid oligonucleotide primers (CODEHOPs). An interactive program has been written to design CODEHOP PCR primers from conserved blocks of amino acids within multiply-aligned protein sequences. Each CODEHOP consists of a pool of related primers containing all possible nucleotide sequences encoding 3–4 highly conserved amino acids within a 3′ degenerate core. A longer 5′ non-degenerate clamp region contains the most probable nucleotide predicted for each flanking codon. CODEHOPs are used in PCR amplification to isolate distantly related sequences encoding the conserved amino acid sequence. The primer design software and the CODEHOP PCR strategy have been utilized for the identification and characterization of new gene orthologs and paralogs in different plant, animal and bacterial species. In addition, this approach has been successful in identifying new pathogen species. The CODEHOP designer (http://blocks.fhcrc.org/codehop.html) is linked to BlockMaker and the Multiple Alignment Processor within the Blocks Database World Wide Web (http://blocks.fhcrc.org). PMID:12824413

Mode of inheritance and evidence for cistron heterogeneity of chloroplast 16S ribosomal RNA genes in Nicotiana.

PubMed

Vacek, A T; Bourque, D P

1980-09-01

Oligonucleotide maps (fingerprints) of T1 RNase digests of 125I-labeled 16 S chloroplast rRNA of Nicotiana tabacum and N. gossei revealed the presence of T1 oligonucleotide fragment 100 in the 16 S rRNA of N. gossei while N. tabacum 16 S rRNA had a unique T1 oligonucleotide (fragment 101) as well as some fragment 100. From the positions in the fingerprints and from fingerprints of secondary enzymatic digestion of the fragments, we conclude that fragments 100 and 101 are similar in sequence and size, but fragment 100 probably contains an extra uracil residue. This difference is shown to be maternally inherited, thus confirming the location of 16 S chloroplast rRNA genes on chloroplast DNA and ruling out the possibility of genetically active chloroplast rRNA genes in the nucleus. The presence of both fragments 100 and 101 in N. tabacum may indicate sequence heterogeneity between the two cistrons for 16 S chloroplast rRNA. These results demonstrate the feasibility of determining the inheritance of organelle genes by genetic analysis of their primary transcripts.

Optimized synthesis of phosphorothioate oligodeoxyribonucleotides substituted with a 5′-protected thiol function and a 3′-amino group

PubMed Central

Aubert, Yves; Bourgerie, Sylvain; Meunier, Laurent; Mayer, Roger; Roche, Annie-Claude; Monsigny, Michel; Thuong, Nguyen T.; Asseline, Ulysse

2000-01-01

A new deprotection procedure enables a medium scale preparation of phosphodiester and phosphorothioate oligonucleotides substituted with a protected thiol function at their 5′-ends and an amino group at their 3′-ends in good yield (up to 72 OD units/µmol for a 19mer phosphorothioate). Syntheses of 3′-amino-substituted oligonucleotides were carried out on a modified support. A linker containing the thioacetyl moiety was manually coupled in two steps by first adding its phosphoramidite derivative in the presence of tetrazole followed by either oxidation or sulfurization to afford the bis-derivatized oligonucleotide bound to the support. Deprotection was achieved by treating the fully protected oligonucleotide with a mixture of 2,2′-dithiodipyridine and concentrated aqueous ammonia in the presence of phenol and methanol. This procedure enables (i) cleavage of the oligonucleotide from the support, releasing the oligonucleotide with a free amino group at its 3′-end, (ii) deprotection of the phosphate groups and the amino functions of the nucleic bases, as well as (iii) transformation of the 5′-terminal S-acetyl function into a dithiopyridyl group. The bis-derivatized phosphorothioate oligomer was further substituted through a two-step procedure: first, the 3′-amino group was reacted with fluorescein isothiocyanate to yield a fluoresceinylated oligonucleotide; the 5′-dithiopyridyl group was then quantitatively reduced to give a free thiol group which was then substituted by reaction with an Nα-bromoacetyl derivative of a signal peptide containing a KDEL sequence to afford a fluoresceinylated peptide–oligonucleotide conjugate. PMID:10637335

Identification of ecotype-specific marker genes for categorization of beer-spoiling Lactobacillus brevis.

PubMed

Behr, Jürgen; Geissler, Andreas J; Preissler, Patrick; Ehrenreich, Armin; Angelov, Angel; Vogel, Rudi F

2015-10-01

The tolerance to hop compounds, which is mainly associated with inhibition of bacterial growth in beer, is a multi-factorial trait. Any approaches to predict the physiological differences between beer-spoiling and non-spoiling strains on the basis of a single marker gene are limited. We identified ecotype-specific genes related to the ability to grow in Pilsner beer via comparative genome sequencing. The genome sequences of four different strains of Lactobacillus brevis were compared, including newly established genomes of two highly hop tolerant beer isolates, one strain isolated from faeces and one published genome of a silage isolate. Gene fragments exclusively occurring in beer-spoiling strains as well as sequences only occurring in non-spoiling strains were identified. Comparative genomic arrays were established and hybridized with a set of L. brevis strains, which are characterized by their ability to spoil beer. As result, a set of 33 and 4 oligonucleotide probes could be established specifically detecting beer-spoilers and non-spoilers, respectively. The detection of more than one of these marker sequences according to a genetic barcode enables scoring of L. brevis for their beer-spoiling potential and can thus assist in risk evaluation in brewing industry. Copyright © 2015 Elsevier Ltd. All rights reserved.

Detection of cystic fibrosis mutations in a GeneChip{trademark} assay format

DOE Office of Scientific and Technical Information (OSTI.GOV)

Miyada, C.G.; Cronin, M.T.; Kim, S.M.

1994-09-01

We are developing assays for the detection of cystic fibrosis mutations based on DNA hybridization. A DNA sample is amplified by PCR, labeled by incorporating a fluorescein-tagged dNTP, enzymatically treated to produce smaller fragments and hybridized to a series of short (13-16 bases) oligonucleotides synthesized on a glass surface via photolithography. The hybrids are detected by eqifluorescence and mutations are identified by the specific pattern of hybridization. In a GeneChip assay, the chip surface is composed of a series of subarrays, each being specific for a particular mutation. Each subarray is further subdivided into a series of probes (40 total),more » half based on the mutant sequence and the remainder based on the wild-type sequence. For each of the subarrays, there is a redundancy in the number of probes that should hybridize to either a wild-type or a mutant target. The multiple probe strategy provides sequence information for a short five base region overlapping the mutation site. In addition, homozygous wild-type and mutant as well as heterozygous samples are each identified by a specific pattern of hybridization. The small size of each probe feature (250 x 250 {mu}m{sup 2}) permits the inclusion of additional probes required to generate sequence information by hybridization.« less

Stability of non-Watson-Crick G-A/A-G base pair in synthetic DNA and RNA oligonucleotides.

PubMed

Ito, Yuko; Sone, Yumiko; Mizutani, Takaharu

2004-03-01

A non-Watson-Crick G-A/A-G base pair is found in SECIS (selenocysteine-insertion sequence) element in the 3'-untranslated region of Se-protein mRNAs and in the functional site of the hammerhead ribozyme. We studied the stability of G-A/A-G base pair (bold) in 17mer GT(U)GACGGAAACCGGAAC synthetic DNA and RNA oligonucleotides by thermal melting experiments and gel electrophoresis. The measured Tm value of DNA oligonucleotide having G-A/A-G pair showed an intermediate value (58 degrees C) between that of Watson-Crick G-C/C-G base pair (75 degrees C) and that of G-G/A-A of non-base-pair (40 degrees C). Similar thermal melting patterns were obtained with RNA oligonucleotides. This result indicates that the secondary structure of oligonucleotide having G-A/A-G base pair is looser than that of the G-C type Watson-Crick base pair. In the comparison between RNA and DNA having G-A/A-G base pair, the Tm value of the RNA oligonucleotide was 11 degrees C lower than that of DNA, indicating that DNA has a more rigid structure than RNA. The stained pattern of oligonucleotide on polyacrylamide gel clarified that the mobility of the DNA oligonucleotide G-A/A-G base pair changed according to the urea concentration from the rigid state (near the mobility of G-C/C-G oligonucleotide) in the absence of urea to the random state (near the mobility of G-G/A-A oligonucleotide) in 7 M urea. However, the RNA oligonucleotide with G-A/A-G pair moved at an intermediate mobility between that of oligonucleotide with G-C/C-G and of the oligonucleotide with G-G/A-A, and the mobility pattern did not depend on urea concentration. Thus, DNA and RNA oligonucleotides with the G-A/A-G base pair showed a pattern indicating an intermediate structure between the rigid Watson-Crick base pair and the random structure of non-base pair. RNA with G-A/A-G base pair has the intermediate structure not influenced by urea concentration. Finally, this study indicated that the intermediate rigidity imparted by Non-Watson-Crick base pair in SECIS element plays an important role in the selenocysteine expression by UGA codon.

Molecular diversity, cultivation, and improved detection by fluorescent in situ hybridization of a dominant group of human gut bacteria related to Roseburia spp. or Eubacterium rectale.

PubMed

Aminov, Rustam I; Walker, Alan W; Duncan, Sylvia H; Harmsen, Hermie J M; Welling, Gjalt W; Flint, Harry J

2006-09-01

Phylogenetic analysis was used to compare 16S rRNA sequences from 19 cultured human gut strains of Roseburia and Eubacterium rectale with 356 related sequences derived from clone libraries. The cultured strains were found to represent five of the six phylotypes identified. A new oligonucleotide probe, Rrec584, and the previous group probe Rint623, when used in conjunction with a new helper oligonucleotide, each recognized an average of 7% of bacteria detected by the eubacterial probe Eub338 in feces from 10 healthy volunteers. Most of the diversity within this important group of butyrate-producing gut bacteria can apparently be retrieved through cultivation.

Molecular Diversity, Cultivation, and Improved Detection by Fluorescent In Situ Hybridization of a Dominant Group of Human Gut Bacteria Related to Roseburia spp. or Eubacterium rectale

PubMed Central

Aminov, Rustam I.; Walker, Alan W.; Duncan, Sylvia H.; Harmsen, Hermie J. M.; Welling, Gjalt W.; Flint, Harry J.

2006-01-01

Phylogenetic analysis was used to compare 16S rRNA sequences from 19 cultured human gut strains of Roseburia and Eubacterium rectale with 356 related sequences derived from clone libraries. The cultured strains were found to represent five of the six phylotypes identified. A new oligonucleotide probe, Rrec584, and the previous group probe Rint623, when used in conjunction with a new helper oligonucleotide, each recognized an average of 7% of bacteria detected by the eubacterial probe Eub338 in feces from 10 healthy volunteers. Most of the diversity within this important group of butyrate-producing gut bacteria can apparently be retrieved through cultivation. PMID:16957265

Application of a unique server-based oligonucleotide probe selection tool toward a novel biosensor for the detection of Streptococcus pyogenes.

PubMed

Nugen, Sam R; Leonard, Barbara; Baeumner, Antje J

2007-05-15

We developed a software program for the rapid selection of detection probes to be used in nucleic acid-based assays. In comparison to commercially available software packages, our program allows the addition of oligotags as required by nucleic acid sequence-based amplification (NASBA) as well as automatic BLAST searches for all probe/primer pairs. We then demonstrated the usefulness of the program by designing a novel lateral flow biosensor for Streptococcus pyogenes that does not rely on amplification methods such as the polymerase chain reaction (PCR) or NASBA to obtain low limits of detection, but instead uses multiple reporter and capture probes per target sequence and an instantaneous amplification via dye-encapsulating liposomes. These assays will decrease the detection time to just a 20 min hybridization reaction and avoid costly enzymatic gene amplification reactions. The lateral flow assay was developed quantifying the 16S rRNA from S. pyogenes by designing reporter and capture probes that specifically hybridize with the RNA and form a sandwich. DNA reporter probes were tagged with dye-encapsulating liposomes, biotinylated DNA oligonucleotides were used as capture probes. From the initial number of capture and reporter probes chosen, a combination of two capture and three reporter probes were found to provide optimal signal generation and significant enhancement over single capture/reporter probe combinations. The selectivity of the biosensor was proven by analyzing organisms closely related to S. pyogenes, such as other Streptococcus and Enterococcus species. All probes had been selected by the software program within minutes and no iterative optimization and re-design of the oligonucleotides was required which enabled a very rapid biosensor prototyping. While the sensitivity obtained with the biosensor was only 135 ng, future experiments will decrease this significantly by the addition of more reporter and capture probes for either the same rRNA or a different nucleic acid target molecule. This will lead to the possibility of detecting S. pyogenes with a rugged assay that does not require a cell culturing or gene amplification step and will therefore enable rapid, specific and sensitive onsite testing.

Solid-Phase Synthesis of Difficult Purine-Rich PNAs through Selective Hmb Incorporation: Application to the Total Synthesis of Cell Penetrating Peptide-PNAs

PubMed Central

Tailhades, Julien; Takizawa, Hotake; Gait, Michael J.; Wellings, Don A.; Wade, John D.; Aoki, Yoshitsugu; Shabanpoor, Fazel

2017-01-01

Antisense oligonucleotide (ASO)-based drug development is gaining significant momentum following the recent FDA approval of Eteplirsen (an ASO based on phosphorodiamidate morpholino) and Spinraza (2′-O-methoxyethyl-phosphorothioate) in late 2016. Their attractiveness is mainly due to the backbone modifications which have improved the in vivo characteristics of oligonucleotide drugs. Another class of ASO, based on peptide nucleic acid (PNA) chemistry, is also gaining popularity as a platform for development of gene-specific therapy for various disorders. However, the chemical synthesis of long PNAs, which are more target-specific, remains an ongoing challenge. Most of the reported methodology for the solid-phase synthesis of PNA suffer from poor coupling efficiency which limits production to short PNA sequences of less than 15 residues. Here, we have studied the effect of backbone modifications with Hmb (2-hydroxy-4-methoxybenzyl) and Dmb (2,4-dimethoxybenzyl) to ameliorate difficult couplings and reduce “on-resin” aggregation. We firstly synthesized a library of PNA dimers incorporating either Hmb or Dmb and identified that Hmb is superior to Dmb in terms of its ease of removal. Subsequently, we used Hmb backbone modification to synthesize a 22-mer purine-rich PNA, targeting dystrophin RNA splicing, which could not be synthesized by standard coupling methodology. Hmb backbone modification allowed this difficult PNA to be synthesized as well as to be continued to include a cell-penetrating peptide on the same solid support. This approach provides a novel and straightforward strategy for facile solid-phase synthesis of difficult purine-rich PNA sequences. PMID:29094037

Solid-Phase Synthesis of Difficult Purine-Rich PNAs through Selective Hmb Incorporation: Application to the Total Synthesis of Cell Penetrating Peptide-PNAs.

PubMed

Tailhades, Julien; Takizawa, Hotake; Gait, Michael J; Wellings, Don A; Wade, John D; Aoki, Yoshitsugu; Shabanpoor, Fazel

2017-01-01

Antisense oligonucleotide (ASO)-based drug development is gaining significant momentum following the recent FDA approval of Eteplirsen (an ASO based on phosphorodiamidate morpholino) and Spinraza (2'- O -methoxyethyl-phosphorothioate) in late 2016. Their attractiveness is mainly due to the backbone modifications which have improved the in vivo characteristics of oligonucleotide drugs. Another class of ASO, based on peptide nucleic acid (PNA) chemistry, is also gaining popularity as a platform for development of gene-specific therapy for various disorders. However, the chemical synthesis of long PNAs, which are more target-specific, remains an ongoing challenge. Most of the reported methodology for the solid-phase synthesis of PNA suffer from poor coupling efficiency which limits production to short PNA sequences of less than 15 residues. Here, we have studied the effect of backbone modifications with Hmb (2-hydroxy-4-methoxybenzyl) and Dmb (2,4-dimethoxybenzyl) to ameliorate difficult couplings and reduce "on-resin" aggregation. We firstly synthesized a library of PNA dimers incorporating either Hmb or Dmb and identified that Hmb is superior to Dmb in terms of its ease of removal. Subsequently, we used Hmb backbone modification to synthesize a 22-mer purine-rich PNA, targeting dystrophin RNA splicing, which could not be synthesized by standard coupling methodology. Hmb backbone modification allowed this difficult PNA to be synthesized as well as to be continued to include a cell-penetrating peptide on the same solid support. This approach provides a novel and straightforward strategy for facile solid-phase synthesis of difficult purine-rich PNA sequences.

Solid-phase synthesis of difficult purine-rich PNAs through selective Hmb incorporation: Application to the total synthesis of cell penetrating peptide-PNAs

NASA Astrophysics Data System (ADS)

Tailhades, Julien; Takizawa, Hotake; Gait, Michael J.; Wellings, Don A.; Wade, John D.; Aoki, Yoshitsugu; Shabanpoor, Fazel

2017-10-01

Antisense oligonucleotide (ASO)-based drug development is gaining significant momentum following the recent FDA approval of Eteplirsen (an ASO based on phosphorodiamidate morpholino) and Spinraza (2’-O-methoxyethyl-phosphorothioate) in late 2016. Their attractiveness is mainly due to the backbone modifications which have improved the in vivo characteristics of oligonucleotide drugs. Another class of ASO, based on peptide nucleic acid (PNA) chemistry, is also gaining popularity as a platform for development of gene-specific therapy for various disorders. However, the chemical synthesis of long PNAs, which are more target-specific, remains an ongoing challenge. Most of the reported methodology for the solid-phase synthesis of PNA suffer from poor coupling efficiency which limits production to short PNA sequences of less than 15 residues. Here we have studied the effect of backbone modifications with Hmb (2-hydroxy-4-methoxybenzyl) and Dmb (2,4-dimethoxybenzyl) to ameliorate difficult couplings and reduce “on-resin” aggregation. We firstly synthesized a library of PNA dimers incorporating either Hmb or Dmb and identified that Hmb is superior to Dmb in terms of its ease of removal. Subsequently, we used Hmb backbone modification to synthesize a 22-mer purine-rich PNA, targeting dystrophin RNA splicing, which could not be synthesized by standard coupling methodology. Hmb backbone modification allowed this difficult PNA to be synthesized as well as to be continued to include a cell-penetrating peptide on the same solid support. This approach provides a novel and straightforward strategy for facile solid-phase synthesis of difficult purine-rich PNA sequences.

A Highly Sensitive Oligonucleotide Hybridization Assay for Klebsiella pneumoniae Carbapenemase with the Probes on a Gold Nanoparticles Modified Glassy Carbon Electrode.

PubMed

Pan, Hong-zhi; Yu, Hong- Wei; Wang, Na; Zhang, Ze; Wan, Guang-Cai; Liu, Hao; Guan, Xue; Chang, Dong

2015-01-01

To develop a new electrochemical DNA biosensor for determination of Klebsiella pneumoniae carbapenemase, a highly sensitive and selective electrochemical biosensor for DNA detection was constructed based on a glassy carbon electrode (GCE) modified with gold nanoparticles (Au-nano). The Au-nano/GCE was characterized by scanning electromicroscopy, cyclic voltammetry, and electrochemical impedance spectroscopy. The hybridization detection was measured by differential pulse voltammetry using methylene blue as the hybridization indicator. The dynamic range of detection of the sensor for the target DNA sequences was from 1 × 10(-11) to 1 × 10(-8) M, with an LOD of 1 × 10(-12) M. The DNA biosensor had excellent specificity for distinguishing complementary DNA sequence in the presence of non-complementary and mismatched DNA sequence. The Au-nano/GCE showed significant improvement in electrochemical characteristics, and this biosensor was successfully applied for determination of K. pneumoniae.

A low density microarray method for the identification of human papillomavirus type 18 variants.

PubMed

Meza-Menchaca, Thuluz; Williams, John; Rodríguez-Estrada, Rocío B; García-Bravo, Aracely; Ramos-Ligonio, Ángel; López-Monteon, Aracely; Zepeda, Rossana C

2013-09-26

We describe a novel microarray based-method for the screening of oncogenic human papillomavirus 18 (HPV-18) molecular variants. Due to the fact that sequencing methodology may underestimate samples containing more than one variant we designed a specific and sensitive stacking DNA hybridization assay. This technology can be used to discriminate between three possible phylogenetic branches of HPV-18. Probes were attached covalently on glass slides and hybridized with single-stranded DNA targets. Prior to hybridization with the probes, the target strands were pre-annealed with the three auxiliary contiguous oligonucleotides flanking the target sequences. Screening HPV-18 positive cell lines and cervical samples were used to evaluate the performance of this HPV DNA microarray. Our results demonstrate that the HPV-18's variants hybridized specifically to probes, with no detection of unspecific signals. Specific probes successfully reveal detectable point mutations in these variants. The present DNA oligoarray system can be used as a reliable, sensitive and specific method for HPV-18 variant screening. Furthermore, this simple assay allows the use of inexpensive equipment, making it accessible in resource-poor settings.

A Low Density Microarray Method for the Identification of Human Papillomavirus Type 18 Variants

PubMed Central

Meza-Menchaca, Thuluz; Williams, John; Rodríguez-Estrada, Rocío B.; García-Bravo, Aracely; Ramos-Ligonio, Ángel; López-Monteon, Aracely; Zepeda, Rossana C.

2013-01-01

We describe a novel microarray based-method for the screening of oncogenic human papillomavirus 18 (HPV-18) molecular variants. Due to the fact that sequencing methodology may underestimate samples containing more than one variant we designed a specific and sensitive stacking DNA hybridization assay. This technology can be used to discriminate between three possible phylogenetic branches of HPV-18. Probes were attached covalently on glass slides and hybridized with single-stranded DNA targets. Prior to hybridization with the probes, the target strands were pre-annealed with the three auxiliary contiguous oligonucleotides flanking the target sequences. Screening HPV-18 positive cell lines and cervical samples were used to evaluate the performance of this HPV DNA microarray. Our results demonstrate that the HPV-18's variants hybridized specifically to probes, with no detection of unspecific signals. Specific probes successfully reveal detectable point mutations in these variants. The present DNA oligoarray system can be used as a reliable, sensitive and specific method for HPV-18 variant screening. Furthermore, this simple assay allows the use of inexpensive equipment, making it accessible in resource-poor settings. PMID:24077317

Detection of Plasmodium sp. in capybara.

PubMed

dos Santos, Leonilda Correia; Curotto, Sandra Mara Rotter; de Moraes, Wanderlei; Cubas, Zalmir Silvino; Costa-Nascimento, Maria de Jesus; de Barros Filho, Ivan Roque; Biondo, Alexander Welker; Kirchgatter, Karin

2009-07-07

In the present study, we have microscopically and molecularly surveyed blood samples from 11 captive capybaras (Hydrochaeris hydrochaeris) from the Sanctuary Zoo for Plasmodium sp. infection. One animal presented positive on blood smear by light microscopy. Polymerase chain reaction was carried out accordingly using a nested genus-specific protocol, which uses oligonucleotides from conserved sequences flanking a variable sequence region in the small subunit ribosomal RNA (ssrRNA) of all Plasmodium organisms. This revealed three positive animals. Products from two samples were purified and sequenced. The results showed less than 1% divergence between the two capybara sequences. When compared with GenBank sequences, a 55% similarity was obtained to Toxoplasma gondii and a higher similarity (73-77.2%) was found to ssrRNAs from Plasmodium species that infect reptile, avian, rodents, and human beings. The most similar Plasmodium sequence was from Plasmodium mexicanum that infects lizards of North America, where around 78% identity was found. This work is the first report of Plasmodium in capybaras, and due to the low similarity with other Plasmodium species, we suggest it is a new species, which, in the future could be denominated "Plasmodium hydrochaeri".

Systematic Validation and Atomic Force Microscopy of Non-Covalent Short Oligonucleotide Barcode Microarrays

PubMed Central

Cook, Michael A.; Chan, Chi-Kin; Jorgensen, Paul; Ketela, Troy; So, Daniel; Tyers, Mike; Ho, Chi-Yip

2008-01-01

Background Molecular barcode arrays provide a powerful means to analyze cellular phenotypes in parallel through detection of short (20–60 base) unique sequence tags, or “barcodes”, associated with each strain or clone in a collection. However, costs of current methods for microarray construction, whether by in situ oligonucleotide synthesis or ex situ coupling of modified oligonucleotides to the slide surface are often prohibitive to large-scale analyses. Methodology/Principal Findings Here we demonstrate that unmodified 20mer oligonucleotide probes printed on conventional surfaces show comparable hybridization signals to covalently linked 5′-amino-modified probes. As a test case, we undertook systematic cell size analysis of the budding yeast Saccharomyces cerevisiae genome-wide deletion collection by size separation of the deletion pool followed by determination of strain abundance in size fractions by barcode arrays. We demonstrate that the properties of a 13K unique feature spotted 20 mer oligonucleotide barcode microarray compare favorably with an analogous covalently-linked oligonucleotide array. Further, cell size profiles obtained with the size selection/barcode array approach recapitulate previous cell size measurements of individual deletion strains. Finally, through atomic force microscopy (AFM), we characterize the mechanism of hybridization to unmodified barcode probes on the slide surface. Conclusions/Significance These studies push the lower limit of probe size in genome-scale unmodified oligonucleotide microarray construction and demonstrate a versatile, cost-effective and reliable method for molecular barcode analysis. PMID:18253494

Covalent Strategies for Targeting Messenger and Non-Coding RNAs: An Updated Review on siRNA, miRNA and antimiR Conjugates

PubMed Central

Grijalvo, Santiago; Alagia, Adele

2018-01-01

Oligonucleotide-based therapy has become an alternative to classical approaches in the search of novel therapeutics involving gene-related diseases. Several mechanisms have been described in which demonstrate the pivotal role of oligonucleotide for modulating gene expression. Antisense oligonucleotides (ASOs) and more recently siRNAs and miRNAs have made important contributions either in reducing aberrant protein levels by sequence-specific targeting messenger RNAs (mRNAs) or restoring the anomalous levels of non-coding RNAs (ncRNAs) that are involved in a good number of diseases including cancer. In addition to formulation approaches which have contributed to accelerate the presence of ASOs, siRNAs and miRNAs in clinical trials; the covalent linkage between non-viral vectors and nucleic acids has also added value and opened new perspectives to the development of promising nucleic acid-based therapeutics. This review article is mainly focused on the strategies carried out for covalently modifying siRNA and miRNA molecules. Examples involving cell-penetrating peptides (CPPs), carbohydrates, polymers, lipids and aptamers are discussed for the synthesis of siRNA conjugates whereas in the case of miRNA-based drugs, this review article makes special emphasis in using antagomiRs, locked nucleic acids (LNAs), peptide nucleic acids (PNAs) as well as nanoparticles. The biomedical applications of siRNA and miRNA conjugates are also discussed. PMID:29415514

Multicolor fluorescent biosensor for multiplexed detection of DNA.

PubMed

Hu, Rong; Liu, Tao; Zhang, Xiao-Bing; Huan, Shuang-Yan; Wu, Cuichen; Fu, Ting; Tan, Weihong

2014-05-20

Development of efficient methods for highly sensitive and rapid screening of specific oligonucleotide sequences is essential to the early diagnosis of serious diseases. In this work, an aggregated cationic perylene diimide (PDI) derivative was found to efficiently quench the fluorescence emission of a variety of anionic oligonucleotide-labeled fluorophores that emit at wavelengths from the visible to NIR region. This broad-spectrum quencher was then adopted to develop a multicolor biosensor via a label-free approach for multiplexed fluorescent detection of DNA. The aggregated perylene derivative exhibits a very high quenching efficiency on all ssDNA-labeled dyes associated with biosensor detection, having efficiency values of 98.3 ± 0.9%, 97 ± 1.1%, and 98.2 ± 0.6% for FAM, TAMRA, and Cy5, respectively. An exonuclease-assisted autocatalytic target recycling amplification was also integrated into the sensing system. High quenching efficiency combined with autocatalytic target recycling amplification afforded the biosensor with high sensitivity toward target DNA, resulting in a detection limit of 20 pM, which is about 50-fold lower than that of traditional unamplified homogeneous fluorescent assay methods. The quencher did not interfere with the catalytic activity of nuclease, and the biosensor could be manipulated in either preaddition or postaddition manner with similar sensitivity. Moreover, the proposed sensing system allows for simultaneous and multicolor analysis of several oligonucleotides in homogeneous solution, demonstrating its potential application in the rapid screening of multiple biotargets.

Oligonucleotide microarray for the identification of potential mycotoxigenic fungi

PubMed Central

2010-01-01

Background Mycotoxins are secondary metabolites which are produced by numerous fungi and pose a continuous challenge to the safety and quality of food commodities in South Africa. These toxins have toxicologically relevant effects on humans and animals that eat contaminated foods. In this study, a diagnostic DNA microarray was developed for the identification of the most common food-borne fungi, as well as the genes leading to toxin production. Results A total of 40 potentially mycotoxigenic fungi isolated from different food commodities, as well as the genes that are involved in the mycotoxin synthetic pathways, were analyzed. For fungal identification, oligonucleotide probes were designed by exploiting the sequence variations of the elongation factor 1-alpha (EF-1 α) coding regions and the internal transcribed spacer (ITS) regions of the rRNA gene cassette. For the detection of fungi able to produce mycotoxins, oligonucleotide probes directed towards genes leading to toxin production from different fungal strains were identified in data available in the public domain. The probes selected for fungal identification and the probes specific for toxin producing genes were spotted onto microarray slides. Conclusions The diagnostic microarray developed can be used to identify single pure strains or cultures of potentially mycotoxigenic fungi as well as genes leading to toxin production in both laboratory samples and maize-derived foods offering an interesting potential for microbiological laboratories. PMID:20307326

Production of Functional Proteins: Balance of Shear Stress and Gravity

NASA Technical Reports Server (NTRS)

Goodwin, Thomas John (Inventor); Hammond, Timothy Grant (Inventor); Haysen, James Howard (Inventor)

2005-01-01

The present invention provides for a method of culturing cells and inducing the expression of at least one gene in the cell culture. The method provides for contacting the cell with a transcription factor decoy oligonucleotide sequence directed against a nucleotide sequence encoding a shear stress response element.

Coupling molecules and morphology to discover new clades of ciliates.

NASA Astrophysics Data System (ADS)

Grattepanche, J. D.; Maurer-Alcalá, X. X.; Tucker, S. J.; McManus, G. B.; Katz, L. A.

2016-02-01

In a previous study using high-throughput sequencing (Grattepanche et al submitted, oral presentation?), we observe the presence of two clades of spirotrich ciliates mainly present in marine deep-water along the New England coast. These clades, clusters X1 and X2, are characterized by several deletions in their SSU-rDNA and have been observed elsewhere as both identical and similar sequences have been deposited on GenBank from other environmental studies, but lack morphological description. In order to link molecules (SSU-rDNA sequence) to their morphology, we sample below the photic zone (between 60 to 400m of depth) in the New England coast (Northeast Atlantic) in a transect crossing the continental shelf. We designed an oligonucleotide probe specific for choreotrich and oligotrich ciliates and another specific to clusters X1 and X2 to describe these clades through a combination of Fluorescence In Situ Hybridization (FISH) and light microscopy. Our aim is to increase our knowledge on the morphology of these `unknown' clades of ciliates, which will allow for future ecological studies.

Anchoring a Defined Sequence to the 55' Ends of mRNAs : The Bolt to Clone Rare Full Length mRNAs and Generate cDNA Libraries porn a Few Cells.

PubMed

Baptiste, J; Milne Edwards, D; Delort, J; Mallet, J

1993-01-01

Among numerous applications, the polymerase chain reaction (PCR) (1,2) provides a convenient means to clone 5' ends of rare mRNAs and to generate cDNA libraries from tissue available in amounts too low to be processed by conventional methods. Basically, the amplification of cDNAs by the PCR requires the availability of the sequences of two stretches of the molecule to be amplified. A sequence can easily be imposed at the 5' end of the first-strand cDNAs (corresponding to the 3' end of the mRNAs) by priming the reverse transcription with a specific primer (for cloning the 5' end of rare messenger) or with an oligonucleotide tailored with a poly (dT) stretch (for cDNA library construction), taking advantage of the poly (A) sequence that is located at the 3' end of mRNAs. Several strategies have been devised to tag the 3' end of the ss-cDNAs (corresponding to the 55' end of the mRNAs). We (3) and others have described strategies based on the addition of a homopolymeric dG (4,5) or dA (6,7) tail using terminal deoxyribonucleotide transferase (TdT) ("anchor-PCR" [4]). However, this strategy has important limitations. The TdT reaction is difficult to control and has a low efficiency (unpublished observations). But most importantly, the return primers containing a homopolymeric (dC or dT) tail generate nonspecific amplifications, a phenomenon that prevents the isolation of low abundance mRNA species and/or interferes with the relative abundance of primary clones in the library. To circumvent these drawbacks, we have used two approaches. First, we devised a strategy based on a cRNA enrichment procedure, which has been useful to eliminate nonspecific-PCR products and to allow detection and cloning of cDNAs of low abundance (3). More recently, to avoid the nonspecific amplification resulting from the annealing of the homopolymeric tail oligonucleotide, we have developed a novel anchoring strategy that is based on the ligation of an oligonucleotide to the 35' end of ss-cDNAs. This strategy is referred to as SLIC for single-strand ligation to ss-cDNA (8).

Sequence dependence of electron-induced DNA strand breakage revealed by DNA nanoarrays

PubMed Central

Keller, Adrian; Rackwitz, Jenny; Cauët, Emilie; Liévin, Jacques; Körzdörfer, Thomas; Rotaru, Alexandru; Gothelf, Kurt V.; Besenbacher, Flemming; Bald, Ilko

2014-01-01

The electronic structure of DNA is determined by its nucleotide sequence, which is for instance exploited in molecular electronics. Here we demonstrate that also the DNA strand breakage induced by low-energy electrons (18 eV) depends on the nucleotide sequence. To determine the absolute cross sections for electron induced single strand breaks in specific 13 mer oligonucleotides we used atomic force microscopy analysis of DNA origami based DNA nanoarrays. We investigated the DNA sequences 5′-TT(XYX)3TT with X = A, G, C and Y = T, BrU 5-bromouracil and found absolute strand break cross sections between 2.66 · 10−14 cm2 and 7.06 · 10−14 cm2. The highest cross section was found for 5′-TT(ATA)3TT and 5′-TT(ABrUA)3TT, respectively. BrU is a radiosensitizer, which was discussed to be used in cancer radiation therapy. The replacement of T by BrU into the investigated DNA sequences leads to a slight increase of the absolute strand break cross sections resulting in sequence-dependent enhancement factors between 1.14 and 1.66. Nevertheless, the variation of strand break cross sections due to the specific nucleotide sequence is considerably higher. Thus, the present results suggest the development of targeted radiosensitizers for cancer radiation therapy. PMID:25487346

Chemically functionalized gold nanoparticles: Synthesis, characterization, and applications

NASA Astrophysics Data System (ADS)

Daniel, Weston Lewis

This thesis focuses on the development and application of gold nanoparticle based detection systems and biomimetic structures. Each class of modified nanoparticle has properties that are defined by its chemical moieties that interface with solution and the gold nanoparticle core. In Chapter 2, a comparison of the biomolecular composition and binding properties of various preparations of antibody oligonucleotide gold nanoparticle conjugates is presented. These constructs differed significantly in terms of their structure and binding properties. Chapter 3 reports the use of electroless gold deposition as a light scattering signal enhancer in a multiplexed, microarray-based scanometric immunoassay using the gold nanoparticle probes evaluated in Chapter 2. The use of gold development results in greater signal enhancement than the typical silver development, and multiple rounds of metal development were found to increase the resulting signal compared to one development. Chapter 4 describes an amplified scanometric detection method for human telomerase activity. Gold nanoparticles functionalized with specific oligonucleotide sequences can efficiently capture telomerase enzymes and subsequently be elongated. Both the elongated and unmodified oligonucleotide sequences are simultaneously measured. At low telomerase concentrations, elongated strands cannot be detected, but the unmodified sequences, which come from the same probe particles, can be detected because their concentration is higher, providing a novel form of amplification. Chapter 5 reports the development of a novel colorimetric nitrite and nitrate ion assay based upon gold nanoparticle probes functionalized with Griess reaction reagents. This assay takes advantage of the distance-dependent plasmonic properties of the gold nanoparticles and the ability of nitrite ion to facilitate the cross coupling of novel nanoparticle probes. The assay works on the concept of a kinetic end point and can be triggered at the EPA limit for this ion in drinking water. Finally, Chapter 6 describes the synthesis of high density lipoprotein biomimetic nanoparticles capable of binding cholesterol. These structures use a gold nanoparticle core to template the assembly of a mixed phospholipid layer and the adsorption of apolipoprotein A-I. These synthesized structures have the general size and surface composition of natural HDL and bind free cholesterol with a Kd of 4 nM.

Simple and rapid enzymatic method for the synthesis of single-strand oligonucleotides containing trifluorothymidine.

PubMed

Suzuki, Norihiko; Fukushima, Masakazu

2010-11-01

To investigate the mechanism of trifluorothymidine (TFT)-induced DNA damage, we developed an enzymatic method for the synthesis of single-strand oligonucleotides containing TFT-monophosphate residues. Sixteen-mer oligonucleotides and 14-mer 5'-phosphorylated oligonucleotides were annealed to the template of 25-mer, so as to empty one nucleotide site. TFT-triphosphate was incorporated into the site by DNA polymerase and then ligated to 5'-phosphorylated oligonucleotides by DNA ligase. The synthesized 31-mer oligonucleotides containing TFT residues were isolated from the 25-mer complementary template by denaturing polyacrylamide electrophoresis. Using these single-strand oligonucleotides containing TFT residues, the cleavage of TFT residues from DNA, using mismatch uracil-DNA glycosylase (MUG) of E.coli origin, was compared with that of 5-fluorouracil (5FU) and 5-bromodeoxyuridine (BrdU). The TFT/A pair was not cleaved by MUG, while the other pairs, namely, 5FU/A, 5FU/G, BrdU/A, BrdU/G, and TFT/G, were easily cleaved from each synthesized DNA. Thus, this method is useful for obtaining some site-specifically modified oligonucleotides.

Non-lethal sampling for the detection of Myxobolus cerebralis in asymptomatic rainbow trout

USGS Publications Warehouse

Schill, Bane; Waldrop, Thomas; Densmore, Christine; Blazer, Vicki

1999-01-01

We have described in previous reports (Schill et al., 1998) the development of a polymerase chain reaction (PCR) amplification of 18S ribosomal RNA for the detection of Myxozoan parasites. Oligonucleotide primers were developed by multiple alignment of Myxozoan sequence information and analysis by a custom-written computer program (PRIM). Candidate pairs of primer sequences were then analyzed for specificity by BLAST (Basic Local Alignment Search Tool). From these, a set of promising primers (MYXFWD and MYXREV) was chosen for further testing. These were chosen because they should direct detection of a number of Myxozoan species (Table 1). PCR using MXYFWD and MYXREV proved to be robust and relatively free of artifact products. Further, we were able to routinely detect Myxobolus cerebralis in fish tissues (Figure 1).

Dinucleotide repeat polymorphisms in waterfowl (family Anatidae): Characterization of a sex-linked (Z-specific) and 14 autosomal loci

USGS Publications Warehouse

Buchholz, W.G.; Pearce, J.M.; Pierson, B.J.; Scribner, K.T.

1998-01-01

Canada goose (Branta Canadensis) and harlequin duck (Histrionicus histrionicus) DNAs were digested with Sau3AI, and size selected (300-700 bp) fragments were ligated into BamHI-digested pBluscriptII KS+. The enrichment protocol of Ostrander et al.1 was followed. The resulting libraries were screened using a [ƴ-32P]ATP end-labelled (CA)20 oligonucleotides as a hybridization probe. Positive clones were sequenced using cycle-sequencing protocols (Epicentre Technologies, Madison, WI) and primers flanking the inserts. PCR primers were designed to amplify the repeat and yield amplification products of ≈100-200 bp. DNA  samples were screened for variation at these loci using [ƴ-32P]ATP end-labelled primers. The products were resolved using 6% denaturing polyacrylamide gels and autoradiography.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Andersen, G.L.; He, Z.; DeSantis, T.Z.

Microarrays have proven to be a useful and high-throughput method to provide targeted DNA sequence information for up to many thousands of specific genetic regions in a single test. A microarray consists of multiple DNA oligonucleotide probes that, under high stringency conditions, hybridize only to specific complementary nucleic acid sequences (targets). A fluorescent signal indicates the presence and, in many cases, the abundance of genetic regions of interest. In this chapter we will look at how microarrays are used in microbial ecology, especially with the recent increase in microbial community DNA sequence data. Of particular interest to microbial ecologists, phylogeneticmore » microarrays are used for the analysis of phylotypes in a community and functional gene arrays are used for the analysis of functional genes, and, by inference, phylotypes in environmental samples. A phylogenetic microarray that has been developed by the Andersen laboratory, the PhyloChip, will be discussed as an example of a microarray that targets the known diversity within the 16S rRNA gene to determine microbial community composition. Using multiple, confirmatory probes to increase the confidence of detection and a mismatch probe for every perfect match probe to minimize the effect of cross-hybridization by non-target regions, the PhyloChip is able to simultaneously identify any of thousands of taxa present in an environmental sample. The PhyloChip is shown to reveal greater diversity within a community than rRNA gene sequencing due to the placement of the entire gene product on the microarray compared with the analysis of up to thousands of individual molecules by traditional sequencing methods. A functional gene array that has been developed by the Zhou laboratory, the GeoChip, will be discussed as an example of a microarray that dynamically identifies functional activities of multiple members within a community. The recent version of GeoChip contains more than 24,000 50mer oligonucleotide probes and covers more than 10,000 gene sequences in 150 gene categories involved in carbon, nitrogen, sulfur, and phosphorus cycling, metal resistance and reduction, and organic contaminant degradation. GeoChip can be used as a generic tool for microbial community analysis, and also link microbial community structure to ecosystem functioning. Examples of the application of both arrays in different environmental samples will be described in the two subsequent sections.« less

Functionalization of quantum rods with oligonucleotides for programmable assembly with DNA origami

NASA Astrophysics Data System (ADS)

Doane, Tennyson L.; Alam, Rabeka; Maye, Mathew M.

2015-02-01

The DNA-mediated self-assembly of CdSe/CdS quantum rods (QRs) onto DNA origami is described. Two QR types with unique optical emission and high polarization were synthesized, and then functionalized with oligonucleotides (ssDNA) using a novel protection-deprotection approach, which harnessed ssDNA's tailorable rigidity and denaturation temperature to increase DNA coverage by reducing non-specific coordination and wrapping. The QR assembly was programmable, and occurred at two different assembly zones that had capture strands in parallel alignment. QRs with different optical properties were assembled, opening up future studies on orientation dependent QR FRET. The QR-origami conjugates could be purified via gel electrophoresis and sucrose gradient ultracentrifugation. Assembly yields, QR stoichiometry and orientation, as well as energy transfer implications were studied in light of QR distances, origami flexibility, and conditions.The DNA-mediated self-assembly of CdSe/CdS quantum rods (QRs) onto DNA origami is described. Two QR types with unique optical emission and high polarization were synthesized, and then functionalized with oligonucleotides (ssDNA) using a novel protection-deprotection approach, which harnessed ssDNA's tailorable rigidity and denaturation temperature to increase DNA coverage by reducing non-specific coordination and wrapping. The QR assembly was programmable, and occurred at two different assembly zones that had capture strands in parallel alignment. QRs with different optical properties were assembled, opening up future studies on orientation dependent QR FRET. The QR-origami conjugates could be purified via gel electrophoresis and sucrose gradient ultracentrifugation. Assembly yields, QR stoichiometry and orientation, as well as energy transfer implications were studied in light of QR distances, origami flexibility, and conditions. Electronic supplementary information (ESI) available: Experimental conditions, DNA origami blueprint and sequences, FRET calculations. Additional Fig. S1-S13. See DOI: 10.1039/c4nr07662a

Evaluation of sequence alignments and oligonucleotide probes with respect to three-dimensional structure of ribosomal RNA using ARB software package

PubMed Central

Kumar, Yadhu; Westram, Ralf; Kipfer, Peter; Meier, Harald; Ludwig, Wolfgang

2006-01-01

Background Availability of high-resolution RNA crystal structures for the 30S and 50S ribosomal subunits and the subsequent validation of comparative secondary structure models have prompted the biologists to use three-dimensional structure of ribosomal RNA (rRNA) for evaluating sequence alignments of rRNA genes. Furthermore, the secondary and tertiary structural features of rRNA are highly useful and successfully employed in designing rRNA targeted oligonucleotide probes intended for in situ hybridization experiments. RNA3D, a program to combine sequence alignment information with three-dimensional structure of rRNA was developed. Integration into ARB software package, which is used extensively by the scientific community for phylogenetic analysis and molecular probe designing, has substantially extended the functionality of ARB software suite with 3D environment. Results Three-dimensional structure of rRNA is visualized in OpenGL 3D environment with the abilities to change the display and overlay information onto the molecule, dynamically. Phylogenetic information derived from the multiple sequence alignments can be overlaid onto the molecule structure in a real time. Superimposition of both statistical and non-statistical sequence associated information onto the rRNA 3D structure can be done using customizable color scheme, which is also applied to a textual sequence alignment for reference. Oligonucleotide probes designed by ARB probe design tools can be mapped onto the 3D structure along with the probe accessibility models for evaluation with respect to secondary and tertiary structural conformations of rRNA. Conclusion Visualization of three-dimensional structure of rRNA in an intuitive display provides the biologists with the greater possibilities to carry out structure based phylogenetic analysis. Coupled with secondary structure models of rRNA, RNA3D program aids in validating the sequence alignments of rRNA genes and evaluating probe target sites. Superimposition of the information derived from the multiple sequence alignment onto the molecule dynamically allows the researchers to observe any sequence inherited characteristics (phylogenetic information) in real-time environment. The extended ARB software package is made freely available for the scientific community via . PMID:16672074

Development of MTL-CEBPA: Small Activating RNA Drug for Hepatocellular Carcinoma.

PubMed

Setten, Ryan L; Lightfoot, Helen L; Habib, Nagy A; Rossi, John J

2018-06-10

Oligonucleotide drug development has revolutionised the drug discovery field allowing the notoriously "undruggable" genome to potentially become "druggable". Within this field, 'small' or 'short' activating RNAs (saRNA) are a more recently discovered category of short double stranded RNA with clinical potential. SaRNAs promote endogenous transcription from target loci, a phenomenon widely observed in mammals known as RNA activation (RNAa). The ability to target a particular gene is dependent on the sequence of the saRNA. Hence, the potential clinical application of saRNA is to increase target gene expression in a sequence specific manner. SaRNA based oligonucleotide therapeutics present great promise in expanding the "druggable" genome with particular areas of interest including transcription factor activation and haploinsufficency. Review and Conclusion: In this mini-review, we describe the pre-clinical development of the first saRNA drug to enter the clinic. This saRNA, referred to as MTL-CEBPA, induces transcription of the transcription factor CCAAT/enhancer-binding protein alpha (CEBPα), a tumour suppressor and critical regulator of hepatocyte function. MTL-CEBPA is presently in Phase I clinical trials for hepatocellular carcinoma (HCC). The clinical development of MTL-CEBPA will demonstrate "proof of concept", showing that saRNAs can provide the basis for drugs which enhance targeted gene expression and consequently improve disease outcome in patients. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

Biochemical and structural characterization of a novel cooperative binding mode by Pit-1 with CATT repeats in the macrophage migration inhibitory factor promoter

PubMed Central

Agarwal, Sorabh

2018-01-01

Abstract Overexpression of the proinflammatory cytokine macrophage migration inhibitory factor (MIF) is linked to a number of autoimmune diseases and cancer. MIF production has been correlated to the number of CATT repeats in a microsatellite region upstream of the MIF gene. We have characterized the interaction of pituitary-specific positive transcription factor 1 (Pit-1) with a portion of the MIF promoter region flanking a microsatellite polymorphism (−794 CATT5–8). Using fluorescence anisotropy, we quantified tight complex formation between Pit-1 and an oligonucleotide consisting of eight consecutive CATT repeats (8xCATT) with an apparent Kd of 35 nM. Using competition experiments we found a 23 base pair oligonucleotide with 4xCATT repeats to be the minimum DNA sequence necessary for high affinity interaction with Pit-1. The stoichiometry of the Pit-1 DNA interaction was determined to be 2:1 and binding is cooperative in nature. We subsequently structurally characterized the complex and discovered a completely novel binding mode for Pit-1 in contrast to previously described Pit-1 complex structures. The affinity of Pit-1 for the CATT target sequence was found to be highly dependent on cooperativity. This work lays the groundwork for understanding transcriptional regulation of MIF and pursuing Pit-1 as a therapeutic target to treat MIF-mediated inflammatory disorders. PMID:29186613

Detection of mercury(II) ions using colorimetric gold nanoparticles on paper-based analytical devices.

PubMed

Chen, Guan-Hua; Chen, Wei-Yu; Yen, Yu-Chun; Wang, Chia-Wei; Chang, Huan-Tsung; Chen, Chien-Fu

2014-07-15

An on-field colorimetric sensing strategy employing gold nanoparticles (AuNPs) and a paper-based analytical platform was investigated for mercury ion (Hg(2+)) detection at water sources. By utilizing thymine-Hg(2+)-thymine (T-Hg(2+)-T) coordination chemistry, label-free detection oligonucleotide sequences were attached to unmodified gold nanoparticles to provide rapid mercury ion sensing without complicated and time-consuming thiolated or other costly labeled probe preparation processes. Not only is this strategy's sensing mechanism specific toward Hg(2+), rather than other metal ions, but also the conformational change in the detection oligonucleotide sequences introduces different degrees of AuNP aggregation that causes the color of AuNPs to exhibit a mixture variance. To eliminate the use of sophisticated equipment and minimize the power requirement for data analysis and transmission, the color variance of multiple detection results were transferred and concentrated on cellulose-based paper analytical devices, and the data were subsequently transmitted for the readout and storage of results using cloud computing via a smartphone. As a result, a detection limit of 50 nM for Hg(2+) spiked pond and river water could be achieved. Furthermore, multiple tests could be performed simultaneously with a 40 min turnaround time. These results suggest that the proposed platform possesses the capability for sensitive and high-throughput on-site mercury pollution monitoring in resource-constrained settings.

Multifunctional silver nanocluster-hybrid oligonucleotide vehicle for cell imaging and microRNA-targeted gene silencing.

PubMed

Chen, Hau-Yun; Albert, Karunya; Wen, Cheng-Che; Hsieh, Pei-Ying; Chen, Sih-Yu; Huang, Nei-Chung; Lo, Shen-Chuan; Chen, Jen-Kun; Hsu, Hsin-Yun

2017-04-01

Novel therapeutics is urgently needed to prevent cancer-related deaths. MicroRNAs that act as tumor suppressors have been recognized as a next-generation tumor therapy, and the restoration of tumor-suppressive microRNAs using microRNA replacements or mimics may be a less toxic, more effective strategy due to fewer off-target effects. Here, we designed the novel multifunctional oligonucleotide nanocarrier complex composed of a tumor-targeting aptamer sequence specific to mucin 1 (MUC1), poly-cytosine region for fluorescent silver nanocluster (AgNC) synthesis, and complimentary sequence for microRNA miR-34a loading. MiR-34a was employed because of its therapeutic effect of inhibiting oncogene expression and inducing apoptosis in carcinomas. By monitoring the intrinsic fluorescence of AgNC, it was clearly shown that the constructed complex (MUC1-AgNC m -miR-34a) enters MCF-7 cells. To evaluate the efficacy of this nanocarrier for microRNA delivery, we investigated the gene and protein expression levels of downstream miR-34a targets (BCL-2, CDK6, and CCND1) by quantitative PCR and western blotting, respectively, and the results indicated their effective inhibition by miR-34a. This novel multifunctional AgNC-based nanocarrier can aid in improving the efficacy of breast cancer theranostics. Copyright © 2017 Elsevier B.V. All rights reserved.

Incorporation of native antibodies and Fc-fusion proteins on DNA nanostructures via a modular conjugation strategy† †Electronic supplementary information (ESI) available: Experimental methods, DNA origami design, DNA sequences, and additional experimental data. See DOI: 10.1039/c7cc04178k

PubMed Central

Rosier, Bas J. H. M.; Cremers, Glenn A. O.; Engelen, Wouter; Merkx, Maarten; Brunsveld, Luc

2017-01-01

A photocrosslinkable protein G variant was used as an adapter protein to covalently and site-specifically conjugate an antibody and an Fc-fusion protein to an oligonucleotide. This modular approach enables straightforward decoration of DNA nanostructures with complex native proteins while retaining their innate binding affinity, allowing precise control over the nanoscale spatial organization of such proteins for in vitro and in vivo biomedical applications. PMID:28617516

Biorecognition by DNA oligonucleotides after Exposure to Photoresists and Resist Removers

PubMed Central

Dean, Stacey L.; Morrow, Thomas J.; Patrick, Sue; Li, Mingwei; Clawson, Gary; Mayer, Theresa S.; Keating, Christine D.

2013-01-01

Combining biological molecules with integrated circuit technology is of considerable interest for next generation sensors and biomedical devices. Current lithographic microfabrication methods, however, were developed for compatibility with silicon technology rather than bioorganic molecules and consequently it cannot be assumed that biomolecules will remain attached and intact during on-chip processing. Here, we evaluate the effects of three common photoresists (Microposit S1800 series, PMGI SF6, and Megaposit SPR 3012) and two photoresist removers (acetone and 1165 remover) on the ability of surface-immobilized DNA oligonucleotides to selectively recognize their reverse-complementary sequence. Two common DNA immobilization methods were compared: adsorption of 5′-thiolated sequences directly to gold nanowires and covalent attachment of 5′-thiolated sequences to surface amines on silica coated nanowires. We found that acetone had deleterious effects on selective hybridization as compared to 1165 remover, presumably due to incomplete resist removal. Use of the PMGI photoresist, which involves a high temperature bake step, was detrimental to the later performance of nanowire-bound DNA in hybridization assays, especially for DNA attached via thiol adsorption. The other three photoresists did not substantially degrade DNA binding capacity or selectivity for complementary DNA sequences. To determine if the lithographic steps caused more subtle damage, we also tested oligonucleotides containing a single base mismatch. Finally, a two-step photolithographic process was developed and used in combination with dielectrophoretic nanowire assembly to produce an array of doubly-contacted, electrically isolated individual nanowire components on a chip. Post-fabrication fluorescence imaging indicated that nanowire-bound DNA was present and able to selectively bind complementary strands. PMID:23952639

Individual sequences in large sets of gene sequences may be distinguished efficiently by combinations of shared sub-sequences

PubMed Central

Gibbs, Mark J; Armstrong, John S; Gibbs, Adrian J

2005-01-01

Background Most current DNA diagnostic tests for identifying organisms use specific oligonucleotide probes that are complementary in sequence to, and hence only hybridise with the DNA of one target species. By contrast, in traditional taxonomy, specimens are usually identified by 'dichotomous keys' that use combinations of characters shared by different members of the target set. Using one specific character for each target is the least efficient strategy for identification. Using combinations of shared bisectionally-distributed characters is much more efficient, and this strategy is most efficient when they separate the targets in a progressively binary way. Results We have developed a practical method for finding minimal sets of sub-sequences that identify individual sequences, and could be targeted by combinations of probes, so that the efficient strategy of traditional taxonomic identification could be used in DNA diagnosis. The sizes of minimal sub-sequence sets depended mostly on sequence diversity and sub-sequence length and interactions between these parameters. We found that 201 distinct cytochrome oxidase subunit-1 (CO1) genes from moths (Lepidoptera) were distinguished using only 15 sub-sequences 20 nucleotides long, whereas only 8–10 sub-sequences 6–10 nucleotides long were required to distinguish the CO1 genes of 92 species from the 9 largest orders of insects. Conclusion The presence/absence of sub-sequences in a set of gene sequences can be used like the questions in a traditional dichotomous taxonomic key; hybridisation probes complementary to such sub-sequences should provide a very efficient means for identifying individual species, subtypes or genotypes. Sequence diversity and sub-sequence length are the major factors that determine the numbers of distinguishing sub-sequences in any set of sequences. PMID:15817134

Natural antisense transcript-targeted regulation of inducible nitric oxide synthase mRNA levels.

PubMed

Yoshigai, Emi; Hara, Takafumi; Araki, Yoshiro; Tanaka, Yoshito; Oishi, Masaharu; Tokuhara, Katsuji; Kaibori, Masaki; Okumura, Tadayoshi; Kwon, A-Hon; Nishizawa, Mikio

2013-04-01

Natural antisense transcripts (asRNAs) are frequently transcribed from mammalian genes. Recently, we found that non-coding asRNAs are transcribed from the 3' untranslated region (3'UTR) of the rat and mouse genes encoding inducible nitric oxide synthase (iNOS), which catalyzes the production of the inflammatory mediator nitric oxide. The iNOS asRNA stabilizes iNOS mRNA by interacting with the mRNA 3'UTR. Furthermore, single-stranded 'sense' oligonucleotides corresponding to the iNOS mRNA sequence were found to reduce iNOS mRNA levels by interfering with mRNA-asRNA interactions in rat hepatocytes. This method was named natural antisense transcript-targeted regulation (NATRE) technology. In this study, we detected human iNOS asRNA expressed in hepatocarcinoma and colon carcinoma tissues. The human iNOS asRNA harbored a sequence complementary to an evolutionarily conserved region of the iNOS mRNA 3'UTR. When introduced into hepatocytes, iNOS sense oligonucleotides that were modified by substitution with partial phosphorothioate bonds and locked nucleic acids or 2'-O-methyl nucleic acids greatly reduced levels of iNOS mRNA and iNOS protein. Moreover, sense oligonucleotides and short interfering RNAs decreased iNOS mRNA to comparable levels. These results suggest that NATRE technology using iNOS sense oligonucleotides could potentially be used to treat human inflammatory diseases and cancers by reducing iNOS mRNA levels. Copyright © 2013 Elsevier Inc. All rights reserved.

Comparative inhibition of rabbit globin mRNA translation by modified antisense oligodeoxynucleotides.

PubMed Central

Cazenave, C; Stein, C A; Loreau, N; Thuong, N T; Neckers, L M; Subasinghe, C; Hélène, C; Cohen, J S; Toulmé, J J

1989-01-01

We have studied the translation of rabbit globin mRNA in cell free systems (reticulocyte lysate and wheat germ extract) and in microinjected Xenopus oocytes in the presence of anti-sense oligodeoxynucleotides. Results obtained with the unmodified all-oxygen compounds were compared with those obtained when phosphorothioate or alpha-DNA was used. In the wheat germ system a 17-mer sequence targeted to the coding region of beta-globin mRNA was specifically inhibitory when either the unmodified phosphodiester oligonucleotide or its phosphorothioate analogue were used. In contrast no effect was observed with the alpha-oligomer. These results were ascribed to the fact that phosphorothioate oligomers elicit an RNase-H activity comparable to the all-oxygen congeners, while alpha-DNA/mRNA hybrids were a poor substrate. Microinjected Xenopus oocytes followed a similar pattern. The phosphorothioate oligomer was more efficient to prevent translation than the unmodified 17-mer. Inhibition of beta-globin synthesis was observed in the nanomolar concentration range. This result can be ascribed to the nuclease resistance of phosphorothioates as compared to natural phosphodiester linkages, alpha-oligomers were devoid of any inhibitory effect up to 30 microM. Phosphorothioate oligodeoxyribonucleotides were shown to be non-specific inhibitors of protein translation, at concentrations in the micromolar range, in both cell-free systems and oocytes. Non-specific inhibition of translation was dependent on the length of the phosphorothioate oligomer. These non-specific effects were not observed with the unmodified or the alpha-oligonucleotides. Images PMID:2472605

Identifying Group-Specific Sequences for Microbial Communities Using Long k-mer Sequence Signatures

PubMed Central

Wang, Ying; Fu, Lei; Ren, Jie; Yu, Zhaoxia; Chen, Ting; Sun, Fengzhu

2018-01-01

Comparing metagenomic samples is crucial for understanding microbial communities. For different groups of microbial communities, such as human gut metagenomic samples from patients with a certain disease and healthy controls, identifying group-specific sequences offers essential information for potential biomarker discovery. A sequence that is present, or rich, in one group, but absent, or scarce, in another group is considered “group-specific” in our study. Our main purpose is to discover group-specific sequence regions between control and case groups as disease-associated markers. We developed a long k-mer (k ≥ 30 bps)-based computational pipeline to detect group-specific sequences at strain resolution free from reference sequences, sequence alignments, and metagenome-wide de novo assembly. We called our method MetaGO: Group-specific oligonucleotide analysis for metagenomic samples. An open-source pipeline on Apache Spark was developed with parallel computing. We applied MetaGO to one simulated and three real metagenomic datasets to evaluate the discriminative capability of identified group-specific markers. In the simulated dataset, 99.11% of group-specific logical 40-mers covered 98.89% disease-specific regions from the disease-associated strain. In addition, 97.90% of group-specific numerical 40-mers covered 99.61 and 96.39% of differentially abundant genome and regions between two groups, respectively. For a large-scale metagenomic liver cirrhosis (LC)-associated dataset, we identified 37,647 group-specific 40-mer features. Any one of the features can predict disease status of the training samples with the average of sensitivity and specificity higher than 0.8. The random forests classification using the top 10 group-specific features yielded a higher AUC (from ∼0.8 to ∼0.9) than that of previous studies. All group-specific 40-mers were present in LC patients, but not healthy controls. All the assembled 11 LC-specific sequences can be mapped to two strains of Veillonella parvula: UTDB1-3 and DSM2008. The experiments on the other two real datasets related to Inflammatory Bowel Disease and Type 2 Diabetes in Women consistently demonstrated that MetaGO achieved better prediction accuracy with fewer features compared to previous studies. The experiments showed that MetaGO is a powerful tool for identifying group-specific k-mers, which would be clinically applicable for disease prediction. MetaGO is available at https://github.com/VVsmileyx/MetaGO. PMID:29774017

Junctions between i-motif tetramers in supramolecular structures

PubMed Central

Guittet, Eric; Renciuk, Daniel; Leroy, Jean-Louis

2012-01-01

The symmetry of i-motif tetramers gives to cytidine-rich oligonucleotides the capacity to associate into supramolecular structures (sms). In order to determine how the tetramers are linked together in such structures, we have measured by gel filtration chromatography and NMR the formation and dissociation kinetics of sms built by oligonucleotides containing two short C stretches separated by a non-cytidine-base. We show that a stretch of only two cytidines either at the 3′- or 5′-end is long enough to link the tetramers into sms. The analysis of the properties of sms formed by oligonucleotides differing by the length of the oligo-C stretches, the sequence orientation and the nature of the non-C base provides a model of the junction connecting the tetramers in sms. PMID:22362739

DNA binding specificity of the basic-helix-loop-helix protein MASH-1.

PubMed

Meierhan, D; el-Ariss, C; Neuenschwander, M; Sieber, M; Stackhouse, J F; Allemann, R K

1995-09-05

Despite the high degree of sequence similarity in their basic-helix-loop-helix (BHLH) domains, MASH-1 and MyoD are involved in different biological processes. In order to define possible differences between the DNA binding specificities of these two proteins, we investigated the DNA binding properties of MASH-1 by circular dichroism spectroscopy and by electrophoretic mobility shift assays (EMSA). Upon binding to DNA, the BHLH domain of MASH-1 underwent a conformational change from a mainly unfolded to a largely alpha-helical form, and surprisingly, this change was independent of the specific DNA sequence. The same conformational transition could be induced by the addition of 20% 2,2,2-trifluoroethanol. The apparent dissociation constants (KD) of the complexes of full-length MASH-1 with various oligonucleotides were determined from half-saturation points in EMSAs. MASH-1 bound as a dimer to DNA sequences containing an E-box with high affinity KD = 1.4-4.1 x 10(-14) M2). However, the specificity of DNA binding was low. The dissociation constant for the complex between MASH-1 and the highest affinity E-box sequence (KD = 1.4 x 10(-14) M2) was only a factor of 10 smaller than for completely unrelated DNA sequences (KD = approximately 1 x 10(-13) M2). The DNA binding specificity of MASH-1 was not significantly increased by the formation of an heterodimer with the ubiquitous E12 protein. MASH-1 and MyoD displayed similar binding site preferences, suggesting that their different target gene specificities cannot be explained solely by differential DNA binding. An explanation for these findings is provided on the basis of the known crystal structure of the BHLH domain of MyoD.

Homopolymer tail-mediated ligation PCR: a streamlined and highly efficient method for DNA cloning and library construction.

PubMed

Lazinski, David W; Camilli, Andrew

2013-01-01

The amplification of DNA fragments, cloned between user-defined 5' and 3' end sequences, is a prerequisite step in the use of many current applications including massively parallel sequencing (MPS). Here we describe an improved method, called homopolymer tail-mediated ligation PCR (HTML-PCR), that requires very little starting template, minimal hands-on effort, is cost-effective, and is suited for use in high-throughput and robotic methodologies. HTML-PCR starts with the addition of homopolymer tails of controlled lengths to the 3' termini of a double-stranded genomic template. The homopolymer tails enable the annealing-assisted ligation of a hybrid oligonucleotide to the template's recessed 5' ends. The hybrid oligonucleotide has a user-defined sequence at its 5' end. This primer, together with a second primer composed of a longer region complementary to the homopolymer tail and fused to a second 5' user-defined sequence, are used in a PCR reaction to generate the final product. The user-defined sequences can be varied to enable compatibility with a wide variety of downstream applications. We demonstrate our new method by constructing MPS libraries starting from nanogram and sub-nanogram quantities of Vibrio cholerae and Streptococcus pneumoniae genomic DNA.

Animal Viruses Probe dataset (AVPDS) for microarray-based diagnosis and identification of viruses.

PubMed

Yadav, Brijesh S; Pokhriyal, Mayank; Vasishtha, Dinesh P; Sharma, Bhaskar

2014-03-01

AVPDS (Animal Viruses Probe dataset) is a dataset of virus-specific and conserve oligonucleotides for identification and diagnosis of viruses infecting animals. The current dataset contain 20,619 virus specific probes for 833 viruses and their subtypes and 3,988 conserved probes for 146 viral genera. Dataset of virus specific probe has been divided into two fields namely virus name and probe sequence. Similarly conserved probes for virus genera table have genus, and subgroup within genus name and probe sequence. The subgroup within genus is artificially divided subgroups with no taxonomic significance and contains probes which identifies viruses in that specific subgroup of the genus. Using this dataset we have successfully diagnosed the first case of Newcastle disease virus in sheep and reported a mixed infection of Bovine viral diarrhea and Bovine herpesvirus in cattle. These dataset also contains probes which cross reacts across species experimentally though computationally they meet specifications. These probes have been marked. We hope that this dataset will be useful in microarray-based detection of viruses. The dataset can be accessed through the link https://dl.dropboxusercontent.com/u/94060831/avpds/HOME.html.

RNA splicing process analysis for identifying antisense oligonucleotide inhibitors with padlock probe-based isothermal amplification† †Electronic supplementary information (ESI) available: Additional experimental materials, methods, DNA sequences and supplementary figures and tables. See DOI: 10.1039/c7sc01336a Click here for additional data file.

PubMed Central

Ren, Xiaojun; Deng, Ruijie; Wang, Lida; Zhang, Kaixiang

2017-01-01

RNA splicing, which mainly involves two transesterification steps, is a fundamental process of gene expression and its abnormal regulation contributes to serious genetic diseases. Antisense oligonucleotides (ASOs) are genetic control tools that can be used to specifically control genes through alteration of the RNA splicing pathway. Despite intensive research, how ASOs or various other factors influence the multiple processes of RNA splicing still remains obscure. This is largely due to an inability to analyze the splicing efficiency of each step in the RNA splicing process with high sensitivity. We addressed this limitation by introducing a padlock probe-based isothermal amplification assay to achieve quantification of the specific products in different splicing steps. With this amplified assay, the roles that ASOs play in RNA splicing inhibition in the first and second steps could be distinguished. We identified that 5′-ASO could block RNA splicing by inhibiting the first step, while 3′-ASO could block RNA splicing by inhibiting the second step. This method provides a versatile tool for assisting efficient ASO design and discovering new splicing modulators and therapeutic drugs. PMID:28989608

"Spoligoriftyping," a dual-priming-oligonucleotide-based direct-hybridization assay for tuberculosis control with a multianalyte microbead-based hybridization system.

PubMed

Gomgnimbou, Michel Kiréopori; Abadia, Edgar; Zhang, Jian; Refrégier, Guislaine; Panaiotov, Stefan; Bachiyska, Elizabeta; Sola, Christophe

2012-10-01

We developed "spoligoriftyping," a 53-plex assay based on two preexisting methods, the spoligotyping and "rifoligotyping" assays, by combining them into a single assay. Spoligoriftyping allows simultaneous spoligotyping (i.e., clustered regularly interspaced short palindromic repeat [CRISPR]-based genotyping) and characterization of the main rifampin drug resistance mutations on the rpoB hot spot region in a few hours. This test partly uses the dual-priming-oligonucleotide (DPO) principle, which allows simultaneous efficient amplifications of rpoB and the CRISPR locus in the same sample. We tested this method on a set of 114 previously phenotypically and genotypically characterized multidrug-resistant (MDR) Mycobacterium tuberculosis or drug-susceptible M. tuberculosis DNA extracted from clinical isolates obtained from patients from Bulgaria, Nigeria, and Germany. We showed that our method is 100% concordant with rpoB sequencing results and 99.95% (3,911/3,913 spoligotype data points) correlated with classical spoligotyping results. The sensitivity and specificity of our assay were 99 and 100%, respectively, compared to those of phenotypic drug susceptibility testing. Such assays pave the way to the implementation of locally and specifically adapted methods of performing in a single tube both drug resistance mutation detection and genotyping in a few hours.

DNA surface hybridization regimes

PubMed Central

Gong, Ping; Levicky, Rastislav

2008-01-01

Surface hybridization reactions, in which sequence-specific recognition occurs between immobilized and solution nucleic acids, are routinely carried out to quantify and interpret genomic information. Although hybridization is fairly well understood in bulk solution, the greater complexity of an interfacial environment presents new challenges to a fundamental understanding, and hence application, of these assays. At a surface, molecular interactions are amplified by the two-dimensional nature of the immobilized layer, which focuses the nucleic acid charge and concentration to levels not encountered in solution, and which impacts the hybridization behavior in unique ways. This study finds that, at low ionic strengths, an electrostatic balance between the concentration of immobilized oligonucleotide charge and solution ionic strength governs the onset of hybridization. As ionic strength increases, the importance of electrostatics diminishes and the hybridization behavior becomes more complex. Suppression of hybridization affinity constants relative to solution values, and their weakened dependence on the concentration of DNA counterions, indicate that the immobilized strands form complexes that compete with hybridization to analyte strands. Moreover, an unusual regime is observed in which the surface coverage of immobilized oligonucleotides does not significantly influence the hybridization behavior, despite physical closeness and hence compulsory interactions between sites. These results are interpreted and summarized in a diagram of hybridization regimes that maps specific behaviors to experimental ranges of ionic strength and probe coverage. PMID:18381819

Universal detection of phytoplasmas and Xylella spp. by TaqMan singleplex and multiplex real-time PCR with dual priming oligonucleotides.

PubMed

Ito, Takao; Suzaki, Koichi

2017-01-01

Phytoplasmas and Xylella spp. are bacteria that cause many economically important plant diseases worldwide. TaqMan probe-based quantitative real-time polymerase chain reaction (qPCR) assays have been utilized to universally detect phytoplasmas or Xylella fastidiosa. To develop a superior universal qPCR method, we used a dual priming oligonucleotide (DPO) with two annealing sites as a reverse primer to target the well-conserved bacterial 16S rDNA. The new qPCR assays universally detected various species of phytoplasmas and subspecies of X. fastidiosa as well as Xylella taiwanensis, and generally showed superior threshold cycle values when amplifying specific or non-specific products compared to current universal qPCR assays. The proposed qPCR assays were integrated to develop a multiplex qPCR assay that simultaneously detected phytoplasmas, Xylella spp., and an internal plant DNA positive control within 1 hour. This assay could detect a minimum of ten bacterial cells and was compatible with crude extractions used in the rapid screening of various plants. The amplicons were of sufficient lengths to be directly sequenced for preliminary identification, and the primers could be used in universal conventional PCR assays. Additionally, reverse DPO primers can be utilized to improve other probe-based qPCR assays.

Ultrasensitive electrochemical detection of nucleic acids by template enhanced hybridization followed with rolling circle amplification.

PubMed

Ji, Hanxu; Yan, Feng; Lei, Jianping; Ju, Huangxian

2012-08-21

An ultrasensitive protocol for electrochemical detection of DNA is designed with quantum dots (QDs) as a signal tag by combining the template enhanced hybridization process (TEHP) and rolling circle amplification (RCA). Upon the recognition of the molecular beacon (MB) to target DNA, the MB hybridizes with assistants and target DNA to form a ternary ''Y-junction''. The target DNA can be dissociated from the structure under the reaction of nicking endonuclease to initiate the next hybridization process. The template enhanced MB fragments further act as the primers of the RCA reaction to produce thousands of repeated oligonucleotide sequences, which can bind with oligonucleotide functionalized QDs. The attached signal tags can be easily read out by square-wave voltammetry after dissolving with acid. Because of the cascade signal amplification and the specific TEHP and RCA reaction, this newly designed protocol provides an ultrasensitive electrochemical detection of DNA down to the attomolar level (11 aM) with a linear range of 6 orders of magnitude (from 1 × 10(-17) to 1 × 10(-11) M) and can discriminate mismatched DNA from perfect matched target DNA with high selectivity. The high sensitivity and specificity make this method a great potential for early diagnosis in gene-related diseases.

Universal detection of phytoplasmas and Xylella spp. by TaqMan singleplex and multiplex real-time PCR with dual priming oligonucleotides

PubMed Central

Suzaki, Koichi

2017-01-01

Phytoplasmas and Xylella spp. are bacteria that cause many economically important plant diseases worldwide. TaqMan probe-based quantitative real-time polymerase chain reaction (qPCR) assays have been utilized to universally detect phytoplasmas or Xylella fastidiosa. To develop a superior universal qPCR method, we used a dual priming oligonucleotide (DPO) with two annealing sites as a reverse primer to target the well-conserved bacterial 16S rDNA. The new qPCR assays universally detected various species of phytoplasmas and subspecies of X. fastidiosa as well as Xylella taiwanensis, and generally showed superior threshold cycle values when amplifying specific or non-specific products compared to current universal qPCR assays. The proposed qPCR assays were integrated to develop a multiplex qPCR assay that simultaneously detected phytoplasmas, Xylella spp., and an internal plant DNA positive control within 1 hour. This assay could detect a minimum of ten bacterial cells and was compatible with crude extractions used in the rapid screening of various plants. The amplicons were of sufficient lengths to be directly sequenced for preliminary identification, and the primers could be used in universal conventional PCR assays. Additionally, reverse DPO primers can be utilized to improve other probe-based qPCR assays. PMID:28957362

Development of a 16S rRNA-targeted fluorescence in situ hybridization probe for quantification of the ammonia-oxidizer Nitrosotalea devanaterra and its relatives.

PubMed

Restrepo-Ortiz, C X; Merbt, S N; Barrero-Canossa, J; Fuchs, B M; Casamayor, E O

2018-04-28

The Thaumarchaeota SAGMCG-1 group and, in particular, members of the genus Nitrosotalea have high occurrence in acidic soils, the rhizosphere, groundwater and oligotrophic lakes, and play a potential role in nitrogen cycling. In this study, the specific oligonucleotide fluorescence in situ hybridization probe SAG357 was designed for this Thaumarchaeota group based on the available 16S rRNA gene sequences in databases, and included the ammonia-oxidizing species Nitrosotalea devanaterra. Cell permeabilization for catalyzed reporter deposition fluorescence in situ detection and the hybridization conditions were optimized on enrichment cultures of the target species N. devanaterra, as well as the non-target ammonia-oxidizing archaeon Nitrosopumilus maritimus. Probe specificity was improved with a competitor oligonucleotide, and fluorescence intensity and cell visualization were enhanced by the design and application of two adjacent helpers. Probe performance was tested in soil samples along a pH gradient, and counting results matched the expected in situ distributions. Probe SAG357 and the CARD-FISH protocol developed in the present study will help to improve the current understanding of the ecology and physiology of N. devanaterra and its relatives in natural environments. Copyright © 2018 Elsevier GmbH. All rights reserved.

Desulfurization of phosphorothioate oligonucleotides via the sulfur-by-oxygen replacement induced by the hydroxyl radical during negative electrospray ionization mass spectrometry.

PubMed

Wu, Lianming; White, David E; Ye, Connie; Vogt, Frederick G; Terfloth, Gerald J; Matsuhashi, Hayao

2012-07-01

While the occurrence of desulfurization of phosphorothioate oligonucleotides in solution is well established, this study represents the first attempt to investigate the basis of the unexpected desulfurization via the net sulfur-by-oxygen (S-O) replacement during negative electrospray ionization (ESI). The current work, facilitated by quantitative mass deconvolution, demonstrates that considerable desulfurization can take place even under common negative ESI operating conditions. The extent of desulfurization is dependent on the molar phosphorothioate oligonucleotide-to-hydroxyl radical ratio, which is consistent with the corona discharge-induced origin of the hydroxyl radical leading to the S-O replacement. This hypothesis is supported by the fact that an increase of the high-performance liquid chromatography (HPLC) flow rate and the on-column concentration of a phosphorothioate oligonucleotide, as well as a decrease of the electrospray voltage reduce the degree of desulfurization. Comparative LC-tandem mass spectrometry (MS/MS) sequencing of a phosphorothioate oligonucleotide and its corresponding desulfurization product revealed evidence that the S-O replacement occurs at multiple phosphorothioate internucleotide linkage sites. In practice, the most convenient and effective strategy for minimizing this P = O artifact is to increase the LC flow rate and the on-column concentration of phosphorothioate oligonucleotides. Another approach to mitigate possible detrimental effects of the undesired desulfurization is to operate the ESI source at a very low electrospray voltage to diminish the corona discharge; however this will significantly compromise sensitivity when analyzing the low-level P = O impurities in phosphorothioate oligonucleotides. Copyright © 2012 John Wiley & Sons, Ltd.

A new arenavirus in a cluster of fatal transplant-associated diseases.

PubMed

Palacios, Gustavo; Druce, Julian; Du, Lei; Tran, Thomas; Birch, Chris; Briese, Thomas; Conlan, Sean; Quan, Phenix-Lan; Hui, Jeffrey; Marshall, John; Simons, Jan Fredrik; Egholm, Michael; Paddock, Christopher D; Shieh, Wun-Ju; Goldsmith, Cynthia S; Zaki, Sherif R; Catton, Mike; Lipkin, W Ian

2008-03-06

Three patients who received visceral-organ transplants from a single donor on the same day died of a febrile illness 4 to 6 weeks after transplantation. Culture, polymerase-chain-reaction (PCR) and serologic assays, and oligonucleotide microarray analysis for a wide range of infectious agents were not informative. We evaluated RNA obtained from the liver and kidney transplant recipients. Unbiased high-throughput sequencing was used to identify microbial sequences not found by means of other methods. The specificity of sequences for a new candidate pathogen was confirmed by means of culture and by means of PCR, immunohistochemical, and serologic analyses. High-throughput sequencing yielded 103,632 sequences, of which 14 represented an Old World arenavirus. Additional sequence analysis showed that this new arenavirus was related to lymphocytic choriomeningitis viruses. Specific PCR assays based on a unique sequence confirmed the presence of the virus in the kidneys, liver, blood, and cerebrospinal fluid of the recipients. Immunohistochemical analysis revealed arenavirus antigen in the liver and kidney transplants in the recipients. IgM and IgG antiviral antibodies were detected in the serum of the donor. Seroconversion was evident in serum specimens obtained from one recipient at two time points. Unbiased high-throughput sequencing is a powerful tool for the discovery of pathogens. The use of this method during an outbreak of disease facilitated the identification of a new arenavirus transmitted through solid-organ transplantation. Copyright 2008 Massachusetts Medical Society.

Specificity tests of an oligonucleotide probe against food-outbreak salmonella for biosensor detection

NASA Astrophysics Data System (ADS)

Chen, I.-H.; Horikawa, S.; Xi, J.; Wikle, H. C.; Barbaree, J. M.; Chin, B. A.

2017-05-01

Phage based magneto-elastic (ME) biosensors have been shown to be able to rapidly detect Salmonella in various food systems to serve food pathogen monitoring purposes. In this ME biosensor platform, the free-standing strip-shaped magneto-elastic sensor is the transducer and the phage probe that recognizes Salmonella in food serves as the bio-recognition element. According to Sorokulova et al. at 2005, a developed oligonucleotide probe E2 was reported to have high specificity to Salmonella enterica Typhimurium. In the report, the specificity tests were focused in most of Enterobacterace groups outside of Salmonella family. Here, to understand the specificity of phage E2 to different Salmonella enterica serotypes within Salmonella Family, we further tested the specificity of the phage probe to thirty-two Salmonella serotypes that were present in the major foodborne outbreaks during the past ten years (according to Centers for Disease Control and Prevention). The tests were conducted through an Enzyme linked Immunosorbent Assay (ELISA) format. This assay can mimic probe immobilized conditions on the magnetoelastic biosensor platform and also enable to study the binding specificity of oligonucleotide probes toward different Salmonella while avoiding phage/ sensor lot variations. Test results confirmed that this oligonucleotide probe E2 was high specific to Salmonella Typhimurium cells but showed cross reactivity to Salmonella Tennessee and four other serotypes among the thirty-two tested Salmonella serotypes.

Active oligonucleotides incorporating alkylating an agent as potential sequence- and base selective modifier of gene expression.

PubMed

Sasaki, S

2001-04-01

A number of cross-linking (alkylating) agents have been developed and incorporated into the oligonulceotides for sequence selective control of gene expression. Recently, potential application of such active oligonucleotides has been expanding from use for improvement of inhibition efficiency to new biotechnology that may enable chemical alteration of genetic information. These interests in active oligonucleotides have encouraged the generation of new cross-linking agents that exhibit high efficiency for application of either in vitro or in vivo. This mini review summarizes structures of alkylating agents, in particular, a new basic skeleton for cross-linking, a 2'-deoxyribose derivative of 2-amino-6-vinylpurine that has been recently developed by the author's group. The 2-amino-6-vinylpurine has been shown to form a complex with cytidine under acidic conditions, and brings the vinyl and the amino reactive groups into proximity to achieve efficient alkylation. A new strategy was designed so that the reactivity of 2-amino-6-vinylpurine can be induced from the corresponding phenylsulfoxide derivative within a duplex with the complementary strand. The validity of the new strategy has been proven by achievement of cytidine-selective cross-linking with remarkably efficiency.

Modification-dependent restriction endonuclease, MspJI, flips 5-methylcytosine out of the DNA helix

DOE PAGES

Horton, J. R.; Wang, H.; Mabuchi, M. Y.; ...

2014-09-27

MspJI belongs to a family of restriction enzymes that cleave DNA containing 5-methylcytosine (5mC) or 5-hydroxymethylcytosine (5hmC). MspJI is specific for the sequence 5(h)mC-N-N-G or A and cleaves with some variability 9/13 nucleotides downstream. Earlier, we reported the crystal structure of MspJI without DNA and proposed how it might recognize this sequence and catalyze cleavage. Here we report its co-crystal structure with a 27-base pair oligonucleotide containing 5mC. This structure confirms that MspJI acts as a homotetramer and that the modified cytosine is flipped from the DNA helix into an SRA-like-binding pocket. We expected the structure to reveal two DNAmore » molecules bound specifically to the tetramer and engaged with the enzyme's two DNA-cleavage sites. A coincidence of crystal packing precluded this organization, however. We found that each DNA molecule interacted with two adjacent tetramers, binding one specifically and the other non-specifically. The latter interaction, which prevented cleavage-site engagement, also involved base flipping and might represent the sequence-interrogation phase that precedes specific recognition. MspJI is unusual in that DNA molecules are recognized and cleaved by different subunits. Such interchange of function might explain how other complex multimeric restriction enzymes act.« less

Design and Evaluation of a Lactobacillus manihotivorans Species-Specific rRNA-Targeted Hybridization Probe and Its Application to the Study of Sour Cassava Fermentation

PubMed Central

Ampe, Frédéric

2000-01-01

Based on 16S rRNA sequence comparison, we have designed a 20-mer oligonucleotide that targets a region specific to the species Lactobacillus manihotivorans recently isolated from sour cassava fermentation. The probe recognized the rRNA obtained from all the L. manihotivorans strains tested but did not recognize 56 strains of microorganisms from culture collections or directly isolated from sour cassava, including 29 species of lactic acid bacteria. This probe was then successfully used in quantitative RNA blots and demonstrated the importance of L. manihotivorans in the fermentation of sour cassava starch, which could represent up to 20% of total lactic acid bacteria. PMID:10788405

An Optimized Protocol for Electrophoretic Mobility Shift Assay Using Infrared Fluorescent Dye-labeled Oligonucleotides.

PubMed

Hsieh, Yi-Wen; Alqadah, Amel; Chuang, Chiou-Fen

2016-11-29

Electrophoretic Mobility Shift Assays (EMSA) are an instrumental tool to characterize the interactions between proteins and their target DNA sequences. Radioactivity has been the predominant method of DNA labeling in EMSAs. However, recent advances in fluorescent dyes and scanning methods have prompted the use of fluorescent tagging of DNA as an alternative to radioactivity for the advantages of easy handling, saving time, reducing cost, and improving safety. We have recently used fluorescent EMSA (fEMSA) to successfully address an important biological question. Our fEMSA analysis provides mechanistic insight into the effect of a missense mutation, G73E, in the highly conserved HMG transcription factor SOX-2 on olfactory neuron type diversification. We found that mutant SOX-2 G73E protein alters specific DNA binding activity, thereby causing olfactory neuron identity transformation. Here, we present an optimized and cost-effective step-by-step protocol for fEMSA using infrared fluorescent dye-labeled oligonucleotides containing the LIM-4/SOX-2 adjacent target sites and purified SOX-2 proteins (WT and mutant SOX-2 G73E proteins) as a biological example.

Gene Silencing by Gold Nanoshell-Mediated Delivery and Laser-Triggered Release of Antisense Oligonucleotide and siRNA

PubMed Central

Huschka, Ryan; Barhoumi, Aoune; Liu, Qing; Roth, Jack A.; Ji, Lin; Halas, Naomi J.

2013-01-01

The approach of RNA interference (RNAi)- using antisense DNA or RNA oligonucleotides to silence activity of a specific pathogenic gene transcript and reduce expression of the encoded protein- is very useful in dissecting genetic function and holds significant promise as a molecular therapeutic. A major obstacle in achieving gene silencing with RNAi technology is the systemic delivery of therapeutic oligonucleotides. Here we demonstrate an engineered gold nanoshell (NS)-based therapeutic oligonucleotide delivery vehicle, designed to release its cargo on demand upon illumination with a near-infrared (NIR) laser. A poly(L)lysine peptide (PLL) epilayer covalently attached to the NS surface (NS-PLL) is used to capture intact, single-stranded antisense DNA oligonucleotides, or alternatively, double-stranded short-interfering RNA (siRNA) molecules. Controlled release of the captured therapeutic oligonucleotides in each case is accomplished by continuous wave NIR laser irradiation at 800 nm, near the resonance wavelength of the nanoshell. Fluorescently tagged oligonucleotides were used to monitor the time-dependent release process and light-triggered endosomal release. A green fluorescent protein (GFP)-expressing human lung cancer H1299 cell line was used to determine cellular uptake and gene silencing mediated by the NS-PLL carrying GFP gene-specific single-stranded DNA antisense oligonucleotide (AON-GFP), or a double-stranded siRNA (siRNA-GFP), in vitro. Light-triggered delivery resulted in ∼ 47% and ∼49% downregulation of the targeted GFP expression by AON-GFP and siRNA-GFP, respectively. Cytotoxicity induced by both the NS-PLL delivery vector and by laser irradiation is minimal, as demonstrated by a XTT cell proliferation assay. PMID:22862291

Genotype Specification Language.

PubMed

Wilson, Erin H; Sagawa, Shiori; Weis, James W; Schubert, Max G; Bissell, Michael; Hawthorne, Brian; Reeves, Christopher D; Dean, Jed; Platt, Darren

2016-06-17

We describe here the Genotype Specification Language (GSL), a language that facilitates the rapid design of large and complex DNA constructs used to engineer genomes. The GSL compiler implements a high-level language based on traditional genetic notation, as well as a set of low-level DNA manipulation primitives. The language allows facile incorporation of parts from a library of cloned DNA constructs and from the "natural" library of parts in fully sequenced and annotated genomes. GSL was designed to engage genetic engineers in their native language while providing a framework for higher level abstract tooling. To this end we define four language levels, Level 0 (literal DNA sequence) through Level 3, with increasing abstraction of part selection and construction paths. GSL targets an intermediate language based on DNA slices that translates efficiently into a wide range of final output formats, such as FASTA and GenBank, and includes formats that specify instructions and materials such as oligonucleotide primers to allow the physical construction of the GSL designs by individual strain engineers or an automated DNA assembly core facility.

The zebrafish dorsal axis is apparent at the four-cell stage.

PubMed

Gore, Aniket V; Maegawa, Shingo; Cheong, Albert; Gilligan, Patrick C; Weinberg, Eric S; Sampath, Karuna

2005-12-15

A central question in the development of multicellular organisms pertains to the timing and mechanisms of specification of the embryonic axes. In many organisms, specification of the dorsoventral axis requires signalling by proteins of the Transforming growth factor-beta and Wnt families. Here we show that maternal transcripts of the zebrafish Nodal-related morphogen, Squint (Sqt), can localize to two blastomeres at the four-cell stage and predict the dorsal axis. Removal of cells containing sqt transcripts from four-to-eight-cell embryos or injection of antisense morpholino oligonucleotides targeting sqt into oocytes can cause a loss of dorsal structures. Localization of sqt transcripts is independent of maternal Wnt pathway function and requires a highly conserved sequence in the 3' untranslated region. Thus, the dorsoventral axis is apparent by early cleavage stages and may require the maternally encoded morphogen Sqt and its associated factors. Because the 3' untranslated region of the human nodal gene can also localize exogenous sequences to dorsal cells, this mechanism may be evolutionarily conserved.

Natural Antisense Transcripts: Molecular Mechanisms and Implications in Breast Cancers

PubMed Central

Latgé, Guillaume; Poulet, Christophe; Bours, Vincent; Jerusalem, Guy

2018-01-01

Natural antisense transcripts are RNA sequences that can be transcribed from both DNA strands at the same locus but in the opposite direction from the gene transcript. Because strand-specific high-throughput sequencing of the antisense transcriptome has only been available for less than a decade, many natural antisense transcripts were first described as long non-coding RNAs. Although the precise biological roles of natural antisense transcripts are not known yet, an increasing number of studies report their implication in gene expression regulation. Their expression levels are altered in many physiological and pathological conditions, including breast cancers. Among the potential clinical utilities of the natural antisense transcripts, the non-coding|coding transcript pairs are of high interest for treatment. Indeed, these pairs can be targeted by antisense oligonucleotides to specifically tune the expression of the coding-gene. Here, we describe the current knowledge about natural antisense transcripts, their varying molecular mechanisms as gene expression regulators, and their potential as prognostic or predictive biomarkers in breast cancers. PMID:29301303

Natural Antisense Transcripts: Molecular Mechanisms and Implications in Breast Cancers.

PubMed

Latgé, Guillaume; Poulet, Christophe; Bours, Vincent; Josse, Claire; Jerusalem, Guy

2018-01-02

Natural antisense transcripts are RNA sequences that can be transcribed from both DNA strands at the same locus but in the opposite direction from the gene transcript. Because strand-specific high-throughput sequencing of the antisense transcriptome has only been available for less than a decade, many natural antisense transcripts were first described as long non-coding RNAs. Although the precise biological roles of natural antisense transcripts are not known yet, an increasing number of studies report their implication in gene expression regulation. Their expression levels are altered in many physiological and pathological conditions, including breast cancers. Among the potential clinical utilities of the natural antisense transcripts, the non-coding|coding transcript pairs are of high interest for treatment. Indeed, these pairs can be targeted by antisense oligonucleotides to specifically tune the expression of the coding-gene. Here, we describe the current knowledge about natural antisense transcripts, their varying molecular mechanisms as gene expression regulators, and their potential as prognostic or predictive biomarkers in breast cancers.

Sequence-based design of bioactive small molecules that target precursor microRNAs.

PubMed

Velagapudi, Sai Pradeep; Gallo, Steven M; Disney, Matthew D

2014-04-01

Oligonucleotides are designed to target RNA using base pairing rules, but they can be hampered by poor cellular delivery and nonspecific stimulation of the immune system. Small molecules are preferred as lead drugs or probes but cannot be designed from sequence. Herein, we describe an approach termed Inforna that designs lead small molecules for RNA from solely sequence. Inforna was applied to all human microRNA hairpin precursors, and it identified bioactive small molecules that inhibit biogenesis by binding nuclease-processing sites (44% hit rate). Among 27 lead interactions, the most avid interaction is between a benzimidazole (1) and precursor microRNA-96. Compound 1 selectively inhibits biogenesis of microRNA-96, upregulating a protein target (FOXO1) and inducing apoptosis in cancer cells. Apoptosis is ablated when FOXO1 mRNA expression is knocked down by an siRNA, validating compound selectivity. Markedly, microRNA profiling shows that 1 only affects microRNA-96 biogenesis and is at least as selective as an oligonucleotide.

Relative quantification of 40 nucleic acid sequences by multiplex ligation-dependent probe amplification

PubMed Central

Schouten, Jan P.; McElgunn, Cathal J.; Waaijer, Raymond; Zwijnenburg, Danny; Diepvens, Filip; Pals, Gerard

2002-01-01

We describe a new method for relative quantification of 40 different DNA sequences in an easy to perform reaction requiring only 20 ng of human DNA. Applications shown of this multiplex ligation-dependent probe amplification (MLPA) technique include the detection of exon deletions and duplications in the human BRCA1, MSH2 and MLH1 genes, detection of trisomies such as Down’s syndrome, characterisation of chromosomal aberrations in cell lines and tumour samples and SNP/mutation detection. Relative quantification of mRNAs by MLPA will be described elsewhere. In MLPA, not sample nucleic acids but probes added to the samples are amplified and quantified. Amplification of probes by PCR depends on the presence of probe target sequences in the sample. Each probe consists of two oligonucleotides, one synthetic and one M13 derived, that hybridise to adjacent sites of the target sequence. Such hybridised probe oligonucleotides are ligated, permitting subsequent amplification. All ligated probes have identical end sequences, permitting simultaneous PCR amplification using only one primer pair. Each probe gives rise to an amplification product of unique size between 130 and 480 bp. Probe target sequences are small (50–70 nt). The prerequisite of a ligation reaction provides the opportunity to discriminate single nucleotide differences. PMID:12060695

Relative quantification of 40 nucleic acid sequences by multiplex ligation-dependent probe amplification.

PubMed

Schouten, Jan P; McElgunn, Cathal J; Waaijer, Raymond; Zwijnenburg, Danny; Diepvens, Filip; Pals, Gerard

2002-06-15

We describe a new method for relative quantification of 40 different DNA sequences in an easy to perform reaction requiring only 20 ng of human DNA. Applications shown of this multiplex ligation-dependent probe amplification (MLPA) technique include the detection of exon deletions and duplications in the human BRCA1, MSH2 and MLH1 genes, detection of trisomies such as Down's syndrome, characterisation of chromosomal aberrations in cell lines and tumour samples and SNP/mutation detection. Relative quantification of mRNAs by MLPA will be described elsewhere. In MLPA, not sample nucleic acids but probes added to the samples are amplified and quantified. Amplification of probes by PCR depends on the presence of probe target sequences in the sample. Each probe consists of two oligonucleotides, one synthetic and one M13 derived, that hybridise to adjacent sites of the target sequence. Such hybridised probe oligonucleotides are ligated, permitting subsequent amplification. All ligated probes have identical end sequences, permitting simultaneous PCR amplification using only one primer pair. Each probe gives rise to an amplification product of unique size between 130 and 480 bp. Probe target sequences are small (50-70 nt). The prerequisite of a ligation reaction provides the opportunity to discriminate single nucleotide differences.

Methods and kits for nucleic acid analysis using fluorescence resonance energy transfer

DOEpatents

Kwok, Pui-Yan; Chen, Xiangning

1999-01-01

A method for detecting the presence of a target nucleotide or sequence of nucleotides in a nucleic acid is disclosed. The method is comprised of forming an oligonucleotide labeled with two fluorophores on the nucleic acid target site. The doubly labeled oligonucleotide is formed by addition of a singly labeled dideoxynucleoside triphosphate to a singly labeled polynucleotide or by ligation of two singly labeled polynucleotides. Detection of fluorescence resonance energy transfer upon denaturation indicates the presence of the target. Kits are also provided. The method is particularly applicable to genotyping.

Oligonucleotide-based biosensors for in vitro diagnostics and environmental hazard detection.

PubMed

Jung, Il Young; Lee, Eun Hee; Suh, Ah Young; Lee, Seung Jin; Lee, Hyukjin

2016-04-01

Oligonucleotide-based biosensors have drawn much attention because of their broad applications in in vitro diagnostics and environmental hazard detection. They are particularly of interest to many researchers because of their high specificity as well as excellent sensitivity. Recently, oligonucleotide-based biosensors have been used to achieve not only genetic detection of targets but also the detection of small molecules, peptides, and proteins. This has further broadened the applications of these sensors in the medical and health care industry. In this review, we highlight various examples of oligonucleotide-based biosensors for the detection of diseases, drugs, and environmentally hazardous chemicals. Each example is provided with detailed schematics of the detection mechanism in addition to the supporting experimental results. Furthermore, future perspectives and new challenges in oligonucleotide-based biosensors are discussed.

Progress of targeted genome modification approaches in higher plants.

PubMed

Cardi, Teodoro; Neal Stewart, C

2016-07-01

Transgene integration in plants is based on illegitimate recombination between non-homologous sequences. The low control of integration site and number of (trans/cis)gene copies might have negative consequences on the expression of transferred genes and their insertion within endogenous coding sequences. The first experiments conducted to use precise homologous recombination for gene integration commenced soon after the first demonstration that transgenic plants could be produced. Modern transgene targeting categories used in plant biology are: (a) homologous recombination-dependent gene targeting; (b) recombinase-mediated site-specific gene integration; (c) oligonucleotide-directed mutagenesis; (d) nuclease-mediated site-specific genome modifications. New tools enable precise gene replacement or stacking with exogenous sequences and targeted mutagenesis of endogeneous sequences. The possibility to engineer chimeric designer nucleases, which are able to target virtually any genomic site, and use them for inducing double-strand breaks in host DNA create new opportunities for both applied plant breeding and functional genomics. CRISPR is the most recent technology available for precise genome editing. Its rapid adoption in biological research is based on its inherent simplicity and efficacy. Its utilization, however, depends on available sequence information, especially for genome-wide analysis. We will review the approaches used for genome modification, specifically those for affecting gene integration and modification in higher plants. For each approach, the advantages and limitations will be noted. We also will speculate on how their actual commercial development and implementation in plant breeding will be affected by governmental regulations.

Non-nucleoside building blocks for copper-assisted and copper-free click chemistry for the efficient synthesis of RNA conjugates.

PubMed

Jayaprakash, K N; Peng, Chang Geng; Butler, David; Varghese, Jos P; Maier, Martin A; Rajeev, Kallanthottathil G; Manoharan, Muthiah

2010-12-03

Novel non-nucleoside alkyne monomers compatible with oligonucleotide synthesis were designed, synthesized, and efficiently incorporated into RNA and RNA analogues during solid-phase synthesis. These modifications allowed site-specific conjugation of ligands to the RNA oligonucleotides through copper-assisted (CuAAC) and copper-free strain-promoted azide-alkyne cycloaddition (SPAAC) reactions. The SPAAC click reactions of cyclooctyne-oligonucleotides with various classes of azido-functionalized ligands in solution phase and on solid phase were efficient and quantitative and occurred under mild reaction conditions. The SPAAC reaction provides a method for the synthesis of oligonucleotide-ligand conjugates uncontaminated with copper ions.

A programmable method for massively parallel targeted sequencing

PubMed Central

Hopmans, Erik S.; Natsoulis, Georges; Bell, John M.; Grimes, Susan M.; Sieh, Weiva; Ji, Hanlee P.

2014-01-01

We have developed a targeted resequencing approach referred to as Oligonucleotide-Selective Sequencing. In this study, we report a series of significant improvements and novel applications of this method whereby the surface of a sequencing flow cell is modified in situ to capture specific genomic regions of interest from a sample and then sequenced. These improvements include a fully automated targeted sequencing platform through the use of a standard Illumina cBot fluidics station. Targeting optimization increased the yield of total on-target sequencing data 2-fold compared to the previous iteration, while simultaneously increasing the percentage of reads that could be mapped to the human genome. The described assays cover up to 1421 genes with a total coverage of 5.5 Megabases (Mb). We demonstrate a 10-fold abundance uniformity of greater than 90% in 1 log distance from the median and a targeting rate of up to 95%. We also sequenced continuous genomic loci up to 1.5 Mb while simultaneously genotyping SNPs and genes. Variants with low minor allele fraction were sensitively detected at levels of 5%. Finally, we determined the exact breakpoint sequence of cancer rearrangements. Overall, this approach has high performance for selective sequencing of genome targets, configuration flexibility and variant calling accuracy. PMID:24782526

Single-Cell in Situ RNA Analysis With Switchable Fluorescent Oligonucleotides.

PubMed

Xiao, Lu; Guo, Jia

2018-01-01

Comprehensive RNA analyses in individual cells in their native spatial contexts promise to transform our understanding of normal physiology and disease pathogenesis. Here we report a single-cell in situ RNA analysis approach using switchable fluorescent oligonucleotides (SFO). In this method, transcripts are first hybridized by pre-decoding oligonucleotides. These oligonucleotides subsequently recruit SFO to stain their corresponding RNA targets. After fluorescence imaging, all the SFO in the whole specimen are simultaneously removed by DNA strand displacement reactions. Through continuous cycles of target staining, fluorescence imaging, and SFO removal, a large number of different transcripts can be identified by unique fluorophore sequences and visualized at the optical resolution. To demonstrate the feasibility of this approach, we show that the hybridized SFO can be efficiently stripped by strand displacement reactions within 30 min. We also demonstrate that this SFO removal process maintains the integrity of the RNA targets and the pre-decoding oligonucleotides, and keeps them hybridized. Applying this approach, we show that transcripts can be restained in at least eight hybridization cycles with high analysis accuracy, which theoretically would enable the whole transcriptome to be quantified at the single molecule sensitivity in individual cells. This in situ RNA analysis technology will have wide applications in systems biology, molecular diagnosis, and targeted therapies.

Validation of the Swine Protein-Annotated Oligonucleotide Microarray

USDA-ARS?s Scientific Manuscript database

The specificity and utility of the Swine Protein-Annotated Oligonucleotide Microarray, or Pigoligoarray (www.pigoligoarray.org), has been evaluated by profiling the expression of transcripts from four porcine tissues. Tools for comparative analyses of expression on the Pigoligoarray were developed i...

Rapid detection of IHNV by molecular padlock recognition and surface-associated isothermal amplification

NASA Astrophysics Data System (ADS)

McCarthy, Erik L.; Egeler, Teressa J.; Bickerstaff, Lee E.; Pereira da Cunha, Mauricio; Millard, Paul J.

2005-11-01

RNA sequences derived from infectious hematopoeitic necrosis virus (IHNV) could be detected using a combination of surface-associated molecular padlock DNA probes (MPP) and rolling circle amplification (RCA) in microcapillary tubes. DNA oligonucleotides with base sequences identical to RNA obtained from IHNV were recognized by MPP. Circularized MPP were then captured on the inner surface of glass microcapillary tubes by immobilized DNA oligonucleotide primers. Extension of the immobilized primers by isothermal RCA gave rise to DNA concatamers, which were in turn bound by the fluorescent reporter SYBR Green II nucleic acid stain, and measured by microfluorimetry. Surface-associated molecular padlock technology, combined with isothermal RCA, exhibited high selectivity and sensitivity without thermal cycling. This technology is applicable to direct RNA and DNA detection, permitting detection of a variety of viral or bacterial pathogens.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Man, Viet Hoang; Pan, Feng; Sagui, Celeste, E-mail: sagui@ncsu.edu

We explore the use of a fast laser melting simulation approach combined with atomistic molecular dynamics simulations in order to determine the melting and healing responses of B-DNA and Z-DNA dodecamers with the same d(5′-CGCGCGCGCGCG-3′){sub 2} sequence. The frequency of the laser pulse is specifically tuned to disrupt Watson-Crick hydrogen bonds, thus inducing melting of the DNA duplexes. Subsequently, the structures relax and partially refold, depending on the field strength. In addition to the inherent interest of the nonequilibrium melting process, we propose that fast melting by an infrared laser pulse could be used as a technique for a fastmore » comparison of relative stabilities of same-sequence oligonucleotides with different secondary structures with full atomistic detail of the structures and solvent. This could be particularly useful for nonstandard secondary structures involving non-canonical base pairs, mismatches, etc.« less

Impedimetric DNA biosensor based on a nanoporous alumina membrane for the detection of the specific oligonucleotide sequence of dengue virus.

PubMed

Deng, Jiajia; Toh, Chee-Seng

2013-06-17

A novel and integrated membrane sensing platform for DNA detection is developed based on an anodic aluminum oxide (AAO) membrane. Platinum electrodes (~50-100 nm thick) are coated directly on both sides of the alumina membrane to eliminate the solution resistance outside the nanopores. The electrochemical impedance technique is employed to monitor the impedance changes within the nanopores upon DNA binding. Pore resistance (Rp) linearly increases in response towards the increasing concentration of the target DNA in the range of 1 × 10⁻¹² to 1 × 10⁻⁶ M. Moreover, the biosensor selectively differentiates the complementary sequence from single base mismatched (MM-1) strands and non-complementary strands. This study reveals a simple, selective and sensitive method to fabricate a label-free DNA biosensor.

Organizational heterogeneity of vertebrate genomes.

PubMed

Frenkel, Svetlana; Kirzhner, Valery; Korol, Abraham

2012-01-01

Genomes of higher eukaryotes are mosaics of segments with various structural, functional, and evolutionary properties. The availability of whole-genome sequences allows the investigation of their structure as "texts" using different statistical and computational methods. One such method, referred to as Compositional Spectra (CS) analysis, is based on scoring the occurrences of fixed-length oligonucleotides (k-mers) in the target DNA sequence. CS analysis allows generating species- or region-specific characteristics of the genome, regardless of their length and the presence of coding DNA. In this study, we consider the heterogeneity of vertebrate genomes as a joint effect of regional variation in sequence organization superimposed on the differences in nucleotide composition. We estimated compositional and organizational heterogeneity of genome and chromosome sequences separately and found that both heterogeneity types vary widely among genomes as well as among chromosomes in all investigated taxonomic groups. The high correspondence of heterogeneity scores obtained on three genome fractions, coding, repetitive, and the remaining part of the noncoding DNA (the genome dark matter--GDM) allows the assumption that CS-heterogeneity may have functional relevance to genome regulation. Of special interest for such interpretation is the fact that natural GDM sequences display the highest deviation from the corresponding reshuffled sequences.

Modeling the Embrace of a Mutator: APOBEC Selection of Nucleic Acid Ligands.

PubMed

Salter, Jason D; Smith, Harold C

2018-05-23

The 11-member APOBEC (apolipoprotein B mRNA editing catalytic polypeptide-like) family of zinc-dependent cytidine deaminases bind to RNA and single-stranded DNA (ssDNA) and, in specific contexts, modify select (deoxy)cytidines to (deoxy)uridines. In this review, we describe advances made through high-resolution co-crystal structures of APOBECs bound to mono- or oligonucleotides that reveal potential substrate-specific binding sites at the active site and non-sequence-specific nucleic acid binding sites distal to the active site. We also discuss the effect of APOBEC oligomerization on functionality. Future structural studies will need to address how ssDNA binding away from the active site may enhance catalysis and the mechanism by which RNA binding may modulate catalytic activity on ssDNA. Copyright © 2018 The Author(s). Published by Elsevier Ltd.. All rights reserved.

Development and experimental validation of a 20K Atlantic cod (Gadus morhua) oligonucleotide microarray based on a collection of over 150,000 ESTs.

PubMed

Booman, Marije; Borza, Tudor; Feng, Charles Y; Hori, Tiago S; Higgins, Brent; Culf, Adrian; Léger, Daniel; Chute, Ian C; Belkaid, Anissa; Rise, Marlies; Gamperl, A Kurt; Hubert, Sophie; Kimball, Jennifer; Ouellette, Rodney J; Johnson, Stewart C; Bowman, Sharen; Rise, Matthew L

2011-08-01

The collapse of Atlantic cod (Gadus morhua) wild populations strongly impacted the Atlantic cod fishery and led to the development of cod aquaculture. In order to improve aquaculture and broodstock quality, we need to gain knowledge of genes and pathways involved in Atlantic cod responses to pathogens and other stressors. The Atlantic Cod Genomics and Broodstock Development Project has generated over 150,000 expressed sequence tags from 42 cDNA libraries representing various tissues, developmental stages, and stimuli. We used this resource to develop an Atlantic cod oligonucleotide microarray containing 20,000 unique probes. Selection of sequences from the full range of cDNA libraries enables application of the microarray for a broad spectrum of Atlantic cod functional genomics studies. We included sequences that were highly abundant in suppression subtractive hybridization (SSH) libraries, which were enriched for transcripts responsive to pathogens or other stressors. These sequences represent genes that potentially play an important role in stress and/or immune responses, making the microarray particularly useful for studies of Atlantic cod gene expression responses to immune stimuli and other stressors. To demonstrate its value, we used the microarray to analyze the Atlantic cod spleen response to stimulation with formalin-killed, atypical Aeromonas salmonicida, resulting in a gene expression profile that indicates a strong innate immune response. These results were further validated by quantitative PCR analysis and comparison to results from previous analysis of an SSH library. This study shows that the Atlantic cod 20K oligonucleotide microarray is a valuable new tool for Atlantic cod functional genomics research.

Protein-RNA crosslinking in Escherichia coli 30S ribosomal subunits. Identification of a 16S rRNA fragment crosslinked to protein S12 by the use of the chemical crosslinking reagent 1-ethyl-3-dimethyl-aminopropylcarbodiimide.

PubMed Central

Chiaruttini, C; Expert-Bezançon, A; Hayes, D; Ehresmann, B

1982-01-01

1-ethyl-3-dimethyl aminopropylcarbodiimide (EDC) was used to cross-link 30S ribosomal proteins to 16S rRNA within the E. coli 3OS ribosomal subunit. Covalently linked complexes containing 30S proteins and 16S rRNA, isolated by sedimentation of dissociated crosslinked 30S subunits through SDS containing sucrose gradients, were digested with RNase T1, and the resulting oligonucleotide-protein complexes were fractionated on SDS containing polyacrylamide gels. Eluted complexes containing 30S proteins S9 and S12 linked to oligonucleotides were obtained in pure form. Oligonucleotide 5'terminal labelling was successful in the case of S12 containing but not of the S9 containing complex and led to identification of the S12 bound oligonucleotide as CAACUCG which is located at positions 1316-1322 in the 16S rRNA sequence. Protein S12 is crosslinked to the terminal G of this heptanucleotide. Images PMID:6760129

Analytical Devices Based on Direct Synthesis of DNA on Paper.

PubMed

Glavan, Ana C; Niu, Jia; Chen, Zhen; Güder, Firat; Cheng, Chao-Min; Liu, David; Whitesides, George M

2016-01-05

This paper addresses a growing need in clinical diagnostics for parallel, multiplex analysis of biomarkers from small biological samples. It describes a new procedure for assembling arrays of ssDNA and proteins on paper. This method starts with the synthesis of DNA oligonucleotides covalently linked to paper and proceeds to assemble microzones of DNA-conjugated paper into arrays capable of simultaneously capturing DNA, DNA-conjugated protein antigens, and DNA-conjugated antibodies. The synthesis of ssDNA oligonucleotides on paper is convenient and effective with 32% of the oligonucleotides cleaved and eluted from the paper substrate being full-length by HPLC for a 32-mer. These ssDNA arrays can be used to detect fluorophore-linked DNA oligonucleotides in solution, and as the basis for DNA-directed assembly of arrays of DNA-conjugated capture antibodies on paper, detect protein antigens by sandwich ELISAs. Paper-anchored ssDNA arrays with different sequences can be used to assemble paper-based devices capable of detecting DNA and antibodies in the same device and enable simple microfluidic paper-based devices.

G-Quadruplex Forming Oligonucleotides as Anti-HIV Agents.

PubMed

Musumeci, Domenica; Riccardi, Claudia; Montesarchio, Daniela

2015-09-22

Though a variety of different non-canonical nucleic acids conformations have been recognized, G-quadruplex structures are probably the structural motifs most commonly found within known oligonucleotide-based aptamers. This could be ascribed to several factors, as their large conformational diversity, marked responsiveness of their folding/unfolding processes to external stimuli, high structural compactness and chemo-enzymatic and thermodynamic stability. A number of G-quadruplex-forming oligonucleotides having relevant in vitro anti-HIV activity have been discovered in the last two decades through either SELEX or rational design approaches. Improved aptamers have been obtained by chemical modifications of natural oligonucleotides, as terminal conjugations with large hydrophobic groups, replacement of phosphodiester linkages with phosphorothioate bonds or other surrogates, insertion of base-modified monomers, etc. In turn, detailed structural studies have elucidated the peculiar architectures adopted by many G-quadruplex-based aptamers and provided insight into their mechanism of action. An overview of the state-of-the-art knowledge of the relevance of putative G-quadruplex forming sequences within the viral genome and of the most studied G-quadruplex-forming aptamers, selectively targeting HIV proteins, is here presented.

Methods and compositions for efficient nucleic acid sequencing

DOEpatents

Drmanac, Radoje

2006-07-04

Disclosed are novel methods and compositions for rapid and highly efficient nucleic acid sequencing based upon hybridization with two sets of small oligonucleotide probes of known sequences. Extremely large nucleic acid molecules, including chromosomes and non-amplified RNA, may be sequenced without prior cloning or subcloning steps. The methods of the invention also solve various current problems associated with sequencing technology such as, for example, high noise to signal ratios and difficult discrimination, attaching many nucleic acid fragments to a surface, preparing many, longer or more complex probes and labelling more species.

Methods and compositions for efficient nucleic acid sequencing

DOEpatents

Drmanac, Radoje

2002-01-01

Disclosed are novel methods and compositions for rapid and highly efficient nucleic acid sequencing based upon hybridization with two sets of small oligonucleotide probes of known sequences. Extremely large nucleic acid molecules, including chromosomes and non-amplified RNA, may be sequenced without prior cloning or subcloning steps. The methods of the invention also solve various current problems associated with sequencing technology such as, for example, high noise to signal ratios and difficult discrimination, attaching many nucleic acid fragments to a surface, preparing many, longer or more complex probes and labelling more species.

Polymerase chain reaction assay for verifying the labeling of meat and commercial meat products from game birds targeting specific sequences from the mitochondrial D-loop region.

PubMed

Rojas, M; González, I; Pavón, M A; Pegels, N; Hernández, P E; García, T; Martín, R

2010-05-01

A PCR assay was developed for the identification of meats and commercial meat products from quail (Coturnix coturnix), pheasant (Phasianus colchicus), partridge (Alectoris spp.), guinea fowl (Numida meleagris), pigeon (Columba spp.), Eurasian woodcock (Scolopax rusticola), and song thrush (Turdus philomelos) based on oligonucleotide primers targeting specific sequences from the mitochondrial D-loop region. The primers designed generated specific fragments of 96, 100, 104, 106, 147, 127, and 154 bp in length for quail, pheasant, partridge, guinea fowl, pigeon, Eurasian woodcock, and song thrush tissues, respectively. The specificity of each primer pair was tested against DNA from various game and domestic species. In this work, satisfactory amplification was accomplished in the analysis of experimentally pasteurized (72 degrees C for 30 min) and sterilized (121 degrees C for 20 min) meats, as well as in commercial meat products from the target species. The technique was also applied to raw and sterilized muscular binary mixtures, with a detection limit of 0.1% (wt/wt) for each of the targeted species. The proposed PCR assay represents a rapid and straightforward method for the detection of possible mislabeling in game bird meat products.

NAA-modified DNA oligonucleotides with zwitterionic backbones: stereoselective synthesis of A-T phosphoramidite building blocks.

PubMed

Schmidtgall, Boris; Höbartner, Claudia; Ducho, Christian

2015-01-01

Modifications of the nucleic acid backbone are essential for the development of oligonucleotide-derived bioactive agents. The NAA-modification represents a novel artificial internucleotide linkage which enables the site-specific introduction of positive charges into the otherwise polyanionic backbone of DNA oligonucleotides. Following initial studies with the introduction of the NAA-linkage at T-T sites, it is now envisioned to prepare NAA-modified oligonucleotides bearing the modification at X-T motifs (X = A, C, G). We have therefore developed the efficient and stereoselective synthesis of NAA-linked 'dimeric' A-T phosphoramidite building blocks for automated DNA synthesis. Both the (S)- and the (R)-configured NAA-motifs were constructed with high diastereoselectivities to furnish two different phosphoramidite reagents, which were employed for the solid phase-supported automated synthesis of two NAA-modified DNA oligonucleotides. This represents a significant step to further establish the NAA-linkage as a useful addition to the existing 'toolbox' of backbone modifications for the design of bioactive oligonucleotide analogues.

The binding of manganese(II) and zinc(II) to the synthetic oligonucleotide d(C-G-C-G-A-A-T-T-C-G-C-G)2. A 1H NMR study.

PubMed

Frøystein, N A; Sletten, E

1991-03-01

The interaction of the synthetic oligonucleotide d(C-G-C-G-A-A-T-T-C-G-C-G)2 with two different transition-metal ions has been investigated in aqueous solution by means of 1H NMR spectroscopy. The effects on the DNA due to the presence of manganese(II) or zinc(II) have been monitored by observing the paramagnetic broadening and diamagnetic shifts of the non-exchangeable proton resonance lines, respectively. The 1H NMR spectra acquired during the course of the manganese(II) titration show very distinct broadening effects on certain DNA resonance lines. Primarily, the H8 resonance of G4 is affected, but also the H5 and H6 resonances of C3 are clearly affected by the metal. The results imply that the binding of manganese(II) to DNA is sequence specific. The 1H spectra obtained during the zinc(II) titration reveal diamagnetic shift effects which largely conform with the paramagnetic broadening effects due to the presence of manganese(II), although this picture is somewhat more complex. The H8 resonance of G4 displays a clearly visible high-field shift, while for the other guanosine H8 protons this effect is absent. The H1' and H2' protons of C3 show an effect of similar strength, although in the opposite direction, while H5 and H6 of C3 are only slightly affected. Local differences in the structure of the DNA and the basicities of potential binding sites on different base steps in the sequence might account for the observed sequence selectivity.

SPRi-based biosensing platforms for detection of specific DNA sequences using thiolate and dithiocarbamate assemblies

NASA Astrophysics Data System (ADS)

Drozd, Marcin; Pietrzak, Mariusz D.; Malinowska, Elżbieta

2018-05-01

The framework of presented study covers the development and examination of the analytical performance of surface plasmon resonance-based (SPR) DNA biosensors dedicated for a detection of model target oligonucleotide sequence. For this aim, various strategies of immobilization of DNA probes on gold transducers were tested. Besides the typical approaches: chemisorption of thiolated ssDNA (DNA-thiol) and physisorption of non-functionalized oligonucleotides, relatively new method based on chemisorption of dithiocarbamate-functionalized ssDNA (DNA-DTC) was applied for the first time for preparation of DNA-based SPR biosensor. The special emphasis was put on the correlation between the method of DNA immobilization and the composition of obtained receptor layer. The carried out studies focused on the examination of the capability of developed receptors layers to interact with both target DNA and DNA-functionalized AuNPs. It was found, that the detection limit of target DNA sequence (27 nb length) depends on the strategy of probe immobilization and backfilling method, and in the best case it amounted to 0,66 nM. Moreover, the application of ssDNA-functionalized gold nanoparticles (AuNPs) as plasmonic labels for secondary enhancement of SPR response is presented. The influence of spatial organization and surface density of a receptor layer on the ability to interact with DNA-functionalized AuNPs is discussed. Due to the best compatibility of receptors immobilized via DTC chemisorption: 1.47 ± 0.4 ·1012 molecules • cm-2 (with the calculated area occupied by single nanoparticle label of 132.7 nm2), DNA chemisorption based on DTCs is pointed as especially promising for DNA biosensors utilizing indirect detection in competitive assays.

SPRi-Based Biosensing Platforms for Detection of Specific DNA Sequences Using Thiolate and Dithiocarbamate Assemblies.

PubMed

Drozd, Marcin; Pietrzak, Mariusz D; Malinowska, Elżbieta

2018-01-01

The framework of presented study covers the development and examination of the analytical performance of surface plasmon resonance-based (SPR) DNA biosensors dedicated for a detection of model target oligonucleotide sequence. For this aim, various strategies of immobilization of DNA probes on gold transducers were tested. Besides the typical approaches: chemisorption of thiolated ssDNA (DNA-thiol) and physisorption of non-functionalized oligonucleotides, relatively new method based on chemisorption of dithiocarbamate-functionalized ssDNA (DNA-DTC) was applied for the first time for preparation of DNA-based SPR biosensor. The special emphasis was put on the correlation between the method of DNA immobilization and the composition of obtained receptor layer. The carried out studies focused on the examination of the capability of developed receptors layers to interact with both target DNA and DNA-functionalized AuNPs. It was found, that the detection limit of target DNA sequence (27 nb length) depends on the strategy of probe immobilization and backfilling method, and in the best case it amounted to 0.66 nM. Moreover, the application of ssDNA-functionalized gold nanoparticles (AuNPs) as plasmonic labels for secondary enhancement of SPR response is presented. The influence of spatial organization and surface density of a receptor layer on the ability to interact with DNA-functionalized AuNPs is discussed. Due to the best compatibility of receptors immobilized via DTC chemisorption: 1.47 ± 0.4 · 10 12 molecules · cm -2 (with the calculated area occupied by single nanoparticle label of ~132.7 nm 2 ), DNA chemisorption based on DTCs is pointed as especially promising for DNA biosensors utilizing indirect detection in competitive assays.

Isolation and characterization of an RNA aptamer for the HPV-16 E7 oncoprotein.

PubMed

Toscano-Garibay, Julia D; Benítez-Hess, María L; Alvarez-Salas, Luis M

2011-02-01

Cervical cancer is a common neoplastic disease affecting women worldwide. Expression of human papillomavirus type 16 (HPV-16) E6/E7 genes is frequently associated with cervical cancer, representing ideal targets for diagnostic and therapeutic strategies. Aptamers are oligonucleotide ligands capable of binding with high affinity and specificity to relevant markers in therapeutics and disease detection. The aim of the study was to isolate an RNA aptamer specific for the HPV-16 E7 protein. Aptamers were selected from a randomized oligonucleotide library using a modified SELEX method and recombinant HPV-16 E7 protein. Isolated aptamers were cloned and sequenced for in silico analysis. Interaction and electromobility shift assays (EMSA) were performed to establish aptamer specificity and affinity for E7. RNase footprinting and serial deletions of the aptamer and the E7 protein were made to characterize the aptamer-protein complex. Sandwich slot-blot assays were used for K(D) determination. After several rounds of SELEX, an aptamer (G5α3N.4) exhibited specificity for E7 using cell-free and protein extracts. G5α3N.4 binding yielded a K(D) comparable to aptamers directed to other small targets. Enzymatic and genetic analysis of G5α3N.4 binding showed a secondary structure with two stem-loop domains joined by single-stranded region contacting E7 in a clamp-like manner. The G5α3N.4 aptamer also produced specific complexes in HPV-positive cervical carcinoma cells. The affinity and specificity of G5α3N.4 binding domains for the HPV-16 E7 protein may be used for the detection of papillomavirus infection and cervical cancer. Copyright © 2011 IMSS. Published by Elsevier Inc. All rights reserved.

Sequence-specific DNA cleavage by Fe2+-mediated fenton reactions has possible biological implications.

PubMed

Henle, E S; Han, Z; Tang, N; Rai, P; Luo, Y; Linn, S

1999-01-08

Preferential cleavage sites have been determined for Fe2+/H2O2-mediated oxidations of DNA. In 50 mM H2O2, preferential cleavages occurred at the nucleoside 5' to each of the dG moieties in the sequence RGGG, a sequence found in a majority of telomere repeats. Within a plasmid containing a (TTAGGG)81 human telomere insert, 7-fold more strand breakage occurred in the restriction fragment with the insert than in a similar-sized control fragment. This result implies that telomeric DNA could protect coding DNA from oxidative damage and might also link oxidative damage and iron load to telomere shortening and aging. In micromolar H2O2, preferential cleavage occurred at the thymidine within the sequence RTGR, a sequence frequently found to be required in promoters for normal responses of many procaryotic and eucaryotic genes to iron or oxygen stress. Computer modeling of the interaction of Fe2+ with RTGR in B-DNA suggests that due to steric hindrance with the thymine methyl, Fe2+ associates in a specific manner with the thymine flipped out from the base stack so as to allow an octahedrally-oriented coordination of the Fe2+ with the three purine N7 residues. Fe2+-dependent changes in NMR spectra of duplex oligonucleotides containing ATGA versus those containing AUGA or A5mCGA were consistent with this model.

Synthetic oligonucleotide probes deduced from amino acid sequence data. Theoretical and practical considerations.

PubMed

Lathe, R

1985-05-05

Synthetic probes deduced from amino acid sequence data are widely used to detect cognate coding sequences in libraries of cloned DNA segments. The redundancy of the genetic code dictates that a choice must be made between (1) a mixture of probes reflecting all codon combinations, and (2) a single longer "optimal" probe. The second strategy is examined in detail. The frequency of sequences matching a given probe by chance alone can be determined and also the frequency of sequences closely resembling the probe and contributing to the hybridization background. Gene banks cannot be treated as random associations of the four nucleotides, and probe sequences deduced from amino acid sequence data occur more often than predicted by chance alone. Probe lengths must be increased to confer the necessary specificity. Examination of hybrids formed between unique homologous probes and their cognate targets reveals that short stretches of perfect homology occurring by chance make a significant contribution to the hybridization background. Statistical methods for improving homology are examined, taking human coding sequences as an example, and considerations of codon utilization and dinucleotide frequencies yield an overall homology of greater than 82%. Recommendations for probe design and hybridization are presented, and the choice between using multiple probes reflecting all codon possibilities and a unique optimal probe is discussed.

In vitro selection of high temperature Zn(2+)-dependent DNAzymes.

PubMed

Nelson, Kevin E; Bruesehoff, Peter J; Lu, Yi

2005-08-01

In vitro selection of Zn(2+)-dependent RNA-cleaving DNAzymes with activity at 90 degrees C has yielded a diverse spool of selected sequences. The RNA cleavage efficiency was found in all cases to be specific for Zn(2+) over Pb(2+), Ca(2+), Cd(2+), Co(2+), Hg(2+), and Mg(2+). The Zn(2+)-dependent activity assay of the most active sequence showed that the DNAzyme possesses an apparent Zn(2+)-binding dissociation constant of 234 muM and that its activity increases with increasing temperatures from 50-90 degrees C. A fit of the Arrhenius plot data gave E(a) = 15.3 kcal mol(-1). Surprisingly, the selected Zn(2+)-dependent DNAzymes showed only a modest (approximately 3-fold) activity enhancement over the background rate of cleavage of random sequences containing a single embedded ribonucleotide within an otherwise DNA oligonucleotide. The result is attributable to the ability of DNA to sustain cleavage activity at high temperature with minimal secondary structure when Zn(2+) is present. Since this effect is highly specific for Zn(2+), this metal ion may play a special role in molecular evolution of nucleic acids at high temperature.

The actin multigene family and livestock speciation using the polymerase chain reaction.

PubMed

Fairbrother, K S; Hopwood, A J; Lockley, A K; Bardsley, R G

1998-01-01

Actins constitute a family of highly-conserved multifunctional intracellular proteins, best known as myofibrillar components in striated muscle fibres. Most vertebrate genomes contain numerous actin genes with high sequence homology in protein coding regions but considerable variability in intron number and sizes. This genetic diversity can be utilised for livestock speciation purposes. The high sequence conservation has enabled a single pair of oligonucleotides to be used to prime the polymerase chain reaction (PCR) with DNA extracted from all animals so far studied. Multiple amplification products were obtained which on gel electrophoresis constituted characteristic species-specific 'fingerprints'. The patterns were reproducible, did not vary between individuals of the same breed or between different breeds within a species, and could be generated even from heat-processed muscle held at 120 degrees C for one hour. Given the capacity of PCR to amplify relatively short sequences in highly-degraded DNA, this approach may be suitable for authentication of processed meat products.

Current Challenges in Delivery and Cytosolic Translocation of Therapeutic RNAs

PubMed Central

Lucchino, Marco

2018-01-01

RNA interference (RNAi) is a fundamental cellular process for the posttranscriptional regulation of gene expression. RNAi can exogenously be modulated by small RNA oligonucleotides, such as microRNAs (miRNAs) and small interfering RNAs (siRNAs), or by antisense oligonucleotides. These small oligonucleotides provided the scientific community with powerful and versatile tools to turn off the expression of genes of interest, and hold out the promise of new therapeutic solutions against a wide range of gene-associated pathologies. However, unmodified nucleic acids are highly instable in biological systems, and their weak interaction with plasma proteins confers an unfavorable pharmacokinetics. In this review, we first provide an overview of the most efficient chemical strategies that, over the past 30 years, have been used to significantly improve the therapeutic potential of oligonucleotides. Oligonucleotides targeting and delivery technologies are then presented, including covalent conjugates between oligonucleotides and targeting ligand, and noncovalent association with lipid or polymer nanoparticles. Finally, we specifically focus on the endosomal escape step, which represents a major stumbling block for the effective use of oligonucleotides as therapeutic agents. The need for approaches to quantitatively measure endosomal escape and cytosolic arrival of biomolecules is discussed in the context of the development of efficient oligonucleotide targeting and delivery vectors. PMID:29883296

Quartz crystal microbalance (QCM) affinity biosensor for genetically modified organisms (GMOs) detection.

PubMed

Mannelli, Ilaria; Minunni, Maria; Tombelli, Sara; Mascini, Marco

2003-03-01

A DNA piezoelectric sensor has been developed for the detection of genetically modified organisms (GMOs). Single stranded DNA (ssDNA) probes were immobilised on the sensor surface of a quartz crystal microbalance (QCM) device and the hybridisation between the immobilised probe and the target complementary sequence in solution was monitored. The probe sequences were internal to the sequence of the 35S promoter (P) and Nos terminator (T), which are inserted sequences in the genome of GMOs regulating the transgene expression. Two different probe immobilisation procedures were applied: (a) a thiol-dextran procedure and (b) a thiol-derivatised probe and blocking thiol procedure. The system has been optimised using synthetic oligonucleotides, which were then applied to samples of plasmidic and genomic DNA isolated from the pBI121 plasmid, certified reference materials (CRM), and real samples amplified by the polymerase chain reaction (PCR). The analytical parameters of the sensor have been investigated (sensitivity, reproducibility, lifetime etc.). The results obtained showed that both immobilisation procedures enabled sensitive and specific detection of GMOs, providing a useful tool for screening analysis in food samples.

Ab initio gene identification in metagenomic sequences

PubMed Central

Zhu, Wenhan; Lomsadze, Alexandre; Borodovsky, Mark

2010-01-01

We describe an algorithm for gene identification in DNA sequences derived from shotgun sequencing of microbial communities. Accurate ab initio gene prediction in a short nucleotide sequence of anonymous origin is hampered by uncertainty in model parameters. While several machine learning approaches could be proposed to bypass this difficulty, one effective method is to estimate parameters from dependencies, formed in evolution, between frequencies of oligonucleotides in protein-coding regions and genome nucleotide composition. Original version of the method was proposed in 1999 and has been used since for (i) reconstructing codon frequency vector needed for gene finding in viral genomes and (ii) initializing parameters of self-training gene finding algorithms. With advent of new prokaryotic genomes en masse it became possible to enhance the original approach by using direct polynomial and logistic approximations of oligonucleotide frequencies, as well as by separating models for bacteria and archaea. These advances have increased the accuracy of model reconstruction and, subsequently, gene prediction. We describe the refined method and assess its accuracy on known prokaryotic genomes split into short sequences. Also, we show that as a result of application of the new method, several thousands of new genes could be added to existing annotations of several human and mouse gut metagenomes. PMID:20403810

Homopolymer tail-mediated ligation PCR: a streamlined and highly efficient method for DNA cloning and library construction

PubMed Central

Lazinski, David W.; Camilli, Andrew

2013-01-01

The amplification of DNA fragments, cloned between user-defined 5′ and 3′ end sequences, is a prerequisite step in the use of many current applications including massively parallel sequencing (MPS). Here we describe an improved method, called homopolymer tail-mediated ligation PCR (HTML-PCR), that requires very little starting template, minimal hands-on effort, is cost-effective, and is suited for use in high-throughput and robotic methodologies. HTML-PCR starts with the addition of homopolymer tails of controlled lengths to the 3′ termini of a double-stranded genomic template. The homopolymer tails enable the annealing-assisted ligation of a hybrid oligonucleotide to the template's recessed 5′ ends. The hybrid oligonucleotide has a user-defined sequence at its 5′ end. This primer, together with a second primer composed of a longer region complementary to the homopolymer tail and fused to a second 5′ user-defined sequence, are used in a PCR reaction to generate the final product. The user-defined sequences can be varied to enable compatibility with a wide variety of downstream applications. We demonstrate our new method by constructing MPS libraries starting from nanogram and sub-nanogram quantities of Vibrio cholerae and Streptococcus pneumoniae genomic DNA. PMID:23311318

A novel process of viral vector barcoding and library preparation enables high-diversity library generation and recombination-free paired-end sequencing

PubMed Central

Davidsson, Marcus; Diaz-Fernandez, Paula; Schwich, Oliver D.; Torroba, Marcos; Wang, Gang; Björklund, Tomas

2016-01-01

Detailed characterization and mapping of oligonucleotide function in vivo is generally a very time consuming effort that only allows for hypothesis driven subsampling of the full sequence to be analysed. Recent advances in deep sequencing together with highly efficient parallel oligonucleotide synthesis and cloning techniques have, however, opened up for entirely new ways to map genetic function in vivo. Here we present a novel, optimized protocol for the generation of universally applicable, barcode labelled, plasmid libraries. The libraries are designed to enable the production of viral vector preparations assessing coding or non-coding RNA function in vivo. When generating high diversity libraries, it is a challenge to achieve efficient cloning, unambiguous barcoding and detailed characterization using low-cost sequencing technologies. With the presented protocol, diversity of above 3 million uniquely barcoded adeno-associated viral (AAV) plasmids can be achieved in a single reaction through a process achievable in any molecular biology laboratory. This approach opens up for a multitude of in vivo assessments from the evaluation of enhancer and promoter regions to the optimization of genome editing. The generated plasmid libraries are also useful for validation of sequencing clustering algorithms and we here validate the newly presented message passing clustering process named Starcode. PMID:27874090

Array of nucleic acid probes on biological chips for diagnosis of HIV and methods of using the same

DOEpatents

Chee, Mark; Gingeras, Thomas R.; Fodor, Stephen P. A.; Hubble, Earl A.; Morris, MacDonald S.

1999-01-19

The invention provides an array of oligonucleotide probes immobilized on a solid support for analysis of a target sequence from a human immunodeficiency virus. The array comprises at least four sets of oligonucleotide probes 9 to 21 nucleotides in length. A first probe set has a probe corresponding to each nucleotide in a reference sequence from a human immunodeficiency virus. A probe is related to its corresponding nucleotide by being exactly complementary to a subsequence of the reference sequence that includes the corresponding nucleotide. Thus, each probe has a position, designated an interrogation position, that is occupied by a complementary nucleotide to the corresponding nucleotide. The three additional probe sets each have a corresponding probe for each probe in the first probe set. Thus, for each nucleotide in the reference sequence, there are four corresponding probes, one from each of the probe sets. The three corresponding probes in the three additional probe sets are identical to the corresponding probe from the first probe or a subsequence thereof that includes the interrogation position, except that the interrogation position is occupied by a different nucleotide in each of the four corresponding probes.

Development of highly sensitive electrochemical genosensor based on multiwalled carbon nanotubes-chitosan-bismuth and lead sulfide nanoparticles for the detection of pathogenic Aeromonas.

PubMed

Fernandes, António Maximiano; Abdalhai, Mandour H; Ji, Jian; Xi, Bing-Wen; Xie, Jun; Sun, Jiadi; Noeline, Rasoamandrary; Lee, Byong H; Sun, Xiulan

2015-01-15

In this paper, we reported the construction of new high sensitive electrochemical genosensor based on multiwalled carbon nanotubes-chitosan-bismuth complex (MWCNT-Chi-Bi) and lead sulfide nanoparticles for the detection of pathogenic Aeromonas. Lead sulfide nanoparticles capped with 5'-(NH2) oligonucleotides thought amide bond was used as signalizing probe DNA (sz-DNA) and thiol-modified oligonucleotides sequence was used as fixing probe DNA (fDNA). The two probes hybridize with target Aeromonas DNA (tDNA) sequence (fDNA-tDNA-szDNA). The signal of hybridization is detected by differential pulse voltammetry (DPV) after electrodeposition of released lead nanoparticles (PbS) from sz-DNA on the surface of glass carbon electrode decorated with MWCNT-Chi-Bi, which improves the deposition and traducing electrical signal. The optimization of incubation time, hybridization temperature, deposition potential, deposition time and the specificity of the probes were investigated. Our results showed the highest sensibility to detect the target gene when compared with related biosensors and polymerase chain reaction (PCR). The detection limit for this biosensor was 1.0×10(-14) M. We could detect lower than 10(2) CFU mL(-1) of Aeromonas in spiked tap water. This method is rapid and sensitive for the detection of pathogenic bacteria and would become a potential application in biomedical diagnosis, food safety and environmental monitoring. Copyright © 2014 Elsevier B.V. All rights reserved.

Small-scale high-throughput sequencing-based identification of new therapeutic tools in cystic fibrosis.

PubMed

Bonini, Jennifer; Varilh, Jessica; Raynal, Caroline; Thèze, Corinne; Beyne, Emmanuelle; Audrezet, Marie-Pierre; Ferec, Claude; Bienvenu, Thierry; Girodon, Emmanuelle; Tuffery-Giraud, Sylvie; Des Georges, Marie; Claustres, Mireille; Taulan-Cadars, Magali

2015-10-01

Although 97-99% of CFTR mutations have been identified, great efforts must be made to detect yet-unidentified mutations. We developed a small-scale next-generation sequencing approach for reliably and quickly scanning the entire gene, including noncoding regions, to identify new mutations. We applied this approach to 18 samples from patients suffering from cystic fibrosis (CF) in whom only one mutation had hitherto been identified. Using an in-house bioinformatics pipeline, we could rapidly identify a second disease-causing CFTR mutation for 16 of 18 samples. Of them, c.1680-883A>G was found in three unrelated CF patients. Analysis of minigenes and patients' transcripts showed that this mutation results in aberrantly spliced transcripts because of the inclusion of a pseudoexon. It is located only three base pairs from the c.1680-886A>G mutation (1811+1.6kbA>G), the fourth most frequent mutation in southwestern Europe. We next tested the effect of antisense oligonucleotides targeting splice sites on these two mutations on pseudoexon skipping. Oligonucleotide transfection resulted in the restoration of the full-length, in-frame CFTR transcript, demonstrating the effect of antisense oligonucleotide-induced pseudoexon skipping in CF. Our data confirm the importance of analyzing noncoding regions to find unidentified mutations, which is essential to designing targeted therapeutic approaches.

Cy3 and Cy5 dyes attached to oligonucleotide terminus stabilize DNA duplexes: predictive thermodynamic model.

PubMed

Moreira, Bernardo G; You, Yong; Owczarzy, Richard

2015-03-01

Cyanine dyes are important chemical modifications of oligonucleotides exhibiting intensive and stable fluorescence at visible light wavelengths. When Cy3 or Cy5 dye is attached to 5' end of a DNA duplex, the dye stacks on the terminal base pair and stabilizes the duplex. Using optical melting experiments, we have determined thermodynamic parameters that can predict the effects of the dyes on duplex stability quantitatively (ΔG°, Tm). Both Cy dyes enhance duplex formation by 1.2 kcal/mol on average, however, this Gibbs energy contribution is sequence-dependent. If the Cy5 is attached to a pyrimidine nucleotide of pyrimidine-purine base pair, the stabilization is larger compared to the attachment to a purine nucleotide. This is likely due to increased stacking interactions of the dye to the purine of the complementary strand. Dangling (unpaired) nucleotides at duplex terminus are also known to enhance duplex stability. Stabilization originated from the Cy dyes is significantly larger than the stabilization due to the presence of dangling nucleotides. If both the dangling base and Cy3 are present, their thermodynamic contributions are approximately additive. New thermodynamic parameters improve predictions of duplex folding, which will help design oligonucleotide sequences for biophysical, biological, engineering, and nanotechnology applications. Copyright © 2015. Published by Elsevier B.V.

Solid-phase synthesis of a nucleopeptide from the linking site of adenovirus-2 nucleoprotein, -Ser(p5'CATCAT)-Gly-Asp-. Convergent versus stepwise strategy.

PubMed Central

Robles, J; Pedroso, E; Grandas, A

1995-01-01

The synthesis of a nucleopeptide with the sequence -Ser(p5'CATCAT)-Gly-Asp- has been undertaken by either convergent or stepwise solid-phase strategies, both of which use base-labile permanent protecting groups. The coupling of phosphitylated protected peptides onto oligonucleotide-resins did not afford the desired nucleopeptide, which was nevertheless obtained after oligonucleotide elongation at the hydroxyl group of the resin-bound peptide and deprotection under mild basic conditions. A preliminary study on the stability of different nucleopeptides to bases is also reported. PMID:7479079

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sun, Zhen; Department of Biochemistry and Molecular Biology, Program in Molecular Cell Biology, Zhejiang University School of Medicine, Hangzhou, Zhejiang 310058; Xiang, Wenqing

Highlights: {yields} LNA-modified oligonucleotides can pass through the plasma membrane of cultured cells even without using transfection machinery. {yields} LNA-modified oligonucleotides passed efficiently across the cell membrane, and lipid-coating facilitated translocation from the cytoplasm to the nucleus. {yields} LNA-oligonucleotide designed to target nuclear HBV DNA efficiently suppresses HBV replication and transcription in cultured hepatic cells. -- Abstract: Silencing target genes with small regulatory RNAs is widely used to investigate gene function and therapeutic drug development. Recently, triplex-based approaches have provided another attractive means to achieve targeted gene regulation and gene manipulation at the molecular and cellular levels. Nuclear entry ofmore » oligonucleotides and enhancement of their affinity to the DNA targets are key points of such approaches. In this study, we developed lipid-based transport of a locked-nucleic-acid (LNA)-modified oligonucleotide for hepatitis B virus (HBV) DNA interference in human hepatocytes expressing HBV genomic DNA. In these cells, the LNA-modified oligonucleotides passed efficiently across the cell membrane, and lipid-coating facilitated translocation from the cytoplasm to the nucleus. The oligonucleotide specifically targeting HBV DNA clearly interfered with HBV DNA transcription as shown by a block in pregenomic RNA (pgRNA) production. The HBV DNA-targeted oligonucleotide suppressed HBV DNA replication and HBV protein production more efficiently than small interfering RNAs directed to the pgRNA. These results demonstrate that fusion with lipid can carry LNA-modified oligonucleotides to the nucleus where they regulate gene expression. Interfering with HBV DNA transcription by LNA-modified oligonucleotides has strong potential as a new strategy for HBV inhibition.« less

In vitro evolution of chemically-modified nucleic acid aptamers: Pros and cons, and comprehensive selection strategies.

PubMed

Lipi, Farhana; Chen, Suxiang; Chakravarthy, Madhuri; Rakesh, Shilpa; Veedu, Rakesh N

2016-12-01

Nucleic acid aptamers are single-stranded DNA or RNA oligonucleotide sequences that bind to a specific target molecule with high affinity and specificity through their ability to adopt 3-dimensional structure in solution. Aptamers have huge potential as targeted therapeutics, diagnostics, delivery agents and as biosensors. However, aptamers composed of natural nucleotide monomers are quickly degraded in vivo and show poor pharmacodynamic properties. To overcome this, chemically-modified nucleic acid aptamers are developed by incorporating modified nucleotides after or during the selection process by Systematic Evolution of Ligands by EXponential enrichment (SELEX). This review will discuss the development of chemically-modified aptamers and provide the pros and cons, and new insights on in vitro aptamer selection strategies by using chemically-modified nucleic acid libraries.

In vitro evolution of chemically-modified nucleic acid aptamers: Pros and cons, and comprehensive selection strategies

PubMed Central

Chen, Suxiang; Chakravarthy, Madhuri; Rakesh, Shilpa; Veedu, Rakesh N.

2016-01-01

ABSTRACT Nucleic acid aptamers are single-stranded DNA or RNA oligonucleotide sequences that bind to a specific target molecule with high affinity and specificity through their ability to adopt 3-dimensional structure in solution. Aptamers have huge potential as targeted therapeutics, diagnostics, delivery agents and as biosensors. However, aptamers composed of natural nucleotide monomers are quickly degraded in vivo and show poor pharmacodynamic properties. To overcome this, chemically-modified nucleic acid aptamers are developed by incorporating modified nucleotides after or during the selection process by Systematic Evolution of Ligands by EXponential enrichment (SELEX). This review will discuss the development of chemically-modified aptamers and provide the pros and cons, and new insights on in vitro aptamer selection strategies by using chemically-modified nucleic acid libraries. PMID:27715478

Single-tube, non-isotopic, multiplex PCR/OLA assay and sequence-coded separation for simultaneous screening of 31 cystic fibrosis mutations

DOE Office of Scientific and Technical Information (OSTI.GOV)

Brinson, E.C.; Adriano, T.; Bloch, W.

1994-09-01

We have developed a rapid, single-tube, non-isotopic assay that screens a patient sample for the presence of 31 cystic fibrosis (CF) mutations. This assay can identify these mutations in a single reaction tube and a single electrophoresis run. Sample preparation is a simple, boil-and-go procedure, completed in less than an hour. The assay is composed of a 15-plex PCR, followed by a 61-plex oligonucleotide ligation assay (OLA), and incorporates a novel detection scheme, Sequence Coded Separation. Initially, the multiplex PCR amplifies 15 relevant segments of the CFTR gene, simultaneously. These PCR amplicons serve as templates for the multiplex OLA, whichmore » detects the normal or mutant allele at all loci, simultaneously. Each polymorphic site is interrogated by three oligonucleotide probes, a common probe and two allele-specific probes. Each common probe is tagged with a fluorescent dye, and the competing normal and mutant allelic probes incorporate different, non-nucleotide, mobility modifiers. These modifiers are composed of hexaethylene oxide (HEO) units, incorporated as HEO phosphoramidite monomers during automated DNA synthesis. The OLA is based on both probe hybridization and the ability of DNA ligase to discriminate single base mismatches at the junction between paired probes. Each single tube assay is electrophoresed in a single gel lane of a 4-color fluorescent DNA sequencer (Applied Biosystems, Model 373A). Each of the ligation products is identified by its unique combination of electrophoretic mobility and one of three colors. The fourth color is reserved for the in-lane size standard, used by GENESCAN{sup TM} software (Applied Biosystems) to size the OLA electrophoresis products. The Genotyper{sub TM} software (Applied Biosystems) decodes these Sequence-Coded-Separation data to create a patient summary report for all loci tested.« less

Sequence diversity within the HA-1 gene as detected by melting temperature assay without oligonucleotide probes

PubMed Central

Graziano, Claudio; Giorgi, Massimo; Malentacchi, Cecilia; Mattiuz, Pier Luigi; Porfirio, Berardino

2005-01-01

Background The minor histocompatibility antigens (mHags) are self-peptides derived from common cellular proteins and presented by MHC class I and II molecules. Disparities in mHags are a potential risk for the development of graft-versus-host disease (GvHD) in the recipients of bone marrow from HLA-identical donors. Two alleles have been identified in the mHag HA-1. The correlation between mismatches of the mHag HA-1 and GvHD has been suggested and methods to facilitate large-scale testing were afterwards developed. Methods We used sequence specific primer (SSP) PCR and direct sequencing to detect HA-1 gene polymorphisms in a sample of 131 unrelated Italian subjects. We then set up a novel melting temperature (Tm) assay that may help identification of HA-1 alleles without oligonucleotide probes. Results We report the frequencies of HA-1 alleles in the Italian population and the presence of an intronic 5 base-pair deletion associated with the immunogeneic allele HA-1H. We also detected novel variable sites with respect to the consensus sequence of HA-1 locus. Even though recombination/gene conversion events are documented, there is considerable linkage disequilibrium in the data. The gametic associations between HA-1R/H alleles and the intronic 5-bp ins/del polymorphism prompted us to try the Tm analysis with SYBR® Green I. We show that the addition of dimethylsulfoxide (DMSO) during the assay yields distinct patterns when amplicons from HA-1H homozygotes, HA-1R homozygotes, and heterozygotes are analysed. Conclusion The possibility to use SYBR® Green I to detect Tm differences between allelic variants is attractive but requires great caution. We succeeded in allele discrimination of the HA-1 locus using a relatively short (101 bp) amplicon, only in the presence of DMSO. We believe that, at least in certain assets, Tm assays may benefit by the addition of DMSO or other agents affecting DNA strand conformation and stability. PMID:16202172

The oligonucleotide frequency derived error gradient and its application to the binning of metagenome fragments

PubMed Central

2009-01-01

Background The characterisation, or binning, of metagenome fragments is an important first step to further downstream analysis of microbial consortia. Here, we propose a one-dimensional signature, OFDEG, derived from the oligonucleotide frequency profile of a DNA sequence, and show that it is possible to obtain a meaningful phylogenetic signal for relatively short DNA sequences. The one-dimensional signal is essentially a compact representation of higher dimensional feature spaces of greater complexity and is intended to improve on the tetranucleotide frequency feature space preferred by current compositional binning methods. Results We compare the fidelity of OFDEG against tetranucleotide frequency in both an unsupervised and semi-supervised setting on simulated metagenome benchmark data. Four tests were conducted using assembler output of Arachne and phrap, and for each, performance was evaluated on contigs which are greater than or equal to 8 kbp in length and contigs which are composed of at least 10 reads. Using both G-C content in conjunction with OFDEG gave an average accuracy of 96.75% (semi-supervised) and 95.19% (unsupervised), versus 94.25% (semi-supervised) and 82.35% (unsupervised) for tetranucleotide frequency. Conclusion We have presented an observation of an alternative characteristic of DNA sequences. The proposed feature representation has proven to be more beneficial than the existing tetranucleotide frequency space to the metagenome binning problem. We do note, however, that our observation of OFDEG deserves further anlaysis and investigation. Unsupervised clustering revealed OFDEG related features performed better than standard tetranucleotide frequency in representing a relevant organism specific signal. Further improvement in binning accuracy is given by semi-supervised classification using OFDEG. The emphasis on a feature-driven, bottom-up approach to the problem of binning reveals promising avenues for future development of techniques to characterise short environmental sequences without bias toward cultivable organisms. PMID:19958473

Bioinformatics analysis and detection of gelatinase encoded gene in Lysinibacillussphaericus

NASA Astrophysics Data System (ADS)

Repin, Rul Aisyah Mat; Mutalib, Sahilah Abdul; Shahimi, Safiyyah; Khalid, Rozida Mohd.; Ayob, Mohd. Khan; Bakar, Mohd. Faizal Abu; Isa, Mohd Noor Mat

2016-11-01

In this study, we performed bioinformatics analysis toward genome sequence of Lysinibacillussphaericus (L. sphaericus) to determine gene encoded for gelatinase. L. sphaericus was isolated from soil and gelatinase species-specific bacterium to porcine and bovine gelatin. This bacterium offers the possibility of enzymes production which is specific to both species of meat, respectively. The main focus of this research is to identify the gelatinase encoded gene within the bacteria of L. Sphaericus using bioinformatics analysis of partially sequence genome. From the research study, three candidate gene were identified which was, gelatinase candidate gene 1 (P1), NODE_71_length_93919_cov_158.931839_21 which containing 1563 base pair (bp) in size with 520 amino acids sequence; Secondly, gelatinase candidate gene 2 (P2), NODE_23_length_52851_cov_190.061386_17 which containing 1776 bp in size with 591 amino acids sequence; and Thirdly, gelatinase candidate gene 3 (P3), NODE_106_length_32943_cov_169.147919_8 containing 1701 bp in size with 566 amino acids sequence. Three pairs of oligonucleotide primers were designed and namely as, F1, R1, F2, R2, F3 and R3 were targeted short sequences of cDNA by PCR. The amplicons were reliably results in 1563 bp in size for candidate gene P1 and 1701 bp in size for candidate gene P3. Therefore, the results of bioinformatics analysis of L. Sphaericus resulting in gene encoded gelatinase were identified.

Versatile design and synthesis platform for visualizing genomes with Oligopaint FISH probes

PubMed Central

Beliveau, Brian J.; Joyce, Eric F.; Apostolopoulos, Nicholas; Yilmaz, Feyza; Fonseka, Chamith Y.; McCole, Ruth B.; Chang, Yiming; Li, Jin Billy; Senaratne, Tharanga Niroshini; Williams, Benjamin R.; Rouillard, Jean-Marie; Wu, Chao-ting

2012-01-01

A host of observations demonstrating the relationship between nuclear architecture and processes such as gene expression have led to a number of new technologies for interrogating chromosome positioning. Whereas some of these technologies reconstruct intermolecular interactions, others have enhanced our ability to visualize chromosomes in situ. Here, we describe an oligonucleotide- and PCR-based strategy for fluorescence in situ hybridization (FISH) and a bioinformatic platform that enables this technology to be extended to any organism whose genome has been sequenced. The oligonucleotide probes are renewable, highly efficient, and able to robustly label chromosomes in cell culture, fixed tissues, and metaphase spreads. Our method gives researchers precise control over the sequences they target and allows for single and multicolor imaging of regions ranging from tens of kilobases to megabases with the same basic protocol. We anticipate this technology will lead to an enhanced ability to visualize interphase and metaphase chromosomes. PMID:23236188

Methods for determining the genetic affinity of microorganisms and viruses

NASA Technical Reports Server (NTRS)

Fox, George E. (Inventor); Willson, III, Richard C. (Inventor); Zhang, Zhengdong (Inventor)

2012-01-01

Selecting which sub-sequences in a database of nucleic acid such as 16S rRNA are highly characteristic of particular groupings of bacteria, microorganisms, fungi, etc. on a substantially phylogenetic tree. Also applicable to viruses comprising viral genomic RNA or DNA. A catalogue of highly characteristic sequences identified by this method is assembled to establish the genetic identity of an unknown organism. The characteristic sequences are used to design nucleic acid hybridization probes that include the characteristic sequence or its complement, or are derived from one or more characteristic sequences. A plurality of these characteristic sequences is used in hybridization to determine the phylogenetic tree position of the organism(s) in a sample. Those target organisms represented in the original sequence database and sufficient characteristic sequences can identify to the species or subspecies level. Oligonucleotide arrays of many probes are especially preferred. A hybridization signal can comprise fluorescence, chemiluminescence, or isotopic labeling, etc.; or sequences in a sample can be detected by direct means, e.g. mass spectrometry. The method's characteristic sequences can also be used to design specific PCR primers. The method uniquely identifies the phylogenetic affinity of an unknown organism without requiring prior knowledge of what is present in the sample. Even if the organism has not been previously encountered, the method still provides useful information about which phylogenetic tree bifurcation nodes encompass the organism.

Endosymbiotic Microbiota of the Bamboo Pseudococcid Antonina crawii (Insecta, Homoptera)

PubMed Central

Fukatsu, Takema; Nikoh, Naruo

2000-01-01

We characterized the intracellular symbiotic microbiota of the bamboo pseudococcid Antonina crawii by performing a molecular phylogenetic analysis in combination with in situ hybridization. Almost the entire length of the bacterial 16S rRNA gene was amplified and cloned from A. crawii whole DNA. Restriction fragment length polymorphism analysis revealed that the clones obtained included three distinct types of sequences. Nucleotide sequences of the three types were determined and subjected to a molecular phylogenetic analysis. The first sequence was a member of the γ subdivision of the division Proteobacteria (γ-Proteobacteria) to which no sequences in the database were closely related, although the sequences of endosymbionts of other homopterans, such as psyllids and aphids, were distantly related. The second sequence was a β-Proteobacteria sequence and formed a monophyletic group with the sequences of endosymbionts from other pseudococcids. The third sequence exhibited a high level of similarity to sequences of Spiroplasma spp. from ladybird beetles and a tick. Localization of the endosymbionts was determined by using tissue sections of A. crawii and in situ hybridization with specific oligonucleotide probes. The γ- and β-Proteobacteria symbionts were packed in the cytoplasm of the same mycetocytes (or bacteriocytes) and formed a large mycetome (or bacteriome) in the abdomen. The spiroplasma symbionts were also present intracellularly in various tissues at a low density. We observed that the anterior poles of developing eggs in the ovaries were infected by the γ- and β-Proteobacteria symbionts in a systematic way, which ensured vertical transmission. Five representative pseudococcids were examined by performing diagnostic PCR experiments with specific primers; the β-Proteobacteria symbiont was detected in all five pseudococcids, the γ-Proteobacteria symbiont was found in three, and the spiroplasma symbiont was detected only in A. crawii. PMID:10653730

A one-step reaction for the rapid identification of Lactobacillus mindensis, Lactobacillus panis, Lactobacillus paralimentarius, Lactobacillus pontis and Lactobacillus frumenti using oligonucleotide primers designed from the 16S-23S rRNA intergenic sequences.

PubMed

Ferchichi, M; Valcheva, R; Prévost, H; Onno, B; Dousset, X

2008-06-01

Species-specific primers targeting the 16S-23S ribosomal DNA (rDNA) intergenic spacer region (ISR) were designed to rapidly discriminate between Lactobacillus mindensis, Lactobacillus panis, Lactobacillus paralimentarius, Lactobacillus pontis and Lactobacillus frumenti species recently isolated from French sourdough. The 16S-23S ISRs were amplified using primers 16S/p2 and 23S/p7, which anneal to positions 1388-1406 of the 16S rRNA gene and to positions 207-189 of the 23S rRNA gene respectively, Escherichia coli numbering (GenBank accession number V00331). Clone libraries of the resulting amplicons were constructed using a pCR2.1 TA cloning kit and sequenced. Species-specific primers were designed based on the sequences obtained and were used to amplify the 16S-23S ISR in the Lactobacillus species considered. For all of them, two PCR amplicons, designated as small ISR (S-ISR) and large ISR (L-ISR), were obtained. The L-ISR is composed of the corresponding S-ISR, interrupted by a sequence containing tRNA(Ile) and tRNA(Ala) genes. Based on these sequences, species-specific primers were designed and proved to identify accurately the species considered among 30 reference Lactobacillus species tested. Designed species-specific primers enable a rapid and accurate identification of L. mindensis, L. paralimentarius, L. panis, L. pontis and L. frumenti species among other lactobacilli. The proposed method provides a powerful and convenient means of rapidly identifying some sourdough lactobacilli, which could be of help in large starter culture surveys.

Molecular Strain Typing of Mycobacterium tuberculosis: a Review of Frequently Used Methods

PubMed Central

2016-01-01

Tuberculosis, caused by the bacterium Mycobacterium tuberculosis, remains one of the most serious global health problems. Molecular typing of M. tuberculosis has been used for various epidemiologic purposes as well as for clinical management. Currently, many techniques are available to type M. tuberculosis. Choosing the most appropriate technique in accordance with the existing laboratory conditions and the specific features of the geographic region is important. Insertion sequence IS6110-based restriction fragment length polymorphism (RFLP) analysis is considered the gold standard for the molecular epidemiologic investigations of tuberculosis. However, other polymerase chain reaction-based methods such as spacer oligonucleotide typing (spoligotyping), which detects 43 spacer sequence-interspersing direct repeats (DRs) in the genomic DR region; mycobacterial interspersed repetitive units–variable number tandem repeats, (MIRU-VNTR), which determines the number and size of tandem repetitive DNA sequences; repetitive-sequence-based PCR (rep-PCR), which provides high-throughput genotypic fingerprinting of multiple Mycobacterium species; and the recently developed genome-based whole genome sequencing methods demonstrate similar discriminatory power and greater convenience. This review focuses on techniques frequently used for the molecular typing of M. tuberculosis and discusses their general aspects and applications. PMID:27709842

Molecular Strain Typing of Mycobacterium tuberculosis: a Review of Frequently Used Methods.

PubMed

Ei, Phyu Win; Aung, Wah Wah; Lee, Jong Seok; Choi, Go Eun; Chang, Chulhun L

2016-11-01

Tuberculosis, caused by the bacterium Mycobacterium tuberculosis, remains one of the most serious global health problems. Molecular typing of M. tuberculosis has been used for various epidemiologic purposes as well as for clinical management. Currently, many techniques are available to type M. tuberculosis. Choosing the most appropriate technique in accordance with the existing laboratory conditions and the specific features of the geographic region is important. Insertion sequence IS6110-based restriction fragment length polymorphism (RFLP) analysis is considered the gold standard for the molecular epidemiologic investigations of tuberculosis. However, other polymerase chain reaction-based methods such as spacer oligonucleotide typing (spoligotyping), which detects 43 spacer sequence-interspersing direct repeats (DRs) in the genomic DR region; mycobacterial interspersed repetitive units-variable number tandem repeats, (MIRU-VNTR), which determines the number and size of tandem repetitive DNA sequences; repetitive-sequence-based PCR (rep-PCR), which provides high-throughput genotypic fingerprinting of multiple Mycobacterium species; and the recently developed genome-based whole genome sequencing methods demonstrate similar discriminatory power and greater convenience. This review focuses on techniques frequently used for the molecular typing of M. tuberculosis and discusses their general aspects and applications.

Genetic heterogeneity in type 1 Gaucher disease: Multiple genotypes in Ashkenazic and non-Ashkenazic individuals

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tsuji, Shoji; Martin, B.M.; Stubblefield, B.K.

1988-04-01

Nucleotide sequence analysis of a genomic clone from an Ashkenazic Jewish patient with type 1 Gaucher disease revealed a single-base mutation (adenosine to guanosine transition) in exon 9 of the glucocerebrosidase gene. This change results in the amino acid substitution of serine for asparagine. Transient expression studies following oligonucleotide-directed mutagenesis of the normal cDNA confirmed that the mutation results in loss of glucocerebrosidase activity. Allele-specific hybridization with oligonucleotide probes demonstrated that this mutation was found exclusively in type 1 phenotype. None of the 6 type 2 patients, 11 type 3 patients, or 12 normal controls had this allele. In contrast,more » 15 of 24 type 1 patients had one allele with this mutation, and 3 others were homozygous for the mutation. Furthermore, some of the Ashkenazic Jewish type 1 patients had only one allele with this mutation, suggesting that even in this population there is allelic heterozygosity. These findings indicate that there are multiple allelic mutations responsible for type 1 Gaucher disease in both the Jewish and non-Jewish populations. Allelic-specific hybridization demonstrating this mutation in exon 9, used in conjunction with the Nci I restriction fragment length polymorphism described as a marker for neuronopathic Gaucher disease, provides a tool for diagnosis and genetic counseling that is {approx}80% informative in all Gaucher patients studied.« less

Biostable aptamers with antagonistic properties to the neuropeptide nociceptin/orphanin FQ

PubMed Central

FAULHAMMER, DIRK; ESCHGFÄLLER, BERND; STARK, SANDRA; BURGSTALLER, PETRA; ENGLBERGER, WERNER; ERFURTH, JEANNETTE; KLEINJUNG, FRANK; RUPP, JOHANNA; VULCU, SEBASTIAN DAN; SCHRÖDER, WERNER; VONHOFF, STEFAN; NAWRATH, HERMANN; GILLEN, CLEMENS; KLUSSMANN, SVEN

2004-01-01

The neuropeptide nociceptin/orphanin FQ (N/OFQ), the endogenous ligand of the opioid receptor-like 1 (ORL1) receptor, has been shown to play a prominent role in the regulation of several biological functions such as pain and stress. Here we describe the isolation and characterization of N/OFQ binding biostable RNA aptamers (Spiegelmers) using a mirror-image in vitro selection approach. Spiegelmers are l-enantiomeric oligonucleotide ligands that display high affinity and specificity to their targets and high resistance to enzymatic degradation compared to d-oligonucleotides. A representative Spiegelmer from the selections performed was size-minimized to two distinct sequences capable of high affinity binding to N/OFQ. The Spiegelmers were shown to antagonize binding of N/OFQ to the ORL1 receptor in a binding-competition assay. The calculated IC50 values for the Spiegelmers NOX 2149 and NOX 2137a/b were 110 nM and 330 nM, respectively. The competitive antagonistic properties of these Spiegelmers were further demonstrated by their effective and specific inhibition of G-protein activation in two additional models. The Spiegelmers antagonized the N/OFQ-induced GTPγS incorporation into cell membranes of a CHO-K1 cell line expressing the human ORL1 receptor. In oocytes from Xenopus laevis, NOX 2149 showed an antagonistic effect to the N/OFQ-ORL 1 receptor system that was functionally coupled with G-protein-regulated inwardly rectifying K+ channels. PMID:14970396

Antisense oligonucleotides targeting translation inhibitory elements in 5' UTRs can selectively increase protein levels.

PubMed

Liang, Xue-Hai; Sun, Hong; Shen, Wen; Wang, Shiyu; Yao, Joyee; Migawa, Michael T; Bui, Huynh-Hoa; Damle, Sagar S; Riney, Stan; Graham, Mark J; Crooke, Rosanne M; Crooke, Stanley T

2017-09-19

A variety of diseases are caused by deficiencies in amounts or activity of key proteins. An approach that increases the amount of a specific protein might be of therapeutic benefit. We reasoned that translation could be specifically enhanced using trans-acting agents that counter the function of negative regulatory elements present in the 5' UTRs of some mRNAs. We recently showed that translation can be enhanced by antisense oligonucleotides (ASOs) that target upstream open reading frames. Here we report the amount of a protein can also be selectively increased using ASOs designed to hybridize to other translation inhibitory elements in 5' UTRs. Levels of human RNASEH1, LDLR, and ACP1 and of mouse ACP1 and ARF1 were increased up to 2.7-fold in different cell types and species upon treatment with chemically modified ASOs targeting 5' UTR inhibitory regions in the mRNAs encoding these proteins. The activities of ASOs in enhancing translation were sequence and position dependent and required helicase activity. The ASOs appear to improve the recruitment of translation initiation factors to the target mRNA. Importantly, ASOs targeting ACP1 mRNA significantly increased the level of ACP1 protein in mice, suggesting that this approach has therapeutic and research potentials. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

Stabilizing effect of propionic acid derivative of anthraquinone--polyamine conjugate incorporated into α-β chimeric oligonucleotides on the alternate-stranded triple helix.

PubMed

Moriguchi, Tomohisa; Azam, A T M Zafrul; Shinozuka, Kazuo

2011-06-15

Two types of anthraquinone conjugates were synthesized as non-nucleosidic oligonucleotide components. These include an anthraquinone derivative conjugated with 2,2-bis(hydroxymethyl)propionic acid and an anthraquinone--polyamine derivative conjugated with 2,2-bis(hydroxymethyl)propionic acid. The conjugates were successfully incorporated into the "linking-region" of the α-β chimeric oligonucleotides via phosphoramidite method as non-nucleosidic backbone units. The resultant novel α-β chimeric oligonucleotides possessed two diastereomers that were generated by the introduction of the anthraquinone conjugate with a stereogenic carbon atom. The isomers were successfully separated by a reversed-phase HPLC. UV-melting experiments revealed that both stereoisomers formed a substantially stable alternate-strand triple helix, irrespective of the stereochemistry of the incorporated non-nucleosidic backbone unit. However, the enhancing effect on thermal stability depended on the length of the alkyl linker connecting anthraquinone moiety and the propionic acid moiety. The sequence discrimination ability of the chimeric oligonucleotides toward mismatch target duplex was also examined. The T(m) values of the triplexes containing the mismatch target were substantially lower than the T(m) values of those containing the full-match target. The thermodynamic parameters (ΔH°, ΔS°, and ΔG°) required for the dissociation of the triplexes into the third strand and target duplex were also measured.

The sequence of sequencers: The history of sequencing DNA

PubMed Central

Heather, James M.; Chain, Benjamin

2016-01-01

Determining the order of nucleic acid residues in biological samples is an integral component of a wide variety of research applications. Over the last fifty years large numbers of researchers have applied themselves to the production of techniques and technologies to facilitate this feat, sequencing DNA and RNA molecules. This time-scale has witnessed tremendous changes, moving from sequencing short oligonucleotides to millions of bases, from struggling towards the deduction of the coding sequence of a single gene to rapid and widely available whole genome sequencing. This article traverses those years, iterating through the different generations of sequencing technology, highlighting some of the key discoveries, researchers, and sequences along the way. PMID:26554401

Sequence requirements of oligonucleotide chiral selectors for the capillary electrophoresis resolution of low-affinity DNA binders.

PubMed

Tohala, Luma; Oukacine, Farid; Ravelet, Corinne; Peyrin, Eric

2017-05-01

We recently reported that a great variety of DNA oligonucleotides (ONs) used as chiral selectors in partial-filling capillary electrophoresis (CE) exhibited interesting enantioresolution properties toward low-affinity DNA binders. Herein, the sequence prerequisites of ONs for the CE enantioseparation process were studied. First, the chiral resolution properties of a series of homopolymeric sequences (Poly-dT) of different lengths (from 5 to 60-mer) were investigated. It was shown that the size increase-dependent random coil-like conformation of Poly-dT favorably acted on the apparent selectivity and resolution. The base-unpairing state constituted also an important factor in the chiral resolution ability of ONs as the switch from the single-stranded to double-stranded structure was responsible for a significant decrease in the analyte selectivity range. Finally, the chemical diversity enhanced the enantioresolution ability of single-stranded ONs. The present work could lay the foundation for the design of performant ON chiral selectors for the CE separation of weak DNA binder enantiomers. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Selection and characterization of a DNA aptamer to crystal violet.

PubMed

Chen, Yang; Wang, Jine; Zhang, Yajie; Xu, Lijun; Gao, Tian; Wang, Bing; Pei, Renjun

2018-06-13

Aptamers are short single-stranded DNA or RNA, which can be selected in vitro by systematic evolution of ligands by exponential enrichment (SELEX). In order to develop novel light-up probes to substitute G-quadruplex (G4), we selected a DNA aptamer for crystal violet (CV), a triphenylmethane light-up dye, by a modified affinity chromatography-based SELEX. The ssDNA pool was first coupled on streptavidin-coated agarose beads through a biotin labeled complementary oligonucleotide, and then the aptamer sequences would be released from agarose beads by CV affinity. This method is simple, straightforward and effective. The aptamer sequence with a low micromolar dissociation constant (Kd) and good specificity was achieved after 11 rounds of selection. The light-up properties of the CV-aptamer were also investigated, and the CV showed dramatic fluorescence enhancement. The CV-aptamer pair could be further used as a novel light-up fluorescent probe to design biosensors.

Multiplex amplification of large sets of human exons.

PubMed

Porreca, Gregory J; Zhang, Kun; Li, Jin Billy; Xie, Bin; Austin, Derek; Vassallo, Sara L; LeProust, Emily M; Peck, Bill J; Emig, Christopher J; Dahl, Fredrik; Gao, Yuan; Church, George M; Shendure, Jay

2007-11-01

A new generation of technologies is poised to reduce DNA sequencing costs by several orders of magnitude. But our ability to fully leverage the power of these technologies is crippled by the absence of suitable 'front-end' methods for isolating complex subsets of a mammalian genome at a scale that matches the throughput at which these platforms will routinely operate. We show that targeting oligonucleotides released from programmable microarrays can be used to capture and amplify approximately 10,000 human exons in a single multiplex reaction. Additionally, we show integration of this protocol with ultra-high-throughput sequencing for targeted variation discovery. Although the multiplex capture reaction is highly specific, we found that nonuniform capture is a key issue that will need to be resolved by additional optimization. We anticipate that highly multiplexed methods for targeted amplification will enable the comprehensive resequencing of human exons at a fraction of the cost of whole-genome resequencing.

Using DNA origami nanostructures to determine absolute cross sections for UV photon-induced DNA strand breakage.

PubMed

Vogel, Stefanie; Rackwitz, Jenny; Schürman, Robin; Prinz, Julia; Milosavljević, Aleksandar R; Réfrégiers, Matthieu; Giuliani, Alexandre; Bald, Ilko

2015-11-19

We have characterized ultraviolet (UV) photon-induced DNA strand break processes by determination of absolute cross sections for photoabsorption and for sequence-specific DNA single strand breakage induced by photons in an energy range from 6.50 to 8.94 eV. These represent the lowest-energy photons able to induce DNA strand breaks. Oligonucleotide targets are immobilized on a UV transparent substrate in controlled quantities through attachment to DNA origami templates. Photon-induced dissociation of single DNA strands is visualized and quantified using atomic force microscopy. The obtained quantum yields for strand breakage vary between 0.06 and 0.5, indicating highly efficient DNA strand breakage by UV photons, which is clearly dependent on the photon energy. Above the ionization threshold strand breakage becomes clearly the dominant form of DNA radiation damage, which is then also dependent on the nucleotide sequence.

The Deinococcus-Thermus phylum and the effect of rRNA composition on phylogenetic tree construction

NASA Technical Reports Server (NTRS)

Weisburg, W. G.; Giovannoni, S. J.; Woese, C. R.

1989-01-01

Through comparative analysis of 16S ribosomal RNA sequences, it can be shown that two seemingly dissimilar types of eubacteria Deinococcus and the ubiquitous hot spring organism Thermus are distantly but specifically related to one another. This confirms an earlier report based upon 16S rRNA oligonucleotide cataloging studies (Hensel et al., 1986). Their two lineages form a distinctive grouping within the eubacteria that deserved the taxonomic status of a phylum. The (partial) sequence of T. aquaticus rRNA appears relatively close to those of other thermophilic eubacteria. e.g. Thermotoga maritima and Thermomicrobium roseum. However, this closeness does not reflect a true evolutionary closeness; rather it is due to a "thermophilic convergence", the result of unusually high G+C composition in the rRNAs of thermophilic bacteria. Unless such compositional biases are taken into account, the branching order and root of phylogenetic trees can be incorrectly inferred.

Molecular analysis of the AGXT gene in Italian patients with primary hyperoxaluria type 1 (PH1).

PubMed

Ferrettini, C; Pirulli, D; Cosseddu, D; Marangella, M; Petrarulo, M; Mazzola, G; Vatta, S; Amoroso, A

1998-01-01

Specimens were collected from 22 Italian patients with primary hyperoxaluria type 1 (PH1). Ten of them had already been analyzed by molecular biology. To clarify the molecular characteristics of the AGXT gene disease responsible for PH1, DNA samples were examined for known mutations by hybridisation of PCR products with Sequence Specific Oligonucleotides (PCR-SSO). We planned to identify new mutations of the AGXT gene by heteroduplex analysis followed by direct sequencing. We had already standardized a) the conditions for the amplification of the 11 exons of AGXT, b) the PCR-SSO technique and c) the heteroduplex analysis of amplified products. Preliminary results demonstrated that the AGXT mutations described in previous studies were found only in 40% of the examined Italian patients with PH1. The remaining 60% of mutations should be characterised in future studies.

Electrostatic interactions guide the active site face of a structure-specific ribonuclease to its RNA substrate.

PubMed

Plantinga, Matthew J; Korennykh, Alexei V; Piccirilli, Joseph A; Correll, Carl C

2008-08-26

Restrictocin, a member of the alpha-sarcin family of site-specific endoribonucleases, uses electrostatic interactions to bind to the ribosome and to RNA oligonucleotides, including the minimal specific substrate, the sarcin/ricin loop (SRL) of 23S-28S rRNA. Restrictocin binds to the SRL by forming a ground-state E:S complex that is stabilized predominantly by Coulomb interactions and depends on neither the sequence nor structure of the RNA, suggesting a nonspecific complex. The 22 cationic residues of restrictocin are dispersed throughout this protein surface, complicating a priori identification of a Coulomb interacting surface. Structural studies have identified an enzyme-substrate interface, which is expected to overlap with the electrostatic E:S interface. Here, we identified restrictocin residues that contribute to binding in the E:S complex by determining the salt dependence [partial differential log(k 2/ K 1/2)/ partial differential log[KCl

Identification of sequence motifs significantly associated with antisense activity.

PubMed

McQuisten, Kyle A; Peek, Andrew S

2007-06-07

Predicting the suppression activity of antisense oligonucleotide sequences is the main goal of the rational design of nucleic acids. To create an effective predictive model, it is important to know what properties of an oligonucleotide sequence associate significantly with antisense activity. Also, for the model to be efficient we must know what properties do not associate significantly and can be omitted from the model. This paper will discuss the results of a randomization procedure to find motifs that associate significantly with either high or low antisense suppression activity, analysis of their properties, as well as the results of support vector machine modelling using these significant motifs as features. We discovered 155 motifs that associate significantly with high antisense suppression activity and 202 motifs that associate significantly with low suppression activity. The motifs range in length from 2 to 5 bases, contain several motifs that have been previously discovered as associating highly with antisense activity, and have thermodynamic properties consistent with previous work associating thermodynamic properties of sequences with their antisense activity. Statistical analysis revealed no correlation between a motif's position within an antisense sequence and that sequences antisense activity. Also, many significant motifs existed as subwords of other significant motifs. Support vector regression experiments indicated that the feature set of significant motifs increased correlation compared to all possible motifs as well as several subsets of the significant motifs. The thermodynamic properties of the significantly associated motifs support existing data correlating the thermodynamic properties of the antisense oligonucleotide with antisense efficiency, reinforcing our hypothesis that antisense suppression is strongly associated with probe/target thermodynamics, as there are no enzymatic mediators to speed the process along like the RNA Induced Silencing Complex (RISC) in RNAi. The independence of motif position and antisense activity also allows us to bypass consideration of this feature in the modelling process, promoting model efficiency and reducing the chance of overfitting when predicting antisense activity. The increase in SVR correlation with significant features compared to nearest-neighbour features indicates that thermodynamics alone is likely not the only factor in determining antisense efficiency.

Customized oligonucleotide microchips that convert multiple genetic information to simple patterns, are portable and reusable

DOEpatents

Mirzabekov, Andrei; Guschin, Dmitry Y.; Chik, Valentine; Drobyshev, Aleksei; Fotin, Alexander; Yershov, Gennadiy; Lysov, Yuri

2002-01-01

This invention relates to using customized oligonucleotide microchips as biosensors for the detection and identification of nucleic acids specific for different genes, organisms and/or individuals in the environment, in food and in biological samples. The microchips are designed to convert multiple bits of genetic information into simpler patterns of signals that are interpreted as a unit. Because of an improved method of hybridizing oligonucleotides from samples to microchips, microchips are reusable and transportable. For field study, portable laser or bar code scanners are suitable.

Magnetic bead/capture DNA/glucose-loaded nanoliposomes for amplifying the glucometer signal in the rapid screening of hepatitis C virus RNA.

PubMed

Tu, Haijian; Lin, Kun; Lun, Yongzhi; Yu, Liuming

2018-06-01

A digital detection strategy based on a portable personal glucometer (PGM) was developed for the simple, rapid, and sensitive detection of hepatitis C virus (HCV) RNA, involving the release of glucose-loaded nanoliposomes due to coupling-site-specific cleavage by the endonuclease BamHI. The glucose-loaded nanoliposomes were synthesized using a reversed-phase evaporation method and provided an amplified signal at the PGM in the presence of HCV RNA. Initially, a 21-mer oligonucleotide complementary to HCV RNA was covalently conjugated to a magnetic bead through the amino group at the 5' end of the oligonucleotide, and then bound to a glucose-loaded liposome by typical carbodiimide coupling at its 3' end. In the presence of the target HCV RNA, the target hybridized with the oligonucleotide to form double-stranded DNA. The symmetrical duplex sequence 5'-GGATCC-3' between guanines was then catalytically cleaved by BamHI, which detached the glucose-loaded liposome from the magnetic bead. Following magnetic separation of the bead, the detached glucose-loaded liposome was lysed using Triton X-100 to release the glucose molecules within it, which were then detected as an amplified signal at the digital PGM. Under optimal conditions, the PGM signal increased with increasing HCV RNA, and displayed a strongly linear dependence on the level of HCV RNA for concentrations ranging from 10 pM to 1.0 μM. The detection limit (LOD) of the system was 1.9 pM. Good reproducibility and favorable specificity were achieved in the analysis of the target HCV RNA. Human serum samples containing HCV RNA were analyzed using this strategy, and the developed sensing platform was observed to yield satisfactory results based on a comparison with the corresponding results from a Cobas ® Amplicor HCV Test Analyzer. Graphical abstract A digital detection strategy utilizing a personal glucometer was developed for the detection of hepatitis C virus RNA. The strategy involved the use of the endonuclease BamHI along with a 21-mer oligonucleotide conjugated to both a magnetic bead and a glucose-loaded nanoliposome. Hybridization of the nucleotide with the target RNA triggered the coupling-site-specific cleavage of the duplex by BamHI, leading to the release of the glucose-loaded nanoliposome. Following separation of the magnetic bead, the free nanoliposome was dissolved, liberating the glucose molecules within it, which in turn were detected as an amplified signal by the glucometer.

Novel complex MAD phasing and RNase H structural insights using selenium oligonucleotides

DOE Office of Scientific and Technical Information (OSTI.GOV)

Abdur, Rob; Gerlits, Oksana O.; Gan, Jianhua

2014-02-01

Selenium-derivatized oligonucleotides may facilitate phase determination and high-resolution structure determination for protein–nucleic acid crystallography. The Se atom-specific mutagenesis (SAM) strategy may also enhance the study of nuclease catalysis. The crystal structures of protein–nucleic acid complexes are commonly determined using selenium-derivatized proteins via MAD or SAD phasing. Here, the first protein–nucleic acid complex structure determined using selenium-derivatized nucleic acids is reported. The RNase H–RNA/DNA complex is used as an example to demonstrate the proof of principle. The high-resolution crystal structure indicates that this selenium replacement results in a local subtle unwinding of the RNA/DNA substrate duplex, thereby shifting the RNA scissilemore » phosphate closer to the transition state of the enzyme-catalyzed reaction. It was also observed that the scissile phosphate forms a hydrogen bond to the water nucleophile and helps to position the water molecule in the structure. Consistently, it was discovered that the substitution of a single O atom by a Se atom in a guide DNA sequence can largely accelerate RNase H catalysis. These structural and catalytic studies shed new light on the guide-dependent RNA cleavage.« less

Oligonucleotide-genotyping as a method of detecting the HLA-DR2 (DRw15)-Dw2, -DR2 (DRw15)-Dw12, -DR4-Dw15, and -DR4-D"KT2" haplotypes in the Japanese population.

PubMed

Obata, F; Ito, I; Kaneko, T; Ohkubo, M; Ishimoto, A L; Abe, A; Kashiwagi, N

1989-05-01

We synthesized pairs of four different oligonucleotides, F22, F29, F42, and F158, to analyse the HLA-DR2 (DRw15) and -DR4 haplotypes in the Japanese population. After enzymatically amplifying the HLA-DRB1 gene, we hybridized the oligonucleotide probes with DNA extracted from 42 donors. Hybridization was completed between F22 and the DNA of haplotype DR2 (DRw15)-Dw2, between F29 and the DNA of DR2 (DRw15)-Dw12, between F42 and the DNA of DR4-D"KT2", and between F158 and the DNA of DR4-Dw15. In keeping with the nucleotide sequences of the probes, F29 hybridized also with DNA from the DR9-Dw23 haplotype and F158 with that from some of the DRw8 haplotypes (DRw8-Dw8.3) in the Japanese population. Results of this study demonstrate that the four oligonucleotides make useful probes for detecting the haplotypes above.

Synthesis and evaluation of a photoresponsive quencher for fluorescent hybridization probes.

PubMed

Kovaliov, Marina; Wachtel, Chaim; Yavin, Eylon; Fischer, Bilha

2014-10-21

Nowadays, most nucleic acid detections using fluorescent probes rely on quenching of fluorescence by energy transfer from one fluorophore to another or to a non-fluorescent molecule (quencher). The most widely used quencher in fluorescent probes is 4-((4-(dimethylamino)phenyl)azo)benzoic acid (DABCYL). We targeted a nucleoside-DABCYL analogue which could be incorporated anywhere in an oligonucleotide sequence and in any number, and used as a quencher in different hybridization sensitive probes. Specifically, we introduced a 5-(4-((dimethylamino)phenyl)azo)benzene)-2'-deoxy-uridine (dU(DAB)) quencher. The photoisomerization and dU(DAB)'s ability to quench fluorescein emission have been investigated. We incorporated dU(DAB) into a series of oligonucleotide (ON) probes including strand displacement probes, labeled with both fluorescein (FAM) and dU(DAB), and TaqMan probes bearing one or two dU(DAB) and a FAM fluorophore. We used these probes for the detection of a DNA target in real-time PCR (RT-PCR). All probes showed amplification of targeted DNA. A dU(DAB) modified TaqMan RT-PCR probe was more efficient as compared to a DABCYL bearing probe (93% vs. 87%, respectively). Furthermore, dU(DAB) had a stabilizing effect on the duplex, causing an increase in Tm up to 11 °C. In addition we showed the photoisomerisation of the azobenzene moiety of dU(DAB) and the dU(DAB) triply-labeled oligonucleotide upon irradiation. These findings suggest that dU(DAB) modified probes are promising probes for gene quantification in real-time PCR detection and as photoswitchable devices.

Global Shifts in Genome and Proteome Composition Are Very Tightly Coupled

PubMed Central

Brbić, Maria; Warnecke, Tobias; Kriško, Anita; Supek, Fran

2015-01-01

The amino acid composition (AAC) of proteomes differs greatly between microorganisms and is associated with the environmental niche they inhabit, suggesting that these changes may be adaptive. Similarly, the oligonucleotide composition of genomes varies and may confer advantages at the DNA/RNA level. These influences overlap in protein-coding sequences, making it difficult to gauge their relative contributions. We disentangle these effects by systematically evaluating the correspondence between intergenic nucleotide composition, where protein-level selection is absent, the AAC, and ecological parameters of 909 prokaryotes. We find that G + C content, the most frequently used measure of genomic composition, cannot capture diversity in AAC and across ecological contexts. However, di-/trinucleotide composition in intergenic DNA predicts amino acid frequencies of proteomes to the point where very little cross-species variability remains unexplained (91% of variance accounted for). Qualitatively similar results were obtained for 49 fungal genomes, where 80% of the variability in AAC could be explained by the composition of introns and intergenic regions. Upon factoring out oligonucleotide composition and phylogenetic inertia, the residual AAC is poorly predictive of the microbes’ ecological preferences, in stark contrast with the original AAC. Moreover, highly expressed genes do not exhibit more prominent environment-related AAC signatures than lowly expressed genes, despite contributing more to the effective proteome. Thus, evolutionary shifts in overall AAC appear to occur almost exclusively through factors shaping the global oligonucleotide content of the genome. We discuss these results in light of contravening evidence from biophysical data and further reading frame-specific analyses that suggest that adaptation takes place at the protein level. PMID:25971281

Exploiting sequence similarity to validate the sensitivity of SNP arrays in detecting fine-scaled copy number variations.

PubMed

Wong, Gerard; Leckie, Christopher; Gorringe, Kylie L; Haviv, Izhak; Campbell, Ian G; Kowalczyk, Adam

2010-04-15

High-density single nucleotide polymorphism (SNP) genotyping arrays are efficient and cost effective platforms for the detection of copy number variation (CNV). To ensure accuracy in probe synthesis and to minimize production costs, short oligonucleotide probe sequences are used. The use of short probe sequences limits the specificity of binding targets in the human genome. The specificity of these short probeset sequences has yet to be fully analysed against a normal reference human genome. Sequence similarity can artificially elevate or suppress copy number measurements, and hence reduce the reliability of affected probe readings. For the purpose of detecting narrow CNVs reliably down to the width of a single probeset, sequence similarity is an important issue that needs to be addressed. We surveyed the Affymetrix Human Mapping SNP arrays for probeset sequence similarity against the reference human genome. Utilizing sequence similarity results, we identified a collection of fine-scaled putative CNVs between gender from autosomal probesets whose sequence matches various loci on the sex chromosomes. To detect these variations, we utilized our statistical approach, Detecting REcurrent Copy number change using rank-order Statistics (DRECS), and showed that its performance was superior and more stable than the t-test in detecting CNVs. Through the application of DRECS on the HapMap population datasets with multi-matching probesets filtered, we identified biologically relevant SNPs in aberrant regions across populations with known association to physical traits, such as height, covered by the span of a single probe. This provided empirical confirmation of the existence of naturally occurring narrow CNVs as well as the sensitivity of the Affymetrix SNP array technology in detecting them. The MATLAB implementation of DRECS is available at http://ww2.cs.mu.oz.au/ approximately gwong/DRECS/index.html.

Correlation of Fos expression and circling asymmetry during gerbil vestibular compensation

NASA Technical Reports Server (NTRS)

Kaufman, G. D.; Shinder, M. E.; Perachio, A. A.

1999-01-01

Vestibular compensation is a central nervous system process resulting in recovery of functional movement and control following a unilateral vestibular lesion. Small pressure injections of phosphorothioate 20mer oligonucleotides were used to probe the role of the Fos transcription protein during vestibular compensation in the gerbil brainstem. During isoflurane gas anesthesia, antisense probes against the c-fos mRNA sequence were injected into the medial vestibular and prepositus nuclei unilaterally prior to a unilateral surgical labyrinthectomy. Anionic dyes, which did not interact with the oligonucleotides, were used to mark the injection site and help determine the extent of diffusion. The antiFos oligonucleotide injections reduced Fos expression at the injection site in neurons which normally express Fos after the lesion, and also affected circling behavior induced by hemilabyrinthectomy. With both ipsilateral and contralateral medial vestibular and prepositus nuclei injections, less ipsilateral and more contralateral circling was noted in animals injected with antiFos injections as compared to non-injected controls. The degree of change in these behaviors was dependent upon the side of the injection. Histologically, antiFos injections reduced the number of Fos immunolabeled neurons around the injection site, and increased Fos expression contralaterally. The correlation of the number of neurons with Fos expression to turning behavior was stronger for contralateral versus ipsilateral turns, and for neurons in the caudal and ipsilateral sub-regions of the medial vestibular and prepositus nuclei. The results are discussed in terms of neuronal firing activity versus translational activity based on the asymmetrical expression of the Fos inducible transcription factor in the medial vestibular and prepositus nuclei. Although ubiquitous in the brain, transcription factors like Fos can serve localized and specific roles in sensory-specific adaptive stimuli. Antisense injections can be an effective procedure for localized intervention into complex physiological functions, e.g. vestibular compensation. Copyright 1999 Elsevier Science B.V.

Human immunodeficiency virus type 1 LTR TATA and TAR region sequences required for transcriptional regulation.

PubMed Central

Garcia, J A; Harrich, D; Soultanakis, E; Wu, F; Mitsuyasu, R; Gaynor, R B

1989-01-01

The human immunodeficiency virus (HIV) type 1 LTR is regulated at the transcriptional level by both cellular and viral proteins. Using HeLa cell extracts, multiple regions of the HIV LTR were found to serve as binding sites for cellular proteins. An untranslated region binding protein UBP-1 has been purified and fractions containing this protein bind to both the TAR and TATA regions. To investigate the role of cellular proteins binding to both the TATA and TAR regions and their potential interaction with other HIV DNA binding proteins, oligonucleotide-directed mutagenesis of both these regions was performed followed by DNase I footprinting and transient expression assays. In the TATA region, two direct repeats TC/AAGC/AT/AGCTGC surround the TATA sequence. Mutagenesis of both of these direct repeats or of the TATA sequence interrupted binding over the TATA region on the coding strand, but only a mutation of the TATA sequence affected in vivo assays for tat-activation. In addition to TAR serving as the site of binding of cellular proteins, RNA transcribed from TAR is capable of forming a stable stem-loop structure. To determine the relative importance of DNA binding proteins as compared to secondary structure, oligonucleotide-directed mutations in the TAR region were studied. Local mutations that disrupted either the stem or loop structure were defective in gene expression. However, compensatory mutations which restored base pairing in the stem resulted in complete tat-activation. This indicated a significant role for the stem-loop structure in HIV gene expression. To determine the role of TAR binding proteins, mutations were constructed which extensively changed the primary structure of the TAR region, yet left stem base pairing, stem energy and the loop sequence intact. These mutations resulted in decreased protein binding to TAR DNA and defects in tat-activation, and revealed factor binding specifically to the loop DNA sequence. Further mutagenesis which inverted this stem and loop mutation relative to the HIV LTR mRNA start site resulted in even larger decreases in tat-activation. This suggests that multiple determinants, including protein binding, the loop sequence, and RNA or DNA secondary structure, are important in tat-activation and suggests that tat may interact with cellular proteins binding to DNA to increase HIV gene expression. Images PMID:2721501

DNA-based species detection capabilities using laser transmission spectroscopy

PubMed Central

Mahon, A. R.; Barnes, M. A.; Li, F.; Egan, S. P.; Tanner, C. E.; Ruggiero, S. T.; Feder, J. L.; Lodge, D. M.

2013-01-01

Early detection of invasive species is critical for effective biocontrol to mitigate potential ecological and economic damage. Laser transmission spectroscopy (LTS) is a powerful solution offering real-time, DNA-based species detection in the field. LTS can measure the size, shape and number of nanoparticles in a solution and was used here to detect size shifts resulting from hybridization of the polymerase chain reaction product to nanoparticles functionalized with species-specific oligonucleotide probes or with the species-specific oligonucleotide probes alone. We carried out a series of DNA detection experiments using the invasive freshwater quagga mussel (Dreissena bugensis) to evaluate the capability of the LTS platform for invasive species detection. Specifically, we tested LTS sensitivity to (i) DNA concentrations of a single target species, (ii) the presence of a target species within a mixed sample of other closely related species, (iii) species-specific functionalized nanoparticles versus species-specific oligonucleotide probes alone, and (iv) amplified DNA fragments versus unamplified genomic DNA. We demonstrate that LTS is a highly sensitive technique for rapid target species detection, with detection limits in the picomolar range, capable of successful identification in multispecies samples containing target and non-target species DNA. These results indicate that the LTS DNA detection platform will be useful for field application of target species. Additionally, we find that LTS detection is effective with species-specific oligonucleotide tags alone or when they are attached to polystyrene nanobeads and with both amplified and unamplified DNA, indicating that the technique may also have versatility for broader applications. PMID:23015524