USDA-ARS?s Scientific Manuscript database
High-throughput next-generation sequencing was used to scan the genome and generate reliable sequence of high copy number regions. Using this method, we examined whole plastid genomes as well as nearly 6000 bases of nuclear ribosomal DNA sequences for nine genotypes of Theobroma cacao and an indivi...
Elder, Robert M; Jayaraman, Arthi
2013-10-10
Gene therapy relies on the delivery of DNA into cells, and polycations are one class of vectors enabling efficient DNA delivery. Nuclear localization sequences (NLS), cationic oligopeptides that target molecules for nuclear entry, can be incorporated into polycations to improve their gene delivery efficiency. We use simulations to study the effect of peptide chemistry and sequence on the DNA-binding behavior of NLS-grafted polycations by systematically mutating the residues in the grafts, which are based on the SV40 NLS (peptide sequence PKKKRKV). Replacing arginine (R) with lysine (K) reduces binding strength by eliminating arginine-DNA interactions, but placing R in a less hindered location (e.g., farther from the grafting point to the polycation backbone) has surprisingly little effect on polycation-DNA binding strength. Changing the positions of the hydrophobic proline (P) and valine (V) residues relative to the polycation backbone changes hydrophobic aggregation within the polycation and, consequently, changes the conformational entropy loss that occurs upon polycation-DNA binding. Since conformational entropy loss affects the free energy of binding, the positions of P and V in the grafts affect DNA binding affinity. The insight from this work guides synthesis of polycations with tailored DNA binding affinity and, in turn, efficient DNA delivery.
Ancient DNA analysis reveals woolly rhino evolutionary relationships.
Orlando, Ludovic; Leonard, Jennifer A; Thenot, Aurélie; Laudet, Vincent; Guerin, Claude; Hänni, Catherine
2003-09-01
With ancient DNA technology, DNA sequences have been added to the list of characters available to infer the phyletic position of extinct species in evolutionary trees. We have sequenced the entire 12S rRNA and partial cytochrome b (cyt b) genes of one 60-70,000-year-old sample, and partial 12S rRNA and cyt b sequences of two 40-45,000-year-old samples of the extinct woolly rhinoceros (Coelodonta antiquitatis). Based on these two mitochondrial markers, phylogenetic analyses show that C. antiquitatis is most closely related to one of the three extant Asian rhinoceros species, Dicerorhinus sumatrensis. Calculations based on a molecular clock suggest that the lineage leading to C. antiquitatis and D. sumatrensis diverged in the Oligocene, 21-26 MYA. Both results agree with morphological models deduced from palaeontological data. Nuclear inserts of mitochondrial DNA were identified in the ancient specimens. These data should encourage the use of nuclear DNA in future ancient DNA studies. It also further establishes that the degraded nature of ancient DNA does not completely protect ancient DNA studies based on mitochondrial data from the problems associated with nuclear inserts.
Varela, Eduardo S; Lima, João P M S; Galdino, Alexsandro S; Pinto, Luciano da S; Bezerra, Walderly M; Nunes, Edson P; Alves, Maria A O; Grangeiro, Thalles B
2004-01-01
The complete sequences of nuclear ribosomal DNA (nrDNA) internal transcribed spacer regions (ITS/5.8S) were determined for species belonging to six genera from the subtribe Diocleinae as well as for the anomalous genera Calopogonium and Pachyrhizus. Phylogenetic trees constructed by distance matrix, maximum parsimony and maximum likelihood methods showed that Calopogonium and Pachyrhizus were outside the clade Diocleinae (Canavalia, Camptosema, Cratylia, Dioclea, Cymbosema, and Galactia). This finding supports previous morphological, phytochemical, and molecular evidence that Calopogonium and Pachyrhizus do not belong to the subtribe Diocleinae. Within the true Diocleinae clade, the clustering of genera and species were congruent with morphology-based classifications, suggesting that ITS/5.8S sequences can provide enough informative sites to allow resolution below the genus level. This is the first evidence of the phylogeny of subtribe Diocleinae based on nuclear DNA sequences.
NMR studies on the structure and dynamics of lac operator DNA
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lee, S.C.
Nuclear Magnetic Resonance spectroscopy was used to elucidate the relationships between structure, dynamics and function of the gene regulatory sequence corresponding to the lactose operon operator of Escherichia coli. The length of the DNA fragments examined varied from 13 to 36 base pair, containing all or part of the operator sequence. These DNA fragments are either derived genetically or synthesized chemically. Resonances of the imino protons were assigned by one dimensional inter-base pair nuclear Overhauser enhancement (NOE) measurements. Imino proton exchange rates were measured by saturation recovery methods. Results from the kinetic measurements show an interesting dynamic heterogeneity with amore » maximum opening rate centered about a GTG/CAC sequence which correlates with the biological function of the operator DNA. This particular three base pair sequence occurs frequently and often symmetrically in prokaryotic nd eukaryotic DNA sites where one anticipates specific protein interaction for gene regulation. The observed sequence dependent imino proton exchange rate may be a reflection of variation of the local structure of regulatory DNA. The results also indicate that the observed imino proton exchange rates are length dependent.« less
M. -S. Kim; N. B. Klopfenstein; J. W. Hanna; G. I. McDonald
2006-01-01
Phylogenetic and genetic relationships among 10 North American Armillaria species were analysed using sequence data from ribosomal DNA (rDNA), including intergenic spacer (IGS-1), internal transcribed spacers with associated 5.8S (ITS + 5.8S), and nuclear large subunit rDNA (nLSU), and amplified fragment length polymorphism (AFLP) markers. Based on rDNA sequence data,...
Enlightenment of Yeast Mitochondrial Homoplasmy: Diversified Roles of Gene Conversion
Ling, Feng; Mikawa, Tsutomu; Shibata, Takehiko
2011-01-01
Mitochondria have their own genomic DNA. Unlike the nuclear genome, each cell contains hundreds to thousands of copies of mitochondrial DNA (mtDNA). The copies of mtDNA tend to have heterogeneous sequences, due to the high frequency of mutagenesis, but are quickly homogenized within a cell (“homoplasmy”) during vegetative cell growth or through a few sexual generations. Heteroplasmy is strongly associated with mitochondrial diseases, diabetes and aging. Recent studies revealed that the yeast cell has the machinery to homogenize mtDNA, using a common DNA processing pathway with gene conversion; i.e., both genetic events are initiated by a double-stranded break, which is processed into 3′ single-stranded tails. One of the tails is base-paired with the complementary sequence of the recipient double-stranded DNA to form a D-loop (homologous pairing), in which repair DNA synthesis is initiated to restore the sequence lost by the breakage. Gene conversion generates sequence diversity, depending on the divergence between the donor and recipient sequences, especially when it occurs among a number of copies of a DNA sequence family with some sequence variations, such as in immunoglobulin diversification in chicken. MtDNA can be regarded as a sequence family, in which the members tend to be diversified by a high frequency of spontaneous mutagenesis. Thus, it would be interesting to determine why and how double-stranded breakage and D-loop formation induce sequence homogenization in mitochondria and sequence diversification in nuclear DNA. We will review the mechanisms and roles of mtDNA homoplasmy, in contrast to nuclear gene conversion, which diversifies gene and genome sequences, to provide clues toward understanding how the common DNA processing pathway results in such divergent outcomes. PMID:24710143
Admir J. Giachini; Kentaro Hosaka; Eduardo Nouhra; Joseph Spatafora; James M. Trappe
2010-01-01
Phylogenetic relationships among Geastrales, Gomphales, Hysterangiales, and Phallales were estimated via combined sequences: nuclear large subunit ribosomal DNA (nuc-25S-rDNA), mitochondrial small subunit ribosomal DNA (mit-12S-rDNA), and mitochondrial atp6 DNA (mit-atp6-DNA). Eighty-one taxa comprising 19 genera and 58 species...
Assessing the Fidelity of Ancient DNA Sequences Amplified From Nuclear Genes
Binladen, Jonas; Wiuf, Carsten; Gilbert, M. Thomas P.; Bunce, Michael; Barnett, Ross; Larson, Greger; Greenwood, Alex D.; Haile, James; Ho, Simon Y. W.; Hansen, Anders J.; Willerslev, Eske
2006-01-01
To date, the field of ancient DNA has relied almost exclusively on mitochondrial DNA (mtDNA) sequences. However, a number of recent studies have reported the successful recovery of ancient nuclear DNA (nuDNA) sequences, thereby allowing the characterization of genetic loci directly involved in phenotypic traits of extinct taxa. It is well documented that postmortem damage in ancient mtDNA can lead to the generation of artifactual sequences. However, as yet no one has thoroughly investigated the damage spectrum in ancient nuDNA. By comparing clone sequences from 23 fossil specimens, recovered from environments ranging from permafrost to desert, we demonstrate the presence of miscoding lesion damage in both the mtDNA and nuDNA, resulting in insertion of erroneous bases during amplification. Interestingly, no significant differences in the frequency of miscoding lesion damage are recorded between mtDNA and nuDNA despite great differences in cellular copy numbers. For both mtDNA and nuDNA, we find significant positive correlations between total sequence heterogeneity and the rates of type 1 transitions (adenine → guanine and thymine → cytosine) and type 2 transitions (cytosine → thymine and guanine → adenine), respectively. Type 2 transitions are by far the most dominant and increase relative to those of type 1 with damage load. The results suggest that the deamination of cytosine (and 5-methyl cytosine) to uracil (and thymine) is the main cause of miscoding lesions in both ancient mtDNA and nuDNA sequences. We argue that the problems presented by postmortem damage, as well as problems with contamination from exogenous sources of conserved nuclear genes, allelic variation, and the reliance on single nucleotide polymorphisms, call for great caution in studies relying on ancient nuDNA sequences. PMID:16299392
Loreille, Odile; Ratnayake, Shashikala; Stockwell, Timothy B.; Mallick, Swapan; Skoglund, Pontus; Onorato, Anthony J.; Bergman, Nicholas H.; Reich, David; Irwin, Jodi A.
2018-01-01
High throughput sequencing (HTS) has been used for a number of years in the field of paleogenomics to facilitate the recovery of small DNA fragments from ancient specimens. Recently, these techniques have also been applied in forensics, where they have been used for the recovery of mitochondrial DNA sequences from samples where traditional PCR-based assays fail because of the very short length of endogenous DNA molecules. Here, we describe the biological sexing of a ~4000-year-old Egyptian mummy using shotgun sequencing and two established methods of biological sex determination (RX and RY), by way of mitochondrial genome analysis as a means of sequence data authentication. This particular case of historical interest increases the potential utility of HTS techniques for forensic purposes by demonstrating that data from the more discriminatory nuclear genome can be recovered from the most damaged specimens, even in cases where mitochondrial DNA cannot be recovered with current PCR-based forensic technologies. Although additional work remains to be done before nuclear DNA recovered via these methods can be used routinely in operational casework for individual identification purposes, these results indicate substantial promise for the retrieval of probative individually identifying DNA data from the most limited and degraded forensic specimens. PMID:29494531
2013-01-01
Background Mitochondrial DNA (mtDNA) typing can be a useful aid for identifying people from compromised samples when nuclear DNA is too damaged, degraded or below detection thresholds for routine short tandem repeat (STR)-based analysis. Standard mtDNA typing, focused on PCR amplicon sequencing of the control region (HVS I and HVS II), is limited by the resolving power of this short sequence, which misses up to 70% of the variation present in the mtDNA genome. Methods We used in-solution hybridisation-based DNA capture (using DNA capture probes prepared from modern human mtDNA) to recover mtDNA from post-mortem human remains in which the majority of DNA is both highly fragmented (<100 base pairs in length) and chemically damaged. The method ‘immortalises’ the finite quantities of DNA in valuable extracts as DNA libraries, which is followed by the targeted enrichment of endogenous mtDNA sequences and characterisation by next-generation sequencing (NGS). Results We sequenced whole mitochondrial genomes for human identification from samples where standard nuclear STR typing produced only partial profiles or demonstrably failed and/or where standard mtDNA hypervariable region sequences lacked resolving power. Multiple rounds of enrichment can substantially improve coverage and sequencing depth of mtDNA genomes from highly degraded samples. The application of this method has led to the reliable mitochondrial sequencing of human skeletal remains from unidentified World War Two (WWII) casualties approximately 70 years old and from archaeological remains (up to 2,500 years old). Conclusions This approach has potential applications in forensic science, historical human identification cases, archived medical samples, kinship analysis and population studies. In particular the methodology can be applied to any case, involving human or non-human species, where whole mitochondrial genome sequences are required to provide the highest level of maternal lineage discrimination. Multiple rounds of in-solution hybridisation-based DNA capture can retrieve whole mitochondrial genome sequences from even the most challenging samples. PMID:24289217
van der Kuyl, A C; Kuiken, C L; Dekker, J T; Perizonius, W R; Goudsmit, J
1995-06-01
Monkey mummy bones and teeth originating from the North Saqqara Baboon Galleries (Egypt), soft tissue from a mummified baboon in a museum collection, and nineteenth/twentieth-century skin fragments from mangabeys were used for DNA extraction and PCR amplification of part of the mitochondrial 12S rRNA gene. Sequences aligning with the 12S rRNA gene were recovered but were only distantly related to contemporary monkey mitochondrial 12S rRNA sequences. However, many of these sequences were identical or closely related to human nuclear DNA sequences resembling mitochondrial 12S rRNA (isolated from a cell line depleted in mitochondria) and therefore have to be considered contamination. Subsequently in a separate study we were able to recover genuine mitochondrial 12S rRNA sequences from many extant species of nonhuman Old World primates and sequences closely resembling the human nuclear integrations. Analysis of all sequences by the neighbor-joining (NJ) method indicated that mitochondrial DNA sequences and their nuclear counterparts can be divided into two distinct clusters. One cluster contained all temporary cytoplasmic mitochondrial DNA sequences and approximately half of the monkey nuclear mitochondriallike sequences. A second cluster contained most human nuclear sequences and the other half of monkey nuclear sequences with a separate branch leading to human and gorilla mitochondrial and nuclear sequences. Sequences recovered from ancient materials were equally divided between the two clusters. These results constitute a warning for when working with ancient DNA or performing phylogenetic analysis using mitochondrial DNA as a target sequence: Nuclear counterparts of mitochondrial genes may lead to faulty interpretation of results.
USDA-ARS?s Scientific Manuscript database
We explored the phylogenetic utility of entire plastid DNA sequences in Daucus and compared the results to prior phylogenetic results using plastid, nuclear, and mitochondrial DNA sequences. We obtained, using Illumina sequencing, full plastid sequences of 37 accessions of 20 Daucus taxa and outgrou...
Cameron, Kenneth M.
2009-01-01
Background and Aims Most molecular phylogenetic studies of Orchidaceae have relied heavily on DNA sequences from the plastid genome. Nuclear and mitochondrial loci have only been superficially examined for their systematic value. Since 40% of the genera within Vanilloideae are achlorophyllous mycoheterotrophs, this is an ideal group of orchids in which to evaluate non-plastid gene sequences. Methods Phylogenetic reconstructions for Vanilloideae were produced using independent and combined data from the nuclear 18S, 5·8S and 26S rDNA genes and the mitochondrial atpA gene and nad1b-c intron. Key Results These new data indicate placements for genera such as Lecanorchis and Galeola, for which plastid gene sequences have been mostly unavailable. Nuclear and mitochondrial parsimony jackknife trees are congruent with each other and previously published trees based solely on plastid data. Because of high rates of sequence divergence among vanilloid orchids, even the short 5·8S rDNA gene provides impressive levels of resolution and support. Conclusions Orchid systematists are encouraged to sequence nuclear and mitochondrial gene regions along with the growing number of plastid loci available. PMID:19251715
Albayrak, Levent; Khanipov, Kamil; Pimenova, Maria; Golovko, George; Rojas, Mark; Pavlidis, Ioannis; Chumakov, Sergei; Aguilar, Gerardo; Chávez, Arturo; Widger, William R; Fofanov, Yuriy
2016-12-12
Low-abundance mutations in mitochondrial populations (mutations with minor allele frequency ≤ 1%), are associated with cancer, aging, and neurodegenerative disorders. While recent progress in high-throughput sequencing technology has significantly improved the heteroplasmy identification process, the ability of this technology to detect low-abundance mutations can be affected by the presence of similar sequences originating from nuclear DNA (nDNA). To determine to what extent nDNA can cause false positive low-abundance heteroplasmy calls, we have identified mitochondrial locations of all subsequences that are common or similar (one mismatch allowed) between nDNA and mitochondrial DNA (mtDNA). Performed analysis revealed up to a 25-fold variation in the lengths of longest common and longest similar (one mismatch allowed) subsequences across the mitochondrial genome. The size of the longest subsequences shared between nDNA and mtDNA in several regions of the mitochondrial genome were found to be as low as 11 bases, which not only allows using these regions to design new, very specific PCR primers, but also supports the hypothesis of the non-random introduction of mtDNA into the human nuclear DNA. Analysis of the mitochondrial locations of the subsequences shared between nDNA and mtDNA suggested that even very short (36 bases) single-end sequencing reads can be used to identify low-abundance variation in 20.4% of the mitochondrial genome. For longer (76 and 150 bases) reads, the proportion of the mitochondrial genome where nDNA presence will not interfere found to be 44.5 and 67.9%, when low-abundance mutations at 100% of locations can be identified using 417 bases long single reads. This observation suggests that the analysis of low-abundance variations in mitochondria population can be extended to a variety of large data collections such as NCBI Sequence Read Archive, European Nucleotide Archive, The Cancer Genome Atlas, and International Cancer Genome Consortium.
Analysis of intraspecific patterns in genetic diversity of stream fishes provides a potentially powerful method for assessing the status and trends in the condition of aquatic ecosystems. We analyzed mitochondrial DNA (mtDNA) sequences (590 bases of cytochrome B) and nuclear DNA...
Variations in Nuclear Localization Strategies Among Pol X Family Enzymes.
Kirby, Thomas W; Pedersen, Lars C; Gabel, Scott A; Gassman, Natalie R; London, Robert E
2018-06-22
Despite the essential roles of pol X family enzymes in DNA repair, information about the structural basis of their nuclear import is limited. Recent studies revealed the unexpected presence of a functional NLS in DNA polymerase β, indicating the importance of active nuclear targeting, even for enzymes likely to leak into and out of the nucleus. The current studies further explore the active nuclear transport of these enzymes by identifying and structurally characterizing the functional NLS sequences in the three remaining human pol X enzymes: terminal deoxynucleotidyl transferase (TdT), DNA polymerase μ (pol μ), and DNA polymerase λ (pol λ). NLS identifications are based on Importin α (Impα) binding affinity determined by fluorescence polarization of fluorescein-labeled NLS peptides, X-ray crystallographic analysis of the Impα∆IBB•NLS complexes, and fluorescence-based subcellular localization studies. All three polymerases use NLS sequences located near their N-terminus; TdT and pol μ utilize monopartite NLS sequences, while pol λ utilizes a bipartite sequence, unique among the pol X family members. The pol μ NLS has relatively weak measured affinity for Impα, due in part to its proximity to the N-terminus that limits non-specific interactions of flanking residues preceding the NLS. However, this effect is partially mitigated by an N-terminal sequence unsupportive of Met1 removal by methionine aminopeptidase, leading to a 3-fold increase in affinity when the N-terminal methionine is present. Nuclear targeting is unique to each pol X family enzyme with variations dependent on the structure and unique functional role of each polymerase. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.
Formation of rings from segments of HeLa-cell nuclear deoxyribonucleic acid
Hardman, Norman
1974-01-01
Duplex segments of HeLa-cell nuclear DNA were generated by cleavage with DNA restriction endonuclease from Haemophilus influenzae. About 20–25% of the DNA segments produced, when partly degraded with exonuclease III and annealed, were found to form rings visible in the electron microscope. A further 5% of the DNA segments formed structures that were branched in configuration. Similar structures were generated from HeLa-cell DNA, without prior treatment with restriction endonuclease, when the complementary polynucleotide chains were exposed by exonuclease III action at single-chain nicks. After exposure of an average single-chain length of 1400 nucleotides per terminus at nicks in HeLa-cell DNA by exonuclease III, followed by annealing, the physical length of ring closures was estimated and found to be 0.02–0.1μm, or 50–300 base pairs. An almost identical distribution of lengths was recorded for the regions of complementary base sequence responsible for branch formation. It is proposed that most of the rings and branches are formed from classes of reiterated base sequence with an average length of 180 base pairs arranged intermittenly in HeLa-cell DNA. From the rate of formation of branched structures when HeLa-cell DNA segments were heat-denatured and annealed, it is estimated that the reiterated sequences are in families containing approximately 2400–24000 copies. ImagesPLATE 2PLATE 1 PMID:4462738
Kane, Nolan; Sveinsson, Saemundur; Dempewolf, Hannes; Yang, Ji Yong; Zhang, Dapeng; Engels, Johannes M M; Cronk, Quentin
2012-02-01
To reliably identify lineages below the species level such as subspecies or varieties, we propose an extension to DNA-barcoding using next-generation sequencing to produce whole organellar genomes and substantial nuclear ribosomal sequence. Because this method uses much longer versions of the traditional DNA-barcoding loci in the plastid and ribosomal DNA, we call our approach ultra-barcoding (UBC). We used high-throughput next-generation sequencing to scan the genome and generate reliable sequence of high copy number regions. Using this method, we examined whole plastid genomes as well as nearly 6000 bases of nuclear ribosomal DNA sequences for nine genotypes of Theobroma cacao and an individual of the related species T. grandiflorum, as well as an additional publicly available whole plastid genome of T. cacao. All individuals of T. cacao examined were uniquely distinguished, and evidence of reticulation and gene flow was observed. Sequence variation was observed in some of the canonical barcoding regions between species, but other regions of the chloroplast were more variable both within species and between species, as were ribosomal spacers. Furthermore, no single region provides the level of data available using the complete plastid genome and rDNA. Our data demonstrate that UBC is a viable, increasingly cost-effective approach for reliably distinguishing varieties and even individual genotypes of T. cacao. This approach shows great promise for applications where very closely related or interbreeding taxa must be distinguished.
DNA-based approaches to identify forest fungi in Pacific Islands: A pilot study
Anna E. Case; Sara M. Ashiglar; Phil G. Cannon; Ernesto P. Militante; Edwin R. Tadiosa; Mutya Quintos-Manalo; Nelson M. Pampolina; John W. Hanna; Fred E. Brooks; Amy L. Ross-Davis; Mee-Sook Kim; Ned B. Klopfenstein
2013-01-01
DNA-based diagnostics have been successfully used to characterize diverse forest fungi (e.g., Hoff et al. 2004, Kim et al. 2006, Glaeser & Lindner 2011). DNA sequencing of the internal transcribed spacer (ITS) and large subunit (LSU) regions of nuclear ribosomal DNA (rDNA) has proved especially useful (Sonnenberg et al. 2007, Seifert 2009, Schoch et al. 2012) for...
Ki, Jang-Seu
2010-05-01
Noctiluca scintillans (Macartney) Kofoid et Swezy, 1921 is an unarmoured heterotrophic dinoflagellate with a global distribution, and has been considered as one of the ancestral taxa among dinoflagellates. Recently, 18S rDNA, actin, alpha-, beta-tubulin, and Hsp90-based phylogenies have shown the basal position of the noctilucids. However, the relationships of dinoflagellates in the basal lineages are still controversial. Although the nuclear rDNA (e.g. 18S, ITS-5.8S, and 28S) contains much genetic information, DNA sequences of N. scintillans rDNA molecules were insufficiently characterized as yet. Here the author sequenced a long-range nuclear rDNA, spanning from the 18S to the D5 region of the 28S rDNA, of N. scintillans. The present N. scintillans had a nearly identical genotype (>99.0% similarity) compared to other Noctiluca sequences from different geographic origins. Nucleotide divergence in the partial 28S rDNA was significantly high (p<0.05) as compared to the 18S rDNA, demonstrating that the information from 28S rDNA is more variable. The 28S rDNA phylogeny of 17 selected dinoflagellates, two perkinsids, and two apicomplexans as outgroups showed that N. scintillans and Oxyrrhis marina formed a clade that diverged separately from core dinoflagellates. Copyright (c) 2009 Elsevier GmbH. All rights reserved.
Widespread Transient Hoogsteen Base-Pairs in Canonical Duplex DNA with Variable Energetics
Alvey, Heidi S.; Gottardo, Federico L.; Nikolova, Evgenia N.; Al-Hashimi, Hashim M.
2015-01-01
Hoogsteen base-pairing involves a 180 degree rotation of the purine base relative to Watson-Crick base-pairing within DNA duplexes, creating alternative DNA conformations that can play roles in recognition, damage induction, and replication. Here, using Nuclear Magnetic Resonance R1ρ relaxation dispersion, we show that transient Hoogsteen base-pairs occur across more diverse sequence and positional contexts than previously anticipated. We observe sequence-specific variations in Hoogsteen base-pair energetic stabilities that are comparable to variations in Watson-Crick base-pair stability, with Hoogsteen base-pairs being more abundant for energetically less favorable Watson-Crick base-pairs. Our results suggest that the variations in Hoogsteen stabilities and rates of formation are dominated by variations in Watson-Crick base pair stability, suggesting a late transition state for the Watson-Crick to Hoogsteen conformational switch. The occurrence of sequence and position-dependent Hoogsteen base-pairs provide a new potential mechanism for achieving sequence-dependent DNA transactions. PMID:25185517
Frequent somatic transfer of mitochondrial DNA into the nuclear genome of human cancer cells.
Ju, Young Seok; Tubio, Jose M C; Mifsud, William; Fu, Beiyuan; Davies, Helen R; Ramakrishna, Manasa; Li, Yilong; Yates, Lucy; Gundem, Gunes; Tarpey, Patrick S; Behjati, Sam; Papaemmanuil, Elli; Martin, Sancha; Fullam, Anthony; Gerstung, Moritz; Nangalia, Jyoti; Green, Anthony R; Caldas, Carlos; Borg, Åke; Tutt, Andrew; Lee, Ming Ta Michael; van't Veer, Laura J; Tan, Benita K T; Aparicio, Samuel; Span, Paul N; Martens, John W M; Knappskog, Stian; Vincent-Salomon, Anne; Børresen-Dale, Anne-Lise; Eyfjörd, Jórunn Erla; Myklebost, Ola; Flanagan, Adrienne M; Foster, Christopher; Neal, David E; Cooper, Colin; Eeles, Rosalind; Bova, Steven G; Lakhani, Sunil R; Desmedt, Christine; Thomas, Gilles; Richardson, Andrea L; Purdie, Colin A; Thompson, Alastair M; McDermott, Ultan; Yang, Fengtang; Nik-Zainal, Serena; Campbell, Peter J; Stratton, Michael R
2015-06-01
Mitochondrial genomes are separated from the nuclear genome for most of the cell cycle by the nuclear double membrane, intervening cytoplasm, and the mitochondrial double membrane. Despite these physical barriers, we show that somatically acquired mitochondrial-nuclear genome fusion sequences are present in cancer cells. Most occur in conjunction with intranuclear genomic rearrangements, and the features of the fusion fragments indicate that nonhomologous end joining and/or replication-dependent DNA double-strand break repair are the dominant mechanisms involved. Remarkably, mitochondrial-nuclear genome fusions occur at a similar rate per base pair of DNA as interchromosomal nuclear rearrangements, indicating the presence of a high frequency of contact between mitochondrial and nuclear DNA in some somatic cells. Transmission of mitochondrial DNA to the nuclear genome occurs in neoplastically transformed cells, but we do not exclude the possibility that some mitochondrial-nuclear DNA fusions observed in cancer occurred years earlier in normal somatic cells. © 2015 Ju et al.; Published by Cold Spring Harbor Laboratory Press.
Frequent somatic transfer of mitochondrial DNA into the nuclear genome of human cancer cells
Ju, Young Seok; Tubio, Jose M.C.; Mifsud, William; Fu, Beiyuan; Davies, Helen R.; Ramakrishna, Manasa; Li, Yilong; Yates, Lucy; Gundem, Gunes; Tarpey, Patrick S.; Behjati, Sam; Papaemmanuil, Elli; Martin, Sancha; Fullam, Anthony; Gerstung, Moritz; Nangalia, Jyoti; Green, Anthony R.; Caldas, Carlos; Borg, Åke; Tutt, Andrew; Lee, Ming Ta Michael; van't Veer, Laura J.; Tan, Benita K.T.; Aparicio, Samuel; Span, Paul N.; Martens, John W.M.; Knappskog, Stian; Vincent-Salomon, Anne; Børresen-Dale, Anne-Lise; Eyfjörd, Jórunn Erla; Flanagan, Adrienne M.; Foster, Christopher; Neal, David E.; Cooper, Colin; Eeles, Rosalind; Lakhani, Sunil R.; Desmedt, Christine; Thomas, Gilles; Richardson, Andrea L.; Purdie, Colin A.; Thompson, Alastair M.; McDermott, Ultan; Yang, Fengtang; Nik-Zainal, Serena; Campbell, Peter J.; Stratton, Michael R.
2015-01-01
Mitochondrial genomes are separated from the nuclear genome for most of the cell cycle by the nuclear double membrane, intervening cytoplasm, and the mitochondrial double membrane. Despite these physical barriers, we show that somatically acquired mitochondrial-nuclear genome fusion sequences are present in cancer cells. Most occur in conjunction with intranuclear genomic rearrangements, and the features of the fusion fragments indicate that nonhomologous end joining and/or replication-dependent DNA double-strand break repair are the dominant mechanisms involved. Remarkably, mitochondrial-nuclear genome fusions occur at a similar rate per base pair of DNA as interchromosomal nuclear rearrangements, indicating the presence of a high frequency of contact between mitochondrial and nuclear DNA in some somatic cells. Transmission of mitochondrial DNA to the nuclear genome occurs in neoplastically transformed cells, but we do not exclude the possibility that some mitochondrial-nuclear DNA fusions observed in cancer occurred years earlier in normal somatic cells. PMID:25963125
Schiavo, Giuseppina; Hoffmann, Orsolya Ivett; Ribani, Anisa; Utzeri, Valerio Joe; Ghionda, Marco Ciro; Bertolini, Francesca; Geraci, Claudia; Bovo, Samuele; Fontanesi, Luca
2017-10-01
Nuclear DNA sequences of mitochondrial origin (numts) are derived by insertion of mitochondrial DNA (mtDNA), into the nuclear genome. In this study, we provide, for the first time, a genome picture of numts inserted in the pig nuclear genome. The Sus scrofa reference nuclear genome (Sscrofa10.2) was aligned with circularized and consensus mtDNA sequences using LAST software. A total of 430 numt sequences that may represent 246 different numt integration events (57 numt regions determined by at least two numt sequences and 189 singletons) were identified, covering about 0.0078% of the nuclear genome. Numt integration events were correlated (0.99) to the chromosome length. The longest numt sequence (about 11 kbp) was located on SSC2. Six numts were sequenced and PCR amplified in pigs of European commercial and local pig breeds, of the Chinese Meishan breed and in European wild boars. Three of them were polymorphic for the presence or absence of the insertion. Surprisingly, the estimated age of insertion of two of the three polymorphic numts was more ancient than that of the speciation time of the Sus scrofa, supporting that these polymorphic sites were originated from interspecies admixture that contributed to shape the pig genome. © The Author 2017. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.
Spooner, David M; Ruess, Holly; Iorizzo, Massimo; Senalik, Douglas; Simon, Philipp
2017-02-01
We explored the phylogenetic utility of entire plastid DNA sequences in Daucus and compared the results with prior phylogenetic results using plastid and nuclear DNA sequences. We used Illumina sequencing to obtain full plastid sequences of 37 accessions of 20 Daucus taxa and outgroups, analyzed the data with phylogenetic methods, and examined evidence for mitochondrial DNA transfer to the plastid ( Dc MP). Our phylogenetic trees of the entire data set were highly resolved, with 100% bootstrap support for most of the external and many of the internal clades, except for the clade of D. carota and its most closely related species D. syrticus . Subsets of the data, including regions traditionally used as phylogenetically informative regions, provide various degrees of soft congruence with the entire data set. There are areas of hard incongruence, however, with phylogenies using nuclear data. We extended knowledge of a mitochondrial to plastid DNA insertion sequence previously named Dc MP and identified the first instance in flowering plants of a sequence of potential nuclear genome origin inserted into the plastid genome. There is a relationship of inverted repeat junction classes and repeat DNA to phylogeny, but no such relationship with nonsynonymous mutations. Our data have allowed us to (1) produce a well-resolved plastid phylogeny of Daucus , (2) evaluate subsets of the entire plastid data for phylogeny, (3) examine evidence for plastid and nuclear DNA phylogenetic incongruence, and (4) examine mitochondrial and nuclear DNA insertion into the plastid. © 2017 Spooner et al. Published by the Botanical Society of America. This work is licensed under a Creative Commons public domain license (CC0 1.0).
Schiavo, G; Strillacci, M G; Ribani, A; Bovo, S; Roman-Ponce, S I; Cerolini, S; Bertolini, F; Bagnato, A; Fontanesi, L
2018-06-01
Mitochondrial DNA (mtDNA) insertions have been detected in the nuclear genome of many eukaryotes. These sequences are pseudogenes originated by horizontal transfer of mtDNA fragments into the nuclear genome, producing nuclear DNA sequences of mitochondrial origin (numt). In this study we determined the frequency and distribution of mtDNA-originated pseudogenes in the turkey (Meleagris gallopavo) nuclear genome. The turkey reference genome (Turkey_2.01) was aligned with the reference linearized mtDNA sequence using last. A total of 32 numt sequences (corresponding to 18 numt regions derived by unique insertional events) were identified in the turkey nuclear genome (size ranging from 66 to 1415 bp; identity against the modern turkey mtDNA corresponding region ranging from 62% to 100%). Numts were distributed in nine chromosomes and in one scaffold. They derived from parts of 10 mtDNA protein-coding genes, ribosomal genes, the control region and 10 tRNA genes. Seven numt regions reported in the turkey genome were identified in orthologues positions in the Gallus gallus genome and therefore were present in the ancestral genome that in the Cretaceous originated the lineages of the modern crown Galliformes. Five recently integrated turkey numts were validated by PCR in 168 turkeys of six different domestic populations. None of the analysed numts were polymorphic (i.e. absence of the inserted sequence, as reported in numts of recent integration in other species), suggesting that the reticulate speciation model is not useful for explaining the origin of the domesticated turkey lineage. © 2018 Stichting International Foundation for Animal Genetics.
2011-01-01
Background The classical perspective that interspecific hybridization in animals is rare has been changing due to a growing list of empirical examples showing the occurrence of gene flow between closely related species. Using sequence data from cyt b mitochondrial gene and three intron nuclear genes (RPL9, c-myc, and RPL3) we investigated patterns of nucleotide polymorphism and divergence between two closely related toad species R. marina and R. schneideri. By comparing levels of differentiation at nuclear and mtDNA levels we were able to describe patterns of introgression and infer the history of hybridization between these species. Results All nuclear loci are essentially concordant in revealing two well differentiated groups of haplotypes, corresponding to the morphologically-defined species R. marina and R. schneideri. Mitochondrial DNA analysis also revealed two well-differentiated groups of haplotypes but, in stark contrast with the nuclear genealogies, all R. schneideri sequences are clustered with sequences of R. marina from the right Amazon bank (RAB), while R. marina sequences from the left Amazon bank (LAB) are monophyletic. An Isolation-with-Migration (IM) analysis using nuclear data showed that R. marina and R. schneideri diverged at ≈ 1.69 Myr (early Pleistocene), while R. marina populations from LAB and RAB diverged at ≈ 0.33 Myr (middle Pleistocene). This time of divergence is not consistent with the split between LAB and RAB populations obtained with mtDNA data (≈ 1.59 Myr), which is notably similar to the estimate obtained with nuclear genes between R. marina and R. schneideri. Coalescent simulations of mtDNA phylogeny under the speciation history inferred from nuclear genes rejected the hypothesis of incomplete lineage sorting to explain the conflicting signal between mtDNA and nuclear-based phylogenies. Conclusions The cytonuclear discordance seems to reflect the occurrence of interspecific hybridization between these two closely related toad species. Overall, our results suggest a phenomenon of extensive mtDNA unidirectional introgression from the previously occurring R. schneideri into the invading R. marina. We hypothesize that climatic-induced range shifts during the Pleistocene/Holocene may have played an important role in the observed patterns of introgression. PMID:21939538
Goremykin, Vadim V; Lockhart, Peter J; Viola, Roberto; Velasco, Riccardo
2012-08-01
Mitochondrial genomes of spermatophytes are the largest of all organellar genomes. Their large size has been attributed to various factors; however, the relative contribution of these factors to mitochondrial DNA (mtDNA) expansion remains undetermined. We estimated their relative contribution in Malus domestica (apple). The mitochondrial genome of apple has a size of 396 947 bp and a one to nine ratio of coding to non-coding DNA, close to the corresponding average values for angiosperms. We determined that 71.5% of the apple mtDNA sequence was highly similar to sequences of its nuclear DNA. Using nuclear gene exons, nuclear transposable elements and chloroplast DNA as markers of promiscuous DNA content in mtDNA, we estimated that approximately 20% of the apple mtDNA consisted of DNA sequences imported from other cell compartments, mostly from the nucleus. Similar marker-based estimates of promiscuous DNA content in the mitochondrial genomes of other species ranged between 21.2 and 25.3% of the total mtDNA length for grape, between 23.1 and 38.6% for rice, and between 47.1 and 78.4% for maize. All these estimates are conservative, because they underestimate the import of non-functional DNA. We propose that the import of promiscuous DNA is a core mechanism for mtDNA size expansion in seed plants. In apple, maize and grape this mechanism contributed far more to genome expansion than did homologous recombination. In rice the estimated contribution of both mechanisms was found to be similar. © 2012 The Authors. The Plant Journal © 2012 Blackwell Publishing Ltd.
A phylogenetic study of Laeliinae (Orchidaceae) based on combined nuclear and plastid DNA sequences
van den Berg, Cássio; Higgins, Wesley E.; Dressler, Robert L.; Whitten, W. Mark; Soto-Arenas, Miguel A.; Chase, Mark W.
2009-01-01
Background and Aims Laeliinae are a neotropical orchid subtribe with approx. 1500 species in 50 genera. In this study, an attempt is made to assess generic alliances based on molecular phylogenetic analysis of DNA sequence data. Methods Six DNA datasets were gathered: plastid trnL intron, trnL-F spacer, matK gene and trnK introns upstream and dowstream from matK and nuclear ITS rDNA. Data were analysed with maximum parsimony (MP) and Bayesian analysis with mixed models (BA). Key Results Although relationships between Laeliinae and outgroups are well supported, within the subtribe sequence variation is low considering the broad taxonomic range covered. Localized incongruence between the ITS and plastid trees was found. A combined tree followed the ITS trees more closely, but the levels of support obtained with MP were low. The Bayesian analysis recovered more well-supported nodes. The trees from combined MP and BA allowed eight generic alliances to be recognized within Laeliinae, all of which show trends in morphological characters but lack unambiguous synapomorphies. Conclusions By using combined plastid and nuclear DNA data in conjunction with mixed-models Bayesian inference, it is possible to delimit smaller groups within Laeliinae and discuss general patterns of pollination and hybridization compatibility. Furthermore, these small groups can now be used for further detailed studies to explain morphological evolution and diversification patterns within the subtribe. PMID:19423551
Lin, Ya-Ying
2017-01-01
A portion of the mitochondrial cytochrome c oxidase I gene was sequenced using both genomic DNA and complement DNA from three planktonic copepod Neocalanus species (N. cristatus, N. plumchrus, and N. flemingeri). Small but critical sequence differences in CO1 were observed between gDNA and cDNA from N. plumchrus. Furthermore, careful observation revealed the presence of recombination between sequences in gDNA from N. plumchrus. Moreover, a chimera of the N. cristatus and N. plumchrus sequences was obtained from N. plumchrus gDNA. The observed phenomena can be best explained by the preferential amplification of the nuclear mitochondrial pseudogenes from gDNA of N. plumchrus. Two conclusions can be drawn from the observations. First, nuclear mitochondrial pseudogenes are pervasive in N. plumchrus. Second, a mating between a female N. cristatus and a male N. plumchrus produced viable offspring, which further backcrossed to a N. plumchrus individual. These observations not only demonstrate intriguing mating behavior in these species, but also emphasize the importance of careful interpretation of species marker sequences amplified from gDNA. PMID:28231343
Ali, M A; Al-Hemaid, F M; Lee, J; Hatamleh, A A; Gyulai, G; Rahman, M O
2015-10-02
The present study explored the systematic inventory of Echinops L. (Asteraceae) of Saudi Arabia, with special reference to the molecular typing of Echinops abuzinadianus Chaudhary, an endemic species to Saudi Arabia, based on the internal transcribed spacer (ITS) sequences (ITS1-5.8S-ITS2) of nuclear ribosomal DNA. A sequence similarity search using BLAST and a phylogenetic analysis of the ITS sequence of E. abuzinadianus revealed a high level of sequence similarity with E. glaberrimus DC. (section Ritropsis). The novel primary sequence and the secondary structure of ITS2 of E. abuzinadianus could potentially be used for molecular genotyping.
Kim, Kyunghee; Lee, Sang-Choon; Lee, Junki; Lee, Hyun Oh; Joh, Ho Jun; Kim, Nam-Hoon; Park, Hyun-Seung; Yang, Tae-Jin
2015-01-01
We report complete sequences of chloroplast (cp) genome and 45S nuclear ribosomal DNA (45S nrDNA) for 11 Panax ginseng cultivars. We have obtained complete sequences of cp and 45S nrDNA, the representative barcoding target sequences for cytoplasm and nuclear genome, respectively, based on low coverage NGS sequence of each cultivar. The cp genomes sizes ranged from 156,241 to 156,425 bp and the major size variation was derived from differences in copy number of tandem repeats in the ycf1 gene and in the intergenic regions of rps16-trnUUG and rpl32-trnUAG. The complete 45S nrDNA unit sequences were 11,091 bp, representing a consensus single transcriptional unit with an intergenic spacer region. Comparative analysis of these sequences as well as those previously reported for three Chinese accessions identified very rare but unique polymorphism in the cp genome within P. ginseng cultivars. There were 12 intra-species polymorphisms (six SNPs and six InDels) among 14 cultivars. We also identified five SNPs from 45S nrDNA of 11 Korean ginseng cultivars. From the 17 unique informative polymorphic sites, we developed six reliable markers for analysis of ginseng diversity and cultivar authentication. PMID:26061692
DNA copy number, including telomeres and mitochondria, assayed using next-generation sequencing.
Castle, John C; Biery, Matthew; Bouzek, Heather; Xie, Tao; Chen, Ronghua; Misura, Kira; Jackson, Stuart; Armour, Christopher D; Johnson, Jason M; Rohl, Carol A; Raymond, Christopher K
2010-04-16
DNA copy number variations occur within populations and aberrations can cause disease. We sought to develop an improved lab-automatable, cost-efficient, accurate platform to profile DNA copy number. We developed a sequencing-based assay of nuclear, mitochondrial, and telomeric DNA copy number that draws on the unbiased nature of next-generation sequencing and incorporates techniques developed for RNA expression profiling. To demonstrate this platform, we assayed UMC-11 cells using 5 million 33 nt reads and found tremendous copy number variation, including regions of single and homogeneous deletions and amplifications to 29 copies; 5 times more mitochondria and 4 times less telomeric sequence than a pool of non-diseased, blood-derived DNA; and that UMC-11 was derived from a male individual. The described assay outputs absolute copy number, outputs an error estimate (p-value), and is more accurate than array-based platforms at high copy number. The platform enables profiling of mitochondrial levels and telomeric length. The assay is lab-automatable and has a genomic resolution and cost that are tunable based on the number of sequence reads.
DNA copy number, including telomeres and mitochondria, assayed using next-generation sequencing
2010-01-01
Background DNA copy number variations occur within populations and aberrations can cause disease. We sought to develop an improved lab-automatable, cost-efficient, accurate platform to profile DNA copy number. Results We developed a sequencing-based assay of nuclear, mitochondrial, and telomeric DNA copy number that draws on the unbiased nature of next-generation sequencing and incorporates techniques developed for RNA expression profiling. To demonstrate this platform, we assayed UMC-11 cells using 5 million 33 nt reads and found tremendous copy number variation, including regions of single and homogeneous deletions and amplifications to 29 copies; 5 times more mitochondria and 4 times less telomeric sequence than a pool of non-diseased, blood-derived DNA; and that UMC-11 was derived from a male individual. Conclusion The described assay outputs absolute copy number, outputs an error estimate (p-value), and is more accurate than array-based platforms at high copy number. The platform enables profiling of mitochondrial levels and telomeric length. The assay is lab-automatable and has a genomic resolution and cost that are tunable based on the number of sequence reads. PMID:20398377
Greenberg, Jay R.; Perry, Robert P.
1971-01-01
The relationship of the DNA sequences from which polyribosomal messenger RNA (mRNA) and heterogeneous nuclear RNA (NRNA) of mouse L cells are transcribed was investigated by means of hybridization kinetics and thermal denaturation of the hybrids. Hybridization was performed in formamide solutions at DNA excess. Under these conditions most of the hybridizing mRNA and NRNA react at values of Dot (DNA concentration multiplied by time) expected for RNA transcribed from the nonrepeated or rarely repeated fraction of the genome. However, a fraction of both mRNA and NRNA hybridize at values of Dot about 10,000 times lower, and therefore must be transcribed from highly redundant DNA sequences. The fraction of NRNA hybridizing to highly repeated sequences is about 1.7 times greater than the corresponding fraction of mRNA. The hybrids formed by the rapidly reacting fractions of both NRNA and mRNA melt over a narrow temperature range with a midpoint about 11°C below that of native L cell DNA. This indicates that these hybrids consist of partially complementary sequences with approximately 11% mismatching of bases. Hybrids formed by the slowly reacting fraction of NRNA melt within 4°–6°C of native DNA, indicating very little, if any, mismatching of bases. Hybrids of the slowly reacting components of mRNA, formed under conditions of sufficiently low RNA input, have a high thermal stability, similar to that observed for hybrids of the slowly reacting NRNA component. However, when higher inputs of mRNA are used, hybrids are formed which have a strikingly lower thermal stability. This observation can be explained by assuming that there is sufficient similarity among the relatively rare DNA sequences coding for mRNA so that under hybridization conditions, in which these DNA sequences are not truly in excess, reversible hybrids exhibiting a considerable amount of mispairing are formed. The fact that a comparable phenomenon has not been observed for NRNA may mean that there is less similarity among the relatively rare DNA sequences coding for NRNA than there is among the rare sequences coding for mRNA. PMID:4999767
Nuclear Mitochondrial DNA Activates Replication in Saccharomyces cerevisiae
Chatre, Laurent; Ricchetti, Miria
2011-01-01
The nuclear genome of eukaryotes is colonized by DNA fragments of mitochondrial origin, called NUMTs. These insertions have been associated with a variety of germ-line diseases in humans. The significance of this uptake of potentially dangerous sequences into the nuclear genome is unclear. Here we provide functional evidence that sequences of mitochondrial origin promote nuclear DNA replication in Saccharomyces cerevisiae. We show that NUMTs are rich in key autonomously replicating sequence (ARS) consensus motifs, whose mutation results in the reduction or loss of DNA replication activity. Furthermore, 2D-gel analysis of the mrc1 mutant exposed to hydroxyurea shows that several NUMTs function as late chromosomal origins. We also show that NUMTs located close to or within ARS provide key sequence elements for replication. Thus NUMTs can act as independent origins, when inserted in an appropriate genomic context or affect the efficiency of pre-existing origins. These findings show that migratory mitochondrial DNAs can impact on the replication of the nuclear region they are inserted in. PMID:21408151
Nuclear mitochondrial DNA activates replication in Saccharomyces cerevisiae.
Chatre, Laurent; Ricchetti, Miria
2011-03-08
The nuclear genome of eukaryotes is colonized by DNA fragments of mitochondrial origin, called NUMTs. These insertions have been associated with a variety of germ-line diseases in humans. The significance of this uptake of potentially dangerous sequences into the nuclear genome is unclear. Here we provide functional evidence that sequences of mitochondrial origin promote nuclear DNA replication in Saccharomyces cerevisiae. We show that NUMTs are rich in key autonomously replicating sequence (ARS) consensus motifs, whose mutation results in the reduction or loss of DNA replication activity. Furthermore, 2D-gel analysis of the mrc1 mutant exposed to hydroxyurea shows that several NUMTs function as late chromosomal origins. We also show that NUMTs located close to or within ARS provide key sequence elements for replication. Thus NUMTs can act as independent origins, when inserted in an appropriate genomic context or affect the efficiency of pre-existing origins. These findings show that migratory mitochondrial DNAs can impact on the replication of the nuclear region they are inserted in.
USDA-ARS?s Scientific Manuscript database
Premise of the study: Prunus L. phylogeny has extensively studied using cpDNA sequences. CpDNA has a slow rate of evolution which is beneficial to determine species relationships at a deeper level. However, a limitation of the chloroplast based phylogenies is its transfer by interspecific hybridizat...
van der Walt, Elizna M; Smuts, Izelle; Taylor, Robert W; Elson, Joanna L; Turnbull, Douglass M; Louw, Roan; van der Westhuizen, Francois H
2012-06-01
Mitochondrial disease can be attributed to both mitochondrial and nuclear gene mutations. It has a heterogeneous clinical and biochemical profile, which is compounded by the diversity of the genetic background. Disease-based epidemiological information has expanded significantly in recent decades, but little information is known that clarifies the aetiology in African patients. The aim of this study was to investigate mitochondrial DNA variation and pathogenic mutations in the muscle of diagnosed paediatric patients from South Africa. A cohort of 71 South African paediatric patients was included and a high-throughput nucleotide sequencing approach was used to sequence full-length muscle mtDNA. The average coverage of the mtDNA genome was 81±26 per position. After assigning haplogroups, it was determined that although the nature of non-haplogroup-defining variants was similar in African and non-African haplogroup patients, the number of substitutions were significantly higher in African patients. We describe previously reported disease-associated and novel variants in this cohort. We observed a general lack of commonly reported syndrome-associated mutations, which supports clinical observations and confirms general observations in African patients when using single mutation screening strategies based on (predominantly non-African) mtDNA disease-based information. It is finally concluded that this first extensive report on muscle mtDNA sequences in African paediatric patients highlights the need for a full-length mtDNA sequencing strategy, which applies to all populations where specific mutations is not present. This, in addition to nuclear DNA gene mutation and pathogenicity evaluations, will be required to better unravel the aetiology of these disorders in African patients.
Rapid screening for nuclear genes mutations in isolated respiratory chain complex I defects.
Pagniez-Mammeri, Hélène; Lombes, Anne; Brivet, Michèle; Ogier-de Baulny, Hélène; Landrieu, Pierre; Legrand, Alain; Slama, Abdelhamid
2009-04-01
Complex I or reduced nicotinamide adenine dinucleotide (NADH): ubiquinone oxydoreductase deficiency is the most common cause of respiratory chain defects. Molecular bases of complex I deficiencies are rarely identified because of the dual genetic origin of this multi-enzymatic complex (nuclear DNA and mitochondrial DNA) and the lack of phenotype-genotype correlation. We used a rapid method to screen patients with isolated complex I deficiencies for nuclear genes mutations by Surveyor nuclease digestion of cDNAs. Eight complex I nuclear genes, among the most frequently mutated (NDUFS1, NDUFS2, NDUFS3, NDUFS4, NDUFS7, NDUFS8, NDUFV1 and NDUFV2), were studied in 22 cDNA fragments spanning their coding sequences in 8 patients with a biochemically proved complex I deficiency. Single nucleotide polymorphisms and missense mutations were detected in 18.7% of the cDNA fragments by Surveyor nuclease treatment. Molecular defects were detected in 3 patients. Surveyor nuclease screening is a reliable method for genotyping nuclear complex I deficiencies, easy to interpret, and limits the number of sequence reactions. Its use will enhance the possibility of prenatal diagnosis and help us for a better understanding of complex I molecular defects.
Navigating the tip of the genomic iceberg: Next-generation sequencing for plant systematics.
Straub, Shannon C K; Parks, Matthew; Weitemier, Kevin; Fishbein, Mark; Cronn, Richard C; Liston, Aaron
2012-02-01
Just as Sanger sequencing did more than 20 years ago, next-generation sequencing (NGS) is poised to revolutionize plant systematics. By combining multiplexing approaches with NGS throughput, systematists may no longer need to choose between more taxa or more characters. Here we describe a genome skimming (shallow sequencing) approach for plant systematics. Through simulations, we evaluated optimal sequencing depth and performance of single-end and paired-end short read sequences for assembly of nuclear ribosomal DNA (rDNA) and plastomes and addressed the effect of divergence on reference-guided plastome assembly. We also used simulations to identify potential phylogenetic markers from low-copy nuclear loci at different sequencing depths. We demonstrated the utility of genome skimming through phylogenetic analysis of the Sonoran Desert clade (SDC) of Asclepias (Apocynaceae). Paired-end reads performed better than single-end reads. Minimum sequencing depths for high quality rDNA and plastome assemblies were 40× and 30×, respectively. Divergence from the reference significantly affected plastome assembly, but relatively similar references are available for most seed plants. Deeper rDNA sequencing is necessary to characterize intragenomic polymorphism. The low-copy fraction of the nuclear genome was readily surveyed, even at low sequencing depths. Nearly 160000 bp of sequence from three organelles provided evidence of phylogenetic incongruence in the SDC. Adoption of NGS will facilitate progress in plant systematics, as whole plastome and rDNA cistrons, partial mitochondrial genomes, and low-copy nuclear markers can now be efficiently obtained for molecular phylogenetics studies.
Hughes, Colin E; Eastwood, Ruth J; Donovan Bailey, C
2005-01-01
Phylogenetic analyses of DNA sequences have prompted spectacular progress in assembling the Tree of Life. However, progress in constructing phylogenies among closely related species, at least for plants, has been less encouraging. We show that for plants, the rapid accumulation of DNA characters at higher taxonomic levels has not been matched by conventional sequence loci at the species level, leaving a lack of well-resolved gene trees that is hindering investigations of many fundamental questions in plant evolutionary biology. The most popular approach to address this problem has been to use low-copy nuclear genes as a source of DNA sequence data. However, this has had limited success because levels of variation among nuclear intron sequences across groups of closely related species are extremely variable and generally lower than conventionally used loci, and because no universally useful low-copy nuclear DNA sequence loci have been developed. This suggests that solutions will, for the most part, be lineage-specific, prompting a move away from ‘universal’ gene thinking for species-level phylogenetics. The benefits and limitations of alternative approaches to locate more variable nuclear loci are discussed and the potential of anonymous non-genic nuclear loci is highlighted. Given the virtually unlimited number of loci that can be generated using these new approaches, it is clear that effective screening will be critical for efficient selection of the most informative loci. Strategies for screening are outlined. PMID:16553318
Elucidating polyploidization of bermudagrasses as assessed by organelle and nuclear DNA markers.
Gulsen, Osman; Ceylan, Ahmet
2011-12-01
Clarification of relationships among ploidy series of Cynodon accessions could be beneficial to bermudagrass breeding programs, and would enhance our understanding of the evolutionary biology of this warm season grass species. This study was initiated to elucidate polyploidization among Cynodon accessions with different ploidy series collected from Turkey based on chloroplast and nuclear DNA. Forty Cynodon accessions including 7 diploids, 3 triploids, 10 tetraploids, 11 pentaploids, and 9 hexaploids were analyzed using chloroplast DNA restriction fragment-length polymorphism (cpDNA RFLP), chloroplast DNA simple sequence repeat (cpDNA SSR), and nuclear DNA markers based on neighbor-joining (NJ) and principle component analyses (PCA). All three-marker systems with two statistical algorithms clustered the diploids apart from the other ploidy levels. Assuming autopolyploidy, spontaneous polyploidization followed by rapid diversification among the higher ploidy levels than the diploids is likely in Cynodon's evolution. Few tetraploid and hexaploid accessions were clustered with or closely to the group of diploids, supporting the hypothesis above. Eleven haplotypes as estimated by cpDNA RFLP and SSR markers were detected. This study indicated that the diploids had different organelle genome from the rest of the ploidy series and provided valuable insight into relationships among ploidy series of Cynodon accessions based on cp and nuclear DNAs.
A RAD-based phylogenetics for Orestias fishes from Lake Titicaca.
Takahashi, Tetsumi; Moreno, Edmundo
2015-12-01
The fish genus Orestias is endemic to the Andes highlands, and Lake Titicaca is the centre of the species diversity of the genus. Previous phylogenetic studies based on a single locus of mitochondrial and nuclear DNA strongly support the monophyly of a group composed of many of species endemic to the Lake Titicaca basin (the Lake Titicaca radiation), but the relationships among the species in the radiation remain unclear. Recently, restriction site-associated DNA (RAD) sequencing, which can produce a vast number of short sequences from various loci of nuclear DNA, has emerged as a useful way to resolve complex phylogenetic problems. To propose a new phylogenetic hypothesis of Orestias fishes of the Lake Titicaca radiation, we conducted a cluster analysis based on morphological similarities among fish samples and a molecular phylogenetic analysis based on RAD sequencing. From a morphological cluster analysis, we recognised four species groups in the radiation, and three of the four groups were resolved as monophyletic groups in maximum-likelihood trees based on RAD sequencing data. The other morphology-based group was not resolved as a monophyletic group in molecular phylogenies, and some members of the group were diverged from its sister group close to the root of the Lake Titicaca radiation. The evolution of these fishes is discussed from the phylogenetic relationships. Copyright © 2015 Elsevier Inc. All rights reserved.
Linear and Nonlinear Statistical Characterization of DNA
NASA Astrophysics Data System (ADS)
Norio Oiwa, Nestor; Goldman, Carla; Glazier, James
2002-03-01
We find spatial order in the distribution of protein-coding (including RNAs) and control segments of GenBank genomic sequences, irrespective of ATCG content. This is achieved by correlations, histograms, fractal dimensions and singularity spectra. Estimates of these quantities in complete nuclear genome indicate that coding sequences are long-range correlated and their disposition are self-similar (multifractal) for eukaryotes. These characteristics are absent in prokaryotes, where there are few noncoding sequences, suggesting the `junk' DNA play a relevant role to the genome structure and function. Concerning the genetic message of ATCG sequences, we build a random walk (Levy flight), using DNA symmetry arguments, where we associate A, T, C and G as left, right, down and up steps, respectively. Nonlinear analysis of mitochondrial DNA walks reveal multifractal pattern based on palindromic sequences, which fold in hairpins and loops.
Goncharova, S B; Artiukova, E V; Goncharov, A A
2006-06-01
Nucleotide sequences of the nuclear rDNA ITS regions were determined in 20 species of the subfamily Sedoideae (Crassulaceae). The phylogenetic relationships of these species with other members of the subfamily, occurring mainly in Southeast Asia, were analyzed. It was shown that the genus Orostachys was not monophyletic; its typical subsection was reliably included into the clade of the genus Hylotelephium. Synapomorphic substitutions and indels, specific for the subsection Orostachys, were detected in ITS1. Sister relationships were established between clades Aizopsis and Phedimus, based on which they can be recognized as isolated genera.
Benabdelkrim Filali, Oumama; Kabine, Mostafa; El Hamouchi, Adil; Lemrani, Meryem; Debboun, Mustapha; Sarih, M'hammed
2018-06-05
Anopheles sergentii known as the "oasis vector" or the "desert malaria vector" is considered the main vector of malaria in the southern parts of Morocco. Its presence in Morocco is confirmed for the first time through sequencing of mitochondrial DNA (mDNA) cytochrome c oxidase subunit I (COI) barcodes and nuclear ribosomal DNA (rDNA) second internal transcribed spacer (ITS2) sequences and direct comparison with specimens of A. sergentii of other countries. The DNA barcodes (n = 39) obtained from A. sergentii collected in 2015 and 2016 showed more diversity with 10 haplotypes, compared with 3 haplotypes obtained from ITS2 sequences (n = 59). Moreover, the comparison using the ITS2 sequences showed closer evolutionary relationship between the Moroccan and Egyptian strains than the Iranian strain. Nevertheless, genetic differences due to geographical segregation were also observed. This study provides the first report on the sequence of rDNA-ITS2 and mtDNA COI, which could be used to better understand the biodiversity of A. sergentii.
Ginther, C; Corach, D; Penacino, G A; Rey, J A; Carnese, F R; Hutz, M H; Anderson, A; Just, J; Salzano, F M; King, M C
1993-01-01
DNA samples from 60 Mapuche Indians, representing 39 maternal lineages, were genetically characterized for (1) nucleotide sequences of the mtDNA control region; (2) presence or absence of a nine base duplication in mtDNA region V; (3) HLA loci DRB1 and DQA1; (4) variation at three nuclear genes with short tandem repeats; and (5) variation at the polymorphic marker D2S44. The genetic profile of the Mapuche population was compared to other Amerinds and to worldwide populations. Two highly polymorphic portions of the mtDNA control region, comprising 650 nucleotides, were amplified by the polymerase chain reaction (PCR) and directly sequenced. The 39 maternal lineages were defined by two or three generation families identified by the Mapuches. These 39 lineages included 19 different mtDNA sequences that could be grouped into four classes. The same classes of sequences appear in other Amerinds from North, Central, and South American populations separated by thousands of miles, suggesting that the origin of the mtDNA patterns predates the migration to the Americas. The mtDNA sequence similarity between Amerind populations suggests that the migration throughout the Americas occurred rapidly relative to the mtDNA mutation rate. HLA DRB1 alleles 1602 and 1402 were frequent among the Mapuches. These alleles also occur at high frequency among other Amerinds in North and South America, but not among Spanish, Chinese or African-American populations. The high frequency of these alleles throughout the Americas, and their specificity to the Americas, supports the hypothesis that Mapuches and other Amerind groups are closely related.(ABSTRACT TRUNCATED AT 250 WORDS)
Efficiency of ITS Sequences for DNA Barcoding in Passiflora (Passifloraceae)
Giudicelli, Giovanna Câmara; Mäder, Geraldo; de Freitas, Loreta Brandão
2015-01-01
DNA barcoding is a technique for discriminating and identifying species using short, variable, and standardized DNA regions. Here, we tested for the first time the performance of plastid and nuclear regions as DNA barcodes in Passiflora. This genus is a largely variable, with more than 900 species of high ecological, commercial, and ornamental importance. We analyzed 1034 accessions of 222 species representing the four subgenera of Passiflora and evaluated the effectiveness of five plastid regions and three nuclear datasets currently employed as DNA barcodes in plants using barcoding gap, applied similarity-, and tree-based methods. The plastid regions were able to identify less than 45% of species, whereas the nuclear datasets were efficient for more than 50% using “best match” and “best close match” methods of TaxonDNA software. All subgenera presented higher interspecific pairwise distances and did not fully overlap with the intraspecific distance, and similarity-based methods showed better results than tree-based methods. The nuclear ribosomal internal transcribed spacer 1 (ITS1) region presented a higher discrimination power than the other datasets and also showed other desirable characteristics as a DNA barcode for this genus. Therefore, we suggest that this region should be used as a starting point to identify Passiflora species. PMID:25837628
Wei, Su-Juan; Lu, Yong-Bin; Ye, Quan-Qing; Tang, Shao-Qing
2017-01-01
Camellia flavida is an endangered species of yellow camellia growing in limestone mountains in southwest China. The current classification of C. flavida into two varieties, var. flavida and var. patens, is controversial. We conducted a genetic analysis of C. flavida to determine its taxonomic structure. A total of 188 individual plants from 20 populations across the entire distribution range in southwest China were analyzed using two DNA fragments: a chloroplast DNA fragment from the small single copy region and a single-copy nuclear gene called phenylalanine ammonia-lyase (PAL). Sequences from both chloroplast and nuclear DNA were highly diverse; with high levels of genetic differentiation and restricted gene flow. This result can be attributed to the high habitat heterogeneity in limestone karst, which isolates C. flavida populations from each other. Our nuclear DNA results demonstrate that there are three differentiated groups within C. flavida: var. flavida 1, var. flavida 2, and var. patens. These genetic groupings are consistent with the morphological characteristics of the plants. We suggest that the samples included in this study constitute three taxa and the var. flavida 2 group is the genuine C. flavida. The three groups should be recognized as three management units for conservation concerns. PMID:28579991
Detection and decay rates of prey and prey symbionts in the gut of a predator through metagenomics.
Paula, Débora P; Linard, Benjamin; Andow, David A; Sujii, Edison R; Pires, Carmen S S; Vogler, Alfried P
2015-07-01
DNA methods are useful to identify ingested prey items from the gut of predators, but reliable detection is hampered by low amounts of degraded DNA. PCR-based methods can retrieve minute amounts of starting material but suffer from amplification biases and cross-reactions with the predator and related species genomes. Here, we use PCR-free direct shotgun sequencing of total DNA isolated from the gut of the harlequin ladybird Harmonia axyridis at five time points after feeding on a single pea aphid Acyrthosiphon pisum. Sequence reads were matched to three reference databases: Insecta mitogenomes of 587 species, including H. axyridis sequenced here; A. pisum nuclear genome scaffolds; and scaffolds and complete genomes of 13 potential bacterial symbionts. Immediately after feeding, multicopy mtDNA of A. pisum was detected in tens of reads, while hundreds of matches to nuclear scaffolds were detected. Aphid nuclear DNA and mtDNA decayed at similar rates (0.281 and 0.11 h(-1) respectively), and the detectability periods were 32.7 and 23.1 h. Metagenomic sequencing also revealed thousands of reads of the obligate Buchnera aphidicola and facultative Regiella insecticola aphid symbionts, which showed exponential decay rates significantly faster than aphid DNA (0.694 and 0.80 h(-1) , respectively). However, the facultative aphid symbionts Hamiltonella defensa, Arsenophonus spp. and Serratia symbiotica showed an unexpected temporary increase in population size by 1-2 orders of magnitude in the predator guts before declining. Metagenomics is a powerful tool that can reveal complex relationships and the dynamics of interactions among predators, prey and their symbionts. © 2014 John Wiley & Sons Ltd.
2000 Year-old ancient equids: an ancient-DNA lesson from pompeii remains.
Di Bernardo, Giovanni; Del Gaudio, Stefania; Galderisi, Umberto; Cipollaro, Marilena
2004-11-15
Ancient DNA extracted from 2000 year-old equine bones was examined in order to amplify mitochondrial and nuclear DNA fragments. A specific equine satellite-type sequence representing 3.7%-11% of the entire equine genome, proved to be a suitable target to address the question of the presence of aDNA in ancient bones. The PCR strategy designed to investigate this specific target also allowed us to calculate the molecular weight of amplifiable DNA fragments. Sequencing of a 370 bp DNA fragment of mitochondrial control region allowed the comparison of ancient DNA sequences with those of modern horses to assess their genetic relationship. The 16S rRNA mitochondrial gene was also examined to unravel the post-mortem base modification feature and to test the status of Pompeian equids taxon on the basis of a Mae III restriction site polymorphism. Copyright 2004 Wiley-Liss, Inc.
Coon, Keith D; Valla, Jon; Szelinger, Szabolics; Schneider, Lonnie E; Niedzielko, Tracy L; Brown, Kevin M; Pearson, John V; Halperin, Rebecca; Dunckley, Travis; Papassotiropoulos, Andreas; Caselli, Richard J; Reiman, Eric M; Stephan, Dietrich A
2006-08-01
The role of mitochondrial dysfunction in the pathogenesis of Alzheimer's disease (AD) has been well documented. Though evidence for the role of mitochondria in AD seems incontrovertible, the impact of mitochondrial DNA (mtDNA) mutations in AD etiology remains controversial. Though mutations in mitochondrially encoded genes have repeatedly been implicated in the pathogenesis of AD, many of these studies have been plagued by lack of replication as well as potential contamination of nuclear-encoded mitochondrial pseudogenes. To assess the role of mtDNA mutations in the pathogenesis of AD, while avoiding the pitfalls of nuclear-encoded mitochondrial pseudogenes encountered in previous investigations and showcasing the benefits of a novel resequencing technology, we sequenced the entire coding region (15,452 bp) of mtDNA from 19 extremely well-characterized AD patients and 18 age-matched, unaffected controls utilizing a new, reliable, high-throughput array-based resequencing technique, the Human MitoChip. High-throughput, array-based DNA resequencing of the entire mtDNA coding region from platelets of 37 subjects revealed the presence of 208 loci displaying a total of 917 sequence variants. There were no statistically significant differences in overall mutational burden between cases and controls, however, 265 independent sites of statistically significant change between cases and controls were identified. Changed sites were found in genes associated with complexes I (30.2%), III (3.0%), IV (33.2%), and V (9.1%) as well as tRNA (10.6%) and rRNA (14.0%). Despite their statistical significance, the subtle nature of the observed changes makes it difficult to determine whether they represent true functional variants involved in AD etiology or merely naturally occurring dissimilarity. Regardless, this study demonstrates the tremendous value of this novel mtDNA resequencing platform, which avoids the pitfalls of erroneously amplifying nuclear-encoded mtDNA pseudogenes, and our proposed analysis paradigm, which utilizes the availability of raw signal intensity values for each of the four potential alleles to facilitate quantitative estimates of mtDNA heteroplasmy. This information provides a potential new target for burgeoning diagnostics and therapeutics that could truly assist those suffering from this devastating disorder.
Sequence Effect on the Formation of DNA Minidumbbells.
Liu, Yuan; Lam, Sik Lok
2017-11-16
The DNA minidumbbell (MDB) is a recently identified non-B structure. The reported MDBs contain two TTTA, CCTG, or CTTG type II loops. At present, the knowledge and understanding of the sequence criteria for MDB formation are still limited. In this study, we performed a systematic high-resolution nuclear magnetic resonance (NMR) and native gel study to investigate the effect of sequence variations in tandem repeats on the formation of MDBs. Our NMR results reveal the importance of hydrogen bonds, base-base stacking, and hydrophobic interactions from each of the participating residues. We conclude that in the MDBs formed by tandem repeats, C-G loop-closing base pairs are more stabilizing than T-A loop-closing base pairs, and thymine residues in both the second and third loop positions are more stabilizing than cytosine residues. The results from this study enrich our knowledge on the sequence criteria for the formation of MDBs, paving a path for better exploring their potential roles in biological systems and DNA nanotechnology.
King, Timothy L.; Eackles, Michael S.; Reshetnikov, Andrey N.
2015-01-01
Human-mediated translocations and subsequent large-scale colonization by the invasive fish rotan (Perccottus glenii Dybowski, 1877; Perciformes, Odontobutidae), also known as Amur or Chinese sleeper, has resulted in dramatic transformations of small lentic ecosystems. However, no detailed genetic information exists on population structure, levels of effective movement, or relatedness among geographic populations of P. glenii within the European part of the range. We used massively parallel genomic DNA shotgun sequencing on the semiconductor-based Ion Torrent Personal Genome Machine (PGM) sequencing platform to identify nuclear microsatellite and mitochondrial DNA sequences in P. glenii from European Russia. Here we describe the characterization of nine nuclear microsatellite loci, ascertain levels of allelic diversity, heterozygosity, and demographic status of P. glenii collected from Ilev, Russia, one of several initial introduction points in European Russia. In addition, we mapped sequence reads to the complete P. glenii mitochondrial DNA sequence to identify polymorphic regions. Nuclear microsatellite markers developed for P. glenii yielded sufficient genetic diversity to: (1) produce unique multilocus genotypes; (2) elucidate structure among geographic populations; and (3) provide unique perspectives for analysis of population sizes and historical demographics. Among 4.9 million filtered P. glenii Ion Torrent PGM sequence reads, 11,304 mapped to the mitochondrial genome (NC_020350). This resulted in 100 % coverage of this genome to a mean coverage depth of 102X. A total of 130 variable sites were observed between the publicly available genome from China and the studied composite mitochondrial genome. Among these, 82 were diagnostic and monomorphic between the mitochondrial genomes and distributed among 15 genome regions. The polymorphic sites (N = 48) were distributed among 11 mitochondrial genome regions. Our results also indicate that sequence reads generated from two three-hour runs on the Ion Torrent PGM can generate a sufficient number of nuclear and mitochondrial markers to improve understanding of the evolutionary and ecological dynamics of non-model and in particular, invasive species.
Mitochondrial sequence analysis for forensic identification using pyrosequencing technology.
Andréasson, H; Asp, A; Alderborn, A; Gyllensten, U; Allen, M
2002-01-01
Over recent years, requests for mtDNA analysis in the field of forensic medicine have notably increased, and the results of such analyses have proved to be very useful in forensic cases where nuclear DNA analysis cannot be performed. Traditionally, mtDNA has been analyzed by DNA sequencing of the two hypervariable regions, HVI and HVII, in the D-loop. DNA sequence analysis using the conventional Sanger sequencing is very robust but time consuming and labor intensive. By contrast, mtDNA analysis based on the pyrosequencing technology provides fast and accurate results from the human mtDNA present in many types of evidence materials in forensic casework. The assay has been developed to determine polymorphic sites in the mitochondrial D-loop as well as the coding region to further increase the discrimination power of mtDNA analysis. The pyrosequencing technology for analysis of mtDNA polymorphisms has been tested with regard to sensitivity, reproducibility, and success rate when applied to control samples and actual casework materials. The results show that the method is very accurate and sensitive; the results are easily interpreted and provide a high success rate on casework samples. The panel of pyrosequencing reactions for the mtDNA polymorphisms were chosen to result in an optimal discrimination power in relation to the number of bases determined.
Zuriaga, María Angeles; Mas-Coma, Santiago; Bargues, María Dolores
2015-05-01
A pseudogene, designated as "ps(5.8S+ITS-2)", paralogous to the 5.8S gene and internal transcribed spacer (ITS)-2 of the nuclear ribosomal DNA (rDNA), has been recently found in many triatomine species distributed throughout North America, Central America and northern South America. Among characteristics used as criteria for pseudogene verification, secondary structures and free energy are highlighted, showing a lower fit between minimum free energy, partition function and centroid structures, although in given cases the fit only appeared to be slightly lower. The unique characteristics of "ps(5.8S+ITS-2)" as a processed or retrotransposed pseudogenic unit of the ghost type are reviewed, with emphasis on its potential functionality compared to the functionality of genes and spacers of the normal rDNA operon. Besides the technical problem of the risk for erroneous sequence results, the usefulness of "ps(5.8S+ITS-2)" for specimen classification, phylogenetic analyses and systematic/taxonomic studies should be highlighted, based on consistence and retention index values, which in pseudogenic sequence trees were higher than in functional sequence trees. Additionally, intraindividual, interpopulational and interspecific differences in pseudogene amount and the fact that it is a pseudogene in the nuclear rDNA suggests a potential relationships with fitness, behaviour and adaptability of triatomine vectors and consequently its potential utility in Chagas disease epidemiology and control.
Small nuclear RNA U2 is base-paired to heterogeneous nuclear RNA.
Calvet, J P; Meyer, L M; Pederson, T
1982-07-30
Eukaryotic cells contain a set of low molecular weight nuclear RNA's. One of the more abundant of these is termed U2 RNA. The possibility that U2 RNA is hydrogen-bonded to complementary sequences in other nuclear RNA's was investigated. Cultured human (HeLa) cells were treated with a psoralen derivative that cross-links RNA chains that are base-paired with one another. High molecular weight heterogeneous nuclear RNA was isolated under denaturing conditions, and the psoralen cross-links were reversed. Electrophoresis of the released RNA and hybridization with a human cloned U2 DNA probe revealed that U2 is hydrogen-bonded to complementary sequences in heterogeneous nuclear RNA in vivo. In contrast, U2 RNA is not base-paired with nucleolar RNA, which contains the precursors of ribosomal RNA. The results suggest that U2 RNA participates in messenger RNA processing in the nucleus.
Sunflower centromeres consist of a centromere-specific LINE and a chromosome-specific tandem repeat.
Nagaki, Kiyotaka; Tanaka, Keisuke; Yamaji, Naoki; Kobayashi, Hisato; Murata, Minoru
2015-01-01
The kinetochore is a protein complex including kinetochore-specific proteins that plays a role in chromatid segregation during mitosis and meiosis. The complex associates with centromeric DNA sequences that are usually species-specific. In plant species, tandem repeats including satellite DNA sequences and retrotransposons have been reported as centromeric DNA sequences. In this study on sunflowers, a cDNA-encoding centromere-specific histone H3 (CENH3) was isolated from a cDNA pool from a seedling, and an antibody was raised against a peptide synthesized from the deduced cDNA. The antibody specifically recognized the sunflower CENH3 (HaCENH3) and showed centromeric signals by immunostaining and immunohistochemical staining analysis. The antibody was also applied in chromatin immunoprecipitation (ChIP)-Seq to isolate centromeric DNA sequences and two different types of repetitive DNA sequences were identified. One was a long interspersed nuclear element (LINE)-like sequence, which showed centromere-specific signals on almost all chromosomes in sunflowers. This is the first report of a centromeric LINE sequence, suggesting possible centromere targeting ability. Another type of identified repetitive DNA was a tandem repeat sequence with a 187-bp unit that was found only on a pair of chromosomes. The HaCENH3 content of the tandem repeats was estimated to be much higher than that of the LINE, which implies centromere evolution from LINE-based centromeres to more stable tandem-repeat-based centromeres. In addition, the epigenetic status of the sunflower centromeres was investigated by immunohistochemical staining and ChIP, and it was found that centromeres were heterochromatic.
Basal jawed vertebrate phylogeny inferred from multiple nuclear DNA-coded genes
Kikugawa, Kanae; Katoh, Kazutaka; Kuraku, Shigehiro; Sakurai, Hiroshi; Ishida, Osamu; Iwabe, Naoyuki; Miyata, Takashi
2004-01-01
Background Phylogenetic analyses of jawed vertebrates based on mitochondrial sequences often result in confusing inferences which are obviously inconsistent with generally accepted trees. In particular, in a hypothesis by Rasmussen and Arnason based on mitochondrial trees, cartilaginous fishes have a terminal position in a paraphyletic cluster of bony fishes. No previous analysis based on nuclear DNA-coded genes could significantly reject the mitochondrial trees of jawed vertebrates. Results We have cloned and sequenced seven nuclear DNA-coded genes from 13 vertebrate species. These sequences, together with sequences available from databases including 13 jawed vertebrates from eight major groups (cartilaginous fishes, bichir, chondrosteans, gar, bowfin, teleost fishes, lungfishes and tetrapods) and an outgroup (a cyclostome and a lancelet), have been subjected to phylogenetic analyses based on the maximum likelihood method. Conclusion Cartilaginous fishes have been inferred to be basal to other jawed vertebrates, which is consistent with the generally accepted view. The minimum log-likelihood difference between the maximum likelihood tree and trees not supporting the basal position of cartilaginous fishes is 18.3 ± 13.1. The hypothesis by Rasmussen and Arnason has been significantly rejected with the minimum log-likelihood difference of 123 ± 23.3. Our tree has also shown that living holosteans, comprising bowfin and gar, form a monophyletic group which is the sister group to teleost fishes. This is consistent with a formerly prevalent view of vertebrate classification, although inconsistent with both of the current morphology-based and mitochondrial sequence-based trees. Furthermore, the bichir has been shown to be the basal ray-finned fish. Tetrapods and lungfish have formed a monophyletic cluster in the tree inferred from the concatenated alignment, being consistent with the currently prevalent view. It also remains possible that tetrapods are more closely related to ray-finned fishes than to lungfishes. PMID:15070407
Revisiting Mendel and the Paradox of Gene Restoration
NASA Astrophysics Data System (ADS)
Lolle, Susan J.
2006-03-01
According to the laws of classical Mendelian genetics, genetic information contained in the nuclear genome is stably inherited and is transmitted from one generation to the next in a predictable manner. Several exceptions to the principle of stable inheritance are known but all represent specialized cases where the mechanisms have been relatively well defined. We have recently demonstrated that Arabidopsis plants can inherit specific DNA sequence information that was not present in the chromosomal genome of their parents. This process appears to occur throughout the nuclear genome. Based on our findings we propose that this process represents a completely novel and hitherto unknown mechanism for the maintenance and inheritance of DNA sequence information.
Ritz, C M; Reiker, J; Charles, G; Hoxey, P; Hunt, D; Lowry, M; Stuppy, W; Taylor, N
2012-11-01
The cacti of tribe Tephrocacteae (Cactaceae-Opuntioideae) are adapted to diverse climatic conditions over a wide area of the southern Andes and adjacent lowlands. They exhibit a range of life forms from geophytes and cushion-plants to dwarf shrubs, shrubs or small trees. To confirm or challenge previous morphology-based classifications and molecular phylogenies, we sampled DNA sequences from the chloroplast trnK/matK region and the nuclear low copy gene phyC and compared the resulting phylogenies with previous data gathered from nuclear ribosomal DNA sequences. The here presented chloroplast and nuclear low copy gene phylogenies were mutually congruent and broadly coincident with the classification based on gross morphology and seed micro-morphology and anatomy. Reconstruction of hypothetical ancestral character states suggested that geophytes and cushion-forming species probably evolved several times from dwarf shrubby precursors. We also traced an increase of embryo size at the expense of the nucellus-derived storage tissue during the evolution of the Tephrocacteae, which is thought to be an evolutionary advantage because nutrients are then more rapidly accessible for the germinating embryo. In contrast to these highly concordant phylogenies, nuclear ribosomal DNA data sampled by a previous study yielded conflicting phylogenetic signals. Secondary structure predictions of ribosomal transcribed spacers suggested that this phylogeny is strongly influenced by the inclusion of paralogous sequence probably arisen by genome duplication during the evolution of this plant group. Copyright © 2012 Elsevier Inc. All rights reserved.
2014-01-01
Background Next-generation DNA sequencing (NGS) technologies have made huge impacts in many fields of biological research, but especially in evolutionary biology. One area where NGS has shown potential is for high-throughput sequencing of complete mtDNA genomes (of humans and other animals). Despite the increasing use of NGS technologies and a better appreciation of their importance in answering biological questions, there remain significant obstacles to the successful implementation of NGS-based projects, especially for new users. Results Here we present an ‘A to Z’ protocol for obtaining complete human mitochondrial (mtDNA) genomes – from DNA extraction to consensus sequence. Although designed for use on humans, this protocol could also be used to sequence small, organellar genomes from other species, and also nuclear loci. This protocol includes DNA extraction, PCR amplification, fragmentation of PCR products, barcoding of fragments, sequencing using the 454 GS FLX platform, and a complete bioinformatics pipeline (primer removal, reference-based mapping, output of coverage plots and SNP calling). Conclusions All steps in this protocol are designed to be straightforward to implement, especially for researchers who are undertaking next-generation sequencing for the first time. The molecular steps are scalable to large numbers (hundreds) of individuals and all steps post-DNA extraction can be carried out in 96-well plate format. Also, the protocol has been assembled so that individual ‘modules’ can be swapped out to suit available resources. PMID:24460871
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gottlieb, J.; Muzyczka, N.
1988-06-01
When circular recombinant plasmids containing adeno-associated virus (AAV) DNA sequences are transfected into human cells, the AAV provirus is rescued. Using these circular AAV plasmids as substrates, the authors isolated an enzyme fraction from HeLa cell nuclear extracts that excises intact AAV DNA in vitro from vector DNA and produces linear DNA products. The recognition signal for the enzyme is a polypurine-polypyrimidine sequence which is at least 9 residues long and rich in G . C base pairs. Such sequences are present in AAV recombinant plasmids as part of the first 15 base pairs of the AAV terminal repeat andmore » in some cases as the result of cloning the AAV genome by G . C tailing. The isolated enzyme fraction does not have significant endonucleolytic activity on single-stranded or double-stranded DNA. Plasmid DNA that is transfected into tissue culture cells is cleaved in vivo to produce a pattern of DNA fragments similar to that seen with purified enzyme in vitro. The activity has been called endo R for rescue, and its behavior suggests that it may have a role in recombination of cellular chromosomes.« less
ENVIRONMENTAL INFLUENCES ON GENETIC DIVERSITY OF CREEK CHUBS IN THE MID-ATLANTIC REGION OF THE USA
Analysis of genetic diversity within and among populations of stream fishes may provide a powerful method for assessing the status and trends in the condition of aquatic ecosystems. We analyzed mitochondrial DNA sequences (590 bases of cytochrome B) and nuclear DNA loci (109 amp...
Choe, Se-Eun; Nguyen, Thuy Thi-Dieu; Kang, Tae-Gyu; Kweon, Chang-Hee; Kang, Seung-Won
2011-09-01
Nuclear ribosomal DNA sequence of the second internal transcribed spacer (ITS-2) has been used efficiently to identify the liver fluke species collected from different hosts and various geographic regions. ITS-2 sequences of 19 Fasciola samples collected from Korean native cattle were determined and compared. Sequence comparison including ITS-2 sequences of isolates from this study and reference sequences from Fasciola hepatica and Fasciola gigantica and intermediate Fasciola in Genbank revealed seven identical variable sites of investigated isolates. Among 19 samples, 12 individuals had ITS-2 sequences completely identical to that of pure F. hepatica, five possessed the sequences identical to F. gigantica type, whereas two shared the sequence of both F. hepatica and F. gigantica. No variations in length and nucleotide composition of ITS-2 sequence were observed within isolates that belonged to F. hepatica or F. gigantica. At the position of 218, five Fasciola containing a single-base substitution (C>T) formed a distinct branch inside the F. gigantica-type group which was similar to those of Asian-origin isolates. The phylogenetic tree of the Fasciola spp. based on complete ITS-2 sequences from this study and other representative isolates in different locations clearly showed that pure F. hepatica, F. gigantica type and intermediate Fasciola were observed. The result also provided additional genetic evidence for the existence of three forms of Fasciola isolated from native cattle in Korea by genetic approach using ITS-2 sequence.
van Koningsbruggen, Silvana; Gierliński, Marek; Schofield, Pietá; Martin, David; Barton, Geoffey J.; Ariyurek, Yavuz; den Dunnen, Johan T.
2010-01-01
The nuclear space is mostly occupied by chromosome territories and nuclear bodies. Although this organization of chromosomes affects gene function, relatively little is known about the role of nuclear bodies in the organization of chromosomal regions. The nucleolus is the best-studied subnuclear structure and forms around the rRNA repeat gene clusters on the acrocentric chromosomes. In addition to rDNA, other chromatin sequences also surround the nucleolar surface and may even loop into the nucleolus. These additional nucleolar-associated domains (NADs) have not been well characterized. We present here a whole-genome, high-resolution analysis of chromatin endogenously associated with nucleoli. We have used a combination of three complementary approaches, namely fluorescence comparative genome hybridization, high-throughput deep DNA sequencing and photoactivation combined with time-lapse fluorescence microscopy. The data show that specific sequences from most human chromosomes, in addition to the rDNA repeat units, associate with nucleoli in a reproducible and heritable manner. NADs have in common a high density of AT-rich sequence elements, low gene density and a statistically significant enrichment in transcriptionally repressed genes. Unexpectedly, both the direct DNA sequencing and fluorescence photoactivation data show that certain chromatin loci can specifically associate with either the nucleolus, or the nuclear envelope. PMID:20826608
van Koningsbruggen, Silvana; Gierlinski, Marek; Schofield, Pietá; Martin, David; Barton, Geoffey J; Ariyurek, Yavuz; den Dunnen, Johan T; Lamond, Angus I
2010-11-01
The nuclear space is mostly occupied by chromosome territories and nuclear bodies. Although this organization of chromosomes affects gene function, relatively little is known about the role of nuclear bodies in the organization of chromosomal regions. The nucleolus is the best-studied subnuclear structure and forms around the rRNA repeat gene clusters on the acrocentric chromosomes. In addition to rDNA, other chromatin sequences also surround the nucleolar surface and may even loop into the nucleolus. These additional nucleolar-associated domains (NADs) have not been well characterized. We present here a whole-genome, high-resolution analysis of chromatin endogenously associated with nucleoli. We have used a combination of three complementary approaches, namely fluorescence comparative genome hybridization, high-throughput deep DNA sequencing and photoactivation combined with time-lapse fluorescence microscopy. The data show that specific sequences from most human chromosomes, in addition to the rDNA repeat units, associate with nucleoli in a reproducible and heritable manner. NADs have in common a high density of AT-rich sequence elements, low gene density and a statistically significant enrichment in transcriptionally repressed genes. Unexpectedly, both the direct DNA sequencing and fluorescence photoactivation data show that certain chromatin loci can specifically associate with either the nucleolus, or the nuclear envelope.
Béraud-Colomb, E; Roubin, R; Martin, J; Maroc, N; Gardeisen, A; Trabuchet, G; Goosséns, M
1995-12-01
Analyzing the nuclear DNA from ancient human bones is an essential step to the understanding of genetic diversity in current populations, provided that such systematic studies are experimentally feasible. This article reports the successful extraction and amplification of nuclear DNA from the beta-globin region from 5 of 10 bone specimens up to 12,000 years old. These have been typed for beta-globin frameworks by sequencing through two variable positions and for a polymorphic (AT) chi (T) gamma microsatellite 500 bp upstream of the beta-globin gene. These specimens of human remains are somewhat older than those analyzed in previous nuclear gene sequencing reports and considerably older than those used to study high-copy-number human mtDNA. These results show that the systematic study of nuclear DNA polymorphisms of ancient populations is feasible.
Predicting nuclear gene coalescence from mitochondrial data: the three-times rule.
Palumbi, S R; Cipriano, F; Hare, M P
2001-05-01
Coalescence theory predicts when genetic drift at nuclear loci will result in fixation of sequence differences to produce monophyletic gene trees. However, the theory is difficult to apply to particular taxa because it hinges on genetically effective population size, which is generally unknown. Neutral theory also predicts that evolution of monophyly will be four times slower in nuclear than in mitochondrial genes primarily because genetic drift is slower at nuclear loci. Variation in mitochondrial DNA (mtDNA) within and between species has been studied extensively, but can these mtDNA data be used to predict coalescence in nuclear loci? Comparison of neutral theories of coalescence of mitochondrial and nuclear loci suggests a simple rule of thumb. The "three-times rule" states that, on average, most nuclear loci will be monophyletic when the branch length leading to the mtDNA sequences of a species is three times longer than the average mtDNA sequence diversity observed within that species. A test using mitochondrial and nuclear intron data from seven species of whales and dolphins suggests general agreement with predictions of the three-times rule. We define the coalescence ratio as the mitochondrial branch length for a species divided by intraspecific mtDNA diversity. We show that species with high coalescence ratios show nuclear monophyly, whereas species with low ratios have polyphyletic nuclear gene trees. As expected, species with intermediate coalescence ratios show a variety of patterns. Especially at very high or low coalescence ratios, the three-times rule predicts nuclear gene patterns that can help detect the action of selection. The three-times rule may be useful as an empirical benchmark for evaluating evolutionary processes occurring at multiple loci.
Gehlot, Praveen; Singh, S K; Pathak, Rakesh
2012-09-01
Taxonomy of the fungus Pestalotiopsis based on morphological characters has been equivocal. Molecular characterization often Pestalotiopsis species was done based on nuclear ribosomal DNA internal transcribed spacer (ITS) amplifications. Results of the analyses showed that species of genus Pestalotiopsis are monophyletic. We report ITS length variations, single nucleotide polymorphisms (SNPs) and insertions/ deletions (INDELS) among ten species of Pestalotiopsis that did not cause any phylogenetic error at either genus or species designation levels. New gene sequences have been assigned (Gen Accession numbers from HM 190146 to HM 190155) by the National Centre for Biotechnology Information, USA.
Comment on "Nuclear genomic sequences reveal that polar bears are an old and distinct bear lineage".
Nakagome, Shigeki; Mano, Shuhei; Hasegawa, Masami
2013-03-29
Based on nuclear and mitochondrial DNA, Hailer et al. (Reports, 20 April 2012, p. 344) suggested early divergence of polar bears from a common ancestor with brown bears and subsequent introgression. Our population genetic analysis that traces each of the genealogies in the independent nuclear loci does not support the evolutionary model proposed by the authors.
Using Partial Genomic Fosmid Libraries for Sequencing CompleteOrganellar Genomes
DOE Office of Scientific and Technical Information (OSTI.GOV)
McNeal, Joel R.; Leebens-Mack, James H.; Arumuganathan, K.
2005-08-26
Organellar genome sequences provide numerous phylogenetic markers and yield insight into organellar function and molecular evolution. These genomes are much smaller in size than their nuclear counterparts; thus, their complete sequencing is much less expensive than total nuclear genome sequencing, making broader phylogenetic sampling feasible. However, for some organisms it is challenging to isolate plastid DNA for sequencing using standard methods. To overcome these difficulties, we constructed partial genomic libraries from total DNA preparations of two heterotrophic and two autotrophic angiosperm species using fosmid vectors. We then used macroarray screening to isolate clones containing large fragments of plastid DNA. Amore » minimum tiling path of clones comprising the entire genome sequence of each plastid was selected, and these clones were shotgun-sequenced and assembled into complete genomes. Although this method worked well for both heterotrophic and autotrophic plants, nuclear genome size had a dramatic effect on the proportion of screened clones containing plastid DNA and, consequently, the overall number of clones that must be screened to ensure full plastid genome coverage. This technique makes it possible to determine complete plastid genome sequences for organisms that defy other available organellar genome sequencing methods, especially those for which limited amounts of tissue are available.« less
Zhu, X Q; Chilton, N B; Gasser, R B
1998-05-01
This study evaluated the use of a commercially available DNA intercalating agent (Resolver Gold) in agarose gels for the direct detection of sequence variation in ribosomal DNA (rDNA). This agent binds preferentially to AT sequence motifs in DNA. Regions of nuclear rDNA, known to provide genetic markers for the identification of species of parasitic ascarid nematodes (order Ascaridida), were amplified by polymerase chain reaction (PCR) and subjected to electrophoresis in standard agarose gels versus gels supplemented with Resolver Gold. Individual taxa examined could not be distinguished reliably based on the size of their amplicons in standard agarose gels, whereas they could be readily delineated based on mobility using Resolver Gold-supplemented gels. The latter was achieved because of differences (approximately 0.1-8.2%) in the AT content of the fragments among different taxa, which were associated with significant interspecific differences (approximately 11-39%) in the rDNA sequences employed. There was a tendency for fragments with higher AT content to migrate slower in supplemented agarose gels compared with those of lower AT content. The results indicate the usefulness of this electrophoretic approach to rapidly screen for sequence variability within or among PCR-amplified rDNA fragments of similar sizes but differing AT contents. Although evaluated on rDNA of parasites, the approach has potential to be applied to a range of genes of different groups of infectious organisms.
Callejón, Rocío; Robles, María Del Rosario; Panei, Carlos Javier; Cutillas, Cristina
2016-08-01
A molecular phylogenetic hypothesis is presented for the genus Trichuris based on sequence data from mitochondrial cytochrome c oxidase 1 (cox1) and cytochrome b (cob). The taxa consisted of nine populations of whipworm from five species of Sigmodontinae rodents from Argentina. Bayesian Inference, Maximum Parsimony, and Maximum Likelihood methods were used to infer phylogenies for each gene separately but also for the combined mitochondrial data and the combined mitochondrial and nuclear dataset. Phylogenetic results based on cox1 and cob mitochondrial DNA (mtDNA) revealed three clades strongly resolved corresponding to three different species (Trichuris navonae, Trichuris bainae, and Trichuris pardinasi) showing phylogeographic variation, but relationships among Trichuris species were poorly resolved. Phylogenetic reconstruction based on concatenated sequences had greater phylogenetic resolution for delimiting species and populations intra-specific of Trichuris than those based on partitioned genes. Thus, populations of T. bainae and T. pardinasi could be affected by geographical factors and co-divergence parasite-host.
Nuclear DNA analyses in genetic studies of populations: practice, problems and prospects.
Zhang, De-Xing; Hewitt, Godfrey M
2003-03-01
Population-genetic studies have been remarkably productive and successful in the last decade following the invention of PCR technology and the introduction of mitochondrial and microsatellite DNA markers. While mitochondrial DNA has proven powerful for genealogical and evolutionary studies of animal populations, and microsatellite sequences are the most revealing DNA markers available so far for inferring population structure and dynamics, they both have important and unavoidable limitations. To obtain a fuller picture of the history and evolutionary potential of populations, genealogical data from nuclear loci are essential, and the inclusion of other nuclear markers, i.e. single copy nuclear polymorphic (scnp) sequences, is clearly needed. Four major uncertainties for nuclear DNA analyses of populations have been facing us, i.e. the availability of scnp markers for carrying out such analysis, technical laboratory hurdles for resolving haplotypes, difficulty in data analysis because of recombination, low divergence levels and intraspecific multifurcation evolution, and the utility of scnp markers for addressing population-genetic questions. In this review, we discuss the availability of highly polymorphic single copy DNA in the nuclear genome, describe patterns and rate of evolution of nuclear sequences, summarize past empirical and theoretical efforts to recover and analyse data from scnp markers, and examine the difficulties, challenges and opportunities faced in such studies. We show that although challenges still exist, the above-mentioned obstacles are now being removed. Recent advances in technology and increases in statistical power provide the prospect of nuclear DNA analyses becoming routine practice, allowing allele-discriminating characterization of scnp loci and microsatellite loci. This certainly will increase our ability to address more complex questions, and thereby the sophistication of genetic analyses of populations.
SINE sequences detect DNA fingerprints in salmonid fishes.
Spruell, P; Thorgaard, G H
1996-04-01
DNA probes homologous to two previously described salmonid short interspersed nuclear elements (SINEs) detected DNA fingerprint patterns in 14 species of salmonid fishes. The probes showed more homology to some species than to others and little homology to three nonsalmonid fishes. The DNA fingerprint patterns derived from the SINE probes are individual-specific and inherited in a Mendelian manner. Probes derived from different regions of the same SINE detect only partially overlapping banding patterns, reflecting a more complex SINE structure than has been previously reported. Like the human Alu sequence, the SINEs found in salmonids could provide useful genetic markers and primer sites for PCR-based techniques. These elements may be more desirable for some applications than traditional DNA fingerprinting probes that detect tandemly repeated arrays.
NASA Astrophysics Data System (ADS)
Xu, Jiajie; Jiang, Bo; Chai, Sanming; He, Yuan; Zhu, Jianyi; Shen, Zonggen; Shen, Songdong
2016-09-01
Filamentous Bangia, which are distributed extensively throughout the world, have simple and similar morphological characteristics. Scientists can classify these organisms using molecular markers in combination with morphology. We successfully sequenced the complete nuclear ribosomal DNA, approximately 13 kb in length, from a marine Bangia population. We further analyzed the small subunit ribosomal DNA gene (nrSSU) and the internal transcribed spacer (ITS) sequence regions along with nine other marine, and two freshwater Bangia samples from China. Pairwise distances of the nrSSU and 5.8S ribosomal DNA gene sequences show the marine samples grouping together with low divergences (00.003; 0-0.006, respectively) from each other, but high divergences (0.123-0.126; 0.198, respectively) from freshwater samples. An exception is the marine sample collected from Weihai, which shows high divergence from both other marine samples (0.063-0.065; 0.129, respectively) and the freshwater samples (0.097; 0.120, respectively). A maximum likelihood phylogenetic tree based on a combined SSU-ITS dataset with maximum likelihood method shows the samples divided into three clades, with the two marine sample clades containing Bangia spp. from North America, Europe, Asia, and Australia; and one freshwater clade, containing Bangia atropurpurea from North America and China.
Amor, Nabil; Farjallah, Sarra; Salem, Mohamed; Lamine, Dia Mamadou; Merella, Paolo; Said, Khaled; Ben Slimane, Badreddine
2011-10-01
Fasciolosis caused by Fasciola hepatica and Fasciola gigantica (Platyhelminthes: Trematoda: Digenea) is considered the most important helminth infection of ruminants in tropical countries, causing considerable socioeconomic problems. From Africa, F. gigantica has been previously characterized from Burkina Faso, Senegal, Kenya, Zambia and Mali, while F. hepatica has been reported from Morocco and Tunisia, and both species have been observed from Ethiopia and Egypt on the basis of morphometric differences, while the use of molecular markers is necessary to distinguish exactly between species. Samples identified morphologically as F. gigantica (n=60) from sheep and cattle from different geographical localities of Mauritania were genetically characterized by sequences of the first (ITS-1), the 5.8S, and second (ITS-2) Internal Transcribed Spacers (ITS) of nuclear ribosomal DNA (rDNA) genes and the mitochondrial Cytochrome c Oxidase I (COI) gene. Comparison of the sequences of the Mauritanian samples with sequences of Fasciola spp. from GenBank confirmed that all samples belong to the species F. gigantica. The nucleotide sequencing of ITS rDNA of F. gigantica showed no nucleotide variation in the ITS-1, 5.8S, and ITS-2 rDNA sequences among all samples examined and those from Burkina Faso, Kenya, Egypt and Iran. The phylogenetic trees based on the ITS-1 and ITS-2 sequences showed a close relationship of the Mauritanian samples with isolates of F. gigantica from different localities of Africa and Asia. The COI genotypes of the Mauritanian specimens of F. gigantica had a high level of diversity, and they belonged to the F. gigantica phylogenically distinguishable clade. The present study is the first molecular characterization of F. gigantica in sheep and cattle from Mauritania, allowing a reliable approach for the genetic differentiation of Fasciola spp. and providing basis for further studies on liver flukes in the African countries. Copyright © 2011 Elsevier Inc. All rights reserved.
Redberg, G.L.; Hibbett, D.S.; Ammirati, J.F.; Rodriguez, R.J.
2003-01-01
The genetic diversity and phylogeny of Bridgeoporus nobilissimus have been analyzed. DNA was extracted from spores collected from individual fruiting bodies representing six geographically distinct populations in Oregon and Washington. Spore samples collected contained low levels of bacteria, yeast and a filamentous fungal species. Using taxon-specific PCR primers, it was possible to discriminate among rDNA from bacteria, yeast, a filamentous associate and B. nobilissimus. Nuclear rDNA internal transcribed spacer (ITS) region sequences of B. nobilissimus were compared among individuals representing six populations and were found to have less than 2% variation. These sequences also were used to design dual and nested PCR primers for B. nobilissimus-specific amplification. Mitochondrial small-subunit rDNA sequences were used in a phylogenetic analysis that placed B. nobilissimus in the hymenochaetoid clade, where it was associated with Oxyporus and Schizopora.
Diatom centromeres suggest a mechanism for nuclear DNA acquisition
Diner, Rachel E.; Noddings, Chari M.; Lian, Nathan C.; ...
2017-07-18
Centromeres are essential for cell division and growth in all eukaryotes, and knowledge of their sequence and structure guides the development of artificial chromosomes for functional cellular biology studies. Centromeric proteins are conserved among eukaryotes; however, centromeric DNA sequences are highly variable. We combined forward and reverse genetic approaches with chromatin immunoprecipitation to identify centromeres of the model diatom Phaeodactylum tricornutum. We observed 25 unique centromere sequences typically occurring once per chromosome, a finding that helps to resolve nuclear genome organization and indicates monocentric regional centromeres. Diatom centromere sequences contain low-GC content regions but lack repeats or other conserved sequencemore » features. Native and foreign sequences with similar GC content to P. tricornutum centromeres can maintain episomes and recruit the diatom centromeric histone protein CENH3, suggesting nonnative sequences can also function as diatom centromeres. Thus, simple sequence requirements may enable DNA from foreign sources to persist in the nucleus as extrachromosomal episomes, revealing a potential mechanism for organellar and foreign DNA acquisition.« less
Diatom centromeres suggest a mechanism for nuclear DNA acquisition
DOE Office of Scientific and Technical Information (OSTI.GOV)
Diner, Rachel E.; Noddings, Chari M.; Lian, Nathan C.
Centromeres are essential for cell division and growth in all eukaryotes, and knowledge of their sequence and structure guides the development of artificial chromosomes for functional cellular biology studies. Centromeric proteins are conserved among eukaryotes; however, centromeric DNA sequences are highly variable. We combined forward and reverse genetic approaches with chromatin immunoprecipitation to identify centromeres of the model diatom Phaeodactylum tricornutum. We observed 25 unique centromere sequences typically occurring once per chromosome, a finding that helps to resolve nuclear genome organization and indicates monocentric regional centromeres. Diatom centromere sequences contain low-GC content regions but lack repeats or other conserved sequencemore » features. Native and foreign sequences with similar GC content to P. tricornutum centromeres can maintain episomes and recruit the diatom centromeric histone protein CENH3, suggesting nonnative sequences can also function as diatom centromeres. Thus, simple sequence requirements may enable DNA from foreign sources to persist in the nucleus as extrachromosomal episomes, revealing a potential mechanism for organellar and foreign DNA acquisition.« less
PCR tools for the verification of the specific identity of ascaridoid nematodes from dogs and cats.
Li, M W; Lin, R Q; Chen, H H; Sani, R A; Song, H Q; Zhu, X Q
2007-01-01
Based on the sequences of the internal transcribed spacers (ITS-1 and ITS-2) of nuclear ribosomal DNA (rDNA) of Toxocara canis, Toxocara cati, Toxocara malaysiensis and Toxascaris leonina, specific forward primers were designed in the ITS-1 or ITS-2 for each of the four ascaridoid species of dogs and cats. These primers were used individually together with a conserved primer in the large subunit of rDNA to amplify partial ITS-1 and/or ITS-2 of rDNA from 107 DNA samples from ascaridoids from dogs and cats in China, Australia, Malaysia, England and the Netherlands. This approach allowed their specific identification, with no amplicons being amplified from heterogeneous DNA samples, and sequencing confirmed the identity of the sequences amplified. The minimum amounts of DNA detectable using the PCR assays were 0.13-0.54ng. These PCR assays should provide useful tools for the diagnosis and molecular epidemiological investigations of toxocariasis in humans and animals.
Contrasting population structure from nuclear intron sequences and mtDNA of humpback whales.
Palumbi, S R; Baker, C S
1994-05-01
Powerful analyses of population structure require information from multiple genetic loci. To help develop a molecular toolbox for obtaining this information, we have designed universal oligonucleotide primers that span conserved intron-exon junctions in a wide variety of animal phyla. We test the utility of exon-primed, intron-crossing amplifications by analyzing the variability of actin intron sequences from humpback, blue, and bowhead whales and comparing the results with mitochondrial DNA (mtDNA) haplotype data. Humpback actin introns fall into two major clades that exist in different frequencies in different oceanic populations. It is surprising that Hawaii and California populations, which are very distinct in mtDNAs, are similar in actin intron alleles. This discrepancy between mtDNA and nuclear DNA results may be due either to differences in genetic drift in mitochondrial and nuclear genes or to preferential movement of males, which do not transmit mtDNA to offspring, between separate breeding grounds. Opposing mtDNA and nuclear DNA results can help clarify otherwise hidden patterns of structure in natural populations.
John Syring; Ann Willyard; Richard Cronn; Aaron Liston
2005-01-01
Sequence data from nrITS and cpDNA have failed to fully resolve phylogenetic relationships among Pinus species. Four low-copy nuclear genes, developed from the screening of 73 mapped conifer anchor loci, were sequenced from 12 species representing all subsections. Individual loci do not uniformly support either the nrITS or cpDNA hypotheses and in...
Highly conserved D-loop-like nuclear mitochondrial sequences (Numts) in tiger (Panthera tigris).
Zhang, Wenping; Zhang, Zhihe; Shen, Fujun; Hou, Rong; Lv, Xiaoping; Yue, Bisong
2006-08-01
Using oligonucleotide primers designed to match hypervariable segments I (HVS-1) of Panthera tigris mitochondrial DNA (mtDNA), we amplified two different PCR products (500 bp and 287 bp) in the tiger (Panthera tigris), but got only one PCR product (287 bp) in the leopard (Panthera pardus). Sequence analyses indicated that the sequence of 287 bp was a D-loop-like nuclear mitochondrial sequence (Numts), indicating a nuclear transfer that occurred approximately 4.8-17 million years ago in the tiger and 4.6-16 million years ago in the leopard. Although the mtDNA D-loop sequence has a rapid rate of evolution, the 287-bp Numts are highly conserved; they are nearly identical in tiger subspecies and only 1.742% different between tiger and leopard. Thus, such sequences represent molecular 'fossils' that can shed light on evolution of the mitochondrial genome and may be the most appropriate outgroup for phylogenetic analysis. This is also proved by comparing the phylogenetic trees reconstructed using the D-loop sequence of snow leopard and the 287-bp Numts as outgroup.
Nuclear genomes distinguish cryptic species suggested by their DNA barcodes and ecology
Janzen, Daniel H.; Burns, John M.; Cong, Qian; Hallwachs, Winnie; Dapkey, Tanya; Manjunath, Ramya; Hajibabaei, Mehrdad; Hebert, Paul D. N.; Grishin, Nick V.
2017-01-01
DNA sequencing brings another dimension to exploration of biodiversity, and large-scale mitochondrial DNA cytochrome oxidase I barcoding has exposed many potential new cryptic species. Here, we add complete nuclear genome sequencing to DNA barcoding, ecological distribution, natural history, and subtleties of adult color pattern and size to show that a widespread neotropical skipper butterfly known as Udranomia kikkawai (Weeks) comprises three different species in Costa Rica. Full-length barcodes obtained from all three century-old Venezuelan syntypes of U. kikkawai show that it is a rainforest species occurring from Costa Rica to Brazil. The two new species are Udranomia sallydaleyae Burns, a dry forest denizen occurring from Costa Rica to Mexico, and Udranomia tomdaleyi Burns, which occupies the junction between the rainforest and dry forest and currently is known only from Costa Rica. Whereas the three species are cryptic, differing but slightly in appearance, their complete nuclear genomes totaling 15 million aligned positions reveal significant differences consistent with their 0.00065-Mbp (million base pair) mitochondrial barcodes and their ecological diversification. DNA barcoding of tropical insects reared by a massive inventory suggests that the presence of cryptic species is a widespread phenomenon and that further studies will substantially increase current estimates of insect species richness. PMID:28716927
Postberg, Jan; Heyse, Katharina; Cremer, Marion; Cremer, Thomas; Lipps, Hans J
2008-01-01
Background: In this study we exploit the unique genome organization of ciliates to characterize the biological function of histone modification patterns and chromatin plasticity for the processing of specific DNA sequences during a nuclear differentiation process. Ciliates are single-cell eukaryotes containing two morphologically and functionally specialized types of nuclei, the somatic macronucleus and the germline micronucleus. In the course of sexual reproduction a new macronucleus develops from a micronuclear derivative. During this process specific DNA sequences are eliminated from the genome, while sequences that will be transcribed in the mature macronucleus are retained. Results: We show by immunofluorescence microscopy, Western analyses and chromatin immunoprecipitation (ChIP) experiments that each nuclear type establishes its specific histone modification signature. Our analyses reveal that the early macronuclear anlage adopts a permissive chromatin state immediately after the fusion of two heterochromatic germline micronuclei. As macronuclear development progresses, repressive histone modifications that specify sequences to be eliminated are introduced de novo. ChIP analyses demonstrate that permissive histone modifications are associated with sequences that will be retained in the new macronucleus. Furthermore, our data support the hypothesis that a PIWI-family protein is involved in a transnuclear cross-talk and in the RNAi-dependent control of developmental chromatin reorganization. Conclusion: Based on these data we present a comprehensive analysis of the spatial and temporal pattern of histone modifications during this nuclear differentiation process. Results obtained in this study may also be relevant for our understanding of chromatin plasticity during metazoan embryogenesis. PMID:19014664
Genetic characterization of Common Eiders breeding in the Yukon-Kuskokwim Delta, Alaska
Sonsthagen, Sarah A.; Talbot, Sandra L.; McCracken, Kevin G.
2007-01-01
We assessed population genetic subdivision among four colonies of Common Eiders (Somateria mollissima v-nigrum) breeding in the Yukon-Kuskokwim Delta (YKD), Alaska, using microsatellite genotypes and DNA sequences with differing modes of inheritance. Significant, albeit low, levels of genetic differentiation were observed between mainland populations and Kigigak Island for nuclear intron lamin A and mitochondrial DNA (mtDNA) control region. Intercolony variation in haplotypic frequencies also was observed at mtDNA. Positive growth signatures assayed from microsatellites, nuclear introns, and mtDNA indicate recent colonization of the YKD, and may explain the low levels of structuring observed. Gene flow estimates based on microsatellites, nuclear introns, and mtDNA suggest asymmetrical gene flow between mainland colonies and Kigigak Island, with more individuals on average dispersing from mainland populations to Kigigak Island than vice versa. The directionality of gene flow observed may be explained by the colonization of the YKD from northern glacial refugia or by YKD metapopulation dynamics.
El-Sherry, Shiem; Ogedengbe, Mosun E; Hafeez, Mian A; Barta, John R
2013-07-01
Multiple 18S rDNA sequences were obtained from two single-oocyst-derived lines of each of Eimeria meleagrimitis and Eimeria adenoeides. After analysing the 15 new 18S rDNA sequences from two lines of E. meleagrimitis and 17 new sequences from two lines of E. adenoeides, there were clear indications that divergent, paralogous 18S rDNA copies existed within the nuclear genome of E. meleagrimitis. In contrast, mitochondrial cytochrome c oxidase subunit I (COI) partial sequences from all lines of a particular Eimeria sp. were identical and, in phylogenetic analyses, COI sequences clustered unambiguously in monophyletic and highly-supported clades specific to individual Eimeria sp. Phylogenetic analysis of the new 18S rDNA sequences from E. meleagrimitis showed that they formed two distinct clades: Type A with four new sequences; and Type B with nine new sequences; both Types A and B sequences were obtained from each of the single-oocyst-derived lines of E. meleagrimitis. Together these rDNA types formed a well-supported E. meleagrimitis clade. Types A and B 18S rDNA sequences from E. meleagrimitis had a mean sequence identity of only 97.4% whereas mean sequence identity within types was 99.1-99.3%. The observed intraspecific sequence divergence among E. meleagrimitis 18S rDNA sequence types was even higher (approximately 2.6%) than the interspecific sequence divergence present between some well-recognized species such as Eimeria tenella and Eimeria necatrix (1.1%). Our observations suggest that, unlike COI sequences, 18S rDNA sequences are not reliable molecular markers to be used alone for species identification with coccidia, although 18S rDNA sequences have clear utility for phylogenetic reconstruction of apicomplexan parasites at the genus and higher taxonomic ranks. Copyright © 2013. Published by Elsevier Ltd.
A Novel Model System to Examine Agents Used in Breast Cancer Therapy.
1995-07-01
We have recently characterized a multiprotein DNA replication complex (MRC) that was purified from NODA NIB 468 human breast cancer cells by a series...proliferating cell nuclear antigen (PCNA), RE-C RP-A and DNA topoisomerase I. Based upon its requirements for DNA replication activity and its...SV4O) origin sequences, the MRC executes all of the steps required for the in vitro, bidirectional replication of the SV4O genome. Several of the DNA
Triangulating the provenance of African elephants using mitochondrial DNA
Ishida, Yasuko; Georgiadis, Nicholas J; Hondo, Tomoko; Roca, Alfred L
2013-01-01
African elephant mitochondrial (mt) DNA follows a distinctive evolutionary trajectory. As females do not migrate between elephant herds, mtDNA exhibits low geographic dispersal. We therefore examined the effectiveness of mtDNA for assigning the provenance of African elephants (or their ivory). For 653 savanna and forest elephants from 22 localities in 13 countries, 4258 bp of mtDNA was sequenced. We detected eight mtDNA subclades, of which seven had regionally restricted distributions. Among 108 unique haplotypes identified, 72% were found at only one locality and 84% were country specific, while 44% of individuals carried a haplotype detected only at their sampling locality. We combined 316 bp of our control region sequences with those generated by previous trans-national surveys of African elephants. Among 101 unique control region haplotypes detected in African elephants across 81 locations in 22 countries, 62% were present in only a single country. Applying our mtDNA results to a previous microsatellite-based assignment study would improve estimates of the provenance of elephants in 115 of 122 mis-assigned cases. Nuclear partitioning followed species boundaries and not mtDNA subclade boundaries. For taxa such as elephants in which nuclear and mtDNA markers differ in phylogeography, combining the two markers can triangulate the origins of confiscated wildlife products. PMID:23798975
Pelnena, Dita; Burnyte, Birute; Jankevics, Eriks; Lace, Baiba; Dagyte, Evelina; Grigalioniene, Kristina; Utkus, Algirdas; Krumina, Zita; Rozentale, Jolanta; Adomaitiene, Irina; Stavusis, Janis; Pliss, Liana; Inashkina, Inna
2017-12-12
The most common mitochondrial disorder in children is Leigh syndrome, which is a progressive and genetically heterogeneous neurodegenerative disorder caused by mutations in nuclear genes or mitochondrial DNA (mtDNA). In the present study, a novel and robust method of complete mtDNA sequencing, which allows amplification of the whole mitochondrial genome, was tested. Complete mtDNA sequencing was performed in a cohort of patients with suspected mitochondrial mutations. Patients from Latvia and Lithuania (n = 92 and n = 57, respectively) referred by clinical geneticists were included. The de novo point mutations m.9185T>C and m.13513G>A, respectively, were detected in two patients with lactic acidosis and neurodegenerative lesions. In one patient with neurodegenerative lesions, the mutation m.9185T>C was identified. These mutations are associated with Leigh syndrome. The present data suggest that full-length mtDNA sequencing is recommended as a supplement to nuclear gene testing and enzymatic assays to enhance mitochondrial disease diagnostics.
Setoguchi, H; Watanabe, I
2000-06-01
Hybridization and introgression play important roles in plant evolution, and their occurrence on the oceanic islands provides good examples of plant speciation and diversification. Restriction fragment length polymorphisms (RFLPs) and trnL (UAA) 3'exon-trnF (GAA) intergenic spacer (IGS) sequences of chloroplast DNA (cpDNA), and the sequences of internal transcribed spacer (ITS) of nuclear ribosomal DNA were examined to investigate the occurrence of gene transfer in Ilex species on the Bonin Islands and the Ryukyu Islands in Japan. A gene phylogeny for the plastid genome is in agreement with the morphologically based taxonomy, whereas the nuclear genome phylogeny clusters putatively unrelated endemics both on the Bonin and the Ryukyu Islands. Intersectional hybridization and nuclear gene flow were independently observed in insular endemics of Ilex on both sets of islands without evidence of plastid introgression. Gene flow observed in these island systems can be explained by ecological features of insular endemics, i.e., limits of distribution range or sympatric distribution in a small land area.
Regional differences in mitochondrial DNA methylation in human post-mortem brain tissue.
Devall, Matthew; Smith, Rebecca G; Jeffries, Aaron; Hannon, Eilis; Davies, Matthew N; Schalkwyk, Leonard; Mill, Jonathan; Weedon, Michael; Lunnon, Katie
2017-01-01
DNA methylation is an important epigenetic mechanism involved in gene regulation, with alterations in DNA methylation in the nuclear genome being linked to numerous complex diseases. Mitochondrial DNA methylation is a phenomenon that is receiving ever-increasing interest, particularly in diseases characterized by mitochondrial dysfunction; however, most studies have been limited to the investigation of specific target regions. Analyses spanning the entire mitochondrial genome have been limited, potentially due to the amount of input DNA required. Further, mitochondrial genetic studies have been previously confounded by nuclear-mitochondrial pseudogenes. Methylated DNA Immunoprecipitation Sequencing is a technique widely used to profile DNA methylation across the nuclear genome; however, reads mapped to mitochondrial DNA are often discarded. Here, we have developed an approach to control for nuclear-mitochondrial pseudogenes within Methylated DNA Immunoprecipitation Sequencing data. We highlight the utility of this approach in identifying differences in mitochondrial DNA methylation across regions of the human brain and pre-mortem blood. We were able to correlate mitochondrial DNA methylation patterns between the cortex, cerebellum and blood. We identified 74 nominally significant differentially methylated regions ( p < 0.05) in the mitochondrial genome, between anatomically separate cortical regions and the cerebellum in matched samples ( N = 3 matched donors). Further analysis identified eight significant differentially methylated regions between the total cortex and cerebellum after correcting for multiple testing. Using unsupervised hierarchical clustering analysis of the mitochondrial DNA methylome, we were able to identify tissue-specific patterns of mitochondrial DNA methylation between blood, cerebellum and cortex. Our study represents a comprehensive analysis of the mitochondrial methylome using pre-existing Methylated DNA Immunoprecipitation Sequencing data to identify brain region-specific patterns of mitochondrial DNA methylation.
Repetitive sequences in plant nuclear DNA: types, distribution, evolution and function.
Mehrotra, Shweta; Goyal, Vinod
2014-08-01
Repetitive DNA sequences are a major component of eukaryotic genomes and may account for up to 90% of the genome size. They can be divided into minisatellite, microsatellite and satellite sequences. Satellite DNA sequences are considered to be a fast-evolving component of eukaryotic genomes, comprising tandemly-arrayed, highly-repetitive and highly-conserved monomer sequences. The monomer unit of satellite DNA is 150-400 base pairs (bp) in length. Repetitive sequences may be species- or genus-specific, and may be centromeric or subtelomeric in nature. They exhibit cohesive and concerted evolution caused by molecular drive, leading to high sequence homogeneity. Repetitive sequences accumulate variations in sequence and copy number during evolution, hence they are important tools for taxonomic and phylogenetic studies, and are known as "tuning knobs" in the evolution. Therefore, knowledge of repetitive sequences assists our understanding of the organization, evolution and behavior of eukaryotic genomes. Repetitive sequences have cytoplasmic, cellular and developmental effects and play a role in chromosomal recombination. In the post-genomics era, with the introduction of next-generation sequencing technology, it is possible to evaluate complex genomes for analyzing repetitive sequences and deciphering the yet unknown functional potential of repetitive sequences. Copyright © 2014 The Authors. Production and hosting by Elsevier Ltd.. All rights reserved.
A chromatin insulator determines the nuclear localization of DNA.
Gerasimova, T I; Byrd, K; Corces, V G
2000-11-01
Chromatin insulators might regulate gene expression by controlling the subnuclear organization of DNA. We found that a DNA sequence normally located inside of the nucleus moved to the periphery when the gypsy insulator was placed within the sequence. The presence of the gypsy insulator also caused two sequences, normally found in different regions of the nucleus, to come together at a single location. Alterations in this subnuclear organization imposed by the gypsy insulator correlated with changes in gene expression that took place during the heat-shock response. These global changes in transcription were accompanied by dramatic alterations in the distribution of insulator proteins and DNA. The results suggest that the nuclear organization imposed by the gypsy insulator on the chromatin fiber is important for gene expression.
Sarower, Mohammed Golam; Shahriar, Sheik Istiak Md; Nakamura, Hiromasa; Rouf, Muhammad Abdur; Okada, Shigeru
2017-11-01
Taxonomy of mud crabs genus Scylla has been misidentified for several years due to their high morphological plasticity. Several reports concerning mud crab have been published with misleading identification in Bangladesh. In this study, partial fragments of nuclear and mitochondrial DNA of Scylla species obtained from four locations along the Bangladesh coast were used to resolve taxonomical ambiguity of mud crab species. A single PCR product from the nuclear first internal transcribed spacer (ITS-1) marker and phylogenetic trees constructed based on 16S rDNA sequences indicated that all Scylla species obtained in this study were S. olivacea. Both molecular data and morphological characters revealed that S. olivacea is the only major species in Bangladesh coastal waters. Further, the 16S rDNA haplotypes significantly differed with known S. serrata by 33%. From this study it is clear that 'S. serrata' commonly reported from Bangladesh should be S. olivacea.
C. Mae Culumber; Steve R. Larson; Kevin B. Jensen; Thomas A. Jones
2011-01-01
Leymus is a genomically defined allopolyploid of genus Triticeae with two distinct subgenomes. Chloroplast DNA sequences of Eurasian and North American species are distinct and polyphyletic. However, phylogenies derived from chloroplast and nuclear DNA sequences are confounded by polyploidy and lack of polymorphism among many taxa. The AFLP technique can resolve...
Hawlitschek, Oliver; Porch, Nick; Hendrich, Lars; Balke, Michael
2011-02-09
DNA sequencing techniques used to estimate biodiversity, such as DNA barcoding, may reveal cryptic species. However, disagreements between barcoding and morphological data have already led to controversy. Species delimitation should therefore not be based on mtDNA alone. Here, we explore the use of nDNA and bioclimatic modelling in a new species of aquatic beetle revealed by mtDNA sequence data. The aquatic beetle fauna of Australia is characterised by high degrees of endemism, including local radiations such as the genus Antiporus. Antiporus femoralis was previously considered to exist in two disjunct, but morphologically indistinguishable populations in south-western and south-eastern Australia. We constructed a phylogeny of Antiporus and detected a deep split between these populations. Diagnostic characters from the highly variable nuclear protein encoding arginine kinase gene confirmed the presence of two isolated populations. We then used ecological niche modelling to examine the climatic niche characteristics of the two populations. All results support the status of the two populations as distinct species. We describe the south-western species as Antiporus occidentalis sp.n. In addition to nDNA sequence data and extended use of mitochondrial sequences, ecological niche modelling has great potential for delineating morphologically cryptic species.
Hawlitschek, Oliver; Porch, Nick; Hendrich, Lars; Balke, Michael
2011-01-01
Background DNA sequencing techniques used to estimate biodiversity, such as DNA barcoding, may reveal cryptic species. However, disagreements between barcoding and morphological data have already led to controversy. Species delimitation should therefore not be based on mtDNA alone. Here, we explore the use of nDNA and bioclimatic modelling in a new species of aquatic beetle revealed by mtDNA sequence data. Methodology/Principal Findings The aquatic beetle fauna of Australia is characterised by high degrees of endemism, including local radiations such as the genus Antiporus. Antiporus femoralis was previously considered to exist in two disjunct, but morphologically indistinguishable populations in south-western and south-eastern Australia. We constructed a phylogeny of Antiporus and detected a deep split between these populations. Diagnostic characters from the highly variable nuclear protein encoding arginine kinase gene confirmed the presence of two isolated populations. We then used ecological niche modelling to examine the climatic niche characteristics of the two populations. All results support the status of the two populations as distinct species. We describe the south-western species as Antiporus occidentalis sp.n. Conclusion/Significance In addition to nDNA sequence data and extended use of mitochondrial sequences, ecological niche modelling has great potential for delineating morphologically cryptic species. PMID:21347370
Zheng, Xiaoyan; Cai, Danying; Potter, Daniel; Postman, Joseph; Liu, Jing; Teng, Yuanwen
2014-11-01
Reconstructing the phylogeny of Pyrus has been difficult due to the wide distribution of the genus and lack of informative data. In this study, we collected 110 accessions representing 25 Pyrus species and constructed both phylogenetic trees and phylogenetic networks based on multiple DNA sequence datasets. Phylogenetic trees based on both cpDNA and nuclear LFY2int2-N (LN) data resulted in poor resolution, especially, only five primary species were monophyletic in the LN tree. A phylogenetic network of LN suggested that reticulation caused by hybridization is one of the major evolutionary processes for Pyrus species. Polytomies of the gene trees and star-like structure of cpDNA networks suggested rapid radiation is another major evolutionary process, especially for the occidental species. Pyrus calleryana and P. regelii were the earliest diverged Pyrus species. Two North African species, P. cordata, P. spinosa and P. betulaefolia were descendent of primitive stock Pyrus species and still share some common molecular characters. Southwestern China, where a large number of P. pashia populations are found, is probably the most important diversification center of Pyrus. More accessions and nuclear genes are needed for further understanding the evolutionary histories of Pyrus. Copyright © 2014 Elsevier Inc. All rights reserved.
Beaudet, Denis; de la Providencia, Ivan Enrique; Labridy, Manuel; Roy-Bolduc, Alice; Daubois, Laurence; Hijri, Mohamed
2014-12-19
Arbuscular mycorrhizal fungi (AMF) are multinucleated and coenocytic organisms, in which the extent of the intraisolate nuclear genetic variation has been a source of debate. Conversely, their mitochondrial genomes (mtDNAs) have appeared to be homogeneous within isolates in all next generation sequencing (NGS)-based studies. Although several lines of evidence have challenged mtDNA homogeneity in AMF, extensive survey to investigate intraisolate allelic diversity has not previously been undertaken. In this study, we used a conventional polymerase chain reaction -based approach on selected mitochondrial regions with a high-fidelity DNA polymerase, followed by cloning and Sanger sequencing. Two isolates of Rhizophagus irregularis were used, one cultivated in vitro for several generations (DAOM-197198) and the other recently isolated from the field (DAOM-242422). At different loci in both isolates, we found intraisolate allelic variation within the mtDNA and in a single copy nuclear marker, which highlighted the presence of several nonsynonymous mutations in protein coding genes. We confirmed that some of this variation persisted in the transcriptome, giving rise to at least four distinct nad4 transcripts in DAOM-197198. We also detected the presence of numerous mitochondrial DNA copies within nuclear genomes (numts), providing insights to understand this important evolutionary process in AMF. Our study reveals that genetic variation in Glomeromycota is higher than what had been previously assumed and also suggests that it could have been grossly underestimated in most NGS-based AMF studies, both in mitochondrial and nuclear genomes, due to the presence of low-level mutations. © The Author(s) 2014. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.
Genomic treasure troves: complete genome sequencing of herbarium and insect museum specimens.
Staats, Martijn; Erkens, Roy H J; van de Vossenberg, Bart; Wieringa, Jan J; Kraaijeveld, Ken; Stielow, Benjamin; Geml, József; Richardson, James E; Bakker, Freek T
2013-01-01
Unlocking the vast genomic diversity stored in natural history collections would create unprecedented opportunities for genome-scale evolutionary, phylogenetic, domestication and population genomic studies. Many researchers have been discouraged from using historical specimens in molecular studies because of both generally limited success of DNA extraction and the challenges associated with PCR-amplifying highly degraded DNA. In today's next-generation sequencing (NGS) world, opportunities and prospects for historical DNA have changed dramatically, as most NGS methods are actually designed for taking short fragmented DNA molecules as templates. Here we show that using a standard multiplex and paired-end Illumina sequencing approach, genome-scale sequence data can be generated reliably from dry-preserved plant, fungal and insect specimens collected up to 115 years ago, and with minimal destructive sampling. Using a reference-based assembly approach, we were able to produce the entire nuclear genome of a 43-year-old Arabidopsis thaliana (Brassicaceae) herbarium specimen with high and uniform sequence coverage. Nuclear genome sequences of three fungal specimens of 22-82 years of age (Agaricus bisporus, Laccaria bicolor, Pleurotus ostreatus) were generated with 81.4-97.9% exome coverage. Complete organellar genome sequences were assembled for all specimens. Using de novo assembly we retrieved between 16.2-71.0% of coding sequence regions, and hence remain somewhat cautious about prospects for de novo genome assembly from historical specimens. Non-target sequence contaminations were observed in 2 of our insect museum specimens. We anticipate that future museum genomics projects will perhaps not generate entire genome sequences in all cases (our specimens contained relatively small and low-complexity genomes), but at least generating vital comparative genomic data for testing (phylo)genetic, demographic and genetic hypotheses, that become increasingly more horizontal. Furthermore, NGS of historical DNA enables recovering crucial genetic information from old type specimens that to date have remained mostly unutilized and, thus, opens up a new frontier for taxonomic research as well.
Schuster, Tanja M.; Setaro, Sabrina D.; Tibbits, Josquin F. G.; Batty, Erin L.; Fowler, Rachael M.; McLay, Todd G. B.; Wilcox, Stephen; Ades, Peter K.
2018-01-01
Previous molecular phylogenetic analyses have resolved the Australian bloodwood eucalypt genus Corymbia (~100 species) as either monophyletic or paraphyletic with respect to Angophora (9–10 species). Here we assess relationships of Corymbia and Angophora using a large dataset of chloroplast DNA sequences (121,016 base pairs; from 90 accessions representing 55 Corymbia and 8 Angophora species, plus 33 accessions of related genera), skimmed from high throughput sequencing of genomic DNA, and compare results with new analyses of nuclear ITS sequences (119 accessions) from previous studies. Maximum likelihood and maximum parsimony analyses of cpDNA resolve well supported trees with most nodes having >95% bootstrap support. These trees strongly reject monophyly of Corymbia, its two subgenera (Corymbia and Blakella), most taxonomic sections (Abbreviatae, Maculatae, Naviculares, Septentrionales), and several species. ITS trees weakly indicate paraphyly of Corymbia (bootstrap support <50% for maximum likelihood, and 71% for parsimony), but are highly incongruent with the cpDNA analyses, in that they support monophyly of both subgenera and some taxonomic sections of Corymbia. The striking incongruence between cpDNA trees and both morphological taxonomy and ITS trees is attributed largely to chloroplast introgression between taxa, because of geographic sharing of chloroplast clades across taxonomic groups. Such introgression has been widely inferred in studies of the related genus Eucalyptus. This is the first report of its likely prevalence in Corymbia and Angophora, but this is consistent with previous morphological inferences of hybridisation between species. Our findings (based on continent-wide sampling) highlight a need for more focussed studies to assess the extent of hybridisation and introgression in the evolutionary history of these genera, and that critical testing of the classification of Corymbia and Angophora requires additional sequence data from nuclear genomes. PMID:29668710
Dor, Roi; Carling, Matthew D; Lovette, Irby J; Sheldon, Frederick H; Winkler, David W
2012-10-01
The New World swallow genus Tachycineta comprises nine species that collectively have a wide geographic distribution and remarkable variation both within- and among-species in ecologically important traits. Existing phylogenetic hypotheses for Tachycineta are based on mitochondrial DNA sequences, thus they provide estimates of a single gene tree. In this study we sequenced multiple individuals from each species at 16 nuclear intron loci. We used gene concatenated approaches (Bayesian and maximum likelihood) as well as coalescent-based species tree inference to reconstruct phylogenetic relationships of the genus. We examined the concordance and conflict between the nuclear and mitochondrial trees and between concatenated and coalescent-based inferences. Our results provide an alternative phylogenetic hypothesis to the existing mitochondrial DNA estimate of phylogeny. This new hypothesis provides a more accurate framework in which to explore trait evolution and examine the evolution of the mitochondrial genome in this group. Copyright © 2012 Elsevier Inc. All rights reserved.
2013-01-01
Background Vitis vinifera L. is one of society’s most important agricultural crops with a broad genetic variability. The difficulty in recognizing grapevine genotypes based on ampelographic traits and secondary metabolites prompted the development of molecular markers suitable for achieving variety genetic identification. Findings Here, we propose a comparison between a multi-locus barcoding approach based on six chloroplast markers and a single-copy nuclear gene sequencing method using five coding regions combined with a character-based system with the aim of reconstructing cultivar-specific haplotypes and genotypes to be exploited for the molecular characterization of 157 V. vinifera accessions. The analysis of the chloroplast target regions proved the inadequacy of the DNA barcoding approach at the subspecies level, and hence further DNA genotyping analyses were targeted on the sequences of five nuclear single-copy genes amplified across all of the accessions. The sequencing of the coding region of the UFGT nuclear gene (UDP-glucose: flavonoid 3-0-glucosyltransferase, the key enzyme for the accumulation of anthocyanins in berry skins) enabled the discovery of discriminant SNPs (1/34 bp) and the reconstruction of 130 V. vinifera distinct genotypes. Most of the genotypes proved to be cultivar-specific, and only few genotypes were shared by more, although strictly related, cultivars. Conclusion On the whole, this technique was successful for inferring SNP-based genotypes of grapevine accessions suitable for assessing the genetic identity and ancestry of international cultivars and also useful for corroborating some hypotheses regarding the origin of local varieties, suggesting several issues of misidentification (synonymy/homonymy). PMID:24298902
The primary structure of L37--a rat ribosomal protein with a zinc finger-like motif.
Chan, Y L; Paz, V; Olvera, J; Wool, I G
1993-04-30
The amino acid sequence of the rat 60S ribosomal subunit protein L37 was deduced from the sequence of nucleotides in a recombinant cDNA. Ribosomal protein L37 has 96 amino acids, the NH2-terminal methionine is removed after translation of the mRNA, and has a molecular weight of 10,939. Ribosomal protein L37 has a single zinc finger-like motif of the C2-C2 type. Hybridization of the cDNA to digests of nuclear DNA suggests that there are 13 or 14 copies of the L37 gene. The mRNA for the protein is about 500 nucleotides in length. Rat L37 is related to Saccharomyces cerevisiae ribosomal protein YL35 and to Caenorhabditis elegans L37. We have identified in the data base a DNA sequence that encodes the chicken homolog of rat L37.
Ned B. Klopfenstein; Jane E. Stewart; Yuko Ota; John W. Hanna; Bryce A. Richardson; Amy L. Ross-Davis; Ruben D. Elias-Roman; Kari Korhonen; Nenad Keca; Eugenia Iturritxa; Dionicio Alvarado-Rosales; Halvor Solheim; Nicholas J. Brazee; Piotr Lakomy; Michelle R. Cleary; Eri Hasegawa; Taisei Kikuchi; Fortunato Garza-Ocanas; Panaghiotis Tsopelas; Daniel Rigling; Simone Prospero; Tetyana Tsykun; Jean A. Berube; Franck O. P. Stefani; Saeideh Jafarpour; Vladimir Antonin; Michal Tomsovsky; Geral I. McDonald; Stephen Woodward; Mee-Sook Kim
2017-01-01
Armillaria possesses several intriguing characteristics that have inspired wide interest in understanding phylogenetic relationships within and among species of this genus. Nuclear ribosomal DNA sequenceâbased analyses of Armillaria provide only limited information for phylogenetic studies among widely divergent taxa. More recent studies have shown that translation...
The Neandertal genome and ancient DNA authenticity
Green, Richard E; Briggs, Adrian W; Krause, Johannes; Prüfer, Kay; Burbano, Hernán A; Siebauer, Michael; Lachmann, Michael; Pääbo, Svante
2009-01-01
Recent advances in high-thoughput DNA sequencing have made genome-scale analyses of genomes of extinct organisms possible. With these new opportunities come new difficulties in assessing the authenticity of the DNA sequences retrieved. We discuss how these difficulties can be addressed, particularly with regard to analyses of the Neandertal genome. We argue that only direct assays of DNA sequence positions in which Neandertals differ from all contemporary humans can serve as a reliable means to estimate human contamination. Indirect measures, such as the extent of DNA fragmentation, nucleotide misincorporations, or comparison of derived allele frequencies in different fragment size classes, are unreliable. Fortunately, interim approaches based on mtDNA differences between Neandertals and current humans, detection of male contamination through Y chromosomal sequences, and repeated sequencing from the same fossil to detect autosomal contamination allow initial large-scale sequencing of Neandertal genomes. This will result in the discovery of fixed differences in the nuclear genome between Neandertals and current humans that can serve as future direct assays for contamination. For analyses of other fossil hominins, which may become possible in the future, we suggest a similar ‘boot-strap' approach in which interim approaches are applied until sufficient data for more definitive direct assays are acquired. PMID:19661919
Visualization of chromatin domains created by the gypsy insulator of Drosophila.
Byrd, Keith; Corces, Victor G
2003-08-18
Insulators might regulate gene expression by establishing and maintaining the organization of the chromatin fiber within the nucleus. Biochemical fractionation and in situ high salt extraction of lysed cells show that two known protein components of the gypsy insulator are present in the nuclear matrix. Using FISH with DNA probes located between two endogenous Su(Hw) binding sites, we show that the intervening DNA is arranged in a loop, with the two insulators located at the base. Mutations in insulator proteins, subjecting the cells to a brief heat shock, or destruction of the nuclear matrix lead to disruption of the loop. Insertion of an additional gypsy insulator in the center of the loop results in the formation of paired loops through the attachment of the inserted sequences to the nuclear matrix. These results suggest that the gypsy insulator might establish higher-order domains of chromatin structure and regulate nuclear organization by tethering the DNA to the nuclear matrix and creating chromatin loops.
NASA Astrophysics Data System (ADS)
Narayanaswamy, Nagarjun; Kumar, Manoj; Das, Sadhan; Sharma, Rahul; Samanta, Pralok K.; Pati, Swapan K.; Dhar, Suman K.; Kundu, Tapas K.; Govindaraju, T.
2014-09-01
Sequence-specific recognition of DNA by small turn-on fluorescence probes is a promising tool for bioimaging, bioanalytical and biomedical applications. Here, the authors report a novel cell-permeable and red fluorescent hemicyanine-based thiazole coumarin (TC) probe for DNA recognition, nuclear staining and cell cycle analysis. TC exhibited strong fluorescence enhancement in the presence of DNA containing AT-base pairs, but did not fluoresce with GC sequences, single-stranded DNA, RNA and proteins. The fluorescence staining of HeLa S3 and HEK 293 cells by TC followed by DNase and RNase digestion studies depicted the selective staining of DNA in the nucleus over the cytoplasmic region. Fluorescence-activated cell sorting (FACS) analysis by flow cytometry demonstrated the potential application of TC in cell cycle analysis in HEK 293 cells. Metaphase chromosome and malaria parasite DNA imaging studies further confirmed the in vivo diagnostic and therapeutic applications of probe TC. Probe TC may find multiple applications in fluorescence spectroscopy, diagnostics, bioimaging and molecular and cell biology.
Narayanaswamy, Nagarjun; Kumar, Manoj; Das, Sadhan; Sharma, Rahul; Samanta, Pralok K.; Pati, Swapan K.; Dhar, Suman K.; Kundu, Tapas K.; Govindaraju, T.
2014-01-01
Sequence-specific recognition of DNA by small turn-on fluorescence probes is a promising tool for bioimaging, bioanalytical and biomedical applications. Here, the authors report a novel cell-permeable and red fluorescent hemicyanine-based thiazole coumarin (TC) probe for DNA recognition, nuclear staining and cell cycle analysis. TC exhibited strong fluorescence enhancement in the presence of DNA containing AT-base pairs, but did not fluoresce with GC sequences, single-stranded DNA, RNA and proteins. The fluorescence staining of HeLa S3 and HEK 293 cells by TC followed by DNase and RNase digestion studies depicted the selective staining of DNA in the nucleus over the cytoplasmic region. Fluorescence-activated cell sorting (FACS) analysis by flow cytometry demonstrated the potential application of TC in cell cycle analysis in HEK 293 cells. Metaphase chromosome and malaria parasite DNA imaging studies further confirmed the in vivo diagnostic and therapeutic applications of probe TC. Probe TC may find multiple applications in fluorescence spectroscopy, diagnostics, bioimaging and molecular and cell biology. PMID:25252596
Zock, C; Iselt, A; Doerfler, W
1993-01-01
Human adenovirus type 12 (Ad12) cannot replicate in hamster cells, whereas human cells are permissive for Ad12. Ad12 DNA replication and late-gene and virus-associated RNA expression are blocked in hamster cells. Early Ad12 genes are transcribed, and the viral DNA can be integrated into the host genome. Ad12 DNA replication and late-gene transcription can be complemented in hamster cells by E1 functions of Ad2 or Ad5, for which hamster cells are fully permissive (for a review, see W. Doerfler, Adv. Virus Res. 39:89-128, 1991). We have previously demonstrated that a 33-nucleotide mitigator sequence, which is located in the downstream region of the major late promoter (MLP) of Ad12 DNA, is responsible for the inactivity of the Ad12 MLP in hamster cells (C. Zock and W. Doerfler, EMBO J. 9:1615-1623, 1990). A similar negative regulator has not been found in the MLP of Ad2 DNA. We have now studied the mechanism of action of this mitigator element. The results of nuclear run-on experiments document the absence of MLP transcripts in the nuclei of Ad12-infected BHK21 hamster cells. Surprisingly, the mitigator element cannot elicit its function in in vitro transcription experiments with nuclear extracts from both hamster BHK21 and human HeLa cells. Intact nuclear topology and/or tightly bound nuclear elements that cannot be eluted in nuclear extracts are somehow required for recognition of the Ad12 mitigator. Electrophoretic mobility shift assays have not revealed significant differences in the binding of proteins from human HeLa or hamster BHK21 cells to the mitigator sequence in the MLP of Ad12 DNA or to the corresponding sequence in Ad2 DNA. We have converted the sequence of the mitigator in the MLP of Ad12 DNA to the equivalent sequence in the MLP of Ad2 DNA by site-directed mutagenesis. This construct was not active in hamster cells. When the Ad12 mitigator, on the other hand, was inserted into the Ad2 MLP, the latter's function in hamster cells was not compromised. Deletions in the 5' upstream region of the Ad12 MLP have provided evidence for the existence of additional sequences that codetermine the deficiency of the Ad12 MLP in hamster cells. The amphifunctional YY1 protein from HeLa cells can bind specifically to the mitigator and to upstream elements of the MLP of Ad12 DNA.(ABSTRACT TRUNCATED AT 400 WORDS) Images PMID:8419643
Molecular sled sequences are common in mammalian proteins.
Xiong, Kan; Blainey, Paul C
2016-03-18
Recent work revealed a new class of molecular machines called molecular sleds, which are small basic molecules that bind and slide along DNA with the ability to carry cargo along DNA. Here, we performed biochemical and single-molecule flow stretching assays to investigate the basis of sliding activity in molecular sleds. In particular, we identified the functional core of pVIc, the first molecular sled characterized; peptide functional groups that control sliding activity; and propose a model for the sliding activity of molecular sleds. We also observed widespread DNA binding and sliding activity among basic polypeptide sequences that implicate mammalian nuclear localization sequences and many cell penetrating peptides as molecular sleds. These basic protein motifs exhibit weak but physiologically relevant sequence-nonspecific DNA affinity. Our findings indicate that many mammalian proteins contain molecular sled sequences and suggest the possibility that substantial undiscovered sliding activity exists among nuclear mammalian proteins. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.
Zhang, Chi; Fang, Xin; Qiu, Haopu; Li, Ning
2015-01-01
Real-time PCR amplification of mitochondria gene could not be used for DNA quantification, and that of single copy DNA did not allow an ideal sensitivity. Moreover, cross-reactions among similar species were commonly observed in the published methods amplifying repetitive sequence, which hindered their further application. The purpose of this study was to establish a short interspersed nuclear element (SINE)-based real-time PCR approach having high specificity for species detection that could be used in DNA quantification. After massive screening of candidate Sus scrofa SINEs, one optimal combination of primers and probe was selected, which had no cross-reaction with other common meat species. LOD of the method was 44 fg DNA/reaction. Further, quantification tests showed this approach was practical in DNA estimation without tissue variance. Thus, this study provided a new tool for qualitative detection of porcine component, which could be promising in the QC of meat products.
Sun, Ye; Shaw, Pang-Chui; Fung, Kwok-Pui
2007-01-01
In the present study, we examined nuclear DNA sequences in an attempt to reveal the relationships between Pueraria lobata (Willd). Ohwi, P. thomsonii Benth., and P. montana (Lour.) Merr. We found that internal transcribed spacer (ITS) sequences of nuclear ribosomal DNA are highly divergent in P. lobata and P. thomsonii, and four types of ITS with different length are found in the two species. On the other hand, DNA sequences of 5S rRNA gene spacer are highly conserved across multiple copies in P. lobata and P. thomsonii, they could be used to identify P. lobata, P. thomsonii, and P. montana of this complex, and may serve as a useful tool in medical authentication of Radix Puerariae Lobatae and Radix Puerariae Thomsonii.
Reconciling Apparent Conflicts between Mitochondrial and Nuclear Phylogenies in African Elephants
Georgiadis, Nicholas J.; David, Victor A.; Zhao, Kai; Stephens, Robert M.; Kolokotronis, Sergios-Orestis; Roca, Alfred L.
2011-01-01
Conservation strategies for African elephants would be advanced by resolution of conflicting claims that they comprise one, two, three or four taxonomic groups, and by development of genetic markers that establish more incisively the provenance of confiscated ivory. We addressed these related issues by genotyping 555 elephants from across Africa with microsatellite markers, developing a method to identify those loci most effective at geographic assignment of elephants (or their ivory), and conducting novel analyses of continent-wide datasets of mitochondrial DNA. Results showed that nuclear genetic diversity was partitioned into two clusters, corresponding to African forest elephants (99.5% Cluster-1) and African savanna elephants (99.4% Cluster-2). Hybrid individuals were rare. In a comparison of basal forest “F” and savanna “S” mtDNA clade distributions to nuclear DNA partitions, forest elephant nuclear genotypes occurred only in populations in which S clade mtDNA was absent, suggesting that nuclear partitioning corresponds to the presence or absence of S clade mtDNA. We reanalyzed African elephant mtDNA sequences from 81 locales spanning the continent and discovered that S clade mtDNA was completely absent among elephants at all 30 sampled tropical forest locales. The distribution of savanna nuclear DNA and S clade mtDNA corresponded closely to range boundaries traditionally ascribed to the savanna elephant species based on habitat and morphology. Further, a reanalysis of nuclear genetic assignment results suggested that West African elephants do not comprise a distinct third species. Finally, we show that some DNA markers will be more useful than others for determining the geographic origins of illegal ivory. These findings resolve the apparent incongruence between mtDNA and nuclear genetic patterns that has confounded the taxonomy of African elephants, affirm the limitations of using mtDNA patterns to infer elephant systematics or population structure, and strongly support the existence of two elephant species in Africa. PMID:21701575
Chu, Chien-Hsin; Chang, Lung-Chun; Hsu, Hong-Ming; Wei, Shu-Yi; Liu, Hsing-Wei; Lee, Yu; Kuo, Chung-Chi; Indra, Dharmu; Chen, Chinpan; Ong, Shiou-Jeng; Tai, Jung-Hsiang
2011-01-01
Nuclear proteins usually contain specific peptide sequences, referred to as nuclear localization signals (NLSs), for nuclear import. These signals remain unexplored in the protozoan pathogen, Trichomonas vaginalis. The nuclear import of a Myb2 transcription factor was studied here using immunodetection of a hemagglutinin-tagged Myb2 overexpressed in the parasite. The tagged Myb2 was localized to the nucleus as punctate signals. With mutations of its polybasic sequences, 48KKQK51 and 61KR62, Myb2 was localized to the nucleus, but the signal was diffusive. When fused to a C-terminal non-nuclear protein, the Myb2 sequence spanning amino acid (aa) residues 48 to 143, which is embedded within the R2R3 DNA-binding domain (aa 40 to 156), was essential and sufficient for efficient nuclear import of a bacterial tetracycline repressor (TetR), and yet the transport efficiency was reduced with an additional fusion of a firefly luciferase to TetR, while classical NLSs from the simian virus 40 T-antigen had no function in this assay system. Myb2 nuclear import and DNA-binding activity were substantially perturbed with mutation of a conserved isoleucine (I74) in helix 2 to proline that altered secondary structure and ternary folding of the R2R3 domain. Disruption of DNA-binding activity alone by point mutation of a lysine residue, K51, preceding the structural domain had little effect on Myb2 nuclear localization, suggesting that nuclear translocation of Myb2, which requires an ordered structural domain, is independent of its DNA binding activity. These findings provide useful information for testing whether myriad Mybs in the parasite use a common module to regulate nuclear import. PMID:22021237
Uribe-Convers, Simon; Duke, Justin R.; Moore, Michael J.; Tank, David C.
2014-01-01
• Premise of the study: We present an alternative approach for molecular systematic studies that combines long PCR and next-generation sequencing. Our approach can be used to generate templates from any DNA source for next-generation sequencing. Here we test our approach by amplifying complete chloroplast genomes, and we present a set of 58 potentially universal primers for angiosperms to do so. Additionally, this approach is likely to be particularly useful for nuclear and mitochondrial regions. • Methods and Results: Chloroplast genomes of 30 species across angiosperms were amplified to test our approach. Amplification success varied depending on whether PCR conditions were optimized for a given taxon. To further test our approach, some amplicons were sequenced on an Illumina HiSeq 2000. • Conclusions: Although here we tested this approach by sequencing plastomes, long PCR amplicons could be generated using DNA from any genome, expanding the possibilities of this approach for molecular systematic studies. PMID:25202592
Krüger, Manuela; Stockinger, Herbert; Krüger, Claudia; Schüssler, Arthur
2009-01-01
* At present, molecular ecological studies of arbuscular mycorrhizal fungi (AMF) are only possible above species level when targeting entire communities. To improve molecular species characterization and to allow species level community analyses in the field, a set of newly designed AMF specific PCR primers was successfully tested. * Nuclear rDNA fragments from diverse phylogenetic AMF lineages were sequenced and analysed to design four primer mixtures, each targeting one binding site in the small subunit (SSU) or large subunit (LSU) rDNA. To allow species resolution, they span a fragment covering the partial SSU, whole internal transcribed spacer (ITS) rDNA region and partial LSU. * The new primers are suitable for specifically amplifying AMF rDNA from material that may be contaminated by other organisms (e.g., samples from pot cultures or the field), characterizing the diversity of AMF species from field samples, and amplifying a SSU-ITS-LSU fragment that allows phylogenetic analyses with species level resolution. * The PCR primers can be used to monitor entire AMF field communities, based on a single rDNA marker region. Their application will improve the base for deep sequencing approaches; moreover, they can be efficiently used as DNA barcoding primers.
PCR Primers for Metazoan Nuclear 18S and 28S Ribosomal DNA Sequences
Machida, Ryuji J.; Knowlton, Nancy
2012-01-01
Background Metagenetic analyses, which amplify and sequence target marker DNA regions from environmental samples, are increasingly employed to assess the biodiversity of communities of small organisms. Using this approach, our understanding of microbial diversity has expanded greatly. In contrast, only a few studies using this approach to characterize metazoan diversity have been reported, despite the fact that many metazoan species are small and difficult to identify or are undescribed. One of the reasons for this discrepancy is the availability of universal primers for the target taxa. In microbial studies, analysis of the 16S ribosomal DNA is standard. In contrast, the best gene for metazoan metagenetics is less clear. In the present study, we have designed primers that amplify the nuclear 18S and 28S ribosomal DNA sequences of most metazoan species with the goal of providing effective approaches for metagenetic analyses of metazoan diversity in environmental samples, with a particular emphasis on marine biodiversity. Methodology/Principal Findings Conserved regions suitable for designing PCR primers were identified using 14,503 and 1,072 metazoan sequences of the nuclear 18S and 28S rDNA regions, respectively. The sequence similarity of both these newly designed and the previously reported primers to the target regions of these primers were compared for each phylum to determine the expected amplification efficacy. The nucleotide diversity of the flanking regions of the primers was also estimated for genera or higher taxonomic groups of 11 phyla to determine the variable regions within the genes. Conclusions/Significance The identified nuclear ribosomal DNA primers (five primer pairs for 18S and eleven for 28S) and the results of the nucleotide diversity analyses provide options for primer combinations for metazoan metagenetic analyses. Additionally, advantages and disadvantages of not only the 18S and 28S ribosomal DNA, but also other marker regions as targets for metazoan metagenetic analyses, are discussed. PMID:23049971
Bintz, Brittania J; Dixon, Groves B; Wilson, Mark R
2014-07-01
Next-generation sequencing technologies enable the identification of minor mitochondrial DNA variants with higher sensitivity than Sanger methods, allowing for enhanced identification of minor variants. In this study, mixtures of human mtDNA control region amplicons were subjected to pyrosequencing to determine the detection threshold of the Roche GS Junior(®) instrument (Roche Applied Science, Indianapolis, IN). In addition to expected variants, a set of reproducible variants was consistently found in reads from one particular amplicon. A BLASTn search of the variant sequence revealed identity to a segment of a 611-bp nuclear insertion of the mitochondrial control region (NumtS) spanning the primer-binding sites of this amplicon (Nature 1995;378:489). Primers (Hum Genet 2012;131:757; Hum Biol 1996;68:847) flanking the insertion were used to confirm the presence or absence of the NumtS in buccal DNA extracts from twenty donors. These results further our understanding of human mtDNA variation and are expected to have a positive impact on the interpretation of mtDNA profiles using deep-sequencing methods in casework. © 2014 American Academy of Forensic Sciences.
Gholami, Akram; Subramaniam, Shweta; Geeta, R; Pandey, Arun K
2017-06-01
Alysicarpus Necker ex Desvaux (Fabaceae, Desmodieae) consists of ~30 species that are distributed in tropical and subtropical regions of theworld. In India, the genus is represented by ca. 18 species, ofwhich seven are endemic. Sequences of the nuclear Internal transcribed spacer from38 accessions representing 16 Indian specieswere subjected to phylogenetic analyses. The ITS sequence data strongly support the monophyly of the genus Alysicarpus. Analyses revealed four major well-supported clades within Alysicarpus. Ancestral state reconstructions were done for two morphological characters, namely calyx length in relation to pod (macrocalyx and microcalyx) and pod surface ornamentation (transversely rugose and nonrugose). The present study is the first report on molecular systematics of Indian Alysicarpus.
Freeman, S.; Redman, R.S.; Grantham, G.; Rodriguez, R.J.
1997-01-01
A 7.4-kilobase (kb) DNA plasmid was isolated from Glomerella musae isolate 927 and designated pGML1. Exonuclease treatments indicated that pGML1 was a linear plasmid with blocked 5' termini. Cell-fractionation experiments combined with sequence-specific PCR amplification revealed that pGML1 resided in mitochondria. The pGML1 plasmid hybridized to cesium chloride-fractionated nuclear DNA but not to A + T-rich mitochondrial DNA. An internal 7.0-kb section of pGML1 was cloned and did not hybridize with either nuclear or mitochondrial DNA from G. musae. Sequence analysis revealed identical terminal inverted repeats (TIR) of 520 bp at the ends of the cloned 7.0-kb section of pGML1. The occurrence of pGML1 did not correspond with the pathogenicity of G. musae on banana fruit. Four additional isolates of G. musae possessed extrachromosomal DNA fragments similar in size and sequence to pGML1.
Zhao, Yu-Juan; Gong, Xun
2015-07-08
Leucomeris decora and Nouelia insignis (Asteraceae) are narrowly and allopatrically distributed species, separated by the important biogeographic boundary Tanaka Line in Southwest China. Previous morphological, cytogenetic and molecular studies suggested that L. decora is sister to N. insignis. However, it is less clear how the two species diverged, whether in full isolation or occurring gene flow across the Tanaka Line. Here, we performed a molecular study at the population level to characterize genetic differentiation and decipher phylogeographic history in two closely related species based on variation examined in plastid and nuclear DNAs using a coalescent-based approach. These morphologically distinct species share plastid DNA (cpDNA) haplotypes. In contrast, Bayesian analysis of nuclear DNA (nDNA) uncovered two distinct clusters corresponding to L. decora and N. insignis. Based on the IMa analysis, no strong indication of migration was detected based on both cpDNA and nDNA sequences. The molecular data pointed to a major west-east split in nuclear DNA between the two species corresponding with the Tanaka Line. The coalescent time estimate for all cpDNA haplotypes dated to the Mid-Late Pleistocene. The estimated demographic parameters showed that the population size of L. decora was similar to that of N. insignis and both experienced limited demographic fluctuations recently. The study revealed comprehensive species divergence and phylogeographic histories of N. insignis and L. decora divided by the Tanaka Line. The phylogeographic pattern inferred from cpDNA reflected ancestrally shared polymorphisms without post-divergence gene flow between species. The marked genealogical lineage divergence in nDNA provided some indication of Tanaka Line for its role as a barrier to plant dispersal, and lent support to its importance in promoting strong population structure and allopatric divergence.
Shu, Fan-Fan; Lv, Rui-Qing; Zhang, Yi-Fang; Duan, Gang; Wu, Ding-Yu; Li, Bi-Feng; Yang, Jian-Fa; Zou, Feng-Cai
2012-08-01
On mainland China, liver flukes of Fasciola spp. (Digenea: Fasciolidae) can cause serious acute and chronic morbidity in numerous species of mammals such as sheep, goats, cattle, and humans. The objective of the present study was to examine the taxonomic identity of Fasciola species in Yunnan province by sequences of the first and second internal transcribed spacers (ITS-1 and ITS-2) of nuclear ribosomal DNA (rDNA). The ITS rDNA was amplified from 10 samples representing Fasciola species in cattle from 2 geographical locations in Yunnan Province, by polymerase chain reaction (PCR), and the products were sequenced directly. The lengths of the ITS-1 and ITS-2 sequences were 422 and 361-362 base pairs, respectively, for all samples sequenced. Using ITS sequences, 2 Fasciola species were revealed, namely Fasciola hepatica and Fasciola gigantica. This is the first demonstration of F. gigantica in cattle in Yunnan Province, China using a molecular approach; our findings have implications for studying the population genetic characterization of the Chinese Fasciola species and for the prevention and control of Fasciola spp. in this province.
Li, Ming-Wei; Zhu, Xing-Quan; Gasser, Robin B; Lin, Rui-Qing; Sani, Rehana A; Lun, Zhao-Rong; Jacobs, Dennis E
2006-10-01
Non-isotopic polymerase chain reaction (PCR)-based single-strand conformation polymorphism and sequence analyses of the second internal transcribed spacer (ITS-2) of nuclear ribosomal DNA (rDNA) were utilized to genetically characterise ascaridoids from dogs and cats from China by comparison with those from other countries. The study showed that Toxocara canis, Toxocara cati, and Toxascaris leonina from China were genetically the same as those from other geographical origins. Specimens from cats from Guangzhou, China, which were morphologically consistent with Toxocara malaysiensis, were the same genetically as those from Malaysia, with the exception of a polymorphism in the ITS-2 but no unequivocal sequence difference. This is the first report of T. malaysiensis in cats outside of Malaysia (from where it was originally described), supporting the proposal that this species has a broader geographical distribution. The molecular approach employed provides a powerful tool for elucidating the biology, epidemiology, and zoonotic significance of T. malaysiensis.
Phylogeny and biogeography of Juglans (Juglandaceae) based on matK and ITS sequence data.
Stanford, A M; Harden, R; Parks, C R
2000-06-01
We investigated phylogenetic and biogeographic relationships within Juglans (walnuts), a Tertiary disjunct genus, using 15 species of Juglans and related (Juglandaceae) outgroups. The relationships were analyzed using nucleotide sequences of the chloroplast gene matK and its flanking spacers and of the internal transcribed spacers (ITS) and 5.8S gene of the nuclear ribosomal DNA. The DNA sequences provided 246 informative characters for parsimony analysis. ITS data supported as monophyletic groups the four generic sections, Cardiocaryon, Dioscaryon, Rhysocaryon, and Trachycaryon. Within Rhysocaryon, the temperate black walnuts and the tropical black walnuts were supported as monophyletic groups. When the two data sets were combined, J. cinerea was nested within Cardiocaryon. Combined analysis with published nuclear DNA restriction site data placed J. cinerea in a monophyletic group with Cardiocaryon. These analyses consistently supported Juglans as a monophyletic group and as the sister group to the genus Pterocarya. The results of this work are consistent with the known geological history of Juglans. The fossil record suggests that the butternuts had evolved by the early Oligocene in North America. The presence of butternuts in Eurasia could be the result of migration from North America to Eurasia during the warming trend of the mid Oligocene.
Blangy, A; Léopold, P; Vidal, F; Rassoulzadegan, M; Cuzin, F
1991-01-01
We have reported previously (1) two unexpected consequences of the microinjection into fertilized mouse eggs of a recombinant plasmid designated p12B1, carrying a 343 bp insert of non-repetitive mouse DNA. Injected at very low concentrations, this plasmid could be established as an extrachromosomal genetic element. When injected in greater concentration, an early arrest of embryonic development resulted. In the present work, we have studied this toxic effect in more detail by microinjecting short synthetic oligonucleotides with sequences from the mouse insert. Lethality was associated with the nucleotide sequence GTCACATG, identical with the CDEl element of yeast centromeres. Development of injected embryos was arrested between the one-cell and the early morula stages, with abnormal structures and DNA contents. Electrophoretic mobility shift and DNAse foot-printing assays demonstrated the binding of mouse nuclear protein(s) to the CDEl-like box. Base changes within the CDEl sequence prevented both the toxic effects in embryos and the formation of protein complex in vitro, suggesting that protein binding at such sites in chromosomal DNA plays an important role in early development. Images PMID:1766880
Di Bernardo, Giovanni; Del Gaudio, Stefania; Cammarota, Marcella; Galderisi, Umberto; Cascino, Antonino; Cipollaro, Marilena
2002-02-15
Ancient DNA (aDNA) samples extracted from the bone remains of six equids buried by the Vesuvius eruption in 79 AD were investigated to test pre-amplification and enzymatic repair procedures designed to enhance the rescue of nuclear genes. The extracts, which proved all positive for Equidae mtDNA amplification, proved positive only four times out of 18 when tested for single-copy Equidae nuclear genes (epsilon globin, p53 and gamma interferon). Pre-amplification did not change the number of retrieved aDNA sequences but 10 times out of 14 enzymatic repair restored the amplifiability of the genes analysed, proving that repair increases the rate of successful rescue from 22 to alpha(lambda)mu(omicron)sigma(tau) 80%. These findings support the hypothesis that some of these cross-linked aDNA molecules, which are not completely separated when DNA is extracted under denaturing conditions, become homoduplex substrates for Pol I and/or T4 ligase action upon renaturation. aDNA authenticity is proved by the homology of the nucleotide sequences of loci tested to the corresponding modern Equidae sequences. Data also indicate that cross-linked homoduplex molecules selected by denaturation of the extract are repaired without any chimera formation. The general features of aDNA amplification with and without denaturation and enzymatic repair are discussed.
Di Bernardo, Giovanni; Del Gaudio, Stefania; Cammarota, Marcella; Galderisi, Umberto; Cascino, Antonino; Cipollaro, Marilena
2002-01-01
Ancient DNA (aDNA) samples extracted from the bone remains of six equids buried by the Vesuvius eruption in 79 AD were investigated to test pre-amplification and enzymatic repair procedures designed to enhance the rescue of nuclear genes. The extracts, which proved all positive for Equidae mtDNA amplification, proved positive only four times out of 18 when tested for single-copy Equidae nuclear genes (ɛ globin, p53 and γ interferon). Pre-amplification did not change the number of retrieved aDNA sequences but 10 times out of 14 enzymatic repair restored the amplifiability of the genes analysed, proving that repair increases the rate of successful rescue from 22 to αλµοστ 80%. These findings support the hypothesis that some of these cross-linked aDNA molecules, which are not completely separated when DNA is extracted under denaturing conditions, become homoduplex substrates for Pol I and/or T4 ligase action upon renaturation. aDNA authenticity is proved by the homology of the nucleotide sequences of loci tested to the corresponding modern Equidae sequences. Data also indicate that cross-linked homoduplex molecules selected by denaturation of the extract are repaired without any chimera formation. The general features of aDNA amplification with and without denaturation and enzymatic repair are discussed. PMID:11842122
Suchan, Tomasz; Espíndola, Anahí; Rutschmann, Sereina; Emerson, Brent C; Gori, Kevin; Dessimoz, Christophe; Arrigo, Nils; Ronikier, Michał; Alvarez, Nadir
2017-09-01
Determining phylogenetic relationships among recently diverged species has long been a challenge in evolutionary biology. Cytoplasmic DNA markers, which have been widely used, notably in the context of molecular barcoding, have not always proved successful in resolving such phylogenies. However, with the advent of next-generation-sequencing technologies and associated techniques of reduced genome representation, phylogenies of closely related species have been resolved at a much higher detail in the last couple of years. Here we examine the potential and limitations of one of such techniques-Restriction-site Associated DNA (RAD) sequencing, a method that produces thousands of (mostly) anonymous nuclear markers, in disentangling the phylogeny of the fly genus Chiastocheta (Diptera: Anthomyiidae). In Europe, this genus encompasses seven species of seed predators, which have been widely studied in the context of their ecological and evolutionary interactions with the plant Trollius europaeus (Ranunculaceae). So far, phylogenetic analyses using mitochondrial markers failed to resolve monophyly of most of the species from this recently diversified genus, suggesting that their taxonomy may need a revision. However, relying on a single, non-recombining marker and ignoring potential incongruences between mitochondrial and nuclear loci may provide an incomplete account of the lineage history. In this study, we applied both classical Sanger sequencing of three mtDNA regions and RAD-sequencing, for reconstructing the phylogeny of the genus. Contrasting with results based on mitochondrial markers, RAD-sequencing analyses retrieved the monophyly of all seven species, in agreement with the morphological species assignment. We found robust nuclear-based species assignment of individual samples, and low levels of estimated contemporary gene flow among them. However, despite recovering species' monophyly, interspecific relationships varied depending on the set of RAD loci considered, producing contradictory topologies. Moreover, coalescence-based phylogenetic analyses revealed low supports for most of the interspecific relationships. Our results indicate that despite the higher performance of RAD-sequencing in terms of species trees resolution compared to cytoplasmic markers, reconstructing inter-specific relationships among recently-diverged lineages may lie beyond the possibilities offered by large sets of RAD-sequencing markers in cases of strong gene tree incongruence. Copyright © 2017 Elsevier Inc. All rights reserved.
Bose, Nikhil; Carlberg, Katie; Sensabaugh, George; Erlich, Henry; Calloway, Cassandra
2018-05-01
DNA from biological forensic samples can be highly fragmented and present in limited quantity. When DNA is highly fragmented, conventional PCR based Short Tandem Repeat (STR) analysis may fail as primer binding sites may not be present on a single template molecule. Single Nucleotide Polymorphisms (SNPs) can serve as an alternative type of genetic marker for analysis of degraded samples because the targeted variation is a single base. However, conventional PCR based SNP analysis methods still require intact primer binding sites for target amplification. Recently, probe capture methods for targeted enrichment have shown success in recovering degraded DNA as well as DNA from ancient bone samples using next-generation sequencing (NGS) technologies. The goal of this study was to design and test a probe capture assay targeting forensically relevant nuclear SNP markers for clonal and massively parallel sequencing (MPS) of degraded and limited DNA samples as well as mixtures. A set of 411 polymorphic markers totaling 451 nuclear SNPs (375 SNPs and 36 microhaplotype markers) was selected for the custom probe capture panel. The SNP markers were selected for a broad range of forensic applications including human individual identification, kinship, and lineage analysis as well as for mixture analysis. Performance of the custom SNP probe capture NGS assay was characterized by analyzing read depth and heterozygote allele balance across 15 samples at 25 ng input DNA. Performance thresholds were established based on read depth ≥500X and heterozygote allele balance within ±10% deviation from 50:50, which was observed for 426 out of 451 SNPs. These 426 SNPs were analyzed in size selected samples (at ≤75 bp, ≤100 bp, ≤150 bp, ≤200 bp, and ≤250 bp) as well as mock degraded samples fragmented to an average of 150 bp. Samples selected for ≤75 bp exhibited 99-100% reportable SNPs across varied DNA amounts and as low as 0.5 ng. Mock degraded samples at 1 ng and 10 ng exhibited >90% reportable SNPs. Finally, two-person male-male mixtures were tested at 10 ng in contributor varying ratios. Overall, 85-100% of alleles unique to the minor contributor were observed at all mixture ratios. Results from these studies using the SNP probe capture NGS system demonstrates proof of concept for application to forensically relevant degraded and mixed DNA samples. Copyright © 2018 Elsevier B.V. All rights reserved.
Small tandemly repeated DNA sequences of higher plants likely originate from a tRNA gene ancestor.
Benslimane, A A; Dron, M; Hartmann, C; Rode, A
1986-01-01
Several monomers (177 bp) of a tandemly arranged repetitive nuclear DNA sequence of Brassica oleracea have been cloned and sequenced. They share up to 95% homology between one another and up to 80% with other satellite DNA sequences of Cruciferae, suggesting a common ancestor. Both strands of these monomers show more than 50% homology with many tRNA genes; the best homologies have been obtained with Lys and His yeast mitochondrial tRNA genes (respectively 64% and 60%). These results suggest that small tandemly repeated DNA sequences of plants may have evolved from a tRNA gene ancestor. These tandem repeats have probably arisen via a process involving reverse transcription of polymerase III RNA intermediates, as is the case for interspersed DNA sequences of mammalians. A model is proposed to explain the formation of such small tandemly repeated DNA sequences. Images PMID:3774553
Widłak, P; Rzeszowska-Wolny, J
1993-01-01
The binding of [14C]benzo[a]pyrene (B[a]P) to DNA and proteins in total nuclei and subnuclear fractions of cultured rat hepatocytes was compared. The main targets of B[a]P were non-histone high molecular weight proteins of the nuclear matrix and DNA sequences attached to this structure. Following 24 h exposure to B[a]P the amounts of adducts in the nuclear matrix DNA and proteins were twice as high as in total nuclei. After withdrawal of the carcinogen containing medium the level of B[a]P-induced adducts gradually decreased but always remained the highest in the nuclear matrix proteins. Removal of adducts from the nuclear matrix DNA was more efficient than from the other DNA fractions, and 72 h after exposure to the carcinogen the level of DNA adducts in this fraction was similar to that in total nuclei.
Michalovova, M; Vyskot, B; Kejnovsky, E
2013-10-01
We analysed the size, relative age and chromosomal localization of nuclear sequences of plastid and mitochondrial origin (NUPTs-nuclear plastid DNA and NUMTs-nuclear mitochondrial DNA) in six completely sequenced plant species. We found that the largest insertions showed lower divergence from organelle DNA than shorter insertions in all species, indicating their recent origin. The largest NUPT and NUMT insertions were localized in the vicinity of the centromeres in the small genomes of Arabidopsis and rice. They were also present in other chromosomal regions in the large genomes of soybean and maize. Localization of NUPTs and NUMTs correlated positively with distribution of transposable elements (TEs) in Arabidopsis and sorghum, negatively in grapevine and soybean, and did not correlate in rice or maize. We propose a model where new plastid and mitochondrial DNA sequences are inserted close to centromeres and are later fragmented by TE insertions and reshuffled away from the centromere or removed by ectopic recombination. The mode and tempo of TE dynamism determines the turnover of NUPTs and NUMTs resulting in their species-specific chromosomal distributions.
Tokuhiro, Keizo; Miyagawa, Yasushi; Yamada, Shuichi; Hirose, Mika; Ohta, Hiroshi; Nishimune, Yoshitake; Tanaka, Hiromitsu
2007-03-01
Haspin is a unique protein kinase expressed predominantly in haploid male germ cells. The genomic structure of haspin (Gsg2) has revealed it to be intronless, and the entire transcription unit is in an intron of the integrin alphaE (Itgae) gene. Transcription occurs from a bidirectional promoter that also generates an alternatively spliced integrin alphaE-derived mRNA (Aed). In mice, the testis-specific alternative splicing of Aed is expressed bidirectionally downstream from the Gsg2 transcription initiation site, and a segment consisting of 26 bp transcribes both genomic DNA strands between Gsg2 and the Aed transcription initiation sites. To investigate the mechanisms for this unique gene regulation, we cloned and characterized the Gsg2 promoter region. The 193-bp genomic fragment from the 5' end of the Gsg2 and Aed genes, fused with EGFP and DsRed genes, drove the expression of both proteins in haploid germ cells of transgenic mice. This promoter element contained only a GC-rich sequence, and not the previously reported DNA sequences known to bind various transcription factors--with the exception of E2F1, TCFAP2A1 (AP2), and SP1. Here, we show that the 193-bp DNA sequence is sufficient for the specific, bidirectional, and synchronous expression in germ cells in the testis. We also demonstrate the existence of germ cell nuclear factors specifically bound to the promoter sequence. This activity may be regulated by binding to the promoter sequence with germ cell-specific nuclear complex(es) without regulation via DNA methylation.
Escorza-Treviño, S; Dizon, A E
2000-08-01
Mitochondrial DNA (mtDNA) control-region sequences and microsatellite loci length polymorphisms were used to estimate phylogeographical patterns (historical patterns underlying contemporary distribution), intraspecific population structure and gender-biased dispersal of Phocoenoides dalli dalli across its entire range. One-hundred and thirteen animals from several geographical strata were sequenced over 379 bp of mtDNA, resulting in 58 mtDNA haplotypes. Analysis using F(ST) values (based on haplotype frequencies) and phi(ST) values (based on frequencies and genetic distances between haplotypes) yielded statistically significant separation (bootstrap values P < 0.05) among most of the stocks currently used for management purposes. A minimum spanning network of haplotypes showed two very distinctive clusters, differentially occupied by western and eastern populations, with some common widespread haplotypes. This suggests some degree of phyletic radiation from west to east, superimposed on gene flow. Highly male-biased migration was detected for several population comparisons. Nuclear microsatellite DNA markers (119 individuals and six loci) provided additional support for population subdivision and gender-biased dispersal detected in the mtDNA sequences. Analysis using F(ST) values (based on allelic frequencies) yielded statistically significant separation between some, but not all, populations distinguished by mtDNA analysis. R(ST) values (based on frequencies of and genetic distance between alleles) showed no statistically significant subdivision. Again, highly male-biased dispersal was detected for all population comparisons, suggesting, together with morphological and reproductive data, the existence of sexual selection. Our molecular results argue for nine distinct dalli-type populations that should be treated as separate units for management purposes.
Near, Thomas J; Dornburg, Alex; Friedman, Matt
2014-11-01
The Gonorynchiformes are the sister lineage of the species-rich Otophysi and provide important insights into the diversification of ostariophysan fishes. Phylogenies of gonorynchiforms inferred using morphological characters and mtDNA gene sequences provide differing resolutions with regard to the sister lineage of all other gonorynchiforms (Chanos vs. Gonorynchus) and support for monophyly of the two miniaturized lineages Cromeria and Grasseichthys. In this study the phylogeny and divergence times of gonorynchiforms are investigated with DNA sequences sampled from nine nuclear genes and a published morphological character matrix. Bayesian phylogenetic analyses reveal substantial congruence among individual gene trees with inferences from eight genes placing Gonorynchus as the sister lineage to all other gonorynchiforms. Seven gene trees resolve Cromeria and Grasseichthys as a clade, supporting previous inferences using morphological characters. Phylogenies resulting from either concatenating the nuclear genes, performing a multispecies coalescent species tree analysis, or combining the morphological and nuclear gene DNA sequences resolve Gonorynchus as the living sister lineage of all other gonorynchiforms, strongly support the monophyly of Cromeria and Grasseichthys, and resolve a clade containing Parakneria, Cromeria, and Grasseichthys. The morphological dataset, which includes 13 gonorynchiform fossil taxa that range in age from Early Cretaceous to Eocene, was analyzed in combination with DNA sequences from the nine nuclear genes and a relaxed molecular clock to estimate times of evolutionary divergence. This "tip dating" strategy accommodates uncertainty in the phylogenetic resolution of fossil taxa that provide calibration information in the relaxed molecular clock analysis. The estimated age of the most recent common ancestor (MRCA) of living gonorynchiforms is slightly older than estimates from previous node dating efforts, but the molecular tip dating estimated ages of Kneriinae (Kneria, Parakneria, Cromeria, and Grasseichthys) and the two paedomorphic lineages, Cromeria and Grasseichthys, are considerably younger. Copyright © 2014 Elsevier Inc. All rights reserved.
Gaines, C.A; Hare, M.P; Beck, S.E; Rosenbaum, H.C
2005-01-01
Right whales (genus: Eubalaena) are among the most endangered mammals, yet their taxonomy and phylogeny have been questioned. A phylogenetic hypothesis based on mitochondrial DNA (mtDNA) variation recently prompted a taxonomic revision, increasing the number of right whale species to three. We critically evaluated this hypothesis using sequence data from 13 nuclear DNA (nuDNA) loci as well as the mtDNA control region. Fixed diagnostic characters among the nuclear markers strongly support the hypothesis of three genetically distinct species, despite the lack of any diagnostic morphological characters. A phylogenetic analysis of all data produced a strict consensus cladogram with strong support at nodes that define each right whale species as well as relationships among species. Results showed very little conflict among the individual partitions as well as congruence between the mtDNA and nuDNA datasets. These data clearly demonstrate the strength of using numerous independent genetic markers during a phylogenetic analysis of closely related species. In evaluating phylogenetic support contributed by individual loci, 11 of the 14 loci provided support for at least one of the nodes of interest to this study. Only a single marker (mtDNA control region) provided support at all four nodes. A study using any single nuclear marker would have failed to support the proposed phylogeny, and a strong phylogenetic hypothesis was only revealed by the simultaneous analysis of many nuclear loci. In addition, nuDNA and mtDNA data provided complementary levels of support at nodes of different evolutionary depth indicating that the combined use of mtDNA and nuDNA data is both practical and desirable. PMID:15846869
Cytogenetic and Sequence Analyses of Mitochondrial DNA Insertions in Nuclear Chromosomes of Maize
Lough, Ashley N.; Faries, Kaitlyn M.; Koo, Dal-Hoe; Hussain, Abid; Roark, Leah M.; Langewisch, Tiffany L.; Backes, Teresa; Kremling, Karl A. G.; Jiang, Jiming; Birchler, James A.; Newton, Kathleen J.
2015-01-01
The transfer of mitochondrial DNA (mtDNA) into nuclear genomes is a regularly occurring process that has been observed in many species. Few studies, however, have focused on the variation of nuclear-mtDNA sequences (NUMTs) within a species. This study examined mtDNA insertions within chromosomes of a diverse set of Zea mays ssp. mays (maize) inbred lines by the use of fluorescence in situ hybridization. A relatively large NUMT on the long arm of chromosome 9 (9L) was identified at approximately the same position in four inbred lines (B73, M825, HP301, and Oh7B). Further examination of the similarly positioned 9L NUMT in two lines, B73 and M825, indicated that the large size of these sites is due to the presence of a majority of the mitochondrial genome; however, only portions of this NUMT (∼252 kb total) were found in the publically available B73 nuclear sequence for chromosome 9. Fiber-fluorescence in situ hybridization analysis estimated the size of the B73 9L NUMT to be ∼1.8 Mb and revealed that the NUMT is methylated. Two regions of mtDNA (2.4 kb and 3.3 kb) within the 9L NUMT are not present in the B73 mitochondrial NB genome; however, these 2.4-kb and 3.3-kb segments are present in other Zea mitochondrial genomes, including that of Zea mays ssp. parviglumis, a progenitor of domesticated maize. PMID:26333837
Amor, Nabil; Halajian, Ali; Farjallah, Sarra; Merella, Paolo; Said, Khaled; Ben Slimane, Badreddine
2011-07-01
Fasciolosis caused by Fasciola spp. (Platyhelminthes: Trematoda: Digenea) is considered as the most important helminth infection of ruminants in tropical countries, causing considerable socioeconomic problems. In the endemic regions of the North of Iran, Fasciola hepatica and Fasciola gigantica have been previously characterized on the basis of morphometric differences, but the use of molecular markers is necessary to distinguish exactly between species and intermediate forms. Samples from buffaloes and goats from different localities of northern Iran were identified morphologically and then genetically characterized by sequences of the first (ITS-1) and second (ITS-2) Internal Transcribed Spacers (ITS) of nuclear ribosomal DNA (rDNA). Comparison of the ITS of the northern Iranian samples with sequences of Fasciola spp. from GenBank showed that the examined specimens had sequences identical to those of the most frequent haplotypes of F. hepatica (n=25, 48.1%) and F. gigantica (n=20, 38.45%), which differed from each other in different variable nucleotide positions of ITS region sequences, and their intermediate forms (n=7, 13.45%), which had nucleotides overlapped between the two Fasciola species in all the positions. The ITS sequences from populations of Fasciola isolates in buffaloes and goats had experienced introgression/hybridization as previously reported in isolates from other ruminants and humans. Based on ITS-1 and ITS-2 sequences, flukes are scattered in pure F. hepatica, F. gigantica and intermediate Fasciola clades, revealing that multiple genotypes of Fasciola are able to infect goats and buffaloes in North of Iran. Furthermore, the phylogenetic trees based upon the ITS-1 and ITS-2 sequences showed a close relationship of the Iranian samples with isolates of F. hepatica and F. gigantica from different localities of Africa and Asia. In the present study, the intergenic transcribed spacers ITS-1 and ITS-2 showed to be reliable approaches for the genetic differentiation of Fasciola spp., providing bases for further studies on F. hepatica, F. gigantica and their intermediate forms in the endemic areas in Asia. Copyright © 2011 Elsevier Inc. All rights reserved.
Mitochondrial Genome Sequence of the Legume Vicia faba
Negruk, Valentine
2013-01-01
The number of plant mitochondrial genomes sequenced exceeds two dozen. However, for a detailed comparative study of different phylogenetic branches more plant mitochondrial genomes should be sequenced. This article presents sequencing data and comparative analysis of mitochondrial DNA (mtDNA) of the legume Vicia faba. The size of the V. faba circular mitochondrial master chromosome of cultivar Broad Windsor was estimated as 588,000 bp with a genome complexity of 387,745 bp and 52 conservative mitochondrial genes; 32 of them encoding proteins, 3 rRNA, and 17 tRNA genes. Six tRNA genes were highly homologous to chloroplast genome sequences. In addition to the 52 conservative genes, 114 unique open reading frames (ORFs) were found, 36 without significant homology to any known proteins and 29 with homology to the Medicago truncatula nuclear genome and to other plant mitochondrial ORFs, 49 ORFs were not homologous to M. truncatula but possessed sequences with significant homology to other plant mitochondrial or nuclear ORFs. In general, the unique ORFs revealed very low homology to known closely related legumes, but several sequence homologies were found between V. faba, Beta vulgaris, Nicotiana tabacum, Vitis vinifera, and even the monocots Oryza sativa and Zea mays. Most likely these ORFs arose independently during angiosperm evolution (Kubo and Mikami, 2007; Kubo and Newton, 2008). Computational analysis revealed in total about 45% of V. faba mtDNA sequence being homologous to the Medicago truncatula nuclear genome (more than to any sequenced plant mitochondrial genome), and 35% of this homology ranging from a few dozen to 12,806 bp are located on chromosome 1. Apparently, mitochondrial rrn5, rrn18, rps10, ATP synthase subunit alpha, cox2, and tRNA sequences are part of transcribed nuclear mosaic ORFs. PMID:23675376
Peters, Jeffrey L.; Bolender, Kimberly A.; Pearce, John M.
2012-01-01
Genetic studies of waterfowl (Anatidae) have observed the full spectrum of mitochondrial (mt) DNA population divergence, from apparent panmixia to deep, reciprocally monophyletic lineages. Yet, these studies often found weak or no nuclear (nu) DNA structure, which was often attributed to male-biased gene flow, a common behaviour within this family. An alternative explanation for this ‘conflict’ is that the smaller effective population size and faster sorting rate of mtDNA relative to nuDNA lead to different signals of population structure. We tested these alternatives by sequencing 12 nuDNA introns for a Holarctic pair of waterfowl subspecies, the European goosander (Mergus merganser merganser) and the North American common merganser (M. m. americanus), which exhibit strong population structure in mtDNA. We inferred effective population sizes, gene flow and divergence times from published mtDNA sequences and simulated expected differentiation for nuDNA based on those histories. Between Europe and North America, nuDNA ФST was 3.4-fold lower than mtDNA ФST, a result consistent with differences in sorting rates. However, despite geographically structured and monophyletic mtDNA lineages within continents, nuDNA ФST values were generally zero and significantly lower than predicted. This between- and within-continent contrast held when comparing mtDNA and nuDNA among published studies of ducks. Thus, male-mediated gene flow is a better explanation than slower sorting rates for limited nuDNA differentiation within continents, which is also supported by nonmolecular data. This study illustrates the value of quantitatively testing discrepancies between mtDNA and nuDNA to reject the null hypothesis that conflict simply reflects different sorting rates.
Wang, Hong-Wei; Ge, Song
2006-11-01
Cathaya argyrophylla is an endangered conifer restricted to subtropical mountains of China. To study phylogeographical pattern and demographic history of C. argyrophylla, species-wide genetic variation was investigated using sequences of maternally inherited mtDNA and biparentally inherited nuclear DNA. Of 15 populations sampled from all four distinct regions, only three mitotypes were detected at two loci, without single region having a mixed composition (G(ST) = 1). Average nucleotide diversity (theta(ws) = 0.0024; pi(s) = 0.0029) across eight nuclear loci is significantly lower than those found for other conifers (theta(ws) = 0.003 approximately 0.015; pi(s) = 0.002 approximately 0.012) based on estimates of multiple loci. Because of its highest diversity among the eight nuclear loci and evolving neutrally, one locus (2009) was further used for phylogeographical studies and eight haplotypes resulting from 12 polymorphic sites were obtained from 98 individuals. All the four distinct regions had at least four haplotypes, with the Dalou region (DL) having the highest diversity and the Bamian region (BM) the lowest, paralleling the result of the eight nuclear loci. An AMOVA revealed significant proportion of diversity attributable to differences among regions (13.4%) and among populations within regions (8.9%). F(ST) analysis also indicated significantly high differentiation among populations (F(ST) = 0.22) and between regions (F(ST) = 0.12-0.38). Non-overlapping distribution of mitotypes and high genetic differentiation among the distinct geographical groups suggest the existence of at least four separate glacial refugia. Based on network and mismatch distribution analyses, we do not find evidence of long distance dispersal and population expansion in C. argyrophylla. Ex situ conservation and artificial crossing are recommended for the management of this endangered species.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kiriyama, Takao; Hirano, Makito; Asai, Hirohide
Triple A syndrome is an autosomal recessive neurological disease, mimicking motor neuron disease, and is caused by mutant ALADIN, a nuclear-pore complex component. We recently discovered that the pathogenesis involved impaired nuclear import of DNA repair proteins, including DNA ligase I and the cerebellar ataxia causative protein aprataxin. Such impairment was overcome by fusing classical nuclear localization signal (NLS) and 137-aa downstream sequence of XRCC1, designated stretched NLS (stNLS). We report here that the minimum essential sequence of stNLS (mstNLS) is residues 239-276, downsized by more than 100 aa. mstNLS enabled efficient nuclear import of DNA repair proteins in patientmore » fibroblasts, functioned under oxidative stress, and reduced oxidative-stress-induced cell death, more effectively than stNLS. The stress-tolerability of mstNLS was also exerted in control fibroblasts and neuroblastoma cells. These findings may help develop treatments for currently intractable triple A syndrome and other oxidative-stress-related neurological diseases, and contribute to nuclear compartmentalization study.« less
Edelson, Benjamin S; Best, Timothy P; Olenyuk, Bogdan; Nickols, Nicholas G; Doss, Raymond M; Foister, Shane; Heckel, Alexander; Dervan, Peter B
2004-01-01
A pivotal step forward in chemical approaches to controlling gene expression is the development of sequence-specific DNA-binding molecules that can enter live cells and traffic to nuclei unaided. DNA-binding polyamides are a class of programmable, sequence-specific small molecules that have been shown to influence a wide variety of protein-DNA interactions. We have synthesized over 100 polyamide-fluorophore conjugates and assayed their nuclear uptake profiles in 13 mammalian cell lines. The compiled dataset, comprising 1300 entries, establishes a benchmark for the nuclear localization of polyamide-dye conjugates. Compounds in this series were chosen to provide systematic variation in several structural variables, including dye composition and placement, molecular weight, charge, ordering of the aromatic and aliphatic amino-acid building blocks and overall shape. Nuclear uptake does not appear to be correlated with polyamide molecular weight or with the number of imidazole residues, although the positions of imidazole residues affect nuclear access properties significantly. Generally negative determinants for nuclear access include the presence of a beta-Ala-tail residue and the lack of a cationic alkyl amine moiety, whereas the presence of an acetylated 2,4-diaminobutyric acid-turn is a positive factor for nuclear localization. We discuss implications of these data on the design of polyamide-dye conjugates for use in biological systems.
Nakano, Tadao; Okamoto, Munehiro; Ikeda, Yatsukaho; Hasegawa, Hideo
2006-12-01
Sequences of mitochondrial cytochrome c oxidase subunit 1 (CO1) gene, nuclear internal transcribed spacer 2 (ITS2) region of ribosomal DNA (rDNA), and 5S rDNA of Enterobius vermicularis from captive chimpanzees in five zoos/institutions in Japan were analyzed and compared with those of pinworm eggs from humans in Japan. Three major types of variants appearing in both CO1 and ITS2 sequences, but showing no apparent connection, were observed among materials collected from the chimpanzees. Each one of them was also observed in pinworms in humans. Sequences of 5S rDNA were identical in the materials from chimpanzees and humans. Phylogenetic analysis of CO1 gene revealed three clusters with high bootstrap value, suggesting considerable divergence, presumably correlated with human evolution, has occurred in the human pinworms. The synonymy of E. gregorii with E. vermicularis is supported by the molecular evidence.
Colombo, M M; Swanton, M T; Donini, P; Prescott, D M
1984-01-01
Oxytricha nova is a hypotrichous ciliate with micronuclei and macronuclei. Micronuclei, which contain large, chromosomal-sized DNA, are genetically inert but undergo meiosis and exchange during cell mating. Macronuclei, which contain only small, gene-sized DNA molecules, provide all of the nuclear RNA needed to run the cell. After cell mating the macronucleus is derived from a micronucleus, a derivation that includes excision of the genes from chromosomes and elimination of the remaining DNA. The eliminated DNA includes all of the repetitious sequences and approximately 95% of the unique sequences. We cloned large restriction fragments from the micronucleus that confer replication ability on a replication-deficient plasmid in Saccharomyces cerevisiae. Sequences that confer replication ability are called autonomously replicating sequences. The frequency and effectiveness of autonomously replicating sequences in micronuclear DNA are similar to those reported for DNAs of other organisms introduced into yeast cells. Of the 12 micronuclear fragments with autonomously replicating sequence activity, 9 also showed homology to macronuclear DNA, indicating that they contain a macronuclear gene sequence. We conclude from this that autonomously replicating sequence activity is nonrandomly distributed throughout micronuclear DNA and is preferentially associated with those regions of micronuclear DNA that contain genes. Images PMID:6092934
Turner, Barbara; Paun, Ovidiu; Munzinger, Jérôme; Chase, Mark W.; Samuel, Rosabelle
2016-01-01
Background and Aims Some plant groups, especially on islands, have been shaped by strong ancestral bottlenecks and rapid, recent radiation of phenotypic characters. Single molecular markers are often not informative enough for phylogenetic reconstruction in such plant groups. Whole plastid genomes and nuclear ribosomal DNA (nrDNA) are viewed by many researchers as sources of information for phylogenetic reconstruction of groups in which expected levels of divergence in standard markers are low. Here we evaluate the usefulness of these data types to resolve phylogenetic relationships among closely related Diospyros species. Methods Twenty-two closely related Diospyros species from New Caledonia were investigated using whole plastid genomes and nrDNA data from low-coverage next-generation sequencing (NGS). Phylogenetic trees were inferred using maximum parsimony, maximum likelihood and Bayesian inference on separate plastid and nrDNA and combined matrices. Key Results The plastid and nrDNA sequences were, singly and together, unable to provide well supported phylogenetic relationships among the closely related New Caledonian Diospyros species. In the nrDNA, a 6-fold greater percentage of parsimony-informative characters compared with plastid DNA was found, but the total number of informative sites was greater for the much larger plastid DNA genomes. Combining the plastid and nuclear data improved resolution. Plastid results showed a trend towards geographical clustering of accessions rather than following taxonomic species. Conclusions In plant groups in which multiple plastid markers are not sufficiently informative, an investigation at the level of the entire plastid genome may also not be sufficient for detailed phylogenetic reconstruction. Sequencing of complete plastid genomes and nrDNA repeats seems to clarify some relationships among the New Caledonian Diospyros species, but the higher percentage of parsimony-informative characters in nrDNA compared with plastid DNA did not help to resolve the phylogenetic tree because the total number of variable sites was much lower than in the entire plastid genome. The geographical clustering of the individuals against a background of overall low sequence divergence could indicate transfer of plastid genomes due to hybridization and introgression following secondary contact. PMID:27098088
Hochbach, Anne; Schneider, Julia; Röser, Martin
2015-06-01
To investigate phylogenetic relationships within the grass subfamily Pooideae we studied about 50 taxa covering all recognized tribes, using one plastid DNA (cpDNA) marker (matK gene-3'trnK exon) and for the first time four nuclear single copy gene loci. DNA sequence information from two parts of the nuclear genes topoisomerase 6 (Topo6) spanning the exons 8-13 and 17-19, the exons 9-13 encoding plastid acetyl-CoA-carboxylase (Acc1) and the partial exon 1 of phytochrome B (PhyB) were generated. Individual and nuclear combined data were evaluated using maximum parsimony, maximum likelihood and Bayesian methods. All of the phylogenetic results show Brachyelytrum and the tribe Nardeae as earliest diverging lineages within the subfamily. The 'core' Pooideae (Hordeeae and the Aveneae/Poeae tribe complex) are also strongly supported, as well as the monophyly of the tribes Brachypodieae, Meliceae and Stipeae (except PhyB). The beak grass tribe Diarrheneae and the tribe Duthieeae are not monophyletic in some of the analyses. However, the combined nuclear DNA (nDNA) tree yields the highest resolution and the best delimitation of the tribes, and provides the following evolutionary hypothesis for the tribes: Brachyelytrum, Nardeae, Duthieeae, Meliceae, Stipeae, Diarrheneae, Brachypodieae and the 'core' Pooideae. Within the individual datasets, the phylogenetic trees obtained from Topo6 exon 8-13 shows the most interesting results. The divergent positions of some clone sequences of Ampelodesmos mauritanicus and Trikeraia pappiformis, for instance, may indicate a hybrid origin of these stipoid taxa. Copyright © 2015 Elsevier Inc. All rights reserved.
Al-Qurainy, F; Khan, S; Nadeem, M; Tarroum, M; Alaklabi, A
2013-03-11
The rare and endangered plants of any country are important genetic resources that often require urgent conservation measures. Assessment of phylogenetic relationships and evaluation of genetic diversity is very important prior to implementation of conservation strategies for saving rare and endangered plant species. We used internal transcribed spacer sequences of nuclear ribosomal DNA for the evaluation of sequence identity from the available taxa in the GenBank database by using the Basic Local Alignment Search Tool (BLAST). Two rare plant species viz, Heliotropium strigosum claded with H. pilosum (98% branch support) and Pancratium tortuosum claded with P. tenuifolium (61% branch support) clearly. However, some species, viz Scadoxus multiflorus, Commiphora myrrha and Senecio hadiensis showed close relationships with more than one species. We conclude that nuclear ribosomal internal transcribed spacer sequences are useful markers for phylogenetic study of these rare plant species in Saudi Arabia.
Zeng, Xu; Yuan, Zhengrong; Tong, Xin; Li, Qiushi; Gao, Weiwei; Qin, Minjian; Liu, Zhihua
2012-05-01
Oryzoideae (Poaceae) plants have economic and ecological value. However, the phylogenetic position of some plants is not clear, such as Hygroryza aristata (Retz.) Nees. and Porteresia coarctata (Roxb.) Tateoka (syn. Oryza coarctata). Comprehensive molecular phylogenetic studies have been carried out on many genera in the Poaceae. The different DNA sequences, including nuclear and chloroplast sequences, had been extensively employed to determine relationships at both higher and lower taxonomic levels in the Poaceae. Chloroplast DNA ndhF gene and atpB-rbcL spacer were used to construct phylogenetic trees and estimate the divergence time of Oryzoideae, Bambusoideae, Panicoideae, Pooideae and so on. Complete sequences of atpB-rbcL and ndhF were generated for 17 species representing six species of the Oryzoideae and related subfamilies. Nicotiana tabacum L. was the outgroup species. The two DNA datasets were analyzed, using Maximum Parsimony and Bayesian analysis methods. The molecular phylogeny revealed that H. aristata (Retz.) Nees was the sister to Chikusichloa aquatica Koidz. Moreover, P. coarctata (Roxb.) Tateoka was in the genus Oryza. Furthermore, the result of evolution analysis, which based on the ndhF marker, indicated that the time of origin of Oryzoideae might be 31 million years ago.
Eduardo R. Nouhra; Laura S. Domínguez; Alejandra G. Becerra; James M. Trappe
2005-01-01
Field studies in Argentina's Yunga District revealed Alpova austroalnicola sp. nov., a hypogeous fungus associated with Alnus acuminata ssp, acuminata. Morphological and molecular studies based on amplification and sequencing of the nuclear LSU rDNA gene showed its unique identity within ...
USDA-ARS?s Scientific Manuscript database
This study aims to clarify genetic differentiation of the Drosophila parasitoid Ganaspis brasiliensis (Hymenoptera; Figitidae; Eucoilinae) based on the nucleotide sequences of the cytochrome oxidase subunit 1 (CO1) and three nuclear DNA regions, the inter-transcribed spacers 1 and 2 (ITS1 and ITS2) ...
A multigene molecular phylogenetic assessment of true morels (Morchella) in turkey
USDA-ARS?s Scientific Manuscript database
A collection of 247 true morels (Morchella spp.) primarily from the Mediterranean and Aegean Regions of Southern Turkey, were analyzed for species diversity using partial RNA polymerase I (RPB1) and nuclear ribosomal large subunit (LSU) rDNA gene sequences. Based on the result of this initial scree...
Phylogeny and temporal diversification of darters (Percidae: Etheostomatinae).
Near, Thomas J; Bossu, Christen M; Bradburd, Gideon S; Carlson, Rose L; Harrington, Richard C; Hollingsworth, Phillip R; Keck, Benjamin P; Etnier, David A
2011-10-01
Discussions aimed at resolution of the Tree of Life are most often focused on the interrelationships of major organismal lineages. In this study, we focus on the resolution of some of the most apical branches in the Tree of Life through exploration of the phylogenetic relationships of darters, a species-rich clade of North American freshwater fishes. With a near-complete taxon sampling of close to 250 species, we aim to investigate strategies for efficient multilocus data sampling and the estimation of divergence times using relaxed-clock methods when a clade lacks a fossil record. Our phylogenetic data set comprises a single mitochondrial DNA (mtDNA) gene and two nuclear genes sampled from 245 of the 248 darter species. This dense sampling allows us to determine if a modest amount of nuclear DNA sequence data can resolve relationships among closely related animal species. Darters lack a fossil record to provide age calibration priors in relaxed-clock analyses. Therefore, we use a near-complete species-sampled phylogeny of the perciform clade Centrarchidae, which has a rich fossil record, to assess two distinct strategies of external calibration in relaxed-clock divergence time estimates of darters: using ages inferred from the fossil record and molecular evolutionary rate estimates. Comparison of Bayesian phylogenies inferred from mtDNA and nuclear genes reveals that heterospecific mtDNA is present in approximately 12.5% of all darter species. We identify three patterns of mtDNA introgression in darters: proximal mtDNA transfer, which involves the transfer of mtDNA among extant and sympatric darter species, indeterminate introgression, which involves the transfer of mtDNA from a lineage that cannot be confidently identified because the introgressed haplotypes are not clearly referable to mtDNA haplotypes in any recognized species, and deep introgression, which is characterized by species diversification within a recipient clade subsequent to the transfer of heterospecific mtDNA. The results of our analyses indicate that DNA sequences sampled from single-copy nuclear genes can provide appreciable phylogenetic resolution for closely related animal species. A well-resolved near-complete species-sampled phylogeny of darters was estimated with Bayesian methods using a concatenated mtDNA and nuclear gene data set with all identified heterospecific mtDNA haplotypes treated as missing data. The relaxed-clock analyses resulted in very similar posterior age estimates across the three sampled genes and methods of calibration and therefore offer a viable strategy for estimating divergence times for clades that lack a fossil record. In addition, an informative rank-free clade-based classification of darters that preserves the rich history of nomenclature in the group and provides formal taxonomic communication of darter clades was constructed using the mtDNA and nuclear gene phylogeny. On the whole, the appeal of mtDNA for phylogeny inference among closely related animal species is diminished by the observations of extensive mtDNA introgression and by finding appreciable phylogenetic signal in a modest sampling of nuclear genes in our phylogenetic analyses of darters.
NUREBASE: database of nuclear hormone receptors.
Duarte, Jorge; Perrière, Guy; Laudet, Vincent; Robinson-Rechavi, Marc
2002-01-01
Nuclear hormone receptors are an abundant class of ligand activated transcriptional regulators, found in varying numbers in all animals. Based on our experience of managing the official nomenclature of nuclear receptors, we have developed NUREBASE, a database containing protein and DNA sequences, reviewed protein alignments and phylogenies, taxonomy and annotations for all nuclear receptors. The reviewed NUREBASE is completed by NUREBASE_DAILY, automatically updated every 24 h. Both databases are organized under a client/server architecture, with a client written in Java which runs on any platform. This client, named FamFetch, integrates a graphical interface allowing selection of families, and manipulation of phylogenies and alignments. NUREBASE sequence data is also accessible through a World Wide Web server, allowing complex queries. All information on accessing and installing NUREBASE may be found at http://www.ens-lyon.fr/LBMC/laudet/nurebase.html.
Genetic characterization of Zostera asiatica on the Pacific Coast of North America
Talbot, S.L.; Wyllie-Echeverria, S.; Ward, D.H.; Rearick, J.R.; Sage, G.K.; Chesney, B.; Phillips, R.C.
2006-01-01
We gathered sequence information from the nuclear 5.8S rDNA gene and associated internal transcribed spacers, ITS-1 and ITS-2 (5.8S rDNA/ITS), and the chloroplast maturase K (matK) gene, from Zostera samples collected from subtidal habitats in Monterey and Santa Barbara (Isla Vista) bays, California, to test the hypothesis that these plants are conspecific with Z. asiatica Miki of Asia. Sequences from approximately 520 base pairs of the nuclear 5.8S rDNA/ITS obtained from the subtidal Monterey and Isla Vista Zostera samples were identical to homologous sequences obtained from Z. marina collected from intertidal habitats in Japan, Alaska, Oregon and California. Similarly, sequences from the matK gene from the subtidal Zostera samples were identical to matK sequences obtained from Z. marina collected from intertidal habitats in Japan, Alaska, Oregon and California, but differed from Z. asiatica sequences accessioned into GenBank. This suggests the subtidal plants are conspecific with Z. marina, not Z. asiatica. However, we found that herbarium samples accessioned into the Kyoto University Herbarium, determined to be Z. asiatica, yielded 5.8S rDNA/ITS sequences consistent with either Z. japonica, in two cases, or Z. marina, in one case. Similar results were observed for the chloroplast matK gene; we found haplotypes that were inconsistent with published matK sequences from Z. asiatica collected from Japan. These results underscore the need for closer examination of the relationship between Z. marina along the Pacific Coast of North America, and Z. asiatica of Asia, for the retention and verification of specimens examined in scientific studies, and for assessment of the usefulness of morphological characters in the determination of taxonomic relationships within Zosteraceae.
Santos, Guilherme B; Soares, Manoel do C P; de F Brito, Elisabete M; Rodrigues, André L; Siqueira, Nilton G; Gomes-Gouvêa, Michele S; Alves, Max M; Carneiro, Liliane A; Malheiros, Andreza P; Póvoa, Marinete M; Zaha, Arnaldo; Haag, Karen L
2012-12-01
To date, nothing is known about the genetic diversity of the Echinococcus neotropical species, Echinococcus vogeli and Echinococcus oligarthrus. Here we used mitochondrial and nuclear DNA sequence polymorphisms to uncover the genetic structure, transmission and history of E. vogeli in the Brazilian Amazon, based on a sample of 38 isolates obtained from human and wild animal hosts. We confirm that the parasite is partially synanthropic and show that its populations are diverse. Furthermore, significant geographical structuring is found, with western and eastern populations being genetically divergent. Copyright © 2012 Australian Society for Parasitology Inc. Published by Elsevier Ltd. All rights reserved.
Nuclear magnetic resonance-based model of a TF1/HmU-DNA complex.
Silva, M V; Pasternack, L B; Kearns, D R
1997-12-15
Transcription factor 1 (TF1), a type II DNA-binding protein encoded by the Bacillus subtilis bacteriophage SPO1, has the capacity for sequence-selective DNA binding and a preference for 5-hydroxymethyl-2'-deoxyuridine (HmU)-containing DNA. In NMR studies of the TF1/HmU-DNA complex, intermolecular NOEs indicate that the flexible beta-ribbon and C-terminal alpha-helix are involved in the DNA-binding site of TF1, placing it in the beta-sheet category of DNA-binding proteins proposed to bind by wrapping two beta-ribbon "arms" around the DNA. Intermolecular and intramolecular NOEs were used to generate an energy-minimized model of the protein-DNA complex in which both DNA bending and protein structure changes are evident.
Fluorescence In situ Hybridization: Cell-Based Genetic Diagnostic and Research Applications.
Cui, Chenghua; Shu, Wei; Li, Peining
2016-01-01
Fluorescence in situ hybridization (FISH) is a macromolecule recognition technology based on the complementary nature of DNA or DNA/RNA double strands. Selected DNA strands incorporated with fluorophore-coupled nucleotides can be used as probes to hybridize onto the complementary sequences in tested cells and tissues and then visualized through a fluorescence microscope or an imaging system. This technology was initially developed as a physical mapping tool to delineate genes within chromosomes. Its high analytical resolution to a single gene level and high sensitivity and specificity enabled an immediate application for genetic diagnosis of constitutional common aneuploidies, microdeletion/microduplication syndromes, and subtelomeric rearrangements. FISH tests using panels of gene-specific probes for somatic recurrent losses, gains, and translocations have been routinely applied for hematologic and solid tumors and are one of the fastest-growing areas in cancer diagnosis. FISH has also been used to detect infectious microbias and parasites like malaria in human blood cells. Recent advances in FISH technology involve various methods for improving probe labeling efficiency and the use of super resolution imaging systems for direct visualization of intra-nuclear chromosomal organization and profiling of RNA transcription in single cells. Cas9-mediated FISH (CASFISH) allowed in situ labeling of repetitive sequences and single-copy sequences without the disruption of nuclear genomic organization in fixed or living cells. Using oligopaint-FISH and super-resolution imaging enabled in situ visualization of chromosome haplotypes from differentially specified single-nucleotide polymorphism loci. Single molecule RNA FISH (smRNA-FISH) using combinatorial labeling or sequential barcoding by multiple round of hybridization were applied to measure mRNA expression of multiple genes within single cells. Research applications of these single molecule single cells DNA and RNA FISH techniques have visualized intra-nuclear genomic structure and sub-cellular transcriptional dynamics of many genes and revealed their functions in various biological processes.
Johnson, Leigh A; Chan, Lauren M; Weese, Terri L; Busby, Lisa D; McMurry, Samuel
2008-09-01
Members of the phlox family (Polemoniaceae) serve as useful models for studying various evolutionary and biological processes. Despite its biological importance, no family-wide phylogenetic estimate based on multiple DNA regions with complete generic sampling is available. Here, we analyze one nuclear and five chloroplast DNA sequence regions (nuclear ITS, chloroplast matK, trnL intron plus trnL-trnF intergeneric spacer, and the trnS-trnG, trnD-trnT, and psbM-trnD intergenic spacers) using parsimony and Bayesian methods, as well as assessments of congruence and long branch attraction, to explore phylogenetic relationships among 84 ingroup species representing all currently recognized Polemoniaceae genera. Relationships inferred from the ITS and concatenated chloroplast regions are similar overall. A combined analysis provides strong support for the monophyly of Polemoniaceae and subfamilies Acanthogilioideae, Cobaeoideae, and Polemonioideae. Relationships among subfamilies, and thus for the precise root of Polemoniaceae, remain poorly supported. Within the largest subfamily, Polemonioideae, four clades corresponding to tribes Polemonieae, Phlocideae, Gilieae, and Loeselieae receive strong support. The monogeneric Polemonieae appears sister to Phlocideae. Relationships within Polemonieae, Phlocideae, and Gilieae are mostly consistent between analyses and data permutations. Many relationships within Loeselieae remain uncertain. Overall, inferred phylogenetic relationships support a higher-level classification for Polemoniaceae proposed in 2000.
Johnston, L H; Eberly, S L; Chapman, J W; Araki, H; Sugino, A
1990-01-01
Several Saccharomyces cerevisiae dbf mutants defective in DNA synthesis have been described previously. In this paper, one of them, dbf2, is characterized in detail. The DBF2 gene has been cloned and mapped, and its nucleotide sequence has been determined. This process has identified an open reading frame capable of encoding a protein of molecular weight 64,883 (561 amino acids). The deduced amino acid sequence contains all 11 conserved domains found in various protein kinases. DBF2 was periodically expressed in the cell cycle at a time that clearly differed from the time of expression of either the histone H2A or DNA polymerase I gene. Its first function was completed very near to initiation of DNA synthesis. However, DNA synthesis in the mutant was only delayed at 37 degrees C, and the cells blocked in nuclear division. Consistent with this finding, the execution point occurred about 1 h after DNA synthesis, and the nuclear morphology of the mutant at the restrictive temperature was that of cells blocked in late nuclear division. DBF2 is therefore likely to encode a protein kinase that may function in initiation of DNA synthesis and also in late nuclear division. Images PMID:2181271
Modular structural elements in the replication origin region of Tetrahymena rDNA.
Du, C; Sanzgiri, R P; Shaiu, W L; Choi, J K; Hou, Z; Benbow, R M; Dobbs, D L
1995-01-01
Computer analyses of the DNA replication origin region in the amplified rRNA genes of Tetrahymena thermophila identified a potential initiation zone in the 5'NTS [Dobbs, Shaiu and Benbow (1994), Nucleic Acids Res. 22, 2479-2489]. This region consists of a putative DNA unwinding element (DUE) aligned with predicted bent DNA segments, nuclear matrix or scaffold associated region (MAR/SAR) consensus sequences, and other common modular sequence elements previously shown to be clustered in eukaryotic chromosomal origin regions. In this study, two mung bean nuclease-hypersensitive sites in super-coiled plasmid DNA were localized within the major DUE-like element predicted by thermodynamic analyses. Three restriction fragments of the 5'NTS region predicted to contain bent DNA segments exhibited anomalous migration characteristic of bent DNA during electrophoresis on polyacrylamide gels. Restriction fragments containing the 5'NTS region bound Tetrahymena nuclear matrices in an in vitro binding assay, consistent with an association of the replication origin region with the nuclear matrix in vivo. The direct demonstration in a protozoan origin region of elements previously identified in Drosophila, chick and mammalian origin regions suggests that clusters of modular structural elements may be a conserved feature of eukaryotic chromosomal origins of replication. Images PMID:7784181
Vartanian, Jean-Pierre; Wain-Hobson, Simon
2002-05-28
Nuclear mtDNA sequences (numts) are a widespread family of paralogs evolving as pseudogenes in chromosomal DNA [Zhang, D. E. & Hewitt, G. M. (1996) TREE 11, 247-251 and Bensasson, D., Zhang, D., Hartl, D. L. & Hewitt, G. M. (2001) TREE 16, 314-321]. When trying to identify the species origin of an unknown DNA sample by way of an mtDNA locus, PCR may amplify both mtDNA and numts. Indeed, occasionally numts dominate confounding attempts at species identification [Bensasson, D., Zhang, D. X. & Hewitt, G. M. (2000) Mol. Biol. Evol. 17, 406-415; Wallace, D. C., et al. (1997) Proc. Natl. Acad. Sci. USA 94, 14900-14905]. Rhesus and cynomolgus macaque mtDNA haplotypes were identified in a study of oral polio vaccine samples dating from the late 1950s [Blancou, P., et al. (2001) Nature (London) 410, 1045-1046]. They were accompanied by a number of putative numts. To confirm that these putative numts were of macaque origin, a library of numts corresponding to a small segment of 12S rDNA locus has been made by using DNA from a Chinese rhesus macaque. A broad distribution was found with up to 30% sequence variation. Phylogenetic analysis showed that the evolutionary trajectories of numts and bona fide mtDNA haplotypes do not overlap with the signal exception of the host species; mtDNA fragments are continually crossing over into the germ line. In the case of divergent mtDNA sequences from old oral polio vaccine samples [Blancou, P., et al. (2001) Nature (London) 410, 1045-1046], all were closely related to numts in the Chinese macaque library.
The identification of FANCD2 DNA binding domains reveals nuclear localization sequences.
Niraj, Joshi; Caron, Marie-Christine; Drapeau, Karine; Bérubé, Stéphanie; Guitton-Sert, Laure; Coulombe, Yan; Couturier, Anthony M; Masson, Jean-Yves
2017-08-21
Fanconi anemia (FA) is a recessive genetic disorder characterized by congenital abnormalities, progressive bone-marrow failure, and cancer susceptibility. The FA pathway consists of at least 21 FANC genes (FANCA-FANCV), and the encoded protein products interact in a common cellular pathway to gain resistance against DNA interstrand crosslinks. After DNA damage, FANCD2 is monoubiquitinated and accumulates on chromatin. FANCD2 plays a central role in the FA pathway, using yet unidentified DNA binding regions. By using synthetic peptide mapping and DNA binding screen by electromobility shift assays, we found that FANCD2 bears two major DNA binding domains predominantly consisting of evolutionary conserved lysine residues. Furthermore, one domain at the N-terminus of FANCD2 bears also nuclear localization sequences for the protein. Mutations in the bifunctional DNA binding/NLS domain lead to a reduction in FANCD2 monoubiquitination and increase in mitomycin C sensitivity. Such phenotypes are not fully rescued by fusion with an heterologous NLS, which enable separation of DNA binding and nuclear import functions within this domain that are necessary for FANCD2 functions. Collectively, our results enlighten the importance of DNA binding and NLS residues in FANCD2 to activate an efficient FA pathway. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.
Massively parallel sequencing-enabled mixture analysis of mitochondrial DNA samples.
Churchill, Jennifer D; Stoljarova, Monika; King, Jonathan L; Budowle, Bruce
2018-02-22
The mitochondrial genome has a number of characteristics that provide useful information to forensic investigations. Massively parallel sequencing (MPS) technologies offer improvements to the quantitative analysis of the mitochondrial genome, specifically the interpretation of mixed mitochondrial samples. Two-person mixtures with nuclear DNA ratios of 1:1, 5:1, 10:1, and 20:1 of individuals from different and similar phylogenetic backgrounds and three-person mixtures with nuclear DNA ratios of 1:1:1 and 5:1:1 were prepared using the Precision ID mtDNA Whole Genome Panel and Ion Chef, and sequenced on the Ion PGM or Ion S5 sequencer (Thermo Fisher Scientific, Waltham, MA, USA). These data were used to evaluate whether and to what degree MPS mixtures could be deconvolved. Analysis was effective in identifying the major contributor in each instance, while SNPs from the minor contributor's haplotype only were identified in the 1:1, 5:1, and 10:1 two-person mixtures. While the major contributor was identified from the 5:1:1 mixture, analysis of the three-person mixtures was more complex, and the mixed haplotypes could not be completely parsed. These results indicate that mixed mitochondrial DNA samples may be interpreted with the use of MPS technologies.
Singh, B N; Mudgil, Yashwanti; Sopory, S K; Reddy, M K
2003-07-01
We have successfully expressed enzymatically active plant topoisomerase II in Escherichia coli for the first time, which has enabled its biochemical characterization. Using a PCR-based strategy, we obtained a full-length cDNA and the corresponding genomic clone of tobacco topoisomerase II. The genomic clone has 18 exons interrupted by 17 introns. Most of the 5' and 3' splice junctions follow the typical canonical consensus dinucleotide sequence GU-AG present in other plant introns. The position of introns and phasing with respect to primary amino acid sequence in tobacco TopII and Arabidopsis TopII are highly conserved, suggesting that the two genes are evolved from the common ancestral type II topoisomerase gene. The cDNA encodes a polypeptide of 1482 amino acids. The primary amino acid sequence shows a striking sequence similarity, preserving all the structural domains that are conserved among eukaryotic type II topoisomerases in an identical spatial order. We have expressed the full-length polypeptide in E. coli and purified the recombinant protein to homogeneity. The full-length polypeptide relaxed supercoiled DNA and decatenated the catenated DNA in a Mg(2+)- and ATP-dependent manner, and this activity was inhibited by 4'-(9-acridinylamino)-3'-methoxymethanesulfonanilide (m-AMSA). The immunofluorescence and confocal microscopic studies, with antibodies developed against the N-terminal region of tobacco recombinant topoisomerase II, established the nuclear localization of topoisomerase II in tobacco BY2 cells. The regulated expression of tobacco topoisomerase II gene under the GAL1 promoter functionally complemented a temperature-sensitive TopII(ts) yeast mutant.
USDA-ARS?s Scientific Manuscript database
Flow injection mass spectrometry (FIMS) and proton nuclear magnetic resonance spectrometry (1H-NMR), two metabolic fingerprinting methods, and DNA sequencing were used to identify and authenticate Actaea species. Initially, samples of Actaea racemosa L. from a single source were distinguished from ...
Wen, Jun; Ebihara, Atsushi; Li, De-Zhu
2016-01-01
DNA barcoding is a fast-developing technique to identify species by using short and standard DNA sequences. Universal selection of DNA barcodes in ferns remains unresolved. In this study, five plastid regions (rbcL, matK, trnH-psbA, trnL-F and rps4-trnS) and eight nuclear regions (ITS, pgiC, gapC, LEAFY, ITS2, IBR3_2, DET1, and SQD1_1) were screened and evaluated in the fern genus Adiantum from China and neighboring areas. Due to low primer universality (matK) and/or the existence of multiple copies (ITS), the commonly used barcodes matK and ITS were not appropriate for Adiantum. The PCR amplification rate was extremely low in all nuclear genes except for IBR3_2. rbcL had the highest PCR amplification rate (94.33%) and sequencing success rate (90.78%), while trnH-psbA had the highest species identification rate (75%). With the consideration of discriminatory power, cost-efficiency and effort, the two-barcode combination of rbcL+ trnH-psbA seems to be the best choice for barcoding Adiantum, and perhaps basal polypod ferns in general. The nuclear IBR3_2 showed 100% PCR amplification success rate in Adiantum, however, it seemed that only diploid species could acquire clean sequences without cloning. With cloning, IBR3_2 can successfully distinguish cryptic species and hybrid species from their related species. Because hybridization and allopolyploidy are common in ferns, we argue for including a selected group of nuclear loci as barcodes, especially via the next-generation sequencing, as it is much more efficient to obtain single-copy nuclear loci without the cloning procedure. PMID:27603700
No genome barriers to promiscuous DNA
NASA Astrophysics Data System (ADS)
Lewin, R.
1984-06-01
Farrelly and Butow (1983) used the term 'promiscuous DNA' in their report of the apparent natural transfer of yeast mitochondrial DNA sequences into the nuclear genome. Ellis (1982) applied the same term in an editorial comment. It is pointed out since that time the subject of DNA's promiscuity has exploded with a series of reports. According to a report by Stern (1984), movement of DNA sequences between chloroplasts and mitochondria is not just a rare event but is a rampant process. It was recently concluded that 'the widespread presence of ctDNA sequences in plant mtDNA is best regarded as a dramatic demonstration of the dynamo nature of interactions between the chloroplast and the mitochondrion, similar to the ongoing process of interorganellar DNA transfer already documented between mitochondrion and nucleus and between chloroplast and nucleus'.
Banker, Sarah E; Wade, Elizabeth J; Simon, Chris
2017-11-01
Phylogenetic studies of multiple independently inherited nuclear genes considered in combination with patterns of inheritance of organelle DNA have provided considerable insight into the history of species evolution. In particular, investigations of cicadas in the New Zealand genus Kikihia have identified interesting cases where mitochondrial DNA (mtDNA) crosses species boundaries in some species pairs but not others. Previous phylogenetic studies focusing on mtDNA largely corroborated Kikihia species groups identified by song, morphology and ecology with the exception of a unique South Island mitochondrial haplotype clade-the Westlandica group. This newly identified group consists of diverse taxa previously classified as belonging to three different sub-generic clades. We sequenced five nuclear loci from multiple individuals from every species of Kikihia to assess the nuclear gene concordance for this newly-identified mtDNA lineage. Bayes Factor analysis of the constrained phylogeny suggests some support for the mtDNA-based hypotheses, despite the fact that neither concatenation nor multiple species tree methods resolve the Westlandica group as monophyletic. The nuclear analyses suggest a geographic distinction between clearly defined monophyletic North Island clades and unresolved South Island clades. We suggest that more extreme habitat modification on South Island during the Pliocene and Pleistocene resulted in secondary contact and hybridization between species pairs and a series of mitochondrial capture events followed by subsequent lineage evolution. Copyright © 2017 Elsevier Inc. All rights reserved.
A partial nuclear genome of the Jomons who lived 3000 years ago in Fukushima, Japan
Kanzawa-Kiriyama, Hideaki; Kryukov, Kirill; Jinam, Timothy A; Hosomichi, Kazuyoshi; Saso, Aiko; Suwa, Gen; Ueda, Shintaroh; Yoneda, Minoru; Tajima, Atsushi; Shinoda, Ken-ichi; Inoue, Ituro; Saitou, Naruya
2017-01-01
The Jomon period of the Japanese Archipelago, characterized by cord-marked ‘jomon' potteries, has yielded abundant human skeletal remains. However, the genetic origins of the Jomon people and their relationships with modern populations have not been clarified. We determined a total of 115 million base pair nuclear genome sequences from two Jomon individuals (male and female each) from the Sanganji Shell Mound (dated 3000 years before present) with the Jomon-characteristic mitochondrial DNA haplogroup N9b, and compared these nuclear genome sequences with those of worldwide populations. We found that the Jomon population lineage is best considered to have diverged before diversification of present-day East Eurasian populations, with no evidence of gene flow events between the Jomon and other continental populations. This suggests that the Sanganji Jomon people descended from an early phase of population dispersals in East Asia. We also estimated that the modern mainland Japanese inherited <20% of Jomon peoples' genomes. Our findings, based on the first analysis of Jomon nuclear genome sequence data, firmly demonstrate that the modern mainland Japanese resulted from genetic admixture of the indigenous Jomon people and later migrants. PMID:27581845
Fearnley, I M; Finel, M; Skehel, J M; Walker, J E
1991-01-01
The 39 kDa and 42 kDa subunits of NADH:ubiquinone oxidoreductase from bovine heart mitochondria are nuclear-coded components of the hydrophobic protein fraction of the enzyme. Their amino acid sequences have been deduced from the sequences of overlapping cDNA clones. These clones were amplified from total bovine heart cDNA by means of the polymerase chain reaction, with the use of complex mixtures of oligonucleotide primers based upon fragments of protein sequence determined at the N-terminals of the proteins and at internal sites. The protein sequences of the 39 kDa and 42 kDa subunits are 345 and 320 amino acid residues long respectively, and their calculated molecular masses are 39,115 Da and 36,693 Da. Both proteins are predominantly hydrophilic, but each contains one or two hydrophobic segments that could possibly be folded into transmembrane alpha-helices. The bovine 39 kDa protein sequence is related to that of a 40 kDa subunit from complex I from Neurospora crassa mitochondria; otherwise, it is not related significantly to any known sequence, including redox proteins and two polypeptides involved in import of proteins into mitochondria, known as the mitochondrial processing peptidase and the processing-enhancing protein. Therefore the functions of the 39 kDa and 42 kDa subunits of complex I are unknown. The mitochondrial gene product, ND4, a hydrophobic component of complex I with an apparent molecular mass of about 39 kDa, has been identified in preparations of the enzyme. This subunit stains faintly with Coomassie Blue dye, and in many gel systems it is not resolved from the nuclearcoded 36 kDa subunit. Images Fig. 1. PMID:1832859
Azuma, Noriko; Yamazaki, Tomoyasu; Chiba, Susumu
2011-12-01
We investigated mitochondrial and nuclear DNA genotypes in nominal Littorina sitkana samples from 2 localities in Eastern Hokkaido, northern Japan. Our results indicated the existence of cryptic species. In the analysis of partial mitochondrial Cytchrome b gene sequences, haplotypes of L. sitkana samples were monophyletic in a phylogenetic tree with orthologous sequences from other Littorina species, but were apparently separated in 2 clades. One included typical L. sitkana (CBa clade) samples, which formed a clade with an allopatric species, L. horikawai. The other, CBb, was independent from CBa and L. horikawai. Haplotypes of the mitochondrial 16S rRNA gene also separated into 2 clades. We additionally examined intron sequence of the heat shock cognate 70 (HSC70) nuclear gene and identified 17 haplotypes. These were also separated into 2 clades, HSCa and HSCb. Among the examined Hokkaido samples, 60% of individuals were heterozygotes. However, each heterozygote consisted of haplotypes from the same clade, HSCa or HSCb, and no admixture of HSCa and HSCb haplotypes was observed. These results indicate reproductive isolation between the 2 clades. Among the genotyped Hokkaido samples, 93% of individuals had CBa + HSCa or CBb + HSCb genotypes, and 7% had CBb + HSCa genotypes. The discrepancy between the mtDNA and nuclear DNA haplotypes in a few individuals may have been caused by genetic introgression due to past hybridization.
DNA Barcoding in Fragaria L. (Strawberry) Species
USDA-ARS?s Scientific Manuscript database
DNA barcoding for species identification using a short DNA sequence has been successful in animals due to rapid mutation rates of the mitochondrial genome where the animal DNA barocode, cytochrome c oxidase 1 gene is located. The chloroplast PsbA-trnH spacer and the nuclear ribosomal internal transc...
Fungal endophyte diversity in Sarracenia.
Glenn, Anthony; Bodri, Michael S
2012-01-01
Fungal endophytes were isolated from 4 species of the carnivorous pitcher plant genus Sarracenia: S. minor, S. oreophila, S. purpurea, and S. psittacina. Twelve taxa of fungi, 8 within the Ascomycota and 4 within the Basidiomycota, were identified based on PCR amplification and sequencing of the internal transcribed spacer sequences of nuclear ribosomal DNA (ITS rDNA) with taxonomic identity assigned using the NCBI nucleotide megablast search tool. Endophytes are known to produce a large number of metabolites, some of which may contribute to the protection and survival of the host. We speculate that endophyte-infected Sarracenia may benefit from their fungal associates by their influence on nutrient availability from within pitchers and, possibly, by directly influencing the biota within pitchers.
Isolation of Onchocerca lupi in Dogs and Black Flies, California, USA
Hassan, Hassan K.; Bolcen, Shanna; Kubofcik, Joseph; Nutman, Thomas B.; Eberhard, Mark L.; Middleton, Kelly; Wekesa, Joseph Wakoli; Ruedas, Gimena; Nelson, Kimberly J.; Dubielzig, Richard; De Lombaert, Melissa; Silverman, Bruce; Schorling, Jamie J.; Adler, Peter H.; Beeler, Emily S.
2015-01-01
In southern California, ocular infections caused by Onchocerca lupi were diagnosed in 3 dogs (1 in 2006, 2 in 2012). The infectious agent was confirmed through morphologic analysis of fixed parasites in tissues and by PCR and sequencing of amplicons derived from 2 mitochondrially encoded genes and 1 nuclear-encoded gene. A nested PCR based on the sequence of the cytochrome oxidase subunit 1 gene of the parasite was developed and used to screen Simulium black flies collected from southern California for O. lupi DNA. Six (2.8%; 95% CI 0.6%–5.0%) of 213 black flies contained O. lupi DNA. Partial mitochondrial16S rRNA gene sequences from the infected flies matched sequences derived from black fly larvae cytotaxonomically identified as Simulium tribulatum. These data implicate S. tribulatum flies as a putative vector for O. lupi in southern California. PMID:25897954
The 87-kD A gamma-globin enhancer-binding protein is a product of the HOXB2(HOX2H) locus.
Sengupta, P K; Lavelle, D E; DeSimone, J
1994-03-01
Developmental regulation of globin gene expression may be controlled by developmental stage-specific nuclear proteins that influence interactions between the locus control region and local regulatory sequences near individual globin genes. We previously isolated an 87-kD nuclear protein from K562 cells that bound to DNA sequences in the beta-globin locus control region, gamma-globin promoter, and A gamma-globin enhancer. The presence of this protein in fetal globin-expressing cells and its absence in adult globin-expressing cells suggested that it may be a developmental stage-specific factor. A lambda gt11 K562 cDNA clone encoding a portion of the HOXB2 (formerly HOX2H) homeobox gene was isolated on the basis of the ability of its beta-galactosidase fusion protein to bind to the same DNA sequences as the 87-kD K562 protein. Because no other relationship had been established between the 87-kD K562 protein and the HOXB2 protein other than their ability to bind ot the same DNA sequences, we have investigated whether the two proteins are related antigenically. Our data show that antisera produced against the HOXB2-beta-gal fusion protein and a synthetic HOXB2 decapeptide react specifically with an 87-kD protein from K562 nuclear extract, showing that the 87-kD K562 nuclear protein is a product of the HOXB2 locus, and is the first demonstration of cellular HOXB2 protein.
Wahlberg, Niklas; Weingartner, Elisabet; Warren, Andrew D; Nylin, Sören
2009-01-01
Background Major conflict between mitochondrial and nuclear genes in estimating species relationships is an increasingly common finding in animals. Usually this is attributed to incomplete lineage sorting, but recently the possibility has been raised that hybridization is important in generating such phylogenetic patterns. Just how widespread ancient and/or recent hybridization is in animals and how it affects estimates of species relationships is still not well-known. Results We investigate the species relationships and their evolutionary history over time in the genus Polygonia using DNA sequences from two mitochondrial gene regions (COI and ND1, total 1931 bp) and four nuclear gene regions (EF-1α, wingless, GAPDH and RpS5, total 2948 bp). We found clear, strongly supported conflict between mitochondrial and nuclear DNA sequences in estimating species relationships in the genus Polygonia. Nodes at which there was no conflict tended to have diverged at the same time when analyzed separately, while nodes at which conflict was present diverged at different times. We find that two species create most of the conflict, and attribute the conflict found in Polygonia satyrus to ancient hybridization and conflict found in Polygonia oreas to recent or ongoing hybridization. In both examples, the nuclear gene regions tended to give the phylogenetic relationships of the species supported by morphology and biology. Conclusion Studies inferring species-level relationships using molecular data should never be based on a single locus. Here we show that the phylogenetic hypothesis generated using mitochondrial DNA gives a very different interpretation of the evolutionary history of Polygonia species compared to that generated from nuclear DNA. We show that possible cases of hybridization in Polygonia are not limited to sister species, but may be inferred further back in time. Furthermore, we provide more evidence that Haldane's effect might not be as strong a process in preventing hybridization in butterflies as has been previously thought. PMID:19422691
Kang, J J; Yokoi, T J; Holland, M J
1995-12-01
The 190-base pair (bp) rDNA enhancer within the intergenic spacer sequences of Saccharomyces cerevisiae rRNA cistrons activates synthesis of the 35S-rRNA precursor about 20-fold in vivo (Mestel,, R., Yip, M., Holland, J. P., Wang, E., Kang, J., and Holland, M. J. (1989) Mol. Cell. Biol. 9, 1243-1254). We now report identification and analysis of transcriptional activities mediated by three cis-acting sites within a 90-bp portion of the rDNA enhancer designated the modulator region. In vivo, these sequences mediated termination of transcription by RNA polymerase I and potentiated the activity of the rDNA enhancer element. Two trans-acting factors, REB1 and REB2, bind independently to sites within the modulator region (Morrow, B. E., Johnson, S. P., and Warner, J. R. (1989) J. Biol. Chem. 264, 9061-9068). We show that REB2 is identical to the ABF1 protien. Site-directed mutagenesis of REB1 and ABF1 binding sites demonstrated uncoupling of RNA polymerase I-dependent termination from transcriptional activation in vivo. We conclude that REB1 and ABF1 are required for RNA polymerase I-dependent termination and enhancer function, respectively, Since REB1 and ABF1 proteins also regulate expression of class II genes and other nuclear functions, our results suggest further similarities between RNA polymerase I and II regulatory mechanisms. Two rDNA enhancers flanking a rDNA minigene stimulated RNA polymerase I transcription in a "multiplicative" fashion. Deletion mapping analysis showed that similar cis-acting sequences were required for enhancer function when positioned upstream or downstream from a rDNA minigene.
Cytophotometric and biochemical analyses of DNA in pentaploid and diploid Agave species.
Cavallini, A; Natali, L; Cionini, G; Castorena-Sanchez, I
1996-04-01
Nuclear DNA content, chromatin structure, and DNA composition were investigated in four Agave species: two diploid, Agave tequilana Weber and Agave angustifolia Haworth var. marginata Hort., and two pentaploid, Agave fourcroydes Lemaire and Agave sisalana Perrine. It was determined that the genome size of pentaploid species is nearly 2.5 times that of diploid ones. Cytophotometric analyses of chromatin structure were performed following Feulgen or DAPI staining to determine optical density profiles of interphase nuclei. Pentaploid species showed higher frequencies of condensed chromatin (heterochromatin) than diploid species. On the other hand, a lower frequency of A-T rich (DAPI stained) heterochromatin was found in pentaploid species than in diploid ones, indicating that heterochromatin in pentaploid species is made up of sequences with base compositions different from those of diploid species. Since thermal denaturation profiles of extracted DNA showed minor variations in the base composition of the genomes of the four species, it is supposed that, in pentaploid species, the large heterochromatin content is not due to an overrepresentation of G-C repetitive sequences but rather to the condensation of nonrepetitive sequences, such as, for example, redundant gene copies switched off in the polyploid complement. It is suggested that speciation in the genus Agave occurs through point mutations and minor DNA rearrangements, as is also indicated by the relative stability of the karyotype of this genus. Key words : Agave, DNA cytophotometry, DNA melting profiles, chromatin structure, genome size.
Cospeciation of Psyllids and Their Primary Prokaryotic Endosymbionts
Thao, MyLo L.; Moran, Nancy A.; Abbot, Patrick; Brennan, Eric B.; Burckhardt, Daniel H.; Baumann, Paul
2000-01-01
Psyllids are plant sap-feeding insects that harbor prokaryotic endosymbionts in specialized cells within the body cavity. Four-kilobase DNA fragments containing 16S and 23S ribosomal DNA (rDNA) were amplified from the primary (P) endosymbiont of 32 species of psyllids representing three psyllid families and eight subfamilies. In addition, 0.54-kb fragments of the psyllid nuclear gene wingless were also amplified from 26 species. Phylogenetic trees derived from 16S-23S rDNA and from the host wingless gene are very similar, and tests of compatibility of the data sets show no significant conflict between host and endosymbiont phylogenies. This result is consistent with a single infection of a shared psyllid ancestor and subsequent cospeciation of the host and the endosymbiont. In addition, the phylogenies based on DNA sequences generally agreed with psyllid taxonomy based on morphology. The 3′ end of the 16S rDNA of the P endosymbionts differs from that of other members of the domain Bacteria in the lack of a sequence complementary to the mRNA ribosome binding site. The rate of sequence change in the 16S-23S rDNA of the psyllid P endosymbiont was considerably higher than that of other bacteria, including other fast-evolving insect endosymbionts. The lineage consisting of the P endosymbionts of psyllids was given the designation Candidatus Carsonella (gen. nov.) with a single species, Candidatus Carsonella ruddii (sp. nov.). PMID:10877784
Comparative Analysis of the Complete Chloroplast Genome of Four Endangered Herbals of Notopterygium
Yang, Jiao; Yue, Ming; Niu, Chuan; Ma, Xiong-Feng; Li, Zhong-Hu
2017-01-01
Notopterygium H. de Boissieu (Apiaceae) is an endangered perennial herb endemic to China. A good knowledge of phylogenetic evolution and population genomics is conducive to the establishment of effective management and conservation strategies of the genus Notopterygium. In this study, the complete chloroplast (cp) genomes of four Notopterygium species (N. incisum C. C. Ting ex H. T. Chang, N. oviforme R. H. Shan, N. franchetii H. de Boissieu and N. forrestii H. Wolff) were assembled and characterized using next-generation sequencing. We investigated the gene organization, order, size and repeat sequences of the cp genome and constructed the phylogenetic relationships of Notopterygium species based on the chloroplast DNA and nuclear internal transcribed spacer (ITS) sequences. Comparative analysis of plastid genome showed that the cp DNA are the standard double-stranded molecule, ranging from 157,462 bp (N. oviforme) to 159,607 bp (N. forrestii) in length. The circular DNA each contained a large single-copy (LSC) region, a small single-copy (SSC) region, and a pair of inverted repeats (IRs). The cp DNA of four species contained 85 protein-coding genes, 37 transfer RNA (tRNA) genes and 8 ribosomal RNA (rRNA) genes, respectively. We determined the marked conservation of gene content and sequence evolutionary rate in the cp genome of four Notopterygium species. Three genes (psaI, psbI and rpoA) were possibly under positive selection among the four sampled species. Phylogenetic analysis showed that four Notopterygium species formed a monophyletic clade with high bootstrap support. However, the inconsistent interspecific relationships with the genus Notopterygium were identified between the cp DNA and ITS markers. The incomplete lineage sorting, convergence evolution or hybridization, gene infiltration and different sampling strategies among species may have caused the incongruence between the nuclear and cp DNA relationships. The present results suggested that Notopterygium species may have experienced a complex evolutionary history and speciation process. PMID:28422071
Searching for nuclear export elements in hepatitis D virus RNA.
Freitas, Natália; Cunha, Celso
2013-08-12
To search for the presence of cis elements in hepatitis D virus (HDV) genomic and antigenomic RNA capable of promoting nuclear export. We made use of a well characterized chloramphenicol acetyl-transferase reporter system based on plasmid pDM138. Twenty cDNA fragments corresponding to different HDV genomic and antigenomic RNA sequences were inserted in plasmid pDM138, and used in transfection experiments in Huh7 cells. The relative amounts of HDV RNA in nuclear and cytoplasmic fractions were then determined by real-time polymerase chain reaction and Northern blotting. The secondary structure of the RNA sequences that displayed nuclear export ability was further predicted using a web interface. Finally, the sensitivity to leptomycin B was assessed in order to investigate possible cellular pathways involved in HDV RNA nuclear export. Analysis of genomic RNA sequences did not allow identifying an unequivocal nuclear export element. However, two regions were found to promote the export of reporter mRNAs with efficiency higher than the negative controls albeit lower than the positive control. These regions correspond to nucleotides 266-489 and 584-920, respectively. In addition, when analyzing antigenomic RNA sequences a nuclear export element was found in positions 214-417. Export mediated by the nuclear export element of HDV antigenomic RNA is sensitive to leptomycin B suggesting a possible role of CRM1 in this transport pathway. A cis-acting nuclear export element is present in nucleotides 214-417 of HDV antigenomic RNA.
Dean, Caroline; van den Elzen, Peter; Tamaki, Stanley; Dunsmuir, Pamela; Bedbrook, John
1985-01-01
Twenty-six λ phage clones with homology to coding sequences of the small subunit (SSU) of ribulose 1,5-bisphosphate carboxylase have been isolated from an EMBL3 λ phage bank of Petunia (Mitchell) DNA. Restriction mapping of the phage inserts shows that the clones were obtained from five nonoverlapping regions of petunia DNA that carry seven SSU genes. Comparison of the HindIII genomic fragments of petunia DNA with the HindIII restriction fragments of the isolated phage indicates that petunia nuclear DNA encodes eight SSU genes, seven of which are present in the phage clones. Two incomplete genes, which contain only the 3′ end of an SSU gene, were also found in the phage clones. We demonstrate that the eight SSU genes of petunia can be divided into three gene families based on homology to three petunia cDNA clones. Two gene families contain single SSU genes and the third contains six genes, four of which are closely linked within petunia nuclear DNA. Images PMID:16593584
Choi, Kwang-Shik; Darby, Alistair C.; Causse, Sandrine; Kapitano, Berisha; Hall, Martin J. R.; Steen, Keith; Lutumba, Pascal; Madinga, Joules; Torr, Steve J.; Okedi, Loyce M.; Lehane, Michael J.; Donnelly, Martin J.
2011-01-01
Background The tsetse fly Glossina fuscipes s.l. is responsible for the transmission of approximately 90% of cases of human African trypanosomiasis (HAT) or sleeping sickness. Three G. fuscipes subspecies have been described, primarily based upon subtle differences in the morphology of their genitalia. Here we describe a study conducted across the range of this important vector to determine whether molecular evidence generated from nuclear DNA (microsatellites and gene sequence information), mitochondrial DNA and symbiont DNA support the existence of these taxa as discrete taxonomic units. Principal Findings The nuclear ribosomal Internal transcribed spacer 1 (ITS1) provided support for the three subspecies. However nuclear and mitochondrial sequence data did not support the monophyly of the morphological subspecies G. f. fuscipes or G. f. quanzensis. Instead, the most strongly supported monophyletic group was comprised of flies sampled from Ethiopia. Maternally inherited loci (mtDNA and symbiont) also suggested monophyly of a group from Lake Victoria basin and Tanzania, but this group was not supported by nuclear loci, suggesting different histories of these markers. Microsatellite data confirmed strong structuring across the range of G. fuscipes s.l., and was useful for deriving the interrelationship of closely related populations. Conclusion/Significance We propose that the morphological classification alone is not used to classify populations of G. fuscipes for control purposes. The Ethiopian population, which is scheduled to be the target of a sterile insect release (SIT) programme, was notably discrete. From a programmatic perspective this may be both positive, given that it may reflect limited migration into the area or negative if the high levels of differentiation are also reflected in reproductive isolation between this population and the flies to be used in the release programme. PMID:21858237
Françoso, Elaine; Gomes, Fernando; Arias, Maria Cristina
2016-07-01
Nuclear mitochondrial DNA insertions (NUMTs) are mitochondrial DNA sequences that have been transferred into the nucleus and are recognized by the presence of indels and stop codons. Although NUMTs have been identified in a diverse range of species, their discovery was frequently accidental. Here, our initial goal was to develop and standardize a simple method for isolating NUMTs from the nuclear genome of a single bee. Subsequently, we tested our new protocol by determining whether the indels and stop codons of the cytochrome c oxidase subunit I (COI) sequence of Melipona flavolineata are of nuclear origin. The new protocol successfully demonstrated the presence of a COI NUMT. In addition to NUMT investigations, the protocol described here will also be very useful for studying mitochondrial mutations related to diseases and for sequencing complete mitochondrial genomes with high read coverage by Next-Generation technology.
Liu, G H; Zhou, W; Nisbet, A J; Xu, M J; Zhou, D H; Zhao, G H; Wang, S K; Song, H Q; Lin, R Q; Zhu, X Q
2014-03-01
Trichuris trichiura and Trichuris suis parasitize (at the adult stage) the caeca of humans and pigs, respectively, causing trichuriasis. Despite these parasites being of human and animal health significance, causing considerable socio-economic losses globally, little is known of the molecular characteristics of T. trichiura and T. suis from China. In the present study, the entire first and second internal transcribed spacer (ITS-1 and ITS-2) regions of nuclear ribosomal DNA (rDNA) of T. trichiura and T. suis from China were amplified by polymerase chain reaction (PCR), the representative amplicons were cloned and sequenced, and sequence variation in the ITS rDNA was examined. The ITS rDNA sequences for the T. trichiura and T. suis samples were 1222-1267 bp and 1339-1353 bp in length, respectively. Sequence analysis revealed that the ITS-1, 5.8S and ITS-2 rDNAs of both whipworms were 600-627 bp and 655-661 bp, 154 bp, and 468-486 bp and 530-538 bp in size, respectively. Sequence variation in ITS rDNA within and among T. trichiura and T. suis was examined. Excluding nucleotide variations in the simple sequence repeats, the intra-species sequence variation in the ITS-1 was 0.2-1.7% within T. trichiura, and 0-1.5% within T. suis. For ITS-2 rDNA, the intra-species sequence variation was 0-1.3% within T. trichiura and 0.2-1.7% within T. suis. The inter-species sequence differences between the two whipworms were 60.7-65.3% for ITS-1 and 59.3-61.5% for ITS-2. These results demonstrated that the ITS rDNA sequences provide additional genetic markers for the characterization and differentiation of the two whipworms. These data should be useful for studying the epidemiology and population genetics of T. trichiura and T. suis, as well as for the diagnosis of trichuriasis in humans and pigs.
Amati, B; Pick, L; Laroche, T; Gasser, S M
1990-01-01
Nuclei isolated from eukaryotic cells can be depleted of histones and most soluble nuclear proteins to isolate a structural framework called the nuclear scaffold. This structure maintains specific interactions with genomic DNA at sites known as scaffold attached regions (SARs), which are thought to be the bases of DNA loops. In both Saccharomyces cerevisiae and Schizosaccharomyces pombe, genomic ARS elements are recovered as SARs. In addition, SARs from Drosophila melanogaster bind to yeast nuclear scaffolds in vitro and a subclass of these promotes autonomous replication of plasmids in yeast. In the present report, we present fine mapping studies of the Drosophila ftz SAR, which has both SAR and ARS activities in yeast. The data establish a close relationship between the sequences involved in ARS activity and scaffold binding: ARS elements that can bind the nuclear scaffold in vitro promote more efficient plasmid replication in vivo, but scaffold association is not a strict prerequisite for ARS function. Efficient interaction with nuclear scaffolds from both yeast and Drosophila requires a minimal length of SAR DNA that contains reiteration of a narrow minor groove structure of the double helix. Images Fig. 1. Fig. 2. Fig. 3. Fig. 4. PMID:2123454
Plant DNA sequences from feces: potential means for assessing diets of wild primates.
Bradley, Brenda J; Stiller, Mathias; Doran-Sheehy, Diane M; Harris, Tara; Chapman, Colin A; Vigilant, Linda; Poinar, Hendrik
2007-06-01
Analyses of plant DNA in feces provides a promising, yet largely unexplored, means of documenting the diets of elusive primates. Here we demonstrate the promise and pitfalls of this approach using DNA extracted from fecal samples of wild western gorillas (Gorilla gorilla) and black and white colobus monkeys (Colobus guereza). From these DNA extracts we amplified, cloned, and sequenced small segments of chloroplast DNA (part of the rbcL gene) and plant nuclear DNA (ITS-2). The obtained sequences were compared to sequences generated from known plant samples and to those in GenBank to identify plant taxa in the feces. With further optimization, this method could provide a basic evaluation of minimum primate dietary diversity even when knowledge of local flora is limited. This approach may find application in studies characterizing the diets of poorly-known, unhabituated primate species or assaying consumer-resource relationships in an ecosystem. (c) 2007 Wiley-Liss, Inc.
Population genetic analysis reveals ancient evolution and recent migration of P. ramorum
Erica M. Goss; Meg Larsen; Ignazio Carbone; Donald R. Givens; Gary A. Chastagner; Niklaus J. Gr& uuml; nwald
2010-01-01
Phytophthora ramorum populations in North America and Europe are comprised of three clonal lineages based on several different genetic marker systems (Ivors and others 2006, Martin 2008). Whether these lineages are ancient or a recent artifact of introduction has been unclear. We analyzed DNA sequence variation at five nuclear loci in order to...
Mahelka, Václav; Krak, Karol; Kopecký, David; Fehrer, Judith; Šafář, Jan; Bartoš, Jan; Hobza, Roman; Blavet, Nicolas; Blattner, Frank R
2017-02-14
The movement of nuclear DNA from one vascular plant species to another in the absence of fertilization is thought to be rare. Here, nonnative rRNA gene [ribosomal DNA (rDNA)] copies were identified in a set of 16 diploid barley ( Hordeum ) species; their origin was traceable via their internal transcribed spacer (ITS) sequence to five distinct Panicoideae genera, a lineage that split from the Pooideae about 60 Mya. Phylogenetic, cytogenetic, and genomic analyses implied that the nonnative sequences were acquired between 1 and 5 Mya after a series of multiple events, with the result that some current Hordeum sp. individuals harbor up to five different panicoid rDNA units in addition to the native Hordeum rDNA copies. There was no evidence that any of the nonnative rDNA units were transcribed; some showed indications of having been silenced via pseudogenization. A single copy of a Panicum sp. rDNA unit present in H. bogdanii had been interrupted by a native transposable element and was surrounded by about 70 kbp of mostly noncoding sequence of panicoid origin. The data suggest that horizontal gene transfer between vascular plants is not a rare event, that it is not necessarily restricted to one or a few genes only, and that it can be selectively neutral.
Supervised DNA Barcodes species classification: analysis, comparisons and results
2014-01-01
Background Specific fragments, coming from short portions of DNA (e.g., mitochondrial, nuclear, and plastid sequences), have been defined as DNA Barcode and can be used as markers for organisms of the main life kingdoms. Species classification with DNA Barcode sequences has been proven effective on different organisms. Indeed, specific gene regions have been identified as Barcode: COI in animals, rbcL and matK in plants, and ITS in fungi. The classification problem assigns an unknown specimen to a known species by analyzing its Barcode. This task has to be supported with reliable methods and algorithms. Methods In this work the efficacy of supervised machine learning methods to classify species with DNA Barcode sequences is shown. The Weka software suite, which includes a collection of supervised classification methods, is adopted to address the task of DNA Barcode analysis. Classifier families are tested on synthetic and empirical datasets belonging to the animal, fungus, and plant kingdoms. In particular, the function-based method Support Vector Machines (SVM), the rule-based RIPPER, the decision tree C4.5, and the Naïve Bayes method are considered. Additionally, the classification results are compared with respect to ad-hoc and well-established DNA Barcode classification methods. Results A software that converts the DNA Barcode FASTA sequences to the Weka format is released, to adapt different input formats and to allow the execution of the classification procedure. The analysis of results on synthetic and real datasets shows that SVM and Naïve Bayes outperform on average the other considered classifiers, although they do not provide a human interpretable classification model. Rule-based methods have slightly inferior classification performances, but deliver the species specific positions and nucleotide assignments. On synthetic data the supervised machine learning methods obtain superior classification performances with respect to the traditional DNA Barcode classification methods. On empirical data their classification performances are at a comparable level to the other methods. Conclusions The classification analysis shows that supervised machine learning methods are promising candidates for handling with success the DNA Barcoding species classification problem, obtaining excellent performances. To conclude, a powerful tool to perform species identification is now available to the DNA Barcoding community. PMID:24721333
Statistical physics of nucleosome positioning and chromatin structure
NASA Astrophysics Data System (ADS)
Morozov, Alexandre
2012-02-01
Genomic DNA is packaged into chromatin in eukaryotic cells. The fundamental building block of chromatin is the nucleosome, a 147 bp-long DNA molecule wrapped around the surface of a histone octamer. Arrays of nucleosomes are positioned along DNA according to their sequence preferences and folded into higher-order chromatin fibers whose structure is poorly understood. We have developed a framework for predicting sequence-specific histone-DNA interactions and the effective two-body potential responsible for ordering nucleosomes into regular higher-order structures. Our approach is based on the analogy between nucleosomal arrays and a one-dimensional fluid of finite-size particles with nearest-neighbor interactions. We derive simple rules which allow us to predict nucleosome occupancy solely from the dinucleotide content of the underlying DNA sequences.Dinucleotide content determines the degree of stiffness of the DNA polymer and thus defines its ability to bend into the nucleosomal superhelix. As expected, the nucleosome positioning rules are universal for chromatin assembled in vitro on genomic DNA from baker's yeast and from the nematode worm C.elegans, where nucleosome placement follows intrinsic sequence preferences and steric exclusion. However, the positioning rules inferred from in vivo C.elegans chromatin are affected by global nucleosome depletion from chromosome arms relative to central domains, likely caused by the attachment of the chromosome arms to the nuclear membrane. Furthermore, intrinsic nucleosome positioning rules are overwritten in transcribed regions, indicating that chromatin organization is actively managed by the transcriptional and splicing machinery.
Analysis of DNA Sequences by an Optical Time-Integrating Correlator: Proof-of-Concept Experiments.
1992-05-01
DNA ANALYSIS STRATEGY 4 2.1 Representation of DNA Bases 4 2.2 DNA Analysis Strategy 6 3.0 CUSTOM GENERATORS FOR DNA SEQUENCES 10 3.1 Hardware Design 10...of the DNA bases where each base is represented by a 7-bits long pseudorandom sequence. 5 Figure 4: Coarse analysis of a DNA sequence. 7 Figure 5: Fine...a 20-bases long database. 32 xiii LIST OF TABLES PAGE Table 1: Short representations of the DNA bases where each base is represented by 7-bits long
Enhancing magnetic nanoparticle-based DNA transfection: Intracellular-active cassette features
NASA Astrophysics Data System (ADS)
Vernon, Matthew Martin
Efficient plasmid DNA transfection of embryonic stem cells, mesenchymal stem cells, neural cell lines and the majority of primary cell lines is a current challenge in gene therapy research. Magnetic nanoparticle-based DNA transfection is a gene vectoring technique that is promising because it is capable of outperforming most other non-viral transfection methods in terms of both transfection efficiency and cell viability. The nature of the DNA vector implemented depends on the target cell phenotype, where the particle surface chemistry and DNA binding/unbinding kinetics of the DNA carrier molecule play a critical role in the many steps required for successful gene transfection. Accordingly, Neuromag, an iron oxide/polymer nanoparticle optimized for transfection of neural phenotypes, outperforms many other nanoparticles and lipidbased DNA carriers. Up to now, improvements to nanomagnetic transfection techniques have focused mostly on particle functionalization and transfection parameter optimization (cell confluence, growth media, serum starvation, magnet oscillation parameters, etc.). None of these parameters are capable of assisting the nuclear translocation of delivered plasmid DNA once the particle-DNA complex is released from the endosome and dissociates in the cell's cytoplasm. In this study, incorporation of a DNA targeting sequence (DTS) feature in the transfecting plasmid DNA confers improved nuclear translocation, demonstrating significant improvement in nanomagnetic transfection efficiency in differentiated SH-SY5Y neuroblastoma cells. Other parameters, such as days in vitro, are also found to play a role and represent potential targets for further optimization.
Joint Estimation of Contamination, Error and Demography for Nuclear DNA from Ancient Humans
Slatkin, Montgomery
2016-01-01
When sequencing an ancient DNA sample from a hominin fossil, DNA from present-day humans involved in excavation and extraction will be sequenced along with the endogenous material. This type of contamination is problematic for downstream analyses as it will introduce a bias towards the population of the contaminating individual(s). Quantifying the extent of contamination is a crucial step as it allows researchers to account for possible biases that may arise in downstream genetic analyses. Here, we present an MCMC algorithm to co-estimate the contamination rate, sequencing error rate and demographic parameters—including drift times and admixture rates—for an ancient nuclear genome obtained from human remains, when the putative contaminating DNA comes from present-day humans. We assume we have a large panel representing the putative contaminant population (e.g. European, East Asian or African). The method is implemented in a C++ program called ‘Demographic Inference with Contamination and Error’ (DICE). We applied it to simulations and genome data from ancient Neanderthals and modern humans. With reasonable levels of genome sequence coverage (>3X), we find we can recover accurate estimates of all these parameters, even when the contamination rate is as high as 50%. PMID:27049965
Evaluation and comparison of FTA card and CTAB DNA extraction methods for non-agricultural taxa.
Siegel, Chloe S; Stevenson, Florence O; Zimmer, Elizabeth A
2017-02-01
An efficient, effective DNA extraction method is necessary for comprehensive analysis of plant genomes. This study analyzed the quality of DNA obtained using paper FTA cards prepared directly in the field when compared to the more traditional cetyltrimethylammonium bromide (CTAB)-based extraction methods from silica-dried samples. DNA was extracted using FTA cards according to the manufacturer's protocol. In parallel, CTAB-based extractions were done using the automated AutoGen DNA isolation system. DNA quality for both methods was determined for 15 non-agricultural species collected in situ, by gel separation, spectrophotometry, fluorometry, and successful amplification and sequencing of nuclear and chloroplast gene markers. The FTA card extraction method yielded less concentrated, but also less fragmented samples than the CTAB-based technique. The card-extracted samples provided DNA that could be successfully amplified and sequenced. The FTA cards are also useful because the collected samples do not require refrigeration, extensive laboratory expertise, or as many hazardous chemicals as extractions using the CTAB-based technique. The relative success of the FTA card method in our study suggested that this method could be a valuable tool for studies in plant population genetics and conservation biology that may involve screening of hundreds of individual plants. The FTA cards, like the silica gel samples, do not contain plant material capable of propagation, and therefore do not require permits from the U.S. Department of Agriculture (USDA) Animal and Plant Health Inspection Service (APHIS) for transportation.
Acevedo-Rosas, Raúl; Cameron, Kenneth; Sosa, Victoria; Pell, Susan
2004-07-01
Nuclear ETS and ITS, as well as plastid rpl16 and trnL-F DNA sequences were used to determine relationships among species of Graptopetalum (Crassulaceae) and closely related genera. Graptopetalum is member of a group of taxa restricted to North America, one of the centers of diversity of Crassulaceae; however, their phylogenetic relationships are not yet understood. Nineteen species of Graptopetalum and 24 species from nine other genera of Crassulaceae were sampled for use in three separate parsimony analyses: ITS alone, ETS alone, and a combined nuclear + plastid DNA analysis using all four gene regions. The ETS data set had the highest number of parsimony-informative sites, about 30% more than in ITS, but the most fully resolved tree resulted when the four DNA regions were combined. Only four subclades of the tree received moderate to strong bootstrap support, one of which includes all species of Graptopetalum having a single whorl of stamens. However, Graptopetalum is not monophyletic. Instead, Tacitus bellus and select species of Cremnophila, Sedum, and Echeveria are interspersed among species of Graptopetalum and show evidence of grouping according to geographical range of distribution more so than habit or floral morphology.
Phylogeny and Divergence Times of Gymnosperms Inferred from Single-Copy Nuclear Genes
Guo, Dong-Mei; Yang, Zu-Yu; Wang, Xiao-Quan
2014-01-01
Phylogenetic reconstruction is fundamental to study evolutionary biology and historical biogeography. However, there was not a molecular phylogeny of gymnosperms represented by extensive sampling at the genus level, and most published phylogenies of this group were constructed based on cytoplasmic DNA markers and/or the multi-copy nuclear ribosomal DNA. In this study, we use LFY and NLY, two single-copy nuclear genes that originated from an ancient gene duplication in the ancestor of seed plants, to reconstruct the phylogeny and estimate divergence times of gymnosperms based on a complete sampling of extant genera. The results indicate that the combined LFY and NLY coding sequences can resolve interfamilial relationships of gymnosperms and intergeneric relationships of most families. Moreover, the addition of intron sequences can improve the resolution in Podocarpaceae but not in cycads, although divergence times of the cycad genera are similar to or longer than those of the Podocarpaceae genera. Our study strongly supports cycads as the basal-most lineage of gymnosperms rather than sister to Ginkgoaceae, and a sister relationship between Podocarpaceae and Araucariaceae and between Cephalotaxaceae-Taxaceae and Cupressaceae. In addition, intergeneric relationships of some families that were controversial, and the relationships between Taxaceae and Cephalotaxaceae and between conifers and Gnetales are discussed based on the nuclear gene evidence. The molecular dating analysis suggests that drastic extinctions occurred in the early evolution of gymnosperms, and extant coniferous genera in the Northern Hemisphere are older than those in the Southern Hemisphere on average. This study provides an evolutionary framework for future studies on gymnosperms. PMID:25222863
Organization and evolution of highly repeated satellite DNA sequences in plant chromosomes.
Sharma, S; Raina, S N
2005-01-01
A major component of the plant nuclear genome is constituted by different classes of repetitive DNA sequences. The structural, functional and evolutionary aspects of the satellite repetitive DNA families, and their organization in the chromosomes is reviewed. The tandem satellite DNA sequences exhibit characteristic chromosomal locations, usually at subtelomeric and centromeric regions. The repetitive DNA family(ies) may be widely distributed in a taxonomic family or a genus, or may be specific for a species, genome or even a chromosome. They may acquire large-scale variations in their sequence and copy number over an evolutionary time-scale. These features have formed the basis of extensive utilization of repetitive sequences for taxonomic and phylogenetic studies. Hybrid polyploids have especially proven to be excellent models for studying the evolution of repetitive DNA sequences. Recent studies explicitly show that some repetitive DNA families localized at the telomeres and centromeres have acquired important structural and functional significance. The repetitive elements are under different evolutionary constraints as compared to the genes. Satellite DNA families are thought to arise de novo as a consequence of molecular mechanisms such as unequal crossing over, rolling circle amplification, replication slippage and mutation that constitute "molecular drive". Copyright 2005 S. Karger AG, Basel.
Kim, Min Jee; Choi, Sei-Woong; Kim, Iksoo
2015-04-10
Saturnia (Rinaca) jonasii Butler, 1877 is distributed in Japan, including Tsushima Island and Taiwan, whereas S. boisduvalii Eversmann, 1846 is distributed in northern areas, such as China, Russia, and South Korea. In the present study we found that the specimens from Mt. Hallasan on Jejudo, a southern remote offshore island, were S. jonasii, rather than S. boisduvalii based on morphology, DNA barcode, and nuclear elongation factor 1 alpha (EF-1α) sequences. The major morphological differences between the two species included the shape of wing pattern elements of fore- and hindwings and male and female genitalia. A DNA barcode analysis of the sequences of the Jejudo specimens and S. boisduvalii, along with those of Saturnia species obtained from a public database showed a minimum sequence divergence of 4.26% (28 bp). A phylogenetic analysis also showed clustering of the Jejudo specimens with S. jonasii, separating S. boisduvalii (Bayesian posterior probability = 0.99). The EF-1α-based sequence and phylogenetic analyses of the two species from Jejudo Island and the Korean mainland showed the uniqueness of the Jejudo specimens from S. boisduvalii collected on the Korean mainland, indicating distribution of S. jonasii on Jejudo Island in South Korea, instead of S. boisduvalii.
Hopton, Suzanne R; Thompson, Andrew S
2011-05-17
Previous structural studies of the cyclopropapyrroloindole (CPI) antitumor antibiotics have shown that these ligands bind covalently edge-on into the minor groove of double-stranded DNA. Reversible covalent modification of the DNA via N3 of adenine occurs in a sequence-specific fashion. Early nuclear magnetic resonance and molecular modeling studies with both mono- and bis-alkylating ligands indicated that the ligands fit tightly within the minor groove, causing little distortion of the helix. In this study, we propose a new binding model for several of the CPI-based analogues, in which the aromatic secondary rings form π-stacked complexes within the minor groove. One of the adducts, formed with adozelesin and the d(ATTAAT)(2) sequence, also demonstrates the ability of these ligands to manipulate the DNA of the binding site, resulting in a Hoogsteen base-paired adduct. Although this type of base pairing has been previously observed with the bisfunctional CPI analogue bizelesin, this is the first time that such an observation has been made with a monoalkylating nondimeric analogue. Together, these results provide a new model for the design of CPI-based antitumor antibiotics, which also has a significant bearing on other structurally related and structurally unrelated minor groove-binding ligands. They indicate the dynamic nature of ligand-DNA interactions, demonstrating both DNA conformational flexibility and the ability of two DNA-bound ligands to interact to form stable covalent modified complexes.
Phylogenomics and taxonomy of Lecomtelleae (Poaceae), an isolated panicoid lineage from Madagascar
Besnard, Guillaume; Christin, Pascal-Antoine; Malé, Pierre-Jean G.; Coissac, Eric; Ralimanana, Hélène; Vorontsova, Maria S.
2013-01-01
Background and Aims An accurate characterization of biodiversity requires analyses of DNA sequences in addition to classical morphological descriptions. New methods based on high-throughput sequencing may allow investigation of specimens with a large set of genetic markers to infer their evolutionary history. In the grass family, the phylogenetic position of the monotypic genus Lecomtella, a rare bamboo-like endemic from Madagascar, has never been appropriately evaluated. Until now its taxonomic treatment has remained controversial, indicating the need for re-evaluation based on a combination of molecular and morphological data. Methods The phylogenetic position of Lecomtella in Poaceae was evaluated based on sequences from the nuclear and plastid genomes generated by next-generation sequencing (NGS). In addition, a detailed morphological description of L. madagascariensis was produced, and its distribution and habit were investigated in order to assess its conservation status. Key Results The complete plastid sequence, a ribosomal DNA unit and fragments of low-copy nuclear genes (phyB and ppc) were obtained. All phylogenetic analyses place Lecomtella as an isolated member of the core panicoids, which last shared a common ancestor with other species >20 million years ago. Although Lecomtella exhibits morphological characters typical of Panicoideae, an unusual combination of traits supports its treatment as a separate group. Conclusions The study showed that NGS can be used to generate abundant phylogenetic information rapidly, opening new avenues for grass phylogenetics. These data clearly showed that Lecomtella forms an isolated lineage, which, in combination with its morphological peculiarities, justifies its treatment as a separate tribe: Lecomtelleae. New descriptions of the tribe, genus and species are presented with a typification, a distribution map and an IUCN conservation assessment. PMID:23985988
Phylogenomics and taxonomy of Lecomtelleae (Poaceae), an isolated panicoid lineage from Madagascar.
Besnard, Guillaume; Christin, Pascal-Antoine; Malé, Pierre-Jean G; Coissac, Eric; Ralimanana, Hélène; Vorontsova, Maria S
2013-10-01
An accurate characterization of biodiversity requires analyses of DNA sequences in addition to classical morphological descriptions. New methods based on high-throughput sequencing may allow investigation of specimens with a large set of genetic markers to infer their evolutionary history. In the grass family, the phylogenetic position of the monotypic genus Lecomtella, a rare bamboo-like endemic from Madagascar, has never been appropriately evaluated. Until now its taxonomic treatment has remained controversial, indicating the need for re-evaluation based on a combination of molecular and morphological data. The phylogenetic position of Lecomtella in Poaceae was evaluated based on sequences from the nuclear and plastid genomes generated by next-generation sequencing (NGS). In addition, a detailed morphological description of L. madagascariensis was produced, and its distribution and habit were investigated in order to assess its conservation status. The complete plastid sequence, a ribosomal DNA unit and fragments of low-copy nuclear genes (phyB and ppc) were obtained. All phylogenetic analyses place Lecomtella as an isolated member of the core panicoids, which last shared a common ancestor with other species >20 million years ago. Although Lecomtella exhibits morphological characters typical of Panicoideae, an unusual combination of traits supports its treatment as a separate group. The study showed that NGS can be used to generate abundant phylogenetic information rapidly, opening new avenues for grass phylogenetics. These data clearly showed that Lecomtella forms an isolated lineage, which, in combination with its morphological peculiarities, justifies its treatment as a separate tribe: Lecomtelleae. New descriptions of the tribe, genus and species are presented with a typification, a distribution map and an IUCN conservation assessment.
2011-01-01
Background The melon belongs to the Cucurbitaceae family, whose economic importance among vegetable crops is second only to Solanaceae. The melon has a small genome size (454 Mb), which makes it suitable for molecular and genetic studies. Despite similar nuclear and chloroplast genome sizes, cucurbits show great variation when their mitochondrial genomes are compared. The melon possesses the largest plant mitochondrial genome, as much as eight times larger than that of other cucurbits. Results The nucleotide sequences of the melon chloroplast and mitochondrial genomes were determined. The chloroplast genome (156,017 bp) included 132 genes, with 98 single-copy genes dispersed between the small (SSC) and large (LSC) single-copy regions and 17 duplicated genes in the inverted repeat regions (IRa and IRb). A comparison of the cucumber and melon chloroplast genomes showed differences in only approximately 5% of nucleotides, mainly due to short indels and SNPs. Additionally, 2.74 Mb of mitochondrial sequence, accounting for 95% of the estimated mitochondrial genome size, were assembled into five scaffolds and four additional unscaffolded contigs. An 84% of the mitochondrial genome is contained in a single scaffold. The gene-coding region accounted for 1.7% (45,926 bp) of the total sequence, including 51 protein-coding genes, 4 conserved ORFs, 3 rRNA genes and 24 tRNA genes. Despite the differences observed in the mitochondrial genome sizes of cucurbit species, Citrullus lanatus (379 kb), Cucurbita pepo (983 kb) and Cucumis melo (2,740 kb) share 120 kb of sequence, including the predicted protein-coding regions. Nevertheless, melon contained a high number of repetitive sequences and a high content of DNA of nuclear origin, which represented 42% and 47% of the total sequence, respectively. Conclusions Whereas the size and gene organisation of chloroplast genomes are similar among the cucurbit species, mitochondrial genomes show a wide variety of sizes, with a non-conserved structure both in gene number and organisation, as well as in the features of the noncoding DNA. The transfer of nuclear DNA to the melon mitochondrial genome and the high proportion of repetitive DNA appear to explain the size of the largest mitochondrial genome reported so far. PMID:21854637
Baumann, G; Geisse, S; Sullivan, M
1991-03-01
The structurally unrelated immunosuppressive drugs cyclosporin A (Sandimmun) and FK-506 both interfere with the process of T-cell proliferation by blocking the transcription of the T-cell growth factor interleukin-2 (IL-2). Here we demonstrate that the transcriptional activation of this gene requires the binding of regulatory nuclear proteins to a promoter element with sequence similarity to the consensus binding site for NF-kappa B-related transcription factors. We present evidence that the binding by regulatory nuclear proteins to the kappa B element of the IL-2 promoter is affected negatively by cyclosporin A and FK-506 at concentrations paralleling their immunosuppressive activity in vivo. The decrease in DNA-protein complex formation induced by the immunosuppressive drugs correlates with a decrease in IL-2 production. FK-506 is 10 to 100 times more potent than cyclosporin A in its ability to inhibit sequence-specific DNA binding and IL-2 production. Our findings suggest that the actions of both drugs converge at the level of DNA-protein interaction.
Fungal Endophyte Diversity in Sarracenia
Glenn, Anthony; Bodri, Michael S.
2012-01-01
Fungal endophytes were isolated from 4 species of the carnivorous pitcher plant genus Sarracenia: S. minor, S. oreophila, S. purpurea, and S. psittacina. Twelve taxa of fungi, 8 within the Ascomycota and 4 within the Basidiomycota, were identified based on PCR amplification and sequencing of the internal transcribed spacer sequences of nuclear ribosomal DNA (ITS rDNA) with taxonomic identity assigned using the NCBI nucleotide megablast search tool. Endophytes are known to produce a large number of metabolites, some of which may contribute to the protection and survival of the host. We speculate that endophyte-infected Sarracenia may benefit from their fungal associates by their influence on nutrient availability from within pitchers and, possibly, by directly influencing the biota within pitchers. PMID:22427921
Porter, Teresita M.; Golding, G. Brian
2012-01-01
Nuclear large subunit ribosomal DNA is widely used in fungal phylogenetics and to an increasing extent also amplicon-based environmental sequencing. The relatively short reads produced by next-generation sequencing, however, makes primer choice and sequence error important variables for obtaining accurate taxonomic classifications. In this simulation study we tested the performance of three classification methods: 1) a similarity-based method (BLAST + Metagenomic Analyzer, MEGAN); 2) a composition-based method (Ribosomal Database Project naïve Bayesian classifier, NBC); and, 3) a phylogeny-based method (Statistical Assignment Package, SAP). We also tested the effects of sequence length, primer choice, and sequence error on classification accuracy and perceived community composition. Using a leave-one-out cross validation approach, results for classifications to the genus rank were as follows: BLAST + MEGAN had the lowest error rate and was particularly robust to sequence error; SAP accuracy was highest when long LSU query sequences were classified; and, NBC runs significantly faster than the other tested methods. All methods performed poorly with the shortest 50–100 bp sequences. Increasing simulated sequence error reduced classification accuracy. Community shifts were detected due to sequence error and primer selection even though there was no change in the underlying community composition. Short read datasets from individual primers, as well as pooled datasets, appear to only approximate the true community composition. We hope this work informs investigators of some of the factors that affect the quality and interpretation of their environmental gene surveys. PMID:22558215
Gillespie, J J; Johnston, J S; Cannone, J J; Gutell, R R
2006-01-01
As an accompanying manuscript to the release of the honey bee genome, we report the entire sequence of the nuclear (18S, 5.8S, 28S and 5S) and mitochondrial (12S and 16S) ribosomal RNA (rRNA)-encoding gene sequences (rDNA) and related internally and externally transcribed spacer regions of Apis mellifera (Insecta: Hymenoptera: Apocrita). Additionally, we predict secondary structures for the mature rRNA molecules based on comparative sequence analyses with other arthropod taxa and reference to recently published crystal structures of the ribosome. In general, the structures of honey bee rRNAs are in agreement with previously predicted rRNA models from other arthropods in core regions of the rRNA, with little additional expansion in non-conserved regions. Our multiple sequence alignments are made available on several public databases and provide a preliminary establishment of a global structural model of all rRNAs from the insects. Additionally, we provide conserved stretches of sequences flanking the rDNA cistrons that comprise the externally transcribed spacer regions (ETS) and part of the intergenic spacer region (IGS), including several repetitive motifs. Finally, we report the occurrence of retrotransposition in the nuclear large subunit rDNA, as R2 elements are present in the usual insertion points found in other arthropods. Interestingly, functional R1 elements usually present in the genomes of insects were not detected in the honey bee rRNA genes. The reverse transcriptase products of the R2 elements are deduced from their putative open reading frames and structurally aligned with those from another hymenopteran insect, the jewel wasp Nasonia (Pteromalidae). Stretches of conserved amino acids shared between Apis and Nasonia are illustrated and serve as potential sites for primer design, as target amplicons within these R2 elements may serve as novel phylogenetic markers for Hymenoptera. Given the impending completion of the sequencing of the Nasonia genome, we expect our report eventually to shed light on the evolution of the hymenopteran genome within higher insects, particularly regarding the relative maintenance of conserved rDNA genes, related variable spacer regions and retrotransposable elements. PMID:17069639
Appleyard, Greg D; Forsyth, George W; Kiehlbauch, Laura M; Sigfrid, Kristen N; Hanik, Heather L J; Quon, Anita; Loewen, Matthew E; Grahn, Bruce H
2006-05-01
To investigate the molecular basis of inherited retinal dysplasia in miniature Schnauzers. Retina and retinal pigment epithelial tissues were collected from canine subjects at the age of 3 weeks. Total RNA isolated from these tissues was reverse transcribed to make representative cDNA pools that were compared for differences in gene expression by using a subtractive hybridization technique referred to as representational difference analysis (RDA). Expression differences identified by RDA were confirmed and quantified by real-time reverse-transcription PCR. Mitochondrial morphology from leukocytes and skeletal muscle of normal and affected miniature Schnauzers was examined by transmission electron microscopy. RDA screening of retinal pigment epithelial cDNA identified differences in mRNA transcript coding for two mitochondrial (mt) proteins--cytochrome oxidase subunit 1 and NADH dehydrogenase subunit 6--in affected dogs. Contrary to expectations, these identified sequences did not contain mutations. Based on the implication of mt-DNA-encoded proteins by the RDA experiments we used real-time PCR to compare the relative amounts of mt-DNA template in white blood cells from normal and affected dogs. White blood cells of affected dogs contained less than 30% of the normal amount of two specific mtDNA sequences, compared with the content of the nuclear-encoded glyceraldehyde-3-phosphate dehydrogenase (GA-3-PDH) reference gene. Retina and RPE tissue from affected dogs had reduced mRNA transcript levels for the two mitochondrial genes detected in the RDA experiment. Transcript levels for another mtDNA-encoded gene as well as the nuclear-encoded mitochondrial Tfam transcription factor were reduced in these tissues in affected dogs. Mitochondria from affected dogs were reduced in number and size and were unusually electron dense. Reduced levels of nuclear and mitochondrial transcripts in the retina and RPE of miniature Schnauzers affected with retinal dysplasia suggest that the pathogenesis of the disorder may arise from a lowered energy supply to the retina and RPE.
IN SITU DEMONSTRATION OF DNA HYBRIDIZING WITH CHROMOSOMAL AND NUCLEAR SAP RNA IN CHIRONOMUS TENTANS
Lambert, B.; Wieslander, L.; Daneholt, B.; Egyházi, E.; Ringborg, U.
1972-01-01
Cytological hybridization combined with microdissection of Chironomus tentans salivary gland cells was used to locate DNA complementary to newly synthesized RNA from chromosomes and nuclear sap and from a single chromosomal puff, the Balbiani ring 2 (BR 2). Salivary glands were incubated with tritiated nucleosides. The labeled RNA was extracted from microdissected nuclei and hybridized to denatured squash preparations of salivary gland cells under conditions which primarily allow repeated sequences to interact. The bound RNA, resistant to ribonuclease treatment, was detected radioautographically. It was found that BR 2 RNA hybridizes specifically with the BR 2 region of chromosome IV. Nuclear sap RNA was fractionated into high and low molecular-weight RNA; the former hybridizes with the BR 2 region of chromosome IV, the latter in a diffuse distribution over the whole chromosome set. RNA from chromosome I hybridizes diffusely with all chromosomes. Nucleolar RNA hybridizes specifically with the nucleolar organizers, contained in chromosomes II and III. It is concluded that the BR 2 region of chromosome IV contains repeated DNA sequences and that nuclear sap contains BR 2 RNA. PMID:5025107
Kolleck, Jakob; Yang, Mouyu; Zinner, Dietmar; Roos, Christian
2013-01-01
To evaluate the conservation status of a species or population it is necessary to gain insight into its ecological requirements, reproduction, genetic population structure, and overall genetic diversity. In our study we examined the genetic diversity of Rhinopithecus brelichi by analyzing microsatellite data and compared them with already existing data derived from mitochondrial DNA, which revealed that R. brelichi exhibits the lowest mitochondrial diversity of all so far studied Rhinopithecus species. In contrast, the genetic diversity of nuclear DNA is high and comparable to other Rhinopithecus species, i.e. the examined microsatellite loci are similarly highly polymorphic as in other species of the genus. An explanation for these differences in mitochondrial and nuclear genetic diversity could be a male biased dispersal. Females most likely stay within their natal band and males migrate between bands, thus mitochondrial DNA will not be exchanged between bands but nuclear DNA via males. A Bayesian Skyline Plot based on mitochondrial DNA sequences shows a strong decrease of the female effective population size (Nef) starting about 3,500 to 4,000 years ago, which concurs with the increasing human population in the area and respective expansion of agriculture. Given that we found no indication for a loss of nuclear DNA diversity in R. brelichi it seems that this factor does not represent the most prominent conservation threat for the long-term survival of the species. Conservation efforts should therefore focus more on immediate threats such as development of tourism and habitat destruction. PMID:24009761
Der Sarkissian, Clio; Allentoft, Morten E.; Ávila-Arcos, María C.; Barnett, Ross; Campos, Paula F.; Cappellini, Enrico; Ermini, Luca; Fernández, Ruth; da Fonseca, Rute; Ginolhac, Aurélien; Hansen, Anders J.; Jónsson, Hákon; Korneliussen, Thorfinn; Margaryan, Ashot; Martin, Michael D.; Moreno-Mayar, J. Víctor; Raghavan, Maanasa; Rasmussen, Morten; Velasco, Marcela Sandoval; Schroeder, Hannes; Schubert, Mikkel; Seguin-Orlando, Andaine; Wales, Nathan; Gilbert, M. Thomas P.; Willerslev, Eske; Orlando, Ludovic
2015-01-01
The past decade has witnessed a revolution in ancient DNA (aDNA) research. Although the field's focus was previously limited to mitochondrial DNA and a few nuclear markers, whole genome sequences from the deep past can now be retrieved. This breakthrough is tightly connected to the massive sequence throughput of next generation sequencing platforms and the ability to target short and degraded DNA molecules. Many ancient specimens previously unsuitable for DNA analyses because of extensive degradation can now successfully be used as source materials. Additionally, the analytical power obtained by increasing the number of sequence reads to billions effectively means that contamination issues that have haunted aDNA research for decades, particularly in human studies, can now be efficiently and confidently quantified. At present, whole genomes have been sequenced from ancient anatomically modern humans, archaic hominins, ancient pathogens and megafaunal species. Those have revealed important functional and phenotypic information, as well as unexpected adaptation, migration and admixture patterns. As such, the field of aDNA has entered the new era of genomics and has provided valuable information when testing specific hypotheses related to the past. PMID:25487338
Baculovirus LEF-11 nuclear localization signal is important for viral DNA replication.
Chen, Tingting; Dong, Zhanqi; Hu, Nan; Hu, Zhigang; Dong, Feifan; Jiang, Yaming; Li, Jun; Chen, Peng; Lu, Cheng; Pan, Minhui
2017-06-15
Baculovirus LEF-11 is a small nuclear protein that is involved in viral late gene transcription and DNA replication. However, the characteristics of its nuclear localization signal and its impact on viral DNA replication are unknown. In the present study, systemic bioinformatics analysis showed that the baculovirus LEF-11 contains monopartite and bipartite classical nuclear localization signal sequences (cNLSs), which were also detected in a few alphabaculovirus species. Localization of representative LEF-11 proteins of four baculovirus genera indicated that the nuclear localization characteristics of baculovirus LEF-11 coincided with the predicted results. Moreover, Bombyx mori nucleopolyhedrovirus (BmNPV) LEF-11 could be transported into the nucleus during viral infection in the absence of a cNLSs. Further investigations demonstrated that the NLS of BmNPV LEF-11 is important for viral DNA replication. The findings of the present study indicate that the characteristics of the baculovirus LEF-11 protein and the NLS is essential to virus DNA replication and nuclear transport mechanisms. Copyright © 2017 Elsevier B.V. All rights reserved.
Caramelli, David; Milani, Lucio; Vai, Stefania; Modi, Alessandra; Pecchioli, Elena; Girardi, Matteo; Pilli, Elena; Lari, Martina; Lippi, Barbara; Ronchitelli, Annamaria; Mallegni, Francesco; Casoli, Antonella; Bertorelle, Giorgio; Barbujani, Guido
2008-01-01
Background DNA sequences from ancient speciments may in fact result from undetected contamination of the ancient specimens by modern DNA, and the problem is particularly challenging in studies of human fossils. Doubts on the authenticity of the available sequences have so far hampered genetic comparisons between anatomically archaic (Neandertal) and early modern (Cro-Magnoid) Europeans. Methodology/Principal Findings We typed the mitochondrial DNA (mtDNA) hypervariable region I in a 28,000 years old Cro-Magnoid individual from the Paglicci cave, in Italy (Paglicci 23) and in all the people who had contact with the sample since its discovery in 2003. The Paglicci 23 sequence, determined through the analysis of 152 clones, is the Cambridge reference sequence, and cannot possibly reflect contamination because it differs from all potentially contaminating modern sequences. Conclusions/Significance: The Paglicci 23 individual carried a mtDNA sequence that is still common in Europe, and which radically differs from those of the almost contemporary Neandertals, demonstrating a genealogical continuity across 28,000 years, from Cro-Magnoid to modern Europeans. Because all potential sources of modern DNA contamination are known, the Paglicci 23 sample will offer a unique opportunity to get insight for the first time into the nuclear genes of early modern Europeans. PMID:18628960
Zhang, Lu; Cai, You-Ming; Zhuge, Qiang; Zou, Hui-Yu; Huang, Min-Ren
2002-06-01
Xinjiang is a center of distribution and differentiation of genus Dianthus in China, and has a great deal of species resources. The sequences of ITS region (including ITS-1, 5.8S rDNA and ITS-2) of nuclear ribosomal DNA from 8 species of genus Dianthus wildly distributed in Xinjiang were determined by direct sequencing of PCR products. The result showed that the size of the ITS of Dianthus is from 617 to 621 bp, and the length variation is only 4 bp. There are very high homogeneous (97.6%-99.8%) sequences between species, and about 80% homogeneous sequences between genus Dianthus and outgroup. The sequences of ITS in genus Dianthus are relatively conservative. In general, there are more conversion than transition in the variation sites among genus Dianthus. The conversion rates are relatively high, and the ratios of conversion/transition are 1.0-3.0. On the basis of phylogenetic analysis of nucleotide sequences the species of Dianthus in China would be divided into three sections. There is a distant relationship between sect. Barbulatum Williams and sect. Dianthus and between sect. Barbulatum Williams and sect. Fimbriatum Williams, and there is a close relationship between sect. Dianthus and sect. Fimbriatum Williams. From the phylogenetic tree of ITS it was found that the origin of sect. Dianthusis is earlier than that of sect. Fimbriatum Williams and sect. Barbulatum Williams.
Mitochondrial DNA repairs double-strand breaks in yeast chromosomes.
Ricchetti, M; Fairhead, C; Dujon, B
1999-11-04
The endosymbiotic theory for the origin of eukaryotic cells proposes that genetic information can be transferred from mitochondria to the nucleus of a cell, and genes that are probably of mitochondrial origin have been found in nuclear chromosomes. Occasionally, short or rearranged sequences homologous to mitochondrial DNA are seen in the chromosomes of different organisms including yeast, plants and humans. Here we report a mechanism by which fragments of mitochondrial DNA, in single or tandem array, are transferred to yeast chromosomes under natural conditions during the repair of double-strand breaks in haploid mitotic cells. These repair insertions originate from noncontiguous regions of the mitochondrial genome. Our analysis of the Saccharomyces cerevisiae mitochondrial genome indicates that the yeast nuclear genome does indeed contain several short sequences of mitochondrial origin which are similar in size and composition to those that repair double-strand breaks. These sequences are located predominantly in non-coding regions of the chromosomes, frequently in the vicinity of retrotransposon long terminal repeats, and appear as recent integration events. Thus, colonization of the yeast genome by mitochondrial DNA is an ongoing process.
DNA binding of the p21 repressor ZBTB2 is inhibited by cytosine hydroxymethylation
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lafaye, Céline; Barbier, Ewa; Miscioscia, Audrey
2014-03-28
Highlights: • 5-hmC epigenetic modification is measurable in HeLa, SH-SY5Y and UT7-MPL cell lines. • ZBTB2 binds to DNA probes containing 5-mC but not to sequences containing 5-hmC. • This differential binding is verified with DNA sequences involved in p21 regulation. - Abstract: Recent studies have demonstrated that the modified base 5-hydroxymethylcytosine (5-hmC) is detectable at various rates in DNA extracted from human tissues. This oxidative product of 5-methylcytosine (5-mC) constitutes a new and important actor of epigenetic mechanisms. We designed a DNA pull down assay to trap and identify nuclear proteins bound to 5-hmC and/or 5-mC. We applied thismore » strategy to three cancerous cell lines (HeLa, SH-SY5Y and UT7-MPL) in which we also measured 5-mC and 5-hmC levels by HPLC-MS/MS. We found that the putative oncoprotein Zinc finger and BTB domain-containing protein 2 (ZBTB2) is associated with methylated DNA sequences and that this interaction is inhibited by the presence of 5-hmC replacing 5-mC. As published data mention ZBTB2 recognition of p21 regulating sequences, we verified that this sequence specific binding was also alleviated by 5-hmC. ZBTB2 being considered as a multifunctional cell proliferation activator, notably through p21 repression, this work points out new epigenetic processes potentially involved in carcinogenesis.« less
Specific minor groove solvation is a crucial determinant of DNA binding site recognition
Harris, Lydia-Ann; Williams, Loren Dean; Koudelka, Gerald B.
2014-01-01
The DNA sequence preferences of nearly all sequence specific DNA binding proteins are influenced by the identities of bases that are not directly contacted by protein. Discrimination between non-contacted base sequences is commonly based on the differential abilities of DNA sequences to allow narrowing of the DNA minor groove. However, the factors that govern the propensity of minor groove narrowing are not completely understood. Here we show that the differential abilities of various DNA sequences to support formation of a highly ordered and stable minor groove solvation network are a key determinant of non-contacted base recognition by a sequence-specific binding protein. In addition, disrupting the solvent network in the non-contacted region of the binding site alters the protein's ability to recognize contacted base sequences at positions 5–6 bases away. This observation suggests that DNA solvent interactions link contacted and non-contacted base recognition by the protein. PMID:25429976
Mitochondrial Genomics and Northwestern Atlantic Population Genetics of Marine Annelids
2005-09-01
surfclams , Spisula solidissima, in the western North Atlantic based on mitochondrial and nuclear DNA sequences. Marine Biology, 146: 707-716. Hayden BP...Science 1930 and Engineering DOCTORAL DISSERTATION Mitochondrial Genomics and Northwestern Atlantic Population Genetics of Marine Annelids by Robert M...Jennings September 2005 MITIWHOI 2005-15 Mitochondrial Genomics and Northwestern Atlantic Population Genetics of Marine Annelids by Robert M. Jennings
Structure of the highly repeated, long interspersed DNA family (LINE or L1Rn) of the rat.
D'Ambrosio, E; Waitzkin, S D; Witney, F R; Salemme, A; Furano, A V
1986-01-01
We present the DNA sequence of a 6.7-kilobase member of the rat long interspersed repeated DNA family (LINE or L1Rn). This member (LINE 3) is flanked by a perfect 14-base-pair (bp) direct repeat and is a full-length, or close-to-full-length, member of this family. LINE 3 contains an approximately 100-bp A-rich right end, a number of long (greater than 400-bp) open reading frames, and a ca. 200-bp G + C-rich (ca. 60%) cluster near each terminus. Comparison of the LINE 3 sequence with the sequence of about one-half of another member, which we also present, as well as restriction enzyme analysis of the genomic copies of this family, indicates that in length and overall structure LINE 3 is quite typical of the 40,000 or so other genomic members of this family which would account for as much as 10% of the rat genome. Therefore, the rat LINE family is relatively homogeneous, which contrasts with the heterogeneous LINE families in primates and mice. Transcripts corresponding to the entire LINE sequence are abundant in the nuclear RNA of rat liver. The characteristics of the rat LINE family are discussed with respect to the possible function and evolution of this family of DNA sequences. Images PMID:3023845
Mohanta, Uday Kumar; Ichikawa-Seki, Madoka; Shoriki, Takuya; Katakura, Ken; Itagaki, Tadashi
2014-07-01
This study aimed to precisely discriminate Fasciola spp. based on DNA sequences of nuclear internal transcribed spacer 1 (ITS1) and mitochondrial nicotinamide adenine dinucleotide (NADH) dehydrogenase subunit 1 (nad1) gene. We collected 150 adult flukes from the bile ducts of cattle, buffaloes, sheep, and goats from six different regions of Bangladesh. Spermatogenic status was determined by analyzing stained seminal vesicles. The ITS1 types were analyzed using the polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) method. The nad1 haplotypes were identified based on PCR and direct sequencing and analyzed phylogenetically by comparing with nad1 haplotypes of Fasciola spp. from other Asian countries. Of the 127 aspermic flukes, 98 were identified as Fg type in ITS1, whereas 29 were identified as Fh/Fg type, indicating a combination of ITS1 sequences of Fasciola hepatica and Fasciola gigantica. All the 127 aspermic flukes showed Fsp-NDI-Bd11 in nad1 haplotype with nucleotide sequences identical to aspermic Fasciola sp. from Asian countries. Further, 20 spermic flukes were identified as F. gigantica based on their spermatogenic status and Fg type in ITS1. F. gigantica population was thought to be introduced into Bangladesh considerably earlier than the aspermic Fasciola sp. because 11 haplotypes with high haplotype diversity were detected from the F. gigantica population. However, three flukes from Bangladesh could not be precisely identified, because their spermatogenic status, ITS1 types, and nad1 haplotypes were ambiguous. Therefore, developing a robust method to distinguish aspermic Fasciola sp. from other Fasciola species is necessary in the future.
Liu, Xingfen; Ouyang, Lan; Cai, Xiaohui; Huang, Yanqin; Feng, Xiaomiao; Fan, Quli; Huang, Wei
2013-03-15
Sensitive, reliable, and simple detection of sequence-specific DNA-binding proteins (DBP) is of paramount importance in the area of proteomics, genomics, and biomedicine. We describe herein a novel fluorescent-amplified strategy for ultrasensitive, visual, quantitative, and "turn-on" detection of DBP. A Förster resonance energy transfer (FRET) assay utilizing a cationic conjugated polymer (CCP) and an intercalating dye was designed to detect a key transcription factor, nuclear factor-kappa B (NF-κB), the model target. A series of label-free DNA probes bearing one or two protein-binding sites (PBS) were used to identify the target protein specifically. The binding DBP protects the probe from digestion by exonuclease III, resulting in high efficient FRET due to the high affinity between the intercalating dye and duplex DNA, as well as strong electrostatic interactions between the CCP and DNA probe. By using label-free hairpin DNA or double-stranded DNA containing two PBS as probe, we could detect as low as 1 pg/μL of NF-κB in HeLa nuclear extracts, which is 10000-fold more sensitive than the previously reported methods. The approach also allows naked-eye detection by observing fluorescent color of solutions with the assistance of a hand-held UV lamp. Additionally, a less than 10% relative standard deviation was obtained, which offers a new platform for superior precision, low-cost, and simple detection of DBP. The features of our optical biosensor shows promising potential for early diagnosis of many diseases and high-throughput screening of new drugs targeted to DNA-binding proteins. Copyright © 2012 Elsevier B.V. All rights reserved.
Targeted exome sequencing of suspected mitochondrial disorders
Lieber, Daniel S.; Calvo, Sarah E.; Shanahan, Kristy; Slate, Nancy G.; Liu, Shangtao; Hershman, Steven G.; Gold, Nina B.; Chapman, Brad A.; Thorburn, David R.; Berry, Gerard T.; Schmahmann, Jeremy D.; Borowsky, Mark L.; Mueller, David M.; Sims, Katherine B.
2013-01-01
Objective: To evaluate the utility of targeted exome sequencing for the molecular diagnosis of mitochondrial disorders, which exhibit marked phenotypic and genetic heterogeneity. Methods: We considered a diverse set of 102 patients with suspected mitochondrial disorders based on clinical, biochemical, and/or molecular findings, and whose disease ranged from mild to severe, with varying age at onset. We sequenced the mitochondrial genome (mtDNA) and the exons of 1,598 nuclear-encoded genes implicated in mitochondrial biology, mitochondrial disease, or monogenic disorders with phenotypic overlap. We prioritized variants likely to underlie disease and established molecular diagnoses in accordance with current clinical genetic guidelines. Results: Targeted exome sequencing yielded molecular diagnoses in established disease loci in 22% of cases, including 17 of 18 (94%) with prior molecular diagnoses and 5 of 84 (6%) without. The 5 new diagnoses implicated 2 genes associated with canonical mitochondrial disorders (NDUFV1, POLG2), and 3 genes known to underlie other neurologic disorders (DPYD, KARS, WFS1), underscoring the phenotypic and biochemical overlap with other inborn errors. We prioritized variants in an additional 26 patients, including recessive, X-linked, and mtDNA variants that were enriched 2-fold over background and await further support of pathogenicity. In one case, we modeled patient mutations in yeast to provide evidence that recessive mutations in ATP5A1 can underlie combined respiratory chain deficiency. Conclusion: The results demonstrate that targeted exome sequencing is an effective alternative to the sequential testing of mtDNA and individual nuclear genes as part of the investigation of mitochondrial disease. Our study underscores the ongoing challenge of variant interpretation in the clinical setting. PMID:23596069
Highton, Richard; Hastings, Amy Picard; Palmer, Catherine; Watts, Richard; Hass, Carla A.; Culver, Melanie; Arnold, Stevan
2012-01-01
Salamanders of the North American plethodontid genus Plethodon are important model organisms in a variety of studies that depend on a phylogenetic framework (e.g., chemical communication, ecological competition, life histories, hybridization, and speciation), and consequently their systematics has been intensively investigated over several decades. Nevertheless, we lack a synthesis of relationships among the species. In the analyses reported here we use new DNA sequence data from the complete nuclear albumin gene (1818 bp) and the 12s mitochondrial gene (355 bp), as well as published data for four other genes (Wiens et al., 2006), up to a total of 6989 bp, to infer relationships. We relate these results to past systematic work based on morphology, allozymes, and DNA sequences. Although basal relationships show a strong consensus across studies, many terminal relationships remain in flux despite substantial sequencing and other molecular and morphological studies. This systematic instability appears to be a consequence of contemporaneous bursts of speciation in the late Miocene and Pliocene, yielding many closely related extant species in each of the four eastern species groups. Therefore we conclude that many relationships are likely to remain poorly resolved in the face of additional sequencing efforts. On the other hand, the current classification of the 45 eastern species into four species groups is supported. The Plethodon cinereus group (10 species) is the sister group to the clade comprising the other three groups, but these latter groups (Plethodon glutinosus [28 species], Plethodon welleri [5 species], and Plethodon wehrlei [2 species]) probably diverged from each other at approximately the same time.
Arrieta-Montiel, Maria P; Shedge, Vikas; Davila, Jaime; Christensen, Alan C; Mackenzie, Sally A
2009-12-01
The plant mitochondrial genome is recombinogenic, with DNA exchange activity controlled to a large extent by nuclear gene products. One nuclear gene, MSH1, appears to participate in suppressing recombination in Arabidopsis at every repeated sequence ranging in size from 108 to 556 bp. Present in a wide range of plant species, these mitochondrial repeats display evidence of successful asymmetric DNA exchange in Arabidopsis when MSH1 is disrupted. Recombination frequency appears to be influenced by repeat sequence homology and size, with larger size repeats corresponding to increased DNA exchange activity. The extensive mitochondrial genomic reorganization of the msh1 mutant produced altered mitochondrial transcription patterns. Comparison of mitochondrial genomes from the Arabidopsis ecotypes C24, Col-0, and Ler suggests that MSH1 activity accounts for most or all of the polymorphisms distinguishing these genomes, producing ecotype-specific stoichiometric changes in each line. Our observations suggest that MSH1 participates in mitochondrial genome evolution by influencing the lineage-specific pattern of mitochondrial genetic variation in higher plants.
Gu, Xuan; Zhang, Xiao-qin; Song, Xiao-na; Zang, Yi-mei; Li Yan-peng; Ma, Chang-hua; Zhao, Bai-xiao; Liu, Chun-sheng
2014-12-01
The fruit of Lycium ruthenicum is a common folk medicine in China. Now it is popular for its antioxidative effect and other medical functions. The adulterants of the herb confuse consumers. In order to identify a new adulterant of L. ruthenicum, a research was performed based on NCBI Nucleotide Database ITS Sequence, combined analysis of the origin and morphology of the adulterant to traceable varieties. Total genomic DNA was isolated from the materials, and nuclear DNA ITS sequences were amplified and sequenced; DNA fragments were collated and matched by using ContingExpress. Similarity identification of BLAST analysis was performed. Besides, the distribution of plant origin and morphology were considered to further identification and verification. Families and genera were identified by molecular identification method. The adulterant was identified as plant belonging to Berberis. Origin analysis narrowed the range of sample identification. Seven different kinds of plants in Berberis were potential sources of the sample. Adulterants variety was traced by morphological analysis. The united molecular identification-origin-morphology research proves to be a preceding way to medical herbs traceability with time-saving and economic advantages and the results showed the new adulterant of L. ruthenicum was B. kaschgarica. The main differences between B. kaschgarica and L. ruthenicum are as follows: in terms of the traits, the surface of B. kaschgarica is smooth and crispy, and that of L. ruthenicum is shrinkage, solid and hard. In microscopic characteristics, epicarp cells of B. aschgarica thickening like a string of beads, stone cells as the rectangle, and the stone cell walls of L. ruthenicum is wavy, obvious grain layer. In molecular sequences, the length of ITS sequence of B. kaschgarica is 606 bp, L. ruthenicum is 654 bp, the similarity of the two sequences is 53.32%.
Sun, Cheng; Wyngaard, Grace; Walton, D Brian; Wichman, Holly A; Mueller, Rachel Lockridge
2014-03-11
Chromatin diminution is the programmed deletion of DNA from presomatic cell or nuclear lineages during development, producing single organisms that contain two different nuclear genomes. Phylogenetically diverse taxa undergo chromatin diminution--some ciliates, nematodes, copepods, and vertebrates. In cyclopoid copepods, chromatin diminution occurs in taxa with massively expanded germline genomes; depending on species, germline genome sizes range from 15 - 75 Gb, 12-74 Gb of which are lost from pre-somatic cell lineages at germline--soma differentiation. This is more than an order of magnitude more sequence than is lost from other taxa. To date, the sequences excised from copepods have not been analyzed using large-scale genomic datasets, and the processes underlying germline genomic gigantism in this clade, as well as the functional significance of chromatin diminution, have remained unknown. Here, we used high-throughput genomic sequencing and qPCR to characterize the germline and somatic genomes of Mesocyclops edax, a freshwater cyclopoid copepod with a germline genome of ~15 Gb and a somatic genome of ~3 Gb. We show that most of the excised DNA consists of repetitive sequences that are either 1) verifiable transposable elements (TEs), or 2) non-simple repeats of likely TE origin. Repeat elements in both genomes are skewed towards younger (i.e. less divergent) elements. Excised DNA is a non-random sample of the germline repeat element landscape; younger elements, and high frequency DNA transposons and LINEs, are disproportionately eliminated from the somatic genome. Our results suggest that germline genome expansion in M. edax reflects explosive repeat element proliferation, and that billions of base pairs of such repeats are deleted from the somatic genome every generation. Thus, we hypothesize that chromatin diminution is a mechanism that controls repeat element load, and that this load can evolve to be divergent between tissue types within single organisms.
2014-01-01
Background Chromatin diminution is the programmed deletion of DNA from presomatic cell or nuclear lineages during development, producing single organisms that contain two different nuclear genomes. Phylogenetically diverse taxa undergo chromatin diminution — some ciliates, nematodes, copepods, and vertebrates. In cyclopoid copepods, chromatin diminution occurs in taxa with massively expanded germline genomes; depending on species, germline genome sizes range from 15 – 75 Gb, 12–74 Gb of which are lost from pre-somatic cell lineages at germline – soma differentiation. This is more than an order of magnitude more sequence than is lost from other taxa. To date, the sequences excised from copepods have not been analyzed using large-scale genomic datasets, and the processes underlying germline genomic gigantism in this clade, as well as the functional significance of chromatin diminution, have remained unknown. Results Here, we used high-throughput genomic sequencing and qPCR to characterize the germline and somatic genomes of Mesocyclops edax, a freshwater cyclopoid copepod with a germline genome of ~15 Gb and a somatic genome of ~3 Gb. We show that most of the excised DNA consists of repetitive sequences that are either 1) verifiable transposable elements (TEs), or 2) non-simple repeats of likely TE origin. Repeat elements in both genomes are skewed towards younger (i.e. less divergent) elements. Excised DNA is a non-random sample of the germline repeat element landscape; younger elements, and high frequency DNA transposons and LINEs, are disproportionately eliminated from the somatic genome. Conclusions Our results suggest that germline genome expansion in M. edax reflects explosive repeat element proliferation, and that billions of base pairs of such repeats are deleted from the somatic genome every generation. Thus, we hypothesize that chromatin diminution is a mechanism that controls repeat element load, and that this load can evolve to be divergent between tissue types within single organisms. PMID:24618421
2010-01-01
Background The agriculturally important pasture grass tall fescue (Festuca arundinacea Schreb. syn. Lolium arundinaceum (Schreb.) Darbysh.) is an outbreeding allohexaploid, that may be more accurately described as a species complex consisting of three major (Continental, Mediterranean and rhizomatous) morphotypes. Observation of hybrid infertility in some crossing combinations between morphotypes suggests the possibility of independent origins from different diploid progenitors. This study aims to clarify the evolutionary relationships between each tall fescue morphotype through phylogenetic analysis using two low-copy nuclear genes (encoding plastid acetyl-CoA carboxylase [Acc1] and centroradialis [CEN]), the nuclear ribosomal DNA internal transcribed spacer (rDNA ITS) and the chloroplast DNA (cpDNA) genome-located matK gene. Other taxa within the closely related Lolium-Festuca species complex were also included in the study, to increase understanding of evolutionary processes in a taxonomic group characterised by multiple inter-specific hybridisation events. Results Putative homoeologous sequences from both nuclear genes were obtained from each polyploid species and compared to counterparts from 15 diploid taxa. Phylogenetic reconstruction confirmed F. pratensis and F. arundinacea var. glaucescens as probable progenitors to Continental tall fescue, and these species are also likely to be ancestral to the rhizomatous morphotype. However, these two morphotypes are sufficiently distinct to be located in separate clades based on the ITS-derived data set. All four of the generated data sets suggest independent evolution of the Mediterranean and Continental morphotypes, with minimal affinity between cognate sequence haplotypes. No obvious candidate progenitor species for Mediterranean tall fescues were identified, and only two putative sub-genome-specific haplotypes were identified for this morphotype. Conclusions This study describes the first phylogenetic analysis of the Festuca genus to include representatives of each tall fescue morphotype, and to use low copy nuclear gene-derived sequences to identify putative progenitors of the polyploid species. The demonstration of distinct tall fescue lineages has implications for both taxonomy and molecular breeding strategies, and may facilitate the generation of morphotype and/or sub-genome-specific molecular markers. PMID:20937141
Puranik, Swati; Kumar, Karunesh; Srivastava, Prem S; Prasad, Manoj
2011-10-01
The NAC (NAM/ATAF1,2/CUC2) proteins are among the largest family of plant transcription factors. Its members have been associated with diverse plant processes and intricately regulate the expression of several genes. Inspite of this immense progress, knowledge of their DNA-binding properties are still limited. In our recent publication,1 we reported isolation of a membrane-associated NAC domain protein from Setaria italica (SiNAC). Transactivation analysis revealed that it was a functionally active transcription factor as it could stimulate expression of reporter genes in vivo. Truncations of the transmembrane region of the protein lead to its nuclear localization. Here we describe expression and purification of SiNAC DNA-binding domain. We further report identification of a novel DNA-binding site, [C/G][A/T][T/A][G/C]TC[C/G][A/T][C/G][G/C] for SiNAC by electrophoretic mobility shift assay. The SiNAC-GST protein could bind to the NAC recognition sequence in vitro as well as to sequences where some bases had been reshuffled. The results presented here contribute to our understanding of the DNA-binding specificity of SiNAC protein.
Puranik, Swati; Kumar, Karunesh; Srivastava, Prem S
2011-01-01
The NAC (NAM/ATAF1,2/CUC2) proteins are among the largest family of plant transcription factors. Its members have been associated with diverse plant processes and intricately regulate the expression of several genes. Inspite of this immense progress, knowledge of their DNA-binding properties are still limited. In our recent publication,1 we reported isolation of a membrane-associated NAC domain protein from Setaria italica (SiNAC). Transactivation analysis revealed that it was a functionally active transcription factor as it could stimulate expression of reporter genes in vivo. Truncation of the transmembrane region of the protein lead to its nuclear localization. Here we describe expression and purification of SiNAC DNA-binding domain. We further report identification of a novel DNA-binding site, [C/G][A/T] [T/A][G/C]TC[C/G][A/T][C/G][G/C] for SiNAC by electrophoretic mobility shift assay. The SiNAC-GST protein could bind to the NAC recognition sequence in vitro as well as to sequences where some bases had been reshuffled. The results presented here contribute to our understanding of the DNA-binding specificity of SiNAC protein. PMID:21918373
Kang, Nam Seon; Jeong, Hae Jin; Moestrup, Øjvind; Shin, Woongghi; Nam, Seung Won; Park, Jae Yeon; De Salas, Miguel F; Kim, Ki Woo; Noh, Jae Hoon
2010-01-01
The mixotrophic dinoflagellate Paragymnodinium shiwhaense n. gen., n. sp. is described from living cells and from cells prepared by light, scanning electron, and transmission electron microscopy. In addition, sequences of the small subunit (SSU) and large subunit (LSU) rDNA and photosynthetic pigments are reported. The episome is conical, while the hyposome is hemispherical. Cells are covered with polygonal amphiesmal vesicles arranged in 16 rows and containing a very thin plate-like component. There is neither an apical groove nor apical line of narrow plates. Instead, there is a sulcal extension-like furrow. The cingulum is as wide as 0.2-0.3 x cell length and displaced by 0.2-0.3 x cell length. Cell length and width of live cells fed Amphidinium carterae were 8.4-19.3 and 6.1-16.0 microm, respectively. Paragymnodinium shiwhaense does not have a nuclear envelope chamber nor a nuclear fibrous connective (NFC). Cells contain chloroplasts, nematocysts, trichocysts, and peduncle, though eyespots, pyrenoids, and pusules are absent. The main accessory pigment is peridinin. The sequence of the SSU rDNA of this dinoflagellate (GenBank AM408889) is 4% different from that of Gymnodinium aureolum, Lepidodinium viride, and Gymnodinium catenatum, the three closest species, while the LSU rDNA was 17-18% different from that of G. catenatum, Lepidodinium chlorophorum, and Gymnodinium nolleri. The phylogenetic trees show that this dinoflagellate belongs within the Gymnodinium sensu stricto clade. However, in contrast to Gymnodinium spp., cells lack nuclear envelope chambers, NFC, and an apical groove. Unlike Polykrikos spp., which have a taeniocyst-nematocyst complex, P. shiwhaense has nematocysts without taeniocysts. In addition, P. shiwhaense does not have ocelloids in contrast to Warnowia spp. and Nematodinium spp. Therefore, based on morphological and molecular analyses, we suggest that this taxon is a new species, also within a new genus.
Girman, D J; Vilà, C; Geffen, E; Creel, S; Mills, M G; McNutt, J W; Ginsberg, J; Kat, P W; Mamiya, K H; Wayne, R K
2001-07-01
African wild dogs are large, highly mobile carnivores that are known to disperse over considerable distances and are rare throughout much of their geographical range. Consequently, genetic variation within and differentiation between geographically separated populations is predicted to be minimal. We determined the genetic diversity of mitochondrial DNA (mtDNA) control region sequences and microsatellite loci in seven populations of African wild dogs. Analysis of mtDNA nucleotide diversity suggests that, historically, wild dog populations have been small relative to other large carnivores. However, population declines due to recent habitat loss have not caused a dramatic reduction in genetic diversity. We found one historical and eight recent mtDNA genotypes in 280 individuals that defined two highly divergent clades. In contrast to a previous, more limited, mtDNA analysis, sequences from these clades are not geographically restricted to eastern or southern African populations. Rather, we found a large admixture zone spanning populations from Botswana, Zimbabwe and south-eastern Tanzania. Mitochondrial and microsatellite differentiation between populations was significant and unique mtDNA genotypes and alleles characterized the populations. However, gene flow estimates (Nm) based on microsatellite data were generally greater than one migrant per generation. In contrast, gene flow estimates based on the mtDNA control region were lower than expected given differences in the mode of inheritance of mitochondrial and nuclear markers which suggests a male bias in long-distance dispersal.
An atypical topoisomerase II sequence from the slime mold Physarum polycephalum.
Hugodot, Yannick; Dutertre, Murielle; Duguet, Michel
2004-01-21
We have determined the complete nucleotide sequence of the cDNA encoding DNA topoisomerase II from Physarum polycephalum. Using degenerate primers, based on the conserved amino acid sequences of other eukaryotic enzymes, a 250-bp fragment was polymerase chain reaction (PCR) amplified. This fragment was used as a probe to screen a Physarum cDNA library. A partial cDNA clone was isolated that was truncated at the 3' end. Rapid amplification of cDNA ends (RACE)-PCR was employed to isolate the remaining portion of the gene. The complete sequence of 4613 bp contains an open reading frame of 4494 bp that codes for 1498 amino acid residues with a theoretical molecular weight of 167 kDa. The predicted amino acid sequence shares similarity with those of other eukaryotes and shows the highest degree of identity with the enzyme of Dictyostelium discoideum. However, the enzyme of P. polycephalum contains an atypical amino-terminal domain very rich in serine and proline, whose function is unknown. Remarkably, both a mitochondrial targeting sequence and a nuclear localization signal were predicted respectively in the amino and carboxy-terminus of the protein, as in the case of human topoisomerase III alpha. At the Physarum genomic level, the topoisomerase II gene encompasses a region of about 16 kbp suggesting a large proportion of intronic sequences, an unusual situation for a gene of a lower eukaryote, often free of introns. Finally, expression of topoisomerase II mRNA does not appear significantly dependent on the plasmodium cycle stage, possibly due to the lack of G1 phase or (and) to a mitochondrial localization of the enzyme.
Taylor, Robert W.; Taylor, Geoffrey A.; Durham, Steve E.; Turnbull, Douglass M.
2001-01-01
Studies of single cells have previously shown intracellular clonal expansion of mitochondrial DNA (mtDNA) mutations to levels that can cause a focal cytochrome c oxidase (COX) defect. Whilst techniques are available to study mtDNA rearrangements at the level of the single cell, recent interest has focused on the possible role of somatic mtDNA point mutations in ageing, neurodegenerative disease and cancer. We have therefore developed a method that permits the reliable determination of the entire mtDNA sequence from single cells without amplifying contaminating, nuclear-embedded pseudogenes. Sequencing and PCR–RFLP analyses of individual COX-negative muscle fibres from a patient with a previously described heteroplasmic COX II (T7587C) mutation indicate that mutant loads as low as 30% can be reliably detected by sequencing. This technique will be particularly useful in identifying the mtDNA mutational spectra in age-related COX-negative cells and will increase our understanding of the pathogenetic mechanisms by which they occur. PMID:11470889
Genetic characterization and phylogenetic analysis of Eimeria arloingi in Iranian native kids.
Khodakaram-Tafti, A; Hashemnia, M; Razavi, S M; Sharifiyazdi, H; Nazifi, S
2013-09-01
Among the 16 species of Eimeria from goats, Eimeria arloingi and Eimeria ninakohlyakimovae are regarded as the most pathogenic species in the world and cause clinical caprine coccidiosis. E. arloingi is known to be an important cause of coccidiosis in Iranian kids. Molecular analyses of two portions of nuclear ribosomal DNA (internal transcribed spacer1 (ITS1) and 18S rDNA) were used for the genetic characterization of the E. arloingi. Comparison of the sequencing data of E. arloingi obtained in the present study (ITS1: KC507793 and 18S rDNA: KC507792) with other Eimeria species in the GenBank database revealed a particularly close relationship between E. arloingi and Eimeria spp. from the cattle and sheep. The phylogram based on the ITS1 sequences shows that the E. arloingi, Eimeria bovis, and Eimeria zuernii formed a distinct group separate from the other remaining Eimeria spp. in cattle and poultry. In pairwise alignment, 18S rDNA sequence derived from E. arloingi showed 99% similarity to Eimeria ahsata with differences observed at only three nucleotides. This study showed that the ITS1 and 18S rDNA gene are useful genetic markers for the specific identification and differentiation of Eimeria spp. in ruminants.
Moorhouse-Gann, Rosemary J; Dunn, Jenny C; de Vere, Natasha; Goder, Martine; Cole, Nik; Hipperson, Helen; Symondson, William O C
2018-06-04
DNA metabarcoding is a rapidly growing technique for obtaining detailed dietary information. Current metabarcoding methods for herbivory, using a single locus, can lack taxonomic resolution for some applications. We present novel primers for the second internal transcribed spacer of nuclear ribosomal DNA (ITS2) designed for dietary studies in Mauritius and the UK, which have the potential to give unrivalled taxonomic coverage and resolution from a short-amplicon barcode. In silico testing used three databases of plant ITS2 sequences from UK and Mauritian floras (native and introduced) totalling 6561 sequences from 1790 species across 174 families. Our primers were well-matched in silico to 88% of species, providing taxonomic resolution of 86.1%, 99.4% and 99.9% at the species, genus and family levels, respectively. In vitro, the primers amplified 99% of Mauritian (n = 169) and 100% of UK (n = 33) species, and co-amplified multiple plant species from degraded faecal DNA from reptiles and birds in two case studies. For the ITS2 region, we advocate taxonomic assignment based on best sequence match instead of a clustering approach. With short amplicons of 187-387 bp, these primers are suitable for metabarcoding plant DNA from faecal samples, across a broad geographic range, whilst delivering unparalleled taxonomic resolution.
Direct Detection and Sequencing of Damaged DNA Bases
2011-01-01
Products of various forms of DNA damage have been implicated in a variety of important biological processes, such as aging, neurodegenerative diseases, and cancer. Therefore, there exists great interest to develop methods for interrogating damaged DNA in the context of sequencing. Here, we demonstrate that single-molecule, real-time (SMRT®) DNA sequencing can directly detect damaged DNA bases in the DNA template - as a by-product of the sequencing method - through an analysis of the DNA polymerase kinetics that are altered by the presence of a modified base. We demonstrate the sequencing of several DNA templates containing products of DNA damage, including 8-oxoguanine, 8-oxoadenine, O6-methylguanine, 1-methyladenine, O4-methylthymine, 5-hydroxycytosine, 5-hydroxyuracil, 5-hydroxymethyluracil, or thymine dimers, and show that these base modifications can be readily detected with single-modification resolution and DNA strand specificity. We characterize the distinct kinetic signatures generated by these DNA base modifications. PMID:22185597
Direct detection and sequencing of damaged DNA bases.
Clark, Tyson A; Spittle, Kristi E; Turner, Stephen W; Korlach, Jonas
2011-12-20
Products of various forms of DNA damage have been implicated in a variety of important biological processes, such as aging, neurodegenerative diseases, and cancer. Therefore, there exists great interest to develop methods for interrogating damaged DNA in the context of sequencing. Here, we demonstrate that single-molecule, real-time (SMRT®) DNA sequencing can directly detect damaged DNA bases in the DNA template - as a by-product of the sequencing method - through an analysis of the DNA polymerase kinetics that are altered by the presence of a modified base. We demonstrate the sequencing of several DNA templates containing products of DNA damage, including 8-oxoguanine, 8-oxoadenine, O6-methylguanine, 1-methyladenine, O4-methylthymine, 5-hydroxycytosine, 5-hydroxyuracil, 5-hydroxymethyluracil, or thymine dimers, and show that these base modifications can be readily detected with single-modification resolution and DNA strand specificity. We characterize the distinct kinetic signatures generated by these DNA base modifications.
Sacramento, C B; Moraes, J Z; Denapolis, P M A; Han, S W
2010-08-01
The main objective of the present study was to find suitable DNA-targeting sequences (DTS) for the construction of plasmid vectors to be used to treat ischemic diseases. The well-known Simian virus 40 nuclear DTS (SV40-DTS) and hypoxia-responsive element (HRE) sequences were used to construct plasmid vectors to express the human vascular endothelial growth factor gene (hVEGF). The rate of plasmid nuclear transport and consequent gene expression under normoxia (20% O2) and hypoxia (less than 5% O2) were determined. Plasmids containing the SV40-DTS or HRE sequences were constructed and used to transfect the A293T cell line (a human embryonic kidney cell line) in vitro and mouse skeletal muscle cells in vivo. Plasmid transport to the nucleus was monitored by real-time PCR, and the expression level of the hVEGF gene was measured by ELISA. The in vitro nuclear transport efficiency of the SV40-DTS plasmid was about 50% lower under hypoxia, while the HRE plasmid was about 50% higher under hypoxia. Quantitation of reporter gene expression in vitro and in vivo, under hypoxia and normoxia, confirmed that the SV40-DTS plasmid functioned better under normoxia, while the HRE plasmid was superior under hypoxia. These results indicate that the efficiency of gene expression by plasmids containing DNA binding sequences is affected by the concentration of oxygen in the medium.
Mechanisms and dynamics of nuclear lamina-genome interactions.
Amendola, Mario; van Steensel, Bas
2014-06-01
The nuclear lamina (NL) interacts with the genomic DNA and is thought to influence chromosome organization and gene expression. Both DNA sequences and histone modifications are important for NL tethering of the genomic DNA. These interactions are dynamic in individual cells and can change during differentiation and development. Evidence is accumulating that the NL contributes to the repression of transcription. Advances in mapping, genome-editing and microscopy techniques are increasing our understanding of the molecular mechanisms involved in NL-genome interactions. Copyright © 2014 Elsevier Ltd. All rights reserved.
SivaRaman, L; Subramanian, S; Thimmappaya, B
1986-01-01
Utilizing the gel electrophoresis/DNA binding assay, a factor specific for the upstream transcriptional control sequence of the EIA-inducible adenovirus EIIA-early promoter has been detected in HeLa cell nuclear extract. Analysis of linker-scanning mutants of the promoter by DNA binding assays and methylation-interference experiments show that the factor binds to the 17-nucleotide sequence 5' TGGAGATGACGTAGTTT 3' located between positions -66 and -82 upstream from the cap site. This sequence has been shown to be essential for transcription of this promoter. The EIIA-early-promoter specific factor was found to be present at comparable levels in uninfected HeLa cells and in cells infected with either wild-type adenovirus or the EIA-deletion mutant dl312 under conditions in which the EIA proteins are induced to high levels [7 or 20 hr after infection in the presence of arabinonucleoside (cytosine arabinoside)]. Based on the quantitation in DNA binding assays, it appears that the mechanism of EIA-activated transcription of the EIIA-early promoter does not involve a net change in the amounts of this factor. Images PMID:2942943
Analysis of DNA Sequences by An Optical Time-Integrating Correlator: Proof-Of-Concept Experiments.
1992-05-01
TABLES xv LIST OF ABBREVIATIONS xvii 1.0 INTRODUCTION 1 2.0 DNA ANALYSIS STRATEGY 4 2.1 Representation of DNA Bases 4 2.2 DNA Analysis Strategy 6 3.0...Zehnder architecture. 3 Figure 3: Short representations of the DNA bases where each base is represented by a 7-bits long pseudorandom sequence. 5... DNA bases where each base is represented by 7-bits long pseudorandom sequences. 4 Table 2: Long representations of the DNA bases with 255-bits maximum
Saluz, H P; Feavers, I M; Jiricny, J; Jost, J P
1988-01-01
Genomic sequencing was used to study the in vivo methylation pattern of two CpG sites in the promoter region of the avian vitellogenin gene. The CpG at position +10 was fully methylated in DNA isolated from tissues that do not express the gene but was unmethylated in the liver of mature hens and estradiol-treated roosters. In the latter tissue, this site became demethylated and DNase I hypersensitive after estradiol treatment. A second CpG (position -52) was unmethylated in all tissues examined. In vivo genomic footprinting with dimethyl sulfate revealed different patterns of DNA protection in silent and expressed genes. In rooster liver cells, at least 10 base pairs of DNA, including the methylated CpG, were protected by protein(s). Gel-shift assays indicated that a protein factor, present in rooster liver nuclear extract, bound at this site only when it was methylated. In hen liver cells, the same unmethylated CpG lies within a protected region of approximately equal to 20 base pairs. In vitro DNase I protection and gel-shift assays indicate that this sequence is bound by a protein, which binds both double- and single-stranded DNA. For the latter substrate, this factor was shown to bind solely the noncoding (i.e., mRNA-like) strand. Images PMID:3413118
Evaluation and comparison of FTA card and CTAB DNA extraction methods for non-agricultural taxa1
Siegel, Chloe S.; Stevenson, Florence O.; Zimmer, Elizabeth A.
2017-01-01
Premise of the study: An efficient, effective DNA extraction method is necessary for comprehensive analysis of plant genomes. This study analyzed the quality of DNA obtained using paper FTA cards prepared directly in the field when compared to the more traditional cetyltrimethylammonium bromide (CTAB)–based extraction methods from silica-dried samples. Methods: DNA was extracted using FTA cards according to the manufacturer’s protocol. In parallel, CTAB-based extractions were done using the automated AutoGen DNA isolation system. DNA quality for both methods was determined for 15 non-agricultural species collected in situ, by gel separation, spectrophotometry, fluorometry, and successful amplification and sequencing of nuclear and chloroplast gene markers. Results: The FTA card extraction method yielded less concentrated, but also less fragmented samples than the CTAB-based technique. The card-extracted samples provided DNA that could be successfully amplified and sequenced. The FTA cards are also useful because the collected samples do not require refrigeration, extensive laboratory expertise, or as many hazardous chemicals as extractions using the CTAB-based technique. Discussion: The relative success of the FTA card method in our study suggested that this method could be a valuable tool for studies in plant population genetics and conservation biology that may involve screening of hundreds of individual plants. The FTA cards, like the silica gel samples, do not contain plant material capable of propagation, and therefore do not require permits from the U.S. Department of Agriculture (USDA) Animal and Plant Health Inspection Service (APHIS) for transportation. PMID:28224056
Enantiospecific recognition of DNA sequences by a proflavine Tröger base.
Bailly, C; Laine, W; Demeunynck, M; Lhomme, J
2000-07-05
The DNA interaction of a chiral Tröger base derived from proflavine was investigated by DNA melting temperature measurements and complementary biochemical assays. DNase I footprinting experiments demonstrate that the binding of the proflavine-based Tröger base is both enantio- and sequence-specific. The (+)-isomer poorly interacts with DNA in a non-sequence-selective fashion. In sharp contrast, the corresponding (-)-isomer recognizes preferentially certain DNA sequences containing both A. T and G. C base pairs, such as the motifs 5'-GTT. AAC and 5'-ATGA. TCAT. This is the first experimental demonstration that acridine-type Tröger bases can be used for enantiospecific recognition of DNA sequences. Copyright 2000 Academic Press.
Nakagome, Shigeki; Mano, Shuhei; Hasegawa, Masami
2013-01-01
Recent studies have reported discordant gene trees in the evolution of brown bears and polar bears. Genealogical histories are different among independent nuclear loci and between biparentally inherited autosomal DNA (aDNA) and matrilineal mitochondrial DNA (mtDNA). Based on multi-locus genomic sequences from aDNA and mtDNA, we inferred the population demography of brown and polar bears and found that brown bears have 6 times (aDNA) or more than 14 times (mtDNA) larger population sizes than polar bears and that polar bear lineage is derived from within brown bear diversity. In brown bears, the effective population size ratio of mtDNA to aDNA was at least 0.62, which deviated from the expected value of 0.25, suggesting matriarchal population due to female philopatry and male-biased migration. These results emphasize that ancestral polymorphisms and sex-biased migration may have contributed to conflicting branching patterns in brown and polar bears across aDNA genes and mtDNA. PMID:24236053
Nakagome, Shigeki; Mano, Shuhei; Hasegawa, Masami
2013-01-01
Recent studies have reported discordant gene trees in the evolution of brown bears and polar bears. Genealogical histories are different among independent nuclear loci and between biparentally inherited autosomal DNA (aDNA) and matrilineal mitochondrial DNA (mtDNA). Based on multi-locus genomic sequences from aDNA and mtDNA, we inferred the population demography of brown and polar bears and found that brown bears have 6 times (aDNA) or more than 14 times (mtDNA) larger population sizes than polar bears and that polar bear lineage is derived from within brown bear diversity. In brown bears, the effective population size ratio of mtDNA to aDNA was at least 0.62, which deviated from the expected value of 0.25, suggesting matriarchal population due to female philopatry and male-biased migration. These results emphasize that ancestral polymorphisms and sex-biased migration may have contributed to conflicting branching patterns in brown and polar bears across aDNA genes and mtDNA.
Development of Genetic Markers in Eucalyptus Species by Target Enrichment and Exome Sequencing
Dasgupta, Modhumita Ghosh; Dharanishanthi, Veeramuthu; Agarwal, Ishangi; Krutovsky, Konstantin V.
2015-01-01
The advent of next-generation sequencing has facilitated large-scale discovery, validation and assessment of genetic markers for high density genotyping. The present study was undertaken to identify markers in genes supposedly related to wood property traits in three Eucalyptus species. Ninety four genes involved in xylogenesis were selected for hybridization probe based nuclear genomic DNA target enrichment and exome sequencing. Genomic DNA was isolated from the leaf tissues and used for on-array probe hybridization followed by Illumina sequencing. The raw sequence reads were trimmed and high-quality reads were mapped to the E. grandis reference sequence and the presence of single nucleotide variants (SNVs) and insertions/ deletions (InDels) were identified across the three species. The average read coverage was 216X and a total of 2294 SNVs and 479 InDels were discovered in E. camaldulensis, 2383 SNVs and 518 InDels in E. tereticornis, and 1228 SNVs and 409 InDels in E. grandis. Additionally, SNV calling and InDel detection were conducted in pair-wise comparisons of E. tereticornis vs. E. grandis, E. camaldulensis vs. E. tereticornis and E. camaldulensis vs. E. grandis. This study presents an efficient and high throughput method on development of genetic markers for family– based QTL and association analysis in Eucalyptus. PMID:25602379
DNA Barcoding Green Microalgae Isolated from Neotropical Inland Waters
Hadi, Sámed I. I. A.; Santana, Hugo; Brunale, Patrícia P. M.; Gomes, Taísa G.; Oliveira, Márcia D.; Matthiensen, Alexandre; Oliveira, Marcos E. C.; Silva, Flávia C. P.; Brasil, Bruno S. A. F.
2016-01-01
This study evaluated the feasibility of using the Ribulose Bisphosphate Carboxylase Large subunit gene (rbcL) and the Internal Transcribed Spacers 1 and 2 of the nuclear rDNA (nuITS1 and nuITS2) markers for identifying a very diverse, albeit poorly known group, of green microalgae from neotropical inland waters. Fifty-one freshwater green microalgae strains isolated from Brazil, the largest biodiversity reservoir in the neotropics, were submitted to DNA barcoding. Currently available universal primers for ITS1-5.8S-ITS2 region amplification were sufficient to successfully amplify and sequence 47 (92%) of the samples. On the other hand, new sets of primers had to be designed for rbcL, which allowed 96% of the samples to be sequenced. Thirty-five percent of the strains could be unambiguously identified to the species level based either on nuITS1 or nuITS2 sequences’ using barcode gap calculations. nuITS2 Compensatory Base Change (CBC) and ITS1-5.8S-ITS2 region phylogenetic analysis, together with morphological inspection, confirmed the identification accuracy. In contrast, only 6% of the strains could be assigned to the correct species based solely on rbcL sequences. In conclusion, the data presented here indicates that either nuITS1 or nuITS2 are useful markers for DNA barcoding of freshwater green microalgae, with advantage for nuITS2 due to the larger availability of analytical tools and reference barcodes deposited at databases for this marker. PMID:26900844
Yu, Li; Li, Yi-Wei; Ryder, Oliver A; Zhang, Ya-Ping
2007-10-24
Despite the small number of ursid species, bear phylogeny has long been a focus of study due to their conservation value, as all bear genera have been classified as endangered at either the species or subspecies level. The Ursidae family represents a typical example of rapid evolutionary radiation. Previous analyses with a single mitochondrial (mt) gene or a small number of mt genes either provide weak support or a large unresolved polytomy for ursids. We revisit the contentious relationships within Ursidae by analyzing complete mt genome sequences and evaluating the performance of both entire mt genomes and constituent mtDNA genes in recovering a phylogeny of extremely recent speciation events. This mitochondrial genome-based phylogeny provides strong evidence that the spectacled bear diverged first, while within the genus Ursus, the sloth bear is the sister taxon of all the other five ursines. The latter group is divided into the brown bear/polar bear and the two black bears/sun bear assemblages. These findings resolve the previous conflicts between trees using partial mt genes. The ability of different categories of mt protein coding genes to recover the correct phylogeny is concordant with previous analyses for taxa with deep divergence times. This study provides a robust Ursidae phylogenetic framework for future validation by additional independent evidence, and also has significant implications for assisting in the resolution of other similarly difficult phylogenetic investigations. Identification of base composition bias and utilization of the combined data of whole mitochondrial genome sequences has allowed recovery of a strongly supported phylogeny that is upheld when using multiple alternative outgroups for the Ursidae, a mammalian family that underwent a rapid radiation since the mid- to late Pliocene. It remains to be seen if the reliability of mt genome analysis will hold up in studies of other difficult phylogenetic issues. Although the whole mitochondrial DNA sequence based phylogeny is robust, it remains in conflict with phylogenetic relationships suggested by analysis of limited nuclear-encoded data, a situation that will require gathering more nuclear DNA sequence information.
Yu, Li; Li, Yi-Wei; Ryder, Oliver A; Zhang, Ya-Ping
2007-01-01
Background Despite the small number of ursid species, bear phylogeny has long been a focus of study due to their conservation value, as all bear genera have been classified as endangered at either the species or subspecies level. The Ursidae family represents a typical example of rapid evolutionary radiation. Previous analyses with a single mitochondrial (mt) gene or a small number of mt genes either provide weak support or a large unresolved polytomy for ursids. We revisit the contentious relationships within Ursidae by analyzing complete mt genome sequences and evaluating the performance of both entire mt genomes and constituent mtDNA genes in recovering a phylogeny of extremely recent speciation events. Results This mitochondrial genome-based phylogeny provides strong evidence that the spectacled bear diverged first, while within the genus Ursus, the sloth bear is the sister taxon of all the other five ursines. The latter group is divided into the brown bear/polar bear and the two black bears/sun bear assemblages. These findings resolve the previous conflicts between trees using partial mt genes. The ability of different categories of mt protein coding genes to recover the correct phylogeny is concordant with previous analyses for taxa with deep divergence times. This study provides a robust Ursidae phylogenetic framework for future validation by additional independent evidence, and also has significant implications for assisting in the resolution of other similarly difficult phylogenetic investigations. Conclusion Identification of base composition bias and utilization of the combined data of whole mitochondrial genome sequences has allowed recovery of a strongly supported phylogeny that is upheld when using multiple alternative outgroups for the Ursidae, a mammalian family that underwent a rapid radiation since the mid- to late Pliocene. It remains to be seen if the reliability of mt genome analysis will hold up in studies of other difficult phylogenetic issues. Although the whole mitochondrial DNA sequence based phylogeny is robust, it remains in conflict with phylogenetic relationships suggested by analysis of limited nuclear-encoded data, a situation that will require gathering more nuclear DNA sequence information. PMID:17956639
Identification of a p53-response element in the promoter of the proline oxidase gene
DOE Office of Scientific and Technical Information (OSTI.GOV)
Maxwell, Steve A.; Kochevar, Gerald J.
2008-05-02
Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significantmore » p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.« less
The protective function of noncoding DNA in genome defense of eukaryotic male germ cells.
Qiu, Guo-Hua; Huang, Cuiqin; Zheng, Xintian; Yang, Xiaoyan
2018-04-01
Peripheral and abundant noncoding DNA has been hypothesized to protect the genome and the central protein-coding sequences against DNA damage in somatic genome. In the cytosol, invading exogenous nucleic acids may first be deactivated by small RNAs encoded by noncoding DNA via mechanisms similar to the prokaryotic CRISPR-Cas system. In the nucleus, the radicals generated by radiation in the cytosol, radiation energy and invading exogenous nucleic acids are absorbed, blocked and/or reduced by peripheral heterochromatin, and damaged DNA in heterochromatin is removed and excluded from the nucleus to the cytoplasm through nuclear pore complexes. To further strengthen the hypothesis, this review summarizes the experimental evidence supporting the protective function of noncoding DNA in the genome of male germ cells. Based on these data, this review provides evidence supporting the protective role of noncoding DNA in the genome defense of sperm genome through similar mechanisms to those of the somatic genome.
Migration of mitochondrial DNA in the nuclear genome of colorectal adenocarcinoma.
Srinivasainagendra, Vinodh; Sandel, Michael W; Singh, Bhupendra; Sundaresan, Aishwarya; Mooga, Ved P; Bajpai, Prachi; Tiwari, Hemant K; Singh, Keshav K
2017-03-29
Colorectal adenocarcinomas are characterized by abnormal mitochondrial DNA (mtDNA) copy number and genomic instability, but a molecular interaction between mitochondrial and nuclear genome remains unknown. Here we report the discovery of increased copies of nuclear mtDNA (NUMT) in colorectal adenocarcinomas, which supports link between mtDNA and genomic instability in the nucleus. We name this phenomenon of nuclear occurrence of mitochondrial component as numtogenesis. We provide a description of NUMT abundance and distribution in tumor versus matched blood-derived normal genomes. Whole-genome sequence data were obtained for colon adenocarcinoma and rectum adenocarcinoma patients participating in The Cancer Genome Atlas, via the Cancer Genomics Hub, using the GeneTorrent file acquisition tool. Data were analyzed to determine NUMT proportion and distribution on a genome-wide scale. A NUMT suppressor gene was identified by comparing numtogenesis in other organisms. Our study reveals that colorectal adenocarcinoma genomes, on average, contains up to 4.2-fold more somatic NUMTs than matched normal genomes. Women colorectal tumors contained more NUMT than men. NUMT abundance in tumor predicted parallel abundance in blood. NUMT abundance positively correlated with GC content and gene density. Increased numtogenesis was observed with higher mortality. We identified YME1L1, a human homolog of yeast YME1 (yeast mitochondrial DNA escape 1) to be frequently mutated in colorectal tumors. YME1L1 was also mutated in tumors derived from other tissues. We show that inactivation of YME1L1 results in increased transfer of mtDNA in the nuclear genome. Our study demonstrates increased somatic transfer of mtDNA in colorectal tumors. Our study also reveals sex-based differences in frequency of NUMT occurrence and that NUMT in blood reflects NUMT in tumors, suggesting NUMT may be used as a biomarker for tumorigenesis. We identify YME1L1 as the first NUMT suppressor gene in human and demonstrate that inactivation of YME1L1 induces migration of mtDNA to the nuclear genome. Our study reveals that numtogenesis plays an important role in the development of cancer.
Bendiksby, Mika; Næsborg, Rikke Reese; Timdal, Einar
2018-01-01
Xylopsora canopeorum Timdal, Reese Næsborg & Bendiksby is described as a new species occupying the crowns of large Sequoia sempervirens trees in California, USA. The new species is supported by morphology, anatomy, secondary chemistry and DNA sequence data. While similar in external appearance to X. friesii , it is distinguished by forming smaller, partly coralloid squamules, by the occurrence of soralia and, in some specimens, by the presence of thamnolic acid in addition to friesiic acid in the thallus. Molecular phylogenetic results are based on nuclear (ITS and LSU) as well as mitochondrial (SSU) ribosomal DNA sequence alignments. Phylogenetic hypotheses obtained using Bayesian Inference, Maximum Likelihood and Maximum Parsimony all support X. canopeorum as a distinct evolutionary lineage belonging to the X. caradocensis - X. friesii clade.
Xylopsora canopeorum (Umbilicariaceae), a new lichen species from the canopy of Sequoia sempervirens
Bendiksby, Mika; Næsborg, Rikke Reese; Timdal, Einar
2018-01-01
Abstract Xylopsora canopeorum Timdal, Reese Næsborg & Bendiksby is described as a new species occupying the crowns of large Sequoia sempervirens trees in California, USA. The new species is supported by morphology, anatomy, secondary chemistry and DNA sequence data. While similar in external appearance to X. friesii, it is distinguished by forming smaller, partly coralloid squamules, by the occurrence of soralia and, in some specimens, by the presence of thamnolic acid in addition to friesiic acid in the thallus. Molecular phylogenetic results are based on nuclear (ITS and LSU) as well as mitochondrial (SSU) ribosomal DNA sequence alignments. Phylogenetic hypotheses obtained using Bayesian Inference, Maximum Likelihood and Maximum Parsimony all support X. canopeorum as a distinct evolutionary lineage belonging to the X. caradocensis–X. friesii clade. PMID:29559828
Kowalczyk, Marek; Sekuła, Andrzej; Mleczko, Piotr; Olszowy, Zofia; Kujawa, Anna; Zubek, Szymon; Kupiec, Tomasz
2015-01-01
Aim To assess the usefulness of a DNA-based method for identifying mushroom species for application in forensic laboratory practice. Methods Two hundred twenty-one samples of clinical forensic material (dried mushrooms, food remains, stomach contents, feces, etc) were analyzed. ITS2 region of nuclear ribosomal DNA (nrDNA) was sequenced and the sequences were compared with reference sequences collected from the National Center for Biotechnology Information gene bank (GenBank). Sporological identification of mushrooms was also performed for 57 samples of clinical material. Results Of 221 samples, positive sequencing results were obtained for 152 (69%). The highest percentage of positive results was obtained for samples of dried mushrooms (96%) and food remains (91%). Comparison with GenBank sequences enabled identification of all samples at least at the genus level. Most samples (90%) were identified at the level of species or a group of closely related species. Sporological and molecular identification were consistent at the level of species or genus for 30% of analyzed samples. Conclusion Molecular analysis identified a larger number of species than sporological method. It proved to be suitable for analysis of evidential material (dried hallucinogenic mushrooms) in forensic genetic laboratories as well as to complement classical methods in the analysis of clinical material. PMID:25727040
The campaign to DNA barcode all fishes, FISH-BOL.
Ward, R D; Hanner, R; Hebert, P D N
2009-02-01
FISH-BOL, the Fish Barcode of Life campaign, is an international research collaboration that is assembling a standardized reference DNA sequence library for all fishes. Analysis is targeting a 648 base pair region of the mitochondrial cytochrome c oxidase I (COI) gene. More than 5000 species have already been DNA barcoded, with an average of five specimens per species, typically vouchers with authoritative identifications. The barcode sequence from any fish, fillet, fin, egg or larva can be matched against these reference sequences using BOLD; the Barcode of Life Data System (http://www.barcodinglife.org). The benefits of barcoding fishes include facilitating species identification, highlighting cases of range expansion for known species, flagging previously overlooked species and enabling identifications where traditional methods cannot be applied. Results thus far indicate that barcodes separate c. 98 and 93% of already described marine and freshwater fish species, respectively. Several specimens with divergent barcode sequences have been confirmed by integrative taxonomic analysis as new species. Past concerns in relation to the use of fish barcoding for species discrimination are discussed. These include hybridization, recent radiations, regional differentiation in barcode sequences and nuclear copies of the barcode region. However, current results indicate these issues are of little concern for the great majority of specimens.
Kowalczyk, Marek; Sekuła, Andrzej; Mleczko, Piotr; Olszowy, Zofia; Kujawa, Anna; Zubek, Szymon; Kupiec, Tomasz
2015-02-01
To assess the usefulness of a DNA-based method for identifying mushroom species for application in forensic laboratory practice. Two hundred twenty-one samples of clinical forensic material (dried mushrooms, food remains, stomach contents, feces, etc) were analyzed. ITS2 region of nuclear ribosomal DNA (nrDNA) was sequenced and the sequen-ces were compared with reference sequences collected from the National Center for Biotechnology Information gene bank (GenBank). Sporological identification of mushrooms was also performed for 57 samples of clinical material. Of 221 samples, positive sequencing results were obtained for 152 (69%). The highest percentage of positive results was obtained for samples of dried mushrooms (96%) and food remains (91%). Comparison with GenBank sequences enabled identification of all samples at least at the genus level. Most samples (90%) were identified at the level of species or a group of closely related species. Sporological and molecular identification were consistent at the level of species or genus for 30% of analyzed samples. Molecular analysis identified a larger number of species than sporological method. It proved to be suitable for analysis of evidential material (dried hallucinogenic mushrooms) in forensic genetic laboratories as well as to complement classical methods in the analysis of clinical material.
LOPES, Estela Gallucci; GERALDO, Carlos Alberto; MARCILI, Arlei; SILVA, Ricardo Duarte; KEID, Lara Borges; OLIVEIRA, Trícia Maria Ferreira da Silva; SOARES, Rodrigo Martins
2016-01-01
In visceral leishmaniasis, the detection of the agent is of paramount importance to identify reservoirs of infection. Here, we evaluated the diagnostic attributes of PCRs based on primers directed to cytochrome-B (cytB), cytochrome-oxidase-subunit II (coxII), cytochrome-C (cytC), and the minicircle-kDNA. Although PCRs directed to cytB, coxII, cytC were able to detect different species of Leishmania, and the nucleotide sequence of their amplicons allowed the unequivocal differentiation of species, the analytical and diagnostic sensitivity of these PCRs were much lower than the analytical and diagnostic sensitivity of the kDNA-PCR. Among the 73 seropositive animals, the asymptomatic dogs had spleen and bone marrow samples collected and tested; only two animals were positive by PCRs based on cytB, coxII, and cytC, whereas 18 were positive by the kDNA-PCR. Considering the kDNA-PCR results, six dogs had positive spleen and bone marrow samples, eight dogs had positive bone marrow results but negative results in spleen samples and, in four dogs, the reverse situation occurred. We concluded that PCRs based on cytB, coxII, and cytC can be useful tools to identify Leishmania species when used in combination with automated sequencing. The discordance between the results of the kDNA-PCR in bone marrow and spleen samples may indicate that conventional PCR lacks sensitivity for the detection of infected dogs. Thus, primers based on the kDNA should be preferred for the screening of infected dogs. PMID:27253743
Wu, Qingqing; Xiang, Shengnan; Wang, Wenjun; Zhao, Jinyan; Xia, Jinhua; Zhen, Yueran; Liu, Bang
2018-05-01
Various detection methods have been developed to date for identification of animal species. New techniques based on PCR approach have raised the hope of developing better identification methods, which can overcome the limitations of the existing methods. PCR-based methods used the mitochondrial DNA (mtDNA) as well as nuclear DNA sequences. In this study, by targeting nuclear DNA, multiplex PCR and real-time PCR methods were developed to assist with qualitative and quantitative analysis. The multiplex PCR was found to simultaneously and effectively distinguish four species (fox, dog, mink, and rabbit) ingredients by the different sizes of electrophoretic bands: 480, 317, 220, and 209 bp. Real-time fluorescent PCR's amplification profiles and standard curves showed good quantitative measurement responses and linearity, as indicated by good repeatability and coefficient of determination R 2 > 0.99. The quantitative results of quaternary DNA mixtures including mink, fox, dog, and rabbit DNA are in line with our expectations: R.D. (relative deviation) varied between 1.98 and 12.23% and R.S.D. (relative standard deviation) varied between 3.06 and 11.51%, both of which are well within the acceptance criterion of ≤ 25%. Combining the two methods is suitable for the rapid identification and accurate quantification of fox-, dog-, mink-, and rabbit-derived ingredients in the animal products.
Repetitive part of the banana (Musa acuminata) genome investigated by low-depth 454 sequencing.
Hribová, Eva; Neumann, Pavel; Matsumoto, Takashi; Roux, Nicolas; Macas, Jirí; Dolezel, Jaroslav
2010-09-16
Bananas and plantains (Musa spp.) are grown in more than a hundred tropical and subtropical countries and provide staple food for hundreds of millions of people. They are seed-sterile crops propagated clonally and this makes them vulnerable to a rapid spread of devastating diseases and at the same time hampers breeding improved cultivars. Although the socio-economic importance of bananas and plantains cannot be overestimated, they remain outside the focus of major research programs. This slows down the study of nuclear genome and the development of molecular tools to facilitate banana improvement. In this work, we report on the first thorough characterization of the repeat component of the banana (M. acuminata cv. 'Calcutta 4') genome. Analysis of almost 100 Mb of sequence data (0.15× genome coverage) permitted partial sequence reconstruction and characterization of repetitive DNA, making up about 30% of the genome. The results showed that the banana repeats are predominantly made of various types of Ty1/copia and Ty3/gypsy retroelements representing 16 and 7% of the genome respectively. On the other hand, DNA transposons were found to be rare. In addition to new families of transposable elements, two new satellite repeats were discovered and found useful as cytogenetic markers. To help in banana sequence annotation, a specific Musa repeat database was created, and its utility was demonstrated by analyzing the repeat composition of 62 genomic BAC clones. A low-depth 454 sequencing of banana nuclear genome provided the largest amount of DNA sequence data available until now for Musa and permitted reconstruction of most of the major types of DNA repeats. The information obtained in this study improves the knowledge of the long-range organization of banana chromosomes, and provides sequence resources needed for repeat masking and annotation during the Musa genome sequencing project. It also provides sequence data for isolation of DNA markers to be used in genetic diversity studies and in marker-assisted selection.
Repetitive part of the banana (Musa acuminata) genome investigated by low-depth 454 sequencing
2010-01-01
Background Bananas and plantains (Musa spp.) are grown in more than a hundred tropical and subtropical countries and provide staple food for hundreds of millions of people. They are seed-sterile crops propagated clonally and this makes them vulnerable to a rapid spread of devastating diseases and at the same time hampers breeding improved cultivars. Although the socio-economic importance of bananas and plantains cannot be overestimated, they remain outside the focus of major research programs. This slows down the study of nuclear genome and the development of molecular tools to facilitate banana improvement. Results In this work, we report on the first thorough characterization of the repeat component of the banana (M. acuminata cv. 'Calcutta 4') genome. Analysis of almost 100 Mb of sequence data (0.15× genome coverage) permitted partial sequence reconstruction and characterization of repetitive DNA, making up about 30% of the genome. The results showed that the banana repeats are predominantly made of various types of Ty1/copia and Ty3/gypsy retroelements representing 16 and 7% of the genome respectively. On the other hand, DNA transposons were found to be rare. In addition to new families of transposable elements, two new satellite repeats were discovered and found useful as cytogenetic markers. To help in banana sequence annotation, a specific Musa repeat database was created, and its utility was demonstrated by analyzing the repeat composition of 62 genomic BAC clones. Conclusion A low-depth 454 sequencing of banana nuclear genome provided the largest amount of DNA sequence data available until now for Musa and permitted reconstruction of most of the major types of DNA repeats. The information obtained in this study improves the knowledge of the long-range organization of banana chromosomes, and provides sequence resources needed for repeat masking and annotation during the Musa genome sequencing project. It also provides sequence data for isolation of DNA markers to be used in genetic diversity studies and in marker-assisted selection. PMID:20846365
Liston, A; Robinson, W A; Piñero, D; Alvarez-Buylla, E R
1999-02-01
A 650-bp portion of the nuclear ribosomal DNA internal transcribed spacer region was sequenced in 47 species of Pinus, representing all recognized subsections of the genus, and 2 species of Picea and Cathaya as outgroups. Parsimony analyses of these length variable sequences were conducted using a manual alignment, 13 different automated alignments, elision of the automated alignments, and exclusion of all alignment ambiguous sites. High and moderately supported clades were consistently resolved across the different analyses, while poorly supported clades were inconsistently recovered. Comparison of the topologies highlights taxa of particularly problematic placement including Pinus nelsonii and P. aristata. Within subgenus Pinus, there is moderate support for the monophyly of a narrowly circumscribed subsect. Pinus (=subsect. Sylvestres) and strong support for a clade of North and Central American hard pines. The Himalayan P. roxburghii may be sister species to these "New World hard pines," which have two well-supported subgroups, subsect. Ponderosae and a clade of the remaining five subsections. The position of subsect. Contortae conflicts with its placement in a chloroplast DNA restriction site study. Within subgenus Strobus there is consistent support for the monophyly of a broadly circumscribed subsect. Strobi (including P. krempfii and a polyphyletic subsect. Cembrae) derived from a paraphyletic grade of the remaining soft pines. Relationships among subsects. Gerardianae, Cembroides, and Balfourianae are poorly resolved. Support for the monophyly of subgenus Pinus and subgenus Strobus is not consistently obtained. Copyright 1999 Academic Press.
RDNAnalyzer: A tool for DNA secondary structure prediction and sequence analysis.
Afzal, Muhammad; Shahid, Ahmad Ali; Shehzadi, Abida; Nadeem, Shahid; Husnain, Tayyab
2012-01-01
RDNAnalyzer is an innovative computer based tool designed for DNA secondary structure prediction and sequence analysis. It can randomly generate the DNA sequence or user can upload the sequences of their own interest in RAW format. It uses and extends the Nussinov dynamic programming algorithm and has various application for the sequence analysis. It predicts the DNA secondary structure and base pairings. It also provides the tools for routinely performed sequence analysis by the biological scientists such as DNA replication, reverse compliment generation, transcription, translation, sequence specific information as total number of nucleotide bases, ATGC base contents along with their respective percentages and sequence cleaner. RDNAnalyzer is a unique tool developed in Microsoft Visual Studio 2008 using Microsoft Visual C# and Windows Presentation Foundation and provides user friendly environment for sequence analysis. It is freely available. http://www.cemb.edu.pk/sw.html RDNAnalyzer - Random DNA Analyser, GUI - Graphical user interface, XAML - Extensible Application Markup Language.
Diversity of Basidiomycetes in Michigan Agricultural Soils▿
Lynch, Michael D. J.; Thorn, R. Greg
2006-01-01
We analyzed the communities of soil basidiomycetes in agroecosystems that differ in tillage history at the Kellogg Biological Station Long-Term Ecological Research site near Battle Creek, Michigan. The approach combined soil DNA extraction through a bead-beating method modified to increase recovery of fungal DNA, PCR amplification with basidiomycete-specific primers, cloning and restriction fragment length polymorphism screening of mixed PCR products, and sequencing of unique clones. Much greater diversity was detected than was anticipated in this habitat on the basis of culture-based methods or surveys of fruiting bodies. With “species” defined as organisms yielding PCR products with ≥99% identity in the 5′ 650 bases of the nuclear large-subunit ribosomal DNA, 241 “species” were detected among 409 unique basidiomycete sequences recovered. Almost all major clades of basidiomycetes from basidiomycetous yeasts and other heterobasidiomycetes through polypores and euagarics (gilled mushrooms and relatives) were represented, with a majority from the latter clade. Only 24 of 241 “species” had 99% or greater sequence similarity to named reference sequences in GenBank, and several clades with multiple “species” could not be identified at the genus level by phylogenetic comparisons with named sequences. The total estimated “species” richness for this 11.2-ha site was 367 “species” of basidiomycetes. Since >99% of the study area has not been sampled, the accuracy of our diversity estimate is uncertain. Replication in time and space is required to detect additional diversity and the underlying community structure. PMID:16950900
A revised timescale for human evolution based on ancient mitochondrial genomes
Johnson, Philip L.F.; Bos, Kirsten; Lari, Martina; Bollongino, Ruth; Sun, Chengkai; Giemsch, Liane; Schmitz, Ralf; Burger, Joachim; Ronchitelli, Anna Maria; Martini, Fabio; Cremonesi, Renata G.; Svoboda, Jiří; Bauer, Peter; Caramelli, David; Castellano, Sergi; Reich, David; Pääbo, Svante; Krause, Johannes
2016-01-01
Summary Background Recent analyses of de novo DNA mutations in modern humans have suggested a nuclear substitution rate that is approximately half that of previous estimates based on fossil calibration. This result has led to suggestions that major events in human evolution occurred far earlier than previously thought. Result Here we use mitochondrial genome sequences from 10 securely dated ancient modern humans spanning 40,000 years as calibration points for the mitochondrial clock, thus yielding a direct estimate of the mitochondrial substitution rate. Our clock yields mitochondrial divergence times that are in agreement with earlier estimates based on calibration points derived from either fossils or archaeological material. In particular, our results imply a separation of non-Africans from the most closely related sub-Saharan African mitochondrial DNAs (haplogroup L3) of less than 62,000-95,000 years ago. Conclusion Though single loci like mitochondrial DNA (mtDNA) can only provide biased estimates of population split times, they can provide valid upper bounds; our results exclude most of the older dates for African and non-African split times recently suggested by de novo mutation rate estimates in the nuclear genome. PMID:23523248
A revised timescale for human evolution based on ancient mitochondrial genomes.
Fu, Qiaomei; Mittnik, Alissa; Johnson, Philip L F; Bos, Kirsten; Lari, Martina; Bollongino, Ruth; Sun, Chengkai; Giemsch, Liane; Schmitz, Ralf; Burger, Joachim; Ronchitelli, Anna Maria; Martini, Fabio; Cremonesi, Renata G; Svoboda, Jiří; Bauer, Peter; Caramelli, David; Castellano, Sergi; Reich, David; Pääbo, Svante; Krause, Johannes
2013-04-08
Recent analyses of de novo DNA mutations in modern humans have suggested a nuclear substitution rate that is approximately half that of previous estimates based on fossil calibration. This result has led to suggestions that major events in human evolution occurred far earlier than previously thought. Here, we use mitochondrial genome sequences from ten securely dated ancient modern humans spanning 40,000 years as calibration points for the mitochondrial clock, thus yielding a direct estimate of the mitochondrial substitution rate. Our clock yields mitochondrial divergence times that are in agreement with earlier estimates based on calibration points derived from either fossils or archaeological material. In particular, our results imply a separation of non-Africans from the most closely related sub-Saharan African mitochondrial DNAs (haplogroup L3) that occurred less than 62-95 kya. Though single loci like mitochondrial DNA (mtDNA) can only provide biased estimates of population divergence times, they can provide valid upper bounds. Our results exclude most of the older dates for African and non-African population divergences recently suggested by de novo mutation rate estimates in the nuclear genome. Copyright © 2013 Elsevier Ltd. All rights reserved.
Stone, Anne C; Battistuzzi, Fabia U; Kubatko, Laura S; Perry, George H; Trudeau, Evan; Lin, Hsiuman; Kumar, Sudhir
2010-10-27
Here, we report the sequencing and analysis of eight complete mitochondrial genomes of chimpanzees (Pan troglodytes) from each of the three established subspecies (P. t. troglodytes, P. t. schweinfurthii and P. t. verus) and the proposed fourth subspecies (P. t. ellioti). Our population genetic analyses are consistent with neutral patterns of evolution that have been shaped by demography. The high levels of mtDNA diversity in western chimpanzees are unlike those seen at nuclear loci, which may reflect a demographic history of greater female to male effective population sizes possibly owing to the characteristics of the founding population. By using relaxed-clock methods, we have inferred a timetree of chimpanzee species and subspecies. The absolute divergence times vary based on the methods and calibration used, but relative divergence times show extensive uniformity. Overall, mtDNA produces consistently older times than those known from nuclear markers, a discrepancy that is reduced significantly by explicitly accounting for chimpanzee population structures in time estimation. Assuming the human-chimpanzee split to be between 7 and 5 Ma, chimpanzee time estimates are 2.1-1.5, 1.1-0.76 and 0.25-0.18 Ma for the chimpanzee/bonobo, western/(eastern + central) and eastern/central chimpanzee divergences, respectively.
Lenglez, Sandrine; Hermand, Damien; Decottignies, Anabelle
2010-01-01
Chromosomal double-strand breaks (DSBs) threaten genome integrity and repair of these lesions is often mutagenic. How and where DSBs are formed is a major question conveniently addressed in simple model organisms like yeast. NUMTs, nuclear DNA sequences of mitochondrial origin, are present in most eukaryotic genomes and probably result from the capture of mitochondrial DNA (mtDNA) fragments into chromosomal breaks. NUMT formation is ongoing and was reported to cause de novo human genetic diseases. Study of NUMTs is likely to contribute to the understanding of naturally occurring chromosomal breaks. We show that Schizosaccharomyces pombe NUMTs are exclusively located in noncoding regions with no preference for gene promoters and, when located into promoters, do not affect gene transcription level. Strikingly, most noncoding regions comprising NUMTs are also associated with a DNA replication origin (ORI). Chromatin immunoprecipitation experiments revealed that chromosomal NUMTs are probably not acting as ORI on their own but that mtDNA insertions occurred directly next to ORIs, suggesting that these loci may be prone to DSB formation. Accordingly, induction of excessive DNA replication origin firing, a phenomenon often associated with human tumor formation, resulted in frequent nucleotide deletion events within ORI3001 subtelomeric chromosomal locus, illustrating a novel aspect of DNA replication-driven genomic instability. How mtDNA is fragmented is another important issue that we addressed by sequencing experimentally induced NUMTs. This highlighted regions of S. pombe mtDNA prone to breaking. Together with an analysis of human NUMTs, we propose that these fragile sites in mtDNA may correspond to replication pause sites. PMID:20688779
Cristina Kenney, M.; Chwa, Marilyn; Atilano, Shari R.; Falatoonzadeh, Payam; Ramirez, Claudio; Malik, Deepika; Tarek, Mohamed; Cáceres-del-Carpio, Javier; Nesburn, Anthony B.; Boyer, David S.; Kuppermann, Baruch D.; Vawter, Marquis; Michal Jazwinski, S.; Miceli, Michael; Wallace, Douglas C.; Udar, Nitin
2014-01-01
Age-related macular degeneration (AMD) is the leading cause of vision loss in developed countries. While linked to genetic polymorphisms in the complement pathway, there are many individuals with high risk alleles that do not develop AMD, suggesting that other ‘modifiers’ may be involved. Mitochondrial (mt) haplogroups, defined by accumulations of specific mtDNA single nucleotide polymorphisms (SNPs) which represent population origins, may be one such modifier. J haplogroup has been associated with high risk for AMD while the H haplogroup is protective. It has been difficult to assign biological consequences for haplogroups so we created human ARPE-19 cybrids (cytoplasmic hybrids), which have identical nuclei but mitochondria of either J or H haplogroups, to investigate their effects upon bioenergetics and molecular pathways. J cybrids have altered bioenergetic profiles compared with H cybrids. Q-PCR analyses show significantly lower expression levels for seven respiratory complex genes encoded by mtDNA. J and H cybrids have significantly altered expression of eight nuclear genes of the alternative complement, inflammation and apoptosis pathways. Sequencing of the entire mtDNA was carried out for all the cybrids to identify haplogroup and non-haplogroup defining SNPs. mtDNA can mediate cellular bioenergetics and expression levels of nuclear genes related to complement, inflammation and apoptosis. Sequencing data suggest that observed effects are not due to rare mtDNA variants but rather the combination of SNPs representing the J versus H haplogroups. These findings represent a paradigm shift in our concepts of mt–nuclear interactions. PMID:24584571
NASA Technical Reports Server (NTRS)
Reddy, A. S.; Czernik, A. J.; An, G.; Poovaiah, B. W.
1992-01-01
We cloned and sequenced a plant cDNA that encodes U1 small nuclear ribonucleoprotein (snRNP) 70K protein. The plant U1 snRNP 70K protein cDNA is not full length and lacks the coding region for 68 amino acids in the amino-terminal region as compared to human U1 snRNP 70K protein. Comparison of the deduced amino acid sequence of the plant U1 snRNP 70K protein with the amino acid sequence of animal and yeast U1 snRNP 70K protein showed a high degree of homology. The plant U1 snRNP 70K protein is more closely related to the human counter part than to the yeast 70K protein. The carboxy-terminal half is less well conserved but, like the vertebrate 70K proteins, is rich in charged amino acids. Northern analysis with the RNA isolated from different parts of the plant indicates that the snRNP 70K gene is expressed in all of the parts tested. Southern blotting of genomic DNA using the cDNA indicates that the U1 snRNP 70K protein is coded by a single gene.
Conserved Sequences at the Origin of Adenovirus DNA Replication
Stillman, Bruce W.; Topp, William C.; Engler, Jeffrey A.
1982-01-01
The origin of adenovirus DNA replication lies within an inverted sequence repetition at either end of the linear, double-stranded viral DNA. Initiation of DNA replication is primed by a deoxynucleoside that is covalently linked to a protein, which remains bound to the newly synthesized DNA. We demonstrate that virion-derived DNA-protein complexes from five human adenovirus serological subgroups (A to E) can act as a template for both the initiation and the elongation of DNA replication in vitro, using nuclear extracts from adenovirus type 2 (Ad2)-infected HeLa cells. The heterologous template DNA-protein complexes were not as active as the homologous Ad2 DNA, most probably due to inefficient initiation by Ad2 replication factors. In an attempt to identify common features which may permit this replication, we have also sequenced the inverted terminal repeated DNA from human adenovirus serotypes Ad4 (group E), Ad9 and Ad10 (group D), and Ad31 (group A), and we have compared these to previously determined sequences from Ad2 and Ad5 (group C), Ad7 (group B), and Ad12 and Ad18 (group A) DNA. In all cases, the sequence around the origin of DNA replication can be divided into two structural domains: a proximal A · T-rich region which is partially conserved among these serotypes, and a distal G · C-rich region which is less well conserved. The G · C-rich region contains sequences similar to sequences present in papovavirus replication origins. The two domains may reflect a dual mechanism for initiation of DNA replication: adenovirus-specific protein priming of replication, and subsequent utilization of this primer by host replication factors for completion of DNA synthesis. Images PMID:7143575
Hoy, Marshal S.; Rodriguez, Rusty J.
2013-01-01
Molecular genetic analysis was conducted on two populations of the invasive non-native New Zealand mud snail (Potamopyrgus antipodarum), one from a freshwater ecosystem in Devil's Lake (Oregon, USA) and the other from an ecosystem of higher salinity in the Columbia River estuary (Hammond Harbor, Oregon, USA). To elucidate potential genetic differences between the two populations, three segments of nuclear ribosomal DNA (rDNA), the ITS1-ITS2 regions and the 18S and 28S rDNA genes were cloned and sequenced. Variant sequences within each individual were found in all three rDNA segments. Folding models were utilized for secondary structure analysis and results indicated that there were many sequences which contained structure-altering polymorphisms, which suggests they could be nonfunctional pseudogenes. In addition, analysis of molecular variance (AMOVA) was used for hierarchical analysis of genetic variance to estimate variation within and among populations and within individuals. AMOVA revealed significant variation in the ITS region between the populations and among clones within individuals, while in the 5.8S rDNA significant variation was revealed among individuals within the two populations. High levels of intragenomic variation were found in the ITS regions, which are known to be highly variable in many organisms. More interestingly, intragenomic variation was also found in the 18S and 28S rDNA, which has rarely been observed in animals and is so far unreported in Mollusca. We postulate that in these P. antipodarum populations the effects of concerted evolution are diminished due to the fact that not all of the rDNA genes in their polyploid genome should be essential for sustaining cellular function. This could lead to a lessening of selection pressures, allowing mutations to accumulate in some copies, changing them into variant sequences.
Coprolites as a source of information on the genome and diet of the cave hyena
Bon, Céline; Berthonaud, Véronique; Maksud, Frédéric; Labadie, Karine; Poulain, Julie; Artiguenave, François; Wincker, Patrick; Aury, Jean-Marc; Elalouf, Jean-Marc
2012-01-01
We performed high-throughput sequencing of DNA from fossilized faeces to evaluate this material as a source of information on the genome and diet of Pleistocene carnivores. We analysed coprolites derived from the extinct cave hyena (Crocuta crocuta spelaea), and sequenced 90 million DNA fragments from two specimens. The DNA reads enabled a reconstruction of the cave hyena mitochondrial genome with up to a 158-fold coverage. This genome, and those sequenced from extant spotted (Crocuta crocuta) and striped (Hyaena hyaena) hyena specimens, allows for the establishment of a robust phylogeny that supports a close relationship between the cave and the spotted hyena. We also demonstrate that high-throughput sequencing yields data for cave hyena multi-copy and single-copy nuclear genes, and that about 50 per cent of the coprolite DNA can be ascribed to this species. Analysing the data for additional species to indicate the cave hyena diet, we retrieved abundant sequences for the red deer (Cervus elaphus), and characterized its mitochondrial genome with up to a 3.8-fold coverage. In conclusion, we have demonstrated the presence of abundant ancient DNA in the coprolites surveyed. Shotgun sequencing of this material yielded a wealth of DNA sequences for a Pleistocene carnivore and allowed unbiased identification of diet. PMID:22456883
Kelly, Richard D. W.; Mahmud, Arsalan; McKenzie, Matthew; Trounce, Ian A.; St John, Justin C.
2012-01-01
DNA methylation is an essential mechanism controlling gene expression during differentiation and development. We investigated the epigenetic regulation of the nuclear-encoded, mitochondrial DNA (mtDNA) polymerase γ catalytic subunit (PolgA) by examining the methylation status of a CpG island within exon 2 of PolgA. Bisulphite sequencing identified low methylation levels (<10%) within exon 2 of mouse oocytes, blastocysts and embryonic stem cells (ESCs), while somatic tissues contained significantly higher levels (>40%). In contrast, induced pluripotent stem (iPS) cells and somatic nuclear transfer ESCs were hypermethylated (>20%), indicating abnormal epigenetic reprogramming. Real time PCR analysis of 5-methylcytosine (5mC) and 5-hydroxymethylcytosine (5hmC) immunoprecipitated DNA suggests active DNA methylation and demethylation within exon 2 of PolgA. Moreover, neural differentiation of ESCs promoted de novo methylation and demethylation at the exon 2 locus. Regression analysis demonstrates that cell-specific PolgA expression levels were negatively correlated with DNA methylation within exon 2 and mtDNA copy number. Finally, using chromatin immunoprecipitation (ChIP) against RNA polymerase II (RNApII) phosphorylated on serine 2, we show increased DNA methylation levels are associated with reduced RNApII transcriptional elongation. This is the first study linking nuclear DNA epigenetic regulation with mtDNA regulation during differentiation and cell specialization. PMID:22941637
Abstracts for student symposium
DOE Office of Scientific and Technical Information (OSTI.GOV)
Goldman, B.
Lawrence Livermore National Laboratory Science and Engineering Research Semester (SERS) students are participants in a national program sponsored by the DOE Office of Energy Research. Presented topics from Fall 1993 include: Laser glass, wiring codes, lead in food and food containers, chromium removal from ground water, fiber optic sensors for ph measurement, CFC replacement, predator/prey simulation, detection of micronuclei in germ cells, DNA conformation, stimulated brillouin scattering, DNA sequencing, evaluation of education programs, neural network analysis of nuclear glass, lithium ion batteries, Indonesian snails, optical switching systems, and photoreceiver design. Individual papers are indexed separately on the Energy Data Base.
Pasion, S G; Hines, J C; Aebersold, R; Ray, D S
1992-01-01
A type II DNA topoisomerase, topoIImt, was shown previously to be associated with the kinetoplast DNA of the trypanosomatid Crithidia fasciculata. The gene encoding this kinetoplast-associated topoisomerase has been cloned by immunological screening of a Crithidia genomic expression library with monoclonal antibodies raised against the purified enzyme. The gene CfaTOP2 is a single copy gene and is expressed as a 4.8-kb polyadenylated transcript. The nucleotide sequence of CfaTOP2 has been determined and encodes a predicted polypeptide of 1239 amino acids with a molecular mass of 138,445. The identification of the cloned gene is supported by immunoblot analysis of the beta-galactosidase-CfaTOP2 fusion protein expressed in Escherichia coli and by analysis of tryptic peptide sequences derived from purified topoIImt. CfaTOP2 shares significant homology with nuclear type II DNA topoisomerases of other eukaryotes suggesting that in Crithidia both nuclear and mitochondrial forms of topoisomerase II are encoded by the same gene.
Zlopasa, Livija; Brachner, Andreas; Foisner, Roland
2016-06-01
Ankyrin repeats and LEM domain containing protein 1 (Ankle1) belongs to the LEM protein family, whose members share a chromatin-interacting LEM motif. Unlike most other LEM proteins, Ankle1 is not an integral protein of the inner nuclear membrane but shuttles between the nucleus and the cytoplasm. It contains a GIY-YIG-type nuclease domain, but its function is unknown. The mammalian genome encodes only one other GIY-YIG domain protein, termed Slx1. Slx1 has been described as a resolvase that processes Holliday junctions during homologous recombination-mediated DNA double strand break repair. Resolvase activity is regulated in a spatial and temporal manner during the cell cycle. We hypothesized that Ankle1 may have a similar function and its nucleo-cytoplasmic shuttling may contribute to the regulation of Ankle1 activity. Hence, we aimed at identifying the domains mediating Ankle1 shuttling and investigating whether cellular localization is affected during DNA damage response. Sequence analysis predicts the presence of two canonical nuclear import and export signals in Ankle1. Immunofluorescence microscopy of cells expressing wild-type and various mutated Ankle1-fusion proteins revealed a C-terminally located classical monopartite nuclear localization signal and a centrally located CRM1-dependent nuclear export signal that mediate nucleo-cytoplasmic shuttling of Ankle1. These sequences are also functional in heterologous proteins. The predominant localization of Ankle1 in the cytoplasm, however, does not change upon induction of several DNA damage response pathways throughout the cell cycle. We identified the domains mediating nuclear import and export of Ankle1. Ankle1's cellular localization was not affected following DNA damage.
Intra-isolate genome variation in arbuscular mycorrhizal fungi persists in the transcriptome.
Boon, E; Zimmerman, E; Lang, B F; Hijri, M
2010-07-01
Arbuscular mycorrhizal fungi (AMF) are heterokaryotes with an unusual genetic makeup. Substantial genetic variation occurs among nuclei within a single mycelium or isolate. AMF reproduce through spores that contain varying fractions of this heterogeneous population of nuclei. It is not clear whether this genetic variation on the genome level actually contributes to the AMF phenotype. To investigate the extent to which polymorphisms in nuclear genes are transcribed, we analysed the intra-isolate genomic and cDNA sequence variation of two genes, the large subunit ribosomal RNA (LSU rDNA) of Glomus sp. DAOM-197198 (previously known as G. intraradices) and the POL1-like sequence (PLS) of Glomus etunicatum. For both genes, we find high sequence variation at the genome and transcriptome level. Reconstruction of LSU rDNA secondary structure shows that all variants are functional. Patterns of PLS sequence polymorphism indicate that there is one functional gene copy, PLS2, which is preferentially transcribed, and one gene copy, PLS1, which is a pseudogene. This is the first study that investigates AMF intra-isolate variation at the transcriptome level. In conclusion, it is possible that, in AMF, multiple nuclear genomes contribute to a single phenotype.
Degaki, Theri Leica; Demasi, Marcos Angelo Almeida; Sogayar, Mari Cleide
2009-11-01
Upon searching for glucocorticoid-regulated cDNA sequences associated with the transformed to normal phenotypic reversion of C6/ST1 rat glioma cells, we identified Nrp/b (nuclear restrict protein in brain) as a novel rat gene. Here we report on the identification and functional characterization of the complete sequence encoding the rat NRP/B protein. The cloned cDNA presented a 1767 nucleotides open-reading frame encoding a 589 amino acids residues sequence containing a BTB/POZ (broad complex Tramtrack bric-a-brac/Pox virus and zinc finger) domain in its N-terminal region and kelch motifs in its C-terminal region. Sequence analysis indicates that the rat Nrp/b displays a high level of identity with the equivalent gene orthologs from other organisms. Among rat tissues, Nrp/b expression is more pronounced in brain tissue. We show that overexpression of the Nrp/b cDNA in C6/ST1 cells suppresses anchorage independence in vitro and tumorigenicity in vivo, altering their malignant nature towards a more benign phenotype. Therefore, Nrp/b may be postulated as a novel tumor suppressor gene, with possible relevance for glioblastoma therapy.
Kang, Seokha; Sultana, Tahera; Eom, Keeseon S; Park, Yung Chul; Soonthornpong, Nathan; Nadler, Steven A; Park, Joong-Ki
2009-01-15
The complete mitochondrial genome sequence was determined for the human pinworm Enterobius vermicularis (Oxyurida: Nematoda) and used to infer its phylogenetic relationship to other major groups of chromadorean nematodes. The E. vermicularis genome is a 14,010-bp circular DNA molecule that encodes 36 genes (12 proteins, 22 tRNAs, and 2 rRNAs). This mtDNA genome lacks atp8, as reported for almost all other nematode species investigated. Phylogenetic analyses (maximum parsimony, maximum likelihood, neighbor joining, and Bayesian inference) of nucleotide sequences for the 12 protein-coding genes of 25 nematode species placed E. vermicularis, a representative of the order Oxyurida, as sister to the main Ascaridida+Rhabditida group. Tree topology comparisons using statistical tests rejected an alternative hypothesis favoring a closer relationship among Ascaridida, Spirurida, and Oxyurida, which has been supported from most studies based on nuclear ribosomal DNA sequences. Unlike the relatively conserved gene arrangement found for most chromadorean taxa, E. vermicularis mtDNA gene order is very unique, not sharing similarity to any other nematode species reported to date. This lack of gene order similarity may represent idiosyncratic gene rearrangements unique to this specific lineage of the oxyurids. To more fully understand the extent of gene rearrangement and its evolutionary significance within the nematode phylogenetic framework, additional mitochondrial genomes representing a greater evolutionary diversity of species must be characterized.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kim, Seongman; Chul Ahn, Byung; O'Callaghan, Dennis J.
2012-10-25
The amino acid sequence of the UL31 protein (UL31P) of equine herpesvirus 1 (EHV-1) has homology to that of the ICP8 of herpes simplex virus type 1 (HSV-1). Here we show that the UL31 gene is synergistically trans-activated by the IEP and the UL5P (EICP27). Detection of the UL31 RNA transcript and the UL31P in EHV-1-infected cells at 6 h post-infection (hpi) as well as metabolic inhibition assays indicated that UL31 is an early gene. The UL31P preferentially bound to single-stranded DNA over double-stranded DNA in gel shift assays. Subcellular localization of the green fluorescent protein (GFP)-UL31 fusion proteins revealedmore » that the C-terminal 32 amino acid residues of the UL31P are responsible for the nuclear localization. These findings may contribute to defining the role of the UL31P single-stranded DNA-binding protein in EHV-1 DNA replication.« less
Saccharomyces cerevisiae SSB1 protein and its relationship to nucleolar RNA-binding proteins.
Jong, A Y; Clark, M W; Gilbert, M; Oehm, A; Campbell, J L
1987-08-01
To better define the function of Saccharomyces cerevisiae SSB1, an abundant single-stranded nucleic acid-binding protein, we determined the nucleotide sequence of the SSB1 gene and compared it with those of other proteins of known function. The amino acid sequence contains 293 amino acid residues and has an Mr of 32,853. There are several stretches of sequence characteristic of other eucaryotic single-stranded nucleic acid-binding proteins. At the amino terminus, residues 39 to 54 are highly homologous to a peptide in calf thymus UP1 and UP2 and a human heterogeneous nuclear ribonucleoprotein. Residues 125 to 162 constitute a fivefold tandem repeat of the sequence RGGFRG, the composition of which suggests a nucleic acid-binding site. Near the C terminus, residues 233 to 245 are homologous to several RNA-binding proteins. Of 18 C-terminal residues, 10 are acidic, a characteristic of the procaryotic single-stranded DNA-binding proteins and eucaryotic DNA- and RNA-binding proteins. In addition, examination of the subcellular distribution of SSB1 by immunofluorescence microscopy indicated that SSB1 is a nuclear protein, predominantly located in the nucleolus. Sequence homologies and the nucleolar localization make it likely that SSB1 functions in RNA metabolism in vivo, although an additional role in DNA metabolism cannot be excluded.
Nacheva, Elizabeth; Mokretar, Katya; Soenmez, Aynur; Pittman, Alan M; Grace, Colin; Valli, Roberto; Ejaz, Ayesha; Vattathil, Selina; Maserati, Emanuela; Houlden, Henry; Taanman, Jan-Willem; Schapira, Anthony H; Proukakis, Christos
2017-01-01
Potential bias introduced during DNA isolation is inadequately explored, although it could have significant impact on downstream analysis. To investigate this in human brain, we isolated DNA from cerebellum and frontal cortex using spin columns under different conditions, and salting-out. We first analysed DNA using array CGH, which revealed a striking wave pattern suggesting primarily GC-rich cerebellar losses, even against matched frontal cortex DNA, with a similar pattern on a SNP array. The aCGH changes varied with the isolation protocol. Droplet digital PCR of two genes also showed protocol-dependent losses. Whole genome sequencing showed GC-dependent variation in coverage with spin column isolation from cerebellum. We also extracted and sequenced DNA from substantia nigra using salting-out and phenol / chloroform. The mtDNA copy number, assessed by reads mapping to the mitochondrial genome, was higher in substantia nigra when using phenol / chloroform. We thus provide evidence for significant method-dependent bias in DNA isolation from human brain, as reported in rat tissues. This may contribute to array "waves", and could affect copy number determination, particularly if mosaicism is being sought, and sequencing coverage. Variations in isolation protocol may also affect apparent mtDNA abundance.
Nacheva, Elizabeth; Mokretar, Katya; Soenmez, Aynur; Pittman, Alan M.; Grace, Colin; Valli, Roberto; Ejaz, Ayesha; Vattathil, Selina; Maserati, Emanuela; Houlden, Henry; Taanman, Jan-Willem; Schapira, Anthony H.
2017-01-01
Potential bias introduced during DNA isolation is inadequately explored, although it could have significant impact on downstream analysis. To investigate this in human brain, we isolated DNA from cerebellum and frontal cortex using spin columns under different conditions, and salting-out. We first analysed DNA using array CGH, which revealed a striking wave pattern suggesting primarily GC-rich cerebellar losses, even against matched frontal cortex DNA, with a similar pattern on a SNP array. The aCGH changes varied with the isolation protocol. Droplet digital PCR of two genes also showed protocol-dependent losses. Whole genome sequencing showed GC-dependent variation in coverage with spin column isolation from cerebellum. We also extracted and sequenced DNA from substantia nigra using salting-out and phenol / chloroform. The mtDNA copy number, assessed by reads mapping to the mitochondrial genome, was higher in substantia nigra when using phenol / chloroform. We thus provide evidence for significant method-dependent bias in DNA isolation from human brain, as reported in rat tissues. This may contribute to array “waves”, and could affect copy number determination, particularly if mosaicism is being sought, and sequencing coverage. Variations in isolation protocol may also affect apparent mtDNA abundance. PMID:28683077
Ferri, D V; Munhoz, C F; Neves, P M O; Ferracin, L M; Sartori, D; Vieira, M L C; Fungaro, M H P
2012-12-01
The banana weevil Cosmopolites sordidus (Germar) is one of a number of pests that attack banana crops. The use of the entomopathogenic fungus Beauveria bassiana as a biological control agent for this pest may contribute towards reducing the application of chemical insecticides on banana crops. In this study, the genetic variability of a collection of Brazilian isolates of B. bassiana was evaluated. Samples were obtained from various geographic regions of Brazil, and from different hosts of the Curculionidae family. Based on the DNA fingerprints generated by RAPD and AFLP, we found that 92 and 88 % of the loci were polymorphic, respectively. The B. bassiana isolates were attributed to two genotypic clusters based on the RAPD data, and to three genotypic clusters, when analyzed with AFLP. The nucleotide sequences of nuclear ribosomal DNA intergenic spacers confirmed that all isolates are in fact B. bassiana. Analysis of molecular variance showed that variability among the isolates was not correlated with geographic origin or hosts. A RAPD-specific marker for isolate CG 1024, which is highly virulent to C. sordidus, was cloned and sequenced. Based on the sequences obtained, specific PCR primers BbasCG1024F (5'-TGC GGC TGA GGA GGA CT-3') and BbasCG1024R (5'-TGC GGC TGA GTG TAG AAC-3') were designed for detecting and monitoring this isolate in the field.
Silva-Santiago, Evangelina; Pardo, Juan Pablo; Hernández-Muñoz, Rolando; Aranda-Anzaldo, Armando
2017-01-15
During the interphase the nuclear DNA of metazoan cells is organized in supercoiled loops anchored to constituents of a nuclear substructure or compartment known as the nuclear matrix. The stable interactions between DNA and the nuclear matrix (NM) correspond to a set of topological relationships that define a nuclear higher-order structure (NHOS). Current evidence suggests that the NHOS is cell-type-specific. Biophysical evidence and theoretical models suggest that thermodynamic and structural constraints drive the actualization of DNA-NM interactions. However, if the topological relationships between DNA and the NM were the subject of any biological constraint with functional significance then they must be adaptive and thus be positively selected by natural selection and they should be reasonably conserved, at least within closely related species. We carried out a coarse-grained, comparative evaluation of the DNA-NM topological relationships in primary hepatocytes from two closely related mammals: rat and mouse, by determining the relative position to the NM of a limited set of target sequences corresponding to highly-conserved genomic regions that also represent a sample of distinct chromosome territories within the interphase nucleus. Our results indicate that the pattern of topological relationships between DNA and the NM is not conserved between the hepatocytes of the two closely related species, suggesting that the NHOS, like the karyotype, is species-specific. Copyright © 2016 Elsevier B.V. All rights reserved.
From America to Eurasia: a multigenomes history of the genus Abies.
Semerikova, Svetlana A; Khrunyk, Yuliya Y; Lascoux, Martin; Semerikov, Vladimir L
2018-03-15
The origin of conifer genera, the main components of mountain temperate and boreal forests, was deemed to arise in the Mesozoic, although paleontological records and molecular data point to a recent diversification, presumably related to Neogene cooling. The geographical area(s) where the modern lines of conifers emerged remains uncertain, as is the sequence of events leading to their present distribution. To gain further insights into the biogeography of firs (Abies), we conducted phylogenetic analyses of chloroplast, mitochondrial and nuclear markers. The species tree, generated from ten single-copy nuclear genes, yielded probably the best phylogenetic hypothesis available for Abies. The tree obtained from five regions of chloroplast DNA largely corresponded to the nuclear species tree. Ancestral area reconstructions based on fossil calibrated chloroplast DNA and nuclear DNA trees pointed to repeated intercontinental migrations. The mitochondrial DNA haplotype tree, however, disagreed with nuclear and chloroplast DNA trees. It consisted of two clusters: one included mainly American haplotypes, while the other was composed of only Eurasian haplotypes. Presumably, this conflict is due to inter-continental migrations and introgressive hybridization, accompanied by the capture of the mitotypes from aboriginal species by the invading firs. Given that several species inhabiting Northeastern Asia carry American mitotypes and mutations typical for the American cluster, whereas no Asian mitotypes were detected within the American species, we hypothesize that Abies migrated from America to Eurasia, but not in the opposite direction. The direction and age of intercontinental migrations in firs are congruent with other conifers, such as spruces and pines of subsection Strobus, suggesting that these events had the same cause. Copyright © 2018 Elsevier Inc. All rights reserved.
Method for sequencing DNA base pairs
Sessler, Andrew M.; Dawson, John
1993-01-01
The base pairs of a DNA structure are sequenced with the use of a scanning tunneling microscope (STM). The DNA structure is scanned by the STM probe tip, and, as it is being scanned, the DNA structure is separately subjected to a sequence of infrared radiation from four different sources, each source being selected to preferentially excite one of the four different bases in the DNA structure. Each particular base being scanned is subjected to such sequence of infrared radiation from the four different sources as that particular base is being scanned. The DNA structure as a whole is separately imaged for each subjection thereof to radiation from one only of each source.
Sequencing of adenine in DNA by scanning tunneling microscopy
NASA Astrophysics Data System (ADS)
Tanaka, Hiroyuki; Taniguchi, Masateru
2017-08-01
The development of DNA sequencing technology utilizing the detection of a tunnel current is important for next-generation sequencer technologies based on single-molecule analysis technology. Using a scanning tunneling microscope, we previously reported that dI/dV measurements and dI/dV mapping revealed that the guanine base (purine base) of DNA adsorbed onto the Cu(111) surface has a characteristic peak at V s = -1.6 V. If, in addition to guanine, the other purine base of DNA, namely, adenine, can be distinguished, then by reading all the purine bases of each single strand of a DNA double helix, the entire base sequence of the original double helix can be determined due to the complementarity of the DNA base pair. Therefore, the ability to read adenine is important from the viewpoint of sequencing. Here, we report on the identification of adenine by STM topographic and spectroscopic measurements using a synthetic DNA oligomer and viral DNA.
A novel method of genomic DNA extraction for Cactaceae1
Fehlberg, Shannon D.; Allen, Jessica M.; Church, Kathleen
2013-01-01
• Premise of the study: Genetic studies of Cactaceae can at times be impeded by difficult sampling logistics and/or high mucilage content in tissues. Simplifying sampling and DNA isolation through the use of cactus spines has not previously been investigated. • Methods and Results: Several protocols for extracting DNA from spines were tested and modified to maximize yield, amplification, and sequencing. Sampling of and extraction from spines resulted in a simplified protocol overall and complete avoidance of mucilage as compared to typical tissue extractions. Sequences from one nuclear and three plastid regions were obtained across eight genera and 20 species of cacti using DNA extracted from spines. • Conclusions: Genomic DNA useful for amplification and sequencing can be obtained from cactus spines. The protocols described here are valuable for any cactus species, but are particularly useful for investigators interested in sampling living collections, extensive field sampling, and/or conservation genetic studies. PMID:25202521
Ridley, R G; Patel, H V; Gerber, G E; Morton, R C; Freeman, K B
1986-01-01
A cDNA clone spanning the entire amino acid sequence of the nuclear-encoded uncoupling protein of rat brown adipose tissue mitochondria has been isolated and sequenced. With the exception of the N-terminal methionine the deduced N-terminus of the newly synthesized uncoupling protein is identical to the N-terminal 30 amino acids of the native uncoupling protein as determined by protein sequencing. This proves that the protein contains no N-terminal mitochondrial targeting prepiece and that a targeting region must reside within the amino acid sequence of the mature protein. Images PMID:3012461
NASA Astrophysics Data System (ADS)
Lestari, D.; Bustamam, A.; Novianti, T.; Ardaneswari, G.
2017-07-01
DNA sequence can be defined as a succession of letters, representing the order of nucleotides within DNA, using a permutation of four DNA base codes including adenine (A), guanine (G), cytosine (C), and thymine (T). The precise code of the sequences is determined using DNA sequencing methods and technologies, which have been developed since the 1970s and currently become highly developed, advanced and highly throughput sequencing technologies. So far, DNA sequencing has greatly accelerated biological and medical research and discovery. However, in some cases DNA sequencing could produce any ambiguous and not clear enough sequencing results that make them quite difficult to be determined whether these codes are A, T, G, or C. To solve these problems, in this study we can introduce other representation of DNA codes namely Quaternion Q = (PA, PT, PG, PC), where PA, PT, PG, PC are the probability of A, T, G, C bases that could appear in Q and PA + PT + PG + PC = 1. Furthermore, using Quaternion representations we are able to construct the improved scoring matrix for global sequence alignment processes, by applying a dot product method. Moreover, this scoring matrix produces better and higher quality of the match and mismatch score between two DNA base codes. In implementation, we applied the Needleman-Wunsch global sequence alignment algorithm using Octave, to analyze our target sequence which contains some ambiguous sequence data. The subject sequences are the DNA sequences of Streptococcus pneumoniae families obtained from the Genebank, meanwhile the target DNA sequence are received from our collaborator database. As the results we found the Quaternion representations improve the quality of the sequence alignment score and we can conclude that DNA sequence target has maximum similarity with Streptococcus pneumoniae.
Schwenk, K; Posada, D; Hebert, P D
2000-01-01
We examined phylogenetic relationships among Daphnia using mitochondrial DNA (mtDNA) sequences from the small subunit ribosomal RNA (12S), cytochrome c oxidase subunit I and nuclear DNA sequences from the first and second internal transcribed spacer representing 1612 base positions. Phylogenetic analyses using several species of the three main Daphnia subgenera, Ctenodaphnia, Hyalodaphnia and Daphnia, revealed that the Hyalodaphnia are a monophyletic sister group of the Daphnia. Most Hyalodaphnia species occur on one continent, whereas only three are found in North America and Europe. Endemicity of species is associated with variation in thermal tolerance and habitat differentiation. Although many species of the Hyalodaphnia are known to hybridize in nature, mtDNA divergence is relatively high ca. 9%) compared to other hybridizing arthropods (ca. 3%). Reproductive isolation in Daphnia seems to evolve significantly slower than genetic isolation. We related these findings to what is known about the ecology and genetics of Daphnia in order to better understand the evolutionary diversification of lineages. The relationship of these data to phylogenetic patterns is discussed in the context of speciation processes in Daphnia. PMID:11052533
Baird, Amy B; Braun, Janet K; Engstrom, Mark D; Holbert, Ashlyn C; Huerta, Maritza G; Lim, Burton K; Mares, Michael A; Patton, John C; Bickham, John W
2017-01-01
Previous studies on genetics of hoary bats produced differing conclusions on the timing of their colonization of the Hawaiian Islands and whether or not North American (Aeorestes cinereus) and Hawaiian (A. semotus) hoary bats are distinct species. One study, using mtDNA COI and nuclear Rag2 and CMA1, concluded that hoary bats colonized the Hawaiian Islands no more than 10,000 years ago based on indications of population expansion at that time using Extended Bayesian Skyline Plots. The other study, using 3 mtDNA and 1 Y-chromosome locus, concluded that the Hawaiian Islands were colonized about 1 million years ago. To address the marked inconsistencies between those studies, we examined DNA sequences from 4 mitochondrial and 2 nuclear loci in lasiurine bats to investigate the timing of colonization of the Hawaiian Islands by hoary bats, test the hypothesis that Hawaiian and North American hoary bats belong to different species, and further investigate the generic level taxonomy within the tribe. Phylogenetic analysis and dating of the nodes of mtDNA haplotypes and of nuclear CMA1 alleles show that A. semotus invaded the Hawaiian Islands approximately 1.35 Ma and that multiple arrivals of A. cinereus occurred much more recently. Extended Bayesian Skyline plots show population expansion at about 20,000 years ago in the Hawaiian Islands, which we conclude does not represent the timing of colonization of the Hawaiian Islands given the high degree of genetic differentiation among A. cinereus and A. semotus (4.2% divergence at mtDNA Cytb) and the high degree of genetic diversity within A. semotus. Rather, population expansion 20,000 years ago could have resulted from colonization of additional islands, expansion after a bottleneck, or other factors. New genetic data also support the recognition of A. semotus and A. cinereus as distinct species, a finding consistent with previous morphological and behavioral studies. The phylogenetic analysis of CMA1 alleles shows the presence of 2 clades that are primarily associated with A. semotus mtDNA haplotypes, and are unique to the Hawaiian Islands. There is evidence for low levels of hybridization between A. semotus and A. cinereus on the Hawaiian Islands, but it is not extensive (<15% of individuals are of hybrid origin), and clearly each species is able to maintain its own genetic distinctiveness. Both mtDNA and nuclear DNA sequences show deep divergence between the 3 groups (genera) of lasiurine bats that correspond to the previously recognized morphological differences between them. We show that the Tribe Lasiurini contains the genera Aeorestes (hoary bats), Lasiurus (red bats), and Dasypterus (yellow bats).
Braun, Janet K.; Engstrom, Mark D.; Holbert, Ashlyn C.; Huerta, Maritza G.; Lim, Burton K.; Mares, Michael A.; Patton, John C.
2017-01-01
Previous studies on genetics of hoary bats produced differing conclusions on the timing of their colonization of the Hawaiian Islands and whether or not North American (Aeorestes cinereus) and Hawaiian (A. semotus) hoary bats are distinct species. One study, using mtDNA COI and nuclear Rag2 and CMA1, concluded that hoary bats colonized the Hawaiian Islands no more than 10,000 years ago based on indications of population expansion at that time using Extended Bayesian Skyline Plots. The other study, using 3 mtDNA and 1 Y-chromosome locus, concluded that the Hawaiian Islands were colonized about 1 million years ago. To address the marked inconsistencies between those studies, we examined DNA sequences from 4 mitochondrial and 2 nuclear loci in lasiurine bats to investigate the timing of colonization of the Hawaiian Islands by hoary bats, test the hypothesis that Hawaiian and North American hoary bats belong to different species, and further investigate the generic level taxonomy within the tribe. Phylogenetic analysis and dating of the nodes of mtDNA haplotypes and of nuclear CMA1 alleles show that A. semotus invaded the Hawaiian Islands approximately 1.35 Ma and that multiple arrivals of A. cinereus occurred much more recently. Extended Bayesian Skyline plots show population expansion at about 20,000 years ago in the Hawaiian Islands, which we conclude does not represent the timing of colonization of the Hawaiian Islands given the high degree of genetic differentiation among A. cinereus and A. semotus (4.2% divergence at mtDNA Cytb) and the high degree of genetic diversity within A. semotus. Rather, population expansion 20,000 years ago could have resulted from colonization of additional islands, expansion after a bottleneck, or other factors. New genetic data also support the recognition of A. semotus and A. cinereus as distinct species, a finding consistent with previous morphological and behavioral studies. The phylogenetic analysis of CMA1 alleles shows the presence of 2 clades that are primarily associated with A. semotus mtDNA haplotypes, and are unique to the Hawaiian Islands. There is evidence for low levels of hybridization between A. semotus and A. cinereus on the Hawaiian Islands, but it is not extensive (<15% of individuals are of hybrid origin), and clearly each species is able to maintain its own genetic distinctiveness. Both mtDNA and nuclear DNA sequences show deep divergence between the 3 groups (genera) of lasiurine bats that correspond to the previously recognized morphological differences between them. We show that the Tribe Lasiurini contains the genera Aeorestes (hoary bats), Lasiurus (red bats), and Dasypterus (yellow bats). PMID:29020097
An evolution based biosensor receptor DNA sequence generation algorithm.
Kim, Eungyeong; Lee, Malrey; Gatton, Thomas M; Lee, Jaewan; Zang, Yupeng
2010-01-01
A biosensor is composed of a bioreceptor, an associated recognition molecule, and a signal transducer that can selectively detect target substances for analysis. DNA based biosensors utilize receptor molecules that allow hybridization with the target analyte. However, most DNA biosensor research uses oligonucleotides as the target analytes and does not address the potential problems of real samples. The identification of recognition molecules suitable for real target analyte samples is an important step towards further development of DNA biosensors. This study examines the characteristics of DNA used as bioreceptors and proposes a hybrid evolution-based DNA sequence generating algorithm, based on DNA computing, to identify suitable DNA bioreceptor recognition molecules for stable hybridization with real target substances. The Traveling Salesman Problem (TSP) approach is applied in the proposed algorithm to evaluate the safety and fitness of the generated DNA sequences. This approach improves efficiency and stability for enhanced and variable-length DNA sequence generation and allows extension to generation of variable-length DNA sequences with diverse receptor recognition requirements.
RDNAnalyzer: A tool for DNA secondary structure prediction and sequence analysis
Afzal, Muhammad; Shahid, Ahmad Ali; Shehzadi, Abida; Nadeem, Shahid; Husnain, Tayyab
2012-01-01
RDNAnalyzer is an innovative computer based tool designed for DNA secondary structure prediction and sequence analysis. It can randomly generate the DNA sequence or user can upload the sequences of their own interest in RAW format. It uses and extends the Nussinov dynamic programming algorithm and has various application for the sequence analysis. It predicts the DNA secondary structure and base pairings. It also provides the tools for routinely performed sequence analysis by the biological scientists such as DNA replication, reverse compliment generation, transcription, translation, sequence specific information as total number of nucleotide bases, ATGC base contents along with their respective percentages and sequence cleaner. RDNAnalyzer is a unique tool developed in Microsoft Visual Studio 2008 using Microsoft Visual C# and Windows Presentation Foundation and provides user friendly environment for sequence analysis. It is freely available. Availability http://www.cemb.edu.pk/sw.html Abbreviations RDNAnalyzer - Random DNA Analyser, GUI - Graphical user interface, XAML - Extensible Application Markup Language. PMID:23055611
The problems and promise of DNA barcodes for species diagnosis of primate biomaterials
Lorenz, Joseph G; Jackson, Whitney E; Beck, Jeanne C; Hanner, Robert
2005-01-01
The Integrated Primate Biomaterials and Information Resource (www.IPBIR.org) provides essential research reagents to the scientific community by establishing, verifying, maintaining, and distributing DNA and RNA derived from primate cell cultures. The IPBIR uses mitochondrial cytochrome c oxidase subunit I sequences to verify the identity of samples for quality control purposes in the accession, cell culture, DNA extraction processes and prior to shipping to end users. As a result, IPBIR is accumulating a database of ‘DNA barcodes’ for many species of primates. However, this quality control process is complicated by taxon specific patterns of ‘universal primer’ failure, as well as the amplification or co-amplification of nuclear pseudogenes of mitochondrial origins. To overcome these difficulties, taxon specific primers have been developed, and reverse transcriptase PCR is utilized to exclude these extraneous sequences from amplification. DNA barcoding of primates has applications to conservation and law enforcement. Depositing barcode sequences in a public database, along with primer sequences, trace files and associated quality scores, makes this species identification technique widely accessible. Reference DNA barcode sequences should be derived from, and linked to, specimens of known provenance in web-accessible collections in order to validate this system of molecular diagnostics. PMID:16214744
Church, George M.; Kieffer-Higgins, Stephen
1992-01-01
This invention features vectors and a method for sequencing DNA. The method includes the steps of: a) ligating the DNA into a vector comprising a tag sequence, the tag sequence includes at least 15 bases, wherein the tag sequence will not hybridize to the DNA under stringent hybridization conditions and is unique in the vector, to form a hybrid vector, b) treating the hybrid vector in a plurality of vessels to produce fragments comprising the tag sequence, wherein the fragments differ in length and terminate at a fixed known base or bases, wherein the fixed known base or bases differs in each vessel, c) separating the fragments from each vessel according to their size, d) hybridizing the fragments with an oligonucleotide able to hybridize specifically with the tag sequence, and e) detecting the pattern of hybridization of the tag sequence, wherein the pattern reflects the nucleotide sequence of the DNA.
Gaudeul, Myriam; Gardner, Martin F; Thomas, Philip; Ennos, Richard A; Hollingsworth, Pete M
2014-09-05
New Caledonia harbours a highly diverse and endemic flora, and 13 (out of the 19 worldwide) species of Araucaria are endemic to this territory. Their phylogenetic relationships remain largely unresolved. Using nuclear microsatellites and chloroplast DNA sequencing, we focused on five closely related Araucaria species to investigate among-species relationships and the distribution of within-species genetic diversity across New Caledonia. The species could be clearly distinguished here, except A. montana and A. laubenfelsii that were not differentiated and, at most, form a genetic cline. Given their apparent morphological and ecological similarity, we suggested that these two species may be considered as a single evolutionary unit. We observed cases of nuclear admixture and incongruence between nuclear and chloroplast data, probably explained by introgression and shared ancestral polymorphism. Ancient hybridization was evidenced between A. biramulata and A. laubenfelsii in Mt Do, and is strongly suspected between A. biramulata and A. rulei in Mt Tonta. In both cases, extensive asymmetrical backcrossing eliminated the influence of one parent in the nuclear DNA composition. Shared ancestral polymorphism was also observed for cpDNA, suggesting that species diverged recently, have large effective sizes and/or that cpDNA experienced slow rates of molecular evolution. Within-species genetic structure was pronounced, probably because of low gene flow and significant inbreeding, and appeared clearly influenced by geography. This may be due to survival in distinct refugia during Quaternary climatic oscillations. The study species probably diverged recently and/or are characterized by a slow rate of cpDNA sequence evolution, and introgression is strongly suspected. Within-species genetic structure is tightly linked with geography. We underline the conservation implications of our results, and highlight several perspectives.
DNA sequence-dependent compartmentalization and silencing of chromatin at the nuclear lamina.
Zullo, Joseph M; Demarco, Ignacio A; Piqué-Regi, Roger; Gaffney, Daniel J; Epstein, Charles B; Spooner, Chauncey J; Luperchio, Teresa R; Bernstein, Bradley E; Pritchard, Jonathan K; Reddy, Karen L; Singh, Harinder
2012-06-22
A large fraction of the mammalian genome is organized into inactive chromosomal domains along the nuclear lamina. The mechanism by which these lamina associated domains (LADs) are established remains to be elucidated. Using genomic repositioning assays, we show that LADs, spanning the developmentally regulated IgH and Cyp3a loci contain discrete DNA regions that associate chromatin with the nuclear lamina and repress gene activity in fibroblasts. Lamina interaction is established during mitosis and likely involves the localized recruitment of Lamin B during late anaphase. Fine-scale mapping of LADs reveals numerous lamina-associating sequences (LASs), which are enriched for a GAGA motif. This repeated motif directs lamina association and is bound by the transcriptional repressor cKrox, in a complex with HDAC3 and Lap2β. Knockdown of cKrox or HDAC3 results in dissociation of LASs/LADs from the nuclear lamina. These results reveal a mechanism that couples nuclear compartmentalization of chromatin domains with the control of gene activity. Copyright © 2012 Elsevier Inc. All rights reserved.
Nylinder, Stephan; Cronholm, Bodil; de Lange, Peter J; Walsh, Neville; Anderberg, Arne A
2013-08-01
A species tree phylogeny of the Australian/New Zealand genus Centipeda (Asteraceae) is estimated based on nucleotide sequence data. We analysed sequences of nuclear ribosomal DNA (ETS, ITS) and three plasmid loci (ndhF, psbA-trnH, and trnL-F) using the multi-species coalescent module in BEAST. A total of 129 individuals from all 10 recognised species of Centipeda were sampled throughout the species distribution ranges, including two subspecies. We conclude that the inferred species tree topology largely conform previous assumptions on species relationships. Centipeda racemosa (Snuffweed) is the sister to remaining species, which is also the only consistently perennial representative in the genus. Centipeda pleiocephala (Tall Sneezeweed) and C. nidiformis (Cotton Sneezeweed) constitute a species pair, as does C. borealis and C. minima (Spreading Sneezeweed), all sharing the symplesiomorphic characters of spherical capitulum and convex receptacle with C. racemosa. Another species group comprising C. thespidioides (Desert Sneezeweed), C. cunninghamii (Old man weed, or Common sneeze-weed), C. crateriformis is well-supported but then include the morphologically aberrant C. aotearoana, all sharing the character of having capitula that mature more slowly relative the subtending shoot. Centipeda elatinoides takes on a weakly supported intermediate position between the two mentioned groups, and is difficult to relate to any of the former groups based on morphological characters. Copyright © 2013 Elsevier Inc. All rights reserved.
Phylogeny of the bears (Ursidae) based on nuclear and mitochondrial genes.
Yu, Li; Li, Qing-wei; Ryder, O A; Zhang, Ya-ping
2004-08-01
The taxomic classification and phylogenetic relationships within the bear family remain argumentative subjects in recent years. Prior investigation has been concentrated on the application of different mitochondrial (mt) sequence data, herein we employ two nuclear single-copy gene segments, the partial exon 1 from gene encoding interphotoreceptor retinoid binding protein (IRBP) and the complete intron 1 from transthyretin (TTR) gene, in conjunction with previously published mt data, to clarify these enigmatic problems. The combined analyses of nuclear IRBP and TTR datasets not only corroborated prior hypotheses, positioning the spectacled bear most basally and grouping the brown and polar bear together but also provided new insights into the bear phylogeny, suggesting the sister-taxa association of sloth bear and sun bear with strong support. Analyses based on combination of nuclear and mt genes differed from nuclear analysis in recognizing the sloth bears as the earliest diverging species among the subfamily ursine representatives while the exact placement of the sun bear did not resolved. Asiatic and American black bears clustered as sister group in all analyses with moderate levels of bootstrap support and high posterior probabilities. Comparisons between the nuclear and mtDNA findings suggested that our combined nuclear dataset have the resolving power comparable to mtDNA dataset for the phylogenetic interpretation of the bear family. As can be seen from present study, the unanimous phylogeny for this recently derived family was still not produced and additional independent genetic markers were in need.
Nuclear targeting of viral and non-viral DNA.
Chowdhury, E H
2009-07-01
The nuclear envelope presents a major barrier to transgene delivery and expression using a non-viral vector. Virus is capable of overcoming the barrier to deliver their genetic materials efficiently into the nucleus by virtue of the specialized protein components with the unique amino acid sequences recognizing cellular nuclear transport machinery. However, considering the safety issues in the clinical gene therapy for treating critical human diseases, non-viral systems are highly promising compared with their viral counterparts. This review summarizes the progress on exploring the nuclear traffic mechanisms for the prominent viral vectors and the technological innovations for the nuclear delivery of non-viral DNA by mimicking those natural processes evolved for the viruses as well as for many cellular proteins.
Balasubramani, Subramani Paranthaman; Murugan, Ramar; Ravikumar, Kaliamoorthy; Venkatasubramanian, Padma
2010-09-01
Tribulus terrestris L. (Zygophyllaceae) is one of the highly traded raw drugs and also used as a stimulative food additive in Europe and USA. While, Ayurvedic Pharmacopoeia of India recognizes T. terrestris as Goksura, Tribulus lanuginosus and T. subramanyamii are also traded by the same name raising issues of quality control. The nuclear ribosomal RNA genes and ITS (internal transcribed spacer) sequence were used to develop species-specific DNA markers. The species-specific markers efficiently amplified 295bp for T. terrestris (TT1F and TT1R), 300bp for T. lanuginosus (TL1F and TL1R) and 214bp for T. subramanyamii (TS1F and TS1R). These DNA markers can be used to distinguish T. terrestris from its adulterants. Copyright (c) 2010 Elsevier B.V. All rights reserved.
Asexual-sexual morph connection in the type species of Berkleasmium.
Tanney, Joey; Miller, Andrew N
2017-06-01
Berkleasmium is a polyphyletic genus comprising 37 dematiaceous hyphomycetous species. In this study, independent collections of the type species, B. concinnum , were made from Eastern North America. Nuclear internal transcribed spacer rDNA (ITS) and partial nuc 28S large subunit rDNA (LSU) sequences obtained from collections and subsequent cultures showed that Berkleasmium concinnum is the asexual morph of Neoacanthostigma septoconstrictum ( Tubeufiaceae , Tubeufiales ). Phylogenies inferred from Bayesian inference and maximum likelihood analyses of ITS-LSU sequence data confirmed this asexual-sexual morph connection and a re-examination of fungarium reference specimens also revealed the co-occurrence of N. septoconstrictum ascomata and B. concinnum sporodochia. Neoacanthostigma septoconstrictum is therefore synonymized under B. concinnum on the basis of priority. A specimen identified as N. septoconstrictum from Thailand is described as N. thailandicum sp. nov., based on morphological and genetic distinctiveness.
Legendre, Frédéric; Whiting, Michael F; Bordereau, Christian; Cancello, Eliana M; Evans, Theodore A; Grandcolas, Philippe
2008-08-01
A phylogenetic hypothesis of termite relationships was inferred from DNA sequence data. Seven gene fragments (12S rDNA, 16S rDNA, 18S rDNA, 28S rDNA, cytochrome oxidase I, cytochrome oxidase II and cytochrome b) were sequenced for 40 termite exemplars, representing all termite families and 14 outgroups. Termites were found to be monophyletic with Mastotermes darwiniensis (Mastotermitidae) as sister group to the remainder of the termites. In this remainder, the family Kalotermitidae was sister group to other families. The families Kalotermitidae, Hodotermitidae and Termitidae were retrieved as monophyletic whereas the Termopsidae and Rhinotermitidae appeared paraphyletic. All of these results were very stable and supported with high bootstrap and Bremer values. The evolution of worker caste and foraging behavior were discussed according to the phylogenetic hypothesis. Our analyses suggested that both true workers and pseudergates ("false workers") were the result of at least two different origins. Our data support a traditional hypothesis of foraging behavior, in which the evolutionary transition from a one-piece type to a separate life type occurred through an intermediate behavioral form.
Steiner, G; Hartmuth, K; Skriner, K; Maurer-Fogy, I; Sinski, A; Thalmann, E; Hassfeld, W; Barta, A; Smolen, J S
1992-01-01
RA33 is a nuclear autoantigen with an apparent molecular mass of 33 kD. Autoantibodies against RA33 are found in about 30% of sera from RA patients, but only occasionally in sera from patients with other connective tissue diseases. To characterize RA33, the antigen was purified from HeLa cell nuclear extracts to more than 90% homogeneity by affinity chromatography on heparin-Sepharose and by chromatofocusing. Sequence analysis of five tryptic peptides revealed that their sequences matched corresponding sequences of the A2 protein of the heterogeneous nuclear ribonucleoprotein (hnRNP) complex. Furthermore, RA33 was shown to be present in the 40S hnRNP complex and to behave indistinguishably from A2 in binding to single stranded DNA. In summary, these data strongly indicate that RA33 and A2 are the same protein, and thus identify on a molecular level a new autoantigen. Images PMID:1522214
Method for sequencing DNA base pairs
Sessler, A.M.; Dawson, J.
1993-12-14
The base pairs of a DNA structure are sequenced with the use of a scanning tunneling microscope (STM). The DNA structure is scanned by the STM probe tip, and, as it is being scanned, the DNA structure is separately subjected to a sequence of infrared radiation from four different sources, each source being selected to preferentially excite one of the four different bases in the DNA structure. Each particular base being scanned is subjected to such sequence of infrared radiation from the four different sources as that particular base is being scanned. The DNA structure as a whole is separately imaged for each subjection thereof to radiation from one only of each source. 6 figures.
Tosto, D S; Hopp, H E
1996-01-01
The internal transcribed spacer region (ITS1 and ITS2) of the 18S-25S nuclear ribosomal DNA sequence and the intervening 5.8S region from five species of the genus Oxalis was amplified by polymerase chain reaction and subjected to direct DNA sequencing. On the basis of cytogenetic studies some species of this genus were postulated to be related by the number of chromosomes. Sequence homologies in the ITS1, 5.8S and ITS2 among species are in good agreement with previous relationships established on the basis of chromosome numbers. We also identified a highly conserved sequence of six bp in the ITS1, reported to be present in a wide range of flowering plants, but not in the Oxalidaceae family to which the genus Oxalis belongs to.
Crinipellis brasiliensis, a new species based on morphological and molecular data.
de Arruda, Maricília C C; Sepulveda, German F; Miller, Robert N G; Ferreira, Marisa A S V; Santiago, Denise V R; Resende, Mário Lúcio V; Dianese, José Carmine; Felipe, Maria Sueli S
2005-01-01
Crinipellis perniciosa infects a diversity of hosts causing severe damage to T. cacao production in many Brazilian growing regions. We compared isolates of Crinipellis from different geographic origins and hosts in Brazil by structural analysis using light (LM) and scanning electronic microscopy (SEM), as well as RFLP and sequence data based on the nuclear rDNA ITS region. Statistical analyses of morphometric data of basidia and basidiospores revealed a distinct group of isolates of Crinipellis obtained from Heteropterys acutifolia when compared to representatives from Theobroma cacao, Solanum lycocarpum and Heteropterys nervosa. A similar distinction also was observed based on sequence data of the ITS region such that combined results allowed for the segregation of a new species within the genus Crinipellis.
Fetterman, Jessica L.; Zelickson, Blake R.; Johnson, Larry W.; Moellering, Douglas R.; Westbrook, David G.; Pompilius, Melissa; Sammy, Melissa J.; Johnson, Michelle; Dunham-Snary, Kimberly J.; Cao, Xuemei; Bradley, Wayne E.; Zhang, Jinju; Wei, Chih-Chang; Chacko, Balu; Schurr, Theodore G.; Kesterson, Robert A.; Dell’Italia, Louis J.; Darley-Usmar, Victor M.; Welch, Danny R.; Ballinger, Scott W.
2013-01-01
Synopsis Dysfunctional bioenergetics has emerged as a key feature in many chronic pathologies such as diabetes and cardiovascular disease. This has led to the mitochondrial paradigm in which it has been proposed that mitochondrial DNA (mtDNA) sequence variation contributes to disease susceptibility. In this study we present a novel animal model of mtDNA polymorphisms, the mitochondrial nuclear exchange mouse (MNX), in which the mtDNA from C3H/HeN mouse has been inserted onto the C57/BL6 nuclear background and vice versa to test this concept. Our data show a major contribution of the C57/BL6 mtDNA to the susceptibility to the pathological stress of cardiac volume overload which is independent of the nuclear background. Mitochondria harboring the C57/BL6J mtDNA generate more reactive oxygen species (ROS) and have a higher mitochondrial membrane potential relative to those having the C3H/HeN mtDNA, independent of nuclear background. We propose this is the primary mechanism associated with increased bioenergetic dysfunction in response to volume overload. In summary, these studies support the “mitochondrial paradigm” for the development of disease susceptibility, and show that the mtDNA modulates, cellular bioenergetics, mitochondrial reactive oxygen species generation and susceptibility to cardiac stress. PMID:23924350
Leavitt, Dean H; Bezy, Robert L; Crandall, Keith A; Sites, Jack W
2007-11-01
The lizard genus Xantusia of southwestern North America has received recent attention in relation to delimiting species. Using more than 500 lizards from 156 localities, we further test hypothesized species boundaries and clarify phylogeographical patterns, particularly in regions of potential secondary contact. We sequenced the entire mitochondrial cytochrome b gene for every lizard in the study, plus a second mitochondrial DNA (mtDNA) region and two nuclear introns for subsets of the total sample. Phylogenetic analyses of the mtDNA recover a well-resolved, novel hypothesis for species in the Xantusia vigilis complex. The nuclear DNA (nDNA) data provide independent support for the recognition of X. arizonae, X. bezyi and X. wigginsi. Differences between the respective mtDNA and nDNA topologies result from either the effects of lineage sorting or ancient introgression. Nuclear data confirm the inference that some populations of X. vigilis in northwestern Arizona converged on rock-crevice-dwelling morphology and are not X. arizonae with an introgressed X. vigilis mtDNA genome. The historical independence of ancient cryptic lineages of Xantusia in southern California is also corroborated, though limited introgression is detected. Our proposed biogeographical scenario indicates that diversification of this group was driven by vicariance beginning in the late Miocene. Additionally, Pleistocene climatical changes influenced Xantusia distribution, and the now inhospitable Colorado Desert previously supported night lizard presence. The current taxonomy of the group likely underestimates species diversity within the group, and our results collectively show that while convergence on the rock-crevice-dwelling morphology is one hallmark of Xantusia evolution, morphological stasis is paradoxically another.
Delsuc, Frédéric; Kuch, Melanie; Gibb, Gillian C; Hughes, Jonathan; Szpak, Paul; Southon, John; Enk, Jacob; Duggan, Ana T; Poinar, Hendrik N
2018-05-16
Mylodon darwinii is the extinct giant ground sloth named after Charles Darwin, who first collected its remains in South America. We have successfully obtained a high-quality mitochondrial genome at 99-fold coverage using an Illumina shotgun sequencing of a 12 880-year-old bone fragment from Mylodon Cave in Chile. Low level of DNA damage showed that this sample was exceptionally well preserved for an ancient subfossil, probably the result of the dry and cold conditions prevailing within the cave. Accordingly, taxonomic assessment of our shotgun metagenomic data showed a very high percentage of endogenous DNA with 22% of the assembled metagenomic contigs assigned to Xenarthra. Additionally, we enriched over 15 kb of sequence data from seven nuclear exons, using target sequence capture designed against a wide xenarthran dataset. Phylogenetic and dating analyses of the mitogenomic dataset including all extant species of xenarthrans and the assembled nuclear supermatrix unambiguously place Mylodon darwinii as the sister-group of modern two-fingered sloths, from which it diverged around 22 million years ago. These congruent results from both the mitochondrial and nuclear data support the diphyly of the two modern sloth lineages, implying the convergent evolution of their unique suspensory behaviour as an adaption to arboreality. Our results offer promising perspectives for whole-genome sequencing of this emblematic extinct taxon. © 2018 The Authors.
Salvi, Daniele; Macali, Armando; Mariottini, Paolo
2014-01-01
The bivalve family Ostreidae has a worldwide distribution and includes species of high economic importance. Phylogenetics and systematic of oysters based on morphology have proved difficult because of their high phenotypic plasticity. In this study we explore the phylogenetic information of the DNA sequence and secondary structure of the nuclear, fast-evolving, ITS2 rRNA and the mitochondrial 16S rRNA genes from the Ostreidae and we implemented a multi-locus framework based on four loci for oyster phylogenetics and systematics. Sequence-structure rRNA models aid sequence alignment and improved accuracy and nodal support of phylogenetic trees. In agreement with previous molecular studies, our phylogenetic results indicate that none of the currently recognized subfamilies, Crassostreinae, Ostreinae, and Lophinae, is monophyletic. Single gene trees based on Maximum likelihood (ML) and Bayesian (BA) methods and on sequence-structure ML were congruent with multilocus trees based on a concatenated (ML and BA) and coalescent based (BA) approaches and consistently supported three main clades: (i) Crassostrea, (ii) Saccostrea, and (iii) an Ostreinae-Lophinae lineage. Therefore, the subfamily Crassotreinae (including Crassostrea), Saccostreinae subfam. nov. (including Saccostrea and tentatively Striostrea) and Ostreinae (including Ostreinae and Lophinae taxa) are recognized. Based on phylogenetic and biogeographical evidence the Asian species of Crassostrea from the Pacific Ocean are assigned to Magallana gen. nov., whereas an integrative taxonomic revision is required for the genera Ostrea and Dendostrea. This study pointed out the suitability of the ITS2 marker for DNA barcoding of oyster and the relevance of using sequence-structure rRNA models and features of the ITS2 folding in molecular phylogenetics and taxonomy. The multilocus approach allowed inferring a robust phylogeny of Ostreidae providing a broad molecular perspective on their systematics. PMID:25250663
Salvi, Daniele; Macali, Armando; Mariottini, Paolo
2014-01-01
The bivalve family Ostreidae has a worldwide distribution and includes species of high economic importance. Phylogenetics and systematic of oysters based on morphology have proved difficult because of their high phenotypic plasticity. In this study we explore the phylogenetic information of the DNA sequence and secondary structure of the nuclear, fast-evolving, ITS2 rRNA and the mitochondrial 16S rRNA genes from the Ostreidae and we implemented a multi-locus framework based on four loci for oyster phylogenetics and systematics. Sequence-structure rRNA models aid sequence alignment and improved accuracy and nodal support of phylogenetic trees. In agreement with previous molecular studies, our phylogenetic results indicate that none of the currently recognized subfamilies, Crassostreinae, Ostreinae, and Lophinae, is monophyletic. Single gene trees based on Maximum likelihood (ML) and Bayesian (BA) methods and on sequence-structure ML were congruent with multilocus trees based on a concatenated (ML and BA) and coalescent based (BA) approaches and consistently supported three main clades: (i) Crassostrea, (ii) Saccostrea, and (iii) an Ostreinae-Lophinae lineage. Therefore, the subfamily Crassostreinae (including Crassostrea), Saccostreinae subfam. nov. (including Saccostrea and tentatively Striostrea) and Ostreinae (including Ostreinae and Lophinae taxa) are recognized [corrected]. Based on phylogenetic and biogeographical evidence the Asian species of Crassostrea from the Pacific Ocean are assigned to Magallana gen. nov., whereas an integrative taxonomic revision is required for the genera Ostrea and Dendostrea. This study pointed out the suitability of the ITS2 marker for DNA barcoding of oyster and the relevance of using sequence-structure rRNA models and features of the ITS2 folding in molecular phylogenetics and taxonomy. The multilocus approach allowed inferring a robust phylogeny of Ostreidae providing a broad molecular perspective on their systematics.
Development of a Novel Technology for Label Free DNA Sequencing
2012-05-21
of the C-H bond stretch vibrations in the planes of the corresponding DNA bases , and in the higher-frequency side, sequence-identifier region is...composed of the N-H bond stretch vibrations in the planes of the corresponding DNA bases . In addition, the sequence-identifier dividing region almost...regions are localized at the corresponding DNA bases and exhibit a definable dependence on the sequence form of the codons under study. Final
Fink, J S; Verhave, M; Kasper, S; Tsukada, T; Mandel, G; Goodman, R H
1988-01-01
cAMP-regulated transcription of the human vasoactive intestinal peptide gene is dependent upon a 17-base-pair DNA element located 70 base pairs upstream from the transcriptional initiation site. This element is similar to sequences in other genes known to be regulated by cAMP and to sequences in several viral enhancers. We have demonstrated that the vasoactive intestinal peptide regulatory element is an enhancer that depends upon the integrity of two CGTCA sequence motifs for biological activity. Mutations in either of the CGTCA motifs diminish the ability of the element to respond to cAMP. Enhancers containing the CGTCA motif from the somatostatin and adenovirus genes compete for binding of nuclear proteins from C6 glioma and PC12 cells to the vasoactive intestinal peptide enhancer, suggesting that CGTCA-containing enhancers interact with similar transacting factors. Images PMID:2842787
Gottscho, Andrew D.; Wood, Dustin A.; Vandergast, Amy; Lemos Espinal, Julio A.; Gatesy, John; Reeder, Tod
2017-01-01
Multi-locus nuclear DNA data were used to delimit species of fringe-toed lizards of theUma notata complex, which are specialized for living in wind-blown sand habitats in the deserts of southwestern North America, and to infer whether Quaternary glacial cycles or Tertiary geological events were important in shaping the historical biogeography of this group. We analyzed ten nuclear loci collected using Sanger sequencing and genome-wide sequence and single-nucleotide polymorphism (SNP) data collected using restriction-associated DNA (RAD) sequencing. A combination of species discovery methods (concatenated phylogenies, parametric and non-parametric clustering algorithms) and species validation approaches (coalescent-based species tree/isolation-with-migration models) were used to delimit species, infer phylogenetic relationships, and to estimate effective population sizes, migration rates, and speciation times. Uma notata, U. inornata, U. cowlesi, and an undescribed species from Mohawk Dunes, Arizona (U. sp.) were supported as distinct in the concatenated analyses and by clustering algorithms, and all operational taxonomic units were decisively supported as distinct species by ranking hierarchical nested speciation models with Bayes factors based on coalescent-based species tree methods. However, significant unidirectional gene flow (2NM >1) from U. cowlesi and U. notata into U. rufopunctata was detected under the isolation-with-migration model. Therefore, we conservatively delimit four species-level lineages within this complex (U. inornata, U. notata, U. cowlesi, and U. sp.), treating U. rufopunctata as a hybrid population (U. notata x cowlesi). Both concatenated and coalescent-based estimates of speciation times support the hypotheses that speciation within the complex occurred during the late Pleistocene, and that the geological evolution of the Colorado River delta during this period was an important process shaping the observed phylogeographic patterns.
Kinkar, Liina; Laurimäe, Teivi; Sharbatkhori, Mitra; Mirhendi, Hossein; Kia, Eshrat Beigom; Ponce-Gordo, Francisco; Andresiuk, Vanessa; Simsek, Sami; Lavikainen, Antti; Irshadullah, Malik; Umhang, Gérald; Oudni-M'rad, Myriam; Acosta-Jamett, Gerardo; Rehbein, Steffen; Saarma, Urmas
2017-08-01
Cystic echinococcosis, a zoonotic disease caused by Echinococcus granulosus sensu lato (s. l.), is a significant global public health concern. Echinococcus granulosus s. l. is currently divided into numerous genotypes (G1-G8 and G10) of which G1-G3 are the most frequently implicated genotypes in human infections. Although it has been suggested that G1-G3 could be regarded as a distinct species E. granulosus sensu stricto (s. s.), the evidence to support this is inconclusive. Most importantly, data from nuclear DNA that provide means to investigate the exchange of genetic material between G1-G3 is lacking as none of the published nuclear DNA studies have explicitly included G2 or G3. Moreover, the commonly used relatively short mtDNA sequences, including the complete cox1 gene, have not allowed unequivocal differentiation of genotypes G1-G3. Therefore, significantly longer mtDNA sequences are required to distinguish these genotypes with confidence. The main aim of this study was to evaluate the phylogenetic relations and taxonomy of genotypes G1-G3 using sequences of nearly complete mitogenomes (11,443bp) and three nuclear loci (2984bp). A total of 23 G1-G3 samples were analysed, originating from 5 intermediate host species in 10 countries. The mtDNA data demonstrate that genotypes G1 and G3 are distinct mitochondrial genotypes (separated by 37 mutations), whereas G2 is not a separate genotype or even a monophyletic cluster, but belongs to G3. Nuclear data revealed no genetic separation of G1 and G3, suggesting that these genotypes form a single species due to ongoing gene flow. We conclude that: (a) in the taxonomic sense, genotypes G1 and G3 can be treated as a single species E. granulosus s. s.; (b) genotypes G1 and G3 should be regarded as distinct genotypes only in the context of mitochondrial data; (c) we recommend excluding G2 from the genotype list. Copyright © 2017 Elsevier B.V. All rights reserved.
Dreyer, Christine; Hoffmann, Margarete; Lanz, Christa; Willing, Eva-Maria; Riester, Markus; Warthmann, Norman; Sprecher, Andrea; Tripathi, Namita; Henz, Stefan R; Weigel, Detlef
2007-01-01
Background The guppy, Poecilia reticulata, is a well-known model organism for studying inheritance and variation of male ornamental traits as well as adaptation to different river habitats. However, genomic resources for studying this important model were not previously widely available. Results With the aim of generating molecular markers for genetic mapping of the guppy, cDNA libraries were constructed from embryos and different adult organs to generate expressed sequence tags (ESTs). About 18,000 ESTs were annotated according to BLASTN and BLASTX results and the sequence information from the 3' UTRs was exploited to generate PCR primers for re-sequencing of genomic DNA from different wild type strains. By comparison of EST-linked genomic sequences from at least four different ecotypes, about 1,700 polymorphisms were identified, representing about 400 distinct genes. Two interconnected MySQL databases were built to organize the ESTs and markers, respectively. A robust phylogeny of the guppy was reconstructed, based on 10 different nuclear genes. Conclusion Our EST and marker databases provide useful tools for genetic mapping and phylogenetic studies of the guppy. PMID:17686157
Wang, Baosheng; Khalili Mahani, Marjan; Ng, Wei Lun; Kusumi, Junko; Phi, Hai Hong; Inomata, Nobuyuki; Wang, Xiao-Ru; Szmidt, Alfred E
2014-01-01
Pinus krempfii Lecomte is a morphologically and ecologically unique pine, endemic to Vietnam. It is regarded as vulnerable species with distribution limited to just two provinces: Khanh Hoa and Lam Dong. Although a few phylogenetic studies have included this species, almost nothing is known about its genetic features. In particular, there are no studies addressing the levels and patterns of genetic variation in natural populations of P. krempfii. In this study, we sampled 57 individuals from six natural populations of P. krempfii and analyzed their sequence variation in ten nuclear gene regions (approximately 9 kb) and 14 mitochondrial (mt) DNA regions (approximately 10 kb). We also analyzed variation at seven chloroplast (cp) microsatellite (SSR) loci. We found very low haplotype and nucleotide diversity at nuclear loci compared with other pine species. Furthermore, all investigated populations were monomorphic across all mitochondrial DNA (mtDNA) regions included in our study, which are polymorphic in other pine species. Population differentiation at nuclear loci was low (5.2%) but significant. However, structure analysis of nuclear loci did not detect genetically differentiated groups of populations. Approximate Bayesian computation (ABC) using nuclear sequence data and mismatch distribution analysis for cpSSR loci suggested recent expansion of the species. The implications of these findings for the management and conservation of P. krempfii genetic resources were discussed. PMID:25360263
Soman, Soja Saghar; Tinson, Alex
2016-10-01
Camel racing is a popular sport in the Middle East region, where the demand is high for racing camels with higher stamina and endurance. Devising a technique to measure oxidative capacity and endurance in camels should be useful. Mitochondria are highly specialized organelles involved in metabolism in all higher organisms for sustaining life and providing energy for physical functions. The ratio of mitochondrial DNA (mtDNA) to nuclear DNA (nDNA) is often used as an estimate for the metabolic status of the tissue. A greater quantity of mitochondria per unit of tissue translates into greater oxidative capacity and endurance. In this report, we describe a simple, sensitive and efficient real-time PCR assay for the quantification of blood mitochondria in racing camels. The primer sequences selected for the SYBR green-based PCR assay included mitochondrial D-loop region, mitochondrial ATP6ase gene and the nuclear β-actin gene. The assay was validated using two groups of camels comprising racing and dairy camels. The racing camels demonstrated a higher mtDNA/nDNA ratio compared with dairy camels based on the ΔΔCt values, with a higher variability among racing camels. The mean ΔΔCt values of adult and young racing camels did not vary considerably. The findings show that the present assay can be used as an evaluative tool for racing camels. Copyright © 2016 Elsevier Ltd. All rights reserved.
Szabóová, Dana; Bielik, Peter; Poláková, Silvia; Šoltys, Katarína; Jatzová, Katarína; Szemes, Tomáš
2017-01-01
Abstract The yeast Saccharomyces are widely used to test ecological and evolutionary hypotheses. A large number of nuclear genomic DNA sequences are available, but mitochondrial genomic data are insufficient. We completed mitochondrial DNA (mtDNA) sequencing from Illumina MiSeq reads for all Saccharomyces species. All are circularly mapped molecules decreasing in size with phylogenetic distance from Saccharomyces cerevisiae but with similar gene content including regulatory and selfish elements like origins of replication, introns, free-standing open reading frames or GC clusters. Their most profound feature is species-specific alteration in gene order. The genetic code slightly differs from well-established yeast mitochondrial code as GUG is used rarely as the translation start and CGA and CGC code for arginine. The multilocus phylogeny, inferred from mtDNA, does not correlate with the trees derived from nuclear genes. mtDNA data demonstrate that Saccharomyces cariocanus should be assigned as a separate species and Saccharomyces bayanus CBS 380T should not be considered as a distinct species due to mtDNA nearly identical to Saccharomyces uvarum mtDNA. Apparently, comparison of mtDNAs should not be neglected in genomic studies as it is an important tool to understand the origin and evolutionary history of some yeast species. PMID:28992063
Nuclear DNA sequences from the Middle Pleistocene Sima de los Huesos hominins.
Meyer, Matthias; Arsuaga, Juan-Luis; de Filippo, Cesare; Nagel, Sarah; Aximu-Petri, Ayinuer; Nickel, Birgit; Martínez, Ignacio; Gracia, Ana; Bermúdez de Castro, José María; Carbonell, Eudald; Viola, Bence; Kelso, Janet; Prüfer, Kay; Pääbo, Svante
2016-03-24
A unique assemblage of 28 hominin individuals, found in Sima de los Huesos in the Sierra de Atapuerca in Spain, has recently been dated to approximately 430,000 years ago. An interesting question is how these Middle Pleistocene hominins were related to those who lived in the Late Pleistocene epoch, in particular to Neanderthals in western Eurasia and to Denisovans, a sister group of Neanderthals so far known only from southern Siberia. While the Sima de los Huesos hominins share some derived morphological features with Neanderthals, the mitochondrial genome retrieved from one individual from Sima de los Huesos is more closely related to the mitochondrial DNA of Denisovans than to that of Neanderthals. However, since the mitochondrial DNA does not reveal the full picture of relationships among populations, we have investigated DNA preservation in several individuals found at Sima de los Huesos. Here we recover nuclear DNA sequences from two specimens, which show that the Sima de los Huesos hominins were related to Neanderthals rather than to Denisovans, indicating that the population divergence between Neanderthals and Denisovans predates 430,000 years ago. A mitochondrial DNA recovered from one of the specimens shares the previously described relationship to Denisovan mitochondrial DNAs, suggesting, among other possibilities, that the mitochondrial DNA gene pool of Neanderthals turned over later in their history.
Getzenberg, R H; Coffey, D S
1990-09-01
The DNA of interphase nuclei have very specific three-dimensional organizations that are different in different cell types, and it is possible that this varying DNA organization is responsible for the tissue specificity of gene expression. The nuclear matrix organizes the three-dimensional structure of the DNA and is believed to be involved in the control of gene expression. This study compares the nuclear structural proteins between two sex accessory tissues in the same animal responding to the same androgen stimulation by the differential expression of major tissue-specific secretory proteins. We demonstrate here that the nuclear matrix is tissue specific in the rat ventral prostate and seminal vesicle, and undergoes characteristic alterations in its protein composition upon androgen withdrawal. Three types of nuclear matrix proteins were observed: 1) nuclear matrix proteins that are different and tissue specific in the rat ventral prostate and seminal vesicle, 2) a set of nuclear matrix proteins that either appear or disappear upon androgen withdrawal, and 3) a set of proteins that are common to both the ventral prostate and seminal vesicle and do not change with the hormonal state of the animal. Since the nuclear matrix is known to bind androgen receptors in a tissue- and steroid-specific manner, we propose that the tissue specificity of the nuclear matrix arranges the DNA in a unique conformation, which may be involved in the specific interaction of transcription factors with DNA sequences, resulting in tissue-specific patterns of secretory protein expression.
Jun, Goo; Flickinger, Matthew; Hetrick, Kurt N.; Romm, Jane M.; Doheny, Kimberly F.; Abecasis, Gonçalo R.; Boehnke, Michael; Kang, Hyun Min
2012-01-01
DNA sample contamination is a serious problem in DNA sequencing studies and may result in systematic genotype misclassification and false positive associations. Although methods exist to detect and filter out cross-species contamination, few methods to detect within-species sample contamination are available. In this paper, we describe methods to identify within-species DNA sample contamination based on (1) a combination of sequencing reads and array-based genotype data, (2) sequence reads alone, and (3) array-based genotype data alone. Analysis of sequencing reads allows contamination detection after sequence data is generated but prior to variant calling; analysis of array-based genotype data allows contamination detection prior to generation of costly sequence data. Through a combination of analysis of in silico and experimentally contaminated samples, we show that our methods can reliably detect and estimate levels of contamination as low as 1%. We evaluate the impact of DNA contamination on genotype accuracy and propose effective strategies to screen for and prevent DNA contamination in sequencing studies. PMID:23103226
DOE Office of Scientific and Technical Information (OSTI.GOV)
Mel`nikova, M.N.; Grechko, V.V.; Mednikov, B.M.
1995-08-01
Genetic divergence in repetitive sequences of nuclear DNA of wild and domestic sheep was studied by general restriction endonuclease mapping (i.e., the taxonoprint method). The PCR RAPD method with one and two arbitrary primers was also used to analyze the nuclear DNA polymorphism in some other regions. The taxonoprint method, performed using six endonucleases, showed specificity and virtually complete similarity in the patterns of repetitive DNA sequences of two wild forms, argali and moufflon, and five domestic sheep breeds. Central Asian breeds, Kazakh fine-fleeced, karakuk, ghissar, and eadeelbay, and an English breed, Lincoln, were examined. The results confirm the opinionmore » that wild and domestic sheep may be considered one polytypic species. The PCR-RAPD method, both with one and two arbitrary primers, revealed a closer similarity of all the sheep breeds examined when aragali, rather than with moufflon, was used. These results indicate that the domestication area of sheep was much more broader than was earlier presumed. Otherwise, hybridizations of domestic and wild forms could occasionally occur in the area of their coexistence. The amplification patterns of PCR-RAPD products are the most promising population genetic markers. 27 refs., 4 figs., 7 tabs.« less
2014-01-01
Background Skipper butterflies (Hesperiidae) are a relatively well-studied family of Lepidoptera. However, a combination of DNA barcodes, morphology, and natural history data has revealed several cryptic species complexes within them. Here, we investigate three DNA barcode lineages of what has been identified as Urbanus belli (Hesperiidae, Eudaminae) in Área de Conservación Guanacaste (ACG), northwestern Costa Rica. Results Although no morphological traits appear to distinguish among the three, congruent nuclear and mitochondrial lineage patterns show that “Urbanus belli” in ACG is a complex of three sympatric species. A single strain of Wolbachia present in two of the three cryptic species indicates that Urbanus segnestami Burns (formerly Urbanus belliDHJ01), Urbanus bernikerni Burns (formerly Urbanus belliDHJ02), and Urbanus ehakernae Burns (formerly Urbanus belliDHJ03) may be biologically separated by Wolbachia, as well as by their genetics. Use of parallel sequencing through 454-pyrosequencing improved the utility of ITS2 as a phylogenetic marker and permitted examination of the intra- and interlineage relationships of ITS2 variants within the species complex. Interlineage, intralineage and intragenomic compensatory base pair changes were discovered in the secondary structure of ITS2. Conclusion These findings corroborate the existence of three cryptic species. Our confirmation of a novel cryptic species complex, initially suggested by DNA barcode lineages, argues for using a multi-marker approach coupled with next-generation sequencing for exploration of other suspected species complexes. PMID:25005355
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wu, Liyou; Yi, T. Y.; Van Nostrand, Joy
Phylogenetic analyses were done for the Shewanella strains isolated from Baltic Sea (38 strains), US DOE Hanford Uranium bioremediation site [Hanford Reach of the Columbia River (HRCR), 11 strains], Pacific Ocean and Hawaiian sediments (8 strains), and strains from other resources (16 strains) with three out group strains, Rhodopseudomonas palustris, Clostridium cellulolyticum, and Thermoanaerobacter ethanolicus X514, using DNA relatedness derived from WCGA-based DNA-DNA hybridizations, sequence similarities of 16S rRNA gene and gyrB gene, and sequence similarities of 6 loci of Shewanella genome selected from a shared gene list of the Shewanella strains with whole genome sequenced based on the averagemore » nucleotide identity of them (ANI). The phylogenetic trees based on 16S rRNA and gyrB gene sequences, and DNA relatedness derived from WCGA hybridizations of the tested Shewanella strains share exactly the same sub-clusters with very few exceptions, in which the strains were basically grouped by species. However, the phylogenetic analysis based on DNA relatedness derived from WCGA hybridizations dramatically increased the differentiation resolution at species and strains level within Shewanella genus. When the tree based on DNA relatedness derived from WCGA hybridizations was compared to the tree based on the combined sequences of the selected functional genes (6 loci), we found that the resolutions of both methods are similar, but the clustering of the tree based on DNA relatedness derived from WMGA hybridizations was clearer. These results indicate that WCGA-based DNA-DNA hybridization is an idea alternative of conventional DNA-DNA hybridization methods and it is superior to the phylogenetics methods based on sequence similarities of single genes. Detailed analysis is being performed for the re-classification of the strains examined.« less
Macas, Jiří; Neumann, Pavel; Navrátilová, Alice
2007-01-01
Background Extraordinary size variation of higher plant nuclear genomes is in large part caused by differences in accumulation of repetitive DNA. This makes repetitive DNA of great interest for studying the molecular mechanisms shaping architecture and function of complex plant genomes. However, due to methodological constraints of conventional cloning and sequencing, a global description of repeat composition is available for only a very limited number of higher plants. In order to provide further data required for investigating evolutionary patterns of repeated DNA within and between species, we used a novel approach based on massive parallel sequencing which allowed a comprehensive repeat characterization in our model species, garden pea (Pisum sativum). Results Analysis of 33.3 Mb sequence data resulted in quantification and partial sequence reconstruction of major repeat families occurring in the pea genome with at least thousands of copies. Our results showed that the pea genome is dominated by LTR-retrotransposons, estimated at 140,000 copies/1C. Ty3/gypsy elements are less diverse and accumulated to higher copy numbers than Ty1/copia. This is in part due to a large population of Ogre-like retrotransposons which alone make up over 20% of the genome. In addition to numerous types of mobile elements, we have discovered a set of novel satellite repeats and two additional variants of telomeric sequences. Comparative genome analysis revealed that there are only a few repeat sequences conserved between pea and soybean genomes. On the other hand, all major families of pea mobile elements are well represented in M. truncatula. Conclusion We have demonstrated that even in a species with a relatively large genome like pea, where a single 454-sequencing run provided only 0.77% coverage, the generated sequences were sufficient to reconstruct and analyze major repeat families corresponding to a total of 35–48% of the genome. These data provide a starting point for further investigations of legume plant genomes based on their global comparative analysis and for the development of more sophisticated approaches for data mining. PMID:18031571
Haag, Taiana; Santos, Anelisie S; De Angelo, Carlos; Srbek-Araujo, Ana Carolina; Sana, Dênis A; Morato, Ronaldo G; Salzano, Francisco M; Eizirik, Eduardo
2009-07-01
The elusive nature and endangered status of most carnivore species imply that efficient approaches for their non-invasive sampling are required to allow for genetic and ecological studies. Faecal samples are a major potential source of information, and reliable approaches are needed to foster their application in this field, particularly in areas where few studies have been conducted. A major obstacle to the reliable use of faecal samples is their uncertain species-level identification in the field, an issue that can be addressed with DNA-based assays. In this study we describe a sequence-based approach that efficiently distinguishes jaguar versus puma scats, and that presents several desirable properties: (1) considerably high amplification and sequencing rates; (2) multiple diagnostic sites reliably differentiating the two focal species; (3) high information content that allows for future application in other carnivores; (4) no evidence of amplification of prey DNA; and (5) no evidence of amplification of a nuclear mitochondrial DNA insertion known to occur in the jaguar. We demonstrate the reliability and usefulness of this approach by evaluating 55 field-collected samples from four locations in the highly fragmented Atlantic Forest biome of Brazil and Argentina, and document the presence of one or both of these endangered felids in each of these areas.
Kashiwagi, Tom; Maxwell, Elisabeth A; Marshall, Andrea D; Christensen, Ana B
2015-01-01
Sharks and rays are increasingly being identified as high-risk species for extinction, prompting urgent assessments of their local or regional populations. Advanced genetic analyses can contribute relevant information on effective population size and connectivity among populations although acquiring sufficient regional sample sizes can be challenging. DNA is typically amplified from tissue samples which are collected by hand spears with modified biopsy punch tips. This technique is not always popular due mainly to a perception that invasive sampling might harm the rays, change their behaviour, or have a negative impact on tourism. To explore alternative methods, we evaluated the yields and PCR success of DNA template prepared from the manta ray mucus collected underwater and captured and stored on a Whatman FTA™ Elute card. The pilot study demonstrated that mucus can be effectively collected underwater using toothbrush. DNA stored on cards was found to be reliable for PCR-based population genetics studies. We successfully amplified mtDNA ND5, nuclear DNA RAG1, and microsatellite loci for all samples and confirmed sequences and genotypes being those of target species. As the yields of DNA with the tested method were low, further improvements are desirable for assays that may require larger amounts of DNA, such as population genomic studies using emerging next-gen sequencing.
Maxwell, Elisabeth A.; Marshall, Andrea D.; Christensen, Ana B.
2015-01-01
Sharks and rays are increasingly being identified as high-risk species for extinction, prompting urgent assessments of their local or regional populations. Advanced genetic analyses can contribute relevant information on effective population size and connectivity among populations although acquiring sufficient regional sample sizes can be challenging. DNA is typically amplified from tissue samples which are collected by hand spears with modified biopsy punch tips. This technique is not always popular due mainly to a perception that invasive sampling might harm the rays, change their behaviour, or have a negative impact on tourism. To explore alternative methods, we evaluated the yields and PCR success of DNA template prepared from the manta ray mucus collected underwater and captured and stored on a Whatman FTA™ Elute card. The pilot study demonstrated that mucus can be effectively collected underwater using toothbrush. DNA stored on cards was found to be reliable for PCR-based population genetics studies. We successfully amplified mtDNA ND5, nuclear DNA RAG1, and microsatellite loci for all samples and confirmed sequences and genotypes being those of target species. As the yields of DNA with the tested method were low, further improvements are desirable for assays that may require larger amounts of DNA, such as population genomic studies using emerging next-gen sequencing. PMID:26413431
Shi, Huizhen; Dong, Ji; Irwin, David M; Zhang, Shuyi; Mao, Xiuguang
2016-05-01
Transposition of mitochondrial DNA into the nucleus, which gives rise to nuclear mitochondrial DNAs (NUMTs), has been well documented in eukaryotes. However, very few studies have assessed the frequency of these transpositions during the evolutionary history of a specific taxonomic group. Here we used the horseshoe bats (Rhinolophus) as a case study to determine the frequency and relative timing of nuclear transfers of mitochondrial control region sequences. For this, phylogenetic and coalescent analyzes were performed on NUMTs and authentic mtDNA sequences generated from eight horseshoe bat species. Our results suggest at least three independent transpositions, including two ancient and one more recent, during the evolutionary history of Rhinolophus. The two ancient transpositions are represented by the NUMT-1 and -2 clades, with each clade consisting of NUMTs from almost all studied species but originating from different portions of the mtDNA genome. Furthermore, estimates of the most recent common ancestor for each clade corresponded to the time of the initial diversification of this genus. The recent transposition is represented by NUMT-3, which was discovered only in a specific subgroup of Rhinolophus and exhibited a close relationship to its mitochondrial counterpart. Our similarity searches of mtDNA in the R. ferrumequinum genome confirmed the presence of NUMT-1 and NUMT-2 clade sequences and, for the first time, assessed the extent of NUMTs in a bat genome. To our knowledge, this is the first study to report on the frequency of transpositions of mtDNA occurring before the common ancestry of a genus. Copyright © 2016 Elsevier B.V. All rights reserved.
Ekaphan Kraichak; Sittiporn Parnmen; Robert Lücking; Eimy Rivas Plata; Andre Aptroot; Marcela E.S. Caceres; Damien Ertz; Armin Mangold; Joel A. Mercado-Diaz; Khwanruan Papong; Dries Van der Broeck; Gothamie Weerakoon; H. Thorsten Lumbsch; NO-VALUE
2014-01-01
We present an updated 3-locus molecular phylogeny of tribe Ocellularieae, the second largest tribe within subfamily Graphidoideae in the Graphidaceae. Adding 165 newly generated sequences from the mitochondrial small subunit rDNA (mtSSU), the nuclear large subunit rDNA (nuLSU), and the second largest subunit of the DNA-directed RNA polymerase II (RPB2), we currently...
Effect of Base Sequence "Defects" on the Electrostatic Potential of Dissolved DNA
NASA Astrophysics Data System (ADS)
Adams, Scott V.; Wagner, Katrina; Kephart, Thomas S.; Edwards, Glenn
1997-11-01
An analytical model of the electrostatic potential surrounding dissolved DNA has been developed. The model consists of an all-atom, mathematically helical structure for DNA, in which the atoms are arranged in infinite lines of discrete point charges on concentric cylindrical surfaces. The surrounding solvent and counterions are treated with the Debye-Huckel approximation (Wagner et al., Biophysical Journal 73, 21-30, 1997). Variation in the electrostatic potential due to structural differences between A, B, and Z conformations and homopolymer base sequence is apparent. The most recent modification to the model exploits the principle of superposition to calculate the potential of DNA with a base sequence containing `defects.' That is, the base sequence is no longer uniform along the polymer. Differences between the potential of homopolymer DNA and the potential of DNA containing base `defects' are immediately obvious. These results may aid in understanding the role of electrostatics in base-sequence specificity exhibited by DNA-binding proteins.
Protein Cofactors Are Essential for High-Affinity DNA Binding by the Nuclear Factor κB RelA Subunit.
Mulero, Maria Carmen; Shahabi, Shandy; Ko, Myung Soo; Schiffer, Jamie M; Huang, De-Bin; Wang, Vivien Ya-Fan; Amaro, Rommie E; Huxford, Tom; Ghosh, Gourisankar
2018-05-22
Transcription activator proteins typically contain two functional domains: a DNA binding domain (DBD) that binds to DNA with sequence specificity and an activation domain (AD) whose established function is to recruit RNA polymerase. In this report, we show that purified recombinant nuclear factor κB (NF-κB) RelA dimers bind specific κB DNA sites with an affinity significantly lower than that of the same dimers from nuclear extracts of activated cells, suggesting that additional nuclear cofactors might facilitate DNA binding by the RelA dimers. Additionally, recombinant RelA binds DNA with relatively low affinity at a physiological salt concentration in vitro. The addition of p53 or RPS3 (ribosomal protein S3) increases RelA:DNA binding affinity 2- to >50-fold depending on the protein and ionic conditions. These cofactor proteins do not form stable ternary complexes, suggesting that they stabilize the RelA:DNA complex through dynamic interactions. Surprisingly, the RelA-DBD alone fails to bind DNA under the same solution conditions even in the presence of cofactors, suggesting an important role of the RelA-AD in DNA binding. Reduced RelA:DNA binding at a physiological ionic strength suggests that multiple cofactors might be acting simultaneously to mitigate the electrolyte effect and stabilize the RelA:DNA complex in vivo. Overall, our observations suggest that the RelA-AD and multiple cofactor proteins function cooperatively to prime the RelA-DBD and stabilize the RelA:DNA complex in cells. Our study provides a mechanism for nuclear cofactor proteins in NF-κB-dependent gene regulation.
2015-01-01
The dimensions and arrangements of aromatic rings (topology) in adducts derived from the reactions of polycyclic aromatic hydrocarbon (PAH) diol epoxide metabolites with DNA influence the distortions and stabilities of double-stranded DNA, and hence their recognition and processing by the human nucleotide excision repair (NER) system. Dibenzo[a,l]pyrene (DB[a,l]P) is a highly tumorigenic six-ring PAH, which contains a nonplanar and aromatic fjord region that is absent in the structurally related bay region five-ring PAH benzo[a]pyrene (B[a]P). The PAH diol epoxide–DNA adducts formed include the stereoisomeric 14S and 14Rtrans-anti-DB[a,l]P-N2-dG and the stereochemically analogous 10S- and 10R-B[a]P-N2-dG (B[a]P-dG) guanine adducts. However, nuclear magnetic resonance (NMR) solution studies of the 14S-DB[a,l]P-N2-dG adduct in DNA have not yet been presented. Here we have investigated the 14S-DB[a,l]P-N2-dG adduct in two different sequence contexts using NMR methods with distance-restrained molecular dynamics simulations. In duplexes with dC opposite the adduct deleted, a well-resolved base-displaced intercalative adduct conformation can be observed. In full duplexes, in contrast to the intercalated 14R stereoisomeric adduct, the bulky DB[a,l]P residue in the 14S adduct is positioned in a greatly widened and distorted minor groove, with significant disruptions and distortions of base pairing at the lesion site and two 5′-side adjacent base pairs. These unique structural features are significantly different from those of the stereochemically analogous but smaller B[a]P-dG adduct. The greater size and different topology of the DB[a,l]P aromatic ring system lead to greater structurally destabilizing DNA distortions that are partially compensated by stabilizing DB[a,l]P-DNA van der Waals interactions, whose combined effects impact the NER response to the adduct. These structural results broaden our understanding of the structure–function relationship in NER. PMID:24617538
Lee, James W.; Thundat, Thomas G.
2005-06-14
An apparatus and method for performing nucleic acid (DNA and/or RNA) sequencing on a single molecule. The genetic sequence information is obtained by probing through a DNA or RNA molecule base by base at nanometer scale as though looking through a strip of movie film. This DNA sequencing nanotechnology has the theoretical capability of performing DNA sequencing at a maximal rate of about 1,000,000 bases per second. This enhanced performance is made possible by a series of innovations including: novel applications of a fine-tuned nanometer gap for passage of a single DNA or RNA molecule; thin layer microfluidics for sample loading and delivery; and programmable electric fields for precise control of DNA or RNA movement. Detection methods include nanoelectrode-gated tunneling current measurements, dielectric molecular characterization, and atomic force microscopy/electrostatic force microscopy (AFM/EFM) probing for nanoscale reading of the nucleic acid sequences.
Mitochondrial DNA transfer to the nucleus generates extensive insertion site variation in maize.
Lough, Ashley N; Roark, Leah M; Kato, Akio; Ream, Thomas S; Lamb, Jonathan C; Birchler, James A; Newton, Kathleen J
2008-01-01
Mitochondrial DNA (mtDNA) insertions into nuclear chromosomes have been documented in a number of eukaryotes. We used fluorescence in situ hybridization (FISH) to examine the variation of mtDNA insertions in maize. Twenty overlapping cosmids, representing the 570-kb maize mitochondrial genome, were individually labeled and hybridized to root tip metaphase chromosomes from the B73 inbred line. A minimum of 15 mtDNA insertion sites on nine chromosomes were detectable using this method. One site near the centromere on chromosome arm 9L was identified by a majority of the cosmids. To examine variation in nuclear mitochondrial DNA sequences (NUMTs), a mixture of labeled cosmids was applied to chromosome spreads of ten diverse inbred lines: A188, A632, B37, B73, BMS, KYS, Mo17, Oh43, W22, and W23. The number of detectable NUMTs varied dramatically among the lines. None of the tested inbred lines other than B73 showed the strong hybridization signal on 9L, suggesting that there is a recent mtDNA insertion at this site in B73. Different sources of B73 and W23 were examined for NUMT variation within inbred lines. Differences were detectable, suggesting either that mtDNA is being incorporated or lost from the maize nuclear genome continuously. The results indicate that mtDNA insertions represent a major source of nuclear chromosomal variation.
Hailer, Frank; Kutschera, Verena E; Hallström, Björn M; Fain, Steven R; Leonard, Jennifer A; Arnason, Ulfur; Janke, Axel
2013-03-29
Nakagome et al. reanalyzed some of our data and assert that we cannot refute the mitochondrial DNA-based scenario for polar bear evolution. Their single-locus test statistic is strongly affected by introgression and incomplete lineage sorting, whereas our multilocus approaches are better suited to recover the true species relationships. Indeed, our sister-lineage model receives high support in a Bayesian model comparison.
Zeng, Yan-Fei; Zhang, Jian-Guo; Abuduhamiti, Bawerjan; Wang, Wen-Ting; Jia, Zhi-Qing
2018-05-25
The effects of historical geology and climatic events on the evolution of plants around the Qinghai-Tibetan Plateau region have been at the center of debate for years. To identify the influence of the uplift of the Tianshan Mountains and/or climatic oscillations on the evolution of plants in arid northwest China, we investigated the phylogeography of the Euphrates poplar (Populus euphratica) using chloroplast DNA (cpDNA) sequences and nuclear microsatellites, and estimated its historical distribution using Ecological Niche Modeling (ENM). We found that the Euphrates poplar differed from another desert poplar, P. pruinosa, in both nuclear and chloroplast DNA. The low clonal diversity in both populations reflected the low regeneration rate by seed/seedlings in many locations. Both cpDNA and nuclear markers demonstrated a clear divergence between the Euphrates poplar populations from northern and southern Xinjiang regions. The divergence time was estimated to be early Pleistocene based on cpDNA, and late Pleistocene using an Approximate Bayesian Computation analysis based on microsatellites. Estimated gene flow was low between these two regions, and the limited gene flow occurred mainly via dispersal from eastern regions. ENM analysis supported a wider distribution of the Euphrates poplar at 3 Ma, but a more constricted distribution during both the glacial period and the interglacial period. These results indicate that the deformation of the Tianshan Mountains has impeded gene flow of the Euphrates poplar populations from northern and southern Xinjiang, and the distribution constriction due to climatic oscillations further accelerated the divergence of populations from these regions. To protect the desert poplars, more effort is needed to encourage seed germination and seedling establishment, and to conserve endemic gene resources in the northern Xinjiang region.
Mito-nuclear discord in six congeneric lineages of Holarctic ducks (genus Anas).
Peters, Jeffrey L; Winker, Kevin; Millam, Kendra C; Lavretsky, Philip; Kulikova, Irina; Wilson, Robert E; Zhuravlev, Yuri N; McCracken, Kevin G
2014-06-01
Many species have Holarctic distributions that extend across Europe, Asia and North America. Most genetics research on these species has examined only mitochondrial (mt) DNA, which has revealed wide variance in divergence between Old World (OW) and New World (NW) populations, ranging from shallow, unstructured genealogies to deeply divergent lineages. In this study, we sequenced 20 nuclear introns to test for concordant patterns of OW-NW differentiation between mtDNA and nuclear (nu) DNA for six lineages of Holarctic ducks (genus Anas). Genetic differentiation for both marker types varied widely among these lineages (idiosyncratic population histories), but mtDNA and nuDNA divergence within lineages was not significantly correlated. Moreover, compared with the association between mtDNA and nuDNA divergence observed among different species, OW-NW nuDNA differentiation was generally lower than mtDNA divergence, at least for lineages with deeply divergent mtDNA. Furthermore, coalescent estimates indicated significantly higher rates of gene flow for nuDNA than mtDNA for four of the six lineages. Thus, Holarctic ducks show prominent mito-nuclear discord between OW and NW populations, and we reject differences in sorting rates as the sole cause of the within-species discord. Male-mediated intercontinental gene flow is likely a leading contributor to this discord, although selection could also cause increased mtDNA divergence relative to weak nuDNA differentiation. The population genetics of these ducks contribute to growing evidence that mtDNA can be an unreliable indicator of stage of speciation and that more holistic approaches are needed for species delimitation. © 2014 John Wiley & Sons Ltd.
Saccharomyces cerevisiae SSB1 protein and its relationship to nucleolar RNA-binding proteins.
Jong, A Y; Clark, M W; Gilbert, M; Oehm, A; Campbell, J L
1987-01-01
To better define the function of Saccharomyces cerevisiae SSB1, an abundant single-stranded nucleic acid-binding protein, we determined the nucleotide sequence of the SSB1 gene and compared it with those of other proteins of known function. The amino acid sequence contains 293 amino acid residues and has an Mr of 32,853. There are several stretches of sequence characteristic of other eucaryotic single-stranded nucleic acid-binding proteins. At the amino terminus, residues 39 to 54 are highly homologous to a peptide in calf thymus UP1 and UP2 and a human heterogeneous nuclear ribonucleoprotein. Residues 125 to 162 constitute a fivefold tandem repeat of the sequence RGGFRG, the composition of which suggests a nucleic acid-binding site. Near the C terminus, residues 233 to 245 are homologous to several RNA-binding proteins. Of 18 C-terminal residues, 10 are acidic, a characteristic of the procaryotic single-stranded DNA-binding proteins and eucaryotic DNA- and RNA-binding proteins. In addition, examination of the subcellular distribution of SSB1 by immunofluorescence microscopy indicated that SSB1 is a nuclear protein, predominantly located in the nucleolus. Sequence homologies and the nucleolar localization make it likely that SSB1 functions in RNA metabolism in vivo, although an additional role in DNA metabolism cannot be excluded. Images PMID:2823109
Fetterman, Jessica L; Zelickson, Blake R; Johnson, Larry W; Moellering, Douglas R; Westbrook, David G; Pompilius, Melissa; Sammy, Melissa J; Johnson, Michelle; Dunham-Snary, Kimberly J; Cao, Xuemei; Bradley, Wayne E; Zhang, Jinju; Wei, Chih-Chang; Chacko, Balu; Schurr, Theodore G; Kesterson, Robert A; Dell'italia, Louis J; Darley-Usmar, Victor M; Welch, Danny R; Ballinger, Scott W
2013-10-15
Dysfunctional bioenergetics has emerged as a key feature in many chronic pathologies such as diabetes and cardiovascular disease. This has led to the mitochondrial paradigm in which it has been proposed that mtDNA sequence variation contributes to disease susceptibility. In the present study we show a novel animal model of mtDNA polymorphisms, the MNX (mitochondrial-nuclear exchange) mouse, in which the mtDNA from the C3H/HeN mouse has been inserted on to the C57/BL6 nuclear background and vice versa to test this concept. Our data show a major contribution of the C57/BL6 mtDNA to the susceptibility to the pathological stress of cardiac volume overload which is independent of the nuclear background. Mitochondria harbouring the C57/BL6J mtDNA generate more ROS (reactive oxygen species) and have a higher mitochondrial membrane potential relative to those with C3H/HeN mtDNA, independent of nuclear background. We propose this is the primary mechanism associated with increased bioenergetic dysfunction in response to volume overload. In summary, these studies support the 'mitochondrial paradigm' for the development of disease susceptibility, and show that the mtDNA modulates cellular bioenergetics, mitochondrial ROS generation and susceptibility to cardiac stress.
Evers, R; Grummt, I
1995-01-01
Both the DNA elements and the nuclear factors that direct termination of ribosomal gene transcription exhibit species-specific differences. Even between mammals--e.g., human and mouse--the termination signals are not identical and the respective transcription termination factors (TTFs) which bind to the terminator sequence are not fully interchangeable. To elucidate the molecular basis for this species-specificity, we have cloned TTF-I from human and mouse cells and compared their structural and functional properties. Recombinant TTF-I exhibits species-specific DNA binding and terminates transcription both in cell-free transcription assays and in transfection experiments. Chimeric constructs of mouse TTF-I and human TTF-I reveal that the major determinant for species-specific DNA binding resides within the C terminus of TTF-I. Replacing 31 C-terminal amino acids of mouse TTF-I with the homologous human sequences relaxes the DNA-binding specificity and, as a consequence, allows the chimeric factor to bind the human terminator sequence and to specifically stop rDNA transcription. Images Fig. 2 Fig. 3 Fig. 4 PMID:7597036
Mort, Mark E; Levsen, Nicholas; Randle, Christopher P; Van Jaarsveld, Ernst; Palmer, Annie
2005-07-01
Crassulaceae includes approximately 35 genera and 1500 species of leaf and stem succulent flowering plants. The family is nearly cosmopolitan in distribution, but is particularly diverse in southern Africa, where five genera comprising approximately 325 species are found. One of these genera, Cotyledon, includes 10 species that are largely confined to South Africa, where they are commonly found on rocky hillsides, coastal flats, and cliff faces. Species of Cotyledon are characterized by five-parted, pendulous, sympetalous flowers, but the genus is highly diverse in growth form, flower color and size, and leaf morphology. One particularly variable species, C. orbiculata, has been divided into five varieties based on leaf morphology and biogeography; however, the monophyly of this species as well as the relationships among the varieties have not previously been investigated. Parsimony analyses of a combined data set of DNA sequences from chloroplast and nuclear genome provided the first estimate of phylogeny for Cotyledon, and resulted in two minimum-length trees and a fully resolved phylogeny for the genus. Results indicate that C. orbiculata is not monophyletic and suggest the need for additional studies and a revised classification within the genus.
USDA-ARS?s Scientific Manuscript database
Analysis of DNA methylation patterns relies increasingly on sequencing-based profiling methods. The four most frequently used sequencing-based technologies are the bisulfite-based methods MethylC-seq and reduced representation bisulfite sequencing (RRBS), and the enrichment-based techniques methylat...
Ley, A C; Hardy, O J
2010-11-01
Species delimitation is a fundamental biological concept which is frequently discussed and altered to integrate new insights. These revealed that speciation is not a one step phenomenon but an ongoing process and morphological characters alone are not sufficient anymore to properly describe the results of this process. Here we want to assess the degree of speciation in two closely related lianescent taxa from the tropical African genus Haumania which display distinct vegetative traits despite a high similarity in reproductive traits and a partial overlap in distribution area which might facilitate gene flow. To this end, we combined phylogenetic and phylogeographic analyses using nuclear (nr) and chloroplast (cp) DNA sequences in comparison to morphological species descriptions. The nuclear dataset unambiguously supports the morphological species concept in Haumania. However, the main chloroplastic haplotypes are shared between species and, although a geographic analysis of cpDNA diversity confirms that individuals from the same taxon are more related than individuals from distinct taxa, cp-haplotypes display correlated geographic distributions between species. Hybridization is the most plausible reason for this pattern. A scenario involving speciation in geographic isolation followed by range expansion is outlined. The study highlights the gain of information on the speciation process in Haumania by adding georeferenced molecular data to the morphological characteristics. It also shows that nr and cp sequence data might provide different but complementary information, questioning the reliability of the unique use of chloroplast data for species recognition by DNA barcoding. Copyright © 2010 Elsevier Inc. All rights reserved.
Phylogeographic patterns of Armillaria ostoyae in the western United States
J. W. Hanna; N. B. Klopfenstein; M. -S. Kim; G. I. McDonald; J. A. Moore
2007-01-01
Nuclear ribosomal DNA regions (i.e. large subunit, internal transcribed spacer, 5.8S and intergenic spacer) were sequenced using a direct-polymerase chain reaction method from Armillaria ostoyae genets collected from the western USA. Many of the A. ostoyae genets contained heterogeneity among rDNA repeats, indicating intragenomic variation and likely intraspecific...
Cephalosporium maydis is a distinct species in the Gaeumannomyces-Harpophora species complex.
Saleh, Amgad A; Leslie, John F
2004-01-01
Cephalosporium maydis is an important plant pathogen whose phylogenetic position relative to other fungi has not been established clearly. We compared strains of C. maydis, strains from several other plant-pathogenic Cephalosporium spp. and several possible relatives within the Gaeumannomyces-Harpophora species complex, to which C. maydis has been suggested to belong based on previous preliminary DNA sequence analyses. DNA sequences of the nuclear genes encoding the rDNA ITS region, β-tubulin, histone H3, and MAT-2 support the hypothesis that C. maydis is a distinct taxon within the Gaeumannomyces-Harpophora species complex. Based on amplified fragment length polymorphism (AFLP) profiles, C. maydis also is distinct from the other tested species of Cephalosporium, Phialophora sensu lato and members of Gaeumannomyces-Harpophora species complex, which supports its classification as Harpophora maydis. Oligonucleotide primers for H. maydis were developed that can be used in a PCR diagnostic protocol to rapidly and reliably detect and identify this pathogen. These diagnostic PCR primers will aid the detection of H. maydis in diseased maize because this fungus can be difficult to detect and isolate, and the movement of authentic cultures may be limited by quarantine restrictions.
Guo, Yahong; Tsuruga, Ayako; Yamaguchi, Shigeharu; Oba, Koji; Iwai, Kasumi; Sekita, Setsuko; Mizukami, Hajime
2006-06-01
Chloroplast chlB gene encoding subunit B of light-independent protochlorophyllide reductase was amplified from herbarium and crude drug specimens of Ephedra sinica, E. intermedia, E. equisetina, and E. przewalskii. Sequence comparison of the chlB gene indicated that all the E. sinica specimens have the same sequence type (Type S) distinctive from other species, while there are two sequence types (Type E1 and Type E2) in E. equisetina. E. intermedia and E. prezewalskii revealed an identical sequence type (Type IP). E. sinica was also identified by digesting the chlB fragment with Bcl I. A novel method for DNA authentication of Ephedra Herb based on the sequences of the chloroplast chlB gene and internal transcribed spacer of nuclear rRNA genes was developed and successfully applied for identification of the crude drugs obtained in the Chinese market.
Extracting DNA words based on the sequence features: non-uniform distribution and integrity.
Li, Zhi; Cao, Hongyan; Cui, Yuehua; Zhang, Yanbo
2016-01-25
DNA sequence can be viewed as an unknown language with words as its functional units. Given that most sequence alignment algorithms such as the motif discovery algorithms depend on the quality of background information about sequences, it is necessary to develop an ab initio algorithm for extracting the "words" based only on the DNA sequences. We considered that non-uniform distribution and integrity were two important features of a word, based on which we developed an ab initio algorithm to extract "DNA words" that have potential functional meaning. A Kolmogorov-Smirnov test was used for consistency test of uniform distribution of DNA sequences, and the integrity was judged by the sequence and position alignment. Two random base sequences were adopted as negative control, and an English book was used as positive control to verify our algorithm. We applied our algorithm to the genomes of Saccharomyces cerevisiae and 10 strains of Escherichia coli to show the utility of the methods. The results provide strong evidences that the algorithm is a promising tool for ab initio building a DNA dictionary. Our method provides a fast way for large scale screening of important DNA elements and offers potential insights into the understanding of a genome.
Nilsson, R Henrik; Tedersoo, Leho; Ryberg, Martin; Kristiansson, Erik; Hartmann, Martin; Unterseher, Martin; Porter, Teresita M; Bengtsson-Palme, Johan; Walker, Donald M; de Sousa, Filipe; Gamper, Hannes Andres; Larsson, Ellen; Larsson, Karl-Henrik; Kõljalg, Urmas; Edgar, Robert C; Abarenkov, Kessy
2015-01-01
The nuclear ribosomal internal transcribed spacer (ITS) region is the most commonly chosen genetic marker for the molecular identification of fungi in environmental sequencing and molecular ecology studies. Several analytical issues complicate such efforts, one of which is the formation of chimeric-artificially joined-DNA sequences during PCR amplification or sequence assembly. Several software tools are currently available for chimera detection, but rely to various degrees on the presence of a chimera-free reference dataset for optimal performance. However, no such dataset is available for use with the fungal ITS region. This study introduces a comprehensive, automatically updated reference dataset for fungal ITS sequences based on the UNITE database for the molecular identification of fungi. This dataset supports chimera detection throughout the fungal kingdom and for full-length ITS sequences as well as partial (ITS1 or ITS2 only) datasets. The performance of the dataset on a large set of artificial chimeras was above 99.5%, and we subsequently used the dataset to remove nearly 1,000 compromised fungal ITS sequences from public circulation. The dataset is available at http://unite.ut.ee/repository.php and is subject to web-based third-party curation.
Nilsson, R. Henrik; Tedersoo, Leho; Ryberg, Martin; Kristiansson, Erik; Hartmann, Martin; Unterseher, Martin; Porter, Teresita M.; Bengtsson-Palme, Johan; Walker, Donald M.; de Sousa, Filipe; Gamper, Hannes Andres; Larsson, Ellen; Larsson, Karl-Henrik; Kõljalg, Urmas; Edgar, Robert C.; Abarenkov, Kessy
2015-01-01
The nuclear ribosomal internal transcribed spacer (ITS) region is the most commonly chosen genetic marker for the molecular identification of fungi in environmental sequencing and molecular ecology studies. Several analytical issues complicate such efforts, one of which is the formation of chimeric—artificially joined—DNA sequences during PCR amplification or sequence assembly. Several software tools are currently available for chimera detection, but rely to various degrees on the presence of a chimera-free reference dataset for optimal performance. However, no such dataset is available for use with the fungal ITS region. This study introduces a comprehensive, automatically updated reference dataset for fungal ITS sequences based on the UNITE database for the molecular identification of fungi. This dataset supports chimera detection throughout the fungal kingdom and for full-length ITS sequences as well as partial (ITS1 or ITS2 only) datasets. The performance of the dataset on a large set of artificial chimeras was above 99.5%, and we subsequently used the dataset to remove nearly 1,000 compromised fungal ITS sequences from public circulation. The dataset is available at http://unite.ut.ee/repository.php and is subject to web-based third-party curation. PMID:25786896
Nuclear DNA amounts in angiosperms: progress, problems and prospects.
Bennett, M D; Leitch, I J
2005-01-01
The nuclear DNA amount in an unreplicated haploid chromosome complement (1C-value) is a key diversity character with many uses. Angiosperm C-values have been listed for reference purposes since 1976, and pooled in an electronic database since 1997 (http://www.kew.org/cval/homepage). Such lists are cited frequently and provide data for many comparative studies. The last compilation was published in 2000, so a further supplementary list is timely to monitor progress against targets set at the first plant genome size workshop in 1997 and to facilitate new goal setting. The present work lists DNA C-values for 804 species including first values for 628 species from 88 original sources, not included in any previous compilation, plus additional values for 176 species included in a previous compilation. 1998-2002 saw striking progress in our knowledge of angiosperm C-values. At least 1700 first values for species were measured (the most in any five-year period) and familial representation rose from 30 % to 50 %. The loss of many densitometers used to measure DNA C-values proved less serious than feared, owing to the development of relatively inexpensive flow cytometers and computer-based image analysis systems. New uses of the term genome (e.g. in 'complete' genome sequencing) can cause confusion. The Arabidopsis Genome Initiative C-value for Arabidopsis thaliana (125 Mb) was a gross underestimate, and an exact C-value based on genome sequencing alone is unlikely to be obtained soon for any angiosperm. Lack of this expected benchmark poses a quandary as to what to use as the basal calibration standard for angiosperms. The next decade offers exciting prospects for angiosperm genome size research. The database (http://www.kew.org/cval/homepage) should become sufficiently representative of the global flora to answer most questions without needing new estimations. DNA amount variation will remain a key interest as an integrated strand of holistic genomics.
Sequence-dependent DNA deformability studied using molecular dynamics simulations.
Fujii, Satoshi; Kono, Hidetoshi; Takenaka, Shigeori; Go, Nobuhiro; Sarai, Akinori
2007-01-01
Proteins recognize specific DNA sequences not only through direct contact between amino acids and bases, but also indirectly based on the sequence-dependent conformation and deformability of the DNA (indirect readout). We used molecular dynamics simulations to analyze the sequence-dependent DNA conformations of all 136 possible tetrameric sequences sandwiched between CGCG sequences. The deformability of dimeric steps obtained by the simulations is consistent with that by the crystal structures. The simulation results further showed that the conformation and deformability of the tetramers can highly depend on the flanking base pairs. The conformations of xATx tetramers show the most rigidity and are not affected by the flanking base pairs and the xYRx show by contrast the greatest flexibility and change their conformations depending on the base pairs at both ends, suggesting tetramers with the same central dimer can show different deformabilities. These results suggest that analysis of dimeric steps alone may overlook some conformational features of DNA and provide insight into the mechanism of indirect readout during protein-DNA recognition. Moreover, the sequence dependence of DNA conformation and deformability may be used to estimate the contribution of indirect readout to the specificity of protein-DNA recognition as well as nucleosome positioning and large-scale behavior of nucleic acids.
Berry, Neil; Jenkins, Adrian; Martin, Javier; Davis, Clare; Wood, David; Schild, Geoffrey; Bottiger, Margareta; Holmes, Harvey; Minor, Philip; Almond, Neil
2005-02-25
Inoculation of live experimental oral poliovirus vaccines (OPV CHAT) during the 1950s in central Africa has been proposed to account for the introduction of HIV into human populations. For this to have occurred, it would have been necessary for chimpanzee rather than macaque kidney epithelial cells to have been included in the preparation of early OPV materials. Theoretically, this could have led to contamination with a progenitor of HIV-1 derived from a related simian immunodeficiency virus of chimpanzees (SIVCPZ). In this article we present further detailed analyses of two samples of OPV, CHAT 10A-11 and CHAT 6039/Yugo, which were used in early human trials of poliovirus vaccination. Recovery of poliovirus by culture techniques confirmed the biological viability of the vaccines and sequence analysis of poliovirus RNA specifically identified the presence of the CHAT strain. Independent nested sets of oligonucleotide primers specific for HIV-1/SIVCPZ and HIV-2/SIVMAC/SIVSM phylogenetic lineages, respectively, indicated no evidence of HIV/SIV RNA in either vaccine preparation, at a sensitivity of 100 RNA equivalents/ml. Analysis of cellular substrate by the amplification of two distinct regions of mitochondrial DNA (D-loop control region and 12S ribosomal sequences) revealed no evidence of chimpanzee cellular sequences. However, this approach positively identified rhesus and cynomolgus macaque DNA for the CHAT 10A-11 and CHAT 6039/Yugo vaccine preparations, respectively. Analysis of multiple clones of mtDNA 12S rDNA indicated a relatively high number of nuclear mitochondrial DNA sequences (numts) in the CHAT 10A-11 material, but confirmed the macaque origin of cellular substrate used in vaccine preparation. These data reinforce earlier findings on this topic providing no evidence to support the contention that poliovirus vaccination was responsible for the introduction of HIV into humans and sparking the AIDS pandemic.
The DL1 repeats in the genome of Diphyllobothrium latum.
Usmanova, Nadezhda M; Kazakov, Vasiliy I
2010-07-01
Diphyllobothrium latum is a widespread intestinal parasite, which has a great clinical relevance, but there are no sequences of its nuclear genome. In this paper, a repetitive element in the D. latum genome is firstly described. The adult D. latum was obtained in the result of expulsion from intestinum of a patient suffering from diphyllobothriasis. Genomic DNA was isolated from several proglottids of this individual. PstI restriction products of D. latum genomic DNA were sequenced. Polymerase chain reaction (PCR) amplification of these products using genomic DNA and selected primers was carried out. Thereby a cluster of a repetitive element, called DL1, was discovered. For precise identification of a beginning and an end of the repeat, a product of PCR amplification of D. latum genomic DNA with one specific primer was sequenced. In discussion, several evidences that DL1 repeat is a member of the SINE family of retroposons were adduced.
Googling DNA sequences on the World Wide Web.
Hajibabaei, Mehrdad; Singer, Gregory A C
2009-11-10
New web-based technologies provide an excellent opportunity for sharing and accessing information and using web as a platform for interaction and collaboration. Although several specialized tools are available for analyzing DNA sequence information, conventional web-based tools have not been utilized for bioinformatics applications. We have developed a novel algorithm and implemented it for searching species-specific genomic sequences, DNA barcodes, by using popular web-based methods such as Google. We developed an alignment independent character based algorithm based on dividing a sequence library (DNA barcodes) and query sequence to words. The actual search is conducted by conventional search tools such as freely available Google Desktop Search. We implemented our algorithm in two exemplar packages. We developed pre and post-processing software to provide customized input and output services, respectively. Our analysis of all publicly available DNA barcode sequences shows a high accuracy as well as rapid results. Our method makes use of conventional web-based technologies for specialized genetic data. It provides a robust and efficient solution for sequence search on the web. The integration of our search method for large-scale sequence libraries such as DNA barcodes provides an excellent web-based tool for accessing this information and linking it to other available categories of information on the web.
DNA-based watermarks using the DNA-Crypt algorithm.
Heider, Dominik; Barnekow, Angelika
2007-05-29
The aim of this paper is to demonstrate the application of watermarks based on DNA sequences to identify the unauthorized use of genetically modified organisms (GMOs) protected by patents. Predicted mutations in the genome can be corrected by the DNA-Crypt program leaving the encrypted information intact. Existing DNA cryptographic and steganographic algorithms use synthetic DNA sequences to store binary information however, although these sequences can be used for authentication, they may change the target DNA sequence when introduced into living organisms. The DNA-Crypt algorithm and image steganography are based on the same watermark-hiding principle, namely using the least significant base in case of DNA-Crypt and the least significant bit in case of the image steganography. It can be combined with binary encryption algorithms like AES, RSA or Blowfish. DNA-Crypt is able to correct mutations in the target DNA with several mutation correction codes such as the Hamming-code or the WDH-code. Mutations which can occur infrequently may destroy the encrypted information, however an integrated fuzzy controller decides on a set of heuristics based on three input dimensions, and recommends whether or not to use a correction code. These three input dimensions are the length of the sequence, the individual mutation rate and the stability over time, which is represented by the number of generations. In silico experiments using the Ypt7 in Saccharomyces cerevisiae shows that the DNA watermarks produced by DNA-Crypt do not alter the translation of mRNA into protein. The program is able to store watermarks in living organisms and can maintain the original information by correcting mutations itself. Pairwise or multiple sequence alignments show that DNA-Crypt produces few mismatches between the sequences similar to all steganographic algorithms.
DNA-based watermarks using the DNA-Crypt algorithm
Heider, Dominik; Barnekow, Angelika
2007-01-01
Background The aim of this paper is to demonstrate the application of watermarks based on DNA sequences to identify the unauthorized use of genetically modified organisms (GMOs) protected by patents. Predicted mutations in the genome can be corrected by the DNA-Crypt program leaving the encrypted information intact. Existing DNA cryptographic and steganographic algorithms use synthetic DNA sequences to store binary information however, although these sequences can be used for authentication, they may change the target DNA sequence when introduced into living organisms. Results The DNA-Crypt algorithm and image steganography are based on the same watermark-hiding principle, namely using the least significant base in case of DNA-Crypt and the least significant bit in case of the image steganography. It can be combined with binary encryption algorithms like AES, RSA or Blowfish. DNA-Crypt is able to correct mutations in the target DNA with several mutation correction codes such as the Hamming-code or the WDH-code. Mutations which can occur infrequently may destroy the encrypted information, however an integrated fuzzy controller decides on a set of heuristics based on three input dimensions, and recommends whether or not to use a correction code. These three input dimensions are the length of the sequence, the individual mutation rate and the stability over time, which is represented by the number of generations. In silico experiments using the Ypt7 in Saccharomyces cerevisiae shows that the DNA watermarks produced by DNA-Crypt do not alter the translation of mRNA into protein. Conclusion The program is able to store watermarks in living organisms and can maintain the original information by correcting mutations itself. Pairwise or multiple sequence alignments show that DNA-Crypt produces few mismatches between the sequences similar to all steganographic algorithms. PMID:17535434
Kang, Sang-Ho; Lee, Jeong-Hoon; Lee, Hyun Oh; Ahn, Byoung Ohg; Won, So Youn; Sohn, Seong-Han; Kim, Jung Sun
2017-10-06
Glycyrrhiza uralensis and G. glabra, members of the Fabaceae, are medicinally important species that are native to Asia and Europe. Extracts from these plants are widely used as natural sweeteners because of their much greater sweetness than sucrose. In this study, the three complete chloroplast genomes and five 45S nuclear ribosomal (nr)DNA sequences of these two licorice species and an interspecific hybrid are presented. The chloroplast genomes of G. glabra, G. uralensis and G. glabra × G. uralensis were 127,895 bp, 127,716 bp and 127,939 bp, respectively. The three chloroplast genomes harbored 110 annotated genes, including 76 protein-coding genes, 30 tRNA genes and 4 rRNA genes. The 45S nrDNA sequences were either 5,947 or 5,948 bp in length. Glycyrrhiza glabra and G. glabra × G. uralensis showed two types of nrDNA, while G. uralensis contained a single type. The complete 45S nrDNA sequence unit contains 18S rRNA, ITS1, 5.8S rRNA, ITS2 and 26S rRNA. We identified simple sequence repeat and tandem repeat sequences. We also developed four reliable markers for analysis of Glycyrrhiza diversity authentication.
Hirose, Noriyuki; Nishimura, Kazuko; Inoue-Sakamoto, Maki; Masuda, Michiaki
2013-01-01
Prototheca species are achlorophyllous algae ubiquitous in nature and known to cause localized and systemic infection both in humans and animals. Although identification of the Prototheca species in clinical specimens is a challenge, there are an increasing number of cases in which molecular techniques have successfully been used for diagnosis of protothecosis. In this study, we characterized nuclear ribosomal DNA (rDNA) of a strain of Prototheca (FL11-0001) isolated from a dermatitis patient in Japan for its species identification. When nuclear rDNA of FL11-0001 and that of various other Prototheca strains were compared by polymerase chain reaction (PCR), the results indicated that the sizes of ribosomal internal transcribed spacer (ITS) were different in a species-dependent manner, suggesting that the variation might be useful for differentiation of Prototheca spp. Especially, ITS of P. wickerhamii, the most common cause of human protothecosis, was distinctively larger than that of other Prototheca spp. FL11-0001, whose ITS was comparably large, could easily be identified as P. wickerhamii. The usefulness of the PCR analysis of ITS was also demonstrated by the discovery that one of the clinical isolates that had previously been designated as P. wickerhamii was likely a novel species. Furthermore, our data demonstrated that nucleotide sequences of P. wickerhamii ITS are heterogenous between different rDNA copies in each strain and also polymorphic between strains. Phylogenetic analysis suggested that the ITS sequences could be classified to four clades, based on which P. wickerhamii strains might be grouped into at least two genotypes. Comprehensive characterization of Prototheca rDNA may provide valuable insights into diagnosis and epidemiology of protothecosis, as well as evolution and taxonomy of Prototheca and related organisms. PMID:24312279
Hirose, Noriyuki; Nishimura, Kazuko; Inoue-Sakamoto, Maki; Masuda, Michiaki
2013-01-01
Prototheca species are achlorophyllous algae ubiquitous in nature and known to cause localized and systemic infection both in humans and animals. Although identification of the Prototheca species in clinical specimens is a challenge, there are an increasing number of cases in which molecular techniques have successfully been used for diagnosis of protothecosis. In this study, we characterized nuclear ribosomal DNA (rDNA) of a strain of Prototheca (FL11-0001) isolated from a dermatitis patient in Japan for its species identification. When nuclear rDNA of FL11-0001 and that of various other Prototheca strains were compared by polymerase chain reaction (PCR), the results indicated that the sizes of ribosomal internal transcribed spacer (ITS) were different in a species-dependent manner, suggesting that the variation might be useful for differentiation of Prototheca spp. Especially, ITS of P. wickerhamii, the most common cause of human protothecosis, was distinctively larger than that of other Prototheca spp. FL11-0001, whose ITS was comparably large, could easily be identified as P. wickerhamii. The usefulness of the PCR analysis of ITS was also demonstrated by the discovery that one of the clinical isolates that had previously been designated as P. wickerhamii was likely a novel species. Furthermore, our data demonstrated that nucleotide sequences of P. wickerhamii ITS are heterogenous between different rDNA copies in each strain and also polymorphic between strains. Phylogenetic analysis suggested that the ITS sequences could be classified to four clades, based on which P. wickerhamii strains might be grouped into at least two genotypes. Comprehensive characterization of Prototheca rDNA may provide valuable insights into diagnosis and epidemiology of protothecosis, as well as evolution and taxonomy of Prototheca and related organisms.
[Current applications of high-throughput DNA sequencing technology in antibody drug research].
Yu, Xin; Liu, Qi-Gang; Wang, Ming-Rong
2012-03-01
Since the publication of a high-throughput DNA sequencing technology based on PCR reaction was carried out in oil emulsions in 2005, high-throughput DNA sequencing platforms have been evolved to a robust technology in sequencing genomes and diverse DNA libraries. Antibody libraries with vast numbers of members currently serve as a foundation of discovering novel antibody drugs, and high-throughput DNA sequencing technology makes it possible to rapidly identify functional antibody variants with desired properties. Herein we present a review of current applications of high-throughput DNA sequencing technology in the analysis of antibody library diversity, sequencing of CDR3 regions, identification of potent antibodies based on sequence frequency, discovery of functional genes, and combination with various display technologies, so as to provide an alternative approach of discovery and development of antibody drugs.
Tkach, Vasyl V; Makarikov, Arseny A; Kinsella, John M
2013-01-01
Staphylocystis clydesengeri n. sp. is described from shrews Sorex vagrans in Montana and Washington, United States. It differs from the only previously known North American representative of the genus, S. schilleri, in having more numerous (37-42 vs. 22-30) and larger (39-44 microm vs. 27-30 microm) rostellar hooks. The two species also differ in several other important characters such as relative length of the cirrus pouch, position of gonads and shape of mature proglottides. Morphological differentiation of the new species from all previously known Palearctic species of Staphylocystis from Sorex is also provided. Differentiation from Staphylocystis parasitic in crocidurine shrews is not provided due to the high level of specificity among shrew hymenolepidids to the host genera and much greater levels of sequence divergence between Staphylocystis from the two groups of shrews. Molecular differentiation based on 2,800 base pair long sequences of nuclear ribosomal RNA (complete ITS region and partial 28S region), 663 base pair long sequences of mitochondrial nad1 gene and 542 base pair long sequences of mitochondrial ribosomal 16S gene strongly support the status of Staphylocystis clydesengeri n. sp. Relative utility of the DNA fragments used in this study for reliable differentiation among closely related species of mammalian hymenolepidids is discussed. Nuclear ribosomal RNA region appears to be too conserved for this purpose. Use of at least one mitochondrial gene in addition to nuclear ribosomal RNA or without it, is recommended. Vampirolepis novosibirskiensis Sawada & Kobayashi, 1994 is transferred to Staphylocystis as a junior synonym of S. furcara (Stieda, 1862). Rodentolepis gnoskei Greiman & Tkach, 2012 is transferred to Pararodentolepis Makarikov and Gulyaev, 2009 as a new combination Pararodentolepis gnoskei (Greiman & Tkach, 2012) n. comb.
Xie, Guosen; Mo, Zhongxi
2011-01-21
In this article, we introduce three 3D graphical representations of DNA primary sequences, which we call RY-curve, MK-curve and SW-curve, based on three classifications of the DNA bases. The advantages of our representations are that (i) these 3D curves are strictly non-degenerate and there is no loss of information when transferring a DNA sequence to its mathematical representation and (ii) the coordinates of every node on these 3D curves have clear biological implication. Two applications of these 3D curves are presented: (a) a simple formula is derived to calculate the content of the four bases (A, G, C and T) from the coordinates of nodes on the curves; and (b) a 12-component characteristic vector is constructed to compare similarity among DNA sequences from different species based on the geometrical centers of the 3D curves. As examples, we examine similarity among the coding sequences of the first exon of beta-globin gene from eleven species and validate similarity of cDNA sequences of beta-globin gene from eight species. Copyright © 2010 Elsevier Ltd. All rights reserved.
Star, Bastiaan; Nederbragt, Alexander J.; Hansen, Marianne H. S.; Skage, Morten; Gilfillan, Gregor D.; Bradbury, Ian R.; Pampoulie, Christophe; Stenseth, Nils Chr; Jakobsen, Kjetill S.; Jentoft, Sissel
2014-01-01
Degradation-specific processes and variation in laboratory protocols can bias the DNA sequence composition from samples of ancient or historic origin. Here, we identify a novel artifact in sequences from historic samples of Atlantic cod (Gadus morhua), which forms interrupted palindromes consisting of reverse complementary sequence at the 5′ and 3′-ends of sequencing reads. The palindromic sequences themselves have specific properties – the bases at the 5′-end align well to the reference genome, whereas extensive misalignments exists among the bases at the terminal 3′-end. The terminal 3′ bases are artificial extensions likely caused by the occurrence of hairpin loops in single stranded DNA (ssDNA), which can be ligated and amplified in particular library creation protocols. We propose that such hairpin loops allow the inclusion of erroneous nucleotides, specifically at the 3′-end of DNA strands, with the 5′-end of the same strand providing the template. We also find these palindromes in previously published ancient DNA (aDNA) datasets, albeit at varying and substantially lower frequencies. This artifact can negatively affect the yield of endogenous DNA in these types of samples and introduces sequence bias. PMID:24608104
Local alignment of two-base encoded DNA sequence
Homer, Nils; Merriman, Barry; Nelson, Stanley F
2009-01-01
Background DNA sequence comparison is based on optimal local alignment of two sequences using a similarity score. However, some new DNA sequencing technologies do not directly measure the base sequence, but rather an encoded form, such as the two-base encoding considered here. In order to compare such data to a reference sequence, the data must be decoded into sequence. The decoding is deterministic, but the possibility of measurement errors requires searching among all possible error modes and resulting alignments to achieve an optimal balance of fewer errors versus greater sequence similarity. Results We present an extension of the standard dynamic programming method for local alignment, which simultaneously decodes the data and performs the alignment, maximizing a similarity score based on a weighted combination of errors and edits, and allowing an affine gap penalty. We also present simulations that demonstrate the performance characteristics of our two base encoded alignment method and contrast those with standard DNA sequence alignment under the same conditions. Conclusion The new local alignment algorithm for two-base encoded data has substantial power to properly detect and correct measurement errors while identifying underlying sequence variants, and facilitating genome re-sequencing efforts based on this form of sequence data. PMID:19508732
Pasion, S G; Brown, G W; Brown, L M; Ray, D S
1994-12-01
In trypanosomatids, DNA replication in the nucleus and in the single mitochondrion (or kinetoplast) initiates nearly simultaneously, suggesting that the DNA synthesis (S) phases of the nucleus and the mitochondrion are coordinately regulated. To investigate the basis for the temporal link between nuclear and mitochondrial DNA synthesis phases the expression of the genes encoding DNA ligase I, the 51 and 28 kDa subunits of replication protein A, dihydrofolate reductase and the mitochondrial type II topoisomerase were analyzed during the cell cycle progression of synchronous cultures of Crithidia fasciculata. These DNA replication genes were all expressed periodically, with peak mRNA levels occurring just prior to or at the peak of DNA synthesis in the synchronized cultures. A plasmid clone (pdN-1) in which TOP2, the gene encoding the mitochondrial topoisomerase, was disrupted by the insertion of a NEO drug-resistance cassette was found to express both a truncated TOP2 mRNA and a truncated topoisomerase polypeptide. The truncated mRNA was also expressed periodically coordinate with the expression of the endogenous TOP2 mRNA indicating that cis elements necessary for periodic expression are contained within cloned sequences. The expression of both TOP2 and nuclear DNA replication genes at the G1/S boundary suggests that regulated expression of these genes may play a role in coordinating nuclear and mitochondrial S phases in trypanosomatids.
DNABIT Compress - Genome compression algorithm.
Rajarajeswari, Pothuraju; Apparao, Allam
2011-01-22
Data compression is concerned with how information is organized in data. Efficient storage means removal of redundancy from the data being stored in the DNA molecule. Data compression algorithms remove redundancy and are used to understand biologically important molecules. We present a compression algorithm, "DNABIT Compress" for DNA sequences based on a novel algorithm of assigning binary bits for smaller segments of DNA bases to compress both repetitive and non repetitive DNA sequence. Our proposed algorithm achieves the best compression ratio for DNA sequences for larger genome. Significantly better compression results show that "DNABIT Compress" algorithm is the best among the remaining compression algorithms. While achieving the best compression ratios for DNA sequences (Genomes),our new DNABIT Compress algorithm significantly improves the running time of all previous DNA compression programs. Assigning binary bits (Unique BIT CODE) for (Exact Repeats, Reverse Repeats) fragments of DNA sequence is also a unique concept introduced in this algorithm for the first time in DNA compression. This proposed new algorithm could achieve the best compression ratio as much as 1.58 bits/bases where the existing best methods could not achieve a ratio less than 1.72 bits/bases.
2013-01-01
Background The spatial organization of the genome is being evaluated as a novel indicator of toxicity in conjunction with drug-induced global DNA hypomethylation and concurrent chromatin reorganization. 3D quantitative DNA methylation imaging (3D-qDMI) was applied as a cell-by-cell high-throughput approach to investigate this matter by assessing genome topology through represented immunofluorescent nuclear distribution patterns of 5-methylcytosine (MeC) and global DNA (4,6-diamidino-2-phenylindole = DAPI) in labeled nuclei. Methods Differential progression of global DNA hypomethylation was studied by comparatively dosing zebularine (ZEB) and 5-azacytidine (AZA). Treated and untreated (control) human prostate and liver cancer cells were subjected to confocal scanning microscopy and dedicated 3D image analysis for the following features: differential nuclear MeC/DAPI load and codistribution patterns, cell similarity based on these patterns, and corresponding differences in the topology of low-intensity MeC (LIM) and low in intensity DAPI (LID) sites. Results Both agents generated a high fraction of similar MeC phenotypes across applied concentrations. ZEB exerted similar effects at 10–100-fold higher drug concentrations than its AZA analogue: concentration-dependent progression of global cytosine demethylation, validated by measuring differential MeC levels in repeat sequences using MethyLight, and the concurrent increase in nuclear LIM densities correlated with cellular growth reduction and cytotoxicity. Conclusions 3D-qDMI demonstrated the capability of quantitating dose-dependent drug-induced spatial progression of DNA demethylation in cell nuclei, independent from interphase cell-cycle stages and in conjunction with cytotoxicity. The results support the notion of DNA methylation topology being considered as a potential indicator of causal impacts on chromatin distribution with a conceivable application in epigenetic drug toxicology. PMID:23394161
Sequence periodicity in nucleosomal DNA and intrinsic curvature.
Nair, T Murlidharan
2010-05-17
Most eukaryotic DNA contained in the nucleus is packaged by wrapping DNA around histone octamers. Histones are ubiquitous and bind most regions of chromosomal DNA. In order to achieve smooth wrapping of the DNA around the histone octamer, the DNA duplex should be able to deform and should possess intrinsic curvature. The deformability of DNA is a result of the non-parallelness of base pair stacks. The stacking interaction between base pairs is sequence dependent. The higher the stacking energy the more rigid the DNA helix, thus it is natural to expect that sequences that are involved in wrapping around the histone octamer should be unstacked and possess intrinsic curvature. Intrinsic curvature has been shown to be dictated by the periodic recurrence of certain dinucleotides. Several genome-wide studies directed towards mapping of nucleosome positions have revealed periodicity associated with certain stretches of sequences. In the current study, these sequences have been analyzed with a view to understand their sequence-dependent structures. Higher order DNA structures and the distribution of molecular bend loci associated with 146 base nucleosome core DNA sequence from C. elegans and chicken have been analyzed using the theoretical model for DNA curvature. The curvature dispersion calculated by cyclically permuting the sequences revealed that the molecular bend loci were delocalized throughout the nucleosome core region and had varying degrees of intrinsic curvature. The higher order structures associated with nucleosomes of C.elegans and chicken calculated from the sequences revealed heterogeneity with respect to the deviation of the DNA axis. The results points to the possibility of context dependent curvature of varying degrees to be associated with nucleosomal DNA.
Taylor, Robin L; Bailey, Jeffrey Craig; Freshwater, David Wilson
2017-06-01
Identification of Cladophora species is challenging due to conservation of gross morphology, few discrete autapomorphies, and environmental influences on morphology. Twelve species of marine Cladophora were reported from North Carolina waters. Cladophora specimens were collected from inshore and offshore marine waters for DNA sequence and morphological analyses. The nuclear-encoded rRNA internal transcribed spacer regions (ITS) were sequenced for 105 specimens and used in molecular assisted identification. The ITS1 and ITS2 region was highly variable, and sequences were sorted into ITS Sets of Alignable Sequences (SASs). Sequencing of short hyper-variable ITS1 sections from Cladophora type specimens was used to positively identify species represented by SASs when the types were made available. Secondary structures for the ITS1 locus were also predicted for each specimen and compared to predicted structures from Cladophora sequences available in GenBank. Nine ITS SASs were identified and representative specimens chosen for phylogenetic analyses of 18S and 28S rRNA gene sequences to reveal relationships with other Cladophora species. Phylogenetic analyses indicated that marine Cladophorales were polyphyletic and separated into two clades, the Cladophora clade and the "Siphonocladales" clade. Morphological analyses were performed to assess the consistency of character states within species, and complement the DNA sequence analyses. These analyses revealed intra- and interspecific character state variation, and that combined molecular and morphological analyses were required for the identification of species. One new report, Cladophora dotyana, and one new species Cladophora subtilissima sp. nov., were revealed, and increased the biodiversity of North Carolina marine Cladophora to 14 species. © 2017 Phycological Society of America.
Vázquez, Olalla; Blanco-Canosa, Juan B; Vázquez, M Eugenio; Martínez-Costas, Jose; Castedo, Luis; Mascareñas, José L
2008-11-24
Efficient targeting of DNA by designed molecules requires not only careful fine-tuning of their DNA-recognition properties, but also appropriate cell internalization of the compounds so that they can reach the cell nucleus in a short period of time. Previous observations in our group on the relatively high affinity displayed by conjugates between distamycin derivatives and bZIP basic regions for A-rich DNA sites, led us to investigate whether the covalent attachment of a positively charged cell-penetrating peptide to a distamycin-like tripyrrole might yield high affinity DNA binders with improved cell internalization properties. Our work has led to the discovery of synthetic tripyrrole-octa-arginine conjugates that are capable of targeting specific DNA sites that contain A-rich tracts with low nanomolar affinity; they simultaneously exhibit excellent membrane and nuclear translocation properties in living HeLa cells.
Enhancing Electrotransfection Efficiency through Improvement in Nuclear Entry of Plasmid DNA.
Cervia, Lisa D; Chang, Chun-Chi; Wang, Liangli; Mao, Mao; Yuan, Fan
2018-06-01
The nuclear envelope is a physiological barrier to electrogene transfer. To understand different mechanisms of the nuclear entry for electrotransfected plasmid DNA (pDNA), the current study investigated how manipulation of the mechanisms could affect electrotransfection efficiency (eTE), transgene expression level (EL), and cell viability. In the investigation, cells were first synchronized at G2-M phase prior to electrotransfection so that the nuclear envelope breakdown (NEBD) occurred before pDNA entered the cells. The NEBD significantly increased the eTE and the EL while the cell viability was not compromised. In the second experiment, the cells were treated with a nuclear pore dilating agent (i.e., trans-1,2-cyclohexanediol). The treatment could increase the EL, but had only minor effects on eTE. Furthermore, the treatment was more cytotoxic, compared with the cell synchronization. In the third experiment, a nuclear targeting sequence (i.e., SV40) was incorporated into the pDNA prior to electrotransfection. The incorporation was more effective than the cell synchronization for enhancing the EL, but not the eTE, and the effectiveness was cell type dependent. Taken together, the data described above suggested that synchronization of the NEBD could be a practical approach to improving electrogene transfer in all dividing cells. Copyright © 2018 The Authors. Published by Elsevier Inc. All rights reserved.
Analysis of JC virus DNA replication using a quantitative and high-throughput assay
Shin, Jong; Phelan, Paul J.; Chhum, Panharith; Bashkenova, Nazym; Yim, Sung; Parker, Robert; Gagnon, David; Gjoerup, Ole; Archambault, Jacques; Bullock, Peter A.
2015-01-01
Progressive Multifocal Leukoencephalopathy (PML) is caused by lytic replication of JC virus (JCV) in specific cells of the central nervous system. Like other polyomaviruses, JCV encodes a large T-antigen helicase needed for replication of the viral DNA. Here, we report the development of a luciferase-based, quantitative and high-throughput assay of JCV DNA replication in C33A cells, which, unlike the glial cell lines Hs 683 and U87, accumulate high levels of nuclear T-ag needed for robust replication. Using this assay, we investigated the requirement for different domains of T-ag, and for specific sequences within and flanking the viral origin, in JCV DNA replication. Beyond providing validation of the assay, these studies revealed an important stimulatory role of the transcription factor NF1 in JCV DNA replication. Finally, we show that the assay can be used for inhibitor testing, highlighting its value for the identification of antiviral drugs targeting JCV DNA replication. PMID:25155200
A Validated Methodology for Genetic Identification of Tuna Species (Genus Thunnus)
Viñas, Jordi; Tudela, Sergi
2009-01-01
Background Tuna species of the genus Thunnus, such as the bluefin tunas, are some of the most important and yet most endangered trade fish in the world. Identification of these species in traded forms, however, may be difficult depending on the presentation of the products, which may hamper conservation efforts on trade control. In this paper, we validated a genetic methodology that can fully distinguish between the eight Thunnus species from any kind of processed tissue. Methodology After testing several genetic markers, a complete discrimination of the eight tuna species was achieved using Forensically Informative Nucleotide Sequencing based primarily on the sequence variability of the hypervariable genetic marker mitochondrial DNA control region (mtDNA CR), followed, in some specific cases, by a second validation by a nuclear marker rDNA first internal transcribed spacer (ITS1). This methodology was able to distinguish all tuna species, including those belonging to the subgenus Neothunnus that are very closely related, and in consequence can not be differentiated with other genetic markers of lower variability. This methodology also took into consideration the presence of introgression that has been reported in past studies between T. thynnus, T. orientalis and T. alalunga. Finally, we applied the methodology to cross-check the species identity of 26 processed tuna samples. Conclusions Using the combination of two genetic markers, one mitochondrial and another nuclear, allows a full discrimination between all eight tuna species. Unexpectedly, the genetic marker traditionally used for DNA barcoding, cytochrome oxidase 1, could not differentiate all species, thus its use as a genetic marker for tuna species identification is questioned. PMID:19898615
A validated methodology for genetic identification of tuna species (genus Thunnus).
Viñas, Jordi; Tudela, Sergi
2009-10-27
Tuna species of the genus Thunnus, such as the bluefin tunas, are some of the most important and yet most endangered trade fish in the world. Identification of these species in traded forms, however, may be difficult depending on the presentation of the products, which may hamper conservation efforts on trade control. In this paper, we validated a genetic methodology that can fully distinguish between the eight Thunnus species from any kind of processed tissue. After testing several genetic markers, a complete discrimination of the eight tuna species was achieved using Forensically Informative Nucleotide Sequencing based primarily on the sequence variability of the hypervariable genetic marker mitochondrial DNA control region (mtDNA CR), followed, in some specific cases, by a second validation by a nuclear marker rDNA first internal transcribed spacer (ITS1). This methodology was able to distinguish all tuna species, including those belonging to the subgenus Neothunnus that are very closely related, and in consequence can not be differentiated with other genetic markers of lower variability. This methodology also took into consideration the presence of introgression that has been reported in past studies between T. thynnus, T. orientalis and T. alalunga. Finally, we applied the methodology to cross-check the species identity of 26 processed tuna samples. Using the combination of two genetic markers, one mitochondrial and another nuclear, allows a full discrimination between all eight tuna species. Unexpectedly, the genetic marker traditionally used for DNA barcoding, cytochrome oxidase 1, could not differentiate all species, thus its use as a genetic marker for tuna species identification is questioned.
Telling plant species apart with DNA: from barcodes to genomes
Li, De-Zhu; van der Bank, Michelle
2016-01-01
Land plants underpin a multitude of ecosystem functions, support human livelihoods and represent a critically important component of terrestrial biodiversity—yet many tens of thousands of species await discovery, and plant identification remains a substantial challenge, especially where material is juvenile, fragmented or processed. In this opinion article, we tackle two main topics. Firstly, we provide a short summary of the strengths and limitations of plant DNA barcoding for addressing these issues. Secondly, we discuss options for enhancing current plant barcodes, focusing on increasing discriminatory power via either gene capture of nuclear markers or genome skimming. The former has the advantage of establishing a defined set of target loci maximizing efficiency of sequencing effort, data storage and analysis. The challenge is developing a probe set for large numbers of nuclear markers that works over sufficient phylogenetic breadth. Genome skimming has the advantage of using existing protocols and being backward compatible with existing barcodes; and the depth of sequence coverage can be increased as sequencing costs fall. Its non-targeted nature does, however, present a major informatics challenge for upscaling to large sample sets. This article is part of the themed issue ‘From DNA barcodes to biomes’. PMID:27481790
Mera y Sierra, Roberto; Artigas, Patricio; Cuervo, Pablo; Deis, Erika; Sidoti, Laura; Mas-Coma, Santiago; Bargues, Maria Dolores
2009-12-03
Fascioliasis is widespread in livestock in Argentina. Among activities included in a long-term initiative to ascertain which are the fascioliasis areas of most concern, studies were performed in a recreational farm, including liver fluke infection in different domestic animal species, classification of the lymnaeid vector and verification of natural transmission of fascioliasis by identification of the intramolluscan trematode larval stages found in naturally infected snails. The high prevalences in the domestic animals appeared related to only one lymnaeid species present. Lymnaeid and trematode classification was verified by means of nuclear ribosomal DNA and mitochondrial DNA marker sequencing. Complete sequences of 18S rRNA gene and rDNA ITS-2 and ITS-1, and a fragment of the mtDNA cox1 gene demonstrate that the Argentinian lymnaeid belongs to the species Lymnaea neotropica. Redial larval stages found in a L. neotropica specimen were ascribed to Fasciola hepatica after analysis of the complete ITS-1 sequence. The finding of L. neotropica is the first of this lymnaeid species not only in Argentina but also in Southern Cone countries. The total absence of nucleotide differences between the sequences of specimens from Argentina and the specimens from the Peruvian type locality at the levels of rDNA 18S, ITS-2 and ITS-1, and the only one mutation at the mtDNA cox1 gene suggest a very recent spread. The ecological characteristics of this lymnaeid, living in small, superficial water collections frequented by livestock, suggest that it may be carried from one place to another by remaining in dried mud stuck to the feet of transported animals. The presence of L. neotropica adds pronounced complexity to the transmission and epidemiology of fascioliasis in Argentina, due to the great difficulties in distinguishing, by traditional malacological methods, between the three similar lymnaeid species of the controversial Galba/Fossaria group present in this country: L. viatrix, Galba truncatula and L. neotropica. It also poses a problem with regard to the use, for lymnaeid vector species discrimination, of several molecular techniques which do not show sufficient accuracy, as those relying on the 18S rRNA gene or parts of it, because both L. neotropica and L. viatrix present identical 18S sequence.
Kim, Young-Kyu; Park, Chong-wook; Kim, Ki-Joong
2009-03-31
The chloroplast DNA sequences of Megaleranthis saniculifolia, an endemic and monotypic endangered plant species, were completed in this study (GenBank FJ597983). The genome is 159,924 bp in length. It harbors a pair of IR regions consisting of 26,608 bp each. The lengths of the LSC and SSC regions are 88,326 bp and 18,382 bp, respectively. The structural organizations, gene and intron contents, gene orders, AT contents, codon usages, and transcription units of the Megaleranthis chloroplast genome are similar to those of typical land plant cp DNAs. However, the detailed features of Megaleranthis chloroplast genomes are substantially different from that of Ranunculus, which belongs to the same family, the Ranunculaceae. First, the Megaleranthis cp DNA was 4,797 bp longer than that of Ranunculus due to an expanded IR region into the SSC region and duplicated sequence elements in several spacer regions of the Megaleranthis cp genome. Second, the chloroplast genomes of Megaleranthis and Ranunculus evidence 5.6% sequence divergence in the coding regions, 8.9% sequence divergence in the intron regions, and 18.7% sequence divergence in the intergenic spacer regions, respectively. In both the coding and noncoding regions, average nucleotide substitution rates differed markedly, depending on the genome position. Our data strongly implicate the positional effects of the evolutionary modes of chloroplast genes. The genes evidencing higher levels of base substitutions also have higher incidences of indel mutations and low Ka/Ks ratios. A total of 54 simple sequence repeat loci were identified from the Megaleranthis cp genome. The existence of rich cp SSR loci in the Megaleranthis cp genome provides a rare opportunity to study the population genetic structures of this endangered species. Our phylogenetic trees based on the two independent markers, the nuclear ITS and chloroplast matK sequences, strongly support the inclusion of the Megaleranthis to the Trollius. Therefore, our molecular trees support Ohwi's original treatment of Megaleranthis saniculiforia to Trollius chosenensis Ohwi.
Schneider, T D
2001-12-01
The sequence logo for DNA binding sites of the bacteriophage P1 replication protein RepA shows unusually high sequence conservation ( approximately 2 bits) at a minor groove that faces RepA. However, B-form DNA can support only 1 bit of sequence conservation via contacts into the minor groove. The high conservation in RepA sites therefore implies a distorted DNA helix with direct or indirect contacts to the protein. Here I show that a high minor groove conservation signature also appears in sequence logos of sites for other replication origin binding proteins (Rts1, DnaA, P4 alpha, EBNA1, ORC) and promoter binding proteins (sigma(70), sigma(D) factors). This finding implies that DNA binding proteins generally use non-B-form DNA distortion such as base flipping to initiate replication and transcription.
Mak, Sarah Siu Tze; Gopalakrishnan, Shyam; Carøe, Christian; Geng, Chunyu; Liu, Shanlin; Sinding, Mikkel-Holger S; Kuderna, Lukas F K; Zhang, Wenwei; Fu, Shujin; Vieira, Filipe G; Germonpré, Mietje; Bocherens, Hervé; Fedorov, Sergey; Petersen, Bent; Sicheritz-Pontén, Thomas; Marques-Bonet, Tomas; Zhang, Guojie; Jiang, Hui; Gilbert, M Thomas P
2017-01-01
Abstract Ancient DNA research has been revolutionized following development of next-generation sequencing platforms. Although a number of such platforms have been applied to ancient DNA samples, the Illumina series are the dominant choice today, mainly because of high production capacities and short read production. Recently a potentially attractive alternative platform for palaeogenomic data generation has been developed, the BGISEQ-500, whose sequence output are comparable with the Illumina series. In this study, we modified the standard BGISEQ-500 library preparation specifically for use on degraded DNA, then directly compared the sequencing performance and data quality of the BGISEQ-500 to the Illumina HiSeq2500 platform on DNA extracted from 8 historic and ancient dog and wolf samples. The data generated were largely comparable between sequencing platforms, with no statistically significant difference observed for parameters including level (P = 0.371) and average sequence length (P = 0718) of endogenous nuclear DNA, sequence GC content (P = 0.311), double-stranded DNA damage rate (v. 0.309), and sequence clonality (P = 0.093). Small significant differences were found in single-strand DNA damage rate (δS; slightly lower for the BGISEQ-500, P = 0.011) and the background rate of difference from the reference genome (θ; slightly higher for BGISEQ-500, P = 0.012). This may result from the differences in amplification cycles used to polymerase chain reaction–amplify the libraries. A significant difference was also observed in the mitochondrial DNA percentages recovered (P = 0.018), although we believe this is likely a stochastic effect relating to the extremely low levels of mitochondria that were sequenced from 3 of the samples with overall very low levels of endogenous DNA. Although we acknowledge that our analyses were limited to animal material, our observations suggest that the BGISEQ-500 holds the potential to represent a valid and potentially valuable alternative platform for palaeogenomic data generation that is worthy of future exploration by those interested in the sequencing and analysis of degraded DNA. PMID:28854615
USDA-ARS?s Scientific Manuscript database
The phylogeny of Amaryllidaceae tribe Hippeastreae was inferred using chloroplast (3’ycf1, ndhF, trnL-F) and nuclear (ITS rDNA) sequence data under maximum parsimony and maximum likelihood frameworks. Network analyses were applied to resolve conflicting signals among data sets and putative scenarios...
Sequential addition of short DNA oligos in DNA-polymerase-based synthesis reactions
Gardner, Shea N; Mariella, Jr., Raymond P; Christian, Allen T; Young, Jennifer A; Clague, David S
2013-06-25
A method of preselecting a multiplicity of DNA sequence segments that will comprise the DNA molecule of user-defined sequence, separating the DNA sequence segments temporally, and combining the multiplicity of DNA sequence segments with at least one polymerase enzyme wherein the multiplicity of DNA sequence segments join to produce the DNA molecule of user-defined sequence. Sequence segments may be of length n, where n is an odd integer. In one embodiment the length of desired hybridizing overlap is specified by the user and the sequences and the protocol for combining them are guided by computational (bioinformatics) predictions. In one embodiment sequence segments are combined from multiple reading frames to span the same region of a sequence, so that multiple desired hybridizations may occur with different overlap lengths.
Method for rapid base sequencing in DNA and RNA
Jett, J.H.; Keller, R.A.; Martin, J.C.; Moyzis, R.K.; Ratliff, R.L.; Shera, E.B.; Stewart, C.C.
1987-10-07
A method is provided for the rapid base sequencing of DNA or RNA fragments wherein a single fragment of DNA or RNA is provided with identifiable bases and suspended in a moving flow stream. An exonuclease sequentially cleaves individual bases from the end of the suspended fragment. The moving flow stream maintains the cleaved bases in an orderly train for subsequent detection and identification. In a particular embodiment, individual bases forming the DNA or RNA fragments are individually tagged with a characteristic fluorescent dye. The train of bases is then excited to fluorescence with an output spectrum characteristic of the individual bases. Accordingly, the base sequence of the original DNA or RNA fragment can be reconstructed. 2 figs.
Method for rapid base sequencing in DNA and RNA
Jett, J.H.; Keller, R.A.; Martin, J.C.; Moyzis, R.K.; Ratliff, R.L.; Shera, E.B.; Stewart, C.C.
1990-10-09
A method is provided for the rapid base sequencing of DNA or RNA fragments wherein a single fragment of DNA or RNA is provided with identifiable bases and suspended in a moving flow stream. An exonuclease sequentially cleaves individual bases from the end of the suspended fragment. The moving flow stream maintains the cleaved bases in an orderly train for subsequent detection and identification. In a particular embodiment, individual bases forming the DNA or RNA fragments are individually tagged with a characteristic fluorescent dye. The train of bases is then excited to fluorescence with an output spectrum characteristic of the individual bases. Accordingly, the base sequence of the original DNA or RNA fragment can be reconstructed. 2 figs.
Method for rapid base sequencing in DNA and RNA
Jett, James H.; Keller, Richard A.; Martin, John C.; Moyzis, Robert K.; Ratliff, Robert L.; Shera, E. Brooks; Stewart, Carleton C.
1990-01-01
A method is provided for the rapid base sequencing of DNA or RNA fragments wherein a single fragment of DNA or RNA is provided with identifiable bases and suspended in a moving flow stream. An exonuclease sequentially cleaves individual bases from the end of the suspended fragment. The moving flow stream maintains the cleaved bases in an orderly train for subsequent detection and identification. In a particular embodiment, individual bases forming the DNA or RNA fragments are individually tagged with a characteristic fluorescent dye. The train of bases is then excited to fluorescence with an output spectrum characteristic of the individual bases. Accordingly, the base sequence of the original DNA or RNA fragment can be reconstructed.
DNA barcode goes two-dimensions: DNA QR code web server.
Liu, Chang; Shi, Linchun; Xu, Xiaolan; Li, Huan; Xing, Hang; Liang, Dong; Jiang, Kun; Pang, Xiaohui; Song, Jingyuan; Chen, Shilin
2012-01-01
The DNA barcoding technology uses a standard region of DNA sequence for species identification and discovery. At present, "DNA barcode" actually refers to DNA sequences, which are not amenable to information storage, recognition, and retrieval. Our aim is to identify the best symbology that can represent DNA barcode sequences in practical applications. A comprehensive set of sequences for five DNA barcode markers ITS2, rbcL, matK, psbA-trnH, and CO1 was used as the test data. Fifty-three different types of one-dimensional and ten two-dimensional barcode symbologies were compared based on different criteria, such as coding capacity, compression efficiency, and error detection ability. The quick response (QR) code was found to have the largest coding capacity and relatively high compression ratio. To facilitate the further usage of QR code-based DNA barcodes, a web server was developed and is accessible at http://qrfordna.dnsalias.org. The web server allows users to retrieve the QR code for a species of interests, convert a DNA sequence to and from a QR code, and perform species identification based on local and global sequence similarities. In summary, the first comprehensive evaluation of various barcode symbologies has been carried out. The QR code has been found to be the most appropriate symbology for DNA barcode sequences. A web server has also been constructed to allow biologists to utilize QR codes in practical DNA barcoding applications.
2002-01-01
numerous animal clades, including arthropods (Giribet & Ribera , 1998, 2000). The mitochondrial cytochrome oxidase subunits I and II have proven useful as...16S and 28S, D2 rRNA. Insect Molecular Biology, 6, 273-284. Giribet, G. & Ribera , C. (1998) The position of arthropods in animal kingdom: a search...for a reliable outgroup for internal arthropod phylogeny. Molecular Phylogenetics and Evolution, 9, 481-488. Giribet, G. & Ribera , C. (2000) A review
Lineage-specific evolutionary rate in plants: Contributions of a screening for Cereus (Cactaceae).
Romeiro-Brito, Monique; Moraes, Evandro M; Taylor, Nigel P; Zappi, Daniela C; Franco, Fernando F
2016-01-01
Predictable chloroplast DNA (cpDNA) sequences have been listed for the shallowest taxonomic studies in plants. We investigated whether plastid regions that vary between closely allied species could be applied for intraspecific studies and compared the variation of these plastid segments with two nuclear regions. We screened 16 plastid and two nuclear intronic regions for species of the genus Cereus (Cactaceae) at three hierarchical levels (species from different clades, species of the same clade, and allopatric populations). Ten plastid regions presented interspecific variation, and six of them showed variation at the intraspecific level. The two nuclear regions showed both inter- and intraspecific variation, and in general they showed higher levels of variability in almost all hierarchical levels than the plastid segments. Our data suggest no correspondence between variation of plastid regions at the interspecific and intraspecific level, probably due to lineage-specific variation in cpDNA, which appears to have less effect in nuclear data. Despite the heterogeneity in evolutionary rates of cpDNA, we highlight three plastid segments that may be considered in initial screenings in plant phylogeographic studies.
Freeman, S.; Pham, M.; Rodriguez, R.J.
1993-01-01
Molecular genotyping of Colletotrichum species based on arbitrarily primed PCR, A + T-rich DNA, and nuclear DNA analyses. Experimental Mycology 17, 309-322. Isolates of Colletotrichum were grouped into 10 separate species based on arbitrarily primed PCR (ap-PCR), A + T-rich DNA (AT-DNA) and nuclear DNA banding patterns. In general, the grouping of Colletotrichum isolates by these molecular approaches corresponded to that done by classical taxonomic identification, however, some exceptions were observed. PCR amplification of genomic DNA using four different primers allowed for reliable differentiation between isolates of the 10 species. HaeIII digestion patterns of AT-DNA also distinguished between species of Colletotrichum by generating species-specific band patterns. In addition, hybridization of the repetitive DNA element (GcpR1) to genomic DNA identified a unique set of Pst 1-digested nuclear DNA fragments in each of the 10 species of Colletotrichum tested. Multiple isolates of C. acutatum, C. coccodes, C. fragariae, C. lindemuthianum, C. magna, C. orbiculare, C. graminicola from maize, and C. graminicola from sorghum showed 86-100% intraspecies similarity based on ap-PCR and AT-DNA analyses. Interspecies similarity determined by ap-PCR and AT-DNA analyses varied between 0 and 33%. Three distinct banding patterns were detected in isolates of C. gloeosporioides from strawberry. Similarly, three different banding patterns were observed among isolates of C. musae from diseased banana.
de la Bastide, Paul Y; Leung, Wai Lam; Hintz, William E
2015-01-01
The ITS region of the rDNA gene was compared for Saprolegnia spp. in order to improve our understanding of nucleotide sequence variability within and between species of this genus, determine species composition in Canadian fin fish aquaculture facilities, and to assess the utility of ITS sequence variability in genetic marker development. From a collection of more than 400 field isolates, ITS region nucleotide sequences were studied and it was determined that there was sufficient consistent inter-specific variation to support the designation of species identity based on ITS sequence data. This non-subjective approach to species identification does not rely upon transient morphological features. Phylogenetic analyses comparing our ITS sequences and species designations with data from previous studies generally supported the clade scheme of Diéguez-Uribeondo et al. (2007) and found agreement with the molecular taxonomic cluster system of Sandoval-Sierra et al. (2014). Our Canadian ITS sequence collection will thus contribute to the public database and assist the clarification of Saprolegnia spp. taxonomy. The analysis of ITS region sequence variability facilitated genus- and species-level identification of unknown samples from aquaculture facilities and provided useful information on species composition. A unique ITS-RFLP for the identification of S. parasitica was also described. Copyright © 2014 The British Mycological Society. Published by Elsevier Ltd. All rights reserved.
Schoch, Conrad L; Robbertse, Barbara; Robert, Vincent; Vu, Duong; Cardinali, Gianluigi; Irinyi, Laszlo; Meyer, Wieland; Nilsson, R Henrik; Hughes, Karen; Miller, Andrew N; Kirk, Paul M; Abarenkov, Kessy; Aime, M Catherine; Ariyawansa, Hiran A; Bidartondo, Martin; Boekhout, Teun; Buyck, Bart; Cai, Qing; Chen, Jie; Crespo, Ana; Crous, Pedro W; Damm, Ulrike; De Beer, Z Wilhelm; Dentinger, Bryn T M; Divakar, Pradeep K; Dueñas, Margarita; Feau, Nicolas; Fliegerova, Katerina; García, Miguel A; Ge, Zai-Wei; Griffith, Gareth W; Groenewald, Johannes Z; Groenewald, Marizeth; Grube, Martin; Gryzenhout, Marieka; Gueidan, Cécile; Guo, Liangdong; Hambleton, Sarah; Hamelin, Richard; Hansen, Karen; Hofstetter, Valérie; Hong, Seung-Beom; Houbraken, Jos; Hyde, Kevin D; Inderbitzin, Patrik; Johnston, Peter R; Karunarathna, Samantha C; Kõljalg, Urmas; Kovács, Gábor M; Kraichak, Ekaphan; Krizsan, Krisztina; Kurtzman, Cletus P; Larsson, Karl-Henrik; Leavitt, Steven; Letcher, Peter M; Liimatainen, Kare; Liu, Jian-Kui; Lodge, D Jean; Luangsa-ard, Janet Jennifer; Lumbsch, H Thorsten; Maharachchikumbura, Sajeewa S N; Manamgoda, Dimuthu; Martín, María P; Minnis, Andrew M; Moncalvo, Jean-Marc; Mulè, Giuseppina; Nakasone, Karen K; Niskanen, Tuula; Olariaga, Ibai; Papp, Tamás; Petkovits, Tamás; Pino-Bodas, Raquel; Powell, Martha J; Raja, Huzefa A; Redecker, Dirk; Sarmiento-Ramirez, J M; Seifert, Keith A; Shrestha, Bhushan; Stenroos, Soili; Stielow, Benjamin; Suh, Sung-Oui; Tanaka, Kazuaki; Tedersoo, Leho; Telleria, M Teresa; Udayanga, Dhanushka; Untereiner, Wendy A; Diéguez Uribeondo, Javier; Subbarao, Krishna V; Vágvölgyi, Csaba; Visagie, Cobus; Voigt, Kerstin; Walker, Donald M; Weir, Bevan S; Weiß, Michael; Wijayawardene, Nalin N; Wingfield, Michael J; Xu, J P; Yang, Zhu L; Zhang, Ning; Zhuang, Wen-Ying; Federhen, Scott
2014-01-01
DNA phylogenetic comparisons have shown that morphology-based species recognition often underestimates fungal diversity. Therefore, the need for accurate DNA sequence data, tied to both correct taxonomic names and clearly annotated specimen data, has never been greater. Furthermore, the growing number of molecular ecology and microbiome projects using high-throughput sequencing require fast and effective methods for en masse species assignments. In this article, we focus on selecting and re-annotating a set of marker reference sequences that represent each currently accepted order of Fungi. The particular focus is on sequences from the internal transcribed spacer region in the nuclear ribosomal cistron, derived from type specimens and/or ex-type cultures. Re-annotated and verified sequences were deposited in a curated public database at the National Center for Biotechnology Information (NCBI), namely the RefSeq Targeted Loci (RTL) database, and will be visible during routine sequence similarity searches with NR_prefixed accession numbers. A set of standards and protocols is proposed to improve the data quality of new sequences, and we suggest how type and other reference sequences can be used to improve identification of Fungi. Database URL: http://www.ncbi.nlm.nih.gov/bioproject/PRJNA177353. Published by Oxford University Press 2013. This work is written by US Government employees and is in the public domain in the US.
Wang, Dai; Parrish, Colin R.
1999-01-01
Phage display of cDNA clones prepared from feline cells was used to identify host cell proteins that bound to DNA-containing feline panleukopenia virus (FPV) capsids but not to empty capsids. One gene found in several clones encoded a heterogeneous nuclear ribonucleoprotein (hnRNP)-related protein (DBP40) that was very similar in sequence to the A/B-type hnRNP proteins. DBP40 bound specifically to oligonucleotides representing a sequence near the 5′ end of the genome which is exposed on the outside of the full capsid but did not bind most other terminal sequences. Adding purified DBP40 to an in vitro fill-in reaction using viral DNA as a template inhibited the production of the second strand after nucleotide (nt) 289 but prior to nt 469. DBP40 bound to various regions of the viral genome, including a region between nt 295 and 330 of the viral genome which has been associated with transcriptional attenuation of the parvovirus minute virus of mice, which is mediated by a stem-loop structure of the DNA and cellular proteins. Overexpression of the protein in feline cells from a plasmid vector made them largely resistant to FPV infection. Mutagenesis of the protein binding site within the 5′ end viral genome did not affect replication of the virus. PMID:10438866
Mitochondrial and nuclear genetic relationships of deer (Odocoileus spp.) in western North America
Cronin, Matthew A.
1991-01-01
Odocoileus hemionus (mule deer and black-tailed deer) and Odocoileus virginanus (white-tailed deer) are sympatric in western North America and are characterized by distinct morphology, behavior, and allozyme allele frequencies. However, there is discordance among nuclear and mitochondrial genetic relationships, as mule deer (O. h. hemionus) and white-tailed deer have similar mitochondrial DNA (mtDNA) which is very different from that of black-tailed deer (O. h. columbianus, O. h. sitkensis). I expanded previous studies to clarify the genetic relationships of these groups by determining mtDNA haplotype and allozyme genotypes for 667 deer from several locations in northwestern North America. Different mtDNA haplotypes in mule deer, black-tailed deer, and white-tailed deer indicate that mitochondrial gene flow is restricted. Allozyme allele frequencies indicate that there is also restriction of nuclear gene flow between O. virginianus and O. hemionus, and to a lesser extent between mule deer and black-tailed deer. There is a low level of introgressive hybridization of mtDNA from mule deer and black-tailed deer into white-tailed deer populations and considerable interbreeding of mule deer and black-tailed deer in a contact zone. The discordance of mitochondrial and nuclear genomes is apparent only if mtDNA sequence divergences, and not haplotype frequencies, are considered.
Haplotype Phasing and Inheritance of Copy Number Variants in Nuclear Families
Palta, Priit; Kaplinski, Lauris; Nagirnaja, Liina; Veidenberg, Andres; Möls, Märt; Nelis, Mari; Esko, Tõnu; Metspalu, Andres; Laan, Maris; Remm, Maido
2015-01-01
DNA copy number variants (CNVs) that alter the copy number of a particular DNA segment in the genome play an important role in human phenotypic variability and disease susceptibility. A number of CNVs overlapping with genes have been shown to confer risk to a variety of human diseases thus highlighting the relevance of addressing the variability of CNVs at a higher resolution. So far, it has not been possible to deterministically infer the allelic composition of different haplotypes present within the CNV regions. We have developed a novel computational method, called PiCNV, which enables to resolve the haplotype sequence composition within CNV regions in nuclear families based on SNP genotyping microarray data. The algorithm allows to i) phase normal and CNV-carrying haplotypes in the copy number variable regions, ii) resolve the allelic copies of rearranged DNA sequence within the haplotypes and iii) infer the heritability of identified haplotypes in trios or larger nuclear families. To our knowledge this is the first program available that can deterministically phase null, mono-, di-, tri- and tetraploid genotypes in CNV loci. We applied our method to study the composition and inheritance of haplotypes in CNV regions of 30 HapMap Yoruban trios and 34 Estonian families. For 93.6% of the CNV loci, PiCNV enabled to unambiguously phase normal and CNV-carrying haplotypes and follow their transmission in the corresponding families. Furthermore, allelic composition analysis identified the co-occurrence of alternative allelic copies within 66.7% of haplotypes carrying copy number gains. We also observed less frequent transmission of CNV-carrying haplotypes from parents to children compared to normal haplotypes and identified an emergence of several de novo deletions and duplications in the offspring. PMID:25853576
Haplotype phasing and inheritance of copy number variants in nuclear families.
Palta, Priit; Kaplinski, Lauris; Nagirnaja, Liina; Veidenberg, Andres; Möls, Märt; Nelis, Mari; Esko, Tõnu; Metspalu, Andres; Laan, Maris; Remm, Maido
2015-01-01
DNA copy number variants (CNVs) that alter the copy number of a particular DNA segment in the genome play an important role in human phenotypic variability and disease susceptibility. A number of CNVs overlapping with genes have been shown to confer risk to a variety of human diseases thus highlighting the relevance of addressing the variability of CNVs at a higher resolution. So far, it has not been possible to deterministically infer the allelic composition of different haplotypes present within the CNV regions. We have developed a novel computational method, called PiCNV, which enables to resolve the haplotype sequence composition within CNV regions in nuclear families based on SNP genotyping microarray data. The algorithm allows to i) phase normal and CNV-carrying haplotypes in the copy number variable regions, ii) resolve the allelic copies of rearranged DNA sequence within the haplotypes and iii) infer the heritability of identified haplotypes in trios or larger nuclear families. To our knowledge this is the first program available that can deterministically phase null, mono-, di-, tri- and tetraploid genotypes in CNV loci. We applied our method to study the composition and inheritance of haplotypes in CNV regions of 30 HapMap Yoruban trios and 34 Estonian families. For 93.6% of the CNV loci, PiCNV enabled to unambiguously phase normal and CNV-carrying haplotypes and follow their transmission in the corresponding families. Furthermore, allelic composition analysis identified the co-occurrence of alternative allelic copies within 66.7% of haplotypes carrying copy number gains. We also observed less frequent transmission of CNV-carrying haplotypes from parents to children compared to normal haplotypes and identified an emergence of several de novo deletions and duplications in the offspring.
Chemale, Gustavo; Paneto, Greiciane Gaburro; Menezes, Meiga Aurea Mendes; de Freitas, Jorge Marcelo; Jacques, Guilherme Silveira; Cicarelli, Regina Maria Barretto; Fagundes, Paulo Roberto
2013-05-01
Mitochondrial DNA (mtDNA) analysis is usually a last resort in routine forensic DNA casework. However, it has become a powerful tool for the analysis of highly degraded samples or samples containing too little or no nuclear DNA, such as old bones and hair shafts. The gold standard methodology still constitutes the direct sequencing of polymerase chain reaction (PCR) products or cloned amplicons from the HVS-1 and HVS-2 (hypervariable segment) control region segments. Identifications using mtDNA are time consuming, expensive and can be very complex, depending on the amount and nature of the material being tested. The main goal of this work is to develop a less labour-intensive and less expensive screening method for mtDNA analysis, in order to aid in the exclusion of non-matching samples and as a presumptive test prior to final confirmatory DNA sequencing. We have selected 14 highly discriminatory single nucleotide polymorphisms (SNPs) based on simulations performed by Salas and Amigo (2010) to be typed using SNaPShot(TM) (Applied Biosystems, Foster City, CA, USA). The assay was validated by typing more than 100 HVS-1/HVS-2 sequenced samples. No differences were observed between the SNP typing and DNA sequencing when results were compared, with the exception of allelic dropouts observed in a few haplotypes. Haplotype diversity simulations were performed using 172 mtDNA sequences representative of the Brazilian population and a score of 0.9794 was obtained when the 14 SNPs were used, showing that the theoretical prediction approach for the selection of highly discriminatory SNPs suggested by Salas and Amigo (2010) was confirmed in the population studied. As the main goal of the work is to develop a screening assay to skip the sequencing of all samples in a particular case, a pair-wise comparison of the sequences was done using the selected SNPs. When both HVS-1/HVS-2 SNPs were used for simulations, at least two differences were observed in 93.2% of the comparisons performed. The assay was validated with casework samples. Results show that the method is straightforward and can be used for exclusionary purposes, saving time and laboratory resources. The assay confirms the theoretic prediction suggested by Salas and Amigo (2010). All forensic advantages, such as high sensitivity and power of discrimination, as also the disadvantages, such as the occurrence of allele dropouts, are discussed throughout the article. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.
Toulmin, Anita; Baltierra-Jasso, Laura E; Morten, Michael J; Sabir, Tara; McGlynn, Peter; Schröder, Gunnar F; Smith, Brian O; Magennis, Steven W
2017-09-19
DNA three-way junctions (3WJs) are branched structures that serve as important biological intermediates and as components in DNA nanostructures. We recently derived the global structure of a fully complementary 3WJ and found that it contained unpaired bases at the branchpoint, which is consistent with previous observations of branch flexibility and branchpoint reactivity. By combining high-resolution single-molecule Förster resonance energy transfer, molecular modeling, time-resolved ensemble fluorescence spectroscopy, and the first 19 F nuclear magnetic resonance observations of fully complementary 3WJs, we now show that the 3WJ structure can adopt multiple distinct conformations depending upon the sequence at the branchpoint. A 3WJ with a GC-rich branchpoint adopts an open conformation with unpaired bases at the branch and at least one additional conformation with an increased number of base interactions at the branchpoint. This structural diversity has implications for branch interactions and processing in vivo and for technological applications.
A phylogenetic overview of the antrodia clade (Basidiomycota, Polyporales)
Beatriz Ortiz-Santana; Daniel L. Lindner; Otto Miettinen; Alfredo Justo; David S. Hibbett
2013-01-01
Phylogenetic relationships among members of the antrodia clade were investigated with molecular data from two nuclear ribosomal DNA regions, LSU and ITS. A total of 123 species representing 26 genera producing a brown rot were included in the present study. Three DNA datasets (combined LSU-ITS dataset, LSU dataset, ITS dataset) comprising sequences of 449 isolates were...
humpty dumpty is required for developmental DNA amplification and cell proliferation in Drosophila.
Bandura, Jennifer L; Beall, Eileen L; Bell, Maren; Silver, Hannah R; Botchan, Michael R; Calvi, Brian R
2005-04-26
The full complement of proteins required for the proper regulation of genome duplication are yet to be described. We employ a genetic DNA-replication model system based on developmental amplification of Drosophila eggshell (chorion) genes [1]. Hypomorphic mutations in essential DNA replication genes result in a distinct thin-eggshell phenotype owing to reduced amplification [2]. Here, we molecularly identify the gene, which we have named humpty dumpty (hd), corresponding to the thin-eggshell mutant fs(3)272-9 [3]. We confirm that hd is essential for DNA amplification in the ovary and show that it also is required for cell proliferation during development. Mosaic analysis of hd mutant cells during development and RNAi in Kc cells reveal that depletion of Hd protein results in severe defects in genomic replication and DNA damage. Most Hd protein is found in nuclear foci, and some may traverse the nuclear envelope. Consistent with a role in DNA replication, expression of Hd protein peaks during late G1 and S phase, and it responds to the E2F1/Dp transcription factor. Hd protein sequence is conserved from plants to humans, and published microarrays indicate that expression of its putative human ortholog also peaks at G1/S [4]. Our data suggest that hd defines a new gene family likely required for cell proliferation in all multicellular eukaryotes.
Single-Molecule Electrical Random Resequencing of DNA and RNA
NASA Astrophysics Data System (ADS)
Ohshiro, Takahito; Matsubara, Kazuki; Tsutsui, Makusu; Furuhashi, Masayuki; Taniguchi, Masateru; Kawai, Tomoji
2012-07-01
Two paradigm shifts in DNA sequencing technologies--from bulk to single molecules and from optical to electrical detection--are expected to realize label-free, low-cost DNA sequencing that does not require PCR amplification. It will lead to development of high-throughput third-generation sequencing technologies for personalized medicine. Although nanopore devices have been proposed as third-generation DNA-sequencing devices, a significant milestone in these technologies has been attained by demonstrating a novel technique for resequencing DNA using electrical signals. Here we report single-molecule electrical resequencing of DNA and RNA using a hybrid method of identifying single-base molecules via tunneling currents and random sequencing. Our method reads sequences of nine types of DNA oligomers. The complete sequence of 5'-UGAGGUA-3' from the let-7 microRNA family was also identified by creating a composite of overlapping fragment sequences, which was randomly determined using tunneling current conducted by single-base molecules as they passed between a pair of nanoelectrodes.
Bargues, M Dolores; Zuriaga, M Angeles; Mas-Coma, Santiago
2014-01-01
A pseudogene, paralogous to rDNA 5.8S and ITS-2, is described in Meccus dimidiata dimidiata, M. d. capitata, M. d. maculippenis, M. d. hegneri, M. sp. aff. dimidiata, M. p. phyllosoma, M. p. longipennis, M. p. pallidipennis, M. p. picturata, M. p. mazzottii, Triatoma mexicana, Triatoma nitida and Triatoma sanguisuga, covering North America, Central America and northern South America. Such a nuclear rDNA pseudogene is very rare. In the 5.8S gene, criteria for pseudogene identification included length variability, lower GC content, mutations regarding the functional uniform sequence, and relatively high base substitutions in evolutionary conserved sites. At ITS-2 level, criteria were the shorter sequence and large proportion of insertions and deletions (indels). Pseudogenic 5.8S and ITS-2 secondary structures were different from the functional foldings, different one another, showing less negative values for minimum free energy (mfe) and centroid predictions, and lower fit between mfe, partition function, and centroid structures. A complete characterization indicated a processed pseudogenic unit of the ghost type, escaping from rDNA concerted evolution and with functionality subject to constraints instead of evolving free by neutral drift. Despite a high indel number, low mutation number and an evolutionary rate similar to the functional ITS-2, that pseudogene distinguishes different taxa and furnishes coherent phylogenetic topologies with resolution similar to the functional ITS-2. The discovery of a pseudogene in many phylogenetically related species is unique in animals and allowed for an estimation of its palaeobiogeographical origin based on molecular clock data, inheritance pathways, evolutionary rate and pattern, and geographical spread. Additional to the technical risk to be considered henceforth, this relict pseudogene, designated as "ps(5.8S+ITS-2)", proves to be a valuable marker for specimen classification, phylogenetic analyses, and systematic/taxonomic studies. It opens a new research field, Chagas disease epidemiology and control included, given its potential relationships with triatomine fitness, behaviour and adaptability. Copyright © 2013 Elsevier B.V. All rights reserved.
Molecular phylogeography of the Andean alpine plant, Gunnera magellanica
NASA Astrophysics Data System (ADS)
Shimizu, M.; Fujii, N.; Ito, M.; Asakawa, T.; Nishida, H.; Suyama, C.; Ueda, K.
2015-12-01
To clarify the evolutionary history of Gunnera magellanica (Gunneraceae), an alpine plant of the Andes mountains, we performed molecular phylogeographic analyses based on the sequences of an internal transcribed spacer (ITS) of nuclear ribosomal DNA and four non-coding regions (trnH-psbA, trnL-trnF, atpB-rbcL, rpl16 intron) of chloroplast DNA. We investigated 3, 4, 4 and 11 populations in, Ecuador, Bolivia, Argentina, and Chile, respectively, and detected six ITS genotypes (Types A-F) in G. magellanica. Five genotypes (Types A-E) were observed in the northern Andes population (Ecuador and Bolivia); only one ITS genotype (Type F) was observed in the southern Andes population (Chile and Argentina). Phylogenetic analyses showed that the ITS genotypes of the northern and southern Andes populations form different clades with high bootstrap probability. Furthermore, network analysis, analysis of molecular variance, and spatial analysis of molecular variance showed that there were two major clusters (the northern and southern Andes populations) in this species. Furthermore, in chloroplast DNA analysis, three major clades (northern Andes, Chillan, and southern Andes) were inferred from phylogenetic analyses using four non-coding regions, a finding that was supported by the above three types of analysis. The Chillan clade is the northernmost population in the southern Andes populations. With the exception of the Chillan clade (Chillan population), results of nuclear DNA and chloroplast DNA analyses were consistent. Both markers showed that the northern and southern Andes populations of G. magellanica were genetically different from each other. This type of clear phylogeographical structure was supported by PERMUT analysis according to Pons & Petit (1995, 1996). Moreover, based on our preliminary estimation that is based on the ITS sequences, the northern and southern Andes clades diverged ~0.63-3 million years ago, during a period of upheaval in the Andes. This suggests that the populations of G. magellanica that were distributed along the Andes have been divided into the two local populations of the northern and southern Andes during the uplift of the Andes.
Morea, Edna G O; Viviescas, Maria Alejandra; Fernandes, Carlos A H; Matioli, Fabio F; Lira, Cristina B B; Fernandez, Maribel F; Moraes, Barbara S; da Silva, Marcelo S; Storti, Camila B; Fontes, Marcos R M; Cano, Maria Isabel N
2017-11-01
Leishmania spp. telomeres are composed of 5'-TTAGGG-3' repeats associated with proteins. We have previously identified LaRbp38 and LaRPA-1 as proteins that bind the G-rich telomeric strand. At that time, we had also partially characterized a protein: DNA complex, named LaGT1, but we could not identify its protein component. Using protein-DNA interaction and competition assays, we confirmed that LaGT1 is highly specific to the G-rich telomeric single-stranded DNA. Three protein bands, with LaGT1 activity, were isolated from affinity-purified protein extracts in-gel digested, and sequenced de novo using mass spectrometry analysis. In silico analysis of the digested peptide identified them as a putative calmodulin with sequences identical to the T. cruzi calmodulin. In the Leishmania genome, the calmodulin ortholog is present in three identical copies. We cloned and sequenced one of the gene copies, named it LCalA, and obtained the recombinant protein. Multiple sequence alignment and molecular modeling showed that LCalA shares homology to most eukaryotes calmodulin. In addition, we demonstrated that LCalA is nuclear, partially co-localizes with telomeres and binds in vivo the G-rich telomeric strand. Recombinant LCalA can bind specifically and with relative affinity to the G-rich telomeric single-strand and to a 3'G-overhang, and DNA binding is calcium dependent. We have described a novel candidate component of Leishmania telomeres, LCalA, a nuclear calmodulin that binds the G-rich telomeric strand with high specificity and relative affinity, in a calcium-dependent manner. LCalA is the first reported calmodulin that binds in vivo telomeric DNA. Copyright © 2017 Elsevier B.V. All rights reserved.
Osmylated DNA, a novel concept for sequencing DNA using nanopores
NASA Astrophysics Data System (ADS)
Kanavarioti, Anastassia
2015-03-01
Saenger sequencing has led the advances in molecular biology, while faster and cheaper next generation technologies are urgently needed. A newer approach exploits nanopores, natural or solid-state, set in an electrical field, and obtains base sequence information from current variations due to the passage of a ssDNA molecule through the pore. A hurdle in this approach is the fact that the four bases are chemically comparable to each other which leads to small differences in current obstruction. ‘Base calling’ becomes even more challenging because most nanopores sense a short sequence and not individual bases. Perhaps sequencing DNA via nanopores would be more manageable, if only the bases were two, and chemically very different from each other; a sequence of 1s and 0s comes to mind. Osmylated DNA comes close to such a sequence of 1s and 0s. Osmylation is the addition of osmium tetroxide bipyridine across the C5-C6 double bond of the pyrimidines. Osmylation adds almost 400% mass to the reactive base, creates a sterically and electronically notably different molecule, labeled 1, compared to the unreactive purines, labeled 0. If osmylated DNA were successfully sequenced, the result would be a sequence of osmylated pyrimidines (1), and purines (0), and not of the actual nucleobases. To solve this problem we studied the osmylation reaction with short oligos and with M13mp18, a long ssDNA, developed a UV-vis assay to measure extent of osmylation, and designed two protocols. Protocol A uses mild conditions and yields osmylated thymidines (1), while leaving the other three bases (0) practically intact. Protocol B uses harsher conditions and effectively osmylates both pyrimidines, but not the purines. Applying these two protocols also to the complementary of the target polynucleotide yields a total of four osmylated strands that collectively could define the actual base sequence of the target DNA.
Tomasello, Salvatore; Álvarez, Inés; Vargas, Pablo; Oberprieler, Christoph
2015-01-01
The present study provides results of multi-species coalescent species tree analyses of DNA sequences sampled from multiple nuclear and plastid regions to infer the phylogenetic relationships among the members of the subtribe Leucanthemopsidinae (Compositae, Anthemideae), to which besides the annual Castrilanthemum debeauxii (Degen, Hervier & É.Rev.) Vogt & Oberp., one of the rarest flowering plant species of the Iberian Peninsula, two other unispecific genera (Hymenostemma, Prolongoa), and the polyploidy complex of the genus Leucanthemopsis belong. Based on sequence information from two single- to low-copy nuclear regions (C16, D35, characterised by Chapman et al. (2007)), the multi-copy region of the nrDNA internal transcribed spacer regions ITS1 and ITS2, and two intergenic spacer regions of the cpDNA gene trees were reconstructed using Bayesian inference methods. For the reconstruction of a multi-locus species tree we applied three different methods: (a) analysis of concatenated sequences using Bayesian inference (MrBayes), (b) a tree reconciliation approach by minimizing the number of deep coalescences (PhyloNet), and (c) a coalescent-based species-tree method in a Bayesian framework ((∗)BEAST). All three species tree reconstruction methods unequivocally support the close relationship of the subtribe with the hitherto unclassified genus Phalacrocarpum, the sister-group relationship of Castrilanthemum with the three remaining genera of the subtribe, and the further sister-group relationship of the clade of Hymenostemma+Prolongoa with a monophyletic genus Leucanthemopsis. Dating of the (∗)BEAST phylogeny supports the long-lasting (Early Miocene, 15-22Ma) taxonomical independence and the switch from the plesiomorphic perennial to the apomorphic annual life-form assumed for the Castrilanthemum lineage that may have occurred not earlier than in the Pliocene (3Ma) when the establishment of a Mediterranean climate with summer droughts triggered evolution towards annuality. Copyright © 2014 Elsevier Inc. All rights reserved.
UV-Visible Spectroscopy-Based Quantification of Unlabeled DNA Bound to Gold Nanoparticles.
Baldock, Brandi L; Hutchison, James E
2016-12-20
DNA-functionalized gold nanoparticles have been increasingly applied as sensitive and selective analytical probes and biosensors. The DNA ligands bound to a nanoparticle dictate its reactivity, making it essential to know the type and number of DNA strands bound to the nanoparticle surface. Existing methods used to determine the number of DNA strands per gold nanoparticle (AuNP) require that the sequences be fluorophore-labeled, which may affect the DNA surface coverage and reactivity of the nanoparticle and/or require specialized equipment and other fluorophore-containing reagents. We report a UV-visible-based method to conveniently and inexpensively determine the number of DNA strands attached to AuNPs of different core sizes. When this method is used in tandem with a fluorescence dye assay, it is possible to determine the ratio of two unlabeled sequences of different lengths bound to AuNPs. Two sizes of citrate-stabilized AuNPs (5 and 12 nm) were functionalized with mixtures of short (5 base) and long (32 base) disulfide-terminated DNA sequences, and the ratios of sequences bound to the AuNPs were determined using the new method. The long DNA sequence was present as a lower proportion of the ligand shell than in the ligand exchange mixture, suggesting it had a lower propensity to bind the AuNPs than the short DNA sequence. The ratio of DNA sequences bound to the AuNPs was not the same for the large and small AuNPs, which suggests that the radius of curvature had a significant influence on the assembly of DNA strands onto the AuNPs.
Sequence periodicity in nucleosomal DNA and intrinsic curvature
2010-01-01
Background Most eukaryotic DNA contained in the nucleus is packaged by wrapping DNA around histone octamers. Histones are ubiquitous and bind most regions of chromosomal DNA. In order to achieve smooth wrapping of the DNA around the histone octamer, the DNA duplex should be able to deform and should possess intrinsic curvature. The deformability of DNA is a result of the non-parallelness of base pair stacks. The stacking interaction between base pairs is sequence dependent. The higher the stacking energy the more rigid the DNA helix, thus it is natural to expect that sequences that are involved in wrapping around the histone octamer should be unstacked and possess intrinsic curvature. Intrinsic curvature has been shown to be dictated by the periodic recurrence of certain dinucleotides. Several genome-wide studies directed towards mapping of nucleosome positions have revealed periodicity associated with certain stretches of sequences. In the current study, these sequences have been analyzed with a view to understand their sequence-dependent structures. Results Higher order DNA structures and the distribution of molecular bend loci associated with 146 base nucleosome core DNA sequence from C. elegans and chicken have been analyzed using the theoretical model for DNA curvature. The curvature dispersion calculated by cyclically permuting the sequences revealed that the molecular bend loci were delocalized throughout the nucleosome core region and had varying degrees of intrinsic curvature. Conclusions The higher order structures associated with nucleosomes of C.elegans and chicken calculated from the sequences revealed heterogeneity with respect to the deviation of the DNA axis. The results points to the possibility of context dependent curvature of varying degrees to be associated with nucleosomal DNA. PMID:20487515
Hwang, Dae-Sik; Lee, Bo-Young; Kim, Hui-Su; Lee, Min Chul; Kyung, Do-Hyun; Om, Ae-Son; Rhee, Jae-Sung; Lee, Jae-Seong
2014-11-18
Nuclear receptors (NRs) are a large superfamily of proteins defined by a DNA-binding domain (DBD) and a ligand-binding domain (LBD). They function as transcriptional regulators to control expression of genes involved in development, homeostasis, and metabolism. The number of NRs differs from species to species, because of gene duplications and/or lineage-specific gene losses during metazoan evolution. Many NRs in arthropods interact with the ecdysteroid hormone and are involved in ecdysone-mediated signaling in arthropods. The nuclear receptor superfamily complement has been reported in several arthropods, including crustaceans, but not in copepods. We identified the entire NR repertoire of the copepod Tigriopus japonicus, which is an important marine model species for ecotoxicology and environmental genomics. Using whole genome and transcriptome sequences, we identified a total of 31 nuclear receptors in the genome of T. japonicus. Nomenclature of the nuclear receptors was determined based on the sequence similarities of the DNA-binding domain (DBD) and ligand-binding domain (LBD). The 7 subfamilies of NRs separate into five major clades (subfamilies NR1, NR2, NR3, NR4, and NR5/6). Although the repertoire of NR members in, T. japonicus was similar to that reported for other arthropods, there was an expansion of the NR1 subfamily in Tigriopus japonicus. The twelve unique nuclear receptors identified in T. japonicus are members of NR1L. This expansion may be a unique lineage-specific feature of crustaceans. Interestingly, E78 and HR83, which are present in other arthropods, were absent from the genomes of T. japonicus and two congeneric copepod species (T. japonicus and Tigriopus californicus), suggesting copepod lineage-specific gene loss. We identified all NR receptors present in the copepod, T. japonicus. Knowledge of the copepod nuclear receptor repertoire will contribute to a better understanding of copepod- and crustacean-specific NR evolution.
2000-08-01
4). Sequence recognition of all four DNA bases is achieved by positioning an N- methylimidazole opposite guanine or N-methylpyrrole opposite...unique sequences of DNA based upon selective binding motifs to all four DNA bases , although relatively little is known about the ability of these agents to
USDA-ARS?s Scientific Manuscript database
Genetic variation within the heterothallic cosmopolitan plant pathogen Phytophthora nicotianae was determined in 96 isolates from a wide range of hosts and geographic locations by characterizing four mitochondrial (10% of the genome) and three nuclear loci. Fifty-two SNPs ( average of 1 every 58 bp)...
Godinho, R; Mendonça, B; Crespo, E G; Ferrand, N
2006-06-01
The study of nuclear genealogies in natural populations of nonmodel organisms is expected to provide novel insights into the evolutionary history of populations, especially when developed in the framework of well-established mtDNA phylogeographical scenarios. In the Iberian Peninsula, the endemic Schreiber's green lizard Lacerta schreiberi exhibits two highly divergent and allopatric mtDNA lineages that started to split during the late Pliocene. In this work, we performed a fine-scale analysis of the putative mtDNA contact zone together with a global analysis of the patterns of variation observed at the nuclear beta-fibrinogen intron 7 (beta-fibint7). Using a combination of DNA sequencing with single-strand conformational polymorphism (SSCP) analysis, we show that the observed genealogy at the beta-fibint7 locus reveals extensive admixture between two formerly isolated lizard populations while the two mtDNA lineages remain essentially allopatric. In addition, a private beta-fibint7 haplotype detected in the single population where both mtDNA lineages were found in sympatry is probably the result of intragenic recombination between the two more common and divergent beta-fibint7 haplotypes. Our results suggest that the progressive incorporation of nuclear genealogies in investigating the ancient demography and admixture dynamics of divergent genomes will be necessary to obtain a more comprehensive picture of the evolutionary history of organisms.
Mammella, Marco A; Martin, Frank N; Cacciola, Santa O; Coffey, Michael D; Faedda, Roberto; Schena, Leonardo
2013-06-01
Genetic variation within the heterothallic cosmopolitan plant pathogen Phytophthora nicotianae was determined in 96 isolates from a wide range of hosts and geographic locations by characterizing four mitochondrial (10% of the genome) and three nuclear loci. In all, 52 single-nucleotide polymorphisms (SNPs) (an average of 1 every 58 bp) and 313 sites with gaps representing 5,450 bases enabled the identification of 50 different multilocus mitochondrial haplotypes. Similarly, 24 SNPs (an average of 1 every 69 bp), with heterozygosity observed at each locus, were observed in three nuclear regions (hyp, scp, and β-tub) differentiating 40 multilocus nuclear genotypes. Both mitochondrial and nuclear markers revealed a high level of dispersal of isolates and an inconsistent geographic structuring of populations. However, a specific association was observed for host of origin and genetic grouping with both nuclear and mitochondrial sequences. In particular, the majority of citrus isolates from Italy, California, Florida, Syria, Albania, and the Philippines clustered in the same mitochondrial group and shared at least one nuclear allele. A similar association was also observed for isolates recovered from Nicotiana and Solanum spp. The present study suggests an important role of nursery populations in increasing genetic recombination within the species and the existence of extensive phenomena of migration of isolates that have been likely spread worldwide with infected plant material.
Molecular Diagnosis of Infantile Mitochondrial Disease with Targeted Next-Generation Sequencing
Calvo, Sarah E.; Compton, Alison G.; Hershman, Steven G.; Lim, Sze Chern; Lieber, Daniel S.; Tucker, Elena J.; Laskowski, Adrienne; Garone, Caterina; Liu, Shangtao; Jaffe, David B.; Christodoulou, John; Fletcher, Janice M.; Bruno, Damien L; Goldblatt, Jack; DiMauro, Salvatore; Thorburn, David R.; Mootha, Vamsi K.
2012-01-01
Advances in next-generation sequencing (NGS) promise to facilitate diagnosis of inherited disorders. While in research settings NGS has pinpointed causal alleles using segregation in large families, the key challenge for clinical diagnosis is application to single individuals. To explore its diagnostic utility, we performed targeted NGS in 42 unrelated infants with clinical and biochemical evidence of mitochondrial oxidative phosphorylation disease, who were refractory to traditional molecular diagnosis. These devastating mitochondrial disorders are characterized by phenotypic and genetic heterogeneity, with over 100 causal genes identified to date. We performed “MitoExome” sequencing of the mitochondrial DNA (mtDNA) and exons of ~1000 nuclear genes encoding mitochondrial proteins and prioritized rare mutations predicted to disrupt function. Since patients and controls harbored a comparable number of such heterozygous alleles, we could not prioritize dominant acting genes. However, patients showed a five-fold enrichment of genes with two such mutations that could underlie recessive disease. In total, 23/42 (55%) patients harbored such recessive genes or pathogenic mtDNA variants. Firm diagnoses were enabled in 10 patients (24%) who had mutations in genes previously linked to disease. 13 patients (31%) had mutations in nuclear genes never linked to disease. The pathogenicity of two such genes, NDUFB3 and AGK, was supported by cDNA complementation and evidence from multiple patients, respectively. The results underscore the immediate potential and challenges of deploying NGS in clinical settings. PMID:22277967
The genome of Eimeria spp., with special reference to Eimeria tenella--a coccidium from the chicken.
Shirley, M W
2000-04-10
Eimeria spp. contain at least four genomes. The nuclear genome is best studied in the avian species Eimeria tenella and comprises about 60 Mbp DNA contained within ca. 14 chromosomes; other avian and lupine species appear to possess a nuclear genome of similar size. In addition, sequence data and hybridisation studies have provided direct evidence for extrachromosomal mitochondrial and plastid DNA genomes, and double-stranded RNA segments have also been described. The unique phenotype of "precocious" development that characterises some selected lines of Eimeria spp. not only provides the basis for the first generation of live attenuated vaccines, but offers a significant entrée into studies on the regulation of an apicomplexan life-cycle. With a view to identifying loci implicated in the trait of precocious development, a genetic linkage map of the genome of E. tenella is being constructed in this laboratory from analyses of the inheritance of over 400 polymorphic DNA markers in the progeny of a cross between complementary drug-resistant and precocious parents. Other projects that impinge directly or indirectly on the genome and/or genetics of Eimeria spp. are currently in progress in several laboratories, and include the derivation of expressed sequence tag data and the development of ancillary technologies such as transfection techniques. No large-scale genomic DNA sequencing projects have been reported.
Mayer, Werner; Pavlicev, Mihaela
2007-09-01
The family Lacertidae encompasses more than 250 species distributed in the Palearctis, Ethiopis and Orientalis. Lacertids have been subjected in the past to several morphological and molecular studies to establish their phylogeny. However, the problems of convergent adaptation in morphology and of excessively variable molecular markers have hampered the establishment of well supported deeper phylogenetic relationships. Particularly the adaptations to xeric environments have often been used to establish a scenario for the origin and radiation of major lineages within lacertids. Here we present a molecular phylogenetic study based on two nuclear marker genes and representatives of 37 lacertid genera and distinct species groups (as in the case of the collective genus Lacerta). Roughly 1600 bp of the nuclear rag1 and c-mos genes were sequenced and analyzed. While the results provide good support to the hitherto suggested main subfamilies of Gallotiinae (Gallotia and Psammodromus), Eremiainae and Lacertinae [Harris, D.J., Arnold, E.N., Thomas, R.H., 1998. Relationships of lacertid lizards (Reptilia: Lacertidae) estimated from mitochondrial DNA sequences and morphology. Proc. R. Soc. Lond. B 265, 1939-1948], they also suggest unexpected relationships. In particular, the oriental genus Takydromus, previously considered the sister-group to the three subfamilies, is nested within Lacertinae. Moreover, the genera within the Eremiainae are further divided into two groups, roughly corresponding to their respective geographical distributions in the Ethiopian and the Saharo-Eurasian ranges. The results support an independent origin of adaptations to xeric conditions in different subfamilies. The relationships within the subfamily Lacertinae could not be resolved with the markers used. The species groups of the collective genus Lacerta show a bush-like topology in the inferred Bayesian tree, suggesting rapid radiation. The composition of the subfamilies Eremiainae and Lacertinae as well as their phylogeography are discussed.
Science and technology review, July/August 1997
DOE Office of Scientific and Technical Information (OSTI.GOV)
Upadhye, R.
This month`s issues are entitled Assuring the Safety of Nuclear Power; The Microtechnology Center, When Smaller is Better; Speeding the Gene Hunt: High Speed DNA Sequencing; and Microbial Treatments of High Explosives.
Nishihara, Hidenori; Stanyon, Roscoe; Kusumi, Junko; Hirai, Hirohisa
2018-01-01
Abstract Rod cells of many nocturnal mammals have a “non-standard” nuclear architecture, which is called the inverted nuclear architecture. Heterochromatin localizes to the central region of the nucleus. This leads to an efficient light transmission to the outer segments of photoreceptors. Rod cells of diurnal mammals have the conventional nuclear architecture. Owl monkeys (genus Aotus) are the only taxon of simian primates that has a nocturnal or cathemeral lifestyle, and this adaptation is widely thought to be secondary. Their rod cells were shown to exhibit an intermediate chromatin distribution: a spherical heterochromatin block was found in the central region of the nucleus although it was less complete than that of typical nocturnal mammals. We recently demonstrated that the primary DNA component of this heterochromatin block was OwlRep, a megasatellite DNA consisting of 187-bp-long repeat units. However, the origin of OwlRep was not known. Here we show that OwlRep was derived from HSAT6, a simple repeat sequence found in the centromere regions of human chromosomes. HSAT6 occurs widely in primates, suggesting that it was already present in the last common ancestor of extant primates. Notably, Strepsirrhini and Tarsiformes apparently carry a single HSAT6 copy, whereas many species of Simiiformes contain multiple copies. Comparison of nucleotide sequences of these copies revealed the entire process of the OwlRep formation. HSAT6, with or without flanking sequences, was segmentally duplicated in New World monkeys. Then, in the owl monkey linage after its divergence from other New World monkeys, a copy of HSAT6 was tandemly amplified, eventually forming a megasatellite DNA. PMID:29294004
DNABIT Compress – Genome compression algorithm
Rajarajeswari, Pothuraju; Apparao, Allam
2011-01-01
Data compression is concerned with how information is organized in data. Efficient storage means removal of redundancy from the data being stored in the DNA molecule. Data compression algorithms remove redundancy and are used to understand biologically important molecules. We present a compression algorithm, “DNABIT Compress” for DNA sequences based on a novel algorithm of assigning binary bits for smaller segments of DNA bases to compress both repetitive and non repetitive DNA sequence. Our proposed algorithm achieves the best compression ratio for DNA sequences for larger genome. Significantly better compression results show that “DNABIT Compress” algorithm is the best among the remaining compression algorithms. While achieving the best compression ratios for DNA sequences (Genomes),our new DNABIT Compress algorithm significantly improves the running time of all previous DNA compression programs. Assigning binary bits (Unique BIT CODE) for (Exact Repeats, Reverse Repeats) fragments of DNA sequence is also a unique concept introduced in this algorithm for the first time in DNA compression. This proposed new algorithm could achieve the best compression ratio as much as 1.58 bits/bases where the existing best methods could not achieve a ratio less than 1.72 bits/bases. PMID:21383923
Lin, Yen-Po; Ding, Zheng Yee; Gullan, Penny J; Cook, Lyn G
2017-05-26
Austrolecanium cryptocaryae Lin & Cook sp. n. is described based on adult female morphology and DNA sequences from mitochondrial and nuclear loci. This Australian endemic species was found on the underside of leaves of Cryptocarya microneura (Lauraceae) in Queensland. All phylogenetic analyses of four independent DNA loci and a concatenated dataset show that A. cryptocaryae is monophyletic and closely related to A. sassafras Gullan & Hodgson, the type species of Austrolecanium Gullan & Hodgson. The adult female of A. cryptocaryae is described and illustrated and a table is provided of the characters that differ among adult females of the three species of Austrolecanium currently recognised (A. cappari (Froggatt), A. cryptocaryae sp. n. and A. sassafras).
Development of a PCR-based assay for rapid and reliable identification of pathogenic Fusaria.
Mishra, Prashant K; Fox, Roland T V; Culham, Alastair
2003-01-28
Identification of Fusarium species has always been difficult due to confusing phenotypic classification systems. We have developed a fluorescent-based polymerase chain reaction assay that allows for rapid and reliable identification of five toxigenic and pathogenic Fusarium species. The species includes Fusarium avenaceum, F. culmorum, F. equiseti, F. oxysporum and F. sambucinum. The method is based on the PCR amplification of species-specific DNA fragments using fluorescent oligonucleotide primers, which were designed based on sequence divergence within the internal transcribed spacer region of nuclear ribosomal DNA. Besides providing an accurate, reliable, and quick diagnosis of these Fusaria, another advantage with this method is that it reduces the potential for exposure to carcinogenic chemicals as it substitutes the use of fluorescent dyes in place of ethidium bromide. Apart from its multidisciplinary importance and usefulness, it also obviates the need for gel electrophoresis.
Prescott, D M
1994-01-01
Ciliates contain two types of nuclei: a micronucleus and a macronucleus. The micronucleus serves as the germ line nucleus but does not express its genes. The macronucleus provides the nuclear RNA for vegetative growth. Mating cells exchange haploid micronuclei, and a new macronucleus develops from a new diploid micronucleus. The old macronucleus is destroyed. This conversion consists of amplification, elimination, fragmentation, and splicing of DNA sequences on a massive scale. Fragmentation produces subchromosomal molecules in Tetrahymena and Paramecium cells and much smaller, gene-sized molecules in hypotrichous ciliates to which telomere sequences are added. These molecules are then amplified, some to higher copy numbers than others. rDNA is differentially amplified to thousands of copies per macronucleus. Eliminated sequences include transposonlike elements and sequences called internal eliminated sequences that interrupt gene coding regions in the micronuclear genome. Some, perhaps all, of these are excised as circular molecules and destroyed. In at least some hypotrichs, segments of some micronuclear genes are scrambled in a nonfunctional order and are recorded during macronuclear development. Vegetatively growing ciliates appear to possess a mechanism for adjusting copy numbers of individual genes, which corrects gene imbalances resulting from random distribution of DNA molecules during amitosis of the macronucleus. Other distinctive features of ciliate DNA include an altered use of the conventional stop codons. Images PMID:8078435
Sequential addition of short DNA oligos in DNA-polymerase-based synthesis reactions
Gardner, Shea N [San Leandro, CA; Mariella, Jr., Raymond P.; Christian, Allen T [Tracy, CA; Young, Jennifer A [Berkeley, CA; Clague, David S [Livermore, CA
2011-01-18
A method of fabricating a DNA molecule of user-defined sequence. The method comprises the steps of preselecting a multiplicity of DNA sequence segments that will comprise the DNA molecule of user-defined sequence, separating the DNA sequence segments temporally, and combining the multiplicity of DNA sequence segments with at least one polymerase enzyme wherein the multiplicity of DNA sequence segments join to produce the DNA molecule of user-defined sequence. Sequence segments may be of length n, where n is an even or odd integer. In one embodiment the length of desired hybridizing overlap is specified by the user and the sequences and the protocol for combining them are guided by computational (bioinformatics) predictions. In one embodiment sequence segments are combined from multiple reading frames to span the same region of a sequence, so that multiple desired hybridizations may occur with different overlap lengths. In one embodiment starting sequence fragments are of different lengths, n, n+1, n+2, etc.
Does CTCF mediate between nuclear organization and gene expression?
Ohlsson, Rolf; Lobanenkov, Victor; Klenova, Elena
2010-01-01
The multifunctional zinc-finger protein CCCTC-binding factor (CTCF) is a very strong candidate for the role of coordinating the expression level of coding sequences with their three-dimensional position in the nucleus, apparently responding to a "code" in the DNA itself. Dynamic interactions between chromatin fibers in the context of nuclear architecture have been implicated in various aspects of genome functions. However, the molecular basis of these interactions still remains elusive and is a subject of intense debate. Here we discuss the nature of CTCF-DNA interactions, the CTCF-binding specificity to its binding sites and the relationship between CTCF and chromatin, and we examine data linking CTCF with gene regulation in the three-dimensional nuclear space. We discuss why these features render CTCF a very strong candidate for the role and propose a unifying model, the "CTCF code," explaining the mechanistic basis of how the information encrypted in DNA may be interpreted by CTCF into diverse nuclear functions.
Chazin, W J; Rance, M; Chollet, A; Leupin, W
1991-01-01
The dodecadeoxynucleotide duplex d-(GCATTAATGC)2 has been prepared with all adenine bases replaced by 2-NH2-adenine. This modified duplex has been characterized by nuclear magnetic resonance (NMR) spectroscopy. Complete sequence-specific 1H resonance assignments have been obtained by using a variety of 2D NMR methods. Multiple quantum-filtered and multiple quantum experiments have been used to completely assign all sugar ring protons, including 5'H and 5'H resonances. The assignments form the basis for a detailed comparative analysis of the 1H NMR parameters of the modified and parent duplex. The structural features of both decamer duplexes in solution are characteristic of the B-DNA family. The spin-spin coupling constants in the sugar rings and the relative spatial proximities of protons in the bases and sugars (as determined from the comparison of corresponding nuclear Overhauser effects) are virtually identical in the parent and modified duplexes. Thus, substitution by this adenine analogue in oligonucleotides appears not to disturb the global or local conformation of the DNA duplex. PMID:1945828
DNA Barcode Goes Two-Dimensions: DNA QR Code Web Server
Li, Huan; Xing, Hang; Liang, Dong; Jiang, Kun; Pang, Xiaohui; Song, Jingyuan; Chen, Shilin
2012-01-01
The DNA barcoding technology uses a standard region of DNA sequence for species identification and discovery. At present, “DNA barcode” actually refers to DNA sequences, which are not amenable to information storage, recognition, and retrieval. Our aim is to identify the best symbology that can represent DNA barcode sequences in practical applications. A comprehensive set of sequences for five DNA barcode markers ITS2, rbcL, matK, psbA-trnH, and CO1 was used as the test data. Fifty-three different types of one-dimensional and ten two-dimensional barcode symbologies were compared based on different criteria, such as coding capacity, compression efficiency, and error detection ability. The quick response (QR) code was found to have the largest coding capacity and relatively high compression ratio. To facilitate the further usage of QR code-based DNA barcodes, a web server was developed and is accessible at http://qrfordna.dnsalias.org. The web server allows users to retrieve the QR code for a species of interests, convert a DNA sequence to and from a QR code, and perform species identification based on local and global sequence similarities. In summary, the first comprehensive evaluation of various barcode symbologies has been carried out. The QR code has been found to be the most appropriate symbology for DNA barcode sequences. A web server has also been constructed to allow biologists to utilize QR codes in practical DNA barcoding applications. PMID:22574113
Hirotani, M; Kuroda, R; Suzuki, H; Yoshikawa, T
2000-05-01
A cDNA encoding UDP-glucose: baicalein 7-O-glucosyltransferase (UBGT) was isolated from a cDNA library from hairy root cultures of Scutellaria baicalensis Georgi probed with a partial-length cDNA clone of a UDP-glucose: flavonoid 3-O-glucosyltransferase (UFGT) from grape (Vitis vinifera L.). The heterologous probe contained a glucosyltransferase consensus amino acid sequence which was also present in the Scutellaria cDNA clones. The complete nucleotide sequence of the 1688-bp cDNA insert was determined and the deduced amino acid sequences are presented. The nucleotide sequence analysis of UBGT revealed an open reading frame encoding a polypeptide of 476 amino acids with a calculated molecular mass of 53,094 Da. The reaction product for baicalein and UDP-glucose catalyzed by recombinant UBGT in Escherichia coli was identified as authentic baicalein 7-O-glucoside using high-performance liquid chromatography and proton nuclear magnetic resonance spectroscopy. The enzyme activities of recombinant UBGT expressed in E. coli were also detected towards flavonoids such as baicalein, wogonin, apigenin, scutellarein, 7,4'-dihydroxyflavone and kaempferol, and phenolic compounds. The accumulation of UBGT mRNA in hairy roots was in response to wounding or salicylic acid treatments.
Genetic characterization of Pompeii and Herculaneum Equidae buried by Vesuvius in 79 AD.
Di Bernardo, G; Galderisi, U; Del Gaudio, S; D'Aniello, A; Lanave, C; De Robertis, M T; Cascino, Antonino; Cipollaro, M
2004-05-01
DNA extracted from the skeletons of five equids discovered in a Pompeii stable and of a horse found in Herculaneum was investigated. Amino acid racemization level was consistent with the presence of DNA. Post-mortem base modifications were excluded by sequencing a 146 bp fragment of the 16S rRNA mitochondrial gene. Sequencing of a 370 bp fragment of mitochondrial (mt)DNA control region allowed the construction of a phylogenetic tree that, along with sequencing of nuclear genes (epsilon globin, gamma interferon, and p53) fragments, gave us the possibility to address some questions puzzling archaeologists. What animals-donkeys, horses, or crossbreeds-were they? And, given they had been evidently assigned to one specific job, were they all akin or were they animals with different mitochondrial haplotypes? The conclusions provided by molecular analysis show that the Pompeii remains are those of horses and mules. Furthermore one of the equids (CAV5) seems to belong to a haplotype, which is either not yet documented in the GenBank or has since disappeared. As its characteristics closely recall those of donkeys, which is the out group chosen to construct the tree, that appears to have evolved within the Equidae family much earlier than horses, this assumption seems to be nearer the truth.
Analysis of DNA Sequences by an Optical Time-Integrating Correlator: Proposal
1991-11-01
OF THE PROBLEM AND CURRENT TECHNOLOGY 2 3.0 TIME-INTEGRATING CORRELATOR 2 4.0 REPRESENTATIONS OF THE DNA BASES 8 5.0 DNA ANALYSIS STRATEGY 8 6.0... DNA bases where each base is represented by a 7-bits long pseudorandom sequence. 9 Figure 5: The flow of data in a DNA analysis system based on an...logarithmic scale and a linear scale. 15 x LIST OF TABLES PAGE Table 1: Short representations of the DNA bases where each base is represented by 7-bits
cgDNAweb: a web interface to the cgDNA sequence-dependent coarse-grain model of double-stranded DNA.
De Bruin, Lennart; Maddocks, John H
2018-06-14
The sequence-dependent statistical mechanical properties of fragments of double-stranded DNA is believed to be pertinent to its biological function at length scales from a few base pairs (or bp) to a few hundreds of bp, e.g. indirect read-out protein binding sites, nucleosome positioning sequences, phased A-tracts, etc. In turn, the equilibrium statistical mechanics behaviour of DNA depends upon its ground state configuration, or minimum free energy shape, as well as on its fluctuations as governed by its stiffness (in an appropriate sense). We here present cgDNAweb, which provides browser-based interactive visualization of the sequence-dependent ground states of double-stranded DNA molecules, as predicted by the underlying cgDNA coarse-grain rigid-base model of fragments with arbitrary sequence. The cgDNAweb interface is specifically designed to facilitate comparison between ground state shapes of different sequences. The server is freely available at cgDNAweb.epfl.ch with no login requirement.
González-Porter, Gracia P.; Maldonado, Jesús E.; Flores-Villela, Oscar; Vogt, Richard C.; Janke, Axel; Fleischer, Robert C.; Hailer, Frank
2013-01-01
The critically endangered Central American River Turtle (Dermatemys mawii) is the only remaining member of the Dermatemydidae family, yet little is known about its population structuring. In a previous study of mitochondrial (mt) DNA in the species, three main lineages were described. One lineage (Central) was dominant across most of the range, while two other lineages were restricted to Papaloapan (PAP; isolated by the Isthmus of Tehuantepec and the Sierra de Santa Marta) or the south-eastern part of the range (1D). Here we provide data from seven polymorphic microsatellite loci and the R35 intron to re-evaluate these findings using DNA from the nuclear genome. Based on a slightly expanded data set of a total of 253 samples from the same localities, we find that mtDNA and nuclear DNA markers yield a highly congruent picture of the evolutionary history and population structuring of D. mawii. While resolution provided by the R35 intron (sequenced for a subset of the samples) was very limited, the microsatellite data revealed pronounced population structuring. Within the Grijalva-Usumacinta drainage basin, however, many populations separated by more than 300 kilometers showed signals of high gene flow. Across the entire range, neither mitochondrial nor nuclear DNA show a significant isolation-by-distance pattern, but both genomes highlight that the D. mawii population in the Papaloapan basin is genetically distinctive. Further, both marker systems detect unique genomic signals in four individuals with mtDNA clade 1D sampled on the southeast edge of the Grijalva-Usumacinta basin. These individuals may represent a separate cryptic taxon that is likely impacted by recent admixture. PMID:24086253
Drovetski, Sergei V.; Raković, Marko; Semenov, Georgy; Fadeev, Igor V.; Red’kin, Yaroslav A.
2014-01-01
Phylogeographic studies of Holarctic birds are challenging because they involve vast geographic scale, complex glacial history, extensive phenotypic variation, and heterogeneous taxonomic treatment across countries, all of which require large sample sizes. Knowledge about the quality of phylogeographic information provided by different loci is crucial for study design. We use sequences of one mtDNA gene, one sex-linked intron, and one autosomal intron to elucidate large scale phylogeographic patterns in the Holarctic lark genus Eremophila. The mtDNA ND2 gene identified six geographically, ecologically, and phenotypically concordant clades in the Palearctic that diverged in the Early - Middle Pleistocene and suggested paraphyly of the horned lark (E. alpestris) with respect to the Temminck's lark (E. bilopha). In the Nearctic, ND2 identified five subclades which diverged in the Late Pleistocene. They overlapped geographically and were not concordant phenotypically or ecologically. Nuclear alleles provided little information on geographic structuring of genetic variation in horned larks beyond supporting the monophyly of Eremophila and paraphyly of the horned lark. Multilocus species trees based on two nuclear or all three loci provided poor support for haplogroups identified by mtDNA. The node ages calculated using mtDNA were consistent with the available paleontological data, whereas individual nuclear loci and multilocus species trees appeared to underestimate node ages. We argue that mtDNA is capable of discovering independent evolutionary units within avian taxa and can provide a reasonable phylogeographic hypothesis when geographic scale, geologic history, and phenotypic variation in the study system are too complex for proposing reasonable a priori hypotheses required for multilocus methods. Finally, we suggest splitting the currently recognized horned lark into five Palearctic and one Nearctic species. PMID:24498139
Vuataz, Laurent; Sartori, Michel; Wagner, André; Monaghan, Michael T.
2011-01-01
Aquatic larvae of many Rhithrogena mayflies (Ephemeroptera) inhabit sensitive Alpine environments. A number of species are on the IUCN Red List and many recognized species have restricted distributions and are of conservation interest. Despite their ecological and conservation importance, ambiguous morphological differences among closely related species suggest that the current taxonomy may not accurately reflect the evolutionary diversity of the group. Here we examined the species status of nearly 50% of European Rhithrogena diversity using a widespread sampling scheme of Alpine species that included 22 type localities, general mixed Yule-coalescent (GMYC) model analysis of one standard mtDNA marker and one newly developed nDNA marker, and morphological identification where possible. Using sequences from 533 individuals from 144 sampling localities, we observed significant clustering of the mitochondrial (cox1) marker into 31 GMYC species. Twenty-one of these could be identified based on the presence of topotypes (expertly identified specimens from the species' type locality) or unambiguous morphology. These results strongly suggest the presence of both cryptic diversity and taxonomic oversplitting in Rhithrogena. Significant clustering was not detected with protein-coding nuclear PEPCK, although nine GMYC species were congruent with well supported terminal clusters of nDNA. Lack of greater congruence in the two data sets may be the result of incomplete sorting of ancestral polymorphism. Bayesian phylogenetic analyses of both gene regions recovered four of the six recognized Rhithrogena species groups in our samples as monophyletic. Future development of more nuclear markers would facilitate multi-locus analysis of unresolved, closely related species pairs. The DNA taxonomy developed here lays the groundwork for a future revision of the important but cryptic Rhithrogena genus in Europe. PMID:21611178
Mapping Base Modifications in DNA by Transverse-Current Sequencing
NASA Astrophysics Data System (ADS)
Alvarez, Jose R.; Skachkov, Dmitry; Massey, Steven E.; Kalitsov, Alan; Velev, Julian P.
2018-02-01
Sequencing DNA modifications and lesions, such as methylation of cytosine and oxidation of guanine, is even more important and challenging than sequencing the genome itself. The traditional methods for detecting DNA modifications are either insensitive to these modifications or require additional processing steps to identify a particular type of modification. Transverse-current sequencing in nanopores can potentially identify the canonical bases and base modifications in the same run. In this work, we demonstrate that the most common DNA epigenetic modifications and lesions can be detected with any predefined accuracy based on their tunneling current signature. Our results are based on simulations of the nanopore tunneling current through DNA molecules, calculated using nonequilibrium electron-transport methodology within an effective multiorbital model derived from first-principles calculations, followed by a base-calling algorithm accounting for neighbor current-current correlations. This methodology can be integrated with existing experimental techniques to improve base-calling fidelity.
USDA-ARS?s Scientific Manuscript database
We needed to obtain an alternative to conventional cloning to generate high-quality DNA sequences from a variety of nuclear orthologs for phylogenetic studies in potato, to save time and money and to avoid problems typically encountered in cloning. We tested a variety of SSCP protocols to include pu...
Falk, Marni J; Shen, Lishuang; Gonzalez, Michael; Leipzig, Jeremy; Lott, Marie T; Stassen, Alphons P M; Diroma, Maria Angela; Navarro-Gomez, Daniel; Yeske, Philip; Bai, Renkui; Boles, Richard G; Brilhante, Virginia; Ralph, David; DaRe, Jeana T; Shelton, Robert; Terry, Sharon F; Zhang, Zhe; Copeland, William C; van Oven, Mannis; Prokisch, Holger; Wallace, Douglas C; Attimonelli, Marcella; Krotoski, Danuta; Zuchner, Stephan; Gai, Xiaowu
2015-03-01
Success rates for genomic analyses of highly heterogeneous disorders can be greatly improved if a large cohort of patient data is assembled to enhance collective capabilities for accurate sequence variant annotation, analysis, and interpretation. Indeed, molecular diagnostics requires the establishment of robust data resources to enable data sharing that informs accurate understanding of genes, variants, and phenotypes. The "Mitochondrial Disease Sequence Data Resource (MSeqDR) Consortium" is a grass-roots effort facilitated by the United Mitochondrial Disease Foundation to identify and prioritize specific genomic data analysis needs of the global mitochondrial disease clinical and research community. A central Web portal (https://mseqdr.org) facilitates the coherent compilation, organization, annotation, and analysis of sequence data from both nuclear and mitochondrial genomes of individuals and families with suspected mitochondrial disease. This Web portal provides users with a flexible and expandable suite of resources to enable variant-, gene-, and exome-level sequence analysis in a secure, Web-based, and user-friendly fashion. Users can also elect to share data with other MSeqDR Consortium members, or even the general public, either by custom annotation tracks or through the use of a convenient distributed annotation system (DAS) mechanism. A range of data visualization and analysis tools are provided to facilitate user interrogation and understanding of genomic, and ultimately phenotypic, data of relevance to mitochondrial biology and disease. Currently available tools for nuclear and mitochondrial gene analyses include an MSeqDR GBrowse instance that hosts optimized mitochondrial disease and mitochondrial DNA (mtDNA) specific annotation tracks, as well as an MSeqDR locus-specific database (LSDB) that curates variant data on more than 1300 genes that have been implicated in mitochondrial disease and/or encode mitochondria-localized proteins. MSeqDR is integrated with a diverse array of mtDNA data analysis tools that are both freestanding and incorporated into an online exome-level dataset curation and analysis resource (GEM.app) that is being optimized to support needs of the MSeqDR community. In addition, MSeqDR supports mitochondrial disease phenotyping and ontology tools, and provides variant pathogenicity assessment features that enable community review, feedback, and integration with the public ClinVar variant annotation resource. A centralized Web-based informed consent process is being developed, with implementation of a Global Unique Identifier (GUID) system to integrate data deposited on a given individual from different sources. Community-based data deposition into MSeqDR has already begun. Future efforts will enhance capabilities to incorporate phenotypic data that enhance genomic data analyses. MSeqDR will fill the existing void in bioinformatics tools and centralized knowledge that are necessary to enable efficient nuclear and mtDNA genomic data interpretation by a range of shareholders across both clinical diagnostic and research settings. Ultimately, MSeqDR is focused on empowering the global mitochondrial disease community to better define and explore mitochondrial diseases. Copyright © 2014 Elsevier Inc. All rights reserved.
Falk, Marni J.; Shen, Lishuang; Gonzalez, Michael; Leipzig, Jeremy; Lott, Marie T.; Stassen, Alphons P.M.; Diroma, Maria Angela; Navarro-Gomez, Daniel; Yeske, Philip; Bai, Renkui; Boles, Richard G.; Brilhante, Virginia; Ralph, David; DaRe, Jeana T.; Shelton, Robert; Terry, Sharon; Zhang, Zhe; Copeland, William C.; van Oven, Mannis; Prokisch, Holger; Wallace, Douglas C.; Attimonelli, Marcella; Krotoski, Danuta; Zuchner, Stephan; Gai, Xiaowu
2014-01-01
Success rates for genomic analyses of highly heterogeneous disorders can be greatly improved if a large cohort of patient data is assembled to enhance collective capabilities for accurate sequence variant annotation, analysis, and interpretation. Indeed, molecular diagnostics requires the establishment of robust data resources to enable data sharing that informs accurate understanding of genes, variants, and phenotypes. The “Mitochondrial Disease Sequence Data Resource (MSeqDR) Consortium” is a grass-roots effort facilitated by the United Mitochondrial Disease Foundation to identify and prioritize specific genomic data analysis needs of the global mitochondrial disease clinical and research community. A central Web portal (https://mseqdr.org) facilitates the coherent compilation, organization, annotation, and analysis of sequence data from both nuclear and mitochondrial genomes of individuals and families with suspected mitochondrial disease. This Web portal provides users with a flexible and expandable suite of resources to enable variant-, gene-, and exome-level sequence analysis in a secure, Web-based, and user-friendly fashion. Users can also elect to share data with other MSeqDR Consortium members, or even the general public, either by custom annotation tracks or through use of a convenient distributed annotation system (DAS) mechanism. A range of data visualization and analysis tools are provided to facilitate user interrogation and understanding of genomic, and ultimately phenotypic, data of relevance to mitochondrial biology and disease. Currently available tools for nuclear and mitochondrial gene analyses include an MSeqDR GBrowse instance that hosts optimized mitochondrial disease and mitochondrial DNA (mtDNA) specific annotation tracks, as well as an MSeqDR locus-specific database (LSDB) that curates variant data on more than 1,300 genes that have been implicated in mitochondrial disease and/or encode mitochondria-localized proteins. MSeqDR is integrated with a diverse array of mtDNA data analysis tools that are both freestanding and incorporated into an online exome-level dataset curation and analysis resource (GEM.app) that is being optimized to support needs of the MSeqDR community. In addition, MSeqDR supports mitochondrial disease phenotyping and ontology tools, and provides variant pathogenicity assessment features that enable community review, feedback, and integration with the public ClinVar variant annotation resource. A centralized Web-based informed consent process is being developed, with implementation of a Global Unique Identifier (GUID) system to integrate data deposited on a given individual from different sources. Community-based data deposition into MSeqDR has already begun. Future efforts will enhance capabilities to incorporate phenotypic data that enhance genomic data analyses. MSeqDR will fill the existing void in bioinformatics tools and centralized knowledge that are necessary to enable efficient nuclear and mtDNA genomic data interpretation by a range of shareholders across both clinical diagnostic and research settings. Ultimately, MSeqDR is focused on empowering the global mitochondrial disease community to better define and explore mitochondrial disease. PMID:25542617
Method for rapid base sequencing in DNA and RNA with two base labeling
Jett, J.H.; Keller, R.A.; Martin, J.C.; Posner, R.G.; Marrone, B.L.; Hammond, M.L.; Simpson, D.J.
1995-04-11
A method is described for rapid-base sequencing in DNA and RNA with two-base labeling and employing fluorescent detection of single molecules at two wavelengths. Bases modified to accept fluorescent labels are used to replicate a single DNA or RNA strand to be sequenced. The bases are then sequentially cleaved from the replicated strand, excited with a chosen spectrum of electromagnetic radiation, and the fluorescence from individual, tagged bases detected in the order of cleavage from the strand. 4 figures.
Method for rapid base sequencing in DNA and RNA with two base labeling
Jett, James H.; Keller, Richard A.; Martin, John C.; Posner, Richard G.; Marrone, Babetta L.; Hammond, Mark L.; Simpson, Daniel J.
1995-01-01
Method for rapid-base sequencing in DNA and RNA with two-base labeling and employing fluorescent detection of single molecules at two wavelengths. Bases modified to accept fluorescent labels are used to replicate a single DNA or RNA strand to be sequenced. The bases are then sequentially cleaved from the replicated strand, excited with a chosen spectrum of electromagnetic radiation, and the fluorescence from individual, tagged bases detected in the order of cleavage from the strand.
Ludgate, Jackie L; Wright, James; Stockwell, Peter A; Morison, Ian M; Eccles, Michael R; Chatterjee, Aniruddha
2017-08-31
Formalin fixed paraffin embedded (FFPE) tumor samples are a major source of DNA from patients in cancer research. However, FFPE is a challenging material to work with due to macromolecular fragmentation and nucleic acid crosslinking. FFPE tissue particularly possesses challenges for methylation analysis and for preparing sequencing-based libraries relying on bisulfite conversion. Successful bisulfite conversion is a key requirement for sequencing-based methylation analysis. Here we describe a complete and streamlined workflow for preparing next generation sequencing libraries for methylation analysis from FFPE tissues. This includes, counting cells from FFPE blocks and extracting DNA from FFPE slides, testing bisulfite conversion efficiency with a polymerase chain reaction (PCR) based test, preparing reduced representation bisulfite sequencing libraries and massively parallel sequencing. The main features and advantages of this protocol are: An optimized method for extracting good quality DNA from FFPE tissues. An efficient bisulfite conversion and next generation sequencing library preparation protocol that uses 50 ng DNA from FFPE tissue. Incorporation of a PCR-based test to assess bisulfite conversion efficiency prior to sequencing. We provide a complete workflow and an integrated protocol for performing DNA methylation analysis at the genome-scale and we believe this will facilitate clinical epigenetic research that involves the use of FFPE tissue.
Dendritic Cell-Based Immunotherapy of Breast Cancer: Modulation by CpG DNA
2005-09-01
tumor-associated antigens and bacterial DNA oligodeoxynucleotides containing unmethylated CpG sequences (CpG DNA) further augment the immune priming...associated antigens by cytotoxic T lymphocytes, and bacterial DNA oligodeoxy- nucleotides containing unmethylated CpG sequences (CpG DNA) can further...further amplify their immunostimulatory capacity and bacterial DNA oligodeoxynucleotides (ODN) containing unmethylated CpG sequences (CpG DNA) provide such
Barker, F Keith; Barrowclough, George F; Groth, Jeff G
2002-01-01
Passerine birds comprise over half of avian diversity, but have proved difficult to classify. Despite a long history of work on this group, no comprehensive hypothesis of passerine family-level relationships was available until recent analyses of DNA-DNA hybridization data. Unfortunately, given the value of such a hypothesis in comparative studies of passerine ecology and behaviour, the DNA-hybridization results have not been well tested using independent data and analytical approaches. Therefore, we analysed nucleotide sequence variation at the nuclear RAG-1 and c-mos genes from 69 passerine taxa, including representatives of most currently recognized families. In contradiction to previous DNA-hybridization studies, our analyses suggest paraphyly of suboscine passerines because the suboscine New Zealand wren Acanthisitta was found to be sister to all other passerines. Additionally, we reconstructed the parvorder Corvida as a basal paraphyletic grade within the oscine passerines. Finally, we found strong evidence that several family-level taxa are misplaced in the hybridization results, including the Alaudidae, Irenidae, and Melanocharitidae. The hypothesis of relationships we present here suggests that the oscine passerines arose on the Australian continental plate while it was isolated by oceanic barriers and that a major northern radiation of oscines (i.e. the parvorder Passerida) originated subsequent to dispersal from the south. PMID:11839199
Barker, F Keith; Barrowclough, George F; Groth, Jeff G
2002-02-07
Passerine birds comprise over half of avian diversity, but have proved difficult to classify. Despite a long history of work on this group, no comprehensive hypothesis of passerine family-level relationships was available until recent analyses of DNA-DNA hybridization data. Unfortunately, given the value of such a hypothesis in comparative studies of passerine ecology and behaviour, the DNA-hybridization results have not been well tested using independent data and analytical approaches. Therefore, we analysed nucleotide sequence variation at the nuclear RAG-1 and c-mos genes from 69 passerine taxa, including representatives of most currently recognized families. In contradiction to previous DNA-hybridization studies, our analyses suggest paraphyly of suboscine passerines because the suboscine New Zealand wren Acanthisitta was found to be sister to all other passerines. Additionally, we reconstructed the parvorder Corvida as a basal paraphyletic grade within the oscine passerines. Finally, we found strong evidence that several family-level taxa are misplaced in the hybridization results, including the Alaudidae, Irenidae, and Melanocharitidae. The hypothesis of relationships we present here suggests that the oscine passerines arose on the Australian continental plate while it was isolated by oceanic barriers and that a major northern radiation of oscines (i.e. the parvorder Passerida) originated subsequent to dispersal from the south.
Renz, Adina J.; Meyer, Axel; Kuraku, Shigehiro
2013-01-01
Cartilaginous fishes, divided into Holocephali (chimaeras) and Elasmoblanchii (sharks, rays and skates), occupy a key phylogenetic position among extant vertebrates in reconstructing their evolutionary processes. Their accurate evolutionary time scale is indispensable for better understanding of the relationship between phenotypic and molecular evolution of cartilaginous fishes. However, our current knowledge on the time scale of cartilaginous fish evolution largely relies on estimates using mitochondrial DNA sequences. In this study, making the best use of the still partial, but large-scale sequencing data of cartilaginous fish species, we estimate the divergence times between the major cartilaginous fish lineages employing nuclear genes. By rigorous orthology assessment based on available genomic and transcriptomic sequence resources for cartilaginous fishes, we selected 20 protein-coding genes in the nuclear genome, spanning 2973 amino acid residues. Our analysis based on the Bayesian inference resulted in the mean divergence time of 421 Ma, the late Silurian, for the Holocephali-Elasmobranchii split, and 306 Ma, the late Carboniferous, for the split between sharks and rays/skates. By applying these results and other documented divergence times, we measured the relative evolutionary rate of the Hox A cluster sequences in the cartilaginous fish lineages, which resulted in a lower substitution rate with a factor of at least 2.4 in comparison to tetrapod lineages. The obtained time scale enables mapping phenotypic and molecular changes in a quantitative framework. It is of great interest to corroborate the less derived nature of cartilaginous fish at the molecular level as a genome-wide phenomenon. PMID:23825540
Renz, Adina J; Meyer, Axel; Kuraku, Shigehiro
2013-01-01
Cartilaginous fishes, divided into Holocephali (chimaeras) and Elasmoblanchii (sharks, rays and skates), occupy a key phylogenetic position among extant vertebrates in reconstructing their evolutionary processes. Their accurate evolutionary time scale is indispensable for better understanding of the relationship between phenotypic and molecular evolution of cartilaginous fishes. However, our current knowledge on the time scale of cartilaginous fish evolution largely relies on estimates using mitochondrial DNA sequences. In this study, making the best use of the still partial, but large-scale sequencing data of cartilaginous fish species, we estimate the divergence times between the major cartilaginous fish lineages employing nuclear genes. By rigorous orthology assessment based on available genomic and transcriptomic sequence resources for cartilaginous fishes, we selected 20 protein-coding genes in the nuclear genome, spanning 2973 amino acid residues. Our analysis based on the Bayesian inference resulted in the mean divergence time of 421 Ma, the late Silurian, for the Holocephali-Elasmobranchii split, and 306 Ma, the late Carboniferous, for the split between sharks and rays/skates. By applying these results and other documented divergence times, we measured the relative evolutionary rate of the Hox A cluster sequences in the cartilaginous fish lineages, which resulted in a lower substitution rate with a factor of at least 2.4 in comparison to tetrapod lineages. The obtained time scale enables mapping phenotypic and molecular changes in a quantitative framework. It is of great interest to corroborate the less derived nature of cartilaginous fish at the molecular level as a genome-wide phenomenon.
The comet assay in human biomonitoring.
Anderson, Diana; Dhawan, Alok; Laubenthal, Julian
2013-01-01
Human biomonitoring studies aim to identify potential exposures to environmental, occupational, or lifestyle toxicants in human populations and are commonly used by public health decision makers to predict disease risk. The Comet assay measures changes in genomic stability and is one of the most reliable biomarkers to indicate early biological effects, and therefore accepted by various governmental regulatory agencies. The appeal of the Comet assay lies in its relative simplicity, rapidity, sensitivity, and economic efficiency. Furthermore, the assay is known for its broad versatility, as it can be applied to virtually any human cell and easily adapted in order to detect particular biomarkers of interest, such as DNA repair capacity or single- and double-strand breaks. In a standard experiment, isolated single cells are first embedded in agarose, and then lysed in high-salt solutions in order to remove all cellular contents except the DNA attached to a nuclear scaffold. Subsequent electrophoresis results in accumulation of undamaged DNA sequences at the proximity of the nuclear scaffold, while damaged sequences migrate towards the anode. When visualized with fluorochromes, these migrated DNA fragments resemble a comet tail and can be quantified for their intensity and shape according to internationally drafted guidelines.
Gauthier-Rouvière, C; Cavadore, J C; Blanchard, J M; Lamb, N J; Fernandez, A
1991-01-01
Indirect immunofluorescence analysis, using antibodies directed against peptide sequences outside the DNA-binding domain of the 67-kDa serum response factor (p67SRF), revealed a punctuated nuclear staining, constant throughout the cell cycle and in all different cell lines tested. p67SRF was also tightly associated with chromatin through all stages of mitosis. Inhibition of p67SRF activity in vivo, through microinjection of anti-p67SRF antibodies, specifically suppressed DNA synthesis induced after serum addition or ras microinjection, suggesting that these antibodies were effective in preventing expression of serum response element (SRE)-regulated genes. A similar inhibition was also obtained in cells injected with oligonucleotides corresponding to the DNA binding sequence for p67SRF protein, SRE. Moreover, this inhibition of DNA synthesis by anti-p67SRF or SRE injection was still observed in cells injected during late G1, well after c-fos induction. These data imply that genes regulated by p67SRF are continuously involved in the proliferation pathway throughout G1 and that p67SRF forms an integral component of mammalian cell transcriptional control. Images PMID:1782216
Su, Jiao; Zhang, Haijie; Jiang, Bingying; Zheng, Huzhi; Chai, Yaqin; Yuan, Ruo; Xiang, Yun
2011-11-15
We report an ultrasensitive electrochemical approach for the detection of uropathogen sequence-specific DNA target. The sensing strategy involves a dual signal amplification process, which combines the signal enhancement by the enzymatic target recycling technique with the sensitivity improvement by the quantum dot (QD) layer-by-layer (LBL) assembled labels. The enzyme-based catalytic target DNA recycling process results in the use of each target DNA sequence for multiple times and leads to direct amplification of the analytical signal. Moreover, the LBL assembled QD labels can further enhance the sensitivity of the sensing system. The coupling of these two effective signal amplification strategies thus leads to low femtomolar (5fM) detection of the target DNA sequences. The proposed strategy also shows excellent discrimination between the target DNA and the single-base mismatch sequences. The advantageous intrinsic sequence-independent property of exonuclease III over other sequence-dependent enzymes makes our new dual signal amplification system a general sensing platform for monitoring ultralow level of various types of target DNA sequences. Copyright © 2011 Elsevier B.V. All rights reserved.
Molecular characterization of a Toxocara variant from cats in Kuala Lumpur, Malaysia.
Zhu, X Q; Jacobs, D E; Chilton, N B; Sani, R A; Cheng, N A; Gasser, R B
1998-08-01
The ascaridoid nematode of cats from Kuala Lumpur, Malaysia, previously identified morphologically as Toxocara canis, was characterized using a molecular approach. The nuclear ribosomal DNA (rDNA) region spanning the first internal transcribed spacer (ITS-1), the 5.8S gene and the second internal transcribed spacer (ITS-2) was amplified and sequenced. The sequences for the parasite from Malaysian cats were compared with those for T. canis and T. cati. The sequence data showed that this taxon was genetically more similar to T. cati than to T. canis in the ITS-1, 5.8S and ITS-2. Differences in the ITS-1 and ITS-2 sequences between the taxa (9.4-26.1%) were markedly higher than variation between samples within T. canis and T. cati (0-2.9%). The sequence data demonstrate that the parasite from Malaysian cats is neither T. canis nor T. cati and indicate that it is a distinct species. Based on these data, PCR-linked restriction fragment length polymorphism (RFLP) and single-strand conformation polymorphism (SSCP) methods were employed for the unequivocal differentiation of the Toxocara variant from T. canis and T. cati. These methods should provide valuable tools for studying the life-cycle, transmission pattern(s) and zoonotic potential of this parasite.
Zhang, Dequan; Jiang, Bei; Duan, Lizhen; Zhou, Nong
2016-01-01
DNA barcoding is a technique used to identify species based on species-specific differences in short regions of their DNA. It is widely used in species discrimination of medicinal plants and traditional medicines. In the present study, four potential DNA barcodes, namely rbcL , matK , trnH-psbA and ITS (nuclear ribosomal internal transcribed spacer) were adopted for species discrimination in Crawfurdia Wall (Genetiaceae). Identification ability of these DNA barcodes and combinations were evaluated using three classic methods (Distance, Blast and Tree-Building). As a result, ITS, trnH-psbA and rbcL regions showed great universality for a success rate of 100%; whereas matK was disappointing for which only 65% samples gained useful DNA sequences. ITS region, which could clearly and effectively identify the five species in Crawfurdia , performed very well in this study. On the contrary, trnH-psbA and rbcL performed poorly in discrimination among these species. ITS marker was an ideal DNA barcode in Crawfurdia and it should be incorporated into one of the core barcodes for seed plants.
Stanevičiūtė, Gražina; Stunžėnas, Virmantas; Petkevičiūtė, Romualda
2015-01-01
The family Echinostomatidae Looss, 1899 exhibits a substantial taxonomic diversity, morphological criteria adopted by different authors have resulted in its subdivision into an impressive number of subfamilies. The status of the subfamily Echinochasminae Odhner, 1910 was changed in various classifications. Genetic characteristics and phylogenetic analysis of four Echinostomatidae species - Echinochasmus sp., Echinochasmuscoaxatus Dietz, 1909, Stephanoprorapseudoechinata (Olsson, 1876) and Echinoparyphiummordwilkoi Skrjabin, 1915 were obtained to understand well enough the homogeneity of the Echinochasminae and phylogenetic relationships within the Echinostomatidae. Chromosome set and nuclear rDNA (ITS2 and 28S) sequences of parthenites of Echinochasmus sp. were studied. The karyotype of this species (2n=20, one pair of large bi-armed chromosomes and others are smaller-sized, mainly one-armed, chromosomes) differed from that previously described for two other representatives of the Echinochasminae, Echinochasmusbeleocephalus (von Linstow, 1893), 2n=14, and Episthmiumbursicola (Creplin, 1937), 2n=18. In phylogenetic trees based on ITS2 and 28S datasets, a well-supported subclade with Echinochasmus sp. and Stephanoprorapseudoechinata clustered with one well-supported clade together with Echinochasmusjaponicus Tanabe, 1926 (data only for 28S) and Echinochasmuscoaxatus. These results supported close phylogenetic relationships between Echinochasmus Dietz, 1909 and Stephanoprora Odhner, 1902. Phylogenetic analysis revealed a clear separation of related species of Echinostomatoidea restricted to prosobranch snails as first intermediate hosts, from other species of Echinostomatidae and Psilostomidae, developing in Lymnaeoidea snails as first intermediate hosts. According to the data based on rDNA phylogeny, it was supposed that evolution of parasitic flukes linked with first intermediate hosts. Digeneans parasitizing prosobranch snails showed higher dynamic of karyotype evolution provided by different chromosomal rearrangements including Robertsonian translocations and pericentric inversions than more stable karyotype of digenean worms parasitizing lymnaeoid pulmonate snails.
Rutschmann, Sereina; Detering, Harald; Simon, Sabrina; Funk, David H; Gattolliat, Jean-Luc; Hughes, Samantha J; Raposeiro, Pedro M; DeSalle, Rob; Sartori, Michel; Monaghan, Michael T
2017-02-01
The study of processes driving diversification requires a fully sampled and well resolved phylogeny, although a lack of phylogenetic markers remains a limitation for many non-model groups. Multilocus approaches to the study of recent diversification provide a powerful means to study the evolutionary process, but their application remains restricted because multiple unlinked loci with suitable variation for phylogenetic or coalescent analysis are not available for most non-model taxa. Here we identify novel, putative single-copy nuclear DNA (nDNA) phylogenetic markers to study the colonization and diversification of an aquatic insect species complex, Cloeon dipterum L. 1761 (Ephemeroptera: Baetidae), in Macaronesia. Whole-genome sequencing data from one member of the species complex were used to identify 59 nDNA loci (32,213 base pairs), followed by Sanger sequencing of 29 individuals sampled from 13 islands of three Macaronesian archipelagos. Multispecies coalescent analyses established six putative species. Three island species formed a monophyletic clade, with one species occurring on the Azores, Europe and North America. Ancestral state reconstruction indicated at least two colonization events from the mainland (to the Canaries, respectively Azores) and one within the archipelago (between Madeira and the Canaries). Random subsets of the 59 loci showed a positive linear relationship between number of loci and node support. In contrast, node support in the multispecies coalescent tree was negatively correlated with mean number of phylogenetically informative sites per locus, suggesting a complex relationship between tree resolution and marker variability. Our approach highlights the value of combining genomics, coalescent-based phylogeography, species delimitation, and phylogenetic reconstruction to resolve recent diversification events in an archipelago species complex. Copyright © 2016 Elsevier Inc. All rights reserved.
Froenicke, Lutz; Lavelle, Dean; Martineau, Belinda; Perroud, Bertrand; Michelmore, Richard
2013-01-01
Several applications of high throughput genome and transcriptome sequencing would benefit from a reduction of the high-copy-number sequences in the libraries being sequenced and analyzed, particularly when applied to species with large genomes. We adapted and analyzed the consequences of a method that utilizes a thermostable duplex-specific nuclease for reducing the high-copy components in transcriptomic and genomic libraries prior to sequencing. This reduces the time, cost, and computational effort of obtaining informative transcriptomic and genomic sequence data for both fully sequenced and non-sequenced genomes. It also reduces contamination from organellar DNA in preparations of nuclear DNA. Hybridization in the presence of 3 M tetramethylammonium chloride (TMAC), which equalizes the rates of hybridization of GC and AT nucleotide pairs, reduced the bias against sequences with high GC content. Consequences of this method on the reduction of high-copy and enrichment of low-copy sequences are reported for Arabidopsis and lettuce. PMID:23409088
Matvienko, Marta; Kozik, Alexander; Froenicke, Lutz; Lavelle, Dean; Martineau, Belinda; Perroud, Bertrand; Michelmore, Richard
2013-01-01
Several applications of high throughput genome and transcriptome sequencing would benefit from a reduction of the high-copy-number sequences in the libraries being sequenced and analyzed, particularly when applied to species with large genomes. We adapted and analyzed the consequences of a method that utilizes a thermostable duplex-specific nuclease for reducing the high-copy components in transcriptomic and genomic libraries prior to sequencing. This reduces the time, cost, and computational effort of obtaining informative transcriptomic and genomic sequence data for both fully sequenced and non-sequenced genomes. It also reduces contamination from organellar DNA in preparations of nuclear DNA. Hybridization in the presence of 3 M tetramethylammonium chloride (TMAC), which equalizes the rates of hybridization of GC and AT nucleotide pairs, reduced the bias against sequences with high GC content. Consequences of this method on the reduction of high-copy and enrichment of low-copy sequences are reported for Arabidopsis and lettuce.
Boutte, Julien; Aliaga, Benoît; Lima, Oscar; Ferreira de Carvalho, Julie; Ainouche, Abdelkader; Macas, Jiri; Rousseau-Gueutin, Mathieu; Coriton, Olivier; Ainouche, Malika; Salmon, Armel
2015-01-01
Gene and whole-genome duplications are widespread in plant nuclear genomes, resulting in sequence heterogeneity. Identification of duplicated genes may be particularly challenging in highly redundant genomes, especially when there are no diploid parents as a reference. Here, we developed a pipeline to detect the different copies in the ribosomal RNA gene family in the hexaploid grass Spartina maritima from next-generation sequencing (Roche-454) reads. The heterogeneity of the different domains of the highly repeated 45S unit was explored by identifying single nucleotide polymorphisms (SNPs) and assembling reads based on shared polymorphisms. SNPs were validated using comparisons with Illumina sequence data sets and by cloning and Sanger (re)sequencing. Using this approach, 29 validated polymorphisms and 11 validated haplotypes were reported (out of 34 and 20, respectively, that were initially predicted by our program). The rDNA domains of S. maritima have similar lengths as those found in other Poaceae, apart from the 5′-ETS, which is approximately two-times longer in S. maritima. Sequence homogeneity was encountered in coding regions and both internal transcribed spacers (ITS), whereas high intragenomic variability was detected in the intergenic spacer (IGS) and the external transcribed spacer (ETS). Molecular cytogenetic analysis by fluorescent in situ hybridization (FISH) revealed the presence of one pair of 45S rDNA signals on the chromosomes of S. maritima instead of three expected pairs for a hexaploid genome, indicating loss of duplicated homeologous loci through the diploidization process. The procedure developed here may be used at any ploidy level and using different sequencing technologies. PMID:26530424
The changing epitome of species identification – DNA barcoding
Ajmal Ali, M.; Gyulai, Gábor; Hidvégi, Norbert; Kerti, Balázs; Al Hemaid, Fahad M.A.; Pandey, Arun K.; Lee, Joongku
2014-01-01
The discipline taxonomy (the science of naming and classifying organisms, the original bioinformatics and a basis for all biology) is fundamentally important in ensuring the quality of life of future human generation on the earth; yet over the past few decades, the teaching and research funding in taxonomy have declined because of its classical way of practice which lead the discipline many a times to a subject of opinion, and this ultimately gave birth to several problems and challenges, and therefore the taxonomist became an endangered race in the era of genomics. Now taxonomy suddenly became fashionable again due to revolutionary approaches in taxonomy called DNA barcoding (a novel technology to provide rapid, accurate, and automated species identifications using short orthologous DNA sequences). In DNA barcoding, complete data set can be obtained from a single specimen irrespective to morphological or life stage characters. The core idea of DNA barcoding is based on the fact that the highly conserved stretches of DNA, either coding or non coding regions, vary at very minor degree during the evolution within the species. Sequences suggested to be useful in DNA barcoding include cytoplasmic mitochondrial DNA (e.g. cox1) and chloroplast DNA (e.g. rbcL, trnL-F, matK, ndhF, and atpB rbcL), and nuclear DNA (ITS, and house keeping genes e.g. gapdh). The plant DNA barcoding is now transitioning the epitome of species identification; and thus, ultimately helping in the molecularization of taxonomy, a need of the hour. The ‘DNA barcodes’ show promise in providing a practical, standardized, species-level identification tool that can be used for biodiversity assessment, life history and ecological studies, forensic analysis, and many more. PMID:24955007
Riethmüller, A; Voglmayr, H; Göker, M; Weiß, M; Oberwinkler, F
2002-01-01
In order to investigate phylogenetic relationships of the Peronosporomycetes (Oomycetes), nuclear large subunit ribosomal DNA sequences containing the D1 and D2 region were analyzed of 92 species belonging to the orders Peronosporales, Pythiales, Leptomitales, Rhipidiales, Saprolegniales and Sclerosporales. The data were analyzed applying methods of neighbor-joining as well as maximum parsimony, both statistically supported using the bootstrap method. The results confirm the major division between the Pythiales and Peronosporales on the one hand and the Saprolegniales, Leptomitales, and Rhipidiales on the other. The Sclerosporales were shown to be polyphyletic; while Sclerosporaceae are nested within the Peronosporaceae, the Verrucalvaceae are merged within the Saprolegniales. Within the Peronosporomycetidae, Pythiales as well as Peronosporales as currently defined are polyphyletic. The well supported Albugo clade appears to be the most basal lineage, followed by a Pythium-Lagenidium clade. The third, highly supported clade comprises the Peronosporaceae together with Sclerospora, Phytophthora, and Peronophythora. Peronophythora is placed within Phytophthora, indicating that both genera should be merged. Bremiella seems to be polyphyletic within the genus Plasmopara, suggesting a transfer to Plasmopara. The species of Peronospora do not appear as a monophyletic group. Peronospora species growing on Brassicaceae form a highly supported clade.
Alasaad, S; Soglia, D; Spalenza, V; Maione, S; Soriguer, R C; Pérez, J M; Rasero, R; Degiorgis, M P Ryser; Nimmervoll, H; Zhu, X Q; Rossi, L
2009-02-05
The present study examined the relationship among individual Sarcoptes scabiei mites from 13 wild mammalian populations belonging to nine species in four European countries using the second internal transcribed spacer (ITS-2) of nuclear ribosomal DNA (rDNA) as genetic marker. The ITS-2 plus primer flanking 5.8S and 28S rDNA (ITS-2+) was amplified from individual mites by polymerase chain reaction (PCR) and the amplicons were sequenced directly. A total of 148 ITS-2+ sequences of 404bp in length were obtained and 67 variable sites were identified (16.59%). UPGMA analyses did not show any geographical or host-specific clustering, and a similar outcome was obtained using population pairwise Fst statistics. These results demonstrated that ITS-2 rDNA does not appear to be suitable for examining genetic diversity among mite populations.
Population structure of the giant garter snake, Thamnophis gigas
Paquin, M.M.; Wylie, G.D.; Routman, E.J.
2006-01-01
The giant garter snake, Thamnophis gigas, is a threatened species endemic to California's Central Valley. We tested the hypothesis that current watershed boundaries have caused genetic differentiation among populations of T. gigas. We sampled 14 populations throughout the current geographic range of T. gigas and amplified 859 bp from the mitochondrial gene ND4 and one nuclear microsatellite locus. DNA sequence variation from the mitochondrial gene indicates there is some genetic structuring of the populations, with high F ST values and unique haplotypes occurring at high frequency in several populations. We found that clustering populations by watershed boundary results in significant between-region genetic variance for mtDNA. However, analysis of allele frequencies at the microsatellite locus NSU3 reveals very low F ST values and little between-region variation in allele frequencies. The discordance found between mitochondrial and microsatellite data may be explained by aspects of molecular evolution and/or T. gigas life history characteristics. Differences in effective population size between mitochondrial and nuclear DNA, or male-biased gene flow, result in a lower migration rate of mitochondrial haplotypes relative to nuclear alleles. However, we cannot exclude homoplasy as one explanation for homogeneity found for the single microsatellite locus. The mitochondrial nucleotide sequence data supports conservation practices that identify separate management units for T. gigas. ?? Springer 2006.
Eo, Soo Hyung; DeWoody, J. Andrew
2010-01-01
Rates of biological diversification should ultimately correspond to rates of genome evolution. Recent studies have compared diversification rates with phylogenetic branch lengths, but incomplete phylogenies hamper such analyses for many taxa. Herein, we use pairwise comparisons of confamilial sauropsid (bird and reptile) mitochondrial DNA (mtDNA) genome sequences to estimate substitution rates. These molecular evolutionary rates are considered in light of the age and species richness of each taxonomic family, using a random-walk speciation–extinction process to estimate rates of diversification. We find the molecular clock ticks at disparate rates in different families and at different genes. For example, evolutionary rates are relatively fast in snakes and lizards, intermediate in crocodilians and slow in turtles and birds. There was also rate variation across genes, where non-synonymous substitution rates were fastest at ATP8 and slowest at CO3. Family-by-gene interactions were significant, indicating that local clocks vary substantially among sauropsids. Most importantly, we find evidence that mitochondrial genome evolutionary rates are positively correlated with speciation rates and with contemporary species richness. Nuclear sequences are poorly represented among reptiles, but the correlation between rates of molecular evolution and species diversification also extends to 18 avian nuclear genes we tested. Thus, the nuclear data buttress our mtDNA findings. PMID:20610427
An Optimal Seed Based Compression Algorithm for DNA Sequences
Gopalakrishnan, Gopakumar; Karunakaran, Muralikrishnan
2016-01-01
This paper proposes a seed based lossless compression algorithm to compress a DNA sequence which uses a substitution method that is similar to the LempelZiv compression scheme. The proposed method exploits the repetition structures that are inherent in DNA sequences by creating an offline dictionary which contains all such repeats along with the details of mismatches. By ensuring that only promising mismatches are allowed, the method achieves a compression ratio that is at par or better than the existing lossless DNA sequence compression algorithms. PMID:27555868
Thomas, W. Kelley; Vida, J. T.; Frisse, Linda M.; Mundo, Manuel; Baldwin, James G.
1997-01-01
To effectively integrate DNA sequence analysis and classical nematode taxonomy, we must be able to obtain DNA sequences from formalin-fixed specimens. Microdissected sections of nematodes were removed from specimens fixed in formalin, using standard protocols and without destroying morphological features. The fixed sections provided sufficient template for multiple polymerase chain reaction-based DNA sequence analyses. PMID:19274156
Van Kreijl, C F; Bos, J L
1977-01-01
The repeating nucleotide sequence of 68 base pairs in the mtDNA from an ethidium-induced cytoplasmic petite mutant of yeast has been determined. For sequence analysis specifically primed and terminated RNA copies, obtained by in vitro transcription of the separated strands, were use. The sequence consists of 66 consecutive AT base pairs flanked by two GC pairs and comprises nearly all of the mutant mitochondrial genome. The sequence, moreover, also represents the first part of wild-type mtDNA sequence so far. Images PMID:198740
Sequence and characterization of cytoplasmic nuclear protein import factor p97
1995-01-01
Nuclear location sequence-mediated binding of karyophilic proteins to the nuclear pore complexes is one of the earliest steps in nuclear protein import. We previously identified two cytosolic proteins that reconstitute this step in a permeabilized cell assay: the 54/56-kD NLS receptor and p97. A monoclonal antibody to p97 localizes the protein to the cytoplasm and the nuclear envelope. p97 is extracted from nuclear envelopes under the same conditions as the O-glycosylated nucleoporins indicating a tight association with the pore complex. The antibody inhibits import in a permeabilized cell assay but does not affect binding of karyophiles to the nuclear pore complex. Immunodepletion of p97 renders the cytosol inactive for import and identifies at least three other cytosolic proteins that interact with p97. cDNA cloning of p97 shows that it is a unique protein containing 23 cysteine residues. Recombinant p97 binds zinc and a bound metal ion is required for the nuclear envelope binding activity of the protein. PMID:7615630
DNA sequence analysis with droplet-based microfluidics
Abate, Adam R.; Hung, Tony; Sperling, Ralph A.; Mary, Pascaline; Rotem, Assaf; Agresti, Jeremy J.; Weiner, Michael A.; Weitz, David A.
2014-01-01
Droplet-based microfluidic techniques can form and process micrometer scale droplets at thousands per second. Each droplet can house an individual biochemical reaction, allowing millions of reactions to be performed in minutes with small amounts of total reagent. This versatile approach has been used for engineering enzymes, quantifying concentrations of DNA in solution, and screening protein crystallization conditions. Here, we use it to read the sequences of DNA molecules with a FRET-based assay. Using probes of different sequences, we interrogate a target DNA molecule for polymorphisms. With a larger probe set, additional polymorphisms can be interrogated as well as targets of arbitrary sequence. PMID:24185402
DOE Office of Scientific and Technical Information (OSTI.GOV)
Benasutti, M.; Ejadi, S.; Whitlow, M.D.
The mutagenic and carcinogenic chemical aflatoxin B/sub 1/ (AFB/sub 1/) reacts almost exclusively at the N(7)-position of guanine following activation to its reactive form, the 8,9-epoxide (AFB/sub 1/ oxide). In general N(7)-guanine adducts yield DNA strand breaks when heated in base, a property that serves as the basis for the Maxam-Gilbert DNA sequencing reaction specific for guanine. Using DNA sequencing methods, other workers have shown that AFB/sub 1/ oxide gives strand breaks at positions of guanines; however, the guanine bands varied in intensity. This phenomenon has been used to infer that AFB/sub 1/ oxide prefers to react with guanines inmore » some sequence contexts more than in others and has been referred to as sequence specificity of binding. Herein, data on the reaction of AFB/sub 1/ oxide with several synthetic DNA polymers with different sequences are presented, and (following hydrolysis) adduct levels are determine by high-pressure liquid chromatography. These results reveal that for AFB/sub 1/ oxide (1) the N(7)-guanine adduct is the major adduct found in all of the DNA polymers, (2) adduct levels vary in different sequences, and, thus, sequence specificity is also observed by this more direct method, and (3) the intensity of bands in DNA sequencing gels is likely to reflect adduct levels formed at the N(7)-position of guanine. Knowing this, a reinvestigation of the reactivity of guanines in different DNA sequences using DNA sequencing methods was undertaken. Methods are developed to determine the X (5'-side) base and the Y (3'-side) base are most influential in determining guanine reactivity. These rules in conjunction with molecular modeling studies were used to assess the binding sites that might be utilized by AFB/sub 1/ oxide in its reaction with DNA.« less
Deciphering amphibian diversity through DNA barcoding: chances and challenges.
Vences, Miguel; Thomas, Meike; Bonett, Ronald M; Vieites, David R
2005-10-29
Amphibians globally are in decline, yet there is still a tremendous amount of unrecognized diversity, calling for an acceleration of taxonomic exploration. This process will be greatly facilitated by a DNA barcoding system; however, the mitochondrial population structure of many amphibian species presents numerous challenges to such a standardized, single locus, approach. Here we analyse intra- and interspecific patterns of mitochondrial variation in two distantly related groups of amphibians, mantellid frogs and salamanders, to determine the promise of DNA barcoding with cytochrome oxidase subunit I (cox1) sequences in this taxon. High intraspecific cox1 divergences of 7-14% were observed (18% in one case) within the whole set of amphibian sequences analysed. These high values are not caused by particularly high substitution rates of this gene but by generally deep mitochondrial divergences within and among amphibian species. Despite these high divergences, cox1 sequences were able to correctly identify species including disparate geographic variants. The main problems with cox1 barcoding of amphibians are (i) the high variability of priming sites that hinder the application of universal primers to all species and (ii) the observed distinct overlap of intraspecific and interspecific divergence values, which implies difficulties in the definition of threshold values to identify candidate species. Common discordances between geographical signatures of mitochondrial and nuclear markers in amphibians indicate that a single-locus approach can be problematic when high accuracy of DNA barcoding is required. We suggest that a number of mitochondrial and nuclear genes may be used as DNA barcoding markers to complement cox1.
Nanjappa, Deepak; Audic, Stephane; Romac, Sarah; Kooistra, Wiebe H C F; Zingone, Adriana
2014-01-01
Continuous efforts to estimate actual diversity and to trace the species distribution and ranges in the natural environments have gone in equal pace with advancements of the technologies in the study of microbial species diversity from microscopic observations to DNA-based barcoding. DNA metabarcoding based on Next Generation Sequencing (NGS) constitutes the latest advancement in these efforts. Here we use NGS data from different sites to investigate the geographic range of six species of the diatom family Leptocylindraceae and to identify possible new taxa within the family. We analysed the V4 and V9 regions of the nuclear-encoded SSU rDNA gene region in the NGS database of the European ERA-Biodiversa project BioMarKs, collected in plankton and sediments at six coastal sites in European coastal waters, as well as environmental sequences from the NCBI database. All species known in the family Leptocylindraceae were detected in both datasets, but the much larger Illumina V9 dataset showed a higher species coverage at the various sites than the 454 V4 dataset. Sequences identical or similar to the references of Leptocylindrus aporus, L. convexus, L. danicus/hargravesii and Tenuicylindrus belgicus were found in the Mediterranean Sea, North Atlantic Ocean and Black Sea as well as at locations outside Europe. Instead, sequences identical or close to that of L. minimus were found in the North Atlantic Ocean and the Black Sea but not in the Mediterranean Sea, while sequences belonging to a yet undescribed taxon were encountered only in Oslo Fjord and Baffin Bay. Identification of Leptocylindraceae species in NGS datasets has expanded our knowledge of the species biogeographic distribution and of the overall diversity of this diatom family. Individual species appear to be widespread, but not all of them are found everywhere. Despite the sequencing depth allowed by NGS and the wide geographic area covered by this study, the diversity of this ancient diatom family appears to be low, at least at the level of the marker used in this study.
Nanjappa, Deepak; Audic, Stephane; Romac, Sarah; Kooistra, Wiebe H. C. F.; Zingone, Adriana
2014-01-01
Background Continuous efforts to estimate actual diversity and to trace the species distribution and ranges in the natural environments have gone in equal pace with advancements of the technologies in the study of microbial species diversity from microscopic observations to DNA-based barcoding. DNA metabarcoding based on Next Generation Sequencing (NGS) constitutes the latest advancement in these efforts. Here we use NGS data from different sites to investigate the geographic range of six species of the diatom family Leptocylindraceae and to identify possible new taxa within the family. Methodology/Principal Findings We analysed the V4 and V9 regions of the nuclear-encoded SSU rDNA gene region in the NGS database of the European ERA-Biodiversa project BioMarKs, collected in plankton and sediments at six coastal sites in European coastal waters, as well as environmental sequences from the NCBI database. All species known in the family Leptocylindraceae were detected in both datasets, but the much larger Illumina V9 dataset showed a higher species coverage at the various sites than the 454 V4 dataset. Sequences identical or similar to the references of Leptocylindrus aporus, L. convexus, L. danicus/hargravesii and Tenuicylindrus belgicus were found in the Mediterranean Sea, North Atlantic Ocean and Black Sea as well as at locations outside Europe. Instead, sequences identical or close to that of L. minimus were found in the North Atlantic Ocean and the Black Sea but not in the Mediterranean Sea, while sequences belonging to a yet undescribed taxon were encountered only in Oslo Fjord and Baffin Bay. Conclusions/Significance Identification of Leptocylindraceae species in NGS datasets has expanded our knowledge of the species biogeographic distribution and of the overall diversity of this diatom family. Individual species appear to be widespread, but not all of them are found everywhere. Despite the sequencing depth allowed by NGS and the wide geographic area covered by this study, the diversity of this ancient diatom family appears to be low, at least at the level of the marker used in this study. PMID:25133638
Image Encryption Algorithm Based on Hyperchaotic Maps and Nucleotide Sequences Database
2017-01-01
Image encryption technology is one of the main means to ensure the safety of image information. Using the characteristics of chaos, such as randomness, regularity, ergodicity, and initial value sensitiveness, combined with the unique space conformation of DNA molecules and their unique information storage and processing ability, an efficient method for image encryption based on the chaos theory and a DNA sequence database is proposed. In this paper, digital image encryption employs a process of transforming the image pixel gray value by using chaotic sequence scrambling image pixel location and establishing superchaotic mapping, which maps quaternary sequences and DNA sequences, and by combining with the logic of the transformation between DNA sequences. The bases are replaced under the displaced rules by using DNA coding in a certain number of iterations that are based on the enhanced quaternary hyperchaotic sequence; the sequence is generated by Chen chaos. The cipher feedback mode and chaos iteration are employed in the encryption process to enhance the confusion and diffusion properties of the algorithm. Theoretical analysis and experimental results show that the proposed scheme not only demonstrates excellent encryption but also effectively resists chosen-plaintext attack, statistical attack, and differential attack. PMID:28392799
Brown and polar bear Y chromosomes reveal extensive male-biased gene flow within brother lineages.
Bidon, Tobias; Janke, Axel; Fain, Steven R; Eiken, Hans Geir; Hagen, Snorre B; Saarma, Urmas; Hallström, Björn M; Lecomte, Nicolas; Hailer, Frank
2014-06-01
Brown and polar bears have become prominent examples in phylogeography, but previous phylogeographic studies relied largely on maternally inherited mitochondrial DNA (mtDNA) or were geographically restricted. The male-specific Y chromosome, a natural counterpart to mtDNA, has remained underexplored. Although this paternally inherited chromosome is indispensable for comprehensive analyses of phylogeographic patterns, technical difficulties and low variability have hampered its application in most mammals. We developed 13 novel Y-chromosomal sequence and microsatellite markers from the polar bear genome and screened these in a broad geographic sample of 130 brown and polar bears. We also analyzed a 390-kb-long Y-chromosomal scaffold using sequencing data from published male ursine genomes. Y chromosome evidence support the emerging understanding that brown and polar bears started to diverge no later than the Middle Pleistocene. Contrary to mtDNA patterns, we found 1) brown and polar bears to be reciprocally monophyletic sister (or rather brother) lineages, without signals of introgression, 2) male-biased gene flow across continents and on phylogeographic time scales, and 3) male dispersal that links the Alaskan ABC islands population to mainland brown bears. Due to female philopatry, mtDNA provides a highly structured estimate of population differentiation, while male-biased gene flow is a homogenizing force for nuclear genetic variation. Our findings highlight the importance of analyzing both maternally and paternally inherited loci for a comprehensive view of phylogeographic history, and that mtDNA-based phylogeographic studies of many mammals should be reevaluated. Recent advances in sequencing technology render the analysis of Y-chromosomal variation feasible, even in nonmodel organisms. © The Author 2014. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
Cook, W B; Walker, J C
1992-01-01
A cDNA encoding a nuclear-encoded chloroplast nucleic acid-binding protein (NBP) has been isolated from maize. Identified as an in vitro DNA-binding activity, NBP belongs to a family of nuclear-encoded chloroplast proteins which share a common domain structure and are thought to be involved in posttranscriptional regulation of chloroplast gene expression. NBP contains an N-terminal chloroplast transit peptide, a highly acidic domain and a pair of ribonucleoprotein consensus sequence domains. NBP is expressed in a light-dependent, organ-specific manner which is consistent with its involvement in chloroplast biogenesis. The relationship of NBP to the other members of this protein family and their possible regulatory functions are discussed. Images PMID:1346929
Farah, Azman H.; Lee, Shiou Yih; Gao, Zhihui; Yao, Tze Leong; Madon, Maria; Mohamed, Rozi
2018-01-01
The tribe Aquilarieae of the family Thymelaeaceae consists of two genera, Aquilaria and Gyrinops, with a total of 30 species, distributed from northeast India, through southeast Asia and the south of China, to Papua New Guinea. They are an important botanical resource for fragrant agarwood, a prized product derived from injured or infected stems of these species. The aim of this study was to estimate the genome size of selected Aquilaria species and comprehend the evolutionary history of Aquilarieae speciation through molecular phylogeny. Five non-coding chloroplast DNA regions and a nuclear region were sequenced from 12 Aquilaria and three Gyrinops species. Phylogenetic trees constructed using combined chloroplast DNA sequences revealed relationships of the studied 15 members in Aquilarieae, while nuclear ribosomal DNA internal transcribed spacer (ITS) sequences showed a paraphyletic relationship between Aquilaria species from Indochina and Malesian. We exposed, for the first time, the estimated divergence time for Aquilarieae speciation, which was speculated to happen during the Miocene Epoch. The ancestral split and biogeographic pattern of studied species were discussed. Results showed no large variation in the 2C-values for the five Aquilaria species (1.35–2.23 pg). Further investigation into the genome size may provide additional information regarding ancestral traits and its evolution history. PMID:29896211
"First generation" automated DNA sequencing technology.
Slatko, Barton E; Kieleczawa, Jan; Ju, Jingyue; Gardner, Andrew F; Hendrickson, Cynthia L; Ausubel, Frederick M
2011-10-01
Beginning in the 1980s, automation of DNA sequencing has greatly increased throughput, reduced costs, and enabled large projects to be completed more easily. The development of automation technology paralleled the development of other aspects of DNA sequencing: better enzymes and chemistry, separation and imaging technology, sequencing protocols, robotics, and computational advancements (including base-calling algorithms with quality scores, database developments, and sequence analysis programs). Despite the emergence of high-throughput sequencing platforms, automated Sanger sequencing technology remains useful for many applications. This unit provides background and a description of the "First-Generation" automated DNA sequencing technology. It also includes protocols for using the current Applied Biosystems (ABI) automated DNA sequencing machines. © 2011 by John Wiley & Sons, Inc.
Novel Genetic Resources in the Genus Vigna Unveiled from Gene Bank Accessions
Takahashi, Yu; Somta, Prakit; Muto, Chiaki; Iseki, Kohtaro; Naito, Ken; Pandiyan, Muthaiyan; Natesan, Senthil; Tomooka, Norihiko
2016-01-01
The genus Vigna (Fabaceae) consists of five subgenera, and includes more than 100 wild species. In Vigna, 10 crops have been domesticated from three subgenera, Vigna, Plectrotropis, and Ceratotropis. The habitats of wild Vigna species are so diverse that their genomes could harbor various genes responsible for environmental stress adaptation, which could lead to innovations in agriculture. Since some of the gene bank Vigna accessions were unidentified and they seemed to be novel genetic resources, these accessions were identified based on morphological traits. The phylogenetic positions were estimated based on the DNA sequences of nuclear rDNA-ITS and chloroplast atpB-rbcL spacer regions. Based on the results, the potential usefulness of the recently described species V. indica and V. sahyadriana, and some wild Vigna species, i.e., V. aconitifolia, V. dalzelliana, V. khandalensis, V. marina var. oblonga, and V. vexillata, was discussed. PMID:26800459
Hsu, Hong-Ming; Lee, Yu; Indra, Dharmu; Wei, Shu-Yi; Liu, Hsing-Wei; Chang, Lung-Chun; Chen, Chinpan; Ong, Shiou-Jeng
2012-01-01
In Trichomonas vaginalis, a novel nuclear localization signal spanning the folded R2R3 DNA-binding domain of a Myb2 protein was previously identified. To study whether a similar signal is used for nuclear translocation by other Myb proteins, nuclear translocation of Myb3 was examined in this report. When overexpressed, hemagglutinin-tagged Myb3 was localized to nuclei of transfected cells, with a cellular distribution similar to that of endogenous Myb3. Fusion to a bacterial tetracycline repressor, R2R3, of Myb3 that spans amino acids (aa) 48 to 156 was insufficient for nuclear translocation of the fusion protein, unless its C terminus was extended to aa 167. The conserved isoleucine in helix 2 of R2R3, which is important for Myb2's structural integrity in maintaining DNA-binding activity and nuclear translocation, was also vital for the former activity of Myb3, but less crucial for the latter. Sequential nuclear influx and efflux of Myb3, which require further extension of the nuclear localization signal to aa 180, were immediately induced after iron repletion. Sequence elements that regulate nuclear translocation with cytoplasmic retention, nuclear influx, and nuclear efflux were identified within the C-terminal tail. These results suggest that the R2R3 DNA-binding domain also serves as a common module for the nuclear translocation of both Myb2 and Myb3, but there are intrinsic differences between the two nuclear localization signals. PMID:23042127
Coordination of tRNA transcription with export at nuclear pore complexes in budding yeast.
Chen, Miao; Gartenberg, Marc R
2014-05-01
tRNAs are encoded by RNA polymerase III-transcribed genes that reside at seemingly random intervals along the chromosomes of budding yeast. Existing evidence suggests that the genes congregate together at the nucleolus and/or centromeres. In this study, we re-examined spatial and temporal aspects of tRNA gene (tDNA) expression. We show that tDNA transcription fluctuates during cell cycle progression. In M phase, when tRNA synthesis peaks, tDNAs localize at nuclear pore complexes (NPCs). Docking of a tDNA requires the DNA sequence of the contacted gene, nucleoporins Nup60 and Nup2, and cohesin. Characterization of mutants that block NPC localization revealed that docking is a consequence of elevated tDNA transcription. NPC-tDNA contact falters in the absence of the principal exportin of nascent tRNA, Los1, and genetic assays indicate that gating of tDNAs at NPCs favors cytoplasmic accumulation of functional tRNA. Collectively, the data suggest that tDNAs associate with NPCs to coordinate RNA polymerase III transcription with the nuclear export of pre-tRNA. The M-phase specificity of NPC contact reflects a regulatory mechanism that may have evolved, in part, to avoid collisions between DNA replication forks and transcribing RNA polymerase III machinery at NPCs.
Coordination of tRNA transcription with export at nuclear pore complexes in budding yeast
Chen, Miao; Gartenberg, Marc R.
2014-01-01
tRNAs are encoded by RNA polymerase III-transcribed genes that reside at seemingly random intervals along the chromosomes of budding yeast. Existing evidence suggests that the genes congregate together at the nucleolus and/or centromeres. In this study, we re-examined spatial and temporal aspects of tRNA gene (tDNA) expression. We show that tDNA transcription fluctuates during cell cycle progression. In M phase, when tRNA synthesis peaks, tDNAs localize at nuclear pore complexes (NPCs). Docking of a tDNA requires the DNA sequence of the contacted gene, nucleoporins Nup60 and Nup2, and cohesin. Characterization of mutants that block NPC localization revealed that docking is a consequence of elevated tDNA transcription. NPC–tDNA contact falters in the absence of the principal exportin of nascent tRNA, Los1, and genetic assays indicate that gating of tDNAs at NPCs favors cytoplasmic accumulation of functional tRNA. Collectively, the data suggest that tDNAs associate with NPCs to coordinate RNA polymerase III transcription with the nuclear export of pre-tRNA. The M-phase specificity of NPC contact reflects a regulatory mechanism that may have evolved, in part, to avoid collisions between DNA replication forks and transcribing RNA polymerase III machinery at NPCs. PMID:24788517
Fiannaca, Antonino; La Rosa, Massimo; Rizzo, Riccardo; Urso, Alfonso
2015-07-01
In this paper, an alignment-free method for DNA barcode classification that is based on both a spectral representation and a neural gas network for unsupervised clustering is proposed. In the proposed methodology, distinctive words are identified from a spectral representation of DNA sequences. A taxonomic classification of the DNA sequence is then performed using the sequence signature, i.e., the smallest set of k-mers that can assign a DNA sequence to its proper taxonomic category. Experiments were then performed to compare our method with other supervised machine learning classification algorithms, such as support vector machine, random forest, ripper, naïve Bayes, ridor, and classification tree, which also consider short DNA sequence fragments of 200 and 300 base pairs (bp). The experimental tests were conducted over 10 real barcode datasets belonging to different animal species, which were provided by the on-line resource "Barcode of Life Database". The experimental results showed that our k-mer-based approach is directly comparable, in terms of accuracy, recall and precision metrics, with the other classifiers when considering full-length sequences. In addition, we demonstrate the robustness of our method when a classification is performed task with a set of short DNA sequences that were randomly extracted from the original data. For example, the proposed method can reach the accuracy of 64.8% at the species level with 200-bp fragments. Under the same conditions, the best other classifier (random forest) reaches the accuracy of 20.9%. Our results indicate that we obtained a clear improvement over the other classifiers for the study of short DNA barcode sequence fragments. Copyright © 2015 Elsevier B.V. All rights reserved.
Wannasan, Anchalee; Khositharattanakool, Pathamet; Chaiwong, Prasong; Piangjai, Somsak; Uparanukraw, Pichart; Morakote, Nimit
2014-11-01
Molecular techniques were used to identify Fasciola species collected from Chiang Mai Thailand. Morphometrically, 65 stained and 45 fresh worms collected from cattle suggested the possible occurrence of both F. gigantica and F. hepatica. Twenty-two worms comprising 15 from cattle and 7 from human patients, were identified subsequently based on three genetic markers: mitochondrial nicotinamide adenine dinucleotide dehydrogenase subunit 1 (nad1), mitochondrial cytochrome c oxidase subunit 1 (cox1) and nuclear ribosomal internal transcribed spacer 2 (ITS2). All of them presented the F. gigantica type in maternally inherited mitochondrial sequences (nad1 and cox1), with six types in each sequence (FgNDI-CM1 to FgNDI-CM6 and FgCOI-CM1 to FgCOI-CM6, respectively). Remarkably, the predominant nad1 type, FgNDI-CM6, was identical to that of aspermic Fasciola sp. formerly reported from Thailand, Japan, Korea, China, Vietnam, and Myanmar. ITS2 sequences were analyzed successfully in 20 worms. Fifteen worms showed the F. gigantica type and five (including one worm from a patient) had mixed ITS2 sequences of both F. gigantica and F. hepatica in the same worms, with additional heterogeneity within both ITS2 types. This study revealed the intermediate form of Fasciola coexisting with F. gigantica for the first time in Thailand.
Lineage-specific evolutionary rate in plants: Contributions of a screening for Cereus (Cactaceae)1
Romeiro-Brito, Monique; Moraes, Evandro M.; Taylor, Nigel P.; Zappi, Daniela C.; Franco, Fernando F.
2016-01-01
Premise of the study: Predictable chloroplast DNA (cpDNA) sequences have been listed for the shallowest taxonomic studies in plants. We investigated whether plastid regions that vary between closely allied species could be applied for intraspecific studies and compared the variation of these plastid segments with two nuclear regions. Methods: We screened 16 plastid and two nuclear intronic regions for species of the genus Cereus (Cactaceae) at three hierarchical levels (species from different clades, species of the same clade, and allopatric populations). Results: Ten plastid regions presented interspecific variation, and six of them showed variation at the intraspecific level. The two nuclear regions showed both inter- and intraspecific variation, and in general they showed higher levels of variability in almost all hierarchical levels than the plastid segments. Discussion: Our data suggest no correspondence between variation of plastid regions at the interspecific and intraspecific level, probably due to lineage-specific variation in cpDNA, which appears to have less effect in nuclear data. Despite the heterogeneity in evolutionary rates of cpDNA, we highlight three plastid segments that may be considered in initial screenings in plant phylogeographic studies. PMID:26819857
Liu, Jian; Zhang, Shouzhou; Nagalingum, Nathalie S; Chiang, Yu-Chung; Lindstrom, Anders J; Gong, Xun
2018-05-18
The gymnosperm genus Cycas is the sole member of Cycadaceae, and is the largest genus of extant cycads. There are about 115 accepted Cycas species mainly distributed in the paleotropics. Based on morphology, the genus has been divided into six sections and eight subsections, but this taxonomy has not yet been tested in a molecular phylogenetic framework. Although the monophyly of Cycas is broadly accepted, the intrageneric relationships inferred from previous molecular phylogenetic analyses are unclear due to insufficient sampling or uninformative DNA sequence data. In this study, we reconstructed a phylogeny of Cycas using four chloroplast intergenic spacers and seven low-copy nuclear genes and sampling 90% of extant Cycas species. The maximum likelihood and Bayesian inference phylogenies suggest: (1) matrices of either concatenated cpDNA markers or of concatenated nDNA lack sufficient informative sites to resolve the phylogeny alone, however, the phylogeny from the combined cpDNA-nDNA dataset suggests the genus can be roughly divided into 13 clades and six sections that are in agreement with the current classification of the genus; (2) although with partial support, a clade combining sections Panzhihuaenses + Asiorientales is resolved as the earliest diverging branch; (3) section Stangerioides is not monophyletic because the species resolve as a grade; (4) section Indosinenses is not monophyletic as it includes Cycas macrocarpa and C. pranburiensis from section Cycas; (5) section Cycas is the most derived group and its subgroups correspond with geography. Copyright © 2018 Elsevier Inc. All rights reserved.
A DNA sequence obtained by replacement of the dopamine RNA aptamer bases is not an aptamer.
Álvarez-Martos, Isabel; Ferapontova, Elena E
2017-08-05
A unique specificity of the aptamer-ligand biorecognition and binding facilitates bioanalysis and biosensor development, contributing to discrimination of structurally related molecules, such as dopamine and other catecholamine neurotransmitters. The aptamer sequence capable of specific binding of dopamine is a 57 nucleotides long RNA sequence reported in 1997 (Biochemistry, 1997, 36, 9726). Later, it was suggested that the DNA homologue of the RNA aptamer retains the specificity of dopamine binding (Biochem. Biophys. Res. Commun., 2009, 388, 732). Here, we show that the DNA sequence obtained by the replacement of the RNA aptamer bases for their DNA analogues is not able of specific biorecognition of dopamine, in contrast to the original RNA aptamer sequence. This DNA sequence binds dopamine and structurally related catecholamine neurotransmitters non-specifically, as any DNA sequence, and, thus, is not an aptamer and cannot be used neither for in vivo nor in situ analysis of dopamine in the presence of structurally related neurotransmitters. Copyright © 2017 Elsevier Inc. All rights reserved.
De Lange, P. J.; Heenan, P. B.; Keeling, D. J.; Murray, B. G.; Smissen, R.; Sykes, W. R.
2008-01-01
Background and Aims Crassula hunua and C. ruamahanga have been taxonomically controversial. Here their distinctiveness is assessed so that their taxonomic and conservation status can be clarified. Methods Populations of these two species were analysed using morphological, chromosomal and DNA sequence data. Key Results It proved impossible to differentiate between these two species using 12 key morphological characters. Populations were found to be chromosomally variable with 11 different chromosome numbers ranging from 2n = 42 to 2n = 100. Meiotic behaviour and levels of pollen stainability were both variable. Phylogenetic analyses showed that differences exist in both nuclear and plastid DNA sequences between individual plants, sometimes from the same population. Conclusions The results suggest that these plants are a species complex that has evolved through interspecific hybridization and polyploidy. Their high levels of chromosomal and DNA sequence variation present a problem for their conservation. PMID:18055560
Liu, Juan; Qi, Zhe-Chen; Zhao, Yun-Peng; Fu, Cheng-Xin; Jenny Xiang, Qiu-Yun
2012-09-01
The complete nucleotide sequence of the chloroplast genome (cpDNA) of Smilax china L. (Smilacaceae) is reported. It is the first complete cp genome sequence in Liliales. Genomic analyses were conducted to examine the rate and pattern of cpDNA genome evolution in Smilax relative to other major lineages of monocots. The cpDNA genomic sequences were combined with those available for Lilium to evaluate the phylogenetic position of Liliales and to investigate the influence of taxon sampling, gene sampling, gene function, natural selection, and substitution rate on phylogenetic inference in monocots. Phylogenetic analyses using sequence data of gene groups partitioned according to gene function, selection force, and total substitution rate demonstrated evident impacts of these factors on phylogenetic inference of monocots and the placement of Liliales, suggesting potential evolutionary convergence or adaptation of some cpDNA genes in monocots. Our study also demonstrated that reduced taxon sampling reduced the bootstrap support for the placement of Liliales in the cpDNA phylogenomic analysis. Analyses of sequences of 77 protein genes with some missing data and sequences of 81 genes (all protein genes plus the rRNA genes) support a sister relationship of Liliales to the commelinids-Asparagales clade, consistent with the APG III system. Analyses of 63 cpDNA protein genes for 32 taxa with few missing data, however, support a sister relationship of Liliales (represented by Smilax and Lilium) to Dioscoreales-Pandanales. Topology tests indicated that these two alignments do not significantly differ given any of these three cpDNA genomic sequence data sets. Furthermore, we found no saturation effect of the data, suggesting that the cpDNA genomic sequence data used in the study are appropriate for monocot phylogenetic study and long-branch attraction is unlikely to be the cause to explain the result of two well-supported, conflict placements of Liliales. Further analyses using sufficient nuclear data remain necessary to evaluate these two phylogenetic hypotheses regarding the position of Liliales and to address the causes of signal conflict among genes and partitions. Copyright © 2012 Elsevier Inc. All rights reserved.
Stech, Michael; Veldman, Sarina; Larraín, Juan; Muñoz, Jesús; Quandt, Dietmar; Hassel, Kristian; Kruijer, Hans
2013-01-01
In bryophytes a morphological species concept is still most commonly employed, but delimitation of closely related species based on morphological characters is often difficult. Here we test morphological species circumscriptions in a species complex of the moss genus Racomitrium, the R. canescens complex, based on variable DNA sequence markers from the plastid (rps4-trnT-trnL region) and nuclear (nrITS) genomes. The extensive morphological variability within the complex has led to different opinions about the number of species and intraspecific taxa to be distinguished. Molecular phylogenetic reconstructions allowed to clearly distinguish all eight currently recognised species of the complex plus a ninth species that was inferred to belong to the complex in earlier molecular analyses. The taxonomic significance of intraspecific sequence variation is discussed. The present molecular data do not support the division of the R. canescens complex into two groups of species (subsections or sections). Most morphological characters, albeit being in part difficult to apply, are reliable for species identification in the R. canescens complex. However, misidentification of collections that were morphologically intermediate between species questioned the suitability of leaf shape as diagnostic character. Four partitions of the molecular markers (rps4-trnT, trnT-trnL, ITS1, ITS2) that could potentially be used for molecular species identification (DNA barcoding) performed almost equally well concerning amplification and sequencing success. Of these, ITS1 provided the highest species discrimination capacity and should be considered as a DNA barcoding marker for mosses, especially in complexes of closely related species. Molecular species identification should be complemented by redefining morphological characters, to develop a set of easy-to-use molecular and non-molecular identification tools for improving biodiversity assessments and ecological research including mosses. PMID:23341927