Sample records for sequence sufficiently complementary

  1. Kit for detecting nucleic acid sequences using competitive hybridization probes

    DOEpatents

    Lucas, Joe N.; Straume, Tore; Bogen, Kenneth T.

    2001-01-01

    A kit is provided for detecting a target nucleic acid sequence in a sample, the kit comprising: a first hybridization probe which includes a nucleic acid sequence that is sufficiently complementary to selectively hybridize to a first portion of the target sequence, the first hybridization probe including a first complexing agent for forming a binding pair with a second complexing agent; and a second hybridization probe which includes a nucleic acid sequence that is sufficiently complementary to selectively hybridize to a second portion of the target sequence to which the first hybridization probe does not selectively hybridize, the second hybridization probe including a detectable marker; a third hybridization probe which includes a nucleic acid sequence that is sufficiently complementary to selectively hybridize to a first portion of the target sequence, the third hybridization probe including the same detectable marker as the second hybridization probe; and a fourth hybridization probe which includes a nucleic acid sequence that is sufficiently complementary to selectively hybridize to a second portion of the target sequence to which the third hybridization probe does not selectively hybridize, the fourth hybridization probe including the first complexing agent for forming a binding pair with the second complexing agent; wherein the first and second hybridization probes are capable of simultaneously hybridizing to the target sequence and the third and fourth hybridization probes are capable of simultaneously hybridizing to the target sequence, the detectable marker is not present on the first or fourth hybridization probes and the first, second, third, and fourth hybridization probes each include a competitive nucleic acid sequence which is sufficiently complementary to a third portion of the target sequence that the competitive sequences of the first, second, third, and fourth hybridization probes compete with each other to hybridize to the third portion of the target sequence.

  2. The illusion of specific capture: surface and solution studies of suboptimal oligonucleotide hybridization

    PubMed Central

    2013-01-01

    Background Hybridization based assays and capture systems depend on the specificity of hybridization between a probe and its intended target. A common guideline in the construction of DNA microarrays, for instance, is that avoiding complementary stretches of more than 15 nucleic acids in a 50 or 60-mer probe will eliminate sequence specific cross-hybridization reactions. Here we present a study of the behavior of partially matched oligonucleotide pairs with complementary stretches starting well below this threshold complementarity length – in silico, in solution, and at the microarray surface. The modeled behavior of pairs of oligonucleotide probes and their targets suggests that even a complementary stretch of sequence 12 nt in length would give rise to specific cross-hybridization. We designed a set of binding partners to a 50-mer oligonucleotide containing complementary stretches from 6 nt to 21 nt in length. Results Solution melting experiments demonstrate that stable partial duplexes can form when only 12 bp of complementary sequence are present; surface hybridization experiments confirm that a signal close in magnitude to full-strength signal can be obtained from hybridization of a 12 bp duplex within a 50mer oligonucleotide. Conclusions Microarray and other molecular capture strategies that rely on a 15 nt lower complementarity bound for eliminating specific cross-hybridization may not be sufficiently conservative. PMID:23445545

  3. Method for performing site-specific affinity fractionation for use in DNA sequencing

    DOEpatents

    Mirzabekov, Andrei Darievich; Lysov, Yuri Petrovich; Dubley, Svetlana A.

    1999-01-01

    A method for fractionating and sequencing DNA via affinity interaction is provided comprising contacting cleaved DNA to a first array of oligonucleotide molecules to facilitate hybridization between said cleaved DNA and the molecules; extracting the hybridized DNA from the molecules; contacting said extracted hybridized DNA with a second array of oligonucleotide molecules, wherein the oligonucleotide molecules in the second array have specified base sequences that are complementary to said extracted hybridized DNA; and attaching labeled DNA to the second array of oligonucleotide molecules, wherein the labeled re-hybridized DNA have sequences that are complementary to the oligomers. The invention further provides a method for performing multi-step conversions of the chemical structure of compounds comprising supplying an array of polyacrylamide vessels separated by hydrophobic surfaces; immobilizing a plurality of reactants, such as enzymes, in the vessels so that each vessel contains one reactant; contacting the compounds to each of the vessels in a predetermined sequence and for a sufficient time to convert the compounds to a desired state; and isolating the converted compounds from said array.

  4. Miniaturized reaction vessel system, method for performing site-specific biochemical reactions and affinity fractionation for use in DNA sequencing

    DOEpatents

    Mirzabekov, Andrei Darievich; Lysov, Yuri Petrovich; Dubley, Svetlana A.

    2000-01-01

    A method for fractionating and sequencing DNA via affinity interaction is provided comprising contacting cleaved DNA to a first array of oligonucleotide molecules to facilitate hybridization between said cleaved DNA and the molecules; extracting the hybridized DNA from the molecules; contacting said extracted hybridized DNA with a second array of oligonucleotide molecules, wherein the oligonucleotide molecules in the second array have specified base sequences that are complementary to said extracted hybridized DNA; and attaching labeled DNA to the second array of oligonucleotide molecules, wherein the labeled re-hybridized DNA have sequences that are complementary to the oligomers. The invention further provides a method for performing multi-step conversions of the chemical structure of compounds comprising supplying an array of polyacrylamide vessels separated by hydrophobic surfaces; immobilizing a plurality of reactants, such as enzymes, in the vessels so that each vessel contains one reactant; contacting the compounds to each of the vessels in a predetermined sequence and for a sufficient time to convert the compounds to a desired state; and isolating the converted compounds from said array.

  5. Method for performing site-specific affinity fractionation for use in DNA sequencing

    DOEpatents

    Mirzabekov, A.D.; Lysov, Y.P.; Dubley, S.A.

    1999-05-18

    A method for fractionating and sequencing DNA via affinity interaction is provided comprising contacting cleaved DNA to a first array of oligonucleotide molecules to facilitate hybridization between the cleaved DNA and the molecules; extracting the hybridized DNA from the molecules; contacting the extracted hybridized DNA with a second array of oligonucleotide molecules, wherein the oligonucleotide molecules in the second array have specified base sequences that are complementary to the extracted hybridized DNA; and attaching labeled DNA to the second array of oligonucleotide molecules, wherein the labeled re-hybridized DNA have sequences that are complementary to the oligomers. The invention further provides a method for performing multi-step conversions of the chemical structure of compounds comprising supplying an array of polyacrylamide vessels separated by hydrophobic surfaces; immobilizing a plurality of reactants, such as enzymes, in the vessels so that each vessel contains one reactant; contacting the compounds to each of the vessels in a predetermined sequence and for a sufficient time to convert the compounds to a desired state; and isolating the converted compounds from the array. 14 figs.

  6. A Single Molecular Beacon Probe Is Sufficient for the Analysis of Multiple Nucleic Acid Sequences

    PubMed Central

    Gerasimova, Yulia V.; Hayson, Aaron; Ballantyne, Jack; Kolpashchikov, Dmitry M.

    2010-01-01

    Molecular beacon (MB) probes are dual-labeled hairpin-shaped oligodeoxyribonucleotides that are extensively used for real-time detection of specific RNA/DNA analytes. In the MB probe, the loop fragment is complementary to the analyte: therefore, a unique probe is required for the analysis of each new analyte sequence. The conjugation of an oligonucleotide with two dyes and subsequent purification procedures add to the cost of MB probes, thus reducing their application in multiplex formats. Here we demonstrate how one MB probe can be used for the analysis of an arbitrary nucleic acid. The approach takes advantage of two oligonucleotide adaptor strands, each of which contains a fragment complementary to the analyte and a fragment complementary to an MB probe. The presence of the analyte leads to association of MB probe and the two DNA strands in quadripartite complex. The MB probe fluorescently reports the formation of this complex. In this design, the MB does not bind the analyte directly; therefore, the MB sequence is independent of the analyte. In this study one universal MB probe was used to genotype three human polymorphic sites. This approach promises to reduce the cost of multiplex real-time assays and improve the accuracy of single-nucleotide polymorphism genotyping. PMID:20665615

  7. Self-complementary circular codes in coding theory.

    PubMed

    Fimmel, Elena; Michel, Christian J; Starman, Martin; Strüngmann, Lutz

    2018-04-01

    Self-complementary circular codes are involved in pairing genetic processes. A maximal [Formula: see text] self-complementary circular code X of trinucleotides was identified in genes of bacteria, archaea, eukaryotes, plasmids and viruses (Michel in Life 7(20):1-16 2017, J Theor Biol 380:156-177, 2015; Arquès and Michel in J Theor Biol 182:45-58 1996). In this paper, self-complementary circular codes are investigated using the graph theory approach recently formulated in Fimmel et al. (Philos Trans R Soc A 374:20150058, 2016). A directed graph [Formula: see text] associated with any code X mirrors the properties of the code. In the present paper, we demonstrate a necessary condition for the self-complementarity of an arbitrary code X in terms of the graph theory. The same condition has been proven to be sufficient for codes which are circular and of large size [Formula: see text] trinucleotides, in particular for maximal circular codes ([Formula: see text] trinucleotides). For codes of small-size [Formula: see text] trinucleotides, some very rare counterexamples have been constructed. Furthermore, the length and the structure of the longest paths in the graphs associated with the self-complementary circular codes are investigated. It has been proven that the longest paths in such graphs determine the reading frame for the self-complementary circular codes. By applying this result, the reading frame in any arbitrary sequence of trinucleotides is retrieved after at most 15 nucleotides, i.e., 5 consecutive trinucleotides, from the circular code X identified in genes. Thus, an X motif of a length of at least 15 nucleotides in an arbitrary sequence of trinucleotides (not necessarily all of them belonging to X) uniquely defines the reading (correct) frame, an important criterion for analyzing the X motifs in genes in the future.

  8. Orthogonal Polynomials Associated with Complementary Chain Sequences

    NASA Astrophysics Data System (ADS)

    Behera, Kiran Kumar; Sri Ranga, A.; Swaminathan, A.

    2016-07-01

    Using the minimal parameter sequence of a given chain sequence, we introduce the concept of complementary chain sequences, which we view as perturbations of chain sequences. Using the relation between these complementary chain sequences and the corresponding Verblunsky coefficients, the para-orthogonal polynomials and the associated Szegő polynomials are analyzed. Two illustrations, one involving Gaussian hypergeometric functions and the other involving Carathéodory functions are also provided. A connection between these two illustrations by means of complementary chain sequences is also observed.

  9. Automatic detection of pelvic lymph nodes using multiple MR sequences

    NASA Astrophysics Data System (ADS)

    Yan, Michelle; Lu, Yue; Lu, Renzhi; Requardt, Martin; Moeller, Thomas; Takahashi, Satoru; Barentsz, Jelle

    2007-03-01

    A system for automatic detection of pelvic lymph nodes is developed by incorporating complementary information extracted from multiple MR sequences. A single MR sequence lacks sufficient diagnostic information for lymph node localization and staging. Correct diagnosis often requires input from multiple complementary sequences which makes manual detection of lymph nodes very labor intensive. Small lymph nodes are often missed even by highly-trained radiologists. The proposed system is aimed at assisting radiologists in finding lymph nodes faster and more accurately. To the best of our knowledge, this is the first such system reported in the literature. A 3-dimensional (3D) MR angiography (MRA) image is employed for extracting blood vessels that serve as a guide in searching for pelvic lymph nodes. Segmentation, shape and location analysis of potential lymph nodes are then performed using a high resolution 3D T1-weighted VIBE (T1-vibe) MR sequence acquired by Siemens 3T scanner. An optional contrast-agent enhanced MR image, such as post ferumoxtran-10 T2*-weighted MEDIC sequence, can also be incorporated to further improve detection accuracy of malignant nodes. The system outputs a list of potential lymph node locations that are overlaid onto the corresponding MR sequences and presents them to users with associated confidence levels as well as their sizes and lengths in each axis. Preliminary studies demonstrates the feasibility of automatic lymph node detection and scenarios in which this system may be used to assist radiologists in diagnosis and reporting.

  10. Geranyl diphosphate synthase from mint

    DOEpatents

    Croteau, Rodney Bruce; Wildung, Mark Raymond; Burke, Charles Cullen; Gershenzon, Jonathan

    1999-01-01

    A cDNA encoding geranyl diphosphate synthase from peppermint has been isolated and sequenced, and the corresponding amino acid sequence has been determined. Accordingly, an isolated DNA sequence (SEQ ID No:1) is provided which codes for the expression of geranyl diphosphate synthase (SEQ ID No:2) from peppermint (Mentha piperita). In other aspects, replicable recombinant cloning vehicles are provided which code for geranyl diphosphate synthase or for a base sequence sufficiently complementary to at least a portion of the geranyl diphosphate synthase DNA or RNA to enable hybridization therewith (e.g., antisense geranyl diphosphate synthase RNA or fragments of complementary geranyl diphosphate synthase DNA which are useful as polymerase chain reaction primers or as probes for geranyl diphosphate synthase or related genes). In yet other aspects, modified host cells are provided that have been transformed, transfected, infected and/or injected with a recombinant cloning vehicle and/or DNA sequence encoding geranyl diphosphate synthase. Thus, systems and methods are provided for the recombinant expression of geranyl diphosphate synthase that may be used to facilitate the production, isolation and purification of significant quantities of recombinant geranyl diphosphate synthase for subsequent use, to obtain expression or enhanced expression of geranyl diphosphate synthase in plants in order to enhance the production of monoterpenoids, to produce geranyl diphosphate in cancerous cells as a precursor to monoterpenoids having anti-cancer properties or may be otherwise employed for the regulation or expression of geranyl diphosphate synthase or the production of geranyl diphosphate.

  11. Geranyl diphosphate synthase from mint

    DOEpatents

    Croteau, R.B.; Wildung, M.R.; Burke, C.C.; Gershenzon, J.

    1999-03-02

    A cDNA encoding geranyl diphosphate synthase from peppermint has been isolated and sequenced, and the corresponding amino acid sequence has been determined. Accordingly, an isolated DNA sequence (SEQ ID No:1) is provided which codes for the expression of geranyl diphosphate synthase (SEQ ID No:2) from peppermint (Mentha piperita). In other aspects, replicable recombinant cloning vehicles are provided which code for geranyl diphosphate synthase or for a base sequence sufficiently complementary to at least a portion of the geranyl diphosphate synthase DNA or RNA to enable hybridization therewith (e.g., antisense geranyl diphosphate synthase RNA or fragments of complementary geranyl diphosphate synthase DNA which are useful as polymerase chain reaction primers or as probes for geranyl diphosphate synthase or related genes). In yet other aspects, modified host cells are provided that have been transformed, transfected, infected and/or injected with a recombinant cloning vehicle and/or DNA sequence encoding geranyl diphosphate synthase. Thus, systems and methods are provided for the recombinant expression of geranyl diphosphate synthase that may be used to facilitate the production, isolation and purification of significant quantities of recombinant geranyl diphosphate synthase for subsequent use, to obtain expression or enhanced expression of geranyl diphosphate synthase in plants in order to enhance the production of monoterpenoids, to produce geranyl diphosphate in cancerous cells as a precursor to monoterpenoids having anti-cancer properties or may be otherwise employed for the regulation or expression of geranyl diphosphate synthase or the production of geranyl diphosphate. 5 figs.

  12. Recombinant pinoresinol/lariciresinol reductase, recombinant dirigent protein, and methods of use

    DOEpatents

    Lewis, Norman G.; Davin, Laurence B.; Dinkova-Kostova, Albena T.; Fujita, Masayuki; Gang, David R.; Sarkanen, Simo; Ford, Joshua D.

    2001-04-03

    Dirigent proteins and pinoresinol/lariciresinol reductases have been isolated, together with cDNAs encoding dirigent proteins and pinoresinol/lariciresinol reductases. Accordingly, isolated DNA sequences are provided which code for the expression of dirigent proteins and pinoresinol/lariciresinol reductases. In other aspects, replicable recombinant cloning vehicles are provided which code for dirigent proteins or pinoresinol/lariciresinol reductases or for a base sequence sufficiently complementary to at least a portion of dirigent protein or pinoresinol/lariciresinol reductase DNA or RNA to enable hybridization therewith. In yet other aspects, modified host cells are provided that have been transformed, transfected, infected and/or injected with a recombinant cloning vehicle and/or DNA sequence encoding dirigent protein or pinoresinol/lariciresinol reductase. Thus, systems and methods are provided for the recombinant expression of dirigent proteins and/or pinoresinol/lariciresinol reductases.

  13. Recominant Pinoresino-Lariciresinol Reductase, Recombinant Dirigent Protein And Methods Of Use

    DOEpatents

    Lewis, Norman G.; Davin, Laurence B.; Dinkova-Kostova, Albena T.; Fujita, Masayuki , Gang; David R. , Sarkanen; Simo , Ford; Joshua D.

    2003-10-21

    Dirigent proteins and pinoresinol/lariciresinol reductases have been isolated, together with cDNAs encoding dirigent proteins and pinoresinol/lariciresinol reductases. Accordingly, isolated DNA sequences are provided from source species Forsythia intermedia, Thuja plicata, Tsuga heterophylla, Eucommia ulmoides, Linum usitatissimum, and Schisandra chinensis, which code for the expression of dirigent proteins and pinoresinol/lariciresinol reductases. In other aspects, replicable recombinant cloning vehicles are provided which code for dirigent proteins or pinoresinol/lariciresinol reductases or for a base sequence sufficiently complementary to at least a portion of dirigent protein or pinoresinol/lariciresinol reductase DNA or RNA to enable hybridization therewith. In yet other aspects, modified host cells are provided that have been transformed, transfected, infected and/or injected with a recombinant cloning vehicle and/or DNA sequence encoding dirigent protein or pinoresinol/lariciresinol reductase. Thus, systems and methods are provided for the recombinant expression of dirigent proteins and/or pinoresinol/lariciresinol reductases.

  14. Effect of sequencing of complementary feeding in relation to breast-feeding on total intake in infants.

    PubMed

    Shah, Dheeraj; Singh, Meenakshi; Gupta, Piyush; Faridi, M M A

    2014-03-01

    The aim of the present study was to evaluate whether the order of complementary feeding in relation to breast-feeding affects breast milk, semisolid, or total energy intake in infants. The present study was designed as a randomized crossover trial. The study was conducted in a tertiary care hospital. The study participants were 25 healthy infants between the ages of 7 and 11 months who were exclusively breast-fed for at least 6 months and were now receiving complementary foods for at least 1 month in addition to breast-feeding. Infants were randomized to follow a sequence of either complementary feeding before breast-feeding (sequence A) or complementary feeding after breast-feeding (sequence B) for the first day (24 hours) of the study period using simple randomization. For the next day, the sequence was reversed for each child. All babies received 3 actively fed complementary food meals per day (morning, afternoon, and evening). A semisolid study diet was prepared in the hospital by cooking rice and pulse with oil using a standard method, ensuring the energy density of at least 0.6 kcal/g. The infants were allowed ad libitum breast-feeding during the observation period. Semisolid intake was directly measured and breast milk intake was quantified by test weighing method. Energy intake from complementary foods was calculated from the product of energy density of the diet served on that day and the total amount consumed. The total energy intake and energy intake from breast milk and complementary foods between the 2 sequences were compared. The mean (standard deviation) energy intake from breast milk during 12 hours of daytime by following sequence A (complementary feeding before breast-feeding) was 132.0 (67.4) kcal in comparison with 135.9 (56.2) kcal in sequence B, which was not statistically different (P = 0.83). The mean (standard deviation) energy consumed from semisolids in sequences A and B was also comparable (88.6 [75.5] kcal vs. 85.5 [89.7] kcal; P = 0.58). The total energy intake during daytime in sequence A was 220.6 (96.2) kcal in comparison with 221.5 (94.0) kcal in sequence B, which was also comparable (P = 0.97). The results related to energy intake through breast milk and total energy intake were not different when insensible losses during feeding were adjusted in both groups. Altering the sequence of complementary feeding in relation to breast-feeding does not affect total energy intake.

  15. Vertically stacked multi-heterostructures of layered materials for logic transistors and complementary inverters

    PubMed Central

    Yu, Woo Jong; Li, Zheng; Zhou, Hailong; Chen, Yu; Wang, Yang; Huang, Yu; Duan, Xiangfeng

    2014-01-01

    The layered materials such as graphene have attracted considerable interest for future electronics. Here we report the vertical integration of multi-heterostructures of layered materials to enable high current density vertical field-effect transistors (VFETs). An n-channel VFET is created by sandwiching few-layer molybdenum disulfide (MoS2) as the semiconducting channel between a monolayer graphene and a metal thin film. The VFETs exhibit a room temperature on-off ratio >103, while at same time deliver a high current density up to 5,000 A/cm2, sufficient for high performance logic applications. This study offers a general strategy for the vertical integration of various layered materials to obtain both p- and n-channel transistors for complementary logic functions. A complementary inverter with larger than unit voltage gain is demonstrated by vertically stacking the layered materials of graphene, Bi2Sr2Co2O8 (p-channel), graphene, MoS2 (n-channel), and metal thin film in sequence. The ability to simultaneously achieve high on-off ratio, high current density, and logic integration in the vertically stacked multi-heterostructures can open up a new dimension for future electronics to enable three-dimensional integration. PMID:23241535

  16. Sequence-Selective Formation of Synthetic H-Bonded Duplexes

    PubMed Central

    2017-01-01

    Oligomers equipped with a sequence of phenol and pyridine N-oxide groups form duplexes via H-bonding interactions between these recognition units. Reductive amination chemistry was used to synthesize all possible 3-mer sequences: AAA, AAD, ADA, DAA, ADD, DAD, DDA, and DDD. Pairwise interactions between the oligomers were investigated using NMR titration and dilution experiments in toluene. The measured association constants vary by 3 orders of magnitude (102 to 105 M–1). Antiparallel sequence-complementary oligomers generally form more stable complexes than mismatched duplexes. Mismatched duplexes that have an excess of H-bond donors are stabilized by the interaction of two phenol donors with one pyridine N-oxide acceptor. Oligomers that have a H-bond donor and acceptor on the ends of the chain can fold to form intramolecular H-bonds in the free state. The 1,3-folding equilibrium competes with duplex formation and lowers the stability of duplexes involving these sequences. As a result, some of the mismatch duplexes are more stable than some of the sequence-complementary duplexes. However, the most stable mismatch duplexes contain DDD and compete with the most stable sequence-complementary duplex, AAA·DDD, so in mixtures that contain all eight sequences, sequence-complementary duplexes dominate. Even higher fidelity sequence selectivity can be achieved if alternating donor–acceptor sequences are avoided. PMID:28857551

  17. Chirality- and sequence-selective successive self-sorting via specific homo- and complementary-duplex formations

    PubMed Central

    Makiguchi, Wataru; Tanabe, Junki; Yamada, Hidekazu; Iida, Hiroki; Taura, Daisuke; Ousaka, Naoki; Yashima, Eiji

    2015-01-01

    Self-recognition and self-discrimination within complex mixtures are of fundamental importance in biological systems, which entirely rely on the preprogrammed monomer sequences and homochirality of biological macromolecules. Here we report artificial chirality- and sequence-selective successive self-sorting of chiral dimeric strands bearing carboxylic acid or amidine groups joined by chiral amide linkers with different sequences through homo- and complementary-duplex formations. A mixture of carboxylic acid dimers linked by racemic-1,2-cyclohexane bis-amides with different amide sequences (NHCO or CONH) self-associate to form homoduplexes in a completely sequence-selective way, the structures of which are different from each other depending on the linker amide sequences. The further addition of an enantiopure amide-linked amidine dimer to a mixture of the racemic carboxylic acid dimers resulted in the formation of a single optically pure complementary duplex with a 100% diastereoselectivity and complete sequence specificity stabilized by the amidinium–carboxylate salt bridges, leading to the perfect chirality- and sequence-selective duplex formation. PMID:26051291

  18. Arrays of nucleic acid probes on biological chips

    DOEpatents

    Chee, Mark; Cronin, Maureen T.; Fodor, Stephen P. A.; Huang, Xiaohua X.; Hubbell, Earl A.; Lipshutz, Robert J.; Lobban, Peter E.; Morris, MacDonald S.; Sheldon, Edward L.

    1998-11-17

    DNA chips containing arrays of oligonucleotide probes can be used to determine whether a target nucleic acid has a nucleotide sequence identical to or different from a specific reference sequence. The array of probes comprises probes exactly complementary to the reference sequence, as well as probes that differ by one or more bases from the exactly complementary probes.

  19. Distance-dependent duplex DNA destabilization proximal to G-quadruplex/i-motif sequences

    PubMed Central

    König, Sebastian L. B.; Huppert, Julian L.; Sigel, Roland K. O.; Evans, Amanda C.

    2013-01-01

    G-quadruplexes and i-motifs are complementary examples of non-canonical nucleic acid substructure conformations. G-quadruplex thermodynamic stability has been extensively studied for a variety of base sequences, but the degree of duplex destabilization that adjacent quadruplex structure formation can cause has yet to be fully addressed. Stable in vivo formation of these alternative nucleic acid structures is likely to be highly dependent on whether sufficient spacing exists between neighbouring duplex- and quadruplex-/i-motif-forming regions to accommodate quadruplexes or i-motifs without disrupting duplex stability. Prediction of putative G-quadruplex-forming regions is likely to be assisted by further understanding of what distance (number of base pairs) is required for duplexes to remain stable as quadruplexes or i-motifs form. Using oligonucleotide constructs derived from precedented G-quadruplexes and i-motif-forming bcl-2 P1 promoter region, initial biophysical stability studies indicate that the formation of G-quadruplex and i-motif conformations do destabilize proximal duplex regions. The undermining effect that quadruplex formation can have on duplex stability is mitigated with increased distance from the duplex region: a spacing of five base pairs or more is sufficient to maintain duplex stability proximal to predicted quadruplex/i-motif-forming regions. PMID:23771141

  20. DNA Cloning of Plasmodium falciparum Circumsporozoite Gene: Amino Acid Sequence of Repetitive Epitope

    NASA Astrophysics Data System (ADS)

    Enea, Vincenzo; Ellis, Joan; Zavala, Fidel; Arnot, David E.; Asavanich, Achara; Masuda, Aoi; Quakyi, Isabella; Nussenzweig, Ruth S.

    1984-08-01

    A clone of complementary DNA encoding the circumsporozoite (CS) protein of the human malaria parasite Plasmodium falciparum has been isolated by screening an Escherichia coli complementary DNA library with a monoclonal antibody to the CS protein. The DNA sequence of the complementary DNA insert encodes a four-amino acid sequence: proline-asparagine-alanine-asparagine, tandemly repeated 23 times. The CS β -lactamase fusion protein specifically binds monoclonal antibodies to the CS protein and inhibits the binding of these antibodies to native Plasmodium falciparum CS protein. These findings provide a basis for the development of a vaccine against Plasmodium falciparum malaria.

  1. Nucleic acid molecules encoding isopentenyl monophosphate kinase, and methods of use

    DOEpatents

    Croteau, Rodney B.; Lange, Bernd M.

    2001-01-01

    A cDNA encoding isopentenyl monophosphate kinase (IPK) from peppermint (Mentha x piperita) has been isolated and sequenced, and the corresponding amino acid sequence has been determined. Accordingly, an isolated DNA sequence (SEQ ID NO:1) is provided which codes for the expression of isopentenyl monophosphate kinase (SEQ ID NO:2), from peppermint (Mentha x piperita). In other aspects, replicable recombinant cloning vehicles are provided which code for isopentenyl monophosphate kinase, or for a base sequence sufficiently complementary to at least a portion of isopentenyl monophosphate kinase DNA or RNA to enable hybridization therewith. In yet other aspects, modified host cells are provided that have been transformed, transfected, infected and/or injected with a recombinant cloning vehicle and/or DNA sequence encoding isopentenyl monophosphate kinase. Thus, systems and methods are provided for the recombinant expression of the aforementioned recombinant isopentenyl monophosphate kinase that may be used to facilitate its production, isolation and purification in significant amounts. Recombinant isopentenyl monophosphate kinase may be used to obtain expression or enhanced expression of isopentenyl monophosphate kinase in plants in order to enhance the production of isopentenyl monophosphate kinase, or isoprenoids derived therefrom, or may be otherwise employed for the regulation or expression of isopentenyl monophosphate kinase, or the production of its products.

  2. HYBRIDIZATION PROPERTIES OF DNA SEQUENCES DIRECTING THE SYNTHESIS OF MESSENGER RNA AND HETEROGENEOUS NUCLEAR RNA

    PubMed Central

    Greenberg, Jay R.; Perry, Robert P.

    1971-01-01

    The relationship of the DNA sequences from which polyribosomal messenger RNA (mRNA) and heterogeneous nuclear RNA (NRNA) of mouse L cells are transcribed was investigated by means of hybridization kinetics and thermal denaturation of the hybrids. Hybridization was performed in formamide solutions at DNA excess. Under these conditions most of the hybridizing mRNA and NRNA react at values of Dot (DNA concentration multiplied by time) expected for RNA transcribed from the nonrepeated or rarely repeated fraction of the genome. However, a fraction of both mRNA and NRNA hybridize at values of Dot about 10,000 times lower, and therefore must be transcribed from highly redundant DNA sequences. The fraction of NRNA hybridizing to highly repeated sequences is about 1.7 times greater than the corresponding fraction of mRNA. The hybrids formed by the rapidly reacting fractions of both NRNA and mRNA melt over a narrow temperature range with a midpoint about 11°C below that of native L cell DNA. This indicates that these hybrids consist of partially complementary sequences with approximately 11% mismatching of bases. Hybrids formed by the slowly reacting fraction of NRNA melt within 4°–6°C of native DNA, indicating very little, if any, mismatching of bases. Hybrids of the slowly reacting components of mRNA, formed under conditions of sufficiently low RNA input, have a high thermal stability, similar to that observed for hybrids of the slowly reacting NRNA component. However, when higher inputs of mRNA are used, hybrids are formed which have a strikingly lower thermal stability. This observation can be explained by assuming that there is sufficient similarity among the relatively rare DNA sequences coding for mRNA so that under hybridization conditions, in which these DNA sequences are not truly in excess, reversible hybrids exhibiting a considerable amount of mispairing are formed. The fact that a comparable phenomenon has not been observed for NRNA may mean that there is less similarity among the relatively rare DNA sequences coding for NRNA than there is among the rare sequences coding for mRNA. PMID:4999767

  3. Hardware Acceleration Of Multi-Deme Genetic Algorithm for DNA Codeword Searching

    DTIC Science & Technology

    2008-01-01

    C and G are complementary to each other. A Watson - Crick complement of a DNA sequence is another DNA sequence which replaces all the A with T or vise...versa and replaces all the T with A or vise versa, and also switches the 5’ and 3’ ends. A DNA sequence binds most stably with its Watson - Crick ...bind with 5 Watson - Crick pairs. The length of the longest complementary sequence between two flexible DNA strands, A and B, is the same as the

  4. Increased complexity of circRNA expression during species evolution.

    PubMed

    Dong, Rui; Ma, Xu-Kai; Chen, Ling-Ling; Yang, Li

    2017-08-03

    Circular RNAs (circRNAs) are broadly identified from precursor mRNA (pre-mRNA) back-splicing across various species. Recent studies have suggested a cell-/tissue- specific manner of circRNA expression. However, the distinct expression pattern of circRNAs among species and its underlying mechanism still remain to be explored. Here, we systematically compared circRNA expression from human and mouse, and found that only a small portion of human circRNAs could be determined in parallel mouse samples. The conserved circRNA expression between human and mouse is correlated with the existence of orientation-opposite complementary sequences in introns that flank back-spliced exons in both species, but not the circRNA sequences themselves. Quantification of RNA pairing capacity of orientation-opposite complementary sequences across circRNA-flanking introns by Complementary Sequence Index (CSI) identifies that among all types of complementary sequences, SINEs, especially Alu elements in human, contribute the most for circRNA formation and that their diverse distribution across species leads to the increased complexity of circRNA expression during species evolution. Together, our integrated and comparative reference catalog of circRNAs in different species reveals a species-specific pattern of circRNA expression and suggests a previously under-appreciated impact of fast-evolved SINEs on the regulation of (circRNA) gene expression.

  5. Using complementary DNA from MyoD-transduced fibroblasts to sequence large muscle genes.

    PubMed

    Waddell, Leigh B; Monnier, Nicole; Cooper, Sandra T; North, Kathryn N; Clarke, Nigel F

    2011-08-01

    Large muscle genes are often sequenced using complementary DNA (cDNA) made from muscle messenger RNA (mRNA) to reduce the cost and workload associated with sequencing from genomic DNA. Two potential barriers are the availability of a frozen muscle biopsy, and difficulties in detecting nonsense mutations due to nonsense-mediated mRNA decay (NMD). We present patient examples showing that use of MyoD-transduced fibroblasts as a source of muscle-specific mRNA overcomes these potential difficulties in sequencing large muscle-related genes. Copyright © 2011 Wiley Periodicals, Inc.

  6. Isolation and bacterial expression of a sesquiterpene synthase CDNA clone from peppermint(mentha .chi. piperita, L.) that produces the aphid alarm pheromone (E)-.beta.-farnesene

    DOEpatents

    Croteau, Rodney Bruce; Wildung, Mark Raymond; Crock, John E.

    1999-01-01

    A cDNA encoding (E)-.beta.-farnesene synthase from peppermint (Mentha piperita) has been isolated and sequenced, and the corresponding amino acid sequence has been determined. Accordingly, an isolated DNA sequence (SEQ ID NO:1) is provided which codes for the expression of (E)-.beta.-farnesene synthase (SEQ ID NO:2), from peppermint (Mentha piperita). In other aspects, replicable recombinant cloning vehicles are provided which code for (E)-.beta.-farnesene synthase, or for a base sequence sufficiently complementary to at least a portion of (E)-.beta.-farnesene synthase DNA or RNA to enable hybridization therewith. In yet other aspects, modified host cells are provided that have been transformed, transfected, infected and/or injected with a recombinant cloning vehicle and/or DNA sequence encoding (E)-.beta.-farnesene synthase. Thus, systems and methods are provided for the recombinant expression of the aforementioned recombinant (E)-.beta.-farnesene synthase that may be used to facilitate its production, isolation and purification in significant amounts. Recombinant (E)-.beta.-farnesene synthase may be used to obtain expression or enhanced expression of (E)-.beta.-farnesene synthase in plants in order to enhance the production of (E)-.beta.-farnesene, or may be otherwise employed for the regulation or expression of (E)-.beta.-farnesene synthase, or the production of its product.

  7. Isolation and bacterial expression of a sesquiterpene synthase cDNA clone from peppermint (Mentha x piperita, L.) that produces the aphid alarm pheromone (E)-.beta.-farnesene

    DOEpatents

    Croteau, Rodney Bruce; Crock, John E.

    2005-01-25

    A cDNA encoding (E)-.beta.-farnesene synthase from peppermint (Mentha piperita) has been isolated and sequenced, and the corresponding amino acid sequence has been determined. Accordingly, an isolated DNA sequence (SEQ ID NO:1) is provided which codes for the expression of (E)-.beta.-farnesene synthase (SEQ ID NO:2), from peppermint (Mentha piperita). In other aspects, replicable recombinant cloning vehicles are provided which code for (E)-.beta.-farnesene synthase, or for a base sequence sufficiently complementary to at least a portion of (E)-.beta.-farnesene synthase DNA or RNA to enable hybridization therewith. In yet other aspects, modified host cells are provided that have been transformed, transfected, infected and/or injected with a recombinant cloning vehicle and/or DNA sequence encoding (E)-.beta.-farnesene synthase. Thus, systems and methods are provided for the recombinant expression of the aforementioned recombinant (E)-.beta.-famesene synthase that may be used to facilitate its production, isolation and purification in significant amounts. Recombinant (E)-.beta.-farnesene synthase may be used to obtain expression or enhanced expression of (E)-.beta.-famesene synthase in plants in order to enhance the production of (E)-.beta.-farnesene, or may be otherwise employed for the regulation or expression of (E)-.beta.-farnesene synthase, or the production of its product.

  8. Microfluidics-Based Lab-on-Chip Systems in DNA-Based Biosensing: An Overview

    PubMed Central

    Dutse, Sabo Wada; Yusof, Nor Azah

    2011-01-01

    Microfluidics-based lab-on-chip (LOC) systems are an active research area that is revolutionising high-throughput sequencing for the fast, sensitive and accurate detection of a variety of pathogens. LOCs also serve as portable diagnostic tools. The devices provide optimum control of nanolitre volumes of fluids and integrate various bioassay operations that allow the devices to rapidly sense pathogenic threat agents for environmental monitoring. LOC systems, such as microfluidic biochips, offer advantages compared to conventional identification procedures that are tedious, expensive and time consuming. This paper aims to provide a broad overview of the need for devices that are easy to operate, sensitive, fast, portable and sufficiently reliable to be used as complementary tools for the control of pathogenic agents that damage the environment. PMID:22163925

  9. Complementary feeding: a commentary by the ESPGHAN Committee on Nutrition.

    PubMed

    Agostoni, Carlo; Decsi, Tamas; Fewtrell, Mary; Goulet, Olivier; Kolacek, Sanja; Koletzko, Berthold; Michaelsen, Kim Fleischer; Moreno, Luis; Puntis, John; Rigo, Jacques; Shamir, Raanan; Szajewska, Hania; Turck, Dominique; van Goudoever, Johannes

    2008-01-01

    This position paper on complementary feeding summarizes evidence for health effects of complementary foods. It focuses on healthy infants in Europe. After reviewing current knowledge and practices, we have formulated these conclusions: Exclusive or full breast-feeding for about 6 months is a desirable goal. Complementary feeding (ie, solid foods and liquids other than breast milk or infant formula and follow-on formula) should not be introduced before 17 weeks and not later than 26 weeks. There is no convincing scientific evidence that avoidance or delayed introduction of potentially allergenic foods, such as fish and eggs, reduces allergies, either in infants considered at increased risk for the development of allergy or in those not considered to be at increased risk. During the complementary feeding period, >90% of the iron requirements of a breast-fed infant must be met by complementary foods, which should provide sufficient bioavailable iron. Cow's milk is a poor source of iron and should not be used as the main drink before 12 months, although small volumes may be added to complementary foods. It is prudent to avoid both early (<4 months) and late (>or=7 months) introduction of gluten, and to introduce gluten gradually while the infant is still breast-fed, inasmuch as this may reduce the risk of celiac disease, type 1 diabetes mellitus, and wheat allergy. Infants and young children receiving a vegetarian diet should receive a sufficient amount ( approximately 500 mL) of breast milk or formula and dairy products. Infants and young children should not be fed a vegan diet.

  10. Cryptic Hepatitis B and E in Patients With Acute Hepatitis of Unknown Etiology.

    PubMed

    Ganova-Raeva, Lilia; Punkova, Lili; Campo, David S; Dimitrova, Zoya; Skums, Pavel; Vu, Nga H; Dat, Do T; Dalton, Harry R; Khudyakov, Yury

    2015-12-15

    Up to 30% of acute viral hepatitis has no known etiology. To determine the disease etiology in patients with acute hepatitis of unknown etiology (HUE), serum specimens were obtained from 38 patients residing in the United Kingdom and Vietnam and from 26 healthy US blood donors. All specimens tested negative for known viral infections causing hepatitis, using commercially available serological and nucleic acid assays. Specimens were processed by sequence-independent complementary DNA amplification and next-generation sequencing (NGS). Sufficient material for individual NGS libraries was obtained from 12 HUE cases and 26 blood donors; the remaining HUE cases were sequenced as a pool. Read mapping was done by targeted and de novo assembly. Sequences from hepatitis B virus (HBV) were detected in 7 individuals with HUE (58.3%) and the pooled library, and hepatitis E virus (HEV) was detected in 2 individuals with HUE (16.7%) and the pooled library. Both HEV-positive cases were coinfected with HBV. HBV sequences belonged to genotypes A, D, or G, and HEV sequences belonged to genotype 3. No known hepatotropic viruses were detected in the tested normal human sera. NGS-based detection of HBV and HEV infections is more sensitive than using commercially available assays. HBV and HEV may be cryptically associated with HUE. Published by Oxford University Press on behalf of the Infectious Diseases Society of America 2015. This work is written by (a) US Government employee(s) and is in the public domain in the US.

  11. Zepto-molar electrochemical detection of Brucella genome based on gold nanoribbons covered by gold nanoblooms

    NASA Astrophysics Data System (ADS)

    Rahi, Amid; Sattarahmady, Naghmeh; Heli, Hossein

    2015-12-01

    Gold nanoribbons covered by gold nanoblooms were sonoelectrodeposited on a polycrystalline gold surface at -1800 mV (vs. AgCl) with the assistance of ultrasound and co-occurrence of the hydrogen evolution reaction. The nanostructure, as a transducer, was utilized to immobilize a Brucella-specific probe and fabrication of a genosensor, and the process of immobilization and hybridization was detected by electrochemical methods, using methylene blue as a redox marker. The proposed method for detection of the complementary sequence, sequences with base-mismatched (one-, two- and three-base mismatches), and the sequence of non-complementary sequence was assayed. The fabricated genosensor was evaluated for the assay of the bacteria in the cultured and human samples without polymerase chain reactions (PCR). The genosensor could detect the complementary sequence with a calibration sensitivity of 0.40 μA dm3 mol-1, a linear concentration range of 10 zmol dm-3 to 10 pmol dm-3, and a detection limit of 1.71 zmol dm-3.

  12. Nucleotide Sequence Analysis of RNA Synthesized from Rabbit Globin Complementary DNA

    PubMed Central

    Poon, Raymond; Paddock, Gary V.; Heindell, Howard; Whitcome, Philip; Salser, Winston; Kacian, Dan; Bank, Arthur; Gambino, Roberto; Ramirez, Francesco

    1974-01-01

    Rabbit globin complementary DNA made with RNA-dependent DNA polymerase (reverse transcriptase) was used as template for in vitro synthesis of 32P-labeled RNA. The sequences of the nucleotides in most of the fragments resulting from combined ribonuclease T1 and alkaline phosphatase digestion have been determined. Several fragments were long enough to fit uniquely with the α or β globin amino-acid sequences. These data demonstrate that the cDNA was copied from globin mRNA and contained no detectable contaminants. Images PMID:4139714

  13. Cadmium sulfide nanocluster-based electrochemical stripping detection of DNA hybridization.

    PubMed

    Zhu, Ningning; Zhang, Aiping; He, Pingang; Fang, Yuzhi

    2003-03-01

    A novel, sensitive electrochemical DNA hybridization detection assay, using cadmium sulfide (CdS) nanoclusters as the oligonucleotide labeling tag, is described. The assay relies on the hybridization of the target DNA with the CdS nanocluster oligonucleotide DNA probe, followed by the dissolution of the CdS nanoclusters anchored on the hybrids and the indirect determination of the dissolved cadmium ions by sensitive anodic stripping voltammetry (ASV) at a mercury-coated glassy carbon electrode (GCE). The results showed that only a complementary sequence could form a double-stranded dsDNA-CdS with the DNA probe and give an obvious electrochemical response. A three-base mismatch sequence and non-complementary sequence had negligible response. The combination of the large number of cadmium ions released from each dsDNA hybrid with the remarkable sensitivity of the electrochemical stripping analysis for cadmium at mercury-film GCE allows detection at levels as low as 0.2 pmol L(-1) of the complementary sequence of DNA.

  14. Hairpin Bisulfite Sequencing: Synchronous Methylation Analysis on Complementary DNA Strands of Individual Chromosomes.

    PubMed

    Giehr, Pascal; Walter, Jörn

    2018-01-01

    The accurate and quantitative detection of 5-methylcytosine is of great importance in the field of epigenetics. The method of choice is usually bisulfite sequencing because of the high resolution and the possibility to combine it with next generation sequencing. Nevertheless, also this method has its limitations. Following the bisulfite treatment DNA strands are no longer complementary such that in a subsequent PCR amplification the DNA methylation patterns information of only one of the two DNA strand is preserved. Several years ago Hairpin Bisulfite sequencing was developed as a method to obtain the pattern information on complementary DNA strands. The method requires fragmentation (usually by enzymatic cleavage) of genomic DNA followed by a covalent linking of both DNA strands through ligation of a short DNA hairpin oligonucleotide to both strands. The ligated covalently linked dsDNA products are then subjected to a conventional bisulfite treatment during which all unmodified cytosines are converted to uracils. During the treatment the DNA is denatured forming noncomplementary ssDNA circles. These circles serve as a template for a locus specific PCR to amplify chromosomal patterns of the region of interest. As a result one ends up with a linearized product, which contains the methylation information of both complementary DNA strands.

  15. A novel self-powered and sensitive label-free DNA biosensor in microbial fuel cell.

    PubMed

    Asghary, Maryam; Raoof, Jahan Bakhsh; Rahimnejad, Mostafa; Ojani, Reza

    2016-08-15

    In this work, a novel self-powered, sensitive, low-cost, and label-free DNA biosensor is reported by applying a two-chambered microbial fuel cell (MFC) as a power supply. A graphite electrode and an Au nanoparticles modified graphite electrode (AuNP/graphite electrode) were used as anode and cathode in the MFC system, respectively. The active biocatalyst in the anodic chamber was a mixed culture of microorganisms. The sensing element of the biosensor was fabricated by the well-known Au-thiol binding the ssDNA probe on the surface of an AuNP/graphite cathode. Electrons produced by microorganisms were transported from the anode to the cathode through an external circuit, which could be detected by the terminal multi-meter detector. The difference between power densities of the ssDNA probe modified cathode in the absence and presence of complementary sequence served as the detection signal of the DNA hybridization with detection limit of 3.1nM. Thereafter, this biosensor was employed for diagnosis and determination of complementary sequence in a human serum sample. The hybridization specificity studies further revealed that the developed DNA biosensor could distinguish fully complementary sequences from one-base mismatched and non-complementary sequences. Copyright © 2016 Elsevier B.V. All rights reserved.

  16. Ion-channel genosensor for the detection of specific DNA sequences derived from Plum Pox Virus in plant extracts.

    PubMed

    Malecka, Kamila; Michalczuk, Lech; Radecka, Hanna; Radecki, Jerzy

    2014-10-09

    A DNA biosensor for detection of specific oligonucleotides sequences of Plum Pox Virus (PPV) in plant extracts and buffer is proposed. The working principles of a genosensor are based on the ion-channel mechanism. The NH2-ssDNA probe was deposited onto a glassy carbon electrode surface to form an amide bond between the carboxyl group of oxidized electrode surface and amino group from ssDNA probe. The analytical signals generated as a result of hybridization were registered in Osteryoung square wave voltammetry in the presence of [Fe(CN)6]3-/4- as a redox marker. The 22-mer and 42-mer complementary ssDNA sequences derived from PPV and DNA samples from plants infected with PPV were used as targets. Similar detection limits of 2.4 pM (31.0 pg/mL) and 2.3 pM (29.5 pg/mL) in the concentration range 1-8 pM were observed in the presence of the 22-mer ssDNA and 42-mer complementary ssDNA sequences of PPV, respectively. The genosensor was capable of discriminating between samples consisting of extracts from healthy plants and leaf extracts from infected plants in the concentration range 10-50 pg/mL. The detection limit was 12.8 pg/mL. The genosensor displayed good selectivity and sensitivity. The 20-mer partially complementary DNA sequences with four complementary bases and DNA samples from healthy plants used as negative controls generated low signal.

  17. Cloning and sequence analysis of complementary DNA encoding an aberrantly rearranged human T-cell gamma chain.

    PubMed Central

    Dialynas, D P; Murre, C; Quertermous, T; Boss, J M; Leiden, J M; Seidman, J G; Strominger, J L

    1986-01-01

    Complementary DNA (cDNA) encoding a human T-cell gamma chain has been cloned and sequenced. At the junction of the variable and joining regions, there is an apparent deletion of two nucleotides in the human cDNA sequence relative to the murine gamma-chain cDNA sequence, resulting simultaneously in the generation of an in-frame stop codon and in a translational frameshift. For this reason, the sequence presented here encodes an aberrantly rearranged human T-cell gamma chain. There are several surprising differences between the deduced human and murine gamma-chain amino acid sequences. These include poor homology in the variable region, poor homology in a discrete segment of the constant region precisely bounded by the expected junctions of exon CII, and the presence in the human sequence of five potential sites for N-linked glycosylation. Images PMID:3458221

  18. Nucleotide sequence of a complementary DNA encoding pea cytosolic copper/zinc superoxide dismutase. [Pisum sativum L

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    White, D.A.; Zilinskas, B.A.

    1991-08-01

    The authors now report the nucleotide sequence of the cytosolic Cu/Zn SOD cloned from a {lambda}gt11 cDNA library constructed from mRNA extracted from leaves of 7- to 10-d pea seedlings (Pisum sativum L.). The clone was isolated using a 22-base synthetic oligonucleotide complementary to the amino acid sequence CGIIGLQG. This sequence, found at the protein's carboxy terminus, is highly conserved among plant cytosolic Cu/Zn SODs but not chloroplastic Cu/Zn SODs. The 738-base pair sequence contains an open reading frame specifying 152 codons and a predicted M{sub r} of 18,024 D. The deduced amino acid sequence is highly homologous (79-82% identity)more » with the sequences of other known plant cytosolic Cu/Zn SODs but less highly conserved (63-65%) when compared with several chloroplastic Cu/Zn SODs including pea (10).« less

  19. Nature and distribution of feline sarcoma virus nucleotide sequences.

    PubMed Central

    Frankel, A E; Gilbert, J H; Porzig, K J; Scolnick, E M; Aaronson, S A

    1979-01-01

    The genomes of three independent isolates of feline sarcoma virus (FeSV) were compared by molecular hybridization techniques. Using complementary DNAs prepared from two strains, SM- and ST-FeSV, common complementary DNA'S were selected by sequential hybridization to FeSV and feline leukemia virus RNAs. These DNAs were shown to be highly related among the three independent sarcoma virus isolates. FeSV-specific complementary DNAs were prepared by selection for hybridization by the homologous FeSV RNA and against hybridization by fline leukemia virus RNA. Sarcoma virus-specific sequences of SM-FeSV were shown to differ from those of either ST- or GA-FeSV strains, whereas ST-FeSV-specific DNA shared extensive sequence homology with GA-FeSV. By molecular hybridization, each set of FeSV-specific sequences was demonstrated to be present in normal cat cellular DNA in approximately one copy per haploid genome and was conserved throughout Felidae. In contrast, FeSV-common sequences were present in multiple DNA copies and were found only in Mediterranean cats. The present results are consistent with the concept that each FeSV strain has arisen by a mechanism involving recombination between feline leukemia virus and cat cellular DNA sequences, the latter represented within the cat genome in a manner analogous to that of a cellular gene. PMID:225544

  20. PET Imaging Stability Measurements During Simultaneous Pulsing of Aggressive MR Sequences on the SIGNA PET/MR System.

    PubMed

    Deller, Timothy W; Khalighi, Mohammad Mehdi; Jansen, Floris P; Glover, Gary H

    2018-01-01

    The recent introduction of simultaneous whole-body PET/MR scanners has enabled new research taking advantage of the complementary information obtainable with PET and MRI. One such application is kinetic modeling, which requires high levels of PET quantitative stability. To accomplish the required PET stability levels, the PET subsystem must be sufficiently isolated from the effects of MR activity. Performance measurements have previously been published, demonstrating sufficient PET stability in the presence of MR pulsing for typical clinical use; however, PET stability during radiofrequency (RF)-intensive and gradient-intensive sequences has not previously been evaluated for a clinical whole-body scanner. In this work, PET stability of the GE SIGNA PET/MR was examined during simultaneous scanning of aggressive MR pulse sequences. Methods: PET performance tests were acquired with MR idle and during simultaneous MR pulsing. Recent system improvements mitigating RF interference and gain variation were used. A fast recovery fast spin echo MR sequence was selected for high RF power, and an echo planar imaging sequence was selected for its high heat-inducing gradients. Measurements were performed to determine PET stability under varying MR conditions using the following metrics: sensitivity, scatter fraction, contrast recovery, uniformity, count rate performance, and image quantitation. A final PET quantitative stability assessment for simultaneous PET scanning during functional MRI studies was performed with a spiral in-and-out gradient echo sequence. Results: Quantitation stability of a 68 Ge flood phantom was demonstrated within 0.34%. Normalized sensitivity was stable during simultaneous scanning within 0.3%. Scatter fraction measured with a 68 Ge line source in the scatter phantom was stable within the range of 40.4%-40.6%. Contrast recovery and uniformity were comparable for PET images acquired simultaneously with multiple MR conditions. Peak noise equivalent count rate was 224 kcps at an effective activity concentration of 18.6 kBq/mL, and the count rate curves and scatter fraction curve were consistent for the alternating MR pulsing states. A final test demonstrated quantitative stability during a spiral functional MRI sequence. Conclusion: PET stability metrics demonstrated that PET quantitation was not affected during simultaneous aggressive MRI. This stability enables demanding applications such as kinetic modeling. © 2018 by the Society of Nuclear Medicine and Molecular Imaging.

  1. Transcriptome analysis by strand-specific sequencing of complementary DNA

    PubMed Central

    Parkhomchuk, Dmitri; Borodina, Tatiana; Amstislavskiy, Vyacheslav; Banaru, Maria; Hallen, Linda; Krobitsch, Sylvia; Lehrach, Hans; Soldatov, Alexey

    2009-01-01

    High-throughput complementary DNA sequencing (RNA-Seq) is a powerful tool for whole-transcriptome analysis, supplying information about a transcript's expression level and structure. However, it is difficult to determine the polarity of transcripts, and therefore identify which strand is transcribed. Here, we present a simple cDNA sequencing protocol that preserves information about a transcript's direction. Using Saccharomyces cerevisiae and mouse brain transcriptomes as models, we demonstrate that knowing the transcript's orientation allows more accurate determination of the structure and expression of genes. It also helps to identify new genes and enables studying promoter-associated and antisense transcription. The transcriptional landscapes we obtained are available online. PMID:19620212

  2. Transcriptome analysis by strand-specific sequencing of complementary DNA.

    PubMed

    Parkhomchuk, Dmitri; Borodina, Tatiana; Amstislavskiy, Vyacheslav; Banaru, Maria; Hallen, Linda; Krobitsch, Sylvia; Lehrach, Hans; Soldatov, Alexey

    2009-10-01

    High-throughput complementary DNA sequencing (RNA-Seq) is a powerful tool for whole-transcriptome analysis, supplying information about a transcript's expression level and structure. However, it is difficult to determine the polarity of transcripts, and therefore identify which strand is transcribed. Here, we present a simple cDNA sequencing protocol that preserves information about a transcript's direction. Using Saccharomyces cerevisiae and mouse brain transcriptomes as models, we demonstrate that knowing the transcript's orientation allows more accurate determination of the structure and expression of genes. It also helps to identify new genes and enables studying promoter-associated and antisense transcription. The transcriptional landscapes we obtained are available online.

  3. Rapid amplification of 5' complementary DNA ends (5' RACE).

    PubMed

    2005-08-01

    This method is used to extend partial cDNA clones by amplifying the 5' sequences of the corresponding mRNAs 1-3. The technique requires knowledge of only a small region of sequence within the partial cDNA clone. During PCR, the thermostable DNA polymerase is directed to the appropriate target RNA by a single primer derived from the region of known sequence; the second primer required for PCR is complementary to a general feature of the target-in the case of 5' RACE, to a homopolymeric tail added (via terminal transferase) to the 3' termini of cDNAs transcribed from a preparation of mRNA. This synthetic tail provides a primer-binding site upstream of the unknown 5' sequence of the target mRNA. The products of the amplification reaction are cloned into a plasmid vector for sequencing and subsequent manipulation.

  4. Nucleic and amino acid sequences relating to a novel transketolase, and methods for the expression thereof

    DOEpatents

    Croteau, Rodney Bruce; Wildung, Mark Raymond; Lange, Bernd Markus; McCaskill, David G.

    2001-01-01

    cDNAs encoding 1-deoxyxylulose-5-phosphate synthase from peppermint (Mentha piperita) have been isolated and sequenced, and the corresponding amino acid sequences have been determined. Accordingly, isolated DNA sequences (SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7) are provided which code for the expression of 1-deoxyxylulose-5-phosphate synthase from plants. In another aspect the present invention provides for isolated, recombinant DXPS proteins, such as the proteins having the sequences set forth in SEQ ID NO:4, SEQ ID NO:6 and SEQ ID NO:8. In other aspects, replicable recombinant cloning vehicles are provided which code for plant 1-deoxyxylulose-5-phosphate synthases, or for a base sequence sufficiently complementary to at least a portion of 1-deoxyxylulose-5-phosphate synthase DNA or RNA to enable hybridization therewith. In yet other aspects, modified host cells are provided that have been transformed, transfected, infected and/or injected with a recombinant cloning vehicle and/or DNA sequence encoding a plant 1-deoxyxylulose-5-phosphate synthase. Thus, systems and methods are provided for the recombinant expression of the aforementioned recombinant 1-deoxyxylulose-5-phosphate synthase that may be used to facilitate its production, isolation and purification in significant amounts. Recombinant 1-deoxyxylulose-5-phosphate synthase may be used to obtain expression or enhanced expression of 1-deoxyxylulose-5-phosphate synthase in plants in order to enhance the production of 1-deoxyxylulose-5-phosphate, or its derivatives such as isopentenyl diphosphate (BP), or may be otherwise employed for the regulation or expression of 1-deoxyxylulose-5-phosphate synthase, or the production of its products.

  5. Simulations Using Random-Generated DNA and RNA Sequences

    ERIC Educational Resources Information Center

    Bryce, C. F. A.

    1977-01-01

    Using a very simple computer program written in BASIC, a very large number of random-generated DNA or RNA sequences are obtained. Students use these sequences to predict complementary sequences and translational products, evaluate base compositions, determine frequencies of particular triplet codons, and suggest possible secondary structures.…

  6. [Analysis of Conformational Features of Watson-Crick Duplex Fragments by Molecular Mechanics and Quantum Mechanics Methods].

    PubMed

    Poltev, V I; Anisimov, V M; Sanchez, C; Deriabina, A; Gonzalez, E; Garcia, D; Rivas, F; Polteva, N A

    2016-01-01

    It is generally accepted that the important characteristic features of the Watson-Crick duplex originate from the molecular structure of its subunits. However, it still remains to elucidate what properties of each subunit are responsible for the significant characteristic features of the DNA structure. The computations of desoxydinucleoside monophosphates complexes with Na-ions using density functional theory revealed a pivotal role of DNA conformational properties of single-chain minimal fragments in the development of unique features of the Watson-Crick duplex. We found that directionality of the sugar-phosphate backbone and the preferable ranges of its torsion angles, combined with the difference between purines and pyrimidines. in ring bases, define the dependence of three-dimensional structure of the Watson-Crick duplex on nucleotide base sequence. In this work, we extended these density functional theory computations to the minimal' fragments of DNA duplex, complementary desoxydinucleoside monophosphates complexes with Na-ions. Using several computational methods and various functionals, we performed a search for energy minima of BI-conformation for complementary desoxydinucleoside monophosphates complexes with different nucleoside sequences. Two sequences are optimized using ab initio method at the MP2/6-31++G** level of theory. The analysis of torsion angles, sugar ring puckering and mutual base positions of optimized structures demonstrates that the conformational characteristic features of complementary desoxydinucleoside monophosphates complexes with Na-ions remain within BI ranges and become closer to the corresponding characteristic features of the Watson-Crick duplex crystals. Qualitatively, the main characteristic features of each studied complementary desoxydinucleoside monophosphates complex remain invariant when different computational methods are used, although the quantitative values of some conformational parameters could vary lying within the limits typical for the corresponding family. We observe that popular functionals in density functional theory calculations lead to the overestimated distances between base pairs, while MP2 computations and the newer complex functionals produce the structures that have too close atom-atom contacts. A detailed study of some complementary desoxydinucleoside monophosphate complexes with Na-ions highlights the existence of several energy minima corresponding to BI-conformations, in other words, the complexity of the relief pattern of the potential energy surface of complementary desoxydinucleoside monophosphate complexes. This accounts for variability of conformational parameters of duplex fragments with the same base sequence. Popular molecular mechanics force fields AMBER and CHARMM reproduce most of the conformational characteristics of desoxydinucleoside monophosphates and their complementary complexes with Na-ions but fail to reproduce some details of the dependence of the Watson-Crick duplex conformation on the nucleotide sequence.

  7. Complete complementary DNA-derived amino acid sequence of canine cardiac phospholamban.

    PubMed Central

    Fujii, J; Ueno, A; Kitano, K; Tanaka, S; Kadoma, M; Tada, M

    1987-01-01

    Complementary DNA (cDNA) clones specific for phospholamban of sarcoplasmic reticulum membranes have been isolated from a canine cardiac cDNA library. The amino acid sequence deduced from the cDNA sequence indicates that phospholamban consists of 52 amino acid residues and lacks an amino-terminal signal sequence. The protein has an inferred mol wt 6,080 that is in agreement with its apparent monomeric mol wt 6,000, estimated previously by sodium dodecyl sulfate-polyacrylamide gel electrophoresis. Phospholamban contains two distinct domains, a hydrophilic region at the amino terminus (domain I) and a hydrophobic region at the carboxy terminus (domain II). We propose that domain I is localized at the cytoplasmic surface and offers phosphorylatable sites whereas domain II is anchored into the sarcoplasmic reticulum membrane. PMID:3793929

  8. Monoterpene synthases from common sage (Salvia officinalis)

    DOEpatents

    Croteau, Rodney Bruce; Wise, Mitchell Lynn; Katahira, Eva Joy; Savage, Thomas Jonathan

    1999-01-01

    cDNAs encoding (+)-bornyl diphosphate synthase, 1,8-cineole synthase and (+)-sabinene synthase from common sage (Salvia officinalis) have been isolated and sequenced, and the corresponding amino acid sequences has been determined. Accordingly, isolated DNA sequences (SEQ ID No:1; SEQ ID No:3 and SEQ ID No:5) are provided which code for the expression of (+)-bornyl diphosphate synthase (SEQ ID No:2), 1,8-cineole synthase (SEQ ID No:4) and (+)-sabinene synthase SEQ ID No:6), respectively, from sage (Salvia officinalis). In other aspects, replicable recombinant cloning vehicles are provided which code for (+)-bornyl diphosphate synthase, 1,8-cineole synthase or (+)-sabinene synthase, or for a base sequence sufficiently complementary to at least a portion of (+)-bornyl diphosphate synthase, 1,8-cineole synthase or (+)-sabinene synthase DNA or RNA to enable hybridization therewith. In yet other aspects, modified host cells are provided that have been transformed, transfected, infected and/or injected with a recombinant cloning vehicle and/or DNA sequence encoding (+)-bornyl diphosphate synthase, 1,8-cineole synthase or (+)-sabinene synthase. Thus, systems and methods are provided for the recombinant expression of the aforementioned recombinant monoterpene synthases that may be used to facilitate their production, isolation and purification in significant amounts. Recombinant (+)-bornyl diphosphate synthase, 1,8-cineole synthase and (+)-sabinene synthase may be used to obtain expression or enhanced expression of (+)-bornyl diphosphate synthase, 1,8-cineole synthase and (+)-sabinene synthase in plants in order to enhance the production of monoterpenoids, or may be otherwise employed for the regulation or expression of (+)-bornyl diphosphate synthase, 1,8-cineole synthase and (+)-sabinene synthase, or the production of their products.

  9. Ensemble Data Mining Methods

    NASA Technical Reports Server (NTRS)

    Oza, Nikunj C.

    2004-01-01

    Ensemble Data Mining Methods, also known as Committee Methods or Model Combiners, are machine learning methods that leverage the power of multiple models to achieve better prediction accuracy than any of the individual models could on their own. The basic goal when designing an ensemble is the same as when establishing a committee of people: each member of the committee should be as competent as possible, but the members should be complementary to one another. If the members are not complementary, Le., if they always agree, then the committee is unnecessary---any one member is sufficient. If the members are complementary, then when one or a few members make an error, the probability is high that the remaining members can correct this error. Research in ensemble methods has largely revolved around designing ensembles consisting of competent yet complementary models.

  10. A Programmable DNA Double-Write Material: Synergy of Photolithography and Self-Assembly Nanofabrication.

    PubMed

    Song, Youngjun; Takahashi, Tsukasa; Kim, Sejung; Heaney, Yvonne C; Warner, John; Chen, Shaochen; Heller, Michael J

    2017-01-11

    We demonstrate a DNA double-write process that uses UV to pattern a uniquely designed DNA write material, which produces two distinct binding identities for hybridizing two different complementary DNA sequences. The process requires no modification to the DNA by chemical reagents and allows programmed DNA self-assembly and further UV patterning in the UV exposed and nonexposed areas. Multilayered DNA patterning with hybridization of fluorescently labeled complementary DNA sequences, biotin probe/fluorescent streptavidin complexes, and DNA patterns with 500 nm line widths were all demonstrated.

  11. Advanced surface-enhanced Raman gene probe systems and methods thereof

    DOEpatents

    Vo-Dinh, Tuan

    2001-01-01

    The subject invention is a series of methods and systems for using the Surface-Enhanced Raman (SER)-labeled Gene Probe for hybridization, detection and identification of SER-labeled hybridized target oligonucleotide material comprising the steps of immobilizing SER-labeled hybridized target oligonucleotide material on a support means, wherein the SER-labeled hybridized target oligonucleotide material comprise a SER label attached either to a target oligonucleotide of unknown sequence or to a gene probe of known sequence complementary to the target oligonucleotide sequence, the SER label is unique for the target oligonucleotide strands of a particular sequence wherein the SER-labeled oligonucleotide is hybridized to its complementary oligonucleotide strand, then the support means having the SER-labeled hybridized target oligonucleotide material adsorbed thereon is SERS activated with a SERS activating means, then the support means is analyzed.

  12. Composition for nucleic acid sequencing

    DOEpatents

    Korlach, Jonas [Ithaca, NY; Webb, Watt W [Ithaca, NY; Levene, Michael [Ithaca, NY; Turner, Stephen [Ithaca, NY; Craighead, Harold G [Ithaca, NY; Foquet, Mathieu [Ithaca, NY

    2008-08-26

    The present invention is directed to a method of sequencing a target nucleic acid molecule having a plurality of bases. In its principle, the temporal order of base additions during the polymerization reaction is measured on a molecule of nucleic acid, i.e. the activity of a nucleic acid polymerizing enzyme on the template nucleic acid molecule to be sequenced is followed in real time. The sequence is deduced by identifying which base is being incorporated into the growing complementary strand of the target nucleic acid by the catalytic activity of the nucleic acid polymerizing enzyme at each step in the sequence of base additions. A polymerase on the target nucleic acid molecule complex is provided in a position suitable to move along the target nucleic acid molecule and extend the oligonucleotide primer at an active site. A plurality of labelled types of nucleotide analogs are provided proximate to the active site, with each distinguishable type of nucleotide analog being complementary to a different nucleotide in the target nucleic acid sequence. The growing nucleic acid strand is extended by using the polymerase to add a nucleotide analog to the nucleic acid strand at the active site, where the nucleotide analog being added is complementary to the nucleotide of the target nucleic acid at the active site. The nucleotide analog added to the oligonucleotide primer as a result of the polymerizing step is identified. The steps of providing labelled nucleotide analogs, polymerizing the growing nucleic acid strand, and identifying the added nucleotide analog are repeated so that the nucleic acid strand is further extended and the sequence of the target nucleic acid is determined.

  13. Method for sequencing nucleic acid molecules

    DOEpatents

    Korlach, Jonas; Webb, Watt W.; Levene, Michael; Turner, Stephen; Craighead, Harold G.; Foquet, Mathieu

    2006-06-06

    The present invention is directed to a method of sequencing a target nucleic acid molecule having a plurality of bases. In its principle, the temporal order of base additions during the polymerization reaction is measured on a molecule of nucleic acid, i.e. the activity of a nucleic acid polymerizing enzyme on the template nucleic acid molecule to be sequenced is followed in real time. The sequence is deduced by identifying which base is being incorporated into the growing complementary strand of the target nucleic acid by the catalytic activity of the nucleic acid polymerizing enzyme at each step in the sequence of base additions. A polymerase on the target nucleic acid molecule complex is provided in a position suitable to move along the target nucleic acid molecule and extend the oligonucleotide primer at an active site. A plurality of labelled types of nucleotide analogs are provided proximate to the active site, with each distinguishable type of nucleotide analog being complementary to a different nucleotide in the target nucleic acid sequence. The growing nucleic acid strand is extended by using the polymerase to add a nucleotide analog to the nucleic acid strand at the active site, where the nucleotide analog being added is complementary to the nucleotide of the target nucleic acid at the active site. The nucleotide analog added to the oligonucleotide primer as a result of the polymerizing step is identified. The steps of providing labelled nucleotide analogs, polymerizing the growing nucleic acid strand, and identifying the added nucleotide analog are repeated so that the nucleic acid strand is further extended and the sequence of the target nucleic acid is determined.

  14. Method for sequencing nucleic acid molecules

    DOEpatents

    Korlach, Jonas; Webb, Watt W.; Levene, Michael; Turner, Stephen; Craighead, Harold G.; Foquet, Mathieu

    2006-05-30

    The present invention is directed to a method of sequencing a target nucleic acid molecule having a plurality of bases. In its principle, the temporal order of base additions during the polymerization reaction is measured on a molecule of nucleic acid, i.e. the activity of a nucleic acid polymerizing enzyme on the template nucleic acid molecule to be sequenced is followed in real time. The sequence is deduced by identifying which base is being incorporated into the growing complementary strand of the target nucleic acid by the catalytic activity of the nucleic acid polymerizing enzyme at each step in the sequence of base additions. A polymerase on the target nucleic acid molecule complex is provided in a position suitable to move along the target nucleic acid molecule and extend the oligonucleotide primer at an active site. A plurality of labelled types of nucleotide analogs are provided proximate to the active site, with each distinguishable type of nucleotide analog being complementary to a different nucleotide in the target nucleic acid sequence. The growing nucleic acid strand is extended by using the polymerase to add a nucleotide analog to the nucleic acid strand at the active site, where the nucleotide analog being added is complementary to the nucleotide of the target nucleic acid at the active site. The nucleotide analog added to the oligonucleotide primer as a result of the polymerizing step is identified. The steps of providing labelled nucleotide analogs, polymerizing the growing nucleic acid strand, and identifying the added nucleotide analog are repeated so that the nucleic acid strand is further extended and the sequence of the target nucleic acid is determined.

  15. Integrative analysis of Arabidopsis thaliana transcriptomics reveals intuitive splicing mechanism for circular RNA.

    PubMed

    Sun, Xiaoyong; Wang, Lin; Ding, Jiechao; Wang, Yanru; Wang, Jiansheng; Zhang, Xiaoyang; Che, Yulei; Liu, Ziwei; Zhang, Xinran; Ye, Jiazhen; Wang, Jie; Sablok, Gaurav; Deng, Zhiping; Zhao, Hongwei

    2016-10-01

    A new regulatory class of small endogenous RNAs called circular RNAs (circRNAs) has been described as miRNA sponges in animals. Using 16 Arabidopsis thaliana RNA-Seq data sets, we identified 803 circRNAs in RNase R-/non-RNase R-treated samples. The results revealed the following features: Canonical and noncanonical splicing can generate circRNAs; chloroplasts are a hotspot for circRNA generation; furthermore, limited complementary sequences exist not only in introns, but also in the sequences flanking splice sites. The latter finding suggests that multiple combinations between complementary sequences may facilitate the formation of the circular structure. Our results contribute to a better understanding of this novel class of plant circRNAs. © 2016 Federation of European Biochemical Societies.

  16. Complementary DNA sequences encoding the multimammate rat MHC class II DQ alpha and beta chains and cross-species sequence comparison in rodents.

    PubMed

    de Bellocq, J Goüy; Leirs, H

    2009-09-01

    Sequences of the complete open reading frame (ORF) for rodents major histocompatibility complex (MHC) class II genes are rare. Multimammate rat (Mastomys natalensis) complementary DNA (cDNA) encoding the alpha and beta chains of MHC class II DQ gene was cloned from a rapid amplifications of cDNA Emds (RACE) cDNA library. The ORFs consist of 801 and 771 bp encoding 266 and 256 amino acid residues for DQB and DQA, respectively. The genomic structure of Mana-DQ genes is globally analogous to that described for other rodents except for the insertion of a serine residue in the signal peptide of Mana-DQB, which is unique among known rodents.

  17. Sequence-based screening for self-sufficient P450 monooxygenase from a metagenome library.

    PubMed

    Kim, B S; Kim, S Y; Park, J; Park, W; Hwang, K Y; Yoon, Y J; Oh, W K; Kim, B Y; Ahn, J S

    2007-05-01

    Cytochrome P450 monooxygenases (CYPs) are useful catalysts for oxidation reactions. Self-sufficient CYPs harbour a reductive domain covalently connected to a P450 domain and are known for their robust catalytic activity with great potential as biocatalysts. In an effort to expand genetic sources of self-sufficient CYPs, we devised a sequence-based screening system to identify them in a soil metagenome. We constructed a soil metagenome library and performed sequence-based screening for self-sufficient CYP genes. A new CYP gene, syk181, was identified from the metagenome library. Phylogenetic analysis revealed that SYK181 formed a distinct phylogenic line with 46% amino-acid-sequence identity to CYP102A1 which has been extensively studied as a fatty acid hydroxylase. The heterologously expressed SYK181 showed significant hydroxylase activity towards naphthalene and phenanthrene as well as towards fatty acids. Sequence-based screening of metagenome libraries is expected to be a useful approach for searching self-sufficient CYP genes. The translated product of syk181 shows self-sufficient hydroxylase activity towards fatty acids and aromatic compounds. SYK181 is the first self-sufficient CYP obtained directly from a metagenome library. The genetic and biochemical information on SYK181 are expected to be helpful for engineering self-sufficient CYPs with broader catalytic activities towards various substrates, which would be useful for bioconversion of natural products and biodegradation of organic chemicals.

  18. Spontaneous Decoding of the Timing and Content of Human Object Perception from Cortical Surface Recordings Reveals Complementary Information in the Event-Related Potential and Broadband Spectral Change

    PubMed Central

    Miller, Kai J.; Schalk, Gerwin; Hermes, Dora; Ojemann, Jeffrey G.; Rao, Rajesh P. N.

    2016-01-01

    The link between object perception and neural activity in visual cortical areas is a problem of fundamental importance in neuroscience. Here we show that electrical potentials from the ventral temporal cortical surface in humans contain sufficient information for spontaneous and near-instantaneous identification of a subject’s perceptual state. Electrocorticographic (ECoG) arrays were placed on the subtemporal cortical surface of seven epilepsy patients. Grayscale images of faces and houses were displayed rapidly in random sequence. We developed a template projection approach to decode the continuous ECoG data stream spontaneously, predicting the occurrence, timing and type of visual stimulus. In this setting, we evaluated the independent and joint use of two well-studied features of brain signals, broadband changes in the frequency power spectrum of the potential and deflections in the raw potential trace (event-related potential; ERP). Our ability to predict both the timing of stimulus onset and the type of image was best when we used a combination of both the broadband response and ERP, suggesting that they capture different and complementary aspects of the subject’s perceptual state. Specifically, we were able to predict the timing and type of 96% of all stimuli, with less than 5% false positive rate and a ~20ms error in timing. PMID:26820899

  19. A cis-antisense RNA acts in trans in Staphylococcus aureus to control translation of a human cytolytic peptide.

    PubMed

    Sayed, Nour; Jousselin, Ambre; Felden, Brice

    2011-12-25

    Antisense RNAs (asRNAs) pair to RNAs expressed from the complementary strand, and their functions are thought to depend on nucleotide overlap with genes on the opposite strand. There is little information on the roles and mechanisms of asRNAs. We show that a cis asRNA acts in trans, using a domain outside its target complementary sequence. SprA1 small regulatory RNA (sRNA) and SprA1(AS) asRNA are concomitantly expressed in S. aureus. SprA1(AS) forms a complex with SprA1, preventing translation of the SprA1-encoded open reading frame by occluding translation initiation signals through pairing interactions. The SprA1 peptide sequence is within two RNA pseudoknots. SprA1(AS) represses production of the SprA1-encoded cytolytic peptide in trans, as its overlapping region is dispensable for regulation. These findings demonstrate that sometimes asRNA functional domains are not their gene-target complementary sequences, suggesting there is a need for mechanistic re-evaluation of asRNAs expressed in prokaryotes and eukaryotes.

  20. DNA Photo Lithography with Cinnamate-based Photo-Bio-Nano-Glue

    NASA Astrophysics Data System (ADS)

    Feng, Lang; Li, Minfeng; Romulus, Joy; Sha, Ruojie; Royer, John; Wu, Kun-Ta; Xu, Qin; Seeman, Nadrian; Weck, Marcus; Chaikin, Paul

    2013-03-01

    We present a technique to make patterned functional surfaces, using a cinnamate photo cross-linker and photolithography. We have designed and modified a complementary set of single DNA strands to incorporate a pair of opposing cinnamate molecules. On exposure to 360nm UV, the cinnamate makes a highly specific covalent bond permanently linking only the complementary strands containing the cinnamates. We have studied this specific and efficient crosslinking with cinnamate-containing DNA in solution and on particles. UV addressability allows us to pattern surfaces functionally. The entire surface is coated with a DNA sequence A incorporating cinnamate. DNA strands A'B with one end containing a complementary cinnamated sequence A' attached to another sequence B, are then hybridized to the surface. UV photolithography is used to bind the A'B strand in a specific pattern. The system is heated and the unbound DNA is washed away. The pattern is then observed by thermo-reversibly hybridizing either fluorescently dyed B' strands complementary to B, or colloids coated with B' strands. Our techniques can be used to reversibly and/or permanently bind, via DNA linkers, an assortment of molecules, proteins and nanostructures. Potential applications range from advanced self-assembly, such as templated self-replication schemes recently reported, to designed physical and chemical patterns, to high-resolution multi-functional DNA surfaces for genetic detection or DNA computing.

  1. Complementary Feeding: Review of Recommendations, Feeding Practices, and Adequacy of Homemade Complementary Food Preparations in Developing Countries – Lessons from Ethiopia

    PubMed Central

    Abeshu, Motuma Adimasu; Lelisa, Azeb; Geleta, Bekesho

    2016-01-01

    Breastfeeding provides the ideal food during the first 6 months of life. Complementary feeding starts when breast milk is no longer sufficient by itself, where the target age is for 6–23 months. The gap between nutritional requirement and amount obtained from breast milk increases with age. For energy, 200, 300, and 550 kcal per day is expected to be covered by complementary foods at 6–8, 9–11, and 12–23 months, respectively. In addition, the complementary foods must provide relatively large proportions of micronutrients such as iron, zinc, phosphorus, magnesium, calcium, and vitamin B6. In several parts of the developing world, complementary feeding continues as a challenge to good nutrition in children. In Ethiopia, only 4.2% of breastfed children of 6–23 months of age have a minimum acceptable diet. The gaps are mostly attributed to either poor dietary quality or poor feeding practices, if not both. Commercial fortified foods are often beyond the reach of the poor. Thus, homemade complementary foods remain commonly used. Even when based on an improved recipe, however, unfortified plant-based complementary foods provide insufficient key micronutrients (especially, iron, zinc, and calcium) during the age of 6–23 months. Thus, this review assessed complementary feeding practice and recommendation and reviewed the level of adequacy of homemade complementary foods. PMID:27800479

  2. Diversity analysis in Cannabis sativa based on large-scale development of expressed sequence tag-derived simple sequence repeat markers.

    PubMed

    Gao, Chunsheng; Xin, Pengfei; Cheng, Chaohua; Tang, Qing; Chen, Ping; Wang, Changbiao; Zang, Gonggu; Zhao, Lining

    2014-01-01

    Cannabis sativa L. is an important economic plant for the production of food, fiber, oils, and intoxicants. However, lack of sufficient simple sequence repeat (SSR) markers has limited the development of cannabis genetic research. Here, large-scale development of expressed sequence tag simple sequence repeat (EST-SSR) markers was performed to obtain more informative genetic markers, and to assess genetic diversity in cannabis (Cannabis sativa L.). Based on the cannabis transcriptome, 4,577 SSRs were identified from 3,624 ESTs. From there, a total of 3,442 complementary primer pairs were designed as SSR markers. Among these markers, trinucleotide repeat motifs (50.99%) were the most abundant, followed by hexanucleotide (25.13%), dinucleotide (16.34%), tetranucloetide (3.8%), and pentanucleotide (3.74%) repeat motifs, respectively. The AAG/CTT trinucleotide repeat (17.96%) was the most abundant motif detected in the SSRs. One hundred and seventeen EST-SSR markers were randomly selected to evaluate primer quality in 24 cannabis varieties. Among these 117 markers, 108 (92.31%) were successfully amplified and 87 (74.36%) were polymorphic. Forty-five polymorphic primer pairs were selected to evaluate genetic diversity and relatedness among the 115 cannabis genotypes. The results showed that 115 varieties could be divided into 4 groups primarily based on geography: Northern China, Europe, Central China, and Southern China. Moreover, the coefficient of similarity when comparing cannabis from Northern China with the European group cannabis was higher than that when comparing with cannabis from the other two groups, owing to a similar climate. This study outlines the first large-scale development of SSR markers for cannabis. These data may serve as a foundation for the development of genetic linkage, quantitative trait loci mapping, and marker-assisted breeding of cannabis.

  3. Diversity Analysis in Cannabis sativa Based on Large-Scale Development of Expressed Sequence Tag-Derived Simple Sequence Repeat Markers

    PubMed Central

    Cheng, Chaohua; Tang, Qing; Chen, Ping; Wang, Changbiao; Zang, Gonggu; Zhao, Lining

    2014-01-01

    Cannabis sativa L. is an important economic plant for the production of food, fiber, oils, and intoxicants. However, lack of sufficient simple sequence repeat (SSR) markers has limited the development of cannabis genetic research. Here, large-scale development of expressed sequence tag simple sequence repeat (EST-SSR) markers was performed to obtain more informative genetic markers, and to assess genetic diversity in cannabis (Cannabis sativa L.). Based on the cannabis transcriptome, 4,577 SSRs were identified from 3,624 ESTs. From there, a total of 3,442 complementary primer pairs were designed as SSR markers. Among these markers, trinucleotide repeat motifs (50.99%) were the most abundant, followed by hexanucleotide (25.13%), dinucleotide (16.34%), tetranucloetide (3.8%), and pentanucleotide (3.74%) repeat motifs, respectively. The AAG/CTT trinucleotide repeat (17.96%) was the most abundant motif detected in the SSRs. One hundred and seventeen EST-SSR markers were randomly selected to evaluate primer quality in 24 cannabis varieties. Among these 117 markers, 108 (92.31%) were successfully amplified and 87 (74.36%) were polymorphic. Forty-five polymorphic primer pairs were selected to evaluate genetic diversity and relatedness among the 115 cannabis genotypes. The results showed that 115 varieties could be divided into 4 groups primarily based on geography: Northern China, Europe, Central China, and Southern China. Moreover, the coefficient of similarity when comparing cannabis from Northern China with the European group cannabis was higher than that when comparing with cannabis from the other two groups, owing to a similar climate. This study outlines the first large-scale development of SSR markers for cannabis. These data may serve as a foundation for the development of genetic linkage, quantitative trait loci mapping, and marker-assisted breeding of cannabis. PMID:25329551

  4. Labeled nucleotide phosphate (NP) probes

    DOEpatents

    Korlach, Jonas [Ithaca, NY; Webb, Watt W [Ithaca, NY; Levene, Michael [Ithaca, NY; Turner, Stephen [Ithaca, NY; Craighead, Harold G [Ithaca, NY; Foquet, Mathieu [Ithaca, NY

    2009-02-03

    The present invention is directed to a method of sequencing a target nucleic acid molecule having a plurality of bases. In its principle, the temporal order of base additions during the polymerization reaction is measured on a molecule of nucleic acid, i.e. the activity of a nucleic acid polymerizing enzyme on the template nucleic acid molecule to be sequenced is followed in real time. The sequence is deduced by identifying which base is being incorporated into the growing complementary strand of the target nucleic acid by the catalytic activity of the nucleic acid polymerizing enzyme at each step in the sequence of base additions. A polymerase on the target nucleic acid molecule complex is provided in a position suitable to move along the target nucleic acid molecule and extend the oligonucleotide primer at an active site. A plurality of labelled types of nucleotide analogs are provided proximate to the active site, with each distinguishable type of nucleotide analog being complementary to a different nucleotide in the target nucleic acid sequence. The growing nucleic acid strand is extended by using the polymerase to add a nucleotide analog to the nucleic acid strand at the active site, where the nucleotide analog being added is complementary to the nucleotide of the target nucleic acid at the active site. The nucleotide analog added to the oligonucleotide primer as a result of the polymerizing step is identified. The steps of providing labelled nucleotide analogs, polymerizing the growing nucleic acid strand, and identifying the added nucleotide analog are repeated so that the nucleic acid strand is further extended and the sequence of the target nucleic acid is determined.

  5. Nucleic acid indexing

    DOEpatents

    Guilfoyle, Richard A.; Guo, Zhen

    2001-01-01

    A restriction site indexing method for selectively amplifying any fragment generated by a Class II restriction enzyme includes adaptors specific to fragment ends containing adaptor indexing sequences complementary to fragment indexing sequences near the termini of fragments generated by Class II enzyme cleavage. A method for combinatorial indexing facilitates amplification of restriction fragments whose sequence is not known.

  6. Nucleic acid indexing

    DOEpatents

    Guilfoyle, Richard A.; Guo, Zhen

    1999-01-01

    A restriction site indexing method for selectively amplifying any fragment generated by a Class II restriction enzyme includes adaptors specific to fragment ends containing adaptor indexing sequences complementary to fragment indexing sequences near the termini of fragments generated by Class II enzyme cleavage. A method for combinatorial indexing facilitates amplification of restriction fragments whose sequence is not known.

  7. Microchip method for the enrichment of specific DNA sequences

    DOEpatents

    Mirzabekov, A.D.; Lysov, Y.P.; Shick, V.V.; Dubiley, S.A.

    1998-12-22

    A method for enriching specific genetic material sequences is provided, whereby oligonucleotide molecules complementary to the desired genetic material is first used to isolate the genetic material from a first source of genomic material. Then the genetic material is used as a label to isolate similar genetic sequences from other sources. 4 figs.

  8. Microchip method for the enrichment of specific DNA sequences

    DOEpatents

    Mirzabekov, Andrei Darievich; Lysov, Yuri Petrovich; Shick, Valentine Vladimirovich; Dubiley, Svetlana Alekseevna

    1998-01-01

    A method for enriching specific genetic material sequences is provided, whereby oligonucleotide molecules complementary to the desired genetic material is first used to isolate the genetic material from a first source of genomic material. Then the genetic material is used as a label to isolate similar genetic sequences from other sources.

  9. MRI of normal and abnormal duodenum using Half-Fourier Single-Shot RARE and gadolinium-enhanced spoiled gradient echo sequences.

    PubMed

    Marcos, H B; Semelka, R C; Noone, T C; Woosley, J T; Lee, J K

    1999-07-01

    The objective of this research was two-fold: First, to describe the normal and abnormal MR appearances of the duodenum using combined Half-Fourier Acquisition Single Shot RARE (HASTE) and gadolinium-enhanced standard and fat suppressed spoiled gradient echo (SGE) sequences. The second objective was to assess the ability of these combined sequences to detect and characterize duodenal diseases. MR examinations were performed on fifty consecutive patients with no clinical history of duodenal diseases, who were 1) imaged with HASTE and gadolinium-enhanced standard and fat suppressed SGE sequences and 2) referred to MR examination for reasons other than duodenal diseases, and were reviewed retrospectively to determine the normal MR appearances of the duodenum. A second population of patients with abnormal duodenum who were imaged with the same MR sequences were included in the second part of this study. This population was composed of 20 consecutive patients with subsequently proven duodenal abnormalities, including: malrotation (2), diverticula (4), intussusception (1), sprue (1), polyps (2), neurofibroma (1), lymphoma (1), Zollinger Ellison syndrome (1), metastatic disease (1), Crohn's disease (1), and wall thickening and duodenitis (5). Normal measurements of the duodenum are described. Abnormalities of wall thickness and duodenal masses required combined HASTE and gadolinium-enhanced SGE images to evaluate well. Abnormalities of the bowel lumen (e.g., diverticula and intussusception), and developmental variants (e.g., malrotation), were sufficiently visualized on HASTE images alone. Bowel inflammation was best shown on gadolinium-enhanced fat suppressed SGE images. HASTE and gadolinium-enhanced fat suppressed SGE sequences are complementary techniques for the demonstration of normal and abnormal duodenum. The combined use of both sequences allows evaluation of different aspects of bowel diseases; abnormalities of position, lumen, and contents are well shown on HASTE, while inflammation is best shown on gadolinium enhanced fat suppressed SGE, and wall thickening and masses are best evaluated with the combined use of both techniques.

  10. SNBRFinder: A Sequence-Based Hybrid Algorithm for Enhanced Prediction of Nucleic Acid-Binding Residues.

    PubMed

    Yang, Xiaoxia; Wang, Jia; Sun, Jun; Liu, Rong

    2015-01-01

    Protein-nucleic acid interactions are central to various fundamental biological processes. Automated methods capable of reliably identifying DNA- and RNA-binding residues in protein sequence are assuming ever-increasing importance. The majority of current algorithms rely on feature-based prediction, but their accuracy remains to be further improved. Here we propose a sequence-based hybrid algorithm SNBRFinder (Sequence-based Nucleic acid-Binding Residue Finder) by merging a feature predictor SNBRFinderF and a template predictor SNBRFinderT. SNBRFinderF was established using the support vector machine whose inputs include sequence profile and other complementary sequence descriptors, while SNBRFinderT was implemented with the sequence alignment algorithm based on profile hidden Markov models to capture the weakly homologous template of query sequence. Experimental results show that SNBRFinderF was clearly superior to the commonly used sequence profile-based predictor and SNBRFinderT can achieve comparable performance to the structure-based template methods. Leveraging the complementary relationship between these two predictors, SNBRFinder reasonably improved the performance of both DNA- and RNA-binding residue predictions. More importantly, the sequence-based hybrid prediction reached competitive performance relative to our previous structure-based counterpart. Our extensive and stringent comparisons show that SNBRFinder has obvious advantages over the existing sequence-based prediction algorithms. The value of our algorithm is highlighted by establishing an easy-to-use web server that is freely accessible at http://ibi.hzau.edu.cn/SNBRFinder.

  11. Complementary DNA cloning and molecular evolution of opine dehydrogenases in some marine invertebrates.

    PubMed

    Kimura, Tomohiro; Nakano, Toshiki; Yamaguchi, Toshiyasu; Sato, Minoru; Ogawa, Tomohisa; Muramoto, Koji; Yokoyama, Takehiko; Kan-No, Nobuhiro; Nagahisa, Eizou; Janssen, Frank; Grieshaber, Manfred K

    2004-01-01

    The complete complementary DNA sequences of genes presumably coding for opine dehydrogenases from Arabella iricolor (sandworm), Haliotis discus hannai (abalone), and Patinopecten yessoensis (scallop) were determined, and partial cDNA sequences were derived for Meretrix lusoria (Japanese hard clam) and Spisula sachalinensis (Sakhalin surf clam). The primers ODH-9F and ODH-11R proved useful for amplifying the sequences for opine dehydrogenases from the 4 mollusk species investigated in this study. The sequence of the sandworm was obtained using primers constructed from the amino acid sequence of tauropine dehydrogenase, the main opine dehydrogenase in A. iricolor. The complete cDNA sequence of A. iricolor, H. discus hannai, and P. yessoensis encode 397, 400, and 405 amino acids, respectively. All sequences were aligned and compared with published databank sequences of Loligo opalescens, Loligo vulgaris (squid), Sepia officinalis (cuttlefish), and Pecten maximus (scallop). As expected, a high level of homology was observed for the cDNA from closely related species, such as for cephalopods or scallops, whereas cDNA from the other species showed lower-level homologies. A similar trend was observed when the deduced amino acid sequences were compared. Furthermore, alignment of these sequences revealed some structural motifs that are possibly related to the binding sites of the substrates. The phylogenetic trees derived from the nucleotide and amino acid sequences were consistent with the classification of species resulting from classical taxonomic analyses.

  12. Delineating the Diversity of Spinal Interneurons in Locomotor Circuits.

    PubMed

    Gosgnach, Simon; Bikoff, Jay B; Dougherty, Kimberly J; El Manira, Abdeljabbar; Lanuza, Guillermo M; Zhang, Ying

    2017-11-08

    Locomotion is common to all animals and is essential for survival. Neural circuits located in the spinal cord have been shown to be necessary and sufficient for the generation and control of the basic locomotor rhythm by activating muscles on either side of the body in a specific sequence. Activity in these neural circuits determines the speed, gait pattern, and direction of movement, so the specific locomotor pattern generated relies on the diversity of the neurons within spinal locomotor circuits. Here, we review findings demonstrating that developmental genetics can be used to identify populations of neurons that comprise these circuits and focus on recent work indicating that many of these populations can be further subdivided into distinct subtypes, with each likely to play complementary functions during locomotion. Finally, we discuss data describing the manner in which these populations interact with each other to produce efficient, task-dependent locomotion. Copyright © 2017 the authors 0270-6474/17/3710835-07$15.00/0.

  13. Molecular cloning of a gene encoding translation initiation factor (TIF) from Candida albicans.

    PubMed

    Mirbod, F; Nakashima, S; Kitajima, Y; Ghannoum, M A; Cannon, R D; Nozawa, Y

    1996-01-01

    The differential display technique was applied to compare mRNAs from two clinical isolates of Candida albicans with different virulence; high (potent strain, 16240) and low (weak strain, 18084) extracellular phospholipase activities. Complementary DNA fragments corresponding to several apparently differentially expressed mRNAs were recovered and sequenced. A complementary DNA fragment seen distinctly in the potent phospholipase producing strain was highly homologous to the yeast translation initiation factor (TIF). The selected DNA fragment was then used as a probe to isolate its corresponding complementary DNA clone from a library of C. albicans genomic DNA. The sequence of isolated gene revealed an open reading frame of 1194 nucleotides with the potential to encode a protein of 397 amino acids with a predicted molecular weight of 43 kDa. Over its entire length, the amino acid sequence showed strong homology (78-89%) to Saccharomyces cerevisiae TIF and (63-80%) to mouse eIF-4A proteins. Therefore, our C. albicans gene was identified to be TIF (Ca TIF). Northern blot analysis in the two strains of C. albicans revealed that Ca TIF expression is 1.5-fold higher in the potent phospholipase producing strain. The restriction endonuclease digestion of genomic DNA from this potent strain revealed at least two hybridized bands in Southern blot analysis, suggesting two or more closely related sequences in the C. albicans genome.

  14. New redox-active layer create via epoxy-amine reaction - The base of genosensor for the detection of specific DNA and RNA sequences of avian influenza virus H5N1.

    PubMed

    Malecka, Kamila; Stachyra, Anna; Góra-Sochacka, Anna; Sirko, Agnieszka; Zagórski-Ostoja, Włodzimierz; Dehaen, Wim; Radecka, Hanna; Radecki, Jerzy

    2015-03-15

    This paper concerns the development of a redox-active monolayer and its application for the construction of an electrochemical genosensor designed for the detection of specific DNA and RNA oligonucleotide sequences related to the avian influenza virus (AIV) type H5N1. This new redox layer was created on a gold electrode surface step by step. Cyclic Voltammetry, Osteryoung Square-Wave Voltammetry and Differential Pulse Voltammetry were used for its characterization. This new redox-active layer was applied for the construction of the DNA biosensor. The NH2-NC3 probe (20-mer) was covalently attached to the gold electrode surface via a "click" reaction between the amine and an epoxide group. The hybridization process was monitored using the Osteryoung Square-Wave Voltammetry. The 20-mer DNA and ca. 280-mer RNA oligonucleotides were used as the targets. The constructed genosensor was capable to determine complementary oligonucleotide sequences with a detection limit in the pM range. It is able to distinguish the different position of the part RNA complementary to the DNA probe. The genosensor was very selective. The 20-mer DNA as well as the 280-mer RNA oligonucleotides without a complementary sequence generated a weak signal. Copyright © 2014 Elsevier B.V. All rights reserved.

  15. Comprehensive viral enrichment enables sensitive respiratory virus genomic identification and analysis by next generation sequencing.

    PubMed

    O'Flaherty, Brigid M; Li, Yan; Tao, Ying; Paden, Clinton R; Queen, Krista; Zhang, Jing; Dinwiddie, Darrell L; Gross, Stephen M; Schroth, Gary P; Tong, Suxiang

    2018-06-01

    Next generation sequencing (NGS) technologies have revolutionized the genomics field and are becoming more commonplace for identification of human infectious diseases. However, due to the low abundance of viral nucleic acids (NAs) in relation to host, viral identification using direct NGS technologies often lacks sufficient sensitivity. Here, we describe an approach based on two complementary enrichment strategies that significantly improves the sensitivity of NGS-based virus identification. To start, we developed two sets of DNA probes to enrich virus NAs associated with respiratory diseases. The first set of probes spans the genomes, allowing for identification of known viruses and full genome sequencing, while the second set targets regions conserved among viral families or genera, providing the ability to detect both known and potentially novel members of those virus groups. Efficiency of enrichment was assessed by NGS testing reference virus and clinical samples with known infection. We show significant improvement in viral identification using enriched NGS compared to unenriched NGS. Without enrichment, we observed an average of 0.3% targeted viral reads per sample. However, after enrichment, 50%-99% of the reads per sample were the targeted viral reads for both the reference isolates and clinical specimens using both probe sets. Importantly, dramatic improvements on genome coverage were also observed following virus-specific probe enrichment. The methods described here provide improved sensitivity for virus identification by NGS, allowing for a more comprehensive analysis of disease etiology. © 2018 O'Flaherty et al.; Published by Cold Spring Harbor Laboratory Press.

  16. Nucleic acid analysis using terminal-phosphate-labeled nucleotides

    DOEpatents

    Korlach, Jonas [Ithaca, NY; Webb, Watt W [Ithaca, NY; Levene, Michael [Ithaca, NY; Turner, Stephen [Ithaca, NY; Craighead, Harold G [Ithaca, NY; Foquet, Mathieu [Ithaca, NY

    2008-04-22

    The present invention is directed to a method of sequencing a target nucleic acid molecule having a plurality of bases. In its principle, the temporal order of base additions during the polymerization reaction is measured on a molecule of nucleic acid, i.e. the activity of a nucleic acid polymerizing enzyme on the template nucleic acid molecule to be sequenced is followed in real time. The sequence is deduced by identifying which base is being incorporated into the growing complementary strand of the target nucleic acid by the catalytic activity of the nucleic acid polymerizing enzyme at each step in the sequence of base additions. A polymerase on the target nucleic acid molecule complex is provided in a position suitable to move along the target nucleic acid molecule and extend the oligonucleotide primer at an active site. A plurality of labelled types of nucleotide analogs are provided proximate to the active site, with each distinguishable type of nucleotide analog being complementary to a different nucleotide in the target nucleic acid sequence. The growing nucleic acid strand is extended by using the polymerase to add a nucleotide analog to the nucleic acid strand at the active site, where the nucleotide analog being added is complementary to the nucleotide of the target nucleic acid at the active site. The nucleotide analog added to the oligonucleotide primer as a result of the polymerizing step is identified. The steps of providing labelled nucleotide analogs, polymerizing the growing nucleic acid strand, and identifying the added nucleotide analog are repeated so that the nucleic acid strand is further extended and the sequence of the target nucleic acid is determined.

  17. Individual sequences in large sets of gene sequences may be distinguished efficiently by combinations of shared sub-sequences

    PubMed Central

    Gibbs, Mark J; Armstrong, John S; Gibbs, Adrian J

    2005-01-01

    Background Most current DNA diagnostic tests for identifying organisms use specific oligonucleotide probes that are complementary in sequence to, and hence only hybridise with the DNA of one target species. By contrast, in traditional taxonomy, specimens are usually identified by 'dichotomous keys' that use combinations of characters shared by different members of the target set. Using one specific character for each target is the least efficient strategy for identification. Using combinations of shared bisectionally-distributed characters is much more efficient, and this strategy is most efficient when they separate the targets in a progressively binary way. Results We have developed a practical method for finding minimal sets of sub-sequences that identify individual sequences, and could be targeted by combinations of probes, so that the efficient strategy of traditional taxonomic identification could be used in DNA diagnosis. The sizes of minimal sub-sequence sets depended mostly on sequence diversity and sub-sequence length and interactions between these parameters. We found that 201 distinct cytochrome oxidase subunit-1 (CO1) genes from moths (Lepidoptera) were distinguished using only 15 sub-sequences 20 nucleotides long, whereas only 8–10 sub-sequences 6–10 nucleotides long were required to distinguish the CO1 genes of 92 species from the 9 largest orders of insects. Conclusion The presence/absence of sub-sequences in a set of gene sequences can be used like the questions in a traditional dichotomous taxonomic key; hybridisation probes complementary to such sub-sequences should provide a very efficient means for identifying individual species, subtypes or genotypes. Sequence diversity and sub-sequence length are the major factors that determine the numbers of distinguishing sub-sequences in any set of sequences. PMID:15817134

  18. Specific DNA duplex formation at an artificial lipid bilayer: towards a new DNA biosensor technology.

    PubMed

    Werz, Emma; Korneev, Sergei; Montilla-Martinez, Malayko; Wagner, Richard; Hemmler, Roland; Walter, Claudius; Eisfeld, Jörg; Gall, Karsten; Rosemeyer, Helmut

    2012-02-01

    A novel technique is described which comprises a base-specific DNA duplex formation at a lipid bilayer-H(2) O-phase boundary layer. Two different probes of oligonucleotides both carrying a double-tailed lipid at the 5'-terminus were incorporated into stable artificial lipid bilayers separating two compartments (cis/trans-channel) of an optically transparent microfluidic sample carrier with perfusion capabilities. Both the cis- and trans-channels are filled with saline buffer. Injection of a cyanine-5-labeled target DNA sequence, which is complementary to only one of the oligonucleotide probes, into the cis-channel, followed by a thorough perfusion, leads to an immobilization of the labeled complementary oligonucleotide on the membrane as detected by single-molecule fluorescence spectroscopy and microscopy. In the case of fluorescent but non-complementary DNA sequences, no immobilized fluorescent oligonucleotide duplex could be detected on the membrane. This clearly verifies a specific duplex formation at the membrane interface. Copyright © 2012 Verlag Helvetica Chimica Acta AG, Zürich.

  19. Cryptic splice site in the complementary DNA of glucocerebrosidase causes inefficient expression.

    PubMed

    Bukovac, Scott W; Bagshaw, Richard D; Rigat, Brigitte A; Callahan, John W; Clarke, Joe T R; Mahuran, Don J

    2008-10-15

    The low levels of human lysosomal glucocerebrosidase activity expressed in transiently transfected Chinese hamster ovary (CHO) cells were investigated. Reverse transcription PCR (RT-PCR) demonstrated that a significant portion of the transcribed RNA was misspliced owing to the presence of a cryptic splice site in the complementary DNA (cDNA). Missplicing results in the deletion of 179 bp of coding sequence and a premature stop codon. A repaired cDNA was constructed abolishing the splice site without changing the amino acid sequence. The level of glucocerebrosidase expression was increased sixfold. These data demonstrate that for maximum expression of any cDNA construct, the transcription products should be examined.

  20. A Highly Sensitive Oligonucleotide Hybridization Assay for Klebsiella pneumoniae Carbapenemase with the Probes on a Gold Nanoparticles Modified Glassy Carbon Electrode.

    PubMed

    Pan, Hong-zhi; Yu, Hong- Wei; Wang, Na; Zhang, Ze; Wan, Guang-Cai; Liu, Hao; Guan, Xue; Chang, Dong

    2015-01-01

    To develop a new electrochemical DNA biosensor for determination of Klebsiella pneumoniae carbapenemase, a highly sensitive and selective electrochemical biosensor for DNA detection was constructed based on a glassy carbon electrode (GCE) modified with gold nanoparticles (Au-nano). The Au-nano/GCE was characterized by scanning electromicroscopy, cyclic voltammetry, and electrochemical impedance spectroscopy. The hybridization detection was measured by differential pulse voltammetry using methylene blue as the hybridization indicator. The dynamic range of detection of the sensor for the target DNA sequences was from 1 × 10(-11) to 1 × 10(-8) M, with an LOD of 1 × 10(-12) M. The DNA biosensor had excellent specificity for distinguishing complementary DNA sequence in the presence of non-complementary and mismatched DNA sequence. The Au-nano/GCE showed significant improvement in electrochemical characteristics, and this biosensor was successfully applied for determination of K. pneumoniae.

  1. Increasing Success Rates in Developmental Math: The Complementary Role of Individual and Institutional Characteristics

    ERIC Educational Resources Information Center

    Fong, Kristen E.; Melguizo, Tatiana; Prather, George

    2015-01-01

    This study tracks students' progression through developmental math sequences and defines progression as both attempting and passing each level of the sequence. A model of successful progression in developmental education was built utilizing individual-, institutional-, and developmental math-level factors. Employing step-wise logistic regression…

  2. Comparison of impedimetric detection of DNA hybridization on the various biosensors based on modified glassy carbon electrodes with PANHS and nanomaterials of RGO and MWCNTs.

    PubMed

    Benvidi, Ali; Tezerjani, Marzieh Dehghan; Jahanbani, Shahriar; Mazloum Ardakani, Mohammad; Moshtaghioun, Seyed Mohammad

    2016-01-15

    In this research, we have developed lable free DNA biosensors based on modified glassy carbon electrodes (GCE) with reduced graphene oxide (RGO) and carbon nanotubes (MWCNTs) for detection of DNA sequences. This paper compares the detection of BRCA1 5382insC mutation using independent glassy carbon electrodes (GCE) modified with RGO and MWCNTs. A probe (BRCA1 5382insC mutation detection (ssDNA)) was then immobilized on the modified electrodes for a specific time. The immobilization of the probe and its hybridization with the target DNA (Complementary DNA) were performed under optimum conditions using different electrochemical techniques such as cyclic voltammetry (CV) and electrochemical impedance spectroscopy (EIS). The proposed biosensors were used for determination of complementary DNA sequences. The non-modified DNA biosensor (1-pyrenebutyric acid-N- hydroxysuccinimide ester (PANHS)/GCE), revealed a linear relationship between ∆Rct and logarithm of the complementary target DNA concentration ranging from 1.0×10(-16)molL(-1) to 1.0×10(-10)mol L(-1) with a correlation coefficient of 0.992, for DNA biosensors modified with multi-wall carbon nanotubes (MWCNTs) and reduced graphene oxide (RGO) wider linear range and lower detection limit were obtained. For ssDNA/PANHS/MWCNTs/GCE a linear range 1.0×10(-17)mol L(-1)-1.0×10(-10)mol L(-1) with a correlation coefficient of 0.993 and for ssDNA/PANHS/RGO/GCE a linear range from 1.0×10(-18)mol L(-1) to 1.0×10(-10)mol L(-1) with a correlation coefficient of 0.985 were obtained. In addition, the mentioned biosensors were satisfactorily applied for discriminating of complementary sequences from noncomplementary sequences, so the mentioned biosensors can be used for the detection of BRCA1-associated breast cancer. Copyright © 2015. Published by Elsevier B.V.

  3. Direct Nanoscale Conversion of Biomolecular Signals into Electronic Information

    DTIC Science & Technology

    2008-09-22

    the electrode surface. In this experiment, the single free cysteine group featured in the GOx structure was exploited to demonstrate that orientation...first with GOx-ssDNA conjugates featuring a sequence complementary to the address strand, then with a non-complementary conjugate and finally with...fully-functional for an enzyme that features a free thiol group, or that can be engineered to incorporate a thiol onto its outer shell

  4. A Dual Interaction Between the 5'- and 3'-Ends of the Melon Necrotic Spot Virus (MNSV) RNA Genome Is Required for Efficient Cap-Independent Translation.

    PubMed

    Miras, Manuel; Rodríguez-Hernández, Ana M; Romero-López, Cristina; Berzal-Herranz, Alfredo; Colchero, Jaime; Aranda, Miguel A; Truniger, Verónica

    2018-01-01

    In eukaryotes, the formation of a 5'-cap and 3'-poly(A) dependent protein-protein bridge is required for translation of its mRNAs. In contrast, several plant virus RNA genomes lack both of these mRNA features, but instead have a 3'-CITE (for cap-independent translation enhancer), a RNA element present in their 3'-untranslated region that recruits translation initiation factors and is able to control its cap-independent translation. For several 3'-CITEs, direct RNA-RNA long-distance interactions based on sequence complementarity between the 5'- and 3'-ends are required for efficient translation, as they bring the translation initiation factors bound to the 3'-CITE to the 5'-end. For the carmovirus melon necrotic spot virus (MNSV), a 3'-CITE has been identified, and the presence of its 5'-end in cis has been shown to be required for its activity. Here, we analyze the secondary structure of the 5'-end of the MNSV RNA genome and identify two highly conserved nucleotide sequence stretches that are complementary to the apical loop of its 3'-CITE. In in vivo cap-independent translation assays with mutant constructs, by disrupting and restoring sequence complementarity, we show that the interaction between the 3'-CITE and at least one complementary sequence in the 5'-end is essential for virus RNA translation, although efficient virus translation and multiplication requires both connections. The complementary sequence stretches are invariant in all MNSV isolates, suggesting that the dual 5'-3' RNA:RNA interactions are required for optimal MNSV cap-independent translation and multiplication.

  5. Colorimetric molecular diagnosis of the HIV gag gene using DNAzyme and a complementary DNA-extended primer.

    PubMed

    Kim, Seong U; Batule, Bhagwan S; Mun, Hyoyoung; Byun, Ju-Young; Shim, Won-Bo; Kim, Min-Gon

    2018-02-07

    We have developed a novel strategy for the colorimetric detection of PCR products by utilizing a target-specific primer modified at the 5'-end with an anti-DNAzyme sequence. A single-stranded DNAzyme sequence folds into a G-quadruplex structure with hemin and shows strong peroxidase activity. When the complementary strand binds to the DNAzyme sequence, it blocks the formation of the G-quadraduplex structure and loses its peroxidase activity. In the presence of the target gene, PCR amplification proceeds, and anti-DNAzyme sequence modified primers present in the reaction mixture form a double strand through primer extension. Therefore, it does not block the DNAzyme sequence. Further, a colorimetric signal is generated by the addition of 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulfonate) (ABTS) and H 2 O 2 at the end of the reaction. We have successfully detected a single copy of the HIV type 1 gag gene in buffer and 10 copies in human serum. The strategy developed could be used to detect DNA and RNA in complex biological samples by simple primer designing that includes DNAzyme and a DNA extended primer.

  6. A systematic review of evidence for the effectiveness of practitioner-based complementary and alternative therapies in the management of rheumatic diseases: osteoarthritis.

    PubMed

    Macfarlane, Gary J; Paudyal, Priya; Doherty, Michael; Ernst, Edzard; Lewith, George; MacPherson, Hugh; Sim, Julius; Jones, Gareth T

    2012-12-01

    To critically review the evidence on the efficacy and effectiveness of practitioner-based complementary therapies for patients with osteoarthritis. We excluded t'ai chi and acupuncture, which have been the subject of recent reviews. Randomized controlled trials, published in English up to May 2011, were identified using systematic searches of bibliographic databases and searching of reference lists. Information was extracted on outcomes, statistical significance in comparison with alternative treatments and reported side effects. The methodological quality of the identified studies was determined using the Jadad scoring system. Outcomes considered were pain and patient global assessment. In all, 16 eligible trials were identified covering 12 therapies. Overall, there was no good evidence of the effectiveness of any of the therapies in relation to pain or global health improvement/quality of life because most therapies only had a single randomized controlled trial. Where positive results were reported, they were often comparing an active intervention with no intervention. Therapies with multiple trials either provided null (biofeedback) or inconsistent results (magnet therapy), or the trials available scored poorly for quality (chiropractic). There were few adverse events reported in the trials. There is not sufficient evidence to recommend any of the practitioner-based complementary therapies considered here for the management of OA, but neither is there sufficient evidence to conclude that they are not effective or efficacious.

  7. DNA–DNA kissing complexes as a new tool for the assembly of DNA nanostructures

    PubMed Central

    Barth, Anna; Kobbe, Daniela; Focke, Manfred

    2016-01-01

    Kissing-loop annealing of nucleic acids occurs in nature in several viruses and in prokaryotic replication, among other circumstances. Nucleobases of two nucleic acid strands (loops) interact with each other, although the two strands cannot wrap around each other completely because of the adjacent double-stranded regions (stems). In this study, we exploited DNA kissing-loop interaction for nanotechnological application. We functionalized the vertices of DNA tetrahedrons with DNA stem-loop sequences. The complementary loop sequence design allowed the hybridization of different tetrahedrons via kissing-loop interaction, which might be further exploited for nanotechnology applications like cargo transport and logical elements. Importantly, we were able to manipulate the stability of those kissing-loop complexes based on the choice and concentration of cations, the temperature and the number of complementary loops per tetrahedron either at the same or at different vertices. Moreover, variations in loop sequences allowed the characterization of necessary sequences within the loop as well as additional stability control of the kissing complexes. Therefore, the properties of the presented nanostructures make them an important tool for DNA nanotechnology. PMID:26773051

  8. Different strategies for the detection of bioagents using electrochemical and photoelectrochemical genosensors

    NASA Astrophysics Data System (ADS)

    Voccia, Diego; Bettazi, Francesca; Palchetti, Ilaria

    2015-10-01

    In recent years various kinds of biosensors for the detection of pathogens have been developed. A genosensor consists in the immobilization, onto the surface of a chosen transducer, of an oligonucleotide with a specific base sequence called capture probe. The complementary sequence (the analytical target, i.e. a specific sequence of the DNA/RNA of the pathogen) present in the sample is recognized and captured by the probe through the hybridization reaction. The evaluation of the extent of the hybridization allows one to confirm whether the sample contains the complementary sequence of the probe or not. Electrochemical transducers have received considerable attention in connection with the detection of DNA hybridization. Moreover, recently, with the emergence of novel photoelectrochemically active species and new detection schemes, photoelectrochemistry has resulted in substantial progress in its analytical performance for biosensing applications. In this paper, some examples of electrochemical genosensors for multiplexed pathogen detection are shown. Moreover, the preliminary experiments towards the development of a photoelectrochemical genosensor using a TiO2 - nanocrystal-modified ITO electrode are discussed.

  9. Two RNAs or DNAs May Artificially Fuse Together at a Short Homologous Sequence (SHS) during Reverse Transcription or Polymerase Chain Reactions, and Thus Reporting an SHS-Containing Chimeric RNA Requires Extra Caution

    PubMed Central

    Xie, Bingkun; Yang, Wei; Ouyang, Yongchang; Chen, Lichan; Jiang, Hesheng; Liao, Yuying; Liao, D. Joshua

    2016-01-01

    Tens of thousands of chimeric RNAs have been reported. Most of them contain a short homologous sequence (SHS) at the joining site of the two partner genes but are not associated with a fusion gene. We hypothesize that many of these chimeras may be technical artifacts derived from SHS-caused mis-priming in reverse transcription (RT) or polymerase chain reactions (PCR). We cloned six chimeric complementary DNAs (cDNAs) formed by human mitochondrial (mt) 16S rRNA sequences at an SHS, which were similar to several expression sequence tags (ESTs).These chimeras, which could not be detected with cDNA protection assay, were likely formed because some regions of the 16S rRNA are reversely complementary to another region to form an SHS, which allows the downstream sequence to loop back and anneal at the SHS to prime the synthesis of its complementary strand, yielding a palindromic sequence that can form a hairpin-like structure.We identified a 16S rRNA that ended at the 4th nucleotide(nt) of the mt-tRNA-leu was dominant and thus should be the wild type. We also cloned a mouse Bcl2-Nek9 chimeric cDNA that contained a 5-nt unmatchable sequence between the two partners, contained two copies of the reverse primer in the same direction but did not contain the forward primer, making it unclear how this Bcl2-Nek9 was formed and amplified. Moreover, a cDNA was amplified because one primer has 4 nts matched to the template, suggesting that there may be many more artificial cDNAs than we have realized, because the nuclear and mt genomes have many more 4-nt than 5-nt or longer homologues. Altogether, the chimeric cDNAs we cloned are good examples suggesting that many cDNAs may be artifacts due to SHS-caused mis-priming and thus greater caution should be taken when new sequence is obtained from a technique involving DNA polymerization. PMID:27148738

  10. Species delimitation in the Central African herbs Haumania (Marantaceae) using georeferenced nuclear and chloroplastic DNA sequences.

    PubMed

    Ley, A C; Hardy, O J

    2010-11-01

    Species delimitation is a fundamental biological concept which is frequently discussed and altered to integrate new insights. These revealed that speciation is not a one step phenomenon but an ongoing process and morphological characters alone are not sufficient anymore to properly describe the results of this process. Here we want to assess the degree of speciation in two closely related lianescent taxa from the tropical African genus Haumania which display distinct vegetative traits despite a high similarity in reproductive traits and a partial overlap in distribution area which might facilitate gene flow. To this end, we combined phylogenetic and phylogeographic analyses using nuclear (nr) and chloroplast (cp) DNA sequences in comparison to morphological species descriptions. The nuclear dataset unambiguously supports the morphological species concept in Haumania. However, the main chloroplastic haplotypes are shared between species and, although a geographic analysis of cpDNA diversity confirms that individuals from the same taxon are more related than individuals from distinct taxa, cp-haplotypes display correlated geographic distributions between species. Hybridization is the most plausible reason for this pattern. A scenario involving speciation in geographic isolation followed by range expansion is outlined. The study highlights the gain of information on the speciation process in Haumania by adding georeferenced molecular data to the morphological characteristics. It also shows that nr and cp sequence data might provide different but complementary information, questioning the reliability of the unique use of chloroplast data for species recognition by DNA barcoding. Copyright © 2010 Elsevier Inc. All rights reserved.

  11. Packaging of Mason-Pfizer monkey virus (MPMV) genomic RNA depends upon conserved long-range interactions (LRIs) between U5 and gag sequences

    PubMed Central

    Kalloush, Rawan M.; Vivet-Boudou, Valérie; Ali, Lizna M.; Mustafa, Farah; Marquet, Roland; Rizvi, Tahir A.

    2016-01-01

    MPMV has great potential for development as a vector for gene therapy. In this respect, precisely defining the sequences and structural motifs that are important for dimerization and packaging of its genomic RNA (gRNA) are of utmost importance. A distinguishing feature of the MPMV gRNA packaging signal is two phylogenetically conserved long-range interactions (LRIs) between U5 and gag complementary sequences, LRI-I and LRI-II. To test their biological significance in the MPMV life cycle, we introduced mutations into these structural motifs and tested their effects on MPMV gRNA packaging and propagation. Furthermore, we probed the structure of key mutants using SHAPE (selective 2′hydroxyl acylation analyzed by primer extension). Disrupting base-pairing of the LRIs affected gRNA packaging and propagation, demonstrating their significance to the MPMV life cycle. A double mutant restoring a heterologous LRI-I was fully functional, whereas a similar LRI-II mutant failed to restore gRNA packaging and propagation. These results demonstrate that while LRI-I acts at the structural level, maintaining base-pairing is not sufficient for LRI-II function. In addition, in vitro RNA dimerization assays indicated that the loss of RNA packaging in LRI mutants could not be attributed to the defects in dimerization. Our findings suggest that U5-gag LRIs play an important architectural role in maintaining the structure of the 5′ region of the MPMV gRNA, expanding the crucial role of LRIs to the nonlentiviral group of retroviruses. PMID:27095024

  12. Method for identifying and quantifying nucleic acid sequence aberrations

    DOEpatents

    Lucas, Joe N.; Straume, Tore; Bogen, Kenneth T.

    1998-01-01

    A method for detecting nucleic acid sequence aberrations by detecting nucleic acid sequences having both a first and a second nucleic acid sequence type, the presence of the first and second sequence type on the same nucleic acid sequence indicating the presence of a nucleic acid sequence aberration. The method uses a first hybridization probe which includes a nucleic acid sequence that is complementary to a first sequence type and a first complexing agent capable of attaching to a second complexing agent and a second hybridization probe which includes a nucleic acid sequence that selectively hybridizes to the second nucleic acid sequence type over the first sequence type and includes a detectable marker for detecting the second hybridization probe.

  13. Method for identifying and quantifying nucleic acid sequence aberrations

    DOEpatents

    Lucas, J.N.; Straume, T.; Bogen, K.T.

    1998-07-21

    A method is disclosed for detecting nucleic acid sequence aberrations by detecting nucleic acid sequences having both a first and a second nucleic acid sequence type, the presence of the first and second sequence type on the same nucleic acid sequence indicating the presence of a nucleic acid sequence aberration. The method uses a first hybridization probe which includes a nucleic acid sequence that is complementary to a first sequence type and a first complexing agent capable of attaching to a second complexing agent and a second hybridization probe which includes a nucleic acid sequence that selectively hybridizes to the second nucleic acid sequence type over the first sequence type and includes a detectable marker for detecting the second hybridization probe. 11 figs.

  14. Generation of sequence signatures from DNA amplification fingerprints with mini-hairpin and microsatellite primers.

    PubMed

    Caetano-Anollés, G; Gresshoff, P M

    1996-06-01

    DNA amplification fingerprinting (DAF) with mini-hairpins harboring arbitrary "core" sequences at their 3' termini were used to fingerprint a variety of templates, including PCR products and whole genomes, to establish genetic relationships between plant tax at the interspecific and intraspecific level, and to identify closely related fungal isolates and plant accessions. No correlation was observed between the sequence of the arbitrary core, the stability of the mini-hairpin structure and DAF efficiency. Mini-hairpin primers with short arbitrary cores and primers complementary to simple sequence repeats present in microsatellites were also used to generate arbitrary signatures from amplification profiles (ASAP). The ASAP strategy is a dual-step amplification procedure that uses at least one primer in each fingerprinting stage. ASAP was able to reproducibly amplify DAF products (representing about 10-15 kb of sequence) following careful optimization of amplification parameters such as primer and template concentration. Avoidance of primer sequences partially complementary to DAF product termini was necessary in order to produce distinct fingerprints. This allowed the combinatorial use of oligomers in nucleic acid screening, with numerous ASAP fingerprinting reactions based on a limited number of primer sequences. Mini-hairpin primers and ASAP analysis significantly increased detection of polymorphic DNA, separating closely related bermudagrass (Cynodon) cultivars and detecting putatively linked markers in bulked segregant analysis of the soybean (Glycine max) supernodulation (nitrate-tolerant symbiosis) locus.

  15. Timing of introduction of complementary food: short- and long-term health consequences.

    PubMed

    Przyrembel, Hildegard

    2012-01-01

    Complementary food is needed when breast milk (or infant formula) alone is no longer sufficient for both nutritional and developmental reasons. The timing of its introduction, therefore, is an individual decision, although 6 months of exclusive breastfeeding can be recommended for most healthy term infants. The new foods are intended to 'complement' ongoing breastfeeding with those dietary items whose intake has become marginal or insufficient. Both breastfeeding and complementary feeding can have direct or later consequences on health. The evaluation of consequences of both early and late introduction of complementary food can neither disregard the effect of breastfeeding compared to formula feeding nor the composition or quality of the complementary food. Possible short-term health effects concern growth velocity and infections, and possible long-term effects may relate to atopic diseases, type 1 and 2 diabetes, obesity and neuromuscular development. On the basis of the currently available evidence, it is impossible to exactly determine the age when risks related to the start of complementary feeding are lowest or highest for most of these effects, with the possible exception of infections and early growth velocity. The present knowledge on undesirable health effects, however, is mainly based on observational studies, and although some mechanisms have been proposed, further prospective studies have to clarify these unsolved issues. Even less evidence on the consequences of the timing of complementary food introduction is available for formula-fed infants. Copyright © 2012 S. Karger AG, Basel.

  16. The Performance of a PN Spread Spectrum Receiver Preceded by an Adaptive Interference Suppression Filter.

    DTIC Science & Technology

    1982-12-01

    Sequence dj Estimate of the Desired Signal DEL Sampling Time Interval DS Direct Sequence c Sufficient Statistic E/T Signal Power Erfc Complimentary Error...Namely, a white Gaussian noise (WGN) generator was added. Also, a statistical subroutine was added in order to assess performance improvement at the...reference code and then passed through a correlation detector whose output is the sufficient 1 statistic , e . Using a threshold device and the sufficient

  17. The Murine Norovirus Core Subgenomic RNA Promoter Consists of a Stable Stem-Loop That Can Direct Accurate Initiation of RNA Synthesis

    PubMed Central

    Yunus, Muhammad Amir; Lin, Xiaoyan; Bailey, Dalan; Karakasiliotis, Ioannis; Chaudhry, Yasmin; Vashist, Surender; Zhang, Guo; Thorne, Lucy; Kao, C. Cheng

    2014-01-01

    ABSTRACT All members of the Caliciviridae family of viruses produce a subgenomic RNA during infection. The subgenomic RNA typically encodes only the major and minor capsid proteins, but in murine norovirus (MNV), the subgenomic RNA also encodes the VF1 protein, which functions to suppress host innate immune responses. To date, the mechanism of norovirus subgenomic RNA synthesis has not been characterized. We have previously described the presence of an evolutionarily conserved RNA stem-loop structure on the negative-sense RNA, the complementary sequence of which codes for the viral RNA-dependent RNA polymerase (NS7). The conserved stem-loop is positioned 6 nucleotides 3′ of the start site of the subgenomic RNA in all caliciviruses. We demonstrate that the conserved stem-loop is essential for MNV viability. Mutant MNV RNAs with substitutions in the stem-loop replicated poorly until they accumulated mutations that revert to restore the stem-loop sequence and/or structure. The stem-loop sequence functions in a noncoding context, as it was possible to restore the replication of an MNV mutant by introducing an additional copy of the stem-loop between the NS7- and VP1-coding regions. Finally, in vitro biochemical data suggest that the stem-loop sequence is sufficient for the initiation of viral RNA synthesis by the recombinant MNV RNA-dependent RNA polymerase, confirming that the stem-loop forms the core of the norovirus subgenomic promoter. IMPORTANCE Noroviruses are a significant cause of viral gastroenteritis, and it is important to understand the mechanism of norovirus RNA synthesis. Here we describe the identification of an RNA stem-loop structure that functions as the core of the norovirus subgenomic RNA promoter in cells and in vitro. This work provides new insights into the molecular mechanisms of norovirus RNA synthesis and the sequences that determine the recognition of viral RNA by the RNA-dependent RNA polymerase. PMID:25392209

  18. MiFish, a set of universal PCR primers for metabarcoding environmental DNA from fishes: detection of more than 230 subtropical marine species

    PubMed Central

    Miya, M.; Sato, Y.; Fukunaga, T.; Sado, T.; Poulsen, J. Y.; Sato, K.; Minamoto, T.; Yamamoto, S.; Yamanaka, H.; Araki, H.; Kondoh, M.; Iwasaki, W.

    2015-01-01

    We developed a set of universal PCR primers (MiFish-U/E) for metabarcoding environmental DNA (eDNA) from fishes. Primers were designed using aligned whole mitochondrial genome (mitogenome) sequences from 880 species, supplemented by partial mitogenome sequences from 160 elasmobranchs (sharks and rays). The primers target a hypervariable region of the 12S rRNA gene (163–185 bp), which contains sufficient information to identify fishes to taxonomic family, genus and species except for some closely related congeners. To test versatility of the primers across a diverse range of fishes, we sampled eDNA from four tanks in the Okinawa Churaumi Aquarium with known species compositions, prepared dual-indexed libraries and performed paired-end sequencing of the region using high-throughput next-generation sequencing technologies. Out of the 180 marine fish species contained in the four tanks with reference sequences in a custom database, we detected 168 species (93.3%) distributed across 59 families and 123 genera. These fishes are not only taxonomically diverse, ranging from sharks and rays to higher teleosts, but are also greatly varied in their ecology, including both pelagic and benthic species living in shallow coastal to deep waters. We also sampled natural seawaters around coral reefs near the aquarium and detected 93 fish species using this approach. Of the 93 species, 64 were not detected in the four aquarium tanks, rendering the total number of species detected to 232 (from 70 families and 152 genera). The metabarcoding approach presented here is non-invasive, more efficient, more cost-effective and more sensitive than the traditional survey methods. It has the potential to serve as an alternative (or complementary) tool for biodiversity monitoring that revolutionizes natural resource management and ecological studies of fish communities on larger spatial and temporal scales. PMID:26587265

  19. The murine norovirus core subgenomic RNA promoter consists of a stable stem-loop that can direct accurate initiation of RNA synthesis.

    PubMed

    Yunus, Muhammad Amir; Lin, Xiaoyan; Bailey, Dalan; Karakasiliotis, Ioannis; Chaudhry, Yasmin; Vashist, Surender; Zhang, Guo; Thorne, Lucy; Kao, C Cheng; Goodfellow, Ian

    2015-01-15

    All members of the Caliciviridae family of viruses produce a subgenomic RNA during infection. The subgenomic RNA typically encodes only the major and minor capsid proteins, but in murine norovirus (MNV), the subgenomic RNA also encodes the VF1 protein, which functions to suppress host innate immune responses. To date, the mechanism of norovirus subgenomic RNA synthesis has not been characterized. We have previously described the presence of an evolutionarily conserved RNA stem-loop structure on the negative-sense RNA, the complementary sequence of which codes for the viral RNA-dependent RNA polymerase (NS7). The conserved stem-loop is positioned 6 nucleotides 3' of the start site of the subgenomic RNA in all caliciviruses. We demonstrate that the conserved stem-loop is essential for MNV viability. Mutant MNV RNAs with substitutions in the stem-loop replicated poorly until they accumulated mutations that revert to restore the stem-loop sequence and/or structure. The stem-loop sequence functions in a noncoding context, as it was possible to restore the replication of an MNV mutant by introducing an additional copy of the stem-loop between the NS7- and VP1-coding regions. Finally, in vitro biochemical data suggest that the stem-loop sequence is sufficient for the initiation of viral RNA synthesis by the recombinant MNV RNA-dependent RNA polymerase, confirming that the stem-loop forms the core of the norovirus subgenomic promoter. Noroviruses are a significant cause of viral gastroenteritis, and it is important to understand the mechanism of norovirus RNA synthesis. Here we describe the identification of an RNA stem-loop structure that functions as the core of the norovirus subgenomic RNA promoter in cells and in vitro. This work provides new insights into the molecular mechanisms of norovirus RNA synthesis and the sequences that determine the recognition of viral RNA by the RNA-dependent RNA polymerase. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  20. MiFish, a set of universal PCR primers for metabarcoding environmental DNA from fishes: detection of more than 230 subtropical marine species.

    PubMed

    Miya, M; Sato, Y; Fukunaga, T; Sado, T; Poulsen, J Y; Sato, K; Minamoto, T; Yamamoto, S; Yamanaka, H; Araki, H; Kondoh, M; Iwasaki, W

    2015-07-01

    We developed a set of universal PCR primers (MiFish-U/E) for metabarcoding environmental DNA (eDNA) from fishes. Primers were designed using aligned whole mitochondrial genome (mitogenome) sequences from 880 species, supplemented by partial mitogenome sequences from 160 elasmobranchs (sharks and rays). The primers target a hypervariable region of the 12S rRNA gene (163-185 bp), which contains sufficient information to identify fishes to taxonomic family, genus and species except for some closely related congeners. To test versatility of the primers across a diverse range of fishes, we sampled eDNA from four tanks in the Okinawa Churaumi Aquarium with known species compositions, prepared dual-indexed libraries and performed paired-end sequencing of the region using high-throughput next-generation sequencing technologies. Out of the 180 marine fish species contained in the four tanks with reference sequences in a custom database, we detected 168 species (93.3%) distributed across 59 families and 123 genera. These fishes are not only taxonomically diverse, ranging from sharks and rays to higher teleosts, but are also greatly varied in their ecology, including both pelagic and benthic species living in shallow coastal to deep waters. We also sampled natural seawaters around coral reefs near the aquarium and detected 93 fish species using this approach. Of the 93 species, 64 were not detected in the four aquarium tanks, rendering the total number of species detected to 232 (from 70 families and 152 genera). The metabarcoding approach presented here is non-invasive, more efficient, more cost-effective and more sensitive than the traditional survey methods. It has the potential to serve as an alternative (or complementary) tool for biodiversity monitoring that revolutionizes natural resource management and ecological studies of fish communities on larger spatial and temporal scales.

  1. Biorecognition by DNA oligonucleotides after Exposure to Photoresists and Resist Removers

    PubMed Central

    Dean, Stacey L.; Morrow, Thomas J.; Patrick, Sue; Li, Mingwei; Clawson, Gary; Mayer, Theresa S.; Keating, Christine D.

    2013-01-01

    Combining biological molecules with integrated circuit technology is of considerable interest for next generation sensors and biomedical devices. Current lithographic microfabrication methods, however, were developed for compatibility with silicon technology rather than bioorganic molecules and consequently it cannot be assumed that biomolecules will remain attached and intact during on-chip processing. Here, we evaluate the effects of three common photoresists (Microposit S1800 series, PMGI SF6, and Megaposit SPR 3012) and two photoresist removers (acetone and 1165 remover) on the ability of surface-immobilized DNA oligonucleotides to selectively recognize their reverse-complementary sequence. Two common DNA immobilization methods were compared: adsorption of 5′-thiolated sequences directly to gold nanowires and covalent attachment of 5′-thiolated sequences to surface amines on silica coated nanowires. We found that acetone had deleterious effects on selective hybridization as compared to 1165 remover, presumably due to incomplete resist removal. Use of the PMGI photoresist, which involves a high temperature bake step, was detrimental to the later performance of nanowire-bound DNA in hybridization assays, especially for DNA attached via thiol adsorption. The other three photoresists did not substantially degrade DNA binding capacity or selectivity for complementary DNA sequences. To determine if the lithographic steps caused more subtle damage, we also tested oligonucleotides containing a single base mismatch. Finally, a two-step photolithographic process was developed and used in combination with dielectrophoretic nanowire assembly to produce an array of doubly-contacted, electrically isolated individual nanowire components on a chip. Post-fabrication fluorescence imaging indicated that nanowire-bound DNA was present and able to selectively bind complementary strands. PMID:23952639

  2. The timing of introduction of complementary foods and later health.

    PubMed

    Agostoni, Carlo; Przyrembel, Hildegard

    2013-01-01

    Complementary food is needed when human milk (or infant formula) alone is no longer sufficient for nutritional reasons. The timing of introduction needs to be determined on an individual basis although 6 months of exclusive breastfeeding can be recommended for most healthy term infants. Solid foods are intended to 'complement' ongoing breastfeeding with those dietary items whose intake has become marginal or insufficient. Both breastfeeding and complementary feeding can have direct or later consequences on health. Possible short-term health effects concern growth velocity and infections while possible long-term effects may relate to obesity, cardiovascular disease, autoimmunity (celiac disease and type 1 diabetes) and atopic disorders. For most of these it is impossible on the basis of the available evidence to conclude on the age when risks related to the start of complementary feeding are lowest or highest, with the possible exception of infections and early growth velocity. For undesirable health consequences, whilst potential mechanisms are recognized, the evidence from mostly observational studies is insufficient and requires more and prospective research. While the 6-month goal is desirable, introduction of suitable complementary food after 4 completed months with ongoing breastfeeding can be considered without adverse health consequences for infants living in affluent countries. Even less evidence on the consequences of the timing of complementary food introduction is available for formula-fed infants. Copyright © 2013 S. Karger AG, Basel.

  3. Construction Strategy for an Internal Amplification Control for Real-Time Diagnostic Assays Using Nucleic Acid Sequence-Based Amplification: Development and Clinical Application

    PubMed Central

    Rodríguez-Lázaro, David; D'Agostino, Martin; Pla, Maria; Cook, Nigel

    2004-01-01

    An important analytical control in molecular amplification-based methods is an internal amplification control (IAC), which should be included in each reaction mixture. An IAC is a nontarget nucleic acid sequence which is coamplified simultaneously with the target sequence. With negative results for the target nucleic acid, the absence of an IAC signal indicates that amplification has failed. A general strategy for the construction of an IAC for inclusion in molecular beacon-based real-time nucleic acid sequence-based amplification (NASBA) assays is presented. Construction proceeds in two phases. In the first phase, a double-stranded DNA molecule that contains nontarget sequences flanked by target sequences complementary to the NASBA primers is produced. At the 5′ end of this DNA molecule is a T7 RNA polymerase binding sequence. In the second phase of construction, RNA transcripts are produced from the DNA by T7 RNA polymerase. This RNA is the IAC; it is amplified by the target NASBA primers and is detected by a molecular beacon probe complementary to the internal nontarget sequences. As a practical example, an IAC for use in an assay for the detection of Mycobacterium avium subsp. paratuberculosis is described, its incorporation and optimization within the assay are detailed, and its application to spiked and natural clinical samples is shown to illustrate the correct interpretation of the diagnostic results. PMID:15583319

  4. Unconventional therapies in asthma: an overview.

    PubMed

    Lewith, G T; Watkins, A D

    1996-11-01

    Acupuncture, homoeopathy, mind-body therapies, and nutritional, herbal, and environmental medicine have all been used in the management of patients with asthma. This paper reviews the evidence base for the use of these unconventional or complementary therapies. Although there is a paucity of large randomized, controlled trials in this area, there is sufficient evidence to suggest that many of these therapies can produce objective and subjective benefit in selected groups of patients. In view of the increasing popularity of complementary medicine among patients and general practitioners, there is now an urgent need for high-quality research to determine how, or whether, these therapies may be interwoven with the more orthodox treatments currently available.

  5. Analysis and model on space-time characteristics of wind power output based on the measured wind speed data

    NASA Astrophysics Data System (ADS)

    Shi, Wenhui; Feng, Changyou; Qu, Jixian; Zha, Hao; Ke, Dan

    2018-02-01

    Most of the existing studies on wind power output focus on the fluctuation of wind farms and the spatial self-complementary of wind power output time series was ignored. Therefore the existing probability models can’t reflect the features of power system incorporating wind farms. This paper analyzed the spatial self-complementary of wind power and proposed a probability model which can reflect temporal characteristics of wind power on seasonal and diurnal timescales based on sufficient measured data and improved clustering method. This model could provide important reference for power system simulation incorporating wind farms.

  6. Why Current Statistics of Complementary Alternative Medicine Clinical Trials is Invalid.

    PubMed

    Pandolfi, Maurizio; Carreras, Giulia

    2018-06-07

    It is not sufficiently known that frequentist statistics cannot provide direct information on the probability that the research hypothesis tested is correct. The error resulting from this misunderstanding is compounded when the hypotheses under scrutiny have precarious scientific bases, which, generally, those of complementary alternative medicine (CAM) are. In such cases, it is mandatory to use inferential statistics, considering the prior probability that the hypothesis tested is true, such as the Bayesian statistics. The authors show that, under such circumstances, no real statistical significance can be achieved in CAM clinical trials. In this respect, CAM trials involving human material are also hardly defensible from an ethical viewpoint.

  7. Uprobe: a genome-wide universal probe resource for comparative physical mapping in vertebrates.

    PubMed

    Kellner, Wendy A; Sullivan, Robert T; Carlson, Brian H; Thomas, James W

    2005-01-01

    Interspecies comparisons are important for deciphering the functional content and evolution of genomes. The expansive array of >70 public vertebrate genomic bacterial artificial chromosome (BAC) libraries can provide a means of comparative mapping, sequencing, and functional analysis of targeted chromosomal segments that is independent and complementary to whole-genome sequencing. However, at the present time, no complementary resource exists for the efficient targeted physical mapping of the majority of these BAC libraries. Universal overgo-hybridization probes, designed from regions of sequenced genomes that are highly conserved between species, have been demonstrated to be an effective resource for the isolation of orthologous regions from multiple BAC libraries in parallel. Here we report the application of the universal probe design principal across entire genomes, and the subsequent creation of a complementary probe resource, Uprobe, for screening vertebrate BAC libraries. Uprobe currently consists of whole-genome sets of universal overgo-hybridization probes designed for screening mammalian or avian/reptilian libraries. Retrospective analysis, experimental validation of the probe design process on a panel of representative BAC libraries, and estimates of probe coverage across the genome indicate that the majority of all eutherian and avian/reptilian genes or regions of interest can be isolated using Uprobe. Future implementation of the universal probe design strategy will be used to create an expanded number of whole-genome probe sets that will encompass all vertebrate genomes.

  8. Electrochemical DNA biosensor for bovine papillomavirus detection using polymeric film on screen-printed electrode.

    PubMed

    Nascimento, Gustavo A; Souza, Elaine V M; Campos-Ferreira, Danielly S; Arruda, Mariana S; Castelletti, Carlos H M; Wanderley, Marcela S O; Ekert, Marek H F; Bruneska, Danyelly; Lima-Filho, José L

    2012-01-01

    A new electrochemical DNA biosensor for bovine papillomavirus (BPV) detection that was based on screen-printed electrodes was comprehensively studied by electrochemical methods of cyclic voltammetry (CV) and differential pulse voltammetry (DPV). A BPV probe was immobilised on a working electrode (gold) modified with a polymeric film of poly-L-lysine (PLL) and chitosan. The experimental design was carried out to evaluate the influence of polymers, probe concentration (BPV probe) and immobilisation time on the electrochemical reduction of methylene blue (MB). The polymer poly-L-lysine (PLL), a probe concentration of 1 μM and an immobilisation time of 60 min showed the best result for the BPV probe immobilisation. With the hybridisation of a complementary target sequence (BPV target), the electrochemical signal decreased compared to a BPV probe immobilised on the modified PLL-gold electrode. Viral DNA that was extracted from cattle with papillomatosis also showed a decrease in the MB electrochemical reduction, which suggested that the decreased electrochemical signal corresponded to a bovine papillomavirus infection. The hybridisation specificity experiments further indicated that the biosensor could discriminate the complementary sequence from the non-complementary sequence. Thus, the results showed that the development of analytical devices, such as a biosensor, could assist in the rapid and efficient detection of bovine papillomavirus DNA and help in the prevention and treatment of papillomatosis in cattle. Copyright © 2012 Elsevier B.V. All rights reserved.

  9. Teaching Note--Integrating Theory and Research Methods in a First-Year Doctoral Sequence or Program

    ERIC Educational Resources Information Center

    Pollio, David E.; MacNeil, Gordon; Womack, Bethany; Brazeal, Michelle; Church, Wesley T., II

    2016-01-01

    This teaching note describes an innovative process in which faculty members worked collaboratively to create an integrated three-course sequence of requisite course content in a PhD program, developed complementary assignments, and coordinated a classroom experience that led to the creation of an individualized area statement and eventual…

  10. Methods for chromosome-specific staining

    DOEpatents

    Gray, Joe W.; Pinkel, Daniel

    1995-01-01

    Methods and compositions for chromosome-specific staining are provided. Compositions comprise heterogenous mixtures of labeled nucleic acid fragments having substantially complementary base sequences to unique sequence regions of the chromosomal DNA for which their associated staining reagent is specific. Methods include methods for making the chromosome-specific staining compositions of the invention, and methods for applying the staining compositions to chromosomes.

  11. Impact of sequencing depth in ChIP-seq experiments

    PubMed Central

    Jung, Youngsook L.; Luquette, Lovelace J.; Ho, Joshua W.K.; Ferrari, Francesco; Tolstorukov, Michael; Minoda, Aki; Issner, Robbyn; Epstein, Charles B.; Karpen, Gary H.; Kuroda, Mitzi I.; Park, Peter J.

    2014-01-01

    In a chromatin immunoprecipitation followed by high-throughput sequencing (ChIP-seq) experiment, an important consideration in experimental design is the minimum number of sequenced reads required to obtain statistically significant results. We present an extensive evaluation of the impact of sequencing depth on identification of enriched regions for key histone modifications (H3K4me3, H3K36me3, H3K27me3 and H3K9me2/me3) using deep-sequenced datasets in human and fly. We propose to define sufficient sequencing depth as the number of reads at which detected enrichment regions increase <1% for an additional million reads. Although the required depth depends on the nature of the mark and the state of the cell in each experiment, we observe that sufficient depth is often reached at <20 million reads for fly. For human, there are no clear saturation points for the examined datasets, but our analysis suggests 40–50 million reads as a practical minimum for most marks. We also devise a mathematical model to estimate the sufficient depth and total genomic coverage of a mark. Lastly, we find that the five algorithms tested do not agree well for broad enrichment profiles, especially at lower depths. Our findings suggest that sufficient sequencing depth and an appropriate peak-calling algorithm are essential for ensuring robustness of conclusions derived from ChIP-seq data. PMID:24598259

  12. Structure of weakly 2-dependent siphons

    NASA Astrophysics Data System (ADS)

    Chao, Daniel Yuh; Chen, Jiun-Ting

    2013-09-01

    Deadlocks arising from insufficiently marked siphons in flexible manufacturing systems can be controlled by adding monitors to each siphon - too many for large systems. Li and Zhou add monitors to elementary siphons only while controlling the rest of (called dependent) siphons by adjusting control depth variables of elementary siphons. Only a linear number of monitors are required. The control of weakly dependent siphons (WDSs) is rather conservative since only positive terms were considered. The structure for strongly dependent siphons (SDSs) has been studied earlier. Based on this structure, the optimal sequence of adding monitors has been discovered earlier. Better controllability has been discovered to achieve faster and more permissive control. The results have been extended earlier to S3PGR2 (systems of simple sequential processes with general resource requirements). This paper explores the structures for WDSs, which, as found in this paper, involve elementary resource circuits interconnecting at more than (for SDSs, exactly) one resource place. This saves the time to compute compound siphons, their complementary sets and T-characteristic vectors. Also it allows us (1) to improve the controllability of WDSs and control siphons and (2) to avoid the time to find independent vectors for elementary siphons. We propose a sufficient and necessary test for adjusting control depth variables in S3PR (systems of simple sequential processes with resources) to avoid the sufficient-only time-consuming linear integer programming test (LIP) (Nondeterministic Polynomial (NP) time complete problem) required previously for some cases.

  13. In situ hybridization in paracoccidioidomycosis.

    PubMed

    De Brito, T; Sandhu, G S; Kline, B C; Aleff, R A; Sandoval, M P; Santos, R T; Brandão, A A; Lacaz, C S

    1999-06-01

    In situ hybridization (ISH) was performed using oral biopsies from patients with paracoccidioidomycosis and guinea pig testes inoculated with a culture of Paracoccidioides brasiliensis isolated from soil, employing both a 14 base-pair specific oligoprobe (ACT CCC CCG TGG TC) and its complementary sequence. When combining ISH with the Gridley stain which detects fungal cell walls, about 2-3% of the fungal cells present in the tissues were labelled. When the complementary probe was used, labelling was higher, reaching the 3% level.

  14. COMplementary Primer ASymmetric PCR (COMPAS-PCR) Applied to the Identification of Salmo salar, Salmo trutta and Their Hybrids

    PubMed Central

    2016-01-01

    Avoiding complementarity between primers when designing a PCR assay constitutes a central rule strongly anchored in the mind of the molecular scientist. 3’-complementarity will extend the primers during PCR elongation using one another as template, consequently disabling further possible involvement in traditional target amplification. However, a 5’-complementarity will leave the primers unchanged during PCR cycles, albeit sequestered to one another, therefore also suppressing target amplification. We show that 5’-complementarity between primers may be exploited in a new PCR method called COMplementary-Primer-Asymmetric (COMPAS)-PCR, using asymmetric primer concentrations to achieve target PCR amplification. Moreover, such a design may paradoxically reduce spurious non-target amplification by actively sequestering the limiting primer. The general principles were demonstrated using 5S rDNA direct repeats as target sequences to design a species-specific assay for identifying Salmo salar and Salmo trutta using almost fully complementary primers overlapping the same target sequence. Specificity was enhanced by using 3’-penultimate point mutations and the assay was further developed to enable identification of S. salar x S. trutta hybrids by High Resolution Melt analysis in a 35 min one-tube assay. This small paradigm shift, using highly complementary primers for PCR, should help develop robust assays that previously would not be considered. PMID:27783658

  15. An algorithm to compute the sequency ordered Walsh transform

    NASA Technical Reports Server (NTRS)

    Larsen, H.

    1976-01-01

    A fast sequency-ordered Walsh transform algorithm is presented; this sequency-ordered fast transform is complementary to the sequency-ordered fast Walsh transform introduced by Manz (1972) and eliminating gray code reordering through a modification of the basic fast Hadamard transform structure. The new algorithm retains the advantages of its complement (it is in place and is its own inverse), while differing in having a decimation-in time structure, accepting data in normal order, and returning the coefficients in bit-reversed sequency order. Applications include estimation of Walsh power spectra for a random process, sequency filtering and computing logical autocorrelations, and selective bit reversing.

  16. The construction, identification and partial characterization of plasmids containing guinea-pig milk protein complementary DNA sequences.

    PubMed Central

    Craig, R K; Hall, L; Parker, D; Campbell, P N

    1981-01-01

    A complementary DNA (cDNA) plasmid library has been constructed in the plasmid pAT153, using poly(A)-containing RNA isolated from the lactating guinea-pig mammary gland as the starting material. Double stranded cDNA was inserted into the EcoRI site of the plasmid using poly(dA . dT) tails, then transformed into Escherichia coli HB101. From the resulting colonies we have selected and partially characterized plasmids containing cDNA copies of the mRNAs for casein A, casein B, casein C and alpha-lactalbumin. However, the proportion containing casein C cDNA was exceptionally low, and these contained at best 60% of the mRNA sequence. Images Fig. 2. Fig. 3. Fig. 4. Fig. 5. PMID:7306038

  17. Complementary feeding: clinically relevant factors affecting timing and composition.

    PubMed

    Krebs, Nancy F; Hambidge, K Michael

    2007-02-01

    Exclusive breastfeeding for the first 6 mo of life followed by optimal complementary feeding are critical public health measures for reducing and preventing morbidity and mortality in young children. Clinical factors, such as birth weight, prematurity, and illness, that affect the iron and zinc requirements of younger infants are discussed. Maternal diet and nutritional status do not have a strong effect on the mineral content of human milk, but physiologic changes in milk and the infants' status determine the dependence of the infant on complementary foods in addition to human milk to meet iron and zinc requirements after 6 mo. The nature of zinc absorption, which is suitably characterized by saturation response modeling, dictates that plant-based diets, which are low in zinc, are associated with low absolute daily absorbed zinc, which is inadequate to meet requirements. Foods with a higher zinc content, such as meats, are much more likely to be sufficient to meet dietary requirements. Current plant-based complementary feeding patterns for older fully breastfed infants in both developed and developing countries pose a risk of zinc deficiency. The strong rationale for the potential benefits of providing meat as an early complementary food, and the examples of successful intervention programs, provide potent incentives to pursue broader implementation programs, with concurrent rigorous evaluation of both efficacy and effectiveness.

  18. The influence of sequence context and length on the kinetics of DNA duplex formation from complementary hairpins possessing (CNG) repeats.

    PubMed

    Paiva, Anthony M; Sheardy, Richard D

    2005-04-20

    The formation of unusual structures during DNA replication has been invoked for gene expansion in genomes possessing triplet repeat sequences, CNG, where N = A, C, G, or T. In particular, it has been suggested that the daughter strand of the leading strand partially dissociates from the parent strand and forms a hairpin. The equilibrium between the fully duplexed parent:daugter species and the parent:hairpin species is dependent upon their relative stabilities and the rates of reannealing of the daughter strand back to the parent. These stabilities and rates are ultimately influenced by the sequence context of the DNA and its length. Previous work has demonstrated that longer strands are more stable than shorter strands and that the identity of N also influences the thermal stability [Paiva, A. M.; Sheardy, R. D. Biochemistry 2004, 43, 14218-14227]. Here, we show that the rate of duplex formation from complementary hairpins is also sequence context and length dependent. In particular, longer duplexes have higher activation energies than shorter duplexes of the same sequence context. Further, [(CCG):(GGC)] duplexes have lower activation energies than corresponding [(CAG):(GTC)] duplexes of the same length. Hence, hairpins formed from long CNG sequences are more thermodynamically stable and have slower kinetics for reannealing to their complement than shorter analogues. Gene expansion can now be explained in terms of thermodynamics and kinetics.

  19. FMLRC: Hybrid long read error correction using an FM-index.

    PubMed

    Wang, Jeremy R; Holt, James; McMillan, Leonard; Jones, Corbin D

    2018-02-09

    Long read sequencing is changing the landscape of genomic research, especially de novo assembly. Despite the high error rate inherent to long read technologies, increased read lengths dramatically improve the continuity and accuracy of genome assemblies. However, the cost and throughput of these technologies limits their application to complex genomes. One solution is to decrease the cost and time to assemble novel genomes by leveraging "hybrid" assemblies that use long reads for scaffolding and short reads for accuracy. We describe a novel method leveraging a multi-string Burrows-Wheeler Transform with auxiliary FM-index to correct errors in long read sequences using a set of complementary short reads. We demonstrate that our method efficiently produces significantly more high quality corrected sequence than existing hybrid error-correction methods. We also show that our method produces more contiguous assemblies, in many cases, than existing state-of-the-art hybrid and long-read only de novo assembly methods. Our method accurately corrects long read sequence data using complementary short reads. We demonstrate higher total throughput of corrected long reads and a corresponding increase in contiguity of the resulting de novo assemblies. Improved throughput and computational efficiency than existing methods will help better economically utilize emerging long read sequencing technologies.

  20. RNA-primed complementary-sense DNA synthesis of the geminivirus African cassava mosaic virus.

    PubMed Central

    Saunders, K; Lucy, A; Stanley, J

    1992-01-01

    The plant DNA virus African cassava mosaic virus (ACMV) is believed to replicate by a rolling circle mechanism. To investigate complementary-sense DNA (lagging strand) synthesis, we have analysed the heterogenous form of complementary-sense DNA (H3 DNA) from infected Nicotiana benthamiana by two-dimensional agarose gel electrophoresis and blot hybridisation. The presence of an RNA moeity is demonstrated by comparison of results for nucleic acids resolved on neutral/alkaline and neutral/formamide gels, suggesting that complementary-sense DNA synthesis on the virus-sense single-stranded DNA template is preceded by the synthesis of an RNA primer. Hybridisation with probes to specific parts of ACMV DNA A genome indicates that synthesis of the putative RNA primer initiates between nucleotides 2581-221, a region that includes intergenic sequences that have been implicated in geminivirus DNA replication and the control of gene expression. Images PMID:1475192

  1. Methods for chromosome-specific staining

    DOEpatents

    Gray, J.W.; Pinkel, D.

    1995-09-05

    Methods and compositions for chromosome-specific staining are provided. Compositions comprise heterogeneous mixtures of labeled nucleic acid fragments having substantially complementary base sequences to unique sequence regions of the chromosomal DNA for which their associated staining reagent is specific. Methods include ways for making the chromosome-specific staining compositions of the invention, and methods for applying the staining compositions to chromosomes. 3 figs.

  2. Methods and compositions for chromosome-specific staining

    DOEpatents

    Gray, Joe W.; Pinkel, Daniel

    2003-07-22

    Methods and compositions for chromosome-specific staining are provided. Compositions comprise heterogenous mixtures of labeled nucleic acid fragments having substantially complementary base sequences to unique sequence regions of the chromosomal DNA for which their associated staining reagent is specific. Methods include methods for making the chromosome-specific staining compositions of the invention, and methods for applying the staining compositions to chromosomes.

  3. Through Increasing "Information Literacy" Capital and Habitus (Agency): The Complementary Impact on Composition Skills When Appropriately Sequenced

    ERIC Educational Resources Information Center

    Karas, Timothy

    2017-01-01

    Through a case study approach of a cohort of community college students at a single community college, the impact on success rates in composition courses was analyzed based on the sequence of completing an information literacy course. Two student cohorts were sampled based on completing an information literacy course prior to, or concurrently with…

  4. Integrating a DNA barcoding project with an ecological survey: a case study on temperate intertidal polychaete communities in Qingdao, China

    NASA Astrophysics Data System (ADS)

    Zhou, Hong; Zhang, Zhinan; Chen, Haiyan; Sun, Renhua; Wang, Hui; Guo, Lei; Pan, Haijian

    2010-07-01

    In this study, we integrated a DNA barcoding project with an ecological survey on intertidal polychaete communities and investigated the utility of CO1 gene sequence as a DNA barcode for the classification of the intertidal polychaetes. Using 16S rDNA as a complementary marker and combining morphological and ecological characterization, some of dominant and common polychaete species from Chinese coasts were assessed for their taxonomic status. We obtained 22 haplotype gene sequences of 13 taxa, including 10 CO1 sequences and 12 16S rDNA sequences. Based on intra- and inter-specific distances, we built phylogenetic trees using the neighbor-joining method. Our study suggested that the mitochondrial CO1 gene was a valid DNA barcoding marker for species identification in polychaetes, but other genes, such as 16S rDNA, could be used as a complementary genetic marker. For more accurate species identification and effective testing of species hypothesis, DNA barcoding should be incorporated with morphological, ecological, biogeographical, and phylogenetic information. The application of DNA barcoding and molecular identification in the ecological survey on the intertidal polychaete communities demonstrated the feasibility of integrating DNA taxonomy and ecology.

  5. A bimetallic nanocomposite modified genosensor for recognition and determination of thalassemia gene.

    PubMed

    Hamidi-Asl, Ezat; Raoof, Jahan Bakhsh; Naghizadeh, Nahid; Akhavan-Niaki, Haleh; Ojani, Reza; Banihashemi, Ali

    2016-10-01

    The main roles of DNA in the cells are to maintain and properly express genetic information. It is important to have analytical methods capable of fast and sensitive detection of DNA damage. DNA hybridization sensors are well suited for diagnostics and other purposes, including determination of bacteria and viruses. Beta thalassemias (βth) are due to mutations in the β-globin gene. In this study, an electrochemical biosensor which detects the sequences related to the β-globin gene issued from real samples amplified by polymerase chain reaction (PCR) is described for the first time. The biosensor relies on the immobilization of 20-mer single stranded oligonucleotide (probe) related to βth sequence on the carbon paste electrode (CPE) modified by 15% silver (Ag) and platinum (Pt) nanoparticles to prepare the bimetallic nanocomposite electrode and hybridization of this oligonucleotide with its complementary sequence (target). The extent of hybridization between the probe and target sequences was shown by using linear sweep voltammetry (LSV) with methylene blue (MB) as hybridization indicator. The selectivity of sensor was investigated using PCR samples containing non-complementary oligonucleotides. The detection limit of biosensor was calculated about 470.0pg/μL. Copyright © 2016 Elsevier B.V. All rights reserved.

  6. Array of nucleic acid probes on biological chips for diagnosis of HIV and methods of using the same

    DOEpatents

    Chee, Mark; Gingeras, Thomas R.; Fodor, Stephen P. A.; Hubble, Earl A.; Morris, MacDonald S.

    1999-01-19

    The invention provides an array of oligonucleotide probes immobilized on a solid support for analysis of a target sequence from a human immunodeficiency virus. The array comprises at least four sets of oligonucleotide probes 9 to 21 nucleotides in length. A first probe set has a probe corresponding to each nucleotide in a reference sequence from a human immunodeficiency virus. A probe is related to its corresponding nucleotide by being exactly complementary to a subsequence of the reference sequence that includes the corresponding nucleotide. Thus, each probe has a position, designated an interrogation position, that is occupied by a complementary nucleotide to the corresponding nucleotide. The three additional probe sets each have a corresponding probe for each probe in the first probe set. Thus, for each nucleotide in the reference sequence, there are four corresponding probes, one from each of the probe sets. The three corresponding probes in the three additional probe sets are identical to the corresponding probe from the first probe or a subsequence thereof that includes the interrogation position, except that the interrogation position is occupied by a different nucleotide in each of the four corresponding probes.

  7. Packaging of Mason-Pfizer monkey virus (MPMV) genomic RNA depends upon conserved long-range interactions (LRIs) between U5 and gag sequences.

    PubMed

    Kalloush, Rawan M; Vivet-Boudou, Valérie; Ali, Lizna M; Mustafa, Farah; Marquet, Roland; Rizvi, Tahir A

    2016-06-01

    MPMV has great potential for development as a vector for gene therapy. In this respect, precisely defining the sequences and structural motifs that are important for dimerization and packaging of its genomic RNA (gRNA) are of utmost importance. A distinguishing feature of the MPMV gRNA packaging signal is two phylogenetically conserved long-range interactions (LRIs) between U5 and gag complementary sequences, LRI-I and LRI-II. To test their biological significance in the MPMV life cycle, we introduced mutations into these structural motifs and tested their effects on MPMV gRNA packaging and propagation. Furthermore, we probed the structure of key mutants using SHAPE (selective 2'hydroxyl acylation analyzed by primer extension). Disrupting base-pairing of the LRIs affected gRNA packaging and propagation, demonstrating their significance to the MPMV life cycle. A double mutant restoring a heterologous LRI-I was fully functional, whereas a similar LRI-II mutant failed to restore gRNA packaging and propagation. These results demonstrate that while LRI-I acts at the structural level, maintaining base-pairing is not sufficient for LRI-II function. In addition, in vitro RNA dimerization assays indicated that the loss of RNA packaging in LRI mutants could not be attributed to the defects in dimerization. Our findings suggest that U5-gag LRIs play an important architectural role in maintaining the structure of the 5' region of the MPMV gRNA, expanding the crucial role of LRIs to the nonlentiviral group of retroviruses. © 2016 Kalloush et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

  8. Extremes of fractional noises: A model for the timings of arrhythmic heart beats in post-infarction patients

    NASA Astrophysics Data System (ADS)

    Witt, Annette; Ehlers, Frithjof; Luther, Stefan

    2017-09-01

    We have analyzed symbol sequences of heart beat annotations obtained from 24-h electrocardiogram recordings of 184 post-infarction patients (from the Cardiac Arrhythmia Suppression Trial database, CAST). In the symbol sequences, each heart beat was coded as an arrhythmic or as a normal beat. The symbol sequences were analyzed with a model-based approach which relies on two-parametric peaks over the threshold (POT) model, interpreting each premature ventricular contraction (PVC) as an extreme event. For the POT model, we explored (i) the Shannon entropy which was estimated in terms of the Lempel-Ziv complexity, (ii) the shape parameter of the Weibull distribution that best fits the PVC return times, and (iii) the strength of long-range correlations quantified by detrended fluctuation analysis (DFA) for the two-dimensional parameter space. We have found that in the frame of our model the Lempel-Ziv complexity is functionally related to the shape parameter of the Weibull distribution. Thus, two complementary measures (entropy and strength of long-range correlations) are sufficient to characterize realizations of the two-parametric model. For the CAST data, we have found evidence for an intermediate strength of long-range correlations in the PVC timings, which are correlated to the age of the patient: younger post-infarction patients have higher strength of long-range correlations than older patients. The normalized Shannon entropy has values in the range 0.5

  9. Rapid method to detect duplex formation in sequencing by hybridization methods

    DOEpatents

    Mirzabekov, A.D.; Timofeev, E.N.; Florentiev, V.L.; Kirillov, E.V.

    1999-01-19

    A method for determining the existence of duplexes of oligonucleotide complementary molecules is provided. A plurality of immobilized oligonucleotide molecules, each of a specific length and each having a specific base sequence, is contacted with complementary, single stranded oligonucleotide molecules to form a duplex. Each duplex facilitates intercalation of a fluorescent dye between the base planes of the duplex. The invention also provides for a method for constructing oligonucleotide matrices comprising confining light sensitive fluid to a surface and exposing the light-sensitive fluid to a light pattern. This causes the fluid exposed to the light to coalesce into discrete units and adhere to the surface. This places each of the units in contact with a set of different oligonucleotide molecules so as to allow the molecules to disperse into the units. 13 figs.

  10. Impedimetric DNA biosensor based on a nanoporous alumina membrane for the detection of the specific oligonucleotide sequence of dengue virus.

    PubMed

    Deng, Jiajia; Toh, Chee-Seng

    2013-06-17

    A novel and integrated membrane sensing platform for DNA detection is developed based on an anodic aluminum oxide (AAO) membrane. Platinum electrodes (~50-100 nm thick) are coated directly on both sides of the alumina membrane to eliminate the solution resistance outside the nanopores. The electrochemical impedance technique is employed to monitor the impedance changes within the nanopores upon DNA binding. Pore resistance (Rp) linearly increases in response towards the increasing concentration of the target DNA in the range of 1 × 10⁻¹² to 1 × 10⁻⁶ M. Moreover, the biosensor selectively differentiates the complementary sequence from single base mismatched (MM-1) strands and non-complementary strands. This study reveals a simple, selective and sensitive method to fabricate a label-free DNA biosensor.

  11. Rapid method to detect duplex formation in sequencing by hybridization methods

    DOEpatents

    Mirzabekov, Andrei Darievich; Timofeev, Edward Nikolaevich; Florentiev, Vladimer Leonidovich; Kirillov, Eugene Vladislavovich

    1999-01-01

    A method for determining the existence of duplexes of oligonucleotide complementary molecules is provided whereby a plurality of immobilized oligonucleotide molecules, each of a specific length and each having a specific base sequence, is contacted with complementary, single stranded oligonucleotide molecules to form a duplex so as to facilitate intercalation of a fluorescent dye between the base planes of the duplex. The invention also provides for a method for constructing oligonucleotide matrices comprising confining light sensitive fluid to a surface, exposing said light-sensitive fluid to a light pattern so as to cause the fluid exposed to the light to coalesce into discrete units and adhere to the surface; and contacting each of the units with a set of different oligonucleotide molecules so as to allow the molecules to disperse into the units.

  12. A novel aptasensor for the ultra-sensitive detection of adenosine triphosphate via aptamer/quantum dot based resonance energy transfer.

    PubMed

    Li, Zheng; Wang, Yijing; Liu, Ying; Zeng, Yongyi; Huang, Aimin; Peng, Niancai; Liu, Xiaolong; Liu, Jingfeng

    2013-09-07

    We designed a novel aptamer based biosensor (aptasensor) for ultrasensitive detection of adenosine triphosphate (ATP) through resonance energy transfer (RET). The ATP aptamer was modified with Cy3 at the 3' end, and a green quantum dot (525) was attached to the 5' end of its complementary sequence respectively. The ATP aptamer and its complementary sequence could assemble into a duplex structure in the absence of target ATP, and then decrease the distance between the quantum dot and Cy3 which could produce significant RET signal. Upon ATP binding, the ATP aptamer could dissociate with its complementary sequence and then increase the distance between the quantum dot and Cy3 which would significantly decrease the RET signal. Therefore, the ATP detection could be easily achieved through detection of the fluorescence intensity ratio between 525 nm and 560 nm. The results show that the emission fluorescence intensity ratio of 525/560 is linearly related to the logarithmic concentration of ATP. The linear range of this aptasensor is from 0.1 nM to 1 μM, and the detection limit is lower down to 0.01 nM. Excellent selectivity of this aptasensor for ATP has been demonstrated through the detection of thymidine triphosphate (TTP), cytidine triphosphate (CTP), guanosine triphosphate (GTP) and adenosine diphosphate (ADP) respectively as control. The method we described here could easily detect ATP with excellent selectivity, linearity and sensitivity down to the nanomolar range, as well as avoid photobleaching.

  13. The field effect transistor DNA biosensor based on ITO nanowires in label-free hepatitis B virus detecting compatible with CMOS technology.

    PubMed

    Shariati, Mohsen

    2018-05-15

    In this paper the field-effect transistor DNA biosensor for detecting hepatitis B virus (HBV) based on indium tin oxide nanowires (ITO NWs) in label free approach has been fabricated. Because of ITO nanowires intensive conductance and functional modified surface, the probe immobilization and target hybridization were increased strongly. The high resolution transmission electron microscopy (HRTEM) measurement showed that ITO nanowires were crystalline and less than 50nm in diameter. The single-stranded hepatitis B virus DNA (SS-DNA) was immobilized as probe on the Au-modified nanowires. The DNA targets were measured in a linear concentration range from 1fM to 10µM. The detection limit of the DNA biosensor was about 1fM. The time of the hybridization process for defined single strand was 90min. The switching ratio of the biosensor between "on" and "off" state was ~ 1.1 × 10 5 . For sensing the specificity of the biosensor, non-complementary, mismatch and complementary DNA oligonucleotide sequences were clearly discriminated. The HBV biosensor confirmed the highly satisfied specificity for differentiating complementary sequences from non-complementary and the mismatch oligonucleotides. The response time of the DNA sensor was 37s with a high reproducibility. The stability and repeatability of the DNA biosensor showed that the peak current of the biosensor retained 98% and 96% of its initial response for measurements after three and five weeks, respectively. Copyright © 2018 Elsevier B.V. All rights reserved.

  14. Enhanced characterization of singly protonated phosphopeptide ions by femtosecond laser-induced ionization/dissociation tandem mass spectrometry (fs-LID-MS/MS).

    PubMed

    Smith, Scott A; Kalcic, Christine L; Safran, Kyle A; Stemmer, Paul M; Dantus, Marcos; Reid, Gavin E

    2010-12-01

    To develop an improved understanding of the regulatory role that post-translational modifications (PTMs) involving phosphorylation play in the maintenance of normal cellular function, tandem mass spectrometry (MS/MS) strategies coupled with ion activation techniques such as collision-induced dissociation (CID) and electron-transfer dissociation (ETD) are typically employed to identify the presence and site-specific locations of the phosphate moieties within a given phosphoprotein of interest. However, the ability of these techniques to obtain sufficient structural information for unambiguous phosphopeptide identification and characterization is highly dependent on the ion activation method employed and the properties of the precursor ion that is subjected to dissociation. Herein, we describe the application of a recently developed alternative ion activation technique for phosphopeptide analysis, termed femtosecond laser-induced ionization/dissociation (fs-LID). In contrast to CID and ETD, fs-LID is shown to be particularly suited to the analysis of singly protonated phosphopeptide ions, yielding a wide range of product ions including a, b, c, x, y, and z sequence ions, as well as ions that are potentially diagnostic of the positions of phosphorylation (e.g., 'a(n)+1-98'). Importantly, the lack of phosphate moiety losses or phosphate group 'scrambling' provides unambiguous information for sequence identification and phosphorylation site characterization. Therefore, fs-LID-MS/MS can serve as a complementary technique to established methodologies for phosphoproteomic analysis. Copyright © 2010. Published by Elsevier Inc.

  15. The construction and partial characterization of plasmids containing complementary DNA sequences to human calcitonin precursor polyprotein.

    PubMed Central

    Allison, J; Hall, L; MacIntyre, I; Craig, R K

    1981-01-01

    (1) Total poly(A)-containing RNA isolated from human thyroid medullary carcinoma tissue was shown to direct the synthesis in the wheat germ cell-free system of a major (Mr 21000) and several minor forms of human calcitonin precursor polyproteins. Evidence for processing of these precursor(s) by the wheat germ cell-free system is also presented. (2) A small complementary DNA (cDNA) plasmid library has been constructed in the PstI site of the plasmid pAT153, using total human thyroid medullary carcinoma poly(A)-containing RNA as the starting material. (3) Plasmids containing abundant cDNA sequences were selected by hybridization in situ, and two of these (ph T-B3 and phT-B6) were characterized by hybridization--translation and restriction analysis. Each was shown to contain human calcitonin precursor polyprotein cDNA sequences. (4) RNA blotting techniques demonstrate that the human calcitonin precursor polyprotein is encoded within a mRNA containing 1000 bases. (5) The results demonstrate that human calcitonin is synthesized as a precursor polyprotein. Images Fig. 1. Fig. 2. Fig. 3. PMID:6896146

  16. Electrochemical DNA biosensor based on a glassy carbon electrode modified with gold nanoparticles and graphene for sensitive determination of Klebsiella pneumoniae carbapenemase.

    PubMed

    Pan, Hong-zhi; Yu, Hong-wei; Wang, Na; Zhang, Ze; Wan, Guang-cai; Liu, Hao; Guan, Xue; Chang, Dong

    2015-11-20

    We describe the fabrication of a sensitive electrochemical DNA biosensor for determination of Klebsiella pneumoniae carbapenemase (KPC). The highly sensitive and selective electrochemical biosensor for DNA detection was constructed based on a glassy carbon electrode (GCE) modified with gold nanoparticles (Au-NPs) and graphene (Gr). Then Au-NPs/Gr/GCE was characterized by scanning electro microscope (SEM), cyclic voltammetry (CV) and electrochemical impedance spectroscopy (EIS). The hybridization detection was measured by diffierential pulse voltammetry (DPV) using methylene blue (MB) as the hybridization indicator. The dynamic range of detection of the sensor for the target DNA sequences was from 1 × 10(-12) to 1 × 10(-7)mol/L, with a detection limit of 2 × 10(-13)mol/L. The DNA biosensor had excellent specificity for distinguishing complementary DNA sequence in the presence of non-complementary and mismatched DNA sequence. The results demonstrated that the Au-NPs/Gr nanocomposite was a promising substrate for the development of high-performance electrocatalysts for determination of KPC. Copyright © 2015 Elsevier B.V. All rights reserved.

  17. CAPRRESI: Chimera Assembly by Plasmid Recovery and Restriction Enzyme Site Insertion.

    PubMed

    Santillán, Orlando; Ramírez-Romero, Miguel A; Dávila, Guillermo

    2017-06-25

    Here, we present chimera assembly by plasmid recovery and restriction enzyme site insertion (CAPRRESI). CAPRRESI benefits from many strengths of the original plasmid recovery method and introduces restriction enzyme digestion to ease DNA ligation reactions (required for chimera assembly). For this protocol, users clone wildtype genes into the same plasmid (pUC18 or pUC19). After the in silico selection of amino acid sequence regions where chimeras should be assembled, users obtain all the synonym DNA sequences that encode them. Ad hoc Perl scripts enable users to determine all synonym DNA sequences. After this step, another Perl script searches for restriction enzyme sites on all synonym DNA sequences. This in silico analysis is also performed using the ampicillin resistance gene (ampR) found on pUC18/19 plasmids. Users design oligonucleotides inside synonym regions to disrupt wildtype and ampR genes by PCR. After obtaining and purifying complementary DNA fragments, restriction enzyme digestion is accomplished. Chimera assembly is achieved by ligating appropriate complementary DNA fragments. pUC18/19 vectors are selected for CAPRRESI because they offer technical advantages, such as small size (2,686 base pairs), high copy number, advantageous sequencing reaction features, and commercial availability. The usage of restriction enzymes for chimera assembly eliminates the need for DNA polymerases yielding blunt-ended products. CAPRRESI is a fast and low-cost method for fusing protein-coding genes.

  18. Structural correlates of affinity in fetal versus adult endplate nicotinic receptors

    NASA Astrophysics Data System (ADS)

    Nayak, Tapan Kumar; Chakraborty, Srirupa; Zheng, Wenjun; Auerbach, Anthony

    2016-04-01

    Adult-type nicotinic acetylcholine receptors (AChRs) mediate signalling at mature neuromuscular junctions and fetal-type AChRs are necessary for proper synapse development. Each AChR has two neurotransmitter binding sites located at the interface of a principal and a complementary subunit. Although all agonist binding sites have the same core of five aromatic amino acids, the fetal site has ~30-fold higher affinity for the neurotransmitter ACh. Here we use molecular dynamics simulations of adult versus fetal homology models to identify complementary-subunit residues near the core that influence affinity, and use single-channel electrophysiology to corroborate the results. Four residues in combination determine adult versus fetal affinity. Simulations suggest that at lower-affinity sites, one of these unsettles the core directly and the others (in loop E) increase backbone flexibility to unlock a key, complementary tryptophan from the core. Swapping only four amino acids is necessary and sufficient to exchange function between adult and fetal AChRs.

  19. Enantiospecific recognition of DNA sequences by a proflavine Tröger base.

    PubMed

    Bailly, C; Laine, W; Demeunynck, M; Lhomme, J

    2000-07-05

    The DNA interaction of a chiral Tröger base derived from proflavine was investigated by DNA melting temperature measurements and complementary biochemical assays. DNase I footprinting experiments demonstrate that the binding of the proflavine-based Tröger base is both enantio- and sequence-specific. The (+)-isomer poorly interacts with DNA in a non-sequence-selective fashion. In sharp contrast, the corresponding (-)-isomer recognizes preferentially certain DNA sequences containing both A. T and G. C base pairs, such as the motifs 5'-GTT. AAC and 5'-ATGA. TCAT. This is the first experimental demonstration that acridine-type Tröger bases can be used for enantiospecific recognition of DNA sequences. Copyright 2000 Academic Press.

  20. Small nuclear RNA U2 is base-paired to heterogeneous nuclear RNA.

    PubMed

    Calvet, J P; Meyer, L M; Pederson, T

    1982-07-30

    Eukaryotic cells contain a set of low molecular weight nuclear RNA's. One of the more abundant of these is termed U2 RNA. The possibility that U2 RNA is hydrogen-bonded to complementary sequences in other nuclear RNA's was investigated. Cultured human (HeLa) cells were treated with a psoralen derivative that cross-links RNA chains that are base-paired with one another. High molecular weight heterogeneous nuclear RNA was isolated under denaturing conditions, and the psoralen cross-links were reversed. Electrophoresis of the released RNA and hybridization with a human cloned U2 DNA probe revealed that U2 is hydrogen-bonded to complementary sequences in heterogeneous nuclear RNA in vivo. In contrast, U2 RNA is not base-paired with nucleolar RNA, which contains the precursors of ribosomal RNA. The results suggest that U2 RNA participates in messenger RNA processing in the nucleus.

  1. RNA-programmed genome editing in human cells

    PubMed Central

    Jinek, Martin; East, Alexandra; Cheng, Aaron; Lin, Steven; Ma, Enbo; Doudna, Jennifer

    2013-01-01

    Type II CRISPR immune systems in bacteria use a dual RNA-guided DNA endonuclease, Cas9, to cleave foreign DNA at specific sites. We show here that Cas9 assembles with hybrid guide RNAs in human cells and can induce the formation of double-strand DNA breaks (DSBs) at a site complementary to the guide RNA sequence in genomic DNA. This cleavage activity requires both Cas9 and the complementary binding of the guide RNA. Experiments using extracts from transfected cells show that RNA expression and/or assembly into Cas9 is the limiting factor for Cas9-mediated DNA cleavage. In addition, we find that extension of the RNA sequence at the 3′ end enhances DNA targeting activity in vivo. These results show that RNA-programmed genome editing is a facile strategy for introducing site-specific genetic changes in human cells. DOI: http://dx.doi.org/10.7554/eLife.00471.001 PMID:23386978

  2. Rapid method to detect duplex formation in sequencing by hybridization methods, a method for constructing containment structures for reagent interaction

    DOEpatents

    Mirzabekov, Andrei Darievich; Yershov, Gennadiy Moiseyevich; Guschin, Dmitry Yuryevich; Gemmell, Margaret Anne; Shick, Valentine V.; Proudnikov, Dmitri Y.; Timofeev, Edward N.

    2002-01-01

    A method for determining the existence of duplexes of oligonucleotide complementary molecules is provided whereby a plurality of immobilized oligonucleotide molecules, each of a specific length and each having a specific base sequence, is contacted with complementary, single stranded oligonucleotide molecules to form a duplex so as to facilitate intercalation of a fluorescent dye between the base planes of the duplex. The invention also provides for a method for constructing oligonucleotide matrices comprising confining light sensitive fluid to a surface, exposing said light-sensitive fluid to a light pattern so as to cause the fluid exposed to the light to polymerize into discrete units and adhere to the surface; and contacting each of the units with a set of different oligonucleotide molecules so as to allow the molecules to disperse into the units.

  3. Mesomorphic phase transitions of 3F7HPhF studied by complementary methods

    NASA Astrophysics Data System (ADS)

    Deptuch, Aleksandra; Jaworska-Gołąb, Teresa; Marzec, Monika; Pociecha, Damian; Fitas, Jakub; Żurowska, Magdalena; Tykarska, Marzena; Hooper, James

    2018-02-01

    Physical properties and the phase sequence of (S)-4‧-(1-methylheptyloxycarbonyl)biphenyl-4-yl 4-[7-(2,2,3,3,4,4,4-heptafluorobutoxy) heptyl-1-oxy]-2-fluorobenzoate exhibiting the liquid crystalline paraelectric smectic A*, ferroelectric smectic C* and antiferroelectric smectic CA* phases were studied by complementary methods in the temperature range from -125 to 120 °C. Differential scanning calorimetry measurements together with polarizing optical microscopy provided the phase sequence, including the glass transition and a cold crystallization. X-ray diffraction was used to obtain the unit-cell parameters of the crystal phase, as well as the layer thickness and correlation length in the liquid crystalline smectic phases. The tilt angle was found to reach 45°, as determined from the measurements of the layer thickness and molecular modeling. Relaxation processes in the smectic phases and the fragility parameter were studied using frequency-domain dielectric spectroscopy.

  4. Kits for Characterization of Chromosomal Inversions Using Probes

    NASA Technical Reports Server (NTRS)

    Ray, F. Andrew (Inventor)

    2017-01-01

    A kit for the characterization of chromosomal inversions using single-stranded probes that are either all identical or all complementary to a single-stranded chromatid is described. Reporter species are attached to oligonucleotide strands designed such that they may hybridize to portions of only one of a pair of single-stranded sister chromatids which may be prepared by the CO-FISH procedure. If an inversion has occurred, these marker probes will be detected on the second sister chromatid at the same location as the inversion on the first chromatid. The kit includes non-repetitive probes that are either all identical or all complementary to at least a portion of a target DNA sequence of only one DNA strand of only one chromatid and may in some embodiments include reagents suitable for performing CO-FISH and/or reagents for hybridizing the probes to the target DNA sequence.

  5. Design and characterization of a nanopore-coupled polymerase for single-molecule DNA sequencing by synthesis on an electrode array

    PubMed Central

    Stranges, P. Benjamin; Palla, Mirkó; Kalachikov, Sergey; Nivala, Jeff; Dorwart, Michael; Trans, Andrew; Kumar, Shiv; Porel, Mintu; Chien, Minchen; Tao, Chuanjuan; Morozova, Irina; Li, Zengmin; Shi, Shundi; Aberra, Aman; Arnold, Cleoma; Yang, Alexander; Aguirre, Anne; Harada, Eric T.; Korenblum, Daniel; Pollard, James; Bhat, Ashwini; Gremyachinskiy, Dmitriy; Bibillo, Arek; Chen, Roger; Davis, Randy; Russo, James J.; Fuller, Carl W.; Roever, Stefan; Ju, Jingyue; Church, George M.

    2016-01-01

    Scalable, high-throughput DNA sequencing is a prerequisite for precision medicine and biomedical research. Recently, we presented a nanopore-based sequencing-by-synthesis (Nanopore-SBS) approach, which used a set of nucleotides with polymer tags that allow discrimination of the nucleotides in a biological nanopore. Here, we designed and covalently coupled a DNA polymerase to an α-hemolysin (αHL) heptamer using the SpyCatcher/SpyTag conjugation approach. These porin–polymerase conjugates were inserted into lipid bilayers on a complementary metal oxide semiconductor (CMOS)-based electrode array for high-throughput electrical recording of DNA synthesis. The designed nanopore construct successfully detected the capture of tagged nucleotides complementary to a DNA base on a provided template. We measured over 200 tagged-nucleotide signals for each of the four bases and developed a classification method to uniquely distinguish them from each other and background signals. The probability of falsely identifying a background event as a true capture event was less than 1.2%. In the presence of all four tagged nucleotides, we observed sequential additions in real time during polymerase-catalyzed DNA synthesis. Single-polymerase coupling to a nanopore, in combination with the Nanopore-SBS approach, can provide the foundation for a low-cost, single-molecule, electronic DNA-sequencing platform. PMID:27729524

  6. 'Cold shock' increases the frequency of homology directed repair gene editing in induced pluripotent stem cells.

    PubMed

    Guo, Q; Mintier, G; Ma-Edmonds, M; Storton, D; Wang, X; Xiao, X; Kienzle, B; Zhao, D; Feder, John N

    2018-02-01

    Using CRISPR/Cas9 delivered as a RNA modality in conjunction with a lipid specifically formulated for large RNA molecules, we demonstrate that homology directed repair (HDR) rates between 20-40% can be achieved in induced pluripotent stem cells (iPSC). Furthermore, low HDR rates (between 1-20%) can be enhanced two- to ten-fold in both iPSCs and HEK293 cells by 'cold shocking' cells at 32 °C for 24-48 hours following transfection. This method can also increases the proportion of loci that have undergone complete sequence conversion across the donor sequence, or 'perfect HDR', as opposed to partial sequence conversion where nucleotides more distal to the CRISPR cut site are less efficiently incorporated ('partial HDR'). We demonstrate that the structure of the single-stranded DNA oligo donor can influence the fidelity of HDR, with oligos symmetric with respect to the CRISPR cleavage site and complementary to the target strand being more efficient at directing 'perfect HDR' compared to asymmetric non-target strand complementary oligos. Our protocol represents an efficient method for making CRISPR-mediated, specific DNA sequence changes within the genome that will facilitate the rapid generation of genetic models of human disease in iPSCs as well as other genome engineered cell lines.

  7. Hiding message into DNA sequence through DNA coding and chaotic maps.

    PubMed

    Liu, Guoyan; Liu, Hongjun; Kadir, Abdurahman

    2014-09-01

    The paper proposes an improved reversible substitution method to hide data into deoxyribonucleic acid (DNA) sequence, and four measures have been taken to enhance the robustness and enlarge the hiding capacity, such as encode the secret message by DNA coding, encrypt it by pseudo-random sequence, generate the relative hiding locations by piecewise linear chaotic map, and embed the encoded and encrypted message into a randomly selected DNA sequence using the complementary rule. The key space and the hiding capacity are analyzed. Experimental results indicate that the proposed method has a better performance compared with the competing methods with respect to robustness and capacity.

  8. [Guidelines for complementary feeding in healthy infants].

    PubMed

    Romero-Velarde, Enrique; Villalpando-Carrión, Salvador; Pérez-Lizaur, Ana Berta; Iracheta-Gerez, Ma de la Luz; Alonso-Rivera, Carlos Gilberto; López-Navarrete, Gloria Elena; García-Contreras, Andrea; Ochoa-Ortiz, Erika; Zarate-Mondragón, Flora; López-Pérez, Gerardo Tiburcio; Chávez-Palencia, Clío; Guajardo-Jáquez, Manuel; Vázquez-Ortiz, Salvador; Pinzón-Navarro, Beatriz Adriana; Torres-Duarte, Karely Noemy; Vidal-Guzmán, José Domingo; Michel-Gómez, Pedro Luis; López-Contreras, Iris Nallely; Arroyo-Cruz, Liliana Verenice; Almada-Velasco, Pamela; Saltigeral-Simental, Patricia; Ríos-Aguirre, Alejandro; Domínguez-Pineda, Lorena; Rodríguez-González, Perla; Crabtree-Ramírez, Úrsula; Hernández-Rosiles, Vanessa; Pinacho-Velázquez, José Luis

    A proper nutrition during the first two years of life is critical to reach the full potential of every human being; now, this period is recognized as a critical window for promoting optimal growth, development, and good health. Therefore, adequate feeding at this stage of life has an impact on health, nutritional status, growth and development of children; not only in the short term, but in the medium and long term. This paper provides recommendations on complementary feeding (CF) presented as questions or statements that are important for those who take care for children during this stage of life. For example: When to start complementary feedings: 4 or 6 months of age?; Exposure to potentially allergenic foods; Introduction of sweetened beverages; Use of artificial sweeteners and light products; Food introduction sequence; Food consistency changes according to neurological maturation; Number of days to test acceptance and tolerance to new foods; Amounts for each meal; Inadequate complementary feeding practices; Myths and realities of complementary feeding; Developmental milestones; Practice of "Baby Led Weaning" and practice of vegetarianism. Copyright © 2016 Hospital Infantil de México Federico Gómez. Publicado por Masson Doyma México S.A. All rights reserved.

  9. A Rapid, High-Quality, Cost-Effective, Comprehensive and Expandable Targeted Next-Generation Sequencing Assay for Inherited Heart Diseases.

    PubMed

    Wilson, Kitchener D; Shen, Peidong; Fung, Eula; Karakikes, Ioannis; Zhang, Angela; InanlooRahatloo, Kolsoum; Odegaard, Justin; Sallam, Karim; Davis, Ronald W; Lui, George K; Ashley, Euan A; Scharfe, Curt; Wu, Joseph C

    2015-09-11

    Thousands of mutations across >50 genes have been implicated in inherited cardiomyopathies. However, options for sequencing this rapidly evolving gene set are limited because many sequencing services and off-the-shelf kits suffer from slow turnaround, inefficient capture of genomic DNA, and high cost. Furthermore, customization of these assays to cover emerging targets that suit individual needs is often expensive and time consuming. We sought to develop a custom high throughput, clinical-grade next-generation sequencing assay for detecting cardiac disease gene mutations with improved accuracy, flexibility, turnaround, and cost. We used double-stranded probes (complementary long padlock probes), an inexpensive and customizable capture technology, to efficiently capture and amplify the entire coding region and flanking intronic and regulatory sequences of 88 genes and 40 microRNAs associated with inherited cardiomyopathies, congenital heart disease, and cardiac development. Multiplexing 11 samples per sequencing run resulted in a mean base pair coverage of 420, of which 97% had >20× coverage and >99% were concordant with known heterozygous single nucleotide polymorphisms. The assay correctly detected germline variants in 24 individuals and revealed several polymorphic regions in miR-499. Total run time was 3 days at an approximate cost of $100 per sample. Accurate, high-throughput detection of mutations across numerous cardiac genes is achievable with complementary long padlock probe technology. Moreover, this format allows facile insertion of additional probes as more cardiomyopathy and congenital heart disease genes are discovered, giving researchers a powerful new tool for DNA mutation detection and discovery. © 2015 American Heart Association, Inc.

  10. Partial characterization of normal and Haemophilus influenzae-infected mucosal complementary DNA libraries in chinchilla middle ear mucosa.

    PubMed

    Kerschner, Joseph E; Erdos, Geza; Hu, Fen Ze; Burrows, Amy; Cioffi, Joseph; Khampang, Pawjai; Dahlgren, Margaret; Hayes, Jay; Keefe, Randy; Janto, Benjamin; Post, J Christopher; Ehrlich, Garth D

    2010-04-01

    We sought to construct and partially characterize complementary DNA (cDNA) libraries prepared from the middle ear mucosa (MEM) of chinchillas to better understand pathogenic aspects of infection and inflammation, particularly with respect to leukotriene biogenesis and response. Chinchilla MEM was harvested from controls and after middle ear inoculation with nontypeable Haemophilus influenzae. RNA was extracted to generate cDNA libraries. Randomly selected clones were subjected to sequence analysis to characterize the libraries and to provide DNA sequence for phylogenetic analyses. Reverse transcription-polymerase chain reaction of the RNA pools was used to generate cDNA sequences corresponding to genes associated with leukotriene biosynthesis and metabolism. Sequence analysis of 921 randomly selected clones from the uninfected MEM cDNA library produced approximately 250,000 nucleotides of almost entirely novel sequence data. Searches of the GenBank database with the Basic Local Alignment Search Tool provided for identification of 515 unique genes expressed in the MEM and not previously described in chinchillas. In almost all cases, the chinchilla cDNA sequences displayed much greater homology to human or other primate genes than with rodent species. Genes associated with leukotriene metabolism were present in both normal and infected MEM. Based on both phylogenetic comparisons and gene expression similarities with humans, chinchilla MEM appears to be an excellent model for the study of middle ear inflammation and infection. The higher degree of sequence similarity between chinchillas and humans compared to chinchillas and rodents was unexpected. The cDNA libraries from normal and infected chinchilla MEM will serve as useful molecular tools in the study of otitis media and should yield important information with respect to middle ear pathogenesis.

  11. Partial Characterization of Normal and Haemophilus influenzae–Infected Mucosal Complementary DNA Libraries in Chinchilla Middle Ear Mucosa

    PubMed Central

    Kerschner, Joseph E.; Erdos, Geza; Hu, Fen Ze; Burrows, Amy; Cioffi, Joseph; Khampang, Pawjai; Dahlgren, Margaret; Hayes, Jay; Keefe, Randy; Janto, Benjamin; Post, J. Christopher; Ehrlich, Garth D.

    2010-01-01

    Objectives We sought to construct and partially characterize complementary DNA (cDNA) libraries prepared from the middle ear mucosa (MEM) of chinchillas to better understand pathogenic aspects of infection and inflammation, particularly with respect to leukotriene biogenesis and response. Methods Chinchilla MEM was harvested from controls and after middle ear inoculation with nontypeable Haemophilus influenzae. RNA was extracted to generate cDNA libraries. Randomly selected clones were subjected to sequence analysis to characterize the libraries and to provide DNA sequence for phylogenetic analyses. Reverse transcription–polymerase chain reaction of the RNA pools was used to generate cDNA sequences corresponding to genes associated with leukotriene biosynthesis and metabolism. Results Sequence analysis of 921 randomly selected clones from the uninfected MEM cDNA library produced approximately 250,000 nucleotides of almost entirely novel sequence data. Searches of the GenBank database with the Basic Local Alignment Search Tool provided for identification of 515 unique genes expressed in the MEM and not previously described in chinchillas. In almost all cases, the chinchilla cDNA sequences displayed much greater homology to human or other primate genes than with rodent species. Genes associated with leukotriene metabolism were present in both normal and infected MEM. Conclusions Based on both phylogenetic comparisons and gene expression similarities with humans, chinchilla MEM appears to be an excellent model for the study of middle ear inflammation and infection. The higher degree of sequence similarity between chinchillas and humans compared to chinchillas and rodents was unexpected. The cDNA libraries from normal and infected chinchilla MEM will serve as useful molecular tools in the study of otitis media and should yield important information with respect to middle ear pathogenesis. PMID:20433028

  12. A search for pre-main sequence stars in the high-latitude molecular clouds. II - A survey of the Einstein database

    NASA Technical Reports Server (NTRS)

    Caillault, Jean-Pierre; Magnani, Loris

    1990-01-01

    The preliminary results are reported of a survey of every EINSTEIN image which overlaps any high-latitude molecular cloud in a search for X-ray emitting pre-main sequence stars. This survey, together with complementary KPNO and IRAS data, will allow the determination of how prevalent low mass star formation is in these clouds in general and, particularly, in the translucent molecular clouds.

  13. Post-main-sequence planetary system evolution.

    PubMed

    Veras, Dimitri

    2016-02-01

    The fates of planetary systems provide unassailable insights into their formation and represent rich cross-disciplinary dynamical laboratories. Mounting observations of post-main-sequence planetary systems necessitate a complementary level of theoretical scrutiny. Here, I review the diverse dynamical processes which affect planets, asteroids, comets and pebbles as their parent stars evolve into giant branch, white dwarf and neutron stars. This reference provides a foundation for the interpretation and modelling of currently known systems and upcoming discoveries.

  14. SU-F-J-54: Towards Real-Time Volumetric Imaging Using the Treatment Beam and KV Beam

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Chen, M; Rozario, T; Liu, A

    Purpose: Existing real-time imaging uses dual (orthogonal) kV beam fluoroscopies and may result in significant amount of extra radiation to patients, especially for prolonged treatment cases. In addition, kV projections only provide 2D information, which is insufficient for in vivo dose reconstruction. We propose real-time volumetric imaging using prior knowledge of pre-treatment 4D images and real-time 2D transit data of treatment beam and kV beam. Methods: The pre-treatment multi-snapshot volumetric images are used to simulate 2D projections of both the treatment beam and kV beam, respectively, for each treatment field defined by the control point. During radiation delivery, the transitmore » signals acquired by the electronic portal image device (EPID) are processed for every projection and compared with pre-calculation by cross-correlation for phase matching and thus 3D snapshot identification or real-time volumetric imaging. The data processing involves taking logarithmic ratios of EPID signals with respect to the air scan to reduce modeling uncertainties in head scatter fluence and EPID response. Simulated 2D projections are also used to pre-calculate confidence levels in phase matching. Treatment beam projections that have a low confidence level either in pre-calculation or real-time acquisition will trigger kV beams so that complementary information can be exploited. In case both the treatment beam and kV beam return low confidence in phase matching, a predicted phase based on linear regression will be generated. Results: Simulation studies indicated treatment beams provide sufficient confidence in phase matching for most cases. At times of low confidence from treatment beams, kV imaging provides sufficient confidence in phase matching due to its complementary configuration. Conclusion: The proposed real-time volumetric imaging utilizes the treatment beam and triggers kV beams for complementary information when the treatment beam along does not provide sufficient confidence for phase matching. This strategy minimizes the use of extra radiation to patients. This project is partially supported by a Varian MRA grant.« less

  15. Sequence specificity of mutagen-nucleic acid complexes in solution: intercalation and mutagen-base pair overlap geometries for proflavine binding to dC-dC-dG-dG and dG-dG-dC-dC self-complementary duplexes.

    PubMed

    Patel, D J; Canuel, L L

    1977-07-01

    The complex formed between the mutagen proflavine and the dC-dC-dG-dG and dG-dG-dC-dC self-complementary tetranucleotide duplexes has been monitored by proton high resolution nuclear magnetic resonance spectroscopy in 0.1 M phosphate solution at high nucleotide/drug ratios. The large upfield shifts (0.5 to 0.85 ppm) observed at all the proflavine ring nonexchangeable protons on complex formation are consistent with intercalation of the mutagen between base pairs of the tetranucleotide duplex. We have proposed an approximate overlap geometry between the proflavine ring and nearest neighbor base pairs at the intercalation site from a comparison between experimental shifts and those calculated for various stacking orientations. We have compared the binding of actinomycin D, propidium diiodide, and proflavine to self-complementary tetranucleotide sequences dC-dC-dG-dG and dG-dG-dC-dC by UV absorbance changes in the drug bands between 400 and 500 nm. Actinomycin D exhibits a pronounced specificity for sequences with dG-dC sites (dG-dG-dC-dC), while propidium diiodide and proflavine exhibit a specificity for sequences with dC-dG sites (dC-dC-dG-dG). Actinomycin D binds more strongly than propidium diiodide and proflavine to dC-dG-dC-dG (contains dC-dG and dG-dC binding sites), indicative of the additional stabilization from hydrogen bonding and hydrophobic interactions between the pentapeptide lactone rings of actinomycin D and the base pair edges and sugar-phosphate backbone of the tetranucleotide duplex.

  16. Sequence specificity of mutagen-nucleic acid complexes in solution: Intercalation and mutagen-base pair overlap geometries for proflavine binding to dC-dC-dG-dG and dG-dG-dC-dC self-complementary duplexes

    PubMed Central

    Patel, Dinshaw J.; Canuel, Lita L.

    1977-01-01

    The complex formed between the mutagen proflavine and the dC-dC-dG-dG and dG-dG-dC-dC self-complementary tetranucleotide duplexes has been monitored by proton high resolution nuclear magnetic resonance spectroscopy in 0.1 M phosphate solution at high nucleotide/drug ratios. The large upfield shifts (0.5 to 0.85 ppm) observed at all the proflavine ring nonexchangeable protons on complex formation are consistent with intercalation of the mutagen between base pairs of the tetranucleotide duplex. We have proposed an approximate overlap geometry between the proflavine ring and nearest neighbor base pairs at the intercalation site from a comparison between experimental shifts and those calculated for various stacking orientations. We have compared the binding of actinomycin D, propidium diiodide, and proflavine to self-complementary tetranucleotide sequences dC-dC-dG-dG and dG-dG-dC-dC by UV absorbance changes in the drug bands between 400 and 500 nm. Actinomycin D exhibits a pronounced specificity for sequences with dG-dC sites (dG-dG-dC-dC), while propidium diiodide and proflavine exhibit a specificity for sequences with dC-dG sites (dC-dC-dG-dG). Actinomycin D binds more strongly than propidium diiodide and proflavine to dC-dG-dC-dG (contains dC-dG and dG-dC binding sites), indicative of the additional stabilization from hydrogen bonding and hydrophobic interactions between the pentapeptide lactone rings of actinomycin D and the base pair edges and sugar-phosphate backbone of the tetranucleotide duplex. PMID:268613

  17. Solid phase sequencing of biopolymers

    DOEpatents

    Cantor, Charles; Koster, Hubert

    2010-09-28

    This invention relates to methods for detecting and sequencing target nucleic acid sequences, to mass modified nucleic acid probes and arrays of probes useful in these methods, and to kits and systems which contain these probes. Useful methods involve hybridizing the nucleic acids or nucleic acids which represent complementary or homologous sequences of the target to an array of nucleic acid probes. These probes comprise a single-stranded portion, an optional double-stranded portion and a variable sequence within the single-stranded portion. The molecular weights of the hybridized nucleic acids of the set can be determined by mass spectroscopy, and the sequence of the target determined from the molecular weights of the fragments. Nucleic acids whose sequences can be determined include DNA or RNA in biological samples such as patient biopsies and environmental samples. Probes may be fixed to a solid support such as a hybridization chip to facilitate automated molecular weight analysis and identification of the target sequence.

  18. Primary structure of prostaglandin G/H synthase from sheep vesicular gland determined from the complementary DNA sequence.

    PubMed Central

    DeWitt, D L; Smith, W L

    1988-01-01

    Prostaglandin G/H synthase (8,11,14-icosatrienoate, hydrogen-donor:oxygen oxidoreductase, EC 1.14.99.1) catalyzes the first step in the formation of prostaglandins and thromboxanes, the conversion of arachidonic acid to prostaglandin endoperoxides G and H. This enzyme is the site of action of nonsteroidal anti-inflammatory drugs. We have isolated a 2.7-kilobase complementary DNA (cDNA) encompassing the entire coding region of prostaglandin G/H synthase from sheep vesicular glands. This cDNA, cloned from a lambda gt 10 library prepared from poly(A)+ RNA of vesicular glands, hybridizes with a single 2.75-kilobase mRNA species. The cDNA clone was selected using oligonucleotide probes modeled from amino acid sequences of tryptic peptides prepared from the purified enzyme. The full-length cDNA encodes a protein of 600 amino acids, including a signal sequence of 24 amino acids. Identification of the cDNA as coding for prostaglandin G/H synthase is based on comparison of amino acid sequences of seven peptides comprising 103 amino acids with the amino acid sequence deduced from the nucleotide sequence of the cDNA. The molecular weight of the unglycosylated enzyme lacking the signal peptide is 65,621. The synthase is a glycoprotein, and there are three potential sites for N-glycosylation, two of them in the amino-terminal half of the molecule. The serine reported to be acetylated by aspirin is at position 530, near the carboxyl terminus. There is no significant similarity between the sequence of the synthase and that of any other protein in amino acid or nucleotide sequence libraries, and a heme binding site(s) is not apparent from the amino acid sequence. The availability of a full-length cDNA clone coding for prostaglandin G/H synthase should facilitate studies of the regulation of expression of this enzyme and the structural features important for catalysis and for interaction with anti-inflammatory drugs. Images PMID:3125548

  19. Ultrahigh-resolution Fourier transform ion cyclotron resonance mass spectrometry and tandem mass spectrometry for peptide de novo amino acid sequencing for a seven-protein mixture by paired single-residue transposed Lys-N and Lys-C digestion.

    PubMed

    Guan, Xiaoyan; Brownstein, Naomi C; Young, Nicolas L; Marshall, Alan G

    2017-01-30

    Bottom-up tandem mass spectrometry (MS/MS) is regularly used in proteomics to identify proteins from a sequence database. De novo sequencing is also available for sequencing peptides with relatively short sequence lengths. We recently showed that paired Lys-C and Lys-N proteases produce peptides of identical mass and similar retention time, but different tandem mass spectra. Such parallel experiments provide complementary information, and allow for up to 100% MS/MS sequence coverage. Here, we report digestion by paired Lys-C and Lys-N proteases of a seven-protein mixture: human hemoglobin alpha, bovine carbonic anhydrase 2, horse skeletal muscle myoglobin, hen egg white lysozyme, bovine pancreatic ribonuclease, bovine rhodanese, and bovine serum albumin, followed by reversed-phase nanoflow liquid chromatography, collision-induced dissociation, and 14.5 T Fourier transform ion cyclotron resonance mass spectrometry. Matched pairs of product peptide ions of equal precursor mass and similar retention times from each digestion are compared, leveraging single-residue transposed information with independent interferences to confidently identify fragment ion types, residues, and peptides. Selected pairs of product ion mass spectra for de novo sequenced protein segments from each member of the mixture are presented. Pairs of the transposed product ions as well as complementary information from the parallel experiments allow for both high MS/MS coverage for long peptide sequences and high confidence in the amino acid identification. Moreover, the parallel experiments in the de novo sequencing reduce false-positive matches of product ions from the single-residue transposed peptides from the same segment, and thereby further improve the confidence in protein identification. Copyright © 2016 John Wiley & Sons, Ltd. Copyright © 2016 John Wiley & Sons, Ltd.

  20. Weaning Time in Preterm Infants: An Audit of Italian Primary Care Paediatricians.

    PubMed

    Baldassarre, Maria Elisabetta; Di Mauro, Antonio; Pedico, Annarita; Rizzo, Valentina; Capozza, Manuela; Meneghin, Fabio; Lista, Gianluca; Laforgia, Nicola

    2018-05-15

    According to the 2016 Italian National Institute of Statistics (Istat) data in Italy, about 6.7% of all newborns are born prematurely. Due to the lack of data on current complementary feeding in preterm infants in Italy, the aim of the survey was to evaluate individual attitudes of primary care paediatricians, concerning the introduction of complementary foods in preterm infants. An internet-based survey was conducted among primary care paediatricians, working in Italy, regarding (1) timing of the introduction of complementary foods to preterm newborns; (2) type of complementary foods introduced; (3) vitamin D and iron supplementations. A total of 347 primary care Italian paediatricians answered the questionnaire; 44% of responders based the timing of the introduction of solid food exclusively on an infant's age, 18% on an infant's neurodevelopmental status and 4% on the body weight; the remaining 34% based the timing on two or more of these aspects. The type of complementary foods did not comply with an evidence-based sequence; 98% of participants promoted vitamin D supplementation and 89% promoted iron supplementation with great diversity in timing and doses. Due to limited evidence, there is a great heterogeneity in the attitudes of primary care paediatricians concerning the introduction of complementary foods to preterm newborns. Further research is needed to provide evidence-based guidelines regarding weaning preterm newborns.

  1. Inducible Alkylation of DNA by a Quinone Methide-Peptide Nucleic Acid Conjugate†

    PubMed Central

    Liu, Yang; Rokita, Steven E.

    2012-01-01

    The reversibility of alkylation by a quinone methide intermediate (QM) avoids the irreversible consumption that plagues most reagents based on covalent chemistry and allows for site specific reaction that is controlled by the thermodynamics rather than kinetics of target association. This characteristic was originally examined with an oligonucleotide QM conjugate but broad application depends on alternative derivatives that are compatible with a cellular environment. Now, a peptide nucleic acid (PNA) derivative has been constructed and shown to exhibit an equivalent ability to delivery the reactive QM in a controlled manner. This new conjugate demonstrates high selectivity for a complementary sequence of DNA even when challenged with an alternative sequence containing a single T/T mismatch. Alkylation of non-complementary sequences is only possible when a template strand is present to co-localize the conjugate and its target. For efficient alkylation in this example, a single-stranded region of the target is required adjacent to the QM conjugate. Most importantly, the intrastrand self adducts formed between the PNA and its attached QM remained active and reversible over more than eight days in aqueous solution prior to reaction with a chosen target added subsequently. PMID:22243337

  2. Isothermal folding of a light-up bio-orthogonal RNA origami nanoribbon.

    PubMed

    Torelli, Emanuela; Kozyra, Jerzy Wieslaw; Gu, Jing-Ying; Stimming, Ulrich; Piantanida, Luca; Voïtchovsky, Kislon; Krasnogor, Natalio

    2018-05-03

    RNA presents intringuing roles in many cellular processes and its versatility underpins many different applications in synthetic biology. Nonetheless, RNA origami as a method for nanofabrication is not yet fully explored and the majority of RNA nanostructures are based on natural pre-folded RNA. Here we describe a biologically inert and uniquely addressable RNA origami scaffold that self-assembles into a nanoribbon by seven staple strands. An algorithm is applied to generate a synthetic De Bruijn scaffold sequence that is characterized by the lack of biologically active sites and repetitions larger than a predetermined design parameter. This RNA scaffold and the complementary staples fold in a physiologically compatible isothermal condition. In order to monitor the folding, we designed a new split Broccoli aptamer system. The aptamer is divided into two nonfunctional sequences each of which is integrated into the 5' or 3' end of two staple strands complementary to the RNA scaffold. Using fluorescence measurements and in-gel imaging, we demonstrate that once RNA origami assembly occurs, the split aptamer sequences are brought into close proximity forming the aptamer and turning on the fluorescence. This light-up 'bio-orthogonal' RNA origami provides a prototype that can have potential for in vivo origami applications.

  3. Large scale DNA microsequencing device

    DOEpatents

    Foote, Robert S.

    1997-01-01

    A microminiature sequencing apparatus and method provide means for simultaneously obtaining sequences of plural polynucleotide strands. The apparatus comprises a microchip into which plural channels have been etched using standard lithographic procedures and chemical wet etching. The channels include a reaction well and a separating section. Enclosing the channels is accomplished by bonding a transparent cover plate over the apparatus. A first oligonucleotide strand is chemically affixed to the apparatus through an alkyl chain. Subsequent nucleotides are selected by complementary base pair bonding. A target nucleotide strand is used to produce a family of labelled sequencing strands in each channel which are separated in the separating section. During or following separation the sequences are determined using appropriate detection means.

  4. Large scale DNA microsequencing device

    DOEpatents

    Foote, Robert S.

    1999-01-01

    A microminiature sequencing apparatus and method provide means for simultaneously obtaining sequences of plural polynucleotide strands. The apparatus comprises a microchip into which plural channels have been etched using standard lithographic procedures and chemical wet etching. The channels include a reaction well and a separating section. Enclosing the channels is accomplished by bonding a transparent cover plate over the apparatus. A first oligonucleotide strand is chemically affixed to the apparatus through an alkyl chain. Subsequent nucleotides are selected by complementary base pair bonding. A target nucleotide strand is used to produce a family of labelled sequencing strands in each channel which are separated in the separating section. During or following separation the sequences are determined using appropriate detection means.

  5. Large scale DNA microsequencing device

    DOEpatents

    Foote, R.S.

    1999-08-31

    A microminiature sequencing apparatus and method provide means for simultaneously obtaining sequences of plural polynucleotide strands. The apparatus comprises a microchip into which plural channels have been etched using standard lithographic procedures and chemical wet etching. The channels include a reaction well and a separating section. Enclosing the channels is accomplished by bonding a transparent cover plate over the apparatus. A first oligonucleotide strand is chemically affixed to the apparatus through an alkyl chain. Subsequent nucleotides are selected by complementary base pair bonding. A target nucleotide strand is used to produce a family of labelled sequencing strands in each channel which are separated in the separating section. During or following separation the sequences are determined using appropriate detection means. 11 figs.

  6. DETECTION OF DNA DAMAGE USING A FIBEROPTIC BIOSENSOR

    EPA Science Inventory

    A rapid and sensitive fiber optic biosensor assay for radiation-induced DNA damage is reported. For this assay, a biotin-labeled capture oligonucleotide (38 mer) was immobilized to an avidin-coated quartz fiber. Hybridization of a dye-labeled complementary sequence was observed...

  7. Phylogenetic Analysis of Marine Picoplankton Using Tau RNA Sequences.

    DTIC Science & Technology

    1991-02-01

    Pacific Ocean (Aloha Station). DNA prepared from both populations was analyzed by hybridization using kingdom -specific probes complementary to 16S rRNA...euba:-teria. Few eukaryotes, no archaebacteria detected (at low resolution). "* Fluorescendly labeled phylogenetir group-specific oligon ucleotfides

  8. Structure, sequence and expression of the hepatitis delta (δ) viral genome

    NASA Astrophysics Data System (ADS)

    Wang, Kang-Sheng; Choo, Qui-Lim; Weiner, Amy J.; Ou, Jing-Hsiung; Najarian, Richard C.; Thayer, Richard M.; Mullenbach, Guy T.; Denniston, Katherine J.; Gerin, John L.; Houghton, Michael

    1986-10-01

    Biochemical and electron microscopic data indicate that the human hepatitis δ viral agent contains a covalently closed circular and single-stranded RNA genome that has certain similarities with viroid-like agents from plants. The sequence of the viral genome (1,678 nucleotides) has been determined and an open reading frame within the complementary strand has been shown to encode an antigen that binds specifically to antisera from patients with chronic hepatitis δ viral infections.

  9. Post-main-sequence planetary system evolution

    PubMed Central

    Veras, Dimitri

    2016-01-01

    The fates of planetary systems provide unassailable insights into their formation and represent rich cross-disciplinary dynamical laboratories. Mounting observations of post-main-sequence planetary systems necessitate a complementary level of theoretical scrutiny. Here, I review the diverse dynamical processes which affect planets, asteroids, comets and pebbles as their parent stars evolve into giant branch, white dwarf and neutron stars. This reference provides a foundation for the interpretation and modelling of currently known systems and upcoming discoveries. PMID:26998326

  10. Circular codes revisited: a statistical approach.

    PubMed

    Gonzalez, D L; Giannerini, S; Rosa, R

    2011-04-21

    In 1996 Arquès and Michel [1996. A complementary circular code in the protein coding genes. J. Theor. Biol. 182, 45-58] discovered the existence of a common circular code in eukaryote and prokaryote genomes. Since then, circular code theory has provoked great interest and underwent a rapid development. In this paper we discuss some theoretical issues related to the synchronization properties of coding sequences and circular codes with particular emphasis on the problem of retrieval and maintenance of the reading frame. Motivated by the theoretical discussion, we adopt a rigorous statistical approach in order to try to answer different questions. First, we investigate the covering capability of the whole class of 216 self-complementary, C(3) maximal codes with respect to a large set of coding sequences. The results indicate that, on average, the code proposed by Arquès and Michel has the best covering capability but, still, there exists a great variability among sequences. Second, we focus on such code and explore the role played by the proportion of the bases by means of a hierarchy of permutation tests. The results show the existence of a sort of optimization mechanism such that coding sequences are tailored as to maximize or minimize the coverage of circular codes on specific reading frames. Such optimization clearly relates the function of circular codes with reading frame synchronization. Copyright © 2011 Elsevier Ltd. All rights reserved.

  11. How close is close: 16S rRNA sequence identity may not be sufficient to guarantee species identity

    NASA Technical Reports Server (NTRS)

    Fox, G. E.; Wisotzkey, J. D.; Jurtshuk, P. Jr

    1992-01-01

    16S rRNA (genes coding for rRNA) sequence comparisons were conducted with the following three psychrophilic strains: Bacillus globisporus W25T (T = type strain) and Bacillus psychrophilus W16AT, and W5. These strains exhibited more than 99.5% sequence identity and within experimental uncertainty could be regarded as identical. Their close taxonomic relationship was further documented by phenotypic similarities. In contrast, previously published DNA-DNA hybridization results have convincingly established that these strains do not belong to the same species if current standards are used. These results emphasize the important point that effective identity of 16S rRNA sequences is not necessarily a sufficient criterion to guarantee species identity. Thus, although 16S rRNA sequences can be used routinely to distinguish and establish relationships between genera and well-resolved species, very recently diverged species may not be recognizable.

  12. Integrated Bottom-Up and Top-Down Liquid Chromatography-Mass Spectrometry for Characterization of Recombinant Human Growth Hormone Degradation Products.

    PubMed

    Wang, Yu Annie; Wu, Di; Auclair, Jared R; Salisbury, Joseph P; Sarin, Richa; Tang, Yang; Mozdzierz, Nicholas J; Shah, Kartik; Zhang, Anna Fan; Wu, Shiaw-Lin; Agar, Jeffery N; Love, J Christopher; Love, Kerry R; Hancock, William S

    2017-12-05

    With the advent of biosimilars to the U.S. market, it is important to have better analytical tools to ensure product quality from batch to batch. In addition, the recent popularity of using a continuous process for production of biopharmaceuticals, the traditional bottom-up method, alone for product characterization and quality analysis is no longer sufficient. Bottom-up method requires large amounts of material for analysis and is labor-intensive and time-consuming. Additionally, in this analysis, digestion of the protein with enzymes such as trypsin could induce artifacts and modifications which would increase the complexity of the analysis. On the other hand, a top-down method requires a minimum amount of sample and allows for analysis of the intact protein mass and sequence generated from fragmentation within the instrument. However, fragmentation usually occurs at the N-terminal and C-terminal ends of the protein with less internal fragmentation. Herein, we combine the use of the complementary techniques, a top-down and bottom-up method, for the characterization of human growth hormone degradation products. Notably, our approach required small amounts of sample, which is a requirement due to the sample constraints of small scale manufacturing. Using this approach, we were able to characterize various protein variants, including post-translational modifications such as oxidation and deamidation, residual leader sequence, and proteolytic cleavage. Thus, we were able to highlight the complementarity of top-down and bottom-up approaches, which achieved the characterization of a wide range of product variants in samples of human growth hormone secreted from Pichia pastoris.

  13. Titanium Dioxide Nanoparticle-Based Interdigitated Electrodes: A Novel Current to Voltage DNA Biosensor Recognizes E. coli O157:H7.

    PubMed

    Nadzirah, Sh; Azizah, N; Hashim, Uda; Gopinath, Subash C B; Kashif, Mohd

    2015-01-01

    Nanoparticle-mediated bio-sensing promoted the development of novel sensors in the front of medical diagnosis. In the present study, we have generated and examined the potential of titanium dioxide (TiO2) crystalline nanoparticles with aluminium interdigitated electrode biosensor to specifically detect single-stranded E.coli O157:H7 DNA. The performance of this novel DNA biosensor was measured the electrical current response using a picoammeter. The sensor surface was chemically functionalized with (3-aminopropyl) triethoxysilane (APTES) to provide contact between the organic and inorganic surfaces of a single-stranded DNA probe and TiO2 nanoparticles while maintaining the sensing system's physical characteristics. The complement of the target DNA of E. coli O157:H7 to the carboxylate-probe DNA could be translated into electrical signals and confirmed by the increased conductivity in the current-to-voltage curves. The specificity experiments indicate that the biosensor can discriminate between the complementary sequences from the base-mismatched and the non-complementary sequences. After duplex formation, the complementary target sequence can be quantified over a wide range with a detection limit of 1.0 x 10(-13)M. With target DNA from the lysed E. coli O157:H7, we could attain similar sensitivity. Stability of DNA immobilized surface was calculated with the relative standard deviation (4.6%), displayed the retaining with 99% of its original response current until 6 months. This high-performance interdigitated DNA biosensor with high sensitivity, stability and non-fouling on a novel sensing platform is suitable for a wide range of biomolecular interactive analyses.

  14. Titanium Dioxide Nanoparticle-Based Interdigitated Electrodes: A Novel Current to Voltage DNA Biosensor Recognizes E. coli O157:H7

    PubMed Central

    Nadzirah, Sh.; Azizah, N.; Hashim, Uda; Gopinath, Subash C. B.; Kashif, Mohd

    2015-01-01

    Nanoparticle-mediated bio-sensing promoted the development of novel sensors in the front of medical diagnosis. In the present study, we have generated and examined the potential of titanium dioxide (TiO2) crystalline nanoparticles with aluminium interdigitated electrode biosensor to specifically detect single-stranded E.coli O157:H7 DNA. The performance of this novel DNA biosensor was measured the electrical current response using a picoammeter. The sensor surface was chemically functionalized with (3-aminopropyl) triethoxysilane (APTES) to provide contact between the organic and inorganic surfaces of a single-stranded DNA probe and TiO2 nanoparticles while maintaining the sensing system’s physical characteristics. The complement of the target DNA of E. coli O157:H7 to the carboxylate-probe DNA could be translated into electrical signals and confirmed by the increased conductivity in the current-to-voltage curves. The specificity experiments indicate that the biosensor can discriminate between the complementary sequences from the base-mismatched and the non-complementary sequences. After duplex formation, the complementary target sequence can be quantified over a wide range with a detection limit of 1.0 x 10-13M. With target DNA from the lysed E. coli O157:H7, we could attain similar sensitivity. Stability of DNA immobilized surface was calculated with the relative standard deviation (4.6%), displayed the retaining with 99% of its original response current until 6 months. This high-performance interdigitated DNA biosensor with high sensitivity, stability and non-fouling on a novel sensing platform is suitable for a wide range of biomolecular interactive analyses. PMID:26445455

  15. High-Resolution Sequence-Function Mapping of Full-Length Proteins

    PubMed Central

    Kowalsky, Caitlin A.; Klesmith, Justin R.; Stapleton, James A.; Kelly, Vince; Reichkitzer, Nolan; Whitehead, Timothy A.

    2015-01-01

    Comprehensive sequence-function mapping involves detailing the fitness contribution of every possible single mutation to a gene by comparing the abundance of each library variant before and after selection for the phenotype of interest. Deep sequencing of library DNA allows frequency reconstruction for tens of thousands of variants in a single experiment, yet short read lengths of current sequencers makes it challenging to probe genes encoding full-length proteins. Here we extend the scope of sequence-function maps to entire protein sequences with a modular, universal sequence tiling method. We demonstrate the approach with both growth-based selections and FACS screening, offer parameters and best practices that simplify design of experiments, and present analytical solutions to normalize data across independent selections. Using this protocol, sequence-function maps covering full sequences can be obtained in four to six weeks. Best practices introduced in this manuscript are fully compatible with, and complementary to, other recently published sequence-function mapping protocols. PMID:25790064

  16. Aptamer-based electrochemical sensors with aptamer-complementary DNA oligonucleotides as probe.

    PubMed

    Lu, Ying; Li, Xianchan; Zhang, Limin; Yu, Ping; Su, Lei; Mao, Lanqun

    2008-03-15

    This study describes a facile and general strategy for the development of aptamer-based electrochemical sensors with a high specificity toward the targets and a ready regeneration feature. Very different from the existing strategies for the development of electrochemical aptasensors with the aptamers as the probes, the strategy proposed here is essentially based on the utilization of the aptamer-complementary DNA (cDNA) oligonucleotides as the probes for electrochemical sensing. In this context, the sequences at both ends of the cDNA are tailor-made to be complementary and both the redox moiety (i.e., ferrocene in this study) and thiol group are labeled onto the cDNA. The labeled cDNA are hybridized with their respective aptamers (i.e., ATP- and thrombin-binding aptamers in this study) to form double-stranded DNA (ds-DNA) and the electrochemical aptasensors are prepared by self-assembling the labeled ds-DNA onto Au electrodes. Upon target binding, the aptamers confined onto electrode surface dissociate from their respective cDNA oligonucleotides into the solution and the single-stranded cDNA could thus tend to form a hairpin structure through the hybridization of the complementary sequences at both its ends. Such a conformational change of the cDNA resulting from the target binding-induced dissociation of the aptamers essentially leads to the change in the voltammetric signal of the redox moiety labeled onto the cDNA and thus constitutes the mechanism for the electrochemical aptasensors for specific target sensing. The aptasensors demonstrated here with the cDNA as the probe are readily regenerated and show good responses toward the targets. This study may offer a new and relatively general approach to electrochemical aptasensors with good analytical properties and potential applications.

  17. Electrochemical detection of sequence-specific DNA based on formation of G-quadruplex-hemin through continuous hybridization chain reaction.

    PubMed

    Sun, Xiaofan; Chen, Haohan; Wang, Shuling; Zhang, Yiping; Tian, Yaping; Zhou, Nandi

    2018-08-27

    A high-sensitive detection of sequence-specific DNA was established based on the formation of G-quadruplex-hemin complex through continuous hybridization chain reaction (HCR). Taking HIV DNA sequence as an example, a capture probe complementary to part of HIV DNA was firstly self-assembled onto the surface of Au electrode. Then a specially designed assistant probe with both terminals complementary to the target DNA and a G-quadruplex-forming sequence in the center was introduced into the detection solution. In the presence of both the target DNA and the assistant probe, the target DNA can be captured on the electrode surface and then a continuous HCR can be conducted due to the mutual recognition of the target DNA and the assistant probe, leading to the formation of a large number of G-quadruplex on the electrode surface. With the help of hemin, a pronounced electrochemical signal can be observed in differential pulse voltammetry (DPV), due to the formation of G-quadruplex-hemin complex. The peak current is linearly related with the logarithm of the concentration of the target DNA in the range from 10 fM to 10 pM. The electrochemical sensor has high selectivity to clearly discriminate single-base mismatched and three-base mismatched sequences from the original HIV DNA sequence. Moreover, the established DNA sensor was challenged by detection of HIV DNA in human serum samples, which showed the low detection limit of 6.3 fM. Thus it has great application prospect in the field of clinical diagnosis and environmental monitoring. Copyright © 2018 Elsevier B.V. All rights reserved.

  18. A label-free fluorescent direct detection of live Salmonella typhimurium using cascade triple trigger sequences-regenerated strand displacement amplification and hairpin template-generated-scaffolded silver nanoclusters.

    PubMed

    Zhang, Peng; Liu, Hui; Li, Xiaocheng; Ma, Suzhen; Men, Shuai; Wei, Heng; Cui, Jingjing; Wang, Hongning

    2017-01-15

    The harm of Salmonella typhimurium (S. typhimurium) to public health mainly by the consumption of contaminated agricultural products or water stresses an urgent need for rapid detection methods to help control the spread of S. typhimurium. In this work, an intelligently designed sensor system took creative advantage of triple trigger sequences-regenerated strand displacement amplification and self-protective hairpin template-generated-scaffolded silver nanoclusters (AgNCs) for the first time. In the presence of live S. typhimurium, single-stranded trigger sequences were released from aptamer-trigger sequences complex, initiating a branch migration to open the hairpin template I containing complementary scaffolds of AgNCs. Then the first strand displacement amplification was induced to produce numerous scaffolds of AgNCs and reporter strands which initiated a branch migration to open the hairpin template II containing complementary scaffolds of AgNCs. Then the second strand displacement amplification was induced to generate numerous scaffolds of AgNCs and trigger sequences which initiated the third branch migration and strand displacement amplification to produce numerous scaffolds of AgNCs and reporter strands in succession. Cyclically, the reproduction of the trigger sequences and cascade successive production of scaffolds were achieved successfully, forming highly fluorescent AgNCs, thus providing significantly enhanced fluorescent signals to achieve ultrasensitive detection of live S. typhimurium down to 50 CFU/mL with a linear range from 10 2 to 10 7 CFU/mL. It is the first report on a fluorescent biosensor for detecting viable S. typhimurium directly, which can distinguish from heat denatured S. typhimurium. And it develops a new strategy to generate the DNA-scaffolds for forming AgNCs. Copyright © 2016 Elsevier B.V. All rights reserved.

  19. Circular RNAs: Unexpected outputs of many protein-coding genes

    PubMed Central

    Wilusz, Jeremy E.

    2017-01-01

    ABSTRACT Pre-mRNAs from thousands of eukaryotic genes can be non-canonically spliced to generate circular RNAs, some of which accumulate to higher levels than their associated linear mRNA. Recent work has revealed widespread mechanisms that dictate whether the spliceosome generates a linear or circular RNA. For most genes, circular RNA biogenesis via backsplicing is far less efficient than canonical splicing, but circular RNAs can accumulate due to their long half-lives. Backsplicing is often initiated when complementary sequences from different introns base pair and bring the intervening splice sites close together. This process is further regulated by the combinatorial action of RNA binding proteins, which allow circular RNAs to be expressed in unique patterns. Some genes do not require complementary sequences to generate RNA circles and instead take advantage of exon skipping events. It is still unclear what most mature circular RNAs do, but future investigations into their functions will be facilitated by recently described methods to modulate circular RNA levels. PMID:27571848

  20. Identification of antisense nucleic acid hybridization sites in mRNA molecules with self-quenching fluorescent reporter molecules

    PubMed Central

    Gifford, Lida K.; Opalinska, Joanna B.; Jordan, David; Pattanayak, Vikram; Greenham, Paul; Kalota, Anna; Robbins, Michelle; Vernovsky, Kathy; Rodriguez, Lesbeth C.; Do, Bao T.; Lu, Ponzy; Gewirtz, Alan M.

    2005-01-01

    We describe a physical mRNA mapping strategy employing fluorescent self-quenching reporter molecules (SQRMs) that facilitates the identification of mRNA sequence accessible for hybridization with antisense nucleic acids in vitro and in vivo, real time. SQRMs are 20–30 base oligodeoxynucleotides with 5–6 bp complementary ends to which a 5′ fluorophore and 3′ quenching group are attached. Alone, the SQRM complementary ends form a stem that holds the fluorophore and quencher in contact. When the SQRM forms base pairs with its target, the structure separates the fluorophore from the quencher. This event can be reported by fluorescence emission when the fluorophore is excited. The stem–loop of the SQRM suggests that SQRM be made to target natural stem–loop structures formed during mRNA synthesis. The general utility of this method is demonstrated by SQRM identification of targetable sequence within c-myb and bcl-6 mRNA. Corresponding antisense oligonucleotides reduce these gene products in cells. PMID:15718294

  1. Programmable hydrogels for controlled cell catch and release using hybridized aptamers and complementary sequences.

    PubMed

    Zhang, Zhaoyang; Chen, Niancao; Li, Shihui; Battig, Mark R; Wang, Yong

    2012-09-26

    The ability to regulate cell-material interactions is important in various applications such as regenerative medicine and cell separation. This study successfully demonstrates that the binding states of cells on a hydrogel surface can be programmed by using hybridized aptamers and triggering complementary sequences (CSs). In the absence of the triggering CSs, the aptamers exhibit a stable, hybridized state in the hydrogel for cell-type-specific catch. In the presence of the triggering CSs, the aptamers are transformed into a new hybridized state that leads to the rapid dissociation of the aptamers from the hydrogel. As a result, the cells are released from the hydrogel. The entire procedure of cell catch and release during the transformation of the aptamers is biocompatible and does not involve any factor destructive to either the cells or the hydrogel. Thus, the programmable hydrogel is regenerable and can be applied to a new round of cell catch and release when needed.

  2. Dynamic covalent chemistry enables formation of antimicrobial peptide quaternary assemblies in a completely abiotic manner

    NASA Astrophysics Data System (ADS)

    Reuther, James F.; Dees, Justine L.; Kolesnichenko, Igor V.; Hernandez, Erik T.; Ukraintsev, Dmitri V.; Guduru, Rusheel; Whiteley, Marvin; Anslyn, Eric V.

    2018-01-01

    Naturally occurring peptides and proteins often use dynamic disulfide bonds to impart defined tertiary/quaternary structures for the formation of binding pockets with uniform size and function. Although peptide synthesis and modification are well established, controlling quaternary structure formation remains a significant challenge. Here, we report the facile incorporation of aryl aldehyde and acyl hydrazide functionalities into peptide oligomers via solid-phase copper-catalysed azide-alkyne cycloaddition (SP-CuAAC) click reactions. When mixed, these complementary functional groups rapidly react in aqueous media at neutral pH to form peptide-peptide intermolecular macrocycles with highly tunable ring sizes. Moreover, sequence-specific figure-of-eight, dumbbell-shaped, zipper-like and multi-loop quaternary structures were formed selectively. Controlling the proportions of reacting peptides with mismatched numbers of complementary reactive groups results in the formation of higher-molecular-weight sequence-defined ladder polymers. This also amplified antimicrobial effectiveness in select cases. This strategy represents a general approach to the creation of complex abiotic peptide quaternary structures.

  3. Antisense phosphorothioate oligonucleotides: selective killing of the intracellular parasite Leishmania amazonensis.

    PubMed

    Ramazeilles, C; Mishra, R K; Moreau, S; Pascolo, E; Toulmé, J J

    1994-08-16

    We targeted the mini-exon sequence, present at the 5' end of every mRNA of the protozoan parasite Leishmania amazonensis, by phosphorothioate oligonucleotides. A complementary 16-mer (16PS) was able to kill amastigotes--the intracellular stage of the parasite--in murine macrophages in culture. After 24 hr of incubation with 10 microM 16PS, about 30% infected macrophages were cured. The oligomer 16PS acted through antisense hybridization in a sequence-dependent way; no effect on parasites was observed with noncomplementary phosphorothioate oligonucleotides. The antisense oligonucleotide 16PS was a selective killer of the protozoans without any detrimental effect to the host macrophage. Using 16PS linked to a palmitate chain, which enabled it to complex with low density lipoproteins, improved the leishmanicidal efficiency on intracellular amastigotes, probably due to increased endocytosis. Phosphorothioate oligonucleotides complementary to the intron part of the mini-exon pre-RNA were also effective, suggesting that antisense oligomers could prevent trans-splicing in these parasites.

  4. Aggregating and Predicting Sequence Labels from Crowd Annotations

    PubMed Central

    Nguyen, An T.; Wallace, Byron C.; Li, Junyi Jessy; Nenkova, Ani; Lease, Matthew

    2017-01-01

    Despite sequences being core to NLP, scant work has considered how to handle noisy sequence labels from multiple annotators for the same text. Given such annotations, we consider two complementary tasks: (1) aggregating sequential crowd labels to infer a best single set of consensus annotations; and (2) using crowd annotations as training data for a model that can predict sequences in unannotated text. For aggregation, we propose a novel Hidden Markov Model variant. To predict sequences in unannotated text, we propose a neural approach using Long Short Term Memory. We evaluate a suite of methods across two different applications and text genres: Named-Entity Recognition in news articles and Information Extraction from biomedical abstracts. Results show improvement over strong baselines. Our source code and data are available online1. PMID:29093611

  5. Complementarity to an miRNA seed region is sufficient to induce moderate repression of a target transcript in the unicellular green alga Chlamydomonas reinhardtii.

    PubMed

    Yamasaki, Tomohito; Voshall, Adam; Kim, Eun-Jeong; Moriyama, Etsuko; Cerutti, Heriberto; Ohama, Takeshi

    2013-12-01

    MicroRNAs (miRNAs) are 20-24 nt non-coding RNAs that play important regulatory roles in a broad range of eukaryotes by pairing with mRNAs to direct post-transcriptional repression. The mechanistic details of miRNA-mediated post-transcriptional regulation have been well documented in multicellular model organisms. However, this process remains poorly studied in algae such as Chlamydomonas reinhardtii, and specific features of miRNA biogenesis, target mRNA recognition and subsequent silencing are not well understood. In this study, we report on the characterization of a Chlamydomonas miRNA, cre-miR1174.2, which is processed from a near-perfect hairpin RNA. Using Gaussia luciferase (gluc) reporter genes, we have demonstrated that cre-miR1174.2 is functional in Chlamydomonas and capable of triggering site-specific cleavage at the center of a perfectly complementary target sequence. A mismatch tolerance test assay, based on pools of transgenic strains, revealed that target hybridization to nucleotides of the seed region, at the 5' end of an miRNA, was sufficient to induce moderate repression of expression. In contrast, pairing to the 3' region of the miRNA was not critical for silencing. Our results suggest that the base-pairing requirements for small RNA-mediated repression in C. reinhardtii are more similar to those of metazoans compared with the extensive complementarity that is typical of land plants. Individual Chlamydomonas miRNAs may potentially modulate the expression of numerous endogenous targets as a result of these relaxed base-pairing requirements. © 2013 The Authors The Plant Journal © 2013 John Wiley & Sons Ltd.

  6. [Correlation of codon biases and potential secondary structures with mRNA translation efficiency in unicellular organisms].

    PubMed

    Vladimirov, N V; Likhoshvaĭ, V A; Matushkin, Iu G

    2007-01-01

    Gene expression is known to correlate with degree of codon bias in many unicellular organisms. However, such correlation is absent in some organisms. Recently we demonstrated that inverted complementary repeats within coding DNA sequence must be considered for proper estimation of translation efficiency, since they may form secondary structures that obstruct ribosome movement. We have developed a program for estimation of potential coding DNA sequence expression in defined unicellular organism using its genome sequence. The program computes elongation efficiency index. Computation is based on estimation of coding DNA sequence elongation efficiency, taking into account three key factors: codon bias, average number of inverted complementary repeats, and free energy of potential stem-loop structures formed by the repeats. The influence of these factors on translation is numerically estimated. An optimal proportion of these factors is computed for each organism individually. Quantitative translational characteristics of 384 unicellular organisms (351 bacteria, 28 archaea, 5 eukaryota) have been computed using their annotated genomes from NCBI GenBank. Five potential evolutionary strategies of translational optimization have been determined among studied organisms. A considerable difference of preferred translational strategies between Bacteria and Archaea has been revealed. Significant correlations between elongation efficiency index and gene expression levels have been shown for two organisms (S. cerevisiae and H. pylori) using available microarray data. The proposed method allows to estimate numerically the coding DNA sequence translation efficiency and to optimize nucleotide composition of heterologous genes in unicellular organisms. http://www.mgs.bionet.nsc.ru/mgs/programs/eei-calculator/.

  7. Genome organisation and sequence comparison suggest intraspecies incongruence in M RNA of Watermelon bud necrosis virus.

    PubMed

    Kumar, Rakesh; Mandal, B; Geetanjali, A S; Jain, R K; Jaiwal, P K

    2010-08-01

    Watermelon bud necrosis virus (WBNV), a member of the genus Tospovirus, family Bunyaviridae is an important viral pathogen in watermelon cultivation in India. The complete genome sequence properties of WBNV are not available. In the present study, the complete M RNA sequence and the genome organisation of a WBNV isolate infecting watermelon in Delhi (WBNV-wDel) were determined. The M RNA was 4,794 nucleotides (nt) long and potentially coded for a movement protein (NSm) of 34.22 kDa (307 amino acids) on the viral sense strand and a Gn/Gc glycoprotein precursor of 127.15 kDa (1,121 amino acids) on the complementary strand. The two open reading frames were separated by an intergenic region of 402 nt. The 5' and 3' untranslated regions were 55 and 47 nt long, respectively, containing complementary termini typical of tospoviruses. WBNV-wDel was most closely related (79.1% identity) to Groundnut bud necrosis virus, an important tospovirus that occurs in several crops in India, and was different (63.3-75.2% identity) from the other cucurbit-infecting tospoviruses known to occur in Taiwan and Japan. Sequence analysis of NSm and Gn/Gc revealed phylogenetic incongruence between WBNV-wDel and another isolate originating from central India (WBNV-Wm-Som isolate). The Wm-Som isolate showed evolutionary divergence from the wDel isolate in the Gn/Gc protein (74.6% identity) potentially due to recombination with the other tospoviruses that are known to occur in India. This is the first report of a comparison of complete sequences of M RNA of WBNV.

  8. Results with Complementary Food Using Local Food Ingredients.

    PubMed

    Ahmed, Tahmeed; Islam, Munirul; Choudhury, Nuzhat; Hossain, Iqbal; Huq, Sayeeda; Mahfuz, Mustafa; Sarker, Shafiqul Alam

    2017-01-01

    Appropriate complementary food is a must for optimum growth of infants and children. The food should be diverse and be given in sufficient quantities 2-4 times a day depending upon age. Poverty, food insecurity, and lack of awareness regarding the choice of nutritious food ingredients are deterrents to optimum complementary feeding. In Bangladesh, 77% of children do not receive appropriate complementary food and, hence, the high prevalence of childhood malnutrition. We developed ready-to-use complementary foods (RUCFs) using locally available food ingredients, rice/lentil and chickpea, which conform to standard specifications. These foods were found to be acceptable by children and their mothers compared to the Pushti packet, the cereal-based supplement used in the erstwhile National Nutrition Program of Bangladesh. In a cluster-randomized community-based trial in rural Bangladesh among more than 5,000 children, the efficacy of rice/lentil- and chickpea-based RUCFs was compared with another commonly used supplementary food called wheat-soy blend++ (WSB++) and a commercial product called Plumpy'doz. Deceleration in length for age was significantly lower (by 0.02-0.04/month) in the rice/lentil, Plumpy'doz, and chickpea groups compared to the control group at 18 months of age. Weight-for-length z-score decline was lower only in Plumpy'doz and chickpea groups. WSB++ was not different from the control group. In children who received chickpea RUCF or Plumpy'doz, the prevalence of stunting was 5-6% lower at 18 months. These foods can be used to prevent or treat malnutrition among children, particularly those from food-insecure households. © 2017 Nestec Ltd., Vevey/S. Karger AG, Basel.

  9. Problem-Solving Test: Conditional Gene Targeting Using the Cre/loxP Recombination System

    ERIC Educational Resources Information Center

    Szeberényi, József

    2013-01-01

    Terms to be familiar with before you start to solve the test: gene targeting, knock-out mutation, bacteriophage, complementary base-pairing, homologous recombination, deletion, transgenic organisms, promoter, polyadenylation element, transgene, DNA replication, RNA polymerase, Shine-Dalgarno sequence, restriction endonuclease, polymerase chain…

  10. Draft versus finished sequence data for DNA and protein diagnostic signature development

    PubMed Central

    Gardner, Shea N.; Lam, Marisa W.; Smith, Jason R.; Torres, Clinton L.; Slezak, Tom R.

    2005-01-01

    Sequencing pathogen genomes is costly, demanding careful allocation of limited sequencing resources. We built a computational Sequencing Analysis Pipeline (SAP) to guide decisions regarding the amount of genomic sequencing necessary to develop high-quality diagnostic DNA and protein signatures. SAP uses simulations to estimate the number of target genomes and close phylogenetic relatives (near neighbors or NNs) to sequence. We use SAP to assess whether draft data are sufficient or finished sequencing is required using Marburg and variola virus sequences. Simulations indicate that intermediate to high-quality draft with error rates of 10−3–10−5 (∼8× coverage) of target organisms is suitable for DNA signature prediction. Low-quality draft with error rates of ∼1% (3× to 6× coverage) of target isolates is inadequate for DNA signature prediction, although low-quality draft of NNs is sufficient, as long as the target genomes are of high quality. For protein signature prediction, sequencing errors in target genomes substantially reduce the detection of amino acid sequence conservation, even if the draft is of high quality. In summary, high-quality draft of target and low-quality draft of NNs appears to be a cost-effective investment for DNA signature prediction, but may lead to underestimation of predicted protein signatures. PMID:16243783

  11. A nanophosphor-based method for selective DNA recovery in Synthosomes.

    PubMed

    Nallani, Madhavan; Onaca, Ozana; Gera, Nimish; Hildenbrand, Karlheinz; Hoheisel, Werner; Schwaneberg, Ulrich

    2006-01-01

    A nanocompartment system composed of an ABA triblock copolymer, where A is poly(dimethylsiloxane) and B is poly(2-methyloxazoline), has been developed for selective recovery and detection of DNA. Translocation of TAMRA-labeled complementary primers into the nanocompartment system has been achieved through two deletion mutants (FhuA Delta1-129; FhuA Delta1-160) of the channel protein FhuA. Translocation was monitored by fluorescence resonance energy transfer through hybridization of the TAMRA-labeled primer to the complementary sequence of a nanophosphor-DNA-conjugate, which reduces its half-life (FhuA Delta1-129, 16.0% reduced; FhuA Delta1-160, 39.0% reduced).

  12. Complementary and partially complementary DNA duplexes tethered to a functionalized substrate: a molecular dynamics approach to biosensing.

    PubMed

    Monti, Susanna; Cacelli, Ivo; Ferretti, Alessandro; Prampolini, Giacomo; Barone, Vincenzo

    2011-07-21

    Molecular dynamics simulations (90 ns) of different DNA complexes attached to a functionalized substrate in solution were performed in order to clarify the behavior of mismatched DNA sequences captured by a tethered DNA probe (biochip). Examination of the trajectories revealed that the substrate influence and a series of cooperative events, including recognition, reorientation and reorganization of the bases, could induce the formation of stable duplexes having non-canonical arrangements. Major adjustment of the structures was observed when the mutated base was located in the end region of the chain close to the surface. This journal is © the Owner Societies 2011

  13. DNA Sequences from Formalin-Fixed Nematodes: Integrating Molecular and Morphological Approaches to Taxonomy

    PubMed Central

    Thomas, W. Kelley; Vida, J. T.; Frisse, Linda M.; Mundo, Manuel; Baldwin, James G.

    1997-01-01

    To effectively integrate DNA sequence analysis and classical nematode taxonomy, we must be able to obtain DNA sequences from formalin-fixed specimens. Microdissected sections of nematodes were removed from specimens fixed in formalin, using standard protocols and without destroying morphological features. The fixed sections provided sufficient template for multiple polymerase chain reaction-based DNA sequence analyses. PMID:19274156

  14. ddClone: joint statistical inference of clonal populations from single cell and bulk tumour sequencing data.

    PubMed

    Salehi, Sohrab; Steif, Adi; Roth, Andrew; Aparicio, Samuel; Bouchard-Côté, Alexandre; Shah, Sohrab P

    2017-03-01

    Next-generation sequencing (NGS) of bulk tumour tissue can identify constituent cell populations in cancers and measure their abundance. This requires computational deconvolution of allelic counts from somatic mutations, which may be incapable of fully resolving the underlying population structure. Single cell sequencing (SCS) is a more direct method, although its replacement of NGS is impeded by technical noise and sampling limitations. We propose ddClone, which analytically integrates NGS and SCS data, leveraging their complementary attributes through joint statistical inference. We show on real and simulated datasets that ddClone produces more accurate results than can be achieved by either method alone.

  15. Large scale DNA microsequencing device

    DOEpatents

    Foote, R.S.

    1997-08-26

    A microminiature sequencing apparatus and method provide a means for simultaneously obtaining sequences of plural polynucleotide strands. The apparatus cosists of a microchip into which plural channels have been etched using standard lithographic procedures and chemical wet etching. The channels include a reaction well and a separating section. Enclosing the channels is accomplished by bonding a transparent cover plate over the apparatus. A first oligonucleotide strand is chemically affixed to the apparatus through an alkyl chain. Subsequent nucleotides are selected by complementary base pair bonding. A target nucleotide strand is used to produce a family of labelled sequencing strands in each channel which are separated in the separating section. During or following separation the sequences are determined using appropriate detection means. 17 figs.

  16. Isolates of viral hemorrhagic septicemia virus from North America and Europe can be detected and distinguished by DNA probes

    USGS Publications Warehouse

    Batts, W.N.; Arakawa, C.K.; Bernard, J.; Winton, J.R.

    1993-01-01

    Biotinylated DNA probes were constructed to hybndize with speclfic sequences within the messenger RNA (mRNA) of the nucleoprotein (N) gene of vlral hemorrhagic septicemia virus (VHSV) reference strains from Europe (07-71) and North Arnenca (Makah) Probes were synthesized that were complementary to (1) a 29-nucleotide sequence near the center of the N gene conlmon to both the 07-71 and Makah reference strains of the virus (2) a unique 28- nucleotide sequence that followed the open readng frame of the Makah N gene mRNA most of which was absent In the 07-71 strain, and (3) a 22-nucleobde sequence wthin the 07-71 N gene that had 6 nllsmatches \

  17. THE INTERFERENCE OF INACTIVE SERUM AND EGG-WHITE IN THE PHENOMENON OF COMPLEMENT FIXATIONS.

    PubMed

    Noguchi, H; Bronfenbrenner, J

    1911-01-05

    The fixing property of a specific precipitate and of syphilitic serum in the presence of certain antigenic lipoids, can be removed by adding certain non-complementary proteins of blood serum or hen's egg. This disappearance of the complementary activity in the syphilis reaction, as well as in the true Bordet-Gengou reaction, is a phenomenon which incidentally accompanies the fixation of certain serum constituents, some of which possess a complementary activity. The presence or absence of the complementary property in these protein components does not influence fixation. Whether the disappearance of the complementary activity during the phenomenon of so-called fixation is due to a mechanical precipitation of the molecules through absorption or whether it is due to a physico-chemical alteration of the active molecules, is unknown. It is more probable that a chemical interaction takes place in the case of the syphilis reaction. Certain sera, for example, those derived from man and goat, show a low fixability. It is interesting to note that the fixability is gradually diminished when these sera and egg-white are heated to a temperature above 56 degrees C., and totally disappears at 85 degrees C. The coagulation of proteins with absolute alcohol or by boiling, destroys their interfering property. The fact that the fixation is not selectively directed towards complement, has a very important meaning for exact serology. The one-sided accuracy as to the complementary unity is no longer sufficient for quantitative work. Both the complementary and the volumetric unity of a serum serving as the source of complement should be taken into consideration. Besides, the fixability of the sera of various species of animals must also be considered. From these facts a formula may be derived for deciding the degree of suitableness of a serum. see PDF for Equation X is the degree of suitableness; K, the species constant for the fixability; P, the complementary activity; and V, the volume of serum. It will be seen that the suitableness is proportional to the fixability constant and the complementary unity, and inversely proportional to the volume of serum employed. As to what species yields the largest value for X, we refer the reader to our studies published elsewhere.

  18. Rapid high-throughput analysis of ochratoxin A by the self-assembly of DNAzyme-aptamer conjugates in wine.

    PubMed

    Yang, Cheng; Lates, Vasilica; Prieto-Simón, Beatriz; Marty, Jean-Louis; Yang, Xiurong

    2013-11-15

    We report a new label-free colorimetric aptasensor based on DNAzyme-aptamer conjugate for rapid and high-throughput detection of Ochratoxin A (OTA, a possible human carcinogen, group 2B) in wine. Two oligonucleotides were designed for this detection. One is N1 for biorecognition, which includes two adjacent sequences: the OTA-specific aptamer sequence and the horseradish peroxidase (HRP)-mimicking DNAzyme sequence. The other is a blocking DNA (B2), which is partially complementary to a part of the OTA aptamer and partially complementary to a part of the DNAzyme. The existence of OTA reduces the hybridization between N1 and B2. Thus, the activity of the non-hybridized DNAzyme is linearly correlated with the concentration of OTA up to 30 nM with a limit of detection of 4 nM (3σ). Meanwhile, a double liquid-liquid extraction (LLE) method is accordingly developed to purify OTA from wine. Compared with the existing HPLC-FD or immunoassay methods, the proposed strategy presents the most appropriate balance between accuracy and facility, resulting in a considerable improvement of real-time quality control, and thereby, preventing chronic poisoning caused by OTA contained red wine. Copyright © 2013 Elsevier B.V. All rights reserved.

  19. Rapid detection of microbial DNA by a novel isothermal genome exponential amplification reaction (GEAR) assay.

    PubMed

    Prithiviraj, Jothikumar; Hill, Vincent; Jothikumar, Narayanan

    2012-04-20

    In this study we report the development of a simple target-specific isothermal nucleic acid amplification technique, termed genome exponential amplification reaction (GEAR). Escherichia coli was selected as the microbial target to demonstrate the GEAR technique as a proof of concept. The GEAR technique uses a set of four primers; in the present study these primers targeted 5 regions on the 16S rRNA gene of E. coli. The outer forward and reverse Tab primer sequences are complementary to each other at their 5' end, whereas their 3' end sequences are complementary to their respective target nucleic acid sequences. The GEAR assay was performed at a constant temperature 60 °C and monitored continuously in a real-time PCR instrument in the presence of an intercalating dye (SYTO 9). The GEAR assay enabled amplification of as few as one colony forming units of E. coli per reaction within 30 min. We also evaluated the GEAR assay for rapid identification of bacterial colonies cultured on agar media directly in the reaction without DNA extraction. Cells from E. coli colonies were picked and added directly to GEAR assay mastermix without prior DNA extraction. DNA in the cells could be amplified, yielding positive results within 15 min. Published by Elsevier Inc.

  20. Molecular analysis of RAPD DNA based markers: their potential use for the detection of genetic variability in jojoba (Simmondsia chinensis L Schneider).

    PubMed

    Amarger, V; Mercier, L

    1995-01-01

    We have applied the recently developed technique of random amplified polymorphic DNA (RAPD) for the discrimination between two jojoba clones at the genomic level. Among a set of 30 primers tested, a simple reproducible pattern with three distinct fragments for clone D and two distinct fragments for clone E was obtained with primer OPB08. Since RAPD products are the results of arbitrarily priming events and because a given primer can amplify a number of non-homologous sequences, we wondered whether or not RAPD bands, even those of similar size, were derived from different loci in the two clones. To answer this question, two complementary approaches were used: i) cloning and sequencing of the amplification products from clone E; and ii) complementary Southern analysis of RAPD gels using cloned or amplified fragments (directly recovered from agarose gels) as RFLP probes. The data reported here show that the RAPD reaction generates multiple amplified fragments. Some fragments, although resolved as a single band on agarose gels, contain different DNA species of the same size. Furthermore, it appears that the cloned RAPD products of known sequence that do not target repetitive DNA can be used as hybridization probes in RFLP to detect a polymorphism among individuals.

  1. Development of a Fluorescence Resonance Energy Transfer (FRET)-Based DNA Biosensor for Detection of Synthetic Oligonucleotide of Ganoderma boninense.

    PubMed

    Bakhori, Noremylia Mohd; Yusof, Nor Azah; Abdullah, Abdul Halim; Hussein, Mohd Zobir

    2013-12-12

    An optical DNA biosensor based on fluorescence resonance energy transfer (FRET) utilizing synthesized quantum dot (QD) has been developed for the detection of specific-sequence of DNA for Ganoderma boninense, an oil palm pathogen. Modified QD that contained carboxylic groups was conjugated with a single-stranded DNA probe (ssDNA) via amide-linkage. Hybridization of the target DNA with conjugated QD-ssDNA and reporter probe labeled with Cy5 allows for the detection of related synthetic DNA sequence of Ganoderma boninense gene based on FRET signals. Detection of FRET emission before and after hybridization was confirmed through the capability of the system to produce FRET at 680 nm for hybridized sandwich with complementary target DNA. No FRET emission was observed for non-complementary system. Hybridization time, temperature and effect of different concentration of target DNA were studied in order to optimize the developed system. The developed biosensor has shown high sensitivity with detection limit of 3.55 × 10-9 M. TEM results show that the particle size of QD varies in the range between 5 to 8 nm after ligand modification and conjugation with ssDNA. This approach is capable of providing a simple, rapid and sensitive method for detection of related synthetic DNA sequence of Ganoderma boninense.

  2. Development of a Fluorescence Resonance Energy Transfer (FRET)-Based DNA Biosensor for Detection of Synthetic Oligonucleotide of Ganoderma boninense.

    PubMed

    Mohd Bakhori, Noremylia; Yusof, Nor Azah; Abdullah, Abdul Halim; Hussein, Mohd Zobir

    2013-12-01

    An optical DNA biosensor based on fluorescence resonance energy transfer (FRET) utilizing synthesized quantum dot (QD) has been developed for the detection of specific-sequence of DNA for Ganoderma boninense, an oil palm pathogen. Modified QD that contained carboxylic groups was conjugated with a single-stranded DNA probe (ssDNA) via amide-linkage. Hybridization of the target DNA with conjugated QD-ssDNA and reporter probe labeled with Cy5 allows for the detection of related synthetic DNA sequence of Ganoderma boninense gene based on FRET signals. Detection of FRET emission before and after hybridization was confirmed through the capability of the system to produce FRET at 680 nm for hybridized sandwich with complementary target DNA. No FRET emission was observed for non-complementary system. Hybridization time, temperature and effect of different concentration of target DNA were studied in order to optimize the developed system. The developed biosensor has shown high sensitivity with detection limit of 3.55 × 10(-9) M. TEM results show that the particle size of QD varies in the range between 5 to 8 nm after ligand modification and conjugation with ssDNA. This approach is capable of providing a simple, rapid and sensitive method for detection of related synthetic DNA sequence of Ganoderma boninense.

  3. Single-Molecule Counting of Point Mutations by Transient DNA Binding

    NASA Astrophysics Data System (ADS)

    Su, Xin; Li, Lidan; Wang, Shanshan; Hao, Dandan; Wang, Lei; Yu, Changyuan

    2017-03-01

    High-confidence detection of point mutations is important for disease diagnosis and clinical practice. Hybridization probes are extensively used, but are hindered by their poor single-nucleotide selectivity. Shortening the length of DNA hybridization probes weakens the stability of the probe-target duplex, leading to transient binding between complementary sequences. The kinetics of probe-target binding events are highly dependent on the number of complementary base pairs. Here, we present a single-molecule assay for point mutation detection based on transient DNA binding and use of total internal reflection fluorescence microscopy. Statistical analysis of single-molecule kinetics enabled us to effectively discriminate between wild type DNA sequences and single-nucleotide variants at the single-molecule level. A higher single-nucleotide discrimination is achieved than in our previous work by optimizing the assay conditions, which is guided by statistical modeling of kinetics with a gamma distribution. The KRAS c.34 A mutation can be clearly differentiated from the wild type sequence (KRAS c.34 G) at a relative abundance as low as 0.01% mutant to WT. To demonstrate the feasibility of this method for analysis of clinically relevant biological samples, we used this technology to detect mutations in single-stranded DNA generated from asymmetric RT-PCR of mRNA from two cancer cell lines.

  4. DNA microdevice for electrochemical detection of Escherichia coli 0157:H7 molecular markers.

    PubMed

    Berganza, J; Olabarria, G; García, R; Verdoy, D; Rebollo, A; Arana, S

    2007-04-15

    An electrochemical DNA sensor based on the hybridization recognition of a single-stranded DNA (ssDNA) probe immobilized onto a gold electrode to its complementary ssDNA is presented. The DNA probe is bound on gold surface electrode by using self-assembled monolayer (SAM) technology. An optimized mixed SAM with a blocking molecule preventing the nonspecific adsorption on the electrode surface has been prepared. In this paper, a DNA biosensor is designed by means of the immobilization of a single stranded DNA probe on an electrochemical transducer surface to recognize specifically Escherichia coli (E. coli) 0157:H7 complementary target DNA sequence via cyclic voltammetry experiments. The 21 mer DNA probe including a C6 alkanethiol group at the 5' phosphate end has been synthesized to form the SAM onto the gold surface through the gold sulfur bond. The goal of this paper has been to design, characterise and optimise an electrochemical DNA sensor. In order to investigate the oligonucleotide probe immobilization and the hybridization detection, experiments with different concentration of DNA and mismatch sequences have been performed. This microdevice has demonstrated the suitability of oligonucleotide Self-assembled monolayers (SAMs) on gold as immobilization method. The DNA probes deposited on gold surface have been functional and able to detect changes in bases sequence in a 21-mer oligonucleotide.

  5. Solid phase sequencing of double-stranded nucleic acids

    DOEpatents

    Fu, Dong-Jing; Cantor, Charles R.; Koster, Hubert; Smith, Cassandra L.

    2002-01-01

    This invention relates to methods for detecting and sequencing of target double-stranded nucleic acid sequences, to nucleic acid probes and arrays of probes useful in these methods, and to kits and systems which contain these probes. Useful methods involve hybridizing the nucleic acids or nucleic acids which represent complementary or homologous sequences of the target to an array of nucleic acid probes. These probe comprise a single-stranded portion, an optional double-stranded portion and a variable sequence within the single-stranded portion. The molecular weights of the hybridized nucleic acids of the set can be determined by mass spectroscopy, and the sequence of the target determined from the molecular weights of the fragments. Nucleic acids whose sequences can be determined include nucleic acids in biological samples such as patient biopsies and environmental samples. Probes may be fixed to a solid support such as a hybridization chip to facilitate automated determination of molecular weights and identification of the target sequence.

  6. FATHEAD MINNOW VITELLOGENIN: COMPLEMENTARY DNA SEQUENCE AND MESSENGER RNA AND PROTEIN EXPRESSION AFTER 17B-ESTRADIOL TREATMENT

    EPA Science Inventory

    Induction of vitellogenin (VTG) in oviparous animals has been proposed as a sensitive indicator of invironmental contaminants that activate the estrogen receptor. In the present study, a sensitive ribonuclease protection assay (RPA) for VTG messenger RNA (mRNA) was developed for ...

  7. Comparative study of switchgrass cultivars using RNA sequencing technology

    USDA-ARS?s Scientific Manuscript database

    Switchgrass (Panicum virgatum L.) is a C4 perennial grass, identified as a promising bioenergy crop. Switchgrass exists in two ecotypes, upland and lowland, which are heterotic, or genetically complementary to each other. The objectives of this study are to assess the potential of SNP markers as a b...

  8. Construction of high-quality recombination maps with low-coverage genomic sequencing for joint linkage analysis in maize

    USDA-ARS?s Scientific Manuscript database

    A genome-wide association study (GWAS) is the foremost strategy used for finding genes that control human diseases and agriculturally important traits, but it often reports false positives. In contrast, its complementary method, linkage analysis, provides direct genetic confirmation, but with limite...

  9. Zn2+ blocks annealing of complementary single-stranded DNA in a sequence-selective manner

    USDA-ARS?s Scientific Manuscript database

    A simple low-temperature EDTA-free agarose gel electrophoresis procedure (LTEAGE) coupled with UV-Vis spectrum and fluorescence quenching analyses was developed and the Zn2+-single-stranded (ss) DNA interaction was investigated under near-physiological conditions. It was found that Zn2+ blocked the...

  10. Signatures of selection among sex-determining alleles of the honey bee.

    PubMed

    Hasselmann, Martin; Beye, Martin

    2004-04-06

    Patterns of DNA polymorphisms are a primary tool for dissecting signatures of selection; however, the underlying selective forces are poorly understood for most genes. A classical example of diversifying selection is the complementary sex-determining locus that is found in the very large insect order Hymenoptera (bees, wasps, ants, and sawflies). The gene responsible for sex determination, the complementary sex determiner (csd), has been most recently identified in the honey bee. Females are heterozygous at this locus. Males result when there is only one functional allele present, as a result of either homozygosity (fertilized eggs) or, more commonly, hemizygosity (unfertilized eggs). The homozygotes, diploid males, do not reproduce and have zero fitness, which implies positive selection in favor of rare alleles. Large differences in csd cDNA sequences within and between four populations were found that fall into two major groups, types I and II. Type I consists of several allelic lineages that were maintained over an extended period, an indication of balancing selection. Diversifying selection has operated on several confined parts of the protein, as shown by an excess of nonsynonymous differences. Elevated sequence differences indicate another selected part near a repeat region. These findings have general implications about the understanding of both the function of the multiallelic mechanism and the adaptive processes on the level of nucleotide sequences. Moreover, the first csd sequence data are a notable basis for the avoidance of diploid males in bee selection programs by allele-assisted breeding.

  11. The Mechanism of Synchronous Precise Regulation of Two Shrimp White Spot Syndrome Virus Targets by a Viral MicroRNA

    PubMed Central

    He, Yaodong; Ma, Tiantian; Zhang, Xiaobo

    2017-01-01

    MicroRNAs (miRNAs), important factors in animal innate immunity, suppress the expressions of their target genes by binding to target mRNA’s 3′ untranslated regions (3′UTRs). However, the mechanism of synchronous regulation of multiple targets by a single miRNA remains unclear. In this study, the interaction between a white spot syndrome virus (WSSV) miRNA (WSSV-miR-N32) and its two viral targets (wsv459 and wsv322) was characterized in WSSV-infected shrimp. The outcomes indicated that WSSV-encoded miRNA (WSSV-miR-N32) significantly inhibited virus infection by simultaneously targeting wsv459 and wsv322. The silencing of wsv459 or wsv322 by siRNA led to significant decrease of WSSV copies in shrimp, showing that the two viral genes were required for WSSV infection. WSSV-miR-N32 could mediate 5′–3′ exonucleolytic digestion of its target mRNAs, which stopped at the sites of target mRNA 3′UTRs close to the sequence complementary to the miRNA seed sequence. The complementary bases (to the target mRNA sequence) of a miRNA 9th–18th non-seed sequence were essential for the miRNA targeting. Therefore, our findings presented novel insights into the mechanism of miRNA-mediated suppression of target gene expressions, which would be helpful for understanding the roles of miRNAs in innate immunity of invertebrate. PMID:29230209

  12. Computational sequence analysis of predicted long dsRNA transcriptomes of major crops reveals sequence complementarity with human genes.

    PubMed

    Jensen, Peter D; Zhang, Yuanji; Wiggins, B Elizabeth; Petrick, Jay S; Zhu, Jin; Kerstetter, Randall A; Heck, Gregory R; Ivashuta, Sergey I

    2013-01-01

    Long double-stranded RNAs (long dsRNAs) are precursors for the effector molecules of sequence-specific RNA-based gene silencing in eukaryotes. Plant cells can contain numerous endogenous long dsRNAs. This study demonstrates that such endogenous long dsRNAs in plants have sequence complementarity to human genes. Many of these complementary long dsRNAs have perfect sequence complementarity of at least 21 nucleotides to human genes; enough complementarity to potentially trigger gene silencing in targeted human cells if delivered in functional form. However, the number and diversity of long dsRNA molecules in plant tissue from crops such as lettuce, tomato, corn, soy and rice with complementarity to human genes that have a long history of safe consumption supports a conclusion that long dsRNAs do not present a significant dietary risk.

  13. Analysis of hepatitis C virus RNA dimerization and core-RNA interactions.

    PubMed

    Ivanyi-Nagy, Roland; Kanevsky, Igor; Gabus, Caroline; Lavergne, Jean-Pierre; Ficheux, Damien; Penin, François; Fossé, Philippe; Darlix, Jean-Luc

    2006-01-01

    The core protein of hepatitis C virus (HCV) has been shown previously to act as a potent nucleic acid chaperone in vitro, promoting the dimerization of the 3'-untranslated region (3'-UTR) of the HCV genomic RNA, a process probably mediated by a small, highly conserved palindromic RNA motif, named DLS (dimer linkage sequence) [G. Cristofari, R. Ivanyi-Nagy, C. Gabus, S. Boulant, J. P. Lavergne, F. Penin and J. L. Darlix (2004) Nucleic Acids Res., 32, 2623-2631]. To investigate in depth HCV RNA dimerization, we generated a series of point mutations in the DLS region. We find that both the plus-strand 3'-UTR and the complementary minus-strand RNA can dimerize in the presence of core protein, while mutations in the DLS (among them a single point mutation that abolished RNA replication in a HCV subgenomic replicon system) completely abrogate dimerization. Structural probing of plus- and minus-strand RNAs, in their monomeric and dimeric forms, indicate that the DLS is the major if not the sole determinant of UTR RNA dimerization. Furthermore, the N-terminal basic amino acid clusters of core protein were found to be sufficient to induce dimerization, suggesting that they retain full RNA chaperone activity. These findings may have important consequences for understanding the HCV replicative cycle and the genetic variability of the virus.

  14. Constitutively expressing cell lines that secrete a truncated bovine herpes virus-1 glycoprotein (gpI) stimulate T-lymphocyte responsiveness.

    PubMed

    Leary, T P; Gao, Y; Splitter, G A

    1992-07-01

    The desire to obtain authentically glycosylated viral protein products in sufficient quantity for immunological study has led to the use of eucaryotic expression vectors for protein production. An additional advantage is that these protein products can be studied individually in the absence of their native viral environment. We have cloned a complementary DNA (cDNA) encoding bovine herpes virus-1 (BHV-1) glycoprotein 1 (gpI) into the eucaryotic expression vector, pZipNeo SVX1. Since this protein is normally embedded within the membrane of BHV-1 infected cells, we removed sequences encoding the transmembrane domain of the native protein. After transfection of the plasmid construct into the canine osteosarcoma cell line, D17, or Madin-Darby bovine kidney (MDBK) cells, a truncated BHV-1 (gpI) was secreted into the culture medium as demonstrated by radioimmunoprecipitation and SDS-PAGE. Both a CD4+ T-lymphocyte line specific for BHV-1 and freshly isolated T lymphocytes could recognize and respond to the secreted recombinant gpI. Further, recombinant gpI could elicit both antibody and cellular responses in cattle when used as an immunogen. Having established constitutively glycoprotein producing cell lines, future studies in vaccine evaluation of gpI will be facilitated.

  15. A rapid and reliable PCR method for genotyping the ABO blood group.

    PubMed

    O'Keefe, D S; Dobrovic, A

    1993-01-01

    The ABO blood group has been used extensively as a marker in population studies, epidemiology, and forensic work. However, until the cloning of the gene, it was not possible to determine the genotype of group A and B individuals without recourse to family studies. We have developed a method to determine the ABO genotype directly from human DNA using multiplex PCR and restriction enzyme analysis. Two PCR fragments spanning positions 258 and 700 of the cDNA sequence are amplified. The site at position 258 allows us to differentiate the O allele from the A and B alleles. The site at position 700 allows us to distinguish the B allele from the A and O alleles. Analysis at the two sites thus allows us to distinguish the three alleles. The multiplex PCR product is digested separately with four enzymes, two for each of the sites. The pair of enzymes for each site cut in a reciprocal fashion. Whereas one enzyme for each site is theoretically sufficient for genotyping, the use of complementary pairs of enzymes prevents the assignment of a false genotype as a result of false negative or partial digestion. This method is fast and reliable, does not rely on probing of blots, and should be widely applicable.

  16. DNA nanomapping using CRISPR-Cas9 as a programmable nanoparticle.

    PubMed

    Mikheikin, Andrey; Olsen, Anita; Leslie, Kevin; Russell-Pavier, Freddie; Yacoot, Andrew; Picco, Loren; Payton, Oliver; Toor, Amir; Chesney, Alden; Gimzewski, James K; Mishra, Bud; Reed, Jason

    2017-11-21

    Progress in whole-genome sequencing using short-read (e.g., <150 bp), next-generation sequencing technologies has reinvigorated interest in high-resolution physical mapping to fill technical gaps that are not well addressed by sequencing. Here, we report two technical advances in DNA nanotechnology and single-molecule genomics: (1) we describe a labeling technique (CRISPR-Cas9 nanoparticles) for high-speed AFM-based physical mapping of DNA and (2) the first successful demonstration of using DVD optics to image DNA molecules with high-speed AFM. As a proof of principle, we used this new "nanomapping" method to detect and map precisely BCL2-IGH translocations present in lymph node biopsies of follicular lymphoma patents. This HS-AFM "nanomapping" technique can be complementary to both sequencing and other physical mapping approaches.

  17. Phenotypic and genotypic analysis of Borrelia burgdorferi isolates from various sources.

    PubMed Central

    Adam, T; Gassmann, G S; Rasiah, C; Göbel, U B

    1991-01-01

    A total of 17 B. burgdorferi isolates from various sources were characterized by sodium dodecyl sulfate-polyacrylamide gel electrophoresis of whole-cell proteins, restriction enzyme analysis, Southern hybridization with probes complementary to unique regions of evolutionarily conserved genes (16S rRNA and fla), and direct sequencing of in vitro polymerase chain reaction-amplified fragments of the 16S rRNA gene. Three groups were distinguished on the basis of phenotypic and genotypic traits, the latter traced to the nucleotide sequence level. Images PMID:1649797

  18. Male infertility: lifestyle factors and holistic, complementary, and alternative therapies.

    PubMed

    Yao, David F; Mills, Jesse N

    2016-01-01

    While we may be comfortable with an allopathic approach to male infertility, we are also responsible for knowledge about lifestyle modifications and holistic, complementary, and alternative therapies that are used by many of our patients. This paper provides an evidence-based review separating fact from fiction for several of these therapies. There is sufficient literature to support weight reduction by diet and exercise, smoking cessation, and alcohol moderation. Supplements that have demonstrated positive effects on male fertility on small randomized controlled trial (RCT) include aescin, coenzyme Q 10 , glutathione, Korean red ginseng, L-carnitine, nigella sativa, omega-3, selenium, a combination of zinc and folate, and the Menevit antioxidant. There is no support for the use of Vitamin C, Vitamin E, or saffron. The data for Chinese herbal medications, acupuncture, mind-body practice, scrotal cooling, and faith-based healing are sparse or inconclusive.

  19. Use of ITS2 region as the universal DNA barcode for plants and animals.

    PubMed

    Yao, Hui; Song, Jingyuan; Liu, Chang; Luo, Kun; Han, Jianping; Li, Ying; Pang, Xiaohui; Xu, Hongxi; Zhu, Yingjie; Xiao, Peigen; Chen, Shilin

    2010-10-01

    The internal transcribed spacer 2 (ITS2) region of nuclear ribosomal DNA is regarded as one of the candidate DNA barcodes because it possesses a number of valuable characteristics, such as the availability of conserved regions for designing universal primers, the ease of its amplification, and sufficient variability to distinguish even closely related species. However, a general analysis of its ability to discriminate species in a comprehensive sample set is lacking. In the current study, 50,790 plant and 12,221 animal ITS2 sequences downloaded from GenBank were evaluated according to sequence length, GC content, intra- and inter-specific divergence, and efficiency of identification. The results show that the inter-specific divergence of congeneric species in plants and animals was greater than its corresponding intra-specific variations. The success rates for using the ITS2 region to identify dicotyledons, monocotyledons, gymnosperms, ferns, mosses, and animals were 76.1%, 74.2%, 67.1%, 88.1%, 77.4%, and 91.7% at the species level, respectively. The ITS2 region unveiled a different ability to identify closely related species within different families and genera. The secondary structure of the ITS2 region could provide useful information for species identification and could be considered as a molecular morphological characteristic. As one of the most popular phylogenetic markers for eukaryota, we propose that the ITS2 locus should be used as a universal DNA barcode for identifying plant species and as a complementary locus for CO1 to identify animal species. We have also developed a web application to facilitate ITS2-based cross-kingdom species identification (http://its2-plantidit.dnsalias.org).

  20. Use of ITS2 Region as the Universal DNA Barcode for Plants and Animals

    PubMed Central

    Luo, Kun; Han, Jianping; Li, Ying; Pang, Xiaohui; Xu, Hongxi; Zhu, Yingjie; Xiao, Peigen; Chen, Shilin

    2010-01-01

    Background The internal transcribed spacer 2 (ITS2) region of nuclear ribosomal DNA is regarded as one of the candidate DNA barcodes because it possesses a number of valuable characteristics, such as the availability of conserved regions for designing universal primers, the ease of its amplification, and sufficient variability to distinguish even closely related species. However, a general analysis of its ability to discriminate species in a comprehensive sample set is lacking. Methodology/Principal Findings In the current study, 50,790 plant and 12,221 animal ITS2 sequences downloaded from GenBank were evaluated according to sequence length, GC content, intra- and inter-specific divergence, and efficiency of identification. The results show that the inter-specific divergence of congeneric species in plants and animals was greater than its corresponding intra-specific variations. The success rates for using the ITS2 region to identify dicotyledons, monocotyledons, gymnosperms, ferns, mosses, and animals were 76.1%, 74.2%, 67.1%, 88.1%, 77.4%, and 91.7% at the species level, respectively. The ITS2 region unveiled a different ability to identify closely related species within different families and genera. The secondary structure of the ITS2 region could provide useful information for species identification and could be considered as a molecular morphological characteristic. Conclusions/Significance As one of the most popular phylogenetic markers for eukaryota, we propose that the ITS2 locus should be used as a universal DNA barcode for identifying plant species and as a complementary locus for CO1 to identify animal species. We have also developed a web application to facilitate ITS2-based cross-kingdom species identification (http://its2-plantidit.dnsalias.org). PMID:20957043

  1. Genome-wide target profiling of piggyBac and Tol2 in HEK 293: pros and cons for gene discovery and gene therapy

    PubMed Central

    2011-01-01

    Background DNA transposons have emerged as indispensible tools for manipulating vertebrate genomes with applications ranging from insertional mutagenesis and transgenesis to gene therapy. To fully explore the potential of two highly active DNA transposons, piggyBac and Tol2, as mammalian genetic tools, we have conducted a side-by-side comparison of the two transposon systems in the same setting to evaluate their advantages and disadvantages for use in gene therapy and gene discovery. Results We have observed that (1) the Tol2 transposase (but not piggyBac) is highly sensitive to molecular engineering; (2) the piggyBac donor with only the 40 bp 3'-and 67 bp 5'-terminal repeat domain is sufficient for effective transposition; and (3) a small amount of piggyBac transposases results in robust transposition suggesting the piggyBac transpospase is highly active. Performing genome-wide target profiling on data sets obtained by retrieving chromosomal targeting sequences from individual clones, we have identified several piggyBac and Tol2 hotspots and observed that (4) piggyBac and Tol2 display a clear difference in targeting preferences in the human genome. Finally, we have observed that (5) only sites with a particular sequence context can be targeted by either piggyBac or Tol2. Conclusions The non-overlapping targeting preference of piggyBac and Tol2 makes them complementary research tools for manipulating mammalian genomes. PiggyBac is the most promising transposon-based vector system for achieving site-specific targeting of therapeutic genes due to the flexibility of its transposase for being molecularly engineered. Insights from this study will provide a basis for engineering piggyBac transposases to achieve site-specific therapeutic gene targeting. PMID:21447194

  2. Crystallization and preliminary X-ray diffraction analysis of a self-complementary DNA heptacosamer with a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3;-terminus

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Yeo, Hyun Koo; Lee, Jae Young

    2012-04-18

    The self-complementary DNA heptacosamer (a 27-mer oligonucleotide) with sequence d(CGAGCACTGCGCAGTGCTCGTTGTTAT) forms a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus. Crystals of the oligonucleotide were obtained by sitting-drop vapor diffusion and diffracted to 2.8 {angstrom} resolution. The oligonucleotide was crystallized at 277 K using polyethylene glycol as a precipitant in the presence of magnesium chloride. The crystals belonged to the triclinic space group, with unit-cell parameters a = 48.74, b = 64.23, c = 79.34 {angstrom}, {alpha} = 91.37, {beta} = 93.21, {gamma} = 92.35{sup o}.

  3. Analysis of bacterial populations in the environment using two-dimensional gel electrophoresis of genomic DNA and complementary DNA.

    PubMed

    Liu, Guo-Hua; Nakamura, Tatsuo; Amemiya, Takashi; Rajendran, Narasimmalu; Itoh, Kiminori

    2011-01-01

    Two-dimensional gel electrophoresis (2-DGE) mapping of genomic DNA and complementary DNA (cDNA) amplicons was attempted to analyze total and active bacterial populations within soil and activated sludge samples. Distinct differences in the number and species of bacterial populations and those that were metabolically active at the time of sampling were visually observed especially for the soil community. Statistical analyses and sequencing based on the 2-DGE data further revealed the relationships between total and active bacterial populations within each community. This high-resolution technique would be useful for obtaining a better understanding of bacterial population structures in the environment.

  4. Crystallization and preliminary X-ray diffraction analysis of a self-complementary DNA heptacosamer with a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus.

    PubMed

    Yeo, Hyun Koo; Lee, Jae Young

    2010-05-01

    The self-complementary DNA heptacosamer (a 27-mer oligonucleotide) with sequence d(CGAGCACTGCGCAGTGCTCGTTGTTAT) forms a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus. Crystals of the oligonucleotide were obtained by sitting-drop vapour diffusion and diffracted to 2.8 A resolution. The oligonucleotide was crystallized at 277 K using polyethylene glycol as a precipitant in the presence of magnesium chloride. The crystals belonged to the triclinic space group, with unit-cell parameters a = 48.74, b = 64.23, c = 79.34 A, alpha = 91.37, beta = 93.21, gamma = 92.35 degrees .

  5. Triple helix purification and sequencing

    DOEpatents

    Wang, Renfeng; Smith, Lloyd M.; Tong, Xinchun E.

    1995-01-01

    Disclosed herein are methods, kits, and equipment for purifying single stranded circular DNA and then using the DNA for DNA sequencing purposes. Templates are provided with an insert having a hybridization region. An elongated oligonucleotide has two regions that are complementary to the insert and the oligo is bound to a magnetic anchor. The oligo hybridizes to the insert on two sides to form a stable triple helix complex. The anchor can then be used to drag the template out of solution using a magnet. The system can purify sequencing templates, and if desired the triple helix complex can be opened up to a double helix so that the oligonucleotide will act as a primer for further DNA synthesis.

  6. Triple helix purification and sequencing

    DOEpatents

    Wang, R.; Smith, L.M.; Tong, X.E.

    1995-03-28

    Disclosed herein are methods, kits, and equipment for purifying single stranded circular DNA and then using the DNA for DNA sequencing purposes. Templates are provided with an insert having a hybridization region. An elongated oligonucleotide has two regions that are complementary to the insert and the oligo is bound to a magnetic anchor. The oligo hybridizes to the insert on two sides to form a stable triple helix complex. The anchor can then be used to drag the template out of solution using a magnet. The system can purify sequencing templates, and if desired the triple helix complex can be opened up to a double helix so that the oligonucleotide will act as a primer for further DNA synthesis. 4 figures.

  7. A Guide to the PLAZA 3.0 Plant Comparative Genomic Database.

    PubMed

    Vandepoele, Klaas

    2017-01-01

    PLAZA 3.0 is an online resource for comparative genomics and offers a versatile platform to study gene functions and gene families or to analyze genome organization and evolution in the green plant lineage. Starting from genome sequence information for over 35 plant species, precomputed comparative genomic data sets cover homologous gene families, multiple sequence alignments, phylogenetic trees, and genomic colinearity information within and between species. Complementary functional data sets, a Workbench, and interactive visualization tools are available through a user-friendly web interface, making PLAZA an excellent starting point to translate sequence or omics data sets into biological knowledge. PLAZA is available at http://bioinformatics.psb.ugent.be/plaza/ .

  8. Probability of coding of a DNA sequence: an algorithm to predict translated reading frames from their thermodynamic characteristics.

    PubMed Central

    Tramontano, A; Macchiato, M F

    1986-01-01

    An algorithm to determine the probability that a reading frame codifies for a protein is presented. It is based on the results of our previous studies on the thermodynamic characteristics of a translated reading frame. We also develop a prediction procedure to distinguish between coding and non-coding reading frames. The procedure is based on the characteristics of the putative product of the DNA sequence and not on periodicity characteristics of the sequence, so the prediction is not biased by the presence of overlapping translated reading frames or by the presence of translated reading frames on the complementary DNA strand. PMID:3753761

  9. Performance trade-off in an adaptive IEEE 802.11ad waveform design for a joint automotive radar and communication system.

    DOT National Transportation Integrated Search

    2017-05-01

    The IEEE 802.11ad waveform can be used for automotive radar by exploiting the Golay complementary sequences in the preamble of a frame. The performance of radar, however, is limited by the preamble structure. In this paper, we propose an adaptive pre...

  10. Oligonucleoside alkyl or arylphosphonate derivatives capable of crosslinking with or cleaving nucleic acids

    DOEpatents

    Miller, Paul S.; Ts'o, Paul O.P.

    1999-06-15

    A composition for inactivating a target nucleic acid which comprises an oligonucleoside alkyl or arylphosphonate analogue which is complementary to the sequence of the target nucleic acid and includes a functional group which reacts with the target nucleic acid to render the target nucleic acid inactive or nonfunctional.

  11. Topological Interaction by Entanglement of DNA

    NASA Astrophysics Data System (ADS)

    Feng, Lang; Sha, Ruojie; Seeman, Nadrian; Chaikin, Paul

    2012-02-01

    We find and study a new type of interaction between colloids, Topological Interaction by Entanglement of DNA (TIED), due to concatenation of loops formed by palindromic DNA. Consider a particle coated with palindromic DNA of sequence ``P1.'' Below the DNA hybridization temperature (Tm), loops of the self-complementary DNA form on the particle surface. Direct hybridization with similar particle covered with a different sequence P2 do not occur. However when particles are held together at T > Tm, then cooled to T < Tm, some of the loops entangle and link, similar to a Olympic Gel. We quantitatively observe and measure this topological interaction between colloids in a ˜5^o C temperature window, ˜6^o C lower than direct binding of complementary DNA with similar strength and introduce the concept of entanglement binding free energy. To prove our interaction to be topological, we unknot the purely entangled binding sites between colloids by adding Topoisomerase I which unconcatenates our loops. This research suggests novel history dependent ways of binding particles and serves as a new design tool in colloidal self-assembly.

  12. Identification and Characterization of a Cis Antisense RNA of the rpoH Gene of Salmonella enterica Serovar Typhi.

    PubMed

    Xiong, Changyan; Li, Xuejiao; Liu, Juanli; Zhao, Xin; Xu, Shungao; Huang, Xinxiang

    2018-01-01

    Antisense RNAs from complementary strands of protein coding genes regulate the expression of genes involved in many cellular processes. Using deep sequencing analysis of the Salmonella enterica serovar Typhi ( S. Typhi) transcriptome, a novel antisense RNA encoded on the strand complementary to the rpoH gene was revealed. In this study, the molecular features of this antisense RNA were assessed using northern blotting and rapid amplification of cDNA ends. The 3,508 nt sequence of RNA was identified as the antisense RNA of the rpoH gene and was named ArpH. ArpH was found to attenuate the invasion of HeLa cells by S. Typhi by regulating the expression of SPI-1 genes. In an rpoH mutant strain, the invasive capacity of S. Typhi was increased, whereas overexpression of ArpH positively regulates rpoH mRNA levels. Results of this study suggest that the cis -encoded antisense RNA ArpH is likely to affect the invasive capacity of S. Typhi by regulating the expression of rpoH .

  13. Multiple primary cancers of breast and cervix uteri: An epidemiological approach to analysis

    PubMed Central

    Prior, P.; Waterhouse, J. A. H.

    1981-01-01

    Index sites of breast and cervix uteri were selected from populationbased data held at the West Midlands and Birmingham Regional Cancer Registry, and the expected numbers of second primary cancers in cervix and breast were computed (sequence analyses). In the breast series (17,756 patients) a small deficit of cervical tumours was observed (O = 16, E = 2·119, O/E = 0·76, P > 0·05), while in the cervix series (4817 patients) a small excess of breast tumours was found (O = 29, E = 23·38, O/E = 1·24, P > 0·05) over a period of 15 years. A theoretical statement of the combined risk of the 2 tumours occurring in the same individual of a general population was developed and was compared with the practical approach of summing the sequence analyses (complementary analysis). Complementary analysis indicated that there was no excess of women with the 2 primary tumours (O = 45, E = 44·57, O/E = 1·01) and that cancers of the breast and cervix uteri are not aetiologically related. PMID:7248147

  14. Formation of template-switching artifacts by linear amplification.

    PubMed

    Chakravarti, Dhrubajyoti; Mailander, Paula C

    2008-07-01

    Linear amplification is a method of synthesizing single-stranded DNA from either a single-stranded DNA or one strand of a double-stranded DNA. In this protocol, molecules of a single primer DNA are extended by multiple rounds of DNA synthesis at high temperature using thermostable DNA polymerases. Although linear amplification generates the intended full-length single-stranded product, it is more efficient over single-stranded templates than double-stranded templates. We analyzed linear amplification over single- or double-stranded mouse H-ras DNA (exon 1-2 region). The single-stranded H-ras template yielded only the intended product. However, when the double-stranded template was used, additional artifact products were observed. Increasing the concentration of the double-stranded template produced relatively higher amounts of these artifact products. One of the artifact DNA bands could be mapped and analyzed by sequencing. It contained three template-switching products. These DNAs were formed by incomplete DNA strand extension over the template strand, followed by switching to the complementary strand at a specific Ade nucleotide within a putative hairpin sequence, from which DNA synthesis continued over the complementary strand.

  15. Mapping of aldose reductase gene sequences to human chromosomes 1, 3, 7, 9, 11, and 13

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bateman, J.B.; Kojis, T.; Heinzmann, C.

    1993-09-01

    Aldose reductase (alditol:NAD(P)+ 1-oxidoreductase; EC 1.1.1.21) (AR) catalyzes the reduction of several aldehydes, including that of glucose, to the corresponding sugar alcohol. Using a complementary DNA clone encoding human AR, the authors mapped the gene sequences to human chromosomes 1, 3, 7, 9, 11, 13, 14, and 18 by somatic cell hybridization. By in situ hybridization analysis, sequences were localized to human chromosomes 1q32-q43, 3p12, 7q31-q35, 9q22, 11p14-p15, and 13q14-q21. As a putative functional AR gene has been mapped to chromosome 7 and a putative pseudogene to chromosome 3, the sequences on the other seven chromosomes may represent other activemore » genes, non-aldose reductase homologous sequences, or pseudogenes. 24 refs., 3 figs., 2 tabs.« less

  16. Highly Complementary Target RNAs Promote Release of Guide RNAs from Human Argonaute2

    PubMed Central

    De, Nabanita; Young, Lisa; Lau, Pick-Wei; Meisner, Nicole-Claudia; Morrissey, David V.; MacRae, Ian J.

    2013-01-01

    SUMMARY Argonaute proteins use small RNAs to guide the silencing of complementary target RNAs in many eukaryotes. Although small RNA biogenesis pathways are well studied, mechanisms for removal of guide RNAs from Argonaute are poorly understood. Here we show that the Argonaute2 (Ago2) guide RNA complex is extremely stable, with a half-life on the order of days. However, highly complementary target RNAs destabilize the complex and significantly accelerate release of the guide RNA from Ago2. This “unloading” activity can be enhanced by mismatches between the target and the guide 5′ end and attenuated by mismatches to the guide 3′ end. The introduction of 3′ mismatches leads to more potent silencing of abundant mRNAs in mammalian cells. These findings help to explain why the 3′ ends of mammalian microRNAs (miRNAs) rarely match their targets, suggest a mechanism for sequence-specific small RNA turnover, and offer insights for controlling small RNAs in mammalian cells. PMID:23664376

  17. Conformational Heterogeneity in a Fully Complementary DNA Three-Way Junction with a GC-Rich Branchpoint.

    PubMed

    Toulmin, Anita; Baltierra-Jasso, Laura E; Morten, Michael J; Sabir, Tara; McGlynn, Peter; Schröder, Gunnar F; Smith, Brian O; Magennis, Steven W

    2017-09-19

    DNA three-way junctions (3WJs) are branched structures that serve as important biological intermediates and as components in DNA nanostructures. We recently derived the global structure of a fully complementary 3WJ and found that it contained unpaired bases at the branchpoint, which is consistent with previous observations of branch flexibility and branchpoint reactivity. By combining high-resolution single-molecule Förster resonance energy transfer, molecular modeling, time-resolved ensemble fluorescence spectroscopy, and the first 19 F nuclear magnetic resonance observations of fully complementary 3WJs, we now show that the 3WJ structure can adopt multiple distinct conformations depending upon the sequence at the branchpoint. A 3WJ with a GC-rich branchpoint adopts an open conformation with unpaired bases at the branch and at least one additional conformation with an increased number of base interactions at the branchpoint. This structural diversity has implications for branch interactions and processing in vivo and for technological applications.

  18. A Golay complementary TS-based symbol synchronization scheme in variable rate LDPC-coded MB-OFDM UWBoF system

    NASA Astrophysics Data System (ADS)

    He, Jing; Wen, Xuejie; Chen, Ming; Chen, Lin

    2015-09-01

    In this paper, a Golay complementary training sequence (TS)-based symbol synchronization scheme is proposed and experimentally demonstrated in multiband orthogonal frequency division multiplexing (MB-OFDM) ultra-wideband over fiber (UWBoF) system with a variable rate low-density parity-check (LDPC) code. Meanwhile, the coding gain and spectral efficiency in the variable rate LDPC-coded MB-OFDM UWBoF system are investigated. By utilizing the non-periodic auto-correlation property of the Golay complementary pair, the start point of LDPC-coded MB-OFDM UWB signal can be estimated accurately. After 100 km standard single-mode fiber (SSMF) transmission, at the bit error rate of 1×10-3, the experimental results show that the short block length 64QAM-LDPC coding provides a coding gain of 4.5 dB, 3.8 dB and 2.9 dB for a code rate of 62.5%, 75% and 87.5%, respectively.

  19. A few nucleotide polymorphisms are sufficient to recruit nuclear factors differentially to the intron 1 of HPV-16 intratypic variants.

    PubMed

    López-Urrutia, Eduardo; Valdés, Jesús; Bonilla-Moreno, Raúl; Martínez-Salazar, Martha; Martínez-Garcia, Martha; Berumen, Jaime; Villegas-Sepúlveda, Nicolás

    2012-06-01

    The HPV-16 E6/E7 genes, which contain intron 1, are processed by alternative splicing and its transcripts are detected with a heterogeneous profile in tumours cells. Frequently, the HPV-16 positive carcinoma cells bear viral variants that contain single nucleotide polymorphisms into its DNA sequence. We were interested in analysing the contribution of this polymorphism to the heterogeneity in the pattern of the E6/E7 spliced transcripts. Using the E6/E7 sequences from three closely related HPV-16 variants, we have shown that a few nucleotide changes are sufficient to produce heterogeneity in the splicing profile. Furthermore, using mutants that contained a single SNP, we also showed that one nucleotide change was sufficient to reproduce the heterogeneous splicing profile. Additionally, a difference of two or three SNPs among these viral sequences was sufficient to recruit differentially several splicing factors to the polymorphic E6/E7 transcripts. Moreover, only one SNP was sufficient to alter the binding site of at least one splicing factor, changing the ability of splicing factors to bind the transcript. Finally, the factors that were differentially bound to the short form of intron 1 of one of these E6/E7 variants were identified as TIA1 and/or TIAR and U1-70k, while U2AF65, U5-52k and PTB were preferentially bound to the transcript of the other variants. Copyright © 2012 Elsevier B.V. All rights reserved.

  20. Toward a General Approach for RNA-Templated Hierarchical Assembly of Split-Proteins

    PubMed Central

    Furman, Jennifer L.; Badran, Ahmed H.; Ajulo, Oluyomi; Porter, Jason R.; Stains, Cliff I.; Segal, David J.; Ghosh, Indraneel

    2010-01-01

    The ability to conditionally turn on a signal or induce a function in the presence of a user-defined RNA target has potential applications in medicine and synthetic biology. Although sequence-specific pumilio repeat proteins can target a limited set of ssRNA sequences, there are no general methods for targeting ssRNA with designed proteins. As a first step toward RNA recognition, we utilized the RNA binding domain of argonaute, implicated in RNA interference, for specifically targeting generic 2-nucleotide, 3' overhangs of any dsRNA. We tested the reassembly of a split-luciferase enzyme guided by argonaute-mediated recognition of newly generated nucleotide overhangs when ssRNA is targeted by a designed complementary guide sequence. This approach was successful when argonaute was utilized in conjunction with a pumilio repeat and expanded the scope of potential ssRNA targets. However, targeting any desired ssRNA remained elusive as two argonaute domains provided minimal reassembled split-luciferase. We next designed and tested a second hierarchical assembly, wherein ssDNA guides are appended to DNA hairpins that serve as a scaffold for high affinity zinc fingers attached to split-luciferase. In the presence of a ssRNA target containing adjacent sequences complementary to the guides, the hairpins are brought into proximity, allowing for zinc finger binding and concomitant reassembly of the fragmented luciferase. The scope of this new approach was validated by specifically targeting RNA encoding VEGF, hDM2, and HER2. These approaches provide potentially general design paradigms for the conditional reassembly of fragmented proteins in the presence of any desired ssRNA target. PMID:20681585

  1. Neptune: a bioinformatics tool for rapid discovery of genomic variation in bacterial populations

    PubMed Central

    Marinier, Eric; Zaheer, Rahat; Berry, Chrystal; Weedmark, Kelly A.; Domaratzki, Michael; Mabon, Philip; Knox, Natalie C.; Reimer, Aleisha R.; Graham, Morag R.; Chui, Linda; Patterson-Fortin, Laura; Zhang, Jian; Pagotto, Franco; Farber, Jeff; Mahony, Jim; Seyer, Karine; Bekal, Sadjia; Tremblay, Cécile; Isaac-Renton, Judy; Prystajecky, Natalie; Chen, Jessica; Slade, Peter

    2017-01-01

    Abstract The ready availability of vast amounts of genomic sequence data has created the need to rethink comparative genomics algorithms using ‘big data’ approaches. Neptune is an efficient system for rapidly locating differentially abundant genomic content in bacterial populations using an exact k-mer matching strategy, while accommodating k-mer mismatches. Neptune’s loci discovery process identifies sequences that are sufficiently common to a group of target sequences and sufficiently absent from non-targets using probabilistic models. Neptune uses parallel computing to efficiently identify and extract these loci from draft genome assemblies without requiring multiple sequence alignments or other computationally expensive comparative sequence analyses. Tests on simulated and real datasets showed that Neptune rapidly identifies regions that are both sensitive and specific. We demonstrate that this system can identify trait-specific loci from different bacterial lineages. Neptune is broadly applicable for comparative bacterial analyses, yet will particularly benefit pathogenomic applications, owing to efficient and sensitive discovery of differentially abundant genomic loci. The software is available for download at: http://github.com/phac-nml/neptune. PMID:29048594

  2. Formation of rings from segments of HeLa-cell nuclear deoxyribonucleic acid

    PubMed Central

    Hardman, Norman

    1974-01-01

    Duplex segments of HeLa-cell nuclear DNA were generated by cleavage with DNA restriction endonuclease from Haemophilus influenzae. About 20–25% of the DNA segments produced, when partly degraded with exonuclease III and annealed, were found to form rings visible in the electron microscope. A further 5% of the DNA segments formed structures that were branched in configuration. Similar structures were generated from HeLa-cell DNA, without prior treatment with restriction endonuclease, when the complementary polynucleotide chains were exposed by exonuclease III action at single-chain nicks. After exposure of an average single-chain length of 1400 nucleotides per terminus at nicks in HeLa-cell DNA by exonuclease III, followed by annealing, the physical length of ring closures was estimated and found to be 0.02–0.1μm, or 50–300 base pairs. An almost identical distribution of lengths was recorded for the regions of complementary base sequence responsible for branch formation. It is proposed that most of the rings and branches are formed from classes of reiterated base sequence with an average length of 180 base pairs arranged intermittenly in HeLa-cell DNA. From the rate of formation of branched structures when HeLa-cell DNA segments were heat-denatured and annealed, it is estimated that the reiterated sequences are in families containing approximately 2400–24000 copies. ImagesPLATE 2PLATE 1 PMID:4462738

  3. Development of a Fluorescence Resonance Energy Transfer (FRET)-Based DNA Biosensor for Detection of Synthetic Oligonucleotide of Ganoderma boninense

    PubMed Central

    Mohd Bakhori, Noremylia; Yusof, Nor Azah; Abdullah, Abdul Halim; Hussein, Mohd Zobir

    2013-01-01

    An optical DNA biosensor based on fluorescence resonance energy transfer (FRET) utilizing synthesized quantum dot (QD) has been developed for the detection of specific-sequence of DNA for Ganoderma boninense, an oil palm pathogen. Modified QD that contained carboxylic groups was conjugated with a single-stranded DNA probe (ssDNA) via amide-linkage. Hybridization of the target DNA with conjugated QD-ssDNA and reporter probe labeled with Cy5 allows for the detection of related synthetic DNA sequence of Ganoderma boninense gene based on FRET signals. Detection of FRET emission before and after hybridization was confirmed through the capability of the system to produce FRET at 680 nm for hybridized sandwich with complementary target DNA. No FRET emission was observed for non-complementary system. Hybridization time, temperature and effect of different concentration of target DNA were studied in order to optimize the developed system. The developed biosensor has shown high sensitivity with detection limit of 3.55 × 10−9 M. TEM results show that the particle size of QD varies in the range between 5 to 8 nm after ligand modification and conjugation with ssDNA. This approach is capable of providing a simple, rapid and sensitive method for detection of related synthetic DNA sequence of Ganoderma boninense. PMID:25587406

  4. Isolation of a complementary DNA clone for thyroid microsomal antigen. Homology with the gene for thyroid peroxidase.

    PubMed Central

    Seto, P; Hirayu, H; Magnusson, R P; Gestautas, J; Portmann, L; DeGroot, L J; Rapoport, B

    1987-01-01

    The thyroid microsomal antigen (MSA) in autoimmune thyroid disease is a protein of approximately 107 kD. We screened a human thyroid cDNA library constructed in the expression vector lambda gt11 with anti-107-kD monoclonal antibodies. Of five clones obtained, the recombinant beta-galactosidase fusion protein from one clone (PM-5) was confirmed to react with the monoclonal antiserum. The complementary DNA (cDNA) insert from PM-5 (0.8 kb) was used as a probe on Northern blot analysis to estimate the size of the mRNA coding for the MSA. The 2.9-kb messenger RNA (mRNA) species observed was the same size as that coding for human thyroid peroxidase (TPO). The probe did not bind to human liver mRNA, indicating the thyroid-specific nature of the PM-5-related mRNA. The nucleotide sequence of PM-5 (842 bp) was determined and consisted of a single open reading frame. Comparison of the nucleotide sequence of PM-5 with that presently available for pig TPO indicates 84% homology. In conclusion, a cDNA clone representing part of the microsomal antigen has been isolated. Sequence homology with porcine TPO, as well as identity in the size of the mRNA species for both the microsomal antigen and TPO, indicate that the microsomal antigen is, at least in part, TPO. Images PMID:3654979

  5. Synthesis and fluorescence studies of multiple labeled oligonucleotides containing dansyl fluorophore covalently attached at 2'-terminus of cytidine via carbamate linkage.

    PubMed

    Misra, Arvind; Mishra, Satyendra; Misra, Krishna

    2004-01-01

    Synthesis of modified oligonucleotides in which the specific cytidine nucleoside analogues linked at 2'-OH position via a carbamate bond with an amino ethyl derivative of dansyl fluorophore is reported. For the multiple labeling of oligonucleotides, a strategy involving prelabeling at the monomeric level followed by solid phase assembly of oligonucleotides to obtain regiospecifically labeled probes has been described. The labeled monomer was phosphitylated using 2-cyanoethyl-N,N,N',N'-tetraisopropyl-phosphoramidite (Bis-reagent) and pyridiniumtrifluoro acetate (Py.TFA) as an activator. To ascertain the minimal number of labeled monomers required for a specific length of oligonucleotide for detection and also to assess the effect of carbamate linkage on hybridization, hexamer and 20-mer sequences were selected. Both were labeled with 1, 2, and 3 monomers at the 5'-end and hybridized with normal (unmodified) complementary sequences. As compared to midsequence or 3'-terminal labeling reported earlier, the 5'-terminal labeling has been found to have minimal contact-mediated quenching on duplex formation. This may be due to complementary deoxyguanosine (dG) rich oligonucleotide sequences or CG base pairs at a terminus that is known to yield stronger binding. This is one reason for selecting cytidine for labeling. The results may aid rational design of multiple fluorescent DNA probes for nonradioactive detection of nucleic acids.

  6. An integrated semiconductor device enabling non-optical genome sequencing.

    PubMed

    Rothberg, Jonathan M; Hinz, Wolfgang; Rearick, Todd M; Schultz, Jonathan; Mileski, William; Davey, Mel; Leamon, John H; Johnson, Kim; Milgrew, Mark J; Edwards, Matthew; Hoon, Jeremy; Simons, Jan F; Marran, David; Myers, Jason W; Davidson, John F; Branting, Annika; Nobile, John R; Puc, Bernard P; Light, David; Clark, Travis A; Huber, Martin; Branciforte, Jeffrey T; Stoner, Isaac B; Cawley, Simon E; Lyons, Michael; Fu, Yutao; Homer, Nils; Sedova, Marina; Miao, Xin; Reed, Brian; Sabina, Jeffrey; Feierstein, Erika; Schorn, Michelle; Alanjary, Mohammad; Dimalanta, Eileen; Dressman, Devin; Kasinskas, Rachel; Sokolsky, Tanya; Fidanza, Jacqueline A; Namsaraev, Eugeni; McKernan, Kevin J; Williams, Alan; Roth, G Thomas; Bustillo, James

    2011-07-20

    The seminal importance of DNA sequencing to the life sciences, biotechnology and medicine has driven the search for more scalable and lower-cost solutions. Here we describe a DNA sequencing technology in which scalable, low-cost semiconductor manufacturing techniques are used to make an integrated circuit able to directly perform non-optical DNA sequencing of genomes. Sequence data are obtained by directly sensing the ions produced by template-directed DNA polymerase synthesis using all-natural nucleotides on this massively parallel semiconductor-sensing device or ion chip. The ion chip contains ion-sensitive, field-effect transistor-based sensors in perfect register with 1.2 million wells, which provide confinement and allow parallel, simultaneous detection of independent sequencing reactions. Use of the most widely used technology for constructing integrated circuits, the complementary metal-oxide semiconductor (CMOS) process, allows for low-cost, large-scale production and scaling of the device to higher densities and larger array sizes. We show the performance of the system by sequencing three bacterial genomes, its robustness and scalability by producing ion chips with up to 10 times as many sensors and sequencing a human genome.

  7. Capturing the Temporal Sequence of Interaction in Young Siblings

    PubMed Central

    Steele, Fiona; Jenkins, Jennifer

    2015-01-01

    We explored whether young children exhibit subtypes of behavioral sequences during sibling interaction. Ten-minute, free-play observations of over 300 sibling dyads were coded for positivity, negativity and disengagement. The data were analyzed using growth mixture modeling (GMM). Younger (18-month-old) children’s temporal behavioral sequences showed a harmonious (53%) and a casual (47%) class. Older (approximately four-year-old) children’s behavior was more differentiated revealing a harmonious (25%), a deteriorating (31%), a recovery (22%) and a casual (22%) class. A more positive maternal affective climate was associated with more positive patterns. Siblings’ sequential behavioral patterns tended to be complementary rather than reciprocal in nature. The study illustrates a novel use of GMM and makes a theoretical contribution by showing that young children exhibit distinct types of temporal behavioral sequences that are related to parenting processes. PMID:25996957

  8. Rapid DNA Sequencing by Direct Nanoscale Reading of Nucleotide Bases on Individual DNA Chains

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lee, James Weifu; Meller, Amit

    2007-01-01

    Since the independent invention of DNA sequencing by Sanger and by Gilbert 30 years ago, it has grown from a small scale technique capable of reading several kilobase-pair of sequence per day into today's multibillion dollar industry. This growth has spurred the development of new sequencing technologies that do not involve either electrophoresis or Sanger sequencing chemistries. Sequencing by Synthesis (SBS) involves multiple parallel micro-sequencing addition events occurring on a surface, where data from each round is detected by imaging. New High Throughput Technologies for DNA Sequencing and Genomics is the second volume in the Perspectives in Bioanalysis series, whichmore » looks at the electroanalytical chemistry of nucleic acids and proteins, development of electrochemical sensors and their application in biomedicine and in the new fields of genomics and proteomics. The authors have expertly formatted the information for a wide variety of readers, including new developments that will inspire students and young scientists to create new tools for science and medicine in the 21st century. Reviews of complementary developments in Sanger and SBS sequencing chemistries, capillary electrophoresis and microdevice integration, MS sequencing and applications set the framework for the book.« less

  9. Oligonucleoside alkyl or arylphosphonate derivatives capable of crosslinking with or cleaving nucleic acids

    DOEpatents

    Miller, P.S.; Ts'o, P.O.P.

    1999-06-15

    A composition for inactivating a target nucleic acid which comprises an oligonucleoside alkyl or arylphosphonate analogue which is complementary to the sequence of the target nucleic acid is provided. It includes a functional group which reacts with the target nucleic acid to render the target nucleic acid inactive or nonfunctional. 16 figs.

  10. Surface-enhanced Raman scattering detection of DNA derived from the West Nile virus genome using magnetic capture of Raman-active gold nanoparticles

    USDA-ARS?s Scientific Manuscript database

    A model paramagnetic nanoparticle (MNP) assay is demonstrated for surface-enhanced Raman scattering (SERS) detection of DNA oligonucleotides derived from the West Nile virus (WNV) genome. Detection is based on the capture of WNV target sequences by hybridization with complementary oligonucleotide pr...

  11. Is the extraction by Whatman FTA filter matrix technology and sequencing of large ribosomal subunit D1-D2 region sufficient for identification of clinical fungi?

    PubMed

    Kiraz, Nuri; Oz, Yasemin; Aslan, Huseyin; Erturan, Zayre; Ener, Beyza; Akdagli, Sevtap Arikan; Muslumanoglu, Hamza; Cetinkaya, Zafer

    2015-10-01

    Although conventional identification of pathogenic fungi is based on the combination of tests evaluating their morphological and biochemical characteristics, they can fail to identify the less common species or the differentiation of closely related species. In addition these tests are time consuming, labour-intensive and require experienced personnel. We evaluated the feasibility and sufficiency of DNA extraction by Whatman FTA filter matrix technology and DNA sequencing of D1-D2 region of the large ribosomal subunit gene for identification of clinical isolates of 21 yeast and 160 moulds in our clinical mycology laboratory. While the yeast isolates were identified at species level with 100% homology, 102 (63.75%) clinically important mould isolates were identified at species level, 56 (35%) isolates at genus level against fungal sequences existing in DNA databases and two (1.25%) isolates could not be identified. Consequently, Whatman FTA filter matrix technology was a useful method for extraction of fungal DNA; extremely rapid, practical and successful. Sequence analysis strategy of D1-D2 region of the large ribosomal subunit gene was found considerably sufficient in identification to genus level for the most clinical fungi. However, the identification to species level and especially discrimination of closely related species may require additional analysis. © 2015 Blackwell Verlag GmbH.

  12. Deep sequencing methods for protein engineering and design.

    PubMed

    Wrenbeck, Emily E; Faber, Matthew S; Whitehead, Timothy A

    2017-08-01

    The advent of next-generation sequencing (NGS) has revolutionized protein science, and the development of complementary methods enabling NGS-driven protein engineering have followed. In general, these experiments address the functional consequences of thousands of protein variants in a massively parallel manner using genotype-phenotype linked high-throughput functional screens followed by DNA counting via deep sequencing. We highlight the use of information rich datasets to engineer protein molecular recognition. Examples include the creation of multiple dual-affinity Fabs targeting structurally dissimilar epitopes and engineering of a broad germline-targeted anti-HIV-1 immunogen. Additionally, we highlight the generation of enzyme fitness landscapes for conducting fundamental studies of protein behavior and evolution. We conclude with discussion of technological advances. Copyright © 2016 Elsevier Ltd. All rights reserved.

  13. Characterizing genomic alterations in cancer by complementary functional associations.

    PubMed

    Kim, Jong Wook; Botvinnik, Olga B; Abudayyeh, Omar; Birger, Chet; Rosenbluh, Joseph; Shrestha, Yashaswi; Abazeed, Mohamed E; Hammerman, Peter S; DiCara, Daniel; Konieczkowski, David J; Johannessen, Cory M; Liberzon, Arthur; Alizad-Rahvar, Amir Reza; Alexe, Gabriela; Aguirre, Andrew; Ghandi, Mahmoud; Greulich, Heidi; Vazquez, Francisca; Weir, Barbara A; Van Allen, Eliezer M; Tsherniak, Aviad; Shao, Diane D; Zack, Travis I; Noble, Michael; Getz, Gad; Beroukhim, Rameen; Garraway, Levi A; Ardakani, Masoud; Romualdi, Chiara; Sales, Gabriele; Barbie, David A; Boehm, Jesse S; Hahn, William C; Mesirov, Jill P; Tamayo, Pablo

    2016-05-01

    Systematic efforts to sequence the cancer genome have identified large numbers of mutations and copy number alterations in human cancers. However, elucidating the functional consequences of these variants, and their interactions to drive or maintain oncogenic states, remains a challenge in cancer research. We developed REVEALER, a computational method that identifies combinations of mutually exclusive genomic alterations correlated with functional phenotypes, such as the activation or gene dependency of oncogenic pathways or sensitivity to a drug treatment. We used REVEALER to uncover complementary genomic alterations associated with the transcriptional activation of β-catenin and NRF2, MEK-inhibitor sensitivity, and KRAS dependency. REVEALER successfully identified both known and new associations, demonstrating the power of combining functional profiles with extensive characterization of genomic alterations in cancer genomes.

  14. Supramolecular luminescence from oligofluorenol-based supramolecular polymer semiconductors.

    PubMed

    Zhang, Guang-Wei; Wang, Long; Xie, Ling-Hai; Lin, Jin-Yi; Huang, Wei

    2013-11-13

    Supramolecular luminescence stems from non-covalent exciton behaviors of active π-segments in supramolecular entities or aggregates via intermolecular forces. Herein, a π-conjugated oligofluorenol, containing self-complementary double hydrogen bonds, was synthesized using Suzuki coupling as a supramolecular semiconductor. Terfluorenol-based random supramolecular polymers were confirmed via concentration-dependent nuclear magnetic resonance (NMR) and dynamic light scattering (DLS). The photoluminescent spectra of the TFOH-1 solution exhibit a green emission band (g-band) at approximately ~520 nm with reversible features, as confirmed through titration experiments. Supramolecular luminescence of TFOH-1 thin films serves as robust evidence for the aggregates of g-band. Our results suggest that the presence of polyfluorene ketone defects is a sufficient condition, rather than a sufficient-necessary condition for the g-band. Supramolecular electroluminescence will push organic devices into the fields of supramolecular optoelectronics, spintronics, and mechatronics.

  15. Somatic association of telocentric chromosomes carrying homologous centromeres in common wheat.

    PubMed

    Mello-Sampayo, T

    1973-01-01

    Measurements of distances between telocentric chromosomes, either homologous or representing the opposite arms of a metacentric chromosome (complementary telocentrics), were made at metaphase in root tip cells of common wheat carrying two homologous pairs of complementary telocentrics of chromosome 1 B or 6 B (double ditelosomic 1 B or 6 B). The aim was to elucidate the relative locations of the telocentric chromosomes within the cell. The data obtained strongly suggest that all four telocentrics of chromosome 1 B or 6 B are spacially and simultaneously co-associated. In plants carrying two complementary (6 B (S) and 6 B (L)) and a non-related (5 B (L)) telocentric, only the complementary chromosomes were found to be somatically associated. It is thought, therefore, that the somatic association of chromosomes may involve more than two chromosomes in the same association and, since complementary telocentrics are as much associated as homologous, that the homology between centromeres (probably the only homologous region that exists between complementary telocentrics) is a very important condition for somatic association of chromosomes. The spacial arrangement of chromosomes was studied at anaphase and prophase and the polar orientation of chromosomes at prophase was found to resemble anaphase orientation. This was taken as good evidence for the maintenance of the chromosome arrangement - the Rabl orientation - and of the peripheral location of the centromere and its association with the nuclear membrane. Within this general arrangement homologous telocentric chromosomes were frequently seen to have their centromeres associated or directed towards each other. The role of the centromere in somatic association as a spindle fibre attachment and chromosome binder is discussed. It is suggested that for non-homologous chromosomes to become associated in root tips, the only requirement needed should be the homology of centromeres such as exists between complementary telocentrics, or, as a possible alternative, common repeated sequences of DNA molecules around the centromere region.

  16. Generation of RNA in abiotic conditions.

    NASA Astrophysics Data System (ADS)

    di Mauro, Ernesto

    Generation of RNA in abiotic conditions. Ernesto Di Mauro Dipartimento di Genetica Bi-ologia Molecolare, Universit` "Sapienza" Roma, Italy. a At least four conditions must be satisfied for the spontaneous generation of (pre)-genetic poly-mers: 1) availability of precursors that are activated enough to spontaneously polymerize. Preliminary studies showed that (a) nucleic bases and acyclonucleosides can be synthesized from formamide H2NCOH by simply heating with prebiotically available mineral catalysts [last reviewed in (1)], and that b) nucleic bases can be phosphorylated in every possible posi-tion [2'; 3'; 5'; cyclic 2',3'; cyclic 3',5' (2)]. The higher stability of the cyclic forms allows their accumulation. 2) A polymerization mechanism. A reaction showing the formation of RNA polymers starting from prebiotically plausible precursors (3',5' cyclic GMP and 3', 5'cyclic AMP) was recently reported (3). Polymerization in these conditions is thermodynamically up-hill and an equilibrium is attained that limits the maximum length of the polymer produced to about 40 nucleotides for polyG and 100 nucleotides for polyA. 3) Ligation of the synthesized oligomers. If this type of reaction could occur according to a terminal-joining mechanism and could generate canonical 3',5' phosphodiester bonds, exponential growth would be obtained of the generated oligomers. This type of reaction has been reported (4) , limited to homogeneous polyA sequences and leading to the production of polyA dimers and tetramers. What is still missing are: 4) mechanisms that provide the proof of principle for the generation of sequence complexity. We will show evidence for two mechanisms providing this proof of principle for simple complementary sequences. Namely: abiotic sequence complementary-driven terminal ligation and sequence-complementary terminal growth. In conclusion: all the steps leading to the generation of RNA in abiotic conditions are satisfied. (1) R Saladino, C Crestini, F. Ciciriello, S. Pino, G. Costanzo, E. Di Mauro. From formamide to RNA: the roles of formamide and water in the evolution of chemical information. Research In Microbiology, Special Issue on The Origin of life and Microbiology (2009) 160:441-448. (2) Costanzo, G., Saladino, R., Crestini, C., Ciciriello, F., and Di Mauro, E. Nucleoside phos-phorylation by phosphate minerals. J. Biol. Chem. (2007) 282: 16729-16735. (3) Samanta Pino, Fabiana Ciciriello, Giovanna Costanzo and E. Di Mauro, Nonenzymatic RNA Ligation in Water J. Biol. Chem. (2008), 283: 36494-36503 (4) Costanzo, G., Pino, S., Ciciriello, F., and Di Mauro, E. Generation of long RNA chains in water. J Biol Chem. (2009) 284:33206-33216.

  17. [Bases for adequate complementary feeding in infants and young children].

    PubMed

    Gil Hernández, A; Uauy Dagach, R; Dalmau Serra, J

    2006-11-01

    Infants can be exclusively breast fed or formula fed for the first 6 months of life and their nutritional requirements are completely fulfilled. However, from 6 months onwards, human milk is not sufficient to supply all the nutrients necessary for infants and young children. Therefore, adequate supplementary feeding, in terms of both quantity and quality, should be provided. The present article aims to describe the scientific bases for practical recommendations on complementary feeding during infancy and early childhood, which may be useful to pediatricians and should serve to improve the health status of the infant population in Spain. In this sense, the new international recommendations for energy, protein and other nutrient requirements are reviewed. In Spain, the law applicable to manufacturing infant cereals and homogenized infant foods is that published by the European Union in specific directives. However, taking into consideration new advances in knowledge of nutritional requirements, we have considered a number of issues that could be relevant for the manufacture of these foods. Finally, we propose a series of basic principles that should serve as a guide for the complementary feeding of infants (whether breast fed, formula fed, or receiving mixed feeding) and young children. These recommendations are particularly addressed to pediatricians working in primary health services.

  18. FA-SAT Is an Old Satellite DNA Frozen in Several Bilateria Genomes

    PubMed Central

    Chaves, Raquel; Ferreira, Daniela; Mendes-da-Silva, Ana; Meles, Susana; Adega, Filomena

    2017-01-01

    Abstract In recent years, a growing body of evidence has recognized the tandem repeat sequences, and specifically satellite DNA, as a functional class of sequences in the genomic “dark matter.” Using an original, complementary, and thus an eclectic experimental design, we show that the cat archetypal satellite DNA sequence, FA-SAT, is “frozen” conservatively in several Bilateria genomes. We found different genomic FA-SAT architectures, and the interspersion pattern was conserved. In Carnivora genomes, the FA-SAT-related sequences are also amplified, with the predominance of a specific FA-SAT variant, at the heterochromatic regions. We inspected the cat genome project to locate FA-SAT array flanking regions and revealed an intensive intermingling with transposable elements. Our results also show that FA-SAT-related sequences are transcribed and that the most abundant FA-SAT variant is not always the most transcribed. We thus conclude that the DNA sequences of FA-SAT and their transcripts are “frozen” in these genomes. Future work is needed to disclose any putative function that these sequences may play in these genomes. PMID:29608678

  19. Quantiprot - a Python package for quantitative analysis of protein sequences.

    PubMed

    Konopka, Bogumił M; Marciniak, Marta; Dyrka, Witold

    2017-07-17

    The field of protein sequence analysis is dominated by tools rooted in substitution matrices and alignments. A complementary approach is provided by methods of quantitative characterization. A major advantage of the approach is that quantitative properties defines a multidimensional solution space, where sequences can be related to each other and differences can be meaningfully interpreted. Quantiprot is a software package in Python, which provides a simple and consistent interface to multiple methods for quantitative characterization of protein sequences. The package can be used to calculate dozens of characteristics directly from sequences or using physico-chemical properties of amino acids. Besides basic measures, Quantiprot performs quantitative analysis of recurrence and determinism in the sequence, calculates distribution of n-grams and computes the Zipf's law coefficient. We propose three main fields of application of the Quantiprot package. First, quantitative characteristics can be used in alignment-free similarity searches, and in clustering of large and/or divergent sequence sets. Second, a feature space defined by quantitative properties can be used in comparative studies of protein families and organisms. Third, the feature space can be used for evaluating generative models, where large number of sequences generated by the model can be compared to actually observed sequences.

  20. Progress in ion torrent semiconductor chip based sequencing.

    PubMed

    Merriman, Barry; Rothberg, Jonathan M

    2012-12-01

    In order for next-generation sequencing to become widely used as a diagnostic in the healthcare industry, sequencing instrumentation will need to be mass produced with a high degree of quality and economy. One way to achieve this is to recast DNA sequencing in a format that fully leverages the manufacturing base created for computer chips, complementary metal-oxide semiconductor chip fabrication, which is the current pinnacle of large scale, high quality, low-cost manufacturing of high technology. To achieve this, ideally the entire sensory apparatus of the sequencer would be embodied in a standard semiconductor chip, manufactured in the same fab facilities used for logic and memory chips. Recently, such a sequencing chip, and the associated sequencing platform, has been developed and commercialized by Ion Torrent, a division of Life Technologies, Inc. Here we provide an overview of this semiconductor chip based sequencing technology, and summarize the progress made since its commercial introduction. We described in detail the progress in chip scaling, sequencing throughput, read length, and accuracy. We also summarize the enhancements in the associated platform, including sample preparation, data processing, and engagement of the broader development community through open source and crowdsourcing initiatives. © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  1. Zucchini-dependent piRNA processing is triggered by recruitment to the cytoplasmic processing machinery

    PubMed Central

    Rogers, Alicia K.; Situ, Kathy; Perkins, Edward M.; Toth, Katalin Fejes

    2017-01-01

    The piRNA pathway represses transposable elements in the gonads and thereby plays a vital role in protecting the integrity of germline genomes of animals. Mature piRNAs are processed from longer transcripts, piRNA precursors (pre-piRNAs). In Drosophila, processing of pre-piRNAs is initiated by piRNA-guided Slicer cleavage or the endonuclease Zucchini (Zuc). As Zuc does not have any sequence or structure preferences in vitro, it is not known how piRNA precursors are selected and channeled into the Zuc-dependent processing pathway. We show that a heterologous RNA that lacks complementary piRNAs is processed into piRNAs upon recruitment of several piRNA pathway factors. This processing requires Zuc and the helicase Armitage (Armi). Aubergine (Aub), Argonaute 3 (Ago3), and components of the nuclear RDC complex, which are required for normal piRNA biogenesis in germ cells, are dispensable. Our approach allows discrimination of proteins involved in the transcription and export of piRNA precursors from components required for the cytoplasmic processing steps. piRNA processing correlates with localization of the substrate RNA to nuage, a distinct membraneless cytoplasmic compartment, which surrounds the nucleus of germ cells, suggesting that sequestration of RNA to this subcellular compartment is both necessary and sufficient for selecting piRNA biogenesis substrates. PMID:29021243

  2. Analysis of hepatitis C virus RNA dimerization and core–RNA interactions

    PubMed Central

    Ivanyi-Nagy, Roland; Kanevsky, Igor; Gabus, Caroline; Lavergne, Jean-Pierre; Ficheux, Damien; Penin, François; Fossé, Philippe; Darlix, Jean-Luc

    2006-01-01

    The core protein of hepatitis C virus (HCV) has been shown previously to act as a potent nucleic acid chaperone in vitro, promoting the dimerization of the 3′-untranslated region (3′-UTR) of the HCV genomic RNA, a process probably mediated by a small, highly conserved palindromic RNA motif, named DLS (dimer linkage sequence) [G. Cristofari, R. Ivanyi-Nagy, C. Gabus, S. Boulant, J. P. Lavergne, F. Penin and J. L. Darlix (2004) Nucleic Acids Res., 32, 2623–2631]. To investigate in depth HCV RNA dimerization, we generated a series of point mutations in the DLS region. We find that both the plus-strand 3′-UTR and the complementary minus-strand RNA can dimerize in the presence of core protein, while mutations in the DLS (among them a single point mutation that abolished RNA replication in a HCV subgenomic replicon system) completely abrogate dimerization. Structural probing of plus- and minus-strand RNAs, in their monomeric and dimeric forms, indicate that the DLS is the major if not the sole determinant of UTR RNA dimerization. Furthermore, the N-terminal basic amino acid clusters of core protein were found to be sufficient to induce dimerization, suggesting that they retain full RNA chaperone activity. These findings may have important consequences for understanding the HCV replicative cycle and the genetic variability of the virus. PMID:16707664

  3. DNA barcoding amphibians and reptiles.

    PubMed

    Vences, Miguel; Nagy, Zoltán T; Sonet, Gontran; Verheyen, Erik

    2012-01-01

    Only a few major research programs are currently targeting COI barcoding of amphibians and reptiles (including chelonians and crocodiles), two major groups of tetrapods. Amphibian and reptile species are typically old, strongly divergent, and contain deep conspecific lineages which might lead to problems in species assignment with incomplete reference databases. As far as known, there is no single pair of COI primers that will guarantee a sufficient rate of success across all amphibian and reptile taxa, or within major subclades of amphibians and reptiles, which means that the PCR amplification strategy needs to be adjusted depending on the specific research question. In general, many more amphibian and reptile taxa have been sequenced for 16S rDNA, which for some purposes may be a suitable complementary marker, at least until a more comprehensive COI reference database becomes available. DNA barcoding has successfully been used to identify amphibian larval stages (tadpoles) in species-rich tropical assemblages. Tissue sampling, DNA extraction, and amplification of COI is straightforward in amphibians and reptiles. Single primer pairs are likely to have a failure rate between 5 and 50% if taxa of a wide taxonomic range are targeted; in such cases the use of primer cocktails or subsequent hierarchical usage of different primer pairs is necessary. If the target group is taxonomically limited, many studies have followed a strategy of designing specific primers which then allow an easy and reliable amplification of all samples.

  4. Guiding principles for peptide nanotechnology through directed discovery.

    PubMed

    Lampel, A; Ulijn, R V; Tuttle, T

    2018-05-21

    Life's diverse molecular functions are largely based on only a small number of highly conserved building blocks - the twenty canonical amino acids. These building blocks are chemically simple, but when they are organized in three-dimensional structures of tremendous complexity, new properties emerge. This review explores recent efforts in the directed discovery of functional nanoscale systems and materials based on these same amino acids, but that are not guided by copying or editing biological systems. The review summarises insights obtained using three complementary approaches of searching the sequence space to explore sequence-structure relationships for assembly, reactivity and complexation, namely: (i) strategic editing of short peptide sequences; (ii) computational approaches to predicting and comparing assembly behaviours; (iii) dynamic peptide libraries that explore the free energy landscape. These approaches give rise to guiding principles on controlling order/disorder, complexation and reactivity by peptide sequence design.

  5. SxtA gene sequence analysis of dinoflagellate Alexandrium minutum

    NASA Astrophysics Data System (ADS)

    Norshaha, Safida Anira; Latib, Norhidayu Abdul; Usup, Gires; Yusof, Nurul Yuziana Mohd

    2015-09-01

    The dinoflagellate Alexandrium minutum is typically known for the production of potent neurotoxins such as saxitoxin, affecting the health of human seafood consumers via paralytic shellfish poisoning (PSP). These phenomena is related to the harmful algal blooms (HABs) that is believed to be influenced by environmental and nutritional factors. Previous study has revealed that SxtA gene is a starting gene that involved in the saxitoxin production pathway. The aim of this study was to analyse the sequence of the sxtA gene in A. minutum. The dinoflagellates culture was cultured at temperature 26°C with 16:8-hour light:dark photocycle. After the samples were harvested, RNA was extracted, complementary DNA (cDNA) was synthesised and amplified by polymerase chain reaction (PCR). The PCR products were then purified and cloned before sequenced. The SxtA sequence obtained was then analyzed in order to identify the presence of SxtA gene in Alexandrium minutum.

  6. Studying Epigenetic DNA Modifications in Undergraduate Laboratories Using Complementary Bioinformatic and Molecular Approaches

    ERIC Educational Resources Information Center

    Militello, Kevin T.

    2013-01-01

    Epigenetic inheritance is the inheritance of genetic information that is not based on DNA sequence alone. One type of epigenetic information that has come to the forefront in the last few years is modified DNA bases. The most common modified DNA base in nature is 5-methylcytosine. Herein, we describe a laboratory experiment that combines…

  7. Blue light photoreceptors and methods of using the same

    DOEpatents

    Cashmore, Anthony Robert; Ahmad, Margaret; Lin, Chentao

    1998-01-01

    The invention features a substantially pure preparation of a nucleic acid encoding a HY4 or a HY4-related gene. The invention further features transgenic plants encoding a HY4 gene having a shorter stem than substantially homozygous wild type nontransgenic plants; and, transgenic plants comprising complementary HY4 sequences having a longer stem than substantially homozygous wild type nontransgenic plants.

  8. Amplification of Chloroplast DNA Using the Polymerase Chain Reaction (PCR): A Practical Activity for Secondary School Students

    ERIC Educational Resources Information Center

    Hamilton, Kenny; Barfoot, Jan; Crawford, Kathleen E.; Simpson, Craig G.; Beaumont, Paul C.; Bownes, Mary

    2006-01-01

    We describe a polymerase chain reaction (PCR) protocol suitable for use in secondary schools and colleges. This PCR protocol can be used to investigate genetic variation between plants. The protocol makes use of primers which are complementary to sequences of nucleotides that are highly conserved across different plant genera. The regions of…

  9. Top-Down Hydrogen-Deuterium Exchange Analysis of Protein Structures Using Ultraviolet Photodissociation.

    PubMed

    Brodie, Nicholas I; Huguet, Romain; Zhang, Terry; Viner, Rosa; Zabrouskov, Vlad; Pan, Jingxi; Petrotchenko, Evgeniy V; Borchers, Christoph H

    2018-03-06

    Top-down hydrogen-deuterium exchange (HDX) analysis using electron capture or transfer dissociation Fourier transform mass spectrometry (FTMS) is a powerful method for the analysis of secondary structure of proteins in solution. The resolution of the method is a function of the degree of fragmentation of backbone bonds in the proteins. While fragmentation is usually extensive near the N- and C-termini, electron capture (ECD) or electron transfer dissociation (ETD) fragmentation methods sometimes lack good coverage of certain regions of the protein, most often in the middle of the sequence. Ultraviolet photodissociation (UVPD) is a recently developed fast-fragmentation technique, which provides extensive backbone fragmentation that can be complementary in sequence coverage to the aforementioned electron-based fragmentation techniques. Here, we explore the application of electrospray ionization (ESI)-UVPD FTMS on an Orbitrap Fusion Lumos Tribrid mass spectrometer to top-down HDX analysis of proteins. We have incorporated UVPD-specific fragment-ion types and fragment-ion mixtures into our isotopic envelope fitting software (HDX Match) for the top-down HDX analysis. We have shown that UVPD data is complementary to ETD, thus improving the overall resolution when used as a combined approach.

  10. The Role of CRISPR-Cas Systems in Virulence of Pathogenic Bacteria

    PubMed Central

    Staals, Raymond H. J.; Endtz, Hubert P.; van Baarlen, Peter; van der Oost, John

    2014-01-01

    SUMMARY Clustered regularly interspaced short palindromic repeats (CRISPR) and CRISPR-associated (Cas) genes are present in many bacterial and archaeal genomes. Since the discovery of the typical CRISPR loci in the 1980s, well before their physiological role was revealed, their variable sequences have been used as a complementary typing tool in diagnostic, epidemiologic, and evolutionary analyses of prokaryotic strains. The discovery that CRISPR spacers are often identical to sequence fragments of mobile genetic elements was a major breakthrough that eventually led to the elucidation of CRISPR-Cas as an adaptive immunity system. Key elements of this unique prokaryotic defense system are small CRISPR RNAs that guide nucleases to complementary target nucleic acids of invading viruses and plasmids, generally followed by the degradation of the invader. In addition, several recent studies have pointed at direct links of CRISPR-Cas to regulation of a range of stress-related phenomena. An interesting example concerns a pathogenic bacterium that possesses a CRISPR-associated ribonucleoprotein complex that may play a dual role in defense and/or virulence. In this review, we describe recently reported cases of potential involvement of CRISPR-Cas systems in bacterial stress responses in general and bacterial virulence in particular. PMID:24600041

  11. Isolation of complementary DNA clones encoding pathogenesis-related proteins P and Q, two acidic chitinases from tobacco.

    PubMed Central

    Payne, G; Ahl, P; Moyer, M; Harper, A; Beck, J; Meins, F; Ryals, J

    1990-01-01

    Complementary DNA clones encoding two isoforms of the acidic endochitinase (chitinase, EC 3.2.1.14) from tobacco were isolated. Comparison of amino acid sequences deduced from the cDNA clones and the sequence of peptides derived from purified proteins show that these clones encode the pathogenesis-related proteins PR-P and PR-Q. The cDNA inserts were not homologous to either the bacterial form of chitinase or the form from cucumber but shared significant homology to the basic form of chitinase from tobacco and bean. The acidic isoforms of tobacco chitinase did not contain the amino-terminal, cysteine-rich "hevein" domain found in the basic isoforms, indicating that this domain, which binds chitin, is not essential for chitinolytic activity. The accumulation of mRNA for the pathogenesis-related proteins PR-1, PR-R, PR-P, and PR-Q in Xanthi.nc tobacco leaves following infection with tobacco mosaic virus was measured by primer extension. The results indicate that the induction of these proteins during the local necrotic lesion response to the virus is coordinated at the mRNA level. Images PMID:2296608

  12. The role of CRISPR-Cas systems in virulence of pathogenic bacteria.

    PubMed

    Louwen, Rogier; Staals, Raymond H J; Endtz, Hubert P; van Baarlen, Peter; van der Oost, John

    2014-03-01

    Clustered regularly interspaced short palindromic repeats (CRISPR) and CRISPR-associated (Cas) genes are present in many bacterial and archaeal genomes. Since the discovery of the typical CRISPR loci in the 1980s, well before their physiological role was revealed, their variable sequences have been used as a complementary typing tool in diagnostic, epidemiologic, and evolutionary analyses of prokaryotic strains. The discovery that CRISPR spacers are often identical to sequence fragments of mobile genetic elements was a major breakthrough that eventually led to the elucidation of CRISPR-Cas as an adaptive immunity system. Key elements of this unique prokaryotic defense system are small CRISPR RNAs that guide nucleases to complementary target nucleic acids of invading viruses and plasmids, generally followed by the degradation of the invader. In addition, several recent studies have pointed at direct links of CRISPR-Cas to regulation of a range of stress-related phenomena. An interesting example concerns a pathogenic bacterium that possesses a CRISPR-associated ribonucleoprotein complex that may play a dual role in defense and/or virulence. In this review, we describe recently reported cases of potential involvement of CRISPR-Cas systems in bacterial stress responses in general and bacterial virulence in particular.

  13. Design of a sensitive aptasensor based on magnetic microbeads-assisted strand displacement amplification and target recycling.

    PubMed

    Li, Ying; Ji, Xiaoting; Song, Weiling; Guo, Yingshu

    2013-04-03

    A cross-circular amplification system for sensitive detection of adenosine triphosphate (ATP) in cancer cells was developed based on aptamer-target interaction, magnetic microbeads (MBs)-assisted strand displacement amplification and target recycling. Here we described a new recognition probe possessing two parts, the ATP aptamer and the extension part. The recognition probe was firstly immobilized on the surface of MBs and hybridized with its complementary sequence to form a duplex. When combined with ATP, the probe changed its conformation, revealing the extension part in single-strand form, which further served as a toehold for subsequent target recycling. The released complementary sequence of the probe acted as the catalyst of the MB-assisted strand displacement reaction. Incorporated with target recycling, a large amount of biotin-tagged MB complexes were formed to stimulate the generation of chemiluminescence (CL) signal in the presence of luminol and H2O2 by incorporating with streptavidin-HRP, reaching a detection limit of ATP as low as 6.1×10(-10)M. Moreover, sample assays of ATP in Ramos Burkitt's lymphoma B cells were performed, which confirmed the reliability and practicality of the protocol. Copyright © 2013 Elsevier B.V. All rights reserved.

  14. Modeling the Behavior of an Underwater Acoustic Relative Positioning System Based on Complementary Set of Sequences

    PubMed Central

    Aparicio, Joaquín; Jiménez, Ana; Álvarez, Fernando J.; Ureña, Jesús; De Marziani, Carlos; Diego, Cristina

    2011-01-01

    The great variability usually found in underwater media makes modeling a challenging task, but helpful for better understanding or predicting the performance of future deployed systems. In this work, an underwater acoustic propagation model is presented. This model obtains the multipath structure by means of the ray tracing technique. Using this model, the behavior of a relative positioning system is presented. One of the main advantages of relative positioning systems is that only the distances between all the buoys are needed to obtain their positions. In order to obtain the distances, the propagation times of acoustic signals coded by Complementary Set of Sequences (CSS) are used. In this case, the arrival instants are obtained by means of correlation processes. The distances are then used to obtain the position of the buoys by means of the Multidimensional Scaling Technique (MDS). As an early example of an application using this relative positioning system, a tracking of the position of the buoys at different times is performed. With this tracking, the surface current of a particular region could be studied. The performance of the system is evaluated in terms of the distance from the real position to the estimated one. PMID:22247661

  15. A label-free, PCR-free and signal-on electrochemical DNA biosensor for Leishmania major based on gold nanoleaves.

    PubMed

    Moradi, M; Sattarahmady, N; Rahi, A; Hatam, G R; Sorkhabadi, S M Rezayat; Heli, H

    2016-12-01

    Detection of leishmaniasis is important in clinical diagnoses. In the present study, identification of Leishmania parasites was performed by a label-free, PCR-free and signal-on ultrasensitive electrochemical DNA biosensor. Gold nanoleaves were firstly electrodeposited by an electrodeposition method using spermidine as a shape directing agent. The biosensor was fabricated by immobilization of a Leishmania major specific DNA probe onto gold nanoleaves, and methylene blue was employed as a marker. Hybridization of the complementary single stranded DNA sequence with the biosensor under the selected conditions was then investigated. The biosensor could detect a synthetic DNA target in a range of 1.0×10 -10 to 1.0×10 -19 molL -1 with a limit of detection of 1.8×10 -20 molL -1 , and genomic DNA in a range of 0.5-20ngμL -1 with a limit of detection of 0.07ngμL -1 . The biosensor could distinguish Leishmania major from a non-complementary-sequence oligonucleotide and the tropica species with a high selectivity. The biosensor was applicable to detect Leishmania major in patient samples. Copyright © 2016 Elsevier B.V. All rights reserved.

  16. Biomimetic nanochannels based biosensor for ultrasensitive and label-free detection of nucleic acids.

    PubMed

    Sun, Zhongyue; Liao, Tangbin; Zhang, Yulin; Shu, Jing; Zhang, Hong; Zhang, Guo-Jun

    2016-12-15

    A very simple sensing device based on biomimetic nanochannels has been developed for label-free, ultrasensitive and highly sequence-specific detection of DNA. Probe DNA was modified on the inner wall of the nanochannel surface by layer-by-layer (LBL) assembly. After probe DNA immobilization, DNA detection was realized by monitoring the rectified ion current when hybridization occurred. Due to three dimensional (3D) nanoscale environment of the nanochannel, this special geometry dramatically increased the surface area of the nanochannel for immobilization of probe molecules on the inner-surface and enlarged contact area between probes and target-molecules. Thus, the unique sensor reached a reliable detection limit of 10 fM for target DNA. In addition, this DNA sensor could discriminate complementary DNA (c-DNA) from non-complementary DNA (nc-DNA), two-base mismatched DNA (2bm-DNA) and one-base mismatched DNA (1bm-DNA) with high specificity. Moreover, the nanochannel-based biosensor was also able to detect target DNA even in an interfering environment and serum samples. This approach will provide a novel biosensing platform for detection and discrimination of disease-related molecular targets and unknown sequence DNA. Copyright © 2016 Elsevier B.V. All rights reserved.

  17. Citrus psorosis virus RNA 1 is of negative polarity and potentially encodes in its complementary strand a 24K protein of unknown function and 280K putative RNA dependent RNA polymerase.

    PubMed

    Naum-Onganía, Gabriela; Gago-Zachert, Selma; Peña, Eduardo; Grau, Oscar; Garcia, Maria Laura

    2003-10-01

    Citrus psorosis virus (CPsV), the type member of genus Ophiovirus, has three genomic RNAs. Complete sequencing of CPsV RNA 1 revealed a size of 8184 nucleotides and Northern blot hybridization with chain specific probes showed that its non-coding strand is preferentially encapsidated. The complementary strand of RNA 1 contains two open reading frames (ORFs) separated by a 109-nt intergenic region, one located near the 5'-end potentially encoding a 24K protein of unknown function, and another of 280K containing the core polymerase motifs characteristic of viral RNA-dependent RNA polymerases (RdRp). Comparison of the core RdRp motifs of negative-stranded RNA viruses, supports grouping CPsV, Ranunculus white mottle virus (RWMV) and Mirafiori lettuce virus (MiLV) within the same genus (Ophiovirus), constituting a monophyletic group separated from all other negative-stranded RNA viruses. Furthermore, RNAs 1 of MiLV, CPsV and RWMV are similar in size and those of MiLV and CPsV also in genomic organization and sequence.

  18. Genomic Sequencing of Bordetella pertussis for Epidemiology and Global Surveillance of Whooping Cough.

    PubMed

    Bouchez, Valérie; Guglielmini, Julien; Dazas, Mélody; Landier, Annie; Toubiana, Julie; Guillot, Sophie; Criscuolo, Alexis; Brisse, Sylvain

    2018-06-01

    Bordetella pertussis causes whooping cough, a highly contagious respiratory disease that is reemerging in many world regions. The spread of antigen-deficient strains may threaten acellular vaccine efficacy. Dynamics of strain transmission are poorly defined because of shortcomings in current strain genotyping methods. Our objective was to develop a whole-genome genotyping strategy with sufficient resolution for local epidemiologic questions and sufficient reproducibility to enable international comparisons of clinical isolates. We defined a core genome multilocus sequence typing scheme comprising 2,038 loci and demonstrated its congruence with whole-genome single-nucleotide polymorphism variation. Most cases of intrafamilial groups of isolates or of multiple isolates recovered from the same patient were distinguished from temporally and geographically cocirculating isolates. However, epidemiologically unrelated isolates were sometimes nearly undistinguishable. We set up a publicly accessible core genome multilocus sequence typing database to enable global comparisons of B. pertussis isolates, opening the way for internationally coordinated surveillance.

  19. Degradation of Serotonin N-Acetyltransferase, a Circadian Regulator, by the N-end Rule Pathway.

    PubMed

    Wadas, Brandon; Borjigin, Jimo; Huang, Zheping; Oh, Jang-Hyun; Hwang, Cheol-Sang; Varshavsky, Alexander

    2016-08-12

    Serotonin N-acetyltransferase (AANAT) converts serotonin to N-acetylserotonin (NAS), a distinct biological regulator and the immediate precursor of melatonin, a circulating hormone that influences circadian processes, including sleep. N-terminal sequences of AANAT enzymes vary among vertebrates. Mechanisms that regulate the levels of AANAT are incompletely understood. Previous findings were consistent with the possibility that AANAT may be controlled through its degradation by the N-end rule pathway. By expressing the rat and human AANATs and their mutants not only in mammalian cells but also in the yeast Saccharomyces cerevisiae, and by taking advantage of yeast genetics, we show here that two "complementary" forms of rat AANAT are targeted for degradation by two "complementary" branches of the N-end rule pathway. Specifically, the N(α)-terminally acetylated (Nt-acetylated) Ac-AANAT is destroyed through the recognition of its Nt-acetylated N-terminal Met residue by the Ac/N-end rule pathway, whereas the non-Nt-acetylated AANAT is targeted by the Arg/N-end rule pathway, which recognizes the unacetylated N-terminal Met-Leu sequence of rat AANAT. We also show, by constructing lysine-to-arginine mutants of rat AANAT, that its degradation is mediated by polyubiquitylation of its Lys residue(s). Human AANAT, whose N-terminal sequence differs from that of rodent AANATs, is longer-lived than its rat counterpart and appears to be refractory to degradation by the N-end rule pathway. Together, these and related results indicate both a major involvement of the N-end rule pathway in the control of rodent AANATs and substantial differences in the regulation of rodent and human AANATs that stem from differences in their N-terminal sequences. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  20. Capillary electrophoresis, a method for the determination of nucleic acid ligands covalently attached to quantum dots representing a donor of Förster resonance energy transfer.

    PubMed

    Datinská, Vladimíra; Klepárník, Karel; Belšánová, Barbora; Minárik, Marek; Foret, František

    2018-05-09

    The synthesis and determination of the structure of a Förster resonance energy transfer probe intended for the detection of specific nucleic acid sequences are described here. The probe is based on the hybridization of oligonucleotide modified quantum dots with a fluorescently labeled nucleic acid sample resulting in changes of the fluorescence emission due to the energy transfer effect. The stoichiometry distribution of oligonucleotides conjugated to quantum dots was determined by capillary electrophoresis separation. The results indicate that one to four molecules of oligonucleotide are conjugated to the surface of a single nanoparticle. This conclusion is confirmed by the course of the dependence of Förster resonance energy transfer efficiency on the concentration of fluorescently labeled complementary single-stranded nucleic acid, showing saturation. While the energy transfer efficiency of the probe hybridized with complementary nucleic acid strands was 30%, negligible efficiency was observed with a non-complementary strands. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

  1. Nucleotide sequence analysis of the gene encoding the Deinococcus radiodurans surface protein, derived amino acid sequence, and complementary protein chemical studies

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Peters, J.; Peters, M.; Lottspeich, F.

    1987-11-01

    The complete nucleotide sequence of the gene encoding the surface (hexagonally packed intermediate (HPI))-layer polypeptide of Deinococcus radiodurans Sark was determined and found to encode a polypeptide of 1036 amino acids. Amino acid sequence analysis of about 30% of the residues revealed that the mature polypeptide consists of at least 978 amino acids. The N terminus was blocked to Edman degradation. The results of proteolytic modification of the HPI layer in situ and M/sub r/ estimations of the HPI polypeptide expressed in Escherichia coli indicated that there is a leader sequence. The N-terminal region contained a very high percentage (29%)more » of threonine and serine, including a cluster of nine consecutive serine or threonine residues, whereas a stretch near the C terminus was extremely rich in aromatic amino acids (29%). The protein contained at least two disulfide bridges, as well as tightly bound reducing sugars and fatty acids.« less

  2. Detection and isolation of nucleic acid sequences using competitive hybridization probes

    DOEpatents

    Lucas, Joe N.; Straume, Tore; Bogen, Kenneth T.

    1997-01-01

    A method for detecting a target nucleic acid sequence in a sample is provided using hybridization probes which competitively hybridize to a target nucleic acid. According to the method, a target nucleic acid sequence is hybridized to first and second hybridization probes which are complementary to overlapping portions of the target nucleic acid sequence, the first hybridization probe including a first complexing agent capable of forming a binding pair with a second complexing agent and the second hybridization probe including a detectable marker. The first complexing agent attached to the first hybridization probe is contacted with a second complexing agent, the second complexing agent being attached to a solid support such that when the first and second complexing agents are attached, target nucleic acid sequences hybridized to the first hybridization probe become immobilized on to the solid support. The immobilized target nucleic acids are then separated and detected by detecting the detectable marker attached to the second hybridization probe. A kit for performing the method is also provided.

  3. Detection and isolation of nucleic acid sequences using competitive hybridization probes

    DOEpatents

    Lucas, J.N.; Straume, T.; Bogen, K.T.

    1997-04-01

    A method for detecting a target nucleic acid sequence in a sample is provided using hybridization probes which competitively hybridize to a target nucleic acid. According to the method, a target nucleic acid sequence is hybridized to first and second hybridization probes which are complementary to overlapping portions of the target nucleic acid sequence, the first hybridization probe including a first complexing agent capable of forming a binding pair with a second complexing agent and the second hybridization probe including a detectable marker. The first complexing agent attached to the first hybridization probe is contacted with a second complexing agent, the second complexing agent being attached to a solid support such that when the first and second complexing agents are attached, target nucleic acid sequences hybridized to the first hybridization probe become immobilized on to the solid support. The immobilized target nucleic acids are then separated and detected by detecting the detectable marker attached to the second hybridization probe. A kit for performing the method is also provided. 7 figs.

  4. Repeat sequence chromosome specific nucleic acid probes and methods of preparing and using

    DOEpatents

    Weier, H.U.G.; Gray, J.W.

    1995-06-27

    A primer directed DNA amplification method to isolate efficiently chromosome-specific repeated DNA wherein degenerate oligonucleotide primers are used is disclosed. The probes produced are a heterogeneous mixture that can be used with blocking DNA as a chromosome-specific staining reagent, and/or the elements of the mixture can be screened for high specificity, size and/or high degree of repetition among other parameters. The degenerate primers are sets of primers that vary in sequence but are substantially complementary to highly repeated nucleic acid sequences, preferably clustered within the template DNA, for example, pericentromeric alpha satellite repeat sequences. The template DNA is preferably chromosome-specific. Exemplary primers and probes are disclosed. The probes of this invention can be used to determine the number of chromosomes of a specific type in metaphase spreads, in germ line and/or somatic cell interphase nuclei, micronuclei and/or in tissue sections. Also provided is a method to select arbitrarily repeat sequence probes that can be screened for chromosome-specificity. 18 figs.

  5. Repeat sequence chromosome specific nucleic acid probes and methods of preparing and using

    DOEpatents

    Weier, Heinz-Ulrich G.; Gray, Joe W.

    1995-01-01

    A primer directed DNA amplification method to isolate efficiently chromosome-specific repeated DNA wherein degenerate oligonucleotide primers are used is disclosed. The probes produced are a heterogeneous mixture that can be used with blocking DNA as a chromosome-specific staining reagent, and/or the elements of the mixture can be screened for high specificity, size and/or high degree of repetition among other parameters. The degenerate primers are sets of primers that vary in sequence but are substantially complementary to highly repeated nucleic acid sequences, preferably clustered within the template DNA, for example, pericentromeric alpha satellite repeat sequences. The template DNA is preferably chromosome-specific. Exemplary primers ard probes are disclosed. The probes of this invention can be used to determine the number of chromosomes of a specific type in metaphase spreads, in germ line and/or somatic cell interphase nuclei, micronuclei and/or in tissue sections. Also provided is a method to select arbitrarily repeat sequence probes that can be screened for chromosome-specificity.

  6. Combined analysis of whole human blood parameters by Raman spectroscopy and spectral-domain low-coherence interferometry

    NASA Astrophysics Data System (ADS)

    Gnyba, M.; Wróbel, M. S.; Karpienko, K.; Milewska, D.; Jedrzejewska-Szczerska, M.

    2015-07-01

    In this article the simultaneous investigation of blood parameters by complementary optical methods, Raman spectroscopy and spectral-domain low-coherence interferometry, is presented. Thus, the mutual relationship between chemical and physical properties may be investigated, because low-coherence interferometry measures optical properties of the investigated object, while Raman spectroscopy gives information about its molecular composition. A series of in-vitro measurements were carried out to assess sufficient accuracy for monitoring of blood parameters. A vast number of blood samples with various hematological parameters, collected from different donors, were measured in order to achieve a statistical significance of results and validation of the methods. Preliminary results indicate the benefits in combination of presented complementary methods and form the basis for development of a multimodal system for rapid and accurate optical determination of selected parameters in whole human blood. Future development of optical systems and multivariate calibration models are planned to extend the number of detected blood parameters and provide a robust quantitative multi-component analysis.

  7. Multimodal imaging of human cerebellum - merging X-ray phase microtomography, magnetic resonance microscopy and histology

    NASA Astrophysics Data System (ADS)

    Schulz, Georg; Waschkies, Conny; Pfeiffer, Franz; Zanette, Irene; Weitkamp, Timm; David, Christian; Müller, Bert

    2012-11-01

    Imaging modalities including magnetic resonance imaging and X-ray computed tomography are established methods in daily clinical diagnosis of human brain. Clinical equipment does not provide sufficient spatial resolution to obtain morphological information on the cellular level, essential for applying minimally or non-invasive surgical interventions. Therefore, generic data with lateral sub-micrometer resolution have been generated from histological slices post mortem. Sub-cellular spatial resolution, lost in the third dimension as a result of sectioning, is obtained using magnetic resonance microscopy and micro computed tomography. We demonstrate that for human cerebellum grating-based X-ray phase tomography shows complementary contrast to magnetic resonance microscopy and histology. In this study, the contrast-to-noise values of magnetic resonance microscopy and phase tomography were comparable whereas the spatial resolution in phase tomography is an order of magnitude better. The registered data with their complementary information permit the distinct segmentation of tissues within the human cerebellum.

  8. Two Complementary Mechanisms Underpin Cell Wall Patterning during Xylem Vessel Development[OPEN

    PubMed Central

    Tang, Lu; Barkwill, Sarah; Lathe, Rahul; McFarlane, Heather E.

    2017-01-01

    The evolution of the plant vasculature was essential for the emergence of terrestrial life. Xylem vessels are solute-transporting elements in the vasculature that possess secondary wall thickenings deposited in intricate patterns. Evenly dispersed microtubule (MT) bands support the formation of these wall thickenings, but how the MTs direct cell wall synthesis during this process remains largely unknown. Cellulose is the major secondary wall constituent and is synthesized by plasma membrane-localized cellulose synthases (CesAs) whose catalytic activity propels them through the membrane. We show that the protein CELLULOSE SYNTHASE INTERACTING1 (CSI1)/POM2 is necessary to align the secondary wall CesAs and MTs during the initial phase of xylem vessel development in Arabidopsis thaliana and rice (Oryza sativa). Surprisingly, these MT-driven patterns successively become imprinted and sufficient to sustain the continued progression of wall thickening in the absence of MTs and CSI1/POM2 function. Hence, two complementary principles underpin wall patterning during xylem vessel development. PMID:28947492

  9. Complementary codes for odor identity and intensity in olfactory cortex

    PubMed Central

    Bolding, Kevin A; Franks, Kevin M

    2017-01-01

    The ability to represent both stimulus identity and intensity is fundamental for perception. Using large-scale population recordings in awake mice, we find distinct coding strategies facilitate non-interfering representations of odor identity and intensity in piriform cortex. Simply knowing which neurons were activated is sufficient to accurately represent odor identity, with no additional information about identity provided by spike time or spike count. Decoding analyses indicate that cortical odor representations are not sparse. Odorant concentration had no systematic effect on spike counts, indicating that rate cannot encode intensity. Instead, odor intensity can be encoded by temporal features of the population response. We found a subpopulation of rapid, largely concentration-invariant responses was followed by another population of responses whose latencies systematically decreased at higher concentrations. Cortical inhibition transforms olfactory bulb output to sharpen these dynamics. Our data therefore reveal complementary coding strategies that can selectively represent distinct features of a stimulus. DOI: http://dx.doi.org/10.7554/eLife.22630.001 PMID:28379135

  10. Development of SCAR (sequence-characterized amplified region) markers as a complementary tool for identification of ginger (Zingiber officinale Roscoe) from crude drugs and multicomponent formulations.

    PubMed

    Chavan, Preeti; Warude, Dnyaneshwar; Joshi, Kalpana; Patwardhan, Bhushan

    2008-05-01

    Zingiber officinale Roscoe (common or culinary ginger) is an official drug in Ayurvedic, Indian herbal, Chinese, Japanese, African and British Pharmacopoeias. The objective of the present study was to develop DNA-based markers that can be applied for the identification and differentiation of the commercially important plant Z. officinale Roscoe from the closely related species Zingiber zerumbet (pinecone, bitter or 'shampoo' ginger) and Zingiber cassumunar [cassumunar or plai (Thai) ginger]. The rhizomes of the other two Zingiber species used in the present study are morphologically similar to that of Z. officinale Roscoe and can be used as its adulterants or contaminants. Various methods, including macroscopy, microscopy and chemoprofiling, have been reported for the quality control of crude ginger and its products. These methods are reported to have limitations in distinguishing Z. officinale from closely related species. Hence, newer complementary methods for correct identification of ginger are useful. In the present study, RAPD (random amplification of polymorphic DNA) analysis was used to identify putative species-specific amplicons for Z. officinale. These were further cloned and sequenced to develop SCAR (sequence-characterized amplified region) markers. The developed SCAR markers were tested in several non-Zingiber species commonly used in ginger-containing formulations. One of the markers, P3, was found to be specific for Z. officinale and was successfully applied for detection of Z. officinale from Trikatu, a multicomponent formulation.

  11. Palindromic Sequence Artifacts Generated during Next Generation Sequencing Library Preparation from Historic and Ancient DNA

    PubMed Central

    Star, Bastiaan; Nederbragt, Alexander J.; Hansen, Marianne H. S.; Skage, Morten; Gilfillan, Gregor D.; Bradbury, Ian R.; Pampoulie, Christophe; Stenseth, Nils Chr; Jakobsen, Kjetill S.; Jentoft, Sissel

    2014-01-01

    Degradation-specific processes and variation in laboratory protocols can bias the DNA sequence composition from samples of ancient or historic origin. Here, we identify a novel artifact in sequences from historic samples of Atlantic cod (Gadus morhua), which forms interrupted palindromes consisting of reverse complementary sequence at the 5′ and 3′-ends of sequencing reads. The palindromic sequences themselves have specific properties – the bases at the 5′-end align well to the reference genome, whereas extensive misalignments exists among the bases at the terminal 3′-end. The terminal 3′ bases are artificial extensions likely caused by the occurrence of hairpin loops in single stranded DNA (ssDNA), which can be ligated and amplified in particular library creation protocols. We propose that such hairpin loops allow the inclusion of erroneous nucleotides, specifically at the 3′-end of DNA strands, with the 5′-end of the same strand providing the template. We also find these palindromes in previously published ancient DNA (aDNA) datasets, albeit at varying and substantially lower frequencies. This artifact can negatively affect the yield of endogenous DNA in these types of samples and introduces sequence bias. PMID:24608104

  12. Strategies for optimizing BioNano and Dovetail explored through a second reference quality assembly for the legume model, Medicago truncatula.

    PubMed

    Moll, Karen M; Zhou, Peng; Ramaraj, Thiruvarangan; Fajardo, Diego; Devitt, Nicholas P; Sadowsky, Michael J; Stupar, Robert M; Tiffin, Peter; Miller, Jason R; Young, Nevin D; Silverstein, Kevin A T; Mudge, Joann

    2017-08-04

    Third generation sequencing technologies, with sequencing reads in the tens- of kilo-bases, facilitate genome assembly by spanning ambiguous regions and improving continuity. This has been critical for plant genomes, which are difficult to assemble due to high repeat content, gene family expansions, segmental and tandem duplications, and polyploidy. Recently, high-throughput mapping and scaffolding strategies have further improved continuity. Together, these long-range technologies enable quality draft assemblies of complex genomes in a cost-effective and timely manner. Here, we present high quality genome assemblies of the model legume plant, Medicago truncatula (R108) using PacBio, Dovetail Chicago (hereafter, Dovetail) and BioNano technologies. To test these technologies for plant genome assembly, we generated five assemblies using all possible combinations and ordering of these three technologies in the R108 assembly. While the BioNano and Dovetail joins overlapped, they also showed complementary gains in continuity and join numbers. Both technologies spanned repetitive regions that PacBio alone was unable to bridge. Combining technologies, particularly Dovetail followed by BioNano, resulted in notable improvements compared to Dovetail or BioNano alone. A combination of PacBio, Dovetail, and BioNano was used to generate a high quality draft assembly of R108, a M. truncatula accession widely used in studies of functional genomics. As a test for the usefulness of the resulting genome sequence, the new R108 assembly was used to pinpoint breakpoints and characterize flanking sequence of a previously identified translocation between chromosomes 4 and 8, identifying more than 22.7 Mb of novel sequence not present in the earlier A17 reference assembly. Adding Dovetail followed by BioNano data yielded complementary improvements in continuity over the original PacBio assembly. This strategy proved efficient and cost-effective for developing a quality draft assembly compared to traditional reference assemblies.

  13. Multihormonal induction of hepatic α2u-globulin mRNA as measured by hybridization to complementary DNA

    PubMed Central

    Kurtz, David T.; Feigelson, Philip

    1977-01-01

    A procedure is presented for the preparation of a 3H-labeled complementary DNA (cDNA) specific for the mRNA coding for α2u-globulin, a male rat liver protein under multihormonal control that represents approximately 1% of hepatic protein synthesis. Rat liver polysomes are incubated with monospecific rabbit antiserum to α2u-globulin, which binds to the nascent α2u-globulin chains on the polysomes. These antibody-polysome complexes are then adsorbed to goat antiserum to rabbit IgG that is covalently linked to p-aminobenzylcellulose. mRNA preparations are thus obtained that contain 30-40% α2u-globulin mRNA. A labeled cDNA is made to this α2u-globulin-enriched mRNA preparation by using RNA-dependent DNA polymerase (reverse transcriptase). To remove the non-α2u-globulin sequences, this cDNA preparation is hybridized to an RNA concentration × incubation time (R0t) of 1000 mol of ribonucleotide per liter × sec with female rat liver mRNA, which, though it shares the vast majority of mRNA sequences with male liver, contains no α2u-globulin mRNA sequences. The cDNA remaining single-stranded is isolated by hydroxylapatite chromatography and is shown to be specific for α2u-globulin mRNA by several criteria. Good correlation was found in all endocrine states studied between the hepatic level of α2u-globulin, the level of functional α2u-globulin mRNA as assayed in a wheat germ cell-free translational system, and the level of α2u-globulin mRNA sequences as measured by hybridization to the α2u-globulin cDNA. Thus, the hormonal control of hepatic α2u-globulin synthesis by sex steroids and thyroid hormone occurs through modulation of the cellular level of α2u-globulin mRNA sequences, presumably by hormonal control of transcriptive synthesis. PMID:73184

  14. Complementary DNA cloning and constitutive expression of cytochrome P450 1C1 in the gills of carp (Cyprinus carpio).

    PubMed

    Itakura, Takao; El-Kady, Mohamed; Mitsuo, Ryoichi; Kaminishi, Yoshio

    2005-01-01

    Cytochrome P450 (CYP) enzymes constitute a multigene family of many endogenous and xenobiotic substances. The CYP1 family is of particular interest in environmental toxicology because its members are dominant in the metabolism of polycyclic aromatic hydrocarbons (PAHs), polychlorinated biphenyls (PCBs), and aryl amines. A new complementary DNA of the CYP1C subfamily encoding CYP1C1 was isolated from carp liver after intraperitoneal injection of beta-napthoflavone (BNF). The full-length cDNA obtained contained a 5' noncoding region of 244 bp, an open reading frame of 1572 bp coding for 524 amino acids, a stop codon, and a 3' noncoding region of 965 bp. The predicted molecular weight of the protein was approximately 59.3 kDa. The deduced amino acid sequence of this cDNA was 82.1% and 80.2% similar to Japanese eel and scup CYP1C1 sequences, respectively, while it exhibited a similarity of 74.9% with the scup CYP1C2 sequence. The deduced amino acid sequence of carp CYP1C1 showed similarities with those of the reported CYP1B1s of teleosts and mammals of 48.4, 48.8, 48.2, 48.6, 45.3, and 45.5% for carp CYP1B1, carp CYP1B2, plaice CYP1B1, and human, rat, and mouse CYP1B1, respectively. The phylogenetic tree constructed using fish and mammalian CYP1 sequences suggested a closer relationship of the CYP1C subfamily to CYP1B than to CYP1A. The tree showed the possibility of the existence of CYP1C subfamily genes in mammalian species. Northern blot analysis for the liver, intestine, gills, and kidney showed no detectable induced expression but constitutive expression in the gill organs.

  15. Co-operation between Polymerases and Nucleotide Synthetases in the RNA World.

    PubMed

    Kim, Ye Eun; Higgs, Paul G

    2016-11-01

    It is believed that life passed through an RNA World stage in which replication was sustained by catalytic RNAs (ribozymes). The two most obvious types of ribozymes are a polymerase, which uses a neighbouring strand as a template to make a complementary sequence to the template, and a nucleotide synthetase, which synthesizes monomers for use by the polymerase. When a chemical source of monomers is available, the polymerase can survive on its own. When the chemical supply of monomers is too low, nucleotide production by the synthetase is essential and the two ribozymes can only survive when they are together. Here we consider a computational model to investigate conditions under which coexistence and cooperation of these two types of ribozymes is possible. The model considers six types of strands: the two functional sequences, the complementary strands to these sequences (which are required as templates), and non-functional mutants of the two sequences (which act as parasites). Strands are distributed on a two-dimensional lattice. Polymerases replicate strands on neighbouring sites and synthetases produce monomers that diffuse in the local neighbourhood. We show that coexistence of unlinked polymerases and synthetases is possible in this spatial model under conditions in which neither sequence could survive alone; hence, there is a selective force for increasing complexity. Coexistence is dependent on the relative lengths of the two functional strands, the strand diffusion rate, the monomer diffusion rate, and the rate of deleterious mutations. The sensitivity of this two-ribozyme system suggests that evolution of a system of many types of ribozymes would be difficult in a purely spatial model with unlinked genes. We therefore speculate that linkage of genes onto mini-chromosomes and encapsulation of strands in protocells would have been important fairly early in the history of life as a means of enabling more complex systems to evolve.

  16. Identification and characterization of circular RNAs in zebrafish.

    PubMed

    Shen, Yudong; Guo, Xianwu; Wang, Weimin

    2017-01-01

    Circular RNA (circRNA), a class of RNAs with circular structure, has received little attention until recently, when some new features and functions were discovered. In the present study, we sequenced circRNAs in zebrafish (Danio rerio) and identified 3868 circRNAs using three algorithms (find_circ, CIRI, segemehl). The analysis of microRNA target sites on circRNAs shows that some circRNAs may function as miRNA sponges. Furthermore, we identified the existence of reverse complementary sequences in the flanking regions of only 25 (2.64%) exonic circRNAs, indicating that the mechanism of zebrafish exonic circRNA biogenesis might be different from that in mammals. Moreover, 1122 (29%) zebrafish circRNA sequences showed homology with human, mouse and coelacanth circRNAs. © 2016 Federation of European Biochemical Societies.

  17. A statistical physics perspective on alignment-independent protein sequence comparison.

    PubMed

    Chattopadhyay, Amit K; Nasiev, Diar; Flower, Darren R

    2015-08-01

    Within bioinformatics, the textual alignment of amino acid sequences has long dominated the determination of similarity between proteins, with all that implies for shared structure, function and evolutionary descent. Despite the relative success of modern-day sequence alignment algorithms, so-called alignment-free approaches offer a complementary means of determining and expressing similarity, with potential benefits in certain key applications, such as regression analysis of protein structure-function studies, where alignment-base similarity has performed poorly. Here, we offer a fresh, statistical physics-based perspective focusing on the question of alignment-free comparison, in the process adapting results from 'first passage probability distribution' to summarize statistics of ensemble averaged amino acid propensity values. In this article, we introduce and elaborate this approach. © The Author 2015. Published by Oxford University Press.

  18. Materials and fabrication sequences for water soluble silicon integrated circuits at the 90 nm node

    NASA Astrophysics Data System (ADS)

    Yin, Lan; Bozler, Carl; Harburg, Daniel V.; Omenetto, Fiorenzo; Rogers, John A.

    2015-01-01

    Tungsten interconnects in silicon integrated circuits built at the 90 nm node with releasable configurations on silicon on insulator wafers serve as the basis for advanced forms of water-soluble electronics. These physically transient systems have potential uses in applications that range from temporary biomedical implants to zero-waste environmental sensors. Systematic experimental studies and modeling efforts reveal essential aspects of electrical performance in field effect transistors and complementary ring oscillators with as many as 499 stages. Accelerated tests reveal timescales for dissolution of the various constituent materials, including tungsten, silicon, and silicon dioxide. The results demonstrate that silicon complementary metal-oxide-semiconductor circuits formed with tungsten interconnects in foundry-compatible fabrication processes can serve as a path to high performance, mass-produced transient electronic systems.

  19. Directional, seamless, and restriction enzyme-free construction of random-primed complementary DNA libraries using phosphorothioate-modified primers.

    PubMed

    Howland, Shanshan W; Poh, Chek-Meng; Rénia, Laurent

    2011-09-01

    Directional cloning of complementary DNA (cDNA) primed by oligo(dT) is commonly achieved by appending a restriction site to the primer, whereas the second strand is synthesized through the combined action of RNase H and Escherichia coli DNA polymerase I (PolI). Although random primers provide more uniform and complete coverage, directional cloning with the same strategy is highly inefficient. We report that phosphorothioate linkages protect the tail sequence appended to random primers from the 5'→3' exonuclease activity of PolI. We present a simple strategy for constructing a random-primed cDNA library using the efficient, size-independent, and seamless In-Fusion cloning method instead of restriction enzymes. Copyright © 2011 Elsevier Inc. All rights reserved.

  20. Whole-Genome Sequences of Thirteen Isolates of Borrelia burgdorferi

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Schutzer S. E.; Dunn J.; Fraser-Liggett, C. M.

    2011-02-01

    Borrelia burgdorferi is a causative agent of Lyme disease in North America and Eurasia. The first complete genome sequence of B. burgdorferi strain 31, available for more than a decade, has assisted research on the pathogenesis of Lyme disease. Because a single genome sequence is not sufficient to understand the relationship between genotypic and geographic variation and disease phenotype, we determined the whole-genome sequences of 13 additional B. burgdorferi isolates that span the range of natural variation. These sequences should allow improved understanding of pathogenesis and provide a foundation for novel detection, diagnosis, and prevention strategies.

  1. High-Speed Binary-Output Image Sensor

    NASA Technical Reports Server (NTRS)

    Fossum, Eric; Panicacci, Roger A.; Kemeny, Sabrina E.; Jones, Peter D.

    1996-01-01

    Photodetector outputs digitized by circuitry on same integrated-circuit chip. Developmental special-purpose binary-output image sensor designed to capture up to 1,000 images per second, with resolution greater than 10 to the 6th power pixels per image. Lower-resolution but higher-frame-rate prototype of sensor contains 128 x 128 array of photodiodes on complementary metal oxide/semiconductor (CMOS) integrated-circuit chip. In application for which it is being developed, sensor used to examine helicopter oil to determine whether amount of metal and sand in oil sufficient to warrant replacement.

  2. Supramolecular Luminescence from Oligofluorenol-Based Supramolecular Polymer Semiconductors

    PubMed Central

    Zhang, Guang-Wei; Wang, Long; Xie, Ling-Hai; Lin, Jin-Yi; Huang, Wei

    2013-01-01

    Supramolecular luminescence stems from non-covalent exciton behaviors of active π-segments in supramolecular entities or aggregates via intermolecular forces. Herein, a π-conjugated oligofluorenol, containing self-complementary double hydrogen bonds, was synthesized using Suzuki coupling as a supramolecular semiconductor. Terfluorenol-based random supramolecular polymers were confirmed via concentration-dependent nuclear magnetic resonance (NMR) and dynamic light scattering (DLS). The photoluminescent spectra of the TFOH-1 solution exhibit a green emission band (g-band) at approximately ~520 nm with reversible features, as confirmed through titration experiments. Supramolecular luminescence of TFOH-1 thin films serves as robust evidence for the aggregates of g-band. Our results suggest that the presence of polyfluorene ketone defects is a sufficient condition, rather than a sufficient-necessary condition for the g-band. Supramolecular electroluminescence will push organic devices into the fields of supramolecular optoelectronics, spintronics, and mechatronics. PMID:24232455

  3. Mammoth and Mastodon collagen sequences; survival and utility

    NASA Astrophysics Data System (ADS)

    Buckley, M.; Larkin, N.; Collins, M.

    2011-04-01

    Near-complete collagen (I) sequences are proposed for elephantid and mammutid taxa, based upon available African elephant genomic data and supported with LC-MALDI-MS/MS and LC-ESI-MS/MS analyses of collagen digests from proboscidean bone. Collagen sequence coverage was investigated from several specimens of two extinct mammoths ( Mammuthus trogontherii and Mammuthus primigenius), the extinct American mastodon ( Mammut americanum), the extinct straight-tusked elephant ( Elephas ( Palaeoloxodon) antiquus) and extant Asian ( Elephas maximus) and African ( Loxodonta africana) elephants and compared between the two ionization techniques used. Two suspected mammoth fossils from the British Middle Pleistocene (Cromerian) deposits of the West Runton Forest Bed were analysed to investigate the potential use of peptide mass spectrometry for fossil identification. Despite the age of the fossils, sufficient peptides were obtained to identify these as elephantid, and sufficient sequence variation to discriminate elephantid and mammutid collagen (I). In-depth LC-MS analyses further failed to identify a peptide that could be used to reliably distinguish between the three genera of elephantids ( Elephas, Loxodonta and Mammuthus), an observation consistent with predicted amino acid substitution rates between these species.

  4. DNA Extraction Protocols for Whole-Genome Sequencing in Marine Organisms.

    PubMed

    Panova, Marina; Aronsson, Henrik; Cameron, R Andrew; Dahl, Peter; Godhe, Anna; Lind, Ulrika; Ortega-Martinez, Olga; Pereyra, Ricardo; Tesson, Sylvie V M; Wrange, Anna-Lisa; Blomberg, Anders; Johannesson, Kerstin

    2016-01-01

    The marine environment harbors a large proportion of the total biodiversity on this planet, including the majority of the earths' different phyla and classes. Studying the genomes of marine organisms can bring interesting insights into genome evolution. Today, almost all marine organismal groups are understudied with respect to their genomes. One potential reason is that extraction of high-quality DNA in sufficient amounts is challenging for many marine species. This is due to high polysaccharide content, polyphenols and other secondary metabolites that will inhibit downstream DNA library preparations. Consequently, protocols developed for vertebrates and plants do not always perform well for invertebrates and algae. In addition, many marine species have large population sizes and, as a consequence, highly variable genomes. Thus, to facilitate the sequence read assembly process during genome sequencing, it is desirable to obtain enough DNA from a single individual, which is a challenge in many species of invertebrates and algae. Here, we present DNA extraction protocols for seven marine species (four invertebrates, two algae, and a marine yeast), optimized to provide sufficient DNA quality and yield for de novo genome sequencing projects.

  5. Classification of HCV and HIV-1 Sequences with the Branching Index

    PubMed Central

    Hraber, Peter; Kuiken, Carla; Waugh, Mark; Geer, Shaun; Bruno, William J.; Leitner, Thomas

    2009-01-01

    SUMMARY Classification of viral sequences should be fast, objective, accurate, and reproducible. Most methods that classify sequences use either pairwise distances or phylogenetic relations, but cannot discern when a sequence is unclassifiable. The branching index (BI) combines distance and phylogeny methods to compute a ratio that quantifies how closely a query sequence clusters with a subtype clade. In the hypothesis-testing framework of statistical inference, the BI is compared with a threshold to test whether sufficient evidence exists for the query sequence to be classified among known sequences. If above the threshold, the null hypothesis of no support for the subtype relation is rejected and the sequence is taken as belonging to the subtype clade with which it clusters on the tree. This study evaluates statistical properties of the branching index for subtype classification in HCV and HIV-1. Pairs of BI values with known positive and negative test results were computed from 10,000 random fragments of reference alignments. Sampled fragments were of sufficient length to contain phylogenetic signal that groups reference sequences together properly into subtype clades. For HCV, a threshold BI of 0.71 yields 95.1% agreement with reference subtypes, with equal false positive and false negative rates. For HIV-1, a threshold of 0.66 yields 93.5% agreement. Higher thresholds can be used where lower false positive rates are required. In synthetic recombinants, regions without breakpoints are recognized accurately; regions with breakpoints do not uniquely represent any known subtype. Web-based services for viral subtype classification with the branching index are available online. PMID:18753218

  6. ContEst16S: an algorithm that identifies contaminated prokaryotic genomes using 16S RNA gene sequences.

    PubMed

    Lee, Imchang; Chalita, Mauricio; Ha, Sung-Min; Na, Seong-In; Yoon, Seok-Hwan; Chun, Jongsik

    2017-06-01

    Thanks to the recent advancement of DNA sequencing technology, the cost and time of prokaryotic genome sequencing have been dramatically decreased. It has repeatedly been reported that genome sequencing using high-throughput next-generation sequencing is prone to contaminations due to its high depth of sequencing coverage. Although a few bioinformatics tools are available to detect potential contaminations, these have inherited limitations as they only use protein-coding genes. Here we introduce a new algorithm, called ContEst16S, to detect potential contaminations using 16S rRNA genes from genome assemblies. We screened 69 745 prokaryotic genomes from the NCBI Assembly Database using ContEst16S and found that 594 were contaminated by bacteria, human and plants. Of the predicted contaminated genomes, 8 % were not predicted by the existing protein-coding gene-based tool, implying that both methods can be complementary in the detection of contaminations. A web-based service of the algorithm is available at www.ezbiocloud.net/tools/contest16s.

  7. The promises and pitfalls of RNA-interference-based therapeutics

    PubMed Central

    Castanotto, Daniela; Rossi, John J.

    2009-01-01

    The discovery that gene expression can be controlled by the Watson–Crick base-pairing of small RNAs with messenger RNAs containing complementary sequence — a process known as RNA interference — has markedly advanced our understanding of eukaryotic gene regulation and function. The ability of short RNA sequences to modulate gene expression has provided a powerful tool with which to study gene function and is set to revolutionize the treatment of disease. Remarkably, despite being just one decade from its discovery, the phenomenon is already being used therapeutically in human clinical trials, and biotechnology companies that focus on RNA-interference-based therapeutics are already publicly traded. PMID:19158789

  8. Structure and Function of Lipopolysaccharide Binding Protein

    NASA Astrophysics Data System (ADS)

    Schumann, Ralf R.; Leong, Steven R.; Flaggs, Gail W.; Gray, Patrick W.; Wright, Samuel D.; Mathison, John C.; Tobias, Peter S.; Ulevitch, Richard J.

    1990-09-01

    The primary structure of lipopolysaccharide binding protein (LBP), a trace plasma protein that binds to the lipid A moiety of bacterial lipopolysaccharides (LPSs), was deduced by sequencing cloned complementary DNA. LBP shares sequence identity with another LPS binding protein found in granulocytes, bactericidal/permeability-increasing protein, and with cholesterol ester transport protein of the plasma. LBP may control the response to LPS under physiologic conditions by forming high-affinity complexes with LPS that bind to monocytes and macrophages, which then secrete tumor necrosis factor. The identification of this pathway for LPS-induced monocyte stimulation may aid in the development of treatments for diseases in which Gram-negative sepsis or endotoxemia are involved.

  9. Programmable release of multiple protein drugs from aptamer-functionalized hydrogels via nucleic acid hybridization.

    PubMed

    Battig, Mark R; Soontornworajit, Boonchoy; Wang, Yong

    2012-08-01

    Polymeric delivery systems have been extensively studied to achieve localized and controlled release of protein drugs. However, it is still challenging to control the release of multiple protein drugs in distinct stages according to the progress of disease or treatment. This study successfully demonstrates that multiple protein drugs can be released from aptamer-functionalized hydrogels with adjustable release rates at predetermined time points using complementary sequences (CSs) as biomolecular triggers. Because both aptamer-protein interactions and aptamer-CS hybridization are sequence-specific, aptamer-functionalized hydrogels constitute a promising polymeric delivery system for the programmable release of multiple protein drugs to treat complex human diseases.

  10. Periodic Assembly of Nanospecies on Repetitive DNA Sequences Generated on Gold Nanoparticles by Rolling Circle Amplification

    NASA Astrophysics Data System (ADS)

    Zhao, Weian; Brook, Michael A.; Li, Yingfu

    Periodical assembly of nanospecies is desirable for the construction of nanodevices. We provide a protocol for the preparation of a gold nanoparticle (AuNP)/DNA scaffold on which nanospecies can be assembled in a periodical manner. AuNP/DNA scaffold is prepared by growing long single-stranded DNA (ssDNA) molecules (typically hundreds of nanometers to a few microns in length) on AuNPs via rolling circle amplification (RCA). Since these long ssDNA molecules contain many repetitive sequence units, complementary DNA-attached nanospecies can be assembled through specific hybridization in a controllable and periodical manner.

  11. The C-terminal portion of the cleaved HT motif is necessary and sufficient to mediate export of proteins from the malaria parasite into its host cell

    PubMed Central

    Tarr, Sarah J; Cryar, Adam; Thalassinos, Konstantinos; Haldar, Kasturi; Osborne, Andrew R

    2013-01-01

    The malaria parasite exports proteins across its plasma membrane and a surrounding parasitophorous vacuole membrane, into its host erythrocyte. Most exported proteins contain a Host Targeting motif (HT motif) that targets them for export. In the parasite secretory pathway, the HT motif is cleaved by the protease plasmepsin V, but the role of the newly generated N-terminal sequence in protein export is unclear. Using a model protein that is cleaved by an exogenous viral protease, we show that the new N-terminal sequence, normally generated by plasmepsin V cleavage, is sufficient to target a protein for export, and that cleavage by plasmepsin V is not coupled directly to the transfer of a protein to the next component in the export pathway. Mutation of the fourth and fifth positions of the HT motif, as well as amino acids further downstream, block or affect the efficiency of protein export indicating that this region is necessary for efficient export. We also show that the fifth position of the HT motif is important for plasmepsin V cleavage. Our results indicate that plasmepsin V cleavage is required to generate a new N-terminal sequence that is necessary and sufficient to mediate protein export by the malaria parasite. PMID:23279267

  12. A vertebrate case study of the quality of assemblies derived from next-generation sequences

    PubMed Central

    2011-01-01

    The unparalleled efficiency of next-generation sequencing (NGS) has prompted widespread adoption, but significant problems remain in the use of NGS data for whole genome assembly. We explore the advantages and disadvantages of chicken genome assemblies generated using a variety of sequencing and assembly methodologies. NGS assemblies are equivalent in some ways to a Sanger-based assembly yet deficient in others. Nonetheless, these assemblies are sufficient for the identification of the majority of genes and can reveal novel sequences when compared to existing assembly references. PMID:21453517

  13. Aptamer based SERS detection of Salmonella typhimurium using DNA-assembled gold nanodimers.

    PubMed

    Xu, Xumin; Ma, Xiaoyuan; Wang, Haitao; Wang, Zhouping

    2018-06-12

    The authors describe a surface-enhanced Raman scattering (SERS) based aptasensor for Salmonella typhimurium (S. typhimurium). Gold nanoparticles (AuNPs; 35 nm i.d.) were functionalized with the aptamer (ssDNA 1) and used as the capture probe, while smaller (15 nm) AuNPs were modified with a Cy3-labeled complementary sequence (ssDNA 2) and used as the signalling probe. The asymmetric gold nanodimers (AuNDs) were assemblied with the Raman signal probe and the capture probe via hybridization of the complementary ssDNAs. The gap between two nanoparticles is a "hot spot" in which the Raman reporter Cy3 is localized. It experiences a strong enhancement of the electromagnetic field around the particle. After addition of S. typhimurium, it will be bound by the aptamer which therefore is partially dehybridized from its complementary sequence. Hence, Raman intensity drops. Under the optimal experimental conditions, the SERS signal at 1203 cm -1 increases linearly with the logarithm of the number of colonies in the 10 2 to 10 7  cfu·mL -1 concentration range, and the limit of detection is 35 cfu·mL -1 . The method can be performed within 1 h and was successfully applied to the analysis of spiked milk samples and performed very well and with high specificity. Graphical abstract DNA-assembled asymmetric gold nanodimers (AuNDs) were synthesized and appllied in a SERS-based aptasensor for S. typhimurium. Capture probe was preferentially combined with S. typhimurium and the structure of the AuNDs was destroyed. The "hot spot" vanished partly, this resulting in the decreased Raman intensity of Cy3.

  14. Effects of varied energy density of complementary foods on breast-milk intakes and total energy consumption by healthy, breastfed Bangladeshi children.

    PubMed

    Islam, M Munirul; Peerson, Janet M; Ahmed, Tahmeed; Dewey, Kathryn G; Brown, Kenneth H

    2006-04-01

    Information is needed to design studies of the effects of complementary feeding regimens on children's intakes of complementary foods (CFs) and breast milk. We evaluated the effects of varied energy density of CFs on the time until stabilization of dietary intakes and on total daily energy intakes (EIs) and breast-milk intakes. CFs with low [0.4 kcal/g (LD)] and high [1.5 kcal/g (HD)] energy density were fed 3 times/d to 10 children (aged 9-18 mo) during 2 randomly assigned sequences of three 8-d diet periods (HD-LD-HD or LD-HD-LD) along with ad libitum breastfeeding. CF and breast-milk intakes were measured. Intakes of the HD diet and breast milk did not vary by day of period, but intake of the LD diet increased progressively. During days 5-7 of the last 2 diet periods in each sequence, more of the LD than of the HD diet was consumed (752 +/- 252 and 439 +/- 111 g/d, respectively; P < 0.001), but EIs from CFs were greater with the HD diet. Breast-milk consumption was slightly less (192 +/- 115 and 234 +/- 121 g/d, respectively; P = 0.03) but total daily EI was greater (774 +/- 175 and 441 +/- 85 kcal/d, respectively; P < 0.001) during the HD than during the LD diet period. New information on the effects of newly introduced diets on daily intakes of these diets and of breast milk can be used to design future studies. Total daily EIs were greater with the HD diet despite its negative effects on breast-milk intakes.

  15. Changes in miRNAs Signal High-Risk HPV Infections | Center for Cancer Research

    Cancer.gov

    microRNAs (miRNAs) are approximately 21 nucleotide long, non-coding RNAs that regulate the expression of certain proteins. As part of the RNA-induced silencing complex or RISC, miRNAs bind to complementary sequences in the 3’ untranslated regions of target messenger RNAs, blocking protein synthesis and sometimes leading to the destruction of the target RNA. Numerous studies

  16. Biology of Symbioses between Marine Invertebrates and Intracellular Bacteria

    DTIC Science & Technology

    1990-01-30

    bisphosphate carboxylase We designed from published sequence information oligonucleotide primers which are complementary to conserved regions on RubisCO ...large and small subunit genes. These primers were used successfully to amplify using polymerase chain reaction (PCR) specific regions of RubisCO ...for the large subunit of ribulose bisphosphate carboxylase/oxygenase ( RubisCO ) to symbiont DNA shows that the symbionts from both deep-sea and shallow

  17. Oligonucleotides Containing Aminated 2'-Amino-LNA Nucleotides: Synthesis and Strong Binding to Complementary DNA and RNA.

    PubMed

    Lou, Chenguang; Samuelsen, Simone V; Christensen, Niels Johan; Vester, Birte; Wengel, Jesper

    2017-04-19

    Mono- and diaminated 2'-amino-LNA monomers were synthesized and introduced into oligonucleotides. Each modification imparts significant stabilization of nucleic acid duplexes and triplexes, excellent sequence selectivity, and significant nuclease resistance. Molecular modeling suggested that structural stabilization occurs via intrastrand electrostatic attraction between the protonated amino groups of the aminated 2'-amino-LNA monomers and the host oligonucleotide backbone.

  18. The Ties That Bind: Mapping the Dynamic Enhancer-Promoter Interactome

    DOE PAGES

    Spurrell, Cailyn H.; Dickel, Diane E.; Visel, Axel

    2016-11-17

    Coupling chromosome conformation capture to molecular enrichment for promoter-containing DNA fragments enables the systematic mapping of interactions between individual distal regulatory sequences and their target genes. Here in this Minireview, we describe recent progress in the application of this technique and related complementary approaches to gain insight into the lineage- and cell-type-specific dynamics of interactions between regulators and gene promoters.

  19. probeBase—an online resource for rRNA-targeted oligonucleotide probes and primers: new features 2016

    PubMed Central

    Greuter, Daniel; Loy, Alexander; Horn, Matthias; Rattei, Thomas

    2016-01-01

    probeBase http://www.probebase.net is a manually maintained and curated database of rRNA-targeted oligonucleotide probes and primers. Contextual information and multiple options for evaluating in silico hybridization performance against the most recent rRNA sequence databases are provided for each oligonucleotide entry, which makes probeBase an important and frequently used resource for microbiology research and diagnostics. Here we present a major update of probeBase, which was last featured in the NAR Database Issue 2007. This update describes a complete remodeling of the database architecture and environment to accommodate computationally efficient access. Improved search functions, sequence match tools and data output now extend the opportunities for finding suitable hierarchical probe sets that target an organism or taxon at different taxonomic levels. To facilitate the identification of complementary probe sets for organisms represented by short rRNA sequence reads generated by amplicon sequencing or metagenomic analysis with next generation sequencing technologies such as Illumina and IonTorrent, we introduce a novel tool that recovers surrogate near full-length rRNA sequences for short query sequences and finds matching oligonucleotides in probeBase. PMID:26586809

  20. [Cholinergic anti-inflammatory pathway of some non-pharmacological therapies of complementary medicine: possible implications for treatment of rheumatic and autoimmune diseases].

    PubMed

    Gamus, Dorit

    2011-08-01

    Rheumatologic and autoimmune diseases are among foremost diseases for which patients seek complementary and integrative medicine options. Therefore, physicians should be informed on the advances in research of these therapies, in order to be able to discuss possible indications and contraindications for these treatment modalities with their patients. This review summarizes several therapeutic modalities of complementary medicine that may be involved in the cholinergic anti-inflammatory pathway. The analysis of systematic reviews of acupuncture for rheumatic conditions has concluded that the evidence is sufficiently sound to warrant positive recommendations of this therapy for osteoarthritis, low back pain and lateral elbow pain. There is relatively strong evidence to support the use of hypnosis in pain treatment, such as in cases of fibromyalgia. A recent controlled study that evaLuated tai-chi in fibromyalgia has reported reductions in pain, improvements in mood, quality of Life, self efficacy and exercise capacity. There is also cumulative evidence that acupuncture, hypnosis and tai-chi may decrease the high frequency of heart rate variability, suggesting enhancement of vagus nerve activity. Hence, it has been hypothesized that these modalities might impact the cholinergic anti-inflammatory pathway to modulate inflammation. Further clinical and basic research to confirm this hypothesis should be performed in order to validate integration of these therapies in comprehensive treatment for some inflammatory and autoimmune diseases.

  1. Practice guidelines for acupuncturists using acupuncture as an adjunctive treatment for anorexia nervosa.

    PubMed

    Fogarty, Sarah; Ramjan, Lucie Michelle

    2015-02-01

    Anorexia nervosa is a potentially life-threatening eating disorder where people intentionally refuse to eat sufficient amounts to maintain a healthy body-weight for fear of becoming fat. The intense preoccupation with restriction of food and control of body weight makes this one of the most complex and confusing conditions for practitioners to treat. While no single treatment has been found to be superior to another in the treatment of anorexia nervosa, general practice guidelines are available to guide mainstream treatment, however there are no guidelines for practitioners of complementary therapies. Complementary therapies such as acupuncture show promise as an adjunctive therapy in improving co-morbidities such as depression and anxiety levels among people with anorexia nervosa, by strengthening mind, body and overall well-being. The aim of this guideline is to assist and support acupuncture practitioners to deliver effective and safe adjunctive acupuncture treatments to people with anorexia nervosa, by providing a practice guideline that is underpinned by an ethical and evidence-based framework. The use of complementary therapies and specifically acupuncture in the treatment of anorexia nervosa may provide important adjunctive care to allow a comprehensive treatment approach that potentially improves quality of life, reduces anxiety and instils hope for recovery. It is hoped that acupuncture practitioners treating patients with anorexia nervosa will refer to these guidelines and apply the guidance (as deemed appropriate). Copyright © 2015 Elsevier Ltd. All rights reserved.

  2. Matrix Transformations between Certain Sequence Spaces over the Non-Newtonian Complex Field

    PubMed Central

    Efe, Hakan

    2014-01-01

    In some cases, the most general linear operator between two sequence spaces is given by an infinite matrix. So the theory of matrix transformations has always been of great interest in the study of sequence spaces. In the present paper, we introduce the matrix transformations in sequence spaces over the field ℂ* and characterize some classes of infinite matrices with respect to the non-Newtonian calculus. Also we give the necessary and sufficient conditions on an infinite matrix transforming one of the classical sets over ℂ* to another one. Furthermore, the concept for sequence-to-sequence and series-to-series methods of summability is given with some illustrated examples. PMID:25110740

  3. Use of Formulaic Sequences in Monologues of Chinese EFL Learners

    ERIC Educational Resources Information Center

    Qi, Yan; Ding, Yanren

    2011-01-01

    The literature on formulaic language lacks sufficient research on how L2 learners make progress in native-like formulaicity of their target language. This study analyzed the use of formulaic sequences (FSs) by 56 Chinese university English majors in their prepared monologues at the beginning and end of a three-year period and compared the student…

  4. Effect of structure variation of the aptamer-DNA duplex probe on the performance of displacement-based electrochemical aptamer sensors.

    PubMed

    Pang, Jie; Zhang, Ziping; Jin, Haizhu

    2016-03-15

    Electrochemical aptamer-based (E-AB) sensors employing electrode-immobilized, redox-tagged aptamer probes have emerged as a promising platform for the sensitive and quick detection of target analytes ranging from small molecules to proteins. Signal generation in this class of sensor is linked to change in electron transfer efficiency upon binding-induced change in flexibility/conformation of the aptamer probe. Because of this signaling mechanism, signal gains of these sensors can be improved by employing a displacement-based recognition system, which links target binding with a large-scale flexibility/conformation shift from the aptamer-DNA duplex to the single-stranded DNA or the native aptamer. Despite the relatively large number of displacement-based E-AB sensor samples, little attention has been paid to the structure variation of the aptamer-DNA duplex probe. Here we detail the effects of complementary length and position of the aptamer-DNA duplex probe on the performance of a model displacement-based E-AB sensor for ATP. We find that, greater background suppression and signal gain are observed with longer complementary length of the aptamer-DNA duplex probe. However, sensor equilibration time slows monotonically with increasing complementary length; and with too many target binding sites in aptamer sequence being occupied by the complementary DNA, the aptamer-target binding does not occur and no signal gain observed. We also demonstrate that signal gain of the displacement-based E-AB sensor is strongly dependent on the complementary position of the aptamer-DNA duplex probe, with complementary position located at the electrode-attached or redox-tagged end of the duplex probe, larger background suppression and signal increase than that of the middle position are observed. These results highlight the importance of rational structure design of the aptamer-DNA duplex probe and provide new insights into the optimization of displacement-based E-AB sensors. Copyright © 2015 Elsevier B.V. All rights reserved.

  5. COI (cytochrome oxidase-I) sequence based studies of Carangid fishes from Kakinada coast, India.

    PubMed

    Persis, M; Chandra Sekhar Reddy, A; Rao, L M; Khedkar, G D; Ravinder, K; Nasruddin, K

    2009-09-01

    Mitochondrial DNA, cytochrome oxidase-1 gene sequences were analyzed for species identification and phylogenetic relationship among the very high food value and commercially important Indian carangid fish species. Sequence analysis of COI gene very clearly indicated that all the 28 fish species fell into five distinct groups, which are genetically distant from each other and exhibited identical phylogenetic reservation. All the COI gene sequences from 28 fishes provide sufficient phylogenetic information and evolutionary relationship to distinguish the carangid species unambiguously. This study proves the utility of mtDNA COI gene sequence based approach in identifying fish species at a faster pace.

  6. Asymptotic convertibility of entanglement: An information-spectrum approach to entanglement concentration and dilution

    NASA Astrophysics Data System (ADS)

    Jiao, Yong; Wakakuwa, Eyuri; Ogawa, Tomohiro

    2018-02-01

    We consider asymptotic convertibility of an arbitrary sequence of bipartite pure states into another by local operations and classical communication (LOCC). We adopt an information-spectrum approach to address cases where each element of the sequences is not necessarily a tensor power of a bipartite pure state. We derive necessary and sufficient conditions for the LOCC convertibility of one sequence to another in terms of spectral entropy rates of entanglement of the sequences. Based on these results, we also provide simple proofs for previously known results on the optimal rates of entanglement concentration and dilution of general sequences of bipartite pure states.

  7. Molecular evolution of the HoxA cluster in the three major gnathostome lineages

    PubMed Central

    Chiu, Chi-hua; Amemiya, Chris; Dewar, Ken; Kim, Chang-Bae; Ruddle, Frank H.; Wagner, Günter P.

    2002-01-01

    The duplication of Hox clusters and their maintenance in a lineage has a prominent but little understood role in chordate evolution. Here we examined how Hox cluster duplication may influence changes in cluster architecture and patterns of noncoding sequence evolution. We sequenced the entire duplicated HoxAa and HoxAb clusters of zebrafish (Danio rerio) and extended the 5′ (posterior) part of the HoxM (HoxA-like) cluster of horn shark (Heterodontus francisci) containing the hoxa11 and hoxa13 orthologs as well as intergenic and flanking noncoding sequences. The duplicated HoxA clusters in zebrafish each house considerably fewer genes and are dramatically shorter than the single HoxA clusters of human and horn shark. We compared the intergenic sequences of the HoxA clusters of human, horn shark, zebrafish (Aa, Ab), and striped bass and found extensive conservation of noncoding sequence motifs, i.e., phylogenetic footprints, between the human and horn shark, representing two of the three gnathostome lineages. These are putative cis-regulatory elements that may play a role in the regulation of the ancestral HoxA cluster. In contrast, homologous regions of the duplicated HoxAa and HoxAb clusters of zebrafish and the HoxA cluster of striped bass revealed a striking loss of conservation of these putative cis-regulatory sequences in the 3′ (anterior) segment of the cluster, where zebrafish only retains single representatives of group 1, 3, 4, and 5 (HoxAa) and group 2 (HoxAb) genes and in the 5′ part of the clusters, where zebrafish retains two copies of the group 13, 11, and 9 genes, i.e., AbdB-like genes. In analyzing patterns of cis-sequence evolution in the 5′ part of the clusters, we explicitly looked for evidence of complementary loss of conserved noncoding sequences, as predicted by the duplication-degeneration-complementation model in which genetic redundancy after gene duplication is resolved because of the fixation of complementary degenerative mutations. Our data did not yield evidence supporting this prediction. We conclude that changes in the pattern of cis-sequence conservation after Hox cluster duplication are more consistent with being the outcome of adaptive modification rather than passive mechanisms that erode redundancy created by the duplication event. These results support the view that genome duplications may provide a mechanism whereby master control genes undergo radical modifications conducive to major alterations in body plan. Such genomic revolutions may contribute significantly to the evolutionary process. PMID:11943847

  8. Constructing and Modifying Sequence Statistics for relevent Using informR in 𝖱

    PubMed Central

    Marcum, Christopher Steven; Butts, Carter T.

    2015-01-01

    The informR package greatly simplifies the analysis of complex event histories in 𝖱 by providing user friendly tools to build sufficient statistics for the relevent package. Historically, building sufficient statistics to model event sequences (of the form a→b) using the egocentric generalization of Butts’ (2008) relational event framework for modeling social action has been cumbersome. The informR package simplifies the construction of the complex list of arrays needed by the rem() model fitting for a variety of cases involving egocentric event data, multiple event types, and/or support constraints. This paper introduces these tools using examples from real data extracted from the American Time Use Survey. PMID:26185488

  9. Digital Marine Bioprospecting: Mining New Neurotoxin Drug Candidates from the Transcriptomes of Cold-Water Sea Anemones

    PubMed Central

    Urbarova, Ilona; Karlsen, Bård Ove; Okkenhaug, Siri; Seternes, Ole Morten; Johansen, Steinar D.; Emblem, Åse

    2012-01-01

    Marine bioprospecting is the search for new marine bioactive compounds and large-scale screening in extracts represents the traditional approach. Here, we report an alternative complementary protocol, called digital marine bioprospecting, based on deep sequencing of transcriptomes. We sequenced the transcriptomes from the adult polyp stage of two cold-water sea anemones, Bolocera tuediae and Hormathia digitata. We generated approximately 1.1 million quality-filtered sequencing reads by 454 pyrosequencing, which were assembled into approximately 120,000 contigs and 220,000 single reads. Based on annotation and gene ontology analysis we profiled the expressed mRNA transcripts according to known biological processes. As a proof-of-concept we identified polypeptide toxins with a potential blocking activity on sodium and potassium voltage-gated channels from digital transcriptome libraries. PMID:23170083

  10. Multi-locus and long amplicon sequencing approach to study microbial diversity at species level using the MinION™ portable nanopore sequencer

    PubMed Central

    Sanz, Yolanda

    2017-01-01

    Abstract The miniaturized and portable DNA sequencer MinION™ has demonstrated great potential in different analyses such as genome-wide sequencing, pathogen outbreak detection and surveillance, human genome variability, and microbial diversity. In this study, we tested the ability of the MinION™ platform to perform long amplicon sequencing in order to design new approaches to study microbial diversity using a multi-locus approach. After compiling a robust database by parsing and extracting the rrn bacterial region from more than 67000 complete or draft bacterial genomes, we demonstrated that the data obtained during sequencing of the long amplicon in the MinION™ device using R9 and R9.4 chemistries were sufficient to study 2 mock microbial communities in a multiplex manner and to almost completely reconstruct the microbial diversity contained in the HM782D and D6305 mock communities. Although nanopore-based sequencing produces reads with lower per-base accuracy compared with other platforms, we presented a novel approach consisting of multi-locus and long amplicon sequencing using the MinION™ MkIb DNA sequencer and R9 and R9.4 chemistries that help to overcome the main disadvantage of this portable sequencing platform. Furthermore, the nanopore sequencing library, constructed with the last releases of pore chemistry (R9.4) and sequencing kit (SQK-LSK108), permitted the retrieval of the higher level of 1D read accuracy sufficient to characterize the microbial species present in each mock community analysed. Improvements in nanopore chemistry, such as minimizing base-calling errors and new library protocols able to produce rapid 1D libraries, will provide more reliable information in the near future. Such data will be useful for more comprehensive and faster specific detection of microbial species and strains in complex ecosystems. PMID:28605506

  11. High-Throughput Block Optical DNA Sequence Identification.

    PubMed

    Sagar, Dodderi Manjunatha; Korshoj, Lee Erik; Hanson, Katrina Bethany; Chowdhury, Partha Pratim; Otoupal, Peter Britton; Chatterjee, Anushree; Nagpal, Prashant

    2018-01-01

    Optical techniques for molecular diagnostics or DNA sequencing generally rely on small molecule fluorescent labels, which utilize light with a wavelength of several hundred nanometers for detection. Developing a label-free optical DNA sequencing technique will require nanoscale focusing of light, a high-throughput and multiplexed identification method, and a data compression technique to rapidly identify sequences and analyze genomic heterogeneity for big datasets. Such a method should identify characteristic molecular vibrations using optical spectroscopy, especially in the "fingerprinting region" from ≈400-1400 cm -1 . Here, surface-enhanced Raman spectroscopy is used to demonstrate label-free identification of DNA nucleobases with multiplexed 3D plasmonic nanofocusing. While nanometer-scale mode volumes prevent identification of single nucleobases within a DNA sequence, the block optical technique can identify A, T, G, and C content in DNA k-mers. The content of each nucleotide in a DNA block can be a unique and high-throughput method for identifying sequences, genes, and other biomarkers as an alternative to single-letter sequencing. Additionally, coupling two complementary vibrational spectroscopy techniques (infrared and Raman) can improve block characterization. These results pave the way for developing a novel, high-throughput block optical sequencing method with lossy genomic data compression using k-mer identification from multiplexed optical data acquisition. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  12. On site DNA barcoding by nanopore sequencing

    PubMed Central

    Menegon, Michele; Cantaloni, Chiara; Rodriguez-Prieto, Ana; Centomo, Cesare; Abdelfattah, Ahmed; Rossato, Marzia; Bernardi, Massimo; Xumerle, Luciano; Loader, Simon; Delledonne, Massimo

    2017-01-01

    Biodiversity research is becoming increasingly dependent on genomics, which allows the unprecedented digitization and understanding of the planet’s biological heritage. The use of genetic markers i.e. DNA barcoding, has proved to be a powerful tool in species identification. However, full exploitation of this approach is hampered by the high sequencing costs and the absence of equipped facilities in biodiversity-rich countries. In the present work, we developed a portable sequencing laboratory based on the portable DNA sequencer from Oxford Nanopore Technologies, the MinION. Complementary laboratory equipment and reagents were selected to be used in remote and tough environmental conditions. The performance of the MinION sequencer and the portable laboratory was tested for DNA barcoding in a mimicking tropical environment, as well as in a remote rainforest of Tanzania lacking electricity. Despite the relatively high sequencing error-rate of the MinION, the development of a suitable pipeline for data analysis allowed the accurate identification of different species of vertebrates including amphibians, reptiles and mammals. In situ sequencing of a wild frog allowed us to rapidly identify the species captured, thus confirming that effective DNA barcoding in the field is possible. These results open new perspectives for real-time-on-site DNA sequencing thus potentially increasing opportunities for the understanding of biodiversity in areas lacking conventional laboratory facilities. PMID:28977016

  13. Polymerase cross-linking spiral reaction (PCLSR) for detection of African swine fever virus (ASFV) in pigs and wild boars

    PubMed Central

    Woźniakowski, Grzegorz; Frączyk, Magdalena; Kowalczyk, Andrzej; Pomorska-Mól, Małgorzata; Niemczuk, Krzysztof; Pejsak, Zygmunt

    2017-01-01

    The study reports the development of a polymerase cross-linking spiral reaction (PCLSR) for the detection of African swine fever virus (ASFV) DNA in blood collected from infected pigs and wild boars. The method uses 3 specifically designed primers. Two outer-spiral primers comprising of 3′ sequences complementary to ASFV p72 gene sequence and 5′end sequences complementary to exogenous gene of black widow alpha-latrotoxin as well as additional ASFV specific cross-linking primer. The method is specific exclusively to ASFV DNA without cross-reactions with cDNA of classical swine fever virus (CSFV), porcine reproductive respiratory syndrome (PRRSV) or porcine epidemic diarrhea virus (PEDV). The sensitivity of this technique reached 7.2 × 102 copies per μl−1 of plasmid containing p72 gene. The PCLSR was conducted at 65 °C creating cross-linked complex structures. The results of PCLSR were visualized using SYBR Green I dye, gel electrophoresis while the reaction progress was traced using real-time PCR system that resulted in registration of fluorescent curves and melting peaks at 85.3 °C. The developed PCLSR was examined using blood or tissue samples collected from selected 17 ASF cases from infected wild boars and 3 outbreaks in pigs. Further tests have been also conducted using 55 tissue samples from 23 outbreaks and 22 cases. These results showed that PCLSR might be further used for preliminary and cost-effective detection and surveillance of ASFV. PMID:28198455

  14. Polymerase cross-linking spiral reaction (PCLSR) for detection of African swine fever virus (ASFV) in pigs and wild boars.

    PubMed

    Woźniakowski, Grzegorz; Frączyk, Magdalena; Kowalczyk, Andrzej; Pomorska-Mól, Małgorzata; Niemczuk, Krzysztof; Pejsak, Zygmunt

    2017-02-15

    The study reports the development of a polymerase cross-linking spiral reaction (PCLSR) for the detection of African swine fever virus (ASFV) DNA in blood collected from infected pigs and wild boars. The method uses 3 specifically designed primers. Two outer-spiral primers comprising of 3' sequences complementary to ASFV p72 gene sequence and 5'end sequences complementary to exogenous gene of black widow alpha-latrotoxin as well as additional ASFV specific cross-linking primer. The method is specific exclusively to ASFV DNA without cross-reactions with cDNA of classical swine fever virus (CSFV), porcine reproductive respiratory syndrome (PRRSV) or porcine epidemic diarrhea virus (PEDV). The sensitivity of this technique reached 7.2 × 10 2 copies per μl -1 of plasmid containing p72 gene. The PCLSR was conducted at 65 °C creating cross-linked complex structures. The results of PCLSR were visualized using SYBR Green I dye, gel electrophoresis while the reaction progress was traced using real-time PCR system that resulted in registration of fluorescent curves and melting peaks at 85.3 °C. The developed PCLSR was examined using blood or tissue samples collected from selected 17 ASF cases from infected wild boars and 3 outbreaks in pigs. Further tests have been also conducted using 55 tissue samples from 23 outbreaks and 22 cases. These results showed that PCLSR might be further used for preliminary and cost-effective detection and surveillance of ASFV.

  15. ACVP-05: Virus Genetic Analysis from Cell-Free Plasma, Virally Infected Cells or Tissues and Cultured Supernatant Via Single Genome Amplification and Direct Sequencing | Frederick National Laboratory for Cancer Research

    Cancer.gov

    The Viral Evolution Core within the AIDS and Cancer Virus Program will extract viral RNA/DNA from cell-free or cell-associated samples. Complementary (cDNA) will be generated as needed, and cDNA or DNA will be diluted to a single copy prior to nested

  16. Simulations Meet Experiment to Reveal New Insights into DNA Intrinsic Mechanics

    PubMed Central

    Ben Imeddourene, Akli; Elbahnsi, Ahmad; Guéroult, Marc; Oguey, Christophe; Foloppe, Nicolas; Hartmann, Brigitte

    2015-01-01

    The accurate prediction of the structure and dynamics of DNA remains a major challenge in computational biology due to the dearth of precise experimental information on DNA free in solution and limitations in the DNA force-fields underpinning the simulations. A new generation of force-fields has been developed to better represent the sequence-dependent B-DNA intrinsic mechanics, in particular with respect to the BI ↔ BII backbone equilibrium, which is essential to understand the B-DNA properties. Here, the performance of MD simulations with the newly updated force-fields Parmbsc0εζOLI and CHARMM36 was tested against a large ensemble of recent NMR data collected on four DNA dodecamers involved in nucleosome positioning. We find impressive progress towards a coherent, realistic representation of B-DNA in solution, despite residual shortcomings. This improved representation allows new and deeper interpretation of the experimental observables, including regarding the behavior of facing phosphate groups in complementary dinucleotides, and their modulation by the sequence. It also provides the opportunity to extensively revisit and refine the coupling between backbone states and inter base pair parameters, which emerges as a common theme across all the complementary dinucleotides. In sum, the global agreement between simulations and experiment reveals new aspects of intrinsic DNA mechanics, a key component of DNA-protein recognition. PMID:26657165

  17. Inferring the Brassica rapa Interactome Using Protein–Protein Interaction Data from Arabidopsis thaliana

    PubMed Central

    Yang, Jianhua; Osman, Kim; Iqbal, Mudassar; Stekel, Dov J.; Luo, Zewei; Armstrong, Susan J.; Franklin, F. Chris H.

    2013-01-01

    Following successful completion of the Brassica rapa sequencing project, the next step is to investigate functions of individual genes/proteins. For Arabidopsis thaliana, large amounts of protein–protein interaction (PPI) data are available from the major PPI databases (DBs). It is known that Brassica crop species are closely related to A. thaliana. This provides an opportunity to infer the B. rapa interactome using PPI data available from A. thaliana. In this paper, we present an inferred B. rapa interactome that is based on the A. thaliana PPI data from two resources: (i) A. thaliana PPI data from three major DBs, BioGRID, IntAct, and TAIR. (ii) ortholog-based A. thaliana PPI predictions. Linking between B. rapa and A. thaliana was accomplished in three complementary ways: (i) ortholog predictions, (ii) identification of gene duplication based on synteny and collinearity, and (iii) BLAST sequence similarity search. A complementary approach was also applied, which used known/predicted domain–domain interaction data. Specifically, since the two species are closely related, we used PPI data from A. thaliana to predict interacting domains that might be conserved between the two species. The predicted interactome was investigated for the component that contains known A. thaliana meiotic proteins to demonstrate its usability. PMID:23293649

  18. Complementary fMRI and EEG evidence for more efficient neural processing of rhythmic vs. unpredictably timed sounds

    PubMed Central

    van Atteveldt, Nienke; Musacchia, Gabriella; Zion-Golumbic, Elana; Sehatpour, Pejman; Javitt, Daniel C.; Schroeder, Charles

    2015-01-01

    The brain’s fascinating ability to adapt its internal neural dynamics to the temporal structure of the sensory environment is becoming increasingly clear. It is thought to be metabolically beneficial to align ongoing oscillatory activity to the relevant inputs in a predictable stream, so that they will enter at optimal processing phases of the spontaneously occurring rhythmic excitability fluctuations. However, some contexts have a more predictable temporal structure than others. Here, we tested the hypothesis that the processing of rhythmic sounds is more efficient than the processing of irregularly timed sounds. To do this, we simultaneously measured functional magnetic resonance imaging (fMRI) and electro-encephalograms (EEG) while participants detected oddball target sounds in alternating blocks of rhythmic (e.g., with equal inter-stimulus intervals) or random (e.g., with randomly varied inter-stimulus intervals) tone sequences. Behaviorally, participants detected target sounds faster and more accurately when embedded in rhythmic streams. The fMRI response in the auditory cortex was stronger during random compared to random tone sequence processing. Simultaneously recorded N1 responses showed larger peak amplitudes and longer latencies for tones in the random (vs. the rhythmic) streams. These results reveal complementary evidence for more efficient neural and perceptual processing during temporally predictable sensory contexts. PMID:26579044

  19. Biomimetic DNA emulsions: specific, thermo-reversible and adjustable binding from a liquid-like DNA layer

    NASA Astrophysics Data System (ADS)

    Pontani, Lea-Laetitia; Feng, Lang; Dreyfus, Remi; Seeman, Nadrian; Chaikin, Paul; Brujic, Jasna

    2013-03-01

    We develop micron-sized emulsions coated with specific DNA sequences and complementary sticky ends. The emulsions are stabilized with phospholipids on which the DNA strands are grafted through biotin-streptavidin interactions, which allows the DNA to diffuse freely on the surface. We produce two complementary emulsions: one is functionalized with S sticky ends and dyed with red streptavidin, the other displays the complementary S' sticky ends and green streptavidin. Mixing those emulsions reveals specific adhesion between them due to the short-range S-S' hybridization. As expected this interaction is thermo-reversible: the red-green adhesive droplets dissociate upon heating and reassemble after cooling. Here the fluid phospholipids layer also leads to diffusive adhesion patches, which allows the bound droplets to rearrange throughout the packing structure. We quantify the adhesion strength between two droplets and build a theoretical framework that captures the observed trends through parameters such as the size of the droplets, the DNA surface density, the various DNA constructs or the temperature. This colloidal-scale, specific, thermo-reversible biomimetic emulsion offers a new versatile and powerful tool for the development of complex self-assembled materials.

  20. Leptospira species molecular epidemiology in the genomic era.

    PubMed

    Caimi, K; Repetto, S A; Varni, V; Ruybal, P

    2017-10-01

    Leptospirosis is a zoonotic disease which global burden is increasing often related to climatic change. Hundreds of whole genome sequences from worldwide isolates of Leptospira spp. are available nowadays, together with online tools that permit to assign MLST sequence types (STs) directly from raw sequence data. In this work we have applied R7L-MLST to near 500 genomes and strains collection globally distributed. All 10 pathogenic species as well as intermediate were typed using this MLST scheme. The correlation observed between STs and serogroups in our previous work, is still satisfied with this higher dataset sustaining the implementation of MLST to assist serological classification as a complementary approach. Bayesian phylogenetic analysis of concatenated sequences from R7-MLST loci allowed us to resolve taxonomic inconsistencies but also showed that events such as recombination, gene conversion or lateral gene transfer played an important role in the evolution of Leptospira genus. Whole genome sequencing allows us to contribute with suitable epidemiologic information useful to apply in the design of control strategies and also in diagnostic methods for this illness. Copyright © 2017 Elsevier B.V. All rights reserved.

  1. Sequencing the oligosaccharide pool in the low molecular weight heparin dalteparin with offline HPLC and ESI-MS/MS.

    PubMed

    Wang, Zhangjie; Zhang, Tianji; Xie, Shaoshuai; Liu, Xinyue; Li, Hongmei; Linhardt, Robert J; Chi, Lianli

    2018-03-01

    Low molecular weight heparins (LMWHs) are widely used anticoagulant drugs. The composition and sequence of LMWH oligosaccharides determine their safety and efficacy. The short oligosaccharide pool in LMWHs undergoes more depolymerization reactions than the longer chains and is the most sensitive indicator of the manufacturing process. Electrospray ionization tandem mass spectrometry (ESI-MS/MS) has been demonstrated as a powerful tool to sequence synthetic heparin oligosaccharide but never been applied to analyze complicated mixture like LMWHs. We established an offline strong anion exchange (SAX)-high performance liquid chromatography (HPLC) and ESI-MS/MS approach to sequence the short oligosaccharides of dalteparin sodium. With the help of in-house developed MS/MS interpretation software, the sequences of 18 representative species ranging from tetrasaccharide to octasaccharide were obtained. Interestingly, we found a novel 2,3-disulfated hexauronic acid structure and reconfirmed it by complementary heparinase digestion and LC-MS/MS analysis. This approach provides straightforward and in-depth insight to the structure of LMWHs and the reaction mechanism of heparin depolymerization. Copyright © 2017 Elsevier Ltd. All rights reserved.

  2. A simple procedure for parallel sequence analysis of both strands of 5'-labeled DNA.

    PubMed

    Razvi, F; Gargiulo, G; Worcel, A

    1983-08-01

    Ligation of a 5'-labeled DNA restriction fragment results in a circular DNA molecule carrying the two 32Ps at the reformed restriction site. Double digestions of the circular DNA with the original enzyme and a second restriction enzyme cleavage near the labeled site allows direct chemical sequencing of one 5'-labeled DNA strand. Similar double digestions, using an isoschizomer that cleaves differently at the 32P-labeled site, allows direct sequencing of the now 3'-labeled complementary DNA strand. It is possible to directly sequence both strands of cloned DNA inserts by using the above protocol and a multiple cloning site vector that provides the necessary restriction sites. The simultaneous and parallel visualization of both DNA strands eliminates sequence ambiguities. In addition, the labeled circular molecules are particularly useful for single-hit DNA cleavage studies and DNA footprint analysis. As an example, we show here an analysis of the micrococcal nuclease-induced breaks on the two strands of the somatic 5S RNA gene of Xenopus borealis, which suggests that the enzyme may recognize and cleave small AT-containing palindromes along the DNA helix.

  3. SELEX and SHAPE reveal that sequence motifs and an extended hairpin in the 5' portion of Turnip crinkle virus satellite RNA C mediate fitness in plants.

    PubMed

    Bayne, Charlie F; Widawski, Max E; Gao, Feng; Masab, Mohammed H; Chattopadhyay, Maitreyi; Murawski, Allison M; Sansevere, Robert M; Lerner, Bryan D; Castillo, Rinaldys J; Griesman, Trevor; Fu, Jiantao; Hibben, Jennifer K; Garcia-Perez, Alma D; Simon, Anne E; Kushner, David B

    2018-07-01

    Noncoding RNAs use their sequence and/or structure to mediate function(s). The 5' portion (166 nt) of the 356-nt noncoding satellite RNA C (satC) of Turnip crinkle virus (TCV) was previously modeled to contain a central region with two stem-loops (H6 and H7) and a large connecting hairpin (H2). We now report that in vivo functional selection (SELEX) experiments assessing sequence/structure requirements in H2, H6, and H7 reveal that H6 loop sequence motifs were recovered at nonrandom rates and only some residues are proposed to base-pair with accessible complementary sequences within the 5' central region. In vitro SHAPE of SELEX winners indicates that the central region is heavily base-paired, such that along with the lower stem and H2 region, one extensive hairpin exists composing the entire 5' region. As these SELEX winners are highly fit, these characteristics facilitate satRNA amplification in association with TCV in plants. Copyright © 2018 Elsevier Inc. All rights reserved.

  4. Characterization of rat calcitonin mRNA.

    PubMed Central

    Amara, S G; David, D N; Rosenfeld, M G; Roos, B A; Evans, R M

    1980-01-01

    A chimeric plasmic containing cDNA complementary to rat calcitonin mRNA has been constructed. Partial sequence analysis shows that the insert contains a nucleotide sequence encoding the complete amino acid sequence of calcitonin. Two basic amino acids precede and three basic amino acids follow the hormone sequence, suggesting that calcitonin is generated by the proteolytic cleavage of a larger precursor in a manner analogous to that of other small polypeptide hormones. The COOH-terminal proline, known to be amidated in the secreted hormone, is followed by a glycine in the precursor. The cloned calcitonin DNA was used to characterize the expression of calcitonin mRNA. Cytoplasmic mRNAs from calcitonin-producing rat medullary thyroid carcinoma lines and from normal rat thyroid glands contain a single species, 1050 nucleotides long, whch hybridizes to the cloned calcitonin cDNA. The concentration of calcitonin mRNA sequences is greater in those tumors that produce larger amounts of immunoreactive calcitonin. RNAs from other endocrine tissues, including anterior and neurointermediate lobes of rat pituitary, contain no detectable calcitonin mRNA. Images PMID:6933496

  5. Survey of local and global biological network alignment: the need to reconcile the two sides of the same coin.

    PubMed

    Guzzi, Pietro Hiram; Milenkovic, Tijana

    2018-05-01

    Analogous to genomic sequence alignment that allows for across-species transfer of biological knowledge between conserved sequence regions, biological network alignment can be used to guide the knowledge transfer between conserved regions of molecular networks of different species. Hence, biological network alignment can be used to redefine the traditional notion of a sequence-based homology to a new notion of network-based homology. Analogous to genomic sequence alignment, there exist local and global biological network alignments. Here, we survey prominent and recent computational approaches of each network alignment type and discuss their (dis)advantages. Then, as it was recently shown that the two approach types are complementary, in the sense that they capture different slices of cellular functioning, we discuss the need to reconcile the two network alignment types and present a recent first step in this direction. We conclude with some open research problems on this topic and comment on the usefulness of network alignment in other domains besides computational biology.

  6. RNA Editing in Plant Mitochondria

    NASA Astrophysics Data System (ADS)

    Hiesel, Rudolf; Wissinger, Bernd; Schuster, Wolfgang; Brennicke, Axel

    1989-12-01

    Comparative sequence analysis of genomic and complementary DNA clones from several mitochondrial genes in the higher plant Oenothera revealed nucleotide sequence divergences between the genomic and the messenger RNA-derived sequences. These sequence alterations could be most easily explained by specific post-transcriptional nucleotide modifications. Most of the nucleotide exchanges in coding regions lead to altered codons in the mRNA that specify amino acids better conserved in evolution than those encoded by the genomic DNA. Several instances show that the genomic arginine codon CGG is edited in the mRNA to the tryptophan codon TGG in amino acid positions that are highly conserved as tryptophan in the homologous proteins of other species. This editing suggests that the standard genetic code is used in plant mitochondria and resolves the frequent coincidence of CGG codons and tryptophan in different plant species. The apparently frequent and non-species-specific equivalency of CGG and TGG codons in particular suggests that RNA editing is a common feature of all higher plant mitochondria.

  7. Endophytic bacterial diversity in grapevine (Vitis vinifera L.) leaves described by 16S rRNA gene sequence analysis and length heterogeneity-PCR.

    PubMed

    Bulgari, Daniela; Casati, Paola; Brusetti, Lorenzo; Quaglino, Fabio; Brasca, Milena; Daffonchio, Daniele; Bianco, Piero Attilio

    2009-08-01

    Diversity of bacterial endophytes associated with grapevine leaf tissues was analyzed by cultivation and cultivation-independent methods. In order to identify bacterial endophytes directly from metagenome, a protocol for bacteria enrichment and DNA extraction was optimized. Sequence analysis of 16S rRNA gene libraries underscored five diverse Operational Taxonomic Units (OTUs), showing best sequence matches with gamma-Proteobacteria, family Enterobacteriaceae, with a dominance of the genus Pantoea. Bacteria isolation through cultivation revealed the presence of six OTUs, showing best sequence matches with Actinobacteria, genus Curtobacterium, and with Firmicutes genera Bacillus and Enterococcus. Length Heterogeneity-PCR (LH-PCR) electrophoretic peaks from single bacterial clones were used to setup a database representing the bacterial endophytes identified in association with grapevine tissues. Analysis of healthy and phytoplasma-infected grapevine plants showed that LH-PCR could be a useful complementary tool for examining the diversity of bacterial endophytes especially for diversity survey on a large number of samples.

  8. Comparison of sequencing-based methods to profile DNA methylation and identification of monoallelic epigenetic modifications

    PubMed Central

    Harris, R. Alan; Wang, Ting; Coarfa, Cristian; Nagarajan, Raman P.; Hong, Chibo; Downey, Sara L.; Johnson, Brett E.; Fouse, Shaun D.; Delaney, Allen; Zhao, Yongjun; Olshen, Adam; Ballinger, Tracy; Zhou, Xin; Forsberg, Kevin J.; Gu, Junchen; Echipare, Lorigail; O’Geen, Henriette; Lister, Ryan; Pelizzola, Mattia; Xi, Yuanxin; Epstein, Charles B.; Bernstein, Bradley E.; Hawkins, R. David; Ren, Bing; Chung, Wen-Yu; Gu, Hongcang; Bock, Christoph; Gnirke, Andreas; Zhang, Michael Q.; Haussler, David; Ecker, Joseph; Li, Wei; Farnham, Peggy J.; Waterland, Robert A.; Meissner, Alexander; Marra, Marco A.; Hirst, Martin; Milosavljevic, Aleksandar; Costello, Joseph F.

    2010-01-01

    Sequencing-based DNA methylation profiling methods are comprehensive and, as accuracy and affordability improve, will increasingly supplant microarrays for genome-scale analyses. Here, four sequencing-based methodologies were applied to biological replicates of human embryonic stem cells to compare their CpG coverage genome-wide and in transposons, resolution, cost, concordance and its relationship with CpG density and genomic context. The two bisulfite methods reached concordance of 82% for CpG methylation levels and 99% for non-CpG cytosine methylation levels. Using binary methylation calls, two enrichment methods were 99% concordant, while regions assessed by all four methods were 97% concordant. To achieve comprehensive methylome coverage while reducing cost, an approach integrating two complementary methods was examined. The integrative methylome profile along with histone methylation, RNA, and SNP profiles derived from the sequence reads allowed genome-wide assessment of allele-specific epigenetic states, identifying most known imprinted regions and new loci with monoallelic epigenetic marks and monoallelic expression. PMID:20852635

  9. Between Two Fern Genomes

    PubMed Central

    2014-01-01

    Ferns are the only major lineage of vascular plants not represented by a sequenced nuclear genome. This lack of genome sequence information significantly impedes our ability to understand and reconstruct genome evolution not only in ferns, but across all land plants. Azolla and Ceratopteris are ideal and complementary candidates to be the first ferns to have their nuclear genomes sequenced. They differ dramatically in genome size, life history, and habit, and thus represent the immense diversity of extant ferns. Together, this pair of genomes will facilitate myriad large-scale comparative analyses across ferns and all land plants. Here we review the unique biological characteristics of ferns and describe a number of outstanding questions in plant biology that will benefit from the addition of ferns to the set of taxa with sequenced nuclear genomes. We explain why the fern clade is pivotal for understanding genome evolution across land plants, and we provide a rationale for how knowledge of fern genomes will enable progress in research beyond the ferns themselves. PMID:25324969

  10. Added Value of Next-Generation Sequencing for Multilocus Sequence Typing Analysis of a Pneumocystis jirovecii Pneumonia Outbreak1.

    PubMed

    Charpentier, Elena; Garnaud, Cécile; Wintenberger, Claire; Bailly, Sébastien; Murat, Jean-Benjamin; Rendu, John; Pavese, Patricia; Drouet, Thibault; Augier, Caroline; Malvezzi, Paolo; Thiébaut-Bertrand, Anne; Mallaret, Marie-Reine; Epaulard, Olivier; Cornet, Muriel; Larrat, Sylvie; Maubon, Danièle

    2017-08-01

    Pneumocystis jirovecii is a major threat for immunocompromised patients, and clusters of pneumocystis pneumonia (PCP) have been increasingly described in transplant units during the past decade. Exploring an outbreak transmission network requires complementary spatiotemporal and strain-typing approaches. We analyzed a PCP outbreak and demonstrated the added value of next-generation sequencing (NGS) for the multilocus sequence typing (MLST) study of P. jirovecii strains. Thirty-two PCP patients were included. Among the 12 solid organ transplant patients, 5 shared a major and unique genotype that was also found as a minor strain in a sixth patient. A transmission map analysis strengthened the suspicion of nosocomial acquisition of this strain for the 6 patients. NGS-MLST enables accurate determination of subpopulation, which allowed excluding other patients from the transmission network. NGS-MLST genotyping approach was essential to deciphering this outbreak. This innovative approach brings new insights for future epidemiologic studies on this uncultivable opportunistic fungus.

  11. Added Value of Next-Generation Sequencing for Multilocus Sequence Typing Analysis of a Pneumocystis jirovecii Pneumonia Outbreak1

    PubMed Central

    Charpentier, Elena; Garnaud, Cécile; Wintenberger, Claire; Bailly, Sébastien; Murat, Jean-Benjamin; Rendu, John; Pavese, Patricia; Drouet, Thibault; Augier, Caroline; Malvezzi, Paolo; Thiébaut-Bertrand, Anne; Mallaret, Marie-Reine; Epaulard, Olivier; Cornet, Muriel; Larrat, Sylvie

    2017-01-01

    Pneumocystis jirovecii is a major threat for immunocompromised patients, and clusters of pneumocystis pneumonia (PCP) have been increasingly described in transplant units during the past decade. Exploring an outbreak transmission network requires complementary spatiotemporal and strain-typing approaches. We analyzed a PCP outbreak and demonstrated the added value of next-generation sequencing (NGS) for the multilocus sequence typing (MLST) study of P. jirovecii strains. Thirty-two PCP patients were included. Among the 12 solid organ transplant patients, 5 shared a major and unique genotype that was also found as a minor strain in a sixth patient. A transmission map analysis strengthened the suspicion of nosocomial acquisition of this strain for the 6 patients. NGS-MLST enables accurate determination of subpopulation, which allowed excluding other patients from the transmission network. NGS-MLST genotyping approach was essential to deciphering this outbreak. This innovative approach brings new insights for future epidemiologic studies on this uncultivable opportunistic fungus. PMID:28726611

  12. Application of genetic algorithm in integrated setup planning and operation sequencing

    NASA Astrophysics Data System (ADS)

    Kafashi, Sajad; Shakeri, Mohsen

    2011-01-01

    Process planning is an essential component for linking design and manufacturing process. Setup planning and operation sequencing is two main tasks in process planning. Many researches solved these two problems separately. Considering the fact that the two functions are complementary, it is necessary to integrate them more tightly so that performance of a manufacturing system can be improved economically and competitively. This paper present a generative system and genetic algorithm (GA) approach to process plan the given part. The proposed approach and optimization methodology analyses the TAD (tool approach direction), tolerance relation between features and feature precedence relations to generate all possible setups and operations using workshop resource database. Based on these technological constraints the GA algorithm approach, which adopts the feature-based representation, optimizes the setup plan and sequence of operations using cost indices. Case study show that the developed system can generate satisfactory results in optimizing the setup planning and operation sequencing simultaneously in feasible condition.

  13. Integrating alignment-based and alignment-free sequence similarity measures for biological sequence classification.

    PubMed

    Borozan, Ivan; Watt, Stuart; Ferretti, Vincent

    2015-05-01

    Alignment-based sequence similarity searches, while accurate for some type of sequences, can produce incorrect results when used on more divergent but functionally related sequences that have undergone the sequence rearrangements observed in many bacterial and viral genomes. Here, we propose a classification model that exploits the complementary nature of alignment-based and alignment-free similarity measures with the aim to improve the accuracy with which DNA and protein sequences are characterized. Our model classifies sequences using a combined sequence similarity score calculated by adaptively weighting the contribution of different sequence similarity measures. Weights are determined independently for each sequence in the test set and reflect the discriminatory ability of individual similarity measures in the training set. Because the similarity between some sequences is determined more accurately with one type of measure rather than another, our classifier allows different sets of weights to be associated with different sequences. Using five different similarity measures, we show that our model significantly improves the classification accuracy over the current composition- and alignment-based models, when predicting the taxonomic lineage for both short viral sequence fragments and complete viral sequences. We also show that our model can be used effectively for the classification of reads from a real metagenome dataset as well as protein sequences. All the datasets and the code used in this study are freely available at https://collaborators.oicr.on.ca/vferretti/borozan_csss/csss.html. ivan.borozan@gmail.com Supplementary data are available at Bioinformatics online. © The Author 2015. Published by Oxford University Press.

  14. Integrating alignment-based and alignment-free sequence similarity measures for biological sequence classification

    PubMed Central

    Borozan, Ivan; Watt, Stuart; Ferretti, Vincent

    2015-01-01

    Motivation: Alignment-based sequence similarity searches, while accurate for some type of sequences, can produce incorrect results when used on more divergent but functionally related sequences that have undergone the sequence rearrangements observed in many bacterial and viral genomes. Here, we propose a classification model that exploits the complementary nature of alignment-based and alignment-free similarity measures with the aim to improve the accuracy with which DNA and protein sequences are characterized. Results: Our model classifies sequences using a combined sequence similarity score calculated by adaptively weighting the contribution of different sequence similarity measures. Weights are determined independently for each sequence in the test set and reflect the discriminatory ability of individual similarity measures in the training set. Because the similarity between some sequences is determined more accurately with one type of measure rather than another, our classifier allows different sets of weights to be associated with different sequences. Using five different similarity measures, we show that our model significantly improves the classification accuracy over the current composition- and alignment-based models, when predicting the taxonomic lineage for both short viral sequence fragments and complete viral sequences. We also show that our model can be used effectively for the classification of reads from a real metagenome dataset as well as protein sequences. Availability and implementation: All the datasets and the code used in this study are freely available at https://collaborators.oicr.on.ca/vferretti/borozan_csss/csss.html. Contact: ivan.borozan@gmail.com Supplementary information: Supplementary data are available at Bioinformatics online. PMID:25573913

  15. Simplified Identification of mRNA or DNA in Whole Cells

    NASA Technical Reports Server (NTRS)

    Almeida, Eduardo; Kadambi, Geeta

    2007-01-01

    A recently invented method of detecting a selected messenger ribonucleic acid (mRNA) or deoxyribonucleic acid (DNA) sequence offers two important advantages over prior such methods: it is simpler and can be implemented by means of compact equipment. The simplification and miniaturization achieved by this invention are such that this method is suitable for use outside laboratories, in field settings in which space and power supplies may be limited. The present method is based partly on hybridization of nucleic acid, which is a powerful technique for detection of specific complementary nucleic acid sequences and is increasingly being used for detection of changes in gene expression in microarrays containing thousands of gene probes.

  16. The Molecular Basis of Muscular Dystrophy in the mdx Mouse: A Point Mutation

    NASA Astrophysics Data System (ADS)

    Sicinski, Piotr; Geng, Yan; Ryder-Cook, Allan S.; Barnard, Eric A.; Darlison, Mark G.; Barnard, Pene J.

    1989-06-01

    The mdx mouse is an X-linked myopathic mutant, an animal model for human Duchenne muscular dystrophy. In both mouse and man the mutations lie within the dystrophin gene, but the phenotypic differences of the disease in the two species confer much interest on the molecular basis of the mdx mutation. The complementary DNA for mouse dystrophin has been cloned, and the sequence has been used in the polymerase chain reaction to amplify normal and mdx dystrophin transcripts in the area of the mdx mutation. Sequence analysis of the amplification products showed that the mdx mouse has a single base substitution within an exon, which causes premature termination of the polypeptide chain.

  17. Triazole-linked DNA as a primer surrogate in the synthesis of first-strand cDNA.

    PubMed

    Fujino, Tomoko; Yasumoto, Ken-ichi; Yamazaki, Naomi; Hasome, Ai; Sogawa, Kazuhiro; Isobe, Hiroyuki

    2011-11-04

    A phosphate-eliminated nonnatural oligonucleotide serves as a primer surrogate in reverse transcription reaction of mRNA. Despite of the nonnatural triazole linkages in the surrogate, the reverse transcriptase effectively elongated cDNA sequences on the 3'-downstream of the primer by transcription of the complementary sequence of mRNA. A structure-activity comparison with the reference natural oligonucleotides shows the superior priming activity of the surrogate containing triazole-linkages. The nonnatural linkages also protect the transcribed cDNA from digestion reactions with 5'-exonuclease and enable us to remove noise transcripts of unknown origins. Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  18. ConoDictor: a tool for prediction of conopeptide superfamilies.

    PubMed

    Koua, Dominique; Brauer, Age; Laht, Silja; Kaplinski, Lauris; Favreau, Philippe; Remm, Maido; Lisacek, Frédérique; Stöcklin, Reto

    2012-07-01

    ConoDictor is a tool that enables fast and accurate classification of conopeptides into superfamilies based on their amino acid sequence. ConoDictor combines predictions from two complementary approaches-profile hidden Markov models and generalized profiles. Results appear in a browser as tables that can be downloaded in various formats. This application is particularly valuable in view of the exponentially increasing number of conopeptides that are being identified. ConoDictor was written in Perl using the common gateway interface module with a php submission page. Sequence matching is performed with hmmsearch from HMMER 3 and ps_scan.pl from the pftools 2.3 package. ConoDictor is freely accessible at http://conco.ebc.ee.

  19. Health-based risk adjustment: is inpatient and outpatient diagnostic information sufficient?

    PubMed

    Lamers, L M

    Adequate risk adjustment is critical to the success of market-oriented health care reforms in many countries. Currently used risk adjusters based on demographic and diagnostic cost groups (DCGs) do not reflect expected costs accurately. This study examines the simultaneous predictive accuracy of inpatient and outpatient morbidity measures and prior costs. DCGs, pharmacy cost groups (PCGs), and prior year's costs improve the predictive accuracy of the demographic model substantially. DCGs and PCGs seem complementary in their ability to predict future costs. However, this study shows that the combination of DCGs and PCGs still leaves room for cream skimming.

  20. Gambling on a shortcut to genome sequencing

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Roberts, L.

    1991-06-21

    Almost from the start of the Human Genome Project, a debate has been raging over whether to sequence the entire human genome, all 3 billion bases, or just the genes - a mere 2% or 3% of the genome, and by far the most interesting part. In England, Sydney Brenner convinced the Medical Research Council (MRC) to start with the expressed genes, or complementary DNAs. But the US stance has been that the entire sequence is essential if we are to understand the blueprint of man. Craig Venter of the National Institute of Neurological Disorders and Stroke says that focusingmore » on the expressed genes may be even more useful than expected. His strategy involves randomly selecting clones from cDNA libraries which theoretically contain all the genes that are switched on at a particular time in a particular tissue. Then the researchers sequence just a short stretch of each clone, about 400 to 500 bases, to create can expressed sequence tag or EST. The sequences of these ESTs are then stored in a database. Using that information, other researchers can then recreate that EST by using polymerase chain reaction techniques.« less

  1. Peptide de novo sequencing of mixture tandem mass spectra

    PubMed Central

    Hotta, Stéphanie Yuki Kolbeck; Verano‐Braga, Thiago; Kjeldsen, Frank

    2016-01-01

    The impact of mixture spectra deconvolution on the performance of four popular de novo sequencing programs was tested using artificially constructed mixture spectra as well as experimental proteomics data. Mixture fragmentation spectra are recognized as a limitation in proteomics because they decrease the identification performance using database search engines. De novo sequencing approaches are expected to be even more sensitive to the reduction in mass spectrum quality resulting from peptide precursor co‐isolation and thus prone to false identifications. The deconvolution approach matched complementary b‐, y‐ions to each precursor peptide mass, which allowed the creation of virtual spectra containing sequence specific fragment ions of each co‐isolated peptide. Deconvolution processing resulted in equally efficient identification rates but increased the absolute number of correctly sequenced peptides. The improvement was in the range of 20–35% additional peptide identifications for a HeLa lysate sample. Some correct sequences were identified only using unprocessed spectra; however, the number of these was lower than those where improvement was obtained by mass spectral deconvolution. Tight candidate peptide score distribution and high sensitivity to small changes in the mass spectrum introduced by the employed deconvolution method could explain some of the missing peptide identifications. PMID:27329701

  2. Allexiviruses may have acquired inserted sequences between the CP and CRP genes to change the translation reinitiation strategy of CRP.

    PubMed

    Yoshida, Naoto; Shimura, Hanako; Masuta, Chikara

    2018-06-01

    Allexiviruses are economically important garlic viruses that are involved in garlic mosaic diseases. In this study, we characterized the allexivirus cysteine-rich protein (CRP) gene located just downstream of the coat protein (CP) gene in the viral genome. We determined the nucleotide sequences of the CP and CRP genes from numerous allexivirus isolates and performed a phylogenetic analysis. According to the resulting phylogenetic tree, we found that allexiviruses were clearly divided into two major groups (group I and group II) based on the sequences of the CP and CRP genes. In addition, the allexiviruses in group II had distinct sequences just before the CRP gene, while group I isolates did not. The inserted sequence between the CP and CRP genes was partially complementary to garlic 18S rRNA. Using a potato virus X vector, we showed that the CRPs affected viral accumulation and symptom induction in Nicotiana benthamiana, suggesting that the allexivirus CRP is a pathogenicity determinant. We assume that the inserted sequences before the CRP gene may have been generated during viral evolution to alter the termination-reinitiation mechanism for coupled translation of CP and CRP.

  3. PARP Inhibitors in Reproductive System Cancers: Current Use and Developments.

    PubMed

    O'Sullivan Coyne, Geraldine; Chen, Alice P; Meehan, Robert; Doroshow, James H

    2017-02-01

    The repair of DNA damage is a critical cellular process governed by multiple biochemical pathways that are often found to be defective in cancer cells. The poly(ADP-ribose) polymerase (PARP) family of proteins controls response to single-strand DNA breaks by detecting these damaged sites and recruiting the proper factors for repair. Blocking this pathway forces cells to utilize complementary mechanisms to repair DNA damage. While PARP inhibition may not, in itself, be sufficient to cause tumor cell death, inhibition of DNA repair with PARP inhibitors is an effective cytotoxic strategy when it is used in patients who carry other defective DNA-repair mechanisms, such as mutations in the genes BRCA 1 and 2. This discovery has supported the development of PARP inhibitors (PARPi), agents that have proven effective against various types of tumors that carry BRCA mutations. With the application of next-generation sequencing of tumors, there is increased interest in looking beyond BRCA mutations to identify genetic and epigenetic aberrations that might lead to similar defects in DNA repair, conferring susceptibility to PARP inhibition. Identification of these genetic lesions and the development of screening assays for their detection may allow for the selection of patients most likely to respond to this class of anticancer agents. This article provides an overview of clinical trial results obtained with PARPi and describes the companion diagnostic assays being established for patient selection. In addition, we review known mechanisms for resistance to PARPi and potential strategies for combining these agents with other types of therapy.

  4. Complete genome sequence of a potyvirus infecting yam beans (Pachyrhizus spp.) in Peru.

    PubMed

    Fuentes, Segundo; Heider, Bettina; Tasso, Ruby Carolina; Romero, Elisa; Zum Felde, Thomas; Kreuze, Jan Frederik

    2012-04-01

    In 2010, yam beans in a field trial in Peru showed viral disease symptoms. Graft-transmission and positive ELISA results using potyvirus-specific antibodies suggested that the symptoms could be the result of a potyviral infection. Small interfering RNA (siRNA) were extracted from one of the samples and sent for high-throughput sequencing. The full genome of a new potyvirus could be assembled from the resulting siRNA sequences, and it was sufficiently different from other sequences to be considered a member of a new species, which we have designated Yam bean mosaic virus (YBMV). Sequence similarity suggests that YBMV has also been detected in yam beans in Indonesia.

  5. Terminator oligo blocking efficiently eliminates rRNA from Drosophila small RNA sequencing libraries.

    PubMed

    Wickersheim, Michelle L; Blumenstiel, Justin P

    2013-11-01

    A large number of methods are available to deplete ribosomal RNA reads from high-throughput RNA sequencing experiments. Such methods are critical for sequencing Drosophila small RNAs between 20 and 30 nucleotides because size selection is not typically sufficient to exclude the highly abundant class of 30 nucleotide 2S rRNA. Here we demonstrate that pre-annealing terminator oligos complimentary to Drosophila 2S rRNA prior to 5' adapter ligation and reverse transcription efficiently depletes 2S rRNA sequences from the sequencing reaction in a simple and inexpensive way. This depletion is highly specific and is achieved with minimal perturbation of miRNA and piRNA profiles.

  6. Sequencing Needs for Viral Diagnostics

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Gardner, S N; Lam, M; Mulakken, N J

    2004-01-26

    We built a system to guide decisions regarding the amount of genomic sequencing required to develop diagnostic DNA signatures, which are short sequences that are sufficient to uniquely identify a viral species. We used our existing DNA diagnostic signature prediction pipeline, which selects regions of a target species genome that are conserved among strains of the target (for reliability, to prevent false negatives) and unique relative to other species (for specificity, to avoid false positives). We performed simulations, based on existing sequence data, to assess the number of genome sequences of a target species and of close phylogenetic relatives (''nearmore » neighbors'') that are required to predict diagnostic signature regions that are conserved among strains of the target species and unique relative to other bacterial and viral species. For DNA viruses such as variola (smallpox), three target genomes provide sufficient guidance for selecting species-wide signatures. Three near neighbor genomes are critical for species specificity. In contrast, most RNA viruses require four target genomes and no near neighbor genomes, since lack of conservation among strains is more limiting than uniqueness. SARS and Ebola Zaire are exceptional, as additional target genomes currently do not improve predictions, but near neighbor sequences are urgently needed. Our results also indicate that double stranded DNA viruses are more conserved among strains than are RNA viruses, since in most cases there was at least one conserved signature candidate for the DNA viruses and zero conserved signature candidates for the RNA viruses.« less

  7. Chip-scale pattern modification method for equalizing residual layer thickness in nanoimprint lithography

    NASA Astrophysics Data System (ADS)

    Youn, Sung-Won; Suzuki, Kenta; Hiroshima, Hiroshi

    2018-06-01

    A software program for modifying a mold design to obtain a uniform residual layer thickness (RLT) distribution has been developed and its validity was verified by UV-nanoimprint lithography (UV-NIL) simulation. First, the effects of granularity (G) on both residual layer uniformity and filling characteristics were characterized. For a constant complementary pattern depth and a granularity that was sufficiently larger than the minimum pattern width, filling time decreased with the decrease in granularity. For a pattern design with a wide density range and an irregular distribution, the choice of a small granularity was not always a good strategy since the etching depth required for a complementary pattern occasionally exceptionally increased with the decrease in granularity. On basis of the results obtained, the automated method was applied to a chip-scale pattern modification. Simulation results showed a marked improvement in residual layer thickness uniformity for a capacity-equalized (CE) mold. For the given conditions, the standard deviation of RLT decreased in the range from 1/3 to 1/5 in accordance with pattern designs.

  8. Two Complementary Mechanisms Underpin Cell Wall Patterning during Xylem Vessel Development.

    PubMed

    Schneider, Rene; Tang, Lu; Lampugnani, Edwin R; Barkwill, Sarah; Lathe, Rahul; Zhang, Yi; McFarlane, Heather E; Pesquet, Edouard; Niittyla, Totte; Mansfield, Shawn D; Zhou, Yihua; Persson, Staffan

    2017-10-01

    The evolution of the plant vasculature was essential for the emergence of terrestrial life. Xylem vessels are solute-transporting elements in the vasculature that possess secondary wall thickenings deposited in intricate patterns. Evenly dispersed microtubule (MT) bands support the formation of these wall thickenings, but how the MTs direct cell wall synthesis during this process remains largely unknown. Cellulose is the major secondary wall constituent and is synthesized by plasma membrane-localized cellulose synthases (CesAs) whose catalytic activity propels them through the membrane. We show that the protein CELLULOSE SYNTHASE INTERACTING1 (CSI1)/POM2 is necessary to align the secondary wall CesAs and MTs during the initial phase of xylem vessel development in Arabidopsis thaliana and rice ( Oryza sativa ). Surprisingly, these MT-driven patterns successively become imprinted and sufficient to sustain the continued progression of wall thickening in the absence of MTs and CSI1/POM2 function. Hence, two complementary principles underpin wall patterning during xylem vessel development. © 2017 American Society of Plant Biologists. All rights reserved.

  9. Complementary activities of TPX2 and chTOG constitute an efficient importin-regulated microtubule nucleation module

    PubMed Central

    Roostalu, Johanna; Cade, Nicholas I.; Surrey, Thomas

    2016-01-01

    Spindle assembly and function require precise control of microtubule nucleation and dynamics. The chromatin-driven spindle assembly pathway exerts such control locally in the vicinity of chromosomes. One of the key targets of this pathway is TPX2. The molecular mechanism of how TPX2 stimulates microtubule nucleation is not understood. Using microscopy-based dynamic in vitro reconstitution assays with purified proteins, we find that human TPX2 directly stabilises growing microtubule ends and stimulates microtubule nucleation by stabilising early microtubule nucleation intermediates. Human microtubule polymerase chTOG (XMAP215/Msps/Stu2p/Dis1/Alp14 homolog) only weakly promotes nucleation, but acts synergistically with TPX2. Hence, a combination of distinct and complementary activities is sufficient for efficient microtubule formation in vitro. Importins control the efficiency of the microtubule nucleation by selectively blocking TPX2’s interaction with microtubule nucleation intermediates. This in vitro reconstitution reveals the molecular mechanism of regulated microtubule formation by a minimal nucleation module essential for chromatin-dependent microtubule nucleation in cells. PMID:26414402

  10. Complementary activities of TPX2 and chTOG constitute an efficient importin-regulated microtubule nucleation module.

    PubMed

    Roostalu, Johanna; Cade, Nicholas I; Surrey, Thomas

    2015-11-01

    Spindle assembly and function require precise control of microtubule nucleation and dynamics. The chromatin-driven spindle assembly pathway exerts such control locally in the vicinity of chromosomes. One of the key targets of this pathway is TPX2. The molecular mechanism of how TPX2 stimulates microtubule nucleation is not understood. Using microscopy-based dynamic in vitro reconstitution assays with purified proteins, we find that human TPX2 directly stabilizes growing microtubule ends and stimulates microtubule nucleation by stabilizing early microtubule nucleation intermediates. Human microtubule polymerase chTOG (XMAP215/Msps/Stu2p/Dis1/Alp14 homologue) only weakly promotes nucleation, but acts synergistically with TPX2. Hence, a combination of distinct and complementary activities is sufficient for efficient microtubule formation in vitro. Importins control the efficiency of the microtubule nucleation by selectively blocking the interaction of TPX2 with microtubule nucleation intermediates. This in vitro reconstitution reveals the molecular mechanism of regulated microtubule formation by a minimal nucleation module essential for chromatin-dependent microtubule nucleation in cells.

  11. Sequence of the chloroplast 16S rRNA gene and its surrounding regions of Chlamydomonas reinhardii.

    PubMed Central

    Dron, M; Rahire, M; Rochaix, J D

    1982-01-01

    The sequence of a 2 kb DNA fragment containing the chloroplast 16S ribosomal RNA gene from Chlamydomonas reinhardii and its flanking regions has been determined. The algal 16S rRNA sequence (1475 nucleotides) and secondary structure are highly related to those found in bacteria and in the chloroplasts of higher plants. In contrast, the flanking regions are very different. In C. reinhardii the 16S rRNA gene is surrounded by AT rich segments of about 180 bases, which are followed by a long stretch of complementary bases separated from each other by 1833 nucleotides. It is likely that these structures play an important role in the folding and processing of the precursor of 16S rRNA. The primary and secondary structures of the binding sites of two ribosomal proteins in the 16SrRNAs of E. coli and C. reinhardii are considerably related. Images PMID:6296784

  12. The dynamics of genome replication using deep sequencing

    PubMed Central

    Müller, Carolin A.; Hawkins, Michelle; Retkute, Renata; Malla, Sunir; Wilson, Ray; Blythe, Martin J.; Nakato, Ryuichiro; Komata, Makiko; Shirahige, Katsuhiko; de Moura, Alessandro P.S.; Nieduszynski, Conrad A.

    2014-01-01

    Eukaryotic genomes are replicated from multiple DNA replication origins. We present complementary deep sequencing approaches to measure origin location and activity in Saccharomyces cerevisiae. Measuring the increase in DNA copy number during a synchronous S-phase allowed the precise determination of genome replication. To map origin locations, replication forks were stalled close to their initiation sites; therefore, copy number enrichment was limited to origins. Replication timing profiles were generated from asynchronous cultures using fluorescence-activated cell sorting. Applying this technique we show that the replication profiles of haploid and diploid cells are indistinguishable, indicating that both cell types use the same cohort of origins with the same activities. Finally, increasing sequencing depth allowed the direct measure of replication dynamics from an exponentially growing culture. This is the first time this approach, called marker frequency analysis, has been successfully applied to a eukaryote. These data provide a high-resolution resource and methodological framework for studying genome biology. PMID:24089142

  13. Permanent Neonatal Diabetes Caused by Creation of an Ectopic Splice Site within the INS Gene

    PubMed Central

    Gastaldo, Elena; Harries, Lorna W.; Rubio-Cabezas, Oscar; Castaño, Luis

    2012-01-01

    Background The aim of this study was to characterize the genetic etiology in a patient who presented with permanent neonatal diabetes at 2 months of age. Methodology/Principal Findings Regulatory elements and coding exons 2 and 3 of the INS gene were amplified and sequenced from genomic and complementary DNA samples. A novel heterozygous INS mutation within the terminal intron of the gene was identified in the proband and her affected father. This mutation introduces an ectopic splice site leading to the insertion of 29 nucleotides from the intronic sequence into the mature mRNA, which results in a longer and abnormal transcript. Conclusions/Significance This study highlights the importance of routinely sequencing the exon-intron boundaries and the need to carry out additional studies to confirm the pathogenicity of any identified intronic genetic variants. PMID:22235272

  14. Research on Image Encryption Based on DNA Sequence and Chaos Theory

    NASA Astrophysics Data System (ADS)

    Tian Zhang, Tian; Yan, Shan Jun; Gu, Cheng Yan; Ren, Ran; Liao, Kai Xin

    2018-04-01

    Nowadays encryption is a common technique to protect image data from unauthorized access. In recent years, many scientists have proposed various encryption algorithms based on DNA sequence to provide a new idea for the design of image encryption algorithm. Therefore, a new method of image encryption based on DNA computing technology is proposed in this paper, whose original image is encrypted by DNA coding and 1-D logistic chaotic mapping. First, the algorithm uses two modules as the encryption key. The first module uses the real DNA sequence, and the second module is made by one-dimensional logistic chaos mapping. Secondly, the algorithm uses DNA complementary rules to encode original image, and uses the key and DNA computing technology to compute each pixel value of the original image, so as to realize the encryption of the whole image. Simulation results show that the algorithm has good encryption effect and security.

  15. Application of the Ramanujan Fourier Transform for the analysis of secondary structure content in amino acid sequences.

    PubMed

    Mainardi, L T; Pattini, L; Cerutti, S

    2007-01-01

    A novel method is presented for the investigation of protein properties of sequences using Ramanujan Fourier Transform (RFT). The new methodology involves the preprocessing of protein sequence data by numerically encoding it and then applying the RFT. The RFT is based on projecting the obtained numerical series on a set of basis functions constituted by Ramanujan sums (RS). In RS components, periodicities of finite integer length, rather than frequency, (as in classical harmonic analysis) are considered. The potential of the new approach is documented by a few examples in the analysis of hydrophobic profiles of proteins in two classes including abundance of alpha-helices (group A) or beta-strands (group B). Different patterns are provided as evidence. RFT can be used to characterize the structural properties of proteins and integrate complementary information provided by other signal processing transforms.

  16. A highly sensitive and accurate gene expression analysis by sequencing ("bead-seq") for a single cell.

    PubMed

    Matsunaga, Hiroko; Goto, Mari; Arikawa, Koji; Shirai, Masataka; Tsunoda, Hiroyuki; Huang, Huan; Kambara, Hideki

    2015-02-15

    Analyses of gene expressions in single cells are important for understanding detailed biological phenomena. Here, a highly sensitive and accurate method by sequencing (called "bead-seq") to obtain a whole gene expression profile for a single cell is proposed. A key feature of the method is to use a complementary DNA (cDNA) library on magnetic beads, which enables adding washing steps to remove residual reagents in a sample preparation process. By adding the washing steps, the next steps can be carried out under the optimal conditions without losing cDNAs. Error sources were carefully evaluated to conclude that the first several steps were the key steps. It is demonstrated that bead-seq is superior to the conventional methods for single-cell gene expression analyses in terms of reproducibility, quantitative accuracy, and biases caused during sample preparation and sequencing processes. Copyright © 2014 Elsevier Inc. All rights reserved.

  17. Prediction of Protein Structural Classes for Low-Similarity Sequences Based on Consensus Sequence and Segmented PSSM.

    PubMed

    Liang, Yunyun; Liu, Sanyang; Zhang, Shengli

    2015-01-01

    Prediction of protein structural classes for low-similarity sequences is useful for understanding fold patterns, regulation, functions, and interactions of proteins. It is well known that feature extraction is significant to prediction of protein structural class and it mainly uses protein primary sequence, predicted secondary structure sequence, and position-specific scoring matrix (PSSM). Currently, prediction solely based on the PSSM has played a key role in improving the prediction accuracy. In this paper, we propose a novel method called CSP-SegPseP-SegACP by fusing consensus sequence (CS), segmented PsePSSM, and segmented autocovariance transformation (ACT) based on PSSM. Three widely used low-similarity datasets (1189, 25PDB, and 640) are adopted in this paper. Then a 700-dimensional (700D) feature vector is constructed and the dimension is decreased to 224D by using principal component analysis (PCA). To verify the performance of our method, rigorous jackknife cross-validation tests are performed on 1189, 25PDB, and 640 datasets. Comparison of our results with the existing PSSM-based methods demonstrates that our method achieves the favorable and competitive performance. This will offer an important complementary to other PSSM-based methods for prediction of protein structural classes for low-similarity sequences.

  18. The role of replay and theta sequences in mediating hippocampal-prefrontal interactions for memory and cognition.

    PubMed

    Zielinski, Mark C; Tang, Wenbo; Jadhav, Shantanu P

    2017-12-18

    Sequential activity is seen in the hippocampus during multiple network patterns, prominently as replay activity during both awake and sleep sharp-wave ripples (SWRs), and as theta sequences during active exploration. Although various mnemonic and cognitive functions have been ascribed to these hippocampal sequences, evidence for these proposed functions remains primarily phenomenological. Here, we briefly review current knowledge about replay events and theta sequences in spatial memory tasks. We reason that in order to gain a mechanistic and causal understanding of how these patterns influence memory and cognitive processing, it is important to consider how these sequences influence activity in other regions, and in particular, the prefrontal cortex, which is crucial for memory-guided behavior. For spatial memory tasks, we posit that hippocampal-prefrontal interactions mediated by replay and theta sequences play complementary and overlapping roles at different stages in learning, supporting memory encoding and retrieval, deliberative decision making, planning, and guiding future actions. This framework offers testable predictions for future physiology and closed-loop feedback inactivation experiments for specifically targeting hippocampal sequences as well as coordinated prefrontal activity in different network states, with the potential to reveal their causal roles in memory-guided behavior. © 2017 Wiley Periodicals, Inc.

  19. Sensitive detection of mercury and copper ions by fluorescent DNA/Ag nanoclusters in guanine-rich DNA hybridization

    NASA Astrophysics Data System (ADS)

    Peng, Jun; Ling, Jian; Zhang, Xiu-Qing; Bai, Hui-Ping; Zheng, Liyan; Cao, Qiu-E.; Ding, Zhong-Tao

    2015-02-01

    In this work, we designed a new fluorescent oligonucleotides-stabilized silver nanoclusters (DNA/AgNCs) probe for sensitive detection of mercury and copper ions. This probe contains two tailored DNA sequence. One is a signal probe contains a cytosine-rich sequence template for AgNCs synthesis and link sequence at both ends. The other is a guanine-rich sequence for signal enhancement and link sequence complementary to the link sequence of the signal probe. After hybridization, the fluorescence of hybridized double-strand DNA/AgNCs is 200-fold enhanced based on the fluorescence enhancement effect of DNA/AgNCs in proximity of guanine-rich DNA sequence. The double-strand DNA/AgNCs probe is brighter and stable than that of single-strand DNA/AgNCs, and more importantly, can be used as novel fluorescent probes for detecting mercury and copper ions. Mercury and copper ions in the range of 6.0-160.0 and 6-240 nM, can be linearly detected with the detection limits of 2.1 and 3.4 nM, respectively. Our results indicated that the analytical parameters of the method for mercury and copper ions detection are much better than which using a single-strand DNA/AgNCs.

  20. Gene finding in metatranscriptomic sequences.

    PubMed

    Ismail, Wazim Mohammed; Ye, Yuzhen; Tang, Haixu

    2014-01-01

    Metatranscriptomic sequencing is a highly sensitive bioassay of functional activity in a microbial community, providing complementary information to the metagenomic sequencing of the community. The acquisition of the metatranscriptomic sequences will enable us to refine the annotations of the metagenomes, and to study the gene activities and their regulation in complex microbial communities and their dynamics. In this paper, we present TransGeneScan, a software tool for finding genes in assembled transcripts from metatranscriptomic sequences. By incorporating several features of metatranscriptomic sequencing, including strand-specificity, short intergenic regions, and putative antisense transcripts into a Hidden Markov Model, TranGeneScan can predict a sense transcript containing one or multiple genes (in an operon) or an antisense transcript. We tested TransGeneScan on a mock metatranscriptomic data set containing three known bacterial genomes. The results showed that TranGeneScan performs better than metagenomic gene finders (MetaGeneMark and FragGeneScan) on predicting protein coding genes in assembled transcripts, and achieves comparable or even higher accuracy than gene finders for microbial genomes (Glimmer and GeneMark). These results imply, with the assistance of metatranscriptomic sequencing, we can obtain a broad and precise picture about the genes (and their functions) in a microbial community. TransGeneScan is available as open-source software on SourceForge at https://sourceforge.net/projects/transgenescan/.

  1. Use of Ocean Remote Sensing Data to Enhance Predictions with a Coupled General Circulation Model

    NASA Technical Reports Server (NTRS)

    Rienecker, Michele M.

    1999-01-01

    Surface height, sea surface temperature and surface wind observations from satellites have given a detailed time sequence of the initiation and evolution of the 1997/98 El Nino. The data have beet complementary to the subsurface TAO moored data in their spatial resolution and extent. The impact of satellite observations on seasonal prediction in the tropical Pacific using a coupled ocean-atmosphere general circulation model will be presented.

  2. The Ties That Bind: Mapping the Dynamic Enhancer-Promoter Interactome.

    PubMed

    Spurrell, Cailyn H; Dickel, Diane E; Visel, Axel

    2016-11-17

    Coupling chromosome conformation capture to molecular enrichment for promoter-containing DNA fragments enables the systematic mapping of interactions between individual distal regulatory sequences and their target genes. In this Minireview, we describe recent progress in the application of this technique and related complementary approaches to gain insight into the lineage- and cell-type-specific dynamics of interactions between regulators and gene promoters. Copyright © 2016 Elsevier Inc. All rights reserved.

  3. CPTAC Releases Largest-Ever Ovarian Cancer Proteome Dataset from Previously Genome Characterized Tumors | Office of Cancer Clinical Proteomics Research

    Cancer.gov

    National Cancer Institute (NCI) Clinical Proteomic Tumor Analysis Consortium (CPTAC) scientists have just released a comprehensive dataset of the proteomic analysis of high grade serous ovarian tumor samples, previously genomically analyzed by The Cancer Genome Atlas (TCGA).  This is one of the largest public datasets covering the proteome, phosphoproteome and glycoproteome with complementary deep genomic sequencing data on the same tumor.

  4. Cytochrome P450 1C1 complementary DNA cloning, sequence analysis and constitutive expression induced by benzo-a-pyrene in Nile tilapia (Oreochromis niloticus).

    PubMed

    Hassanin, Abeer A I; Kaminishi, Yoshino; Funahashi, Aki; Itakura, Takao

    2012-03-01

    CYP1C is the newest member of the CYP1 family of P450s; however, its physiological significance, inducers, and metabolic functions are unknown. In this study, a new complementary DNA of the CYP1C subfamily encoding CYP1C1 was isolated from Nile tilapia (Oreochromis niloticus) liver after intracoelomic injection with benzo-a-pyrene (BaP). The full-length cDNA was 2223 base pair (bp) long and contained an open reading frame of 1581 bp encoding a protein of 526 amino acids and a stop codon. The sequence exhibited 3' non-coding region of 642 bp. The deduced amino acid sequence of O. niloticus CYP1C1 shows similarities of 86, 82.5, 79.7, 78.7, 77.8, 75.5, 69.6 and 61.3% with scup CYP1C1, killifish CYP1C1,1C2, Japanese eel CYP1C1, zebra fish CYP1C1, common carp CYP1C1, scup CYP1C2, common carp CYP1C2 and zebra fish CYP1C2, respectively. Phylogenetic tree based on the amino acids sequences clearly shows tilapia CYP1C1 and scup CYP1C1 to be more closely related to each other than to CYP1C genes from other species. Furthermore, for measuring BaP induction of CYP1C1 mRNA in different organs of tilapia (O. niloticus), β-actin gene as internal control was selected based on previous studies to assess their expression variability. Real time RCR results revealed that there was a large increase in CYP1C1 mRNA in liver (43.1), intestine (5.1) and muscle (2.4). Copyright © 2011 Elsevier B.V. All rights reserved.

  5. Quantum simulation of ultrafast dynamics using trapped ultracold atoms.

    PubMed

    Senaratne, Ruwan; Rajagopal, Shankari V; Shimasaki, Toshihiko; Dotti, Peter E; Fujiwara, Kurt M; Singh, Kevin; Geiger, Zachary A; Weld, David M

    2018-05-25

    Ultrafast electronic dynamics are typically studied using pulsed lasers. Here we demonstrate a complementary experimental approach: quantum simulation of ultrafast dynamics using trapped ultracold atoms. Counter-intuitively, this technique emulates some of the fastest processes in atomic physics with some of the slowest, leading to a temporal magnification factor of up to 12 orders of magnitude. In these experiments, time-varying forces on neutral atoms in the ground state of a tunable optical trap emulate the electric fields of a pulsed laser acting on bound charged particles. We demonstrate the correspondence with ultrafast science by a sequence of experiments: nonlinear spectroscopy of a many-body bound state, control of the excitation spectrum by potential shaping, observation of sub-cycle unbinding dynamics during strong few-cycle pulses, and direct measurement of carrier-envelope phase dependence of the response to an ultrafast-equivalent pulse. These results establish cold-atom quantum simulation as a complementary tool for studying ultrafast dynamics.

  6. Isolation of a complementary DNA clone for the human complement protein C2 and its use in the identification of a restriction fragment length polymorphism.

    PubMed Central

    Woods, D E; Edge, M D; Colten, H R

    1984-01-01

    Complementary DNA (cDNA) clones corresponding to the major histocompatibility (MHC) class III antigen, complement protein C2, have been isolated from human liver cDNA libraries with the use of a complex mixture of synthetic oligonucleotides (17 mer) that contains 576 different oligonucleotide sequences. The C2 cDNA were used to identify a DNA restriction enzyme fragment length polymorphism that provides a genetic marker within the MHC that was not detectable at the protein level. An extensive search for genomic polymorphisms using a cDNA clone for another MHC class III gene, factor B, failed to reveal any DNA variants. The genomic variants detected with the C2 cDNA probe provide an additional genetic marker for analysis of MHC-linked diseases. Images PMID:6086718

  7. Highly sensitive self-complementary DNA nanoswitches triggered by polyelectrolytes.

    PubMed

    Wu, Jincai; Yu, Feng; Zhang, Zheng; Chen, Yong; Du, Jie; Maruyama, Atsushi

    2016-01-07

    Dimerization of two homologous strands of genomic DNA/RNA is an essential feature of retroviral replication. Herein we show that a cationic comb-type copolymer (CCC), poly(L-lysine)-graft-dextran, accelerates the dimerization of self-complementary stem-loop DNA, frequently found in functional DNA/RNA molecules, such as aptamers. Furthermore, an anionic polymer poly(sodium vinylsulfonate) (PVS) dissociates CCC from the duplex shortly within a few seconds. Then single stem-loop DNA spontaneously transforms from its dimer. Thus we can easily control the dimer and stem-loop DNA by switching on/off CCC activity. Both polyelectrolytes and DNA concentrations are in the nanomole per liter range. The polyelectrolyte-assisted transconformation and sequences design strategy ensures the reversible state control with rapid response and effective switching under physiologically relevant conditions. A further application of this sensitive assembly is to construct an aptamer-type drug delivery system, bind or release functional molecules responding to its transconformation.

  8. Isolation, molecular cloning and in vitro expression of rhesus monkey (Macaca mulatta) prominin-1.s1 complementary DNA encoding a potential hematopoietic stem cell antigen.

    PubMed

    Husain, S M; Shou, Y; Sorrentino, B P; Handgretinger, R

    2006-10-01

    Human prominin-1 (CD133 or AC133) is an important cell surface marker used to isolate primitive hematopoietic stem cells. The commercially available antibody to human prominin-1 does not recognize rhesus prominin-1. Therefore, we isolated, cloned and characterized the complementary DNA (cDNA) of rhesus prominin-1 gene and determined its coding potential. Following the nomenclature of prominin family of genes, we named this cDNA as rhesus prominin-1.s1. The amino acid sequence data of the putative rhesus prominin-1.s1 could be used in designing antigenic peptides to raise antibodies for use in isolation of pure populations of rhesus prominin-1(+) hematopoietic cells. To the best of our knowledge, there has been no previously published report about the isolation of a prominin-1 cDNA from rhesus monkey (Macaca mulatta).

  9. Roles for Msx and Dlx homeoproteins in vertebrate development.

    PubMed

    Bendall, A J; Abate-Shen, C

    2000-04-18

    This review provides a comparative analysis of the expression patterns, functions, and biochemical properties of Msx and Dlx homeobox genes. These comprise multi-gene families that are closely related with respect to sequence features as well as expression patterns during vertebrate development. Thus, members of the Msx and Dlx families are expressed in overlapping, but distinct, patterns and display complementary or antagonistic functions, depending upon the context. A common theme shared among Msx and Dlx genes is that they are required during early, middle, and late phases of development where their differential expression mediates patterning, morphogenesis, and histogenesis of tissues in which they are expressed. With respect to their biochemical properties, Msx proteins function as transcriptional repressors, while Dlx proteins are transcriptional activators. Moreover, their ability to oppose each other's transcriptional actions implies a mechanism underlying their complementary or antagonistic functions during development.

  10. Rational design of micro-RNA-like bifunctional siRNAs targeting HIV and the HIV coreceptor CCR5.

    PubMed

    Ehsani, Ali; Saetrom, Pål; Zhang, Jane; Alluin, Jessica; Li, Haitang; Snøve, Ola; Aagaard, Lars; Rossi, John J

    2010-04-01

    Small-interfering RNAs (siRNAs) and micro-RNAs (miRNAs) are distinguished by their modes of action. SiRNAs serve as guides for sequence-specific cleavage of complementary mRNAs and the targets can be in coding or noncoding regions of the target transcripts. MiRNAs inhibit translation via partially complementary base-pairing to 3' untranslated regions (UTRs) and are generally ineffective when targeting coding regions of a transcript. In this study, we deliberately designed siRNAs that simultaneously direct cleavage and translational suppression of HIV RNAs, or cleavage of the mRNA encoding the HIV coreceptor CCR5 and suppression of translation of HIV. These bifunctional siRNAs trigger inhibition of HIV infection and replication in cell culture. The design principles have wide applications throughout the genome, as about 90% of genes harbor sites that make the design of bifunctional siRNAs possible.

  11. Properties of an unusual DNA primase from an archaeal plasmid

    PubMed Central

    Beck, Kirsten; Lipps, Georg

    2007-01-01

    Primases are specialized DNA-dependent RNA polymerases that synthesize a short oligoribonucleotide complementary to single-stranded template DNA. In the context of cellular DNA replication, primases are indispensable since DNA polymerases are not able to start DNA polymerization de novo. The primase activity of the replication protein from the archaeal plasmid pRN1 synthesizes a rather unusual mixed primer consisting of a single ribonucleotide at the 5′ end followed by seven deoxynucleotides. Ribonucleotides and deoxynucleotides are strictly required at the respective positions within the primer. Furthermore, in contrast to other archaeo-eukaryotic primases, the primase activity is highly sequence-specific and requires the trinucleotide motif GTG in the template. Primer synthesis starts outside of the recognition motif, immediately 5′ to the recognition motif. The fidelity of the primase synthesis is high, as non-complementary bases are not incorporated into the primer. PMID:17709343

  12. Rapid Multistep Synthesis of 1,2,4-Oxadiazoles in a Single Continuous Microreactor Sequence

    PubMed Central

    Grant, Daniel; Dahl, Russell; Cosford, Nicholas D. P.

    2009-01-01

    A general method for the synthesis of bis-substituted 1,2,4-oxadiazoles from readily available arylnitriles and activated carbonyls in a single continuous microreactor sequence is described. The synthesis incorporates three sequential microreactors to produce 1,2,4-oxadiazoles in ~30 min in quantities (40–80 mg) sufficient for full characterization and rapid library supply. PMID:18687005

  13. Draft genome sequence of Thauera sp. strain SWB20, isolated from a Singapore wastewater treatment facility using gel microdroplets

    DOE PAGES

    Dichosa, Armand E. K.; Davenport, Karen W.; Li, Po-E; ...

    2015-03-19

    In this study, we report here the genome sequence of Thauera sp. strain SWB20, isolated from a Singaporean wastewater treatment facility using gel microdroplets (GMDs) and single-cell genomics (SCG). This approach provided a single clonal microcolony that was sufficient to obtain a 4.9-Mbp genome assembly of an ecologically relevant Thauera species.

  14. Sense-antisense (complementary) peptide interactions and the proteomic code; potential opportunities in biology and pharmaceutical science.

    PubMed

    Miller, Andrew D

    2015-02-01

    A sense peptide can be defined as a peptide whose sequence is coded by the nucleotide sequence (read 5' → 3') of the sense (positive) strand of DNA. Conversely, an antisense (complementary) peptide is coded by the corresponding nucleotide sequence (read 5' → 3') of the antisense (negative) strand of DNA. Research has been accumulating steadily to suggest that sense peptides are capable of specific interactions with their corresponding antisense peptides. Unfortunately, although more and more examples of specific sense-antisense peptide interactions are emerging, the very idea of such interactions does not conform to standard biology dogma and so there remains a sizeable challenge to lift this concept from being perceived as a peripheral phenomenon if not worse, into becoming part of the scientific mainstream. Specific interactions have now been exploited for the inhibition of number of widely different protein-protein and protein-receptor interactions in vitro and in vivo. Further, antisense peptides have also been used to induce the production of antibodies targeted to specific receptors or else the production of anti-idiotypic antibodies targeted against auto-antibodies. Such illustrations of utility would seem to suggest that observed sense-antisense peptide interactions are not just the consequence of a sequence of coincidental 'lucky-hits'. Indeed, at the very least, one might conclude that sense-antisense peptide interactions represent a potentially new and different source of leads for drug discovery. But could there be more to come from studies in this area? Studies on the potential mechanism of sense-antisense peptide interactions suggest that interactions may be driven by amino acid residue interactions specified from the genetic code. If so, such specified amino acid residue interactions could form the basis for an even wider amino acid residue interaction code (proteomic code) that links gene sequences to actual protein structure and function, even entire genomes to entire proteomes. The possibility that such a proteomic code should exist is discussed. So too the potential implications for biology and pharmaceutical science are also discussed were such a code to exist.

  15. Protein 3D Structure Computed from Evolutionary Sequence Variation

    PubMed Central

    Sheridan, Robert; Hopf, Thomas A.; Pagnani, Andrea; Zecchina, Riccardo; Sander, Chris

    2011-01-01

    The evolutionary trajectory of a protein through sequence space is constrained by its function. Collections of sequence homologs record the outcomes of millions of evolutionary experiments in which the protein evolves according to these constraints. Deciphering the evolutionary record held in these sequences and exploiting it for predictive and engineering purposes presents a formidable challenge. The potential benefit of solving this challenge is amplified by the advent of inexpensive high-throughput genomic sequencing. In this paper we ask whether we can infer evolutionary constraints from a set of sequence homologs of a protein. The challenge is to distinguish true co-evolution couplings from the noisy set of observed correlations. We address this challenge using a maximum entropy model of the protein sequence, constrained by the statistics of the multiple sequence alignment, to infer residue pair couplings. Surprisingly, we find that the strength of these inferred couplings is an excellent predictor of residue-residue proximity in folded structures. Indeed, the top-scoring residue couplings are sufficiently accurate and well-distributed to define the 3D protein fold with remarkable accuracy. We quantify this observation by computing, from sequence alone, all-atom 3D structures of fifteen test proteins from different fold classes, ranging in size from 50 to 260 residues., including a G-protein coupled receptor. These blinded inferences are de novo, i.e., they do not use homology modeling or sequence-similar fragments from known structures. The co-evolution signals provide sufficient information to determine accurate 3D protein structure to 2.7–4.8 Å Cα-RMSD error relative to the observed structure, over at least two-thirds of the protein (method called EVfold, details at http://EVfold.org). This discovery provides insight into essential interactions constraining protein evolution and will facilitate a comprehensive survey of the universe of protein structures, new strategies in protein and drug design, and the identification of functional genetic variants in normal and disease genomes. PMID:22163331

  16. Evidence-Based Review of BioBran/MGN-3 Arabinoxylan Compound as a Complementary Therapy for Conventional Cancer Treatment.

    PubMed

    Ooi, Soo Liang; McMullen, Debbie; Golombick, Terry; Nut, Dipl; Pak, Sok Cheon

    2018-06-01

    Conventional cancer treatment, including surgery, chemotherapy, and radiotherapy, may not be sufficient to eradicate all malignant cells and prevent recurrence. Intensive treatment often leads to a depressed immune system, drug resistance, and toxicity, hampering the treatment outcomes. BioBran/MGN-3 Arabinoxylan is a standardized arabinoxylan concentrate which has been proposed as a plant-based immunomodulator that can restore the tumor-induced disturbance of the natural immune system, including natural killer cell activity to fight cancer, complementing conventional therapies. To comprehensively review the available evidence on the effects and efficacies of MGN-3 as a complementary therapy for conventional cancer treatment. Systematic search of journal databases and gray literature for primary studies reporting the effects of MGN-3 on cancer and cancer treatment. Thirty full-text articles and 2 conference abstracts were included in this review. MGN-3 has been shown to possess immunomodulating anticancer effects and can work synergistically with chemotherapeutic agents, in vitro. In murine models, MGN-3 has been shown to act against carcinogenic agents, and inhibit tumor growth, either by itself or in combination with other anticancer compounds. Fourteen successful MGN-3 treated clinical cases were found. Eleven clinical studies, including 5 nonrandomized, pre-post intervention studies and 6 randomized controlled trials (RCTs) were located. Reported effects include enhanced immunoprofile, reduced side effects, improved treatment outcomes; one RCT established significantly increased survival rates. There are no reports on adverse events on MGN-3. Most of the clinical trials are small studies with short duration. There is sufficient evidence suggesting MGN-3 to be an effective immunomodulator that can complement conventional cancer treatment. However, more well-designed RCTs on MGN-3 are needed to strengthen the evidence base.

  17. Mosaic organization of DNA nucleotides

    NASA Technical Reports Server (NTRS)

    Peng, C. K.; Buldyrev, S. V.; Havlin, S.; Simons, M.; Stanley, H. E.; Goldberger, A. L.

    1994-01-01

    Long-range power-law correlations have been reported recently for DNA sequences containing noncoding regions. We address the question of whether such correlations may be a trivial consequence of the known mosaic structure ("patchiness") of DNA. We analyze two classes of controls consisting of patchy nucleotide sequences generated by different algorithms--one without and one with long-range power-law correlations. Although both types of sequences are highly heterogenous, they are quantitatively distinguishable by an alternative fluctuation analysis method that differentiates local patchiness from long-range correlations. Application of this analysis to selected DNA sequences demonstrates that patchiness is not sufficient to account for long-range correlation properties.

  18. Recombination of polynucleotide sequences using random or defined primers

    DOEpatents

    Arnold, Frances H.; Shao, Zhixin; Affholter, Joseph A.; Zhao, Huimin H; Giver, Lorraine J.

    2000-01-01

    A method for in vitro mutagenesis and recombination of polynucleotide sequences based on polymerase-catalyzed extension of primer oligonucleotides is disclosed. The method involves priming template polynucleotide(s) with random-sequences or defined-sequence primers to generate a pool of short DNA fragments with a low level of point mutations. The DNA fragments are subjected to denaturization followed by annealing and further enzyme-catalyzed DNA polymerization. This procedure is repeated a sufficient number of times to produce full-length genes which comprise mutants of the original template polynucleotides. These genes can be further amplified by the polymerase chain reaction and cloned into a vector for expression of the encoded proteins.

  19. Recombination of polynucleotide sequences using random or defined primers

    DOEpatents

    Arnold, Frances H.; Shao, Zhixin; Affholter, Joseph A.; Zhao, Huimin; Giver, Lorraine J.

    2001-01-01

    A method for in vitro mutagenesis and recombination of polynucleotide sequences based on polymerase-catalyzed extension of primer oligonucleotides is disclosed. The method involves priming template polynucleotide(s) with random-sequences or defined-sequence primers to generate a pool of short DNA fragments with a low level of point mutations. The DNA fragments are subjected to denaturization followed by annealing and further enzyme-catalyzed DNA polymerization. This procedure is repeated a sufficient number of times to produce full-length genes which comprise mutants of the original template polynucleotides. These genes can be further amplified by the polymerase chain reaction and cloned into a vector for expression of the encoded proteins.

  20. BiQ Analyzer HT: locus-specific analysis of DNA methylation by high-throughput bisulfite sequencing

    PubMed Central

    Lutsik, Pavlo; Feuerbach, Lars; Arand, Julia; Lengauer, Thomas; Walter, Jörn; Bock, Christoph

    2011-01-01

    Bisulfite sequencing is a widely used method for measuring DNA methylation in eukaryotic genomes. The assay provides single-base pair resolution and, given sufficient sequencing depth, its quantitative accuracy is excellent. High-throughput sequencing of bisulfite-converted DNA can be applied either genome wide or targeted to a defined set of genomic loci (e.g. using locus-specific PCR primers or DNA capture probes). Here, we describe BiQ Analyzer HT (http://biq-analyzer-ht.bioinf.mpi-inf.mpg.de/), a user-friendly software tool that supports locus-specific analysis and visualization of high-throughput bisulfite sequencing data. The software facilitates the shift from time-consuming clonal bisulfite sequencing to the more quantitative and cost-efficient use of high-throughput sequencing for studying locus-specific DNA methylation patterns. In addition, it is useful for locus-specific visualization of genome-wide bisulfite sequencing data. PMID:21565797

  1. Gene and translation initiation site prediction in metagenomic sequences

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hyatt, Philip Douglas; LoCascio, Philip F; Hauser, Loren John

    2012-01-01

    Gene prediction in metagenomic sequences remains a difficult problem. Current sequencing technologies do not achieve sufficient coverage to assemble the individual genomes in a typical sample; consequently, sequencing runs produce a large number of short sequences whose exact origin is unknown. Since these sequences are usually smaller than the average length of a gene, algorithms must make predictions based on very little data. We present MetaProdigal, a metagenomic version of the gene prediction program Prodigal, that can identify genes in short, anonymous coding sequences with a high degree of accuracy. The novel value of the method consists of enhanced translationmore » initiation site identification, ability to identify sequences that use alternate genetic codes and confidence values for each gene call. We compare the results of MetaProdigal with other methods and conclude with a discussion of future improvements.« less

  2. Exploration of the relationship between topology and designability of conformations

    NASA Astrophysics Data System (ADS)

    Leelananda, Sumudu P.; Towfic, Fadi; Jernigan, Robert L.; Kloczkowski, Andrzej

    2011-06-01

    Protein structures are evolutionarily more conserved than sequences, and sequences with very low sequence identity frequently share the same fold. This leads to the concept of protein designability. Some folds are more designable and lots of sequences can assume that fold. Elucidating the relationship between protein sequence and the three-dimensional (3D) structure that the sequence folds into is an important problem in computational structural biology. Lattice models have been utilized in numerous studies to model protein folds and predict the designability of certain folds. In this study, all possible compact conformations within a set of two-dimensional and 3D lattice spaces are explored. Complementary interaction graphs are then generated for each conformation and are described using a set of graph features. The full HP sequence space for each lattice model is generated and contact energies are calculated by threading each sequence onto all the possible conformations. Unique conformation giving minimum energy is identified for each sequence and the number of sequences folding to each conformation (designability) is obtained. Machine learning algorithms are used to predict the designability of each conformation. We find that the highly designable structures can be distinguished from other non-designable conformations based on certain graphical geometric features of the interactions. This finding confirms the fact that the topology of a conformation is an important determinant of the extent of its designability and suggests that the interactions themselves are important for determining the designability.

  3. Complementary DNA sequencing and identification of mRNAs from the venomous gland of Agkistrodon piscivorus leucostoma.

    PubMed

    Jia, Ying; Cantu, Bruno A; Sánchez, Elda E; Pérez, John C

    2008-06-15

    To advance our knowledge on the snake venom composition and transcripts expressed in venom gland at the molecular level, we constructed a cDNA library from the venom gland of Agkistrodon piscivorus leucostoma for the generation of expressed sequence tags (ESTs) database. From the randomly sequenced 2112 independent clones, we have obtained ESTs for 1309 (62%) cDNAs, which showed significant deduced amino acid sequence similarity (scores >80) to previously characterized proteins in National Center for Biotechnology Information (NCBI) database. Ribosomal proteins make up 47 clones (2%) and the remaining 756 (36%) cDNAs represent either unknown identity or show BLASTX sequence identity scores of <80 with known GenBank accessions. The most highly expressed gene encoding phospholipase A(2) (PLA(2)) accounting for 35% of A. p. leucostoma venom gland cDNAs was identified and further confirmed by crude venom applied to sodium dodecyl sulfate/polyacrylamide gel electrophoresis (SDS-PAGE) electrophoresis and protein sequencing. A total of 180 representative genes were obtained from the sequence assemblies and deposited to EST database. Clones showing sequence identity to disintegrins, thrombin-like enzymes, hemorrhagic toxins, fibrinogen clotting inhibitors and plasminogen activators were also identified in our EST database. These data can be used to develop a research program that will help us identify genes encoding proteins that are of medical importance or proteins involved in the mechanisms of the toxin venom.

  4. Short-term memory stores organized by information domain.

    PubMed

    Noyce, Abigail L; Cestero, Nishmar; Shinn-Cunningham, Barbara G; Somers, David C

    2016-04-01

    Vision and audition have complementary affinities, with vision excelling in spatial resolution and audition excelling in temporal resolution. Here, we investigated the relationships among the visual and auditory modalities and spatial and temporal short-term memory (STM) using change detection tasks. We created short sequences of visual or auditory items, such that each item within a sequence arose at a unique spatial location at a unique time. On each trial, two successive sequences were presented; subjects attended to either space (the sequence of locations) or time (the sequence of inter item intervals) and reported whether the patterns of locations or intervals were identical. Each subject completed blocks of unimodal trials (both sequences presented in the same modality) and crossmodal trials (Sequence 1 visual, Sequence 2 auditory, or vice versa) for both spatial and temporal tasks. We found a strong interaction between modality and task: Spatial performance was best on unimodal visual trials, whereas temporal performance was best on unimodal auditory trials. The order of modalities on crossmodal trials also mattered, suggesting that perceptual fidelity at encoding is critical to STM. Critically, no cost was attributable to crossmodal comparison: In both tasks, performance on crossmodal trials was as good as or better than on the weaker unimodal trials. STM representations of space and time can guide change detection in either the visual or the auditory modality, suggesting that the temporal or spatial organization of STM may supersede sensory-specific organization.

  5. Infant Gut Microbiota Development Is Driven by Transition to Family Foods Independent of Maternal Obesity.

    PubMed

    Laursen, Martin Frederik; Andersen, Louise B B; Michaelsen, Kim F; Mølgaard, Christian; Trolle, Ellen; Bahl, Martin Iain; Licht, Tine Rask

    2016-01-01

    The first years of life are paramount in establishing our endogenous gut microbiota, which is strongly affected by diet and has repeatedly been linked with obesity. However, very few studies have addressed the influence of maternal obesity on infant gut microbiota, which may occur either through vertically transmitted microbes or through the dietary habits of the family. Additionally, very little is known about the effect of diet during the complementary feeding period, which is potentially important for gut microbiota development. Here, the gut microbiotas of two different cohorts of infants, born either of a random sample of healthy mothers (n = 114), or of obese mothers (n = 113), were profiled by 16S rRNA amplicon sequencing. Gut microbiota data were compared to breastfeeding patterns and detailed individual dietary recordings to assess effects of the complementary diet. We found that maternal obesity did not influence microbial diversity or specific taxon abundances during the complementary feeding period. Across cohorts, breastfeeding duration and composition of the complementary diet were found to be the major determinants of gut microbiota development. In both cohorts, gut microbial composition and alpha diversity were thus strongly affected by introduction of family foods with high protein and fiber contents. Specifically, intake of meats, cheeses, and Danish rye bread, rich in protein and fiber, were associated with increased alpha diversity. Our results reveal that the transition from early infant feeding to family foods is a major determinant for gut microbiota development. IMPORTANCE The potential influence of maternal obesity on infant gut microbiota may occur either through vertically transmitted microbes or through the dietary habits of the family. Recent studies have suggested that the heritability of obesity may partly be caused by the transmission of "obesogenic" gut microbes. However, the findings presented here suggest that maternal obesity per se does not affect the overall composition of the gut microbiota and its development after introduction of complementary foods. Rather, progression in complementary feeding is found to be the major determinant for gut microbiota establishment. Expanding our understanding of the influence of complementary diet on the development and establishment of the gut microbiota will provide us with the knowledge to tailor a beneficial progression of our intestinal microbial community.

  6. Infant Gut Microbiota Development Is Driven by Transition to Family Foods Independent of Maternal Obesity

    PubMed Central

    Laursen, Martin Frederik; Andersen, Louise B. B.; Michaelsen, Kim F.; Mølgaard, Christian; Trolle, Ellen; Bahl, Martin Iain

    2016-01-01

    ABSTRACT The first years of life are paramount in establishing our endogenous gut microbiota, which is strongly affected by diet and has repeatedly been linked with obesity. However, very few studies have addressed the influence of maternal obesity on infant gut microbiota, which may occur either through vertically transmitted microbes or through the dietary habits of the family. Additionally, very little is known about the effect of diet during the complementary feeding period, which is potentially important for gut microbiota development. Here, the gut microbiotas of two different cohorts of infants, born either of a random sample of healthy mothers (n = 114), or of obese mothers (n = 113), were profiled by 16S rRNA amplicon sequencing. Gut microbiota data were compared to breastfeeding patterns and detailed individual dietary recordings to assess effects of the complementary diet. We found that maternal obesity did not influence microbial diversity or specific taxon abundances during the complementary feeding period. Across cohorts, breastfeeding duration and composition of the complementary diet were found to be the major determinants of gut microbiota development. In both cohorts, gut microbial composition and alpha diversity were thus strongly affected by introduction of family foods with high protein and fiber contents. Specifically, intake of meats, cheeses, and Danish rye bread, rich in protein and fiber, were associated with increased alpha diversity. Our results reveal that the transition from early infant feeding to family foods is a major determinant for gut microbiota development. IMPORTANCE The potential influence of maternal obesity on infant gut microbiota may occur either through vertically transmitted microbes or through the dietary habits of the family. Recent studies have suggested that the heritability of obesity may partly be caused by the transmission of “obesogenic” gut microbes. However, the findings presented here suggest that maternal obesity per se does not affect the overall composition of the gut microbiota and its development after introduction of complementary foods. Rather, progression in complementary feeding is found to be the major determinant for gut microbiota establishment. Expanding our understanding of the influence of complementary diet on the development and establishment of the gut microbiota will provide us with the knowledge to tailor a beneficial progression of our intestinal microbial community. PMID:27303699

  7. Investigation of Sequence Clipping and Structural Heterogeneity of an HIV Broadly Neutralizing Antibody by a Comprehensive LC-MS Analysis

    NASA Astrophysics Data System (ADS)

    Ivleva, Vera B.; Schneck, Nicole A.; Gollapudi, Deepika; Arnold, Frank; Cooper, Jonathan W.; Lei, Q. Paula

    2018-05-01

    CAP256 is one of the highly potent, broadly neutralizing monoclonal antibodies (bNAb) designed for HIV-1 therapy. During the process development of one of the constructs, an unexpected product-related impurity was observed via microfluidics gel electrophoresis. A panel of complementary LC-MS analyses was applied for the comprehensive characterization of CAP256 which included the analysis of the intact and reduced protein, the middle-up approach, and a set of complementary peptide mapping techniques and verification of the disulfide bonds. The designed workflow allowed to identify a clip within a protruding acidic loop in the CDR-H3 region of the heavy chain, which can lead to the decrease of bNAb potency. This characterization explained the origin of the additional species reflected by the reducing gel profile. An intra-loop disulfide bond linking the two fragments was identified, which explained why the non-reducing capillary electrophoresis (CE) profile was not affected. The extensive characterization of CAP256 post-translational modifications was performed to investigate a possible cause of CE profile complexity and to illustrate other structural details related to this molecule's biological function. Two sites of the engineered Tyr sulfation were verified in the antigen-binding loop, and pyroglutamate formation was used as a tool for monitoring the extent of antibody clipping. Overall, the comprehensive LC-MS study was crucial to (1) identify the impurity as sequence clipping, (2) pinpoint the clipping location and justify its susceptibility relative to the molecular structure, (3) lead to an upstream process optimization to mitigate product quality risk, and (4) ultimately re-engineer the sequence to be clip-resistant. [Figure not available: see fulltext.

  8. Search and Discovery Strategies for Biotechnology: the Paradigm Shift

    PubMed Central

    Bull, Alan T.; Ward, Alan C.; Goodfellow, Michael

    2000-01-01

    Profound changes are occurring in the strategies that biotechnology-based industries are deploying in the search for exploitable biology and to discover new products and develop new or improved processes. The advances that have been made in the past decade in areas such as combinatorial chemistry, combinatorial biosynthesis, metabolic pathway engineering, gene shuffling, and directed evolution of proteins have caused some companies to consider withdrawing from natural product screening. In this review we examine the paradigm shift from traditional biology to bioinformatics that is revolutionizing exploitable biology. We conclude that the reinvigorated means of detecting novel organisms, novel chemical structures, and novel biocatalytic activities will ensure that natural products will continue to be a primary resource for biotechnology. The paradigm shift has been driven by a convergence of complementary technologies, exemplified by DNA sequencing and amplification, genome sequencing and annotation, proteome analysis, and phenotypic inventorying, resulting in the establishment of huge databases that can be mined in order to generate useful knowledge such as the identity and characterization of organisms and the identity of biotechnology targets. Concurrently there have been major advances in understanding the extent of microbial diversity, how uncultured organisms might be grown, and how expression of the metabolic potential of microorganisms can be maximized. The integration of information from complementary databases presents a significant challenge. Such integration should facilitate answers to complex questions involving sequence, biochemical, physiological, taxonomic, and ecological information of the sort posed in exploitable biology. The paradigm shift which we discuss is not absolute in the sense that it will replace established microbiology; rather, it reinforces our view that innovative microbiology is essential for releasing the potential of microbial diversity for biotechnology penetration throughout industry. Various of these issues are considered with reference to deep-sea microbiology and biotechnology. PMID:10974127

  9. Submolecular Structure and Orientation of Oligonucleotide Duplexes Tethered to Gold Electrodes Probed by Infrared Reflection Absorption Spectroscopy: Effect of the Electrode Potentials.

    PubMed

    Kékedy-Nagy, László; Ferapontova, Elena E; Brand, Izabella

    2017-02-23

    Unique electronic and ligand recognition properties of the DNA double helix provide basis for DNA applications in biomolecular electronic and biosensor devices. However, the relation between the structure of DNA at electrified interfaces and its electronic properties is still not well understood. Here, potential-driven changes in the submolecular structure of DNA double helices composed of either adenine-thymine (dAdT) 25 or cytosine-guanine (dGdC) 20 base pairs tethered to the gold electrodes are for the first time analyzed by in situ polarization modulation infrared reflection absorption spectroscopy (PM IRRAS) performed under the electrochemical control. It is shown that the conformation of the DNA duplexes tethered to gold electrodes via the C 6 alkanethiol linker strongly depends on the nucleic acid sequence composition. The tilt of purine and pyrimidine rings of the complementary base pairs (dAdT and dGdC) depends on the potential applied to the electrode. By contrast, neither the conformation nor orientation of the ionic in character phosphate-sugar backbone is affected by the electrode potentials. At potentials more positive than the potential of zero charge (pzc), a gradual tilting of the double helix is observed. In this tilted orientation, the planes of the complementary purine and pyrimidine rings lie ideally parallel to each other. These potentials do not affect the integral stability of the DNA double helix at the charged interface. At potentials more negative than the pzc, DNA helices adopt a vertical to the gold surface orientation. Tilt of the purine and pyrimidine rings depends on the composition of the double helix. In monolayers composed of (dAdT) 25 molecules the rings of the complementary base pairs lie parallel to each other. By contrast, the tilt of purine and pyrimidine rings in (dGdC) 20 helices depends on the potential applied to the electrode. Such potential-induced mobility of the complementary base pairs can destabilize the helix structure at a submolecular level. These pioneer results on the potential-driven changes in the submolecular structure of double stranded DNA adsorbed on conductive supports contribute to further understanding of the potential-driven sequence-specific electronic properties of surface-tethered oligonucleotides.

  10. Inhibition of Escherichia coli viability by external guide sequences complementary to two essential genes

    PubMed Central

    McKinney, Jeffrey; Guerrier-Takada, Cecilia; Wesolowski, Donna; Altman, Sidney

    2001-01-01

    Narrow spectrum antimicrobial activity has been designed to reduce the expression of two essential genes, one coding for the protein subunit of RNase P (C5 protein) and one for gyrase (gyrase A). In both cases, external guide sequences (EGS) have been designed to complex with either mRNA. Using the EGS technology, the level of microbial viability is reduced to less than 10% of the wild-type strain. The EGSs are additive when used together and depend on the number of nucleotides paired when attacking gyrase A mRNA. In the case of gyrase A, three nucleotides unpaired out of a 15-mer EGS still favor complete inhibition by the EGS but five unpaired nucleotides do not. PMID:11381134

  11. A Simulation Testbed for Airborne Merging and Spacing

    NASA Technical Reports Server (NTRS)

    Santos, Michel; Manikonda, Vikram; Feinberg, Art; Lohr, Gary

    2008-01-01

    The key innovation in this effort is the development of a simulation testbed for airborne merging and spacing (AM&S). We focus on concepts related to airports with Super Dense Operations where new airport runway configurations (e.g. parallel runways), sequencing, merging, and spacing are some of the concepts considered. We focus on modeling and simulating a complementary airborne and ground system for AM&S to increase efficiency and capacity of these high density terminal areas. From a ground systems perspective, a scheduling decision support tool generates arrival sequences and spacing requirements that are fed to the AM&S system operating on the flight deck. We enhanced NASA's Airspace Concept Evaluation Systems (ACES) software to model and simulate AM&S concepts and algorithms.

  12. Preparation of Small RNAs Using Rolling Circle Transcription and Site-Specific RNA Disconnection.

    PubMed

    Wang, Xingyu; Li, Can; Gao, Xiaomeng; Wang, Jing; Liang, Xingguo

    2015-01-13

    A facile and robust RNA preparation protocol was developed by combining rolling circle transcription (RCT) with RNA cleavage by RNase H. Circular DNA with a complementary sequence was used as the template for promoter-free transcription. With the aid of a 2'-O-methylated DNA, the RCT-generated tandem repeats of the desired RNA sequence were disconnected at the exact end-to-end position to harvest the desired RNA oligomers. Compared with the template DNA, more than 4 × 10(3) times the amount of small RNA products were obtained when modest cleavage was carried out during transcription. Large amounts of RNA oligomers could easily be obtained by simply increasing the reaction volume.

  13. Making sense of deep sequencing

    PubMed Central

    Goldman, D.; Domschke, K.

    2016-01-01

    This review, the first of an occasional series, tries to make sense of the concepts and uses of deep sequencing of polynucleic acids (DNA and RNA). Deep sequencing, synonymous with next-generation sequencing, high-throughput sequencing and massively parallel sequencing, includes whole genome sequencing but is more often and diversely applied to specific parts of the genome captured in different ways, for example the highly expressed portion of the genome known as the exome and portions of the genome that are epigenetically marked either by DNA methylation, the binding of proteins including histones, or that are in different configurations and thus more or less accessible to enzymes that cleave DNA. Deep sequencing of RNA (RNASeq) reverse-transcribed to complementary DNA is invaluable for measuring RNA expression and detecting changes in RNA structure. Important concepts in deep sequencing include the length and depth of sequence reads, mapping and assembly of reads, sequencing error, haplotypes, and the propensity of deep sequencing, as with other types of ‘big data’, to generate large numbers of errors, requiring monitoring for methodologic biases and strategies for replication and validation. Deep sequencing yields a unique genetic fingerprint that can be used to identify a person, and a trove of predictors of genetic medical diseases. Deep sequencing to identify epigenetic events including changes in DNA methylation and RNA expression can reveal the history and impact of environmental exposures. Because of the power of sequencing to identify and deliver biomedically significant information about a person and their blood relatives, it creates ethical dilemmas and practical challenges in research and clinical care, for example the decision and procedures to report incidental findings that will increasingly and frequently be discovered. PMID:24925306

  14. Reproducibility and Consistency of In Vitro Nucleosome Reconstitutions Demonstrated by Invitrosome Isolation and Sequencing

    PubMed Central

    Kempton, Colton E.; Heninger, Justin R.; Johnson, Steven M.

    2014-01-01

    Nucleosomes and their positions in the eukaryotic genome play an important role in regulating gene expression by influencing accessibility to DNA. Many factors influence a nucleosome's final position in the chromatin landscape including the underlying genomic sequence. One of the primary reasons for performing in vitro nucleosome reconstitution experiments is to identify how the underlying DNA sequence will influence a nucleosome's position in the absence of other compounding cellular factors. However, concerns have been raised about the reproducibility of data generated from these kinds of experiments. Here we present data for in vitro nucleosome reconstitution experiments performed on linear plasmid DNA that demonstrate that, when coverage is deep enough, these reconstitution experiments are exquisitely reproducible and highly consistent. Our data also suggests that a coverage depth of 35X be maintained for maximal confidence when assaying nucleosome positions, but lower coverage levels may be generally sufficient. These coverage depth recommendations are sufficient in the experimental system and conditions used in this study, but may vary depending on the exact parameters used in other systems. PMID:25093869

  15. INTERDISCIPLINARY PHYSICS AND RELATED AREAS OF SCIENCE AND TECHNOLOGY: Relaxation Property and Stability Analysis of the Quasispecies Models

    NASA Astrophysics Data System (ADS)

    Feng, Xiao-Li; Li, Yu-Xiao; Gu, Jian-Zhong; Zhuo, Yi-Zhong

    2009-10-01

    The relaxation property of both Eigen model and Crow-Kimura model with a single peak fitness landscape is studied from phase transition point of view. We first analyze the eigenvalue spectra of the replication mutation matrices. For sufficiently long sequences, the almost crossing point between the largest and second-largest eigenvalues locates the error threshold at which critical slowing down behavior appears. We calculate the critical exponent in the limit of infinite sequence lengths and compare it with the result from numerical curve fittings at sufficiently long sequences. We find that for both models the relaxation time diverges with exponent 1 at the error (mutation) threshold point. Results obtained from both methods agree quite well. From the unlimited correlation length feature, the first order phase transition is further confirmed. Finally with linear stability theory, we show that the two model systems are stable for all ranges of mutation rate. The Eigen model is asymptotically stable in terms of mutant classes, and the Crow-Kimura model is completely stable.

  16. Isotopically enhanced triple-quantum-dot qubit

    PubMed Central

    Eng, Kevin; Ladd, Thaddeus D.; Smith, Aaron; Borselli, Matthew G.; Kiselev, Andrey A.; Fong, Bryan H.; Holabird, Kevin S.; Hazard, Thomas M.; Huang, Biqin; Deelman, Peter W.; Milosavljevic, Ivan; Schmitz, Adele E.; Ross, Richard S.; Gyure, Mark F.; Hunter, Andrew T.

    2015-01-01

    Like modern microprocessors today, future processors of quantum information may be implemented using all-electrical control of silicon-based devices. A semiconductor spin qubit may be controlled without the use of magnetic fields by using three electrons in three tunnel-coupled quantum dots. Triple dots have previously been implemented in GaAs, but this material suffers from intrinsic nuclear magnetic noise. Reduction of this noise is possible by fabricating devices using isotopically purified silicon. We demonstrate universal coherent control of a triple-quantum-dot qubit implemented in an isotopically enhanced Si/SiGe heterostructure. Composite pulses are used to implement spin-echo type sequences, and differential charge sensing enables single-shot state readout. These experiments demonstrate sufficient control with sufficiently low noise to enable the long pulse sequences required for exchange-only two-qubit logic and randomized benchmarking. PMID:26601186

  17. Influence of gag and RRE Sequences on HIV-1 RNA Packaging Signal Structure and Function.

    PubMed

    Kharytonchyk, Siarhei; Brown, Joshua D; Stilger, Krista; Yasin, Saif; Iyer, Aishwarya S; Collins, John; Summers, Michael F; Telesnitsky, Alice

    2018-07-06

    The packaging signal (Ψ) and Rev-responsive element (RRE) enable unspliced HIV-1 RNAs' export from the nucleus and packaging into virions. For some retroviruses, engrafting Ψ onto a heterologous RNA is sufficient to direct encapsidation. In contrast, HIV-1 RNA packaging requires 5' leader Ψ elements plus poorly defined additional features. We previously defined minimal 5' leader sequences competitive with intact Ψ for HIV-1 packaging, and here examined the potential roles of additional downstream elements. The findings confirmed that together, HIV-1 5' leader Ψ sequences plus a nuclear export element are sufficient to specify packaging. However, RNAs trafficked using a heterologous export element did not compete well with RNAs using HIV-1's RRE. Furthermore, some RNA additions to well-packaged minimal vectors rendered them packaging-defective. These defects were rescued by extending gag sequences in their native context. To understand these packaging defects' causes, in vitro dimerization properties of RNAs containing minimal packaging elements were compared to RNAs with sequence extensions that were or were not compatible with packaging. In vitro dimerization was found to correlate with packaging phenotypes, suggesting that HIV-1 evolved to prevent 5' leader residues' base pairing with downstream residues and misfolding of the packaging signal. Our findings explain why gag sequences have been implicated in packaging and show that RRE's packaging contributions appear more specific than nuclear export alone. Paired with recent work showing that sequences upstream of Ψ can dictate RNA folds, the current work explains how genetic context of minimal packaging elements contributes to HIV-1 RNA fate determination. Copyright © 2018 Elsevier Ltd. All rights reserved.

  18. A Simple Method for the Extraction, PCR-amplification, Cloning, and Sequencing of Pasteuria 16S rDNA from Small Numbers of Endospores.

    PubMed

    Atibalentja, N; Noel, G R; Ciancio, A

    2004-03-01

    For many years the taxonomy of the genus Pasteuria has been marred with confusion because the bacterium could not be cultured in vitro and, therefore, descriptions were based solely on morphological, developmental, and pathological characteristics. The current study sought to devise a simple method for PCR-amplification, cloning, and sequencing of Pasteuria 16S rDNA from small numbers of endospores, with no need for prior DNA purification. Results show that DNA extracts from plain glass bead-beating of crude suspensions containing 10,000 endospores at 0.2 x 10 endospores ml(-1) were sufficient for PCR-amplification of Pasteuria 16S rDNA, when used in conjunction with specific primers. These results imply that for P. penetrans and P. nishizawae only one parasitized female of Meloidogyne spp. and Heterodera glycines, respectively, should be sufficient, and as few as eight cadavers of Belonolaimus longicaudatus with an average number of 1,250 endospores of "Candidatus Pasteuria usgae" are needed for PCR-amplification of Pasteuria 16S rDNA. The method described in this paper should facilitate the sequencing of the 16S rDNA of the many Pasteuria isolates that have been reported on nematodes and, consequently, expedite the classification of those isolates through comparative sequence analysis.

  19. Tuning the Mechanical Properties of a DNA Hydrogel in Three Phases Based on ATP Aptamer.

    PubMed

    Liu, Hengyuan; Cao, Tianyang; Xu, Yun; Dong, Yuanchen; Liu, Dongsheng

    2018-05-31

    By integrating ATP aptamer into the linker DNA, a novel DNA hydrogel was designed, with mechanical properties that could be tuned into three phases. Based on the unique interaction between ATP and its aptamer, the mechanical strength of the hydrogel increased from 204 Pa to 380 Pa after adding ATP. Furthermore, with the addition of the complementary sequence to the ATP aptamer, the mechanical strength could be increased to 570 Pa.

  20. Free Energy Gap and Statistical Thermodynamic Fidelity of DNA Codes

    DTIC Science & Technology

    2007-10-01

    reverse-complement unless otherwise stated. For strand x, let Nx denote its complement. A (perfect) Watson - Crick duplex is the joining of complement...is possible for complementary sequences to form a non-perfectly aligned duplex, we will call any x W Nx duplex a Watson - Crick (WC) duplex. Two...DATES COVERED (From - To) 4. TITLE AND SUBTITLE FREE ENERGY GAP AND STATISTICAL THERMODYNAMIC FIDELITY OF DNA CODES 5a. CONTRACT NUMBER FA8750-07

  1. Free Energy Gap and Statistical Thermodynamic Fidelity of DNA Codes (Postprint)

    DTIC Science & Technology

    2007-01-01

    reverse-complement unless otherwise stated. For strand x, let Nx denote its complement. A (perfect) Watson - Crick duplex is the joining of complement...is possible for complementary sequences to form a non-perfectly aligned duplex, we will call any x W Nx duplex a Watson - Crick (WC) duplex. Two...DATES COVERED (From - To) 4. TITLE AND SUBTITLE FREE ENERGY GAP AND STATISTICAL THERMODYNAMIC FIDELITY OF DNA CODES 5a. CONTRACT NUMBER FA8750-07

  2. The Coding of Biological Information: From Nucleotide Sequence to Protein Recognition

    NASA Astrophysics Data System (ADS)

    Štambuk, Nikola

    The paper reviews the classic results of Swanson, Dayhoff, Grantham, Blalock and Root-Bernstein, which link genetic code nucleotide patterns to the protein structure, evolution and molecular recognition. Symbolic representation of the binary addresses defining particular nucleotide and amino acid properties is discussed, with consideration of: structure and metric of the code, direct correspondence between amino acid and nucleotide information, and molecular recognition of the interacting protein motifs coded by the complementary DNA and RNA strands.

  3. Identification, Functional Characterization, and Evolution of Terpene Synthases from a Basal Dicot1[OPEN

    PubMed Central

    Yahyaa, Mosaab; Matsuba, Yuki; Brandt, Wolfgang; Doron-Faigenboim, Adi; Bar, Einat; McClain, Alan; Davidovich-Rikanati, Rachel; Lewinsohn, Efraim; Pichersky, Eran; Ibdah, Mwafaq

    2015-01-01

    Bay laurel (Laurus nobilis) is an agriculturally and economically important dioecious tree in the basal dicot family Lauraceae used in food and drugs and in the cosmetics industry. Bay leaves, with their abundant monoterpenes and sesquiterpenes, are used to impart flavor and aroma to food, and have also drawn attention in recent years because of their potential pharmaceutical applications. To identify terpene synthases (TPSs) involved in the production of these volatile terpenes, we performed RNA sequencing to profile the transcriptome of L. nobilis leaves. Bioinformatic analysis led to the identification of eight TPS complementary DNAs. We characterized the enzymes encoded by three of these complementary DNAs: a monoterpene synthase that belongs to the TPS-b clade catalyzes the formation of mostly 1,8-cineole; a sesquiterpene synthase belonging to the TPS-a clade catalyzes the formation of mainly cadinenes; and a diterpene synthase of the TPS-e/f clade catalyzes the formation of geranyllinalool. Comparison of the sequences of these three TPSs indicated that the TPS-a and TPS-b clades of the TPS gene family evolved early in the evolution of the angiosperm lineage, and that geranyllinalool synthase activity is the likely ancestral function in angiosperms of genes belonging to an ancient TPS-e/f subclade that diverged from the kaurene synthase gene lineages before the split of angiosperms and gymnosperms. PMID:26157114

  4. Complementary DNA cloning of the pear 1-aminocyclopropane-1-carboxylic acid oxidase gene and agrobacterium-mediated anti-sense genetic transformation.

    PubMed

    Qi, Jing; Dong, Zhen; Zhang, Yu-Xing

    2015-12-01

    The aim of the present study was to genetically modify plantlets of the Chinese yali pear to reduce their expression of ripening-associated 1-aminocyclopropane-1-carboxylic acid oxidase (ACO) and therefore increase the shelf-life of the fruit. Primers were designed with selectivity for the conserved regions of published ACO gene sequences, and yali complementary DNA (cDNA) cloning was performed by reverse transcription quantitative polymerase chain reaction (PCR). The obtained cDNA fragment contained 831 base pairs, encoding 276 amino acid residues, and shared no less than 94% nucleotide sequence identity with other published ACO genes. The cDNA fragment was inversely inserted into a pBI121 expression vector, between the cauliflower mosaic virus 35S promoter and the nopaline synthase terminator, in order to construct the anti‑sense expression vector of the ACO gene; it was transfected into cultured yali plants using Agrobacterium LBA4404. Four independent transgenic lines of pear plantlets were obtained and validated by PCR analysis. A Southern blot assay revealed that there were three transgenic lines containing a single copy of exogenous gene and one line with double copies. The present study provided germplasm resources for the cultivation of novel storage varieties of pears, therefore providing a reference for further applications of anti‑sense RNA technology in the genetic improvement of pears and other fruit.

  5. Human placental lactogen mRNA and its structural genes during pregnancy: quantitation with a complementary DNA.

    PubMed Central

    McWilliams, D; Callahan, R C; Boime, I

    1977-01-01

    A complementary DNA (cDNA) strand was transcribed from human placental lactogen (hPL) mRNA. Based on alkaline sucrose gradient centrifugation, the size of the cDNA was about 8 S, which would represent at least 80% of the hPL mRNA. Previously we showed that four to five times more hPL was synthesized in cell-free extracts derived from term as compared to first trimester placentas. Hybridization of the cDNA with RNA derived from placental tissue revealed that there was about four times more hPL mRNA sequences in total RNA from term placenta than in a comparable quantity of total first trimester RNA. Only background hybridization was observed when the cDNA was incubated with RNA prepared from human kidney. To test if this differential accumulation of hPL mRNA was the result of an amplification of hPL genes, we hybridized the labeled cDNA with cellular DNA from first trimester and term placentas and with DNA isolated from human brain. In all cases, the amount of hPL sequences was approximately two copies per haploid genome. Thus, the enhanced synthesis of hPL mRNA appears to result from a transcriptional activation rather than an amplification of the hPL gene. The increase likely reflects placental differentiation in which the proportion of syncytial trophoblast increases at term. Images PMID:66681

  6. Construction of a complementary DNA library for Parelaphostrongylus tenuis and identification of a potentially sero-diagnostic recombinant antigen.

    PubMed

    Ogunremi, Oladele; Benjamin, Jane; MacDonald, Lily; Schimpf, Robert

    2008-12-01

    Newly developed serological tests for diagnosing parelaphostrongylosis in cervids, using the excretory-secretory products (ES) of the infective larvae of Parelaphostrongylus tenuis in enzyme-linked immunosorbent assays (ELISAs), have demonstrable superiority over the traditional method of larval recovery and microscopic identification. To generate a source of ELISA antigen by genetic engineering, we created a complementary DNA (cDNA) expression library by the reverse transcription of mRNA of P. tenuis adult worms, and ligation with the vector lambda-ZAP II. The library was screened using antisera produced in mice by immunization with a somatic antigen preparation of adult worms. Seventeen clones were isolated, sequenced, and checked for similarity to other DNA sequences in GenBank. A previously identified parasite gene encoding an aspartyl protease inhibitor (API) was isolated from the cDNA library, subcloned and expressed using the pET expression vector to produce a glutathione S transferase (GST)-His-S.Tag-P. tenuis API fusion protein (molecular weight = 63 kDa). An enzyme-linked immunosorbent assay utilizing the API fusion protein as the coating antigen was used to serologically diagnose all white-tailed deer (WTD, 10 out of 10) that had been inoculated with 6 - 150 L3 P. tenuis, indicating that the antigen may be a useful serodiagnostic antigen for P. tenuis infection in this cervid species.

  7. Mutually Exclusive Formation of G-Quadruplex and i-Motif Is a General Phenomenon Governed by Steric Hindrance in Duplex DNA.

    PubMed

    Cui, Yunxi; Kong, Deming; Ghimire, Chiran; Xu, Cuixia; Mao, Hanbin

    2016-04-19

    G-Quadruplex and i-motif are tetraplex structures that may form in opposite strands at the same location of a duplex DNA. Recent discoveries have indicated that the two tetraplex structures can have conflicting biological activities, which poses a challenge for cells to coordinate. Here, by performing innovative population analysis on mechanical unfolding profiles of tetraplex structures in double-stranded DNA, we found that formations of G-quadruplex and i-motif in the two complementary strands are mutually exclusive in a variety of DNA templates, which include human telomere and promoter fragments of hINS and hTERT genes. To explain this behavior, we placed G-quadruplex- and i-motif-hosting sequences in an offset fashion in the two complementary telomeric DNA strands. We found simultaneous formation of the G-quadruplex and i-motif in opposite strands, suggesting that mutual exclusivity between the two tetraplexes is controlled by steric hindrance. This conclusion was corroborated in the BCL-2 promoter sequence, in which simultaneous formation of two tetraplexes was observed due to possible offset arrangements between G-quadruplex and i-motif in opposite strands. The mutual exclusivity revealed here sets a molecular basis for cells to efficiently coordinate opposite biological activities of G-quadruplex and i-motif at the same dsDNA location.

  8. Stacked-unstacked equilibrium at the nick site of DNA.

    PubMed

    Protozanova, Ekaterina; Yakovchuk, Peter; Frank-Kamenetskii, Maxim D

    2004-09-17

    Stability of duplex DNA with respect to separation of complementary strands is crucial for DNA executing its major functions in the cell and it also plays a central role in major biotechnology applications of DNA: DNA sequencing, polymerase chain reaction, and DNA microarrays. Two types of interaction are well known to contribute to DNA stability: stacking between adjacent base-pairs and pairing between complementary bases. However, their contribution into the duplex stability is yet to be determined. Now we fill this fundamental gap in our knowledge of the DNA double helix. We have prepared a series of 32, 300 bp-long DNA fragments with solitary nicks in the same position differing only in base-pairs flanking the nick. Electrophoretic mobility of these fragments in the gel has been studied. Assuming the equilibrium between stacked and unstacked conformations at the nick site, all 32 stacking free energy parameters have been obtained. Only ten of them are essential and they govern the stacking interactions between adjacent base-pairs in intact DNA double helix. A full set of DNA stacking parameters has been determined for the first time. From these data and from a well-known dependence of DNA melting temperature on G.C content, the contribution of base-pairing into duplex stability has been estimated. The obtained energy parameters of the DNA double helix are of paramount importance for understanding sequence-dependent DNA flexibility and for numerous biotechnology applications.

  9. Complementary genetic and genomic approaches help characterize the linkage group I seed protein QTL in soybean

    PubMed Central

    2010-01-01

    Background The nutritional and economic value of many crops is effectively a function of seed protein and oil content. Insight into the genetic and molecular control mechanisms involved in the deposition of these constituents in the developing seed is needed to guide crop improvement. A quantitative trait locus (QTL) on Linkage Group I (LG I) of soybean (Glycine max (L.) Merrill) has a striking effect on seed protein content. Results A soybean near-isogenic line (NIL) pair contrasting in seed protein and differing in an introgressed genomic segment containing the LG I protein QTL was used as a resource to demarcate the QTL region and to study variation in transcript abundance in developing seed. The LG I QTL region was delineated to less than 8.4 Mbp of genomic sequence on chromosome 20. Using Affymetrix® Soy GeneChip and high-throughput Illumina® whole transcriptome sequencing platforms, 13 genes displaying significant seed transcript accumulation differences between NILs were identified that mapped to the 8.4 Mbp LG I protein QTL region. Conclusions This study identifies gene candidates at the LG I protein QTL for potential involvement in the regulation of protein content in the soybean seed. The results demonstrate the power of complementary approaches to characterize contrasting NILs and provide genome-wide transcriptome insight towards understanding seed biology and the soybean genome. PMID:20199683

  10. Rapid detection of Cyprinid herpesvirus-3 (CyHV-3) using a gold nanoparticle-based hybridization assay.

    PubMed

    Saleh, Mona; El-Matbouli, Mansour

    2015-06-01

    Cyprinid herpesvirus-3 (CyHV-3) is a highly infectious pathogen that causes fatal disease in common and koi carp Cyprinus carpio L. CyHV-3 detection is usually based on virus propagation or amplification of the viral DNA using the PCR or LAMP techniques. However, due to the limited susceptibility of cells used for propagation, it is not always possible to successfully isolate CyHV-3 even from tissue samples that have high virus titres. All previously described detection methods including PCR-based assays are time consuming, laborious and require specialized equipment. To overcome these limitations, gold nanoparticles (AuNPs) have been explored for direct and sensitive detection of DNA. In this study, a label-free colorimetric nanodiagnostic method for direct detection of unamplified CyHV-3 DNA using gold nanoparticles is introduced. Under appropriate conditions, DNA probes hybridize with their complementary target sequences in the sample DNA, which results in aggregation of the gold nanoparticles and a concomitant colour change from red to blue, whereas test samples with non complementary DNA sequences remain red. In this study, gold nanoparticles were used to develop and evaluate a specific and sensitive hybridization assay for direct and rapid detection of the highly infectious pathogen termed Cyprinid herpesvirus-3. Copyright © 2015 Elsevier B.V. All rights reserved.

  11. Taxonomically Different Co-Microsymbionts of a Relict Legume, Oxytropis popoviana, Have Complementary Sets of Symbiotic Genes and Together Increase the Efficiency of Plant Nodulation.

    PubMed

    Safronova, Vera I; Belimov, Andrey A; Sazanova, Anna L; Chirak, Elizaveta R; Verkhozina, Alla V; Kuznetsova, Irina G; Andronov, Evgeny E; Puhalsky, Jan V; Tikhonovich, Igor A

    2018-06-20

    Ten rhizobial strains were isolated from root nodules of a relict legume Oxytropis popoviana Peschkova. For identification of the isolates, sequencing of rrs, the internal transcribed spacer region, and housekeeping genes recA, glnII, and rpoB was used. Nine fast-growing isolates were Mesorhizobium-related; eight strains were identified as M. japonicum and one isolate belonged to M. kowhaii. The only slow-growing isolate was identified as a Bradyrhizobium sp. Two strains, M. japonicum Opo-242 and Bradyrhizobium sp. strain Opo-243, were isolated from the same nodule. Symbiotic genes of these isolates were searched throughout the whole-genome sequences. The common nodABC genes and other symbiotic genes required for plant nodulation and nitrogen fixation were present in the isolate Opo-242. Strain Opo-243 did not contain the principal nod, nif, and fix genes; however, five genes (nodP, nodQ, nifL, nolK, and noeL) affecting the specificity of plant-rhizobia interactions but absent in isolate Opo-242 were detected. Strain Opo-243 could not induce nodules but significantly accelerated the root nodule formation after coinoculation with isolate Opo-242. Thus, we demonstrated that taxonomically different strains of the archaic symbiotic system can be co-microsymbionts infecting the same nodule and promoting the nodulation process due to complementary sets of symbiotic genes.

  12. Label-Free Electrochemical Detection of the Specific Oligonucleotide Sequence of Dengue Virus Type 1 on Pencil Graphite Electrodes

    PubMed Central

    Souza, Elaine; Nascimento, Gustavo; Santana, Nataly; Ferreira, Danielly; Lima, Manoel; Natividade, Edna; Martins, Danyelly; Lima-Filho, José

    2011-01-01

    A biosensor that relies on the adsorption immobilization of the 18-mer single-stranded nucleic acid related to dengue virus gene 1 on activated pencil graphite was developed. Hybridization between the probe and its complementary oligonucleotides (the target) was investigated by monitoring guanine oxidation by differential pulse voltammetry (DPV). The pencil graphite electrode was made of ordinary pencil lead (type 4B). The polished surface of the working electrode was activated by applying a potential of 1.8 V for 5 min. Afterward, the dengue oligonucleotides probe was immobilized on the activated electrode by applying 0.5 V to the electrode in 0.5 M acetate buffer (pH 5.0) for 5 min. The hybridization process was carried out by incubating at the annealing temperature of the oligonucleotides. A time of five minutes and concentration of 1 μM were found to be the optimal conditions for probe immobilization. The electrochemical detection of annealing between the DNA probe (TS-1P) immobilized on the modified electrode, and the target (TS-1T) was achieved. The target could be quantified in a range from 1 to 40 nM with good linearity and a detection limit of 0.92 nM. The specificity of the electrochemical biosensor was tested using non-complementary sequences of dengue virus 2 and 3. PMID:22163916

  13. Golay Complementary Waveforms in Reed–Müller Sequences for Radar Detection of Nonzero Doppler Targets

    PubMed Central

    Wang, Xuezhi; Huang, Xiaotao; Suvorova, Sofia; Moran, Bill

    2018-01-01

    Golay complementary waveforms can, in theory, yield radar returns of high range resolution with essentially zero sidelobes. In practice, when deployed conventionally, while high signal-to-noise ratios can be achieved for static target detection, significant range sidelobes are generated by target returns of nonzero Doppler causing unreliable detection. We consider signal processing techniques using Golay complementary waveforms to improve radar detection performance in scenarios involving multiple nonzero Doppler targets. A signal processing procedure based on an existing, so called, Binomial Design algorithm that alters the transmission order of Golay complementary waveforms and weights the returns is proposed in an attempt to achieve an enhanced illumination performance. The procedure applies one of three proposed waveform transmission ordering algorithms, followed by a pointwise nonlinear processor combining the outputs of the Binomial Design algorithm and one of the ordering algorithms. The computational complexity of the Binomial Design algorithm and the three ordering algorithms are compared, and a statistical analysis of the performance of the pointwise nonlinear processing is given. Estimation of the areas in the Delay–Doppler map occupied by significant range sidelobes for given targets are also discussed. Numerical simulations for the comparison of the performances of the Binomial Design algorithm and the three ordering algorithms are presented for both fixed and randomized target locations. The simulation results demonstrate that the proposed signal processing procedure has a better detection performance in terms of lower sidelobes and higher Doppler resolution in the presence of multiple nonzero Doppler targets compared to existing methods. PMID:29324708

  14. The presence of codon-anticodon pairs in the acceptor stem of tRNAs.

    PubMed Central

    Rodin, S; Rodin, A; Ohno, S

    1996-01-01

    A total of 1268 available (excluding mitochondrial) tRNA sequences was used to reconstruct the common consensus image of their acceptor domains. Its structure appeared as a 11-bp-long double-stranded palindrome with complementary triplets in the center, each flanked by the 3'-ACCD and NGGU-5' motifs on each strand (D, base determinator). The palindrome readily extends up to the modern tRNA-like cloverleaf passing through an intermediate hairpin having in the center the single-stranded triplet, in supplement to its double-stranded precursor. The latter might represent an original anticodon-codon pair mapped at 1-2-3 positions of the present-day tRNA acceptors. This conclusion is supported by the striking correlation: in pairs of consensus tRNAs with complementary anticodons, their bases at the 2nd position of the acceptor stem were also complementary. Accordingly, inverse complementarity was also evident at the 71st position of the acceptor stem. With a single exception (tRNA(Phe)-tRNA(Glu) pair), the parallelism is especially impressive for the pairs of tRNAs recognized by aminoacyl-tRNA synthetases (aaRS) from the opposite classes. The above complementarity still doubly presented at the key central position of real single-stranded anticodons and their hypothetical double-stranded precursors is consistent with our previous data pointing to the double-strand use of ancient RNAs in the origin of the main actors in translation- tRNAs with complementary anticodons and the two classes of aaRS. Images Fig. 3 Table 2 Fig. 4 PMID:8643439

  15. Artificial Informational Polymers and Nanomaterials from Ring-Opening Metathesis Polymerization

    NASA Astrophysics Data System (ADS)

    James, Carrie Rae

    Inspired by naturally occurring polymers (DNA, polypeptides, polysaccharides, etc.) that can self-assemble on the nanoscale into complex, information-rich architectures, we have synthesized nucleic acid based polymers using ROMP. These polymers were synthesized using a graft-through strategy, whereby nucleic acids bearing a strained cyclic olefin were directly polymerized. This is the first example of the graft-through polymerization of nucleic acids. Our approach takes advantage of non-charged peptide nucleic acids (PNAs) as elements to incorporate into ROMP polymer backbones. PNA is a synthetic nucleic acid analogue known for its increased affinity and specificity for complementary DNA or RNA. To accomplish the graft-through polymerization of PNA, we conjugated PNA to strained cyclic olefins using solid phase peptide conjugation chemistry. These PNA monomers were then directly polymerized into homo and block copolymers forming brushes, or comb-like arrangements, of information. Block copolymer amphiphiles of these materials, where the PNA brush served as the hydrophilic portion, were capable of self-assembly into spherical nanoparticles (PNA NPs). These PNA NPs were then studied with respect to their ability to hybridize complementary DNA sequences, as well as their ability to undergo cellular internalization. PNA NPs consisting of densely packed brushes of nucleic acids possessed increased thermal stability when mixed with their complementary DNA sequence, indicating a greater DNA binding affinity over their unpolymerized PNA counterparts. In addition, by arranging the PNA into dense brushes at the surface of the nanoparticle, Cy5.5 labeled PNA NPs were able to undergo cellular internalization into HeLa cells without the need for an additional cellular delivery device. Importantly, cellular internalization of PNA has remained a significant challenge in the literature due to the neutrally charged amino-ethyl glycine backbone of PNA. Therefore, this represents a novel way of facilitating cellular uptake of PNA. This materials strategy represents the first direct polymerization of nucleic acids, and presents a novel method for arranging biological information on the nanoscale at high density in order to confer novel attributes.

  16. Activation energies for dissociation of double strand oligonucleotide anions: evidence for watson-crick base pairing in vacuo.

    PubMed

    Schnier, P D; Klassen, J S; Strittmatter, E F; Williams, E R

    1998-09-23

    The dissociation kinetics of a series of complementary and noncomplementary DNA duplexes, (TGCA)(2) (3-), (CCGG)(2) (3-), (AATTAAT)(2) (3-), (CCGGCCG)(2) (3-), A(7)*T(7) (3-), A(7)*A(7) (3-), T(7)*T(7) (3-), and A(7)*C(7) (3-) were investigated using blackbody infrared radiative dissociation in a Fourier transform mass spectrometer. From the temperature dependence of the unimolecular dissociation rate constants, Arrhenius activation parameters in the zero-pressure limit are obtained. Activation energies range from 1.2 to 1.7 eV, and preexponential factors range from 10(13) to 10(19) s(-1). Dissociation of the duplexes results in cleavage of the noncovalent bonds and/or cleavage of covalent bonds leading to loss of a neutral nucleobase followed by backbone cleavage producing sequence-specific (a - base) and w ions. Four pieces of evidence are presented which indicate that Watson-Crick (WC) base pairing is preserved in complementary DNA duplexes in the gas phase: i. the activation energy for dissociation of the complementary dimer, A(7)*T(7) (3-), to the single strands is significantly higher than that for the related noncomplementary A(7)*A(7) (3-) and T(7)*T(7) (3-) dimers, indicating a stronger interaction between strands with a specific base sequence, ii. extensive loss of neutral adenine occurs for A(7)*A(7) (3-) and A(7)*C(7) (3-) but not for A(7)*T(7) (3-) consistent with this process being shut down by WC hydrogen bonding, iii. a correlation is observed between the measured activation energy for dissociation to single strands and the dimerization enthalpy (-DeltaH(d)) in solution, and iv. molecular dynamics carried out at 300 and 400 K indicate that WC base pairing is preserved for A(7)*T(7) (3-) duplex, although the helical structure is essentially lost. In combination, these results provide strong evidence that WC base pairing can exist in the complete absence of solvent.

  17. A two-locus global DNA barcode for land plants: the coding rbcL gene complements the non-coding trnH-psbA spacer region.

    PubMed

    Kress, W John; Erickson, David L

    2007-06-06

    A useful DNA barcode requires sufficient sequence variation to distinguish between species and ease of application across a broad range of taxa. Discovery of a DNA barcode for land plants has been limited by intrinsically lower rates of sequence evolution in plant genomes than that observed in animals. This low rate has complicated the trade-off in finding a locus that is universal and readily sequenced and has sufficiently high sequence divergence at the species-level. Here, a global plant DNA barcode system is evaluated by comparing universal application and degree of sequence divergence for nine putative barcode loci, including coding and non-coding regions, singly and in pairs across a phylogenetically diverse set of 48 genera (two species per genus). No single locus could discriminate among species in a pair in more than 79% of genera, whereas discrimination increased to nearly 88% when the non-coding trnH-psbA spacer was paired with one of three coding loci, including rbcL. In silico trials were conducted in which DNA sequences from GenBank were used to further evaluate the discriminatory power of a subset of these loci. These trials supported the earlier observation that trnH-psbA coupled with rbcL can correctly identify and discriminate among related species. A combination of the non-coding trnH-psbA spacer region and a portion of the coding rbcL gene is recommended as a two-locus global land plant barcode that provides the necessary universality and species discrimination.

  18. Tertiary alphabet for the observable protein structural universe.

    PubMed

    Mackenzie, Craig O; Zhou, Jianfu; Grigoryan, Gevorg

    2016-11-22

    Here, we systematically decompose the known protein structural universe into its basic elements, which we dub tertiary structural motifs (TERMs). A TERM is a compact backbone fragment that captures the secondary, tertiary, and quaternary environments around a given residue, comprising one or more disjoint segments (three on average). We seek the set of universal TERMs that capture all structure in the Protein Data Bank (PDB), finding remarkable degeneracy. Only ∼600 TERMs are sufficient to describe 50% of the PDB at sub-Angstrom resolution. However, more rare geometries also exist, and the overall structural coverage grows logarithmically with the number of TERMs. We go on to show that universal TERMs provide an effective mapping between sequence and structure. We demonstrate that TERM-based statistics alone are sufficient to recapitulate close-to-native sequences given either NMR or X-ray backbones. Furthermore, sequence variability predicted from TERM data agrees closely with evolutionary variation. Finally, locations of TERMs in protein chains can be predicted from sequence alone based on sequence signatures emergent from TERM instances in the PDB. For multisegment motifs, this method identifies spatially adjacent fragments that are not contiguous in sequence-a major bottleneck in structure prediction. Although all TERMs recur in diverse proteins, some appear specialized for certain functions, such as interface formation, metal coordination, or even water binding. Structural biology has benefited greatly from previously observed degeneracies in structure. The decomposition of the known structural universe into a finite set of compact TERMs offers exciting opportunities toward better understanding, design, and prediction of protein structure.

  19. Electron microscopic visualization of complementary labeled DNA with platinum-containing guanine derivative.

    PubMed

    Loukanov, Alexandre; Filipov, Chavdar; Mladenova, Polina; Toshev, Svetlin; Emin, Saim

    2016-04-01

    The object of the present report is to provide a method for a visualization of DNA in TEM by complementary labeling of cytosine with guanine derivative, which contains platinum as contrast-enhanced heavy element. The stretched single-chain DNA was obtained by modifying double-stranded DNA. The labeling method comprises the following steps: (i) stretching and adsorption of DNA on the support film of an electron microscope grid (the hydrophobic carbon film holding negative charged DNA); (ii) complementary labeling of the cytosine bases from the stretched single-stranded DNA pieces on the support film with platinum containing guanine derivative to form base-specific hydrogen bond; and (iii) producing a magnified image of the base-specific labeled DNA. Stretched single-stranded DNA on a support film is obtained by a rapid elongation of DNA pieces on the surface between air and aqueous buffer solution. The attached platinum-containing guanine derivative serves as a high-dense marker and it can be discriminated from the surrounding background of support carbon film and visualized by use of conventional TEM observation at 100 kV accelerated voltage. This method allows examination of specific nucleic macromolecules through atom-by-atom analysis and it is promising way toward future DNA-sequencing or molecular diagnostics of nucleic acids by electron microscopic observation. © 2016 Wiley Periodicals, Inc.

  20. Antagonistic Activity of Lactobacillus plantarum C11: Two New Two-Peptide Bacteriocins, Plantaricins EF and JK, and the Induction Factor Plantaricin A

    PubMed Central

    Anderssen, Erlend L.; Diep, Dzung Bao; Nes, Ingolf F.; Eijsink, Vincent G. H.; Nissen-Meyer, Jon

    1998-01-01

    Six bacteriocinlike peptides (plantaricin A [PlnA], PlnE, PlnF, PlnJ, PlnK, and PlnN) produced by Lactobacillus plantarum C11 were detected by amino acid sequencing and mass spectrometry. Since purification to homogeneity was problematic, all six peptides were obtained by solid-phase peptide synthesis and were tested for bacteriocin activity. It was found that L. plantarum C11 produces two two-peptide bacteriocins (PlnEF and PlnJK); a strain-specific antagonistic activity was detected at nanomolar concentrations when PlnE and PlnF were combined and when PlnJ and PlnK were combined. Complementary peptides were at least 103 times more active when they were combined than when they were present individually, and optimal activity was obtained when the complementary peptides were present in approximately equal amounts. The interaction between complementary peptides was specific, since neither PlnE nor PlnF could complement PlnJ or PlnK, and none of these peptides could complement the peptides constituting the two-peptide bacteriocin lactococcin G. Interestingly, PlnA, which acts as an extracellular signal (pheromone) that triggers bacteriocin production, also possessed a strain-specific antagonistic activity. No bacteriocin activity could be detected for PlnN. PMID:9603847

  1. Solution structure of a highly stable DNA duplex conjugated to a minor groove binder.

    PubMed Central

    Kumar, S; Reed, M W; Gamper, H B; Gorn, V V; Lukhtanov, E A; Foti, M; West, J; Meyer, R B; Schweitzer, B I

    1998-01-01

    The tripeptide 1,2-dihydro-(3 H )-pyrrolo[3,2- e ]indole-7-carboxylate (CDPI3) binds to the minor groove of DNA with high affinity. When this minor groove binder is conjugated to the 5'-end of short oligonucleotides the conjugates form unusually stable hybrids with complementary DNA and thus may have useful diagnostic and/or therapeutic applications. In order to gain an understanding of the structural interactions between the CDPI3minor groove binding moiety and the DNA, we have determined and compared the solution structure of a duplex consisting of oligodeoxyribonucleotide 5'-TGATTATCTG-3' conjugated at the 5'-end to CDPI3 and its complementary strand to an unmodified control duplex of the same sequence using nuclear magnetic resonance techniques. Thermal denaturation studies indicated that the hybrid of this conjugate with its complementary strand had a melting temperature that was 30 degrees C higher compared with the unmodified control duplex. Following restrained molecular dynamics and relaxation matrix refinement, the solution structure of the CDPI3-conjugated DNA duplex demonstrated that the overall shape of the duplex was that of a straight B-type helix and that the CDPI3moiety was bound snugly in the minor groove, where it was stabilized by extensive van der Waal's interactions. PMID:9443977

  2. Solution structure of a highly stable DNA duplex conjugated to a minor groove binder.

    PubMed

    Kumar, S; Reed, M W; Gamper, H B; Gorn, V V; Lukhtanov, E A; Foti, M; West, J; Meyer, R B; Schweitzer, B I

    1998-02-01

    The tripeptide 1,2-dihydro-(3 H )-pyrrolo[3,2- e ]indole-7-carboxylate (CDPI3) binds to the minor groove of DNA with high affinity. When this minor groove binder is conjugated to the 5'-end of short oligonucleotides the conjugates form unusually stable hybrids with complementary DNA and thus may have useful diagnostic and/or therapeutic applications. In order to gain an understanding of the structural interactions between the CDPI3minor groove binding moiety and the DNA, we have determined and compared the solution structure of a duplex consisting of oligodeoxyribonucleotide 5'-TGATTATCTG-3' conjugated at the 5'-end to CDPI3 and its complementary strand to an unmodified control duplex of the same sequence using nuclear magnetic resonance techniques. Thermal denaturation studies indicated that the hybrid of this conjugate with its complementary strand had a melting temperature that was 30 degrees C higher compared with the unmodified control duplex. Following restrained molecular dynamics and relaxation matrix refinement, the solution structure of the CDPI3-conjugated DNA duplex demonstrated that the overall shape of the duplex was that of a straight B-type helix and that the CDPI3moiety was bound snugly in the minor groove, where it was stabilized by extensive van der Waal's interactions.

  3. Molecular sequence data of hepatitis B virus and genetic diversity after vaccination.

    PubMed

    van Ballegooijen, W Marijn; van Houdt, Robin; Bruisten, Sylvia M; Boot, Hein J; Coutinho, Roel A; Wallinga, Jacco

    2009-12-15

    The effect of vaccination programs on transmission of infectious disease is usually assessed by monitoring programs that rely on notifications of symptomatic illness. For monitoring of infectious diseases with a high proportion of asymptomatic cases or a low reporting rate, molecular sequence data combined with modern coalescent-based techniques offer a complementary tool to assess transmission. Here, the authors investigate the added value of using viral sequence data to monitor a vaccination program that was started in 1998 and was targeted against hepatitis B virus in men who have sex with men in Amsterdam, the Netherlands. The incidence in this target group, as estimated from the notifications of acute infections with hepatitis B virus, was low; therefore, there was insufficient power to show a significant change in incidence. In contrast, the genetic diversity, as estimated from the viral sequence collected from the target group, revealed a marked decrease after vaccination was introduced. Taken together, the findings suggest that introduction of vaccination coincided with a change in the target group toward behavior with a higher risk of infection. The authors argue that molecular sequence data provide a powerful additional monitoring instrument, next to conventional case registration, for assessing the impact of vaccination.

  4. Homopolymer tail-mediated ligation PCR: a streamlined and highly efficient method for DNA cloning and library construction.

    PubMed

    Lazinski, David W; Camilli, Andrew

    2013-01-01

    The amplification of DNA fragments, cloned between user-defined 5' and 3' end sequences, is a prerequisite step in the use of many current applications including massively parallel sequencing (MPS). Here we describe an improved method, called homopolymer tail-mediated ligation PCR (HTML-PCR), that requires very little starting template, minimal hands-on effort, is cost-effective, and is suited for use in high-throughput and robotic methodologies. HTML-PCR starts with the addition of homopolymer tails of controlled lengths to the 3' termini of a double-stranded genomic template. The homopolymer tails enable the annealing-assisted ligation of a hybrid oligonucleotide to the template's recessed 5' ends. The hybrid oligonucleotide has a user-defined sequence at its 5' end. This primer, together with a second primer composed of a longer region complementary to the homopolymer tail and fused to a second 5' user-defined sequence, are used in a PCR reaction to generate the final product. The user-defined sequences can be varied to enable compatibility with a wide variety of downstream applications. We demonstrate our new method by constructing MPS libraries starting from nanogram and sub-nanogram quantities of Vibrio cholerae and Streptococcus pneumoniae genomic DNA.

  5. Virtual Cross-Linking of the Active Nemorubicin Metabolite PNU-159682 to Double-Stranded DNA.

    PubMed

    Scalabrin, Matteo; Quintieri, Luigi; Palumbo, Manlio; Riccardi Sirtori, Federico; Gatto, Barbara

    2017-02-20

    The DNA alkylating mechanism of PNU-159682 (PNU), a highly potent metabolite of the anthracycline nemorubicin, was investigated by gel-electrophoretic, HPLC-UV, and micro-HPLC/mass spectrometry (MS) measurements. PNU quickly reacted with double-stranded oligonucleotides, but not with single-stranded sequences, to form covalent adducts which were detectable by denaturing polyacrylamide gel electrophoresis (DPAGE). Ion-pair reverse-phase HPLC-UV analysis on CG rich duplex sequences having a 5'-CCCGGG-3' central core showed the formation of two types of adducts with PNU, which were stable and could be characterized by micro-HPLC/MS. The first type contained one alkylated species (and possibly one reversibly bound species), and the second contained two alkylated species per duplex DNA. The covalent adducts were found to produce effective bridging of DNA complementary strands through the formation of virtual cross-links reminiscent of those produced by classical anthracyclines in the presence of formaldehyde. Furthermore, the absence of reactivity of PNU with CG-rich sequence containing a TA core (CGTACG), and the minor reactivity between PNU and CGC sequences (TACGCG·CGCGTA) pointed out the importance of guanine sequence context in modulating DNA alkylation.

  6. Single-primer fluorescent sequencing

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ruth, J.L.; Morgan, C.A.; Middendorf, L.R.

    Modified linker arm oligonucleotides complementary to standard M13 priming sites were synthesized, labelled with either one, two, or three fluoresceins, and purified by reverse-phase HPLC. When used as primers in standard dideoxy M13 sequencing with /sup 32/P-dNTPs, normal autoradiographic patterns were obtained. To eliminate the radioactivity, direct on-line fluorescence detection was achieved by the use of a scanning 10 mW Argon laser emitting 488 nm light. Fluorescent bands were detected directly in standard 0.2 or 0.35 mm thick polyacrylamide gels at a distance of 24 cm from the loading wells by a photomultiplier tube filtered at 520 nm. Horizontal andmore » temporal location of each band was displayed by computer as a band in real time, providing visual appearance similar to normal 4-lane autoradiograms. Using a single primer labelled with two fluoresceins, sequences of between 500 and 600 bases have been read in a single loading with better than 98% accuracy; up to 400 bases can be read reproducibly with no errors. More than 50 sequences have been determined by this method. This approach requires only 1-2 ug of cloned template, and produces continuous sequence data at about one band per minute.« less

  7. 27nt-RNAs guide histone variant deposition via 'RNA-induced DNA replication interference' and thus transmit parental genome partitioning in Stylonychia.

    PubMed

    Postberg, Jan; Jönsson, Franziska; Weil, Patrick Philipp; Bulic, Aneta; Juranek, Stefan Andreas; Lipps, Hans-Joachim

    2018-06-12

    During sexual reproduction in the unicellular ciliate Stylonychia somatic macronuclei differentiate from germline micronuclei. Thereby, programmed sequence reduction takes place, leading to the elimination of > 95% of germline sequences, which priorly adopt heterochromatin structure via H3K27me3. Simultaneously, 27nt-ncRNAs become synthesized from parental transcripts and are bound by the Argonaute protein PIWI1. These 27nt-ncRNAs cover sequences destined to the developing macronucleus and are thought to protect them from degradation. We provide evidence and propose that RNA/DNA base-pairing guides PIWI1/27nt-RNA complexes to complementary macronucleus-destined DNA target sequences, hence transiently causing locally stalled replication during polytene chromosome formation. This spatiotemporal delay enables the selective deposition of temporarily available histone H3.4K27me3 nucleosomes at all other sequences being continuously replicated, thus dictating their prospective heterochromatin structure before becoming developmentally eliminated. Concomitantly, 27nt-RNA-covered sites remain protected. We introduce the concept of 'RNA-induced DNA replication interference' and explain how the parental functional genome partition could become transmitted to the progeny.

  8. Characterization of the Kenaf (Hibiscus cannabinus) Global Transcriptome Using Illumina Paired-End Sequencing and Development of EST-SSR Markers

    PubMed Central

    Li, Hui; Li, Defang; Chen, Anguo; Tang, Huijuan; Li, Jianjun; Huang, Siqi

    2016-01-01

    Kenaf (Hibiscus cannabinus L.) is an economically important natural fiber crop grown worldwide. However, only 20 expressed tag sequences (ESTs) for kenaf are available in public databases. The aim of this study was to develop large-scale simple sequence repeat (SSR) markers to lay a solid foundation for the construction of genetic linkage maps and marker-assisted breeding in kenaf. We used Illumina paired-end sequencing technology to generate new EST-simple sequences and MISA software to mine SSR markers. We identified 71,318 unigenes with an average length of 1143 nt and annotated these unigenes using four different protein databases. Overall, 9324 complementary pairs were designated as EST-SSR markers, and their quality was validated using 100 randomly selected SSR markers. In total, 72 primer pairs reproducibly amplified target amplicons, and 61 of these primer pairs detected significant polymorphism among 28 kenaf accessions. Thus, in this study, we have developed large-scale SSR markers for kenaf, and this new resource will facilitate construction of genetic linkage maps, investigation of fiber growth and development in kenaf, and also be of value to novel gene discovery and functional genomic studies. PMID:26960153

  9. Complementary DNA cloning and organ expression of cytochrome P450 1C2 in carp (Cyprinus carpio).

    PubMed

    Kaminishi, Yoshio; El-Kady, Mohamed A H; Mitsuo, Ryoichi; Itakura, Takao

    2007-01-01

    Cytochrome P450 (CYP) genes, which make up a large gene superfamily, are known to play an important role in drug metabolism. The CYP1 family, one of the gene families of the CYP superfamily, has three subfamilies of genes whose sequences have been deposited in the GenBank/EMBL thus far: CYP1A, CYP1B, and CYP1C. Mammals as well as fish confront numerous foreign chemicals in the environment that may accumulate to toxic levels unless they are metabolized and eliminated by processes largely mediated by CYP enzymes. A new complementary DNA of the CYP1C subfamily encoding CYP1C2 was isolated from the carp liver after a single intraperitoneal injection of beta-napthoflavone (BNF). The full-length cDNA obtained contained a 5' noncoding region of 198 bp, an open reading frame of 1575 bp coding for 524 amino acids and a stop codon, and a 3' noncoding region of 531 bp. The predicted molecular weight of the protein was approximately 59.3 kDa. The amino acid sequence deduced from the carp CYP1C2 sequence showed a similarity of 76.6% with that deduced from our previously reported carp CYP1C1. It exhibited similarities of 77.3, 73.7, and 76.4% with those deduced from scup CYP1C2, scup CYP1C1, and Japanese eel CYP1C1 sequences, respectively. Carp CYP1C2 cDNA showed similarities with reported CYP1Bs of teleosts and mammals, namely, 47.6, 45.3, 45.7, 44.0, and 44.6% for carp, plaice, human, rat, and mouse CYP1B1s, respectively, while it exhibited a similarity of 49.0% with carp CYP1B2. The carp CYP1C2 sequence was aligned with the CYP1 sequences and has been deposited in the GenBank/EMBL data bank with the accession number AY437777. The phylogenetic tree constructed using fish and mammalian CYP1 sequences suggested a closer relationship of CYP1C with CYP1B than with CYP1A. The tree showed possibile existence of CYP1C subfamily genes in mammalian species. Northern blot analysis of the liver, intestines, kidneys, and gills revealed a distinct induced expression only in the kidneys, with no detectable constitutive expression in the other organs studied.

  10. Detection of the ideal resource for multiqubit teleportation

    NASA Astrophysics Data System (ADS)

    Zhao, Ming-Jing; Chen, Bin; Fei, Shao-Ming

    2015-07-01

    We give a sufficient condition for detecting the entanglement resource for perfect multiqubit teleportation. The criterion involves only local measurements on some complementary observables and can be experimentally implemented. It is also a necessary condition for full separability of multiqubit states. Moreover, by proving the optimality of teleportation witnesses, we solve the open problem in Phys. Rev. A 86, 032315 (2012). Project supported by the National Natural Science Foundation of China (Grant Nos. 11401032, 11275131, and 61473325), the Foundation of Beijing Information Science and Technology University, China (Grant No. 1425032), and the Scientific Research Foundation for the Returned Overseas Chinese Scholars, State Education Ministry of China.

  11. Monopole, astrophysics and cosmic ray observatory at Gran Sasso

    NASA Technical Reports Server (NTRS)

    Demarzo, C.; Enriquez, O.; Giglietto, N.; Posa, F.; Attolini, M.; Baldetti, F.; Giacomelli, G.; Grianti, F.; Margiotta, A.; Serra, P.

    1985-01-01

    A new large area detector, MACRO was approved for installation at the Gran Sasso Laboratory in Italy. The detector will be dedicated to the study of naturally penetrating radiation deep underground. It is designed with the general philosophy of covering the largest possible area with a detector having both sufficient built-in redundancy and use of complementary techniques to study very rare phenomena. The detector capabilities will include monopole investigations significantly below the Parker bound; astrophysics studies of very high energy gamma ray and neutrino point sources; cosmic ray measurements of single and multimuons; and the general observation of rare new forms of matter in the cosmic rays.

  12. "Atypical touch perception in MTS may derive from an abnormally plastic self-representation".

    PubMed

    Bufalari, Ilaria; Porciello, Giuseppina; Aglioti, Salvatore Maria

    2015-01-01

    Mirror Touch Synesthetes (MTSs) feel touch while they observe others being touched. According to the authors, two complementary theoretical frameworks, the Threshold Theory and the Self-Other Theory, explain Mirror Touch Synesthesia (MTS). Based on the behavioral evidence that in MTSs the mere observation of touch is sufficient to elicit self-other merging (i.e., self-representation changes), a condition that in non-MTSs just elicits self-other sharing (i.e., mirroring activity without self-other blurring), and on the rTPJ anatomical alterations in MTS, we argue that MTS may derive from an abnormally plastic self-representation and atypical multisensory integrative mechanisms.

  13. Direct sequencing of hepatitis A virus and norovirus RT-PCR products from environmentally contaminated oyster using M13-tailed primers.

    PubMed

    Williams-Woods, Jacquelina; González-Escalona, Narjol; Burkhardt, William

    2011-12-01

    Human norovirus (HuNoV) and hepatitis A (HAV) are recognized as leading causes of non-bacterial foodborne associated illnesses in the United States. DNA sequencing is generally considered the standard for accurate viral genotyping in support of epidemiological investigations. Due to the genetic diversity of noroviruses (NoV), degenerate primer sets are often used in conventional reverse transcription (RT) PCR and real-time RT-quantitative PCR (RT-qPCR) for the detection of these viruses and cDNA fragments are generally cloned prior to sequencing. HAV detection methods that are sensitive and specific for real-time RT-qPCR yields small fragments sizes of 89-150bp, which can be difficult to sequence. In order to overcome these obstacles, norovirus and HAV primers were tailed with M13 forward and reverse primers. This modification increases the sequenced product size and allows for direct sequencing of the amplicons utilizing complementary M13 primers. HuNoV and HAV cDNA products from environmentally contaminated oysters were analyzed using this method. Alignments of the sequenced samples revealed ≥95% nucleotide identities. Tailing NoV and HAV primers with M13 sequence increases the cDNA product size, offers an alternative to cloning, and allows for rapid, accurate and direct sequencing of cDNA products produced by conventional or real time RT-qPCR assays. Published by Elsevier B.V.

  14. High-Resolution Whole-Genome Sequencing Reveals That Specific Chromatin Domains from Most Human Chromosomes Associate with Nucleoli

    PubMed Central

    van Koningsbruggen, Silvana; Gierliński, Marek; Schofield, Pietá; Martin, David; Barton, Geoffey J.; Ariyurek, Yavuz; den Dunnen, Johan T.

    2010-01-01

    The nuclear space is mostly occupied by chromosome territories and nuclear bodies. Although this organization of chromosomes affects gene function, relatively little is known about the role of nuclear bodies in the organization of chromosomal regions. The nucleolus is the best-studied subnuclear structure and forms around the rRNA repeat gene clusters on the acrocentric chromosomes. In addition to rDNA, other chromatin sequences also surround the nucleolar surface and may even loop into the nucleolus. These additional nucleolar-associated domains (NADs) have not been well characterized. We present here a whole-genome, high-resolution analysis of chromatin endogenously associated with nucleoli. We have used a combination of three complementary approaches, namely fluorescence comparative genome hybridization, high-throughput deep DNA sequencing and photoactivation combined with time-lapse fluorescence microscopy. The data show that specific sequences from most human chromosomes, in addition to the rDNA repeat units, associate with nucleoli in a reproducible and heritable manner. NADs have in common a high density of AT-rich sequence elements, low gene density and a statistically significant enrichment in transcriptionally repressed genes. Unexpectedly, both the direct DNA sequencing and fluorescence photoactivation data show that certain chromatin loci can specifically associate with either the nucleolus, or the nuclear envelope. PMID:20826608

  15. High-resolution whole-genome sequencing reveals that specific chromatin domains from most human chromosomes associate with nucleoli.

    PubMed

    van Koningsbruggen, Silvana; Gierlinski, Marek; Schofield, Pietá; Martin, David; Barton, Geoffey J; Ariyurek, Yavuz; den Dunnen, Johan T; Lamond, Angus I

    2010-11-01

    The nuclear space is mostly occupied by chromosome territories and nuclear bodies. Although this organization of chromosomes affects gene function, relatively little is known about the role of nuclear bodies in the organization of chromosomal regions. The nucleolus is the best-studied subnuclear structure and forms around the rRNA repeat gene clusters on the acrocentric chromosomes. In addition to rDNA, other chromatin sequences also surround the nucleolar surface and may even loop into the nucleolus. These additional nucleolar-associated domains (NADs) have not been well characterized. We present here a whole-genome, high-resolution analysis of chromatin endogenously associated with nucleoli. We have used a combination of three complementary approaches, namely fluorescence comparative genome hybridization, high-throughput deep DNA sequencing and photoactivation combined with time-lapse fluorescence microscopy. The data show that specific sequences from most human chromosomes, in addition to the rDNA repeat units, associate with nucleoli in a reproducible and heritable manner. NADs have in common a high density of AT-rich sequence elements, low gene density and a statistically significant enrichment in transcriptionally repressed genes. Unexpectedly, both the direct DNA sequencing and fluorescence photoactivation data show that certain chromatin loci can specifically associate with either the nucleolus, or the nuclear envelope.

  16. Molecular characterisation of Atlantic salmon paramyxovirus (ASPV): A novel paramyxovirus associated with proliferative gill inflammation

    USGS Publications Warehouse

    Falk, K.; Batts, W.N.; Kvellestad, A.; Kurath, G.; Wiik-Nielsen, J.; Winton, J.R.

    2008-01-01

    Atlantic salmon paramyxovirus (ASPV) was isolated in 1995 from gills of farmed Atlantic salmon suffering from proliferative gill inflammation. The complete genome sequence of ASPV was determined, revealing a genome 16,968 nucleotides in length consisting of six non-overlapping genes coding for the nucleo- (N), phospho- (P), matrix- (M), fusion- (F), haemagglutinin-neuraminidase- (HN) and large polymerase (L) proteins in the order 3???-N-P-M-F-HN-L-5???. The various conserved features related to virus replication found in most paramyxoviruses were also found in ASPV. These include: conserved and complementary leader and trailer sequences, tri-nucleotide intergenic regions and highly conserved transcription start and stop signal sequences. The P gene expression strategy of ASPV was like that of the respiro-, morbilli- and henipaviruses, which express the P and C proteins from the primary transcript and edit a portion of the mRNA to encode V and W proteins. Sequence similarities among various features related to virus replication, pairwise comparisons of all deduced ASPV protein sequences with homologous regions from other members of the family Paramyxoviridae, and phylogenetic analyses of these amino acid sequences suggested that ASPV was a novel member of the sub-family Paramyxovirinae, most closely related to the respiroviruses. ?? 2008 Elsevier B.V. All rights reserved.

  17. Peptide de novo sequencing of mixture tandem mass spectra.

    PubMed

    Gorshkov, Vladimir; Hotta, Stéphanie Yuki Kolbeck; Verano-Braga, Thiago; Kjeldsen, Frank

    2016-09-01

    The impact of mixture spectra deconvolution on the performance of four popular de novo sequencing programs was tested using artificially constructed mixture spectra as well as experimental proteomics data. Mixture fragmentation spectra are recognized as a limitation in proteomics because they decrease the identification performance using database search engines. De novo sequencing approaches are expected to be even more sensitive to the reduction in mass spectrum quality resulting from peptide precursor co-isolation and thus prone to false identifications. The deconvolution approach matched complementary b-, y-ions to each precursor peptide mass, which allowed the creation of virtual spectra containing sequence specific fragment ions of each co-isolated peptide. Deconvolution processing resulted in equally efficient identification rates but increased the absolute number of correctly sequenced peptides. The improvement was in the range of 20-35% additional peptide identifications for a HeLa lysate sample. Some correct sequences were identified only using unprocessed spectra; however, the number of these was lower than those where improvement was obtained by mass spectral deconvolution. Tight candidate peptide score distribution and high sensitivity to small changes in the mass spectrum introduced by the employed deconvolution method could explain some of the missing peptide identifications. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  18. Improving Correlation Algorithms to Detect and Characterize Smaller Magnitude Induced Seismicity Swarms

    NASA Astrophysics Data System (ADS)

    Skoumal, R.; Brudzinski, M.; Currie, B.

    2015-12-01

    Induced seismic sequences often occur as swarms that can include thousands of small (< M 2) earthquakes. While the identification of this microseismicity would invariably aid in the characterization and modeling of induced sequences, traditional earthquake detection techniques often provide incomplete catalogs, even when local networks are deployed. Because induced sequences often include scores of micro-earthquakes that prelude larger magnitude events, the identification of these small magnitude events would be crucial for the early identification of induced sequences. By taking advantage of the repeating, swarm-like nature of induced seismicity, a more robust catalog can be created using complementary correlation algorithms in near real-time without the reliance on traditional earthquake detection and association routines. Since traditional earthquake catalog methodologies using regional networks have a relatively high detection threshold (M 2+), we have sought to develop correlation routines that can detect smaller magnitude sequences. While short-term/long-term amplitude average detection algorithms requires significant signal-to-noise ratio at multiple stations for confident identification, a correlation detector is capable of identifying earthquakes with high confidence using just a single station. The result is an embarrassingly parallel task that can be employed for a network to be used as an early warning system for potentially induced seismicity while also better characterizing tectonic sequences beyond what traditional methods allow.

  19. Solution Hybrid Selection Capture for the Recovery of Functional Full-Length Eukaryotic cDNAs From Complex Environmental Samples

    PubMed Central

    Bragalini, Claudia; Ribière, Céline; Parisot, Nicolas; Vallon, Laurent; Prudent, Elsa; Peyretaillade, Eric; Girlanda, Mariangela; Peyret, Pierre; Marmeisse, Roland; Luis, Patricia

    2014-01-01

    Eukaryotic microbial communities play key functional roles in soil biology and potentially represent a rich source of natural products including biocatalysts. Culture-independent molecular methods are powerful tools to isolate functional genes from uncultured microorganisms. However, none of the methods used in environmental genomics allow for a rapid isolation of numerous functional genes from eukaryotic microbial communities. We developed an original adaptation of the solution hybrid selection (SHS) for an efficient recovery of functional complementary DNAs (cDNAs) synthesized from soil-extracted polyadenylated mRNAs. This protocol was tested on the Glycoside Hydrolase 11 gene family encoding endo-xylanases for which we designed 35 explorative 31-mers capture probes. SHS was implemented on four soil eukaryotic cDNA pools. After two successive rounds of capture, >90% of the resulting cDNAs were GH11 sequences, of which 70% (38 among 53 sequenced genes) were full length. Between 1.5 and 25% of the cloned captured sequences were expressed in Saccharomyces cerevisiae. Sequencing of polymerase chain reaction-amplified GH11 gene fragments from the captured sequences highlighted hundreds of phylogenetically diverse sequences that were not yet described, in public databases. This protocol offers the possibility of performing exhaustive exploration of eukaryotic gene families within microbial communities thriving in any type of environment. PMID:25281543

  20. How to Tackle the Challenge of siRNA Delivery with Sequence-Defined Oligoamino Amides.

    PubMed

    Reinhard, Sören; Wagner, Ernst

    2017-01-01

    RNA interference (RNAi) as a mechanism of gene regulation provides exciting opportunities for medical applications. Synthetic small interfering RNA (siRNA) triggers the knockdown of complementary mRNA sequences in a catalytic fashion and has to be delivered into the cytosol of the targeted cells. The design of adequate carrier systems to overcome multiple extracellular and intracellular roadblocks within the delivery process has utmost importance. Cationic polymers form polyplexes through electrostatic interaction with negatively charged nucleic acids and present a promising class of carriers. Issues of polycations regarding toxicity, heterogeneity, and polydispersity can be overcome by solid-phase-assisted synthesis of sequence-defined cationic oligomers. These medium-sized highly versatile nucleic acid carriers display low cytotoxicity and can be modified and tailored in multiple ways to meet specific requirements of nucleic acid binding, polyplex size, shielding, targeting, and intracellular release of the cargo. In this way, sequence-defined cationic oligomers can mimic the dynamic and bioresponsive behavior of viruses. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  1. The C. elegans CSR-1 argonaute pathway counteracts epigenetic silencing to promote germline gene expression.

    PubMed

    Seth, Meetu; Shirayama, Masaki; Gu, Weifeng; Ishidate, Takao; Conte, Darryl; Mello, Craig C

    2013-12-23

    Organisms can develop adaptive sequence-specific immunity by reexpressing pathogen-specific small RNAs that guide gene silencing. For example, the C. elegans PIWI-Argonaute/piwi-interacting RNA (piRNA) pathway recruits RNA-dependent RNA polymerase (RdRP) to foreign sequences to amplify a transgenerational small-RNA-induced epigenetic silencing signal (termed RNAe). Here, we provide evidence that, in addition to an adaptive memory of silenced sequences, C. elegans can also develop an opposing adaptive memory of expressed/self-mRNAs. We refer to this mechanism, which can prevent or reverse RNAe, as RNA-induced epigenetic gene activation (RNAa). We show that CSR-1, which engages RdRP-amplified small RNAs complementary to germline-expressed mRNAs, is required for RNAa. We show that a transgene with RNAa activity also exhibits accumulation of cognate CSR-1 small RNAs. Our findings suggest that C. elegans adaptively acquires and maintains a transgenerational CSR-1 memory that recognizes and protects self-mRNAs, allowing piRNAs to recognize foreign sequences innately, without the need for prior exposure

  2. A comprehensive assessment of RNA-seq accuracy, reproducibility and information content by the Sequencing Quality Control consortium

    PubMed Central

    2014-01-01

    We present primary results from the Sequencing Quality Control (SEQC) project, coordinated by the United States Food and Drug Administration. Examining Illumina HiSeq, Life Technologies SOLiD and Roche 454 platforms at multiple laboratory sites using reference RNA samples with built-in controls, we assess RNA sequencing (RNA-seq) performance for junction discovery and differential expression profiling and compare it to microarray and quantitative PCR (qPCR) data using complementary metrics. At all sequencing depths, we discover unannotated exon-exon junctions, with >80% validated by qPCR. We find that measurements of relative expression are accurate and reproducible across sites and platforms if specific filters are used. In contrast, RNA-seq and microarrays do not provide accurate absolute measurements, and gene-specific biases are observed, for these and qPCR. Measurement performance depends on the platform and data analysis pipeline, and variation is large for transcript-level profiling. The complete SEQC data sets, comprising >100 billion reads (10Tb), provide unique resources for evaluating RNA-seq analyses for clinical and regulatory settings. PMID:25150838

  3. Biosensing of BCR/ABL fusion gene using an intensity-interrogation surface plasmon resonance imaging system

    NASA Astrophysics Data System (ADS)

    Wu, Jiangling; Huang, Yu; Bian, Xintong; Li, DanDan; Cheng, Quan; Ding, Shijia

    2016-10-01

    In this work, a custom-made intensity-interrogation surface plasmon resonance imaging (SPRi) system has been developed to directly detect a specific sequence of BCR/ABL fusion gene in chronic myelogenous leukemia (CML). The variation in the reflected light intensity detected from the sensor chip composed of gold islands array is proportional to the change of refractive index due to the selective hybridization of surface-bound DNA probes with target ssDNA. SPRi measurements were performed with different concentrations of synthetic target DNA sequence. The calibration curve of synthetic target sequence shows a good relationship between the concentration of synthetic target and the change of reflected light intensity. The detection limit of this SPRi measurement could approach 10.29 nM. By comparing SPRi images, the target ssDNA and non-complementary DNA sequence are able to be distinguished. This SPRi system has been applied for assay of BCR/ABL fusion gene extracted from real samples. This nucleic acid-based SPRi biosensor therefore offers an alternative high-effective, high-throughput label-free tool for DNA detection in biomedical research and molecular diagnosis.

  4. Porcine parvovirus: DNA sequence and genome organization.

    PubMed

    Ranz, A I; Manclús, J J; Díaz-Aroca, E; Casal, J I

    1989-10-01

    We have determined the nucleotide sequence of an almost full-length clone of porcine parvovirus (PPV). The sequence is 4973 nucleotides (nt) long. The 3' end of virion DNA shows a Y-shaped configuration homologous to rodent parvoviruses. The 5' end of virion DNA shows a repetition of 127 nt at the carboxy terminus of the capsid proteins. The overall organization of the PPV genome is similar to those of other autonomous parvoviruses. There are two large open reading frames (ORFs) that almost entirely cover the genome, both located in the same frame of the complementary strand. The left ORF encodes the non-structural protein NS1 and the right ORF encodes the capsid proteins (VP1, VP2 and VP3). Promoter analysis, location of splicing sites and putative amino acid sequences for the viral proteins show a high homology of PPV with feline panleukopenia virus and canine parvoviruses (FPV and CPV) and rodent parvovirus. Therefore we conclude that PPV is related to the Kilham rat virus (KRV) group of autonomous parvoviruses formed by KRV, minute virus of mice, Lu III, H-1, FPV and CPV.

  5. Quartz crystal microbalance (QCM) affinity biosensor for genetically modified organisms (GMOs) detection.

    PubMed

    Mannelli, Ilaria; Minunni, Maria; Tombelli, Sara; Mascini, Marco

    2003-03-01

    A DNA piezoelectric sensor has been developed for the detection of genetically modified organisms (GMOs). Single stranded DNA (ssDNA) probes were immobilised on the sensor surface of a quartz crystal microbalance (QCM) device and the hybridisation between the immobilised probe and the target complementary sequence in solution was monitored. The probe sequences were internal to the sequence of the 35S promoter (P) and Nos terminator (T), which are inserted sequences in the genome of GMOs regulating the transgene expression. Two different probe immobilisation procedures were applied: (a) a thiol-dextran procedure and (b) a thiol-derivatised probe and blocking thiol procedure. The system has been optimised using synthetic oligonucleotides, which were then applied to samples of plasmidic and genomic DNA isolated from the pBI121 plasmid, certified reference materials (CRM), and real samples amplified by the polymerase chain reaction (PCR). The analytical parameters of the sensor have been investigated (sensitivity, reproducibility, lifetime etc.). The results obtained showed that both immobilisation procedures enabled sensitive and specific detection of GMOs, providing a useful tool for screening analysis in food samples.

  6. Sequence-independent construction of ordered combinatorial libraries with predefined crossover points.

    PubMed

    Jézéquel, Laetitia; Loeper, Jacqueline; Pompon, Denis

    2008-11-01

    Combinatorial libraries coding for mosaic enzymes with predefined crossover points constitute useful tools to address and model structure-function relationships and for functional optimization of enzymes based on multivariate statistics. The presented method, called sequence-independent generation of a chimera-ordered library (SIGNAL), allows easy shuffling of any predefined amino acid segment between two or more proteins. This method is particularly well adapted to the exchange of protein structural modules. The procedure could also be well suited to generate ordered combinatorial libraries independent of sequence similarities in a robotized manner. Sequence segments to be recombined are first extracted by PCR from a single-stranded template coding for an enzyme of interest using a biotin-avidin-based method. This technique allows the reduction of parental template contamination in the final library. Specific PCR primers allow amplification of two complementary mosaic DNA fragments, overlapping in the region to be exchanged. Fragments are finally reassembled using a fusion PCR. The process is illustrated via the construction of a set of mosaic CYP2B enzymes using this highly modular approach.

  7. The C. elegans CSR-1 Argonaute pathway counteracts epigenetic silencing to promote germline gene expression

    PubMed Central

    Seth, Meetu; Shirayama, Masaki; Gu, Weifeng; Ishidate, Takao; Conte, Darryl; Mello, Craig C.

    2014-01-01

    SUMMARY Organisms can develop adaptive sequence-specific immunity by re-expressing pathogen-specific small RNAs that guide gene silencing. For example, the C. elegans PIWI-Argonaute/piRNA pathway recruits RNA-dependent RNA polymerase RdRP to foreign sequences to amplify a trans-generational small RNA-induced epigenetic silencing signal (termed RNAe). Here we provide evidence that in addition to an adaptive memory of silenced sequences, C. elegans can also develop an opposing adaptive memory of expressed/self mRNAs. We refer to this mechanism, which can prevent or reverse RNAe as RNA-induced epigenetic gene activation (RNAa). We show that CSR-1, which engages RdRP-amplified small RNAs complementary to germline-expressed mRNAs, is required for RNAa. We show that a transgene with RNAa activity also exhibits accumulation of cognate CSR-1 small RNAs. Our findings suggest that C. elegans adaptively acquires and maintains a trans-generational CSR-1 memory that recognizes and protects self mRNAs, allowing piRNAs to recognize foreign sequences innately, without need for prior exposure. PMID:24360782

  8. Rational Protein Engineering Guided by Deep Mutational Scanning

    PubMed Central

    Shin, HyeonSeok; Cho, Byung-Kwan

    2015-01-01

    Sequence–function relationship in a protein is commonly determined by the three-dimensional protein structure followed by various biochemical experiments. However, with the explosive increase in the number of genome sequences, facilitated by recent advances in sequencing technology, the gap between protein sequences available and three-dimensional structures is rapidly widening. A recently developed method termed deep mutational scanning explores the functional phenotype of thousands of mutants via massive sequencing. Coupled with a highly efficient screening system, this approach assesses the phenotypic changes made by the substitution of each amino acid sequence that constitutes a protein. Such an informational resource provides the functional role of each amino acid sequence, thereby providing sufficient rationale for selecting target residues for protein engineering. Here, we discuss the current applications of deep mutational scanning and consider experimental design. PMID:26404267

  9. Gate sequence for continuous variable one-way quantum computation

    PubMed Central

    Su, Xiaolong; Hao, Shuhong; Deng, Xiaowei; Ma, Lingyu; Wang, Meihong; Jia, Xiaojun; Xie, Changde; Peng, Kunchi

    2013-01-01

    Measurement-based one-way quantum computation using cluster states as resources provides an efficient model to perform computation and information processing of quantum codes. Arbitrary Gaussian quantum computation can be implemented sufficiently by long single-mode and two-mode gate sequences. However, continuous variable gate sequences have not been realized so far due to an absence of cluster states larger than four submodes. Here we present the first continuous variable gate sequence consisting of a single-mode squeezing gate and a two-mode controlled-phase gate based on a six-mode cluster state. The quantum property of this gate sequence is confirmed by the fidelities and the quantum entanglement of two output modes, which depend on both the squeezing and controlled-phase gates. The experiment demonstrates the feasibility of implementing Gaussian quantum computation by means of accessible gate sequences.

  10. Transforming clinical microbiology with bacterial genome sequencing.

    PubMed

    Didelot, Xavier; Bowden, Rory; Wilson, Daniel J; Peto, Tim E A; Crook, Derrick W

    2012-09-01

    Whole-genome sequencing of bacteria has recently emerged as a cost-effective and convenient approach for addressing many microbiological questions. Here, we review the current status of clinical microbiology and how it has already begun to be transformed by using next-generation sequencing. We focus on three essential tasks: identifying the species of an isolate, testing its properties, such as resistance to antibiotics and virulence, and monitoring the emergence and spread of bacterial pathogens. We predict that the application of next-generation sequencing will soon be sufficiently fast, accurate and cheap to be used in routine clinical microbiology practice, where it could replace many complex current techniques with a single, more efficient workflow.

  11. Transforming clinical microbiology with bacterial genome sequencing

    PubMed Central

    2016-01-01

    Whole genome sequencing of bacteria has recently emerged as a cost-effective and convenient approach for addressing many microbiological questions. Here we review the current status of clinical microbiology and how it has already begun to be transformed by the use of next-generation sequencing. We focus on three essential tasks: identifying the species of an isolate, testing its properties such as resistance to antibiotics and virulence, and monitoring the emergence and spread of bacterial pathogens. The application of next-generation sequencing will soon be sufficiently fast, accurate and cheap to be used in routine clinical microbiology practice, where it could replace many complex current techniques with a single, more efficient workflow. PMID:22868263

  12. The hormone response element mimic sequence of GAS5 lncRNA is sufficient to induce apoptosis in breast cancer cells

    PubMed Central

    Pickard, Mark R.; Williams, Gwyn T.

    2016-01-01

    Growth arrest-specific 5 (GAS5) lncRNA promotes apoptosis, and its expression is down-regulated in breast cancer. GAS5 lncRNA is a decoy of glucocorticoid/related receptors; a stem-loop sequence constitutes the GAS5 hormone response element mimic (HREM), which is essential for the regulation of breast cancer cell apoptosis. This preclinical study aimed to determine if the GAS5 HREM sequence alone promotes the apoptosis of breast cancer cells. Nucleofection of hormone-sensitive and –insensitive breast cancer cell lines with a GAS5 HREM DNA oligonucleotide increased both basal and ultraviolet-C-induced apoptosis, and decreased culture viability and clonogenic growth, similar to GAS5 lncRNA. The HREM oligonucleotide demonstrated similar sequence specificity to the native HREM for its functional activity and had no effect on endogenous GAS5 lncRNA levels. Certain chemically modified HREM oligonucleotides, notably DNA and RNA phosphorothioates, retained pro-apoptotic. activity. Crucially the HREM oligonucleotide could overcome apoptosis resistance secondary to deficient endogenous GAS5 lncRNA levels. Thus, the GAS5 lncRNA HREM sequence alone is sufficient to induce apoptosis in breast cancer cells, including triple-negative breast cancer cells. These findings further suggest that emerging knowledge of structure/function relationships in the field of lncRNA biology can be exploited for the development of entirely novel, oligonucleotide mimic-based, cancer therapies. PMID:26862727

  13. Ultraaccurate genome sequencing and haplotyping of single human cells.

    PubMed

    Chu, Wai Keung; Edge, Peter; Lee, Ho Suk; Bansal, Vikas; Bafna, Vineet; Huang, Xiaohua; Zhang, Kun

    2017-11-21

    Accurate detection of variants and long-range haplotypes in genomes of single human cells remains very challenging. Common approaches require extensive in vitro amplification of genomes of individual cells using DNA polymerases and high-throughput short-read DNA sequencing. These approaches have two notable drawbacks. First, polymerase replication errors could generate tens of thousands of false-positive calls per genome. Second, relatively short sequence reads contain little to no haplotype information. Here we report a method, which is dubbed SISSOR (single-stranded sequencing using microfluidic reactors), for accurate single-cell genome sequencing and haplotyping. A microfluidic processor is used to separate the Watson and Crick strands of the double-stranded chromosomal DNA in a single cell and to randomly partition megabase-size DNA strands into multiple nanoliter compartments for amplification and construction of barcoded libraries for sequencing. The separation and partitioning of large single-stranded DNA fragments of the homologous chromosome pairs allows for the independent sequencing of each of the complementary and homologous strands. This enables the assembly of long haplotypes and reduction of sequence errors by using the redundant sequence information and haplotype-based error removal. We demonstrated the ability to sequence single-cell genomes with error rates as low as 10 -8 and average 500-kb-long DNA fragments that can be assembled into haplotype contigs with N50 greater than 7 Mb. The performance could be further improved with more uniform amplification and more accurate sequence alignment. The ability to obtain accurate genome sequences and haplotype information from single cells will enable applications of genome sequencing for diverse clinical needs. Copyright © 2017 the Author(s). Published by PNAS.

  14. Comparison of methods for calculating conditional expectations of sufficient statistics for continuous time Markov chains.

    PubMed

    Tataru, Paula; Hobolth, Asger

    2011-12-05

    Continuous time Markov chains (CTMCs) is a widely used model for describing the evolution of DNA sequences on the nucleotide, amino acid or codon level. The sufficient statistics for CTMCs are the time spent in a state and the number of changes between any two states. In applications past evolutionary events (exact times and types of changes) are unaccessible and the past must be inferred from DNA sequence data observed in the present. We describe and implement three algorithms for computing linear combinations of expected values of the sufficient statistics, conditioned on the end-points of the chain, and compare their performance with respect to accuracy and running time. The first algorithm is based on an eigenvalue decomposition of the rate matrix (EVD), the second on uniformization (UNI), and the third on integrals of matrix exponentials (EXPM). The implementation in R of the algorithms is available at http://www.birc.au.dk/~paula/. We use two different models to analyze the accuracy and eight experiments to investigate the speed of the three algorithms. We find that they have similar accuracy and that EXPM is the slowest method. Furthermore we find that UNI is usually faster than EVD.

  15. Production Scheduling of Sequenced Tapes for Printed Circuit Pack Assembly.

    DTIC Science & Technology

    1987-07-09

    detail. L j 6 The subject matter of this thesis is inspired directly from their technical report. The goals of this research are twofold: 1) Test their...The subject matter of the following chapters describes a heuristic approach to another variation of the sequenced tape production scheduling problem...assignment problem, comprise the subject matter of Chapter 5. It is sufficient to note that the three definitions of the term common correspond to the

  16. Conditions for the invertibility of the nonlinear difference operator (\\mathscr Rx)(n)=H(x(n),x(n+1)), n\\in\\mathbb Z, in the space of bounded number sequences

    NASA Astrophysics Data System (ADS)

    Slyusarchuk, Vasilii E.

    2009-02-01

    Necessary and sufficient conditions are found for the invertibility of the nonlinear difference operator \\displaystyle (\\mathscr Rx)(n)=H(x(n),x(n+1)),\\qquad n\\in\\mathbb Z, in the space of bounded two-sided number sequences. Here H\\colon \\mathbb R^2\\to \\mathbb R is a continuous function. Bibliography: 29 titles.

  17. Augmentation of machine structure to improve its diagnosability

    NASA Technical Reports Server (NTRS)

    Hsieh, L.

    1973-01-01

    Two methods of augmenting the structure of a sequential machine so that it is diagnosable are presented. The checkable (checking sequences) and repeated symbol distinguishing sequences (RDS) are discussed. It was found that as few as twice the number of outputs of the given machine is sufficient for constructing a state-output augmentation with RDS. Techniques for minimizing the number of states in resolving convergences and in resolving equivalent and nonreduced cycles are developed.

  18. Photometric binary stars in Praesepe and the search for globular cluster binaries

    NASA Technical Reports Server (NTRS)

    Bolte, Michael

    1991-01-01

    A radial velocity study of the stars which are located on a second sequence above the single-star zero-age main sequence at a given color in the color-magnitude diagram of the open cluster Praesepe, (NGC 2632) shows that 10, and possibly 11, of 17 are binary systems. Of the binary systems, five have full amplitudes for their velocity variations that are greater than 50 km/s. To the extent that they can be applied to globular clusters, these results suggests that (1) observations of 'second-sequence' stars in globular clusters would be an efficient way of finding main-sequence binary systems in globulars, and (2) current instrumentation on large telescopes is sufficient for establishing unambiguously the existence of main-sequence binary systems in nearby globular clusters.

  19. Gallium plasmonic nanoparticles for label-free DNA and single nucleotide polymorphism sensing

    NASA Astrophysics Data System (ADS)

    Marín, Antonio García; García-Mendiola, Tania; Bernabeu, Cristina Navio; Hernández, María Jesús; Piqueras, Juan; Pau, Jose Luis; Pariente, Félix; Lorenzo, Encarnación

    2016-05-01

    A label-free DNA and single nucleotide polymorphism (SNP) sensing method is described. It is based on the use of the pseudodielectric function of gallium plasmonic nanoparticles (GaNPs) deposited on Si (100) substrates under reversal of the polarization handedness condition. Under this condition, the pseudodielectric function is extremely sensitive to changes in the surrounding medium of the nanoparticle surface providing an excellent sensing platform competitive to conventional surface plasmon resonance. DNA sensing has been carried out by immobilizing a thiolated capture probe sequence from Helicobacter pylori onto GaNP/Si substrates; complementary target sequences of Helicobacter pylori can be quantified over the range of 10 pM to 3.0 nM with a detection limit of 6.0 pM and a linear correlation coefficient of R2 = 0.990. The selectivity of the device allows the detection of a single nucleotide polymorphism (SNP) in a specific sequence of Helicobacter pylori, without the need for a hybridization suppressor in solution such as formamide. Furthermore, it also allows the detection of this sequence in the presence of other pathogens, such as Escherichia coli in the sample. The broad applicability of the system was demonstrated by the detection of a specific gene mutation directly associated with cystic fibrosis in large genomic DNA isolated from blood cells.A label-free DNA and single nucleotide polymorphism (SNP) sensing method is described. It is based on the use of the pseudodielectric function of gallium plasmonic nanoparticles (GaNPs) deposited on Si (100) substrates under reversal of the polarization handedness condition. Under this condition, the pseudodielectric function is extremely sensitive to changes in the surrounding medium of the nanoparticle surface providing an excellent sensing platform competitive to conventional surface plasmon resonance. DNA sensing has been carried out by immobilizing a thiolated capture probe sequence from Helicobacter pylori onto GaNP/Si substrates; complementary target sequences of Helicobacter pylori can be quantified over the range of 10 pM to 3.0 nM with a detection limit of 6.0 pM and a linear correlation coefficient of R2 = 0.990. The selectivity of the device allows the detection of a single nucleotide polymorphism (SNP) in a specific sequence of Helicobacter pylori, without the need for a hybridization suppressor in solution such as formamide. Furthermore, it also allows the detection of this sequence in the presence of other pathogens, such as Escherichia coli in the sample. The broad applicability of the system was demonstrated by the detection of a specific gene mutation directly associated with cystic fibrosis in large genomic DNA isolated from blood cells. Electronic supplementary information (ESI) available. See DOI: 10.1039/c6nr00926c

  20. VaDiR: an integrated approach to Variant Detection in RNA.

    PubMed

    Neums, Lisa; Suenaga, Seiji; Beyerlein, Peter; Anders, Sara; Koestler, Devin; Mariani, Andrea; Chien, Jeremy

    2018-02-01

    Advances in next-generation DNA sequencing technologies are now enabling detailed characterization of sequence variations in cancer genomes. With whole-genome sequencing, variations in coding and non-coding sequences can be discovered. But the cost associated with it is currently limiting its general use in research. Whole-exome sequencing is used to characterize sequence variations in coding regions, but the cost associated with capture reagents and biases in capture rate limit its full use in research. Additional limitations include uncertainty in assigning the functional significance of the mutations when these mutations are observed in the non-coding region or in genes that are not expressed in cancer tissue. We investigated the feasibility of uncovering mutations from expressed genes using RNA sequencing datasets with a method called Variant Detection in RNA(VaDiR) that integrates 3 variant callers, namely: SNPiR, RVBoost, and MuTect2. The combination of all 3 methods, which we called Tier 1 variants, produced the highest precision with true positive mutations from RNA-seq that could be validated at the DNA level. We also found that the integration of Tier 1 variants with those called by MuTect2 and SNPiR produced the highest recall with acceptable precision. Finally, we observed a higher rate of mutation discovery in genes that are expressed at higher levels. Our method, VaDiR, provides a possibility of uncovering mutations from RNA sequencing datasets that could be useful in further functional analysis. In addition, our approach allows orthogonal validation of DNA-based mutation discovery by providing complementary sequence variation analysis from paired RNA/DNA sequencing datasets.

  1. The role of differing probe and target strand lengths in DNA microarrays investigated via Monte Carlo molecular simulation

    NASA Astrophysics Data System (ADS)

    Rivard, Brea R.; Cooper, Sarah J.; Stubbs, John M.

    2018-02-01

    DNA duplexes consisting of a 25mer together with shorter complementary sequences were studied over a range of temperature and surface binding motifs using a coarse-grained two-site nucleotide model. Results were analyzed in terms of hydrogen bonding interactions and structural characteristics and indicate that hybridization is most stable when furthest from the surface binding site. Strand elongation and straightening near the bound end are found to be correlated to duplex destabilization.

  2. Single Molecule Nano-Metronome

    PubMed Central

    Buranachai, Chittanon; McKinney, Sean A.; Ha, Taekjip

    2008-01-01

    We constructed a DNA-based nano-mechanical device called the nano-metronome. Our device is made by introducing complementary single stranded overhangs at the two arms of the DNA four-way junction. The ticking rates of this stochastic metronome depend on ion concentrations and can be changed by a set of DNA-based switches to deactivate/reactivate the sticky end. Since the device displays clearly distinguishable responses even with a single basepair difference, it may lead to a single molecule sensor of minute sequence differences of a target DNA. PMID:16522050

  3. Normalized cDNA libraries

    DOEpatents

    Soares, Marcelo B.; Efstratiadis, Argiris

    1997-01-01

    This invention provides a method to normalize a directional cDNA library constructed in a vector that allows propagation in single-stranded circle form comprising: (a) propagating the directional cDNA library in single-stranded circles; (b) generating fragments complementary to the 3' noncoding sequence of the single-stranded circles in the library to produce partial duplexes; (c) purifying the partial duplexes; (d) melting and reassociating the purified partial duplexes to moderate Cot; and (e) purifying the unassociated single-stranded circles, thereby generating a normalized cDNA library.

  4. Normalized cDNA libraries

    DOEpatents

    Soares, M.B.; Efstratiadis, A.

    1997-06-10

    This invention provides a method to normalize a directional cDNA library constructed in a vector that allows propagation in single-stranded circle form comprising: (a) propagating the directional cDNA library in single-stranded circles; (b) generating fragments complementary to the 3{prime} noncoding sequence of the single-stranded circles in the library to produce partial duplexes; (c) purifying the partial duplexes; (d) melting and reassociating the purified partial duplexes to moderate Cot; and (e) purifying the unassociated single-stranded circles, thereby generating a normalized cDNA library. 4 figs.

  5. Characterizing genomic alterations in cancer by complementary functional associations | Office of Cancer Genomics

    Cancer.gov

    Systematic efforts to sequence the cancer genome have identified large numbers of mutations and copy number alterations in human cancers. However, elucidating the functional consequences of these variants, and their interactions to drive or maintain oncogenic states, remains a challenge in cancer research. We developed REVEALER, a computational method that identifies combinations of mutually exclusive genomic alterations correlated with functional phenotypes, such as the activation or gene dependency of oncogenic pathways or sensitivity to a drug treatment.

  6. Chapter 29: Unproved and controversial methods and theories in allergy-immunology.

    PubMed

    Shah, Rachna; Greenberger, Paul A

    2012-01-01

    Unproved methods and controversial theories in the diagnosis and management of allergy-immunology are those that lack scientific credibility. Some definitions are provided for perspective because in chronic medical conditions, frequently, nonscientifically based treatments are developed that can have a very positive psychological effect on the patients in the absence of objective physical benefit. Standard practice can be described as "the methods of diagnosis and treatment used by reputable physicians in a particular subspecialty or primary care practice" with the understanding that diagnosis and treatment options are consistent with established mechanisms of conditions or diseases.(3) Conventional medicine (Western or allopathic medicine) is that which is practiced by the majority of MDs, DOs, psychologists, RNs, and physical therapists. Complementary medicine uses the practice of conventional medicine with complementary and alternative medicine such as using acupuncture for pain relief in addition to opioids. Alternative medicine implies use of complementary and alternative practices in place of conventional medicine. Unproved and controversial methods and theories do not have supporting data, validation, and sufficient scientific scrutiny, and they should not be used in the practice of allergy-immunology. Some examples of unproven theories about allergic immunologic conditions include allergic toxemia, idiopathic environmental intolerance, association with childhood vaccinations, and adrenal fatigue. Unconventional (unproved) diagnostic methods for allergic-immunologic conditions include cytotoxic tests, provocation-neutralization, electrodermal diagnosis, applied kinesiology assessments, and serum IgG or IgG(4) testing. Unproven treatments and intervention methods for allergic-immunologic conditions include acupuncture, homeopathy ("likes cure likes"), halotherapy, and autologous urine injections.

  7. A combined de novo protein sequencing and cDNA library approach to the venomic analysis of Chinese spider Araneus ventricosus.

    PubMed

    Duan, Zhigui; Cao, Rui; Jiang, Liping; Liang, Songping

    2013-01-14

    In past years, spider venoms have attracted increasing attention due to their extraordinary chemical and pharmacological diversity. The recently popularized proteomic method highly improved our ability to analyze the proteins in the venom. However, the lack of information about isolated venom proteins sequences dramatically limits the ability to confidently identify venom proteins. In the present paper, the venom from Araneus ventricosus was analyzed using two complementary approaches: 2-DE/Shotgun-LC-MS/MS coupled to MASCOT search and 2-DE/Shotgun-LC-MS/MS coupled to manual de novo sequencing followed by local venom protein database (LVPD) search. The LVPD was constructed with toxin-like protein sequences obtained from the analysis of cDNA library from A. ventricosus venom glands. Our results indicate that a total of 130 toxin-like protein sequences were unambiguously identified by manual de novo sequencing coupled to LVPD search, accounting for 86.67% of all toxin-like proteins in LVPD. Thus manual de novo sequencing coupled to LVPD search was proved an extremely effective approach for the analysis of venom proteins. In addition, the approach displays impeccable advantage in validating mutant positions of isoforms from the same toxin-like family. Intriguingly, methyl esterifcation of glutamic acid was discovered for the first time in animal venom proteins by manual de novo sequencing. Crown Copyright © 2012. Published by Elsevier B.V. All rights reserved.

  8. Evaluation of the nutritional characteristics of a finger millet based complementary food.

    PubMed

    Mbithi-Mwikya, Stephen; Van Camp, John; Mamiro, Peter R S; Ooghe, Wilfried; Kolsteren, Patrick; Huyghebaert, Andre

    2002-05-08

    Finger millet (Eleusine coracana), kidney beans (Phaseolus vulgaris), peanuts (Arachis hypogoea), and mango (Mangifera indica) were processed separately and then combined, on the basis of their amino acid scores and energy content, into a complementary food for children of weaning age. The finger millet and kidney beans were processed by germination, autoclaving, and lactic acid fermentation. A mixture containing, on a dry matter basis, 65.2, 19.1, 8.0, and 7.7% of the processed finger millet, kidney beans, peanuts, and mango, respectively, gave a composite protein with an in vitro protein digestibility of 90.2% and an amino acid chemical score of 0.84. This mixture had an energy density of 16.3 kJ.g(-1) of dry matter and a decreased antinutrient content and showed a measurable improvement in the in vitro extractability for calcium, iron, and zinc. A 33% (w/v) pap made from a mix of the processed ingredients had an energy density of 5.4 kJ.g(-1) of pap, which is sufficient to meet the energy requirements of well-nourished children of 6-24 months of age at three servings a day and at the FAO average breast-feeding frequency.

  9. Herbal and nutrient complementary medicines for weight loss: community pharmacists' practices, attitudes, recommendations, information and education needs.

    PubMed

    Taing, Meng-Wong; Tan, Eunice Tze Xin; Williams, Gail M; Clavarino, Alexandra M; McGuire, Treasure M

    2016-05-01

    To investigate pharmacists' herbal/nutrient weight loss complementary medicine (WLCM) practices in the context of other pharmacist weight management support practices (provision of lifestyle advice, orlistat and meal replacement treatments); and gain insight into their attitudes, recommendations, information and education needs. Pharmacists from a randomly selected sample of 214 community pharmacies from different socioeconomic areas in the Greater Brisbane region, Australia, were invited to complete a survey to explore their weight management practices, with a specific focus on herbal/nutrient WLCM practices. Data collected from the sample group represented pharmacist practices within the metropolitan Greater Brisbane region. This survey achieved a 51% response rate. During weight management consultations, a high proportion of customers (37%) sought advice from community pharmacists relating to WLCMs relative to other weight management practices; however, only a small proportion (10%) of pharmacists recommended them. Most were also found to be using resources that may not be evidence-based or do not provide sufficient WLCMs' information. Study results highlight the need for pharmacy professional bodies to develop evidence-based continuing education programmes to assist consumers with popular and widely available WLCMs products. © 2015 Royal Pharmaceutical Society.

  10. Estimating the efficiency of fish cross-species cDNA microarray hybridization.

    PubMed

    Cohen, Raphael; Chalifa-Caspi, Vered; Williams, Timothy D; Auslander, Meirav; George, Stephen G; Chipman, James K; Tom, Moshe

    2007-01-01

    Using an available cross-species cDNA microarray is advantageous for examining multigene expression patterns in non-model organisms, saving the need for construction of species-specific arrays. The aim of the present study was to estimate relative efficiency of cross-species hybridizations across bony fishes, using bioinformatics tools. The methodology may serve also as a model for similar evaluations in other taxa. The theoretical evaluation was done by substituting comparative whole-transcriptome sequence similarity information into the thermodynamic hybridization equation. Complementary DNA sequence assemblages of nine fish species belonging to common families or suborders and distributed across the bony fish taxonomic branch were selected for transcriptome-wise comparisons. Actual cross-species hybridizations among fish of different taxonomic distances were used to validate and eventually to calibrate the theoretically computed relative efficiencies.

  11. Biochemical identification of Argonaute 2 as the sole protein required for RNA-induced silencing complex activity

    PubMed Central

    Rand, Tim A.; Ginalski, Krzysztof; Grishin, Nick V.; Wang, Xiaodong

    2004-01-01

    RNA interference is carried out by the small double-stranded RNA-induced silencing complex (RISC). The RISC-bound small RNA guides the RISC complex to identify and cleave mRNAs with complementary sequences. The proteins that make up the RISC complex and cleave mRNA have not been unequivocally defined. Here, we report the biochemical purification of RISC activity to homogeneity from Drosophila Schnieder 2 cell extracts. Argonaute 2 (Ago-2) is the sole protein component present in the purified, functional RISC. By using a bioinformatics method that combines sequence-profile analysis with predicted protein secondary structure, we found homology between the PIWI domain of Ago-2 and endonuclease V and identified potential active-site amino acid residues within the PIWI domain of Ago-2. PMID:15452342

  12. Biochemical identification of Argonaute 2 as the sole protein required for RNA-induced silencing complex activity.

    PubMed

    Rand, Tim A; Ginalski, Krzysztof; Grishin, Nick V; Wang, Xiaodong

    2004-10-05

    RNA interference is carried out by the small double-stranded RNA-induced silencing complex (RISC). The RISC-bound small RNA guides the RISC complex to identify and cleave mRNAs with complementary sequences. The proteins that make up the RISC complex and cleave mRNA have not been unequivocally defined. Here, we report the biochemical purification of RISC activity to homogeneity from Drosophila Schnieder 2 cell extracts. Argonaute 2 (Ago-2) is the sole protein component present in the purified, functional RISC. By using a bioinformatics method that combines sequence-profile analysis with predicted protein secondary structure, we found homology between the PIWI domain of Ago-2 and endonuclease V and identified potential active-site amino acid residues within the PIWI domain of Ago-2.

  13. Xenopus laevis ribosomal protein genes: isolation of recombinant cDNA clones and study of the genomic organization.

    PubMed Central

    Bozzoni, I; Beccari, E; Luo, Z X; Amaldi, F

    1981-01-01

    Poly-A+ mRNA from Xenopus laevis oocytes, partially enriched for r-protein coding capacity has been used as starting material for preparing a cDNA bank in plasmid pBR322. The clones containing sequences specific for r-proteins have been selected by translation of the complementary mRNAs. Clones for six different r-proteins have been identified and utilized as probes for studying their genomic organization. Two gene copies per haploid genome were found for r-proteins L1, L14, S19, and four-five for protein S1, S8 and L32. Moreover a population polymorphism has been observed for the genomic regions containing sequences for r-protein S1, S8 and L14. Images PMID:6112733

  14. The Limits of Template-Directed Synthesis with Nucleoside-5'-Phosphoro(2-Methyl) Imidazolides

    NASA Technical Reports Server (NTRS)

    Hill, Aubrey R., Jr.; Orgel, Leslie E.; Wu, Taifeng

    1993-01-01

    In earlier work we have shown that C-rich templates containing isolated A, T or G residues and short oligo(G) sequences can be copied effectively using nucleoside-5'-phosphoro(2-methyl)imidazolides as substrates. We now show that isolated A or T residues within an oligo(G) sequence are a complete block to copying and that an isolated C residue is copied inefficiently. Replication is possible only if there are two complementary oligonucleotides each of which acts as a template to facilitate the synthesis of the other. We emphasize the severity of the problems that need to be overcome to make possible non-enzymatic replication in homogeneous aqueous solution. We conclude that an efficient catalyst was involved in the origin of polynucleotide replication.

  15. A Novel Motion Compensation Method for Random Stepped Frequency Radar with M-sequence

    NASA Astrophysics Data System (ADS)

    Liao, Zhikun; Hu, Jiemin; Lu, Dawei; Zhang, Jun

    2018-01-01

    The random stepped frequency radar is a new kind of synthetic wideband radar. In the research, it has been found that it possesses a thumbtack-like ambiguity function which is considered to be the ideal one. This also means that only a precise motion compensation could result in the correct high resolution range profile. In this paper, we will introduce the random stepped frequency radar coded by M-sequence firstly and briefly analyse the effect of relative motion between target and radar on the distance imaging, which is called defocusing problem. Then, a novel motion compensation method, named complementary code cancellation, will be put forward to solve this problem. Finally, the simulated experiments will demonstrate its validity and the computational analysis will show up its efficiency.

  16. Metagenomic discovery of biomass-degrading genes and genomes from cow rumen.

    PubMed

    Hess, Matthias; Sczyrba, Alexander; Egan, Rob; Kim, Tae-Wan; Chokhawala, Harshal; Schroth, Gary; Luo, Shujun; Clark, Douglas S; Chen, Feng; Zhang, Tao; Mackie, Roderick I; Pennacchio, Len A; Tringe, Susannah G; Visel, Axel; Woyke, Tanja; Wang, Zhong; Rubin, Edward M

    2011-01-28

    The paucity of enzymes that efficiently deconstruct plant polysaccharides represents a major bottleneck for industrial-scale conversion of cellulosic biomass into biofuels. Cow rumen microbes specialize in degradation of cellulosic plant material, but most members of this complex community resist cultivation. To characterize biomass-degrading genes and genomes, we sequenced and analyzed 268 gigabases of metagenomic DNA from microbes adherent to plant fiber incubated in cow rumen. From these data, we identified 27,755 putative carbohydrate-active genes and expressed 90 candidate proteins, of which 57% were enzymatically active against cellulosic substrates. We also assembled 15 uncultured microbial genomes, which were validated by complementary methods including single-cell genome sequencing. These data sets provide a substantially expanded catalog of genes and genomes participating in the deconstruction of cellulosic biomass.

  17. Recent research on anidolic daylighting systems: highly reflective coating materials and chronobiological properties

    NASA Astrophysics Data System (ADS)

    Linhart, Friedrich; Wittkopf, Stephen K.; Münch, Mirjam; Scartezzini, Jean-Louis

    2009-08-01

    Making daylight more available in buildings is highly desirable for reasons of energy efficiency, visual comfort, occupant well-being and health. The Anidolic Integrated Ceiling (AIC) is a highly efficient daylighting system, designed to gather and redirect daylight from the outside of a building into its interior with minimal losses. The reflective coating materials used within AICs have a major impact on the optical efficiency of such systems. The first part of our article presents a new computer model of an AIC consisting of more than 30 distinct components. We discuss on which of them the use of expensive, highly reflective coatings makes the most sense. We conclude that coating the component "Anidolic element 1" is always a good choice and that considerable financial savings can be obtained by following an appropriate optimization sequence.The second part of our article discusses chronobiological properties of Anidolic Daylighting Systems (ADS). We recorded daytime irradiance values for several weeks from March to May 2009 in an experimental office setup in our laboratory using a portable digital spectroradiometer. Our results showed to which extent different sky conditions influenced daylight exposure of office workers in an ADS-equipped office room. We conclude that for the tested ADS-equipped office room, daylight supply can be considered largely sufficient during long periods on most working days. However, complementary artificial lighting with blue-enriched polychromatic fluorescent tubes might be useful on days with predominantly overcast skies as well as before 09:00 and after 16:30 on all days.

  18. Identification of loci governing eight agronomic traits using a GBS-GWAS approach and validation by QTL mapping in soya bean.

    PubMed

    Sonah, Humira; O'Donoughue, Louise; Cober, Elroy; Rajcan, Istvan; Belzile, François

    2015-02-01

    Soya bean is a major source of edible oil and protein for human consumption as well as animal feed. Understanding the genetic basis of different traits in soya bean will provide important insights for improving breeding strategies for this crop. A genome-wide association study (GWAS) was conducted to accelerate molecular breeding for the improvement of agronomic traits in soya bean. A genotyping-by-sequencing (GBS) approach was used to provide dense genome-wide marker coverage (>47,000 SNPs) for a panel of 304 short-season soya bean lines. A subset of 139 lines, representative of the diversity among these, was characterized phenotypically for eight traits under six environments (3 sites × 2 years). Marker coverage proved sufficient to ensure highly significant associations between the genes known to control simple traits (flower, hilum and pubescence colour) and flanking SNPs. Between one and eight genomic loci associated with more complex traits (maturity, plant height, seed weight, seed oil and protein) were also identified. Importantly, most of these GWAS loci were located within genomic regions identified by previously reported quantitative trait locus (QTL) for these traits. In some cases, the reported QTLs were also successfully validated by additional QTL mapping in a biparental population. This study demonstrates that integrating GBS and GWAS can be used as a powerful complementary approach to classical biparental mapping for dissecting complex traits in soya bean. © 2014 Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd.

  19. Leaderless Transcripts and Small Proteins Are Common Features of the Mycobacterial Translational Landscape

    PubMed Central

    Lapierre, Pascal; Mir, Mushtaq; Chase, Michael R.; Pyle, Margaret M.; Gawande, Richa; Ahmad, Rushdy; Sarracino, David A.; Ioerger, Thomas R.; Fortune, Sarah M.; Derbyshire, Keith M.; Wade, Joseph T.; Gray, Todd A.

    2015-01-01

    RNA-seq technologies have provided significant insight into the transcription networks of mycobacteria. However, such studies provide no definitive information on the translational landscape. Here, we use a combination of high-throughput transcriptome and proteome-profiling approaches to more rigorously understand protein expression in two mycobacterial species. RNA-seq and ribosome profiling in Mycobacterium smegmatis, and transcription start site (TSS) mapping and N-terminal peptide mass spectrometry in Mycobacterium tuberculosis, provide complementary, empirical datasets to examine the congruence of transcription and translation in the Mycobacterium genus. We find that nearly one-quarter of mycobacterial transcripts are leaderless, lacking a 5’ untranslated region (UTR) and Shine-Dalgarno ribosome-binding site. Our data indicate that leaderless translation is a major feature of mycobacterial genomes and is comparably robust to leadered initiation. Using translational reporters to systematically probe the cis-sequence requirements of leaderless translation initiation in mycobacteria, we find that an ATG or GTG at the mRNA 5’ end is both necessary and sufficient. This criterion, together with our ribosome occupancy data, suggests that mycobacteria encode hundreds of small, unannotated proteins at the 5’ ends of transcripts. The conservation of small proteins in both mycobacterial species tested suggests that some play important roles in mycobacterial physiology. Our translational-reporter system further indicates that mycobacterial leadered translation initiation requires a Shine Dalgarno site in the 5’ UTR and that ATG, GTG, TTG, and ATT codons can robustly initiate translation. Our combined approaches provide the first comprehensive view of mycobacterial gene structures and their non-canonical mechanisms of protein expression. PMID:26536359

  20. Leaderless Transcripts and Small Proteins Are Common Features of the Mycobacterial Translational Landscape.

    PubMed

    Shell, Scarlet S; Wang, Jing; Lapierre, Pascal; Mir, Mushtaq; Chase, Michael R; Pyle, Margaret M; Gawande, Richa; Ahmad, Rushdy; Sarracino, David A; Ioerger, Thomas R; Fortune, Sarah M; Derbyshire, Keith M; Wade, Joseph T; Gray, Todd A

    2015-11-01

    RNA-seq technologies have provided significant insight into the transcription networks of mycobacteria. However, such studies provide no definitive information on the translational landscape. Here, we use a combination of high-throughput transcriptome and proteome-profiling approaches to more rigorously understand protein expression in two mycobacterial species. RNA-seq and ribosome profiling in Mycobacterium smegmatis, and transcription start site (TSS) mapping and N-terminal peptide mass spectrometry in Mycobacterium tuberculosis, provide complementary, empirical datasets to examine the congruence of transcription and translation in the Mycobacterium genus. We find that nearly one-quarter of mycobacterial transcripts are leaderless, lacking a 5' untranslated region (UTR) and Shine-Dalgarno ribosome-binding site. Our data indicate that leaderless translation is a major feature of mycobacterial genomes and is comparably robust to leadered initiation. Using translational reporters to systematically probe the cis-sequence requirements of leaderless translation initiation in mycobacteria, we find that an ATG or GTG at the mRNA 5' end is both necessary and sufficient. This criterion, together with our ribosome occupancy data, suggests that mycobacteria encode hundreds of small, unannotated proteins at the 5' ends of transcripts. The conservation of small proteins in both mycobacterial species tested suggests that some play important roles in mycobacterial physiology. Our translational-reporter system further indicates that mycobacterial leadered translation initiation requires a Shine Dalgarno site in the 5' UTR and that ATG, GTG, TTG, and ATT codons can robustly initiate translation. Our combined approaches provide the first comprehensive view of mycobacterial gene structures and their non-canonical mechanisms of protein expression.

Top